U.S. patent application number 12/046380 was filed with the patent office on 2009-09-24 for method for detoxifying phosphonate herbicides.
Invention is credited to Gerard F. Barry.
Application Number | 20090240073 12/046380 |
Document ID | / |
Family ID | 22323909 |
Filed Date | 2009-09-24 |
United States Patent
Application |
20090240073 |
Kind Code |
A1 |
Barry; Gerard F. |
September 24, 2009 |
METHOD FOR DETOXIFYING PHOSPHONATE HERBICIDES
Abstract
The invention relates in general to methods for detoxifying
phosphonate herbicides. The methods may comprise transacetylating
the phosphonate herbicide. The phosphonate herbicides can comprise
a CP bond and a CN bond and may be glyphosate.
Inventors: |
Barry; Gerard F.; (St.
Louis, MO) |
Correspondence
Address: |
SONNENSCHEIN NATH & ROSENTHAL LLP
P.O. BOX 061080, SOUTH WACKER DRIVE STATION, WILLIS TOWER
CHICAGO
IL
60606
US
|
Family ID: |
22323909 |
Appl. No.: |
12/046380 |
Filed: |
March 11, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10213791 |
Aug 7, 2002 |
7554012 |
|
|
12046380 |
|
|
|
|
09441340 |
Nov 16, 1999 |
6448476 |
|
|
10213791 |
|
|
|
|
60108763 |
Nov 17, 1998 |
|
|
|
Current U.S.
Class: |
558/386 |
Current CPC
Class: |
C12N 15/8274 20130101;
C12N 9/1029 20130101; C12N 15/8275 20130101; C07K 16/40
20130101 |
Class at
Publication: |
558/386 |
International
Class: |
C07F 9/02 20060101
C07F009/02 |
Claims
1.-42. (canceled)
43. A method for detoxifying a phosphonate herbicide comprising
transacetylating the phosphonate herbicide.
44. The method of claim 43, wherein the phosphonate herbicide
comprises a CP bond and a CN bond.
45. The method of claim 43, wherein the phosphonate herbicide is
glyphosate.
Description
REFERENCE TO PRIOR APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 10/213,791, filed Aug. 7, 2002, the disclosure of which is
incorporated herein by reference in its entirety; which is a
divisional of U.S. application Ser. No. 09/441,340, filed Nov. 16,
1999, now U.S. Pat. No. 6,448,476; which claims the benefit of
priority to U.S. Provisional Application Ser. No. 60/108,763 filed
Nov. 17, 1998.
FIELD OF THE INVENTION
[0002] The present invention relates in general to detoxifying
phosphonate herbicides.
DESCRIPTION OF THE PRIOR ART
[0003] Phosphorous containing organic molecules can be naturally
occurring or synthetically derived. Organic molecules containing
phosphorous-carbon (C--P) bonds are also found naturally or as
synthetic compounds, and are often not rapidly degraded, if at all,
by natural enzymatic pathways. Synthetic organophosphonates and
phosphinates, compounds that contain a direct carbon-phosphorous
(C--P) bond in place of the better known carbon-oxygen-phosphorous
linkage of phosphate esters (Metcalf et al., Gene 129:27-32, 1993),
have thus been widely used as insecticides, antibiotics, and as
herbicides (Chen et al., J. Biol. Chem. 265:4461-4471, 1990;
Hilderbrand et al., The role of phosphonates in living systems,
Hilderbrand, R. L., ed, pp. 5-29, CRC Press, Inc., Boca Raton,
Fla., 1983). Phosphonates are ubiquitous in nature, and are found
alone and in a diversity of macromolecular structures in a variety
of organisms (Jiang et al., J. Bacteriol. 177:6411-6421, 1995).
Degradation of phosphonate molecules proceeds through a number of
known routes, a C--P lyase pathway, a phosphonatase pathway, and a
C--N hydrolysis pathway (Wanner, Biodegradation 5:175-184, 1994;
Barry et al., U.S. Pat. No. 5,463,175, 1995). Bacterial isolates
capable of carrying out these steps have been characterized
(Shinabarger et al., J. Bacteriol. 168:702-707, 1986; Kishore et
al., J. Biol. Chem. 262:12, 164-12, 168, 1987; Pipke et al., Appl.
Environ. Microbiol. 54:1293-1296, 1987; Jacob et al., Appl.
Environ. Microbiol. 54:2953-2958, 1988; Lee et al., J. Bacteriol.
174:2501-2510, 1992; Dumora et al., Biochim. Biophys. Acta
997:193-198, 1989; Lacoste et al., J. Gen. Microbiol.
138:1283-1287, 1992). However, with the exception of phosphonatase
and glyphosate oxidase (GOX), other enzymes capable of carrying out
these reactions have not been characterized.
[0004] Several studies have focused on the identification of genes
required for C--P lyase degradation of phosphonates. Wackett et al.
(J. Bacteriol. 169:710-717, 1987) disclosed broad substrate
specificity toward phosphonate degradation by Agrobacterium
radiobacter and specific utilization of glyphosate as a sole
phosphate source. Shinabarger et al. and Kishore et al. disclosed
C--P lyase degradation of the phosphonate herbicide, glyphosate, to
glycine and inorganic phosphate through a sarcosine intermediate by
Pseudomonas species.
[0005] E. coli B strains had previously been shown to be capable of
phosphonate utilization (Chen et al.), whereas E. coli K-12 strains
were incapable of phosphonate degradation. However, K-12 strains
were subsequently shown to contain a complete, though cryptic, set
of genes (psiD or phn) capable of phosphonate utilization (Makino
et al.), as mutants were easily selected by growth on low phosphate
media containing methyl- or ethyl-phosphonate as sole phosphorous
sources. Such K-12 strains adapted for growth on methyl- or
ethylphosphonate were subsequently shown to be able to utilize
other phosphonates as sole phosphorous sources (Wackett et al., J.
Bacteriol. 169:1753-1756, 1987).
[0006] Avila et al. (J. Am. Chem. Soc. 109:6758-6764, 1987) were
interested in the mechanistic appraisal of biodegradative and
detoxifying processes as related to aminomethyl-phosphonates,
including elucidating the intermediates, products, and mechanisms
of the degradative dephosphorylation process. Avila et al. studied
the formation of dephosphorylated biodegradation products from a
variety of aminophosphonate substrates in E. coli K-12 cultures
previously adapted to growth on ethylphosphonate. Furthermore,
Avila et al. utilized N-acetyl-AMPA
(N-acetyl-amino-methyl-phosphonate) as a sole phosphate source in
some of their studies in order to show that acetylated AMPA was not
inhibitory to C--P bond cleavage. In addition, Avila et al. noted
that N-acetyl-AMPA was able to serve as a sole phosphate source
during E. coli K-12 growth, however, they did not observe
N-acetyl-AMPA formation when AMPA was used as a sole phosphate
source. Their results indicated that AMPA was not a substrate for
acetylation in E. coli.
[0007] Chen et al. identified a functional psiD locus from E. coli
B by complementation cloning into an E. coli K-12 strain deficient
for phosphonate utilization, which enabled the K-12 strain to
utilize phosphonate as a sole phosphate source (J. Biol. Chem.
265:4461-4471, 1990). Chen et al. thus disclosed the DNA sequence
of the psiD complementing locus, identified on a 15.5 kb BamHI
fragment containing 17 open reading frames designated phnA-phnQ,
comprising the E. coli B phn operon. The cryptic phn (psiD) operon
from E. coli K-12 was subsequently found to contain an 8-base pair
insertion in phnE. The resulting frameshift in phnE not only
results in defective phnE gene product, but also apparently causes
polar effects on the expression of downstream genes within the
operon, which prevent phosphonate utilization (Makino et al., J.
Bacteriol. 173:2665-2672, 1991). The operon has been more
accurately described to contain the genes phnC-phnP by the work of
Makino et al. Further research has been directed to understanding
the nature of the function of each of the genes within this operon
(Chen et al., J. Biol. Chem. 265:4461-4471, 1990; Makino et al., J.
Bacteriol. 173:2665-2672, 1991; Wanner et al., FEMS Microbiol.
Lett. 100:133-140, 1992; Metcalf et al., Gene 129:27-32, 1993;
Ohtaki et al., Actinomyceteol. 8:66-68, 1994). In all of these
efforts, the phnO gene has been implicated as a regulatory protein
based on its similarity to other nucleotide binding proteins
containing structural helix-turn-helix motifs. Furthermore,
mutagenesis of genes in the phn operon demonstrated that phnO was
not required for phosphonate utilization, further supporting the
proposed regulatory function for this gene (Metcalf et al., J.
Bacteriol. 173:587-600, 1991), at least for the phosphonates
tested. Homologous phn sequences have been identified from other
bacteria, including a gene substantially similar to E. coli phnO,
isolated from S. griseus, using nucleotide sequences deduced from
those in the E. coli phnO gene (Jiang et al., J. Bacteriol.
177:6411-6421, (1995); McGrath et al., Eur. J. Biochem.
234:225-230, (1995); Ohtaki et al., Actinomyceteol. 8:66-68,
(1994)). However, no function other than as a regulatory factor has
been proposed for phnO. A regulatory role for phnO in the CP lyase
operon has been cited again in a recent review (Berlyn, Microbiol.
Molec. Biol. Rev. 62:814-984, 1998).
[0008] Advances in molecular biology, and in particular in plant
sciences in combination with recombinant DNA technology, have
enabled the construction of recombinant plants which contain
normative genes of agronomic importance. Furthermore, when
incorporated into and expressed in a plant, such genes desirably
confer some beneficial trait or characteristic to the recombinant
plant. One such trait is herbicide resistance. A recombinant plant
capable of growth in the presence of a herbicide has a tremendous
advantage over herbicide-susceptible species. In addition,
herbicide tolerant plants provide a more cost effective means for
agronomic production by reducing the need for tillage to control
weeds and volunteers.
[0009] Chemical herbicides have been used for decades to inhibit
plant metabolism, particularly for agronomic purposes as a means
for controlling weeds or volunteer plants in fields of crop plants.
A class of herbicides which have proven to be particularly
effective for these purposes are known as phosphonates or
phosphonic acid herbicides. Perhaps the most agronomically
successful phosphonate herbicide is glyphosate
(N-phosphono-methyl-glycine).
[0010] Recombinant plants have been constructed which are tolerant
to the phosphonate herbicide glyphosate. When applied to plants,
glyphosate is absorbed into the plant tissues and inhibits aromatic
amino acid formation, mediated by an inhibition of the activity of
the plastid-localized 5-enolpyruvyl-3-phosphoshikimic acid synthase
enzyme, also known as EPSP synthase or EPSPS, an enzyme generally
thought to be unique to plants, bacteria and fungi. Recombinant
plants have been transformed with a bacterial EPSPS enzyme which is
much less sensitive to glyphosate inhibition. Therefore, plants
expressing this bacterial EPSPS are less sensitive to glyphosate,
and are often characterized as being glyphosate tolerant.
Therefore, greater amounts of glyphosate can be applied to such
recombinant plants, ensuring the demise of plants which are
susceptible or sensitive to the herbicide. However, other genes
have been identified which, when transformed into a plant genome,
encoding enzymes which also provide glyphosate tolerance. One such
enzyme has been described as GOX, or glyphosate-oxidoreductase. GOX
functions in providing protection to plants from the phosphonate
herbicide glyphosate by catalyzing the degradation of glyphosate to
aminomethyl phosphonic acid (AMPA) and glyoxylate. AMPA produced as
a result of glyphosate degradation can cause bleaching and stunted
or depressed plant growth, among other undesirable characteristics.
Many plant species are also sensitive to exogeneously applied AMPA,
as well as to endogenous AMPA produced as a result of GOX mediated
glyphosate herbicide degradation. No method has been described
which discloses the protection of plants from applications of
phosphonate herbicides such as AMPA.
[0011] Barry et al. (U.S. Pat. No. 5,633,435) disclose genes
encoding EPSP synthase enzymes which are useful in producing
transformed bacteria and plants which are tolerant to glyphosate as
a herbicide, as well as the use of such genes as a method for
selectively controlling weeds in a planted transgenic crop field.
Barry et al. (U.S. Pat. No. 5,463,175) disclose genes encoding
glyphosate oxidoreductase (GOX) enzymes useful in producing
transformed bacteria and plants which degrade glyphosate herbicide
as well as crop plants which are tolerant to glyphosate as a
herbicide. Barry et al. (U.S. Pat. No. 5,463,175) disclosed the
formation of AMPA as a product of GOX mediated glyphosate
metabolism. AMPA has been reported to be much less phytotoxic than
glyphosate for most plant species (Franz, 1985) but not for all
plant species (Maier, 1983; Tanaka et al., 1986). Co-expression of
a gene encoding a protein capable of neutralizing or metabolizing
AMPA produced by glyphosate degradation would provide a substantial
improvement over the use of GOX alone. Thus, a method for
overcoming sensitivity to AMPA formation as a result of glyphosate
degradation, or a method for resistance to AMPA when used as a
herbicide or as a selective agent in plant transformation methods,
would be useful for providing enhanced or improved herbicide
tolerance in transgenic plants and in other organisms sensitive to
such compounds.
[0012] The use of glyphosate as a chemical gametocide has been
described (U.S. Pat. No. 4,735,649). Therein, it is disclosed that
glyphosate can, under optimal conditions, kill about 95% of male
gametes, while leaving about 40-60% of the female gametes capable
of fertilization. In addition, a stunting effect was typically
observed at the application levels disclosed, shown by a reduction
in the size of the plant and by a minor amount of chlorosis. Thus,
a major drawback of using glyphosate as a gametocide, as is
generally true with most gametocides, is the phytotoxic side
effects resulting from lack of sufficient selectivity for male
gametes. These phytotoxic manifestations may be effectuated by AMPA
production in transgenic plants expressing GOX after treatment with
glyphosate. Therefore, it would be advantageous to provide a method
for preventing the stunting effect and chlorosis as side effects of
using glyphosate as a gametocide in transgenic plants expressing
GOX. Furthermore, a more effective method would optimally kill more
than 95% of male gametes or prevent male gametes from maturing and
would leave greater than 60% of female gametes substantially
unaffected. It is believed that tissue specific co-expression of
GOX with a transacylase gene encoding an enzyme capable of
N-acylation of AMPA would achieve this goal.
[0013] It has now been discovered that the E. coli phnO gene
encodes an enzyme having transacylase, acyltransferase, or Acyl-CoA
transacylase activity in which a preferred substrate is a
phosphonate displaying a terminal amine, and in particular
amino-methyl-phosphonic acid (AMPA). The transfer of an acyl group
from an Acyl-CoA to the free terminal amine of AMPA results in the
formation of an N-acylated AMPA. Plants are not known to acylate
AMPA to any great extent, and some plants have been shown to be
sensitive to AMPA and insensitive to acyl-AMPA. Thus, expression of
phnO in plants would be useful in enhancing the phosphonate
herbicide tolerance, particularly when AMPA is used as a herbicide
or selective agent in plant transformation, and more particularly
when glyphosate is used as a herbicide in combination with
recombinant plants expressing a GOX gene.
SUMMARY OF THE INVENTION
[0014] Briefly therefore the present invention is directed to a
composition of matter comprising a novel class of genes which
encode proteins capable of N-acylation of phosphonate compounds and
to methods of using these genes and encoded proteins for improving
plant tolerance to phosphonate herbicides. The present invention is
also directed to a method for selecting recombinant plants and
microbes transformed with genes encoding proteins which are capable
of N-acylation of phosphonate compounds, and to peptides which are
capable of N-acylation of the compound N-amino-methyl-phosphonic
acid (N-AMPA) and other related phosphonate compounds. In addition,
the present invention is also directed to a method for using plants
transformed with transacylase genes to prevent self-fertilization
or to a method for enhancing hetero-fertilization in plants.
[0015] Among the several advantages found to be achieved by the
present invention, therefore, may be noted the provision of
producing stably transformed herbicide tolerant recombinant plants
which have inserted into their genomes a polynucleotide sequence
encoding a desired gene product, preferably an N-acyl-transferase
enzyme. The polynucleotide sequence preferably is composed of a
cassette containing a promoter sequence which is functional in
plants and which is operably linked 5' to a structural DNA sequence
which, when transcribed into an RNA sequence, encodes an
N-acyl-transferase enzyme peptide. The promoter sequence can be
heterologous with respect to the structural DNA sequence and causes
sufficient expression of the transferase enzyme in plant tissue to
provide herbicide tolerance to the plant transformed with the
polynucleotide sequence. The structural sequence is preferably
operably linked 3' to a 3' non-translated polyadenylation sequence
which functions in plants, and which when transcribed into RNA
along with the structural sequence causes the addition of a
polyadenylated nucleotide sequence to the 3' end of the transcribed
RNA. Expression of the structural DNA sequence produces sufficient
levels of the acyltransferase enzyme in the plant tissue to enhance
the herbicide tolerance of the transformed plant.
[0016] As a further embodiment, the structural DNA sequence may
also contain an additional 5' sequence encoding an amino-terminal
peptide sequence which functions in plants to target the peptide
produced from translation of the structural sequence to an
intracellular organelle. This additional coding sequence is
preferably linked in-frame to the structural sequence encoding the
acyltransferase enzyme. The amino terminal peptide sequence can be
either a signal peptide or a transit peptide. The intracellular
organelle can be a chloroplast, a mitochondrion, a vacuole,
endoplasmic reticulum, or other such structure. The structural DNA
sequence may also be linked to 5' sequences such as untranslated
leader sequences (UTL's), intron sequences, or combinations of
these sequences and the like which may serve to enhance expression
of the desired gene product. Intron sequences may also be
introduced within the structural DNA sequence encoding the
acyltransferase enzyme. Alternatively, chloroplast or plastid
transformation can result in localization of an acyltransferase
coding sequence and enzyme to the chloroplast or plastid, obviating
the requirement for nuclear genome transformation, expression from
the nuclear genome, and subsequent targeting of the gene product to
a subcellular organelle.
[0017] Preferably, the recombinant plant expresses a gene encoding
an enzyme which catalyzes the formation of AMPA. AMPA formation can
result from the metabolism of a naturally occurring precursor, from
a precursor such as glyphosate provided to the plant, or can result
from the formation of AMPA through some catabolic pathway.
Co-expression of GOX along with AMPA acyltransferase expression
provides a plant which is surprisingly more resistant to certain
phosphonate herbicides. However, one embodiment allowing plants
transformed with only an N-acyltransferase to grow in the presence
of AMPA or similar or related compounds would provide a useful
selective method for identifying genetically transformed plants,
callus, or embryogenic tissues.
[0018] In accordance with another aspect of the present invention
is the provision of a method for selectively enhancing or improving
herbicide tolerance in a recombinant plant which has inserted into
its nuclear, chloroplast, plastid or mitochondrial genome a
cassette comprised of a polynucleotide sequence which encodes an
N-acyl-transferase enzyme.
[0019] A further embodiment encompasses the improvement of a method
for selectively enhancing herbicide tolerance in a transformed
plant expressing a GOX gene which encodes a glyphosate
oxidoreductase enzyme expressed in the same plants in which an
acyltransferase enzyme is produced.
[0020] In accordance with another aspect of the present invention
is the provision of a method for producing a genetically
transformed herbicide tolerant plant by inserting into a genome of
a plant cell a cassette comprising a polynucleotide sequence which
encodes an N-acyl-transferase enzyme.
[0021] A further embodiment encompasses the improvement of a method
for producing a genetically transformed herbicide tolerant plant
from a plant cell expressing a GOX gene which encodes a glyphosate
oxidoreductase enzyme expressed in the same plant cell in which an
acyltransferase enzyme is produced.
[0022] In any of the foregoing embodiments, the herbicide tolerant
plant or plant cell can be selected from the group consisting of
corn, wheat, cotton, rice, soybean, sugarbeet, canola, flax,
barley, oilseed rape, sunflower, potato, tobacco, tomato, alfalfa,
lettuce, apple, poplar, pine, eucalyptus, acacia, poplar, sweetgum,
radiata pine, loblolly pine, spruce, teak, alfalfa, clovers and
other forage crops, turf grasses, oilpalm, sugarcane, banana,
coffee, tea, cacao, apples, walnuts, almonds, grapes, peanuts,
pulses, petunia, marigolds, vinca, begonias, geraniums, pansy,
impatiens, oats, sorghum, and millet.
[0023] In accordance with another aspect of the present invention
is the provision of a peptide capable of N-acylation of the
compound N-aminomethylphosphonic acid (N-AMPA or AMPA) or other
such compounds which are capable of causing phytotoxic effects when
applied to, introduced into, or produced by plant metabolisms. One
such peptide is N-aminomethylphosphonic acid transacylase (AAT)
derived from expression of an E. coli phnO structural gene
sequence. Other peptides similar in structure and function to the
E. coli phnO gene product are also contemplated.
[0024] Another aspect of the present invention is the provision of
a method for selecting cells transformed with a vector containing
an acyltransferase gene expressing an enzyme capable of N-acylation
of AMPA and like compounds. The method includes the steps of
transforming a population of cells with the vector, and isolating
and purifying the transformed cells from non-transformed cells in
the population after selecting for the transformed cells by
incubation in the presence of amounts of AMPA sufficient to be
inhibitory to the growth or viability of any non-transformed cells.
The transformed cells can be bacterial, plant or fungal cells.
Bacterial cells can be members of any of the families encompassed
by Enterobacteraceae, Mycobacteraceae, Agrobacteraceae, and
Actinobacteraceae, among others. Fungal cells can be members of
Ascomycota, Basidiomycota, etc. Plant cells can be derived from any
member of the Plantae family.
[0025] A further embodiment of the present invention provides for a
method for producing a plant from a tissue, a cell, or other part
of a plant which was derived from a plant transformed with an
acyltransferase gene, a phnO gene, a gox gene, a gene in which GOX
and acyltransferase peptides are produced from a translational
fusion or a transcriptional fusion, or a polycistronic gene which
encodes GOX and acyltransferase peptides.
[0026] A further embodiment of the present invention provides for a
method for producing plants which express all or a portion of a
phnO gene or similar acyltransferase gene, or a GOX gene as an
antisense gene in a tissue specific manner.
[0027] Other aspects also include reagents such as antibodies
directed to AMPA acyltransferase, and polynucleotides for use in
identifying acyltransferase gene sequences. These reagents can be
included in kits containing AMPA acyltransferase, polynucleotides
which are or are complimentary to an AMPA acyltransferase gene
sequence, polynucleotides for use in thermal amplification of an
AMPA acyltransferase gene sequence, antibodies directed to AMPA
acyltransferase for the detection of AMPA acyltransferase in the
laboratory or in the field, and any other reagents necessary for
use in kit form as well as for use in other assays contemplated
herein.
[0028] A further object of the present invention is to provide a
method for using phosphonate herbicides as chemical hybridizing
agents. The method allows for selective gametocidal effects and for
the production of male sterile plants. Such plants may be
engineered so that gox or phnO, or gox and phnO fail to be
expressed in plant tissues required for reproduction, causing
sensitivity to applied phytotoxic compounds which inhibit formation
of mature gamete structures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 illustrates a [.sup.14C] isotope detection HPLC
chromatogram representing a sample of a dosing solution containing
only [.sup.14C] glyphosate (11.3 minutes, 98.8%), and trace amounts
of [.sup.14C] AMPA (5.8 minutes, 0.16%) and an unidentified
[.sup.14C] material (10.2 minutes, 1%).
[0030] FIG. 2 illustrates an HPLC profile of a mixture of standards
of the observed radioactive metabolites [.sup.14C] AMPA, [.sup.14C]
glyphosate, and N-acetyl-[.sup.14C]-AMPA, as well as the impurity
identified as N-acetyl-N-methyl-[.sup.14C]-AMPA.
[0031] FIG. 3 illustrates a representative HPLC profile of an
extract from a corn callus tissue transformed with GOX and AMPA
acetyltransferase, and treated with [.sup.14C] glyphosate. The
peaks indicate [.sup.14C] glyphosate (10.8 minutes, 92.5% of total
observed [.sup.14C]), [.sup.14C] AMPA primarily generated by GOX
mediated glyphosate degradation (5.98 minutes, 1.71% of total
observed [.sup.14C]), and N-acetyl-[.sup.14C]AMPA produced from
acylation of [.sup.14C] AMPA mediated by recombinant AMPA
acyltransferase expressed within callus tissue (13.29 minutes,
4.54% total observed [.sup.14C]).
[0032] FIG. 4 illustrates plasmid pMON17261.
[0033] FIG. 5 illustrates plasmid pMON32571.
[0034] FIG. 6 illustrates plasmid pMON32936.
[0035] FIG. 7 illustrates plasmid pMON32946.
[0036] FIG. 8 illustrates plasmid pMON32948.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The following detailed description of the invention is
provided to aid those skilled in the art in practicing the present
invention. Even so, the following detailed description should not
be construed to unduly limit the present invention as modifications
and variations in the embodiments discussed herein may be made by
those of ordinary skill in the art without departing from the
spirit or scope of the present inventive discovery.
[0038] Many words and phrases are well known in the art of
molecular biology, microbiology, protein chemistry, and plant
sciences and generally have their plain and ordinarily understood
meaning, otherwise to be taken in context. However, the following
words and phrases as used herein have the meanings generally set
forth below.
[0039] AMPA acyltransferase. As used herein, AMPA acyltransferase
refers to an enzyme which functions in transferring an acyl
chemical group from an acylcarrier compound such as coenzyme A,
which is well known and abbreviated in the biological and chemical
arts as CoA. In particular, an AMPA acyltransferase transfers an
acyl chemical group from an acylcarrier to the free amino group of
aminomethylphosphonate, well known to be a byproduct of glyphosate
oxidoreductase mediated glyphosate metabolism. AMPA acyltransferase
(AAT), which herein may also be known as AMPA acetyltransferase,
AMPA transacylase, or acetyl-AMPA synthase (AAS), has been shown
herein to be capable of acetyl transferase activity, propionyl
transferase activity, malonyl transferase activity, and succinyl
transferase activity. Thus, any biologically functional equivalent
of these compounds (acetyl, propionyl, malonyl, or succinyl) which
serves as an acyl-carrier form of substrate capable of functioning
with an AMPA acyltransferase enzyme is within the scope of the
present invention. One AMPA acyltranferase which has been
identified, and shown by example herein to function according to
the description contained herein, has previously been referred to
in the art as PhnO, a protein encoded by the phnO gene within the
E. coli phn operon.
[0040] Biological functional equivalents. As used herein such
equivalents with respect to the AMPA-acyltransferase proteins of
the present invention are peptides, polypeptides and proteins that
contain a sequence or moiety exhibiting sequence similarity to the
novel peptides of the present invention, such as PhnO, and which
exhibit the same or similar functional properties as that of the
polypeptides disclosed herein, including transacylase activity.
Biological equivalents also include peptides, polypeptides and
proteins that react with, i.e. specifically bind to antibodies
raised against PhnO and that exhibit the same or similar
transacylase activity, including both monoclonal and polyclonal
antibodies.
[0041] Biological functional equivalents as used herein with
respect to genes encoding acyltransferases are polynucleotides
which react with the polynucleotide sequences contemplated and
described herein, i.e. which are capable of hybridizing to a
polynucleotide sequence which is or is complementary to a
polynucleotide encoding an acyltransferase which functions in
transacylation of AMPA or which encode substantially similar
acyltransferase proteins contemplated and described herein. A
protein which is substantially similar to the proteins described
herein is a biological functional equivalent and exhibits the same
or similar functional properties as that of the polypeptides
disclosed herein, including improved herbicide tolerance or
improved herbicide resistance. Biological equivalent peptides
contain a sequence or moiety such as one or more active sites which
exhibit sequence similarity to the novel peptides of the present
invention, such as PhnO. Biological equivalents also include
peptides, polypeptides, and proteins that react with, i.e. which
specifically bind to antibodies raised against PhnO and PhnO-like
peptide sequences and which exhibit the same or similar improvement
in herbicidal tolerance or resistance, including both monoclonal
and polyclonal antibodies.
[0042] Chloroplast or plastid localized, as used herein, refers to
a biological molecule, either polynucleotide or polypeptide, which
is positioned within the chloroplast or plastid such that the
molecule is isolated from the cellular cytoplasmic milieu, and
functions within the chloroplast or plastid cytoplasm to provide
the effects claimed in the instant invention. Localization of a
biological molecule to the chloroplast or plastid can occur, with
reference to polynucleotides, by artificial mechanical means such
as electroporation, mechanical microinjection, or by polynucleotide
coated microprojectile bombardment, or with reference to
polypeptides, by secretory or import means wherein a natural,
non-naturally occurring, or heterologous plastid or chloroplast
targeting peptide sequence is used which functions to target,
insert, assist, or localize a linked polypeptide into a chloroplast
or plastid.
[0043] Event refers to a transgenic plant or plant tissue derived
from the insertion of foreign DNA into one or more unique sites in
the nuclear, mitochondrial, plastid or chloroplast DNA.
[0044] Expression: The combination of intracellular processes,
including transcription, translation, and other intracellular
protein and RNA processing and stabilization functions, which a
coding DNA molecule such as a structural gene is subjected to in
order to produce a gene product.
[0045] Non-naturally occurring gene: A non-naturally occurring
acyl-transferase gene of the present invention contains genetic
information encoding a plant functional RNA sequence, but
preferably is a gene encoding an acyl-transferase protein, whether
naturally occurring or a variant of a naturally occurring protein,
prepared in a manner involving any sort of genetic isolation or
manipulation. This includes isolation of the gene from its
naturally occurring state, manipulation of the gene as by codon
modification, site specific mutagenesis, truncation, introduction
or removal of restriction endonuclease cleavage sites, synthesis or
resynthesis of a naturally occurring sequence encoding an
acyltransferase of the present invention by in vitro methodologies
such as phosphoramidite chemical synthesis methods, etc., thermal
amplification methods such as polymerase chain reaction, ligase
chain reaction, inverted polymerase reaction, and the like etc.,
and any other manipulative or isolative method.
[0046] Operably Linked: Nucleic acid segments connected in frame so
that the properties of one influence the expression of the other.
For example, a promoter sequence having properties of polymerase
loading, binding, and initiation of transcription functions
influences the expression of sequences which are linked to the
promoter.
[0047] Plant-Expressible Coding Regions: Coding regions which are
expressible, i.e can be transcribed and/or translated in planta,
because they contain typical plant regulatory elements to
facilitate the expression of a gene of interest.
[0048] Plastid Transit Peptide: Any amino acid sequence useful in
targeting or localizing a linked amino acid, such as a protein
fusion, to a subcellular compartment or organelle such as a plastid
or chloroplast. Amino acid sequences which facilitate entry into a
mitochondria are not altogether unlike or dissimilar from plastid
transit peptides, and are also described as transit peptides, but
fail to function for targeting peptide sequences to plastid or
chloroplast organelles.
[0049] Progeny of a transgenic plant includes any offspring or
descendant of the transgenic plant which contains at least one
heterologous or trans-gene, or any subsequent plant derived from
the transgenic plant which has the transgene in its lineage.
Progeny is not limited to one generation, but rather encompasses
the descendants of the transgenic plant so long as they contain or
express the desired transgene. Seeds containing transgenic embryos
as well as seeds from the transgenic plants and their offspring or
descendants are also important parts of the invention. Transgenic
cells, tissues, seeds or plants which contain a desired transgene
are progeny of the original transgenic cells, tissue, or plant.
[0050] Promoter: A recognition site on a DNA sequence or group of
DNA sequences that provides an expression control element for a
structural gene and to which RNA polymerase specifically binds and
initiates RNA synthesis (transcription) of that gene.
[0051] R.sub.0 is the primary regenerant plant derived from
transformation of plant tissue or cells in culture. Subsequent
progeny or generations derived from the R.sub.0 are referred to as
R.sub.1 (first generation), R.sub.2 (second generation), etc.
[0052] Regeneration: The process of producing a whole plant by
growing a plant from a plant cell or plant tissue (e.g., plant
protoplast or explant).
[0053] Structural Coding Sequence refers to a DNA sequence that
encodes a peptide, polypeptide, or protein that is produced
following transcription of the structural coding sequence to
messenger RNA (mRNA), followed by translation of the mRNA to
produce the desired peptide, polypeptide, or protein product.
[0054] Structural gene: A gene that is expressed to produce a
polypeptide.
[0055] Substantial homology: As this term is used herein,
substantial homology refers to nucleic acid sequences which are
from about 40 to about 65 percent homologous, from about 66 percent
homologous to about 75 percent homologous, from about 76 percent
homologous to about 86 percent homologous, from about 87 percent
homologous to about 90 percent homologous, from about 91 percent
homologous to about 95 percent homologous, and from about 96
percent homologous to about 99 percent homologous to a reference
polynucleotide sequence, such as either an E. coli phnO gene
sequence. A first polynucleotide molecule which is substantially
homologous to a second polynucleotide molecule is or is
complimentary to the second polynucleotide such that the first
polynucleotide molecule hybridizes to the second polynucleotide
molecule or its complementary sequence under stringent
hybridization conditions, with stringency being defined as the
optimum concentration of salt and temperature required to bring
about hybridization of a first polynucleotide to a second
polynucleotide. Methods for varying stringency are well known in
the art but may be referenced in Sambrook et al., Eds., Molecular
Cloning: A Laboratory Manual, Second Edition, 1989, Cold Spring
Harbor Press; or Ausubel et al, Eds., Short Protocols in Molecular
Biology, Third Edition, 1995, John Wiley and Sons, Inc.
Polypeptides which are believed to be within the scope if the
present invention are those which are from about 40 to about 65
percent similar, from about 66 percent similar to about 75 percent
similar, from about 76 percent similar to about 86 percent similar,
from about 87 percent similar to about 90 percent similar, from
about 91 percent similar to about 95 percent similar, and from
about 96 percent similar to about 99 percent similar to a reference
polypeptide sequence, preferably to an E. coli PhnO peptide
sequence.
[0056] Terminator: As used herein with respect to plant specific
sequences intended for in planta expression, the 3' end
transcription termination and polyadenylation sequence.
[0057] Transformation is a process of introducing an exogenous
polynucleotide sequence, such as a plasmid or viral vector or a
recombinant polynucleotide molecule, into a cell, protoplast,
plastid or chloroplast, or mitochondria in which the exogenous
polynucleotide sequence is either incorporated into an endogenous
polynucleotide sequence contained within the cell, or is capable of
autonomous replication. A transformed cell is a cell which has been
altered by the introduction of one or more exogenous polynucleotide
molecules into that cell. A stably transformed cell is a
transformed cell which has incorporated all or a portion of the
exogenous polynucleotide into the cells' nuclear, mitochondrial, or
plastid or chloroplast genomic material such that the exogenous
polynucleotide confers some genotypic or phenotypic trait or traits
to that cell and to the progeny of the transformed cell, measured
by the detection of the exogenously introduced polynucleotide, the
mRNA or protein product of the exogenous polynucleotide, a
metabolite not normally produced by or found within the cell in the
absence of the exogenous polynucleotide, or a visual inspection of
the cell, plant tissue, or plants derived from the transformed
cell.
[0058] Transgene: A transgene is a polynucleotide sequence which
has been transferred to a cell and comprises an expression cassette
containing a structural gene sequence encoding a desired
polypeptide. The transgene is capable of being expressed when in a
recipient transformed cell, tissue, or organism. This may include
an entire plasmid or other vector, or may simply include the plant
functional coding sequence of the transferred polynucleotide. A
transgenic cell is any cell derived from or regenerated from a
transformed cell, including the initially transformed cell.
Exemplary transgenic cells include plant callus tissue derived from
a transformed plant cell and particular cells such as leaf, root,
stem, meristem, and other somatic tissue cells, or reproductive or
germ line and tapetal cells obtained from a stably transformed
transgenic plant. A transgenic event is a plant or progeny thereof
derived from the insertion of at least one exogenous polynucleotide
into the nuclear, plastidic, or mitochondrial genome of a plant
cell or protoplast. A transgenic plant is a plant or a progeny
thereof which has been genetically modified to contain and express
heterologous polynucleotide sequences as proteins or as RNA or DNA
molecules not previously a part of the plant composition. As
specifically exemplified herein, a transgenic cotton plant, for
example, is genetically modified to contain and express at least
one heterologous DNA sequence operably linked to and under the
regulatory control of transcriptional and translational control
sequences which function in plant cells or tissue or in whole
plants. A transgenic plant may also be referred to as a transformed
plant. A transgenic plant also refers to progeny of the initial
transgenic plant where those progeny contain and are capable of
expressing the heterologous coding sequence under the regulatory
control of the plant expressible transcriptional and translational
control sequences described herein. A transgenic plant can produce
transgenic flowers, seeds, bulbs, roots, tubers, fruit, and pollen
and the like and can be crossed by conventional breeding means with
compatible lines of plants to produce hybrid transgenic plants.
[0059] Vector: A DNA or other polynucleotide molecule capable of
replication in a host cell and/or to which another DNA or other
polynucleotide sequence can be operatively linked so as to bring
about replication of the linked sequence. A plasmid is an exemplary
vector.
[0060] In accordance with the present invention, it has been
discovered that plants can produce a phytotoxic compound when
transformed with certain genes encoding enzymes capable of
degrading glyphosate. In particular, glyphosate oxidoreductase
(GOX) mediated metabolism of glyphosate produces a phytotoxic
compound identified as N-aminomethyl-phosphonate (AMPA). Other
studies have shown that an N-acylated derivative of AMPA,
N-acyl-aminomethyl-phosphonate (N-acyl-AMPA or acyl-AMPA), is much
less phytotoxic to most plant species. Enzymes have been identified
which are able to covalently modify AMPA through an acylation
mechanism, resulting in the formation of N-acyl-AMPA. One enzyme in
particular causes exogeneously applied AMPA to be N-acetylated. In
plants expressing this enzyme along with GOX, phytotoxic AMPA
effects are not observed.
[0061] The inventions contemplated herein take advantage of
recombinant polynucleotide cassettes comprised of elements for
regulating gene expression into which sequences, such as structural
genes encoding useful proteins, can be inserted. Insertion of such
sequences into an expression cassette is preferably accomplished
using restriction endonucleases well known in the art, however
other methods for insertion are known. For example, site specific
recombination methods are effective for inserting desired sequences
into such expression cassettes. Expression cassettes contain at
least a plant operable promoter for use in initiating the
production of a messenger RNA molecule from which the useful
protein is translated. Cassettes also contain plant operable
sequences, identified as 3' sequences, which function in
terminating transcription and provide untranslated sequences which
are 3' polyadenylated. Thus, an expression cassette intended for
use in plants should contain at least a promoter sequence linked at
its 3' end to a 3' transcription termination and polyadenylation
sequence. Preferably, a polycloning sequence or linker sequence
containing one or more unique restriction endonuclease cleavage
sites is present bridging the promoter and 3' sequence for
convenient insertion of structural gene sequences and other
elements. An expression cassette intended for use in plants also
preferably contains a 5' untranslated sequence inserted between the
promoter and the 3' sequence. 5' untranslated sequences (UTL's)
have been shown to enhance gene expression in plants. Introns are
also contemplated as sequences which may be present in such
expression cassettes of the present invention. The presence of
plant operable introns has also been shown, in maize in particular,
to enhance gene expression in certain plant species. Introns may be
present in an expression cassette in any number of positions along
the sequence of the cassette. This can include positions between
the promoter and the 3' termination sequence and/or within a
structural gene. There may be more than one intron present in an
expression cassette, however for the purposes of the contemplated
inventions herein, it is preferred that introns be present when
expression cassettes are used in monocotyledonous plants and plant
tissues. Enhancer sequences are also well known in the art and may
be present, although not necessarily as a part of an expression
cassette, as enhancer sequences are known to function when present
upstream or downstream or even at great distances from a promoter
driving expression of a gene of interest.
[0062] The expression of a gene localized to the plant nuclear
genome and which exists in double-stranded DNA form involves
transcription to produce a primary messenger RNA transcript (mRNA)
from one strand of the DNA by RNA polymerase enzyme, and the
subsequent processing of the mRNA primary transcript inside the
nucleus. This processing involves a 3' non-translated
polynucleotide sequence which adds polyadenylate nucleotides to the
3' end of the RNA. Transcription of DNA into mRNA is regulated by a
sequence of DNA usually referred to as the "promoter". The promoter
comprises a sequence of bases that signals RNA polymerase to
associate with the DNA and to initiate the transcription of mRNA
using the template DNA strand to make a corresponding complementary
strand of RNA.
[0063] Those skilled in the art will recognize that there are a
number of promoters which are active in plant cells, and have been
described in the literature. Such promoters may be obtained from
plants, plant viruses, or plant commensal, saprophytic, symbiotic,
or pathogenic microbes and include, but are not limited to, the
nopaline synthase (NOS) and octopine synthase (OCS) promoters
(which are carried on tumor-inducing plasmids of Agrobacterium
tumefaciens), the cauliflower mosaic virus (CaMV) 19S and 35S
promoters, the light-inducible promoter from the small subunit of
ribulose 1,5-bisphosphate carboxylase (ssRUBISCO, a very abundant
plant polypeptide), the rice Act1 promoter, the Figwort Mosaic
Virus (FMV) 35S promoter, the sugar cane bacilliform DNA virus
promoter, the ubiquitin promoter, the peanut chlorotic streak virus
promoter, the comalina yellow virus promoter, the chlorophyll a/b
binding protein promoter, and meristem enhanced promoters Act2,
Act8, Act11 and EF1a and the like. All of these promoters have been
used to create various types of DNA constructs which have been
expressed in plants (see e.g., McElroy et al., 1990; Barry and
Kishore, U.S. Pat. No. 5,463,175) and which are within the scope of
the present invention. Chloroplast and plastid specific promoters,
chloroplast or plastid functional promoters, and chloroplast or
plastid operable promoters are also envisioned. It is preferred
that the particular promoter selected should be capable of causing
sufficient in-planta expression to result in the production of an
effective amount of acyltransferase to render a plant substantially
tolerant to phosphonate herbicides and products of phosphonate
herbicide metabolism. The amount of acyltransferase required to
provide the desired tolerance may vary with the plant species.
[0064] One set of preferred promoters are constitutive promoters
such as the CaMV35S or FMV35S promoters that yield high levels of
expression in most plant organs. Enhanced or duplicated versions of
the CaMV35S and FMV35S promoters are particularly useful in the
practice of this invention (Kay et al, 1987; Rogers, U.S. Pat. No.
5,378,619). In addition, it may also be preferred to bring about
expression of the acyltransferase gene in specific tissues of the
plant, such as leaf, stem, root, tuber, seed, fruit, etc., and the
promoter chosen should have the desired tissue and developmental
specificity. Therefore, promoter function should be optimized by
selecting a promoter with the desired tissue expression
capabilities and approximate promoter strength and selecting a
transformant which produces the desired herbicide tolerance in the
target tissues. This selection approach from the pool of
transformants is routinely employed in expression of heterologous
structural genes in plants since there is variation between
transformants containing the same heterologous gene due to the site
of gene insertion within the plant genome. (Commonly referred to as
"position effect"). In addition to promoters which are known to
cause transcription (constitutive or tissue-specific) of DNA in
plant cells, other promoters may be identified for use in the
current invention by screening a plant cDNA library for genes which
are selectively or preferably expressed in the target tissues and
then determine the promoter regions.
[0065] It is preferred that the promoters utilized have relatively
high expression in all meristematic tissues in addition to other
tissues inasmuch as it is now known that phosphonate herbicides can
be translocated and accumulated in this type of plant tissue.
Alternatively, a combination of chimeric genes can be used to
cumulatively result in the necessary overall expression level of
acyltransferase enzyme to result in the herbicide tolerant
phenotype. A promoter which provides relatively high levels of
expression can cause the production of a desired protein to in
planta levels ranging from 0.1 milligrams per fresh weight gram of
plant tissue, to 0.5 milligrams per fresh weight gram of plant
tissue, to 1.0 milligrams per fresh weight gram of plant tissue, to
2.0 or more milligrams per fresh weight gram of plant tissue. The
in planta levels of a desired protein in genetically isogenic crops
in a field can range across a spectrum, but generally the levels
fall within 70% of a mean, more preferably within 50% of a mean,
and even more preferably within 25% of a mean for all plants
analyzed in a given sample.
[0066] The promoters used in the DNA constructs (i.e. chimeric
plant genes) of the present invention may be modified, if desired,
to affect their control characteristics. For example, the CaMV35S
promoter may be ligated to the portion of the Arabidopsis thaliana
ribulose-1,5-bisphosphate carboxylase small subunit gene
(ssRUBISCO) that represses the expression of ssRUBISCO in the
absence of light, to create a promoter which is active in leaves
but not in roots. The resulting chimeric promoter may be used as
described herein. For purposes of this description, the phrase
"CaMV35S" promoter thus includes variations of CaMV35S promoter,
e.g., promoters derived by means of ligation with operator regions,
random or controlled mutagenesis, et cetera. Furthermore, the
promoters may be altered to contain multiple "enhancer sequences"
to assist in elevating gene expression. Examples of such enhancer
sequences have been reported by Kay et al. (1987).
[0067] One RNA produced by a DNA construct of the present invention
also contains a 5' non-translated leader sequence. This sequence
can be derived from the promoter selected to express the gene, and
can be specifically modified so as to increase translation of the
mRNA. The nontranslated or 5' untranslated leader sequence (NTR or
UTR) can be derived from an unrelated promoter or coding sequence.
For example, the 5' non-translated regions can also be obtained
from viral RNA's, from suitable eucaryotic genes, or from a
synthetic gene sequence. The present invention is not limited to
constructs, as presented in one of the following examples, wherein
the non-translated region is derived from the 5' non-translated
sequence that accompanies the promoter sequence. Examples of plant
gene leader sequences which are useful in the present invention are
the wheat chlorophyll a/b binding protein (cab) leader and the
petunia heat shock protein 70 (hsp70) leader (Winter et al.,
1988).
[0068] For optimal expression in monocotyledonous plants, an intron
should also be included in the DNA expression construct. This
intron would typically be placed near the 5' end of the mRNA in
untranslated sequence. This intron could be obtained from, but not
limited to, a set of introns consisting of the maize hsp70 intron
(Brown et al., U.S. Pat. No. 5,424,412; 1995) or the rice Act1
intron (McElroy et al., 1990).
[0069] Where more than one expression cassette in included within a
plasmid or other polynucleotide construct, a first expression
cassette comprising a DNA molecule typically contains a
constitutive promoter, a structural DNA sequence encoding a
glyphosate oxidoreductase enzyme (GOX), and a 3' non-translated
region. A second expression cassette comprising a DNA molecule
typically contains a constitutive promoter, a structural DNA
sequence encoding an N-acyl-transferase enzyme which is capable of
reacting with AMPA to produce N-acyl-AMPA, and a 3' non-translated
region. Additional expression cassettes comprising a DNA molecule
are also envisioned. For example, genes encoding insecticidal or
fungicidal activities, drought or heat tolerance, antibiotic
compounds, pharmaceutical compounds or reagents such as tumor
suppressor proteins or antibody components, biopolymers, other
commercially useful compounds and the like may also be expressed in
the plants envisioned by the present invention, along with genes
which provide increased herbicide tolerance. A number of
constitutive promoters which are active in plant cells have been
described. Suitable promoters for constitutive expression of either
GOX or an N-acyl-transferase include, but are not limited to, the
cauliflower mosaic virus (CaMV) 35S promoter (Odell et al. 1985),
the Figwort mosaic virus (FMV) 35S (Sanger et al. 1990), the
sugarcane bacilliform DNA virus promoter (Bouhida et al., 1993),
the commelina yellow mottle virus promoter (Medberry and Olszewski
1993), the light-inducible promoter from the small subunit of the
ribulose-1,5-bis-phosphate carboxylase (ssRUBISCO) (Coruzzi et al.,
1984), the rice cytosolic triosephosphate isomerase (TPI) promoter
(Xu et al. 1994), the adenine phosphoribosyltransferase (APRT)
promoter of Arabidopsis (Moffatt et al. 1994), the rice actin 1
gene promoter (Zhong et al. 1996), and the mannopine synthase and
octopine synthase promoters (Ni et al. 1995). All of these
promoters have been used to create various types of
plant-expressible recombinant DNA constructs. Comparative analysis
of constitutive promoters by the expression of reporter genes such
as the uidA (.beta.-glucuronidase) gene from E. coli has been
performed with many of these and other promoters (Li et al. 1997;
Wen et al. 1993).
[0070] Promoters used in the second cassette comprising a DNA
molecule can be selected to control or limit specific expression
where cell lethality is desired. In a preferred embodiment, the
promoter will be capable of directing expression exclusively or
primarily in tissues critical for plant survival or plant
viability, while limiting expression of the second cassette
comprising a DNA molecule in other nonessential tissues. For
example, tissues which differentiate into pollen development or
terminal tissues such as the pollen itself, the tapetal cell layer
of the anther, or the anther tissues. Alternatively, plant
promoters capable of regulating the expression of genes in
particular cell and tissue types are well known. Those that are
most preferred in the embodiments of this invention are promoters
which express specifically during the development of the male
reproductive tissue or in pollen at levels sufficient to produce
inhibitory RNA molecules complementary to the sense RNA transcribed
by the constitutive promoter of the first expression cassette
comprising a DNA molecule. Examples of these types of promoters
include the TA29 tobacco tapetum-specific promoter (Mariani et al.
1990), the PA1 and PA2 chalcone flavonone isomerase promoters from
petunia (van Tunen et al. 1990), the SLG gene promoter from
Brassica oleracea (Heizmann et al. 1991), and LAT gene promoters
from tomato (Twell et al. 1991).
[0071] Anther and pollen-specific promoters from rice have been
isolated. Examples include the Osg6B promoter, which was shown to
drive expression of the .beta.-glucuronidase gene in transgenic
rice in immature anthers. No activity was detected in other tissues
of spikelets, leaves or roots (Yokoi et al. 1997). The PS1
pollen-specific promoter from rice has been shown to specifically
express the .beta.-glucuronidase gene in rice pollen (Zou et al.
1994). Additional rice genes have been identified that specifically
express in the anther tapetum of rice (Tsuchiya et al. 1994,
Tsuchiya et al. 1997). The isolation of additional genes expressed
predominantly during anther development in rice can be performed,
for example, by construction of a cDNA library to identify anther
specific clones (Qu et al.).
[0072] Those skilled in the art are aware of the approaches used in
the isolation of promoters which function in plants, and from genes
or members of gene families that are highly expressed in particular
plant tissues such as in roots, shoots, meristem, leaves, flowers,
fruits, in pollen, or in plant cell types involved in the
production of pollen (Stinson et al. 1987; Brown and Crouch. 1990;
McCormick et al. 1989). Further examples of tissue specific
promoters include the promoter for the exopolygalacturonase gene of
maize (Dubald, et al. 1993) and the promoter for the Zmc13 mRNA
(Hanson, et al. 1989). Promoters which have been shown to
preferentially express in tomato pollen are the LAT52 and LAT59
promoters (Twell et al. 1991). A portion of the maize pZtap
promoter sequence (psgB6-1) was disclosed in U.S. Pat. No.
5,470,359.
[0073] A recombinant DNA molecule of the present invention
typically comprises a promoter operably or operatively linked to a
DNA sequence encoding a 5' non-translated region, a DNA sequence of
a plant intron, a structural sequence encoding a chloroplast
transit peptide (CTP), a DNA coding sequence for a gene encoding
improved herbicide tolerance, and a 3' non-translated region.
[0074] The 5' non-translated leader sequence can be derived from
the promoter selected to express the heterologous DNA sequence, and
can be specifically modified if desired so as to increase
translation of mRNA. A 5' non-translated region can also be
obtained from viral RNAs, from suitable eukaryotic genes, or from a
synthetic gene sequence. The present invention is not limited to
constructs wherein the non-translated region is derived from the 5'
non-translated sequence which accompanies the promoter sequence.
The leader sequence could also be derived from an unrelated
promoter or coding sequence.
[0075] The 3' non-translated region of a plant operable recombinant
DNA molecule contains a polyadenylation signal which functions in
plants to cause the addition of adenylate nucleotides to the 3' end
of the RNA. The 3' non-translated region can be obtained from
various genes which are expressed in plant cells. The nopaline
synthase 3' untranslated region (Fraley et al. 1983), the 3'
untranslated region from pea ssRUBISCO (Coruzzi et al. 1994), the
3' untranslated region from soybean 7S seed storage protein gene
(Schuler et al. 1982) and the pea small subunit of the pea
ssRUBISCO gene are commonly used in this capacity. The 3'
transcribed, non-translated regions containing the polyadenylate
signal of Agrobacterium tumor-inducing (Ti) plasmid genes are also
suitable.
[0076] Examples of plant introns suitable for expression in
monocots includes, for example, maize hsp70 intron, rice actin 1
intron, maize ADH 1 intron, Arabidopsis SSU intron, Arabidopsis
EPSPS intron, petunia EPSPS intron and others known to those
skilled in the art.
[0077] It may be particularly advantageous to direct the
localization of proteins conferring herbicide tolerance to
subcellular compartment, for example, to the mitochondrion,
endoplasmic reticulum, vacuoles, chloroplast or other plastidic
compartment. Proteins can be directed to the chloroplast by
including at their amino-terminus a chloroplast transit peptide
(CTP). Naturally occurring chloroplast targeted proteins,
synthesized as larger precursor proteins containing an
amino-terminal chloroplast targeting peptide directing the
precursor to the chloroplast import machinery, have been previously
identified and are well known in the art. Chloroplast targeting
peptides are generally cleaved by specific endoproteases located
within the chloroplast organelle, thus releasing the targeted
mature and preferably active enzyme from the precursor into the
chloroplast melieu. Examples of sequences encoding peptides which
are suitable for directing the targeting of the herbicide tolerance
gene or transacylase gene product to the chloroplast or plastid of
the plant cell include the petunia EPSPS CTP, the Arabidopsis EPSPS
CTP2 and intron, and others known to those skilled in the art. Such
targeting sequences provide for the desired expressed protein to be
transferred to the cell structure in which it most effectively
functions, or by transferring the desired expressed protein to
areas of the cell in which cellular processes necessary for desired
phenotypic function are concentrated. Chloroplast targeting
peptides have been found to be particularly useful in the selection
of glyphosate resistant plants (Barry et al., U.S. Pat. No.
5,463,175; Barry et al., U.S. Pat. No. 5,633,435). Glyphosate
functions to kill the cell by inhibiting aromatic amino acid
biosynthesis which takes place within the chloroplast. Therefor,
concentrating the resistance gene product within the chloroplast
provides increased resistance to the herbicide. The examples herein
provide for a transacylase which is also targeted to or localized
to and concentrated within the chloroplast. Specific examples of
chloroplast targeting peptides are well known in the art and
include the Arabidopsis thaliana ribulose bisphosphate carboxylase
small subunit ats1A transit peptide, an Arabidopsis thaliana EPSPS
transit peptide and a Zea maize ribulose bisphosphate carboxylase
small subunit transit peptide. One CTP that has functioned herein
to localize heterologous proteins to the chloroplast was derived
from the Arabidopsis thaliana ribulose bisphosphate carboxylase
small subunit ats1A transit peptide. A polynucleotide sequence
encoding a variant of this transit peptide used herein provides the
native transit peptide amino acid sequence plus a reiteration of
the transit peptide cleavage site, and has been shown herein to be
useful for deploying active recombinant transacylase enzyme to the
chloroplast. (SEQ ID NO:9).
[0078] An alternative means for localizing plant operable herbicide
tolerance or herbicide resistance genes to a chloroplast or plastid
includes chloroplast or plastid transformation. Recombinant plants
can be produced in which only the mitochondrial or chloroplast DNA
has been altered to incorporate the molecules envisioned in this
application. Promoters which function in chloroplasts have been
known in the art (Hanley-Bowden et al., Trends in Biochemical
Sciences 12:67-70, 1987). Methods and compositions for obtaining
cells containing chloroplasts into which heterologous DNA has been
inserted have been described, for example by Daniell et al. (U.S.
Pat. No. 5,693,507; 1997) and Maliga et al. (U.S. Pat. No.
5,451,513; 1995).
[0079] The accumulation of AMPA in plants can cause phytotoxic
symptoms which are manifested phenotypically as chlorosis of the
leaves, stunted growth, infertility, and death, although not all of
these symptoms are evidenced in every species of plant. It has been
discovered herein that enzymatic modification of the AMPA molecule
by transacylation to produce N-acyl-AMPA provides a means for
overcoming the phytotoxic effects of AMPA. A method for assaying
the conversion of AMPA to N-acyl-AMPA involves providing [.sup.14C]
labeled AMPA as one substrate for the transacylase enzyme, and
acyl-CoA as another substrate for the enzyme in an aqueous reaction
volume, and separating the [.sup.14C] labeled AMPA substrate from
N-acyl-[.sup.14C]-AMPA product by HPLC on an anion exchange column
as described in the examples herein. Surprisingly, the transacylase
enzyme has been shown to be capable of utilizing other acylated-CoA
compounds as substrates for transacylating the AMPA substrate. In
particular, propionyl-CoA was shown to be a particularly reactive
substrate for the transacylation reaction in vitro, producing
N-propionyl-[.sup.14C]-AMPA. Larger acylated-CoA compounds, i.e.
butyryl-CoA or methylmalonyl-CoA and other organic molecules
covalently linked to CoA which have a carbon chain length greater
than C.sub.3 proved to be less effective in the transacylation
reaction when using AMPA as the acyl-group recipient substrate.
Notwithstanding this information, one skilled in the art would
recognize that other transacylases which are substantially related
by amino acid sequence homology to a PhnO or PhnO-like enzyme as
characterized herein would have a similar substrate specificity in
the AMPA transacylase reaction as compared to that encompassed by
PhnO. These other enzymes too are conceptually within the scope and
spirit of the invention described herein. For example, fatty acid
biosynthesis is mediated by a wide range of acyl-CoA and
acyl-carrier protein compounds which may be useful as substrates in
transacylating phytotoxic compounds such as AMPA. A transacylase
capable of AMPA transacylation using a fatty acid intermediate
could conceivably provide plant protection by eliminating AMPA
phytotoxicity. An enzyme such as PhnO, which is capable of
transacylation, may be useful in detoxifying a wide range of toxic
compounds which contain CP bonds and which additionally contain a
CN linkage.
[0080] Methods and compositions for transforming a bacterium, a
yeast or fungal cell, a plant cell, or an entire plant with one or
more expression vectors comprising a phnO- or phnO-like gene
sequence are further aspects of this disclosure. A transgenic
bacterium, yeast or fungal cell, plant cell, or plant derived from
such a transformation process or the progeny and seeds from such a
transgenic plant are also further embodiments of this
invention.
[0081] Methods for transforming bacteria and yeast or fungal cells
are well known in the art. Typically, means of transformation are
similar to those well known means used to transform other bacteria,
such as E. coli, or yeast, such as Saccharomyces cerevisiae.
Methods for DNA transformation of plant cells include, but are not
limited to Agrobacterium-mediated plant transformation, protoplast
transformation, gene transfer into pollen, injection into
reproductive organs, injection into immature embryos, plastid or
chloroplast transformation, and particle bombardment. Each of these
methods has distinct advantages and disadvantages. Thus, one
particular method of introducing genes into a particular plant
species may not be the most effective for another plant species,
but it is well known by those skilled in the art which methods are
useful for a particular plant species.
[0082] There are many methods for introducing transforming DNA
segments into cells, but not all are suitable for delivering DNA to
plant cells. Suitable methods are believed to include virtually any
method by which DNA can be introduced into a cell, such as by
Agrobacterium infection, binary bacterial artificial chromosome
(BIBAC) vectors (Hamilton et al., 1996), direct delivery of DNA
such as, for example by PEG-mediated transformation of protoplasts
(Omirulleh et al., 1993), by desiccation/inhibition-mediated DNA
uptake, by electroporation, by agitation with silicon carbide
fibers, by acceleration of DNA coated particles, etc. In certain
embodiments, acceleration methods are preferred and include, for
example, microprojectile bombardment and the like.
[0083] Technology for introduction of DNA into cells is well-known
to those of skill in the art. Four general methods for delivering a
gene into cells have been described: (1) chemical methods (Graham
and van der Eb, 1973; Zatloukal et al., 1992); (2) physical methods
such as microinjection (Capecchi, 1980), electroporation (Wong and
Neuman, 1982; Fromm et al., 1985; U.S. Pat. No. 5,384,253) and the
gene gun (Johnston and Tang, 1994; Fynan et al., 1993; Luthra et
al., 1997); (3) viral vectors (Clapp, 1993; Lu et al., 1993;
Eglitis and Anderson, 1988a; 1988b); and (4) receptor-mediated
mechanisms (Curiel et al., 1991; 1992; Wagner et al., 1992)
[0084] Methods for transforming dicots, primarily by use of
Agrobacterium tumefaciens, and obtaining transgenic plants have
been published for cotton (U.S. Pat. No. 5,004,863; U.S. Pat. No.
5,159,135; U.S. Pat. No. 5,518,908), soybean (U.S. Pat. No.
5,569,834; U.S. Pat. No. 5,416,011; McCabe et al. (1988); Christou
et al. (1988)), Brassica (U.S. Pat. No. 5,463,174), peanut (Cheng
et al. (1996); De Kathen and Jabobsen (1990)).
[0085] Transformation of monocots using electroporation, particle
bombardment, and Agrobacterium have also been reported.
Transformation and plant regeneration have been achieved in
asparagus (Bytebier et al. (1987)), barley (Wan and Lemaux (1994)),
maize (Rhodes et al. (1988); Ishida et al. (1996); Gordon-Kamm et
al. (1990); Fromm et al. (1990); Koziel et al. (1993); Armstrong et
al. (1995), oat (Somers et al. (1992)), orchardgrass (Horn et al.
(1988)), rice (Toriyama et al. (1988); Park et al. (1996); Abedinia
et al. (1997); Zhang and Wu (1988); Zhang et al. (1988); Battraw
and Hall (1990); Christou et al. (1991); Park et al. (1996)), rye
(De la Pena et al. (1987)), sugar cane (Bower and Birch (1992)),
tall fescue (Wang et al. (1992)), and wheat (Vasil et al. (1992);
Weeks et al. (1993)). Techniques for monocot transformation and
plant regeneration are also discussed in Davey et al. (1986).
[0086] Recombinant plants could also be produced in which only the
mitochondrial or chloroplast DNA has been altered to incorporate
the molecules envisioned in this application. Promoters which
function in chloroplasts have been known in the art (Handley-Bowden
et al., Trends in Biochemical Sciences 12:67-70, 1987). Methods and
compositions for obtaining cells containing chloroplasts into which
heterologous DNA has been inserted has been described by Daniell et
al., U.S. Pat. No. 5,693,507 (1997) and Maliga et al. (U.S. Pat.
No. 5,451,513; 1995). Recombinant plants which have been
transformed using heterologous DNA, altering both nuclear and
chloroplast or plastidic genomes is also within the scope of this
invention.
[0087] The present invention discloses DNA constructs comprising
polynucleotide sequences encoding AMPA-transacylase. Methods for
identifying and isolating heterologous genes encoding peptides
which function in N-acylation of AMPA are disclosed herein. Methods
for the construction and expression of synthetic genes in plants
are well known by those of skill in the art and are described in
detail in U.S. Pat. No. 5,500,365, and in monocotyledonous plants
in particular in U.S. Pat. No. 5,689,052. The present invention
contemplates the use of AMPA acyltransferase genes alone or in
combination with genes encoding GOX mediated glyphosate degradation
enzymes in the transformation of both monocotyledonous and
dicotyledonous plants. To potentiate the expression of these genes,
the present invention provides DNA constructs comprising
polynucleotide sequences encoding these types of proteins which are
localized to the plant cell cytoplasm as well as sequences encoding
plastid targeting peptides positioned upstream of the
polynucleotide sequences encoding the AMPA transacylase and/or GOX
proteins.
[0088] In one aspect, nucleotide sequence information provided by
the invention allows for the preparation of relatively short DNA
sequences having the ability to specifically hybridize to gene
sequences of the selected polynucleotides disclosed herein. In
these aspects, nucleic acid probes of an appropriate length are
prepared based on a consideration of selected polynucleotide
sequences encoding AMPA transacylase polypeptides, e.g., sequences
such as are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.
Such nucleic acid probes may also be prepared based on a
consideration of selected polynucleotide sequences encoding a
plastid targeting peptide, such as those shown in SEQ ID NO:9, SEQ
ID NO:11, SEQ ID NO:13, and SEQ ID NO:14. The ability of such
nucleic acid probes to specifically hybridize to a gene sequence
encoding an AMPA transacylase polypeptide or a plastid targeting
peptide sequence lends to them particular utility in a variety of
embodiments. Most importantly, the probes may be used in a variety
of assays for detecting the presence of complementary sequences in
a given sample.
[0089] In certain embodiments, it is advantageous to use
oligonucleotide primers. The sequence of such primers is designed
using a polynucleotide of the present invention for use in
detecting, amplifying or mutating a defined sequence of a AMPA
transacylase gene from any suitable organism using PCR.TM.
technology. The process may also be used to detect, amplify or
mutate a defined sequence of the polynucleotide encoding a plastid
targeting peptide. Segments of genes related to the polynucleotides
encoding the AMPA transacylase polypeptides and plastid targeting
peptides of the present invention may also be amplified by PCR.TM.
using such primers.
[0090] To provide certain of the advantages in accordance with the
present invention, a preferred nucleic acid sequence employed for
hybridization studies or assays includes sequences that are
substantially complementary to at least a length of 14 to 30 or so
consecutive nucleotides of a polynucleotide sequence flanking, in
cis with, or encoding an AMPA transacylase, such as that shown in
SEQ ID NO:5 or SEQ ID NO:6, or sequences that are substantially
complementary to at least a length of 14 to 30 or so consecutive
nucleotides of a sequence encoding a plastid targeting peptide. By
"substantially complimentary", it is meant that a polynucleotide is
preferably about 70% complimentary, or more preferably about 80%
complimentary, or even more preferably about 90% complimentary, or
most preferably about 99-100% complimentary in sequence to a target
polynucleotide sequence.
[0091] A size of at least 14 nucleotides in length helps to ensure
that the fragment will be of sufficient length to form a duplex
molecule that is both stable and selective. Molecules having
complementary sequences over segments greater than 14 bases in
length are generally preferred. In order to increase stability and
selectivity of the hybrid, and thereby improve the quality and
degree of specific hybrid molecules obtained, one will generally
prefer to design nucleic acid molecules having gene-complementary
sequences of 14 to 20 nucleotides, or even longer where desired.
Such fragments may be readily prepared by, for example, directly
synthesizing the fragment by chemical means, such as
phosphoramidite chemistries for example; by application of nucleic
acid reproduction technology, such as the PCR.TM. technology of
U.S. Pat. Nos. 4,683,195, and 4,683,202 (each specifically
incorporated herein by reference); or by excising selected DNA
fragments from recombinant plasmids containing appropriate inserts
and suitable restriction sites.
[0092] The present invention also contemplates an expression vector
comprising a polynucleotide of the present invention. Thus, in one
embodiment an expression vector is an isolated and purified DNA
molecule comprising a promoter operably linked to a coding region
that encodes a polypeptide of the present invention, which coding
region is operatively linked to a transcription-terminating region,
whereby the promoter drives the transcription of the coding region.
The coding region may include a segment or sequence encoding a AMPA
transacylase and a segment or sequence encoding a plastid targeting
peptide. The DNA molecule comprising the expression vector may also
contain a plant functional intron, and may also contain other plant
functional elements such as sequences encoding untranslated
sequences (UTL's) and sequences which act as enhancers of
transcription or translation.
[0093] As used herein, the terms "operatively linked" or "operably
linked" mean that a sequence which functions as a promoter is
connected or linked to a coding region in such a way that the
transcription of that coding region is controlled and regulated by
that promoter. Means for operatively linking a promoter to a coding
region to regulate both upstream and downstream are well known in
the art.
[0094] Preferred plant transformation vectors include those derived
from a Ti plasmid of Agrobacterium tumefaciens, as well as those
disclosed, e.g., by Herrera-Estrella (1983), Bevan (1983), Klee
(1985) and Eur. Pat. Appl. No. EP 0120516 (each specifically
incorporated herein by reference). In addition, plant preferred
transformation vectors directed to chloroplast or plastid
transformation include those disclosed in U.S. Pat. No. 5,693,507
(1997), U.S. Pat. No. 5,451,513 (1995), McBride et al. (1995),
Staub et al. (1995a), Staub et al. (1995b), and WO 95/24492 (each
specifically incorporated herein by reference).
[0095] Where an expression vector of the present invention is to be
used to transform a plant, a promoter is selected that has the
ability to drive expression in that particular species of plant.
Promoters that function in different plant species are also well
known in the art. Promoters useful in expressing the polypeptide in
plants are those which are inducible, viral, synthetic, or
constitutive as described (Odell et al., 1985), and/or temporally
regulated, spatially regulated, and spatio-temporally regulated.
Preferred promoters include the enhanced CaMV35S promoters, and the
FMV35S promoter.
[0096] The expression of a gene which exists in double-stranded DNA
form localized to the plant nuclear genome involves transcription
of messenger RNA (mRNA) from the coding strand of the DNA by an RNA
polymerase enzyme, and the subsequent processing of the mRNA
primary transcript inside the nucleus. Genes expressed from within
a chloroplast or plastid also produce an mRNA transcript which is
not processed further prior to translation. In any event,
transcription of DNA into mRNA is regulated by a region of DNA
referred to as the "promoter". The DNA comprising the promoter is
represented by a sequence of bases that signals RNA polymerase to
associate with the DNA and to initiate the transcription of mRNA
using one of the DNA strands as a template to make a corresponding
strand of RNA. The particular promoter selected should be capable
of causing sufficient expression of an AMPA acyltransferase enzyme
coding sequence to result in the production of an herbicide
tolerance effective or herbicide resistance effective amount of the
transacylase protein localized to the desired intracellular
location.
[0097] Structural genes can be driven by a variety of promoters in
plant tissues. Promoters can be near-constitutive (i.e. they drive
transcription of the transgene in all tissue), such as the CaMV35S
promoter, or tissue-specific or developmentally specific promoters
affecting dicots or monocots. Where the promoter is a
near-constitutive promoter such as CaMV35S or FMV35S, increases in
polypeptide expression are found in a variety of transformed plant
tissues and most plant organs (e.g., callus, leaf, seed, stem,
meristem, flower, and root). Enhanced or duplicate versions of the
CaMV35S and FMV35S promoters are particularly useful in the
practice of this invention (Kay et al., 1987; Rogers, U.S. Pat. No.
5,378,619).
[0098] Those skilled in the art will recognize that there are a
number of promoters which are active in plant cells, and have been
described in the literature. Such promoters may be obtained from
plants or plant viruses and include, but are not limited to, the
nopaline synthase (NOS) and octopine synthase (OCS) promoters
(which are carried on tumor-inducing plasmids of A. tumefaciens),
the cauliflower mosaic virus (CaMV) 19S and 35S promoters, the
light-inducible promoter from the small subunit of ribulose
1,5-bisphosphate carboxylase (ssRUBISCO, a very abundant plant
polypeptide), the rice Act1 promoter and the Figwort Mosaic Virus
(FMV) 35S promoter. All of these promoters have been used to create
various types of DNA constructs which have been expressed in plants
(see e.g., McElroy et al., 1990, U.S. Pat. No. 5,463,175).
[0099] In addition, it may also be preferred to bring about
expression of genes such as an AMPA acyltransferase which improve
herbicide tolerance or herbicide resistance in specific tissues of
a plant by using plant integrating vectors containing a
tissue-specific promoter. Specific target tissues may include the
leaf, stem, root, tuber, seed, fruit, etc., and the promoter chosen
should have the desired tissue and developmental specificity.
Therefore, promoter function should be optimized by selecting a
promoter with the desired tissue expression capabilities and
approximate promoter strength, and selecting a transformant which
produces the desired transacylase activity in the target tissues.
This selection approach from the pool of transformants is routinely
employed in expression of heterologous structural genes in plants
since there is variation between transformants containing the same
heterologous gene due to the site of gene insertion within the
plant genome (commonly referred to as "position effect"). In
addition to promoters which are known to cause transcription
(constitutive or tissue-specific) of DNA in plant cells, other
promoters may be identified for use in the current invention by
screening a plant cDNA library for genes which are selectively or
preferably expressed in the target tissues, then determining the
promoter regions. Chloroplast or plastid functional promoters are
known in the art (Hanley-Bowden et al., Daniell et al., Maliga et
al.).
[0100] Other exemplary tissue-specific promoters are corn sucrose
synthetase 1 (Yang et al., 1990), corn alcohol dehydrogenase 1
(Vogel et al., 1989), corn light harvesting complex (Simpson,
1986), corn heat shock protein (Odell et al., 1985), pea small
subunit RuBP carboxylase (Poulsen et al., 1986; Cashmore et al.,
1983), Ti plasmid mannopine synthase (McBride and Summerfelt,
1989), Ti plasmid nopaline synthase (Langridge et al., 1989),
petunia chalcone isomerase (Van Tunen et al., 1988), bean glycine
rich protein 1 (Keller et al., 1989), CaMV 35S transcript (Odell et
al., 1985) and Potato patatin (Wenzler et al., 1989) promoters.
Preferred promoters are the cauliflower mosaic virus (CaMV 35S)
promoter and the S-E9 small subunit RuBP carboxylase promoter.
[0101] The promoters used in the DNA constructs of the present
invention may be modified, if desired, to affect their control
characteristics. For example, the CaMV35S promoter may be ligated
to the portion of the ssRUBISCO gene that represses the expression
of ssRUBISCO in the absence of light, to create a promoter which is
active in leaves but not in roots. For purposes of this
description, the phrase "CaMV35S" promoter thus includes variations
of CaMV35S promoter, e.g., promoters derived by means of ligation
with operator regions, random or controlled mutagenesis, etc.
Furthermore, the promoters may be altered to contain multiple
"enhancer sequences" to assist in elevating gene expression.
Examples of such enhancer sequences have been reported by Kay et
al. (1987). Chloroplast or plastid specific promoters are known in
the art (Daniell et al., U.S. Pat. No. 5,693,507; herein
incorporated by reference). Promoters obtainable from chloroplast
genes, for example, such as the psbA gene from spinach or pea, the
rbcL and atpB promoter regions from maize, and rRNA promoters. Any
chloroplast or plastid operable promoter is within the scope of the
present invention.
[0102] A transgenic plant of the present invention produced from a
plant cell transformed with a tissue specific promoter can be
crossed with a second transgenic plant developed from a plant cell
transformed with a different tissue specific promoter to produce a
hybrid transgenic plant that shows the effects of transformation in
more than one specific tissue.
[0103] The RNA produced by a DNA construct of the present invention
may also contain a 5' non-translated leader sequence (5'UTL). This
sequence can be derived from the promoter selected to express the
gene, and can be specifically modified so as to increase
translation of the mRNA. The 5' non-translated regions can also be
obtained from viral RNAs, from suitable eukaryotic genes, or from a
synthetic gene sequence. The present invention is not limited to
constructs wherein the non-translated region is derived from the 5'
non-translated sequence that accompanies the promoter sequence. One
plant gene leader sequence for use in the present invention is the
petunia heat shock protein 70 (hsp70) leader (Winter et al.,
1988).
[0104] 5' UTL's are capable of regulating gene expression when
localized to the DNA sequence between the transcription initiation
site and the start of the coding sequence. Compilations of leader
sequences have been made to predict optimum or sub-optimum
sequences and generate "consensus" and preferred leader sequences
(Joshi, 1987). Preferred leader sequences are contemplated to
include those which comprise sequences predicted to direct optimum
expression of the linked structural gene, i.e. to include a
preferred consensus leader sequence which may increase or maintain
mRNA stability and prevent inappropriate initiation of translation.
The choice of such sequences will be known to those of skill in the
art in light of the present disclosure. Sequences that are derived
from genes that are highly expressed in plants, and in maize in
particular, will be most preferred. One particularly useful leader
may be the petunia HSP70 leader.
[0105] In accordance with the present invention, expression vectors
designed to specifically potentiate the expression of the
polypeptide in the transformed plant may include certain regions
encoding plastid or chloroplast targeting peptides, herein
abbreviated in various forms as CTP, CTP1, CTP2, etc., each
representing a different or variant targeting peptide sequence.
These regions allow for the cellular processes involved in
transcription, translation and expression of the encoded protein to
be fully exploited when associated with certain GOX or AMPA
transacylase protein sequences. Such targeting peptides function in
a variety of ways, such as for example, by transferring the
expressed protein to the cell structure in which it most
effectively operates, or by transferring the expressed protein to
areas of the cell in which cellular processes necessary for
expression are concentrated. The use of CTP's may also increase the
frequency of recovery of morphologically normal plants, and the
frequency at which transgenic plants may be recovered.
[0106] Chloroplast targeting peptides have been found particularly
useful in the glyphosate resistant selectable marker system. In
this system, plants transformed to express a protein conferring
glyphosate resistance are transformed along with a CTP that targets
the peptide to the plant cell's chloroplasts. Glyphosate inhibits
the shikimic acid pathway which leads to the biosynthesis of
aromatic compounds including amino acids and vitamins.
Specifically, glyphosate inhibits the conversion of
phosphoenolpyruvic acid and 3-phosphoshikimic acid to
5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme
5-enolpyruvyl-3-phosphoshikimic acid synthase (EPSP synthase or
EPSPS). Introduction of a transgene encoding EPSPS allows the plant
cell to resist the effects of glyphosate, especially when the
transgene encodes a glyphosate insensitive EPSPS enzyme. Thus, as
the herbicide glyphosate functions to kill the cell by interrupting
aromatic amino acid biosynthesis, particularly in the cell's
chloroplast, the CTP allows increased resistance to the herbicide
by concentrating what glyphosate resistance enzyme the cell
expresses in the chloroplast, i.e. in the target organelle of the
cell. Exemplary herbicide resistance enzymes include EPSPS and
glyphosate oxido-reductase (GOX) genes (see Comai, 1985, U.S. Pat.
No. 4,535,060, specifically incorporated herein by reference in its
entirety).
[0107] CTPs can target proteins to chloroplasts and other plastids.
For example, the target organelle may be the amyloplast. Preferred
CTP's of the present invention include those targeting both
chloroplasts as well as other plastids. Specific examples of
preferred CTP's include the maize RUBISCO SSU protein CTP, and
functionally related peptides such as the Arabidopsis thaliana
RUBISCO small subunit CTP and the Arabidopsis thaliana EPSPS CTP.
These CTP's are exemplified by the polynucleotide and amino acid
sequences shown in SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, and SEQ
ID NO:14 respectively.
[0108] Recombinant plants, cells, seeds, and other plant tissues
could also be produced in which only the mitochondrial or
chloroplast DNA has been altered to incorporate the molecules
envisioned in this application. Promoters which function in
chloroplasts have been known in the art (Hanley-Bowden et al.,
Trends in Biochemical Sciences 12:67-70, 1987). Methods and
compositions for obtaining cells containing chloroplasts into which
heterologous DNA has been inserted has been described in U.S. Pat.
No. 5,693,507 (1997). McBride et al. (WO 95/24492) disclose
localization and expression of genes encoding Cry1A
.delta.-endotoxin protein in tobacco plant chloroplast genomes.
[0109] An exemplary embodiment of the invention involves the
plastid or chloroplast targeting or plastid or chloroplast
localization of genes encoding enzymes or proteins conferring
herbicide tolerance or herbicide resistance in plants. Plastid or
chloroplast targeting sequences have been isolated from numerous
nuclear encoded plant genes and have been shown to direct
importation of cytoplasmically synthesized proteins into plastids
or chloroplasts (reviewed in Keegstra and Olsen, 1989). A variety
of plastid targeting sequences, well known in the art, including
but not limited to ADPGPP, EPSP synthase, or ssRUBISCO, may be
utilized in practicing this invention. In addition, plastidic
targeting sequences (peptide and nucleic acid) for monocotyledonous
crops may consist of a genomic coding fragment containing an intron
sequence as well as a duplicated proteolytic cleavage site in the
encoded plastidic targeting sequences.
[0110] The preferred CTP sequence for dicotyledonous crops is
referred to herein as (SEQ ID NO:9), and consists of a genomic
coding fragment containing the chloroplast targeting peptide
sequence from the EPSP synthase gene of Arabidopsis thaliana in
which the transit peptide cleavage site of the pea ssRUBISCO CTP
replaces the native EPSP synthase CTP cleavage site (Klee et al.,
1987).
[0111] For optimized expression in monocotyledonous plants, an
intron may also be included in the DNA expression construct. Such
an intron is typically placed near the 5' end of the mRNA in
untranslated sequence. This intron could be obtained from, but not
limited to, a set of introns consisting of the maize heat shock
protein (HSP) 70 intron (U.S. Pat. No. 5,424,412; 1995), the rice
Act1 intron (McElroy et al., 1990), the Adh intron 1 (Callis et
al., 1987), or the sucrose synthase intron (Vasil et al.,
1989).
[0112] The 3' non-translated region of the genes of the present
invention which are localized to the plant nuclear genome also
contain a polyadenylation signal which functions in plants to cause
the addition of adenylate nucleotides to the 3' end of the mRNA.
RNA polymerase transcribes a nuclear genome coding DNA sequence
through a site where polyadenylation occurs. Typically, DNA
sequences located a few hundred base pairs downstream of the
polyadenylation site serve to terminate transcription. Those DNA
sequences are referred to herein as transcription-termination
regions. Those regions are required for efficient polyadenylation
of transcribed messenger RNA (mRNA). Examples of preferred 3'
regions are (1) the 3' transcribed, non-translated regions
containing the polyadenylation signal of Agrobacterium
tumor-inducing (Ti) plasmid genes, such as the nopaline synthase
(NOS) gene and (2) the 3' ends of plant genes such as the pea
ribulose-1,5-bisphosphate carboxylase small subunit gene,
designated herein as E9 (Fischhoff et al., 1987). Constructs will
typically include the gene of interest along with a 3' end DNA
sequence that acts as a signal to terminate transcription and, in
constructs intended for nuclear genome expression, allow for the
poly-adenylation of the resultant mRNA. The most preferred 3'
elements are contemplated to be those from the nopaline synthase
gene of A. tumefaciens (nos 3' end) (Bevan et al., 1983), the
terminator for the T7 transcript from the octopine synthase gene of
A. tumefaciens, and the 3' end of the protease inhibitor I or II
genes from potato or tomato. Regulatory elements such as TMV
.OMEGA. element (Gallie, et al., 1989), may further be included
where desired.
[0113] According to the present invention and as noted above,
chloroplast or plastid localized genes encoding enzymes conferring
herbicide tolerance or herbicide resistance characteristics to
plants do not require sequences which confer transcription
termination and polyadenylation signals, but instead may only
require transcription termination information at the 3' end of the
gene. For coding sequences introduced into a chloroplast or
plastid, or into a chloroplast or plastid genome, mRNA
transcription termination is similar to methods well known in the
bacterial gene expression art. For example, either in a
polycistronic or a monocistronic sequence, transcription can be
terminated by stem and loop structures or by structures similar to
rho dependent sequences.
[0114] Transcription enhancers or duplications of enhancers could
be used to increase expression. These enhancers often are found 5'
to the start of transcription in a promoter that functions in
eukaryotic cells, but can often be inserted in the forward or
reverse orientation 5' or 3' to the coding sequence. Examples of
enhancers include elements from the CaMV 35S promoter, octopine
synthase genes (Ellis et al., 1987), the rice actin gene, and
promoter from non-plant eukaryotes (e.g., yeast; Ma et al.,
1988).
[0115] In certain embodiments of the invention, the use of internal
ribosome binding sites (IRES) elements are used to create
multigene, or polycistronic, messages. IRES elements are able to
bypass the ribosome scanning model of 5' methylated Cap dependent
translation and begin translation at internal sites (Pelletier and
Sonenberg, 1988). IRES elements from two members of the
picornavirus family (polio and encephalomyocarditis) have been
described (Pelletier and Sonenberg, 1988), as well an IRES from a
mammalian message (Macejak and Sarnow, 1991). IRES elements can be
linked to heterologous open reading frames. Multiple open reading
frames can be transcribed together, each separated by an IRES,
creating polycistronic messages. By virtue of the IRES element,
each open reading frame is accessible to ribosomes for efficient
translation. Multiple genes can be efficiently expressed using a
single promoter/enhancer to transcribe a single message.
[0116] Any heterologous open reading frame can be linked to IRES
elements. This includes genes for secreted proteins, multi-subunit
proteins, encoded by independent genes, intracellular or
membrane-bound proteins and selectable markers. In this way,
expression of several proteins can be simultaneously engineered
into a cell with a single construct and a single selectable
marker.
[0117] Constructs intended for expression from within a chloroplast
or plastid utilizing chloroplast or plastid specific
transcriptional and translational machinery can contain either
mono- or polycistronic sequences.
[0118] The choice of which expression vector and ultimately to
which promoter a polypeptide coding region is operatively linked
depends directly on the functional properties desired, e.g., the
location and timing of protein expression, and the host cell to be
transformed. These are well known limitations inherent in the art
of constructing recombinant DNA molecules. However, a vector useful
in practicing the present invention is capable of directing the
expression of the polypeptide coding region to which it is
operatively linked.
[0119] Typical vectors useful for expression of genes in higher
plants are well known in the art and include vectors derived from
the tumor-inducing (Ti) plasmid of A. tumefaciens described (Rogers
et al., 1987). However, several other plant integrating vector
systems are known to function in plants including pCaMVCN transfer
control vector described (Fromm et al., 1985). pCaMVCN (available
from Pharmacia, Piscataway, N.J.) includes the CaMV35S
promoter.
[0120] In preferred embodiments, the vector used to express the
polypeptide includes a selection marker that is effective in a
plant cell, preferably a drug resistance selection marker. One
preferred drug resistance marker is the gene whose expression
results in kanamycin resistance; i.e. the chimeric gene containing
the nopaline synthase promoter, Tn5 neomycin phosphotransferase II
(nptII) and nopaline synthase 3' non-translated region described
(Rogers et al., 1988).
[0121] Means for preparing expression vectors are well known in the
art. Expression (transformation) vectors used to transform plants
and methods of making those vectors are described in U.S. Pat. Nos.
4,971,908, 4,940,835, 4,769,061 and 4,757,011 (each of which is
specifically incorporated herein by reference). Those vectors can
be modified to include a coding sequence in accordance with the
present invention.
[0122] A variety of methods have been developed to operatively link
DNA to vectors via complementary cohesive termini or blunt ends.
For instance, complementary homopolymer tracts can be added to the
DNA segment to be inserted and to the vector DNA. The vector and
DNA segment are then joined by hydrogen bonding between the
complementary homopolymeric tails to form recombinant DNA
molecules.
[0123] A coding region that encodes a polypeptide having the
ability to confer enhanced herbicide resistance enzymatic activity
to a cell is preferably a polynucleotide encoding an AMPA
transacylase or a functional equivalent alone or in combination
with a gene encoding a GOX enzyme or a functional equivalent of
GOX. In accordance with such embodiments, a coding region
comprising the DNA sequence of SEQ ID NO:3, SEQ ID NO:7, or SEQ ID
NO:19 is also preferred.
[0124] Specific genes encoding AMPA transacylase that have been
shown to successfully transform plants in conjunction with plastid
targeting peptide-encoding genes, to express the AMPA transacylase
at sufficient herbicidally protective levels are those genes
comprised within the plasmid vectors. Preferred plasmids containing
plastid targeting sequences include pMON17261, pMON10151,
pMON10149, pMON32570, pMON32571, pMON32572, pMON32573, pMON32926,
pMON32931, pMON32932, pMON32936, pMON32938, pMON32946, pMON32947,
pMON32948, and pMON32950. These plasmids contain polynucleotide
sequences which encode targeting sequences as shown in SEQ ID NO:9,
SEQ ID NO:1, SEQ ID NO:13, SEQ ID NO:14. Expression cassettes
comprising plant operable promoters linked to coding sequences,
some with and some without f' untranslated sequences and/or intron
sequences, wherein the coding sequences contain at least an AMPA
transacylase or transacetylase, linked to plant operable
termination sequences are disclosed in particular as set forth in
SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, and SEQ ID
NO:31.
[0125] The work described herein has identified methods of
potentiating in planta expression of an AMPA transacylase, which
confer protection from glyphosate and related herbicides to plants
when incorporated into the nuclear, plastid, or chloroplast genome
of susceptible plants which also express a GOX or similar gene.
U.S. Pat. No. 5,500,365 (specifically incorporated herein by
reference) describes a method for synthesizing plant genes to
optimize the expression level of the protein for which the
synthesized gene encodes. This method relates to the modification
of the structural gene sequences of the exogenous transgene, to
make them more "plant-like" and therefore more likely to be
translated and expressed by the plant. A similar method for
enhanced expression of transgenes, preferably in monocotyledonous
plants, is disclosed in U.S. Pat. No. 5,689,052 (specifically
incorporated herein by reference). Agronomic, horticultural,
ornamental, and other economically or commercially useful plants
can be made in accordance with the methods described herein.
[0126] Such plants may co-express the AMPA transacylase gene and/or
a GOX gene along with other antifungal, antibacterial, or antiviral
pathogenesis-related peptides, polypeptides, or proteins;
insecticidal proteins; other proteins conferring herbicide
resistance; and proteins involved in improving the quality of plant
products or agronomic performance of plants. Simultaneous
co-expression of multiple heterologous proteins in plants is
advantageous in that it can exploits more than one mode of action
to control plant damage or improve the quality of the plant or
products produced by the plants metabolism.
[0127] It is contemplated that introduction of large DNA sequences
comprising more than one gene may be desirable. Introduction of
such sequences may be facilitated by use of bacterial or yeast
artificial chromosomes (BACs or YACs, respectively), or even plant
artificial chromosomes. For example, the use of BACs for
Agrobacterium-mediated transformation was disclosed by Hamilton et
al. (1996).
[0128] Ultimately, the most desirable DNA sequences for
introduction into a monocot genome may be homologous genes or gene
families which encode a desired trait (for example, increased
yield), and which are introduced under the control of novel
promoters or enhancers, etc., or perhaps even homologous or tissue
specific (e.g., root-collar/sheath-, whorl-, stalk-, earshank-,
kernel- or leaf-specific) promoters or control elements. Indeed, it
is envisioned that a particular use of the present invention may be
the production of transformants comprising a transgene which is
targeted in a tissue-specific manner. For example, herbicide
resistance or herbicide tolerance genes may be expressed
specifically or specifically regulated in a negative manner in the
plants reproductive tissues which can provide a means for enhancing
herbicide tolerance or sensitivity to those tissues. Such
regulatory control means can provide methods for regulating the
escape of transgenes into the environment or for controlling the
illicit use of proprietary or licensed intellectual or
commercialized property.
[0129] Vectors for use in tissue-specific targeting of gene
expression in transgenic plants typically will include
tissue-specific promoters and also may include other
tissue-specific control elements such as enhancer sequences.
Promoters which direct specific or enhanced expression in certain
plant tissues will be known to those of skill in the art in light
of the present disclosure.
[0130] It also is contemplated that tissue specific expression may
be functionally accomplished by introducing a constitutively
expressed gene (all tissues) in combination with an antisense gene
that is expressed only in those tissues where the gene product is
not desired. For example, a gene coding for the AMPA transacylase
from E. coli may be introduced such that it is expressed in all
tissues using the 35S promoter from Cauliflower Mosaic Virus.
Alternatively, a rice actin promoter or a histone promoter from a
dicot or monocot species also could be used for constitutive
expression of a gene. Furthermore, it is contemplated that
promoters combining elements from more than one promoter may be
useful. For example, U.S. Pat. No. 5,491,288 discloses combining a
Cauliflower Mosaic Virus promoter with a histone promoter.
Therefore, expression of an antisense transcript of the AMPA
transacylase gene in a maize kernel, using for example a zein
promoter, would prevent accumulation of the transacylase in seed.
Thus, in a plant expressing both GOX and the transacylase,
application of glyphosate herbicide would result in seed tissues
which fail to mature. Conversely, antisense suppression of the GOX
gene would effectuate the same result. Preferably, suppression of
the transacylase in specific tissues would be more advantageous,
particularly where specific tissues have demonstrated an
intolerance to AMPA or related compounds. It is specifically
contemplated by the inventor that a similar strategy could be used
with the instant invention to direct expression of a screenable or
selectable marker in seed tissue.
[0131] Alternatively, one may wish to obtain novel tissue-specific
promoter sequences for use in accordance with the present
invention. To achieve this, one may first isolate cDNA clones from
the tissue concerned and identify those clones which are expressed
specifically in that tissue, for example, using Northern blotting.
Ideally, one would like to identify a gene that is not present in a
high copy number, but which gene product is relatively abundant in
specific tissues. The promoter and control elements of
corresponding genomic clones may this be localized using the
techniques of molecular biology known to those of skill in the
art.
[0132] It is contemplated that expression of some genes in
transgenic plants will be desired only under specified conditions.
For example, it is proposed that expression of certain genes that
confer resistance to environmentally stress factors such as drought
will be desired only under actual stress conditions. It further is
contemplated that expression of such genes throughout a plants
development may have detrimental effects. It is known that a large
number of genes exist that respond to the environment. For example,
expression of some genes such as rbcS, encoding the small subunit
of ribulose bisphosphate carboxylase, is regulated by light as
mediated through phytochrome. Other genes are induced by secondary
stimuli. For example, synthesis of abscisic acid (ABA) is induced
by certain environmental factors, including but not limited to
water stress. A number of genes have been shown to be induced by
ABA (Skriver and Mundy, 1990). It also is expected that expression
of genes conferring resistance to applications of herbicides would
be desired only under conditions in which herbicide is actually
present. Therefore, for some desired traits, inducible expression
of genes in transgenic plants will be desired.
[0133] It is proposed that, in some embodiments of the present
invention, expression of a gene in a transgenic plant will be
desired only in a certain time period during the development of the
plant. Developmental timing frequently is correlated with tissue
specific gene expression. For example expression of zein storage
proteins is initiated in the endosperm about 15 days after
pollination.
[0134] It also is contemplated that it may be useful to
specifically target DNA insertion within a cell. For example, it
may be useful to target introduced DNA to the nucleus, and in
particular into a precise position within one of the plant
chromosomes in order to achieve site specific integration. For
example, it would be useful to have a gene introduced through
transformation which acts to replace an existing gene in the cell,
or to complement a gene which is not functional or present at
all.
[0135] A plant transformed with an expression vector of the present
invention is also contemplated. A transgenic plant derived from
such a transformed or transgenic cell is also contemplated. Those
skilled in the art will recognize that a chimeric plant gene
containing a structural coding sequence of the present invention
can be inserted into the genome of a plant by methods well known in
the art. Such methods for DNA transformation of plant cells include
Agrobacterium-mediated plant transformation, the use of liposomes,
transformation using viruses or pollen, electroporation, protoplast
transformation, gene transfer into pollen, injection into
reproductive organs, injection into immature embryos and particle
bombardment. Each of these methods has distinct advantages and
disadvantages. Thus, one particular method of introducing genes
into a particular plant strain may not necessarily be the most
effective for another plant strain, but it is well known which
methods are useful for a particular plant strain.
[0136] There are many methods for introducing transforming DNA
segments into cells, but not all are suitable for delivering DNA to
plant cells. Suitable methods are believed to include virtually any
method by which DNA can be introduced into a cell, such as
infection by A. tumefaciens and related Agrobacterium strains,
direct delivery of DNA such as, for example, by PEG-mediated
transformation of protoplasts (Omirulleh et al., 1993), by
desiccation/inhibition-mediated DNA uptake, by electroporation, by
agitation with silicon carbide fibers, by acceleration of DNA
coated particles, etc. In certain embodiments, acceleration methods
are preferred and include, for example, microprojectile bombardment
and the like.
[0137] Technology for introduction of DNA into cells is well-known
to those of skill in the art. Four general methods for delivering a
gene into cells have been described: (1) chemical methods (Graham
and van der Eb, 1973); (2) physical methods such as microinjection
(Capecchi, 1980), electroporation (Wong and Neumann, 1982; Fromm et
al., 1985) and the gene gun (Johnston and Tang, 1994; Fynan et al.,
1993); (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis and
Anderson, 1988a; 1988b); and (4) receptor-mediated mechanisms
(Curiel et al., 1991; 1992; Wagner et al., 1992).
[0138] The application of brief, high-voltage electric pulses to a
variety of animal and plant cells leads to the formation of
nanometer-sized pores in the plasma membrane. DNA is taken directly
into the cell cytoplasm either through these pores or as a
consequence of the redistribution of membrane components that
accompanies closure of the pores. Electroporation can be extremely
efficient and can be used both for transient expression of cloned
genes and for establishment of cell lines that carry integrated
copies of the gene of interest. Electroporation, in contrast to
calcium phosphate-mediated transfection and protoplast fusion,
frequently gives rise to cell lines that carry one, or at most a
few, integrated copies of the foreign DNA.
[0139] The introduction of DNA by means of electroporation is
well-known to those of skill in the art. To effect transformation
by electroporation, one may employ either friable tissues such as a
suspension culture of cells, or embryogenic callus, or
alternatively, one may transform immature embryos or other
organized tissues directly. One would partially degrade the cell
walls of the chosen cells by exposing them to pectin-degrading
enzymes (pectolyases) or mechanically wounding in a controlled
manner, rendering the cells more susceptible to transformation.
Such cells would then be recipient to DNA transfer by
electroporation, which may be carried out at this stage, and
transformed cells then identified by a suitable selection or
screening protocol dependent on the nature of the newly
incorporated DNA.
[0140] A further advantageous method for delivering transforming
DNA segments to plant cells is microprojectile bombardment. In this
method, particles may be coated with nucleic acids and delivered
into cells by a propelling force. Exemplary particles include those
comprised of tungsten, gold, platinum, and the like. Using these
particles, DNA is carried through the cell wall and into the
cytoplasm on the surface of small metal particles as described
(Klein et al., 1987; Klein et al., 1988; Kawata et al., 1988). The
metal particles penetrate through several layers of cells and thus
allow the transformation of cells within tissue explants. The
microprojectile bombardment method is preferred for the
identification of chloroplast or plastid directed transformation
events.
[0141] An advantage of microprojectile bombardment, in addition to
it being an effective means of reproducibly stably transforming
plant cells, is that neither the isolation of protoplasts (Cristou
et al., 1988) nor the susceptibility to Agrobacterium infection is
required. An illustrative embodiment of a method for delivering DNA
into plant cells by acceleration is a Biolistics Particle Delivery
System, which can be used to propel particles coated with DNA or
cells through a screen, such as a stainless steel or Nytex screen,
onto a filter surface covered with the plant cultured cells in
suspension. The screen disperses the particles so that they are not
delivered to the recipient cells in large aggregates. It is
believed that a screen intervening between the projectile apparatus
and the cells to be bombarded reduces the size of projectiles
aggregate and may contribute to a higher frequency of
transformation by reducing damage inflicted on the recipient cells
by projectiles that are too large.
[0142] For the bombardment, cells in suspension are preferably
concentrated on filters or solid culture medium. Alternatively,
immature embryos or other target cells may be arranged on solid
culture medium. The cells to be bombarded are positioned at an
appropriate distance below the microprojectile stopping plate. If
desired, one or more screens are also positioned between the
acceleration device and the cells to be bombarded. Through the use
of techniques set forth herein one may obtain up to 1000 or more
foci of cells transiently expressing a marker gene. The number of
cells in a focus which express the exogenous gene product 48 hours
post-bombardment often range from 1 to 10 and average 1 to 3.
[0143] In bombardment transformation, one may optimize the
pre-bombardment culturing conditions and the bombardment parameters
to yield the maximum numbers of stable transformants. Both the
physical and biological parameters for bombardment are important in
this technology. Physical factors are those that involve
manipulating the DNA/microprojectile precipitate or those that
affect the flight and velocity of either the macro- or
microprojectiles. Biological factors include all steps involved in
manipulation of cells before and immediately after bombardment, the
osmotic adjustment of target cells to help alleviate the trauma
associated with bombardment, and also the nature of the
transforming DNA, such as linearized DNA or intact supercoiled
plasmids. It is believed that pre-bombardment manipulations are
especially important for successful transformation of immature
plant embryos.
[0144] Accordingly, it is contemplated that one may desire to
adjust various of the bombardment parameters in small scale studies
to fully optimize the conditions. One may particularly wish to
adjust physical parameters such as gap distance, flight distance,
tissue distance, and helium pressure. One may also minimize the
trauma reduction factors (TRFs) by modifying conditions which
influence the physiological state of the recipient cells and which
may therefore influence transformation and integration
efficiencies. For example, the osmotic state, tissue hydration and
the subculture stage or cell cycle of the recipient cells may be
adjusted for optimum transformation. The execution of other routine
adjustments will be known to those of skill in the art in light of
the present disclosure.
[0145] The methods of particle-mediated transformation is
well-known to those of skill in the art. U.S. Pat. No. 5,015,580
(specifically incorporated herein by reference) describes the
transformation of soybeans using such a technique.
[0146] Agrobacterium-mediated transfer is a widely applicable
system for introducing genes into plant cells because the DNA can
be introduced into whole plant tissues, thereby bypassing the need
for regeneration of an intact plant from a protoplast. The use of
Agrobacterium-mediated plant integrating vectors to introduce DNA
into plant cells is well known in the art. See, for example, the
methods described (Fraley et al., 1985; Rogers et al., 1987). The
genetic engineering of cotton plants using Agrobacterium-mediated
transfer is described in U.S. Pat. No. 5,004,863 (specifically
incorporated herein by reference); like transformation of lettuce
plants is described in U.S. Pat. No. 5,349,124 (specifically
incorporated herein by reference); and the Agrobacterium-mediated
transformation of soybean is described in U.S. Pat. No. 5,416,011
(specifically incorporated herein by reference). Further, the
integration of the Ti-DNA is a relatively precise process resulting
in few rearrangements. The region of DNA to be transferred is
defined by the border sequences, and intervening DNA is usually
inserted into the plant genome as described (Spielmann et al.,
1986; Jorgensen et al., 1987).
[0147] Modern Agrobacterium transformation vectors are capable of
replication in E. coli as well as Agrobacterium, allowing for
convenient manipulations as described (Klee et al., 1985).
Moreover, recent technological advances in vectors for
Agrobacterium-mediated gene transfer have improved the arrangement
of genes and restriction sites in the vectors to facilitate
construction of vectors capable of expressing various polypeptide
coding genes. The vectors described (Rogers et al., 1987), have
convenient multi-linker regions flanked by a promoter and a
polyadenylation site for direct expression of inserted polypeptide
coding genes and are suitable for present purposes. In addition,
Agrobacterium containing both armed and disarmed Ti genes can be
used for the transformations. In those plant varieties where
Agrobacterium-mediated transformation is efficient, it is the
method of choice because of the facile and defined nature of the
gene transfer.
[0148] Agrobacterium-mediated transformation of leaf disks and
other tissues such as cotyledons and hypocotyls appears to be
limited to plants that Agrobacterium naturally infects.
Agrobacterium-mediated transformation is most efficient in
dicotyledonous plants. Few monocots appear to be natural hosts for
Agrobacterium, although transgenic plants have been produced in
asparagus using Agrobacterium vectors as described (Bytebier et
al., 1987). Other monocots recently have also been transformed with
Agrobacterium. Included in this group are corn (Ishida et al.) and
rice (Cheng et al.).
[0149] A transgenic plant formed using Agrobacterium transformation
methods typically contains a single gene on one chromosome. Such
transgenic plants can be referred to as being heterozygous for the
added gene. However, inasmuch as use of the word "heterozygous"
usually implies the presence of a complementary gene at the same
locus of the second chromosome of a pair of chromosomes, and there
is no such gene in a plant containing one added gene as here, it is
believed that a more accurate name for such a plant is an
independent segregant, because the added, exogenous gene segregates
independently during mitosis and meiosis.
[0150] An independent segregant may be preferred when the plant is
commercialized as a hybrid, such as corn. In this case, an
independent segregant containing the gene is crossed with another
plant, to form a hybrid plant that is heterozygous for the gene of
interest.
[0151] An alternate preference is for a transgenic plant that is
homozygous for the added structural gene; i.e. a transgenic plant
that contains two added genes, one gene at the same locus on each
chromosome of a chromosome pair. A homozygous transgenic plant can
be obtained by sexually mating (selfing) an independent segregant
transgenic plant that contains a single added gene, germinating
some of the seed produced and analyzing the resulting plants
produced for gene of interest activity and mendelian inheritance
indicating homozygosity relative to a control (native,
non-transgenic) or an independent segregant transgenic plant.
[0152] Two different transgenic plants can be mated to produce
offspring that contain two independently segregating added,
exogenous genes. Selfing of appropriate progeny can produce plants
that are homozygous for both added, exogenous genes that encode a
polypeptide of interest. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated.
[0153] Transformation of plant protoplasts can be achieved using
methods based on calcium phosphate precipitation, polyethylene
glycol treatment, electroporation, and combinations of these
treatments (see e.g., Potrykus et al., 1985; Lorz et al., 1985;
Fromm et al., 1985; Uchimiya et al., 1986; Callis et al., 1987;
Marcotte et al., 1988).
[0154] Application of these systems to different plant germplasm
depends upon the ability to regenerate that particular plant
variety from protoplasts. Illustrative methods for the regeneration
of cereals from protoplasts are described (see, e.g., Fujimura et
al., 1985; Toriyama et al., 1986; Yamada et al., 1986; Abdullah et
al., 1986).
[0155] To transform plant germplasm that cannot be successfully
regenerated from protoplasts, other ways to introduce DNA into
intact cells or tissues can be utilized. For example, regeneration
of cereals from immature embryos or explants can be effected as
described (Vasil, 1988).
[0156] Unmodified bacterial genes are often poorly expressed in
transgenic plant cells. Plant codon usage more closely resembles
that of humans and other higher organisms than unicellular
organisms, such as bacteria. Several reports have disclosed methods
for improving expression of recombinant genes in plants (Murray et
al., 1989; Diehn et al., 1996; Iannacone et al., 1997; Rouwendal et
al., 1997; Futterer et al., 1997; and Futterer and Hohn, 1996).
These reports disclose various methods for engineering coding
sequences to represent sequences which are more efficiently
translated based on plant codon frequency tables, improvements in
codon third base position bias, using recombinant sequences which
avoid suspect polyadenylation or A/T rich domains or intron
splicing consensus sequences.
[0157] U.S. Pat. No. 5,500,365 (specifically incorporated herein by
reference) describes the preferred method for synthesizing plant
genes to optimize the expression level of the protein for which the
synthesized gene encodes. This method relates to the modification
of the structural gene sequences of the exogenous transgene, to
make them more "plant-like" and therefore more likely to be
translated and expressed by the plant, monocot or dicot. However,
the method as disclosed in U.S. Pat. No. 5,689,052 provides for
enhanced expression of transgenes, preferably in monocotyledonous
plants, which is herein incorporated in its entirety by reference.
Briefly, according to Brown et al., the frequency of rare and
semi-rare monocotyledonous codons in a polynucleotide sequence
encoding a desired protein are reduced and replaced with more
preferred monocotyledonous codons. Enhanced accumulation of a
desired polypeptide encoded by a modified polynucleotide sequence
in a monocotyledonous plant is the result of increasing the
frequency of preferred codons by analyzing the coding sequence in
successive six nucleotide fragments and altering the sequence based
on the frequency of appearance of the six-mers as to the frequency
of appearance of the rarest 284, 484, and 664 six-mers in
monocotyledenous plants. Furthermore, Brown et al. disclose the
enhanced expression of a recombinant gene by applying the method
for reducing the frequency of rare codons with methods for reducing
the occurrence of polyadenylation signals and intron splice sites
in the nucleotide sequence, removing self-complementary sequences
in the nucleotide sequence and replacing such sequences with
nonself-complementary nucleotides while maintaining a structural
gene encoding the polypeptide, and reducing the frequency of
occurrence of 5'-CG-3' di-nucleotide pairs in the nucleotide
sequence. These steps are performed sequentially and have a
cumulative effect resulting in a nucleotide sequence containing a
preferential utilization of the more-preferred monocotyledonous
codons for monocotyledonous plants for a majority of the amino
acids present in the desired polypeptide.
[0158] Thus, the amount of a gene coding for a polypeptide of
interest can be increased in plants by transforming those plants
using transformation methods such as those disclosed herein. In
particular, chloroplast or plastid transformation can result in
desired coding sequences being present in up to about 10,000 copies
per cell in tissues containing these subcellular organelle
structures (McBride et al., Bio/Technology 13:362-365, 1995).
[0159] DNA can also be introduced into plants by direct DNA
transfer into pollen as described (Zhou et al., 1983; Hess, 1987).
Expression of polypeptide coding genes can be obtained by injection
of the DNA into reproductive organs of a plant as described (Pena
et al., 1987). DNA can also be injected directly into the cells of
immature embryos and introduced into cells by rehydration of
desiccated embryos as described (Neuhaus et al., 1987; Benbrook et
al., 1986).
[0160] After effecting delivery of exogenous DNA to recipient
cells, the next step to obtain a transgenic plant generally concern
identifying the transformed cells for further culturing and plant
regeneration. As mentioned herein, in order to improve the ability
to identify transformants, one may desire to employ a selectable or
screenable marker gene as, or in addition to, the expressible gene
of interest. In this case, one would then generally assay the
potentially transformed cell population by exposing the cells to a
selective agent or agents, or one would screen the cells for the
desired marker gene trait.
[0161] An exemplary embodiment of methods for identifying
transformed cells involves exposing the transformed cultures to a
selective agent, such as a metabolic inhibitor, an antibiotic,
herbicide or the like. Cells which have been transformed and have
stably integrated a marker gene conferring resistance to the
selective agent used, will grow and divide in culture. Sensitive
cells will not be amenable to further culturing. One example of a
preferred marker gene confers resistance to glyphosate. When this
gene is used as a selectable marker, the putatively transformed
cell culture is treated with glyphosate. Upon treatment, transgenic
cells will be available for further culturing while sensitive, or
non-transformed cells, will not. This method is described in detail
in U.S. Pat. No. 5,569,834, which is specifically incorporated
herein by reference. Another example of a preferred selectable
marker system is the neomycin phosphotransferase (nptII) resistance
system by which resistance to the antibiotic kanamycin is
conferred, as described in U.S. Pat. No. 5,569,834 (specifically
incorporated herein by reference). Again, after transformation with
this system, transformed cells will be available for further
culturing upon treatment with kanamycin, while non-transformed
cells will not. Yet another preferred selectable marker system
involves the use of a gene construct conferring resistance to
paromomycin. Use of this type of a selectable marker system is
described in U.S. Pat. No. 5,424,412 (specifically incorporated
herein by reference).
[0162] Another preferred selectable marker system involves the use
of the genes contemplated by this invention. In particular, a phnO
gene or a substantially similar gene encoding an AMPA transacylase
can be utilized as a selectable marker. Plant cells which have had
a recombinant DNA molecule introduced into their genome can be
selected from a population of cells which failed to incorporate a
recombinant molecule by growing the cells in the presence of AMPA.
One skilled in the art will recognize the particular advantages
that this selectable marker system has over previous selectable
marker systems. The selectable marker used in the recombinant DNA
integrated into a plant genome reduces the amount of DNA targeted
for integration because the selectable marker will also be used for
improved herbicide tolerance or improved herbicide resistance in
plants generated from transformed plant cells. This selectable
marker also provides an additional marker system not known before,
particularly in a field in which there are often only a limited
number of selectable markers available.
[0163] Transplastonomic selection (selection of plastid or
chloroplast transformation events) is simplified by taking
advantage of the sensitivity of chloroplasts or plastids to
spectinomycin, an inhibitor of plastid or chloroplast protein
synthesis, but not of protein synthesis by the nuclear genome
encoded cytoplasmic ribosomes. Spectinomycin prevents the
accumulation of chloroplast proteins required for photosynthesis
and so spectinomycin resistant transformed plant cells may be
distinguished on the basis of their difference in color: the
resistant, transformed cells are green, whereas the sensitive cells
are white, due to inhibition of plastid-protein synthesis.
Transformation of chloroplasts or plastids with a suitable
bacterial aad gene, or with a gene encoding a spectinomycin
resistant plastid or chloroplast functional ribosomal RNA provides
a means for selection and maintenance of transplastonomic events
(Maliga, Trends in Biotechnology 11:101-106, 1993).
[0164] It is further contemplated that combinations of screenable
and selectable markers will be useful for identification of
transformed cells. In some cell or tissue types a selection agent,
such as glyphosate or kanamycin, may either not provide enough
killing activity to clearly recognize transformed cells or may
cause substantial nonselective inhibition of transformants and
nontransformants alike, thus causing the selection technique to not
be effective. It is proposed that selection with a growth
inhibiting compound, such as glyphosate at concentrations below
those that cause 100% inhibition followed by screening of growing
tissue for expression of a screenable marker gene such as kanamycin
would allow one to recover transformants from cell or tissue types
that are not amenable to selection alone. It is proposed that
combinations of selection and screening may enable one to identify
transformants in a wider variety of cell and tissue types. The
availability of the transacylases of the present invention may
obviate the necessity for combination selection and screening by
providing an additional selection means.
[0165] The development or regeneration of plants from either single
plant protoplasts or various explants is well known in the art
(Weissbach and Weissbach, 1988). This regeneration and growth
process typically includes the steps of selection of transformed
cells, culturing those individualized cells through the usual
stages of embryonic development through the rooted plantlet stage.
Transgenic embryos and seeds are similarly regenerated. The
resulting transgenic rooted shoots are thereafter planted in an
appropriate plant growth medium such as soil.
[0166] The development or regeneration of plants containing the
foreign, exogenous gene that encodes a polypeptide of interest
introduced by Agrobacterium from leaf explants can be achieved by
methods well known in the art such as described (Horsch et al.,
1985). In this procedure, transformants are cultured in the
presence of a selection agent and in a medium that induces the
regeneration of shoots in the plant strain being transformed as
described (Fraley et al., 1983). In particular, U.S. Pat. No.
5,349,124 (specification incorporated herein by reference) details
the creation of genetically transformed lettuce cells and plants
resulting therefrom which express hybrid crystal proteins
conferring insecticidal activity against Lepidopteran larvae to
such plants.
[0167] This procedure typically produces shoots within two to four
months and those shoots are then transferred to an appropriate
root-inducing medium containing the selective agent and an
antibiotic to prevent bacterial growth. Shoots that rooted in the
presence of the selective agent to form plantlets are then
transplanted to soil or other media to allow the production of
roots. These procedures vary depending upon the particular plant
strain employed, such variations being well known in the art.
[0168] Preferably, the regenerated plants are self-pollinated to
provide homozygous transgenic plants, or pollen obtained from the
regenerated plants is crossed to seed-grown plants of agronomically
important, preferably inbred lines. Conversely, pollen from plants
of those important lines is used to pollinate regenerated plants. A
transgenic plant of the present invention containing a desired
polypeptide is cultivated using methods well known to one skilled
in the art.
[0169] In one embodiment, a transgenic plant of this invention thus
has an increased amount of a coding region encoding an AMPA
transacylase polypeptide which may also be expressed along with a
plastid targeting peptide. A preferred transgenic plant is an
independent segregant and can transmit that gene and its activity
to its progeny. A more preferred transgenic plant is homozygous for
that gene, and transmits that gene to all of its offspring on
sexual mating. Seed from a transgenic plant may be grown in the
field or greenhouse, and resulting sexually mature transgenic
plants are self-pollinated to generate true breeding plants. The
progeny from these plants become true breeding lines that are
evaluated for expression of the transacylase transgene as well as
for improved herbicide tolerance, particularly when the
transacylase transgene is co-expressed along with a gene encoding a
GOX enzyme.
[0170] The genes and acyltransferases according to the subject
invention include not only the full length sequences disclosed
herein but also fragments of these sequences, or fusion proteins,
which retain the characteristic improved herbicidal protective
activity of the sequences specifically exemplified herein.
[0171] It should be apparent to a person of skill in this art that
AMPA transacylase genes and peptides can be identified and obtained
through several means. The specific genes, or portions thereof, may
be obtained from a culture depository, or constructed
synthetically, for example, by use of a gene machine. Variations of
these genes may be readily constructed using standard techniques
for making point mutations. Also, fragments of these genes can be
made using commercially available exonucleases or endonucleases
according to standard procedures. For example, enzymes such as
Bal31 or site-directed mutagenesis can be used to systematically
cut off nucleotides from the ends of these genes. Also, genes which
code for active fragments may be obtained using a variety of other
restriction enzymes. Proteases may be used to directly obtain
active fragments of such transacylases.
[0172] Equivalent AMPA transacylases and/or genes encoding these
transacylases can also be isolated from E. coli strains and/or DNA
libraries using the teachings provided herein. For example,
antibodies to the transacylases disclosed and claimed herein can be
used to identify and isolate other transacylases from a mixture of
proteins. Specifically, antibodies may be raised to the
transacylases disclosed herein and used to specifically identify
equivalent AMPA transacylases by immunoprecipitation, column
immuno-purification, enzyme linked immunoassay (ELISA), or Western
blotting.
[0173] A further method for identifying the peptides and genes of
the subject invention is through the use of oligonucleotide probes.
These probes are nucleotide sequences having a detectable label. As
is well known in the art, if the probe molecule and sequences in a
target nucleic acid sample hybridize by forming a strong bond
between the two molecules, it can be reasonably assumed that the
probe and target sample contain essentially identical
polynucleotide sequences. The probe's detectable label provides a
means for determining in a known manner whether hybridization has
occurred. Such a probe analysis provides a rapid method for
identifying AMPA transacylase genes of the subject invention.
[0174] The nucleotide segments which are used as probes according
to the invention can be synthesized by use of DNA synthesizers
using standard procedures. In the use of the nucleotide segments as
probes, the particular probe is labeled with any suitable label
known to those skilled in the art, including radioactive and
non-radioactive labels. Typical radioactive labels include
.sup.32P, .sup.125I, .sup.35S, or the like. A probe labeled with a
radioactive isotope can be constructed from a nucleotide sequence
complementary to the DNA sample by a conventional nick translation
reaction, using a DNase and DNA polymerase. The probe and sample
can then be combined in a hybridization buffer solution and held at
an appropriate temperature until annealing occurs. Thereafter, the
membrane is washed free of extraneous materials, leaving the sample
and bound probe molecules typically detected and quantified by
autoradiography and/or liquid scintillation counting.
[0175] Non-radioactive labels include, for example, ligands such as
biotin or thyroxin, as well as enzymes such as hydrolyses or
peroxidases, or the various chemiluminescers such as luciferin, or
fluorescent compounds like fluorescein, rhodamine, Texas Red, and
derivatives and the like. The probe may also be labeled at both
ends with different types of labels for ease of separation, as, for
example, by using an isotopic label at the end mentioned above and
a biotin label at the other end, or with different fluorescent
emitters which have overlapping absorption and emission
spectra.
[0176] Duplex formation and stability depend on substantial
complementary between the two strands of a hybrid, and, as noted
above, a certain degree of mismatch can be tolerated. Therefore,
the probes of the subject invention include mutations (both single
and multiple), deletions, insertions of the described sequences,
and combinations thereof, wherein said mutations, insertions and
deletions permit formation of stable hybrids with the target
polynucleotide of interest. Mutations, insertions, and deletions
can be produced in a given polynucleotide sequence in many ways, by
methods currently known to an ordinarily skilled artisan, and
perhaps by other methods which may become known in the future.
[0177] The potential variations in the probes listed is due, in
part, to the redundancy of the genetic code. Because of the
redundancy of the genetic code, more than one coding nucleotide
triplet (codon) can be used for most of the amino acids used to
make proteins. Therefore different nucleotide sequences can code
for a particular amino acid. Thus, the amino acid sequence of the
E. coli AMPA transacylase and peptide, and the plastid targeting
peptides and the polynucleotides which code for them, can be
prepared by equivalent nucleotide sequences encoding the same amino
acid sequence of the protein or peptide. Accordingly, the subject
invention includes such equivalent nucleotide sequences. Also,
inverse or complement sequences are an aspect of the subject
invention and can be readily used by a person skilled in this art.
In addition it has been shown that proteins of identified structure
and function may be constructed by changing the amino acid sequence
if such changes do not alter the protein secondary structure
(Kaiser and Kezdy, 1984). Thus, the subject invention includes
mutants of the amino acid sequence depicted herein which do not
alter the protein secondary structure, or if the structure is
altered, the biological activity is substantially retained.
Further, the invention also includes mutants of organisms hosting
all or part of a gene encoding an AMPA acyltransferase and/or gene
encoding a plastid targeting peptide, as discussed in the present
invention. Such mutants can be made by techniques well known to
persons skilled in the art. For example, UV irradiation can be used
to prepare mutants of host organisms. Likewise, such mutants may
include asporogenous host cells which also can be prepared by
procedures well known in the art.
[0178] Site-specific or site-directed mutagenesis is a technique
useful in the preparation of individual, novel and unique useful
peptides, or biologically functional equivalent proteins or
peptides, through specific mutagenesis of structural genes encoding
such peptides. The technique further provides a ready ability to
prepare and test sequence variants by altering the coding sequence
of a gene, for example, by introducing one or more nucleotide
sequence changes into the DNA for the purpose of creating a new or
useful restriction endonuclease cleavage recognition sequence or
for the purpose of altering the coding sequence so that a gene's
codons and percent G/C represent those more commonly used by a
particular genus or species. Site-specific mutagenesis allows the
production of deletion, insertion, or replacement mutations through
the use of specific mutagenesis oligonucleotide sequences
comprising the DNA sequence of the desired mutation. Mutagenesis
oligonucleotides typically provide a primer sequence of sufficient
size and sequence complexity to form a stable duplex on both sides
of the desired mutation target site. Typically, a primer of about
17 to 25 nucleotides in length is preferred, with about 5 to 10
residues overlapping either side of the desired mutation target
site.
[0179] In general, the technique of site-specific mutagenesis is
well known in the art, as exemplified by various publications. As
will be appreciated, the technique typically employs a phage vector
which exists in both a single stranded and double stranded form.
Typical vectors useful in site-directed mutagenesis include vectors
such as the M13 phage. These phage are readily commercially
available and their use is generally well known to those skilled in
the art. Double stranded plasmids are also routinely employed in
site directed mutagenesis, and often contain a filamentous phage
origin of replication which, in the presence of a helper phage,
allows synthesis of single stranded DNA from the plasmid
vector.
[0180] In general, site-directed mutagenesis in accordance herewith
is performed by first obtaining a single-stranded vector or melting
apart of two strands of a double stranded vector which includes
within its sequence a mutation target site. A mutagenesis
oligonucleotide primer bearing the desired mutant sequence is
prepared, generally synthetically. The mutagenesis primer is then
annealed with the single-stranded vector at the mutation target
site, and subjected to DNA polymerizing enzymes such as E. coli
polymerase I Klenow fragment, in order to complete the synthesis of
the mutation-bearing strand. Thus, a heteroduplex is formed wherein
one strand encodes the original non-mutated sequence and the second
strand bears the desired mutation. This heteroduplex vector is then
used to transform appropriate cells, such as E. coli cells, and
clones are selected which include recombinant vectors containing
the mutation represented by the mutagenesis primer sequence.
[0181] The preparation of sequence variants of the selected
peptide-encoding DNA segments using site-directed mutagenesis is
provided as a means of producing potentially useful species and is
not meant to be limiting as there are other ways in which sequence
variants of peptides and the DNA sequences encoding them may be
obtained. For example, recombinant vectors encoding the desired
peptide sequence may be treated with mutagenic agents, such as
hydroxylamine, to obtain sequence variants. Such procedures may
favorably change the protein's biochemical and biophysical
characteristics or its mode of action. These include, but are not
limited to: 1) improved AMPA transacylase formation, 2) improved
protein stability or reduced protease degradation, 3) improved
substrate recognition and binding, 4) improved enzyme kinetics, and
5) improved N-acyl-AMPA formation due to any or all of the reasons
stated above.
[0182] Modification and changes may be made in the structure of the
peptides of the present invention and DNA segments which encode
them and still obtain a functional molecule that encodes a protein
or peptide with desirable characteristics. The biologically
functional equivalent peptides, polypeptides, and proteins
contemplated herein should possess at least from about 40% to about
65% sequence similarity, preferably from about 66% to about 75%
sequence similarity, more preferably from about 76% to about 85%
similarity, and most preferably from about 86% to about 90% or
greater sequence similarity to the sequence of, or corresponding
moiety within, the AMPA acyltransferase amino acid sequences
disclosed herein.
[0183] The following is a discussion based upon changing the amino
acids of a protein to create an equivalent, or even an improved,
second-generation molecule. In particular embodiments of the
invention, mutated AMPA transacylase proteins are contemplated to
be useful for improving or enhancing the in planta expression of
the protein, and consequently increasing or improving the AMPA
transacylase activity and/or expression of the recombinant
transgene in a plant cell. The amino acid changes may be achieved
by changing the codons of the DNA sequence, according to the codons
given in Table 1, in dicotyledonous, and more particularly in
monocotyledonous plants.
TABLE-US-00001 TABLE 1 Amino Acid Codons Alanine Ala A GCA GCC GCG
GCU Cysteine Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic
acid Glu E GAA GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA
GGC GGG GGU Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU
Lysine Lys K AAA AAG Leucine Leu L UUA UUG CUA CUC CUG CUU
Methionine Met M AUG Asparagine Asn N AAC AAU Proline Pro P CCA CCC
CCG CCU Glutamine Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG
CGU Serine Ser S AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC
ACG ACU Valine Val V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine
Tyr Y UAC UAU
[0184] For example, certain amino acids may be substituted for
other amino acids in a protein structure without appreciable loss
of interactive binding capacity with structures such as, for
example, antigen-binding regions of antibodies or binding sites on
substrate molecules. Since it is the interactive capacity and
nature of a protein that defines that protein's biological
functional activity, certain amino acid sequence substitutions can
be made in a protein sequence, and, of course, its underlying DNA
coding sequence, and nevertheless obtain a protein with like
properties. It is thus contemplated by the inventor that various
changes may be made in the peptide sequences of the disclosed
compositions, or corresponding DNA sequences which encode said
peptides without appreciable loss of their biological utility or
activity.
[0185] In making such changes, the hydropathic index of amino acids
may be considered. The importance of the hydropathic amino acid
index in conferring interactive biologic function on a protein is
generally understood in the art (Kyte and Doolittle, 1982,
incorporate herein by reference). It is accepted that the relative
hydropathic character of the amino acid contributes to the
secondary structure of the resultant protein, which in turn defines
the interaction of the protein with other molecules, for example,
enzymes, substrates, receptors, DNA, antibodies, antigens, and the
like.
[0186] Each amino acid has been assigned a hydropathic index on the
basis of their hydrophobicity and charge characteristics (Kyte and
Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine
(-4.5).
[0187] It is known in the art that certain amino acids may be
substituted by other amino acids having a similar hydropathic index
or score and still result in a protein with similar biological
activity, i.e. still obtain a biological functionally equivalent
protein. In making such changes, the substitution of amino acids
whose hydropathic indices are within .+-.2 is preferred, those
which are within .+-.1 are particularly preferred, and those within
.+-.0.5 are even more particularly preferred.
[0188] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity. U.S. Pat. No. 4,554,101, incorporated herein by
reference, states that the greatest local average hydrophilicity of
a protein, as governed by the hydrophilicity of its adjacent amino
acids, correlates with a biological property of the protein.
[0189] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (+3.0); aspartate (+3.0.+-.1); glutamate
(+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5);
histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine
(-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryptophan (-3.4).
[0190] It is understood that an amino acid can be substituted for
another having a similar hydrophilicity value and still obtain a
biologically equivalent, and in particular, an immunologically
equivalent protein. In such changes, the substitution of amino
acids whose hydrophilicity values are within .+-.2 is preferred,
those which are within .+-.1 are particularly preferred, and those
within .+-.0.5 are even more particularly preferred.
[0191] As outlined above, amino acid substitutions are generally
therefore based on the relative similarity of the amino acid
side-chain substituents, for example, their hydrophobicity,
hydrophilicity, charge, size, and the like. Exemplary substitutions
which take various of the foregoing characteristics into
consideration are well known to those of skill in the art and
include: arginine and lysine; glutamate and aspartate; serine and
threonine; glutamine and asparagine; and valine, leucine and
isoleucine.
[0192] Polynucleotides encoding heterologous proteins are known by
those skilled in the art, to often be poorly expressed when
incorporated into the nuclear DNA of transgenic plants (reviewed by
Diehn et al., 1996). Preferably, a nucleotide sequence encoding a
heterologous protein of interest is designed essentially as
described in U.S. Pat. Nos. 5,500,365 and 5,689,052 (each
specifically incorporated herein by reference). Examples of
nucleotide sequences useful for expression include but are not
limited to, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, and SEQ ID
NO:19.
[0193] Substitutes for an amino acid within the fundamental
polypeptide sequence can be selected from other members of the
class to which the naturally occurring amino acid belongs. Amino
acids can be divided into the following four groups: (1) acidic
amino acids; (2) basic amino acids; (3) neutral polar amino acids;
and (4) neutral non-polar amino acids. Representative amino acids
within these various groups include, but are not limited to: (1)
acidic (negatively charged) amino acids such as aspartic acid and
glutamic acid; (2) basic (positively charged) amino acids such as
arginine, histidine, and lysine; (3) neutral polar amino acids such
as glycine, serine, threonine, cyteine, cystine, tyrosine,
asparagine, and glutamine; (4) neutral nonpolar (hydrophobic) amino
acids such as alanine, leucine, isoleucine, valine, proline,
phenylalanine, tryptophan, and methionine.
[0194] Conservative amino acid changes within a fundamental
polypeptide sequence can be made by substituting one amino acid
within one of these groups with another amino acid within the same
group. The encoding nucleotide sequence (gene, plasmid DNA, cDNA,
or synthetic DNA) will thus have corresponding base substitutions,
permitting it to encode biologically functional equivalent forms of
an AMPA transacylase.
[0195] The following examples describe preferred embodiments of the
invention. Other embodiments within the scope of the claims herein
will be apparent to one skilled in the art of endeavor from
consideration of the specification or practice of the invention as
disclosed herein. It is intended that the specification, together
with the examples, be considered exemplary only, with the scope and
spirit of the invention being indicated by the claims which follow
the examples. In the examples all percentages are given on a weight
basis unless otherwise indicated.
EXAMPLES
Example 1
[0196] This example illustrates the growth inhibitory effects of
N-aminomethyl phosphonic acid (AMPA) on plant callus tissue, and
the lack of inhibition of N-acetyl-aminomethyl phosphonic acid on
plant callus tissue in in vitro culture conditions.
[0197] Certain recombinant plant species which express a bacterial
GOX gene, and which were also exposed to glyphosate, can exhibit
phytotoxic effects manifested through such symptoms as chlorosis,
flower abscission, and reduced fertility. The basis for these
symptoms had not previously been determined. Previous studies had
indicated that plants expressing GOX metabolized glyphosate to AMPA
and glyoxylate (U.S. Pat. No. 5,463,175). Glyoxylate is readily
metabolized by plants, however AMPA persists in plant tissues and
may be the cause of phytotoxic effects such as chlorosis, stunting,
or other undesirable effects. It had previously been shown that
Achromobacter species LBAA was able to enzymatically modify AMPA to
N-acetyl AMPA (U.S. Pat. No. 5,463,175). The Achromobacter data,
coupled with the plant phytotoxicity data, indicated that
N-acylation of AMPA in planta may provide effective relief from
chlorosis and other undesirable effects. Thus, tobacco callus
tissue was exposed to AMPA and to N-acetyl AMPA in order to
determine if either of these compounds exhibited cytotoxic effects
similar to those observed in plants expressing GOX and exposed to
glyphosate.
[0198] Tobacco callus was generated from leaf pieces of wild type
Nicotiana tabacum cv. "Samsun" tobacco on MS104 plates (MS salts
4.3 g/l, sucrose 30 g/l, B5 vitamins 500.times.2 ml/l, NAA 0.1
mg/l, and Bacto Agar 1.0 mg/l). Callus tissue was applied to plates
with or without AMPA and with or without N-acetyl AMPA. Plates
contained AMPA or N-acetyl AMPA at concentrations of 0.1 mM or 0.4
mM. Plates were incubated for up to three weeks and monitored
periodically.
[0199] Callus tissue on control plates containing no AMPA or
N-acetyl AMPA grew at normal rates, regenerating roots and shoots
as expected. Callus tissue in the presence of AMPA was severely
inhibited. No growth was observed, showing the phytotoxic effect of
AMPA at these concentrations. Callus tissue on plates containing
N-acetyl AMPA was not inhibited, and formed roots and shoots
similar to control callus tissue growth. This result indicated that
AMPA, as a byproduct of GOX mediated metabolism of glyphosate,
could be responsible for the observed phototoxicity in plants. This
result also indicated the possibility of an improved method for
selecting plants from genetically transformed callus tissue, as
well as a possible method for enhancing glyphosate herbicide
resistance.
Example 2
[0200] This example illustrates that degradation of glyphosate by
GOX enzyme hydrolysis in the bacterium Achromobacter sp. strain
LBAA results in the production of AMPA and N-acetyl AMPA.
[0201] It has been previously shown that GOX mediated glyphosate
degradation produced glyoxylate and AMPA (Barry et al., U.S. Pat.
No. 5,463,175). Achromobacter sp. strain LBAA was also shown to
produce AMPA and glyoxylate as a result of glyphosate degradation.
The glyphosate degradation pathway was characterized in resting
cells of glyphosate-grown Achromobacter sp. strain LBAA according
to the following procedure. Cells from a 100 ml culture of LBAA,
grown in DF3S medium containing glucose, gluconate and citrate as
carbon sources and with thiamine and Yeast Extract (0.01%) to
supply trace requirements and with glyphosate at 0.2 mM as a
phosphorous source, were harvested at a cell density of 200 Klett
units, washed twice with 20 ml of DF3S medium and the equivalent of
20 ml of cells were resuspended in 100 .mu.l of the same medium
containing [.sup.14C]glyphosate (2.5 ml of 52 mCi/mmol, Amersham;
CFA.745). The cell mix was incubated at 30.degree. C. with shaking
and 20 ml samples were withdrawn at various intervals. The samples
were centrifuged to separate the cells from the broth supernatant.
Both the supernatant and cell pellets were analyzed by HPLC.
[0202] Samples prepared in this way were analyzed by strong anion
exchange (SAX) HPLC with radioisotope label detection to determine
their levels of [.sup.14C]-AMPA and N-acetyl-[.sup.14C]-AMPA.
Samples were injected using a Waters WISP autoinjector.
Chromatographic profiles and quantitative data were collected using
MACS2, Monsanto's automated chromatography data collection system.
A Spherisorb S5 SAX, 250 mm.times.10 mm column, or an Alltech 5
micron, 250 mm.times.10 mm SAX column was used for the analyses.
Solvents used were designated as solution A and solution B.
Solution A contained 0.005M KH.sub.2PO.sub.4 adjusted to pH 2.0
with H.sub.3PO.sub.4 in 4% methanol. Solution B contained 0.10 M
KH.sub.2PO.sub.4 adjusted to pH 2.0 with H.sub.3PO.sub.4 in 4%
methanol. Each sample run time consisted of a step gradient program
with an eluent flow rate of 3 ml per minute and a scintillation
fluid (tradename ATOMFLOW, No. NEN-995 obtained from Packard
Instruments) flow rate of 9 ml per minute. The HPLC solvent profile
for distinguishing [.sup.14C]-AMPA from N-acetyl-[.sup.14C]-AMPA in
each sample analyzed was represented by 100% solvent A at times
zero through 5 minutes, then solvent B at 100% at time 5 minutes
through 15 minutes, then 100% solvent A through 20 minutes at which
time the column is prepared to receive another sample.
[0203] Cell pellets were first resuspended in DF3S medium made
acidic by addition of 0.65N HCl, boiled for 5 minutes, then
centrifuged briefly to provide a solution phase for HPLC analysis.
Supernatants were treated similarly prior to HPLC analysis. An
acidified glyphosate control was also subjected to HPLC analysis,
and the glyphosate retention time (RT) was determined to be 10.8
minutes. The amount of radioactivity in the glyphosate peak
remaining in the supernatant after two hours incubation had
decreased to about 33% of the initial levels, indicating that the
glyphosate was extensively metabolized. About 3% of the glyphosate
was found to be within the cell. Material co-eluting with the
methylamine standard with an RT of 6 minutes accounted for about 5%
of the initial amount of radioactivity in the supernatant and for
about 1.5% of the initial amount of radioactivity identified in the
cell contents.
[0204] The GOX mediated glyphosate degradation pathway was
elucidated further in a subsequent experiment where the metabolism
of [.sup.14C]AMPA was compared to that of [.sup.14C]glyphosate as
indicated above in resting cells harvested at 165 Klett units and
resuspended at the equivalent of 15 ml cells per 100 ml DF3S
medium. The samples were analyzed by HPLC and consisted of whole
cultures acidified and treated as described above. Cultures exposed
to [.sup.14C]glyphosate for two hours were found to have 25% of the
label in the methylamine/N-acetyl-methylamine peak with a retention
time of 14.7 minutes, 12.5% as AMPA with a retention time of 6
minutes, 30% in a peak with a retention time of 13.2 minutes, and
30% as glyphosate with a retention time of 10.8 minutes. Analysis
of cultures exposed to [.sup.14C]-AMPA for two hours indicated that
15% of the label was found as N-acetyl-methylamine/methylamine, 59%
as AMPA, and 18% in the 13.2 minute peak. The material eluting at
13.2 minutes was identified as N-acetyl-AMPA by negative ion
electrospray mass spectrometry. The result showed strong ions at
m/e 152 and m/e 154, as expected for this compound, which has a
molecular weight of 153 Daltons. The m/e 154 ion was due to the
isotopic .sup.14C atom. N-acetyl-methyl-[.sup.14C]-AMPA arises from
N-methyl-[.sup.14C]-AMPA, which is a known impurity in preparations
of [.sup.14C]-AMPA.
[0205] These data indicated that the glyphosate degradation pathway
in Achromobacter strain LBAA proceeds from hydrolysis of glyphosate
to AMPA, which is then converted to the products methylamine
presumably through a dephosphorylation step, and N-acetyl-AMPA
presumably through some previously unknown transacylation step. A
small amount of N-acetyl-AMPA is then converted to
N-acetyl-methylamine. A similar acylation step has been inferred
from the products identified in E. coli when
aminomethylphosphonates are utilized as sole sources of phosphate
(Avila et al., 1987).
Example 3
[0206] This example illustrates the identification of an AMPA
acyltransferase activity in E. coli.
[0207] Avila et al. (1987) identified dephosphorylated
biodegradation products from the metabolism of a variety of
aminophosphonate substrates used as sole phosphate sources in vivo
in E. coli while studying C--P bond scission. Their studies
indicated that AMPA was not a substrate for acylation in E. coli
K-12. In addition, Avila et al. were interested in the effect of
N-linked chemical substitutions on C--P bond scission of
phosphonates in E. coli, and identified N-acetylated products
derived from the metabolism of some aminophosphonates. Avila et al.
also demonstrated that `wild type` E. coli K12 strains, unlike wild
type E. coli B strains, are unable to use phosphonates as a source
of phosphate. Thus, in consideration of the phytotoxic effects of
AMPA on callus tissue as shown in Example 1 and the generation of
AMPA from GOX mediated glyphosate degradation as shown in Example
2, the E. coli data in Avila et al. indicated that there may be an
enzyme or pathway present in some bacterial species which is
capable of converting aminomethylphosphonate (AMPA) to
N-acetyl-AMPA. An enzyme or pathway with those characteristics
would, if expressed in plants, confer a significant advantage to
plants expressing GOX when treated with glyphosate.
[0208] To test this, an E. coli K-12 strain adapted for growth on
AMPA was grown on low phosphate containing medium in order to
obtain cell lysates to be assayed for the presence of an enzyme
capable of AMPA N-acylation. The phn (mpu) operon is cryptic in E.
coli K-12 due to an 8 base pair insertion which causes a frameshift
mutation in the phnE gene. The frameshift inactivates PhnE and
creates a polar effect on translation of other genes downstream of
phnE within the operon, resulting in the inability of such mutants
to use phosphonates as phosphate sources (Makino et al., J.
Bacteriol. 173:2665-2672, 1991). Selection of a spontaneously
derived mutation restores the function of the phn operon (phn+ or
mpu+). Thus, K-12 strains adapted for growth on AMPA,
methyl-phosphonate, or ethyl-phosphonate contain such effective
spontaneously derived mutations.
[0209] Briefly, an aliquot of a fresh L-broth culture of E. coli
K-12 strain JM101 (mpu-) was plated onto MOPS (Neidhardt et al.,
1974) complete agar medium containing amino acids at 25 mg/ml,
vitamin B1 [thiamine] at 10 mg/ml, 0.2% glucose, and 1.5% DIFCO
"Purified" agar along with aminomethylphosphonate (AMPA; 0.2 mM;
Sigma Chemical Co., St. Louis, Mo.) as the sole phosphate source,
and incubated at 37.degree. C. for three days. Colonies arising on
this media were picked and streaked onto MOPS complete agar
containing either AMPA or methylphosphonate (Alfa) as the sole
phosphate source. One colony, designated E. coli JM101 mpu+, was
chosen from those that grew equally and uniformly on both
phosphonate containing media, and was further designated as E. coli
strain GB993.
[0210] The phn operon is induced when E. coli is grown in media
lacking or limited in a phosphate source. Therefore, E. coli GB993
was compared to the parental JM101 strain when grown in MOPS
minimal media. GB993 and its mpu- parent strain, JM101, were grown
under identical conditions, varying only the amount of phosphate
available or supplemented with AMPA. 50 ml cultures were grown in
duplicate in 250 ml sidearm-Erlenmeyer flasks with continuous
shaking at 37.degree. C. in MOPS medium (5 mls of 10.times.MOPS
salts, 0.5 ml 1 mg/ml thiamin, 0.5 ml 20% glucose, to 50 mls with
dH.sub.20) containing 0.1 or 5 mM phosphate, or 0.1 mM phosphate
supplemented with approximately 0.2 mM AMPA, pH 7.0. The cultures
were generally grown to about 220 Klett units and the cells were
pelleted by centrifugation, resuspended in 1.5 mls of 10 mM Tris/1
mM DTT, and lysed with two passes through a French press at 1,000
psi. Lysates were centrifuged to remove debris and the supernatant
passed through a G-50 column equilibrated with 50 mM Tris pH 7.0.
Table 2 shows the results of cell cultures grown in this
manner.
TABLE-US-00002 TABLE 2 Effects of Phosphate Substrate on Cell
Growth Strain JM101 JM101 JM101 GB993 GB993 GB993 0.1 mM 5 mM 0.2
mM 0.1 mM 5 mM 0.2 mM Phosphate Phosphate AMPA Phosphate Phosphate
AMPA Growth Period (hrs) 48 29 54 48 29 54 Harvest Density 155 240
-- 140 244 185 (Klett Units) -- indicates no measurable growth
[0211] An HPLC assay was used to determine the presence or absence
of any AMPA acyltransferase activity in the media and cell lysates.
The assay monitors the conversion of [.sup.14C]AMPA to
N-acetyl-[.sup.14C] AMPA. Generally, 100 .mu.l of a 2.times. assay
solution consisting of 16.5 mg acetyl-CoA, 250 .mu.l of 2M Tris, pH
7.5, 4.5 mls dH.sub.20 and [.sup.14C]AMPA (30 mM) was mixed with
25-75 .mu.l of lysate and 1 .mu.l each of 0.5 M MgCl.sub.2 and
MnCl.sub.2, and brought to 200 .mu.l with dH.sub.20. The assay was
incubated for 30 minutes at 37.degree. C., and quenched with 200
.mu.l 90-100 mM NaOAc (sodium acetate) pH 4.4 in ethanol and then
analyzed immediately by HPLC as described above, or stored at
-20.degree. C. Only GB993 lysate samples derived from cultures
grown in the presence of AMPA or 0.1 mM phosphate supplemented
media demonstrated appreciable AMPA acyltransferase activity. This
result indicated that a gene encoding an acyltransferase enzyme
capable of AMPA N-acylation was present in GB993 and was regulated
for expression when grown under low phosphate conditions. Thus, the
coding sequence for the enzymatic activity appears to be part of
the pho regulon and may reside in the phn operon.
Example 4
[0212] This example illustrates the identification of an E. coli
phn operon gene encoding an enzyme capable of AMPA acylation.
[0213] Example 3 indicated that the AMPA acyltransferase activity
observed in lysates of E. coli may be encoded by a gene in the phn
operon. The entire phn operon in E. coli B and in E. coli K-12 has
previously been cloned and sequenced B (Wanner et al., Chen et
al.). The E. coli K-12 phn operon DNA sequence has been shown to be
identical to the published DNA sequence of the phn operon from E.
coli B with the exception of an eight base pair insertion in the
phnE gene (Wanner et al). Clones containing various amounts of the
phn operon genes from either bacterial genetic background are
readily available (Wanner et al., Chen et al., Dr. J. W. Frost at
Purdue University). Plasmids containing differing amounts of the
JM101 phn operon DNA were used to transform JM101 (mpu-) in order
to test for a plasmid localized phn gene that, when expressed,
confers upon JM101 the ability to utilize AMPA as a sole phosphate
source.
[0214] A plasmid obtained from J. Frost (Dr. J. W. Frost,
Department of Chemistry, Purdue University, West Lafayette, Ind.
47907), designated herein as pF, contains an E. coli K-12 8 kb
EcoRI fragment which encodes the phn operon genes phnG through
phnQ. A single NcoI site is present at the 5' end of the phnG
coding region. Plasmid pF was digested with EcoRI and NcoI,
releasing a 2 kb NcoI-EcoRI fragment containing the genes phnG
through phnI, and a second NcoI-EcoRI fragment about 6 kb in length
containing the genes phnJ through phnQ. Each fragment was gel
purified and ligated into a cloning and expression vector in an
orientation which would allow for expression of the phn operon
genes present within each of the NcoI-EcoRI fragments from a
plasmid borne inducible promoter. The 2 kb fragment was inserted
into the NcoI-EcoRI sites within the vector pMON7258, a positive
selection cloning vector identical to pUC118 with the exception of
polylinker domain (Viera et al., Methods Enzymol. 153:3, 1987), the
resulting plasmid being designated as p58-1. The orientation of the
2 kb fragment in p58-1 allows for the expression of the phnG-phnI
genes from the lac promoter within the vector. The 6 kb EcoRI-NcoI
fragment was inserted into the NcoI and EcoRI sites in a similar
positive selection vector, pMON7259, producing the plasmid
designated as pMON17195. pMON7259 is identical to pUC119 except for
the polylinker domain, which contains a multiple cloning site
opposite in orientation to that within pMON7258, and which also
allows for expression of the phnJ-phnQ genes from a lac promoter.
p58-1 and pMON7259 were transformed into E. coli K12 (mpu-) strain
JM101, and maintained with ampicillin antibiotic resistance
selection. pMON7259 and pF were also transformed into JM101 as
negative and positive controls, respectively.
[0215] Cultures of each transformant were grown overnight in M9
liquid broth media supplemented with 2% casamino acids, thiamine,
and 0.2% glucose with shaking at 37.degree. C., and then diluted
1:50 into 50 ml of fresh pre-warmed media of the same composition
in a 250 ml side-armed Erlenmeyer flask. Cultures were incubated
with shaking at 37.degree. C. until reaching a cell density of
about 80-100 Klett Units as measured on a Klett-Summerson
spectrophotometer through a #2 green filter. Expression from the
plasmid lac promoter was induced by the addition of 100 microliters
of 500 mM IPTG so that the final IPTG concentration was about 1 mM.
The induction phase growth period was allowed to progress for two
hours. Table 3 shows the cell density profile of each culture from
1:50 dilution through the two hour induction period.
TABLE-US-00003 TABLE 3 Induction Profile of JM101 Cultures
Harboring Various phn Plasmids Plasmid Culture IPTG I.sub.0 I.sub.1
I.sub.2 pMON7259 + 13 75 222 p58-1 + 15 70 212 pMON17195 + 15 90
220 pF + 17 97 290 pF - 15 -- 260 I.sub.0 indicates the cell
culture density at the 1:50 dilution time point; I.sub.1 indicates
the cell culture density at the time of IPTG addition; and I.sub.2
indicates the cell culture density at the time of harvest.
[0216] The cells in each culture were harvested by centrifugation
at 10,000 rpm for 10 minutes at 4.degree. C. in a Beckman J2
centrifuge. The cell pellet was washed one time in ice cold 154 mM
NaCl solution, and then resuspended in 1.5 ml extraction buffer (50
mM Tris-HCl pH 7.5, 1 mM DTT, 50 mM Tris-HCl pH 7.5). Cell
suspensions were ruptured with two passes through a French Press at
1000 psi. The resulting lysate was centrifuged for 15 minutes at
14,000 rpm at 4.degree. C. in an EPPENDORF.TM. model 5402
microcentrifuge in order to remove debris. Each cleared lysate was
transferred to a fresh pre-chilled tube and the volume of the
extract was adjusted to 2.5 ml with 50 mM Tris-HCl pH 7.5. A PD10
column was equilibrated with 25 ml 50 mM Tris-HCl, pH 7.5 and then
each sample was applied to the desalting column. Each eluted sample
was adjusted to 3.5 ml with 50 mM Tris-HCl, pH 7.5. Each sample was
distributed to assay tubes and mixed with reagents in order to
assay for the presence of AMPA acyltransferase activity as shown in
Table 4.
TABLE-US-00004 TABLE 4 Assay Conditions for Bacterial Lysates
Expressing phn Genes 2X Assay Extract 50 mM Tris Mix Total Sample
IPTG Volume* Volume* Volume* Volume* pMON7259 + 25 75 100 200
pMON7259 + 100 0 100 200 p58-1 + 25 75 100 200 p58-1 + 100 0 100
200 pMON17195 + 25 75 100 200 pMON17195 + 100 0 100 200 pF + 25 75
100 200 pF + 100 0 100 200 pF - 25 75 100 200 pF - 100 0 100 200 --
na 0 100 100 200 *all volumes are in microliters Composition of
mixtures of each sample, designated by plasmid content, as prepared
for AMPA acyltransferase assay.
Each mixture was incubated at 37.degree. C. for 30 minutes, and
quenched with an equal volume (200 microliters) of 90-100 mM NaOAc
(sodium acetate), pH 4.4 in ethanol and if not analyzed immediately
by HPLC as described above, then stored overnight at -20.degree. C.
Unused portions of each lysate were stored either at 4.degree. C.,
or mixed with glycerol to 10% by volume, and stored at -20.degree.
C.
[0217] Samples of each lysate subjected to the AMPA transacylase
assay were analyzed by HPLC for the presence of [.sup.14C]AMPA and
acylated [.sup.14C]AMPA, as described above. The results are shown
in Table 5.
TABLE-US-00005 TABLE 5 HPLC Analysis of Bacterial Lysate Conversion
of AMPA to Acetyl-AMPA Sample % Acetyl AMPA % AMPA pMON7259 no data
no data pMON7259 8 92 p58-1 5 95 p58-1 13 87 pMON17195 100 0
pMON17195 100 0 pF 61 39 pF 97 3 pF 52 48 pF 90 10 -- -- 100
Results of HPLC analysis of each sample, indicating the relative
amount of [.sup.14C] AMPA or acetyl-[.sup.14C]AMPA as a percentage
of the total amount of [.sup.14C] in both peaks combined.
[0218] This data indicated that the plasmid containing the 6 kb
NcoI-EcoRI fragment isolated from pF in pMON17195 contained one or
more genes which, upon IPTG induction of the lac promoter in an
mpu- strain of E. coli, elicited the production of an
acyltransferase activity capable of converting all of the
[.sup.14C]AMPA available in the assay mix to acetyl-[.sup.14C]AMPA.
The gene or genes required for AMPA N-acylation were further
defined by restriction deletion analysis.
[0219] Plasmids containing various segments of the phn operon from
either E. coli B or E. coli K-12 were constructed to further
delineate the nature of the phn operon gene or genes involved in
conferring AMPA acyltransferase activity when expressed in an mpu-
E. coli JM101. pMON7333 contains the pMON17195 equivalent E. coli
DNA insertion, but in pUC119, and is a single E. coli B strain
HindIII fragment containing the wild type phn operon genes phnG
through phnQ. pMON15020 was constructed by cloning a 5,713 base
pair NcoI to EcoRI E. coli B DNA fragment from pMON7333 into
pMON7259, and contains the genes phnJ through phnQ. pMON15022 was
constructed by inserting a 1,686 base pair EcoRI to SalI fragment
from pMON17195 into the positive selection cloning and expression
vector pBlueScriptSP (Invitrogen), which contains the E. coli K-12
genes phnO, P and Q. pMON15023 was constructed by deleting an 1,820
base pair SalI fragment from pMON17195, leaving behind the E. coli
K-12 phn operon genes phnJ and phnK, the 5' end of phnL, and all of
phnO, P and Q.
[0220] The plasmids pMON17195, pMON15020, pMON15022, pMON15023, and
pMON7259 were transformed into the mpu- E. coli K-12 strain JM101
and were maintained by ampicillin antibiotic selection. Overnight
cultures of each of these transformants were grown with antibiotic
selection and were diluted 1:50 into fresh M9 media as described
above, and incubated at 37.degree. C. with shaking in 250 ml
sidearm-Erlenmeyer flasks to a cell density of about 100 Klett
units. Each culture was induced with IPTG as in example 3, and
incubated for two additional hours with shaking. The cells were
harvested by centrifugation in a Beckman J2 centrifuge at 4,000 RPM
for 10 minutes at 4.degree. C. Cell pellets were washed once with
50 ml of 154 mM NaCl, and stored at -20.degree. C.
[0221] Cell pellets were resuspended in 1.5 ml Extraction Buffer as
in example 3 and ruptured by two passes through a French Press at
1000 psi. The ruptured cell suspensions were centrifuged in an
Eppindorf microcentrifuge Model 5402 for 15 minutes at 14,000 rpm
and at 4.degree. C. The cleared lysates were decanted into new
tubes pre-chilled on ice, and the total volume was adjusted to 2.5
ml with addition of Extraction Buffer. These samples were desalted
over a PD10 column pre-equilibrated with 25 ml of 50 mM Tris-HCl,
pH 7.5, and eluted with 3.5 ml of 50 mM Tris HCl pH 7.5. Samples
were then subjected to an AMPA acylation assay as described above,
incubated for 30 minutes at 37.degree. C., and quenched with 200
microliters of 90.9 mM NaOAc pH 4.4. The volumes of each sample
used in the assay are noted in Table 6. All volumes represent
microliters of each solution used.
TABLE-US-00006 TABLE 6 Assay Conditions for Bacterial Lysates
Expressing phn Genes from Plasmids Plasmid Extract 50 mM Tris 2X
Assay Mix Total Volume -- -- 100 100 200 pMON 17195 25 75 100 200
pMON 17195 100 -- 100 200 pMON 15020 75 75 100 200 pMON 15020 100
-- 100 200 pMON 15022 75 75 100 200 pMON 15022 100 -- 100 200 pMON
15023 75 75 100 200 pMON 15023 100 -- 100 200 pMON 7259 75 75 100
200 pMON 7259 100 -- 100 200 Composition of mixtures of each
sample, designated by plasmid content, as prepared for AMPA
acyltransferase assay
[0222] Quenched samples were subjected to HPLC analysis as
described above. Table 7 illustrates the results of HPLC analysis
of each sample, indicating the relative amount of [.sup.14C] AMPA
or acetyl-[.sup.14C]AMPA as a percentage of the total amount of
[.sup.14C] in both peaks combined.
TABLE-US-00007 TABLE 7 HPLC Analysis of Bacterial Lysate
[.sup.14C]-AMPA Conversion to Acetyl-[.sup.14C]-AMPA Extract
%[.sup.14C]- Total % Sample Volume AMPA % Acetyl-[.sup.14C]-AMPA
[.sup.14C] -- -- 100 -- 100 pMON17195 25 66 34 100 pMON17195 100 26
74 100 pMON15020 75 -- 100 100 pMON15020 100 -- 100 100 pMON15022
75 -- 100 100 pMON15022 100 -- 100 100 pMON15023 75 -- 100 100
pMON15023 100 -- 100 100 pMON 7259 75 87 13 100 pMON 7259 100 72 28
100 HPLC analysis of each sample, indicating the relative amount of
[.sup.14C] AMPA or acetyl-[.sup.14C]AMPA as a percentage of the
total amount of [.sup.14C] in both peaks combined
The data in Table 7 indicates that AMPA acylation activity is
derived from the phn operon open reading frames consisting of phnO,
phnP, and phnQ, which are the only phn genes present in pMON15022.
Other plasmids conferring AMPA acylation activity upon induction
also contained at least the phnO, P, and Q genes, providing strong
evidence that the observed activity was the result of one or more
of these gene products. Therefore, additional plasmids were
constructed based on the phnO, P, and Q gene sequences in order to
determine which gene or genes were required for the acylation
function.
[0223] Bacterial acylase, transacylase, and acyltransferase genes
have been known in the literature for some time. Most are small
15-25 K Da proteins. Therefore, on the basis of size comparison,
only the phnO and phnQ gene products would fall into this category.
However, based on similarity comparisons with other proteins in the
GENBANK, SWISSPROT, and EMBL databases, the predicted phnO gene
product appeared to most closely resemble other proteins having
acylase activity. For example, the E. coli PhnO protein aligned
well with a gentamicin acetyltransferase-3-I described in Wohlleben
et al. (Mol. Gen. Genet. 217:202-208, 1989). pMON15020 containing
the E. coli B phn operon genes phnJ through phnP on a single 6.0 kb
NcoI-EcoRI fragment was digested with SalI and EcoRI to release a
2.0 kb fragment containing the phnO, P and Q genes. This 2 kb
fragment was excised and purified from a 0.7% TAE Agarose gel,
treated with T4 DNA polymerase to excise the 3' overhanging ends,
then with Klenow and deoxynucleotide triphosphates (dXTP's) to
provide blunt ends, and then ligated into the EcoRV site of
pBlueScriptSP to produce plasmid pMON15024. pMON15024 was digested
with NdeI and EcoRI, deleting a 1200 base pair fragment containing
most of the phnP and all of the phnQ coding sequences. The
remaining pMON15024 plasmid fragment still containing the phnO gene
was treated with Klenow fragment DNA polymerase in the presence of
dideoxynucleotides according to the manufacturer's instructions in
order to fill in the 3' ends exposed by restriction enzyme
digestion, then ligated together to produce the plasmid pMON15027.
pMON15027 contains only the phnO gene flanked 3' by a small portion
of phnP. The 1200 base pair NdeI to EcoRI fragment obtained from
pMON15024 was cloned into pMON2123 to produce pMON15026, which
contains the 3' two thirds of the phnP gene flanked 3' by phnQ.
Plasmids pMON15024, 15026, and 15027 were introduced into mpu-
JM101, and cell lysates of transformants were analyzed as above
after growth and induction for the presence of AMPA acyltransferase
activity. Only pMON15024 and pMON15027 exhibited acyltransferase
activity, indicating that the phnO gene product was responsible for
AMPA acylation.
[0224] A DNA fragment containing only the phnO gene with convenient
flanking restriction endonuclease sites for use in further cloning
manipulations was produced using thermal cycling methods. Synthetic
oligonucleotide primers were synthesized by Midland Certified
Reagents, Co. (Midland Tex.) based on the published phnO gene and
flanking sequence in order to amplify the phnO gene (Chen et al.,
J. Biol. Chem. 256: 4461-4471, 1990). The sequence
AAACACCATGGCTGCTTGTG (SEQ ID NO: 5), designated AATPCR6, represents
a synthetic oligonucleotide which is homologous to the template
strand of the phnO gene. The 5' adenosine residue of SEQ ID NO: 5
corresponds to base pair 13,955 of the published phn operon
sequence, immediately 5' of the phnO ATG initiation codon at
position 13,962-13,964 (Chen et al., J. Biol. Chem. 256: 4461-4471,
1990). SEQ ID NO: 5 incorporates a single base pair mismatch from
the published phnO sequence at position 13,965 represented by a C
to G inversion, which generates an alanine codon in place of a
proline codon at position 2 and also creates a unique NcoI
restriction site spanning the ATG initiation codon. The sequence
GTGACGAATTCGAGCTCATTACAGCGCCTTGGTGA (SEQ ID NO: 6), designated
AATPCR7, represents a synthetic oligonucleotide which is homologous
to the coding strand of the phnO gene. The 3' adenosine residue of
SEQ ID NO: 6 corresponds to base pair 14,380 of the published phn
operon (Chen et al., J. Biol. Chem. 256: 4461-4471, 1990). The
thymidine at position number nineteen of SEQ ID NO: 6 corresponds
to the adenosine at position 14,396 of the published phnO sequence
(Chen et al.). A portion of SEQ ID NO: 6 overlaps the native phnO
termination codon, introduces a second in frame termination codon
immediately 3' of and adjacent to the native termination codon, and
also introduces unique EcoRI and SacI restriction sites 3' of these
termination codons.
[0225] pMON15024 was used as a template for amplification of the
phnO gene in a standard thermal amplification reaction. Briefly, a
100 microliter reaction sample was prepared which contained 0.1 ng
template DNA, reaction buffer, 200 pM each primer, 200 mM dNTP,
1.25 U Taq DNA polymerase and was overlayed with mineral oil. This
reaction sample was subjected to thirty five cycles at 94.degree.
C. for one minute, 50.degree. C. for two minutes, and 72.degree. C.
for three minutes which resulted in the amplification of a 459 base
pair DNA product as determined by analysis of five microliters of
the reaction sample on a ethidium bromide stained 0.7% TAE agarose
gel. A 444 base pair product was purified using standard methods
from a 1% TAE agarose gel after digestion of a sample of the 459
base pair amplification product with NcoI and EcoRI restriction
endonucleases. The 444 base pair product was ligated into
compatible sites in pMON7259 to generate pMON15028. Cell lysates
prepared as above from IPTG induced cultures of JM101 containing
pMON15028 were analyzed for the presence of AMPA acyltransferase
activity and compared to cultures containing pMON15027. The results
were indistinguishable, thus confirming that phnO encoded an enzyme
capable of AMPA acylation. In addition, this result indicated that
the P2A mutation in the protein, which was introduced into the gene
coding sequence as a result of thermal amplification using the
AATPCR6 oligonucleotide primer (SEQ ID NO: 5), was without effect
on the acyltransferase activity of the resulting PhnO protein when
expressed in E. coli.
Example 5
[0226] This example illustrates the production of polyclonal
antibodies directed to the PhnO peptide.
[0227] Further studies of the phnO gene product required the use of
antibodies directed to the PhnO protein. Therefore, PhnO was
overproduced in E. coli JM101 for use as an immunogen in
stimulating the production of antibodies upon injection into a
goat. The phnO gene containing the P2A mutation in plasmid
pMON15028 was introduced into plasmid pMON17061 on an NcoI to EcoRI
DNA fragment, producing pMON15032. phnO expression in pMON15032 is
under the control of the E. coli recA promoter adjacent to the
bacteriophage T7 gene 10 L ribosome binding sequence. Cells were
grown to mid log phase and induced by addition of nalidixic acid to
the culture to approximately 50 parts per million, from a stock
solution of 50 mg nalidixic acid powder dissolved in 1 ml 0.1 N
NaOH. The culture was maintained under inducing conditions for
twelve hours at 37.degree. C. Cells were harvested as described in
example 3, and sonicated in phosphate buffered saline. About 23% of
the total soluble protein in the induced E. coli lysates was
determined to be PhnO and approximately 60% of the total PhnO
protein was released into the soluble phase as judged by SDS-PAGE
and Coomassie blue staining. The protein was further purified by
preparative SDS-PAGE providing a sufficient quantity of PhnO for
use in producing antibody which binds to or reacts antigenically
with PhnO or related AMPA transacylase proteins. Briefly, the PhnO
protein was separated by size from other proteins in a 15% SDS-PAGE
gel. A gel slice containing the PhnO protein was excised, weighed,
and homogenized using a polytron in a volume of phosphate buffered
saline (PBS, pH 7.0) equal to the mass of the gel slice. The
homogenate was mixed with an equal volume of complete Freund's
media until a colloidal mixture was obtained. An 8-ml inoculum of
this mixture was used for the first injection into a goat. Two
weeks post-injection, a 50-ml bleed was collected and serum was
separated from blood solids by centrifugation. A booster injection
of gel purified PhnO protein was administered in a colloidal
mixture of 50% incomplete Freund's adjuvant at four weeks, and at
six weeks a second bleed was obtained.
[0228] The serum from the second bleed was used to screen for the
presence of sufficient antibody titers specific for PhnO protein.
Extracts from JM101 cells containing pMON15032 were subjected to
western blot analysis. The concentration of protein in the extract
was determined to be about 55 mg/ml by Bradford assay, and a prior
Coomassie stained gel using this same extract was subjected to a
densitometer scan which indicated that about 23% of the total cell
protein was PhnO. The extract was desalted over a PD10 column,
eluted with 10 mM Tris pH 7.5, and diluted with an equal volume of
2.times.SDS sample buffer. Serial dilutions were prepared using
1.times. sample buffer and loaded into wells of a 15% SDS PAGE gel.
Additional samples were mixed with a tobacco leaf protein extract
containing 10 additional micrograms of protein per lane in addition
to the E. coli PhnO extracts. The tobacco leaf protein extracts
were used to screen for the presence of cross reactive antibody to
plant proteins. Proteins were separated according to size by
electrophoresis at 7.5 mA constant for fourteen hours at 4.degree.
C., and the gel was electroblotted onto a MSI 0.45 micron
nitrocellulose filter at 0.5 Ampere in Tris-Glycine transfer buffer
for one hour. The membrane was then blocked with TBST (Tris, BSA,
NaCl, Tween-20, Short Protocols in Molecular Biology, 3rd Ed.,
Wiley and Sons, Pub.) for two hours at room temperature, incubated
forty-five minutes with a 1:500 dilution of the second bleed serum
at room temperature, washed two times in TBST, incubated another
forty-five minutes with alkaline phosphatase conjugated rabbit
anti-goat IgG (Boehringer Mannheim Biochemicals, Inc.), washed
three times with TBST and one time with alkaline phosphatase
buffer, and finally incubated for two and one half minutes with a
standard color development solution containing NBT and BCIP. The
reaction was terminated by washing the membrane with ample
quantities of distilled water. The antibody was able to detect PhnO
protein in as little as 50 nanograms of E. coli extract independent
of the presence of additional plant proteins in one half of the
samples. In addition, very few cross reactive bands were detected
in either set of samples, indicating that the serum sample contains
very little IgG which cross reacts with either E. coli or tobacco
plant proteins when tested using this western blot method.
[0229] An alternative source for generating antibody which is
capable of specific binding to or reacting antigenically with PhnO
protein was also utilized. A phnO gene was placed into a commercial
vector (Invitrogen) containing a metal binding amino acid coding
sequence (His6) upstream of and in frame with the phnO coding
sequence. The His 6-phnO DNA sequence was inserted into the E. coli
expression vector pMON6235 on an NcoI to EcoRI fragment, under the
control of an E. coli arabinose operon araBAD promoter, producing
plasmid pMON32909. His6-PhnO protein was produced upon arabinose
induction of E. coli W3110 cells containing pMON32909, and purified
over a metal affinity column according to the manufacturers'
instructions.
[0230] His-tagged purified His6-PhnO protein standard was injected
into 6 New Zealand White rabbits using an immunization procedure
similar to that used for the goat, described above. Antiserum
raised in these rabbits was also shown to be specific for binding
PhnO protein and non-cross reactive with other E. coli bacterial or
tobacco plant proteins.
Example 6
[0231] This example illustrates properties of an AMPA transacylase
enzyme using aminomethylphosphonate and acetyl-CoA as substrates in
an enzyme assay as measured by endpoint kinetic analysis.
[0232] The apparent Km (Km) and Vmax (Vmax) of PhnO enzyme were
determined for the substrates aminomethlyphosphonate and
acetyl-CoA. Determination of the PhnO Km and Vmax were made by
endpoint kinetic analyses, determining the enzyme velocity in
consuming each substrate at varying substrate concentrations, and
plotting the inverse of the enzyme velocity versus the inverse of
the substrate concentration to produce a Lineweaver-Burk plot of
enzyme kinetics. The conversion of [.sup.14C]-AMPA to
N-acetyl-[.sup.14C]-AMPA was monitored as in example 2, using
enzyme in a desalted crude lysate of E. coli expressing phnO from
pMON15032, produced as in example 4. Total protein per ml of
extract was determined by the method of Bradford which indicated
approximately 22.5 mg/ml. Densitometric scanning of Coomassie
stained SDS-polyacrylamide gels resolving PhnO protein from these
lysates indicated that PhnO represents about 23% of total protein,
thus the cell extract was determined to contain about 5.2 mg PhnO
protein per ml. In a first assay to determine the apparent Km and
Vmax of PhnO for AMPA, [.sup.14C]-AMPA concentrations ranged from 2
to 38 mM. Enzyme reactions were incubated at 37.degree. C. for 5
minutes and quenched with 1 volume of 100 mM sodium acetate
(NaOAc), pH 4.4, in ethanol. Samples were analyzed by HPLC to
determine the amount of [.sup.14C]-AMPA converted to
N-acetyl-[.sup.14C]-AMPA. The assay conditions and output for each
set of reactions are shown in Table 8.
TABLE-US-00008 TABLE 8 PhnO Enzyme Kinetics for AMPA Substrate
Sample S.sup.1 % Turnover.sup.2 Velocity.sup.3 1/S 1/V V/S 1 200
39.5 79 1.0 0.0127 79.00 2 400 35.1 140 0.5 0.0071 70.00 3 800 32.9
263 0.25 0.0038 65.75 4 1200 26.8 322 0.166 0.0031 53.67 5 1600
26.2 426 0.125 0.0023 53.25 6 2000 22.1 442 0.100 0.0023 44.20 7
2400 19.2 461 0.083 0.0022 38.42 8 2800 17.6 493 0.071 0.0020 35.21
9 3200 17.3 554 0.063 0.0018 34.63 10 3600 14.5 522 0.056 0.0019
29.00 11 4000 13.6 544 0.050 0.0018 27.20 12 6000 12.7 762 0.033
0.0013 25.15 13 7600 10 760 0.026 0.0013 19.76 .sup.1AMPA substrate
concentration in reaction in nm (nanomoles) .sup.2% turnover
measured by the percent of N-acetyl-[.sup.14C]-AMPA formed in
relation to the amount of [.sup.14C]-AMPA remaining in the sample
.sup.3enzyme velocity in units of AMPA (nm) converted to
N-acetyl-AMPA per minute per mg of protein
A Linweaver-Burk plot of the 1/V vs. 1/S data from Table 8
indicates that the apparent Km of PhnO for AMPA as a substrate is
about 9 mM, and the apparent Vmax is about 824 U/mg protein.
[0233] The apparent Km of PhnO for the substrate acetyl-CoA was
determined in similar experiments. After several attempts to obtain
end point kinetics, it was determined that the turnover number was
too low to be reliable at AMPA concentrations of about 30 mM and
enzyme amounts of about 1-10 ng. An alternative approach was tried
using tritium labeled acetyl-CoA. The specific activity of the
label was about 40.times. higher than with [.sup.14C], providing a
gain in sensitivity that allowed for the determination of the
apparent Km of PhnO for Acetyl-CoA. The [.sup.3H]-acetyl-CoA
(Amersham, Inc.) specific activity was 360 mCi/mg or 250 .mu.Ci/ml.
The transacylation mediated by PhnO from [.sup.3H]-acetyl-CoA to
[.sup.3H]-acetyl-AMPA was monitored by weak anion exchange HPLC
chromatography, with the retention times of acetyl-CoA and
acetyl-AMPA adjusted so that these compounds were separated by
about three minutes. This was accomplished by adjusting the
concentration of KH.sub.2PO.sub.4 buffer (pH 5.5) to 40 mM with a
flow rate of 1 ml per minute over an AX100 weak anion exchange
column. Each sample was reacted with PhnO and 30 mM AMPA for five
minutes at 37.degree. C. and quenched with 100 mM NaOAc pH 4.4 in
ethanol, then analyzed by HPLC. [.sup.3H]-acetyl-CoA substrate
ranged from 25 micromolar to 1.3 mM in each reaction along with
about 5 ng PhnO, 50 mM Tris pH 7.5, 1 mM MnCl.sub.2, 1 mM
MgCl.sub.2, and 30 mM AMPA. Samples were analyzed by HPLC to
determine the amounts of N--[.sup.3H]-acetyl-AMPA produced, and
[.sup.3H]-acetyl-CoA remaining. The assay conditions and results
for these reactions are shown in Table 9.
TABLE-US-00009 TABLE 9 PhnO Enzyme Kinetics for Acetyl-CoA Donor
Substrate Sample No. [Acetyl-CoA].sup.1 Velocity.sup.2 1/[S].sup.3
1/V.sup.4 V/S.sup.5 1 25 34 0.0400 0.0294 1.3600 2 50 66 0.0200
0.0152 1.3200 3 75 94 0.0133 0.0106 1.2533 4 100 125 0.0100 0.0080
1.2500 5 125 150 0.0080 0.0067 1.2000 6 150 173 0.0066 0.0058
1.1533 7 175 193 0.0057 0.0052 1.1029 8 200 219 0.0050 0.0046
1.0950 9 225 240 0.0044 0.0042 1.0667 10 250 259 0.0040 0.0039
1.0360 11 375 339 0.0027 0.0030 0.9040 12 390 287 0.0026 0.0035
0.7359 13 520 331 0.0019 0.0030 0.6365 14 650 352 0.0015 0.0028
0.5415 15 780 372 0.0013 0.0027 0.4769 16 910 397 0.0011 0.0025
0.4363 17 1040 411 0.0009 0.0024 0.3952 18 1170 425 0.0008 0.0024
0.3632 19 1300 434 0.0007 0.0023 0.3338 .sup.1substrate
concentration in micromolar units .sup.2enzyme velocity as measured
by amount of [.sup.3H] incorporated into [.sup.3H]-acetyl-AMPA per
unit time .sup.3inverse substrate concentration .sup.4inverse
velocity .sup.5ratio of velocity to substrate concentration
A Linweaver-Burk plot of the 1/V vs. 1/S data from Table 9
indicates that the apparent Km of PhnO for acetyl-CoA as a
substrate is between 375-390 micromolar, and the apparent Vmax is
about 824 U/mg protein.
[0234] An approximate pH range of activity for the PhnO enzyme was
determined using enzyme in a crude lysate of E. coli expressing
phnO from pMON15032. The ability of the enzyme to produce N-acetyl
AMPA from a mixture containing acetyl-CoA and AMPA across a range
of pH values was determined. The reactions were carried out in
MES/MOPS/Tricine buffer equilibrated to a pH value from 4.5 to 9.0,
with actual pH values ranging from 5.2 through 9.0. Briefly, 95
microliters of an appropriate buffer was mixed with 100 microliters
of 2.times. assay mix as described in example 4, and 5 microliters
of desalted E. coli lysate containing approximately 400
ng/microliter PhnO protein. The reaction was incubated at
37.degree. C. for five minutes and quenched with 100 mM NaOAc pH
4.4 in ethanol, and analyzed by HPLC as described in example 4. The
results are shown in Table 10.
TABLE-US-00010 TABLE 10 PhnO Enzyme pH Profile .sup.3Velocity
Buffer .sup.1Mock .sup.2% N-Acetyl CoA (nmole/min/ pH Reaction pH
Turnover (nmole) microgram) 5.0 5.23 3.7 222 22.2 5.5 5.62 3.9 234
23.4 6.0 5.92 4.2 252 25.2 6.5 6.47 13.3 798 79.8 7.0 7.0 27.0 1620
162.0 7.5 7.48 32.0 1920 192.0 8.0 8.05 34.3 2058 205.8 8.5 8.46
33.5 2010 201.0 9.0 9.0 33.9 2034 203.4 .sup.1indicates true pH
value after combining all reagents for each initial buffer pH value
given .sup.2determined as in Table 9 for Km and Vmax
.sup.3determined as in Table 9 for Vmax
The results indicate that optimum PhnO transacylase activity using
AMPA and acetyl-CoA as substrates is about pH 8.0. However PhnO
efficiently converts AMPA to N-acetyl-AMPA using acetyl-CoA as the
acetyl donor across a pH range from about 6.5 to at least 9.0.
[0235] Additional experiments were carried out with purified PhnO
protein to further characterize the scope of the enzyme's substrate
preference for acyl-CoA acyl donor compounds. It has been
established herein that at least one substrate acyl-donor or
leaving group can be a two carbon acid compound such as the
acetyl-moiety in the compound Acetyl-CoA. It was not known what
range of acyl-molecules comprised of different carbon chain lengths
would or could function as a leaving group from the acyl-CoA acyl
donor when reacted with PhnO transacylase and AMPA as the
acyl-receptor molecule. Therefor, an HPLC assay similar to that
described in Example 2 was developed to determine the scope of the
enzymes' ability to transfer an acyl-group from an acyl-CoA acyl
donor to [.sup.14C]-AMPA.
[0236] PhnO was purified from a one liter Luria Bertani broth
culture of E. coli JM101 expressing a recombinant phnO gene from
pMON15032 after nalidixic acid induction for three hours at
37.degree. C. Cells were harvested by centrifugation and
resuspended in 40 ml cold Tris buffer (0.1 M Tris-HCl pH 8) and
placed on ice. The cell suspension was brought to 1 mM DTT and 0.5
mM PMSF. The suspension was lysed by 2 passages through a
prechilled French pressure cell at 1,100 psi, centrifuged at 12,000
g (10,000 rpm in an Sorvall SA600 rotor) for 40 min at 4.degree.
C., then placed on ice. The cleared supernatants were poured into
fresh 15 ml polypropylene tubes. The samples were split again into
two equal portions and maintained at -80.degree. C. until used
further for purification of PhnO protein. 20 microliters of the
soluble fraction was assayed for enzyme activity using the HPLC
method described above in Example 2, except after terminating the
assay with acid addition, the sample was stored at -80.degree. C. A
Sephacryl S200 column was prepared according to the manufacturers'
instructions and equilibrated with a solution containing 20 mM Tris
pH 8.0 and 0.5 mM MgCl.sub.2. The entire total soluble extract was
layered over the top of the column bed after thawing on ice. Forty
9 ml fractions were collected from the column eluate, and thirty
microliters of each fraction was analyzed by western blot using
anti-PhnO antiserum after resolution on a 15% SDS-PAGE gel. Also,
thirty microliters of each fraction was analyzed for AMPA acyl
transferase activity using the method described in Example 2.
Samples which exhibited acyl transferase activity and which
corresponded to positive western blot data were pooled. These were
represented by fractions 7 through 19 in this example, and were
combined into a 100 ml volume, distributed into ten 10 tubes each
containing 10 ml volumes, and stored at -80.degree. C. for further
use.
[0237] Anion exchange chromatography was used to determine the
elution pattern of PhnO away from other contaminating proteins that
co-elute during the Sephacryl S200 fractionation. One tube from the
combined PhnO positive fractions was thawed on ice and injected
into a 5/5 Mono-Q column pre-equilibrated with buffers A (one liter
of 20 mM Tris-HCl pH 8.0 Mili-Q distilled deionized water) and B
(one liter of 20 mM Tris-HCl pH 8.0, 1 M NaCl). The sample
containing PhnO active protein was injected into the column and one
milliliter fractions were collected. The column was washed for five
minutes with a flow rate of 1.8 ml per minute Buffer A after
loading the PhnO containing sample. At five minutes, Buffer B was
added to the flow volume at 0.5 ml per minute for four minutes.
Buffer B was ramped up to 22% of the flow volume at 10 minutes, 30%
at 12 minutes, 36% at 13 minutes, 41% at 14 minutes, 46% at 15
minutes, 74% at 16 minutes, and 100% at 16 minutes through 22
minutes, at which point Buffer B flow was terminated and Buffer A
was reinitiated at 100% to equilibrate the column. Ten microliter
volumes from individual fractions collected from the Mono-Q column
were analyzed by western blot and for transacylase activity as
described in Example 2. Fractions which exhibited positive AMPA
acyltransferase activity and which correlated with the Western blot
data were pooled and maintained as a purified protein sample.
Samples of this purified PhnO protein were used to determine
enzyme's acyl donor substrate specificity.
[0238] Enzyme reactions were prepared as follows. 100 microliter
reactions consisted of 50 mM Tris-HCl pH 8.0, 1 mM MgCl.sub.2, 3
microliters of 1.3 mM [.sup.14C]-AMPA (115,392 dpm per microliter),
0.1 mM or 1 mM acyl-CoA acyl donor, and 2.5 microliter purified
enzyme sample. A assay premix was prepared from which 45
microliters was used in each 100 microliter reaction. This 45
microliter premix sample consisted of 40 microliters distilled and
deionized water, 2 microliters of 50 mM MgCl.sub.2, and 3
microliters of 1.3 mM [.sup.14C]-AMPA (115,392 dpm per microliter).
Reactions were initiated by mixing 40 microliters of 125 mM
Tris-HCl pH 8.0, 2.5 microliters protein sample and 10 microliters
acyl-CoA acyl donor compound in a microcentrifuge tube at room
temperature. Each acyl-CoA acyl donor compound was prepared as a
stock solution of 1 mM, 5 mM or 10 mM stocks. Each tube was then
mixed with 45 microliters of the assay premix containing the
[.sup.14C]-AMPA receptor substrate, mixed gently and transferred to
a 30.degree. C. water bath for 5 minutes. Each reaction was
terminated with the addition of 4 microliters of 1M HCl, mixed by
vortexing, and placed on ice or stored at -20.degree. C. until
assayed for the presence of [.sup.14C]-AMPA or related compounds by
HPLC.
[0239] HPLC analysis was carried out using a Waters 510 dual pump
HPLC system with a 481 wavelength max UV detector and a
scintillation pump, a Phenomenex PHENOSPHERE 5 micrometer 80 .ANG.
SAX-silica HPLC column (250.times.4.6 mm, 3500 PSI max pressure),
Buffer A consisting of 5 mM KH.sub.2PO.sub.4, 4% methanol, adjusted
to pH 2.0 with H.sub.3PO.sub.4, and Buffer B consisting of 200 mM
KH.sub.2PO.sub.4, 4% methanol adjusted to pH 2.0 with
H.sub.3PO.sub.4, and HAZARD Atomflow (Packard) containing 64% 1,2,4
trimethylbenzene, 7.5% sodium-dicotyl sulfosuccinate, 3.5% sodium
diamylsulfosuccinate, and 6% polyoxyethylene(4)lauryl ether. HPLC
gradient conditions for each sample analysis were similar to those
described in Example 2, with minor variations. The flow rates are
provided in Table 11.
TABLE-US-00011 TABLE 11 HPLC Gradient Conditions Time Flow (min)
(ml/min) % A % B Flow Rate.sup.1 0.0 1 100 0 3 2.0 1 100 0 3 5.0 1
50 50 3 15.0 1 0 100 3 17.0 1 0 100 3 17.3 1 100 0 3 21.0 1 100 0 3
21.3 0.1 100 0 0 .sup.1Scintillation fluid flow rate in milliliters
per minute
[0240] Stock solutions of Acyl-CoA acyl donor compounds were
prepared as described above, and these are listed here: Na
Acetyl-CoA, Li n-propionyl-CoA, Li glutaryl-CoA, Li methylmalonyl
CoA, Li crotonoyl-CoA, Li isobutyryl-CoA, Na succinyl-CoA, Li
tiglyl-CoA, Li n-valeryl-CoA, and Li desulfo-CoA. All compounds
were obtained from Sigma Chemical Company, St. Louis, Mo. The
percent activity of the purified enzyme for transfer of the CoA
associated acyl-moiety to [.sup.14C]-AMPA was determined by
measuring the percentage of [.sup.14C]-AMPA HPLC chromatogram peak
area converted to some other [.sup.14C]-compound, such as
N-acetyl-[.sup.14C]-AMPA, with the amount of
N-acetyl-[.sup.14C]-AMPA produced during the reaction in which
[.sup.14C]-AMPA and 1 mM acetyl-CoA are substrates for PhnO being
established as the 100% reference. The results are shown in Table
12.
TABLE-US-00012 TABLE 12 AMPA Transacylase Enzyme Efficiency for
Acyl-CoA Acyl Donor Substrate Acyl-CoA Acyl Donor [.sup.14C]-AMPA %
Conversion.sup.1 % Activity Acetyl-CoA 0.1 mM 79.2 79.2 Acety-CoA
0.5 mM 98.7 98.7 Acety-CoA 1 mM 100.00 100.00 Propionyl-CoA 0.1 mM
78.2 78.2 Propionyl-CoA 0.5 mM 97.8 97.8 Propionyl-CoA 1 mM 100.00
100.00 Glutaryl-CoA 0.1 mM 0.81 0.81 Glutaryl-CoA 0.5 mM 0.00 0.00
Glutaryl-CoA 1 mM 0.57 0.57 Methylmalonyl-CoA 0.1 mM 1.11 1.11
Methylmalonyl-CoA 0.5 mM 2.08 2.08 Methylmalonyl-CoA 1 mM 2.21 2.21
Crotonoyl-CoA 0.1 mM 0.80 0.80 Crotonoyl-CoA 0.5 mM 0.00 0.00
Crotonoyl-CoA 1 mM 0.00 0.00 Isobutyryl-CoA 0.1 mM 2.10 2.10
Isobutyryl-CoA 0.5 mM 0.20 0.20 Isobutyryl-CoA 1 mM 0.00 0.00
Succinyl-CoA 0.1 mM 5.06 5.06 Succinyl-CoA 0.5 mM 3.38 3.38
Succinyl-CoA 1 mM 1.56 1.56 Tiglyl-CoA 0.1 mM 0.00 0.00 Tiglyl-CoA
0.5 mM 0.00 0.00 Tiglyl-CoA 1 mM 0.99 0.99 Valeryl-CoA 0.1 mM 0.24
0.24 Valeryl-CoA 0.5 mM 0.00 0.00 Valeryl-CoA 1 mM 0.33 0.33
Desulfo-CoA 0.1 mM 0.95 0.95 Desulfo-CoA 0.5 mM 1.25 1.25
Desulfo-CoA 1 mM 0.52 0.52 .sup.1percentage of [.sup.14C]-AMPA HPLC
chromatogram peak area converted to some other [.sup.14C]-compound,
such as N-acetyl-[.sup.14C]-AMPA, with the amount of
N-acetyl-[.sup.14C]-AMPA produced during the reaction in which
[.sup.14C]-AMPA and 1 mM acetyl-CoA are substrates for PhnO being
established as the 100% reference
[0241] These results indicate that PhnO enzyme is capable of
efficiently utilizing acyl-CoA associated compounds which have an
acyl group with a carbon chain length of not more than three for
transacylating AMPA. Other compounds which have a longer carbon
chain length than propionyl- and which are not broad or bulky, such
as methylmalonly-, isobutyryl-, and succinyl-CoA compounds are also
effective acyl-CoA acyl donors, but at a lower enzyme
efficiency.
Example 7
[0242] This example illustrates the in vitro expression and
targeting of an AMPA acyltransferase protein into isolated
chloroplasts.
[0243] Many chloroplast-localized proteins are expressed from
nuclear genes as precursors and are targeted to the chloroplast by
a chloroplast transit peptide (CTP). The CTP is removed during
steps involved in import of the targeted protein into the
chloroplast. Examples of such chloroplast proteins include the
small subunit (SSU) of ribulose-1,5-bisphosphate carboxylase
(RUBISCO), 5-enol-pyruvylshikimate-3-phosphate (EPSPS), ferredoxin,
ferredoxin oxidoreductase, the light-harvesting-complex protein I
and protein II, and thioredoxin F. It has been demonstrated in vivo
and in vitro that non-chloroplast proteins may be targeted to the
chloroplast by use of fusions with a CTP and that a CTP sequence is
sufficient to target a protein to the chloroplast (Della-Cioppa et
al., 1987). 5-enolpyruvylshikimate-3-phosphate synthetase (EPSPS)
enzyme is located in the chloroplast and is the glyphosate target
in plants. Targeting glyphosate oxidoreductase to the chloroplast
has been found to provide tolerance to plants to glyphosate,
although GOX localized to the cytoplasm is also able to provide
such tolerance. Generally, recombinant GOX enzyme is localized to
the chloroplast. GOX mediated glyphosate metabolism produces AMPA,
which has been shown to be phytotoxic. It has been shown herein
that PhnO is capable of AMPA N-acylation and that N-acetyl-AMPA is
not phytotoxic. Therefore, it may be necessary to inactivate AMPA
in plants. This assumes that AMPA acyltransferase can be expressed
in plants as an active enzyme, and that such acyltransferases are
capable of being imported into the chloroplast and retain enzymatic
activity. In view of the AMPA phytotoxicity as described in example
1, an AMPA acyltransferase gene was introduced into plant
expression vectors to test expression in plants. In addition,
import of acyltransferase into chloroplasts was also tested.
[0244] A DNA sequence encoding a chloroplast targeting peptide was
linked 5' to and in frame with a DNA sequence encoding an AMPA
acyltransferase. A DNA sequence encoding an arabidopsis
ribulose-1-bis-phosphate carboxylase small subunit chloroplast
transit peptide (CTP, SEQ ID NO:9) was excised from pMON17058 using
BglII and NcoI restriction endonucleases, and inserted into
complementary restriction sites in pMON15028 to produce pMON15029,
so that the CTP coding sequence was linked 5' to and in frame with
the phnO coding sequence in pMON15028. The resulting chimeric phnO
gene in pMON15029 is capable of producing a chloroplast targeted
PhnO protein. An EcoRI to BglII DNA cassette containing the
CTP-PhnO coding sequence, SEQ ID NO:10, from pMON15029 was inserted
into EcoRI and BamHI sites in pBlueScript KS(-) to produce
pMON15036. The CTP-PhnO coding sequence in pMON15036 can be
expressed in an in vitro transcription/translation system from a
phage T3 promoter. A similar plant transient expression plasmid,
pMON15035, was constructed, but without the chloroplast targeting
sequence. An EcoRI to BglII DNA fragment containing only the phnO
coding sequence was excised from pMON15028 and inserted into EcoRI
and BamHI sites in pBlueScript KS(+) so that PhnO could be produced
from a phage T7 promoter in an in vitro transcription/translation
system. An NcoI to EcoRI DNA sequence encoding PhnO was excised
from pMON15028 and inserted into pMON17061, producing pMON15032.
pMON15032 provides for expression of phnO from an E. coli recA
promoter. A BglII to EcoRI DNA fragment encoding PhnO was excised
from pMON15028 and inserted into pBlueScript SK(-) to produce
pMON15033. pMON15033 provides for expression of phnO from an E.
coli lac promoter. A BglII to EcoRI DNA fragment encoding CTP-PhnO
was excised from pMON15029 and inserted into compatible sites in
pBlueScript SK(-), providing for expression of chloroplast targeted
PhnO protein from an E. coli lac promoter from pMON15034.
[0245] pMON15032, pMON15033, and pMON15034 were introduced into E.
coli JM101. Cultures were grown and induced as described above,
except that expression from cells containing pMON15032 was induced
with addition of 50 parts per million nalidixic acid in 0.1 M NaOH.
Cleared lysates were prepared from each culture and subjected to an
AMPA acyltransferase assay as described above in order to determine
the presence of AMPA acyltransferase activity. All lysates
contained substantial amounts of acyltransferase activity above
control levels. More importantly, the CTP-PhnO peptide (SEQ ID
NO:12) expressed from pMON15034 appeared to retain full enzymatic
acyltransferase activity.
[0246] pMON15035 (PhnO) and pMON15036 (CTP-PhnO) were used in vitro
to generate [.sup.35S]-methionine labeled PhnO protein for use in a
chloroplast import assay. Briefly, the procedure used for in vitro
transcription and translation was as described in Short Protocols
In Molecular Biology, Third Edition, Ed. Ausubel et al., Wiley
& Sons Pub., (1995), which is herein incorporated by reference.
About 20 micrograms of plasmid DNA was digested to completion with
HindIII restriction endonuclease in a 100 microliter reaction. 20
microliters of the plasmid digest, or about 4 micrograms of
linearized plasmid DNA, was used in an in vitro transcription
reaction to generate mRNA for producing PhnO or CTP-PhnO protein
product in later translation reactions. Transcription reactions
consisted of 20 microliters of linearized plasmid DNA, 20
microliters of a 5.times. transcription buffer (200 mM TrisHCl pH
8.0, 40 mM MgCl.sub.2, 10 mM spermidine and 250 mM NaCl), 20
microliters of 5.times. ribonucleoside triphosphate mix (5 mm each
ATP, CTP, UTP, 5 mM diguanosine triphosphate (G-5'ppp5'-G)TP, 5 mM
GTP), 10 microliters 0.1 M dithiothreitol (DTT), 10 microliters
RNasin.TM. (a pancreatic ribonuclease inhibitor mixture from
Promega), 4 microliters RNA polymerase (T7 or T3, New England
Biolabs, Inc.), and distilled, deionized water to 100 microliters.
Each reaction was incubated at 37.degree. C. for one hour. 4.5
microliters of each reaction was analyzed on a 1.4% agarose
formaldehyde gel to ensure that each reaction produced adequate RNA
template for the following translation step.
[0247] 20 microliters of the transcription reactions were used for
producing [.sup.35S]-methionine labeled PhnO proteins for use in a
chloroplast import assay. Briefly, RNA was mixed with 6 microliters
of an aqueous amino acid mixture without methionine, 15 microliters
of [.sup.35S]-methionine (1400 Ci/mmol, Amersham), and 200
microliters of a rabbit reticulocyte lysate. These reactions were
incubated at 37.degree. C. for two hours and placed on dry ice for
storage. A 10 microliter sample of each reaction was analyzed on a
15% SDS-PAGE gel. Gels were vacuum dried and placed directly onto
the emulsion side of KODAK.TM. X-O-MAT.TM. film for
autoradiography. The results indicated that each plasmid produced
respective peptides of predicted molecular mass for PhnO
(pMON15035) and CTP-PhnO (pMON15036) in sufficient quantity to test
for uptake into chloroplasts in an import assay.
[0248] Intact chloroplasts were isolated from one head of deveined
Romaine lettuce according to Edelman et al., Methods in Chloroplast
Molecular Biology, Elsevier Biomedical Press, Chap. 86, 1982. One
liter of grinding buffer (GR-buffer) stock was prepared (2 mM
NaEDTA, 1 mM MgCl2, 1 mM MnCl2, 50 mM Hepes-KOH pH 7.5, and 0.33 mM
sorbitol). Immediately before use, 890 mg of ascorbic acid was
added to 900 ml of GR-buffer stock solution. One head of torn,
deveined Romaine lettuce was mixed with 900 ml GR-buffer and
emacerated by mixing in a Waring blender three times for three
seconds each time at high speed. The slurry was filtered through
four layers of Miracloth, and the filtrate was centrifuged at 5,000
RPM for 10 minutes at 4.degree. C. in a SORVALL.TM. GS-3 rotor. The
supernatant was decanted and the pellet resuspended with a glass
rod in 4 milliliters of GR-buffer. Chloroplasts were isolated by
centrifugation through a Percoll gradient. 80% Percoll was prepared
by mixing 16 mls of PBF-Percoll with 4 mls of 5.times. Buffer (10
mM EDTA, 5 mM MgCl.sub.2, 5 mM MnCl.sub.2, 250 mM Hepes-KOH, 30
grams sorbitol, 490 mg NaAscorbate, 85.5 mg glutathione to 100 mls
with ddH.sub.20). A 40% Percoll solution was prepared by combining
8 mls PBF-Percoll with 4 mls 5.times. Buffer and 8 mls of
ddH.sub.20. A Percoll gradient was prepared in a 30 ml Corex tube
by layering 10 mls of 40% Percoll onto 10 mls of 80% Percoll.
Chloroplasts were isolated by layering the resuspended chloroplasts
onto the percoll gradient, spinning at 9,500 RPM for ten minutes in
an SS-34 SORVALL.TM. swinging bucket rotor at 4.degree. C. for ten
minutes with the brake on. Broken chloroplasts remain in the upper
layer and were pipetted off. The intact chloroplasts were located
at the interface of the 40/80% Percoll gradient and were removed to
a new 30 ml COREX.TM. tube. The isolated chloroplasts were washed
two times with GR-buffer and centrifuged for collection after each
wash in a SS-34 rotor at 6,000 RPM for ten minutes at 4.degree. C.
with the brake off. Isolated, washed chloroplasts were resuspended
in 1 ml sterile 50 mM Hepes-KOH pH 7.7, 330 mM sorbitol by gently
stirring with a glass rod, and the chlorophyll concentration of the
slurry was determined. 5 mls of an 80% acetone solution was added
to 20 microliters of the chloroplast slurry and vortexed gently.
The resulting mixture was filtered through a Whatman.TM. #1 filter
paper into a culture tube. The absorbance of the filtrate was
determined at 645 nm and 663 nm against an 80% acetone blank. The
chlorophyll concentration in micrograms per ml was determined
according to equation #1 as [chlorophyll
.mu.g/ml]=[A.sub.645+[A.sub.663*(8.02)]. The mass of the
chlorophyll in .mu.g is calculated by taking the amount of
chlorophyll measured in .mu.g/ml and multiplying by the volume into
which the chloroplasts were resuspended (equation #2), which is 5
mls in this example. Thus, the concentration of chlorophyll in
.mu.g/.mu.l in the measured sample is equivalent to the value
determined in equation #2 divided by the volume of the sample
measured, which in this example is 20 .mu.l. In this example,
A.sub.645 was determined to be 0.496, and A.sub.663 was determined
to be 1.0814. Thus, the concentration of chlorophyll in the
measured sample was 4.67 .mu.g/.mu.l. The concentration of
chlorophyll in the chloroplast slurry was adjusted to 4.0
.mu.g/.mu.l with Hepes-KOH pH 7.7, 330 mM sorbitol solution and the
resulting chloroplast suspension was stored on ice in the dark.
[0249] A typical 300 microliter uptake experiment contained 5 mM
ATP, 8.3 mM unlabeled methionine, 322 mM sorbitol, 58.3 mM
Hepes-KOH (pH 8.0), 50 microliters reticulocyte lysate translation
products, and intact chloroplasts (about 200 microgram
chlorophyll). The uptake mixtures were gently rocked at room
temperature in 10.times.75 mm glass tubes, directly in front of a
fiber optic illuminator set at maximum light intensity using a 150
Watt bulb. Two separate 70 microliter samples of each uptake mix
were removed at 0, 5, 10 and 15 minutes. One sample was centrifuged
over 100 microliter silicone-oil gradients in 150 microliter
polyethylene tubes by centrifugation at 11,000.times.g for 30
seconds, and immediately frozen in dry ice. Under these conditions,
the intact chloroplasts form a pellet under the silicone-oil layer
and the incubation medium containing the reticulocyte lysate
remains floating on the surface of the interface. The other sample
was treated with protease (one tenth volume or 7 microliters of
0.25 mg/ml each trypsin and chymotrypsin protease mixture) for
thirty minutes on ice, then subjected to silicone-oil separation
and frozen on dry ice. The chloroplast pellets were then
resuspended in 50-100 microliters of a lysis buffer (10 mM
Hepes-KOH pH 7.5, 1 mM PMSF, 1 mM benzamidine, 5 mM
.epsilon.-amino-n-caproic acid, and 30 micrograms per ml aprotinin)
and centrifuged at 15,000.times.g for 20 minutes to pellet the
thylakoid membranes. The cleared supernatant (stromal proteins)
from this spin, and an aliquot of the reticulocyte lysate
incubation medium from each uptake experiment, were mixed with an
equal volume of 2.times.SDS-PAGE sample buffer and analyzed on a
15% SDS-PAGE gel, dried, and exposed to film as described above.
Chloroplasts exposed to [.sup.35S]-methionine labeled CTP-PhnO
contained [.sup.35S]-labeled protein of a size consistent with the
predicted CTP-processed form of PhnO, while chloroplasts exposed to
methionine labeled PhnO were devoid of labeled protein. Labeled
protein imported into the chloroplasts was also protease resistant.
These results indicated that PhnO could be targeted to chloroplasts
when fused to a plastid targeting peptide sequence.
Example 8
[0250] This example illustrates the identification and
characterization of plants transformed with an AMPA
acyltransferase.
[0251] A wide variety of plant species have been successfully
transformed using any number of plant transformation methodologies
well known in the art. In particular, Agrobacterium tumefaciens
mediated plant transformation is the preferred method presently in
use, however, ballistic methods which increase delivery of naked
DNA directly to plant cells through microprojectile bombardment are
also very effective in producing recombinantly transformed plants.
In addition, methods which involve the use of liposomes,
electroporation, chemicals that increase free DNA uptake, and
transformation using viruses or pollen are alternatives which can
be used to insert DNA constructs of this invention into plant
cells. Plants which can be transformed by the practice of the
present invention include but are not limited to corn, wheat,
cotton, rice, soybean, sugarbeet, canola, flax, barley, oilseed
rape, sunflower, potato, tobacco, tomato, alfalfa, lettuce, apple,
poplar, pine, eucalyptus, acacia, poplar, sweetgum, radiata pine,
loblolly pine, spruce, teak, alfalfa, clovers and other forage
crops, turf grasses, oilpalm, sugarcane, banana, coffee, tea,
cacao, apples, walnuts, almonds, grapes, peanuts, pulses, petunia,
marigolds, vinca, begonias, geraniums, pansy, impatiens, oats,
sorghum, and millet. DNA molecules for use in the present invention
can be native or naturally occurring genes or chimeric genes
constructed from useful polynucleotide sequences including
promoters, enhancers, translated or non-translated leaders,
sequences encoding signal peptides, sequences encoding transit
peptides, structural genes, fusions of structural genes,
terminators, introns, inverted repeats or direct repeats, linkers,
and polyadenylation sequences. DNA sequences contemplated in this
invention include single and double stranded polynucleotide
sequences, linear sequences, and covalently closed circular
polynucleotide sequences, plasmids, bacmids, cosmids, bacterial
artificial chromosomes (BAC's), yeast artificial chromosomes
(YAC's), and viral DNA and RNA sequences. In consideration of
Agrobacterium mediated plant transformation, suitable plant
transformation vectors include those derived from a Ti plasmid of
Agrobacterium tumefaciens, as well as those disclosed, for example
by Herrera-Estrella (1983), Bevan (1984), Klee (1985) and EPO
publication 120,516 (Schilperoort et al.). In addition to plant
transformation vectors derived from the Ti or root-inducing (Ri)
plasmids of Agrobacterium, alternative methods as described above
can be used to insert the DNA constructs of this invention into
plant cells.
[0252] Plasmids used for plant transformation generally were
constructed from vectors which have been described elsewhere,
particularly in U.S. Pat. No. 5,463,175 (Barry et al., 1995), which
is herein incorporated by reference. Plasmids were constructed and
maintained in E. coli using Tn7 aminoglycoside adenylyltransferase
resistance (aad gene, commonly referred to as
streptomycin/spectinomycin or Spc/Str resistance), which is also a
determinant for selection and maintenance in Agrobacterium. Other
plasmid maintenance and selectable markers well known in the art
for use in E. coli were also used, consisting essentially of
neomycin phosphotransferase, gentamycin acetyltransferase, and beta
lactamase genes alone or present in combination on a single
replicon or vector. Plasmids generally contain oriV, a replication
origin derived from the broad host range plasmid RK2, and ori322
and bom (origin of replication for maintenance in E. coli, and
basis of mobility for conjugational transfer respectively)
sequences derived from plasmid pBR322.
[0253] A phnO gene encoding an AMPA acyltransferase was inserted
into expression cassettes in plant transformation vectors. These
cassettes generally contain the following elements in sequential 5'
to 3' order: a sequence comprising a plant operable promoter, a
sequence encoding a chloroplast or plastid transit peptide, a
cloning site or sites contained within a polylinker, and a plant
functional 3' nontranslated region. Expression cassettes often are
constructed to contain unique restriction sites flanking the
cassette domain so that the entire cassette can be excised from one
plasmid and placed into other similarly constructed plasmid
vectors. Restriction sites comprised of eight base pair recognition
sequences are preferred, and most cassettes in the present
invention are flanked at least on one end by a NotI restriction
endonuclease recognition site. Preferred promoters are the figwort
mosaic virus promoter, P-FMV (Gowda et al., 1989), the cauliflower
mosaic virus 35S promoter CaMV 35S (Odell et al., 1985), or the
enhanced CaMV 35S promoter (U.S. Pat. No. 5,196,525; Kay et al.,
1987). A number of other promoters which are active in plant cells
have been described in the literature. Such promoters may be
obtained from plants or plant viruses and include, but are not
limited to the nopaline synthase (NOS) and octopine synthase (OCS)
promoters which are carried on tumor-inducing plasmids generally
found within virulent and non-virulent strains of Agrobacterium
tumefaciens, the cauliflower mosaic virus (CaMV) 19S promoter, the
comalina yellow mottle virus promoter, the sugar cane bacilliform
DNA virus promoter, the peanut chlorotic streak virus promoter, the
rice actin promoter, and the light-inducible ribulose
1,5-bisphosphate carboxylase small subunit promoter (ssRUBISCO).
These promoters can used to create various types of DNA constructs
useful for gene expression in plants (see for example Barry et al.
U.S. Pat. No. 5,463,175). Particularly desirable promoters which
are contemplated because of their constitutive nature are the
Cauliflower Mosaic Virus 35S (CaMV35S) and the Figwort Mosaic Virus
35S (FMV35S) promoters which have previously been shown to produce
high levels of expression in most plant organs. Other promoters
which would direct tissue specific or targeted expression are also
contemplated, for example in tissue such as leaves, meristem,
flower, fruit and organs of reproductive character. In addition,
chimeric promoters are also envisioned. Nopaline synthase gene (NOS
3') and the pea ribulose bisphosphate carboxylase synthase E9 gene
(E9 3') 3' nontranslated termination and polyadenylation sequences
were also used.
[0254] Expression cassettes consisting of a AMPA acyltransferase
structural gene inserted downstream of a promoter and between a
sequence encoding a chloroplast targeting peptide and a 3'
nontranslated sequence were generally present on a plant
transformation vector. Expression cassettes were generally flanked
on either end of the cassette by a nopaline type T-DNA right border
region on one end and a left border region on the other end, both
border regions derived from pTiT37 (Fraley et al., 1985). Some
plant transformation vectors only contained the right border
region, required for initiation of T-DNA transfer from
Agrobacterium to the host cell. Most plant transformation vectors
also contained a GOX (glyphosate oxidoreductase) gene, as described
above, and in U.S. Pat. No. 5,463,175. GOX enzyme expressed from
these vectors was generally targeted to the chloroplast when
inserted into the plant genome.
[0255] Plant transformation vectors were mobilized into the ABI
Agrobacterium strain A208 carrying the disarmed Ti plasmid pTiC58
(pMP90RK) (Koncz and Schell, 1986). The Ti plasmid does not carry
the T-DNA phytohormone genes which induce crown gall formation.
Mating of the plant vector into ABI was done by the triparental
conjugation system using the helper plasmid pRK2013 (Ditta et al.,
1980). Alternatively, the plant transformation plasmid can be
introduced into the ABI strain by electroporation as described by
Mattanovich et al. (Efficient transformation of Agrobacterium spp.
by electroporation, Nucleic Acids Res. (1989), 17(16), 6747), which
is herein incorporated by reference. When plant tissue is incubated
with the ABI::plant vector conjugate, the recombinant vector is
transferred to the plant cells by the vir functions encoded by the
disarmed pTiC58 plasmid. Ideally, the recombinant vector opens at
the T-DNA right border region, and the DNA between the right and
left border sequences is transferred directionally and inserted
into the host plant genome, although the entire recombinant plant
transformation vector sequence may be transferred and inserted. The
pTiC58 Ti plasmid does not transfer to the plant cells but remains
in the Agrobacterium donor.
[0256] Recombinant plants can be regenerated from plant cells or
plant tissue which has been transformed with a functional AMPA
acyltransferase structural gene. The choice of methodology for the
regeneration step is not critical, with suitable protocols being
available for hosts from Leguminosae (alfalfa, soybean, clover,
etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage,
radish, rapeseed, etc.), Cucurbitaceae (melons and cucumber),
Gramineae (wheat, rice, corn, etc.), Solanaceae (potato, tobacco,
tomato, peppers), and various floral crops. See for example,
Ammirato, 1984; Shimamoto, 1989; Fromm, 1990; and Vasil, 1990).
Recombinant plants which have been transformed with an AMPA
acyltransferase can also be selected on medium containing AMPA. The
appropriate inhibitory concentration of AMPA can readily be
determined by one of ordinary skill in the art for any particular
host by screening for AMPA toxicity as described in example 1.
Alternatively, when AMPA acyltransferase is transformed into plants
previously transformed with GOX and selected for growth on
glyphosate, either AMPA or glyphosate can be used as the selective
ingredient for selecting for transformation events which express
sufficient levels of AMPA acyltransferase enzyme. Glyphosate must
be applied at levels which would otherwise be inhibitory to a
recombinant plant expressing GOX and selected for growth on
glyphosate, due to the increased level of AMPA which may be
produced as a result of GOX mediated glyphosate degradation. In
plants which express recombinant GOX enzyme, exposure to increasing
levels of glyphosate has been shown to induce yellowing or
chlorosis of the leaves, stunted growth characteristics, and
infertility. AMPA acyltransferase expressed coordinately or in
combination with GOX expression can overcome these detrimental
effects. It is also possible to use AMPA as a plant transformation
selectable marker as an alternative to glyphosate selection.
[0257] Tobacco
[0258] Tobacco plants were transformed with a phnO gene. A tobacco
leaf disc transformation procedure employed healthy tissue from a
leaf of about one month old. After a 15-20 minute surface
sterilization with 10% CLOROX.TM. plus a surfactant, leaves were
rinsed three times in sterile water. Leaf discs were punched with a
sterile paper punch, and placed upside down on MS104 media (4.3 g/l
MS salts, 30 g/l sucrose, 2 ml/l 500.times. B5 vitamins, 0.1 mg/l
NAA, and 1.0 mg/l BA), and pre-cultured for one day. Discs were
then inoculated with an 1:5 diluted overnight culture of disarmed
Agrobacterium ABI containing the subject vector (final culture
density about 0.6 OD as determined at 550 nm). The inoculation was
done by placing the discs in sterile centrifuge tubes along with
the culture. After thirty to sixty seconds, the liquid was drained
off and the discs were blotted between sterile filter paper. The
discs were then placed upside down on a filter disc on MS104 feeder
plates and incubated for 2-3 days. After this co-culture period,
the discs were transferred, still upside down, to selection plates
containing MS104 media. After 2-3 weeks, callus formed, and
individual clumps were separated from the leaf discs. Shoots were
cleanly cut from the callus when they were large enough to
distinguish from stems. The shoots were placed on hormone-free
rooting media (MSO: 4.3 g/l MS salts, 30 g/l sucrose, and 2
ml/1500.times. B5 vitamins) with selection. Roots formed in 1-2
weeks. Any leaf callus assays are preferably done on rooted shoots
while still sterile. Rooted shoots were placed in soil and were
maintained in a high humidity environment (ie: plastic containers
or bags). The shoots were hardened off by gradually exposing them
to ambient humidity conditions.
[0259] Three tobacco transformation events, designated as lines
33476, 36779, and 37235 were selected for further analysis.
pMON17226 (Barry et al., U.S. Pat. No. 5,463,175, 1995) was used to
produce plant line 33476 which contains an FMV-CTP-GOX gene
construct. Lines 36779 and 37235 were produced using pMON17261,
which is a plasmid derived from pMON17226 which contains NotI
cassette containing an FMV-CTP-PhnO gene sequence (SEQ ID NO:11) in
addition to FMV-CTP-GOX. The NotI cassette was constructed as
follows. The sequence encoding CTP, represented by SEQ ID NO:9, was
excised from pMON17058 as a BglII to NcoI fragment and inserted
into pMON15028, forming a sequence represented by SEQ ID NO:11 in
which the CTP coding sequence was upstream of and in frame with the
PhnO coding sequence represented within SEQ ID NO:7. The resulting
construct was designated as pMON15029. The CTP-PhnO coding sequence
was excised from pMON15029 on a BglII to SacI fragment and combined
with pMON17063 fragments to produce pMON15038. pMON17063 was
disassembled using restriction digestion to provide parts necessary
for pMON15038 construction. pMON17063 was digested with SacI and
HindIII to produce a vector backbone into which a promoter fragment
and the CTP-PhnO sequence were inserted. pMON17063 was also
digested in a separate reaction with HindIII and BglII to produce a
fragment containing an FMV promoter sequence. The promoter fragment
and the CTP-PhnO fragment were ligated together in a reaction along
with the vector backbone fragment to produce pMON15038, containing
a NotI cassette harboring a sequence encoding a chloroplast
targeted PhnO peptide expressed from an FMV promoter and flanked
downstream by a NOS E9 3' transcription termination and
polyadenylation sequence. This NotI sequence was excised from
pMON15038 and inserted into the unique NotI site in pMON17241 to
produce pMON17261, containing a chloroplast targeted GOX coding
sequence expressed from an FMV promoter and flanked downstream by
an E9 3' sequence, along with the CTP-PhnO coding sequence and
expression cassette. Transformation events derived from this vector
are expected not only to be resistant to glyphosate, but to provide
resistance to AMPA phytotoxicity as well. Lines 36779 and 37235
derived from pMON17261 were analyzed for the presence of genes
encoding glyphosate oxidoreductase and AMPA acyltransferase by PCR,
for the presence of GOX and PhnO enzymes by western blot, and for
the presence of metabolites produced as a result of GOX mediated
[.sup.14C]-glyphosate degradation by HPLC.
[0260] Line 33476, obtained as a transformation event derived from
pMON17226, was selected as a "GOX only" control. Lines 36779 and
37235 demonstrated different phenotypes upon exposure to glyphosate
and were selected as glyphosate resistant events arising after
transformation with pMON17261. Line 37235 became bleached or
yellowed upon exposure to glyphosate, similar in phenotype to the
GOX only line 33476. However, line 36779 displayed no such
bleaching effect. DNA was extracted from leaf tissue for each of
these events as well as from wt Samsun tobacco leaf, and subjected
to PCR to determine the presence or absence of the transforming
phnO gene.
[0261] Genomic DNA isolated from transformed tobacco lines was used
as the template DNA in a PCR reaction and reaction products were
compared to wild type Samsum tobacco. PCR reactions consisted of 50
microliters total volume containing 10.times. amplification buffer,
1.5 mM MgCl.sub.2, deoxynucleotide mix with each at 1 mM, 50-100 ng
genomic DNA, primers each at a final concentration of 16.8 pM, and
1.5 units of AmpliTaq DNA polymerase (Cetus/Perkin Elmer). Primers
(synthesized to order by GENOSYS) consisted of the sequences as set
forth in SEQ ID NO:21 and SEQ ID NO:22. SEQ ID NO:21 is a 20 base
pair sequence capable of priming the synthesis of the P2A phnO gene
sequence (SEQ ID NO:7) and hybridizes to the first twenty
nucleotides of the coding sequence in that gene. SEQ ID NO:22 is
also a 20 base pair sequence, but is capable of priming synthesis
of a phnO gene from the terminal coding sequence into the
structural coding region and hybridizes to the terminal twenty
nucleotides of the sequence encoding PhnO. Amplification conditions
consisted of three cycles of 97.degree. C. for one minute,
60.degree. C. for two minutes, and 72.degree. C. for two minutes,
followed by 37 cycles of 94.degree. C. for one minute, 60.degree.
C. for two minutes, and 72.degree. C. for two minutes, followed
generally by a 4.degree. C. soak. 10 microliter samples were
generally analyzed by 1% TAE agarose gel electrophoresis to resolve
the relevant bands from residual primers. Upon ethidium bromide
staining of the product gels, a phnO gene amplification product
about 432 base pairs as judged by the migration position versus
HindIII digested lambda molecular weight markers appeared only in
the line 33779 extracts, indicating the presence of the phnO gene
in that line.
[0262] Seed from Ro transformation events were obtained after self
crossing in growth chamber conditions. Ro seed were cured and
planted to generate R1 progeny. Source leaves of R1 progeny at the
five leaf stage were exposed to [.sup.14C]-glyphosate by spotting a
2 microliter sample onto each vein (50 microliters of
[.sup.14C]-glyphosate Na+ salt, 517,000 dpm/microgram, 0.42
microgram/microliter mixed with 10 microliters of glycerol). Each
leaf received several spots depending on the number of veins on
that leaf. Three days later 15 additional 2 microliter spots were
applied to each leaf. Two weeks later, five 2 microliter spots were
applied to each of two leaves on each plant. These were new leaves
and were not the older leaves to which glyphosate was initially
applied. Five days after this last application, about 300
milligrams of tissue was sampled from two sink leaves on each
plant. The samples from each plant were homogenized in separate 1
ml volumes of deionized water, centrifuged at 9,000 RPM in a
microcentrifuge, and the aqueous volumes were collected and stored
on ice. Extracts were analyzed by HPLC for the presence of
[.sup.14C] labeled metabolites as in Example 2. The extract
obtained from line 33476 (GOX) contained only [.sup.14C]-AMPA. The
extract obtained from line 37235 contained non-metabolized
[.sup.14C]-glyphosate as well as a trace but measurable amount of
[.sup.14C]-AMPA. Only N-acetyl-[.sup.14C]-AMPA was observed in the
extract obtained from line 36779. These results are consistent with
the PCR data which indicated that line 36779 contained at least one
copy of the phnO gene. In addition, the lack of a bleaching effect
in line 36779 after exposure to glyphosate is consistent with the
presence of functional GOX and PhnO enzymes and the absence of
detectable [.sup.14C]-AMPA.
[0263] Cotton
[0264] A recombinant phnO gene was transformed into Coker 312
variety cotton (Gossypium hirsutum L.). Glyphosate tolerant cotton
lines were produced by Agrobacterium mediated plant transformation
using double border binary plasmid vectors containing either (1)
gox, an Achromobacter sp. strain LBAA gene encoding a
glyphosate-metabolizing enzyme glyphosate oxidoreductase (GOX), (2)
the gox gene and an E. coli phnO gene encoding PhnO, or (3) the
gox/phnO double gene construct along with an Agrobacterium strain
CP4 gene encoding 5-enolpyruvylshikimate-3-phosphate synthase
(EPSPS). All vectors are capable of replication in both
Agrobacterium tumefaciens and E. coli hosts, and contain an
aminoglycoside adenylyltransferase gene (aad) conferring resistance
to aminoglycosides such as spectinomycin or streptomycin and
providing a method for plasmid maintenance.
[0265] pMON17241 contains a recombinant gene consisting of a 35S
FMV promoter linked 5' to an Arabidopsis thaliana
ribulose-1,5-bisphosphate carboxylase small subunit (SSU1A) gene
sequence encoding a plastid or chloroplast targeting peptide (Timko
et al., 1988) which is translationally fused to a gox gene coding
sequence, which is linked 3' to a 3' untranslated region,
designated E9, from a pea ribulose-1,5-bisphosphate carboxylase
gene.
[0266] pMON17213 is a double gene plant transformation vector
containing expression cassettes comprising (1) a 35S FMV promoter
linked to a sequence encoding an Arabidopsis thaliana EPSPS
chloroplast targeting peptide linked in-frame to a strain CP4 EPSPS
coding sequence, which is linked 3' to an E9 3' untranslated
region; and (2) a 35S FMV promoter linked to an SSU1A gene sequence
encoding a plastid targeting peptide linked in-frame to a GOX
coding sequence, which is linked 3' to a NOS 3' termination
sequence.
[0267] pMON17261, described above, is a double gene plant
transformation vector containing expression cassettes comprising
(1) an FMV 35S promoter linked to an SSU1A chloroplast targeting
peptide coding sequence linked in-frame to a GOX coding sequence,
which is flanked downstream by the E9 3' untranslated region; and
(2) an FMV 35S promoter linked to an SSU1A chloroplast targeting
peptide coding sequence (SEQ ID NO:9) linked in-frame to a PhnO
coding sequence (SEQ ID NO:7), which is linked 3' to a NOS 3'
sequence.
[0268] pMON10151 is a double gene plant transformation vector
containing expression cassettes comprising (1) an FMV 35S promoter
linked to an SSU1A chloroplast targeting peptide coding sequence
(SEQ ID NO:9) linked in-frame to a PhnO coding sequence (SEQ ID
NO:7), which is flanked downstream by a NOS 3' sequence; and (2) an
enhanced 35S promoter linked to an SSU1A chloroplast targeting
peptide coding sequence linked in-frame to a GOX coding sequence
which is flanked downstream by a NOS 3' sequence.
[0269] pMON10149 is a triple gene plant transformation vector
containing expression cassettes comprising (1) an FMV 35S promoter
and a petunia HSP70 5' untranslated leader sequence linked to an
SSU1A chloroplast targeting peptide coding sequence linked in-frame
to an EPSPS coding sequence, which is flanked downstream by the E9
3' termination and polyadenylation sequence; (2) an FMV 35S
promoter linked to an SSU1A chloroplast targeting peptide coding
sequence (SEQ ID NO:9) linked in-frame to a PhnO coding sequence
(SEQ ID NO:7), which is flanked downstream by a NOS 3' sequence;
and (3) an enhanced 35S CaMV promoter linked to an SSU1A
chloroplast targeting peptide coding sequence linked in-frame to a
GOX coding sequence, which is flanked downstream by a nopaline
synthase 3' polyadenylation sequence (NOS 3').
[0270] Plasmid vectors were assembled in E. coli K12 strains and
mated into a disarmed ABI Agrobacterium strain. Aminoglycoside
resistant Agrobacterium strains were used to transform Coker 312
derived hypocotyl sections with modifications as described by
Umbeck et al. (1987) and Umbeck (U.S. Pat. No. 5,159,135 (1992),
incorporated herein by reference), except that plants were
regenerated with modifications described by Trolinder and Goodin
(1987). Selection for glyphosate resistance produced several lines
of cotton callus, which were subsequently determined by PCR of
genomic DNA to contain the respective genes encoding EPSPS, GOX or
PhnO transferred from Agrobacterium. Additionally, these same
callus lines were determined by Western blot analysis to express
the desired genes. After plant regeneration, whole cotton plants
which contained the indicated coding sequences were recovered.
[0271] Previously identified plants transformed with a double gene
glyphosate resistance cassette comprised of EPSPS and GOX encoding
genes were determined to be resistant to glyphosate when applied at
48 ounces per acre through the 6-7 leaf stage, however severe
bleaching of the leaves was observed. This phytotoxic effect was
presumed to be due to the formation of AMPA as a result of GOX
mediated glyphosate degradation. To test this, AMPA was sprayed at
three different rates onto wild type Coker 312 plants. Leaf
chlorosis and stunted growth was observed in plants at four days
post-application of glyphosate at 640 ounces per acre and at eight
days post-application of 64 ounces per acre. These results
suggested that the phytotoxic effect observed in EPSPS/GOX
transformed cotton plant lines was a result of GOX mediated AMPA
production in plants, and that the phytotoxic effect may be
obviated by co-expression of an AMPA acyltransferase along with
GOX. To test this, cotton plants expressing GOX or GOX plus EPSPS
alone or in combination with PhnO expression were treated with
[.sup.14C]-glyphosate, and the metabolism of the isotope labeled
glyphosate was monitored in leaf tissue seven days after
application.
[0272] Coker 312 glyphosate resistant recombinant cotton line 4416
was selected as a glyphosate resistant cotton line after
transformation with pMON10149, a triple gene Agrobacterium
tumefaciens mediated double border plant transformation vector
containing chloroplast targeted EPSPS, GOX, and PhnO, each
expressed independently from separate 35S promoters. Several 4416
R3 plants were raised from R2 seed. One leaf of each plantlet at
the three or four stage was treated with a mixture of ROUNDUP
ULTRA.TM. commercial herbicide mixture (Lot No. GLP-9701-7428-F)
which had been fortified with [.sup.14C]-glyphosate (Code No.
C-2251). The ROUNDUP ULTRA.TM. was shown to be 30.25% glyphosate
acid by weight and the [.sup.14C]-glyphosate had a radiochemical
purity of 97.3% and a specific activity of 36.36 mCi/mmol. The
treatment solution consisted of approximately 38 .mu.L containing
1.60.times.10.sup.6 dpm with a [.sup.14C]-glyphosate specific
activity of 1.713.times.10.sup.3 dpm/.mu.g glyphosate acid. Three
or seven days after topical application the treated leaves were
rinsed with water, frozen in liquid nitrogen, fractured with a
spatula and then ground using a TEKMAR.TM. tissuemizer in 10 mL of
water. The leaf extracts were adjusted to pH 3.5-4.0 with 1N HCl
and approximately 4-8000 dpm were analyzed for the presence of
[.sup.14C]-metabolites by HPLC with liquid scintillation vial
collection and detection (HPLC/LSC) as described in example 2. The
new growth including the meristem and new leaves that emerged
following topical application were also extracted and analyzed for
[.sup.14C]-metabolites. The results are shown in Table 13.
TABLE-US-00013 TABLE 13 [.sup.14C]-Glyphosate Metabolism In
Glyphosate Resistant Cotton % [.sup.14C] metabolite in Glyphosate %
[.sup.14C] metabolite in Treated Leaf Extract . . .* New Growth
Extract . . .* Line 4416 N-Acetyl- N-Acetyl- Plant# Glyphosate AMPA
AMPA Glyphosate AMPA AMPA MD03 55.2 2.5 37.4 nd** nd 93.4 MD04 94.6
2.1 1.7 97.9 nd nd A01 48.6 2.1 44.7 0.9 0.2 95.8 A02 67.3 2.0 29.1
0.7 0.2 96.5 A03 48.8 2.0 43.4 1.2 nd 94.0 A04 19.4 1.6 73.9 1.5 nd
94.0 A05 59.9 2.2 31.1 2.2 0.2 95.2 A06 38.2 nd 60.9 1.5 0.2 93.5
A07 64.1 nd 26.8 1.4 0.5 93.9 A08 90.9 2.0 1.9 91.2 2.5 1.9
*[.sup.14C]-Glyphosate, [.sup.14C]-AMPA, and
N-Acetyl-[.sup.14C]-AMPA as a percentage of total [.sup.14C]
isotope observed by HPLC/LSC in each sample. **nd indicates that
the metabolite was not detected by HPLC/LSC
[0273] Analysis of the water rinsed glyphosate treated leaves
indicated the presence of significant levels of
N-acetyl-[.sup.14C]-AMPA in eight of the ten plants tested. These
levels represented 27-74% of the isotope extracted from the treated
leaves. The remaining activity was almost entirely
[.sup.14C]-glyphosate. Very little of the [.sup.14C] isotope was
present as [.sup.14C]-AMPA. The remaining two plants had very
limited ability to metabolize glyphosate as indicated by the high
levels of [.sup.14C]-glyphosate remaining on or in the leaves. One
of these plants also showed signs of stunting seven days after
treatment, indicating glyphosate phytotoxicity.
[0274] Analysis of new growth in the ten plants tested showed that
the predominant form of [.sup.14C] labeled metabolite present was
N-acetyl-[.sup.14C]-AMPA at greater than 90% of the total
radioisotope in the samples. In contrast, more than 90% of the
isotope in the remaining two plants was in the form of
[.sup.14C]-glyphosate, consistent with the analysis of the extract
from the treatment leaf for these two plants.
[0275] The metabolism of [.sup.14C]-glyphosate in recombinant
cotton lines 4268 (GOX/PhnO) and 3753 (EPSPS/GOX) was also studied.
Plants in this study were treated as indicated above for cotton
line 4416, by applying droplets of ROUNDUP ULTRA fortified with
[.sup.14C]-glyphosate to a single leaf on each plant at the three
to four leaf stage. Treated leaves were harvested and rinsed with
water, then ground and extracted, and extracts were analyzed by
HPLC as described above for the presence of [.sup.14C]-glyphosate,
[.sup.14C]-AMPA, and N-acetyl-[.sup.14C]-AMPA. New growth,
including the meristem and new leaves that emerged following
application were also extracted and analyzed. The results are shown
in Table 14.
TABLE-US-00014 TABLE 14 [.sup.14C]-Glyphosate Metabolism In
Glyphosate Resistant Cotton *% [.sup.14C] metabolite in Glyphosate
*% [.sup.14C] metabolite in Treated Leaf Extract . . . New Growth
Extract . . . Plant Glyphosate AMPA N-Acetyl-AMPA Glyphosate AMPA
N-Acetyl-AMPA GOX/PhnO Plants B01 76.7 3.0 14.0 3.4 1.0 89.9 B02
63.9 4.8 25.0 1.1 1.5 91.5 B03 54.4 3.2 36.4 0.8 nd 94.7 B04 58.3
5.7 28.9 1.1 1.2 91.0 EPSPS/GOX Plants C01 59.8 26.6 nd 3.72 85.7
nd C02 92.7 2.1 0.8 92.8 0.8 nd C03 81.2 10.7 nd 13.5 72.0 1.9 C04
86.2 6.4 1.0 13.9 76.2 nd *[.sup.14C]-Glyphosate, [.sup.14C]-AMPA,
and N-Acetyl-[.sup.14C]-AMPA as a percentage of total [.sup.14C]
isotope labeled metabolites observed after HPLC/LSC analysis in
each sample. **nd indicates that the metabolite was not detected by
HPLC/LSC.
[0276] Significant levels of N-acetyl-[.sup.14C]-AMPA were present
in the treated leaves of all four line 4268 plants (GOX/PhnO;
B01-B04). In contrast, N-acetyl-[.sup.14C]-AMPA was not detectable
in extracts obtained from line 3753 plants (EPSPS/GOX; C01-C04).
Three of these plants contained significant levels of
[.sup.14C]-AMPA in treated leaf extracts, ranging from 6-27%. One
line 3753 plant was deficient in the conversion of
[.sup.14C]-glyphosate to N-acetyl-[.sup.14C]-AMPA, and this plant
also appeared to be stunted.
[0277] 90-95% of the [.sup.14C] isotope in extracts of new growth
from line 4268 plants was determined to be in the form of
N-acetyl-[.sup.14C]-AMPA. However, 72-86% of the [.sup.14C] isotope
in extracts of new growth from three of the line 3753 plants was
determined to be [.sup.14C]-AMPA, with [.sup.14C]-glyphosate
accounting for the remainder of the isotope in these tissues. 93%
of the isotope obtained from line 3753 plant number C02 was
determined to be [.sup.14C]-glyphosate, consistent with the lack of
glyphosate metabolism in the application leaf as well as the
observed stunting. In addition, growth regions of all line 3753
plants were discolored and yellow following treatment, but improved
with time. By harvest, new growth leaves became mottled.
[0278] These results are consistent with the presence of active gox
and phnO gene products in the indicated plants. The GOX and PhnO
proteins are metabolizing glyphosate to AMPA and N-acetyl-AMPA in
the predicted manner, and line 4268 plant extracts provide a
similar metabolic pattern to that observed with line 4416 plant
extracts as judged by HPLC and by phenotypic observation. In both
lines, the predominant [.sup.14C] product in new growth tissue
extracts after [.sup.14C]-glyphosate application is
N-acetyl-[.sup.14C]-AMPA. The phytotoxicity as observed by
discoloration of plant leaves in line 3753 after glyphosate
application is associated with the lack of an AMPA
N-acyltransferase activity. In contrast, the presence of an AMPA
N-acyltransferase activity in both the 4416 and the 4268 plant
lines resulted in a lack of phytotoxic effects observed in line
3753 plants.
[0279] Canola
[0280] Canola plants were transformed with the vectors pMON17138
and pMON17261 and a number of plant lines of the transformed canola
were obtained which exhibited glyphosate tolerance. Plants were
transformed according to the method described in Barry et al. (U.S.
Pat. No. 5,633,435). Briefly, Brassica napus cv Westar plants were
grown in controlled growth chamber conditions as described. Four
terminal internodes from plants just prior to bolting or plants in
the process of bolting but before flowering were removed and
surface sterilized in 70% v/v ethanol for one minute, then in 2%
w/v sodium hypochlorite for twenty minutes, then rinsed three times
with sterile distilled deionized water. Stems with leaves attached
could be refrigerated in moist plastic bags for up to three days
prior to sterilization. Six to seven stem segments were cut into 5
mm discs with a Redco Vegetable Slicer 200 maintaining orientation
of basal end. Stem discs (explants) were inoculated with 1
milliliter of ABI Agrobacterium tumefaciens strain A208 containing
a recombinant plant transformation plasmid prepared as described
above. Explants were placed basal side down in petri plates
containing 0.1.times. standard MS salts, B5 vitamins, 3% sucrose,
0.8% agar, pH 5.7, 1 mg/l BA (6-benzyladenine). The plates were
layered with 1.5 ml of media containing MS salts, B5 vitamins, 3%
sucrose, pH 5.7, 4 mg/l p-chlorophenoxyacetic acid, 0.005 mg/l
kinetin and covered with sterile filter paper.
[0281] Following a 2.3 day co-culture, explants were transferred to
deep dish petri plates (seven explants per plate) containing MS
salts, B5 vitamins, 3% sucrose, 0.8% agar, pH 5.7, 1 mg/l BA, 500
mg/l carbenicillin, 50 mg/l cefotaxime, 200 mg/l kanamycin or 175
mg/l gentamicin for selection, and transferred after three weeks to
fresh media, five explants per plate. Explants were cultured in a
growth room at 25.degree. C. with continuous light (Cool White).
After an additional three weeks, shoots were excised from the
explants, and leaf recallusing assays were initiated to confirm
modification of R.sub.0 shoots. Three tiny pieces of leaf tissue
were placed on recallusing media containing MS salts, B5 vitamins,
3% sucrose, 0.8% agar, pH 5.7, 5 mg/l BA, 0.5 mg/l naphthalene
acetic acid (NAA), 500 mg/l carbenicillin, 50 mg/l cefotaxime, 200
mg/l kanamycin or gentamicin or 0.5 mM glyphosate. The leaf assays
were incubated in a growth room under the same conditions as
explant culture. After an additional three weeks, the leaf
recallusing assays were scored for herbicide tolerance (callus or
green leaf tissue) or sensitivity (bleaching).
[0282] Each shoot stem was dipped in ROOTONE at the time of
excision, placed in a two inch pot containing Metro-MIX 350, and
maintained in a closed humid environment in a growth chamber at
24.degree. C., 16/8 hour photoperiod, 400 uE per square meter per
second (HID lamps) for a hardening-off period of approximately
three weeks.
[0283] Plasmid pMON17138 is an Agrobacterium mediated single border
plant transformation vector maintained in the bacterium by
selection on streptomycin or spectinomycin. pMON17138 contains a
single right Ti border flanking the 3' end of the genetic elements
desired to be transferred into the plant genome. This vector
contains two plant operable expression cassettes. One cassette is
comprised of a caulimovirus 35S promoter driving expression of a
neomycin phosphotransferase gene (nptII), flanked downstream by a
nopaline synthase 3' transcription termination and polyadenylation
sequence (NOS 3'). The other cassette is comprised of a figwort
mosaic virus promoter (described in Rogers, U.S. Pat. No.
5,678,319) upstream of a pea ribulose bisphosphate carboxylase
small subunit transcription termination and polyadenylation
sequence. A chloroplast targeted glyphosate oxidoreductase (GOX)
coding sequence is inserted between the promoter and pea 3'
sequence.
[0284] Plasmid pMON17261 is an Agrobacterium mediated double border
plant transformation vector similar to pMON17138. A chloroplast
targeted GOX encoding cassette identical to that in pMON17138 is
present downstream from a Ti right border, and upstream of an
additional plant operable expression cassette comprised of a
figwort mosaic virus promoter (P-FMV) linked to a NOS 3' sequence.
A chloroplast targeted PhnO coding sequence is inserted between the
second P-FMV and NOS3' sequences.
[0285] R.sub.1 plants derived from transformation events using
pMON17261 and pMON17138 were evaluated using a glyphosate spray
test described in Barry et al. (U.S. Pat. No. 5,633,435).
[0286] Corn
[0287] An AMPA acyltransferase gene has also been introduced into
Black Mexican Sweet corn cells with expression of the gene and
glyphosate resistance detected in callus. Callus tissue was
transformed according to the method described in Barry et al. (U.S.
Pat. No. 5,463,175). Various plasmids were used to introduce
glyphosate resistance genes encoding GOX and EPSPS in combination
with an AMPA acyltransferase gene into corn cells. These plasmids
differed from each other with respect to promoters used,
chloroplast or plastid targeting peptide sequences used,
untranslated leader sequences used, presence or absence of an
intron, and type of 3' terminator used, however all plasmids
contained a synthetically derived AMPA acyltransferase gene
encoding PhnO containing the P2A mutation. The synthetic gene was
constructed from three smaller polynucleotide sequences synthesized
for Monsanto and characterized for the presence of the desired DNA
coding sequence and amino acid sequence translation by Stratagene,
Inc., La Jolla, Calif. The non-naturally occurring gene was
assembled from three smaller sequences comprised of SEQ ID NO:16,
SEQ ID NO:17, and SEQ ID NO:18, wherein the fully assembled gene is
represented by SEQ ID NO:19, and is present in each of the plasmids
used for the corn callus transformation. The non-naturally
occurring gene coding sequence was established based on the method
described in Fishhoff et al. in U.S. Pat. No. 5,500,365 in which
monocot preferred codons were used in place of those preferred by
E. coli. The fully assembled gene encodes a full length PhnO
protein identical to the native protein sequence with the exception
of the P2A mutation introduced by PCR using SEQ ID NO:5 and SEQ ID
NO:6 to engineer appropriate restriction endonuclease recognition
sites into the flanking ends of the coding sequence. Plasmids which
were used in generating the corn callus data are shown in Table 15
along with differences with respect to genetic elements flanking
the AMPA acyltransferase encoding sequence.
TABLE-US-00015 TABLE 15 Corn Callus Transformation Plasmids and
Relevant Genetic Elements Plasmid Relevant Genetic Elements*
pMON32926 [Pe35S/I-Zm.cndot.Hsp70/CTP/phnO/T-At.cndot.Nos].fwdarw.
GOX .fwdarw. EPSPS pMON32931
[Pe35S/I-Zm.cndot.Hsp70/phnO/T-At.cndot.Nos] .fwdarw. GOX .fwdarw.
EPSPS pMON32932 [Pe35S/I-Zm.cndot.Hsp70/CTP/phnO/T-At.cndot.Nos]
.fwdarw. GOX .fwdarw. EPSPS pMON32936
[P-Os.cndot.Act1/I-Os.cndot.Act1/CTP/phnO/T-At.cndot.Nos].fwdarw- .
GOX .fwdarw. EPSPS pMON32938
[P-Os.cndot.Act1/I-Os.cndot.Act1/CTP/phnO/T-At.cndot.Nos] .fwdarw.
GOX .fwdarw. EPSPS pMON32946
[Pe35S/L-Ta.cndot.Cab/CTP/phnO/T-Ta.cndot.Hsp70] ].fwdarw. GOX
.fwdarw. EPSPS pMON32947
[Pe35S/L-Ta.cndot.Hsp70/CTP/phnO/T-Ta.cndot.Hsp70] .fwdarw. GOX
.fwdarw. EPSPS pMON32948 EPSPS.fwdarw.
[Pe35S/I-Zm.cndot.Hsp70/CTP/phnO/T-At.cndot.Nos] .fwdarw. GOX
pMON32950
EPSPS.fwdarw.[Pe35S/I-Zm.cndot.Hsp70/CTP/phnO/T-At.cndot.Nos].fw-
darw. GOX pMON32570 EPSPS
.fwdarw.[Pe35S/L-Ta.cndot.Cab/I-Os.cndot.Act1/CTP/phnO/T-Ta.cndot.Hsp70].-
fwdarw.GOX pMON32571 EPSPS
.fwdarw.[Pe35S/L-Ta.cndot.Cab/I-Os.cndot.Act1/CTP/phnO/T-Ta.cndot.Hsp70]
.fwdarw.GOX pMON32572 EPSPS
.fwdarw.[Pe35S/L-Zm.cndot.Hsp70/I-Os.cndot.Act1/CTP/phnO/T-Ta.cndot.Hsp70-
].fwdarw.GOX pMON32573 EPSPS
.fwdarw.[Pe35S/L-Ta.cndot.Cab/I-Os.cndot.Act1/CTP/phnO/T-Ta.cndot.Hsp70].-
fwdarw.GOX *Genetic elements contained within PhnO expression
cassettes as indicated in each plasmid. Elements are shown in the
order in which they appear in the plasmid, along with the presence
of other genes encoding herbicide resistance, if present, flanking
the PhnO expression cassette. .fwdarw. indicates the direction of
transcription of each gene or genes flanking the PhnO expression
cassette. Individual elements are described in the text.
Promoters which were used included the CaMV e35 S promoter and the
rice actin promoter (P-Os.Act1). Introns which were used included
those obtained from plant genes such as corn Hsp70 (I-Zm.Hsp70) and
rice actin (I-Os.Act1). Non-translated leader sequences which were
used included wheat chlorophyll a/b binding protein (L-Ta.Cab) and
corn Hsp70 (L-Zm.Hsp70). Termination and polyadenylation sequences
which were used included Agrobacterium tumefaciens NOS 3'
(T-At.Nos) and wheat Hsp70 (T-Ta.Hsp70). The same chloroplast
targeting sequence was used in all PhnO expression cassettes,
represented by SEQ ID NO: 9.
[0288] A [.sup.14C]-glyphosate metabolism assay was used for
determining whether transformed corn callus tissues contain
functioning forms of these enzymes. The assay was developed to
screen large numbers of corn callus samples. Callus was obtained
from Monsanto Company and Dekalb Seed Company corn transformation
groups. The Monsanto callus samples, individually designated as
callus lines "19nn-nn-nn" in Table 16, were produced from HI II X
B73 corn embryos. Callus samples were bombarded with complete
covalently closed circular recombinant plant transformation vector
plasmid DNA or with linear DNA fragments isolated from such
plasmids 25-50 days after embryo isolation. Transformed lines were
identified 8-14 weeks after bombardment. These lines were
sub-cultured on fresh media every 2 weeks and were 5-7 months old
when used in the metabolism assay. The Dekalb callus lines OO, OR,
OW, OX, and OY were obtained from HI II x AW embryos. All line
designations correspond to the recombinant plasmid or linear
fragment used for ballistic transformation of callus tissue as
noted in the legend to Table 16.
[0289] 4.5 mCi of N-phosphono-[.sup.14C]-methylglycine
([.sup.14C]-glyphosate) was obtained from the Monsanto
Radiosynthesis group in a 1.5 mM aqueous solution, having a
specific radioactivity of 39.4 mCi/mM (5.2.times.10.sup.5
dpm/microgram). The sample was identified with code number
C-2182.2. A stock solution sterilized by filtration through a
0.2-micron Acrodisk (Gelman no. 4192) was prepared by combining 2.5
mL [.sup.14C]-glyphosate (3.3.times.10.sup.8 dpm) with 2.5 mL of
corn callus growth medium (N6 medium) and 5.0 mg of Mon 0818
surfactant. [.sup.14C]-glyphosate in the resulting dose solution
was 0.75 mM. The N6 medium was described by Chu et al. (1975) and
was prepared using salts and vitamins obtained from Sigma Chemical
Company, St. Louis, Mo. Mon 0818 surfactant is ethoxylated
tallowamine, the surfactant used in Roundup herbicide. The dose
solution was subjected to HPLC analysis as described in Example 2.
The results are shown in a chromatogram illustrated in FIG. 1.
Three radioactive peaks were resolved, the largest of which
corresponded to glyphosate (11.3 min, 98.8%). Impurity peaks
corresponding to [.sup.14C]-AMPA (5.8 min, 0.16%) and an
unidentified material (10.2 min, 1.0%) were also present in the
dose solution. No peaks corresponding to N-acetyl-[.sup.14C]-AMPA
were present in the dose solution. Two additional dose solutions
were prepared using these reagents, each of which were scaled three
fold to 15 ml volumes based on the preparation method described
above.
[0290] N-acetyl-[.sup.14C]-AMPA was synthesized for use as a
retention time HPLC standard. 1 mL of pyridine and 2 mL of acetic
anhydride was added to a 20-mL screw cap culture tube and chilled
on ice. 0.1 mL of an aqueous solution of [.sup.14C]-AMPA
(6.2.times.10.sup.6 dpm, code C-2127.2) was added to the chilled
solution. The tube was then removed from the ice bath and warmed to
about 50-60.degree. C. A 10-.mu.L sample was removed after about 30
minutes and combined with 0.5 mL of water and analyzed according to
the HPLC method set forth above. [.sup.14C]-AMPA was not detected,
however two new radioactive peaks were identified; one peak at 13.9
minutes (68%) and the other at 15.4 minutes (32%). A sample of the
material eluting at 13.9 minutes was isolated and analyzed by
negative ion electrospray mass spectrometry. The result showed
strong ions at m/e 152 and 154, as expected for this compound,
which has a molecular weight of 153 Daltons; the m/z 154 ion was
due to the isotopic [.sup.14C]atom. The radioactive peak eluting at
15.4 minutes was not isolated. However, in a separate HPLC
experiment, it was shown to co-elute with synthetic
N-acetyl-N-methyl-AMPA. N-methyl-[.sup.14C]-AMPA has previously
been shown to be an impurity in the initial [.sup.14C]-AMPA
material.
[0291] Under aseptic conditions, corn callus samples were
transferred to individual wells of sterile 48-well COSTAR cell
culture clusters (cat. No. 3548). The individual callus samples
were not weighed. However, in several cases the total weight of the
callus samples in a 48-well plate was determined. Typically, the
average weight of individual callus samples was approximately
200-250 mg. In each assay, a nontransformed callus sample, HI II X
B73, was included as a control. 50 .mu.L of dose solution
containing 3.3.times.10.sup.6 dpm of [.sup.14C]-glyphosate was
added to each callus sample. 48-well plates were sealed with
parafilm and placed in a plastic bag containing a wet paper towel
to provide a moist atmosphere. Bags were closed and placed in a
dark drawer at 25.degree. C. for 10 days. Each callus sample was
subsequently transferred to a labeled microcentrifuge tube (VWR,
1.7-mL, cat. No. 20170-620). 1.0 mL of de-ionized water was added
to each tube, and the tubes were closed and placed in round 20-tube
floating microcentrifuge racks (Nalge cat. no. 5974-1015). These
microfuge tubes were floated in boiling water for 30 minutes,
shaken using a vortex mixer, and centrifuged for 5 minutes using a
Fisher brand microcentrifuge. 120-.mu.L supernatant samples were
removed for analysis by HPLC as described below. The samples were
injected using a Waters WISP autoinjector. Chromatographic profiles
were obtained for each sample analyzed, and quantitative
information was obtained by extrapolating the area under the
radioactive elution peaks to total [.sup.14C] in each sample. FIG.
2 shows an HPLC profile of a mixture of standards of the observed
radioactive metabolites [.sup.14C] AMPA, [.sup.14C] glyphosate, and
N-acetyl-[.sup.14C]-AMPA and the impurity identified as
N-acetyl-N-methyl-[.sup.14C]-AMPA.
[0292] HPLC analysis was typically completed using a SPHERISORB.TM.
S5 SAX 250 mm.times.10 mm column for most analyses. Some samples
were analyzed on an ALLTECH.TM. 5-micron, 250.times.10 mm SAX
column, which provided similar performance. Two solvents were
prepared. Solvent A consisted of 0.005 M KH.sub.2PO.sub.4, adjusted
to pH 2.0 with H.sub.3PO.sub.4 and contained 4% methanol. Solvent B
consisted of 0.10 M KH.sub.2PO.sub.4, adjusted to pH 2.0 with
H.sub.3PO.sub.4 and also contained 4% methanol. The eluent flow
rate was set at 3 mL/min, and the scintillation fluid flow rate was
set at 9 mL/min using ATOMFLOW.TM. scintillation fluid (No.
NEN-995, from Packard Instruments). All column solvent steps were
linear, with the injection and column solvent flow rates as
indicated in example 2. The column is prepared for an additional
injection at 20 minutes.
[0293] Callus samples from 359 transformed corn lines were combined
with 50-.mu.L aliquots of [.sup.14C]-glyphosate dose solution and
incubated for 10 days in the dark. Each post-incubation callus
sample, together with its clinging dose material, was transferred
to a 1.7-mL microcentrifuge tube along with 1 mL of water, and each
tube was placed in boiling water. This step causes cell lysis,
releasing soluble intracellular compounds including any isotope
labeled compounds such as glyphosate, AMPA, and N-acetyl-AMPA. It
was determined during method development that if the
post-incubation calli were rinsed thoroughly with water, 85-95% of
the radioactivity was rinsed off, and HPLC analysis showed that
virtually all of the radioactivity in the rinses was due to
[.sup.14C]-glyphosate and none was attributable to
[.sup.14C]-metabolites. In these experiments, the rinsed calli gave
extracts containing [.sup.14C]-metabolites in addition to
[.sup.14C]-glyphosate. This indicated that the radioactivity in the
rinses was due mainly, if not exclusively, to unabsorbed surface
[.sup.14C]-glyphosate. It is important to take this into account
when considering the rather low percentages of the dose converted
to metabolites, because the percentage calculation includes large
amounts of unabsorbed surface radioactivity. The method development
work also showed that simply boiling the incubated calli in water
released as much radioactivity as could be released by a
conventional grinding/extracting procedure. Experiments were
conducted to show that oiling did not alter the metabolite
profiles. The streamlined procedures made it possible to analyze
large numbers of samples (e.g., 96) at one time. Table 16 shows
representative data of the callus samples producing the highest
levels of N-acetyl-[.sup.14C]-AMPA or [.sup.14C]-AMPA obtained
after HPLC analysis. A representative chromatogram of a GOX plus
AMPA acyltransferase transformed, glyphosate treated, callus
extract sample is shown in FIG. 3.
TABLE-US-00016 TABLE 16 Transformed Corn Callus Lines Producing
Amounts of AMPA or N-Acetyl-AMPA Callus Producing
N-Acetyl-[.sup.14C]-AMPA Callus Producing [.sup.14C]-AMPA
Transformed Percent** Transformed Percent** Callus* with . . .
N-Acetyl-[.sup.14C]-AMPA Callus* with . . . [.sup.14C]-AMPA
1978-05-02 pMON32570 0.27 1980-28-03 pMON32571 2.89 1978-08-01
pMON32570 0.94 OR523 pMON32926 2.00 1978-20-02 pMON32570 0.57 OR534
pMON32926 5.00 1978-21-02 pMON32570 0.23 OR537 pMON32926 2.00
1978-22-01 pMON32570 0.90 OR539 pMON32926 5.08 1978-24-02 pMON32570
1.80 1971-08-01 pMON32932 2.64 1978-35-01 pMON32570 0.22 1971-27-03
pMON32932 3.63 1980-01-01 pMON32570 0.27 OO505 pMON32932 2.73
1980-03-01 pMON32571 0.22 OO509 pMON32932 2.86 1981-28-01 pMON32571
0.25 OO510 pMON32932 2.34 1981-02-01 pMON32572 0.65 OO512 pMON32932
2.31 1981-03-01 pMON32572 0.74 OO514 pMON32932 1.98 1981-18-01
pMON32572 0.22 OO535 pMON32932 2.88 1981-23-01 pMON32572 0.48 OO538
pMON32932 2.70 1981-24-02 pMON32572 0.29 OO539 pMON32932 1.97
1981-32-02 pMON32572 1.08 OO553 pMON32932 3.56 1977-05-03 pMON32573
0.39 OO576 pMON32932 3.49 OR516 pMON32926 1.91 OO579 pMON32932 2.85
1972-14-01 pMON32931 0.40 1986-17-01 pMON32936 2.29 1972-32-01
pMON32931 0.75 1986-18-03 pMON32936 3.05 1972-33-01 pMON32931 0.55
1986-18-04 pMON32936 2.15 OO544 pMON32932 0.28 1986-28-02 pMON32936
2.06 1986-06-01 pMON32936 0.30 1983-12-02 pMON32938 2.41 1986-08-01
pMON32936 1.13 1983-31-01 pMON32938 2.90 1986-08-03 pMON32936 0.70
1985-03-02 pMON32946 2.51 1986-12-01 pMON32936 0.33 1985-38-01
pMON32947 1.99 1986-18-02 pMON32936 0.40 OX512 pMON32948 2.43
1986-18-03 pMON32936 0.51 OX533 pMON32948 3.91 1986-18-04 pMON32936
1.09 OX556 pMON32948 12.11 1986-22-04 pMON32936 0.64 OY504
pMON32950 2.25 1983-11-01 pMON32938 0.21 OY511 pMON32950 2.53 OW534
pMON32946 0.77 OY528 pMON32950 2.58 OW542 pMON32946 0.85 OY532
pMON32950 2.24 1985-26-01 pMON32947 0.60 OY534 pMON32950 4.02
1985-26-03 pMON32947 0.71 OY535 pMON32950 2.34 1985-11-04 pMON32952
0.37 OY540 pMON32950 5.57 *All lines were transformed using
ballistic methods. Lines designated by 19xx-yy-zz were transformed
with isolated linear fragments of plasmids. Linear fragments were
isolated so as to be separate from plasmid backbone structure.
**percent radioactivity detected for N-Acetyl-[.sup.14C]-AMPA or
[.sup.14C]-AMPA peaks determined as a fraction of the total amount
of radioactivity in the sample, including residual
[.sup.14C]-glyphosate as described in the text.
19 of the 359 callus samples tested produced extracts containing
N-acetyl-[.sup.14C]-AMPA at a level distinctly higher than the
other callus samples. Callus OR516 was the strongest in this
respect and was analyzed five times during a period of two months,
providing values ranging from 0.50-4.54% (average 1.91%). The basis
for the relatively large spread in the percentage of
N-acetyl-[.sup.14C]-AMPA formed at various times is unknown. In
four of the five analyses of OR516, the percentage of
N-acetyl-[.sup.14C]-AMPA present was higher than that of
[.sup.14C]-AMPA, indicating an efficient conversion of
[.sup.14C]-AMPA to N-acetyl-[.sup.14C]-AMPA. The callus next most
efficient in producing N-acetyl-[.sup.14C]-AMPA was 1978-24-02,
which was the only other callus besides OR516 that contained more
N-acetyl-[.sup.14C]-AMPA than [.sup.14C]-AMPA in its extract. One
hundred of the 359 callus samples tested produced extracts
containing [.sup.14C]-AMPA at a level distinctly higher than other
callus samples. OX556 was a superlative producer of
[.sup.14C]-AMPA, yielding more than twice as much of the metabolite
as any other callus in the study. The control callus, HI II X B73,
which contained no inserted genes, produced no detectable levels of
N-acetyl-[.sup.14C]-AMPA and only background levels of
[.sup.14C]-AMPA. This result indicates that expression of an AMPA
acyltransferase in corn is effective in conversion of AMPA produced
as a result of GOX mediated glyphosate degradation to
N-acetyl-AMPA.
[0294] Wheat
[0295] GOX mediated glyphosate degradation has been shown to
produce AMPA, and AMPA has previously been shown to be the source
of phytotoxic effects. Therefor, effects of wheat plant exposure to
the compounds AMPA or N-acetyl-AMPA was determined as in example 2
in order to observe any wheat sensitivity or insensitivity to
either of these compounds. The observation of any phytotoxic
effects would indicate that GOX mediated glyphosate metabolism
would be detrimental to Triticum species.
[0296] Wheat immature embryos were exposed to different
concentrations of AMPA and N-acetyl-AMPA in a wheat embryo
germination assay. MMSO base media was prepared containing 40 grams
per liter maltose, 2 grams per liter GELRITE.TM., MS salts, and
vitamins. Salts, vitamins, and maltose were dissolved in 3500 ml
water and the pH was adjusted to 5.8. 500 ml was dispensed into a
separate bottle along with 1 gram of GELRITE.TM. and autoclaved for
17 minutes. After the medium had cooled to about 45.degree. C.,
AMPA or N-acetyl-AMPA was added to a defined concentration. The
mixture was poured into six square Sundae cups under sterile
conditions and allowed to solidify.
[0297] Immature wheat embryos were isolated from twenty day old
seedlings (after anther formation) and inoculated into each MMSO
media. Each Sundae cup contained nine immature embryo's. Three
separate plates were used for each concentration of AMPA (0, 0.1,
0.15, 0.2, 0.25, 0.3, and 1.0 mM) or N-acetyl-AMPA (0, 0.1, 0.3,
1.0, and 3.0 mM). Sundae cups were incubated for ten days and the
length of roots and shoots were determined and compared. The
results are shown in Table 17.
TABLE-US-00017 TABLE 17 Comparison of AMPA and N-acetyl AMPA on
Germinating Shoot and Root Length Phosphonate Compound Shoot (cm)
Root (cm) AMPA (mM) 0.00 12.6 .+-. 2.6 7.0 .+-. 1.9 0.10 11.7 .+-.
2.5 8.0 .+-. 2.0 0.15 11.3 .+-. 2.1 6.3 .+-. 1.7 0.20 9.2 .+-. 1.8
4.6 .+-. 2.1 0.25 8.5 .+-. 1.8 3.1 .+-. 1.6 0.30 6.6 .+-. 1.8 2.6
.+-. 1.6 1.00 0.9 .+-. 0.1 0.4 .+-. 0.1 N-Acetyl-AMPA 0.00 12.6
.+-. 2.6 7.0 .+-. 1.9 0.10 12.0 .+-. 2.4 5.9 .+-. 1.4 0.30 11.7
.+-. 3.5 5.2 .+-. 1.2 1.00 12.2 .+-. 3.2 5.4 .+-. 1.5 3.00 11.2
.+-. 2.6 5.9 .+-. 1.6
[0298] AMPA was not substantially inhibitory to growth and
elongation of immature embryo's at concentrations under 0.2 mM.
However, concentrations above 0.2 mM were severely inhibitory to
both shoot and root elongation, indicating that AMPA may also be
phytotoxic to wheat and, considering the nature of the monocot crop
species as a whole, phytotoxic to other monocotyledonous crops as
well as turf grasses. Germination of immature embryo's was
significantly affected when the AMPA level was higher than 0.20 mM.
1.00 mM AMPA eliminated the germination of immature embryo's in
wheat. In contrast, N-acetyl-AMPA was not inhibitory to shoots and
only mildly inhibitory to root elongation at any concentrations
tested in this experiment. The highest N-acetyl-AMPA concentration
tested was greater than ten times the minimal non-inhibitory
concentration determined for AMPA. There are no significant effects
to immature embryo germination when the N-acetyl-AMPA concentration
is less than 3.0 mM. This result indicates that N-acetylation of
AMPA in wheat would prevent AMPA phytotoxicity arising as a result
of GOX mediated glyphosate herbicide metabolism.
[0299] Recombinant glyphosate tolerant wheat plants were generated
according to the method of Zhou et al. (Plant Cell Reports
15:159-163, 1995). Briefly, spring wheat, Triticum aestivum cv
Bobwhite, was used as the target transformation line. Stock plants
were grown in an environmentally controlled growth chamber with a
16 hour photoperiod at 800 microJoule per square meter per second
provided by high-intensity discharge lights (Sylvania, GTE Products
Corp., Manchester, N.H.). The day/night temperatures were
18/16.degree. C. Immature caryopses were collected from the plants
14 days after anthesis. Immature embryos were dissected aseptically
and cultured on MMS2 medium, a Murashige and Skoog (Physiol. Plant
15:473-497, 1962) basal medium supplemented with 40 grams per liter
maltose and 2 milligrams per liter 2,4-D. In some experiments, CM4
medium was used. CM4 medium contains is MMS2 medium, but contains
only 0.5 milligrams per liter 2,4-D and includes 2.2 milligrams per
liter picloram. The immature embryos were cultured at 26.degree. C.
in the dark.
[0300] Immature embryos were transferred five days after culture
initiation to an osmotic treatment CM4 medium containing 0.35 M
mannitol four hours prior to bombardment according to the method of
Russell et al. (In Vitro Cell Devel. Biol., 28P:97-105, 1992).
Thirty to forty embryos were placed in the center of each plate and
bombarded in a DuPont PDS1000 apparatus. Plasmid DNA was adsorbed
onto 1 .mu.m tungsten particles according to the method of Sanford
et al. (Particle Sci. Technol., 5:27-37, 1987). Embryos were
bombarded twice at a distance of 13 mm from the stopping plate. A
100 .mu.m stainless steel screen was placed immediately below the
stopping plate.
[0301] After a 16 hour post bombardment treatment on the osmotic
medium, the embryos were transferred to MMS2 or CM4 medium.
Following a one week delay, the embryos were transferred to the
MMS2 or CM4 medium containing 2 mM glyphosate. After 9-12 weeks of
callus proliferation on the selection medium, calli were
transferred to a MMS0.2 regeneration medium containing 0.2 mg/l
2,4-D and 0.1 mM glyphosate. Shoots obtained from the regeneration
medium were transferred to MMS0 without 2,4-D but containing 0.02
mM glyphosate.
[0302] Glyphosate tolerant R.sub.0 plants as well as R1 progeny
were transferred to 15 centimeter diameter pots and grown in an
environmentally controlled chamber as described above. Two weeks
later, the plants were sprayed with 3 ml/liter ROUNDUP (41% active
ingredient, Monsanto Company) in a spray chamber, which was
designed to mimic a field dose application of 0.6 kilograms
glyphosate per hectare. Damage symptoms were observed and recorded
at different stages following the spraying.
[0303] Genomic DNA was isolated from leaf tissue of R.sub.0 and
R.sub.1 progeny following the method of Shure et al. (Cell
35:225-233, 1983). Fifteen micrograms of genomic DNA was digested
with BglII restriction endonuclease and fractionated on a 0.8%
agarose gel. The DNA was transferred to Hybond N membranes
(Amersham) according to the standard procedure described in
Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, 1989). The membranes were probed
independently for the presence of genes encoding EPSPS and GOX. A
3.4 kb DNA fragment containing the EPSPS gene and a 4.8 kb DNA
fragment containing the GOX gene were released from pMON19574 by
BglII restriction endonuclease digestion, isolated by 0.7% agarose
gel electrophoresis, and labeled with [.sup.32P] dCTP using a
Stratagene PRIME-IT II random primer labeling kit. Probes were
labeled to a specific activity of 3.times.10.sup.9 counts per
minute per microgram and 1.3.times.10.sup.9 counts per minute per
microgram, respectively. Membranes were hybridized for 14 hours at
42.degree. C. in a solution containing 50% formamide, 5.times.SSC,
5.times.Denhardt's, 0.5% SDS, and 100 microgram per milliliter
tRNA. The condition of the final wash was 0.1% SSC and 0.1% SDS at
60.degree. C. for fifteen minutes.
[0304] EPSPS and GOX protein assays were conducted using crude
protein extracts from leaf tissue of R.sub.0 plants and total
proteins were quantified following the method of Bradford (Anal.
Biochem. 72:248-256, 1976). The percentage of EPSPS and GOX protein
represented in the extracts was quantified using an ELISA method
and calculated as percent total extractable protein.
[0305] Immature embryos from the R.sub.0 transgenic and Bobwhite
control plants were isolated twenty days after anthesis and
cultured on the MMS0 medium with 0.02 mM glyphosate for a
germination test. Germinated and non-germinated embryos were
recorded ten days later and the data was analyzed by .chi..sup.2
test for 3:1 segregation. Tolerant plants from the germination test
were transferred to soil and sprayed with three milliliters per
liter of ROUNDUP as described above.
[0306] Five plasmids harboring glyphosate resistance genes were
used to transform immature wheat embryos as described above.
pMON19338 contains a nucleotide cassette encoding a petunia EPSPS
chloroplast transit peptide in frame with an Agrobacterium strain
CP4 EPSPS enzyme sequence. The nucleotide cassette is inserted
downstream of a cauliflower mosaic virus enhanced 35S promoter
linked 3' to a maize HPS70 intron sequence and upstream of a
nopaline synthase 3' transcription termination and polyadenylation
sequence. Convenient restriction sites are positioned between the
intron sequence and the 3' termination sequence for insertion of
genetic elements. pMON19643 is identical to pMON19338 except that a
GOX enzyme encoding sequence is used in place of the Agrobacterium
EPSPS enzyme encoding sequence. pMON19574 is identical to pMON19338
but additionally contains a chloroplast targeted
glyphosate-oxidoreductase expression cassette identical to that in
pMON19643 downstream of and immediately adjacent to the EPSPS
expression cassette. pMON32570 is similar to pMON19574 in that
expression cassettes encoding a chloroplast targeted EPSPS and
chloroplast targeted GOX are present, however, an expression
cassette encoding a chloroplast targeted AMPA acyltransferase
enzyme is also present between the EPSPS and GOX expression
cassettes. Other elements which are present in pMON19574 and not in
the other plasmids are also worthy of mention. For example, a wheat
major chlorophyll a/b binding protein gene 5' untranslated leader
is present between the enhanced 35S promoter and intron in both the
EPSPS and AMPA acyltransferase expression cassettes (McElroy et
al., Plant Cell 2:163-171, 1990). Also, a wheat hsp17 gene 3'
transcription termination and polyadenylation sequence is present
in place of the nopaline synthase 3' sequence for both EPSPS and
AMPA acyltransferase expression cassettes. All plasmids produced
recombinant glyphosate tolerant wheat plants using the ballistic
transformation method described above. However, plasmids which were
capable of expressing GOX only or GOX along with an AMPA
acyltransferase either did not produce recombinant glyphosate
tolerant wheat plants or produced plants which experienced problems
with stunted growth, aberrant segregation of phenotypes, and
infertility and were not analyzed further. The data obtained after
biolistic transformation using the described plasmids is shown in
Table 18.
TABLE-US-00018 TABLE 18 Wheat Biolistic Transformation Data
Glyphosate Tolerance # Transgenic Transformation Gene(s) # Explants
Events Efficiency.sup.1 GOX 120 0 0 GOX + PhnO 434 6 1.4 EPSPS 120
6 5.0 EPSPS + GOX 120 1 0.8 EPSPS + PhnO + GOX 10,068 314 3.1
.sup.1transformation efficiency based on percentage of transgenic
events identified from a total population of explants arising from
a combination of experiments in which a particular vector construct
has been bombarded into immature embryo's.
[0307] Transformed glyphosate tolerant plants arising out of these
transformations were self crossed and allowed to produce R1 seed,
which were used to generate R1 plants. Glyphosate tolerance
generally segregated in the expected ratio of 3:1 in R1 plants as
judged by R1 plant sensitivities after spraying with glyphosate at
the three leaf stage. Glyphosate tolerant R1 plants were self
crossed and allowed to produce R2 seed. R2 seed was germinated from
a number of different glyphosate tolerant lines to produce R2
glyphosate tolerant plants to which [.sup.14C]-glyphosate was
applied as described above. Plant leaf and stem tissues were
harvested at 48 hours after glyphosate application, and water
soluble compounds were extracted as described above and analyzed by
HPLC as in example 2 for the presence of [.sup.14C]-glyphosate
metabolites. The total area under the [.sup.14C] isotope labeled
peaks eluting from the column was summed to provide a baseline of
100% [.sup.14C]-compound identification for each sample analyzed.
The results are shown in Table 19.
TABLE-US-00019 TABLE 19 Glyphosate Metabolism In Wheat Plant
Extracts.sup.1 Sample & Glyphosate Plant [.sup.14C]-
[.sup.14C]- Acetyl- Tolerance Gene(s) Line No. Glyphosate AMPA
[.sup.14C]-AMPA [.sup.14C]-Other.sup.4 Standard.sup.2 na 30 26 31
13 na 29 24 29 18 na 35 29 36 0 Growth Medium.sup.3 na 60 32 0.2 8
na 48 25 2 25 na 87 7 0 6 EPSPS 24756 43 25 1 31 24756 53 46 0 1
25397 61 38 0 1 25397 37 19 1.2 43 25397 64 20 0 16 EPSPS + PhnO +
GOX 27249 6 7 85 2 27249 14 12 61 13 27249 5 24 33 38 25462 48 21 0
31 25462 44 5 0 51 25462 54 35 0 11 26281 48 14 17 21 26281 64 11
13 12 26281 38 7 7 48 28598 20 7 5 68 28598 25 7 5 63 Bobwhite na
74 26 0 0 na 17 15 0 32 na 34 24 0 42 .sup.1plant tissue extracts
were analyzed by HPLC after [.sup.14C]-glyphosate application as in
Example 1, and the area under the plots for each peak were summed
to provide a base of 100% [.sup.14C]-compound identification for
each sample. .sup.2standard solution containing approximately equal
[.sup.14C] molar ratios of each known glyphosate metabolism related
compound. .sup.3growth medium including [.sup.14C]-glyphosate;
glyphosate has previously been shown to be degraded by a photolytic
process to AMPA, which can be autoacylated in the presence of
certain acyl compounds (MSL-0598). .sup.4uncharacterized
[.sup.14C]-labeled compounds which are resolved using the disclosed
chromatographic method. Retention time of glyphosate is about 9.6
minutes, AMPA is about 5.4 minutes, N-acetyl-AMPA is about 12.5
minutes, and the major [.sup.14C]-labeled impurity in the
[.sup.14C]-glyphosate sample is about 4.7 minutes.
The standard solution contains approximately equal molar ratios of
each of the compounds glyphosate, AMPA and N-acetyl-AMPA, as well
as a number of impurities which are present as a result of the
chemical synthesis of these isotope labeled compounds. Growth
medium to which [.sup.14C]-glyphosate was added was treated to the
same conditions as wheat plants, ie, the medium was exposed to
incident light intensities which plants received. As expected,
photodegradation of glyphosate to AMPA was observed, and a small
percentage of AMPA appeared to be converted to acetyl-AMPA,
probably as a result of exposure in the growth medium to other
acylated compounds. Photodegradation of glyphosate by visible light
exposure to AMPA as the major degradation product has been observed
previously (Lund-Hoeie et al., Photodegradation of the herbicide
glyphosate in water. Bull. Environ. Contam. Toxicol. 36:723-729,
1986). Recombinant wheat plants transformed with an EPSPS-only
plasmid did not produce [.sup.14C]-AMPA or acetyl-[.sup.14C]-AMPA
from [.sup.14C]-glyphosate. [.sup.14C]-AMPA and trace amounts of
acetyl-[.sup.14C]-AMPA which were observed were within the limits
observed as a result of photodegradation in the growth medium
control. Non-recombinant Bobwhite control plants treated with
[.sup.14C]-glyphosate also did not produce AMPA or acetyl-AMPA.
Plants transformed with the triple gene construct plasmid
containing genes capable of expressing EPSPS, PhnO and GOX produced
variable results. About one third of these plants appeared to
efficiently convert glyphosate to acetyl-AMPA, indicating that the
GOX and PhnO enzymes were present and functional. Southern blot
analyses demonstrated that the transgenes were integrated into the
wheat genomes and transmitted to the following generations. Western
blot analysis using anti-EPSPS, anti-GOX, or anti-PhnO antiserum to
detect these proteins in the triple gene transformed plant extracts
provided further insight into the basis for the variable
[.sup.14C]-glyphosate metabolism observation. Western blot analysis
indicated that all of the lines were producing EPSPS, however only
line 27249 was producing GOX and PhnO protein. This result is
consistent with the data in Table 19, which shows that line 27249
efficiently metabolizes [.sup.14C]-glyphosate to
acetyl-[.sup.14C]-AMPA. This plant line also did not demonstrate
stunting, partial fertility, or altered segregation phenotypes
associated with other lines. These results indicate that
co-expression of GOX and AMPA acyltransferase in wheat plants
expressing recombinant EPSPS provides improved herbicide
tolerance.
Example 9
[0308] This example illustrates the transformation of tobacco
chloroplasts with a phnO gene.
[0309] Recombinant plants can be produced in which only the
mitochondrial or chloroplast DNA has been altered to incorporate
the molecules envisioned in this application. Promoters which
function in chloroplasts have been known in the art (Hanley-Bowden
et al., Trends in Biochemical Sciences 12:67-70, 1987). Methods and
compositions for obtaining cells containing chloroplasts into which
heterologous DNA has been inserted have been described, for example
by Daniell et al. (U.S. Pat. No. 5,693,507; 1997) and Maliga et al.
(U.S. Pat. No. 5,451,513; 1995). A vector can be constructed which
contains an expression cassette from which an acyltransferase
protein could be produced. A cassette could contain a chloroplast
operable promoter sequence driving expression of, for example, a
phnO gene, constructed in much the same manner as other
polynucleotides herein, using PCR methodologies, restriction
endonuclease digestion, and ligation etc. A chloroplast expressible
gene would provide a promoter and a 5' untranslated region from a
heterologous gene or chloroplast gene such as psbA, which would
provide for transcription and translation of a DNA sequence
encoding an acyltransferase protein in the chloroplast; a DNA
sequence encoding an acyltransferase protein; and a transcriptional
and translational termination region such as a 3' inverted repeat
region of a chloroplast gene that could stabilize an expressed mRNA
coding for an acyltransferase protein. Expression from within the
chloroplast would enhance gene product accumulation. A host cell
containing chloroplasts or plastids can be transformed with the
expression cassette and then the resulting cell containing the
transformed chloroplasts can be grown to express the
acyltransferase protein. A cassette may also include an antibiotic,
herbicide tolerance, or other selectable marker gene in addition to
the acyltransferase gene. The expression cassette may be flanked by
DNA sequences obtained from a chloroplast DNA which would
facilitate stable integration of the expression cassette into the
chloroplast genome, particularly by homologous recombination.
Alternatively, the expression cassette may not integrate, but by
including an origin of replication obtained from a chloroplast DNA,
would be capable of providing for replication of, for example, a
heterologous phnO or other acyltransferase gene within the
chloroplast.
[0310] Plants can be generated from cells containing transformed
chloroplasts and can then be grown to produce seeds, from which
additional plants can be generated. Such transformation methods are
advantageous over nuclear genome transformation, in particular
where chloroplast transformation is effected by integration into
the chloroplast genome, because chloroplast genes in general are
maternally inherited. This provides environmentally "safer"
transgenic plants, virtually eliminating the possibility of escapes
into the environment. Furthermore, chloroplasts can be transformed
multiple times to produce functional chloroplast genomes which
express multiple desired recombinant proteins, whereas nuclear
genomic transformation has been shown to be rather limited when
multiple genes are desired. Segregational events are thus avoided
using chloroplast or plastid transformation. Unlike plant nuclear
genome expression, expression in chloroplasts or plastids can be
initiated from only one promoter and continue through a
polycistronic region to produce multiple peptides from a single
mRNA.
[0311] The expression cassette would be produced in much the same
way that other plant transformation vectors are constructed. Plant
chloroplast operable DNA sequences can be inserted into a bacterial
plasmid and linked to DNA sequences expressing desired gene
products, such as PhnO proteins or other similar acyltransferases,
so that the acyltransferase protein is produced within the
chloroplast, obviating the requirement for nuclear gene regulation,
capping, splicing, or polyadenylation of nuclear regulated genes,
or chloroplast or plastid targeting sequences. An expression
cassette comprising a phnO or similar acyltransferase gene, which
is either synthetically constructed or a native gene derived
directly from an E. coli genome, would be inserted into a
restriction site in a vector constructed for the purpose of
chloroplast or plastid transformation. The cassette would be
flanked upstream by a chloroplast or plastid functional promoter
and downstream by a chloroplast or plastid functional transcription
and translation termination sequence. The resulting cassette could
be incorporated into the chloroplast or plastid genome using well
known homologous recombination methods. Alternatively, chloroplast
or plastid transformation could be obtained by using an
autonomously replicating plasmid or other vector capable of
propagation within the chloroplast or plastid. One means of
effectuating this method would be to utilize a portion of the
chloroplast or plastid genome required for chloroplast or plastid
replication initiation as a means for maintaining the plasmid or
vector in the transformed chloroplast or plastid. A sequence
enabling stable replication of a chloroplast or plastid epigenetic
element could easily be identified from random cloning of a
chloroplast or plastid genome into a standard bacterial vector
which also contains a chloroplast or plastid selectable marker
gene, followed by transformation of chloroplasts or plastids and
selection for transformed cells on an appropriate selection medium.
Introduction of an expression cassette as described herein into a
chloroplast or plastid replicable epigenetic element would provide
an effective means for localizing an acyltransferase gene and
protein to the chloroplast or plastid.
[0312] In view of the above, it will be seen that the several
advantages of the invention are achieved and other advantageous
results attained. As various changes could be made in the above
methods and compositions without departing from the spirit and
scope of the invention, it is intended that all matter contained in
the above description, and shown in the accompanying drawings and
sequences, shall be interpreted as illustrative and not in a
limiting sense.
REFERENCED LITERATURE
[0313] Avila et al., J. Am. Chem. Soc. 109:6758-6764, 1987. [0314]
Berlyn, Microbiol. Molec. Biol. Rev. 62:814-984, 1998. [0315] Chen
et al., J. Biol. Chem. 265:4461-4471, 1990. [0316] Dumora et al.,
Biochim. Biophys. Acta 997:193-198, 1989. [0317] Franz, Discovery,
development and chemistry of glyphosate, in The Herbicide
Glyphosate. Eds. E. Grossbard and D. Atkinson. Butterworths. pp.
3-17, 1985. [0318] Hanley-Bowden et al., Trends in Biochemical
Sciences 12:67-70, 1987. [0319] Hilderbrand et al., The role of
phosphonates in living systems; Hilderbrand, R. L., Ed, pp. 5-29,
CRC Press, Inc., Boca Raton, Fla., 1983. [0320] Jacob et al., Appl.
Environ. Microbiol. 54:2953-2958, 1988 [0321] Jiang et al., J.
Bacteriol. 177:6411-6421, 1995. [0322] Kishore et al., J. Biol.
Chem. 262:12,164-12, 168, 1987. [0323] Lacoste et al., J. Gen.
Microbiol. 138:1283-1287, 1992. [0324] Lee et al., J. Bacteriol.
174:2501-2510, 1992. [0325] Maier, Phosphorous Sulfur 14:295, 1983.
[0326] Makino et al., J. Bacteriol. 173:2665-2672, 1991. [0327]
McGrath et al., Eur. J. Biochem. 234:225-230, 1995. [0328] Metcalf
et al., J. Bacteriol. 173:587-600, 1991. [0329] Metcalf et al.,
Gene 129:27-32, 1993. [0330] Ohtaki et al., Actinomyceteol.
8:66-68, 1994. [0331] Pipke et al., Appl. Environ. Microbiol.
54:1293-1296, 1987. [0332] Shinabarger et al., J. Bacteriol.
168:702-707, 1986. [0333] Tanaka et al., J. Fac. Agr. Kyushu Univ.
30:209-223, 1986. [0334] Wackett et al., J. Bacteriol. 169:710-717,
1987a [0335] Wackett et al., J. Bacteriol. 169:1753-1756, 1987b.
[0336] Wanner et al., FEMS Microbiol. Lett. 100:133-140, 1992.
[0337] Wanner, Biodegradation 5:175-184, 1994. [0338] Wohlleben et
al., Mol. Gen. Genet. 217:202-208, 1989.
REFERENCED PATENT DOCUMENTS
[0338] [0339] Barry et al., U.S. Pat. No. 5,463,175, 1995. [0340]
Barry et al., U.S. Pat. No. 5,633,435, 1997 [0341] Comai, U.S. Pat.
No. 4,535,060, 1985. [0342] Daniell et al., U.S. Pat. No.
5,693,507; 1997. [0343] Maliga et al., U.S. Pat. No. 5,451,513;
1995. [0344] McBride et al., WO 95/2449
Sequence CWU 1
1
32115611DNAEscherichia coli 1ggatccagca tcgacgccag tttttccacc
attgtcagtc gcaggctaag cggcgcattt 60aacatgccgc cgttcgtcca tgtctgaagc
tgcacacgcg aaagaagttc ctgcatcagt 120cgttcacgaa actgctgctg
atgggcttgt ggaaggcggg catcatcgcc ctgcgccaga 180tccactaaaa
agcggggata aaccgactcc agcacgcgac cggggccgtc cagtaacgtc
240ttggtcaata tcgttctgcc gtgaaaagtg tttgaatatc atcgcgtaac
agctgggcgt 300cggtgtaaat ccagccgtga gtcatcacag tctgctgcaa
ttgctgctgc atcagcctga 360ccaccgattc attttgttga cgcagagcca
ggctttcgcg taaacgcgtc tgtaattccg 420tcaaacatga agcgaactca
gcgaaaaaag tattcatgcc tgccgtaaca gattcatcga 480cctgctctgc
cagaacttta gccatttgtt ggcaataaag atcgacttct gcgcttaatg
540ctcgttgcaa cacactgtaa tcaaccgttt ctgtcgggga tttctcattt
ccccgtcccc 600agtcgggctg attcaaccag cgcgaaaaag tctcacgcac
aacgcctaaa cgcgtgctct 660gctcgtccgt tgcatcctgg cgcgaaatga
ctgcactgaa cagctggcga gtgttgaagt 720ggggaactac gccgtgaaaa
acaggaaaat gaaacccagg acgaaaccct gactcgctca 780attccatttt
gacttgttgc tcaatggggc gaataacatc ggttaacact cggcaaaggg
840tggattccag ctcggcaaaa cgcagcgtaa agtcgcgact gatggtgttc
tgcgccgtct 900gtaacagtgt ctcacagcgg gtacgcatct cgcttaacgg
ctccgaatca tcctgaaaca 960aggcggctaa ctgcgcattc agcgcatctt
gttgttgacg cagaaagtgg ttggcggagg 1020tcagggccag ctcgatttca
tgtttaatct cgccgctcac ctgcgcctga ttgagttgca 1080atagctgcaa
actttcttcg acctgatgga tattttgccg caattgttca caagcgacgt
1140ttaacccgtg cgcacgaaaa tccaggtatt cccgcgcctg ctgcgcgtaa
ttcaacagtt 1200tatgcgcagc agatcgcaaa gcatacaacg aggcgttagc
gtaagcggca tgaagcaacg 1260cctgaattgg ctgggcgaac agcgaatctt
cccacaactg atcggcagca tgacgaatat 1320gttcgaggtc cgccagatcg
gcatgacgcc agcgcctgcc gagcgcggca tgggcaaaat 1380cttccaccca
gcgttgttgc tctggcgctg gtaacttacc gttgttggct aactcatggc
1440gcgcccgatt cgccaggtag ccccacatcg acgacaccgg aaatatctgc
tgtggcgtaa 1500tacagccttt catcagcgtc ccggaaatca gtgcccgcac
ctggtcggcg tcgtcactgt 1560tacgatcctg ttgatcgaac ttattgacca
gcacatacag cggcaccgat tgccccaccg 1620ccaaaatcgc ctcacggacc
tcttcatcgg agatcgattt cagttgcgta taatccagca 1680ccgccagtac
cgccgaggcg cgtgccagct gctggttaag cattttttgc agatgcggtt
1740gcccggcttc atttggcccg ggggtatcca gtaacgtcaa ctgaccggga
taactctcca 1800gccccgccag atggacaaac tccacttcaa tcacgggaat
atgctcaatg gcggcgtaag 1860cagaaaaagg aaaatcgacg tccagcgcct
tcgccagtcg cactaaatca ttcaaacttt 1920tcagacaatg aaaaataggc
tgggcaccca gataatattt ttcgaaagcg acgccatttt 1980cgatccgctg
cataagcgca cgcatatctt tatctatttc cagcacatcg gtcagatgct
2040taatatcgca atcacgcagg cgctgttgta attgttgaat taaacaatcg
attggcgcga 2100catgtgaaaa atgcagtacc ggttcctttt gcccgggcgt
atggcgaata agcgtcggca 2160gcgcagtcat tgggcgatta cgattaggca
gaacctccgt accaacaatg gcattaatgg 2220tggttgattt ccctgctttc
atggtaccga caattgcaag caccatttcc agtcgggaaa 2280ttttacgcaa
ctcattattc agcatcgcgt gacgttcggc gatattaggc tgactccagg
2340gtaaagccag ttgtggcgcg tcgtctccgg gtacagagag aggcattttt
tccagtaact 2400gcaactgttg gcgagaaagc tgtaacaggc gttcagcctc
ctgacttaac tcatacaggg 2460tctgtgtgta catagaaaat tcttccttaa
agcaaatttt gttattttat ttagccagat 2520tgtttttgag ttctgttttc
ggcttttata attactgcaa gaaataattt tatatttagt 2580gtgttgtttt
ttatcagaat aaataacgtc ttctgatacg tttaaaacgt cagaaagata
2640aaaatatcat gtgaattaaa aaaagaacaa gtagagcatt aacattatct
taaataataa 2700atagaggcaa aaagattatt ttctttttgc gtttcctttc
aaatgaaaac gatcgtcgtc 2760taaaatcagc agtacccccg acaaactcag
ggattttgtg tataattgcg gcctttttcg 2820gcaatctgcc gttttttggc
gcttttgccc tgctgacttt tgaggaaatc cacatgtcat 2880taccacactg
cccaaaatgc aactccgaat acacttacga agataacggc atgtacatct
2940gcccggaatg tgcctacgaa tggaacgacg cagaacctgc acaggaaagc
gacgagctga 3000tcgttaaaga tgctaacggc aatctgctgg ctgacggcga
cagcgttacc atcattaaag 3060atctgaaggt gaaaggtagc tcttcgatgc
tgaaaattgg caccaaagtg aaaaacatcc 3120gcctggttga aggcgaccat
aacatcgatt gcaaaatcga cggttttggt ccgatgaaac 3180tgaaatctga
gtttgtgaaa aagaactgat tgtattgtga tcggtaagcc ggataaggcg
3240ctcgcgccgc atccggcaac ggtgccagat gcctgatgcg acgcttgcgc
gtcttatcag 3300gcctacaaat tcccgcaccc tccgtaggcc ggataaggcg
tttacgccgc atccggcaac 3360ggtgccgact gcctgatgcg acgcttgcgc
gtcttatcag gcctacaaat tcccgcaccc 3420tccgtaggcc ggataaggcg
tttacgccgc atccggcaac agtgccaact gcctgatgcg 3480acgcttgcgc
gtcttatcag gcctacaaat tcccgcaccc tccgtaggcc ggataaggcg
3540tttacgccgc atccggcaat ggtgccgact gcctgatgcg acgcttgcgc
gtcttatcag 3600gcctacaaat tcccgcaccc tccgtaggcc ggataaggcg
tttacgccgc atccggcaac 3660agtgccgact gcctgatgcg acgctcgcgc
gtcttatcag gccgcctctc atctgtataa 3720atttcgaact acacttaact
ggcttctctt aactgaggtc accatcatgc cgttaagtcc 3780ctacctctct
tttgccggta actgttccga cgcgattgcc tattatcaac gtacgttggg
3840cgcggaactg ctctataaaa tcagcttcgg cgaaatgcca aaatcagcgc
aggacagcgc 3900cgagaactgc ccttccggaa tgcaatttcc cgataccgcc
atcgctcatg ccaacgtgcg 3960cattgccgga agcgacatca tgatgagcga
tgccatgccg tcaggaaaag ccagctactc 4020cggctttacg ctggtgctcg
attcgcaaca ggtcgaagaa ggaaaacgct ggtttgacaa 4080tcttgccgct
aacggaaaaa tcgaaatggc ctggcaggaa actttctggg cgcatggctt
4140tggcaaagtc accgataaat ttggcgtacc gtggatgatt aatgtcgtca
aacaacaacc 4200aacgcaataa cccgccggga ggcccgccct cccgcactgt
catcgaattc ccgttaactc 4260ttcatctgtt agtcactttt aattaaccaa
atcgtcacaa taatccgcca cgatggagcc 4320acttttttag ggaggctgca
tcatgcaaac gattatccgt gtcgagaagc tcgccaaaac 4380cttcaatcag
catcaggcgc tgcatgcggt tgatctgaac attcatcacg gtgaaatggt
4440ggctctgctt gggccgtcgg gttccggcaa atccaccctt ttacgtcact
taagcggttt 4500gattaccggc gataaatccg ccggcagcca tatcgagctg
ctgggccgca cagtccagcg 4560cgaaggccgt ctggcgcgcg atatccgcaa
aagccgcgcc aacaccggct acatcttcca 4620acaattcaac ctggtgaacc
gcctgagcgt actggagaac gtgctgattg gcgcgctcgg 4680cagcacgccg
ttctggcgca cctgttttag ctggtttacc cgcgagcaga aacaacgcgc
4740gttacaggcg ctgacccgcg ttggcatggt gcattttgcc catcaacgcg
tttccaccct 4800ctccggcgga cagcagcagc gtgtggcgat tgcccgcgcg
ctgatgcagc aggcgaaggt 4860gattctggcc gatgaaccca tcgcctcgct
ggacccggaa tccgcccgca tcgtgatgga 4920caccctgcgc gacatcaatc
agaacgacgg catcaccgtg gtcgtcacgc tgcatcaggt 4980ggattacgcc
ctgcgctact gcgaacgcat cgtcgccctg cgccaggggc acgttttcta
5040cgacggcagc agccaacagt ttgataacga acgttttgac catctctacc
gcagcattaa 5100tcgcatcgaa gagaacgcga aagctgcctg acatccccat
cattgaggaa aacgaatgaa 5160cgctaagata attgcctcgc tggccttcac
cagcatgttc agcctcagca ccctgttaag 5220cccggcacac gccgaagagc
aggaaaaggc gctgaatttc ggcattattt caacggaatc 5280acagcaaaac
ctgaaaccgc aatggacgcc attcttacag gatatggaga agaagctggg
5340cgtgaaggtg aacgccttct ttgccccaga ctacgcaggc attatccagg
gaatgcgctt 5400caataaagtg gatatcgcct ggtacggcaa cctgtcggca
atggaagcgg tggatcgcgc 5460caacggccag gtcttcgccc agacggtcgc
ggcggatgga tcgccaggtt actggagcgt 5520gttgatcgtc aacaaagata
gtccgatcaa caacctgaac gatctgctgg cgaagcggaa 5580agatctcacc
ttcggcaatg gcgatcctaa ctccacctct ggcttcctcg tccccggtta
5640ctacgtcttc gccaaaaaca atatctccgc cagcgacttc aagcgcaccg
tcaacgccgg 5700gcatgaaacc aacgcgctgg ccgtcgccaa caagcaggtg
gatgtggcga ccaacaacac 5760cgaaaacctc gacaagctga aaacctccgc
gccggagaag ctgaaagaac tgaaagtgat 5820ctggaaatcg ccgctgatcc
caggcgatcc gatcgtctgg cgtaaaaatc tttccgaaac 5880caccaaagac
aagatctacg acttctttat gaattacggc aaaacgccgg aagagaaagc
5940ggtgctggaa cgcctgggct gggcgccgtt ccgcgcctcc agcgacctgc
aactggtgcc 6000gattcgccag ctcgcactgt ttaaagagat gcagggcgtg
aaaagcaata aaggactgaa 6060tgagcaggac aagctggcaa aaaccaccgc
gattcaggcg caactggatg acctggaccg 6120cctgaacaac gcgctaagcg
cgatgagttc ggtgagtaaa gcggtgcagt aaatcgtagg 6180tcggataaga
cgccccggcg tcgcatccga caatgtgcag gcgttgatgc cggatgcggt
6240gcaagcacct tatccggcct acagaccgga gccaaacatg caaaccatca
ccatcgcccc 6300acccaagcgc agctggttct cgcttctgag ctgggccgtt
gttctcgccg tgctggtcgt 6360ctcgtggcag ggcgcggaaa tggccccgct
cacgctgatt aaagacggcg gcaacatggc 6420aaccttcgct gccgacttct
tcccgcccga tttcagccag tggcaggatt acctcaccga 6480aatggccgtc
acgctgcaaa tcgccgtctg gggcaccgcg ctggcggtgg ttctctccat
6540cccctttggc ctgatgagcg ccgaaaacct ggtgccgtgg tgggtttacc
agcccgttcg 6600ccgcctgatg gacgcctgcc gcgccattaa cgaaatggtc
ttcgccatgc tgttcgtggt 6660cgccgtcggt ctcggaccgt tcgctggcgt
gctggcgcta tttatccaca ccaccggcgt 6720gctctccaag ctgctttccg
aagcggtaga agcaattgaa cctggcccgg tggaaggcat 6780tcgcgccacc
ggtgccaaca agctcgaaga gatcctctac ggcgtgctgc cgcaggtgat
6840gccgctgctg atctcctact ccctctatcg cttcgaatcc aacgtccgct
cggcgaccgt 6900cgtcggcatg gtcggcgcgg gcgggatcgg cgtcaccctg
tgggaagcga ttcgcggttt 6960ccagttccaa caaacctgcg ccctgatggt
gcttatcatc gtcacggtca gcctgctgga 7020tttcctctct caacggttgc
gtaagcactt tatctgataa gcgaggcatt gatatctatg 7080cacttgtcta
cacatccgac cagctaccca acacgctatc aagagatagc cgcaaaactt
7140gagcaggagc ttcgtcaaca ctaccgctgc ggcgactatc ttcccgccga
gcagcaactg 7200gcagcgcgct ttgaggtgaa tcgccacacc ctgcgccgcg
ccatcgacca actggtggaa 7260aaaggctggg tacagcgccg tcagggcgtc
ggcgtgctgg tgctgatgcg cccgttcgat 7320tacccgctca acgcccaggc
gcgttttagc cagaatctgc tggatcaggg cagccatccc 7380accagcgaaa
aactgctttc ggtattgcgc cccgcgtccg gccacgtcgc tgacgcactg
7440gggattaccg agggggagaa cgtcatccac ctgcgcaccc tgcgtcgggt
caacggcgtc 7500gcgctctgtt taatcgacca ctacttcgcg gacctcaccc
tctggccgac gctgcaacgc 7560ttcgacagcg gctcgctgca cgattttctg
cgcgagcaaa ccggaattgc gctgcgccgc 7620agccagacgc ggatcagcgc
ccgccgcgcc caggccaaag agtgccagcg tcttgaaatc 7680ccgaatatgt
cgccgctgct gtgcgtgcgc acccttaacc accgtgacgg tgaaagcagc
7740ccggcggagt actccgtcag cctgacgcgc gccgacatga ttgaattcac
tatggagcac 7800tgaatgcacg cagataccgc gacccgccag cactggatgt
ccgtgctggc gcacagccaa 7860ccggctgaac tggcagcacg cctgaacgcg
ctaaacatca ccgccgacta tgaggtgatc 7920cgcgccgctg aaactggcct
ggtacagatt caggcgcgga tgggcggcac cggcgaacgt 7980ttttttgccg
gcgacgccac gctgacccgc gccgccgtgc gcctgactga cggcacgctc
8040ggctacagct gggtgctggg gcgtgataaa cagcacgccg aacgctgcgc
gctgattgac 8100gcgctgatgc agcaatctcg ccactttcaa aacttatcag
aaacccttat tgccccgctg 8160gacgctgacc gtatggcacg cattgccgca
cgccaggccg aagtgaacgc cagccgggtc 8220gacttcttta cgatggttcg
cggagacaac gcatgaccct ggaaaccgct tttatgcttc 8280ccgtgcagga
tgcccagcac agttttcgtc gcctgttaaa ggccatgagc gagccgggcg
8340tgattgtcgc cctgcatcag ctcaaacgcg gctggcaacc gctgaatatc
gccaccacca 8400gcgtgctgct gacgctggcc gataacgaca cgccggtgtg
gctttctacc ccattaaata 8460acgatatcgt caaccagagc ctgcgttttc
ataccaacgc gccgctggtc agccagccgg 8520aacaggcgac cttcgcggtg
acggatgagg cgatttccag cgaacagctc aacgcccttt 8580ccaccggcac
cgccgttgcg ccggaagcgg gcgcgacgct gattttacag gtcgccagcc
8640tgagcggcgg gcgcatgttg cgtctcaccg gcgcgggtat tgccgaagaa
cgaatgatcg 8700ctccgcagct gccggagtgc attctgcacg aactcaccga
gcgcccgcac ccgttcccgc 8760tcggcatcga cctgatcctg acctgcggcg
aacgcctgct ggctattccg cgaaccacgc 8820atgtggaggt gtgctgatgt
acgttgccgt aaaagggggc gaaaaggcga tcgacgccgc 8880ccacgccctg
caagagagcc gacgccgggg cgataccgat ttgcctgaac tgagcgtcgc
8940ccagattgaa cagcagctta acctcgcggt agatcgcgtg atgaccgaag
gcggcattgc 9000cgaccgcgaa ctggcggcgc tggcgctgaa acaggccagc
ggcgataacg ttgaagcgat 9060tttcctgctg cgcgcctacc gcaccacgtt
ggcgaagctg gcggtaagcg agccgctcga 9120caccaccggg atgcgtctcg
aacgccgtat ctccgccgtt tataaagaca ttcccggcgg 9180ccagctgctt
ggcccaacct acgactacac ccatcgcctg ctcgatttta ccctgctggc
9240aaacggcgaa gcgccgacgc tgaccaccgc cgacagcgaa caacagccgt
cgccgcacgt 9300tttcagcctg ctggcgcgtc aggggctggc gaagtttgaa
gaggatagcg gcgcacagcc 9360ggatgacatc acccgcacgc cgccggttta
cccctgctca cgttcttccc gtttgcagca 9420gttgatgcgc ggcgacgaag
gctatttgct ggcgctggcc tactccaccc agcgtggtta 9480cggacgcaat
cacccgttcg cgggcgagat ccgcagtggt tacatcgacg tgtcgattgt
9540gccggaagag ctgggatttg cggtaaacgt cggcgaacta ctgatgaccg
agtgtgaaat 9600ggtcaacggt tttatcgacc cgccggatga gccgccgcac
ttcacgcgcg gctacgggct 9660ggtattcggc atgagcgagc gcaaagcgat
ggcaatggcg ctggtcgatc gtgcgttgca 9720ggctccggaa tacggcgagc
acgcgacagg cccggcgcag gatgaagagt ttgtgctggc 9780acatgccgac
aacgtcgaag ccgcaggctt tgtctcgcac ctcaaactcc cccactacgt
9840cgatttccag gccgaactgg agctactcaa acgtctgcaa caggagaaga
accatggcta 9900atctgagcgg ctacaacttt gcctacctcg acgagcagac
caaacgcatg atccgccgcg 9960ccatcttaaa agcggtggcg atccccggtt
atcaggtgcc gtttggcggg cgcgagatgc 10020cgatgccata cggctgggga
accggcggca tacagctcac cgccagcgtg attggcgaaa 10080gcgacgtgct
aaaggtgatt gaccagggtg cggatgacac caccaacgcc gtgtcgattc
10140gcaacttctt taagcgcgtg accggggtaa acaccactga acgtacggac
gatgcgacgc 10200ttatccagac gcgtcaccgc atccccgaaa cgccgctgac
cgaagatcag atcattatct 10260tccaggtgcc aatcccggaa ccgctgcgct
ttatcgagcc gcgcgaaacg gaaacccgca 10320ccatgcacgc gctggaagag
tacggcgtga tgcaggtgaa actgtatgaa gatatcgccc 10380gcttcggtca
tatcgccact acctacgcct atccggtgaa ggtgaacggg cgctacgtaa
10440tggacccgtc gccgatcccg aaattcgata acccaaaaat ggacatgatg
cccgccctgc 10500aactgttcgg cgcggggcgc gagaagcgca tctatgcggt
gccgccgttt acccgcgtgg 10560aaagtctcga tttcgacgat cacccgttca
ccgttcagca gtgggatgag ccatgcgcca 10620tctgcggatc gacccacagc
tatcttgatg aagtggtgct ggatgacgcc ggaaaccgca 10680tgtttgtctg
ctccgatacc gattattgcc gccaacagag cgaggcaaaa aaccaatgaa
10740tcaaccgtta ctttcggtca ataacctgac ccacctttac gcgccgggca
aaggctttag 10800cgatgtctct tttgatttat ggccggggga agtgctgggc
attgtcgggg aatccggctc 10860cgggaagacc acgctgctga agtcgatctc
cgcgcgcctg acgccgcagc agggggaaat 10920tcactacgag aaccgttcgc
tgtatgcaat gagcgaggcc gaccgccgtc gcctgctgcg 10980taccgaatgg
ggcgtggtgc atcagcatcc actcgacggc ctgcgccgcc aggtgtcggc
11040aggcggcaat atcggcgagc ggctgatggc gaccggggca cgtcattacg
gcgatattcg 11100tgccaccgcg cagaagtggc tggaagaggt ggagattccc
gccaaccgga tcgacgacct 11160gccgaccacc ttttccggcg gtatgcagca
gcgtttgcag attgcccgca acctggtgac 11220gcatccgaag ctggtgttta
tggatgaacc gaccggcggg ctggatgtgt cggtgcaggc 11280ccgcctgctc
gacctgctgc gcggcctggt ggtggagctg aacctcgcgg tggtgattgt
11340cacccatgat ttaggcgtcg cccgcctgct ggcggaccgt ttgctggtga
tgaagcaggg 11400gcaagtggtg gagagtgggt taaccgaccg cgtgctcgac
gacccgcatc atccgtatac 11460acagctgctg gtgtcatcgg ttttgcagaa
ttgagccggt gccggatgcg gcgtaaacgc 11520cttatccggc ctacaaatgc
gctccccgta ggtcggataa gacgcgtcag cgtcgcatcc 11580gacacccgaa
ccacgaggcg aaaaatgatt aacgtacaaa acgtcagtaa aaccttcatc
11640ctgcaccagc aaaacggcgt gcgcctgccc gtcctcaatc gcgcctcgct
caccgtcaac 11700gcgggcgaat gcgtggtgct ccacggccat tccggcagcg
gcaaatcaac tctgctacgc 11760tcgctgtacg ccaactatct acccgacgaa
ggtcaaatcc agatcaaaca cggtgacgag 11820tgggtagacc tggtcaccgc
gccagcgcgc aaagtggtgg aaatccgcaa aaccaccgtc 11880ggctgggtga
gccagtttct gcgcgtcatc ccgcgtatct cagcactgga agtggtgatg
11940cagccgctgc tcgataccgg cgttccgcgt gaagcctgcg ccgctaaagc
cgcgcgtctt 12000ctcacccgcc tgaacgtgcc ggaacgcctg tggcacctgg
caccatcgac attttccggt 12060ggcgaacagc agcgcgtcaa catcgcccgc
ggctttatcg tcgactaccc cattctgctg 12120cttgacgaac ctaccgcctc
gctggacgcc aaaaacagcg ccgcggtggt ggaactgatt 12180cgcgaagcca
aaacccgtgg cgcagccatc gtaggcatct tccatgacga agctgtacgt
12240aatgacgtcg ccgaccgcct gcacccaatg ggagcctctt catgattatc
aataacgtta 12300agctggtgct ggaaaacgag gtggtaagcg gttcgctgga
ggtgcagaac ggcgaaatcc 12360gcgcctttgc cgaaagccag agccgcctgc
cggaggcgat ggacggcgaa ggcggctggc 12420tgctgccggg gctgattgag
ctgcataccg ataatctgga taaattcttc accccgcgcc 12480cgaaagttga
ctggcctgcc cactcggcga tgagcagcca cgacgcgctg atggtggcga
12540gcggcatcac caccgtactg gatgccgtgg caattggcga cgtgcgcgac
ggcggcgatc 12600ggctggagaa tctggagaag atgatcaacg ccatcgaaga
gacgcagaaa cgcggcgtca 12660accgcgccga gcaccgtctg catctgcgct
gcgaactgcc gcatcacacc acgctgccgc 12720tgtttgaaaa actggtgcag
cgcgagccgg tgacgctggt gtcgctgatg gaccactcgc 12780cgggccagcg
ccagttcgcc aaccgcgaga agtatcgcga atattatcag ggcaaatact
12840ccctcactga tgcgcagatg cagcagtacg aagaagagca actggcgctc
gccgcacgct 12900ggtcgcagcc gaatcgcgaa tccatcgccg ccctgtgccg
cgcgcgaaaa attgcgcttg 12960ccagccacga tgacgccacc cacgcccacg
ttgctgaatc tcaccagctt ggcagcgtga 13020tcgccgaatt tcccaccacg
ttcgaagcgg cggaagcctc gcgcaagcat ggcatgaacg 13080tgctgatggg
cgcgccgaat attgtgcgcg gcggctcgca ctccggcaac gtggcggcca
13140gtgaactggc gcagcttggc ctgctggata tcctctcttc cgactactac
cccgccagcc 13200tgctcgatgc ggcatttcgc gtcgccgatg acgagagcaa
ccgctttacg ctgccgcagg 13260cggtgaagct ggtgactaaa aatccagcgc
aggcgcttaa tctccaggat cgcggggtga 13320ttggcgaggg caaacgcgcc
gacctggtgc tggcgcatcg caaggacaat catattcata 13380tcgaccacgt
ctggcgtcag ggtaaaaggg tgttctgatg atgggaaaac tgatttggtt
13440aatggggccg tccggctccg ggaaagacag cctgctggcg gaactccgcc
tgcgggaaca 13500aactcagtta ctggtggcgc atcgctacat cacgcgcgat
gccagcgccg gaagtgaaaa 13560ccatatcgcc ctgagcgagc aggagttttt
tacccgcgcg gggcaaaatc tgttggcctt 13620aagctggcac gctaacggtc
tgtattatgg cgtcggcgtc gagattgatc tctggctgca 13680cgccggattc
gacgtgctgg tcaacggctc acgcgcccat ctgccgcagg cgcgggcgcg
13740ctatcaatcg gcgctgctgc ccgtctgttt acaggtttcg ccggagatcc
tccgccagcg 13800cctggaaaac cgtggccgtg aaaacgccag tgaaattaac
gcccgcctgg cgcgcgccgc 13860ccgctatact ccacaggatt gccatacgct
caacaatgac ggcagcctgc gccagtcggt 13920cgacacgctg ctgacgctga
tccatcagaa ggagaaacac catgcctgct tgtgagcttc 13980gcccggccac
gcagtacgac accgacgcgg tttacgcgct gatttgtgag ctaaaacagg
14040cggagtttga ccaccacgcg tttcgcgtgg gttttaacgc caatctgcgc
gacccaaaca 14100tgcgctacca tctggcgctg cttgatggcg aagttgtcgg
catgatcggc ctgcatttgc 14160agtttcatct gcatcatgtc aactggatcg
gcgaaattca ggagttggtg gtaatgccgc 14220aggcgcgcgg tctgaacgtc
ggcagtaagt tactggcgtg ggcagaagaa gaagcccgcc 14280aggccggggc
cgaaatgacc gaactttcga ccaacgtgaa gcgccacgac gcgcaccgtt
14340tctatctgcg cgaaggctac gagcagagcc acttccgctt caccaaggcg
ctgtaacatg 14400agcctgaccc tcacgctcac cggcaccggc ggcgcacagg
gcgttccggc atggggctgc 14460gagtgtgcgg cctgcgccag agcgcggcgc
tcgccgcagt atcgccgcca accgtgcagc 14520ggcgtagtga agtttaacga
cgcaatcacc ctgatcgacg ccgggctgca cgatctcgcc 14580gatcgctggt
cgcccggatc gttccagcag tttttgctga cgcattatca tatggatcac
14640gtccaggggc tgtttccgct gcgctggggc gttggcgatc cgatcccggt
ttacggcccg 14700ccggatgaac agggctgcga cgatctgttt aaacatccgg
gcctgcttga tttcagccac 14760acggtggaac cgtttgtggt gtttgatttg
caggggttac aggtcacgcc cctgccgctc 14820aaccactcaa aactgacctt
cggttatctg ctggaaacgg cacacagccg ggtggcgtgg 14880ctgtctgaca
ccgcaggctt gccggaaaaa acgctgaaat ttttacgcaa taatcagccg
14940caggtaatgg tgatggattg cagtcacccg ccgcgcgcgg atgcaccgcg
taatcactgt 15000gatttaaata ccgtgcttgc gctgaatcag gttatccgct
cgccacgggt gattctgacc 15060catatcagcc accagtttga tgcgtggctg
atggaaaacg cactaccgtc agggtttgag 15120gtggggtttg atgggatgga
gattggggtg gcgtgatgag agggaatgtg cgcgctggcc 15180ccctcaccct
aaccctctcc ccagaggggc gaggggaccg attgtgctcg atattgaata
15240ttgcgctcgt tttctccctc tccccattgg ggtgaggggc gatgcctgct
ccatacccaa 15300cctcatcgcc catactcatc ttccattctc cgctcttcat
cctccagttg ccgacgctcc 15360tgatcaagct ggcgctggcg atcgtccagc
tgcctgcggc gatcttcaaa ctggcggcgg 15420cggtcgtcat attgtctgcg
ccgatcgtcg ctcacttcac gctgccagcc gtggtcgcgc 15480gaatcttcat
agttgaagcg gcgcacgaaa aacgcgaaag cgtttcacga taaatgcgaa
15540aactttagct ttcgcgcttc aaatgaaaca gatgtattaa ttactgcttt
ttattcatta 15600catggggatc c 15611211672DNAEscherichia coli
2gaattcccgt taactcttca tctgttagtc acttttaatt aaccaaatcg tcacaataat
60ccgccacgat ggagccactt ttttagggag gctgcatcat gcaaacgatt atccgtgtcg
120agaagctcgc caaaaccttc aatcagcatc aggcgctgca tgcggttgat
ctgaacattc 180atcacggtga aatggtggct ctgcttgggc cgtcgggttc
cggaaaatcc acccttttac 240gtcacttaag cggtttgatt accggcgata
aatctgtcgg tagccatatc gagctgctgg 300gccgcacagt ccagcgcgaa
ggccgcctgg cccgcgatat ccgcaaaagc cgcgcccata 360ccggctacat
attccaacaa ttcaacctgg tgaaccgcct gagcgtactg gagaacgtgc
420tgattggcgc gctcggcagc acgccgttct ggcgcacctg ttttagctgg
ttcaccggcg 480agcagaaaca gcgcgcgtta caggcgctga cccgcgttgg
catggtgcat tttgcccatc 540agcgcgtttc caccctctcc ggcggccagc
agcaacgtgt ggcgattgcc cgtgcgctga 600tgcagcaggc gaaagtgatt
ctggccgatg aacccatcgc ctcgctggac ccagaatcag 660cgcgcatcgt
gatggacacc ctgcgcgaca tcaaccagaa cgacggcatc accgtggtcg
720tcacgctgca tcaggtggat tacgccctgc gctactgcga acgcatcgtc
gccctgcgcc 780aggggcacgt cttctacgac ggcagcagcc aacagtttga
taacgaacgt tttgaccatc 840tctaccgcag cattaaccgc gtcgaagaga
acgcgaaagc tgcctgacat ccccatcatt 900gaggaaaacg aatgaacgct
aagataattg cctcgctggc cttcaccagc atgttcagcc 960tcagcaccct
gttaagcccg gcgcacgccg aagagcagga aaaggcgttg aatttcggca
1020ttatttcaac ggaatcacag caaaacctga aaccgcaatg gacgccgttc
ttgcaggata 1080tggagaagaa gctgggcgtg aaggtcaacg ccttctttgc
cccggactac gcgggcatta 1140tccaggggat gcgcttcaat aaagtggata
tcgcctggta cggcaatctg tcggcgatgg 1200aagcggtgga tcgcgccaat
ggccaggtct tcgcccagac ggtcgcggcg gatggatcgc 1260cgggttactg
gagcgtgttg atcgtcaaca aagacagtcc gatcaacaac ctgaacgatc
1320tgctggcgaa gcggaaagat ctcacctttg gcaatggcga tcctaactcc
acctctggct 1380tcctcgtccc cggctactac gtcttcgcca aaaacaatat
ctccgccagc gacttcaagc 1440gcaccgtcaa cgccgggcat gaaaccaacg
cgctggccgt cgccaacaag caggtggatg 1500ttgccaccaa caacaccgaa
aacctcgaca agctgaaaac ctccgcgcca gagaagctga 1560aagaactgaa
ggtgatctgg aagtcgccgc tgatcccagg cgatccgatc gtctggcgca
1620agaatctttc cgaaaccacc aaagacaaga tctacgactt ctttatgaac
tacggcaaaa 1680cgccggaaga aaaagcggtg ctggaacgcc tgggctgggc
gccattccgc gcttccagcg 1740acctgcaact ggtgccgatt cgccagctcg
cgctgtttaa agagatgcag ggcgtgaaaa 1800gcaataaagg actgaatgag
caggacaagc tggcaaaaac caccgagatt caggcgcagc 1860tggatgacct
ggaccgcctg aacaacgcgc taagcgcgat gagttcggtg agtaaagcgg
1920tgcagtaaat cgtaggtcgg ataagacgcc ccggcgtcgc atccgacaat
gtgcaggcgt 1980tgatgccgga tgcggtgcaa gcaccttatc cggcctacag
accggagcca aacatgcaaa 2040ccatcaccat cgccccaccc aagcgcagct
ggttctcgct tctgagctgg gccgttgtac 2100tcgccgtgtt ggtcgtctcg
tggcagggcg cggaaatggc cccgcttacg ctgatcaaag 2160acggcggcaa
catggcgacg ttcgccgccg acttcttccc gcccgatttc agccagtggc
2220aggattacct caccgaaatg gccgtcacgc tgcaaatcgc cgtctggggc
accgcgctgg 2280cggtggttct ctccatcccc tttggcctga tgagcgccga
aaacctggtg ccgtggtggg 2340tttaccagcc cgttcgccgc ctgatggacg
cctgccgcgc cattaacgaa atggtcttcg 2400ccatgctgtt cgtggtcgcc
gtcggcctcg gcccgttcgc tggcgtgctg gcgtgctggc 2460gctgtttatc
cacaccaccg gcgtgctctc caagctgctt tccgaagcgg tggaagcgat
2520tgagcccggc ccggtggaag gcattcgcgc caccggtgcc aacaagctcg
aagagatcct 2580ctacggcgtg ctgccacagg tgatgccact gctgatctcc
tactccctct atcgcttcga 2640atccaacgtc cgctcggcga ccgtcgtcgg
catggtcggc gcaggcggga tcggcgtcac 2700cctgtgggaa gcgattcgcg
gtttccagtt ccaacaaacc tgcgccctga tggtgcttat 2760catcgtcacg
gtcagcctgc tggatttcct ctctcaacgg ttgcgtaagc actttatctg
2820ataagcgagg cattgatatc tatgcacttg tctacacatc cgaccagcta
cccaacacgc 2880tatcaagaga tagccgcaaa acttgagcag gagcttcgtc
aacactaccg ctgcggcgac 2940tatcttcccg ccgagcagca actggcagcg
cgctttgagg tgaatcgcca caccctgcgc 3000cgcgccatcg accaactggt
ggaaaaaggc tgggtacagc gccgtcaggg cgtcggcgtg 3060ctggtgctga
tgcgcccgtt cgattacccg ctcaacgccc aggcgcgttt tagccagaat
3120ctgctggatc agggcagcca tcccaccagc gaaaaactgc tttcggtatt
gcgccccgcg 3180tccggccacg tcgctgacgc actggggatt accgaggggg
agaacgtcat ccacctgcgc 3240accctgcgtc gtgtcaacgg cgtcgcgctc
tgtttaatcg accactactt cgcggacctc 3300accctctggc cgacgctgca
acgcttcgac agcggctcgc tgcacgattt tctgcgcgag 3360caaaccggaa
ttgcgctgcg ccgcagccag acgcggatca gcgcccgccg cgcccaggcc
3420aaagagtgcc agcgtcttga aatcccgaat atgtcgccgc tgctgtgcgt
gcgcaccctt 3480aaccaccgtg acggtgaaag cagcccggcg gagtactccg
tcagcctgac gcgcgccgac 3540atgattgaat tcactatgga gcactgaatg
cacgcagata ccgcgacccg ccagcactgg 3600atgtccgtgc tggcgcacag
ccaaccggct gaactggcag cacgcctgaa cgcgctaaac 3660atcaccgccg
actatgaggt gatccgcgcc gctgaaactg gcctggtaca gattcaggcg
3720cggatgggcg gcaccggcga acgttttttt gccggcgacg ccacgctgac
ccgcgccgcc 3780gtgcgcctga ctgacggcac gctcggctac agctgggtgc
aggggcgtga taaacagcac 3840gccgaacgct gcgcgctgat tgacgcgctg
atgcagcaat ctcgccactt tcaaaactta 3900tcagaaaccc ttattgcccc
gctggacgct gaccgtatgg cacgcattgc cgcacgccag 3960gccgaagtga
acgccagccg ggtcgacttc tttacgatgg ttcgcggaga caacgcatga
4020ccctggaaac cgcttttatg cttcccgtgc aggatgccca gcacagtttt
cgtcgcctgt 4080taaaggccat gagcgagccg ggcgtgattg tcgccctgca
tcagctcaaa cgcggctggc 4140aaccgctgaa tatcgccacc accagcgtgc
tgctgacgct ggccgataac gacacgccgg 4200tgtggctttc taccccatta
aataacgata tcgtcaacca gagcctgcgt tttcatacca 4260acgcgccgct
ggtcagccag ccggaacagg cgaccttcgc ggtgacggat gaggcgattt
4320ccagcgaaca gctcaacgcc ctttccaccg gcaccgccgt tgcgccggaa
gcgggtgcga 4380cgctgatttt acaggtcgcc agcctgagcg gcggacgcat
gttgcgcctt actggtgcgg 4440gtattgccga agaacgaatg atcgctccgc
agctgccgga gtgcattctg cacgaactca 4500ccgagcgccc gcatccgttc
ccgctcggca tcgacctgat cctgacctgt ggcgagcgcc 4560tgctggctat
tccgcgaacc actcatgtgg aggtgtgctg atgtacgttg ccgtgaaagg
4620gggcgagaag gcgatcgacg ccgcccacgc cctgcaagag agccgacgcc
gaggcgatac 4680cgatttgccc gaactgagcg tcgcccagat tgaacagcag
cttaacctcg cggtagatcg 4740cgtgatgacc gaaggcggca ttgccgaccg
cgaactggcg gcgctggcgc tgaaacaggc 4800cagcggcgat aacgttgaag
cgattttcct gctgcgcgcc taccgcacca cgttggcgaa 4860gctggcggta
agcgagccgc tcgacaccac cgggatgcgt ctcgaacgcc gtatctccgc
4920cgtttataaa gacattcccg gcggccagct gcttggccca acctacgact
acacccatcg 4980cctgctcgat tttaccctgc tggcaaacgg cgaagcgccg
acgctgacca ccgccgacag 5040cgaacagcag ccgtcgccgc acgttttcag
cctgctggcg cgtcaggggc tggcgaagtt 5100tgaagaggat agcggcgcac
agccggatga catcacccgc acgccgccgg tttacccctg 5160ctcacgctcc
tcccgtttgc agcagttgat gcgcggcgac gaaggctatt tgctggcgct
5220ggcctactcc acccaacgcg gttacgggcg caatcacccg ttcgcaggcg
agatccgcag 5280cggctatatc gacgtgtcga ttgtgccgga agagctggga
tttgcggtga acgtcggcga 5340actgctgatg actgagtgtg aaatggttaa
cggttttatc gacccgccgg gtgagccgcc 5400gcacttcacg cgcggctacg
ggctggtgtt cggcatgagc gagcgcaaag cgatggcgat 5460ggcgctggtc
gaccgcgctc tgcaagcccc ggagtacggc gagcacgcga caggcccggc
5520gcaggatgaa gagttcgtgc tggcacatgc cgacaacgtc gaagccgcag
gctttgtctc 5580acacctcaaa ctcccccact acgtcgattt ccaggccgaa
ctggagctac tcaaacgtct 5640gcaacaggag cagaaccatg gctaatctga
gcggctacaa ctttgcctac ctcgacgagc 5700agaccaaacg catgatccgc
cgcgccatct taaaagcggt ggcgatcccc ggttatcagg 5760tgccgtttgg
cgggcgcgag atgccgatgc cgtacggctg gggaaccggc ggcattcagc
5820ttaccgccag cgtgattggc gaaagcgacg tgctgaaggt gattgaccag
ggcgcggatg 5880acaccaccaa cgccgtgtcg attcgcaact tcttcaagcg
cgtgaccggg gtaaacacca 5940cggaacgtac ggacgatgcg acggttatcc
agacgcgtca ccgcatcccc gaaacgccgc 6000tgaccgaaga tcagataatt
atcttccagg tgccaatccc cgagccgctg cgctttatcg 6060agccgcgcga
aacggaaacc cgcaccatgc acgcgctgga agagtacggc gtgatgcagg
6120tgaaactgta tgaagatatc gcccgcttcg gtcatatcgc caccacctac
gcctatccgg 6180tgaaggtaaa tgggcgctac gtgatggacc cgtcgccgat
cccgaaattc gataacccaa 6240aaatggacat gatgcccgcc ctgcaactgt
tcggcgcggg gcgcgagaag cgcatctatg 6300cggtgccgcc gtttacccgc
gtggaaagtc tcgatttcga cgatcacccg ttcaccgttc 6360agcagtggga
tgagccatgc gccatctgcg gatcgaccca cagctatctt gatgaagtgg
6420tgctggatga cgccggaaac cgcatgtttg tctgctccga taccgattat
tgccgccaac 6480agagcgaggc aaaaaaccaa tgaatcaacc gttactttcg
gtcaataacc tgacccacct 6540ttacgcgccg ggcaaaggct ttagcgatgt
ctcttttgat ttatggccgg gggaagtgct 6600gggcattgtc ggggaatccg
gctccgggaa gaccacgctg ctgaagtcga tctccgcgcg 6660cctgacgccg
cagcaggggg aaattcacta cgagaaccgt tcgctgtatg caatgagcga
6720ggccgaccgc cgtcgcctgc tgcgtaccga atggggcgtg gtgcatcagc
atccactcga 6780cggcctgcgc cgccaggtgt cggcaggcgg caatatcggc
gagcggctga tggcgaccgg 6840ggcacgtcat tacggcgata ttcgtgccac
cgcgcagaag tggctggaag aggtggagat 6900tcccgccaac cggatcgacg
acctgccgac caccttttcc ggcggtatgc agcagcgttt 6960gcagattgcc
cgcaacctgg tgacgcatcc gaagctggtg tttatggatg aaccgaccgg
7020cgggctggat gtgtcggtgc aggcccgcct gctcgacctg ctgcgcggcc
tggtggtgga 7080gctgaacctc gcggtggtga ttgtcaccca tgatttaggc
gtcgcccgcc tgctggcgga 7140ccgtttgctg gtgatgaagc aggggcaagt
ggtggagagt gggttaaccg accgcgtgct 7200cgacgacccg catcatccgt
atacacagct gctggtgtca tcggttttgc agaattgagc 7260cggtgccgga
tgcggcgtaa acgccttatc cggcctacaa atgcgctccc cgtaggtcgg
7320ataagacgcg tcagcgtcgc atccgacacc cgaaccacga ggcgaaaaat
gattaacgta 7380caaaacgtca gtaaaacctt catcctgcac cagcaaaacg
gcgtgcgcct gcccgtcctc 7440aatcgcgcct cgctcaccgt caacgcgggc
gaatgcgtgg tgctccacgg ccattccggc 7500agcggcaaat caactctgct
acgctcgctg tacgccaact atctgcccga cgaaggtcaa 7560atccagatca
aacacggtga cgagtgggta gacctggtca ccgcgccagc gcgcaaagtg
7620gtggaaatcc gcaaaaccac cgtcggctgg gtgagccagt ttctgcgcgt
catcccgcgt 7680atctcagcac tggaagtggt gatgcagccg ctgctcgata
ccggcgttcc gcgtgaagcc 7740tgcgccgcta aagccgcgcg tcttctcacc
cgcctgaacg tgccggaacg cctgtggcac 7800ctggcaccat cgacattttc
cggtggcgaa cagcagcgcg tcaacatcgc ccgcggcttt 7860atcgtcgact
accccattct gctgcttgac gaacctaccg cctcgctgga cgccaaaaac
7920agcgccgcgg tggtggaact gattcgcgaa gccaaaaccc gtggcgcagc
catcgtaggc 7980atcttccatg acgaagctgt acgtaatgac gtcgccgacc
gcctgcaccc aatgggagcc 8040tcttcatgat tatcaataac gttaagctgg
tgctggaaaa cgaggtggta agcggttcgc 8100tggaggtgca gaacggcgaa
atccgcgcct ttgccgaaag ccagagccgc ctgccggagg 8160cgatggacgg
cgaaggcggc tggctgctgc cggggctgat tgagctgcat accgataatc
8220tggataaatt cttcaccccg cgcccgaaag ttgactggcc tgcccactcg
gcgatgagca 8280gccacgacgc gctgatggtg gcgagcggca tcaccaccgt
actggatgcc gtggcaattg 8340gcgacgtgcg cgacggcggc gatcggctgg
agaatctgga gaagatgatc aacgccatcg 8400aagagacgca gaaacgcggc
gtcaaccgcg ccgagcaccg tctgcatctg cgctgcgaac 8460tgccgcatca
caccacgctg ccgctgtttg aaaaactggt gcagcgcgag ccggtgacgc
8520tggtgtcgct gatggaccac tcgccgggcc agcgccagtt cgccaaccgc
gagaagtatc 8580gcgaatatta tcagggcaaa tactccctca ctgatgcgca
gatgcagcag tacgaagaag 8640agcaactggc gctcgccgca cgctggtcgc
agccgaatcg cgaatccatc gccgccctgt 8700gccgcgcgcg aaaaattgcg
cttgccagcc acgatgacgc cacccacgcc cacgttgctg 8760aatctcacca
gcttggcagc gtgatcgccg aatttcccac cacgttcgaa gcggcggaag
8820cctcgcgcaa gcatggcatg aacgtgctga tgggcgcgcc gaatattgtg
cgcggcggct 8880cgcactccgg caacgtggcg gccagtgaac tggcgcagct
tggcctgctg gatatcctct 8940cttccgacta ctaccccgcc agcctgctcg
atgcggcatt tcgcgtcgcc gatgaccaga 9000gcaaccgctt tacgctgccg
caggcggtga agctggtgac taaaaatcca gcgcaggcgc 9060ttaatctcca
ggatcgcggg gtgattggcg agggcaaacg cgccgacctg gtgctggcgc
9120atcgcaagga caatcatatt catatcgacc acgtctggcg tcagggtaaa
agggtgttct 9180gatgatggga aaactgattt ggttaatggg gccgtccggc
tccgggaaag acagcctgct 9240ggcggaactc cgcctgcggg aacaaactca
gttactggtg gcgcatcgct acatcacgcg 9300cgatgccagc gccggaagtg
aaaaccatat cgccctgagc gagcaggagt tttttacccg 9360cgcggggcaa
aatctgttgg ccttaagctg gcacgctaac ggtctgtatt atggcgtcgg
9420cgtcgagatt gatctctggc tgcacgccgg attcgacgtg ctggtcaacg
gctcacgcgc 9480ccatctgccg caggcgcggg cgcgctatca atcggcgctg
ctgcccgtct gtttacaggt 9540ttcgccggag atcctccgcc agcgcctgga
aaaccgtggc cgtgaaaacg ccagtgaaat 9600taacgcccgc ctggcgcgcg
ccgcccgcta tactccacag gattgccata cgctcaacaa 9660tgacggcagc
ctgcgccagt cggtcgacac gctgctgacg ctgatccatc agaaggagaa
9720acaccatgcc tgcttgtgag cttcgcccgg ccacgcagta cgacaccgac
gcggtttacg 9780cgctgatttg tgagctaaaa caggcggagt ttgaccacca
cgcgtttcgc gtgggtttta 9840acgccaatct gcgcgaccca aacatgcgct
accatctggc gctgcttgat ggcgaagttg 9900tcggcatgat cggcctgcat
ttgcagtttc atctgcatca tgtcaactgg atcggcgaaa 9960ttcaggagtt
ggtggtaatg ccgcaggcgc gcggtctgaa cgtcggcagt aagttactgg
10020cgtgggcaga agaagaagcc cgccaggccg gggccgaaat gaccgaactt
tcgaccaacg 10080tgaagcgcca cgacgcgcac cgtttctatc tgcgcgaagg
ctacgagcag agccacttcc 10140gcttcaccaa ggcgctgtaa catgagcctg
accctcacgc tcaccggcac cggcggcgca 10200cagggcgttc cggcatgggg
ctgcgagtgt gcggcctgcg ccagagcgcg gcgctcgccg 10260cagtatcgcc
gccaaccgtg cagcggcgta gtgaagttta acgacgcaat caccctgatc
10320gacgccgggc tgcacgatct cgccgatcgc tggtcgcccg gatcgttcca
gcagtttttg 10380ctgacgcatt atcatatgga tcacgtccag gggctgtttc
cgctgcgctg gggcgttggc 10440gatccgatcc cggtttacgg cccgccggat
gaacagggct gcgacgatct gtttaaacat 10500ccgggcctgc ttgatttcag
ccacacggtg gaaccgtttg tggtgtttga tttgcagggg 10560ttacaggtca
cgcccctgcc gctcaaccac tcaaaactga ccttcggtta tctgctggaa
10620acggcacaca gccgggtggc gtggctgtct gacaccgcag gtttgccgga
aaaaacgctg 10680aaatttttac gcaataatca gccgcaggta atggtgatgg
attgcagtca cccgccgcgc 10740gcggatgcac cgcgtaatca ctgtgattta
aataccgtgc ttgcgctgaa tcaggttatc 10800cgctcgccac gggtgattct
gacccatatc agccaccagt ttgatgcgtg gctgatggaa 10860aacgcactac
cgtcagggtt tgaggtgggg tttgatggga tggagattgg ggtggcgtga
10920tgagagggaa tgtgcgcgct ggccccctca ccctaaccct ctccccagag
gggcgagggg 10980accgattgtg ctcgatattg aatattgcgc tcgttttctc
cctctcccca ttggggtgag 11040gggcgatgcc tgctccatac ccaacctcat
cgcccatact catcttccat tctccgctct 11100tcatcctcca gttgccgacg
ctcctgatca agctggcgct ggcgatcgtc cagctgcctg 11160cggcgatctt
caaactggcg gcggcggtcg tcatattgtc tgcgccgatc gtcgctcact
11220tcacgctgcc agccgtcgtc gcgcgaatct tcatagtctc gcccacggtc
agggttataa 11280gcgtcattaa tcgcctgctg aatattgcca atggtgtcgt
cgataatatc ggcctgggcc 11340ggaacgtgga cagcgtgagc agggtgaata
aaagaaatag cggaaagcgt ttcattagcc 11400aacctcaaaa agaaactcta
tccacattaa tcattactca tccatgcaag tagtggatga 11460atctcaattt
ctccgctgct ctattgccgt aatcgcctcc acgcgttgtt gatgacgacc
11520gccttcgtac tgtgcgccca gccacgcatc cacaatcatt tttgccagtt
cgaggccaac 11580cactcgtgaa ccaaaagcca gcacgttggt gtcgttatgc
tgccgcgaaa gttgcgcgga 11640ataaggttcg ctacagacga ccgcgcgaat tc
116723435DNAEscherichia coli 3atgcctgctt gtgagcttcg cccggccacg
cagtacgaca ccgacgcggt ttacgcgctg 60atttgtgagc taaaacaggc ggagtttgac
caccacgcgt ttcgcgtggg ttttaacgcc 120aatctgcgcg acccaaacat
gcgctaccat ctggcgctgc ttgatggcga agttgtcggc 180atgatcggcc
tgcatttgca gtttcatctg catcatgtca actggatcgg cgaaattcag
240gagttggtgg taatgccgca ggcgcgcggt ctgaacgtcg gcagtaagtt
actggcgtgg 300gcagaagaag aagcccgcca ggccggggcc gaaatgaccg
aactttcgac caacgtgaag 360cgccacgacg cgcaccgttt ctatctgcgc
gaaggctacg agcagagcca cttccgcttc 420accaaggcgc tgtaa
4354144PRTEscherichia coli 4Met Pro Ala Cys Glu Leu Arg Pro Ala Thr
Gln Tyr Asp Thr Asp Ala 1 5 10 15Val Tyr Ala Leu Ile Cys Glu Leu
Lys Gln Ala Glu Phe Asp His His 20 25 30Ala Phe Arg Val Gly Phe Asn
Ala Asn Leu Arg Asp Pro Asn Met Arg 35 40 45Tyr His Leu Ala Leu Leu
Asp Gly Glu Val Val Gly Met Ile Gly Leu 50 55 60His Leu Gln Phe His
Leu His His Val Asn Trp Ile Gly Glu Ile Gln 65 70 75 80Glu Leu Val
Val Met Pro Gln Ala Arg Gly Leu Asn Val Gly Ser Lys 85 90 95Leu Leu
Ala Trp Ala Glu Glu Glu Ala Arg Gln Ala Gly Ala Glu Met 100 105
110Thr Glu Leu Ser Thr Asn Val Lys Arg His Asp Ala His Arg Phe Tyr
115 120 125Leu Arg Glu Gly Tyr Glu Gln Ser His Phe Arg Phe Thr Lys
Ala Leu 130 135 140520DNAArtificial SequenceDescription of
Artificial Sequencesynthetic oligonucleotide 5aaacaccatg gctgcttgtg
20635DNAArtificial SequenceDescription of Artificial
Sequencesynthetic oligonucleotide 6gtgacgaatt cgagctcatt acagcgcctt
ggtga 357435DNAArtificial SequenceDescription of Artificial
Sequencenon- naturally occurring nucleotide sequence encoding
modified PhnO protein P2A; g-c at nucleotide position 4 7atg gct
gct tgt gag ctt cgc ccg gcc acg cag tac gac acc gac gcg 48Met Ala
Ala Cys Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr Asp Ala 1 5 10
15gtt tac gcg ctg att tgt gag cta aaa cag gcg gag ttt gac cac cac
96Val Tyr Ala Leu Ile Cys Glu Leu Lys Gln Ala Glu Phe Asp His His
20 25 30gcg ttt cgc gtg ggt ttt aac gcc aat ctg cgc gac cca aac atg
cgc 144Ala Phe Arg Val Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn Met
Arg 35 40 45tac cat ctg gcg ctg ctt gat ggc gaa gtt gtc ggc atg atc
ggc ctg 192Tyr His Leu Ala Leu Leu Asp Gly Glu Val Val Gly Met Ile
Gly Leu 50 55 60cat ttg cag ttt cat ctg cat cat gtc aac tgg atc ggc
gaa att cag 240His Leu Gln Phe His Leu His His Val Asn Trp Ile Gly
Glu Ile Gln 65 70 75 80gag ttg gtg gta atg ccg cag gcg cgc ggt ctg
aac gtc ggc agt aag 288Glu Leu Val Val Met Pro
Gln Ala Arg Gly Leu Asn Val Gly Ser Lys 85 90 95tta ctg gcg tgg gca
gaa gaa gaa gcc cgc cag gcc ggg gcc gaa atg 336Leu Leu Ala Trp Ala
Glu Glu Glu Ala Arg Gln Ala Gly Ala Glu Met 100 105 110acc gaa ctt
tcg acc aac gtg aag cgc cac gac gcg cac cgt ttc tat 384Thr Glu Leu
Ser Thr Asn Val Lys Arg His Asp Ala His Arg Phe Tyr 115 120 125ctg
cgc gaa ggc tac gag cag agc cac ttc cgc ttc acc aag gcg ctg 432Leu
Arg Glu Gly Tyr Glu Gln Ser His Phe Arg Phe Thr Lys Ala Leu 130 135
140taa 4358144PRTArtificial Sequence 8Met Ala Ala Cys Glu Leu Arg
Pro Ala Thr Gln Tyr Asp Thr Asp Ala 1 5 10 15Val Tyr Ala Leu Ile
Cys Glu Leu Lys Gln Ala Glu Phe Asp His His 20 25 30Ala Phe Arg Val
Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg 35 40 45Tyr His Leu
Ala Leu Leu Asp Gly Glu Val Val Gly Met Ile Gly Leu 50 55 60His Leu
Gln Phe His Leu His His Val Asn Trp Ile Gly Glu Ile Gln 65 70 75
80Glu Leu Val Val Met Pro Gln Ala Arg Gly Leu Asn Val Gly Ser Lys
85 90 95Leu Leu Ala Trp Ala Glu Glu Glu Ala Arg Gln Ala Gly Ala Glu
Met 100 105 110Thr Glu Leu Ser Thr Asn Val Lys Arg His Asp Ala His
Arg Phe Tyr 115 120 125Leu Arg Glu Gly Tyr Glu Gln Ser His Phe Arg
Phe Thr Lys Ala Leu 130 135 1409264DNAArtificial
SequenceDescription of Artificial Sequencetransit peptide coding
sequence 9atg gct tcc tct atg ctc tct tcc gct act atg gtt gcc tct
ccg gct 48Met Ala Ser Ser Met Leu Ser Ser Ala Thr Met Val Ala Ser
Pro Ala 1 5 10 15cag gcc act atg gtc gct cct ttc aac gga ctt aag
tcc tcc gct gcc 96Gln Ala Thr Met Val Ala Pro Phe Asn Gly Leu Lys
Ser Ser Ala Ala 20 25 30ttc cca gcc acc cgc aag gct aac aac gac att
act tcc atc aca agc 144Phe Pro Ala Thr Arg Lys Ala Asn Asn Asp Ile
Thr Ser Ile Thr Ser 35 40 45aac ggc gga aga gtt aac tgc atg cag gtg
tgg cct ccg att gga aag 192Asn Gly Gly Arg Val Asn Cys Met Gln Val
Trp Pro Pro Ile Gly Lys 50 55 60aag aag ttt gag act ctc tct tac ctt
cct gac ctt acc gat tcc ggt 240Lys Lys Phe Glu Thr Leu Ser Tyr Leu
Pro Asp Leu Thr Asp Ser Gly 65 70 75 80ggt cgc gtc aac tgc atg cag
gcc 264Gly Arg Val Asn Cys Met Gln Ala 851088PRTArtificial Sequence
10Met Ala Ser Ser Met Leu Ser Ser Ala Thr Met Val Ala Ser Pro Ala 1
5 10 15Gln Ala Thr Met Val Ala Pro Phe Asn Gly Leu Lys Ser Ser Ala
Ala 20 25 30Phe Pro Ala Thr Arg Lys Ala Asn Asn Asp Ile Thr Ser Ile
Thr Ser 35 40 45Asn Gly Gly Arg Val Asn Cys Met Gln Val Trp Pro Pro
Ile Gly Lys 50 55 60Lys Lys Phe Glu Thr Leu Ser Tyr Leu Pro Asp Leu
Thr Asp Ser Gly 65 70 75 80Gly Arg Val Asn Cys Met Gln Ala
8511696DNAArtificial SequenceDescription of Artificial Sequence
CTP-AMPA acetyltransferase coding sequence and amino acid sequence
translation 11atg gct tcc tct atg ctc tct tcc gct act atg gtt gcc
tct ccg gct 48Met Ala Ser Ser Met Leu Ser Ser Ala Thr Met Val Ala
Ser Pro Ala 1 5 10 15cag gcc act atg gtc gct cct ttc aac gga ctt
aag tcc tcc gct gcc 96Gln Ala Thr Met Val Ala Pro Phe Asn Gly Leu
Lys Ser Ser Ala Ala 20 25 30ttc cca gcc acc cgc aag gct aac aac gac
att act tcc atc aca agc 144Phe Pro Ala Thr Arg Lys Ala Asn Asn Asp
Ile Thr Ser Ile Thr Ser 35 40 45aac ggc gga aga gtt aac tgc atg cag
gtg tgg cct ccg att gga aag 192Asn Gly Gly Arg Val Asn Cys Met Gln
Val Trp Pro Pro Ile Gly Lys 50 55 60aag aag ttt gag act ctc tct tac
ctt cct gac ctt acc gat tcc ggt 240Lys Lys Phe Glu Thr Leu Ser Tyr
Leu Pro Asp Leu Thr Asp Ser Gly 65 70 75 80ggt cgc gtc aac tgc atg
cag gcc atg gct gct tgt gag ctt cgc ccg 288Gly Arg Val Asn Cys Met
Gln Ala Met Ala Ala Cys Glu Leu Arg Pro 85 90 95gcc acg cag tac gac
acc gac gcg gtt tac gcg ctg att tgt gag cta 336Ala Thr Gln Tyr Asp
Thr Asp Ala Val Tyr Ala Leu Ile Cys Glu Leu 100 105 110aaa cag gcg
gag ttt gac cac cac gcg ttt cgc gtg ggt ttt aac gcc 384Lys Gln Ala
Glu Phe Asp His His Ala Phe Arg Val Gly Phe Asn Ala 115 120 125aat
ctg cgc gac cca aac atg cgc tac cat ctg gcg ctg ctt gat ggc 432Asn
Leu Arg Asp Pro Asn Met Arg Tyr His Leu Ala Leu Leu Asp Gly 130 135
140gaa gtt gtc ggc atg atc ggc ctg cat ttg cag ttt cat ctg cat cat
480Glu Val Val Gly Met Ile Gly Leu His Leu Gln Phe His Leu His
His145 150 155 160gtc aac tgg atc ggc gaa att cag gag ttg gtg gta
atg ccg cag gcg 528Val Asn Trp Ile Gly Glu Ile Gln Glu Leu Val Val
Met Pro Gln Ala 165 170 175cgc ggt ctg aac gtc ggc agt aag tta ctg
gcg tgg gca gaa gaa gaa 576Arg Gly Leu Asn Val Gly Ser Lys Leu Leu
Ala Trp Ala Glu Glu Glu 180 185 190gcc cgc cag gcc ggg gcc gaa atg
acc gaa ctt tcg acc aac gtg aag 624Ala Arg Gln Ala Gly Ala Glu Met
Thr Glu Leu Ser Thr Asn Val Lys 195 200 205cgc cac gac gcg cac cgt
ttc tat ctg cgc gaa ggc tac gag cag agc 672Arg His Asp Ala His Arg
Phe Tyr Leu Arg Glu Gly Tyr Glu Gln Ser 210 215 220cac ttc cgc ttc
acc aag gcg ctg 696His Phe Arg Phe Thr Lys Ala Leu225
23012232PRTArtificial Sequence 12Met Ala Ser Ser Met Leu Ser Ser
Ala Thr Met Val Ala Ser Pro Ala 1 5 10 15Gln Ala Thr Met Val Ala
Pro Phe Asn Gly Leu Lys Ser Ser Ala Ala 20 25 30Phe Pro Ala Thr Arg
Lys Ala Asn Asn Asp Ile Thr Ser Ile Thr Ser 35 40 45Asn Gly Gly Arg
Val Asn Cys Met Gln Val Trp Pro Pro Ile Gly Lys 50 55 60Lys Lys Phe
Glu Thr Leu Ser Tyr Leu Pro Asp Leu Thr Asp Ser Gly 65 70 75 80Gly
Arg Val Asn Cys Met Gln Ala Met Ala Ala Cys Glu Leu Arg Pro 85 90
95Ala Thr Gln Tyr Asp Thr Asp Ala Val Tyr Ala Leu Ile Cys Glu Leu
100 105 110Lys Gln Ala Glu Phe Asp His His Ala Phe Arg Val Gly Phe
Asn Ala 115 120 125Asn Leu Arg Asp Pro Asn Met Arg Tyr His Leu Ala
Leu Leu Asp Gly 130 135 140Glu Val Val Gly Met Ile Gly Leu His Leu
Gln Phe His Leu His His145 150 155 160Val Asn Trp Ile Gly Glu Ile
Gln Glu Leu Val Val Met Pro Gln Ala 165 170 175Arg Gly Leu Asn Val
Gly Ser Lys Leu Leu Ala Trp Ala Glu Glu Glu 180 185 190Ala Arg Gln
Ala Gly Ala Glu Met Thr Glu Leu Ser Thr Asn Val Lys 195 200 205Arg
His Asp Ala His Arg Phe Tyr Leu Arg Glu Gly Tyr Glu Gln Ser 210 215
220His Phe Arg Phe Thr Lys Ala Leu225 23013415DNAZea
maysN_region(15)..(163)intron(164)..(322)C_region(323)..(411)
13tctagaggat cagcatggcg cccaccgtga tgatggcctc gtcggccacc gccgtcgctc
60cgttcctggg gctcaagtcc accgccagcc tccccgtcgc ccgccgctcc tccagaagcc
120tcggcaacgt cagcaacggc ggaaggatcc ggtgcatgca ggtaacaaat
gcatcctagc 180tagtagttct ttgcattgca gcagctgcag ctagcgagtt
agtaatagga agggaactga 240tgatccatgc atggactgat gtgtgttgcc
catcccatcc catcccattt cccaaacgaa 300ccgaaaacac cgtactacgt
gcaggtgtgg ccctacggca acaagaagtt cgagacgctg 360tcgtacctgc
cgccgctgtc gaccggcggg cgcatccgct gcatgcaggc catgg
41514174DNAArtificial SequenceDescription of Artificial Sequence
chloroplast or plastid transit peptide coding sequence and amino
acid sequence translation 14atg gct tcc tct atg ctc tct tcc gct act
atg gtt gcc tct ccg gct 48Met Ala Ser Ser Met Leu Ser Ser Ala Thr
Met Val Ala Ser Pro Ala 1 5 10 15cag gcc act atg gtc gct cct ttc
aac gga ctt aag tcc tcc gct gcc 96Gln Ala Thr Met Val Ala Pro Phe
Asn Gly Leu Lys Ser Ser Ala Ala 20 25 30ttc cca gcc acc cgc aag gct
aac aac gac att act tcc atc aca agc 144Phe Pro Ala Thr Arg Lys Ala
Asn Asn Asp Ile Thr Ser Ile Thr Ser 35 40 45aac ggc gga aga gtt aac
tgc atg cag gcc 174Asn Gly Gly Arg Val Asn Cys Met Gln Ala 50
551558PRTArtificial Sequence 15Met Ala Ser Ser Met Leu Ser Ser Ala
Thr Met Val Ala Ser Pro Ala 1 5 10 15Gln Ala Thr Met Val Ala Pro
Phe Asn Gly Leu Lys Ser Ser Ala Ala 20 25 30Phe Pro Ala Thr Arg Lys
Ala Asn Asn Asp Ile Thr Ser Ile Thr Ser 35 40 45Asn Gly Gly Arg Val
Asn Cys Met Gln Ala 50 5516157DNAArtificial SequenceDescription of
Artificial Sequence synthetic oligonucleotide representing base
pairs 1 through 157 of a 432 base pair AMPA acyltransferase gene
16atggccgctt gcgagcttcg cccagccacg cagtacgaca ccgacgccgt gtacgcgctg
60atctgcgagc tcaagcaggc ggagttcgac caccacgcct tccgcgtggg cttcaacgcc
120aacctgcgcg accccaacat gcgctaccat ctggcgc 15717187DNAArtificial
SequenceDescription of Artificial Sequence synthetic
oligonucleotide sequence representing base pairs 158 through 344 of
a 432 base pair AMPA acyltransferase gene 17tgcttgatgg cgaagtggtc
ggcatgatcg gcctgcacct ccagttccac ctgcatcatg 60tcaactggat cggcgagatc
caggagctgg tcgtgatgcc acaggcgagg ggtctgaacg 120tcggcagcaa
gctcctggcg tgggccgagg aggaagccag gcaggccgga gccgagatga 180ccgagct
1871888DNAArtificial SequenceDescription of Artificial Sequence
synthetic oligonucleotide sequence representing base pairs 345
through 432 of a 432 base pair AMPA acyltransferase gene
18cagcaccaac gtgaagcgcc acgacgcgca ccgcttctac ctgcgcgaag gctacgagca
60gagccacttc cgcttcacca aggcgctg 8819432DNAArtificial
SequenceDescription of Artificial Sequence synthetic
oligonucleotide providing monocot optimized coding sequence for an
AMPA acetyltransferase 19atg gcc gct tgc gag ctt cgc cca gcc acg
cag tac gac acc gac gcc 48Met Ala Ala Cys Glu Leu Arg Pro Ala Thr
Gln Tyr Asp Thr Asp Ala 1 5 10 15gtg tac gcg ctg atc tgc gag ctc
aag cag gcg gag ttc gac cac cac 96Val Tyr Ala Leu Ile Cys Glu Leu
Lys Gln Ala Glu Phe Asp His His 20 25 30gcc ttc cgc gtg ggc ttc aac
gcc aac ctg cgc gac ccc aac atg cgc 144Ala Phe Arg Val Gly Phe Asn
Ala Asn Leu Arg Asp Pro Asn Met Arg 35 40 45tac cat ctg gcg ctg ctt
gat ggc gaa gtg gtc ggc atg atc ggc ctg 192Tyr His Leu Ala Leu Leu
Asp Gly Glu Val Val Gly Met Ile Gly Leu 50 55 60cac ctc cag ttc cac
ctg cat cat gtc aac tgg atc ggc gag atc cag 240His Leu Gln Phe His
Leu His His Val Asn Trp Ile Gly Glu Ile Gln 65 70 75 80gag ctg gtc
gtg atg cca cag gcg agg ggt ctg aac gtc ggc agc aag 288Glu Leu Val
Val Met Pro Gln Ala Arg Gly Leu Asn Val Gly Ser Lys 85 90 95ctc ctg
gcg tgg gcc gag gag gaa gcc agg cag gcc gga gcc gag atg 336Leu Leu
Ala Trp Ala Glu Glu Glu Ala Arg Gln Ala Gly Ala Glu Met 100 105
110acc gag ctc agc acc aac gtg aag cgc cac gac gcg cac cgc ttc tac
384Thr Glu Leu Ser Thr Asn Val Lys Arg His Asp Ala His Arg Phe Tyr
115 120 125ctg cgc gaa ggc tac gag cag agc cac ttc cgc ttc acc aag
gcg ctg 432Leu Arg Glu Gly Tyr Glu Gln Ser His Phe Arg Phe Thr Lys
Ala Leu 130 135 14020144PRTArtificial Sequence 20Met Ala Ala Cys
Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr Asp Ala 1 5 10 15Val Tyr
Ala Leu Ile Cys Glu Leu Lys Gln Ala Glu Phe Asp His His 20 25 30Ala
Phe Arg Val Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg 35 40
45Tyr His Leu Ala Leu Leu Asp Gly Glu Val Val Gly Met Ile Gly Leu
50 55 60His Leu Gln Phe His Leu His His Val Asn Trp Ile Gly Glu Ile
Gln 65 70 75 80Glu Leu Val Val Met Pro Gln Ala Arg Gly Leu Asn Val
Gly Ser Lys 85 90 95Leu Leu Ala Trp Ala Glu Glu Glu Ala Arg Gln Ala
Gly Ala Glu Met 100 105 110Thr Glu Leu Ser Thr Asn Val Lys Arg His
Asp Ala His Arg Phe Tyr 115 120 125Leu Arg Glu Gly Tyr Glu Gln Ser
His Phe Arg Phe Thr Lys Ala Leu 130 135 1402120DNAArtificial
SequenceDescription of Artificial Sequence synthetic
oligonucleotide PHN1 for use as an amplification primer
21atggctgctt gtgagcttcg 202220DNAArtificial SequenceDescription of
Artificial Sequence synthetic oligonucleotide PHN2 for use as an
amplification primer 22cagcgccttg gtgaagcgga 20231630DNAArtificial
SequenceDescription of Artificial Sequence expression cassette
comprising plant operable promoter linked to a coding sequence
encoding an AMPA acetyltransferase linked to a transcription
termination sequence 23gcggccgcgt tcaagcttga gctcaggatt tagcagcatt
ccagattggg ttcaatcaac 60aaggtacgag ccatatcact ttattcaaat tggtatcgcc
aaaaccaaga aggaactccc 120atcctcaaag gtttgtaagg aagaattctc
agtccaaagc ctcaacaagg tcagggtaca 180gagtctccaa accattagcc
aaaagctaca ggagatcaat gaagaatctt caatcaaagt 240aaactactgt
tccagcacat gcatcatggt cagtaagttt cagaaaaaga catccaccga
300agacttaaag ttagtgggca tctttgaaag taatcttgtc aacatcgagc
agctggcttg 360tggggaccag acaaaaaagg aatggtgcag aattgttagg
cgcacctacc aaaagcatct 420ttgcctttat tgcaaagata aagcagattc
ctctagtaca agtggggaac aaaataacgt 480ggaaaagagc tgtcctgaca
gcccactcac taatgcgtat gacgaacgca gtgacgacca 540caaaagaatt
ccctctatat aagaaggcat tcattcccat ttgaaggatc atcagatact
600gaaccaatcc ttctagaaga tctccacaat ggcttcctct atgctctctt
ccgctactat 660ggttgcctct ccggctcagg ccactatggt cgctcctttc
aacggactta agtcctccgc 720tgccttccca gccacccgca aggctaacaa
cgacattact tccatcacaa gcaacggcgg 780aagagttaac tgcatgcagg
tgtggcctcc gattggaaag aagaagtttg agactctctc 840ttaccttcct
gaccttaccg attccggtgg tcgcgtcaac tgcatgcagg cc atg gct 898 Met Ala
1gct tgt gag ctt cgc ccg gcc acg cag tac gac acc gac gcg gtt tac
946Ala Cys Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr Asp Ala Val Tyr
5 10 15gcg ctg att tgt gag cta aaa cag gcg gag ttt gac cac cac gcg
ttt 994Ala Leu Ile Cys Glu Leu Lys Gln Ala Glu Phe Asp His His Ala
Phe 20 25 30cgc gtg ggt ttt aac gcc aat ctg cgc gac cca aac atg cgc
tac cat 1042Arg Val Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg
Tyr His 35 40 45 50ctg gcg ctg ctt gat ggc gaa gtt gtc ggc atg atc
ggc ctg cat ttg 1090Leu Ala Leu Leu Asp Gly Glu Val Val Gly Met Ile
Gly Leu His Leu 55 60 65cag ttt cat ctg cat cat gtc aac tgg atc ggc
gaa att cag gag ttg 1138Gln Phe His Leu His His Val Asn Trp Ile Gly
Glu Ile Gln Glu Leu 70 75 80gtg gta atg ccg cag gcg cgc ggt ctg aac
gtc ggc agt aag tta ctg 1186Val Val Met Pro Gln Ala Arg Gly Leu Asn
Val Gly Ser Lys Leu Leu 85 90 95gcg tgg gca gaa gaa gaa gcc cgc cag
gcc ggg gcc gaa atg acc gaa 1234Ala Trp Ala Glu Glu Glu Ala Arg Gln
Ala Gly Ala Glu Met Thr Glu 100 105 110ctt tcg acc aac gtg aag cgc
cac gac gcg cac cgt ttc tat ctg cgc 1282Leu Ser Thr Asn Val Lys Arg
His Asp Ala His Arg Phe Tyr Leu Arg115 120 125 130gaa ggc tac gag
cag agc cac ttc cgc ttc acc aag gcg ctg 1324Glu Gly Tyr Glu Gln Ser
His Phe Arg Phe Thr Lys Ala Leu 135 140taatgagctc ggtaccggat
ccaattcccg atcgttcaaa catttggcaa taaagtttct 1384taagattgaa
tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg
1444ttaagcatgt aataattaac atgtaatgca tgacgttatt tatgagatgg
gtttttatga 1504ttagagtccc gcaattatac atttaatacg cgatagaaaa
caaaatatag cgcgcaaact 1564aggataaatt atcgcgcgcg gtgtcatcta
tgttactaga tcggggatcg atccccgggc 1624ggccgc 163024144PRTArtificial
Sequence 24Met Ala Ala Cys Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr
Asp Ala 1 5 10 15Val Tyr Ala Leu Ile Cys Glu Leu Lys Gln Ala Glu
Phe Asp His His 20 25 30Ala Phe Arg Val Gly Phe Asn Ala Asn Leu Arg
Asp Pro Asn Met Arg 35 40 45Tyr His Leu Ala Leu Leu Asp Gly Glu Val
Val Gly Met Ile Gly Leu 50 55 60His Leu Gln Phe His Leu His His Val
Asn Trp Ile Gly Glu Ile Gln 65 70 75 80Glu Leu Val Val Met Pro Gln
Ala Arg Gly Leu Asn Val Gly Ser Lys 85 90 95Leu Leu Ala Trp Ala Glu
Glu Glu Ala Arg Gln Ala Gly Ala Glu Met 100 105 110Thr Glu Leu Ser
Thr Asn Val Lys Arg His Asp Ala His Arg Phe Tyr 115 120 125Leu Arg
Glu Gly Tyr Glu Gln Ser His Phe Arg Phe Thr Lys Ala Leu 130 135
140252122DNAArtificial SequenceDescription of Artificial
Sequenceexpression cassette comprising plant promoter linked to
sequence encoding AMPA acetyl transferase linked to termination
sequence 25ctgcaggtcc gatgtgagac ttttcaacaa agggtaatat ccggaaacct
cctcggattc 60cattgcccag ctatctgtca ctttattgtg aagatagtgg aaaaggaagg
tggctcctac 120aaatgccatc attgcgataa aggaaaggcc atcgttgaag
atgcctctgc cgacagtggt 180cccaaagatg gacccccacc cacgaggagc
atcgtggaaa aagaagacgt tccaaccacg 240tcttcaaagc aagtggattg
atgtgatggt ccgatgtgag acttttcaac aaagggtaat 300atccggaaac
ctcctcggat tccattgccc agctatctgt cactttattg tgaagatagt
360ggaaaaggaa ggtggctcct acaaatgcca tcattgcgat aaaggaaagg
ccatcgttga 420agatgcctct gccgacagtg gtcccaaaga tggaccccca
cccacgagga gcatcgtgga 480aaaagaagac gttccaacca cgtcttcaaa
gcaagtggat tgatgtgata tctccactga 540cgtaagggat gacgcacaat
cccactatcc ttcgcaagac ccttcctcta tataaggaag 600ttcatttcat
ttggagagga cacgctgaca agctgactct agcagatcct ctagaaccat
660cttccacaca ctcaagccac actattggag aacacacagg gacaacacac
cataagatcc 720aagggaggcc tccgccgccg ccggtaacca ccccgcccct
ctcctctttc tttctccgtt 780tttttttccg tctcggtctc gatctttggc
cttggtagtt tgggtgggcg agaggcggct 840tcgtgcgcgc ccagatcggt
gcgcgggagg ggcgggatct cgcggggaat ggggctctcg 900gatgtagatc
tgcgatccgc cgttgttggg ggagatgatg gggcgtttaa aatttcgccg
960tgctaaacaa gatcaggaag aggggaaaag ggcactatgg tttatatttt
tatatatttc 1020tgctgcttcg tcaggcttag atgtgctaga tctttctttc
ttctttttgt gggtagaatt 1080taatccctca gcattgttca tcggtagttt
ttcttttcat gatttcgtga caaatgcagc 1140ctcgtgcgga gcttttttgt
aggtagaagt gatcaaccat ggcgcaagtt agcagaatct 1200gcaatggtgt
gcagaaccca tctcttatct ccaatctctc gaaatccagt caacgcaaat
1260ctcccttatc ggtttctctg aagacgcagc agcatccacg agcttatccg
atttcgtcgt 1320cgtggggatt gaagaagagt gggatgacgt taattggctc
tgagcttcgt cctcttaagg 1380tcatgtcttc tgtttccacg gcgtgc atg gcc gct
tgc gag ctt cgc cca gcc 1433 Met Ala Ala Cys Glu Leu Arg Pro Ala 1
5acg cag tac gac acc gac gcc gtg tac gcg ctg atc tgc gag ctc aag
1481Thr Gln Tyr Asp Thr Asp Ala Val Tyr Ala Leu Ile Cys Glu Leu Lys
10 15 20 25cag gcg gag ttc gac cac cac gcc ttc cgc gtg ggc ttc aac
gcc aac 1529Gln Ala Glu Phe Asp His His Ala Phe Arg Val Gly Phe Asn
Ala Asn 30 35 40ctg cgc gac ccc aac atg cgc tac cat ctg gcg ctg ctt
gat ggc gaa 1577Leu Arg Asp Pro Asn Met Arg Tyr His Leu Ala Leu Leu
Asp Gly Glu 45 50 55gtg gtc ggc atg atc ggc ctg cac ctc cag ttc cac
ctg cat cat gtc 1625Val Val Gly Met Ile Gly Leu His Leu Gln Phe His
Leu His His Val 60 65 70aac tgg atc ggc gag atc cag gag ctg gtc gtg
atg cca cag gcg agg 1673Asn Trp Ile Gly Glu Ile Gln Glu Leu Val Val
Met Pro Gln Ala Arg 75 80 85ggt ctg aac gtc ggc agc aag ctc ctg gcg
tgg gcc gag gag gaa gcc 1721Gly Leu Asn Val Gly Ser Lys Leu Leu Ala
Trp Ala Glu Glu Glu Ala 90 95 100 105agg cag gcc gga gcc gag atg
acc gag ctc agc acc aac gtg aag cgc 1769Arg Gln Ala Gly Ala Glu Met
Thr Glu Leu Ser Thr Asn Val Lys Arg 110 115 120cac gac gcg cac cgc
ttc tac ctg cgc gaa ggc tac gag cag agc cac 1817His Asp Ala His Arg
Phe Tyr Leu Arg Glu Gly Tyr Glu Gln Ser His 125 130 135ttc cgc ttc
acc aag gcg ctg taaagatctg aattctgcat gcgtttggac 1868Phe Arg Phe
Thr Lys Ala Leu 140gtatgctcat tcaggttgga gccaatttgg ttgatgtgtg
tgcgagttct tgcgagtctg 1928atgagacatc tctgtattgt gtttctttcc
ccagtgtttt ctgtacttgt gtaatcggct 1988aatcgccaac agattcggcg
atgaataaat gagaaataaa ttgttctgat tttgagtgca 2048aaaaaaaagg
aattagatct gtgtgtgttt tttggatccc cggggcggcc gccccgggtg
2108gtgagcttct gcag 212226144PRTArtificial Sequence 26Met Ala Ala
Cys Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr Asp Ala 1 5 10 15Val
Tyr Ala Leu Ile Cys Glu Leu Lys Gln Ala Glu Phe Asp His His 20 25
30Ala Phe Arg Val Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg
35 40 45Tyr His Leu Ala Leu Leu Asp Gly Glu Val Val Gly Met Ile Gly
Leu 50 55 60His Leu Gln Phe His Leu His His Val Asn Trp Ile Gly Glu
Ile Gln 65 70 75 80Glu Leu Val Val Met Pro Gln Ala Arg Gly Leu Asn
Val Gly Ser Lys 85 90 95Leu Leu Ala Trp Ala Glu Glu Glu Ala Arg Gln
Ala Gly Ala Glu Met 100 105 110Thr Glu Leu Ser Thr Asn Val Lys Arg
His Asp Ala His Arg Phe Tyr 115 120 125Leu Arg Glu Gly Tyr Glu Gln
Ser His Phe Arg Phe Thr Lys Ala Leu 130 135 140272378DNAArtificial
SequenceDescription of Artificial Sequenceexpression cassette
comprising a plant promoter linked to an intron, a sequence
encoding an AMPA acetyl transferase, and a termination sequence
27gatatcccta gggcggccgc gttaacaagc ttactcgagg tcattcatat gcttgagaag
60agagtcggga tagtccaaaa taaaacaaag gtaagattac ctggtcaaaa gtgaaaacat
120cagttaaaag gtggtataaa gtaaaatatc ggtaataaaa ggtggcccaa
agtgaaattt 180actcttttct actattataa aaattgagga tgtttttgtc
ggtactttga tacgtcattt 240ttgtatgaat tggtttttaa gtttattcgc
ttttggaaat gcatatctgt atttgagtcg 300ggttttaagt tcgtttgctt
ttgtaaatac agagggattt gtataagaaa tatctttaga 360aaaacccata
tgctaatttg acataatttt tgagaaaaat atatattcag gcgaattctc
420acaatgaaca ataataagat taaaatagct ttcccccgtt gcagcgcatg
ggtatttttt 480ctagtaaaaa taaaagataa acttagactc aaaacattta
caaaaacaac ccctaaagtt 540cctaaagccc aaagtgctat ccacgatcca
tagcaagccc agcccaaccc aacccaaccc 600agcccacccc agtccagcca
actggacaat agtctccaca cccccccact atcaccgtga 660gttgtccgca
cgcaccgcac gtctcgcagc caaaaaaaaa aagaaagaaa aaaaagaaaa
720agaaaaaaca gcaggtgggt ccgggtcgtg ggggccggaa acgcgaggag
gatcgcgagc 780cagcgacgag gccggccctc cctccgcttc caaagaaacg
ccccccatcg ccactatata 840catacccccc cctctcctcc catcccccca
accctaccac caccaccacc accacctcca 900cctcctcccc cctcgctgcc
ggacgacgag ctcctccccc ctccccctcc gccgccgccg 960cgccggtaac
caccccgccc ctctcctctt tctttctccg tttttttttc cgtctcggtc
1020tcgatctttg gccttggtag tttgggtggg cgagaggcgg cttcgtgccg
cccagatcgg 1080tgcgcgggag gggcgggatc tcgcggctgg ctctcgcccc
cgtggatccg gcccggatct 1140cgcggggaat ggggctctcg gatgtagatc
tgcgatccgc cgttgttggg gccgatgatg 1200gggcccttaa aatttccgcc
gtgctaaaca agatcaggaa gaggggaaaa gggcactatg 1260gtttatattt
ttatatattt ctgctgcttc gtcaggctta gatgtgctag atctttcttt
1320cttctttttg tgggtagaat ttaatccctc agcattgttc atcggtagtt
tttcttttca 1380tgattcgtga caaatgcagc ctcgtgcgga cgtttttttg
taggtagaag tgatcaacca 1440tggcgcaagt tagcagaatc tgcaatggtg
tgcagaaccc atctcttatc tccaatctct 1500cgaaatccag tcaacgcaaa
tctcccttat cggtttctct gaagacgcag cagcatccac 1560gagcttatcc
gatttcgtcg tcgtggggat tgaagaagag tgggatgacg ttaattggct
1620ctgagcttcg tcctcttaag gtcatgtctt ctgtttccac ggcgtgc atg gcc gct
1676 Met Ala Ala 1tgc gag ctt cgc cca gcc acg cag tac gac acc gac
gcc gtg tac gcg 1724Cys Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr Asp
Ala Val Tyr Ala 5 10 15ctg atc tgc gag ctc aag cag gcg gag ttc gac
cac cac gcc ttc cgc 1772Leu Ile Cys Glu Leu Lys Gln Ala Glu Phe Asp
His His Ala Phe Arg 20 25 30 35gtg ggc ttc aac gcc aac ctg cgc gac
ccc aac atg cgc tac cat ctg 1820Val Gly Phe Asn Ala Asn Leu Arg Asp
Pro Asn Met Arg Tyr His Leu 40 45 50gcg ctg ctt gat ggc gaa gtg gtc
ggc atg atc ggc ctg cac ctc cag 1868Ala Leu Leu Asp Gly Glu Val Val
Gly Met Ile Gly Leu His Leu Gln 55 60 65ttc cac ctg cat cat gtc aac
tgg atc ggc gag atc cag gag ctg gtc 1916Phe His Leu His His Val Asn
Trp Ile Gly Glu Ile Gln Glu Leu Val 70 75 80gtg atg cca cag gcg agg
ggt ctg aac gtc ggc agc aag ctc ctg gcg 1964Val Met Pro Gln Ala Arg
Gly Leu Asn Val Gly Ser Lys Leu Leu Ala 85 90 95tgg gcc gag gag gaa
gcc agg cag gcc gga gcc gag atg acc gag ctc 2012Trp Ala Glu Glu Glu
Ala Arg Gln Ala Gly Ala Glu Met Thr Glu Leu100 105 110 115agc acc
aac gtg aag cgc cac gac gcg cac cgc ttc tac ctg cgc gaa 2060Ser Thr
Asn Val Lys Arg His Asp Ala His Arg Phe Tyr Leu Arg Glu 120 125
130ggc tac gag cag agc cac ttc cgc ttc acc aag gcg ctg taaagatctg
2109Gly Tyr Glu Gln Ser His Phe Arg Phe Thr Lys Ala Leu 135
140aattcccgat cgttcaaaca tttggcaata aagtttctta agattgaatc
ctgttgccgg 2169tcttgcgatg attatcatat aatttctgtt gaattacgtt
aagcatgtaa taattaacat 2229gtaatgcatg acgttattta tgagatgggt
ttttatgatt agagtcccgc aattatacat 2289ttaatacgcg atagaaaaca
aaatatagcg cgcaaactag gataaattat cgcgcgcggt 2349gtcatctatg
ttactagatc ggggatatc 237828144PRTArtificial Sequence 28Met Ala Ala
Cys Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr Asp Ala 1 5 10 15Val
Tyr Ala Leu Ile Cys Glu Leu Lys Gln Ala Glu Phe Asp His His 20 25
30Ala Phe Arg Val Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg
35 40 45Tyr His Leu Ala Leu Leu Asp Gly Glu Val Val Gly Met Ile Gly
Leu 50 55 60His Leu Gln Phe His Leu His His Val Asn Trp Ile Gly Glu
Ile Gln 65 70 75 80Glu Leu Val Val Met Pro Gln Ala Arg Gly Leu Asn
Val Gly Ser Lys 85 90 95Leu Leu Ala Trp Ala Glu Glu Glu Ala Arg Gln
Ala Gly Ala Glu Met 100 105 110Thr Glu Leu Ser Thr Asn Val Lys Arg
His Asp Ala His Arg Phe Tyr 115 120 125Leu Arg Glu Gly Tyr Glu Gln
Ser His Phe Arg Phe Thr Lys Ala Leu 130 135 140292107DNAArtificial
SequenceDescription of Artificial Sequenceexpression cassette
comprising plant operable promoter linked to a leader, intron, a
sequence encoding an AMPA acetyltransferase, and termination
sequence 29gcggccgcgt taacaagctt ctgcaggtcc gatgtgagac ttttcaacaa
agggtaatat 60ccggaaacct cctcggattc cattgcccag ctatctgtca ctttattgtg
aagatagtgg 120aaaaggaagg tggctcctac aaatgccatc attgcgataa
aggaaaggcc atcgttgaag 180atgcctctgc cgacagtggt cccaaagatg
gacccccacc cacgaggagc atcgtggaaa 240aagaagacgt tccaaccacg
tcttcaaagc aagtggattg atgtgatggt ccgatgtgag 300acttttcaac
aaagggtaat atccggaaac ctcctcggat tccattgccc agctatctgt
360cactttattg tgaagatagt ggaaaaggaa ggtggctcct acaaatgcca
tcattgcgat 420aaaggaaagg ccatcgttga agatgcctct gccgacagtg
gtcccaaaga tggaccccca 480cccacgagga gcatcgtgga aaaagaagac
gttccaacca cgtcttcaaa gcaagtggat 540tgatgtgata tctccactga
cgtaagggat gacgcacaat cccactatcc ttcgcaagac 600ccttcctcta
tataaggaag ttcatttcat ttggagagga cacgctgaca agctgactct
660agcagatcct ctagaaccat cttccacaca ctcaagccac actattggag
aacacacagg 720gacaacacac cataagatcc aagggaggcc tccgccgccg
ccggtaacca ccccgcccct 780ctcctctttc tttctccgtt tttttttccg
tctcggtctc gatctttggc cttggtagtt 840tgggtgggcg agaggcggct
tcgtgcgcgc ccagatcggt gcgcgggagg ggcgggatct 900cgcggggaat
ggggctctcg gatgtagatc tgcgatccgc cgttgttggg ggagatgatg
960gggcgtttaa aatttcgccg tgctaaacaa gatcaggaag aggggaaaag
ggcactatgg 1020tttatatttt tatatatttc tgctgcttcg tcaggcttag
atgtgctaga tctttctttc 1080ttctttttgt gggtagaatt taatccctca
gcattgttca tcggtagttt ttcttttcat 1140gatttcgtga caaatgcagc
ctcgtgcgga gcttttttgt aggtagaagt gatcaaccat 1200ggcgcaagtt
agcagaatct gcaatggtgt gcagaaccca tctcttatct ccaatctctc
1260gaaatccagt caacgcaaat ctcccttatc ggtttctctg aagacgcagc
agcatccacg 1320agcttatccg atttcgtcgt cgtggggatt gaagaagagt
gggatgacgt taattggctc 1380tgagcttcgt cctcttaagg tcatgtcttc
tgtttccacg gcgtgc atg gcc gct 1435 Met Ala Ala 1tgc gag ctt cgc cca
gcc acg cag tac gac acc gac gcc gtg tac gcg 1483Cys Glu Leu Arg Pro
Ala Thr Gln Tyr Asp Thr Asp Ala Val Tyr Ala 5 10 15ctg atc tgc gag
ctc aag cag gcg gag ttc gac cac cac gcc ttc cgc 1531Leu Ile Cys Glu
Leu Lys Gln Ala Glu Phe Asp His His Ala Phe Arg 20 25 30 35gtg ggc
ttc aac gcc aac ctg cgc gac ccc aac atg cgc tac cat ctg 1579Val Gly
Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg Tyr His Leu 40 45 50gcg
ctg ctt gat ggc gaa gtg gtc ggc atg atc ggc ctg cac ctc cag 1627Ala
Leu Leu Asp Gly Glu Val Val Gly Met Ile Gly Leu His Leu Gln 55 60
65ttc cac ctg cat cat gtc aac tgg atc ggc gag atc cag gag ctg gtc
1675Phe His Leu His His Val Asn Trp Ile Gly Glu Ile Gln Glu Leu Val
70 75 80gtg atg cca cag gcg agg ggt ctg aac gtc ggc agc aag ctc ctg
gcg 1723Val Met Pro Gln Ala Arg Gly Leu Asn Val Gly Ser Lys Leu Leu
Ala 85 90 95tgg gcc gag gag gaa gcc agg cag gcc gga gcc gag atg acc
gag ctc 1771Trp Ala Glu Glu Glu Ala Arg Gln Ala Gly Ala Glu Met Thr
Glu Leu100 105 110 115agc acc aac gtg aag cgc cac gac gcg cac cgc
ttc tac ctg cgc gaa 1819Ser Thr Asn Val Lys Arg His Asp Ala His Arg
Phe Tyr Leu Arg Glu 120 125 130ggc tac gag cag agc cac ttc cgc ttc
acc aag gcg ctg taaagatctg 1868Gly Tyr Glu Gln Ser His Phe Arg Phe
Thr Lys Ala Leu 135 140aattctgcat gcgtttggac gtatgctcat tcaggttgga
gccaatttgg ttgatgtgtg 1928tgcgagttct tgcgagtctg atgagacatc
tctgtattgt gtttctttcc ccagtgtttt 1988ctgtacttgt gtaatcggct
aatcgccaac agattcggcg atgaataaat gagaaataaa 2048ttgttctgat
tttgagtgca aaaaaaaagg aattagatct gtgtgtgttt tttggatcc
210730144PRTArtificial Sequence 30Met Ala Ala Cys Glu Leu Arg Pro
Ala Thr Gln Tyr Asp Thr Asp Ala 1 5 10 15Val Tyr Ala Leu Ile Cys
Glu Leu Lys Gln Ala Glu Phe Asp His His 20 25 30Ala Phe Arg Val Gly
Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg 35 40 45Tyr His Leu Ala
Leu Leu Asp Gly Glu Val Val Gly Met Ile Gly Leu 50 55 60His Leu Gln
Phe His Leu His His Val Asn Trp Ile Gly Glu Ile Gln 65 70 75 80Glu
Leu Val Val Met Pro Gln Ala Arg Gly Leu Asn Val Gly Ser Lys 85 90
95Leu Leu Ala Trp Ala Glu Glu Glu Ala Arg Gln Ala Gly Ala Glu Met
100 105 110Thr Glu Leu Ser Thr Asn Val Lys Arg His Asp Ala His Arg
Phe Tyr 115 120 125Leu Arg Glu Gly Tyr Glu Gln Ser His Phe Arg Phe
Thr Lys Ala Leu 130 135 140312436DNAArtificial SequenceDescription
of Artificial Sequencemonocot expression cassette comprising plant
operable promoter linked to an intron, a sequence coding for an
AMPA acetyltransferase, and a termination sequence 31gcggccgcgt
taacaagctt ctgcaggtcc gatgtgagac ttttcaacaa agggtaatat 60ccggaaacct
cctcggattc cattgcccag ctatctgtca ctttattgtg aagatagtgg
120aaaaggaagg tggctcctac aaatgccatc attgcgataa aggaaaggcc
atcgttgaag 180atgcctctgc cgacagtggt cccaaagatg gacccccacc
cacgaggagc atcgtggaaa 240aagaagacgt tccaaccacg tcttcaaagc
aagtggattg atgtgatggt ccgatgtgag 300acttttcaac aaagggtaat
atccggaaac ctcctcggat tccattgccc agctatctgt 360cactttattg
tgaagatagt ggaaaaggaa ggtggctcct acaaatgcca tcattgcgat
420aaaggaaagg ccatcgttga agatgcctct gccgacagtg gtcccaaaga
tggaccccca 480cccacgagga gcatcgtgga aaaagaagac gttccaacca
cgtcttcaaa gcaagtggat 540tgatgtgata tctccactga cgtaagggat
gacgcacaat cccactatcc ttcgcaagac 600ccttcctcta
tataaggaag ttcatttcat ttggagagga cacgctgaca agctgactct
660agcagatcta ccgtcttcgg tacgcgctca ctccgccctc tgcctttgtt
actgccacgt 720ttctctgaat gctctcttgt gtggtgattg ctgagagtgg
tttagctgga tctagaatta 780cactctgaaa tcgtgttctg cctgtgctga
ttacttgccg tcctttgtag cagcaaaata 840tagggacatg gtagtacgaa
acgaagatag aacctacaca gcaatacgag aaatgtgtaa 900tttggtgctt
agcggtattt atttaagcac atgttggtgt tatagggcac ttggattcag
960aagtttgctg ttaatttagg cacaggcttc atactacatg ggtcaatagt
atagggattc 1020atattatagg cgatactata ataatttgtt cgtctgcaga
gcttattatt tgccaaaatt 1080agatattcct attctgtttt tgtttgtgtg
ctgttaaatt gttaacgcct gaaggaataa 1140atataaatga cgaaattttg
atgtttatct ctgctccttt attgtgacca taagtcaaga 1200tcagatgcac
ttgttttaaa tattgttgtc tgaagaaata agtactgaca gtattttgat
1260gcattgatct gcttgtttgt tgtaacaaaa tttaaaaata aagagtttcc
tttttgttgc 1320tctccttacc tcctgatggt atctagtatc taccaactga
cactatattg cttctcttta 1380catacgtatc ttgctcgatg ccttctccct
agtgttgacc agtgttactc acatagtctt 1440tgctcatttc attgtaatgc
agataccaag cggcctctag aggatccagg agcaaccatg 1500gcgcaagtta
gcagaatctg caatggtgtg cagaacccat ctcttatctc caatctctcg
1560aaatccagtc aacgcaaatc tcccttatcg gtttctctga agacgcagca
gcatccacga 1620gcttatccga tttcgtcgtc gtggggattg aagaagagtg
ggatgacgtt aattggctct 1680gagcttcgtc ctcttaaggt catgtcttct
gtttccacgg cgtgc atg gcc gct tgc 1737 Met Ala Ala Cys 1gag ctt cgc
cca gcc acg cag tac gac acc gac gcc gtg tac gcg ctg 1785Glu Leu Arg
Pro Ala Thr Gln Tyr Asp Thr Asp Ala Val Tyr Ala Leu 5 10 15 20atc
tgc gag ctc aag cag gcg gag ttc gac cac cac gcc ttc cgc gtg 1833Ile
Cys Glu Leu Lys Gln Ala Glu Phe Asp His His Ala Phe Arg Val 25 30
35ggc ttc aac gcc aac ctg cgc gac ccc aac atg cgc tac cat ctg gcg
1881Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn Met Arg Tyr His Leu Ala
40 45 50ctg ctt gat ggc gaa gtg gtc ggc atg atc ggc ctg cac ctc cag
ttc 1929Leu Leu Asp Gly Glu Val Val Gly Met Ile Gly Leu His Leu Gln
Phe 55 60 65cac ctg cat cat gtc aac tgg atc ggc gag atc cag gag ctg
gtc gtg 1977His Leu His His Val Asn Trp Ile Gly Glu Ile Gln Glu Leu
Val Val 70 75 80atg cca cag gcg agg ggt ctg aac gtc ggc agc aag ctc
ctg gcg tgg 2025Met Pro Gln Ala Arg Gly Leu Asn Val Gly Ser Lys Leu
Leu Ala Trp 85 90 95 100gcc gag gag gaa gcc agg cag gcc gga gcc gag
atg acc gag ctc agc 2073Ala Glu Glu Glu Ala Arg Gln Ala Gly Ala Glu
Met Thr Glu Leu Ser 105 110 115acc aac gtg aag cgc cac gac gcg cac
cgc ttc tac ctg cgc gaa ggc 2121Thr Asn Val Lys Arg His Asp Ala His
Arg Phe Tyr Leu Arg Glu Gly 120 125 130tac gag cag agc cac ttc cgc
ttc acc aag gcg ctg taaagatctg 2167Tyr Glu Gln Ser His Phe Arg Phe
Thr Lys Ala Leu 135 140aattcccgat cgttcaaaca tttggcaata aagtttctta
agattgaatc ctgttgccgg 2227tcttgcgatg attatcatat aatttctgtt
gaattacgtt aagcatgtaa taattaacat 2287gtaatgcatg acgttattta
tgagatgggt ttttatgatt agagtcccgc aattatacat 2347ttaatacgcg
atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt
2407gtcatctatg ttactagatc ggggatatc 243632144PRTArtificial Sequence
32Met Ala Ala Cys Glu Leu Arg Pro Ala Thr Gln Tyr Asp Thr Asp Ala 1
5 10 15Val Tyr Ala Leu Ile Cys Glu Leu Lys Gln Ala Glu Phe Asp His
His 20 25 30Ala Phe Arg Val Gly Phe Asn Ala Asn Leu Arg Asp Pro Asn
Met Arg 35 40 45Tyr His Leu Ala Leu Leu Asp Gly Glu Val Val Gly Met
Ile Gly Leu 50 55 60His Leu Gln Phe His Leu His His Val Asn Trp Ile
Gly Glu Ile Gln 65 70 75 80Glu Leu Val Val Met Pro Gln Ala Arg Gly
Leu Asn Val Gly Ser Lys 85 90 95Leu Leu Ala Trp Ala Glu Glu Glu Ala
Arg Gln Ala Gly Ala Glu Met 100 105 110Thr Glu Leu Ser Thr Asn Val
Lys Arg His Asp Ala His Arg Phe Tyr 115 120 125Leu Arg Glu Gly Tyr
Glu Gln Ser His Phe Arg Phe Thr Lys Ala Leu 130 135 140
* * * * *