U.S. patent application number 12/417294 was filed with the patent office on 2009-09-24 for human cord blood derived unrestricted somatic stem cells (ussc).
This patent application is currently assigned to Kourion Therapeutics GmbH. Invention is credited to Peter Wernet.
Application Number | 20090238803 12/417294 |
Document ID | / |
Family ID | 22925565 |
Filed Date | 2009-09-24 |
United States Patent
Application |
20090238803 |
Kind Code |
A1 |
Wernet; Peter |
September 24, 2009 |
HUMAN CORD BLOOD DERIVED UNRESTRICTED SOMATIC STEM CELLS (USSC)
Abstract
A composition in human cord and placental blood which comprises
unrestricted somatic stem cells is described here which can be
amplified in vitro to large quantities sufficient for medical
applications as regenerative medicines. Initiation and maintenance
as well as ex vivo expansion protocols of such stem cells from cord
blood is described. Furthermore, it is shown that from these cells
employing varying differentiation induction protocols distinct
lineage progenitors for hematopoiesis and endothel, as well as
mesenchymal progenitors for muscle bone, cartilage and fat as well
as neural progenitors can be cultured and expanded for use in
regenerative medicine.
Inventors: |
Wernet; Peter; (Dusseldorf,
DE) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Assignee: |
Kourion Therapeutics GmbH
Dusseldorf
DE
|
Family ID: |
22925565 |
Appl. No.: |
12/417294 |
Filed: |
April 2, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10758644 |
Jan 15, 2004 |
7556801 |
|
|
12417294 |
|
|
|
|
09985335 |
Nov 2, 2001 |
7560280 |
|
|
10758644 |
|
|
|
|
60245168 |
Nov 3, 2000 |
|
|
|
Current U.S.
Class: |
424/93.7 ;
435/372 |
Current CPC
Class: |
A61P 9/00 20180101; A61K
35/545 20130101; A61P 25/16 20180101; A61P 1/00 20180101; A61P 3/10
20180101; A61P 7/00 20180101; A61K 35/51 20130101; A61P 41/00
20180101; A61P 43/00 20180101; C12N 5/0607 20130101; A61K 35/50
20130101; A61P 25/00 20180101; A61P 1/16 20180101; A61P 21/00
20180101 |
Class at
Publication: |
424/93.7 ;
435/372 |
International
Class: |
A61K 35/14 20060101
A61K035/14; C12N 5/08 20060101 C12N005/08; A61P 9/00 20060101
A61P009/00; A61P 1/16 20060101 A61P001/16; A61P 3/10 20060101
A61P003/10; A61P 25/00 20060101 A61P025/00; A61P 25/16 20060101
A61P025/16; A61P 7/00 20060101 A61P007/00; A61K 35/12 20060101
A61K035/12 |
Claims
1. An isolated unrestricted somatic stem cell (USSC) prepared from
human umbilical cord blood or placental blood, wherein said USSC is
negative for the CD14 and CD45 antigens and positive for the CD13
and CD29 and lacks expression of hyaluronan synthase.
2. A medicament comprising the isolated cell of claim 1 and a
pharmaceutically acceptable carrier.
3. A method for treating a disease other than a disease of
connective tissue, bone, or cartilage in a human patient, said
method comprising administering to said patient an unrestricted
somatic stem cell (USSC), wherein said USSC is negative for the
CD14 and CD45 antigens and positive for the CD13 and CD29 and lacks
expression of hyaluronan synthase.
4. The method of claim 3, wherein said USSC is isolated from
umbilical cord blood or placental blood.
5. The method of claim 3, wherein said disease is a vascular
disease.
6. The method of claim 3, wherein said disease is a hepatic
disease.
7. The method of claim 3, wherein said disease is type 1
diabetes.
8. The method of claim 3, wherein said disease is a neural
disease.
9. The method of claim 3, wherein said disease is Parkinson's
disease.
10. The method of claim 3, wherein said disease is a hematological
disease.
Description
[0001] This application is a division of, and claims priority from,
U.S. Ser. No. 10/758,644, filed Jan. 15, 2004, allowed, which is a
continuation of Ser. No. 09/985,335, filed Nov. 2, 2001, allowed,
which claims benefit to the filing date of U.S. provisional patent
application 60/245,168, filed Nov. 3, 2000. Each of these
applications is hereby incorporated by reference in their
entirety.
[0002] The present invention pertains to a somatic stem cell, a
plurality of stem cells, a medicament comprising the stem cell of
the invention and a method for purification, isolation and unique
differentiation-potential of the stem cell of the invention.
[0003] Although stem cells are permanently self-replacing, they are
generally slow cycling.
[0004] Conventionally, it is thought that these cells give rise to
a transient amplifying cell population with limited self-renewal
capacity to increase numbers of differentiated cells. Hitherto, the
challenge has been to locate stem cells in the adult human and,
therefore a number of surrogate markers (e.g. colony forming tests
for the hematopoietic lineage) have been employed in the existing
literature.
[0005] A number of U.S. patents e.g. U.S. Pat. Nos. 5,486,359;
5,591,625; 5,736,396; 5,811,094; 5,827,740; 5,837,539; 5,908,782;
5,908,784; 5,942,225; 5,965,436; 6,010,696; 6,022,540; 6,087,113;
5,858,390; 5,804,446; 5,856,796; 5,654,186; 6,054,121; 5,827,735;
5,906,934 are dealing with mesenchymal stem cells (MSC), which can
be differentiated into several progenitor cells, for example muscle
progenitor cells, connective tissue cell progenitors or oval cells.
Muscle progenitor cells are differentiating further into cardiac,
skeletal as well as smooth muscle cells, whereas the connective
tissue cell progenitor may differentiate into bone, cartilage as
well as fat. Oval cells can differentiate into liver or pancreas
cells (Grompe et al, 2001).
[0006] The presence of non-hematopoietic stem cells within
umbilical cord blood is still under discussion (Mayani et al. 2000,
Mareschi et al. 2001). The German patent application DE 198 03 267
A1 was the first to describe osteoblast progenitors and bone
formation from human cord blood.
[0007] However, the use of these mesenchymal progenitor cells of
prior art is often limited since they are too far developed in
order to be useful tools for generating organs or tissues. In other
words, they seem to be already too much committed and specialized
to yield a functional regenerating organ or tissue.
[0008] It is therefore an object of the invention to provide a stem
cell which is able to differentiate into different progenitor cells
such as mesenchymal cells, neural cells, blood cells or endothelial
cells.
[0009] It is another object of the invention to provide a stem cell
which does not have the drawbacks of embryonic stem cells.
[0010] It has been found that a newly identified somatic stem cell
is able to solve the objects addressed above. The somatic stem cell
of the invention is derived from human umbilical cord blood,
placental blood and/or the blood from a newborn child, said somatic
stem cell being distinct from but capable to differentiate into
mesenchymal stem or progenitor cells, hematopoietic lineage stem or
progenitor cells, neural stem or progenitor cells or endothelial
stem or liver progenitor cells. These cells represent the
progenitor of the hematopoietic lineage, the mesenchymal stem cells
as well as neural stem cells. This unique multifunctional capacity
and the technology to expand these cord blood (CB) derived
unrestricted somatic stem cells (USSC), either as such somatic stem
cells or as committed cells under distinct differentiation
protocols, allows precise characterization, standardization and
utilization for the production and implementation of stem cell
therapy in regenerative medicine.
[0011] FIG. 1 shows a photomicrograph of primary USSC culture Cells
plated at low density.
[0012] FIG. 2 shows a photomicrograph of confluent USSC
culture.
[0013] FIG. 3 shows a FACS analysis for CD45 antigen over course of
in vitro culture.
[0014] FIG. 4 shows a FACS analysis for SSEA4 embryonic marker.
[0015] FIG. 5 shows a FACS analysis for HLA-class I (A,B,C), HLA DR
and CD14.
[0016] FIG. 6 shows a FACS kinetic for CD34 surface marker.
[0017] FIG. 7 shows a photomicrograph of USSC cells after neuronal
induction.
[0018] FIG. 8 shows that USSCs of the invention express the neural
stem cell marker nestin anti-nestin immunostaining.
[0019] FIG. 9 shows USSCs generating cells of the neuronal
lineage.
[0020] FIG. 10 shows USSCs generating cells of the glial
lineage.
[0021] FIG. 11 shows mineralised nodule formation after osteogenic
induction and after staining with alizarin red (B).
[0022] FIG. 12 shows Alcian Blue staining of USSC-derived pellet
culture.
[0023] FIG. 13 shows collagen type II staining (green) of USSC
cultures after chondrogenic differentiation.
[0024] FIG. 14 shows adipogenic differentiation of USSC cultures as
demonstrated by Oil Red staining.
[0025] FIG. 15 shows photomicrographs of USSC cultures before and
after myogenic differentiation.
[0026] FIG. 16 shows immunocytochemistry for slow-acting myosin
after azacytidine treatment.
[0027] FIG. 17 shows oval cell phenotype of USSC derivatives.
[0028] FIG. 18 shows survival and integration of USSC cultures
after injection into SCID mouse liver parenchyma.
[0029] The somatic stem cells of the invention can be isolated and
purified by several methods comprising the steps of density
gradient isolation, culture of adherent cells and subculture
applying growth factors as described in example 1. After a
confluent cell layer has been established, the isolation process to
derive cells of this invention is routinely controlled by
morphology (fibroblastoid morphology) and phenotypical analyses
using antibodies directed against CD13 (positive), CD14 (negative),
CD45 (negative), and CD29 (positive; see example 2) surface
antigens.
[0030] The somatic stem cell of the invention is reacting
negatively with markers specific for the hematopoietic lineage
such, as CD45 and hence, is distinct from hematopoietic stem cells
which can also be isolated from placental cord blood. CD14 is
another surface antigen that can not be detected on USSCs. Further,
the stem cell of this invention is characterized by a set of
antigens which are present on the cell surface such as CD13, CD29,
CD44, and CD49e. USSC preparations are further characterized by the
presence of mRNA transcripts for certain receptor molecules like
epidermal growth factor receptor (EGF-R), platelet derived growth
factor receptor alpha (PDGF-RA), and insulin growth factor receptor
(IGF-R). These cells are also typically expressing transcription
factors such as YB1 (Y-box transcription factor 1), Runx1 (runt
related transcription factor 1) and AML1C (acute myeloid leukemia 1
transcription factor) as detected by RT-PCR. However, USSC
preparations are typically negative for transcripts for the
chondrogenic transcription factor Cart-1 and neural markers such as
neurofilament, synaptophysin, tyrosine hydroxylase (TH) and glial
fibrillary acidic protein (GFAP).
TABLE-US-00001 TABLE 1 Analysis of the transcription patterns of
USSCs by RT-PCR Name PCR-result USSC PCR-result (other tissue)
PDGFR alpha + +(adult bone) IGFR + +(adult bone) Neurofilament -
+(adult liver) CD105 + +(mononuclear cells from CB) GFAP - +(fetal
brain) Synaptophysin - +(fetal brain) Tyrosinhydroxylase - +(fetal
brain) YB1 + +(fetal brain) Runx1 + +(adult bone) AML1c + +(adult
bone) BMPR II + +(adult cartilage) Collagen type I + +(adult bone)
Cart-1 - +(mononuclear cells from CB) Chondroadherin - +(adult
bone) CD49e + +(adult bone) RT-PCR results achieved with predicted
oligonucleotide primers and mRNAs from USSCs and positive control
mRNAs from other tissues like bone, cartilage, brain or cord blood
mononuclear cells.
[0031] The RNA expression of USSC preparations and bone marrow
derived MSCs (Caplan, 1991) were directly compared by using
quantitative Affymetrix GeneChip.TM. microarrays. The transcript of
the Fibulin-2 gene (gene bank number X82494) was detected in USSCs
at high expression levels but not in MSCs production was previously
demonstrated in fibroblasts (Pan et al., 1993). Northern blot
analysis of mRNA from various human tissues reveals an abundant
4.5-kb transcript in heart, placenta and ovary tissues (Zhang et
al., 1994). The protein has been localized at the light
microscopical level in human embryos of gestational weeks 4-10,
using polyclonal antibodies. Fibulin-2 was detected primarily
within the neuropithelium, spinal ganglia and peripheral nerves
(Miosge et al., 1996)
[0032] In the rat animal model, rat liver myofibroblasts (rMF) are
colocalized with fibulin-2. These cells were located in the portal
field, the walls of central veins, and only occasionally in the
parenchyma. In early stages of fibrosis rMF were detected within
the developing scars. In advanced stages of fibrosis rMF accounted
for the majority of the cells located within the scar (Knittel et
al., 1999). In an other animal model, mouse Fibulin-2 protein is
expressed during epithelial-mesenchymal transformation in the
endocardial cushion matrix during embryonic heart development.
Fibulin-2 is also synthesized by the smooth muscle precursor cells
of developing aortic arch vessels and the coronary endothelial
cells that are originated from neural crest cells and epicardial
cells, respectively (Tsuda et al., 2001).
[0033] The transcripts of the Hyaluronan Synthase gene (D84424),
Fibromodulin gene (U05291) and the transcript 1NFLS (W03846) were
not detected in USSCs but at high levels in MSCs. Northern blot
analysis indicated that the Hyaluronan Synthase is ubiquitously
expressed in human tissues (Itano and Kimata, 1996). The product of
this enzyme, Hyaluronan, serves a variety of functions, including
space filling, lubrication of joints, and provision of a matrix
through which cells can migrate (Hall et al., 1995). Fibromodulin
is a member of a family of small interstitial proteoglycans. The
protein exhibits a wide tissue distribution, with the highest
abundance observed in articular cartilage, tendon, and ligament
(Sztrolovics et al., 1994). The transcript 1NFLS was cloned from
human fetal liver.
[0034] The CD24 gene (L33930) is expressed in a very low level in
the USSCs compared with the expression level in the MSCs. CD24 is
expressed in many B-lineage cells and on mature granulocytes (Van
der Schoot et al., 1989).
[0035] When compared to MSCs, the somatic cells of this invention
are distinct based on the tissue source they are isolated from.
Further, USSCs are characterized by no expression of human
leukocyte antigen class I (HLA-class I). In contrast to the somatic
stem cells of this invention, the previously described MSCs
isolated from bone marrow and muscle tissue, express very high
levels of HLA-class I antigen on their cell surface. The cell of
this invention also expresses the stage specific early antigen 4
(SSEA4) (see FIG. 4).
[0036] Typically, the somatic stem cell of the invention shows
fibroblastoid cell shape and proliferates in an adherent
manner.
[0037] In a preferred embodiment of the present invention the
somatic stem cell of the invention (USSC) is present in a plurality
or mixtures representing precursors of other somatic stem cells
e.g. of the haematopoietic lineage preferably expressing AC133 and
CD34, mesenchymal progenitor somatic stem cells, neuronal
progenitor somatic stem cells or combinations thereof. This
embodiment is advantageous since it comprises a high regenerative
potential based on the capability to differentiate into other
different somatic stem cells or the presence of such somatic stem
cells as preferred embodiment of the invention. Preferably the
mesenchymal progenitor somatic stem cells or the neural progenitor
somatic stem cells are produced by differentiation from a stem cell
of the invention.
[0038] According to the invention a medicament (regenerative
therapeutic) is provided comprising the somatic stem cells of the
invention as well as a plurality or mixtures of somatic stem cells
according to the invention. The medicament may further contain
carrier substances or auxiliary substances, which are medically and
pharmacologically acceptable. The present invention is also related
with a method of using USSC or a plurality or mixtures of stem
cells of the invention in gene therapy, organ replacement, testing
of pharmaceuticals, in vitro growth of blood vessels, therapy of
vascular, bone, hepatic, pancreatic and neural diseases.
[0039] For example, the USSCs of the present invention may be
applied locally at the site of need, e.g. with or without
biomaterials.
[0040] Depending on the kind of disease local and/or systemic
administration of the USSCs is suitable. The USSCs may be applied
directly or together with pharmaceutically acceptable carriers or
adjuvants. It may be advantageous to add further substances which
promote curing of the diseases. For example, in orthopedic
applications substances which improve bone regeneration may be
co-applied with the USSCs.
[0041] Basically, the methods known for the application of MSCs can
be applied in an analogous manner when applying USSCs. Furthermore,
the application of stem cells is described for example in B. E.
Strauer et al. M. "Intrakoronare, humane autologe
Stammzelltransplantation zur Myokardregeneration nach Herzinfarkt",
Dtsch med Wochenschr 2001; 126: 932-938; Quarto R., et al. "Repair
of Large Bone Defects with the Use of Autologous Bone Marrow
Stromal Cells", N Engl J Med 2001; 344:385-386; Vacanti C. A.,
"Brief Report: Replacement of an Avulsed Phalanx with
Tissue-Engineered Bone" N Engl J Med 2001; 344:1511-1514, May 17,
2001; Hentz V. R., "Tissue Engineering for Reconstruction of the
Thumb", N Engl 3 Med 2001; 344:1547-1548; Brittberg M., "Treatment
of Deep Cartilage Defects in the Knee with Autologous Chondrocyte
Transplantation", N Engl J Med 1994; 331:889-895, Oct. 6, 1994;
Freed C. R., "Transplantation of Embryonic Dopamine Neurons for
Severe Parkinson's Disease", N Engl J Med 2001; 344:710-719;
Shin'oka T., "Transplantation of a Tissue-Engineered Pulmonary
Artery", N Engl J Med 2001; 344:532-533. Shapiro A. M. J., Islet
Transplantation in Seven Patients with Type 1 Diabetes Mellitus
Using a Glucocorticoid-Free Immunosuppressive Regimen N Engl J Med
2000; 343:230-238. These references are incorporated by
reference.
[0042] The stem cells of the invention are further described in
greater detail.
[0043] The stem cells of the invention are adherent cells with a
fibroblastoid cell shape and two or three nucleoli (see FIG. 1)
obtained after trypsin EDTA-treatment and reseeding under
appropriate culture conditions (example 1) rapidly expand to
confluence of a long stretched morphology (FIG. 2). FIG. 1 shows a
photomicrograph of primary USSC culture. The cells plated at low
density demonstrate the fibroblastoid morphology of USSCs. These
cells can readily be grown over greater than 14 culture passages.
FIG. 2 shows a photomicrograph of confluent USSC culture. Almost
confluent cell USSC layer shows a parallel orientation of
cells.
[0044] The surface marker phenotype of the primary adherent cell
layer as well as all derivatives thereof in subsequent passages are
and remain negative for the CD45 marker. FIG. 3 shows a FACS
analysis for CD45 antigen over the course of in vitro culture,
CD45, a characteristic marker antigen for hematopoietic cell is
almost not detectable in USSCs from later passages. (FIG. 3 at days
48, 54, 82).
[0045] After in vitro culture using method A (example 1), USSC
preparations become positive for the stage-specific early antigen 4
(SSEA4) and show the homogenous expression of this embryonic
marker. FIG. 4 shows a FACS analysis for SSEA4 embryonic marker.
Cells expanded by method A (example 1) strongly show expression of
the stage-specific early antigen 4 (SSEA4). At the same time, USSC
cultures are negative for HLA-class I surface antigen expression.
(FIG. 5A), HLA-DR antigen expression (FIG. 5B) as well as CD14
negative (FIG. 5C). FIG. 5 shows a FACS analysis for HLA-class I
(A,B,C), HLA DR and CD14. USSC cultures of the invention after
expansion in vitro are negative for HLA-class I antigens (Panel A).
These cells are also negative for HLA-DR (Panel B) and CD14 (Panel
C) surface antigens, characteristic for antigen presenting cells
(HLA-DR) and monocytes (CD14).
[0046] FIG. 6 shows a FACS kinetic for CD34 surface marker. The
USSCs were grown in H5100/PEI for over 10 passages. During this
culture period a significant increase of CD34 antigen expression
was observed. With regard to the hematopoietic stem cell marker
CD34, FIG. 6 reveals that in passage 3 until day 54 no CD34
positive cells can be detected. In contrast, in the seventh passage
on day 82 a novel CD34 positive subpopulation is appearing. On the
other hand, if such CD34 or/and FIK1 positive progenitors were
cultured with cytokine conditioned medium specific for
hematopoietic differentiation, the typical mixed or hematopoietic
colonies for red and white blood cell precursors (CFU-GM and BFU-E)
developed comparable to CD45.sup.+ hematopoeitic progenitor cells
(Example 9).
[0047] On the other hand, if cord blood mononuclear cells depleted
for CD14 are cultured in high glucose containing medium, they
reveal the typical characteristics of neural stem cells. FIG. 7
shows a photomicrograph of USSC cells after neuronal induction.
USSCs of the invention cultured in Dulbecco's modified eagle medium
(DMEM) high glucose demonstrate an astrocyte-like morphology. FIG.
7 shows an example of such cultured cells showing glial morphology
obtained after 13 days in culture (example 6). After being expanded
with PEI, USSCs express the neural stem cell marker nestin. A first
observation indicates that nestin staining is less pronounced after
cells have been stimulated with neural inducing agents like
retinoid acid (RA), basic fibroblast growth factor bFGF, and nerve
growth factor .beta. (NGF-.beta.) (McKay, 1997).
[0048] In detail, FIG. 8 shows USSCs of the invention expressing
the neural stem cell marker nestin. (A) USSCs were incubated in
H5100/PEI medium for 7 days and subjected to standard anti-nestin
immunohistochemistry. (B) Cells were incubated for 7 days in
H5100/PEI following 9 days of induction in H5100 with RA, bFGF, and
NGF. Note that nestin staining is reduced compared to cells grown
under conditions in (A).
[0049] Further analysis of these cells reveals also expression of
proteins characteristic for neural cells like .gamma.-aminobutyric
acid (GABA, FIG. 9 B), tyrosine hydroxylase (FIG. 9 B),
synaptophysin (FIG. 9 D), neurofilament (FIG. 9 F), or typical
glial antigens like galactocerebroside (GalC, FIG. 10B) and glial
fibrillary acidic protein (GFAP, FIG. 10 D). FIG. 9 shows USSCs of
the invention generating cells of the neuronal lineage. USSCs of
the invention were grown in H5100/PEI for 7 days and kept for 27
days on H5100 containing RA, bFGF and NGF. After standard fixation
protocols, neuronal specific antibodies were applied. (A, C, D)
Phase-contrast photographs, (B, D, F) fluorescence photographs of
same preparations as in A, C, D. The DNA stainer DAPI (blue) is
used to stain the nucleus of cells. (B) Double-immunofluorescence
photograph using anti-GABA (red), and anti-tyrosine hydroxylase
(TH, green). (D) An anti-synaptophysin staining (green). (F) A
neuron specific anti-neurofilament staining is shown (red). A
cocktail of antibodies against different subtypes of neurofilament
was used. FIG. 10 shows USSCs of the invention generating cells of
the glial lineage. Cells were subjected to the same cell culture
conditions as shown in FIG. 9. DAPI is in blue. (A, C)
Representation of phase contrast photographs. (B) Same cells as
seen in (A) which have been subjected to anti-GalC immunostaining
(red). (D) Same cell as in (C) stained with the anti-glial
fibrillary acid protein (GFAP, red).
[0050] If, however, the above described universal stem cells are
taken from any of the expansion passages and induced in DAG
(dexamethasone, ascorbic acid, .beta.-glycerol phosphate)
containing culture conditions or in fibronectin containing medium,
differentiation along the osteogenic lineage is induced (example
3). As shown in Table 2, bone specific marker genes (alkaline
phosphatase, osteocalcin, collagen type I) are readily induced and
detectable by RT-PCR.
TABLE-US-00002 TABLE 2 RT-PCR analysis during osteogenic
differentiation of USSCs. control day 7 day 14 .beta.-actin (pos.
control) + + + alkaline phosphatase - + + collagen type II - + +
osteocalcin + + -
[0051] All three marker genes of osteogenic differentiation show an
increased mRNA expression at day 7 of DAG induction. .beta.-actin
serves as a positive control.
[0052] FIG. 11 shows a mineralised nodule formation after
osteogenic induction and after staining with alizarin red (B).
Osteogenic differentiation of nearly confluent USSC layers was
induced by addition of dexamethasone, ascorbic acid and
.beta.-glycerolphosphate to the culture medium H5100. At day 10 of
stimulation characteristic bone nodules appear (11A). Mineral
deposition of these nodules can be demonstrated by Alizarin Red
staining (11B). Under these osteogenic induction conditions, the
cells of the invention undergo complete osteogenic differentiation
as demonstrated by accumulation of mineralised bone in distinct
nodules (FIG. 11A) which can be stained with Alizarin Red (FIG.
11B). Alternatively, the accumulation of hydroxyapatite in the cell
culture can be detected after six days by von Kossa staining
[0053] From these results it is evident, that cord blood contains a
hitherto undetected very early stem cell which can be expanded to
large quantities. In addition, this cell can be induced to
differentiate into MSCs and from there into osteoblasts, as already
demonstrated in FIG. 11A. After complete induction with DAG a
further differentiation to mineralized bone nodules can be
obtained, as shown in FIG. 11B with Alizarin Red staining.
[0054] The versatily of the cells of this invention is even greater
as demonstrated by the chondrogenic differentiation after
cultivation in DMEM high glucose containing dexamethasone, proline,
sodium pyruvate, ITS+ Premix, and TGF-.beta.1 (Johnstone et al.,
1998). At day 0, and 14, of these differentiation experiments,
cells were harvested and analyzed by RT-PCR (Table 3, example
4).
TABLE-US-00003 TABLE 3 RT-PCR analysis during chondrogenic
differentiation of USSCs Control day 14 .beta.-actin (pos. control)
+ + Cart-1 - + collagen type II (unspliced) - + Chondroadherin -
+
[0055] At day 14 of chondrogenic stimulation three characteristic
marker genes of on going chondrogenesis are expressed.
[0056] The results of these studies clearly demonstrate the
upregulation of Cart-1, a specific chondrogenic transcription
factor 14 days after chondrogenic stimulation. Furthermore mRNA
transcripts for two typical cartilage extracellular proteins
(collagen type II and chondroadherin) were also upregulated.
Furthermore, the cells of this invention clearly produced
extracellular proteoglycan molecules typical for chondrocytic
differentiation as demonstrated by Alcian Blue staining.
[0057] FIG. 12 shows Alcian Blue staining of USSC-derived pellet
culture. USSCs were grown under sedimentation culture in a
chondrogenic differentiation medium. After 6 days in induction
medium, no significant amounts of proteoglycans (PG) as
characteristic markers of chondrogenic differentiation are
detectable by Alcian Blue staining (Panel A). In contrast, PGs are
readily detectable as indicated by the blue/green color (Panel
B).
[0058] Furthermore, the presence of the cartilage-specific collagen
type II could be demonstrated at the protein level. FIG. 13:
Collagen type II staining (green) of USSC cultures after
chondrogenic differentiation.
[0059] USSCs were cultured in a chondrogenic differentiation
medium. The expression of the extracellular matrix protein collagen
type II at day 14 was demonstrated by fluorescence microscopy using
anti-collagen type II primary antibody and a FITC anti-mouse
secondary antibody (FIG. 13B).
[0060] The further versatility of the unrestricted stem cell is
shown here by differentiation of such previously under the
PEI-protocol expanded cultures into fat cells with higher
concentrations of dexamethasone (example 5).
[0061] FIG. 14 shows fat cells which can be specifically stained
with Oil Red (Sigma). Adipocytes are characterized by a high amount
of intracellular vesicles and a specific red staining with Oil
Red.
[0062] Furthermore, USSCs when cultured for 24 h in H5100 with 10
.mu.M 5'-azacytidine and subsequently with 100 ng/ml bFGF show
strong evidence for muscle differentiation. A change in cell
morphology is accompanied by the expression of slow-acting myosin
(FIGS. 15 and 16).
[0063] In addition, the appearance and proliferation of typical
oval cells is regularly observed in late passages (FIG. 17) when
PEI induced USSCs are subcloned from the CD34.sup.4 subpopulation,
which has been shown in FIG. 6 (example 8). These cells to variable
degrees express the enzyme dipeptidyl peptidase IV, meaning that
such oval cells can further differentiate into liver cells. In
vitro expanded USSC survive and persist after injection into
regenerating livers of SCID mice with 50% partial hepatectomy as
well as non-hepatectomised livers whereas cord blood derived
mononuclear cells cannot be detected even when 25 fold higher cell
numbers are transplanted. FIG. 18 shows the survival and
integration of USSC cultures after injection into SCID mouse liver
parenchyma. FIG. 18 A: Red fluorescence 7 days after
transplantation indicates survival and integration of human
PKH26-labelled USSCs of the invention into the mouse liver tissue
(without hepatectomy). In contrast, after transplantation of cord
blood derived mononuclear cells (MNCs) no red fluorescence
indicating integration of human MNCs was detectable. FIG. 18 B:
Cryo-section of mouse liver tissue corresponding to A: Transmission
light micrograph of mouse liver tissue with integrated human
USSCs.
[0064] Since the precursor for liver and pancreatic .beta. island
cells is identical, such CB-derived oval cells can also be
differentiated into insulin producing .beta.-island cells making
them useful tools for cell therapy in diabetic patients or in
patients with hepatic failure.
[0065] In addition to these obvious clinical applications any of
the well characterized and under standardized conditions expanded
stem cell components and their progeny can be used to monitor and
define actions and molecular as well as cellular effects of newly
developed pharmacological agents and thus substitute also for
certain animal based experimentation.
[0066] Thus, these well standardized stem cells and differentiated
cells derived from the human cord blood cultures described here be
used as a valuable test reagent for the pharmaceutical and
biomaterial industry.
[0067] USSC preparations under appropriate culture conditions
developed multiple colonies of different hematopoietic lineages,
providing evidence that these cells can give rise to
hematopoiesis.
[0068] Under appropriately conditioned culture medium with defined
concentrations of VEGF, Flt 3L, SCGF (stem cell growth factor) and
in methyl-cellulose such cells develop mixed colonies with cells
also positive for FLK1+ and AC133+, Tie1 and Tie2 markers. Upon
further differentiation the marker profile characteristic for
endothelial cells with AC133 negative, CD31.sup.+, CD54.sup.+,
VWF.sup.+, VE-Catherin.sup.+ did develop.
[0069] The obvious utility of such endothelial cells for the in
vitro growth of autologous and allogeneic blood vessels for therapy
of vascular diseases is claimed here.
[0070] At the same time it is clear that all these in vitro
generated and homogeneously expanded progenitors and their
differentiated cells will--on a clonal level--serve as extremely
important tools for the definition of the role of specific genes
and their products in cell biology and all following medical
applications based on cell- or molecule-mediated therapies.
[0071] Only small numbers of this unique cell type are sufficient
to generate large numbers of adherently growing USSCs of the
invention and the more differentiated mesenchymal stem cell for the
production of medically applicable regenerative cell types.
[0072] One completely new aspect of this knowledge is the fact that
such progenitors can asymmetrically develop into two or more
distinctly differentiating cell types. This reveals a new
biological principle of co-component regulation in functionally
oriented cell regeneration taking place even in vitro.
[0073] The consequence of this invention is that stem cell based
therapeutics have to be engineered according to this principle and
not only consist of one clonal cell type. The invention is further
described in the following non limiting examples.
Example 1
Collection of Cord Blood (CB)
[0074] Collection of cord blood in the Obstetric Departments was
performed with informed consent of the mother. After delivery of
the baby with the placenta still in utero, the umbilical cord was
doubly clamped and transfected 7-10 cm away from the umbilicus.
After disinfection of the cord, the umbilical vein was punctured
and CB collected into collection bags containing citrate phosphate
dextrose (CPD) as anticoagulant.
Isolation of Mononuclear Cells from Cord Blood
[0075] Umbilical cord blood was carefully loaded onto Ficoll
solution (density 1.077 g/cm.sup.3). A density gradient
centrifugation was performed (450 g, room temperature, 25 min). The
mononuclear cells (MNC) of the interphase were collected and washed
twice in phosphate buffer saline, pH 7.3 (PBS).
Generation of Adherent Layers of Fibroblastoid Morphology
[0076] Mononuclear cells were plated out at a density of about
5.times.10.sup.3 cells/cm.sup.2 in T25 culture flasks (Nunclon)
[A.), B.), C.)]. Four different culture methods were used to
initiate growth of adherent stem cells:
A.) CB-derived MNCs were initially cultured in Myelocult H5100
medium (StemCell Technologies, Vancouver/Canada) containing
10.sup.-7 M dexamethasone. B.) CB-derived MNCs were initially
cultured in Mesencult (StemCell Technologies, Vancouver/Canada)
containing 10.sup.-7 M dexamethasone. C.) B-derived MNCs were
initially cultured in DMEM low glucose (Bio-Whittaker) with 30% FCS
containing 10.sup.-7 M dexamethasone. D.) CB-derived MNCs were
plated at a density of 5.times.10.sup.6/ml in 10 ml Myelocult H5100
Medium (StemCell Technologies, Vancouver, Canada) into 50 ml
culture-flasks (Nunclon) without dexamethasone.
[0077] All cultures were incubated at 37.degree. C. In 5% CO.sub.2
in a fully humidified atmosphere, and were fed once a week by
removing the complete medium with the non-adherent cells and adding
10 ml of fresh medium. After several time points the adherent
spindle-shaped cells were removed by treatment with 0.05% trypsin
and 0.53 mM EDTA for 2 min, rinsed with 50% serum-containing
medium, collected by centrifugation at 780 g and analyzed by Flow
cytometry or RT-PCR. After two to three weeks, adherent cells of
fibroblastoid morphology appear in about 30% of all cell
cultures.
Culture Condition for the Expansion of USSCs of the Invention
[0078] USSCs of the invention can be expanded in H5100 medium
containing 10 ng/ml IGF I (Insulin-like growth factor-I), 10 ng/ml
PDGF-BB (Platelet-derived growth factor-BB) and 10 ng/ml rh-human
EGF (Recombinant Human epidermal growth factor) (PEI medium) at a
density ranging from 1.times.10.sup.4 and 1.times.10.sup.5 cells/ml
(expansion method A). Alternatively, USSC preparations can be
expanded in the initial growth medium A, B, and C.
Example 2
Immunophenotyping of Cells by Cytofluorometry
[0079] In order to determine the immunophenotype of USSCs, cells
were stained with FITC-conjugated anti-CD45 (Becton Dickinson,
Coulter), PE conjugated anti-CD14 (PharMingen, Coulter),
anti-SSEA-4 (MC-813-70) labeled with goat F(ab').sub.2 anti-Mouse
IgG+IgM (H+L)-FITC (Coulter), anti-CD10-PE (CALLA, PharMingen),
anti-HLA-class I (Coulter) labeled with goat F(ab').sub.2
anti-Mouse IgG+IgM (H+L)-FITC, anti-CD13-PE (Becton Dickinson,
Coulter); anti-CD29 (Coulter), anti CD44 (Coulter), anti-CD49e
(Coulter), anti-CD90 (Coulter), anti-HLA-class II-FITC (Coulter).
Cells were analyzed using an EPICS XL (Coulter) or a FACS analyzer
(Becton Dickinson).
Example 3
Demonstration of the Osteogenic Differentiation Potential of
USSCs
[0080] USSCs obtained as described in example 1 were cultured in a
standard medium until they reach 70% confluency. Osteogenic
differentiation of these cells was induced by addition of 10.sup.-7
M dexamethasone, 50 .mu.g/ml ascorbic acid, and 10 mM
6-glycerolphosphat (Bruder et al. 1994, Jaiswal et al., 1997). At
day 10 of stimulation, cells showed calcium phosphate deposits
resulting in bone nodules. Mineralized bone nodules were detected
by staining with Alizarin red as follows: The adherent cells in
culture were washed twice with PBS, pH7.3 and stained with 5 ml
0.10% Alizarin Red solution for one hour at room temperature and
subsequently with 0.1% acetic acid and absolute ethanol as well as
PBS. Alizarin Red and von Kossa staining of calcium demonstrate the
mineralisation potential of these cells (Stanford et al., 1995,
Rungby et al., 1993). Osteogenic differentiation was also
demonstrated by RT-PCR using the bone-specific differentiation
markers osteocalcin (OC), osteopontin (OP), bone-specific alkaline
phospatase (AP), bone sialo-protein (BSP), platelet-derived growth
factor receptor alpha (PDGF-Ra), epidermal growth factor receptor
(EGFR), and collagen type I.
Example 4
Demonstration of the Chondrogenic Differentiation Potential of
USSCs
[0081] For chondrogenic differentiation 2.times.10.sup.5 adherent
stem cells were placed in sedimentation culture in 15 ml
polypropylene tubes. DMEM high glucose containing dexamethasone,
praline, sodium pyruvate, ITS+Premix, and TGF-.beta.1 was used as
cell culture medium (Johnstone et al., 1998, Yoo et al., 1998). At
day 7, 14, and 21 cell fractions were analysed by RT-PCR for the
cartilage specific gene products encoding Cart-1, collagen type II
and chondroadherin. In addition, the USSCs were used in
sedimentation cultures. After two weeks Dewax sections were fixed
with 4% paraformaldehyde for 15 min at room temperature and washed
in ethanol. Sections were stained in 1% Alcian Blue/3% acetic acid,
pH 2.5 (Sigma) for 5 min and washed in distilled water. They
clearly demonstrate a positive staining of specific proteoglycans
as demonstrated by Alcian Blue staining (FIG. 12) (Chao, G. et al.,
1993). After a chondrogenic induction period of 14 days cells were
fixed according to a standard protocol and analyzed by fluorescence
microscopy (Rosenbaum et al., 1998) demonstrating the presence of
collagen type II specific extracellular matrix (FIG. 13B).
Example 5
Demonstration of the Adipogenic Differentiation Potential of
USSCs
[0082] USSC were cultured in H5100 containing 10.sup.-6 M
dexamethasone, 50 .mu.g/ml ascorbic acid and 10 mM
.beta.-glycerolphosphat resulting in partly differentiation of
USSCs towards adipocytes as demonstrated by Oil Red staining
(Ramirez-Zacarias et al., 1992).
Example 6
Demonstration of the Neurogenic Differentiation Potential of
USSCs
Cell Isolation and Culture Conditions for Glial Cells
[0083] Mononuclear cord blood cells obtained as described were
depleted for CD14+ cells by CD14/magnetic Activated Cell Sorting
(MACS) isolation system employing VS+ separation columns according
to the instructions of the manufacturer (Miltenyi Biotec, Bergisch
Gladbach). The CD14 depleted mononuclear cells were cultured at a
density of 2.times.10.sup.6/ml in 10 ml High Glucose Medium
(Dulbecco's MEM with 4500 G/L Glucose) into T25 culture-flasks
(Nunclon) and incubated at 37.degree. C. in 5% CO.sub.2 in a fully
humidified atmosphere. After 10-15 days in culture glial shaped
cells were detected.
Differentiation Towards Neural Cells
[0084] A) Cells were expanded for 7 days either in H5100 medium
alone or in the presence of 40 pg/ml PDGFB, 10 pg/ml EGF, 10 pg/ml
IGF-I. Cells were trypsinized and plated at a density of about
3.5.times.10.sup.3 cells/cm.sup.2 in 24-well culture dishes on
coverslips coated with poly D-lysin (PDL) and laminin (PDL/lam).
Subsequently, neuronal differentiation was initiated by addition of
inducing agents such as all-trans retinoid acid (10.sup.-5 M), bFGF
(20 ng/ml), and NGF-.beta. (50 ng/ml).
Fluorescence Microscopy
[0085] After the induction period (27 days) cells were fixed
according to a standard protocol (Rosenbaum et al., 1998) and
stained with antibodies against neural specific antigens. Specimen
were analyzed using fluorescence and transmission light
microscopy.
Example 7
Demonstration of Differentiation Potential in the Myocytic
Lineage
[0086] 1.times.10.sup.4 USSCs were cultured in H5100 medium
(StemCell Technology) supplemented with 10 ng/ml PDGFBB, 10 ng/ml
EGF, 10 ng/ml IGF at 37.degree. C., 5% CO.sup.2 until they reach
about 70% confluency. Thereafter cells were incubated with 10 .mu.M
5'-azacytidine (Sigma) for 24 h, washed twice with PBS and cultured
in H5100 medium supplemented with 100 ng/ml bFGF (Sigma). After 1
week in differentiation medium, the morphology of the cells changed
(FIG. 15). After 10 days, the cells were trypsinized and
transferred to fibronectin-coated glass chamber slide for
immunostaining.
Immunohistochemistry
[0087] Cells were fixed with 5% formaldehyde/PBS for 15 min and
washed twice in PBS, pH7.3. Using a standard protocol, cells were
incubated with an anti-skeletal myosin (slow) specific primary
antibody (clone NOQ7.5.4D, 1:400) (shown in green) and with
anti-CD13 primary antibody (shown in red) or a monoclonal
anti-skeletal myosin primary antibody (clone MY-32, 1:4000).
Staining was positive for USSCs cultured under the above culture
conditions (FIG. 16).
Example 8
[0088] Human USSC cells as well as cord blood derived mononuclear
cells (MNC) were labeled with the PKH26 RED Fluorescent Cell Linker
Kit (Sigma, PKH26-GL). 2.times.10.sup.5 USSCs and 5.times.10.sup.6
MNCs were injected into the liver parenchyma of SCID mice with and
without 50% hepatectomy. 7 days after transplantation complete
liver regeneration was achieved for the hepatectomised animals. The
liver tissue was analyzed by fluorescence microscopy of
cryo-sections for the presence of red labelled human cells (FIG.
18).
Example 9
Demonstration of the Differentiation Potential of USSC into the
Hematopoietic Lineage
[0089] Three different USSCs preparations (USSC.sup.KCBSS in DMEM
medium containing 30% FCS, USSC.sup.KCB12 in H5100 medium
containing dexamethasone, USSC.sup.KCBSS in MesenCult medium
containing dexamethasone and USSC.sup.GK12 in H5100 medium
containing PEI) growing in appropriate expansion medium for
extended periods (passage 5 to 8) were seeded in 250 .mu.l
(2.times.10.sup.4-2.times.10.sup.5 cells) of cell suspension in
triplicate in 24-well plates in hematopoetic specific culture
medium (Methocult 4434). Colonies of more than 50 cells were
counted and classified as derived from granulocyte/macrophage
(CFU-GM), early erythroid (BFU-E) or multipotent (CFU-GEMM)
progenitor cells according to established criteria. Colony
formation in different cultures was evident starting from 1 week of
observation and followed up to 3 weeks under differentiation
conditions. USSC preparations developed multiple colonies of
different lineages, providing evidence that these cells can give
rise to hematopoiesis.
Example 10
Molecular Methods for the Analysis of Unrestricted Somatic Stem
Cells and their Consecutive Differentiation Products
[0090] PCR-primers for the amplification of specific cDNA sequences
from osteocalcin, osteopontin, bone sialo-protein, alkaline
phosphatase, PDGFR.alpha. and EGF receptor were selected from
distinct respective exons, in order to be able to distinguish them
in size of their respectively generated DNA fragments.
[0091] Via cloning into the pCRL1 vector (Invitrogen/USA) and
consecutive transformation into E. coli strain TOP 10F the
respective specific cDNA clones were obtained and characterized via
cycle sequencing on an automated sequencer (Applied
Biosystems).
[0092] RT-PCR reactions were performed in a two step procedure. 200
ng total RNA of the cells are first reverse transcribed with 10 U
AMV Reverse Transcriptase (Promega, Mannheim), 1.5 .mu.mol 3'-gene
specific Primers, 1 mM dNTPs and the supplied buffer (Promega,
Mannheim) in a volume of 20 .mu.l for 1 h at 50.degree. C. The PCR
reaction was performed with 2 .mu.l of the cDNA with 1 U HotStarTaq
DNA Polymerase, buffer and Q-solution (Qiagen, Hilden), 1.5 mM
dNTPs and 20 .mu.mol 3'- and 5'-gene specific primer. The PCR
reaction was carried out with a initiation step for 15 min at
95.degree. C., 37 cycles at 94.degree. C. for 30 sec, 56.degree. C.
for 30 sec, 68.degree. C. for 1 min and a final polymerization step
for 5 min at 68.degree. C.
TABLE-US-00004 TABLE 4 PCR-primers for the amplification of
specific cDNA sequences name 5'primer sequence 3'primer sequence bp
PDGFR alpha acagtggagattacgaatgtg cacarcagtggtgatctcag 251 IGFR
cgagtggagaaatctgcgg gaccagggcgtagttgtag 272 EGFR tgccacaaccagtgtgct
ccacataattacggggacac 205 Neurofilament attcgcgcgcagcttgaag
cctggtaggaggcaatgtc 265 GFAP ctctccctggctcgaatgc cctcctgataactggccg
871 Synaptophysin cctgcagaacaagtaccgag ccttgctgcccatagtcgc 516
Tyrosine hydroxylase caccttcgcgcagttctcg ctgtccagcacgtcgatgg 387
YB1 ggtgaggaggcagcaaatgt agggttggaatactgtggtc 279 Runx1
gcaagctgaggagcggcg gaccgacaaacctgaagtc 296 AML1c
cagtgcttcatgagagaatgc gaccgacaaacctgaagtc 453 Cart-1
ggagacgctggacaatgag ggtagctgtcagtccttggc 560 CD105
cctgccactggacacagg atggcagctctgtggtgttg 411 Collagen Typ I
ggacacaatggattgcaagg aaccactgctccactctgg 441 Collagen Typ II
tttcccaggtcaagatggtc cttcagcacctgtctcacca 377 Osteocalcin
agtccagcaaaggtgcagc ggccgtagaagcgccgat 231 alkaline phosphatase
gcttcagaagctcaacacca cgttgtctgagtaccagtcc 454 beta actin
gagaaaatcttgcaccacac ctcggtgaggatcttcat 340 The table shows the 5'-
and 3'- Primer sequences of the examined genes and the expected
length of the PCR fragment in bp
REFERENCES
[0093] Bruder S., Fink D J., and Caplan A I. (1994). Mesenchymal
stem cells in bone formation, bone repair, and skeletal
regeneration therapy. J. Cell. Biochem. 56: 284. [0094] Caplan, A
I., Mesenchymal stem cells. (1991) J. Orthop. Res. 9: 641-50.
[0095] Grompe, M and Finegold M. J. Liver Stem Cells./p. 455-497
from Stem Cell Biology, Cold Spring Harbor Laboratory Press, 2001.
[0096] Grompe, M. and Finegold M. J. Liver stem cells./p. 455-497
from Stem Cell Biology, Cold Spring Harbor Laboratory Press, 2001.
[0097] Hall, C. L.; Yang, B.; Yang, X.; Zhang; S.; Turley, M.;
Samuel, S.; Lange, L. A.; Wang, C.; Curpen, G. D.; Savani, R. C.;
Greenberg, A. H.; Turley, E. A.: [0098] Overexpression of the
hyaluronan receptor RHAMM is transforming and is also required for
H-ras transformation. Cell 82: 19-26, 1995. [0099] Itano, N.;
Kimata, K. Expression cloning and molecular characterization of HAS
protein, a eukaryotic hyaluronan synthase. J. Biol. Chem. 271:
9875-9878, 1996 [0100] Jaiswal N, Haynesworth S E, Caplan A I,
Bruder S P. Osteogenic differentiation of purified,
culture-expanded human mesenchymal stem cells in vitro. J Cell
Biochem. 1997 February; 64(2):295-312. [0101] Johnstone B, Hering T
M, Caplan A I, Goldberg V M, Yoo J U. In vitro chondrogenesis of
bone marrow-derived mesenchymal progenitor cells. Exp Cell Res.
1998 Jan. 10; 238(1):265-72. [0102] Knittel T, Kobold D, Piscaglia
F, Saile B, Neubauer K, Mehde M, Timpl R, Ramadori G. Localization
of liver myofibroblasts and hepatic stellate cells in normal and
diseased rat livers: distinct roles of (myo-)fibroblast
subpopulations in hepatic tissue repair. Histochem Cell Biol 1999
November; 112(5):387-401 [0103] Kritzik M. R. and Sarvetnick N.
Pancreatic Stem Cells, p. 499-513 from Stem Cell Biology, Cold
Spring Harbor Laboratory Press, 2001. [0104] Mareschi K, Biasin E,
Piacibello W, Aglietta M, Madon E, Fagioli F. Haematologica 2001
October; 86(10):1099-100. Isolation of human mesenchymal stem
cells: bone marrow versus umbilical cord blood. [0105] Pan, T.-C.;
Sasaki, T.; Zhang, R.-Z.; Fassler, R.; Timpl, R.; Chu, M.-L.:
Structure and expression of fibulin-2, a novel extracellular matrix
protein with multiple EGF-like repeats and consensus motifs for
calcium binding. J. Cell Biol. 123: 1269-1277, 1993. [0106]
Ramirez-Zacarias J L, Castro-Munozledo F, Kuri-Harcuch W.
Histochemistry 1992 July; 97(6):493-7. Quantitation of adipose
conversion and triglycerides by staining intracytoplasmic lipids
with Oil red O. [0107] Rosenbaum, C., Kluwe, L., Mautner, V F.,
Friedrich, R. E., Muller, H W., Hanemann, C O. (1998): Enhanced
proliferation and potassium conductance of Schwann cells isolated
from NF2 schwannomas can be reduced by quinidine. Neurobiol Dis 5,
55-64. [0108] Rungby J, Kassem M, Eriksen E F, Danscher G.
Histochem J. 1993 June; 25(6):446-51. The von Kossa reaction for
calcium deposits: silver lactate staining increases sensitivity and
reduces background. [0109] Stanford C M, Jacobson P A, Eanes E D,
Lembke L A, Midura R J. J Biol Chem 1995 Apr. 21; 270(16):9420-8.
Rapidly forming apatitic mineral in an osteoblastic cell line (UMR
106-01 BSP). [0110] Shapiro A. M. J., Lakey 3. R. T., Ryan E. A.,
Korbutt G. S., Toth E., Warnock G. L., Kneteman N. M., Rajotte R.
V. N Engl J Med 2000 Jul. 27; (343):230-238. Islet Transplantation
in Seven Patients with Type 1 Diabetes Mellitus Using a
Glucocorticoid-Free Immunosuppressive Regimen. [0111] Sztrolovics,
R.; Chen, X.-N.; Grover, J.; Roughley, P. I.; Korenberg, J. R.
Localization of the human fibromodulin gene (FMOD) to chromosome
1q32 and completion of the cDNA sequence. Genomics 23: 715-717,
1994. [0112] Tsuda T, Wang H, Timpl R, Chu M L. Fibulin-2
expression marks transformed mesenchymal cells in developing
cardiac valves, aortic arch vessels, and coronary vessels. Dev Dyn
2001 September; 222(1):89-100 [0113] Van der Schoot, C. E.;
Huizinga, T. W. J.; Gadd, S. K.; Majdlc, O.; Wijmans, R.; Knapp,
W.; Von dem Borne, A. E. G.: Identification of three novel
PI-linked proteins on granulocytes In: Knapp, W.; Dorken, B.;
Gilks, W. R.; Rieber, E. P.; Schmidt, R. E.; Stein, H.; Von dem
Borne, A. E. G. K.: Leukocyte Typing IV: White Cell Differentiation
Antigens. Oxford: Oxford Univ. Press (pub.) 1989. Pp. 887-891
[0114] Yoo J U, Barthel T S, Nishimura K, Soichaga L, Caplan A I,
Goldberg V M, Johnstone B. The chondrogenic potential of human
bone-marrow-derived mesenchymal progenitor cells. J Bone Joint Surg
Am. 1998 December; 80(12):1745-57. [0115] Zhang, R.-Z.; Pan, T.-C.;
Zhang, Z.-Y.; Mattel, M.-G.; Timpl, R.; Chu, M.-L. Fibulin-2
(FBLN2): human cDNA sequence, mRNA expression, and mapping of the
gene on human and mouse chromosomes. Genomics 22: 425-430,
1994.
Abbreviations
[0116] DAG osteogenic differentiation medium containing
dexamethasone, ascorbic acid, and .beta.-glycerolphosphat HLA human
leukocyte antigen MSC mesenchymal stem cell, PEI medium containing
PDGF-BB, EGF and IGF SSEA4 stage-specific early antigen 4 USSC
unrestricted somatic stem cell PG proteoglycans
Sequence CWU 1
1
34121DNAArtificialprimer sequence 1acagtggaga ttacgaatgt g
21220DNAArtificialprimer sequence 2cacarcagtg gtgatctcag
20319DNAArtificialprimer sequence 3cgagtggaga aatctgcgg
19419DNAArtificialprimer sequence 4gaccagggcg tagttgtag
19518DNAArtificialprimer sequence 5tgccacaacc agtgtgct
18620DNAArtificialprimer sequence 6ccacataatt acggggacac
20719DNAArtificialprimer sequence 7attcgcgcgc agcttgaag
19819DNAArtificialprimer sequence 8cctggtagga ggcaatgtc
19919DNAArtificialprimer sequence 9ctctccctgg ctcgaatgc
191018DNAArtificialprimer sequence 10cctcctgata actggccg
181120DNAArtificialprimer sequence 11cctgcagaac aagtaccgag
201219DNAArtificialprimer sequence 12ccttgctgcc catagtcgc
191319DNAArtificialprimer sequence 13caccttcgcg cagttctcg
191419DNAArtificialprimer sequence 14ctgtccagca cgtcgatgg
191520DNAArtificialprimer sequence 15ggtgaggagg cagcaaatgt
201620DNAArtificialprimer sequence 16agggttggaa tactgtggtc
201718DNAArtificialprimer sequence 17gcaagctgag gagcggcg
181819DNAArtificialprimer sequence 18gaccgacaaa cctgaagtc
191921DNAArtificialprimer sequence 19cagtgcttca tgagagaatg c
212019DNAArtificialprimer sequence 20gaccgacaaa cctgaagtc
192119DNAArtificialprimer sequence 21ggagacgctg gacaatgag
192220DNAArtificialprimer sequence 22ggtagctgtc agtccttggc
202318DNAArtificialprimer sequence 23cctgccactg gacacagg
182420DNAArtificialprimer sequence 24atggcagctc tgtggtgttg
202520DNAArtificialprimer sequence 25ggacacaatg gattgcaagg
202619DNAArtificialprimer sequence 26aaccactgct ccactctgg
192720DNAArtificialprimer sequence 27tttcccaggt caagatggtc
202820DNAArtificialprimer sequence 28cttcagcacc tgtctcacca
202919DNAArtificialprimer sequence 29agtccagcaa aggtgcagc
193018DNAArtificialprimer sequence 30ggccgtagaa gcgccgat
183120DNAArtificialprimer sequence 31gcttcagaag ctcaacacca
203220DNAArtificialprimer sequence 32cgttgtctga gtaccagtcc
203320DNAArtificialprimer sequence 33gagaaaatct tgcaccacac
203418DNAArtificialprimer sequence 34ctcggtgagg atcttcat 18
* * * * *