U.S. patent application number 12/383897 was filed with the patent office on 2009-09-10 for induction of exon skipping in eukaryotic cells.
This patent application is currently assigned to Academisch Ziekenhuis Leiden. Invention is credited to Johannes Theodorus den Dunnen, Judith Christina, T. van Deutekom, Garrit-Jan Boudewijn van Ommen.
Application Number | 20090228998 12/383897 |
Document ID | / |
Family ID | 8172043 |
Filed Date | 2009-09-10 |
United States Patent
Application |
20090228998 |
Kind Code |
A1 |
van Ommen; Garrit-Jan Boudewijn ;
et al. |
September 10, 2009 |
Induction of exon skipping in eukaryotic cells
Abstract
The present invention provides a method for at least in part
decreasing the production of an aberrant protein in a cell, the
cell comprising pre-mRNA comprising exons coding for the protein,
by inducing so-called exon skipping in the cell. Exon-skipping
results in mature mRNA that does not contain the skipped exon,
which leads to an altered product of the exon codes for amino
acids. Exon skipping is performed by providing a cell with an agent
capable of specifically inhibiting an exon inclusion signal, for
instance, an exon recognition sequence, of the exon. The exon
inclusion signal can be interfered with by a nucleic acid
comprising complementarity to a part of the exon. The nucleic acid,
which is also herewith provided, can be used for the preparation of
a medicament, for instance, for the treatment of an inherited
disease.
Inventors: |
van Ommen; Garrit-Jan
Boudewijn; (Amsterdam, NL) ; van Deutekom; Judith
Christina, T.; (Dordrecht, NL) ; den Dunnen; Johannes
Theodorus; (Rotterdam, NL) |
Correspondence
Address: |
TRASKBRITT, P.C.
P.O. BOX 2550
SALT LAKE CITY
UT
84110
US
|
Assignee: |
Academisch Ziekenhuis
Leiden
|
Family ID: |
8172043 |
Appl. No.: |
12/383897 |
Filed: |
March 30, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10395031 |
Mar 21, 2003 |
|
|
|
12383897 |
|
|
|
|
PCT/NL01/00697 |
Sep 21, 2001 |
|
|
|
10395031 |
|
|
|
|
Current U.S.
Class: |
800/14 ;
435/320.1; 435/463; 435/6.11; 514/44A; 514/44R; 536/23.1;
800/8 |
Current CPC
Class: |
A61P 5/14 20180101; A61K
9/127 20130101; C12N 2750/14142 20130101; A61P 31/12 20180101; C12N
15/86 20130101; A61P 7/04 20180101; A61K 48/00 20130101; A61P 19/04
20180101; A61P 35/04 20180101; C12N 2310/11 20130101; A61K 48/005
20130101; C12N 2310/321 20130101; C12N 2310/315 20130101; A61P
35/00 20180101; C12N 15/11 20130101; A01K 2267/03 20130101; A61P
25/00 20180101; C12N 2320/33 20130101; C12N 15/113 20130101; C12N
2310/346 20130101; A61K 31/7088 20130101; A61P 21/04 20180101; C12N
2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
800/14 ; 800/8;
435/463; 435/6; 435/320.1; 514/44.R; 514/44.A; 536/23.1 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 15/87 20060101 C12N015/87; C12Q 1/68 20060101
C12Q001/68; C12N 15/63 20060101 C12N015/63; A61K 31/7088 20060101
A61K031/7088; C07H 21/02 20060101 C07H021/02 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 21, 2000 |
EP |
00203283.7 |
Claims
1-24. (canceled)
25. A method for directing splicing of a dystrophin pre-mRNA in a
cell having dystrophin pre-mRNA, the method comprising: contacting
the dystrophin pre-mRNA in the cell with an
antisense-oligonucleotide having between 14-40 nucleotides, capable
of specifically inhibiting an exon inclusion signal of exon number
2, 8, 29, 43, 44, 45; 46, 50, 51, 52, or 53 in the pre-mRNA, and
allowing splicing of the pre-mRNA.
26. The method according to claim 25, wherein the cell is a cell
from an individual suffering from Duchenne Muscular Dystrophy
(DMD).
27. The method according to claim 26, wherein the dystrophin
pre-mRNA comprises a DMD deletion of one or more exons selected
from the groups consisting of exons 3-7, 4-7, 5-7, 6-7, 18-44,
35-43, 44, 44-47, 45, 45-54, 45-52, 50, 50-52, 45-50, 46-47, 46-48,
46 49, 46-51, 46-53, 48-52, 48-50, 49-50, 49-52, 52, 52-63, 51,
51-55, 53, and 53-55.
28. The method according to claim 25, wherein the
antisense-oligonucleotide exhibiting the specific inhibition of an
exon inclusion signal is obtainable by a method comprising:
providing a second cell with the antisense-oligonucleotide, the
cell having pre-mRNA containing the exon, culturing the second cell
to form mRNA in the second cell from the pre-mRNA in the second
cell, and determining whether the exon is absent from the thus
formed mRNA in the second cell.
29. The method according to claim 25, further comprising allowing
translation of an mRNA produced from splicing of the dystrophin
pre-mRNA.
30. The method according to claim 29, wherein the mRNA encodes a
functional dystrophin protein.
31. The method according to claim 30, wherein the functional
dystrophin protein comprises at least two domains, wherein at least
one of the domains is encoded by the mRNA as a result of skipping
of at least part of an exon in the dystrophin pre-mRNA.
32. The method according to claim 25, wherein contacting results in
activation of a cryptic splice site in a contacted exon.
33. The method according to claim 25, wherein the exon inclusion
signal is present in an exon comprising a strong splice
donor/acceptor pair.
34. The method according to claim 29, wherein the translation
results in a mutant dystrophin protein or a normal dystrophin
protein.
35. The method according to claim 34, wherein the mutant dystrophin
protein is equivalent to a dystrophin protein of a Becker
patient.
36. The method according to claim 25, wherein the
antisense-oligonucleotide is capable of specifically inhibiting an
exon inclusion signal of exon number 51.
37. The method according to claim 25, wherein the
antisense-oligonucleotide comprises a nucleic acid.
38. The method according to claim 37, wherein the nucleic acid
comprises a 2'-O-methyl-oligoribonucleotide or a
2'-O-methyl-phosphorothioate.
39. The method according to claim 25, wherein the
antisense-oligonucleotide contains between 15-25 nucleotides.
40. The method according to claim 25, further comprising: providing
the cell with another antisense-oligonucleotide capable of
inhibiting an exon inclusion signal present in another exon of the
dystrophin pre-mRNA.
41. A method for at least in part decreasing the production of an
aberrant dystrophin protein in a cell, the cell comprising
dystrophin pre-mRNA comprising exons coding for the aberrant
dystrophin protein, the method comprising: providing the cell with
an antisense-oligonucleotide having between 14-40 nucleotides,
capable of specifically inhibiting an exon inclusion signal of exon
number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53, and allowing
translation of mRNA produced from splicing of the dystrophin
pre-mRNA.
42. The method according to claim 41, wherein the
antisense-oligonucleotide exhibiting the specific inhibition of an
exon inclusion signal is obtainable by a method comprising:
providing a second cell with the antisense-oligonucleotide, the
cell having pre-mRNA containing the exon, culturing the second cell
to form mRNA in the second cell from the pre-mRNA in the second
cell, and determining whether the exon is absent from the thus
formed mRNA in the second cell.
43. The method according to claim 41, wherein the
antisense-oligonucleotide is capable of specifically inhibiting an
exon inclusion signal of exon number 51.
44. The method according to claim 41, wherein the dystrophin
pre-mRNA comprises a Duchenne Muscular Dystrophy (DMD) deletion of
one or more exons selected from the groups consisting of exons 3-7,
4-7, 5-7, 6-7, 18-44, 35-43, 44, 44-47, 45, 45-54, 45-52, 50,
50-52, 45-50, 46-47, 46-48, 46-49, 46-51, 46-53, 48-52, 48-50,
49-50, 49-52, 52, 52-63, 51, 51 55, 53, and 53-55.
45. The method according to claim 41, wherein the
antisense-oligonucleotide comprises a nucleic acid.
46. The method according to claim 21, wherein the nucleic acid
comprises a 2'-O-methyl-oligoribonucleotide or a
2'-O-methyl-phosphorothioate oligoribonucleotide.
47. The method according to claim 45, wherein the
antisense-oligonucleotide contains between 15-25 nucleotides.
48. The method according to claim 41, further comprising: providing
the cell with another antisense-oligonucleotide capable of
inhibiting an exon inclusion signal present in another exon of the
dystrophin pre-mRNA.
49. A method for determining whether a compound is able
specifically inhibit an exon inclusion signal of an exon of a
dystrophin pre-mRNA, the exon being selected from the group
consisting of exon number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or
53 and combinations thereof of the dystrophin pre-mRNA, wherein the
compound has complementarity to a part of the selected exon, the
method comprising: providing a cell having a dystrophin pre-mRNA
containing the exon with the compound, culturing the cell to allow
the formation of an mRNA from the dystrophin pre-mRNA, and
determining whether the exon is absent from the mRNA.
50. The method according to claim 49 further comprising determining
in vitro the relative binding affinity of the compound to an RNA
molecule comprising the exon.
51. A compound identified by the method according to claim 49.
52. A nucleic acid delivery vehicle comprising the compound of
claim 51, or the complement thereof.
53. A nucleic acid delivery vehicle comprising the compound of
claim 51.
54. A method for directing splicing of a dystrophin pre-mRNA in a
subject, the method comprising: administering to the subject the
compound of claim 51.
55. A method for directing splicing of a dystrophin pre-mRNA in a
subject, the method comprising administering to the subject the
nucleic acid delivery vehicle of claim 52.
56. A method for directing splicing of a dystrophin pre-mRNA in a
subject, the method comprising: administering to the subject an
antisense-oligonucleotide, having between 14-40 nucleotides, and
having complementarity to an element located within an exon in the
pre-mRNA, the exon being selected from the group consisting of exon
number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53 and combinations
thereof of a dystrophin gene encoding an aberrant protein, wherein
the antisense-oligonucleotide specifically inhibits and interferes
with an exon inclusion signal of the exon in the pre-mRNA, thus
forming a final mRNA excluding the exon, but encoding a mutant
dystrophin protein having Becker mutant's functionality.
57. The method according to claim 56, wherein the
antisense-oligonucleotide that specifically inhibits and interferes
with an exon inclusion signal of the exon in the pre-mRNA is
obtainable by a method comprising: providing a cell with the
antisense-oligonucleotide, the cell having a pre-mRNA containing
the exon, culturing the cell to form mRNA in the cell from the
pre-mRNA in the cell, and determining whether the exon is absent
from the thus formed mRNA in the cell.
58. The method according to claim 56, wherein the
antisense-oligonucleotide contains between 15-25 nucleotides.
59. A non-human animal provided with the compound of claim 51.
60. The non-human animal of claim 59, further comprising a nucleic
acid encoding a human protein.
61. The non-human animal of claim 60, further comprising a
silencing mutation in a gene encoding an animal homologue of the
human protein.
62. A composition comprising: a nucleic acid or a functional
equivalent thereof capable of inhibiting an exon inclusion signal
in exon 2, 8, 29, 43, 44, 45, 46, 50, 51 or 53 of a dystrophin
pre-mRNA, and having between 14-40 nucleotides.
63. The composition of claim 62, further comprising: a further
nucleic acid or a functional equivalent thereof capable of
inhibiting an exon inclusion signal present in another exon of the
dystrophin pre-mRNA.
64. The composition of claim 62, wherein the nucleic acid is an
antisense-oligonucleotide containing between 15-25 nucleotides.
65. A nucleic acid delivery vehicle comprising: an
antisense-oligonucleotide capable of inhibiting an exon-inclusion
signal in at least one of exons 2, 8, 29, 43, 44, 45, 50, 51, 52 or
53 of a dystrophin pre-mRNA, wherein the antisense-oligonucleotide
contains between 14-40 nucleotides, or the complement of said
antisense-oligonucleotide.
66. The nucleic acid delivery vehicle of claim 65, wherein the
antisense-oligonucleotide contains between 15-25 nucleotides.
67. An antisense-oligonucleotide comprising one a nucleic acid
sequence selected from the group consisting of TABLE-US-00005
hAON#4: 5' CTGCTTCCTCCAACC, (SEQ ID NO: _) hAON#6: 5'
GTTATCTGCTTCCTCCAACC, (SEQ ID NO: _) hAON#8: 5'
GCTTTTCTTTTAGTTGCTGC, (SEQ ID NO: _) hAON#9: 5' TTAGTTGCTGCTCTT,
(SEQ ID NO: _) hAON#11: 5' TTGCTGCTCTTTTCC, (SEQ ID NO: _) hAON#21:
5' CCACAGGTTGTGTCACCAG, (SEQ ID NO: _) hAON#22: 5'
TTTCCTTAGTAACCACAGGTT, (SEQ ID NO: _) hAON#23: 5'
TGGCATTTCTAGTTTGG, (SEQ ID NO: _) hAON#24: 5'
CCAGAGCAGGTACCTCCAACATC, (SEQ ID NO: _) hAON#25: 5'
GGTAAGTTCTGTCCAAGCCC, (SEQ ID NO: _) hAON#26: 5'
TCACCCTCTGTGATTTTAT, (SEQ ID NO: _) hAON#27: 5' CCCTCTGTGATTTT,
(SEQ ID NO: _) hAON#28: 5' TCACCCACCATCACCCT, (SEQ ID NO: _)
hAON#29: 5' TGATATCCTCAAGGTCACCC, (SEQ ID NO: _) hAON#30: 5'
CTGCTTGATGATCATCTCGTT, (SEQ ID NO: _)
a functional part of any thereof, derivative of any thereof, and
analogue of any thereof having the same exon skipping activity in
kind, but not necessarily in amount.
68. The antisense-oligonucleotide of claim 67, containing between
14-40 nucleotides.
69. A nucleic acid delivery vehicle capable of expressing the
antisense-oligonucleotide of claim 67.
70. The nucleic acid delivery vehicle of claim 69, wherein the
nucleic acid delivery vehicle is a single stranded virus.
71. The nucleic acid delivery vehicle of claim 70, wherein said
single stranded virus comprises an adeno-associated virus.
72. A method for directing splicing of a dystrophin pre-mRNA in a
subject, the method comprising administering to the subject the
nucleic acid delivery vehicle of claim 53.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of co-pending U.S. patent
application Ser. No. 10/395,031, filed Mar. 21, 2003, now U.S. Pat.
No. ______, which is a continuation of International Application
PCT/NL01/00697, filed Sep. 21, 2001, designating the United States,
published in English Mar. 28, 2002, as WO 02/024906 A1 and
subsequently published with corrections Jan. 23, 2003, as WO
02/024906 C2, the contents of the entirety of each of which are
hereby incorporated herein by this reference.
TECHNICAL FIELD
[0002] The invention relates to the field of gene therapy.
BACKGROUND
[0003] Given the rapid advances of human genome research,
professionals and the public expect that the near future will bring
us, in addition to understanding of disease mechanisms and refined
and reliable diagnostics, therapies for many devastating genetic
diseases.
[0004] While it is hoped that for some (e.g., metabolic) diseases,
the improved insights will bring easily administrable
small-molecule therapies, it is likely that in most cases one or
another form of gene therapy will ultimately be required, i.e., the
correction, addition or replacement of the defective gene
product.
[0005] In the past few years, research and development in this
field have highlighted several technical difficulties which need to
be overcome, e.g., related to the large size of many genes involved
in genetic disease (limiting the choice of suitable systems to
administer the therapeutic gene), the accessibility of the tissue
in which the therapeutic gene should function (requiring the design
of specific targeting techniques, either physically, by restricted
injection, or biologically, by developing systems with
tissue-specific affinities) and the safety to the patient of the
administration system. These problems are to some extent
interrelated, and it can be generally concluded that the smaller
the therapeutic agent is, the easier it will become to develop
efficient, targetable and safe administration systems.
BRIEF SUMMARY OF THE INVENTION
[0006] The present invention addresses this problem by inducing
so-called exon-skipping in cells. Exon-skipping results in mature
mRNA that does not contain the skipped exon and thus, when the exon
codes for amino acids, can lead to the expression of an altered
product. Technology for exon-skipping is currently directed toward
the use of so-called "Anti-sense Oligonucleotides" (AONs).
[0007] Much of this work is done in the mdx mouse model for
Duchenne muscular dystrophy (DMD). The mdx mouse, which carries a
nonsense mutation in exon 23 of the dystrophin gene, has been used
as an animal model of Duchenne muscular dystrophy. Despite the mdx
mutation, which should preclude the synthesis of a functional
dystrophin protein, rare, naturally occurring dystrophin-positive
fibers have been observed in mdx muscle tissue. These
dystrophin-positive fibers are thought to have arisen from an
apparently naturally occurring exon-skipping mechanism, either due
to somatic mutations or through alternative splicing.
[0008] AONs directed to, respectively, the 3' and 5' splice sites
of introns 22 and 23 in dystrophin pre-mRNA have been shown to
interfere with factors normally involved in removal of intron 23 so
that exon 23 was also removed from the mRNA (Wilton, 1999). In a
similar study, Dunckley et al. (1998) showed that exon skipping
using AONs directed to 3' and 5' splice sites can have unexpected
results. They observed skipping of not only exon 23 but also of
exons 24-29, thus resulting in an mRNA containing an exon 22-exon
30 junction.
[0009] The underlying mechanism for the appearance of the
unexpected 22-30 splicing variant is not known. It could be due to
the fact that splice sites contain consensus sequences leading to
promiscuous hybridization of the oligos used to direct the exon
skipping. Hybridization of the oligos to other splice sites than
the sites of the exon to be skipped of course could easily
interfere with the accuracy of the splicing process. On the other
hand, the accuracy could be lacking due to the fact that two oligos
(for the 5' and the 3' splice site) need to be used. Pre-mRNA
containing one but not the other oligo could be prone to unexpected
splicing variants.
[0010] To overcome these and other problems, the present invention
provides a method for directing splicing of a pre-mRNA in a system
capable of performing a splicing operation comprising contacting
the pre-mRNA in the system with an agent capable of specifically
inhibiting an exon inclusion signal of at least one exon in the
pre-mRNA, the method further comprising allowing splicing of the
pre-mRNA. Interfering with an exon inclusion signal (EIS) has the
advantage that such elements are located within the exon. By
providing an antisense oligo for the interior of the exon to be
skipped, it is possible to interfere with the exon inclusion
signal, thereby effectively masking the exon from the splicing
apparatus. The failure of the splicing apparatus to recognize the
exon to be skipped thus leads to exclusion of the exon from the
final mRNA.
[0011] The present invention does not interfere directly with the
enzymatic process of the splicing machinery (the joining of the
exons). It is thought that this allows the method to be more robust
and reliable. It is thought that an EIS is a particular structure
of an exon that allows splice acceptor and donor to assume a
particular spatial conformation. In this concept, it is the
particular spatial conformation that enables the splicing machinery
to recognize the exon. However, the invention is certainly not
limited to this model.
[0012] It has been found that agents capable of binding to an exon
can inhibit an EIS. Agents may specifically contact the exon at any
point and still be able to specifically inhibit the EIS. The mRNA
may be useful in itself. For instance, production of an undesired
protein can be at least in part reduced by inhibiting inclusion of
a required exon into the mRNA. A preferred method of the invention
further comprises allowing translation of mRNA produced from
splicing of the pre-mRNA. Preferably, the mRNA encodes a functional
protein. In a preferred embodiment, the protein comprises two or
more domains, wherein at least one of the domains is encoded by the
mRNA as a result of skipping of at least part of an exon in the
pre-mRNA.
[0013] Exon skipping will typically, though not necessarily, be of
relevance for proteins in the wild-type configuration, having at
least two functional domains that each performs a function, wherein
the domains are generated from distinct parts of the primary amino
acid sequence. Examples are, for instance, transcription factors.
Typically, these factors comprise a DNA binding domain and a domain
that interacts with other proteins in the cell. Skipping of an exon
that encodes a part of the primary amino acid sequence that lies
between these two domains can lead to a shorter protein that
comprises the same function, at least in part. Thus, detrimental
mutations in this intermediary region (for instance, frame-shift or
stop mutations) can be at least in part repaired by inducing exon
skipping to allow synthesis of the shorter (partly) functional
protein.
[0014] Using a method of the invention, it is also possible to
induce partial skipping of the exon. In this embodiment, the
contacting results in activation of a cryptic splice site in a
contacted exon. This embodiment broadens the potential for
manipulation of the pre-mRNA leading to a functional protein.
Preferably, the system comprises a cell. Preferably, the cell is
cultured in vitro or in the organism in vivo. Typically, though not
necessarily, the organism comprises a human or a mouse.
[0015] In a preferred embodiment, the invention provides a method
for at least in part decreasing the production of an aberrant
protein in a cell, the cell comprising pre-mRNA comprising exons
coding for the protein, the method comprising providing the cell
with an agent capable of specifically inhibiting an exon inclusion
signal of at least one of the exons, the method further comprising
allowing translation of mRNA produced from splicing of the
pre-mRNA.
[0016] Any agent capable of specifically inhibiting an exon
exclusion signal can be used for the present invention. Preferably,
the agent comprises a nucleic acid or a functional equivalent
thereof. Preferably, but not necessarily, the nucleic acid is in
single-stranded form. Peptide nucleic acid and other molecules
comprising the same nucleic acid binding characteristics in kind,
but not necessarily in amount, are suitable equivalents. Nucleic
acid or an equivalent may comprise modifications to provide
additional functionality. For instance, 2'-O-methyl
oligoribonucleotides can be used. These ribonucleotides are more
resistant to RNAse action than conventional oligonucleotides.
[0017] In a preferred embodiment of the invention, the exon
inclusion signal is interfered with by an antisense nucleic acid
directed to an exon recognition sequence (ERS). These sequences are
relatively purine-rich and can be distinguished by scrutinizing the
sequence information of the exon to be skipped (Tanaka et al.,
1994, Mol. Cell. Biol. 14, p. 1347-1354). Exon recognition
sequences are thought to aid inclusion into mRNA of so-called weak
exons (Achsel et al., 1996, J. Biochem. 120, p. 53-60). These weak
exons comprise, for instance, 5' and or 3' splice sites that are
less efficiently recognized by the splicing machinery. In the
present invention, it has been found that exon skipping can also be
induced in so-called strong exons, i.e., exons which are normally
efficiently recognized by the splicing machinery of the cell. From
any given sequence, it is (almost) always possible to predict
whether the sequence comprises putative exons and to determine
whether these exons are strong or weak. Several algorithms for
determining the strength of an exon exist. A useful algorithm can
be found on the NetGene2 splice site prediction server (Brunak, et
al., 1991, J. Mol. Biol. 220, p. 49-65). Exon skipping by a means
of the invention can be induced in (almost) every exon, independent
of whether the exon is a weak exon or a strong exon and also
independent of whether the exon comprises an ERS. In a preferred
embodiment, an exon that is targeted for skipping is a strong exon.
In another preferred embodiment, an exon targeted for skipping does
not comprise an ERS.
[0018] Methods of the invention can be used in many ways. In one
embodiment, a method of the invention is used to at least in part
decrease the production of an aberrant protein. Such proteins can,
for instance, be onco-proteins or viral proteins. In many tumors,
not only the presence of an onco-protein but also its relative
level of expression has been associated with the phenotype of the
tumor cell. Similarly, not only the presence of viral proteins but
also the amount of viral protein in a cell determines the virulence
of a particular virus. Moreover, for efficient multiplication and
spread of a virus, the timing of expression in the life cycle and
the balance in the amount of certain viral proteins in a cell
determines whether viruses are efficiently or inefficiently
produced. Using a method of the invention, it is possible to lower
the amount of aberrant protein in a cell such that, for instance, a
tumor cell becomes less tumorigenic (metastatic) and/or a
virus-infected cell produces less virus.
[0019] In a preferred embodiment, a method of the invention is used
to modify the aberrant protein into a functional protein. In one
embodiment, the functional protein is capable of performing a
function of a protein normally present in a cell but absent in the
cells to be treated. Very often, even partial restoration of
function results in significantly improved performance of the cell
thus treated. Due to the better performance, such cells can also
have a selective advantage over unmodified cells, thus aiding the
efficacy of the treatment.
[0020] This aspect of the invention is particularly suited for the
restoration of expression of defective genes. This is achieved by
causing the specific skipping of targeted exons, thus bypassing or
correcting deleterious mutations (typically stop-mutations or
frame-shifting point mutations, single- or multi-exon deletions or
insertions leading to translation termination).
[0021] Compared to gene-introduction strategies, this novel form of
splice-modulation gene therapy requires the administration of much
smaller therapeutic reagents, typically, but not limited to, 14-40
nucleotides. In a preferred embodiment, molecules of 14-25
nucleotides are used since these molecules are easier to produce
and enter the cell more effectively. The methods of the invention
allow much more flexibility in the subsequent design of effective
and safe administration systems. An important additional advantage
of this aspect of the invention is that it restores (at least some
of) the activity of the endogenous gene, which still possesses most
or all of its gene-regulatory circuitry, thus ensuring proper
expression levels and the synthesis of tissue-specific
isoforms.
[0022] This aspect of the invention can in principle be applied to
any genetic disease or genetic predisposition to disease in which
targeted skipping of specific exons would restore the translational
reading frame when this has been disrupted by the original
mutation, provided that translation of an internally slightly
shorter protein is still fully or partly functional. Preferred
embodiments for which this application can be of therapeutic value
are: predisposition to second hit mutations in tumor suppressor
genes, e.g., those involved in breast cancer, colon cancer,
tuberous sclerosis, neurofibromatosis etc., where (partial)
restoration of activity would preclude the manifestation of
nullosomy by second hit mutations and thus would protect against
tumorigenesis. Another preferred embodiment involves the (partial)
restoration of defective gene products which have a direct disease
causing effect, e.g., hemophilia A (clotting factor VIII
deficiency), some forms of congenital hypothyroidism (due to
thyroglobulin synthesis deficiency) and Duchenne muscular dystrophy
(DMD), in which frame-shifting deletions, duplications and stop
mutations in the X-linked dystrophin gene cause severe, progressive
muscle degradation. DMD is typically lethal in late adolescence or
early adulthood, while non-frame-shifting deletions or duplications
in the same gene cause the much milder Becker muscular dystrophy
(BMD), compatible with a life expectancy between 35-40 years to
normal. In the embodiment as applied to DMD, the present invention
enables exon skipping to extend an existing deletion (or alter the
mRNA product of an existing duplication) by as many adjacent exons
as required to restore the reading frame and generate an internally
slightly shortened, but still functional, protein. Based on the
much milder clinical symptoms of BMD patients with the equivalent
of this induced deletion, the disease in the DMD patients would
have a much milder course after AON-therapy.
[0023] Many different mutations in the dystrophin gene can lead to
a dysfunctional protein. (For a comprehensive inventory see
www.dmd.nl, the internationally accepted database for DMD and
related disorders.) The precise exon to be skipped to generate a
functional dystrophin protein varies from mutation to mutation.
Table 1 comprises a non-limiting list of exons that can be skipped
and lists for the mentioned exons some of the more frequently
occurring dystrophin gene mutations that have been observed in
humans and that can be treated with a method of the invention.
Skipping of the mentioned exon leads to a mutant dystrophin protein
comprising at least the functionality of a Becker mutant. Thus, in
one embodiment, the invention provides a method of the invention
wherein the exon inclusion signal is present in exon numbers 2, 8,
19, 29, 43, 44, 45, 46, 50, 51, 52 or 53 of the human dystrophin
gene. The occurrence of certain deletion/insertion variations is
more frequent than others. In the present invention, it was found
that by inducing skipping of exon 46 with a means or a method of
the invention, approximately 7% of DMD-deletion containing patients
can be treated, resulting in the patients to comprise
dystrophin-positive muscle fibers. By inducing skipping of exon 51,
approximately 15% of DMD-deletion containing patients can be
treated with a means or method of the invention. Such treatment
will result in the patient having at least some dystrophin-positive
fibers. Thus, with either skipping of exon 46 or 51 using a method
of the invention, approximately 22% of the patients containing a
deletion in the dystrophin gene can be treated. Thus, in a
preferred embodiment of the invention, the exon exclusion signal is
present in exon 46 or exon 51. In a particularly preferred
embodiment, the agent comprises a nucleic acid sequence according
to hAON#4, hAON#6, hAON#8, hAON#9, hAON#11 and/or one or more of
hAON#21-30 or a functional part, derivative and/or analogue of the
hAON. A functional part, derivative and/or analogue of the hAON
comprises the same exon skipping activity in kind, but not
necessarily in amount, in a method of the invention.
TABLE-US-00001 TABLE 1 Therapeutic for DMD-deletions Frequency in
Exon to be skipped (exons) www.dmd.nl (%) 2 3-7 2 8 3-7 4 4-7 5-7
6-7 43 44 5 44-47 44 35-43 8 45 45-54 45 18-44 13 46-47 44 46-48
46-49 46-51 46-53 46 45 7 50 51 5 51-55 51 50 15 45-50 48-50 49-50
52 52-63 52 51 3 53 53-55 53 45-52 9 48-52 49-52 50-52 52
[0024] It can be advantageous to induce exon skipping of more than
one exon in the pre-mRNA. For instance, considering the wide
variety of mutations and the fixed nature of exon lengths and amino
acid sequence flanking such mutations, the situation can occur that
for restoration of function more than one exon needs to be skipped.
A preferred but non-limiting example of such a case in the DMD
deletion database is a 46-50 deletion. Patients comprising a 46-50
deletion do not produce functional dystrophin. However, an at least
partially functional dystrophin can be generated by inducing
skipping of both exon 45 and exon 51. Another preferred but
non-limiting example is patients comprising a duplication of exon
2. By providing one agent capable of inhibiting an EIS of exon 2,
it is possible to partly skip either one or both exons 2, thereby
regenerating the wild-type protein next to the truncated or double
exon 2 skipped protein. Another preferred but non-limiting example
is the skipping of exons 45 through 50. This generates an in-frame
Becker-like variant. This Becker-like variant can be generated to
cure any mutation localized in exons 45, 46, 47, 48, 49, and/or 50
or combinations thereof. In one aspect, the invention therefore
provides a method of the invention further comprising providing the
cell with another agent capable of inhibiting an exon inclusion
signal in another exon of the pre-mRNA. Of course, it is completely
within the scope of the invention to use two or more agents for the
induction of exon skipping in pre-mRNA of two or more different
genes.
[0025] In another aspect, the invention provides a method for
selecting the suitable agents for splice-therapy and their
validation as specific exon-skipping agents in pilot experiments. A
method is provided for determining whether an agent is capable of
specifically inhibiting an exon inclusion signal of an exon,
comprising providing a cell having a pre-mRNA containing the exon
with the agent, culturing the cell to allow the formation of an
mRNA from the pre-mRNA and determining whether the exon is absent
the mRNA. In a preferred embodiment, the agent comprises a nucleic
acid or a functional equivalent thereof, the nucleic acid
comprising complementarity to a part of the exon. Agents capable of
inducing specific exon skipping can be identified with a method of
the invention. It is possible to include a prescreen for agents by
first identifying whether the agent is capable of binding with a
relatively high affinity to an exon containing nucleic acid,
preferably RNA. To this end, a method for determining whether an
agent is capable of specifically inhibiting an exon inclusion
signal of an exon is provided, further comprising first determining
in vitro the relative binding affinity of the nucleic acid or
functional equivalent thereof to an RNA molecule comprising the
exon.
[0026] In yet another aspect, an agent is provided that is
obtainable by a method of the invention. In a preferred embodiment,
the agent comprises a nucleic acid or a functional equivalent
thereof. Preferably the agent, when used to induce exon skipping in
a cell, is capable of at least in part reducing the amount of
aberrant protein in the cell. More preferably, the exon skipping
results in an mRNA encoding a protein that is capable of performing
a function in the cell. In a particularly preferred embodiment, the
pre-mRNA is derived from a dystrophin gene. Preferably, the
functional protein comprises a mutant or normal dystrophin protein.
Preferably, the mutant dystrophin protein comprises at least the
functionality of a dystrophin protein in a Becker patient. In a
particularly preferred embodiment, the agent comprises the nucleic
acid sequence of hAON#4, hAON#6, hAON#8, hAON#9, hAON#11 and/or one
or more of hAON#21-30 or a functional part, derivative and/or
analogue of the hAON. A functional part, derivative and/or analogue
of the hAON comprises the same exon skipping activity in kind, but
not necessarily in amount, in a method of the invention.
[0027] The art describes many ways to deliver agents to cells.
Particularly, nucleic acid delivery methods have been widely
developed. The artisan is well capable of determining whether a
method of delivery is suitable for performing the present
invention. In a non-limiting example, the method includes the
packaging of an agent of the invention into liposomes, the
liposomes being provided to cells comprising a target pre-mRNA.
Liposomes are particularly suited for delivery of nucleic acid to
cells. Antisense molecules capable of inducing exon skipping can be
produced in a cell upon delivery of nucleic acid containing a
transcription unit to produce antisense RNA. Non-limiting examples
of suitable transcription units are small nuclear RNA (SNRP) or
tRNA transcription units. The invention, therefore, further
provides a nucleic acid delivery vehicle comprising a nucleic acid
or functional equivalent thereof of the invention capable of
inhibiting an exon inclusion signal. In one embodiment, the
delivery vehicle is capable of expressing the nucleic acid of the
invention. Of course, in case, for instance, single-stranded
viruses are used as a vehicle, it is entirely within the scope of
the invention when such a virus comprises only the antisense
sequence of an agent of the invention. In another embodiment of
single strand viruses, AONs of the invention are encoded by small
nuclear RNA or tRNA transcription units on viral nucleic
encapsulated by the virus as vehicle. A preferred single-stranded
virus is adeno-associated virus.
[0028] In yet another embodiment, the invention provides the use of
a nucleic acid or a nucleic acid delivery vehicle of the invention
for the preparation of a medicament. In a preferred embodiment, the
medicament is used for the treatment of an inherited disease. More
preferably, the medicament is used for the treatment of Duchenne
Muscular Dystrophy.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1. Deletion of exon 45 is one of the most frequent
DMD-mutations. Due to this deletion, exon 44 is spliced to exon 46,
the translational reading frame is interrupted, and a stop codon is
created in exon 46 leading to a dystrophin deficiency. Our aim is
to artificially induce the skipping of an additional exon, exon 46,
in order to reestablish the reading frame and restore the synthesis
of a slightly shorter, but largely functional, dystrophin protein
as found in the much milder affected Becker muscular dystrophy
patients affected by a deletion of both exons 45 and 46.
[0030] FIG. 2. Exon 46 contains a purine-rich region that is
hypothesized to have a potential role in the regulation of its
splicing in the pre-mRNA. A series of overlapping 2'O-methyl
phosphorothioate antisense oligoribonucleotides (AONs) was designed
directed at this purine-rich region in mouse dystrophin exon 46.
The AONs differ both in length and sequence. The chemical
modifications render the AONs resistant to endonucleases and RNaseH
inside the muscle cells. To determine the transfection efficiency
in our in vitro studies, the AONs contained a 5' fluorescein group
which allowed identification of AON-positive cells.
[0031] FIG. 3. To determine the binding affinity of the different
AONs to the target exon 46 RNA, we performed gel mobility shift
assays. In this figure, the five mAONs (mAON#4, 6, 8, 9, and 11)
with highest affinity for the target RNA are shown. Upon binding of
the AONs to the RNA, a complex is formed that exhibits a retarded
gel mobility as can be determined by the band shift. The binding of
the AONs to the target was sequence-specific. A random mAON, i.e.
not specific for exon 46, did not generate a band shift.
[0032] FIGS. 4A and 4B. The mouse- and human-specific AONs which
showed the highest binding affinity in the gel mobility shift
assays were transfected into mouse and human myotube cultures.
[0033] FIG. 4A. RT-PCR analysis showed a truncated product, of
which the size corresponded to exon 45 directly spliced to exon 47,
in the mouse cell cultures upon transfection with the different
mAONs#4, 6, 9, and 11. No exon 46 skipping was detected following
transfection with a random AON.
[0034] FIG. 4B. RT-PCR analysis in the human muscle cell cultures
derived from one unaffected individual (C) and two unrelated DMD
patients (P1 and P2) revealed truncated products upon transfection
with hAON#4 and hAON#8. In the control, this product corresponded
to exon 45 spliced to exon 47, while in the patients, the fragment
size corresponded to exon 44 spliced to exon 47. No exon 46
skipping was detected in the non-transfected cell cultures or
following transfection with a random hAON. Highest exon 46 skipping
efficiencies were obtained with hAON#8.
[0035] FIG. 5. Sequence data from the RT-PCR products obtained from
patient DL279.1 (corresponding to P1 in FIG. 4), which confirmed
the deletion of exon 45 in this patient (upper panel), and the
additional skipping of exon 46 following transfection with hAON#8
(lower panel). The skipping of exon 46 was specific, and exon 44
was exactly spliced to exon 47, which reestablishes the
translational reading frame.
[0036] FIG. 6. Immunohistochemical analysis of the muscle cell
culture from patient DL279.1 upon transfection with hAON#8. Cells
were subject to two different dystrophin antibodies raised against
different regions of the protein, located proximally (ManDys-1, ex.
31-32) and distally (Dys-2, ex. 77-79) from the targeted exon 46.
The lower panel shows the absence of a dystrophin protein in the
myotubes, whereas the hAON#8-induced skipping of exon 46 clearly
restored the synthesis of a dystrophin protein as detected by both
antibodies (upper panel).
[0037] FIG. 7A. RT-PCR analysis of RNA isolated from human control
muscle cell cultures treated with hAON#23, #24, #27, #28, or #29.
An additional aberrant splicing product was obtained in cells
treated with hAON#28 and #29. Sequence analysis revealed the
utilization of an in-frame cryptic splice site within exon 51 that
is used at a low frequency upon AON treatment. The product
generated included a partial exon 51, which also had a restored
reading frame, thereby confirming further the therapeutic
value.
[0038] FIG. 7B. A truncated product, with a size corresponding to
exon 50 spliced to exon 52, was detected in cells treated with
hAON#23 and #28. Sequence analysis of these products confirmed the
precise skipping of exon 51.
[0039] FIG. 8A. Gel mobility shift assays were performed to
determine the binding affinity of the different h29AON#'s for the
exon 29 target RNA. When compared to non-hybridized RNA (none),
h29AON#1, #2, #4, #6, #9, #10, and #11 generated complexes with
lower gel mobilities, indicating their binding to the RNA. A random
AON derived from dystrophin exon 19 did not generate a complex.
[0040] FIG. 8B. RT-PCR analysis of RNA isolated from human control
muscle cell cultures treated with h29AON#1, #2, #4, #6, #9, #10, or
#11 revealed a truncated product of which the size corresponded to
exon 28 spliced to exon 30. These results indicate that exon 29 can
specifically be skipped using AONs directed to sequences either
within (h29AON#1, #2, #4, or #6) or outside (h29AON#9, #10, or #11)
the hypothesized ERS in exon 29. An additional aberrant splicing
product was observed that resulted from skipping of both exon 28
and exon 29 (confirmed by sequence data not shown). Although this
product was also present in non-treated cells, suggesting that this
alternative skipping event may occur naturally, it was enhanced by
the AON-treatment. AON 19, derived from dystrophin exon 19, did not
induce exon 29 skipping.
[0041] FIG. 8C. The specific skipping of exon 29 was confirmed by
sequence data from the truncated RT-PCR fragments. Shown here is
the sequence obtained from the exon 29 skipping product in cells
treated with h29AON#1.
[0042] FIG. 9A. RT-PCR analysis of RNA isolated from mouse
gastrocnemius muscles two days post-injection of 5, 10, or 20 .mu.g
of either mAON#4, #6, or #11. Truncated products, with a size
corresponding to exon 45 spliced to exon 47, were detected in all
treated muscles. The samples -RT, -RNA, AD-1, and AD-2 were
analyzed as negative controls for the RT-PCR reactions.
[0043] FIG. 9B. Sequence analysis of the truncated products
generated by mAON#4 and #6 (and #11, not shown) confirmed the
precise skipping of exon 46.
DETAILED DESCRIPTION OF THE INVENTION
Examples
Example 1
[0044] Since exon 45 is one of the most frequently deleted exons in
DMD, we initially aimed at inducing the specific skipping of exon
46 (FIG. 1). This would produce the shorter, largely functional
dystrophin found in BMD patients carrying a deletion of exons 45
and 46. The system was initially set up for modulation of
dystrophin pre-mRNA splicing of the mouse dystrophin gene. We later
aimed for the human dystrophin gene with the intention to restore
the translational reading frame and dystrophin synthesis in muscle
cells from DMD patients affected by a deletion of exon 45.
Design of mAONs and hAONs
[0045] A series of mouse- and human-specific AONs (mAONs and hAONs)
was designed, directed at an internal part of exon 46 that contains
a stretch of purine-rich sequences and is hypothesized to have a
putative regulatory role in the splicing process of exon 46 (FIG.
2). For the initial screening of the AONs in the gel mobility shift
assays (see below), we used non-modified DNA-oligonucleotides
(synthesized by EuroGentec, Belgium). For the actual transfection
experiments in muscle cells, we used 2'-O-methyl-phosphorothioate
oligoribonucleotides (also synthesized by EuroGentec, Belgium).
These modified RNA oligonucleotides are known to be resistant to
endonucleases and RNaseH, and to bind to RNA with high affinity.
The sequences of those AONs that were eventually effective and
applied in muscle cells in vitro are shown below. The corresponding
mouse and human-specific AONs are highly homologous but not
completely identical.
[0046] The listing below refers to the deoxy-form used for testing,
in the finally used 2-O-methyl ribonucleotides all T's should be
read as U's.
TABLE-US-00002 mAON#2: 5' GCAATTGTTATCTGCTT (SEQ ID NO: 1) mAON#3:
5' GTTATCTGCTTCTTCC (SEQ ID NO: 2) mAON#4: 5' CTGCTTCTTCCAGCC (SEQ
ID NO: 3) mAON#5: 5' TCTGCTTCTTCCAGC (SEQ ID NO: 4) mAON#6: 5'
GTTATCTGCTTCTTCCAGCC (SEQ ID NO: 5) mAON#7: 5' CTTTTAGCTGCTGCTC
(SEQ ID NO: 6) mAON#8: 5' GTTGTTCTTTTAGCTGCTGC (SEQ ID NO: 7)
mAON#9: 5' TTAGCTGCTGCTCAT (SEQ ID NO: 8) mAON#10: 5'
TTTAGCTGCTGCTCATCTCC (SEQ ID NO: 9) mAON#11: 5' CTGCTGCTCATCTCC
(SEQ ID NO: 10) hAON#4: 5' CTGCTTCCTCCAACC (SEQ ID NO: 11) hAON#6:
5' GTTATCTGCTTCCTCCAACC (SEQ ID NO: 12) hAON#8: 5'
GCTTTTCTTTTAGTTGCTGC (SEQ ID NO: 13) hAON#9: 5' TTAGTTGCTGCTCTT
(SEQ ID NO: 14) hAON#11: 5' TTGCTGCTCTTTTCC (SEQ ID NO: 15)
Gel Mobility Shift Assays
[0047] The efficacy of the AONs is determined by their binding
affinity for the target sequence. Notwithstanding recent
improvements in computer simulation programs for the prediction of
RNA-folding, it is difficult to speculate which of the designed
AONs would be capable of binding the target sequence with a
relatively high affinity. Therefore, we performed gel mobility
shift assays (according to protocols described by Bruice et al.,
1997). The exon 46 target RNA fragment was generated by in vitro
T7-transcription from a PCR fragment (amplified from either murine
or human muscle mRNA using a sense primer that contains the T7
promoter sequence) in the presence of 32P-CTP. The binding affinity
of the individual AONs (0.5 pmol) for the target transcript
fragments was determined by hybridization at 37.degree. C. for 30
minutes and subsequent polyacrylamide (8%) gel electrophoresis. We
performed these assays for the screening of both the mouse and
human-specific AONs (FIG. 3). At least 5 different mouse-specific
AONs (mAON#4, 6, 8, 9 and 11) and four corresponding human-specific
AONs (hAON#4, 6, 8, and 9) generated a mobility shift,
demonstrating their binding affinity for the target RNA.
Transfection into Muscle Cell Cultures
[0048] The exon 46-specific AONs which showed the highest target
binding affinity in gel mobility shift assays were selected for
analysis of their efficacy in inducing the skipping in muscle cells
in vitro. In all transfection experiments, we included a
non-specific AON as a negative control for the specific skipping of
exon 46. As mentioned, the system was first set up in mouse muscle
cells. We used both proliferating myoblasts and post-mitotic
myotube cultures (expressing higher levels of dystrophin) derived
from the mouse muscle cell line C2C12. For the subsequent
experiments in human-derived muscle cell cultures, we used primary
muscle cell cultures isolated from muscle biopsies from one
unaffected individual and two unrelated DMD patients carrying a
deletion of exon 45. These heterogeneous cultures contained
approximately 20-40% myogenic cells. The different AONs (at a
concentration of 1 .mu.M) were transfected into the cells using the
cationic polymer PEI (MBI Fermentas) at a ratio-equivalent of 3.
The AONs transfected in these experiments contained a 5'
fluorescein group which allowed us to determine the transfection
efficiencies by counting the number of fluorescent nuclei.
Typically, more than 60% of cells showed specific nuclear uptake of
the AONs. To facilitate RT-PCR analysis, RNA was isolated 24 hours
post-transfection using RNAzol B (CamPro Scientific, The
Netherlands).
RT-PCR and Sequence Analysis
[0049] RNA was reverse transcribed using C. therm. polymerase
(Roche) and an exon 48-specific reverse primer. To facilitate the
detection of skipping of dystrophin exon 46, the cDNA was amplified
by two rounds of PCR, including a nested amplification using
primers in exons 44 and 47 (for the human system), or exons 45 and
47 (for the mouse system). In the mouse myoblast and myotube cell
cultures, we detected a truncated product of which the size
corresponded to exon 45 directly spliced to exon 47 (FIG. 4).
Subsequent sequence analysis confirmed the specific skipping of
exon 46 from these mouse dystrophin transcripts. The efficiency of
exon skipping was different for the individual AONs, with mAON#4
and #11 showing the highest efficiencies. Following these promising
results, we focused on inducing a similar modulation of dystrophin
splicing in the human-derived muscle cell cultures. Accordingly, we
detected a truncated product in the control muscle cells,
corresponding to exon 45 spliced to exon 47. Interestingly, in the
patient-derived muscle cells, a shorter fragment was detected,
which consisted of exon 44 spliced to exon 47. The specific
skipping of exon 46 from the human dystrophin transcripts was
confirmed by sequence data. This splicing modulation of both the
mouse and human dystrophin transcript was neither observed in
non-transfected cell cultures nor in cultures transfected with a
non-specific AON.
Immunohistochemical Analysis
[0050] We intended to induce the skipping of exon 46 in muscle
cells from patients carrying an exon 45 deletion in order to
restore the translation and synthesis of a dystrophin protein. To
detect a dystrophin product upon transfection with hAON#8, the two
patient-derived muscle cell cultures were subject to
immunocytochemistry using two different dystrophin monoclonal
antibodies (Mandys-1 and Dys-2) raised against domains of the
dystrophin protein located proximal and distal of the targeted
region respectively. Fluorescent analysis revealed restoration of
dystrophin synthesis in both patient-derived cell cultures (FIG.
5). Approximately at least 80% of the fibers stained positive for
dystrophin in the treated samples.
[0051] Our results show, for the first time, the restoration of
dystrophin synthesis from the endogenous DMD gene in muscle cells
from DMD patients. This is a proof of principle of the feasibility
of targeted modulation of dystrophin pre-mRNA splicing for
therapeutic purposes.
Targeted Skipping of Exon 51
Simultaneous Skipping of Dystrophin Exons
[0052] The targeted skipping of exon 51. We demonstrated the
feasibility of AON-mediated modulation of dystrophin exon 46
splicing, in mouse and human muscle cells in vitro. These findings
warranted further studies to evaluate AONs as therapeutic agents
for DMD. Since most DMD-causing deletions are clustered in two
mutation hot spots, the targeted skipping of one particular exon
can restore the reading frame in series of patients with different
mutations (see Table 1). Exon 51 is an interesting target exon. The
skipping of this exon is therapeutically applicable in patients
carrying deletions spanning exon 50, exons 45-50, exons 48-50,
exons 49-50, exon 52, and exons 52-63, which includes a total of
15% of patients from our Leiden database.
[0053] We designed a series of ten human-specific AONs (hAON#21-30,
see below) directed at different purine-rich regions within
dystrophin exon 51. These purine-rich stretches suggested the
presence of a putative exon splicing regulatory element that we
aimed to block in order to induce the elimination of that exon
during the splicing process. All experiments were performed
according to protocols as described for the skipping of exon 46
(see above). Gel mobility shift assays were performed to identify
those hAONs with high binding affinity for the target RNA. We
selected the five hAONs that showed the highest affinity. These
hAONs were transfected into human control muscle cell cultures in
order to test the feasibility of skipping exon 51 in vitro. RNA was
isolated 24 hours post-transfection, and cDNA was generated using
an exon 53- or 65-specific reverse primer. PCR-amplification of the
targeted region was performed using different primer combinations
flanking exon 51. The RT-PCR and sequence analysis revealed that we
were able to induce the specific skipping of exon 51 from the human
dystrophin transcript. We subsequently transfected two hAONs (#23
and #29) shown to be capable of inducing skipping of the exon into
six different muscle cell cultures derived from DMD-patients
carrying one of the mutations mentioned above. The skipping of exon
51 in these cultures was confirmed by RT-PCR and sequence analysis
(FIG. 7). More importantly, immunohistochemical analysis, using
multiple antibodies raised against different parts of the
dystrophin protein, showed in all cases that, due to the skipping
of exon 51, the synthesis of a dystrophin protein was restored.
[0054] Exon 51-specific hAONs:
TABLE-US-00003 hAON#21: 5' CCACAGGTTGTGTCACCAG (SEQ ID NO: 16)
hAON#22: 5' TTTCCTTAGTAACCACAGGTT (SEQ ID NO: 17) hAON#23: 5'
TGGCATTTCTAGTTTGG (SEQ ID NO: 18) hAON#24: 5'
CCAGAGCAGGTACCTCCAACATC (SEQ ID NO: 19) hAON#25: 5'
GGTAAGTTCTGTCCAAGCCC (SEQ ID NO: 20) hAON#26: 5'
TCACCCTCTGTGATTTTAT (SEQ ID NO: 21) hAON#27: 5' CCCTCTGTGATTTT (SEQ
ID NO: 22) hAON#28: 5' TCACCCACCATCACCCT (SEQ ID NO: 23) hAON#29:
5' TGATATCCTCAAGGTCACCC (SEQ ID NO: 24) hAON#30: 5'
CTGCTTGATGATCATCTCGTT (SEQ ID NO: 25)
Simultaneous Skipping of Multiple Dystrophin Exons
[0055] The skipping of one additional exon, such as exon 46 or exon
51, restores the reading frame for a considerable number of
different DMD mutations. The range of mutations for which this
strategy is applicable can be enlarged by the simultaneous skipping
of more than one exon. For instance, in DMD patients with a
deletion of exon 46 to exon 50, only the skipping of both the
deletion-flanking exons 45 and 51 enables the reestablishment of
the translational reading frame.
ERS-Independent Exon Skipping
[0056] A mutation in exon 29 leads to the skipping of this exon in
two Becker muscular dystrophy patients (Ginjaar at al., 2000, EJHG,
vol. 8, p. 793-796). We studied the feasibility of directing the
skipping of exon 29 through targeting the site of mutation by AONs.
The mutation is located in a purine-rich stretch that could be
associated with ERS activity. We designed a series of AONs (see
below) directed to sequences both within (h29AON#1 to h29AON#6) and
outside (h29AON#7 to h29AON#11) the hypothesized ERS. Gel mobility
shift assays were performed (as described) to identify those AONs
with highest affinity for the target RNA (FIG. 8). Subsequently,
h29AON#1, #2, #4, #6, #9, #10, and #11 were transfected into human
control myotube cultures using the PEI transfection reagent. RNA
was isolated 24 hrs post-transfection, and cDNA was generated using
an exon 31-specific reverse primer. PCR-amplification of the
targeted region was performed using different primer combinations
flanking exon 29. This RT-PCR and subsequent sequence analysis
(FIGS. 8B and 8C) revealed that we were able to induce the skipping
of exon 29 from the human dystrophin transcript. However, the AONs
that facilitated this skipping were directed to sequences both
within and outside the hypothesized ERS (h29AON#1, #2, #4, #6, #9,
and #11). These results suggest that skipping of exon 29 occurs
independent of whether or not exon 29 contains an ERS and that,
therefore, the binding of the AONs to exon 29 more likely
inactivated an exon inclusion signal rather than an ERS. This proof
of ERS-independent exon skipping may extend the overall
applicability of this therapy to exons without ERS's.
TABLE-US-00004 h29AON#1: 5' TATCCTCTGAATGTCGCATC (SEQ ID NO: 26)
h29AON#2: 5' GGTTATCCTCTGAATGTCGC (SEQ ID NO: 27) h29AON#3: 5'
TCTGTTAGGGTCTGTGCC (SEQ ID NO: 28) h29AON#4: 5' CCATCTGTTAGGGTCTGTG
(SEQ ID NO: 29) h29AON#5: 5' GTCTGTGCCAATATGCG (SEQ ID NO: 30)
h29AON#6: 5' TCTGTGCCAATATGCGAATC (SEQ ID NO: 31) h29AON#7: 5'
TGTCTCAAGTTCCTC (SEQ ID NO: 32) h29AON#8: 5' GAATTAAATGTCTCAAGTTC
(SEQ ID NO: 33) h29AON#9: 5' TTAAATGTCTCAAGTTCC (SEQ ID NO: 34)
h29AON#10: 5' GTAGTTCCCTCCAACG (SEQ ID NO: 35) h29AON#11: 5'
CATGTAGTTCCCTCC (SEQ ID NO: 36)
AON-Induced Exon 46 Skipping In Vivo in Murine Muscle Tissue.
[0057] Following the promising results in cultured muscle cells, we
tested the different mouse dystrophin exon 46-specific AONs in vivo
by injecting them, linked to polyethylenimine (PEI), into the
gastrocnemius muscles of control mice. With mAON#4, #6, and #11,
previously shown to be effective in mouse muscle cells in vitro, we
were able to induce the skipping of exon 46 in muscle tissue in
vivo as determined by both RT-PCR and sequence analysis (FIG. 9).
The in vivo exon 46 skipping was dose-dependent with highest
efficiencies (up to 10%) following injection of 20 .mu.g per muscle
per day for two subsequent days.
REFERENCES
[0058] Achsel et al., 1996, J. Biochem. 120, pp. 53-60. [0059]
Bruice T. W. and Lima, W. F., 1997, Biochemistry 36(16): pp.
5004-5019. [0060] Brunak at al., 1991, J. Mol. Biol. 220, pp.
49-65. [0061] Dunckley, M. G. et al., 1998, Human molecular
genetics 7, pp. 1083-1090. [0062] Ginjaar et al., 2000, EJHG, vol.
8, pp. 793-796. [0063] Mann et al., 2001, PNAS vol. 98, pp. 42-47.
[0064] Tanaka et al., 1994 Mol. Cell. Biol. 14, pp. 1347-1354.
[0065] Wilton, S. D., et al., 1999, Neuromuscular disorders 9, pp.
330-338.
[0066] Details and background on Duchenne Muscular Dystrophy and
related diseases can be found on website http://www.dmd.nl
Sequence CWU 1
1
36116DNAMouse 1gcaatgttat ctgctt 16216DNAMouse 2gttatctgct tcttcc
16314DNAMouse 3tgcttcttcc agcc 14415DNAMouse 4tctgcttctt ccagc
15520DNAMouse 5gttatctgct tcttccagcc 20616DNAMouse 6cttttagctg
ctgctc 16720DNAMouse 7gttgttcttt tagctgctgc 20815DNAMouse
8ttagctgctg ctcat 15920DNAMouse 9tttagctgct gctcatctcc
201015DNAMouse 10ctgctgctca tctcc 151115DNAHuman 11ctgcttcctc caacc
151220DNAHuman 12gttatctgct tcctccaacc 201320DNAHuman 13gcttttcttt
tagttgctgc 201415DNAHuman 14ttagttgctg ctctt 151515DNAHuman
15ttgctgctct tttcc 151619DNAHuman 16ccacaggttg tgtcaccag
191721DNAHuman 17tttccttagt aaccacaggt t 211817DNAHuman
18tggcatttct agtttgg 171923DNAHuman 19ccagagcagg tacctccaac atc
232020DNAHuman 20ggtaagttct gtccaagccc 202119DNAHuman 21tcaccctctg
tgattttat 192214DNAHuman 22ccctctgtga tttt 142317DNAHuman
23tcacccacca tcaccct 172420DNAHuman 24tgatatcctc aaggtcaccc
202521DNAHuman 25ctgcttgatg atcatctcgt t 212620DNAHuman
26tatcctctga atgtcgcatc 202720DNAHuman 27ggttatcctc tgaatgtcgc
202818DNAHuman 28tctgttaggg tctgtgcc 182919DNAHuman 29ccatctgtta
gggtctgtg 193017DNAHuman 30gtctgtgcca atatgcg 173120DNAHuman
31tctgtgccaa tatgcgaatc 203215DNAHuman 32tgtctcaagt tcctc
153320DNAHuman 33gaattaaatg tctcaagttc 203418DNAHuman 34ttaaatgtct
caagttcc 183516DNAHuman 35gtagttccct ccaacg 163615DNAHuman
36catgtagttc cctcc 15
* * * * *
References