U.S. patent application number 12/335960 was filed with the patent office on 2009-09-10 for chemical derivatives and their application as antitelomerase agents.
This patent application is currently assigned to AVENTIS PHARMA S.A.. Invention is credited to Thomas CAULFIELD, Gilles DOERFLINGER, Francois HAMY, Abdelazize LAOUI, Patrick MAILLIET, Jean-Louis MERGNY, Jean-Francois RIOU.
Application Number | 20090226411 12/335960 |
Document ID | / |
Family ID | 27445934 |
Filed Date | 2009-09-10 |
United States Patent
Application |
20090226411 |
Kind Code |
A1 |
MAILLIET; Patrick ; et
al. |
September 10, 2009 |
CHEMICAL DERIVATIVES AND THEIR APPLICATION AS ANTITELOMERASE
AGENTS
Abstract
The present invention relates to cancer therapy and to novel
anticancer agents having a mechanism of action which is quite
specific. It also relates to novel chemical compounds as well as
their therapeutic application in humans.
Inventors: |
MAILLIET; Patrick; (Fontenay
Sous Bois, FR) ; LAOUI; Abdelazize; (Bridgewater,
NJ) ; RIOU; Jean-Francois; (Paris, FR) ;
DOERFLINGER; Gilles; (Les Ulis, FR) ; MERGNY;
Jean-Louis; (Villejuif, FR) ; HAMY; Francois;
(Illzach, FR) ; CAULFIELD; Thomas; (Lebanon,
NJ) |
Correspondence
Address: |
ANDREA Q. RYAN;SANOFI-AVENTIS U.S. LLC
1041 ROUTE 202-206, MAIL CODE: D303A
BRIDGEWATER
NJ
08807
US
|
Assignee: |
AVENTIS PHARMA S.A.
Antony
FR
|
Family ID: |
27445934 |
Appl. No.: |
12/335960 |
Filed: |
December 16, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10993637 |
Nov 19, 2004 |
7482352 |
|
|
12335960 |
|
|
|
|
10103883 |
Mar 25, 2002 |
6887873 |
|
|
10993637 |
|
|
|
|
60332009 |
Nov 23, 2001 |
|
|
|
Current U.S.
Class: |
424/94.6 ;
424/94.1; 514/245; 544/209 |
Current CPC
Class: |
C07D 453/02 20130101;
A61P 35/02 20180101; A61K 31/53 20130101; C07D 401/14 20130101;
A61P 35/00 20180101; C07D 405/14 20130101; C07D 401/12
20130101 |
Class at
Publication: |
424/94.6 ;
544/209; 514/245; 424/94.1 |
International
Class: |
A61K 38/50 20060101
A61K038/50; C07D 403/14 20060101 C07D403/14; A61K 31/53 20060101
A61K031/53; A61P 35/00 20060101 A61P035/00; A61K 38/43 20060101
A61K038/43 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 23, 2001 |
FR |
0103916 |
Aug 2, 2001 |
FR |
0110370 |
Claims
1. A compound which binds a G-quadruplex structure of DNA or RNA,
wherein the compound corresponds to the following formula:
nitrogen-containing aromatic ring-NR.sub.3-distribution
agent-NR'.sub.3-aromatic ring in which: the nitrogen-containing
aromatic ring represents: a quinolinyl or isoquinolinyl radical
optionally substituted with one or more radicals chosen from among:
N(Ra)(Rb), wherein Ra and Rb are identical or different and
represent hydrogen or C1-C4 alkyl radical, and a short-chain C1-C4
alkoxy or alkyl group, a quinolinyl or isoquinolinyl radical
possessing a nitrogen atom in quaternary form, or a pyridinyl
radical; or wherein the nitrogen-containing aromatic ring is
replaced by a benzimidinyl radical; the aromatic ring represents: a
quinolinyl radical optionally substituted with one or more radicals
chosen from among: N(Ra)(Rb), wherein Ra and Rb are identical or
different and represent hydrogen or C1-C4 alkyl radical, and a
short-chain C1-C4 alkoxy or alkyl group, a quinolinyl radical
possessing a nitrogen atom in quaternary form, a benzamidinyl
radical, a pyridinyl radical, a phenyl ring optionally substituted
with a halogen group, C1-C4 alkoxy group, cyano group,
carbonylamino group optionally substituted with one or more C1-C4
alkyl groups, guanyl group, C1-C4 alkylthio group, amino group,
C1-C4 alkylamino group, C1-C4 dialkylamino group for each alkyl,
C1-C4 dialkylamino group for each alkyl in which the alkyl portions
together form a C3-C8 ring, nitro group, C1-C4 alkyleneamino group,
or C2-C4 alkenyleneamino group, or a mono- or bi- or tricyclic
heterocyclic ring comprising 0 to 2 heteroatoms per ring wherein at
least one heteroatom is present in at least one ring that is
optionally substituted with one or more C1-C4 alkyl groups, C1-C4
alkylene groups, or C2-C4 alkenylene groups; R3 and R'3 are
identical or different and represent, independently of one another,
hydrogen or C1-C4 alkyl radical; the distribution agent represents:
i) a triazine group, wherein the triazine group is optionally
substituted with: an aromatic ring as defined above, or a radical
XR1(R2), where X represents a nitrogen to form NR1R2, a linear or
branched C1-C6 alkyl radical to form alkR1R2, an oxygen to form
OR1, or a sulfur to form SR1, wherein R1 and R2, which are
identical or different, are chosen from among hydrogen; a C1-C8
alkyl radical optionally substituted with one or more radicals
which are identical or different; an aromatic ring as defined
above; a quinuclidine radical; a pyrrolidinyl radical which is
optionally substituted with an alkyl or phenylalkyl radical where
alkyl is C1-C4 alkyl; a piperazinyl radical which is optionally
substituted with an alkyl, cycloalkyl or phenylalkyl radical; a
morpholinyl radical; a pyridyl radical or a piperidyl radical which
are optionally substituted with one or more alkyl or phenylalkyl
radicals where alkyl is C1-C4 alkyl; an indazolyl radical; a
naphthyl radical; a benzotriazole radical; a pyrimidinyl radical
optionally substituted with one or more C1-C4 alkyls; and an
acenaphthene radical; or a radical where X represents N or alkyl,
R1 and R2 are as defined above, and R1, R2 and X form a saturated
or unsaturated 3- to 6-membered monocyclic or 8- to 10-membered
bicyclic radical optionally containing one or two identical or
different heteroatoms chosen from N, O or S; with the provisos that
if X represents a nitrogen and R1 and R2 are identical, then R1 and
R2 do not both represent hydrogen or unsubstituted C1-C4 alkyl, and
if X represents a nitrogen and R1 and R2 are different, then one
does not represent hydrogen and the other an unsubstituted C1-C4
alkyl; or ii) a diazine group wherein the diazine group is
optionally substituted with any of the groups defined above for the
triazine group; or any salts, isomeric forms, racemates,
enantiomers and diastereoisomers thereof.
2. The compound of claim 1, wherein one or both of R1 and R2
represents a C1-C8 alkyl radical optionally substituted with one or
more radicals which are identical or different, chosen from among:
an amino radical which is optionally substituted with one or two
radicals which are identical or different, chosen from alkyl,
hydroxyalkyl, alkoxyalkyl, phenylalkyl, carboxyalkyl,
hydroxycarboxyalkyl, acyl, naphthyl, phenyl and alkylphenyl
radicals; a trialkylammonium radical; a hydroxyl radical; a C1-C4
alkoxy radical; a thioalkoxy radical; a trifluoromethyl radical; a
free, salified, esterified or amidated carboxyl radical; a
pyrrolidinyl radical optionally substituted with C1-C4 alkyl; a
piperidyl radical; a piperazinyl radical optionally substituted
with alkyl or phenylalkyl where alkyl is C1-C4 alkyl; a morpholinyl
radical; a pyridyl radical; and a naphthyl radical or phenyl
radical optionally substituted with one or more radicals chosen
from C1-C4 alkoxy radicals, halogen or an amino radical optionally
substituted as defined above.
3. The compound of claim 1, wherein the distribution agent
represents a triazine group optionally substituted with: an
aromatic ring as defined in claim 1, or a radical XR1(R2), where X
represents a nitrogen to form NR1R2, a linear or branched C1-C6
alkyl radical to form alkR1R2, an oxygen to form OR1, or a sulfur
to form SR1, wherein R1 and R2, which are identical or different,
are chosen from: hydrogen; a C1-C8 alkyl radical optionally
substituted with one or more radicals chosen from the radicals
amino, alkylamino, dialkylamino, dialkoxyalkylamino,
dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino,
hydroxycarboxy-alkylamino, trialkylamino, naphthylamino,
phenylamino, acylamino, (alkyl)(phenylalkyl)amino,
(phenyl)(alkyl)amino, (alkylphenyl)(alkyl)amino, hydroxyl, C1-C4
alkoxy, C1-C4 thioalkoxy, trifluoromethyl, free, salified,
esterified or amidated carboxyl, pyrrolidinyl optionally
substituted with C1-C4 alkyl, piperidyl, piperazinyl optionally
substituted with alkyl or phenylalkyl with alkyl as C1-C4,
morpholinyl, pyridyl, naphthyl or phenyl optionally substituted
with one or more radicals chosen from the radicals C1-C4 alkoxy,
halogen, amino, alkylamino and dialkylamino; an aromatic ring as
defined in claim 1; a quinuclidine radical; a pyrrolidinyl radical
which is optionally substituted with an alkyl or phenylalkyl
radical where alkyl is C1-C4 alkyl; a piperazinyl radical which is
optionally substituted with an alkyl, cycloalkyl or phenylalkyl
radical; a morpholinyl radical; a pyridyl radical or a piperidyl
radical which are optionally substituted with one or more alkyl or
phenylalkyl radicals where alkyl is C1-C4 alkyl; an indazolyl
radical; a naphthyl radical; a benzotriazole radical; a pyrimidinyl
radical optionally substituted with one or more C1-C4 alkyls; and
an acenaphthene radical; or a radical where X represents N or
alkyl, R1 and R2 are as defined above, and R1, R2 and X form a
radical chosen from the following radicals: piperazinyl optionally
substituted with one or more radicals which are identical or
different; pyrrolidinyl optionally substituted with C1-C4 alkyl or
alkoxy, hydroxyl, acylamino, pyrrolidinylalkyl and pyridyl;
1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally substituted
with alkyl or pyrrolidinylalkyl; piperidyl optionally substituted
with alkyl, alkoxy or alkoxyalkyl, hydroxyl and cycloalkylalkyl;
morpholinyl; imidazolinyl optionally substituted with alkyl, with
the provisos that if X represents a nitrogen and R1 and R2 are
identical, then R1 and R2 do not both represent hydrogen or
unsubstituted C1-C4 alkyl, and if X represents a nitrogen and R1
and R2 are different, then one does not represent hydrogen and the
other an unsubstituted C1-C4 alkyl; or a diazine group, wherein the
diazine group is optionally substituted with any of the groups
defined above for the triazine group; or any salts, isomeric forms,
racemates, enantiomers and diastereoisomers thereof.
4. The compound of claim 1, wherein the diazine group is a
pyrimidine.
5. The compound of claim 1, wherein X in XR1(R2) is nitrogen, and
one of R1 and R2 is as defined in claim 1 and the other of R1 and
R2 represents hydrogen or C1-C4 alkyl radical optionally
substituted with an amino, alkylamino, dialkylamino or phenyl
radical; or R1, R2, and the nitrogen atom to which they are
attached, form a piperazinyl radical optionally substituted with
one or more radicals chosen from alkyl; aminoalkyl;
alkylaminoalkyl; dialkylaminoalkyl; phenylalkyl; alkoxyalkyl;
hydroxyalkyl; hydroxyalkoxyalkyl; alkoxy; pyrrolidinylalkyl; C3-C8
cycloalkyl; pyrazinyl; pyrimidinyl; pyridyl; furylcarbonyl;
furfurylcarbonyl; quinolyl; pyrrolidinyl optionally substituted
with C1-C4 alkyl, C1-C4 alkoxy, hydroxyl, acylamino,
pyrrolidinylalkyl, or pyridyl; 1,2,3,4-tetrahydroisoquinolinyl;
diazepine optionally substituted with alkyl or pyrrolidinylalkyl;
piperidyl optionally substituted with alkyl, alkoxy or alkoxyalkyl;
hydroxyl; cycloalkylalkyl; morpholinyl; and imidazolinyl optionally
substituted with alkyl.
6. The compound of claim 1, wherein the compound corresponds to the
following formula: nitrogen-containing aromatic
ring-NR.sub.3-distribution agent-NR'.sub.3-aromatic ring in which
the nitrogen-containing aromatic ring represents: a quinolinyl or
isoquinolinyl radical optionally substituted with one or more
radicals chosen from among: N(Ra)(Rb), wherein Ra and Rb are
identical or different and represent hydrogen or C1-C4 alkyl
radical, and a short-chain C1-C4 alkoxy or alkyl group, a
quinolinyl radical possessing a nitrogen atom in quaternary form,
or a pyridinyl radical; or wherein the nitrogen-containing ring is
replaced by a benzimidinyl radical; the aromatic ring represents: a
quinolinyl radical optionally substituted with one or more radicals
chosen from among: N(Ra)(Rb), wherein Ra and Rb are identical or
different and represent hydrogen or C1-C4 alkyl radical, and a
short-chain C1-C4 alkoxy or alkyl group, a quinolinyl radical
possessing a nitrogen atom in quaternary form, a benzamidinyl
radical, a pyridinyl radical, a phenyl ring optionally substituted
with a halogen group, C1-C4 alkoxy group, cyano group,
carbonylamino group optionally substituted with one or more C1-C4
alkyl groups, guanyl group, C1-C4 alkylthio group, amino group,
C1-C4 alkylamino group, C1-C4 dialkylamino group, C1-C4
dialkylamino group in which the alkyl portions together form a
C3-C8 ring, nitro group, C1-C4 alkyleneamino group, or C2-C4
alkenyleneamino group, or a mono- or bi- or tricyclic heterocyclic
ring comprising 0 to 2 heteroatoms per ring wherein at least one
heteroatom is present in at least one ring that is optionally
substituted with one or more C1-C4 alkyl groups, C1-C4 alkylene, or
C2-C4 alkenylene groups; R3 and R'3 are identical or different and
represent, independently of one another, hydrogen or C1-C4 alkyl
radical; the distribution agent represents: i) a triazine group,
wherein the triazine group is optionally substituted with: a
radical XR1(R2), where X represents a nitrogen to form NR1R2, a
linear or branched C1-C6 alkyl radical to form alkR1R2, an oxygen
to form OR1, or a sulfur to form SR1, wherein R1 and R2, which are
identical or different, are chosen from among hydrogen; C1-C8 alkyl
optionally substituted with a radical chosen from amino,
alkylamino, dialkylamino, (phenyl)(alkyl)amino,
(alkylphenyl)(alkyl)-amino, C1-C4 alkoxy, C1-C4 thioalkoxy,
trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl,
pyridyl and phenyl; an aromatic ring as defined in claim 1, a
quinuclidine radical; a pyrrolidinyl, piperazinyl, morpholinyl,
pyridyl or a piperidyl radical optionally substituted with C1-C4
alkyl; or a radical where X represents N or alkyl, R1 and R2 are as
defined above, and R1, R2 and X form a saturated or unsaturated 3-
to 6-membered monocyclic or 8- to 10-membered bicyclic radical
optionally containing one or two identical or different heteroatoms
chosen from N, O or S; with the provisos that if X represents a
nitrogen and R1 and R2 are identical, then R1 and R2 do not both
represent hydrogen or unsubstituted C1-C4 alkyl, and if X
represents a nitrogen and R1 and R2 are different, then one does
not represent hydrogen and the other an unsubstituted C1-C4 alkyl;
or ii) a diazine group wherein the diazine group is optionally
substituted with any of the groups defined above for the triazine
group; or any salts, isomeric forms, racemates, enantiomers and
diastereoisomers thereof.
7. The compound of claim 1, wherein the distribution agent
represents: i) a triazine group optionally substituted with a
radical XR1(R2) where X represents a nitrogen to form NR1R2, an
oxygen to form OR1, or a sulfur to form SR1, wherein R1 and R2,
which are identical or different, are chosen from among: hydrogen,
C1-C8 alkyl optionally substituted with a radical chosen from
amino, alkylamino, dialkylamino, (phenyl)(alkyl)amino,
(alkylphenyl)(alkyl)-amino, C1-C4 alkoxy, pyrrolidinyl, pyridyl,
and phenyl, an aromatic ring as defined in claim 1; a quinuclidine
radical; a pyrrolidinyl radical; and a piperidyl radical optionally
substituted with C1-C4 alkyl, or a radical where X represents N, R1
and R2 are as defined above, and R1, R2, and X form a piperazinyl,
piperidyl, pyrrolidinyl, morpholinyl or thiomorpholinyl radical,
with the provisos that if X represents a nitrogen and R1 and R2 are
identical, then R1 and R2 do not both represent hydrogen or
unsubstituted C1-C4 alkyl, and if X represents a nitrogen and R1
and R2 are different, then one does not represent hydrogen and the
other an unsubstituted C1-C4 alkyl; or ii) a diazine group wherein
the diazine group is optionally substituted with any of the groups
defined above for the triazine group; or any salts, isomeric forms,
racemates, enantiomers and diastereoisomers thereof.
8. The compound of claim 1, wherein X in XR1(R2) represents N, one
of R1 and R2 represents a hydrogen atom and the other of R1 and R2
is as defined in claim 1; or R1 and R2, together with the nitrogen
atom to which they are attached, form a piperazinyl, pyrrolidinyl,
piperidyl, morpholinyl, thiomorpholinyl, imidazolinyl, diazepine,
or 1,2,3,4-tetrahydroisoquinoline radical, all these radicals being
optionally substituted with one or more radicals.
9. A pharmaceutical composition comprising, as active ingredient,
one or more compounds according to claim 1; and a pharmaceutically
acceptable excipient.
10. A pharmaceutical composition comprising, as active ingredient,
one or more compounds according to claim 2; and a pharmaceutically
acceptable excipient.
11. A pharmaceutical composition comprising, as active ingredient,
one or more compounds according to claim 4; and a pharmaceutically
acceptable excipient.
12. A pharmaceutical composition comprising, as active ingredient,
one or more compounds according to claim 7; and a pharmaceutically
acceptable excipient.
13. A method of inhibiting the activity of a telomerase comprising
contacting one or more compounds of claim 1 with a telomerase.
14. A method of treating cancer comprising administering one or
more compounds of claim 1 to a patient in need of said
treatment.
15. The method according to claim 14, wherein the one or more
compounds is administered in combination with a second anticancer
agent.
16. The method according to claim 15, wherein the second anticancer
compound is chosen from alkylating agents, platinum derivatives,
antibiotic agents, antimicrotubule agents, anthracyclines, group I
and II topoisomerases, fluoropyrimidines, cytidine analogues,
adenosine analogues, L-asparaginase, hydroxyurea, trans-retinoic
acid, suramine, irinotecan, topotecan, dexrazoxane, amifostine,
herceptin, estrogenic and androgenic hormones, and antivascular
agents.
17. The method according to claim 14, wherein the one or more
compounds is administered in combination with radiation.
18. The method according to claim 18, wherein the compound and
radiation are administered simultaneously, separately or
sequentially.
Description
[0001] This application is a division of U.S. application Ser. No.
10/993,637, filed Nov. 19, 2004, now allowed, which is a division
of U.S. application Ser. No. 10/103,883, filed Mar. 25, 2002, now
U.S. Pat. No. 6,887,873, which claims the benefit of U.S.
Provisional Application No. 60/332,009, filed Nov. 23, 2001, which
claims priority to French Application No. 01/03,916, filed Mar. 23,
2001, and French Application No. 01/10,370, filed Aug. 2, 2001, all
of which are incorporated herein by reference in their
entirety.
[0002] The present invention relates to cancer therapy and to novel
anticancer agents having a mechanism of action which is quite
specific. It also relates to novel chemical compounds as well as
their therapeutic application in humans.
[0003] The present invention relates to the use of novel
non-nucleotide chemical compounds which interact with specific
structures of deoxyribonucleic acid (DNA) or ribonucleic acid
(RNA). These novel compounds consist of a distribution agent linked
to two aminoaromatic groups. These novel compounds are useful in
the treatment of cancers and act in particular as
telomerase-inhibiting agents. They are particularly useful for
stabilizing DNA in G-quadruplex structure (guanine tetrads). The
therapeutic application of the inhibition of telomerase via the
stabilization of these G-quadruplexes is the termination of
cellular mitosis and the death of rapidly dividing cells such as
cancer cells and possibly the induction of the senescence of cancer
cells.
[0004] The compounds of the present invention have the advantage,
from the therapeutic point of view, of blocking telomerase. From a
biological point of view, telomerase allows the addition of
repetitive DNA sequences of the T T A G G G type, termed telomeric
sequences, at the end of the telomere, during cell division.
Through this action, telomerase renders the cell immortal. Indeed,
in the absence of this enzymatic activity, the cell loses, at each
division, 100 to 150 bases, which rapidly renders it senescent.
During the appearance of rapidly dividing cancer cells, it appeared
that these cells possessed telomeres which were maintained at a
stable length during cell division. In these cancer cells, it
appeared that telomerase was highly activated and that it allowed
the addition of repetitive motifs of telomeric sequences at the end
of the telomere and therefore allowed conservation of the length of
the telomere in the cancer cells. It appeared for some time that
more than 85% of cancer cells showed positive tests for the
presence of telomerase whereas somatic cells do not show this
characteristic.
[0005] Thus, telomerase is a highly coveted target for treating
cancer cells. The first obvious approach for blocking telomerase
was the use of nucleotide structures (Chen et al., Proc. Natl.
Acad. Sci. USA 93(7), 2635-2639). Among the non-nucleotide
compounds which have been used in the prior art, there may be
mentioned the diaminoanthraquinones (Sun et al., J. Med. Chem.
40(14), 2113-6) or the diethyloxadicarbocyanins (Wheelhouse R. T.
et al., J. Am. Chem. Soc. 1998(120), 3261-2).
[0006] Patent WO 99/40087 describes the use of compounds which
interact with the G-quadruplex structures which are perylene
compounds and carbocyanins containing at least seven rings
including two heterocycles.
[0007] It appeared, quite surprisingly, that simple structures made
it possible to obtain a result which is at least equivalent with
structures which are a lot less complicated from a chemical point
of view. The compounds of the present invention which meet the
intended objective, that is to say which bind the
G-quadruplex structure of DNA or of RNA and in particular the
G-quadruplex structure of the telomeres and thereby exhibit a
telomerase-inhibiting activity, correspond to the following general
formula:
nitrogen-containing aromatic ring-NR.sub.3-distribution
agent-NR'.sub.3-aromatic ring
[0008] in which [0009] the nitrogen-containing aromatic ring
represents: [0010] a quinoline or isoquinoline optionally
substituted with at least one radical chosen from a group N(Ra)(Rb)
in which Ra and Rb, which are identical or different, represent
hydrogen or a C1-C4 alkyl radical, and a short-chain C1-C4 alkoxy
or alkyl group or [0011] a quinoline or isoquinoline possessing a
nitrogen atom in quaternary form or [0012] a benzamidine or [0013]
a pyridine [0014] the aromatic ring represents [0015] a quinoline
optionally substituted with at least one radical chosen from a
group N(Ra)(Rb) in which Ra and Rb, which are identical or
different, represent hydrogen or a C1-C4 alkyl radical, and a
short-chain C1-C4 alkoxy or alkyl group or [0016] a quinoline
possessing a nitrogen atom in quaternary form or [0017] a
benzamidine or [0018] a pyridine or [0019] a phenyl ring optionally
substituted with a halogen group; C1-C4 alkoxy group; cyano group;
carbonylamino group optionally substituted with one or more C1-C4
alkyl groups; guanyl group; C1-C4 alkylthio group; amino group,
C1-C4 alkylamino group, C1-C4 dialkylamino group for each alkyl
group and in which the alkyl portions may together form a C3-C8
ring, nitro group; C1-C4 alkyleneamino group; C2-C4 alkenyleneamino
group; [0020] a mono- or bi- or tricyclic heterocyclic ring
comprising 0 to 2 heteroatoms per ring provided that at least one
heteroatom is present in at least one ring optionally substituted
with one or more C1-C4 alkyl groups or with C1-C4 alkylene or C2-C4
alkenylene groups [0021] R3 and R'3, which are identical or
different, represent independently of one another hydrogen or a
C1-C4 alkyl radical [0022] the distribution agent represents:
[0023] a triazine group optionally substituted with an aromatic
ring as defined above or with a radical XR1(R2) in which X
represents a nitrogen, atom N to form NR1R2, a linear or branched
C1-C6 alkyl radical to form alkR1R2, an oxygen atom O to form OR1
or a sulfur atom S to form SR1, with R1 and R2, which are identical
or different, are chosen from a hydrogen atom; a C1-C8 alkyl
radical optionally substituted with one or more radicals which are
identical or different; an aromatic ring as defined above; a
quinuclidine radical; a pyrrolidinyl radical which is itself
optionally substituted with an alkyl or phenylalkyl radical with
alkyl as C1-C4; a piperazinyl radical which is itself optionally
substituted with an alkyl, cycloalkyl or phenylalkyl radical; a
morpholinyl radical; a pyridyl radical or a piperidyl radical which
are optionally substituted with one or more alkyl or phenylalkyl
radicals with alkyl C1-C4; an indazolyl radical; a naphthyl
radical; a benzotriazole radical; a pyrimidinyl radical optionally
substituted with one or more alkyls with alkyl as C1-C4; an
acenaphthene radical, [0024] it being understood that, when XR1R2
represents NR1R2, then R1 and R2, which are identical, both do not
represent hydrogen or unsubstituted C1-C4 alkyl and R1 and R2,
which are different, do not represent one hydrogen and the other
unsubstituted C1-C4 alkyl [0025] or alternatively, when X
represents N or alkyl, R1 and R2 together form with X to which they
are attached a saturated or unsaturated 3- to 6-membered monocyclic
or 8- to 10-membered bicyclic radical optionally containing one or
two heteroatoms, which are identical or different, chosen from N, O
or S, [0026] a diazine group optionally substituted with the same
groups as the triazine
[0027] or one of its salts,
these compounds being in all the possible isomeric forms,
racemates, enantiomers and diastereoisomers.
[0028] Among the compounds defined above, there may be mentioned
the compounds characterized in that, when one or both of R1 and R2
represents (represent) a C1-C8 alkyl radical optionally substituted
with one or more radicals which are identical or different, these
radicals are chosen from the amino radical which is itself
optionally substituted with one or two radicals which are identical
or different, chosen from alkyl, hydroxyalkyl, alkoxyalkyl,
phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl, naphthyl,
phenyl and alkylphenyl radicals; trialkylammonium radical; hydroxyl
radical; C1-C4 alkoxy radical; thioalkoxy radical; trifluoromethyl
radical; free, salified, esterified or amidated carboxyl radical;
pyrrolidinyl radical optionally substituted with C1-C4 alkyl;
piperidyl radical; piperazinyl radical optionally substituted with
alkyl or phenylalkyl with alkyl as C1-C4; morpholinyl radical;
pyridyl radical; naphthyl radical or phenyl radical itself
optionally substituted with one or more radicals chosen from C1-C4
alkoxy radicals, halogen or amino radical optionally substituted as
defined above.
[0029] Among the compounds defined above, there may be mentioned in
particular the compounds characterized in that the distribution
agent represents: [0030] a triazine group optionally substituted
with an aromatic ring as defined above or with a radical XR1(R2) in
which X represents a nitrogen atom N to form NR1R2, a linear or
branched C1-C6 alkyl radical to form alkR1R2, an oxygen atom O to
form OR1 or a sulfur atom S to form SR1, with R1 and R2, which are
identical or different, are chosen from a hydrogen atom; C1-C8
alkyl optionally substituted with one or more radicals chosen from
the radicals amino, alkylamino, dialkylamino, dialkoxyalkylamino,
dihydroxyalkylamino, alkoxyalkylamino, hydroxyalkylamino,
hydroxycarboxyalkylamino, trialkylamino+, naphthylamino,
phenylamino, acylamino, (alkyl)(phenylalkyl)amino,
(phenyl)(alkyl)amino, (alkylphenyl)(alkyl)amino, hydroxyl, C1-C4
alkoxy, C1-C4 thioalkoxy, trifluoromethyl, free, salified,
esterified or amidated carboxyl, pyrrolidinyl optionally
substituted with C1-C4 alkyl, piperidyl, piperazinyl optionally
substituted with alkyl or phenylalkyl with alkyl as C1-C4,
morpholinyl, pyridyl, naphthyl or phenyl optionally substituted
with one or more radicals chosen from the radicals C1-C4 alkoxy,
halogen, amino, alkylamino and dialkylamino; an aromatic ring as
defined above; a quinuclidine radical; a pyrrolidinyl radical which
is itself optionally substituted with an alkyl or phenylalkyl
radical with alkyl as C1-C4; a piperazinyl radical which is itself
optionally substituted with an alkyl, cycloalkyl or phenylalkyl
radical; a morpholinyl radical; a pyridyl radical or a piperidyl
radical which are optionally substituted with one or more alkyl or
phenylalkyl radicals with alkyl C1-C4; an indazolyl radical; a
naphthyl radical, a benzotriazole radical; a pyrimidinyl radical
optionally substituted with one or more alkyls with alkyl as C1-C4;
an acenaphthene radical, [0031] it being understood that, when
XR1R2 represents NR1R2, then R1 and R2, which are identical, both
do not represent hydrogen or unsubstituted C1-C4 alkyl and R1 and
R2, which are different, do not represent one hydrogen and the
other unsubstituted C1-C4 alkyl [0032] or alternatively, when X
represents N or alkyl, R1 and R2 together form with X to which they
are attached a radical chosen from the following radicals:
piperazinyl optionally substituted with one or more radicals which
are identical or different; pyrrolidinyl optionally substituted
with C1-C4 alkyl or alkoxy, hydroxyl, acylamino, pyrrolidinylalkyl
and pyridyl; 1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally
substituted with alkyl or pyrrolidinylalkyl; piperidyl optionally
substituted with alkyl, alkoxy or alkoxyalkyl, hydroxyl and
cycloalkylalkyl; morpholinyl; imidazolinyl optionally substituted
with alkyl, [0033] or a diazine group optionally substituted with
the same groups as the triazine
[0034] or one of its salts,
these compounds being in all the possible isomeric forms,
racemates, enantiomers and diastereoisomers.
[0035] Among the compounds defined above, there may be mentioned
the compounds characterized in that XR1(R2) is such that, when X
represents N, either one of R1 and R2 represents a hydrogen atom or
a C1-C4 alkyl radical optionally substituted with an amino,
alkylamino, dialkylamino or phenyl radical and the other of R1 and
R2 is chosen from the values defined for R1 and R2 in any one of
Claims 1 to 8 or R1 and R2 together form with the nitrogen atom to
which they are attached a piperazinyl radical optionally
substituted with one or more radicals chosen from alkyl,
aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl,
alkoxyalkyl, hydroxyalkyl, hydroxyalkoxyalkyl with alkoxy,
pyrrolidinylalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl,
pyridyl, furylcarbonyl, furfurylcarbonyl, quinolyl; pyrrolidinyl
optionally substituted with C1-C4 alkyl or alkoxy, hydroxyl,
acylamino, pyrrolidinylalkyl and pyridyl;
1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally substituted
with alkyl or pyrrolidinylalkyl; piperidyl optionally substituted
with alkyl, alkoxy or alkoxyalkyl, hydroxyl and cycloalkylalkyl;
morpholinyl; imidazolinyl optionally substituted with alkyl.
[0036] The subject of the present invention is the compounds which
bind the G-quadruplex structure of the telomeres characterized in
that they correspond to the general formula as defined above.
[0037] The present invention thus relates to compounds as defined
above characterized in that they correspond to the following
general formula:
nitrogen-containing aromatic ring-NR.sub.3-distribution
agent-NR'.sub.3-aromatic ring
[0038] in which [0039] the nitrogen-containing aromatic ring
represents: [0040] a quinoline optionally substituted with at least
one group N(Ra)(Rb) in which Ra and Rb, which are identical or
different, represent hydrogen or a C1-C4 alkyl radical, (or) a
short-chain C1-C4 alkoxy or alkyl group or [0041] a quinoline
possessing a nitrogen atom in quaternary form or [0042] a
benzamidine or [0043] a pyridine [0044] the aromatic ring
represents [0045] a quinoline optionally substituted with at least
one group N(Ra)(Rb) in which Ra and Rb, which are identical or
different, represent hydrogen or a C1-C4 alkyl radical, (or) a
short-chain C1-C4 alkoxy or alkyl group or [0046] a quinoline
possessing a nitrogen atom in quaternary form or [0047] a
benzamidine or [0048] a pyridine or [0049] a phenyl ring optionally
substituted with a halogen group; C1-C4 alkoxy group; cyano group;
carbonylamino group optionally substituted with one or more C1-C4
alkyl groups; guanyl group; C1-C4 alkylthio group; amino group,
C1-C4 alkylamino group, C1-C4 dialkylamino group for each alkyl
group and in which the alkyl portions may together form a C3-C8
ring, nitro group; C1-C4 alkyleneamino group; C2-C4 alkenyleneamino
group, [0050] a mono- or bi- or tricyclic heterocyclic ring
comprising 0 to 2 heteroatoms per ring provided that at least one
heteroatom is present in at least one ring optionally substituted
with one or more C1-C4 alkyl groups or with C1-C4 alkylene or C2-C4
alkenylene groups [0051] R3 and R'3, which are identical or
different, represent independently of one another hydrogen or a
C1-C4 alkyl radical [0052] the distribution agent represents:
[0053] a triazine group optionally substituted with a radical
XR1(R2) in which X represents a nitrogen atom N to form NR1R2, a
linear or branched C1-C6 alkyl radical to form alkR1R2, an oxygen
atom O to form OR1 or a sulfur atom S to form SR1, [0054] with R1
and R2, which are identical or different, are chosen from a
hydrogen atom; C1-C8 alkyl optionally substituted with a radical
amino, alkylamino, dialkylamino, (phenyl)(alkyl)amino,
(alkylphenyl)(alkyl)amino, C1-C4 alkoxy, C1-C4 thioalkoxy,
trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl,
pyridyl or phenyl; an aromatic ring as defined above; a
quinuclidine radical, a radical pyrrolidinyl, piperazinyl,
morpholinyl, pyridyl or a piperidyl radical optionally substituted
with C1-C4 alkyl [0055] it being understood that R1 and R2, which
are identical, both do not represent hydrogen or unsubstituted
C1-C4 alkyl and R1 and R2, which are different, do not represent
one hydrogen and the other unsubstituted C1-C4 alkyl [0056] or
alternatively, when X represents N or alkyl, R1 and R2 together
form with X to which they are attached a saturated or unsaturated
3- to 6-membered monocyclic or 8- to 10-membered bicyclic radical
optionally containing one or two heteroatoms, which are identical
or different, chosen from N, O or S, [0057] a diazine group
optionally substituted with the same groups as the triazine
[0058] or one of its salts,
these compounds being in all the possible isomeric forms,
racemates, enantiomers and diastereoisomers.
[0059] For the purposes of the above formula, nitrogen-containing
aromatic ring is understood to mean a heterocycle comprising at
least one nitrogen atom or an aromatic group containing no
heteroatom in the ring but containing at least one nitrogen atom in
a hydrocarbon chain attached to the ring, such as for example a
guanidino or guanyl chain.
[0060] The aromatic ring represents in particular a quinaldine,
quinoline, benzamidine, pyridine and phenyl radical as defined
above and optionally substituted as indicated above.
[0061] As C3-C8 ring which the alkyl portions of the dialkylamino
radicals defined above can form, there may be mentioned for example
aziridine, azetidine, pyrrolidine, oxazolidine, thiazolidine,
piperidine, piperazine, morpholine, thiomorpholine or azepine
rings.
[0062] In the products above and below, the chemical radicals have
their customary meanings which are found in the documents used by
persons skilled in the art and correspond in particular to the
following definitions:
[0063] the term alkyl radical denotes linear or branched radicals,
in particular methyl, ethyl, propyl, isopropyl, butyl, isobutyl,
sec-butyl, tert-butyl, pentyl, isopentyl, hexyl, isohexyl and also
heptyl, octyl, nonyl and decyl radicals and their linear or
branched position isomers,
[0064] the term alkoxy radical denotes linear or branched radicals,
in particular methoxy, ethoxy, propoxy, isopropoxy, linear,
secondary or tertiary butoxy, pentoxy or hexoxy radicals and their
linear or branched position isomers,
[0065] the term halogen atom denotes chlorine, fluorine, bromine or
iodine, and in particular chlorine and fluorine, atoms
[0066] the term cycloalkyl radical denotes cyclohexyl, cyclopropyl,
cyclobutyl and also cycloheptyl and cyclooctyl radicals
[0067] the term alkylphenyl denotes a phenyl radical substituted
with one or more linear or branched alkyl radicals as defined
above, preferably containing at most 4 carbon atoms
[0068] the terms NH(alk) and N(alk)(alk) denote an amino radical
substituted with one or two alkyl radicals, respectively, such
alkyl radicals being linear or branched and preferably containing
at most 4 carbon atoms
[0069] the term acylamino denotes --C(O)--NH2, --C(O)--NH(alk) and
--C(O)--N(alk)(alk) radicals in which the NH(alk) and N(alk)(alk)
radicals have the meaning indicated above
[0070] the term acyl denotes an R--C(O)-- radical in which R
represents a radical chosen from a hydrogen atom, linear or
branched alkyl radicals containing at most 8 carbon atoms or a
saturated or unsaturated carbocyclic or heterocyclic radical,
chosen for example from the aromatic or nonaromatic rings defined
above: the term acyl thus denotes for example formyl, acetyl,
propionyl, butanoyl, pentanoyl, hexanoyl, benzoyl,
pyrrolidinylcarbonyl, pyrazinylcarbonyl, piperazinylcarbonyl,
furylcarbonyl or furfurylcarbonyl radicals.
[0071] The carboxyl radical(s) of the products of formula (I) may
be salified or esterified with various groups known to persons
skilled in the art among which there may be mentioned, for
example:
[0072] among the salifying compounds, inorganic bases such as, for
example, a sodium, potassium, lithium, calcium, magnesium or
ammonium equivalent or organic bases such as, for example,
methylamine, propylamine, trimethylamine, diethylamine,
triethylamine, N,N-dimethylethanolamine,
tris(hydroxymethyl)aminomethane, ethanolamine, pyridine, picoline,
dicyclohexylamine, morpholine, benzylamine, procaine, lysine,
arginine, histidine, N-methylglucamine, among the esterifying
compounds, alkyl radicals in order to form alkoxycarbonyl groups
such as, for example, methoxycarbonyl, ethoxycarbonyl,
tert-butoxycarbonyl or benzyloxycarbonyl, it being possible for
these alkyl radicals to be substituted with radicals chosen for
example from halogen atoms, hydroxyl, alkoxy, acyl, acyloxy,
alkylthio, amino or aryl radicals as, for example, in chloromethyl,
hydroxypropyl, methoxymethyl, propionyloxymethyl, methylthiomethyl,
dimethylaminoethyl, benzyl or phenethyl groups.
[0073] The addition salts with inorganic or organic acids of the
products of formula (I) may be, for example, the salts formed with
hydrochloric, hydrobromic, hydriodic, nitric, sulfuric, phosphoric,
propionic, acetic, trifluoroacetic, formic, benzoic, maleic,
fumaric, succinic, tartaric, citric, oxalic, glyoxylic, aspartic
and ascorbic acids, alkylmonosulfonic acids such as for example
methanesulfonic acid, ethanesulfonic acid, propanesulfonic acid,
alkyldisulfonic acids such as, for example, methanedisulfonic acid,
alpha, beta-ethanedisulfonic acid, arylmonosulfonic acids such as
benzenesulfonic acid and aryldisulfonic acids.
[0074] The pharmaceutically acceptable salts of the products of
formula (I) are in particular utilizable nontoxic salts: such salts
of the products of formula (I) as defined above may be obtained by
ordinary methods known to persons skilled in the art, for example
by combining a compound of formula (I) with an organic or inorganic
acid or a base in a solvent or a dispersant or from another salt by
exchange of cation or anion.
[0075] It may be restated that the stereoisomerism may be defined
within its broad term as the isomerism of compounds having the same
structural formula, but in which the various groups are arranged
differently in space, as in particular in monosubstituted
cyclohexanes in which the substituent may be in the axial or
equatorial position, and the various possible rotational
conformations of the ethane derivatives.
[0076] Nevertheless, there is another type of stereoisomerism, due
to the different spatial arrangements of substituents attached,
either to double bonds, or to rings, which is often called
geometric isomerism or cis-trans isomerism. The term stereoisomers
is used in the present application in its broadest sense and
therefore covers all the compounds indicated above.
[0077] The subject of the present invention is in particular the
compounds as defined above, characterized in that the distribution
agent represents: [0078] a triazine group optionally substituted
with a radical XR1(R2) in which X represents a nitrogen atom N in
order to form NR1R2, an oxygen atom O in order to form OR1 or a
sulfur atom S in order to form SR1, with R1 and R2, which are
identical or different, are chosen from a hydrogen atom; C1-C8
alkyl optionally substituted with a radical amino, alkylamino,
dialkylamino, (phenyl)(alkyl)amino, (alkylphenyl)(alkyl)amino,
C1-C4 alkoxy, with a radical pyrrolidinyl, pyridyl or with a phenyl
radical; an aromatic ring as defined above; a quinuclidine radical,
a pyrrolidinyl radical or a piperidyl radical optionally
substituted with C1-C4 alkyl [0079] it being understood that R1 and
R2, which are identical, both do not represent hydrogen or
unsubstituted C1-C4 alkyl and R1 and R2, which are different, do
not represent one hydrogen and the other unsubstituted C1-C4 alkyl,
[0080] or alternatively, when X represents N, R1 and R2 together
form with X to which they are attached a piperazinyl, piperidyl,
pyrrolidinyl, morpholinyl or thiomorpholinyl radical, [0081] a
diazine group optionally substituted with the same groups as the
triazine
[0082] or one of its salts,
these compounds being in all the possible isomeric forms,
racemates, enantiomers and diastereoisomers.
[0083] The subject of the present invention is particularly the
compounds as defined above, characterized in that the diazine
groups are pyrimidines or quinazolines.
[0084] The subject of the present invention is more particularly
the compounds as defined above, characterized in that XR1(R2) is
such that, when X represents N, either one of R1 and R2 represents
a hydrogen atom and the other of R1 and R2 is chosen from the
values defined for R1 and R2 or R1 and R2 together form with the
nitrogen atom to which they are attached a piperazinyl,
pyrrolidinyl, piperidyl or morpholino radical
[0085] The present invention relates particularly to compounds as
defined above, characterized in that they correspond to formula (I)
below:
##STR00001##
in which: [0086] A represents a radical XR1(R2) in which X
represents a nitrogen, oxygen, or sulfur atom or a C1-C6 alkyl
radical in order to form one of the following radicals: [0087]
NR1R2 with R1 and R2, which are identical or different, are chosen
from a hydrogen atom; a C1-C8 alkyl optionally substituted with one
or more radicals which are identical or different; an aromatic ring
as defined above; a quinuclidine radical; a pyrrolidinyl radical
which is itself optionally substituted with an alkyl or phenylalkyl
radical with alkyl as C1-C4; a piperazinyl radical which is itself
optionally substituted with an alkyl, cycloalkyl or phenylalkyl
radical; a morpholinyl radical; a pyridyl radical or a piperidyl
radical which is optionally substituted with one or more alkyl or
phenylalkyl radicals with alkyl C1-C4; an indazolyl radical; a
naphthyl radical; a benzotriazole radical; a pyrimidinyl radical
optionally substituted with one or more alkyls with alkyl as C1-C4;
an acenaphthene radical, [0088] it being understood that, when
XR1R2 represents NR1R2, then R1 and R2, which are identical, both
do not represent hydrogen or unsubstituted C1-C4 alkyl and R1 and
R2, which are different, do not represent one hydrogen and the
other unsubstituted C1-C4 alkyl or alternatively, when X represents
N or alkyl, R1 and R2 together form with X to which they are
attached a saturated or unsaturated 3- to 6-membered monocyclic or
8- to 10-membered bicyclic radical optionally containing one or two
heteroatoms, which are identical or different, chosen from N, O or
S, [0089] a group OR1 or SR1 in which R1 has the same meaning as
above, it being understood that R1 does not represent hydrogen or
unsubstituted C1-C4 alkyl, or [0090] an alkyl group containing from
1 to 6 carbon atoms, substituted with R1R2 as defined above [0091]
R3 and R'3, which are identical or different, represent
independently of one another hydrogen or a C1-C4 alkyl group [0092]
Ar.sub.1 and Ar.sub.2, which are identical or different, represent
[0093] when Ar.sub.1 and Ar.sub.2 are identical: [0094] a quinoline
motif optionally substituted with at least one group N(Ra)(Rb) in
which Ra and Rb, which are identical or different, represent
hydrogen or a C1-C4 alkyl radical, (or) a short-chain alkoxy or
alkyl group containing 1 to 4 carbon atoms or [0095] a quinoline
possessing a nitrogen atom in quaternary form or [0096] a
benzamidine or [0097] a pyridine attached at the 4-position or
fused with an aryl or heteroaryl group optionally substituted with
a C1-C4 alkyl group [0098] when Ar.sub.1 and Ar.sub.2 are different
[0099] Ar.sub.1 and Ar.sub.2 both represent one of the
possibilities mentioned above for Ar.sub.1 and Ar.sub.2 or [0100]
Ar.sub.1 represents one of the above possibilities and Ar.sub.2
represents [0101] a phenyl ring optionally substituted with a
halogen group, C1-C4 alkoxy group, cyano group, carbonylamino group
optionally substituted with one or more C1-C4 alkyl groups, guanyl
group, C1-C4 alkylthio group, amino group, C1-C4 alkylamino group,
C1-C4 dialkylamino group for each alkyl group, nitro group, C1-C4
alkyleneamino group, (or) C2-C4 alkenyleneamino group, or a
piperazinyl radical optionally substituted with a C1-C4 alkyl
radical, [0102] a mono- or bi- or tricyclic heterocyclic ring
comprising 0 to 2 heteroatoms per ring provided that at least one
heteroatom is present in at least one ring optionally substituted
with one or more C1-C4 alkyl groups or with C1-C4 alkylene or C2-C4
alkenylene groups or one of its salts, these compounds of formula
(I) being in all the possible isomeric forms, racemates,
enantiomers and diastereoisomers.
[0103] The present invention relates in particular to the compounds
as defined above characterized in that, when one or both of R1 and
R2 represents (represent) a C1-C8 alkyl radical optionally
substituted with one or more radicals which are identical or
different, these radicals are chosen from the amino radical which
is itself optionally substituted with one or two radicals which are
identical or different, chosen from alkyl, hydroxyalkyl,
alkoxyalkyl, phenylalkyl, carboxyalkyl, hydroxycarboxyalkyl, acyl,
naphthyl, phenyl and alkylphenyl radicals; trialkylammonium
radical; hydroxyl radical; alkoxy radical; thioalkoxy radical;
trifluoromethyl radical; free, salified, esterified or amidated
carboxyl radical; pyrrolidinyl radical optionally substituted with
C1-C4 alkyl; piperidyl radical; piperazinyl radical optionally
substituted with alkyl or phenylalkyl with alkyl as C1-C4;
morpholinyl radical; pyridyl radical; naphthyl radical or phenyl
radical itself optionally substituted with one or more radicals
chosen from C1-C4 alkoxy radicals, halogen or amino radical
optionally substituted as defined above.
[0104] The present invention thus relates to the compounds as
defined above, characterized in that XR1(R2) is such that, when X
represents N, either one of R1 and R2 represents a hydrogen atom
and the other of R1 and R2 is chosen from the values defined for R1
and R2, or R1 and R2 together form with the nitrogen atom to which
they are attached a piperazinyl, pyrrolidinyl, piperidyl,
morpholinyl, thiomorpholinyl, imidazolinyl, diazepine or
1,2,3,4-tetrahydroisoquinoline radical, all these radicals being
optionally substituted with one or more radicals.
[0105] The present invention relates in particular to the compounds
as defined above, characterized in that A represents an aromatic
ring as defined above or a radical XR1(R2) in which X represents a
nitrogen atom N to form NR1R2, a linear or branched C1-C6 alkyl
radical to form alkR1R2, an oxygen atom O to form OR1 or a sulfur
atom S to form SR1,
with R1 and R2, which are identical or different, are chosen from a
hydrogen atom; C1-C8 alkyl optionally substituted with one or more
radicals chosen from the radicals amino, alkylamino, dialkylamino,
dialkoxyalkylamino, dihydroxyalkylamino, alkoxyalkylamino,
hydroxyalkylamino, hydroxycarboxyalkylamino, trialkylammonium,
naphthylamino, phenylamino, acylamino, (alkyl)(phenylalkyl)amino,
(phenyl)(alkyl)amino, (alkylphenyl)(alkyl)amino, hydroxyl, C1-C4
alkoxy, C1-C4 thioalkoxy, trifluoromethyl, free, salified,
esterified or amidated carboxyl, pyrrolidinyl optionally
substituted with C1-C4 alkyl, piperidyl, piperazinyl optionally
substituted with alkyl or phenylalkyl with alkyl as C1-C4,
morpholinyl, pyridyl, naphthyl or phenyl optionally substituted
with one or more radicals chosen from the radicals C1-C4 alkoxy,
halogen, amino, alkylamino and dialkylamino; an aromatic ring as
defined above; a quinuclidine radical; a pyrrolidinyl radical which
is itself optionally substituted with an alkyl or phenylalkyl
radical with alkyl as C1-C4; a piperazinyl radical which is itself
optionally substituted with an alkyl, cycloalkyl or phenylalkyl
radical; a morpholinyl radical; a pyridyl radical or a piperidyl
radical which are optionally substituted with one or more alkyl or
phenylalkyl radicals with alkyl C1-C4; an indazolyl radical; a
naphthyl radical, a benzotriazole radical; a pyrimidinyl radical
optionally substituted with one or more alkyl radicals with alkyl
as C1-C4; an acenaphthene radical, it being understood that, when
XR1R2 represents NR1R2, then R1 and R2, which are identical, both
do not represent hydrogen or unsubstituted C1-C4 alkyl and R1 and
R2, which are different, do not represent one hydrogen and the
other unsubstituted C1-C4 alkyl or alternatively, when X represents
N or alkyl, R1 and R2 together form with X to which they are
attached a radical chosen from the following radicals: piperazinyl
optionally substituted with one or more radicals which are
identical or different; pyrrolidinyl optionally substituted with
C1-C4 alkyl or alkoxy, hydroxyl, acylamino, pyrrolidinylalkyl and
pyridyl; 1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally
substituted with alkyl or pyrrolidinylalkyl; piperidyl optionally
substituted with alkyl, alkoxy or alkoxyalkyl, hydroxyl and
cycloalkylalkyl; morpholinyl; imidazolinyl optionally substituted
with alkyl.
[0106] The present invention thus relates to the compounds as
defined above, characterized in that XR1(R2) is such that, when X
represents N, either one of R1 and R2 represents the hydrogen atom
or a C1-C4 alkyl radical optionally substituted with an amino,
alkylamino, dialkylamino or phenyl radical and the other of R1 and
R2 is chosen from the values defined for R1 and R2 in any one of
Claims 1 to 8 or R1 and R2 together form with the nitrogen atom to
which they are attached a piperazinyl radical optionally
substituted with one or more radicals chosen from alkyl,
aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, phenylalkyl,
alkoxyalkyl, hydroxyalkyl, hydroxyalkoxyalkyl with alkoxy,
pyrrolidinylalkyl, C3-C8 cycloalkyl, pyrazinyl, pyrimidinyl,
pyridyl, furylcarbonyl, furfurylcarbonyl and quinolyl; pyrrolidinyl
optionally substituted with C1-C4 alkyl or alkoxy, hydroxyl,
acylamino, pyrrolidinylalkyl and pyridyl;
1,2,3,4-tetrahydroisoquinolinyl; diazepine optionally substituted
with alkyl or pyrrolidinylalkyl; piperidyl optionally substituted
with alkyl, alkoxy or alkoxyalkyl, hydroxyl and cycloalkylalkyl;
morpholinyl; imidazolinyl optionally substituted with alkyl.
[0107] The present invention thus relates to the compounds defined
above which bind the G-quadruplex structure of the telomeres,
characterized in that they correspond to formula (I) below:
##STR00002##
in which: [0108] A represents a radical XR1(R2) in which X
represents a nitrogen, oxygen or sulfur atom or a C1-C6 alkyl
radical in order to form one of the following radicals: [0109]
NR1R2 with R1 and R2, which are identical or different, are chosen
from a hydrogen atom; C1-C8 alkyl optionally substituted with a
radical amino, alkylamino, dialkylamino, (phenyl)(alkyl)amino,
(alkylphenyl)(alkyl)amino, C1-C4 alkoxy, C1-C4 thioalkoxy,
trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl,
pyridyl or phenyl; an aromatic ring as defined in Claim 1; a
quinuclidine radical, a radical pyrrolidinyl, piperazinyl,
morpholinyl, pyridyl or a piperidyl radical optionally substituted
with C1-C4 alkyl it being understood that R1 and R2, which are
identical, both do not represent hydrogen or unsubstituted C1-C4
alkyl and R1 and R2, which are different, do not represent one
hydrogen and the other unsubstituted C1-C4 alkyl or alternatively,
when X represents N or alkyl, R1 and R2 together form with X to
which they are attached a saturated or unsaturated 3- to 6-membered
monocyclic or 8- to 10-membered bicyclic radical optionally
containing one or two heteroatoms, which are identical or
different, chosen from N, O or S, [0110] a group OR1 or SR1 in
which R1 has the same meaning as above, it being understood that R1
does not represent hydrogen or unsubstituted C1-C4 alkyl, or [0111]
an alkyl group containing from 1 to 6 carbon atoms, substituted
with R1R2 as defined above [0112] --R3 and R'3, which are identical
or different, represent independently of one another hydrogen or a
C1-C4 alkyl group [0113] Ar.sub.1 and Ar.sub.2, which are identical
or different, represent [0114] 1. when Ar.sub.1 and Ar.sub.2 are
identical: [0115] a quinoline motif optionally substituted with at
least one group N(Ra)(Rb) in which Ra and Rb, which are identical
or different, represent hydrogen or a C1-C4 alkyl radical, (or) a
short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or
[0116] a quinoline possessing a nitrogen atom in quaternary form or
[0117] a benzamidine or [0118] a pyridine attached at the
4-position or fused with an aryl or heteroaryl group optionally
substituted with a C1-C4 alkyl group [0119] 2. when Ar.sub.1 and
Ar.sub.2 are different [0120] Ar.sub.1 and Ar.sub.2 both represent
one of the possibilities mentioned above for Ar.sub.1 and Ar.sub.2
or [0121] Ar.sub.1 represents one of the above possibilities and
Ar.sub.2 represents [0122] a phenyl ring optionally substituted
with a halogen group, C1-C4 alkoxy group, cyano group,
carbonylamino group optionally substituted with one or more C1-C4
alkyl groups, guanyl group, C1-C4 alkylthio group, amino group,
C1-C4 alkylamino group, C1-C4 dialkylamino group for each alkyl
group, nitro group, C1-C4 alkyleneamino group, (or) C2-C4
alkenyleneamino group, or a piperazinyl radical optionally
substituted with a C1-C4 alkyl radical, [0123] a mono- or bi- or
tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per ring
provided that at least one heteroatom is present in at least one
ring optionally substituted with one or more C1-C4 alkyl groups or
with C1-C4 alkylene or C2-C4 alkenylene groups or one of its salts,
these compounds of formula (I) being in all the possible isomeric
forms, racemates, enantiomers and diastereoisomers.
[0124] The present invention also relates to the novel compounds
characterized in that they correspond to formula (I) below:
##STR00003##
in which: A represents a radical XR1(R2) in which X represents a
nitrogen, oxygen or sulfur atom or a C1-C6 alkyl radical in order
to form one of the following radicals: [0125] NR1R2 with R1 and R2,
which are identical or different, are chosen from a hydrogen atom;
C1-C8 alkyl optionally substituted with a radical amino,
alkylamino, dialkylamino, (phenyl)(alkyl)amino,
(alkylphenyl)(alkyl)amino, C1-C4 alkoxy, C1-C4 thioalkoxy,
trifluoromethyl, pyrrolidinyl, piperidyl, piperazinyl, morpholinyl,
pyridyl or phenyl; an aromatic ring as defined in Claim 1; a
quinuclidine radical, a radical pyrrolidinyl, piperazinyl,
morpholinyl, pyridyl or a piperidyl radical optionally substituted
with C1-C4 alkyl it being understood that R1 and R2, which are
identical, both do not represent hydrogen or unsubstituted C1-C4
alkyl and R1 and R2, which are different, do not represent one
hydrogen and the other unsubstituted C1-C4 alkyl [0126] or
alternatively, when X represents N or alkyl, R1 and R2 together
form with X to which they are attached a saturated or unsaturated
3- to 6-membered monocyclic or 8- to 10-membered bicyclic radical
optionally containing one or two heteroatoms, which are identical
or different, chosen from N, O or S, [0127] a group OR1 or SR1 in
which R1 has the same meaning as above, it being understood that R1
does not represent hydrogen or unsubstituted C1-C4 alkyl, or [0128]
an alkyl group containing from 1 to 6 carbon atoms, substituted
with R1R2 as defined above [0129] R3 and R'3, which are identical
or different, represent independently of one another hydrogen or a
C1-C4 alkyl group [0130] Ar.sub.1 and Ar.sub.2, which are identical
or different, represent [0131] when Ar.sub.1 and Ar.sub.2 are
identical: [0132] a quinoline motif optionally substituted with at
least one group N(Ra)(Rb) in which Ra and Rb, which are identical
or different, represent hydrogen or a C1-C4 alkyl radical, (or) a
short-chain alkoxy or alkyl group containing 1 to 4 carbon atoms or
[0133] a quinoline possessing a nitrogen atom in quaternary form or
[0134] a benzamidine or [0135] a pyridine attached at the
4-position or fused with an aryl or heteroaryl group optionally
substituted with a C1-C4 alkyl group [0136] when Ar.sub.1 and
Ar.sub.2 are different [0137] Ar.sub.1 and Ar.sub.2 both represent
one of the possibilities mentioned above for Ar.sub.1 and Ar.sub.2
or [0138] Ar.sub.1 represents one of the above possibilities and
Ar.sub.2 represents [0139] a phenyl ring optionally substituted
with a halogen group, C1-C4 alkoxy group, cyano group,
carbonylamino group optionally substituted with one or more C1-C4
alkyl groups, guanyl group, C1-C4 alkylthio group, amino group,
C1-C4 alkylamino group, C1-C4 dialkylamino group for each alkyl
group, nitro group, C1-C4 alkyleneamino group, (or) C2-C4
alkenyleneamino group, or a piperazinyl radical optionally
substituted with a C1-C4 alkyl radical, [0140] a mono- or bi- or
tricyclic heterocyclic ring comprising 0 to 2 heteroatoms per ring
provided that at least one heteroatom is present in at least one
ring optionally substituted with one or more C1-C4 alkyl groups or
with C1-C4 alkylene or C2-C4 alkenylene groups or one of its salts,
these compounds of formula (I) being in all the possible isomeric
forms, racemates, enantiomers and diastereoisomers.
[0141] The present invention relates in particular to the compounds
of formula (I) as defined above in which A represents a radical
XR1(R2) in which X represents a nitrogen atom N in order to form
NR1R2, an oxygen atom O in order to form OR1 or a sulfur atom S in
order to form SR1 as follows: [0142] NR1R2 with R1 and R2, which
are identical or different, are chosen from a hydrogen atom; C1-C8
alkyl optionally substituted with a radical amino, alkylamino,
dialkylamino, (phenyl)(alkyl)amino, (alkylphenyl)(alkyl)amino,
C1-C4 alkoxy, with a radical pyrrolidinyl, pyridyl or with a phenyl
radical; an aromatic ring as defined in Claim 1; a quinuclidine
radical, a pyrrolidinyl radical or a piperidyl radical optionally
substituted with C1-C4 alkyl [0143] it being understood that R1 and
R2, which are identical, both do not represent hydrogen or
unsubstituted C1-C4 alkyl and R1 and R2, which are different, do
not represent one hydrogen and the other unsubstituted C1-C4 alkyl,
[0144] or alternatively, when X represents N, R1 and R2 together
form with X to which they are attached a piperazinyl, piperidyl,
pyrrolidinyl, morpholinyl or thiomorpholinyl radical, [0145] or a
group OR1 or SR1 in which R1 has the same meaning as above it being
understood that R1 does not represent hydrogen or unsubstituted
C1-C4 alkyl.
[0146] The present invention relates more specifically to the
compounds of formula (I) as defined above in which, when A
represents NR1R2, either one of R1 and R2 represents a hydrogen
atom and the other of R1 and R2 is chosen from the values defined
for R1 and R2, or R1 and R2 together form with the nitrogen atom to
which they are attached a piperazinyl, pyrrolidinyl, piperidyl or
morpholinyl radical.
[0147] The present invention also relates more specifically to the
compounds of formula (I) as defined above in which the group A
represents:
either an amino radical substituted with a radical chosen from the
following groups: 4-amino- or 4-methylamino- or
4-dimethylaminoquinolyl or -quinolinium in which the quinolinium
ring is optionally substituted with a group methyl; pyridyl; phenyl
optionally substituted with one or more halogen atoms or with a
radical piperazinyl or alkylpiperazinyl; C1-C4 alkyl substituted
with a radical amino, alkylamino or dialkylamino,
(phenyl)(alkyl)amino, (alkylphenyl)(alkyl)amino, C2-C4 alkoxy, with
a pyrrolidinyl radical or with a phenyl radical, in which radicals
the alkyl groups possess 1 to 4 carbon atoms; a pyrrolidinyl
radical; a piperidyl radical optionally substituted with a C1-C4
alkyl radical; or a quinuclidine radical or a pyrrolidinyl radical,
a morpholino radical or a piperazinyl radical optionally
substituted with a C1-C4 alkyl radical or a radical O-phenyl,
O-pyridyl or O-alkyl substituted with an amino, alkylamino or
dialkylamino radical
[0148] Among the compounds defined above, there are mentioned
particularly the compounds characterized in that Ar.sub.1 and
Ar.sub.2 represent a group chosen from the following groups:
4-amino- or 4-methylamino- or 4-dimethylaminoquinolyl or
-quinolinium in which the quinolinium ring is optionally
substituted with a group methyl; or phenyl optionally substituted
with one or more halogen atoms.
[0149] Among the compounds defined above, there are also mentioned
particularly the compounds characterized in that the group A
represents:
either an amino radical substituted with a radical chosen from the
following groups: 4-amino- or 4-methylamino- or
4-dimethylaminoquinolyl or -quinolinium in which the quinolinium
ring is optionally substituted with a group methyl; pyridyl; phenyl
optionally substituted with one or more halogen atoms or with a
radical piperazinyl or alkylpiperazinyl; C1-C4 alkyl substituted
with a radical amino, alkylamino or dialkylamino,
(phenyl)(alkyl)amino, (alkylphenyl)(alkyl)amino, C2-C4 alkoxy, with
a pyrrolidinyl radical or with a phenyl radical, in which radicals
the alkyl groups possess 1 to 4 carbon atoms; a pyrrolidinyl
radical; a piperidyl radical optionally substituted with a C1-C4
alkyl radical; or a quinuclidine radical or a pyrrolidinyl radical,
a morpholino radical or a piperazinyl radical optionally
substituted with a C1-C4 alkyl radical or a radical O-phenyl,
O-pyridyl or O-alkyl substituted with an amino, alkylamino or
dialkylamino radical.
[0150] Among the compounds defined above, there are further
particularly mentioned the compounds characterized in that, when
Ar.sub.1 and Ar.sub.2 are identical, Ar.sub.1 and Ar.sub.2
represent a group chosen from the groups 4-amino- or 4-methylamino-
or 4-dimethylaminoquinolyl or -quinolinium in which the quinolinium
ring is optionally substituted with a methyl group.
[0151] Among the compounds defined above, there are mentioned
particularly the compounds characterized in that, when Ar.sub.1 and
Ar.sub.2 are different,
[0152] 1. Ar.sub.1 represents: [0153] a quinoline motif substituted
with at least one group N(Ra)(Rb) in which Ra and Rb, which are
identical or different, represent hydrogen or a C1-C4 alkyl radical
or a short-chain alkoxy or alkyl group containing 1 to 4 carbon
atoms, or [0154] a quinoline possessing a nitrogen atom in
quaternary form or [0155] a benzamidine except in the case where A
represents diethylamine, hydrogen or an amine group or [0156] a
pyridine attached at the 4-position or fused with an aryl or
heteroaryl group
[0157] 2. Ar.sub.2 represents [0158] a ring as defined above but
different or [0159] a phenyl ring optionally substituted with a
halogen, methoxy, cyano, carbonylamino, guanyl, methylthio, amino,
methylamino, dimethylamino, morpholine, C1-C4 alkyleneamino or
C2-C4 alkenyleneamino group [0160] a quinoline, benzimidazole,
indole, benzothiophene, benzofuran, benzothiazole, benzoxazole,
carbazole, quinazoline or quinoxaline ring optionally substituted
with one or more C1-C4 alkyl groups or with C1-C4 alkylene or C2-C4
alkenylene groups
[0161] Among the compounds defined above, there are mentioned more
particularly the compounds characterized in that A represents an
amino radical substituted with a radical chosen from the following
groups: 4-amino- or 4-methylamino- or 4-dimethylaminoquinolinyl or
-quinolinium radicals in which the quinolinium ring is optionally
substituted with a methyl group; C1-C4 alkyl radicals substituted
with an amino, alkylamino, dialkylamino, (phenyl)(alkyl)amino,
(alkylphenyl)(alkyl)amino, pyrrolidinyl or pyridyl radical; or the
quinuclidine radical
[0162] Among the compounds defined above, there are also mentioned
the compounds characterized in that A represents either an amino
radical substituted with a radical pyridyl; phenyl optionally
substituted with a piperazinyl or alkylpiperazinyl radical; a
piperidyl radical optionally substituted with a C1-C4 alkyl radical
or a piperazinyl radical optionally substituted with a C1-C4 alkyl
radical.
[0163] There are mentioned in particular the compounds as defined
above, characterized in that A represents a radical O (or
S)-aromatic ring or a radical O (or S)-alkyl with alkyl optionally
substituted.
[0164] Among the compounds defined above, there are further
mentioned the compounds characterized in that A represents a
radical O-phenyl, O-pyridyl, or O-alkyl substituted with an amino,
alkylamino or dialkylamino radical.
[0165] It is evident that the quinoline motifs may be substituted
by any other group not involved in the intended application; thus,
acridine or isoquinoline or quinazoline or quinoxaline or
phthalazine or benzothiazine or benzoxazine or phenoxazine or
phenothiazine groups are included in the definition of the
quinoline groups.
[0166] Among the above compounds of formula (I), there are
preferred those comprising two heterocycles chosen from the
4-aminoquinolyl, 4-aminoquinolinium or quinolinium groups in which
the quinolinium ring is optionally substituted with a methyl
group.
[0167] Among the preferred products as defined above, there may be
mentioned the products of Examples 1, 2, 11, 17, 19, 20, 27, 29,
31, 32 and 33 of Table 1 below which therefore correspond
respectively to the compounds whose names follow: [0168]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(3-dimethylaminopro-
pyl)amino-[1,3,5]triazine (Example 1) [0169]
2,4,6-tris(4-amino-2-methylquinolin-6-yl)amino-[1,3,5]triazine
(Example 2) [0170]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-(4-dimethylamino--
2-methylquinolin-6-yl)amino-[1,3,5]triazine (Example 11) [0171]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-(quinuclidin-3-yl)amino-[1,-
3,5]triazine (Example 17) [0172]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(1-methylpiperidin--
4-yl)-[1,3,5]triazine (Example 19) [0173]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(1-methylpiperazin--
4-yl)-[1,3,5]triazine (Example 20) [0174]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(pyridin-4-yl)methy-
lamino-[1,3,5]triazine (Example 27) [0175]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-phenoxy-[1,3,5]triazine
(Example 29) [0176]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-(3-dimethylaminopropyl)oxy--
[1,3,5]triazine (Example 31) [0177]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-(pyridin-4-yl)oxy-[1,3,5]tr-
iazine (Example 32) [0178]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-(phenylmethyl)oxy-[1,3,5]tr-
iazine (Example 33).
[0179] Among the preferred products of the present invention as
defined above, there may be mentioned particularly the products of
Table 1 below which correspond to the compounds whose names follow:
[0180]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(3-dimethylaminopro-
pyl)amino-[1,3,5]triazine (Example 1) [0181]
2,4,6-tris(4-amino-2-methylquinolin-6-yl)amino-[1,3,5]triazine
(Example 2) [0182]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-(4-dimethylamino--
2-methylquinolin-6-yl)amino-[1,3,5]triazine (Example 11) [0183]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(1-methylpiperazin--
4-yl)-[1,3,5]triazine (Example 20) [0184]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(pyridin-4-yl)oxy-[-
1,3,5]triazine (Example 115) [0185]
2,4-bis(4-amino-2-methylquinolin-6-yl)amino-6-(quinolin-2-yl)thio-[1,3,5]-
triazine (Example 128) [0186]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-phenyl-[1,3,5]triaz-
ine (Example 134) [0187]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[1-(2-dipropylamino-
ethyl)piperazin-4-yl]-[1,3,5]triazine (Example 137) [0188]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-{[1-2-(2-hydroxyeth-
yl)oxyethyl]piperazin-4-yl}-[1,3,5]triazine (Example 141) [0189]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[2(S)-(pyrrolidin-1-
-yl)methylpyrrolidin-1-yl]-[1,3,5]triazine (Example 149) [0190]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(quinolin-2-yl)thio-
-[1,3,5]triazine (Example 133) [0191]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(1-methylhomopipera-
zin-4-yl)-[1,3,5]triazine (Example 135) [0192]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[1-(3-dimethylamino-
propyl)piperazin-4-yl]-[1,3,5]triazine (Example 136) [0193]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[N-(1-methylpiperid-
in-4-yl)-N-methylamino]-[1,3,5]triazine (Example 138) [0194]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-{1-[3-(pyrrolidin-1-
-yl)propylhomopiperazin-4-yl)-[1,3,5]triazine (Example 139) [0195]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[1-(pyridin-4-yl)pi-
perazin-4-yl]-[1,3,5]triazine (Example 144)
[0196] Among the preferred products of the present invention as
defined above, there may be mentioned most particularly the
products of Table 1 below which correspond to the compounds whose
names follow: [0197]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(1-methylpiperazin--
4-yl)-[1,3,5]triazine (Example 20) [0198]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(quinolin-2-yl)thio-
-[1,3,5]triazine (Example 133) [0199]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(1-methylhomopipera-
zin-4-yl)-[1,3,5]triazine (Example 135) [0200]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[1-(3-dimethylamino-
propyl)piperazin-4-yl]-[1,3,5]triazine (Example 136) [0201]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[N-(1-methylpiperid-
in-4-yl)-N-methylamino]-[1,3,5]triazine (Example 138) [0202]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-{1-[3-(pyrrolidin-1-
-yl)propylhomopiperazin-4-yl)-[1,3,5]triazine (Example 139) [0203]
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-[1-(pyridin-4-yl)pi-
perazin-4-yl]-[1,3,5]triazine (Example 144).
[0204] Another subject of the present invention relates to the use
of the compounds of the formula (I) as pharmaceutical product for
human use.
[0205] The subject of the present invention is most particularly
the pharmaceutical compositions comprising, as active ingredient, a
product of formula (I) as defined above.
[0206] The subject of the present invention is most particularly
the pharmaceutical compositions comprising, as active ingredient, a
product of formula (I) of Table 1 below.
[0207] The subject of the present invention is most particularly
the pharmaceutical compositions comprising, as active ingredient, a
product of formula (I) chosen from those whose names are mentioned
above.
[0208] The invention therefore extends to the pharmaceutical
compositions containing, as active ingredient, at least one of the
medicaments as defined above.
[0209] These pharmaceutical compositions may be administered
orally, parenterally or locally as a topical application to the
skin and the mucous membranes or by injection intravenously or
intramuscularly.
[0210] These compositions may be solids or liquids and may be
provided in any pharmaceutical form commonly used in human medicine
such as, for example, simple or sugar-coated tablets, pills,
lozenges, gelatin capsules, drops, granules, injectable
preparations, ointments, creams or gels; they are prepared
according to the customary methods. The active ingredient may be
incorporated therein with excipients normally used in these
pharmaceutical compositions, such as talc, gum arabic, lactose,
starch, magnesium stearate, cocoa butter, aqueous or nonaqueous
vehicles, fatty substances of animal or plant origin, paraffin
derivatives, glycols, various wetting, dispersing or emulsifying
agents, preservatives.
[0211] The processes for preparing the compounds of formula
(I):
##STR00004##
are described below.
General Method 1
[0212] According to a first preparation method, compounds of
general formula (I) in which Ar.sub.1 and Ar.sub.2 on the one hand
and R.sub.3 and R'.sub.3 on the other hand are identical and
defined as above and R represents a halogen atom such as chlorine
or fluorine, an amino, alkylamino or dialkylamino function in which
the straight or branched alkyl portions contain from 1 to 4 carbon
atoms, an alkyloxy or alkylthio function in which the straight or
branched alkyl portions contain from 1 to 4 carbon atoms, an
alkyloxy or alkylthio function in which the straight or branched
alkyl portions contain from 1 to 4 carbon atoms, may be obtained by
amination of a dihalotriazine, most generally a
dichloro-s-triazine, of general formula (B) in which A is as
defined above, with an aromatic or heteroaromatic amine of general
formula (C) in which Ar is as defined above, the procedure being
carried out according to scheme 1:
##STR00005##
[0213] In the case where A represents a halogen atom, it is useful
to react the corresponding 2,4,6-trihalo-s-triazine of general
formula (B) with the aromatic or heteroaromatic amine ArNHR.sub.3
of general formula (C).
[0214] The procedure is generally carried out by condensing one
mole of dihalo-s-triazine, or trihalo-s-triazine, with 2 moles of
aromatic or heteroaromatic amine. The reaction takes place in an
inert medium under the reaction conditions. There may be mentioned,
among the inert solvents, acetone which is optionally aqueous or an
alcohol which is optionally aqueous such as ethanol, or a
halogenated solvent such as dichloromethane, or an ether such as
diethyl ether or dioxane, or a polar aprotic solvent such as DMF,
DMSO or NMP. The procedure is preferably carried out at a
temperature of between 20.degree. C. and the reflux temperature, in
the presence in particular of an organic base such as
triethylamine, or an inorganic base such as sodium hydroxide or
sodium or potassium carbonate. It is also possible not to use a
base during the amination reaction, and to isolate a hydrochloride
of the product of general formula (A), whose base can then be
released.
[0215] The dihalo- or trihalo-s-triazines of general formula (B)
are either commercially available or are known, and may be obtained
under the conditions described in the literature.
[0216] The aromatic or heteroaromatic amines of general formula (C)
are either known or may be easily prepared by the known methods of
synthesizing aromatic or heteroaromatic amines.
[0217] In the case where Ar.sub.1 and Ar.sub.2 are different, the
triazine of general formula (A) may be obtained by sequential
displacement of the halogen atoms, most generally of the chlorine
atoms, from the products of general formula (B) by the amines
Ar.sub.1NHR.sub.3 and then Ar.sub.2NHR'.sub.3 of general formula
(C) according to scheme 2:
##STR00006##
[0218] Generally, the procedure is carried out with 1 mole of
dihalo-s-triazine, or trihalo-s-triazine, and 1 mole of amine
Ar.sub.1NHR.sub.3. The procedure is preferably carried out in an
inert solvent such as acetone which is optionally aqueous or an
alcohol which is optionally aqueous, such as ethanol, or a
halogenated solvent such as dichloromethane, or an ether such as
diethyl ether or dioxane, or a polar aprotic solvent such as DMF,
DMSO or NMP. According to a better way of carrying out the
invention, the procedure is carried out at a temperature of between
20.degree. C. and 50.degree. C. Next, 1 mole of amine
Ar.sub.2NHR'.sub.3 is added to the product of general formula (D),
which may be optionally isolated. The procedure is carried out in
particular at a temperature of between 50.degree. C. and the reflux
temperature.
[0219] Advantageously, it is possible to carry out the procedure
under the conditions described in J. Fluor. Chem., 1988, 39(1),
117-123.
General Method 2
[0220] According to a second method, the products of general
formula (A) in which Ar.sub.1NHR.sub.3 and Ar.sub.2NHR'.sub.3 are
as defined above and R represents a group NR1R2 or OR1 or SR1 or
alkR1R2 may also be prepared by nucleophilic displacement of a
halogen atom, generally a chlorine atom, from a product of general
formula (A) in which R represents a halogen atom according to
scheme 3:
##STR00007##
[0221] The procedure is generally carried out by condensing 1 mole
of product of general formula (A) in which R represents a halogen
atom, preferably a chlorine atom, with 1 mole of amine R1R2NH or
alcoholate R1O.sup.- or thioalcoholate R1S or organometallic
R1R2alkM, it being possible for M to represent, for example,
magnesium or lithium or zinc. The reaction takes place in an inert
medium under the reaction conditions. There may be mentioned among
the inert solvents acetone which is optionally aqueous or an
alcohol which is optionally aqueous such as ethanol, or a
halogenated solvent such as dichloromethane, or an ether such as
diethyl ether or dioxane or tetrahydrofuran, it being understood
that these ethers are solvents which can be used when an
organometallic R1R2alkM is used, or a polar aprotic solvent such as
DMF, DMSO or NMP. When the entering group represents a group
R1R2NH, the procedure is preferably carried out at a temperature of
between 20.degree. C. and the reflux temperature, in the presence
in particular of an organic base such as triethylamine, or an
inorganic base such as sodium-hydroxide or sodium or potassium
carbonate. It is also possible not to use a base during the
amination reaction, and to isolate a hydrochloride of the product
of general formula (A), the base of which can then be released.
When the entering group represents a group R1O.sup.- or R1S.sup.-,
the procedure is preferably carried out with an alkali metal or
alkaline-earth metal alcoholate or thioalcoholate, such as a sodium
or potassium or lithium or ammonium or cesium or barium salt, in a
polar aprotic solvent such as DMF or DMSO or NMP, at a temperature
of between 50.degree. C. and the reflux temperature. When the
entering group represents a group R1R2alk, the procedure is most
preferably carried out in an ether such as diethyl ether or dioxane
or tetrahydrofuran, at a temperature of between -70.degree. C. and
the reflux temperature of the reaction medium.
[0222] It is understood that the s-triazines of general formula may
be obtained in the form of libraries, by applying the methods
described in schemes 1, 2 or 3 in parallel and/or combinatorial
chemistry in liquid phase or in solid phase, it being understood
that, when the work is carried out in solid phase, any of the
reagents is attached beforehand onto a solid support, chosen
according to the chemical reaction involved, and that said chemical
reaction is followed by an operation of cleaving the product of the
reaction from the solid support.
[0223] The present invention also relates to therapeutic
compositions containing a compound according to the invention, in
combination with a pharmaceutically acceptable carrier according to
the mode of administration chosen. The pharmaceutical composition
may be provided in solid, liquid or liposome form.
[0224] Among the solid compositions, there may be mentioned
powders, gelatin capsules and tablets. Among the oral forms, it is
also possible to include the solid forms which are protected from
the acidic medium of the stomach. The carriers used for the solid
forms consist in particular of inorganic carriers such as
phosphates, carbonates or organic carriers such as lactose,
celluloses, starch or polymers. The liquid forms consist of
solutions, suspensions or dispersions. They contain, as dispersive
carrier, either water or an organic solvent (ethanol, NMP and the
like) or mixtures of surfactants and solvents or of complexing
agents and solvents.
[0225] The administered dose of the compounds of the invention will
be adjusted by the practitioner according to the route of
administration, the patient and the condition of the latter.
[0226] The compounds of the present invention may be administered
alone or mixed with other anticancer agents. Among the possible
combinations, there may be mentioned [0227] alkylating agents and
in particular cyclophosphamide, melphalan, ifosfamide,
chlorambucil, busulfan, thiotepa, prednimustine, carmustine,
lomustine, semustine, streptozotocin, decarbazine, temozolomide,
procarbazine and hexamethylmelamine [0228] platinum derivatives
such as in particular cisplatin, carboplatin or oxaliplatin [0229]
antibiotic agents such as in particular bleomycin, mitomycin,
dactinomycin, [0230] antimicrotubule agents such as in particular
vinblastine, vincristine, vindesine, vinorelbine, taxoids
(paclitaxel and docetaxel) [0231] anthracyclines such as in
particular doxorubicin, daunorubicin, idarubicin, epirubicin,
mitoxantrone, losoxantrone [0232] group I and II topoisomerases
such as etoposide, teniposide, amsacrine, irinotecan, topotecan and
tomudex, [0233] fluoropyrimidines such as 5-fluorouracil, UFT,
floxuridine, [0234] cytidine analogues such as 5-azacytidine,
cytarabine, gemcitabine, 6-mercaptomurine, 6-thioguanine [0235]
adenosine analogues such as pentostatin, cytarabine or fludarabine
phosphate [0236] methotrexate and folinic acid [0237] various
enzymes and compounds such as L-asparaginase, hydroxyurea,
trans-retinoic acid, suramine, dexrazoxane, amifostine, herceptin
as well as oestrogenic and androgenic hormones [0238] antivascular
agents such as combretastatin and colchicine derivatives and their
prodrug.
[0239] It is also possible to combine a radiation treatment with
the compounds of the present invention. These treatments may be
administered simultaneously, separately or sequentially. The
treatment will be adapted to the patient to be treated by the
practitioner.
[0240] The G-quadruplex stabilizing activity may be determined by a
method using the formation of a complex with fluorescein of which
the experimental protocol is described below.
Oligonucleotides
[0241] All the nucleotides, modified or otherwise, were synthesized
by Eurogentec SA, Seraing, Belgium. The oligonucleotide FAM+DABCYL
carries the catalogue reference OL-0371-0802. It has the
sequence:
GGGTTAGGGTTAGGGTTAGGG corresponding to 3.5 repeats of the human
telomeric motif (strand rich in G). The fluorescein is attached to
the 5' end, the DABCYL to the 3' end, by the chemical arms
described by Eurogentec. The concentration of the samples is
checked by spectrophotometry, recording the absorbance spectrum
between 220 and 700 nm and using the molar extinction coefficient
provided by the supplier.
[0242] Buffers
[0243] All the experiments were carried out in a 10 mM sodium
cacodylate buffer pH 7.6 containing 0.1 M lithium chloride (or
sodium chloride). The absence of fluorescent contamination in the
buffer was checked beforehand. The fluorescent oligonucleotide is
added at the final concentration of 0.2 .mu.M.
[0244] Study of Fluorescence
[0245] All the measurements of fluorescence were carried out on a
Spex Fluorolog DM1B apparatus, using an excitation line width of
1.8 nm and an emission line width of 4.5 nm. The samples are placed
in a microquartz cuvette of 0.2.times.1 cm. The temperature of the
sample is controlled by an external water bath. The oligonucleotide
alone was analyzed at 20, 30, 40, 50, 60, 70 and 80.degree. C. The
emission spectra are recorded using an excitation wavelength of 470
nm. The excitation spectra are recorded using either 515 nm or 588
nm as emission wavelength. The spectra are corrected for the
response of the instrument by reference curves. A high extinction
(80-90%) of the fluorescence of fluorescein at room temperature is
observed, in agreement with an intramolecular folding of the
oligonucleotide at 20.degree. C. in the form of a G-quadruplex,
which induces juxtaposition of its 5' and 3' ends which are
respectively linked to fluorescein and to DABCYL. This
juxtaposition causes an already-described phenomenon of extinction
of fluorescence which is used for "molecular beacons".
[0246] Fluorescence Tm
[0247] An oligonucleotide stock solution at the strand
concentration of 0.2 .mu.M in 0.1 M LiCl, 10 mM cacodylate buffer,
pH 7.6, is prepared beforehand, heated briefly at 90.degree. C. and
slowly cooled to 20.degree. C., and then distributed in aliquots of
600 .mu.l in the fluorescence cuvettes. 3 .mu.l of water (for the
control) or 3 .mu.l of test product (stock at 200 .mu.M, final
concentration 1 .mu.M) are then added and mixed. The samples are
then allowed to incubate for at least 1 hour at 20.degree. C.
before each measurement. The use of longer incubation times (up to
24 hours) has no influence on the result obtained.
[0248] Each experiment allows the measurement of only one sample.
The latter is first incubated at an initial temperature of
20.degree. C., heated to 80.degree. C. over 38 minutes, left for 5
minutes at 80.degree. C. and then cooled to 20.degree. C. over 62
minutes. During this time, the fluorescence is measured
simultaneously at two emission wavelengths (515 nm and 588 nm)
using 470 nm as excitation wavelength. A measurement is carried out
every 30 seconds. The temperature of the water bath is recorded in
parallel, and the fluorescence profile as a function of the
temperature is reconstituted from these values. The fluorescence
profiles are then normalized between 20.degree. C. and 80.degree.
C., and the temperature for which the intensity of emission at 515
nm is the mean of those at high and low temperature is called Tm.
Under these conditions, the Tm of the reference sample without
addition of product is 44.degree. C. in a lithium chloride buffer.
This temperature is increased to more than 55.degree. C. in a
sodium chloride buffer. The addition of a G-quadruplex-stabilizing
compound induces an increase in the Tm. This increase is judged to
be significant if it is greater than 3.degree..
[0249] The antitelomerase biological activity is determined by the
following experimental protocol:
[0250] Preparation of the Extract Enriched in Human Telomerase
Activity
[0251] The leukemia line HL60 is obtained from ATCC (American Type
Culture Collection, Rockville, USA). The cells are cultured in
suspension in RPMI 1640 medium containing L-glutamine at 2 mM,
penicillin 200 U/ml, streptomycin 200 .mu.g/ml, gentamycin 50
.mu.g/ml and supplemented with 10% heat-inactivated foetal calf
serum.
[0252] An aliquot of 10.sup.5 cells is centrifuged at 3000.times.G
and the supernatant discarded. The cell pellet is resuspended by
several successive pipettings in 200 .mu.l of lysis buffer
containing 0.5% CHAPS, 10 mM Tris-HCl, pH 7.5, 1 mM MgCl.sub.2, 1
mM EGTA, 5 mM .beta.-mercaptoethanol, 0.1 mM PMSF and 10% glycerol
and is stored in ice for 30 minutes. The lysate is centrifuged at
160,000.times.G for 20 minutes at 4.degree. C. and 160 .mu.l of
supernatant are recovered. The proteins in the extract are assayed
by the Bradford method. The extract is stored at -80.degree. C.
[0253] Assay of the Telomerase Activity
[0254] The inhibition of the telomerase activity is determined by a
protocol for extension of the oligonucleotide TS
(.sup.5'AATCGTTCGAGCAGAGTT.sup.3'), in the presence of a cellular
extract enriched in telomerase activity and compounds which are
added at various concentrations (10 .mu.l, 0.1 and 0.01 .mu.M). The
extension reaction is followed by a PCR amplification of the
extension products with the aid of the oligonucleotides TS and
CXext (.sup.5'GTGCCCTTACCCTTACCCTTACCCTAA.sup.3').
[0255] The reaction medium is prepared based on the following
composition:
TABLE-US-00001 Tris HCl pH 8.3 20 mM MgCl2 1.5 mM Tween 20 0.005%
(P/V) EGTA 1 mM dATP 50 .mu.M dGTP 50 .mu.M dCTP 50 .mu.M dTTP 50
.mu.M Oligonucleotide TS 2 .mu.g/ml Oligonucleotide CXext 2
.mu.g/ml Bovine serum albumin 0.1 mg/ml Taq DNA polymerase 1 U/ml
alpha 32P dCTP (3000 Ci/mmol) 0.5 .mu.l Telomerase extract 200 ng
in a volume of 10 .mu.l Test product or solvent in a volume of 5
.mu.l Double-distilled water QS 50 .mu.l
[0256] The oligonucleotides are obtained from Eurogentec (Belgium)
and are stored at -20.degree. C. at a stock concentration of 1
mg/ml in distilled water.
[0257] The reaction samples are assembled in 0.2 ml PCR tubes and
one drop of paraffin oil is deposited on each of the reactions of
the experiment before closing the tubes.
[0258] The reaction samples are then incubated in a Cetus 4800-type
PCR apparatus under the following temperature conditions:
[0259] 15 minutes at 30.degree. C.,
[0260] 1 minute at 90.degree. C.,
[0261] followed by 30 cycles of,
[0262] 30 seconds at 94.degree. C.,
[0263] 30 seconds at 50.degree. C.,
[0264] and 1 minute 30 seconds at 72.degree. C.,
[0265] followed by a final cycle of 2 minutes at 72.degree. C.
[0266] For each of the samples, an aliquot of 10 .mu.l is pipetted
under the oil layer and mixed with 5 .mu.l of a loading buffer
containing:
TABLE-US-00002 TBE 3X glycerol 32% (P/V) bromophenol blue 0.03%
xylene cyanol 0.03%
[0267] The samples are then analyzed by electrophoresis on 12%
acrylamide gel in a 1.times.TBE buffer for 1 hour at a voltage of
200 volts, with the aid of a Novex electrophoresis system.
[0268] The acrylamide gels are then dried on a sheet of Whatmann 3
mm paper at 80.degree. C. for 1 hour.
[0269] The analysis and the quantification of the reaction products
are carried out with the aid of an InstantImager apparatus
(Pacard).
[0270] For each compound concentration tested, the results are
expressed as percentage inhibition of the reaction and calculated
from the untreated enzymatic control and from the enzyme-free
sample (blank) according to the following formula:
(compound value-blank value/enzymatic control value-blank
value).times.100.
[0271] The concentration of compound inducing a 50% inhibition of
the telomerase reaction (IC50) is determined with the aid of a
semilogarithmic graphical representation of the inhibition values
obtained as a function of each of the compound concentrations
tested.
[0272] A compound is considered to be active as an antitelomerase
agent when the quantity inhibiting 50% of the telomerase reaction
is in particular less than 5 .mu.M.
The cytotoxic biological activity on human tumor lines is
determined according to the following experimental protocol:
[0273] The human cell lines A549 are obtained from ATCC (American
Type Culture Collection, Rockville, USA). The A549 cells are
cultured in a layer in a culture flask in RPMI 1640 medium
containing L-glutamine at 2 mM, penicillin 200 U/ml, streptomycin
200 .mu.g/ml and supplemented with 10% heat-inactivated foetal calf
serum. The KB cells are cultured in a layer in a culture flask in
Dulbelco's medium containing L-glutamine at 2 mM, penicillin 200
U/ml, streptomycin 200 .mu.g/ml and supplemented with 10%
heat-inactivated foetal calf serum.
[0274] The cells at the exponential growth phase are trypsinized,
washed in 1.times.PBS and are inoculated in 96-well microplates
(Costar) in an amount of 4.times.10.sup.4 cells/ml for A549 and of
1.5.times.10.sup.4 cells/ml (0.2 ml/well) and then incubated for 96
hours in the presence of variable concentrations of product to be
studied (10, 1, 0.1 and 0.01 .mu.M, each point in quadruplicate).
16 hours before the end of the incubation, 0.02% final of neutral
red is added to each well. At the end of the incubation, the cells
are washed with 1.times.PBS and lysed with 1% sodium lauryl
sulfate. The cellular incorporation of the dye, which reflects
cellular growth, is evaluated by spectro-photometry at a wavelength
of 540 nm for each sample with the aid of a Dynatech MR5000 reading
apparatus.
[0275] For each compound concentration tested, the results are
expressed as percentage of inhibition of cellular growth and
calculated from the untreated control and the culture medium free
of cells (blank) according to the following formula:
(compound value-blank value/cell control value-blank
value).times.100.
[0276] The concentration of compound inducing a 50% inhibition of
growth (IC50) is determined with the aid of a semilogarithmic
graphical representation of the inhibition values obtained as a
function of each of the compound concentrations tested.
[0277] A compound is considered to be active as cytotoxic agent if
the concentration inhibiting the growth of the tumor cells tested
by 50% is in particular less than 10 .mu.M.
[0278] The following non-limiting examples are given to illustrate
the invention.
[0279] Table 1 below gives the chemical structures as well as the
G-quartet, antitelomerase and cytotoxic activities of 176 products
which constitute, in the chronological order in which they appear
in this table, Examples 1 to 176 of the present invention which
illustrate the present invention without, however, limiting it. In
Table 1 below, `no` appears when the product does not possess a
substituent in the corresponding column in agreement with the
chemical definition of the products of the present invention.
EXAMPLE 1
Preparation of
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(3-dimethylaminopro-
pyl)amino-[1,3,5]triazine
[0280] 0.5 g (0.0036 mol) of potassium carbonate, 1 g (0.00189 mol)
of
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-chloro-[1,3,5]triaz-
ine prepared according to patent W0001561 and 1 ml (0.0078 mol) of
N,N-dimethyl-1,3-propanediamine are successively loaded into a 250
ml round-bottomed flask containing 50 ml of DMF, with stirring, and
then the mixture is heated for 15 hours at 100.degree. C. The
reaction medium is concentrated and taken up in 100 ml of water.
The precipitate formed is filtered, washed with 2.times.50 ml of
0.1N NaOH and then dried. There are thus obtained 1.2 g of
N,N'-bis(4-dimethylamino-2-methylquinolin-6-yl)-N''-(3-dimethylaminopropy-
l)-[1,3,5]triazine, which is purified by flash chromatography on 30
g of silica (35-70 .mu.m), eluting with a mixture (85/10/5) of
dichloromethane, methanol and triethylamine. There is thus
obtained, after drying under vacuum at 40.degree. C., 0.45 g (41%)
of
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(3-dimethylaminopro-
pyl)amino-[1,3,5]triazine, in the form of a yellow powder whose
characteristics are the following:
[0281] elemental analysis: % C=64.845 (cal=66.3); % H=6.855
(cal=7.13); % N=25.275 (cal=26.58);
[0282] .sup.1H NMR spectrum (300 MHz, (CD.sub.3).sub.2SO d6,
.delta. in ppm): 1.73 (mt: 2H); 2.17 (s: 6H); 2.33 (broad t, J=7
Hz: 2H); 2.53 (broad s: 6H); 2.92 (unresolved complex: 12H); 3.43
(mt: 2H); 6.51 and 6.53 (2 broad s: 2H in total); 7.06 (unresolved
complex: 1H); 7.51 (mt: 2H); from 8.10 to 8.30 (mt: 3H); 8.38
(unresolved complex: 1H); 9.24 (broad s: 1H); 9.37 (broad s:
1H).
EXAMPLES 1 TO 28
[0283] Examples 1 to 28 described in Table 1 may be prepared by
parallel synthesis in liquid medium:
[0284] Into a heating magnetic reactor with a Zymark condenser,
type STEM RS2050, containing 25 wells in parallel, provided with a
50 ml glass tube, there are introduced 50 mg of
##STR00008##
4 mole equivalents of R1-NH--R2 and 30 mg of potassium carbonate in
5 ml of DMF. The mixture is heated at 80.degree. C. overnight.
After cooling, the mixture is diluted with 30 ml of water and the
precipitate obtained is filtered. The crude product thus isolated
is generally clean (LC/MS purity >90%), it can however be
purified by LC/MS using a Waters Xterra C18 silica column 3.5
.mu.M, having a diameter of 3 mm and a length of 50 mm, eluting
with a linear elution gradient consisting at the initial time (t0=0
min) of water supplemented with 0.05% of TFA and at the final time
(tf=4 min) of acetonitrile containing 0.05% of TFA. Example 20,
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(4-methylpiperazin--
1-yl)-[1,3,5]triazine, may also be advantageously prepared in the
following manner:
[0285] A solution containing 3 g of
4-dimethylamino-2-methylquinolin-6-amine, 2.75 g of
2,4,6-trichloro-s-triazine and 4 g of potassium carbonate in 300 ml
of tetrahydrofuran is stirred overnight at room temperature, in a 1
l three-necked flask. The reaction medium is filtered, and then the
filtrate is concentrated under reduced pressure; 5.1 g (98%) of
4,6-dichloro-2-(4-dimethylamino-2-methylquinolin-6-yl)amino-[1,3,5]triazi-
ne are thus obtained in the form of a brown solid whose
characteristics are the following:
[0286] mass spectrum (EI/DCI)=349 (M+)
[0287] .sup.1H NMR spectrum (300 MHz, (CD.sub.3).sub.2SO d6,
.delta. in ppm): 2.55 (s: 3H); 3.01 (s: 6H); 6.78 (s: 1H); 7.68
(broad dd, J=9 and 2.5 Hz: 1H); 7.81 (d, J=9 Hz: 1H); 8.41
(unresolved complex: 1H); from 11.00 to 11.80 (broad unresolved
complex: 1H).
[0288] The 5.1 g of
4,6-dichloro-2-(4-dimethylamino-2-methylquinolin-6-yl)amino-[1,3,5]triazi-
ne obtained above are dissolved, in a 1 l three-necked flask, in
500 ml of dioxane and then 2.94 g of
4-dimethylamino-2-methylquinolin-6-amine and 4 g of potassium
carbonate are added. The reaction medium heated, with stirring, at
the reflux temperature of dioxane for 16 hours, and then cooled and
filtered, and then the filtrate is concentrated to dryness. 7.5 g
(99%) of
6-chloro-2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-[1,3,5]triaz-
ine are thus obtained in the form of a brown solid whose
characteristics are the following:
[0289] mass spectrum (EI/DCI)=514 (M+)
[0290] .sup.1H NMR spectrum (400 MHz, (CD.sub.2).sub.3SO d6 at a
temperature of 383 K, .delta. in ppm): 2.57 (s: 6H); 2.95 (s: 12H);
6.72 (s: 2H); 7.77 (d, J=9 Hz: 2H); 7.94 (dd, J=9 and 2 Hz: 2H);
8.31 (d, J=2 Hz: 2H); 9.90 (unresolved complex: 2H).
[0291] The 7.5 g
6-chloro-2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-[1,3,5]triaz-
ine obtained above are dissolved, in a 500 ml three-necked flask,
in 200 ml of dimethylformamide. 6 ml of 4-methylpiperazine and 4 g
of potassium carbonate are then added. The reaction medium is then
heated at 100-105.degree. C. for 20 hours. After concentration
under reduced pressure, the residue is precipitated from 200 ml of
water. The crude product is then purified by flash chromatography
on 300 g of silica (35-70 mesh), eluting with a mixture of
dichloromethane, methanol and triethylamine (85/10/5 by volume).
The fractions containing very predominantly the expected product
are concentrated under reduced pressure, and then taken up in 60 ml
of water, in order to remove the triethylamine. There are thus
obtained, after drying, 3.1 (37%) of pure
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-(4-methylpiperazin--
1-yl)-[1,3,5]triazine in the form of a beige solid whose
characteristics are the following:
[0292] melting point (Kofler stage)=256-60.degree. C.
[0293] .sup.1H NMR spectrum (400 MHz, (CD.sub.2).sub.3SO d6 at a
temperature of 383 K, .delta. in ppm): 2.30 (s: 3H); 2.47 (broad t,
J=5 Hz: 4H); 2.55 (s: 6H); 2.94 (s: 12H); 3.89 (broad t, J=5 Hz:
4H); 6.75 (s: 2H); 7.74 (d, J=9 Hz: 2H); 7.99 (dd, J=9 and 2 Hz:
2H); 8.40 (d, J=2 Hz: 2H); from 8.70 to 9.00 (unresolved complex:
2H).
EXAMPLES 29 TO 33
[0294] Examples 29 to 33 described in Table 1 may be prepared by
parallel synthesis in liquid medium:
[0295] 2 mole equivalents of sodium hydride and 2 mole equivalents
of R1OH in 5 ml of dioxane are introduced into a heating magnetic
reactor with a Zymark condenser, type STEM RS2050, containing 25
wells in parallel provided with a 50 ml glass tube. The mixture is
heated at 40.degree. C. for 30 minutes. There are then added 50 mg
of
##STR00009##
and the mixture is heated under reflux overnight. After cooling,
the mixture is diluted with 30 ml of water and the precipitate
obtained is filtered. The crude product thus isolated is purified
by LC/MS using a Waters Xterra C18 silica column 3.5 .mu.M, having
a diameter of 3 mm and a length of 50 mm, eluting with a linear
elution gradient consisting at the initial time (t0=0 min) of water
supplemented with 0.05% of TFA and at the final time (tf=4 min) of
acetonitrile containing 0.05% of TFA. Examples 34 to 102 may be
obtained by carrying out the procedure as described above for
Examples 1 to 28. Examples 103 to 115 may be obtained by carrying
out the procedure as described above for Examples 29 to 33.
Examples 116 to 133 may be obtained by carrying out the procedure
as described above for Examples 29 to 33, but replacing R1OH with
R1SH. Example 134 may be obtained by carrying out the procedure in
the following manner:
[0296] In a 250 ml three-necked flask, there is dissolved, in 100
ml of dioxane, 1 g of 2,4-dichloro-6-phenyl-[1,3,5]triazine which
may be obtained by carrying out the procedure according to
Tetrahedron 2000, 56, 9705-9711. Next, 0.9 g of
4-dimethylamino-2-methylquinolin-6-amine and 1.2 g of potassium
carbonate are added, and the reaction medium is heated at
80.degree. C. for 18 hours. After cooling, the solvent is
evaporated under reduced pressure and the residue is taken up in
100 ml of water. The precipitate formed is drained, washed with
water and dried under reduced pressure. 1.5 g (89%) of
2-chloro-4-(4-dimethylamino-2-methylquinolin-6-yl)amino-6-phenyl-[1,3,5]t-
riazine are thus obtained in the form of a yellow solid whose
characteristics are the following:
[0297] mass spectrum (EI/DCI)=390 (M+)
[0298] .sup.1H NMR spectrum (400 MHz, (CD.sub.3).sub.2SO d6, at a
temperature of 353
[0299] K, .delta. in ppm): 2.60 (s: 3H); from 2.95 to 3.10 (broad
s: 6H); 6.83 (broad s: 1H); 7.62 (broad t, J=8 Hz: 2H); 7.69 (broad
t, J=8 Hz: 1H); 7.86 (d, J=9 Hz: 1H); 7.92 (broad dd, J=9 and 2 Hz:
1H); 8.43 (broad d, J=8 Hz: 2H); 8.70 (unresolved complex: 1H);
10.76 (unresolved complex: 1H).
[0300] 0.39 g of 4-dimethylamino-2-methylquinolin-6-amine and 0.7 g
of potassium carbonate are added to a solution of 0.75 g of
2-chloro-4-(4-dimethylamino-2-methylquinolin-6-yl)amino-6-phenyl-[1,3,5]t-
riazine in 30 ml of DMF. Next, the reaction medium is heated for 18
hours at 140.degree. C. After cooling and dilution with 100 ml of
water, the precipitate formed is drained and then purified by flash
chromatography on 50 g of silica gel (35-70 mesh), eluting with a
mixture of dichloromethane, methanol and triethylamine (96/2/2 by
volume). There is thus obtained 0.12 g (11%) of pure
2,4-bis(4-dimethylamino-2-methylquinolin-6-yl)amino-6-phenyl-[1,3,5]triaz-
ine in the form of a yellow solid whose characteristics are the
following:
[0301] melting point (Kofler stage)=172.degree. C.
[0302] .sup.1H NMR spectrum (400 MHz, (CD.sub.3).sub.2SO d6, with
addition of a few drops of CD.sub.3COOD d4, at a temperature of 353
K, .delta. in ppm): 2.51 (broad s: 6H); 3.20 (s: 12H); 6.76 (s:
2H); 7.55 (broad t, J=8 Hz: 2H); 7.60 (broad t, J=8 Hz: 1H); 7.87
(d, J=8.5 Hz: 2H); 8.30 (broad dd, J=8.5 and 2 Hz: 2H); 8.40 (broad
d, J=8 Hz: 2H); 8.69 (d, J=2 Hz: 2H).
Examples 135 to 176 may be obtained by carrying out the procedure
as described above for Examples 1 to 28, except that the volume of
DMF is reduced from 5 to 2 ml and that the heating temperature is
increased from 80 to 108-110.degree. C.
EXAMPLE 177
[0303] The G-quartet, antitelomerease and cytotoxic activities of
the various exemplified compounds 1 to 176, given in Table 1, are
determined according to the procedures described above.
TABLE-US-00003 TABLE 1 TRAP Cytotox G4 delta IC50 A549 Ar1 R3 Ar2
R'3 X R1 R2 Tm .degree. C. .mu.M IC50 .mu.M Ex ##STR00010## H
##STR00011## H N ##STR00012## H 11.3 0.55 0.23 1 ##STR00013## H
##STR00014## H N ##STR00015## H 18 0.06 10 2 ##STR00016## H
##STR00017## H N ##STR00018## H 5.5 2.1 6 3 ##STR00019## H
##STR00020## H N ##STR00021## H 5.5 3 4 ##STR00022## H ##STR00023##
H N ##STR00024## H 2.0 2.7 5 ##STR00025## H ##STR00026## H N
##STR00027## H 3.5 6 ##STR00028## H ##STR00029## H N ##STR00030## H
3.0 2.4 7 ##STR00031## H ##STR00032## H N ##STR00033## 1.5 3.2 8
##STR00034## H ##STR00035## H N ##STR00036## H 10.0 0.1 9
##STR00037## H ##STR00038## H N ##STR00039## H 8.9 0.36 10
##STR00040## H ##STR00041## H N ##STR00042## H 11.4 0.6 11
##STR00043## H ##STR00044## H N ##STR00045## H 9.4 0.3 12
##STR00046## H ##STR00047## H N ##STR00048## H 7.2 0.26 13
##STR00049## H ##STR00050## H N ##STR00051## 4.4 0.21 14
##STR00052## H ##STR00053## H N ##STR00054## H 2.7 0.19 1.85 15
##STR00055## H ##STR00056## H N ##STR00057## H 7.2 0.08 16
##STR00058## H ##STR00059## H N ##STR00060## H 17.1 0.1 2.73 17
##STR00061## H ##STR00062## H N ##STR00063## H 2.4 1.2 2.86 18
##STR00064## H ##STR00065## H N ##STR00066## H 3.5 0.53 0.3 19
##STR00067## H ##STR00068## H N ##STR00069## 6.4 0.44 0.35 20
##STR00070## H ##STR00071## H N ##STR00072## H 11..0 21
##STR00073## H ##STR00074## H N ##STR00075## H 2.7 0.34 22
##STR00076## H ##STR00077## H N ##STR00078## 9.2 3.0 23
##STR00079## H ##STR00080## H N ##STR00081## 9.7 1.6 24
##STR00082## H ##STR00083## H N ##STR00084## H 4.2 2.2 25
##STR00085## H ##STR00086## H N ##STR00087## H 4.8 1.1 26
##STR00088## H ##STR00089## H N ##STR00090## H 11.0 0.6 1.0 27
##STR00091## H ##STR00092## H N ##STR00093## H 10.6 0.9 1.5 28
##STR00094## H ##STR00095## H O ##STR00096## no 20.3 4.5 0.32 0.47
29 ##STR00097## H ##STR00098## H O ##STR00099## no 6.8 15.5 1.1
0.24 30 ##STR00100## H ##STR00101## H O ##STR00102## no 15.3 0.3 31
##STR00103## H ##STR00104## H O ##STR00105## no 10.0 0.3 32
##STR00106## H ##STR00107## H O ##STR00108## no 10.0 0.4 33
##STR00109## H ##STR00110## H N ##STR00111## 5.0 0.68 15 34
##STR00112## H ##STR00113## H N ##STR00114## H 11.0 0.5 35
##STR00115## H ##STR00116## H N ##STR00117## H 17.5 0.24 36
##STR00118## H ##STR00119## H N ##STR00120## H 17.5 0.23 37
##STR00121## H ##STR00122## H N ##STR00123## H 9.5 1.0 38
##STR00124## H ##STR00125## H N ##STR00126## H 19.5 0.23 39
##STR00127## H ##STR00128## H N ##STR00129## ##STR00130## 19 0.23
40 ##STR00131## H ##STR00132## H N ##STR00133## H 10 0.36 9.9 41
##STR00134## H ##STR00135## H N ##STR00136## 15.5 0.05 42
##STR00137## H ##STR00138## H N ##STR00139## 18 0.18 10 43
##STR00140## H ##STR00141## H N ##STR00142## 17 0.1 44 ##STR00143##
H ##STR00144## H N ##STR00145## H 16.5 0.33 45 ##STR00146## H
##STR00147## H N ##STR00148## H 18.5 1 46 ##STR00149## H
##STR00150## H N ##STR00151## H 8 0.2 47 ##STR00152## H
##STR00153## H N ##STR00154## Me 14 0.1 48 ##STR00155## H
##STR00156## H N ##STR00157## H 10 1 49 ##STR00158## H ##STR00159##
H N ##STR00160## H 7 0.22 50 ##STR00161## H ##STR00162## H N
##STR00163## H 0.26 51 ##STR00164## H ##STR00165## H N ##STR00166##
H 6.5 1.3 52 ##STR00167## H ##STR00168## H N ##STR00169## Et 15.5
0.2 53 ##STR00170## H ##STR00171## H N ##STR00172## H 16 0.17 54
##STR00173## H ##STR00174## H N ##STR00175## 15.5 0.21 55
##STR00176## H ##STR00177## H N ##STR00178## H 2.5 0.35 56
##STR00179## H ##STR00180## H N ##STR00181## 8 0.3 57 ##STR00182##
H ##STR00183## H N ##STR00184## 6 0.22 58 ##STR00185## H
##STR00186## H N ##STR00187## 11 0.19 59 ##STR00188## H
##STR00189## H N ##STR00190## H 6 3.0 5.7 60 ##STR00191## H
##STR00192## H N ##STR00193## H 0.36 61 ##STR00194## H ##STR00195##
H N ##STR00196## H 7.5 1.2 62 ##STR00197## H ##STR00198## H N
##STR00199## Me 11.5 0.19 63 ##STR00200## H ##STR00201## H N
##STR00202## 12 0.09 64 ##STR00203## H ##STR00204## H N
##STR00205## Me 12.5 1 65 ##STR00206## H ##STR00207## H N
##STR00208## H 9 0.28 66 ##STR00209## H ##STR00210## H N
##STR00211## H 6.5 0.43 67 ##STR00212## H ##STR00213## H N
##STR00214## 8 0.3 11.5 68 ##STR00215## H ##STR00216## H N
##STR00217## 18 0.16 69 ##STR00218## H ##STR00219## H N
##STR00220## 9.5 0.56 70 ##STR00221## H ##STR00222## H N
##STR00223## 0.35 12.4 71 ##STR00224## H ##STR00225## H N
##STR00226## 9.5 0.21 72 ##STR00227## H ##STR00228## H N
##STR00229## 9.5 0.37 73 ##STR00230## H ##STR00231## H N
##STR00232## H 9.5 0.14 74 ##STR00233## H ##STR00234## H N
##STR00235## 13.5 0.05 75 ##STR00236## H ##STR00237## H N
##STR00238## 19 0.11 76 ##STR00239## H ##STR00240## H N
##STR00241## 12.5 0.48 5.6 77 ##STR00242## H ##STR00243## H N
##STR00244## H 1.5 78 ##STR00245## H ##STR00246## H N ##STR00247##
H 3.6 79 ##STR00248## H ##STR00249## H N ##STR00250## H 1.2 80
##STR00251## H ##STR00252## H N ##STR00253## H 1.4 81 ##STR00254##
H ##STR00255## H N ##STR00256## H 1.6 82 ##STR00257## H
##STR00258## H N ##STR00259## H 1.2 14 83 ##STR00260## H
##STR00261## H N ##STR00262## H 2.2 84 ##STR00263## H ##STR00264##
H N ##STR00265## H 3.9 16 85 ##STR00266## H ##STR00267## H N
##STR00268## 6 0.2 18.9 86 ##STR00269## H ##STR00270## H N
##STR00271## H 1.5 87 ##STR00272## H ##STR00273## H N ##STR00274##
6 0.11 88 ##STR00275## H ##STR00276## H N ##STR00277## H 1.2 20 89
##STR00278## H ##STR00279## H N ##STR00280## H 11 0.37 90
##STR00281## H ##STR00282## H N ##STR00283## H 7 0.37 91
##STR00284## H ##STR00285## H N ##STR00286## ##STR00287## 3.5 0.43
7.8 92 ##STR00288## H ##STR00289## H N ##STR00290## H 8 0.37 9.3 93
##STR00291## H ##STR00292## H N ##STR00293## H 0.94 94 ##STR00294##
H ##STR00295## H N ##STR00296## H 0.93 95 ##STR00297## H
##STR00298## H N ##STR00299## H 0.48 96 ##STR00300## H ##STR00301##
H N ##STR00302## H 0.69 97 ##STR00303## H ##STR00304## H N
##STR00305## H 4 0.35 98 ##STR00306## H ##STR00307## H N
##STR00308## H 0.6 99 ##STR00309## H ##STR00310## H N ##STR00311##
H 0.45 100 ##STR00312## H ##STR00313## H N ##STR00314## H 0.81 101
##STR00315## H ##STR00316## H N ##STR00317## H 0.57 102
##STR00318## H ##STR00319## H O ##STR00320## no 7 0.28 11.34 103
##STR00321## H ##STR00322## H O ##STR00323## no 4.5 1.2 11.37 104
##STR00324## H ##STR00325## H O ##STR00326## no 12 0.24 11.57 105
##STR00327## H ##STR00328## H O ##STR00329## no 14.5 0.28 106
##STR00330## H ##STR00331## H O ##STR00332## no 4.5 0.37 107
##STR00333## H ##STR00334## H O ##STR00335## no 3 0.37 108
##STR00336## H ##STR00337## H O ##STR00338## no 4.5 0.34 109
##STR00339## H ##STR00340## H O ##STR00341## no 20.5 0.61 110
##STR00342## H ##STR00343## H O ##STR00344## no 23.5 0.48 111
##STR00345## H ##STR00346## H O ##STR00347## no 15 0.32 112
##STR00348## H ##STR00349## H O ##STR00350## no 6 0.53 113
##STR00351## H ##STR00352## H O ##STR00353## no 13.5 1.26 114
##STR00354## H ##STR00355## H O ##STR00356## no 13 0.5 1.6 115
##STR00357## H ##STR00358## H S ##STR00359## no 1.8 116
##STR00360## H ##STR00361## H S ##STR00362## no 10.5 4.5 1.2 10
19.5 117 ##STR00363## H ##STR00364## H S ##STR00365## no 3.5 1.4
13.7 118 ##STR00366## H ##STR00367## H S ##STR00368## no 4.5
119
##STR00369## H ##STR00370## H S ##STR00371## no 11.5 0.38 17.8 120
##STR00372## H ##STR00373## H S ##STR00374## no 4.5 12.5 0.4 0.36
121 ##STR00375## H ##STR00376## H S ##STR00377## no 13.5 0.37 122
##STR00378## H ##STR00379## H S ##STR00380## no 3 1.3 11.6 123
##STR00381## H ##STR00382## H S ##STR00383## no 3 0.9 6.2 124
##STR00384## H ##STR00385## H S ##STR00386## no 14.5 0.36 125
##STR00387## H ##STR00388## H S ##STR00389## no 19 0.67 11.4 126
##STR00390## H ##STR00391## H S ##STR00392## no 14 0.84 15.9 127
##STR00393## H ##STR00394## H S ##STR00395## no 15 0.39 2.86 128
##STR00396## H ##STR00397## H S ##STR00398## no 15.5 0.82 129
##STR00399## H ##STR00400## H S ##STR00401## no 9 0.3 130
##STR00402## H ##STR00403## H S ##STR00404## no 4.5 0.91 131
##STR00405## H ##STR00406## H S ##STR00407## no 12.5 0.4 132
##STR00408## H ##STR00409## H S ##STR00410## no 25 0.18 133
##STR00411## H ##STR00412## H no ##STR00413## no 8 0.3 0.88 134
##STR00414## H ##STR00415## H N ##STR00416## 20 0.4 0.07 135
##STR00417## H ##STR00418## H N ##STR00419## 20.5 0.12 0.026 136
##STR00420## H ##STR00421## H N ##STR00422## 16 1 0.15 137
##STR00423## H ##STR00424## H N ##STR00425## Me 16 0.5 0.061 138
##STR00426## H ##STR00427## H N ##STR00428## 18.5 0.6 0.045 139
##STR00429## H ##STR00430## H N ##STR00431## H 5.5 1 0.512 140
##STR00432## H ##STR00433## H N ##STR00434## 7 0.9 0.096 141
##STR00435## H ##STR00436## H N ##STR00437## H 9.5 1 1.56 142
##STR00438## H ##STR00439## H N ##STR00440## 13 0.4 0.52 143
##STR00441## H ##STR00442## H N ##STR00443## 22.5 0.4 0.04 144
##STR00444## H ##STR00445## H N ##STR00446## H 5 1 0.42 145
##STR00447## H ##STR00448## H N ##STR00449## Et 6 0.6 0.175 146
##STR00450## H ##STR00451## H N ##STR00452## 1 0.21 147
##STR00453## H ##STR00454## H N ##STR00455## 12 1.5 1.5 148
##STR00456## H ##STR00457## H N ##STR00458## 12.5 2.5 0.096 149
##STR00459## H ##STR00460## H N ##STR00461## H 6.5 2.5 2.47 150
##STR00462## H ##STR00463## H N ##STR00464## 6.5 0.38 151
##STR00465## H ##STR00466## H N ##STR00467## ##STR00468## 9.5 0.47
152 ##STR00469## H ##STR00470## H N ##STR00471## 10 0.41 153
##STR00472## H ##STR00473## H N ##STR00474## 19 0.2 154
##STR00475## H ##STR00476## H N ##STR00477## 14 0.39 155
##STR00478## H ##STR00479## H N ##STR00480## H 14.5 1.2 156 156
##STR00481## H ##STR00482## H N ##STR00483## H 12.5 1.4 157
##STR00484## H ##STR00485## H N ##STR00486## H 8 0.85 158
##STR00487## H ##STR00488## H N ##STR00489## 10.5 0.43 159
##STR00490## H ##STR00491## H N ##STR00492## 10.5 0.36 160
##STR00493## H ##STR00494## H N ##STR00495## ##STR00496## 12 1.9
161 ##STR00497## H ##STR00498## H N ##STR00499## 17 1.7 162
##STR00500## H ##STR00501## H N ##STR00502## 13 1.2 163
##STR00503## H ##STR00504## H N ##STR00505## 12.5 1.6 164
##STR00506## H ##STR00507## H N ##STR00508## H 6.5 1.4 165
##STR00509## H ##STR00510## H N ##STR00511## H 12.5 1.4 166
##STR00512## H ##STR00513## H N ##STR00514## H 6 1.1 167
##STR00515## H ##STR00516## H N ##STR00517## 16.5 1.1 168
##STR00518## H ##STR00519## H N ##STR00520## 16.5 0.7 169
##STR00521## H ##STR00522## H N ##STR00523## H 3 1.3 170
##STR00524## H ##STR00525## H N ##STR00526## H 13 0.49 171
##STR00527## H ##STR00528## H N ##STR00529## H 20 0.33 172
##STR00530## H ##STR00531## H N ##STR00532## H 11.5 0.62 173
##STR00533## H ##STR00534## H N ##STR00535## H 6 0.26 174
##STR00536## H ##STR00537## H N ##STR00538## H 3 3 175 ##STR00539##
H ##STR00540## H N ##STR00541## H 6 3 176
* * * * *