U.S. patent application number 12/165476 was filed with the patent office on 2009-08-27 for quinobenzoxazine analogs and methods of using thereof.
This patent application is currently assigned to Cylene Pharmaceuticals, Inc.. Invention is credited to Fabrice Pierre, Michael Schwaebe, Jeffrey P. Whitten.
Application Number | 20090215761 12/165476 |
Document ID | / |
Family ID | 37115759 |
Filed Date | 2009-08-27 |
United States Patent
Application |
20090215761 |
Kind Code |
A1 |
Whitten; Jeffrey P. ; et
al. |
August 27, 2009 |
QUINOBENZOXAZINE ANALOGS AND METHODS OF USING THEREOF
Abstract
The present invention relates to quinobenzoxazines analogs
having the general formula: ##STR00001## and pharmaceutically
acceptable salts, esters and prodrugs thereof; wherein A, U, W, X,
Z, B, L, R.sup.1, R.sup.3, R.sup.4 and R.sup.5 are substituents.
The present invention also relates to methods for using such
compounds.
Inventors: |
Whitten; Jeffrey P.;
(Santee, CA) ; Pierre; Fabrice; (La Jolla, CA)
; Schwaebe; Michael; (San Diego, CA) |
Correspondence
Address: |
MORRISON & FOERSTER LLP
12531 HIGH BLUFF DRIVE, SUITE 100
SAN DIEGO
CA
92130-2040
US
|
Assignee: |
Cylene Pharmaceuticals,
Inc.
San Diego
CA
|
Family ID: |
37115759 |
Appl. No.: |
12/165476 |
Filed: |
June 30, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11404947 |
Apr 14, 2006 |
7402579 |
|
|
12165476 |
|
|
|
|
60671760 |
Apr 15, 2005 |
|
|
|
Current U.S.
Class: |
514/229.5 ;
435/375; 436/501; 544/99 |
Current CPC
Class: |
C07D 498/06 20130101;
A61P 35/00 20180101 |
Class at
Publication: |
514/229.5 ;
544/99; 435/375; 436/501 |
International
Class: |
A61K 31/5383 20060101
A61K031/5383; C07D 498/06 20060101 C07D498/06; C12N 5/06 20060101
C12N005/06; G01N 33/566 20060101 G01N033/566 |
Claims
1. A compound having formula 1 ##STR00328## and pharmaceutically
acceptable salts, esters and prodrugs thereof, wherein X is H,
OR.sup.2, NR.sup.1R.sup.2, halogen, azido, SR.sup.2 or CH.sub.2R; A
is H, halogen, NR.sup.1R.sup.2, SR.sup.2, OR.sup.2, CH.sub.2R,
azido or NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4; Z is S,
NR.sup.1 or CH.sub.2; U is NR.sup.1R.sup.2 or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4 provided U is not
H; W is an optionally substituted aryl or heteroaryl, which may be
monocyclic or fused with a single or multiple ring optionally
containing a heteroatom; wherein R.sup.1 and R.sup.2 together with
N in NR.sup.1R.sup.2, and R.sup.3 and R.sup.4 together with N in
NR.sup.3R.sup.4 may independently form an optionally substituted
5-6 membered ring containing N, and optionally O or S; R.sup.1 and
R.sup.3 are independently H or a C.sub.1-6 alkyl; and R.sup.2 and
R.sup.4 are independently H, or a C.sub.1-10 alkyl or C.sub.2-10
alkenyl optionally containing one or more non-adjacent heteroatoms
selected from N, O, and S, and optionally substituted with a
substituted or unsubstituted aryl, heteroaryl, carbocyclic, or
heterocyclic ring; or R.sup.2 is an optionally substituted
cycloalkyl, heterocyclic ring, aryl or heteroaryl; R.sup.5 is a
substituent at any position of W and is H, halo, cyano, azido,
--CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or C.sub.2-6 alkenyl,
each optionally substituted by halo, .dbd.O or one or more
heteroatoms; provided X and A both are not H, and further provided
that R.sup.5 is cyano or --CONHR.sup.1 when A is H, halogen or
NR.sup.1R.sup.2; or a compound having formula (1A) ##STR00329## and
pharmaceutically acceptable salts, esters and prodrugs thereof; A
is H, halogen, azido, SR.sup.2, OR.sup.2, CH.sub.2R.sup.2,
NR.sup.1R.sup.2, or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4; Z, U, W,
R.sup.1, R.sup.2, R.sup.3 and R.sup.4 are as defined in formula 1;
and R.sup.5 is a substituent at any position of W and is H, halo,
cyano, azido, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms; wherein each optionally substituted moiety
in formula 1 and 1A is substituted with one or more halo, cyano,
azido, acetyl, amido, OR.sup.2, NR.sup.1R.sup.2, carbamate,
C.sub.1-10 alkyl, C.sub.2-10 alkenyl, each optionally substituted
by halo, .dbd.O, aryl or one or more heteroatoms selected from N, O
and S; or is substituted with an aryl, a carbocyclic or a
heterocyclic ring.
2. The compound of claim 1, wherein each W is independently
selected from the group consisting of ##STR00330## ##STR00331##
##STR00332## wherein Q, Q.sup.1, Q.sup.2, and Q.sup.3 are
independently CH or N; Y is independently O, CH, .dbd.O or
NR.sup.1; and R.sup.5 is as defined in claim 1.
3. The compound of claim 1, wherein each W is an optionally
substituted phenyl, pyridine, biphenyl, naphthalene, phenanthrene,
quinoline, isoquinoline, quinazoline, cinnoline, phthalazine,
quinoxaline, indole, benzimidazole, benzoxazole, benzthiazole,
benzofuran, anthrone, xanthone, acridone, fluorenone, carbazolyl,
pyrimido[4,3-b]furan, pyrido[4,3-b]indole, pyrido[2,3-b]indole,
dibenzofuran, acridine or acridizine.
4. The compound of claim 1 having formula 1, wherein A is SR.sup.2
and X is H.
5. The compound of claim 1, wherein each A is
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4, or an optionally
substituted 5-14 membered heterocyclic ring containing N and
optionally O or S.
6. The compound of claim 5, wherein said 5-14 membered heterocyclic
ring is an optionally substituted tetrahydrofuran, 1,3-dioxolane,
2,3-dihydrofuran, tetrahydropyran, benzofuran, isobenzofuran,
1,3-dihydro-isobenzofuran, isoxazole, 4,5-dihydroisoxazole,
piperidine, piperidin-2-one, pyrrolidine, pyrrolidin-2-one,
pyrrole, pyridine, pyrimidine, octahydro-pyrrolo[3,4-b]pyridine,
piperazine, piperazin-2-one, pyrazine, morpholine, thiomorpholine,
imidazole, imidazolidine-2,4-dione, benzimidazole,
1,3-dihydrobenzimidazol-2-one, indole, thiazole, benzothiazole,
thiadiazole, thiophene, tetrahydro-thiophene 1,1-dioxide,
diazepine, triazole, guanidine, diazabicyclo[2.2.1]heptane,
2,5-diazabicyclo[2.2.1]heptane, or
2,3,4,4a,9,9a-hexahydro-1H-.beta.-carboline.
7. The compound of claim 5, wherein said 5-14 membered heterocyclic
ring is an optionally substituted morpholine, thiomorpholine,
imidazole, pyrrolidine, pyrrolidin-2-one, piperazine,
piperazin-2-one, pyridine, piperidine, or piperidin-2-one.
8. The compound of claim 1, wherein U is
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4.
9. The compound of claim 8, wherein n is 2-3.
10. The compound of claim 8, wherein R.sup.3 and R.sup.4 together
with N form an optionally substituted ring containing N, and
optionally O or S.
11. The compound of claim 8, wherein NR.sup.3R.sup.4 is an
optionally substituted morpholine, thiomorpholine, imidazole,
pyrrolidine, piperazine, pyridine or piperidine.
12. The compound of claim 1, wherein A is an optionally substituted
5-14 membered heterocyclic ring and X is H or halogen.
13. The compound of claim 12, wherein W is an optionally
substituted phenyl.
14. The compound of claim 12, wherein A is an optionally
substituted morpholine, thiomorpholine, imidazole, pyrrolidine,
pyrrolidin-2-one, piperazine, piperazin-2-one, pyridine,
piperidine, or piperidin-2-one.
15. The compound of claim 14, wherein A is an optionally
substituted piperazine.
16. The compound of claim 12, wherein U is
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4.
17. The compound of claim 16, wherein NR.sup.3R.sup.4 is
morpholine, thiomorpholine, imidazole, pyrrolidine, piperazine,
pyridine or piperidine.
18. A pharmaceutical composition comprising the compound of claim 1
and a pharmaceutically acceptable excipient.
19. A compound having formula 2 ##STR00333## and pharmaceutically
acceptable salts, esters and prodrugs thereof; wherein A is
NR.sup.1R.sup.2; Z is S, NR.sup.1 or CH.sub.2; and U is
NR.sup.1R.sup.2 or NR.sup.1--(CR.sup.1.sub.2)--NR.sup.3R.sup.4; B
is a 5-6 membered aryl or heteroaryl; R.sup.1 and R.sup.2 together
with N in NR.sup.1R.sup.2, and R.sup.3 and R.sup.4 together with N
in NR.sup.3R.sup.4 may independently form an optionally substituted
5-6 membered ring containing N, and optionally O or S; R.sup.1 and
R.sup.3 are independently H or a C.sub.1-6 alkyl; and R.sup.2 and
R.sup.4 are independently H, or a C.sub.1-10 alkyl or C.sub.2-10
alkenyl optionally containing one or more non-adjacent heteroatoms
selected from N, O, and S, and optionally substituted with a
substituted or unsubstituted aryl, heteroaryl, carbocyclic, or
heterocyclic ring; or R.sup.2 is an optionally substituted
cycloalkyl, heterocyclic ring, aryl or heteroaryl; R.sup.5 is a
substituent at any position of W and is H, halo, cyano, azido,
--CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or C.sub.2-6 alkenyl,
each optionally substituted by halo, .dbd.O or one or more
heteroatoms; wherein each optionally substituted moiety is
substituted with one or more halo, cyano, azido, acetyl, amido,
OR.sup.2, NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl, C.sub.2-10
alkenyl, each optionally substituted by halo, .dbd.O, aryl or one
or more heteroatoms selected from N, O and S; or is substituted
with an aryl, a carbocyclic or a heterocyclic ring.
20. The compound of claim 19, wherein R.sup.5 is halo.
21. The compound of claim 19, wherein B is phenyl.
22. The compound of claim 19, wherein NR.sup.1R.sup.2 and
NR.sup.3R.sup.4 are independently an optionally substituted
morpholine, thiomorpholine, imidazole, pyrrolidine, piperazine,
pyridine or piperidine.
23. A pharmaceutical composition comprising the compound of claim
19 and a pharmaceutically acceptable excipient.
24. A compound having formula 3 ##STR00334## and pharmaceutically
acceptable salts, esters and prodrugs thereof; wherein A is H or F;
X is H, halo or NR.sup.1R.sup.2; Z is S, NR.sup.1 or CH.sub.2; L is
a C.sub.1-10 alkyl optionally substituted with N, O or S; B is 5-6
membered aryl or heteroaryl; R.sup.1 and R.sup.3 are independently
H or a C.sub.1-6 alkyl; R.sup.2 and R.sup.4 is H, or a C.sub.1-10
alkyl or C.sub.2-10 alkenyl optionally containing one or more
non-adjacent heteroatoms selected from N, O, and S, and optionally
substituted with a substituted or unsubstituted aryl, heteroaryl,
carbocyclic, or heterocyclic ring; or R.sup.2 is an optionally
substituted cycloalkyl, heterocyclic ring, aryl or heteroaryl;
R.sup.5 is a substituent at any position of W and is H, halo,
cyano, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or C.sub.2-6
alkenyl, each optionally substituted by halo, .dbd.O or one or more
heteroatoms; wherein each optionally substituted moiety is
substituted with one or more halo, cyano, azido, acetyl, amido,
OR.sup.2, NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl, C.sub.2-10
alkenyl, each optionally substituted by halo, .dbd.O, aryl or one
or more heteroatoms selected from N, O and S; or is substituted
with an aryl, a carbocyclic or a heterocyclic ring.
25. The compound of claim 24, wherein L is a C.sub.2-4 alkyl.
26. The compound of claim 24, wherein X is NR.sup.1R.sup.2, and
R.sup.2 is an optionally substituted cyclopropyl, phenyl, or
imidazole, or a C.sub.1-6 alkyl optionally substituted with a
cyclopropyl or OR.sup.1.
27. The compound of claim 24, wherein each NR.sup.1R.sup.2 and
NR.sup.3R.sup.4 are independently an optionally substituted
morpholine, thiomorpholine, imidazole, pyrrolidine, piperazine,
pyridine or piperidine.
28. The compound of claim 24, wherein A is F and R.sup.5 is halo,
cyano, amido or azido.
29. The compound of claim 24, wherein W is phenyl or pyridyl.
30. A pharmaceutical composition comprising the compound of claim
24 and a pharmaceutically acceptable excipient.
31. A method for ameliorating a cell proliferative disorder,
comprising administering to a subject in need thereof an effective
amount of the compound of claim 24 or a pharmaceutical composition
thereof and optionally with a chemotherapeutic agent, thereby
ameliorating said cell-proliferative disorder.
32. The method of claim 31, wherein said cell proliferative
disorder is a tumor or cancer.
33. The method of claim 31, wherein said subject is human or an
animal.
34. A method for reducing cell proliferation or inducing cell
death, comprising contacting a system with an effective amount of
the compound of claim 24 or a pharmaceutical composition thereof
and optionally with a chemotherapeutic agent, thereby reducing cell
proliferation or inducing cell death in said system.
35. The method of claim 34, wherein said system is a cell or
tissue.
36. A method for reducing microbial titers or for ameliorating a
microbial infection, comprising contacting a system or a subject
with an effective amount of the compound of claim 24 or a
pharmaceutical composition thereof and optionally with an
antimicrobial agent, thereby reducing microbial titers in said
system or ameliorating said microbial infection in said
subject.
37. The method of claim 36, where the system is a cell or tissue,
and said subject is animal or human.
38. The method of claim 36, wherein the microbial titers or
microbial infection are viral, bacterial or fungal.
39. A method for inducing apoptosis, comprising administering to a
system or a subject in need thereof an effective amount of a
composition comprising a compound in claim 24, or a pharmaceutical
composition thereof and optionally with a chemotherapeutic
agent.
40. The method of claim 39, wherein said subject is human or an
animal, and said system is a cell or tissue.
41. A method for treating or ameliorating a disorder mediated by
c-Myc overexpression, comprising administering to a system or a
subject in need thereof an effective amount of a compound in claim
24, or a pharmaceutical composition thereof and optionally with a
chemotherapeutic agent.
42. A method for determining interaction selectivity between a
compound of claim 1 and nucleic acids capable of forming a
quadruplex structure, comprising: a) contacting a compound in the
absence of a competitor molecule with three or more nucleic acids
capable of forming a quadruplex structure, wherein each nucleic
acid is not a telomere nucleic acid; b) measuring a direct
interaction between the compound and said three or more nucleic
acids; and c) determining interaction selectivity from a comparison
of the interaction measurements.
43. The method of claim 42, wherein said three or more nucleic
acids comprise a nucleotide sequence located 5' of an oncogene
nucleotide sequence.
44. The method of claim 43, wherein said oncogene is MYC, HIF,
VEGF, ABL, TGF, PDGF.alpha., MYB, SPARC, HER, VAV, RET, H-RAS, EGF,
SRC, BCL-1, BCL-2, DHFR, or HMGA.
45. The method of claim 42, wherein the compound is separately
contacted with each of said three or more nucleic acids in a
different vessel.
46. The method of claim 42, wherein interaction selectivity is
determined from a comparison of IC50 values.
47. The method of claim 42, wherein the compound binds and/or
stabilizes a propeller quadrupled a chair-eller quadruplex, or a
basket quadruplex or BCL-2.
48. The method of claim 42, wherein the compound binds and/or
stabilizes BCL-2, H-RAS, RET, BCL-1, DHFR, TGF-.beta.,
HIF-1.alpha., VEGF, c-Myc, or PDGF.alpha..
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 11/404,947 filed Apr. 14, 2006, which claims the benefit
of U.S. provisional application Ser. No. 60/671,760, filed Apr. 15,
2005. The contents of these applications are incorporated herein by
reference.
REFERENCE TO SEQUENCE LISTING SUBMITTED VIA EFS-WEB
[0002] The entire content of the following electronic submission of
the sequence listing via the USPTO EFS-WEB server, as authorized
and set forth in MPEP .sctn.1730 II.B.2(a)(C), is incorporated
herein by reference in its entirety for all purposes. The sequence
listing is identified on the electronically filed text file as
follows:
TABLE-US-00001 File Name Date of Creation Size (bytes)
532232002010Seqlist.txt Jun. 27, 2008 5,004 bytes
FIELD OF THE INVENTION
[0003] The invention relates to substituted quinobenzoxazines
analogs, and methods of using such compounds.
BACKGROUND
[0004] Quadruplexes can form in certain purine-rich strands of
nucleic acids. In duplex nucleic acids, certain purine rich strands
are capable of engaging in a slow equilibrium between a typical
duplex helix structure and in unwound and non-B-form regions. These
unwound and non-B forms can be referred to as "paranemic
structures." Some forms are associated with sensitivity to S1
nuclease digestion, which can be referred to as "nuclease
hypersensitivity elements" or "NHEs." A quadruplex is one type of
paranemic structure and certain NHEs can adopt a quadruplex
structure. Considerable circumstantial evidence suggests that
quadruplex structures can exist in vivo in specific regions of the
genome, including the telomeric ends of chromosomes and oncogene
regulatory regions. (Han, et al., Trends Pharm. Sci. (2000)
21:136-142). Thus, quadruplex forming regions of DNA may be used as
molecular targets for anticancer agents.
SUMMARY OF THE INVENTION
[0005] In one aspect, the present invention provides a compound
having formula 1
##STR00002##
[0006] and pharmaceutically acceptable salts, esters and prodrugs
thereof,
[0007] wherein X is H, OR.sup.2, NR.sup.1R.sup.2, halogen, azido,
SR.sup.2 or CH.sub.2R;
[0008] A is H, halogen, NR.sup.1R.sup.2, SR.sup.2, OR.sup.2,
CH.sub.2R.sup.2, azido or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4;
[0009] Z is O, S, NR.sup.1 or CH.sub.2;
[0010] U is R.sup.2, OR.sup.2, NR.sup.1R.sup.2 or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4 provided U is not
H;
[0011] W is an optionally substituted aryl or heteroaryl, which may
be monocyclic or fused with a single or multiple ring optionally
containing a heteroatom;
[0012] wherein R.sup.1 and R.sup.2 together with N in
NR.sup.1R.sup.2, and R.sup.3 and R.sup.4 together with N in
NR.sup.3R.sup.4 may independently form an optionally substituted
5-6 membered ring containing N, and optionally O or S;
[0013] R.sup.1 and R.sup.3 are independently H or a C.sub.1-6
alkyl; and
[0014] R.sup.2 and R.sup.4 are independently H, or a C.sub.1-10
alkyl or C.sub.2-10 alkenyl optionally containing one or more
non-adjacent heteroatoms selected from N, O, and S, and optionally
substituted with a substituted or unsubstituted aryl, heteroaryl,
carbocyclic, or heterocyclic ring; or R.sup.2 is an optionally
cycloalkyl, substituted heterocyclic ring, aryl or heteroaryl;
[0015] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, azido, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0016] provided X and A both are not H, and further provided that
R.sup.5 is cyano or --CONHR.sup.1 when A is H, halogen or
NR.sup.1R.sup.2;
[0017] or a compound having formula (1A)
##STR00003##
[0018] and pharmaceutically acceptable salts, esters and prodrugs
thereof;
[0019] A is H, halogen, azido, SR.sup.2, OR.sup.2, CH.sub.2R.sup.2,
NR.sup.1R.sup.2, or
NR.sup.1--(CR.sup.1.sub.2)--NR.sup.3R.sup.4;
[0020] Z, U, W, R.sup.1, R.sup.2, R.sup.3 and R.sup.4 are as
defined in formula 1; and
[0021] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, azido, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0022] wherein each optionally substituted moiety in formula 1 and
1A is substituted with one or more halo, cyano, azido, acetyl,
amido, OR.sup.2, NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl,
C.sub.2-10 alkenyl, each optionally substituted by halo, .dbd.O,
aryl or one or more heteroatoms selected from N, O and S; or is
substituted with an aryl, a carbocyclic or a heterocyclic ring.
[0023] In the above formula 1 or 1A, W may be selected from the
group consisting of
##STR00004## ##STR00005## ##STR00006##
[0024] wherein Q, Q.sup.1, Q.sup.2, and Q.sup.3 are independently
CH or N;
[0025] Y is independently O, CH, .dbd.O or NR.sup.1; and
[0026] R.sup.5 is as defined in formula 1.
[0027] In some embodiments, each W in the above formula 1 or 1A may
be an optionally substituted phenyl, pyridine, biphenyl,
naphthalene, phenanthrene, quinoline, isoquinoline, quinazoline,
cinnoline, phthalazine, quinoxaline, indole, benzimidazole,
benzoxazole, benzthiazole, benzofuran, anthrone, xanthone,
acridone, fluorenone, carbazolyl, pyrimido[4,3-b]furan,
pyrido[4,3-b]indole, pyrido[2,3-b]indole, dibenzofuran, acridine or
acridizine. In one embodiment, W is an optionally substituted
phenyl.
[0028] In the above formula 1 or 1A, each Z may be O.
[0029] In one embodiment, A is SR.sup.2 and X is H. In another
embodiment, A is NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4,
or an optionally substituted 5-14 membered heterocyclic ring
containing N and optionally O or S. In some examples, A is an
optionally substituted 5-14 membered heterocyclic ring and X is H
or halogen.
[0030] Examples of 5-14 membered heterocyclic rings include but are
not limited to tetrahydrofuran, 1,3-dioxolane, 2,3-dihydrofuran,
tetrahydropyran, benzofuran, isobenzofuran,
1,3-dihydro-isobenzofuran, isoxazole, 4,5-dihydroisoxazole,
piperidine, piperidin-2-one, pyrrolidine, pyrrolidin-2-one,
pyrrole, pyridine, pyrimidine, octahydro-pyrrolo[3,4-b]pyridine,
piperazine, piperazin-2-one, pyrazine, morpholine, thiomorpholine,
imidazole, imidazolidine-2,4-dione, benzimidazole,
1,3-dihydrobenzimidazol-2-one, indole, thiazole, benzothiazole,
thiadiazole, thiophene, tetrahydro-thiophene 1,1-dioxide,
diazepine, triazole, guanidine, diazabicyclo[2.2.1]heptane,
2,5-diazabicyclo[2.2.1]heptane, or
2,3,4,4a,9,9a-hexahydro-1H-.beta.-carboline. In particular
examples, A is an optionally substituted morpholine,
thiomorpholine, imidazole, pyrrolidine, pyrrolidin-2-one,
piperazine, piperazin-2-one, pyridine, piperidine, or
piperidin-2-one.
[0031] In another embodiment, U in formula 1 is
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4. In some
examples, n is 2-3. In other examples, R.sup.3 and R.sup.4 together
with N form an optionally substituted ring containing N, and
optionally O or S. In particular examples, the NR.sup.3R.sup.4
moiety is an optionally substituted morpholine, thiomorpholine,
imidazole, pyrrolidine, piperazine, pyridine or piperidine.
[0032] In yet another embodiment, W is phenyl; and X is H. In these
embodiments, A may an optionally substituted morpholine,
thiomorpholine, imidazole, pyrrolidine, pyrrolidin-2-one,
piperazine, piperazin-2-one, pyridine, piperidine, or
piperidin-2-one. In some examples, A is an optionally substituted
piperazine. In some of these embodiments, U may be
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4, and in some
examples, the NR.sup.3R.sup.4 moiety is morpholine, thiomorpholine,
imidazole, pyrrolidine, piperazine, pyridine or piperidine.
[0033] In another aspect, the present invention provides a compound
having formula 2
##STR00007##
[0034] and pharmaceutically acceptable salts, esters and prodrugs
thereof;
[0035] wherein A is NR.sup.1R.sup.2;
[0036] Z is O, S, NR.sup.1 or CH.sub.2; and
[0037] U is NR.sup.1R.sup.2 or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4
[0038] B is a 5-6 membered aryl or heteroaryl;
[0039] R.sup.1 and R.sup.2 together with N in NR.sup.1R.sup.2, and
R.sup.3 and R.sup.4 together with N in NR.sup.3R.sup.4 may
independently form an optionally substituted 5-6 membered ring
containing N, and optionally O or S;
[0040] R.sup.1 and R.sup.3 are independently H or a C.sub.1-6
alkyl; and
[0041] R.sup.2 and R.sup.4 are independently H, or a C.sub.1-10
alkyl or C.sub.2-10 alkenyl optionally containing one or more
non-adjacent heteroatoms selected from N, O, and S, and optionally
substituted with a substituted or unsubstituted aryl, heteroaryl,
carbocyclic, or heterocyclic ring; or R.sup.2 is an optionally
substituted cycloalkyl, heterocyclic ring, aryl or heteroaryl;
[0042] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, azido, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0043] wherein each optionally substituted moiety is substituted
with one or more halo, cyano, azido, acetyl, amido, OR.sup.2,
NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl, C.sub.2-10 alkenyl,
each optionally substituted by halo, .dbd.O, aryl or one or more
heteroatoms selected from N, O and S; or is substituted with an
aryl, a carbocyclic or a heterocyclic ring.
[0044] In the above formula 2, W may be phenyl. In some
embodiments, Z is O. In other embodiments, R.sup.5 is halo.
[0045] In the above formula 2, the NR.sup.1R.sup.2 and
NR.sup.3R.sup.4 moieties may independently be an optionally
substituted morpholine, thiomorpholine, imidazole, pyrrolidine,
piperazine, pyridine or piperidine.
[0046] In another aspect, the present invention provides a compound
having formula 3
##STR00008##
[0047] and pharmaceutically acceptable salts, esters and prodrugs
thereof;
[0048] wherein A is H or F;
[0049] X is H, halo or NR.sup.1R.sup.2;
[0050] Z is O, S, NR.sup.1 or CH.sub.2;
[0051] L is a C.sub.1-10 alkyl optionally substituted with N, O or
S;
[0052] B is 5-6 membered aryl or heteroaryl;
[0053] R.sup.1 and R.sup.3 are independently H or a C.sub.1-6
alkyl;
[0054] R.sup.2 and R.sup.4 is H, or a C.sub.1-10 alkyl or
C.sub.2-10 alkenyl optionally containing one or more non-adjacent
heteroatoms selected from N, O, and S, and optionally substituted
with a substituted or unsubstituted aryl, heteroaryl, carbocyclic,
or heterocyclic ring; or R.sup.2 is an optionally substituted
cycloalkyl, heterocyclic ring, aryl or heteroaryl;
[0055] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0056] wherein each optionally substituted moiety is substituted
with one or more halo, cyano, azido, acetyl, amido, OR.sup.2,
NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl, C.sub.2-10 alkenyl,
each optionally substituted by halo, .dbd.O, aryl or one or more
heteroatoms selected from N, O and S; or is substituted with an
aryl, a carbocyclic or a heterocyclic ring;
[0057] provided said compound is not
##STR00009##
[0058] In the above formula 3, W may be phenyl or pyridyl. In some
embodiments, L is a C.sub.2-4 alkyl.
[0059] In the above formula 3, X may be NR.sup.1R.sup.2, and
R.sup.2 is an optionally substituted cyclopropyl, pheny, or
imidazole, or a C.sub.1-6 alkyl optionally substituted with a
cyclopropyl or OR.sup.1.
[0060] In some embodiments, the NR.sup.1R.sup.2 and NR.sup.3R.sup.4
moieties in formula 3 are independently an optionally substituted
morpholine, thiomorpholine, imidazole, pyrrolidine, piperazine,
pyridine or piperidine.
[0061] In yet other embodiments, A in formula 3 is F and R.sup.5 is
halo, cyano, amido or azido.
[0062] The present invention also provides pharmaceutical
compositions comprising a compound having formula 1, 1A, 2 or 3,
and a pharmaceutically acceptable excipient.
[0063] Furthermore, the present invention relates to methods for
ameliorating a cell proliferative disorder, comprising
administering to a subject in need thereof an effective amount of a
compound having formula 1, 1A, 2 or 3, or a pharmaceutical
composition thereof and optionally with a chemotherapeutic agent,
thereby ameliorating said cell-proliferative disorder. For example,
cell proliferation may be reduced, or cell death may be induced.
The cell proliferative disorder may be a tumor or a cancer. The
subject may be human or an animal.
[0064] The present invention also relates to methods for reducing
cell proliferation or inducing cell death, comprising contacting a
system with an effective amount of a compound having formula 1, 1A,
2 or 3, or a pharmaceutical composition thereof and optionally with
a chemotherapeutic agent, thereby reducing cell proliferation or
inducing cell death in said system. The system may be a cell or a
tissue.
[0065] Furthermore, the present invention provides methods for
reducing microbial titers, comprising contacting a system with an
effective amount of a compound having formula 1, 1A, 2 or 3, or a
pharmaceutical composition thereof and optionally with an
antimicrobial agent, thereby reducing microbial titers. The system
may be a cell or a tissue.
[0066] The present invention also provides methods for ameliorating
a microbial infection, comprising administering to a subject in
need thereof an effective amount of a compound having formula 1,
1A, 2 or 3, or a pharmaceutical composition thereof and optionally
with an antimicrobial agent, thereby ameliorating said microbial
infection. The subject may be human or an animal. The microbial
titers may be viral, bacterial or fungal titers.
[0067] The present invention also provides methods for inducing
apoptosis, comprising administering to a system or a subject in
need thereof an effective amount of a compound having formula 1,
1A, 2 or 3, or a pharmaceutical composition thereof and optionally
with a chemotherapeutic agent.
[0068] The present invention also provides methods for treating or
ameliorating a disorder mediated by c-Myc overexpression,
comprising administering to a system or a subject in need thereof
an effective amount of a compound having formula 1, 1A, 2 or 3, or
a pharmaceutical composition thereof and optionally with a
chemotherapeutic agent. The subject may be human or an animal, and
system may be a cell or a tissue.
[0069] The present invention also relates to methods for
determining interaction selectivity between a compound having
formula 1, 1A, 2 or 3, and nucleic acids capable of forming a
quadruplex structure, comprising: a) contacting a compound in the
absence of a competitor molecule with three or more nucleic acids
capable of forming a quadruplex structure, wherein each nucleic
acid is not a telomere nucleic acid; b) measuring a direct
interaction between the compound and said three or more nucleic
acids; and c) determining interaction selectivity from a comparison
of the interaction measurements. In one example, three or more
nucleic acids comprise a nucleotide sequence located 5' of an
oncogene nucleotide sequence. The oncogene may be MYC, HIF, VEGF,
ABL, TGF, PDGF.alpha., MYB, SPARC, HER, VAV, RET, H-RAS, EGF, SRC,
BCL-1, BCL-2, DHFR, or HMGA.
[0070] In the above methods for determining interaction
selectivity, the compound may be separately contacted with each of
said three or more nucleic acids in a different vessel.
Furthermore, the interaction selectivity may be determined from a
comparison of IC.sub.50 values.
[0071] In the above methods, the compound may bind and/or stabilize
a propeller quadruplex. Examples of propeller quadruplexes include
but are not limited to H-RAS, RET, BCL-1, DHFR, TGF-.beta.,
HIF-1.alpha., VEGF, c-Myc, or PDGF.alpha.. In another embodiment,
the compound may bind and/or stabilize a chair-eller or a basket
quadruplex. For example, the compound may bind and/or stabilize
BCL-2.
DEFINITIONS
[0072] As used herein, the term "alkyl" refers to a
carbon-containing compound, and encompasses compounds containing
one or more heteroatoms. The term "alkyl" also encompasses alkyls
substituted with one or more substituents including but not limited
to OR.sup.1, amino, amido, halo, .dbd.O, aryl, heterocyclic groups,
or inorganic substituents.
[0073] As used herein, the term "carbocycle" refers to a cyclic
compound containing only carbon atoms in the ring, whereas a
"heterocycle" refers to a cyclic compound comprising a heteroatom.
The carbocyclic and heterocyclic structures encompass compounds
having monocyclic, bicyclic or multiple ring systems.
[0074] As used herein, the term "aryl" refers to a polyunsaturated,
typically aromatic hydrocarbon substituent, whereas a "heteroaryl"
or "heteroaromatic" refer to an aromatic ring containing a
heteroatom. The aryl and heteroaryl structures encompass compounds
having monocyclic, bicyclic or multiple ring systems.
[0075] As used herein, the term "heteroatom" refers to any atom
that is not carbon or hydrogen, such as nitrogen, oxygen or
sulfur.
[0076] Illustrative examples of heterocycles include but are not
limited to tetrahydrofuran, 1,3-dioxolane, 2,3-dihydrofuran, pyran,
tetrahydropyran, benzofuran, isobenzofuran,
1,3-dihydro-isobenzofuran, isoxazole, 4,5-dihydroisoxazole,
piperidine, pyrrolidine, pyrrolidin-2-one, pyrrole, pyridine,
pyrimidine, octahydro-pyrrolo[3,4-b]pyridine, piperazine, pyrazine,
morpholine, thiomorpholine, imidazole, imidazolidine-2,4-dione,
1,3-dihydrobenzimidazol-2-one, indole, thiazole, benzothiazole,
thiadiazole, thiophene, tetrahydro-thiophene 1,1-dioxide,
diazepine, triazole, guanidine, diazabicyclo[2.2.1]heptane,
2,5-diazabicyclo[2.2.1]heptane,
2,3,4,4a,9,9a-hexahydro-1H-.beta.-carboline, oxirane, oxetane,
tetrahydropyran, dioxane, lactones, aziridine, azetidine,
piperidine, lactams, and may also encompass heteroaryls. Other
illustrative examples of heteroaryls include but are not limited to
furan, pyrrole, pyridine, pyrimidine, imidazole, benzimidazole and
triazole.
[0077] The terms "treat," "treatment" and "therapeutic effect" as
used herein refer to reducing or stopping a cell proliferation rate
(e.g., slowing or halting tumor growth) or reducing the number of
proliferating cancer cells (e.g., removing part or all of a tumor).
These terms also are applicable to reducing a titre of a
microorganism in a system (i.e., cell, tissue, or subject) infected
with a microorganism, reducing the rate of microbial propagation,
reducing the number of symptoms or an effect of a symptom
associated with the microbial infection, and/or removing detectable
amounts of the microbe from the system. Examples of microorganism
include but are not limited to virus, bacterium and fungus.
[0078] As used herein, the term "chemotherapeutic agent" refers to
a therapeutic agent that may be used for treating or ameliorating a
cell proliferative disorder such as tumors or cancer. Examples of
chemotherapeutic agents include but are not limited to an
antineoplastic agent, an alkylating agent, a plant alkaloid, an
antimicrobial agent, a sulfonamide, an antiviral agent, a platinum
agent, and other anticancer agents known in the art. Particular
examples of chemotherapeutic agents include but are not limited to
cisplatin, carboplatin, busulphan, methotrexate, daunorubicin,
doxorubicin, cyclophosphamide, mephalan, vincristine, vinblastine,
chlorambucil, paclitaxel, gemcitabine, and others known in the art.
(See, e.g., Goodman & Gilman's, The Pharmacological Basis of
Therapeutics (9th Ed) (Goodman, et al., eds.) (McGraw-Hill) (1996);
and 1999 Physician's Desk Reference (1998)).
[0079] As used herein, the term "apoptosis" refers to an intrinsic
cell self-destruction or suicide program. In response to a
triggering stimulus, cells undergo a cascade of events including
cell shrinkage, blebbing of cell membranes and chromatic
condensation and fragmentation. These events culminate in cell
conversion to clusters of membrane-bound particles (apoptotic
bodies), which are thereafter engulfed by macrophages.
DESCRIPTION OF THE INVENTION
[0080] The present invention relates to compounds having formula 1,
1A, 2 and 3, and pharmaceutically acceptable salts, esters, and
prodrugs thereof. The present invention also relates to methods for
using the compounds described herein, such as in screening. The
compounds may interact with regions of DNA that can form
quadruplexes, and may also be used for treatment of cell
proliferative disorders.
[0081] In one aspect, the present invention provides a compound
having formula 1
##STR00010##
[0082] and pharmaceutically acceptable salts, esters and prodrugs
thereof,
[0083] wherein X is H, OR.sup.2, NR.sup.1R.sup.2, halogen, azido,
SR.sup.2 or CH.sub.2R;
[0084] A is H, halogen, NR.sup.1R.sup.2, SR.sup.2, OR.sup.2,
CH.sub.2R.sup.2, azido or
NR.sup.1--(CR.sup.1.sub.2)--NR.sup.3R.sup.4;
[0085] Z is O, S, NR.sup.1 or CH.sub.2;
[0086] U is R.sup.2, OR.sup.2, NR.sup.1R.sup.2 or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4 provided U is not
H;
[0087] W is an optionally substituted aryl or heteroaryl, which may
be monocyclic or fused with a single or multiple ring optionally
containing a heteroatom;
[0088] wherein R.sup.1 and R.sup.2 together with N in
NR.sup.1R.sup.2, and R.sup.3 and R.sup.4 together with N in
NR.sup.3R.sup.4 may independently form an optionally substituted
5-6 membered ring containing N, and optionally O or S;
[0089] R.sup.1 and R.sup.3 are independently H or a C.sub.1-6
alkyl; and
[0090] R.sup.2 and R.sup.4 are independently H, or a C.sub.1-10
alkyl or C.sub.2-10 alkenyl optionally containing one or more
non-adjacent heteroatoms selected from N, O, and S, and optionally
substituted with a substituted or unsubstituted aryl, heteroaryl,
carbocyclic, or heterocyclic ring; or R.sup.2 is an optionally
cycloalkyl, substituted heterocyclic ring, aryl or heteroaryl;
[0091] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, azido, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0092] provided X and A both are not H, and further provided that
R.sup.5 is cyano or --CONHR.sup.1 when A is H, halogen or
NR.sup.1R.sup.2;
[0093] or a compound having formula (1A)
##STR00011##
[0094] and pharmaceutically acceptable salts, esters and prodrugs
thereof;
[0095] A is H, halogen, azido, SR.sup.2, OR.sup.2, CH.sub.2R.sup.2,
NR.sup.1R.sup.2, or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4;
[0096] Z, U, W, R.sup.1, R.sup.2, R.sup.3 and R.sup.4 are as
defined in formula 1; and
[0097] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, azido, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0098] wherein each optionally substituted moiety in formula 1 and
1A is substituted with one or more halo, cyano, azido, acetyl,
amido, OR.sup.2, NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl,
C.sub.2-10 alkenyl, each optionally substituted by halo, .dbd.O,
aryl or one or more heteroatoms selected from N, O and S; or is
substituted with an aryl, a carbocyclic or a heterocyclic ring.
[0099] Illustrative examples of compounds having formula 1 are
shown in Table 1A (where R.sub.5 is cyano and amido), Table 1B
(where A is SR.sup.2) and Table 1C (A is NR.sup.1R.sup.2).
TABLE-US-00002 TABLE 1A HCT- 116 Hela STOP MTS MTS IC50uM uM uM
##STR00012## 6.1 3.6 11 ##STR00013## 6.8 0.4 1.2 ##STR00014## 5
0.031 0.21 ##STR00015## 5.3 0.4 0.68 ##STR00016## 10 0.03 0.04
TABLE-US-00003 TABLE 1B HCT- 116 Hela STOP MTS MTS IC50uM uM uM
##STR00017## 3.9 2.8 0.28 ##STR00018## 3.4 10 1.8 ##STR00019## 14
3.9 5.2 ##STR00020## 54 2.9 2.3 ##STR00021## 3.8 3.1 2.5
##STR00022## 10 3.8 3 ##STR00023## 2.9 4.2 4.1
TABLE-US-00004 TABLE 1C HCT- 116 Hela STOP MTS MTS IC50uM uM uM
##STR00024## 6 ##STR00025## ##STR00026## ##STR00027##
[0100] In another aspect, the invention provides a compound having
formula (2)
##STR00028##
[0101] and pharmaceutically acceptable salts, esters and prodrugs
thereof;
[0102] wherein A is NR.sup.1R.sup.2;
[0103] Z is O, S, NR.sup.1 or CH.sub.2; and
[0104] U is NR.sup.1R.sup.2 or
NR.sup.1--(CR.sup.1.sub.2).sub.n--NR.sup.3R.sup.4;
[0105] B is a 5-6 membered aryl or heteroaryl;
[0106] R.sup.1 and R.sup.2 together with N in NR.sup.1R.sup.2, and
R.sup.3 and R.sup.4 together with N in NR.sup.3R.sup.4 may
independently form an optionally substituted 5-6 membered ring
containing N, and optionally O or S;
[0107] R.sup.1 and R.sup.3 are independently H or a C.sub.1-6
alkyl; and
[0108] R.sup.2 and R.sup.4 are independently H, or a C.sub.1-10
alkyl or C.sub.2-10 alkenyl optionally containing one or more
non-adjacent heteroatoms selected from N, O, and S, and optionally
substituted with a substituted or unsubstituted aryl, heteroaryl,
carbocyclic, or heterocyclic ring; or R.sup.2 is an optionally
substituted cycloalkyl, heterocyclic ring, aryl or heteroaryl;
[0109] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, azido, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0110] wherein each optionally substituted moiety is substituted
with one or more halo, cyano, azido, acetyl, amido, OR.sup.2,
NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl, C.sub.2-10 alkenyl,
each optionally substituted by halo, .dbd.O, aryl or one or more
heteroatoms selected from N, O and S; or is substituted with an
aryl, a carbocyclic or a heterocyclic ring.
[0111] In another aspect, the invention provides compounds having
formula (3)
##STR00029##
[0112] and pharmaceutically acceptable salts, esters and prodrugs
thereof;
[0113] wherein A is H or F;
[0114] X is H, halo or NR.sup.1R.sup.2;
[0115] Z is O, S, NR.sup.1 or CH.sub.2;
[0116] L is a C.sub.1-10 alkyl optionally substituted with N, O or
S;
[0117] B is 5-6 membered aryl or heteroaryl;
[0118] R.sup.1 and R.sup.3 are independently H or a C.sub.1-6
alkyl;
[0119] R.sup.2 and R.sup.4 is H, or a C.sub.1-10 alkyl or
C.sub.2-10 alkenyl optionally containing one or more non-adjacent
heteroatoms selected from N, O, and S, and optionally substituted
with a substituted or unsubstituted aryl, heteroaryl, carbocyclic,
or heterocyclic ring; or R.sup.2 is an optionally substituted
cycloalkyl, heterocyclic ring, aryl or heteroaryl;
[0120] R.sup.5 is a substituent at any position of W and is H,
halo, cyano, --CONHR.sup.1, OR.sup.2, or C.sub.1-6 alkyl or
C.sub.2-6 alkenyl, each optionally substituted by halo, .dbd.O or
one or more heteroatoms;
[0121] wherein each optionally substituted moiety is substituted
with one or more halo, cyano, azido, acetyl, amido, OR.sup.2,
NR.sup.1R.sup.2, carbamate, C.sub.1-10 alkyl, C.sub.2-10 alkenyl,
each optionally substituted by halo, .dbd.O, aryl or one or more
heteroatoms selected from N, O and S; or is substituted with an
aryl, a carbocyclic or a heterocyclic ring;
[0122] provided said compound is not
##STR00030##
[0123] Illustrative examples of compounds having formula 2 and 3
are shown in Tables 1D-1F.
TABLE-US-00005 TABLE 1D ##STR00031## ##STR00032## ##STR00033##
##STR00034## ##STR00035## ##STR00036## ##STR00037## ##STR00038##
##STR00039## ##STR00040## ##STR00041## ##STR00042## ##STR00043##
##STR00044## ##STR00045## ##STR00046## ##STR00047## ##STR00048##
##STR00049## ##STR00050## ##STR00051## ##STR00052## ##STR00053##
##STR00054## ##STR00055## ##STR00056## ##STR00057## ##STR00058##
##STR00059## ##STR00060## ##STR00061## ##STR00062## ##STR00063##
##STR00064## ##STR00065## ##STR00066## ##STR00067##
TABLE-US-00006 TABLE 1E ##STR00068## ##STR00069## ##STR00070##
##STR00071## ##STR00072## ##STR00073## ##STR00074## ##STR00075##
##STR00076## ##STR00077## ##STR00078## ##STR00079## ##STR00080##
##STR00081## ##STR00082## ##STR00083## ##STR00084## ##STR00085##
##STR00086## ##STR00087## ##STR00088## ##STR00089## ##STR00090##
##STR00091## ##STR00092## ##STR00093## ##STR00094## ##STR00095##
##STR00096## ##STR00097## ##STR00098## ##STR00099## ##STR00100##
##STR00101## ##STR00102## ##STR00103## ##STR00104## ##STR00105##
##STR00106## ##STR00107## ##STR00108## ##STR00109## ##STR00110##
##STR00111## ##STR00112## ##STR00113## ##STR00114## ##STR00115##
##STR00116## ##STR00117## ##STR00118## ##STR00119## ##STR00120##
##STR00121## ##STR00122## ##STR00123## ##STR00124## ##STR00125##
STOP Data (.mu.M) 1 ##STR00126## >15 2 ##STR00127## >15 3
##STR00128## >15 4 ##STR00129## >15 5 ##STR00130## >15 6
##STR00131## >15 7 ##STR00132## >15 8 ##STR00133## >15 9
##STR00134## >15 10 ##STR00135## >15 11 ##STR00136## >15
12 ##STR00137## >15 13 ##STR00138## >15 14 ##STR00139##
>15 15 ##STR00140## >15 16 ##STR00141## >15 17
##STR00142## >15 18 ##STR00143## >15 19 ##STR00144## >15
20 ##STR00145## >15 21 ##STR00146## >15 22 ##STR00147##
>15 23 ##STR00148## >15 24 ##STR00149## >15 25
##STR00150## >15 26 ##STR00151## >15 27 ##STR00152## >15
28 ##STR00153## >15 29 ##STR00154## >15 30 ##STR00155##
>15 31 ##STR00156## >15 32 ##STR00157## >15 33
##STR00158## >15 34 ##STR00159## >15 35 ##STR00160## >15
36 ##STR00161## >15 37 ##STR00162## >15 38 ##STR00163##
>15 39 ##STR00164## >15 40 ##STR00165## >15 41
##STR00166## >15 42 ##STR00167## >15 43 ##STR00168## >15
44 ##STR00169## >15 45 ##STR00170## >15 46 ##STR00171##
>15 47 ##STR00172## >15 48 ##STR00173## >15 49
##STR00174## >15 50 ##STR00175## >15 51 ##STR00176## >15
52 ##STR00177## >15 53 ##STR00178## >15 54 ##STR00179##
>15 55 ##STR00180## >15 56 ##STR00181## >15 57
##STR00182## >15 58 ##STR00183## >15 59 ##STR00184## 0.75 60
##STR00185## >15 61 ##STR00186## >15 62 ##STR00187## 0.75 63
##STR00188## >15 64 ##STR00189## >15 65 ##STR00190##
>15
66 ##STR00191## >15 67 ##STR00192## >15 68 ##STR00193##
>15 69 ##STR00194## >15 70 ##STR00195## >15 71
##STR00196## >15 72 ##STR00197## >15 73 ##STR00198## 3 74
##STR00199## 3 75 ##STR00200## 11 76 ##STR00201## 3 77 ##STR00202##
>15 78 ##STR00203## >15 79 ##STR00204## >15 80
##STR00205## >15 81 ##STR00206## 5.7 82 ##STR00207## >15 83
##STR00208## >15 84 ##STR00209## >15 85 ##STR00210## 8.2
TABLE-US-00007 TABLE 1F ##STR00211## ##STR00212## ##STR00213##
##STR00214## ##STR00215## ##STR00216## ##STR00217## ##STR00218##
##STR00219## ##STR00220## ##STR00221## ##STR00222## ##STR00223##
##STR00224## STOP DATA (.mu.M) 1 ##STR00225## 4.8 2 ##STR00226##
3.6 3 ##STR00227## >15 4 ##STR00228## 6.8 5 ##STR00229## >15
6 ##STR00230## >15 7 ##STR00231## >15 8 ##STR00232## >15 9
##STR00233## >15 10 ##STR00234## >15 11 ##STR00235## >15
12 ##STR00236## >15 13 ##STR00237## >15 14 ##STR00238## 2.9
15 ##STR00239## 8 16 ##STR00240## 6.6 17 ##STR00241## >15 18
##STR00242## 2.6 19 ##STR00243## 4 20 ##STR00244## 3 21
##STR00245## >15 22 ##STR00246## >15 23 ##STR00247## >15
24 ##STR00248## >15 25 ##STR00249## >15 26 ##STR00250## 4.0
27 ##STR00251## 7.8 28 ##STR00252## 2.8 29 ##STR00253## 3.2 30
##STR00254## 5.1 31 ##STR00255## 7.2 32 ##STR00256## 10 33
##STR00257## 5.0 34 ##STR00258## 10 35 ##STR00259## 2.9 36
##STR00260## 10 37 ##STR00261## 8.2 38 ##STR00262## 10 39
##STR00263## 10 40 ##STR00264## 10 41 ##STR00265## 9.4 42
##STR00266## 10 43 ##STR00267## 7.5 44 ##STR00268## 4.8 45
##STR00269## 7.5 46 ##STR00270## 10 47 ##STR00271## 8.6 48
##STR00272## 9.8 49 ##STR00273## 10 50 ##STR00274## 10
[0124] The compounds may be chiral or achiral. As used herein, a
chiral compound is a compound that is different from its mirror
image, and has an enantiomer. Methods of synthesizing chiral
compounds and resolving a racemic mixture of enantiomers are well
known to those skilled in the art. See, e.g., March, "Advanced
Organic Chemistry," John Wiley and Sons, Inc., New York, (1985),
which is incorporated herein by reference.
[0125] Furthermore, the present invention provides pharmaceutical
compositions comprising compounds having formula 1, 1A, 2 or 3. For
example, the pharmaceutical composition may comprise a compound
having formula 1, 1A, 2 or 3, polyethylene glycol, and propylene
glycol in a buffer solution.
[0126] The compounds described herein may interact with regions of
DNA that can form quadruplexes. Because regions of DNA that can
form quadruplexes are regulators of biological processes such as
oncogene transcription, modulators of quadruplex biological
activity can be utilized as cancer therapeutics. Molecules that
interact with regions of DNA that can form quadruplexes can exert a
therapeutic effect on certain cell proliferative disorders and
related conditions. Particularly, abnormally increased oncogene
expression can cause cell proliferative disorders, and quadruplex
structures typically down-regulate oncogene expression. Examples of
oncogenes include but are not limited to MYC, HIF, VEGF, ABL, TGF,
PDGFA, MYB, SPARC, HUMTEL, HER, VAV, RET, H-RAS, EGF, SRC, BCL1,
BCL2, DHFR, HMGA, and other oncogenes known to one of skill in the
art.
[0127] Molecules that bind to regions of DNA that can form
quadruplexes can exert a biological effect according to different
mechanisms, which include for example, stabilizing a native
quadruplex structure, inhibiting conversion of a native quadruplex
to duplex DNA by blocking strand cleavage, and stabilizing a native
quadruplex structure having a quadruplex-destabilizing nucleotide
substitution and other sequence specific interactions. Thus,
compounds that bind to regions of DNA that can form quadruplexes
described herein may be administered to cells, tissues, or
organisms for the purpose of down-regulating oncogene transcription
and thereby treating cell proliferative disorders.
[0128] Determining whether the biological activity of native DNA
that can form quadruplexes is modulated in a cell, tissue, or
organism can be accomplished by monitoring quadruplex biological
activity. Quadruplex forming regions of DNA biological activity may
be monitored in cells, tissues, or organisms, for example, by
detecting a decrease or increase of gene transcription in response
to contacting the quadruplex forming DNA with a molecule.
Transcription can be detected by directly observing RNA transcripts
or observing polypeptides translated by transcripts, which are
methods well known in the art.
[0129] Molecules that interact with quadruplex forming DNA and
quadruplex forming nucleic acids can be utilized to treat many cell
proliferative disorders. Cell proliferative disorders include, for
example, colorectal cancers and hematopoietic neoplastic disorders
(i.e., diseases involving hyperplastic/neoplastic cells of
hematopoietic origin such as those arising from myeloid, lymphoid
or erythroid lineages, or precursor cells thereof). The diseases
can arise from poorly differentiated acute leukemias, e.g.,
erythroblastic leukemia and acute megakaryoblastic leukemia.
Additional myeloid disorders include, but are not limited to, acute
promyeloid leukemia (APML), acute myelogenous leukemia (AML) and
chronic myelogenous leukemia (CML) (Vaickus, Crit. Rev. in
Oncol./Hemotol. 11:267-297 (1991)). Lymphoid malignancies include,
but are not limited to acute lymphoblastic leukemia (ALL), which
includes B-lineage ALL and T-lineage ALL, chronic lymphocytic
leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia
(HLL) and Waldenstrom's macroglobulinemia (WM). Additional forms of
malignant lymphomas include, but are not limited to non-Hodgkin
lymphoma and variants thereof, peripheral T cell lymphomas, adult T
cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma (CTCL),
large granular lymphocytic leukemia (LGF), Hodgkin's disease and
Reed-Sternberg disease. Cell proliferative disorders also include
cancers of the colorectum, breast, lung, liver, pancreas, cervical,
lymph node, colon, prostate, brain, head and neck, skin, liver,
kidney, and heart. Compounds that interact with regions of DNA that
can form quadruplexes also can be utilized to target cancer related
processes and conditions, such as increased angiogenesis, by
inhibiting angiogenesis in a subject.
[0130] The present invention provides a method for reducing cell
proliferation or for treating or alleviating cell proliferative
disorders, comprising contacting a system having a DNA capable of
forming a quadruplex with a compound having formula 1, 1A, 2 or 3.
The system may be a group of cells or one or more tissues. In one
embodiment, the system is a subject in need of a treatment of a
cell proliferative disorder (e.g., a mammal such as a mouse, rat,
monkey, or human).
[0131] The present invention also provides a method for treating or
ameliorating a cancer associated with c-Myc overexpression, by
administering a compound that interacts with a c-MYC quadruplex
forming region to a subject in need thereof. Examples of cancers
associated with c-Myc overexpression include but are not limited to
colorectal cancer, prostate cancer, and pancreatic cancer.
Furthermore, the present invention provides a method for inhibiting
angiogenesis and optionally treating a cancer associated with
angiogenesis, comprising administering a compound that interacts
with a vascular endothelial growth factor (VEGF) quadruplex forming
region to a subject in need thereof, thereby reducing angiogenesis
and optionally treating a cancer associated with angiogenesis.
[0132] Compounds that interact with quadruplex forming regions of
DNA can also be used to reduce a microbial infection, such as a
viral infection. Retroviruses offer a wealth of potential targets
for G-quadruplex targeted therapeutics. G-quadruplex structures
have been implicated as functional elements in at least two
secondary structures formed by either viral RNA or DNA in HIV, the
dimer linker structure (DLS) and the central DNA flap (CDF).
Additionally, DNA aptamers which are able to adopt either inter- or
intramolecular quadruplex structures are able to inhibit viral
replication. In one example, DNA aptamers are able to inhibit viral
replication by targeting the envelope glycoprotein (putatively). In
another example, DNA aptamers inhibit viral replication by
targeting the HIV-integrase respectively, suggesting the
involvement of native quadruplex structures in interaction with the
integrase enzyme.
[0133] Dimer linker structures, which are common to all
retroviruses, serve to bind two copies of the viral genome together
by a non-covalent interaction between the two 5' ends of the two
viral RNA sequences. The genomic dimer is stably associated with
the gag protein in the mature virus particle. In the case of HIV,
the origin of this non-covalent binding may be traced to a 98
base-pair sequence containing several runs of at least two
consecutive guanines (e.g., the 3' for the formation of RNA dimers
in vitro). An observed cation (potassium) dependence for the
formation and stability of the dimer in vitro, in addition to the
failure of an antisense sequence to effectively dimerize, has
revealed the most likely binding structure to be an intermolecular
G-quadruplex.
[0134] Prior to integration into the host genome, reverse
transcribed viral DNA forms a pre-integration complex (PIC) with at
least two major viral proteins, integrase and reverse
transcriptase, which is subsequently transported into the nucleus.
The Central DNA Flap (CDF) refers to 99-base length single-stranded
tail of the + strand, occurring near the center of the viral duplex
DNA, which is known to a play a role in the nuclear import of the
PIC. Oligonucleotide mimics of the CDF have been shown to form
intermolecular G-quadruplex structures in cell-free systems.
[0135] Thus, compounds that recognize quadruplex forming regions
can be used to bind and/or stabilize the dimer linker structure and
thus prevent de-coupling of the two RNA strands. Also, by binding
to the quadruplex structure formed by the CDF, protein recognition
and/or binding events for nuclear transport of the PIC may be
disrupted. In either case, a substantial advantage can exist over
other anti-viral therapeutics. Current Highly Active
Anti-Retroviral Therapeutic (HAART) regimes rely on the use of
combinations of drugs targeted towards the HIV protease and HIV
integrase. The requirement for multi-drug regimes is to minimize
the emergence of resistance, which will usually develop rapidly
when agents are used in isolation. The source of such rapid
resistance is the infidelity of the reverse transcriptase enzyme
which makes a mutation approximately once in every 10,000 base
pairs. An advantage of targeting viral quadruplex structures over
protein targets is that the development of resistance is slow or is
impossible. A point mutation of the target quadruplex can
compromise the integrity of the quadruplex structure and lead to a
non-functional copy of the virus. A single therapeutic agent based
on this concept may replace the multiple drug regimes currently
employed, with the concomitant benefits of reduced costs and the
elimination of harmful drug/drug interactions.
[0136] The present invention provides a method for reducing a
microbial titer in a system, comprising contacting a system having
a native DNA quadruplex forming region with a compound having
formula 1, 1A, 2 or 3. The system may be one or more cells or
tissues. Examples of microbial titers include but are not limited
to viral, bacterial or fungal titers. In a particular embodiment,
the system is a subject in need of a treatment for a viral
infection (e.g., a mammal such as a mouse, rat, monkey, or human).
Examples of viral infections include infections by a hepatitis
virus (e.g., hepatitis B or C), human immunodeficiency virus (HIV),
rhinovirus, herpes-zoster virus (VZV), herpes simplex virus (e.g.,
HSV-1 or HSV-2), cytomegalovirus (CMV), vaccinia virus, influenza
virus, encephalitis virus, hantavirus, arbovirus, West Nile virus,
human papilloma virus (HPV), Epstein-Barr virus, and respiratory
syncytial virus. The present invention also provides a method for
treating HIV infection by administering a compound having formula
1, 1A, 2 or 3 to a subject in need thereof, thereby reducing the
HIV infection.
Identifying Compounds that can Bind to Quadruplex Forming Regions
of DNA
[0137] Compounds described herein are identified as compounds that
can bind to quadruplex forming regions of DNA where a biological
activity of this region, often expressed as a "signal," produced in
a system containing the compound is different than the signal
produced in a system not containing the compound. While background
signals may be assessed each time a new molecule is probed by the
assay, detecting the background signal is not required each time a
new molecule is assayed.
[0138] Examples of quadruplex forming nucleic acid sequences are
set forth in the following Table 2:
TABLE-US-00008 TABLE 2 SEQ SEQUENCE ID NO ORIGIN
TG.sub.4AG.sub.3TG.sub.4AG.sub.3TG.sub.4AAGG 1 CMYC
GGGGGGGGGGGGGCGGGGGCGGGGGCGGGGGAGGGGC 2 PDGFA
G.sub.8ACGCG.sub.3AGCTG.sub.5AG.sub.3CTTG.sub.4CCAG.sub.3CG.sub.4CGCTTAG.s-
ub.5 3 PDGFB/c- sis AGGAAGGGGAGGGCCGGGGGGAGGTGGC 4 CABL
AGGGGCGGGGCGGGGCGGGGGC 5 RET GGGAGGAAGGGGGCGGGAGCGGGGC 6 BCL-2
GGGGGGCGGGGGCGGGCGCAGGGGGAGGGGGC 7 Cyclin D1/BCL-1
CGGGGCGGGGCGGGGGCGGGGGC 8 H-RAS
AGAGGAGGAGGAGGTCACGGAGGAGGAGGAGAAGGAGGAGGAGGAA 9 CMYB (GGA).sub.4
10 VAV AGAGAAGAGGGGAGGAGGAGGAGGAGAGGAGGAGGCGC 11 HMGA2
GGAGGGGGAGGGG 12 CPIM AGGAGAAGGAGGAGGTGGAGGAGGAGG 13 HER2/neu
AGGAGGAGGAGAATGCGAGGAGGAGGGAGGAGA 14 EGFR
GGGGCGGGCCGGGGGCGGGGTCCCGGCGGGGCGGAG 15 VEGF
CGGGAGGAGGAGGAAGGAGGAAGCGCG 16 CSRC
[0139] In addition to determining whether a test molecule or test
nucleic acid gives rise to a different signal, the affinity of the
interaction between the nucleic acid and the compound may be
quantified. IC.sub.50, K.sub.d, or K.sub.i threshold values may be
compared to the measured IC.sub.50 or K.sub.d values for each
interaction, and thereby identify a test molecule as a quadruplex
interacting molecule or a test nucleic acid as a quadruplex forming
nucleic acid. For example, IC.sub.50 or K.sub.d threshold values of
10 .mu.M or less, 1 .mu.M or less, and 100 nM or less are often
utilized. In another example, threshold values of 10 nM or less, 1
nM or less, 100 pM or less, and 10 pM or less may be utilized to
identify quadruplex interacting molecules and quadruplex forming
nucleic acids.
[0140] Many assays are available for identifying compounds that
have affinity for quadruplex forming regions of DNA. In some of
these assays, the biological activity is the quadruplex nucleic
acid binding to a compound and binding is measured as a signal. In
other assays, the biological activity is a polymerase arresting
function of a quadruplex and the degree of arrest is measured as a
decrease in a signal. In certain assays, the biological activity is
transcription and transcription levels can be quantified as a
signal. In another assay, the biological activity is cell death and
the number of cells undergoing cell death is quantified. Another
assay monitors proliferation rates of cancer cells. Examples of
assays are fluorescence binding assays, gel mobility shift assays
(see, e.g., Jin & Pike, Mol. Endocrinol. (1996) 10:196-205),
polymerase arrest assays, transcription reporter assays, cancer
cell proliferation assays, and apoptosis assays (see, e.g.,
Amersham Biosciences (Piscataway, N.J.)), and embodiments of such
assays are described hereafter. Also, topoisomerase assays can be
utilized to determine whether the quadruplex interacting molecules
have a topoisomerase pathway activity (see, e.g., TopoGEN, Inc.
(Columbus, Ohio)).
Gel Electrophoretic Mobility Shift Assay (EMSA)
[0141] An EMSA is useful for determining whether a nucleic acid
forms a quadruplex and whether a nucleotide sequence is
quadruplex-destabilizing. EMSA is conducted as described previously
(Jin & Pike, Mol. Endocrinol. 10: 196-205 (1996)) with minor
modifications. Generally, synthetic single-stranded
oligonucleotides are labeled in the 5'-terminus with T4-kinase in
the presence of [.gamma.-.sup.32P] ATP (1,000 mCi/mmol, Amersham
Life Science) and purified through a sephadex column.
.sup.32P-labeled oligonucleotides (.about.30,000 cpm) are then
incubated with or without various concentrations of a testing
compound in 20 .mu.l of a buffer containing 10 mM Tris pH 7.5, 100
mM KCl, 5 mM dithiothreitol, 0.1 mM EDTA, 5 mM MgCl.sub.2, 10%
glycerol, 0.05% Nonedit P-40, and 0.1 mg/ml of poly(dI-dC)
(Pharmacia). After incubation for 20 minutes at room temperature,
binding reactions are loaded on a 5% polyacrylamide gel in
0.25.times. Tris borate-EDTA buffer (0.25.times.TBE, 1.times.TBE is
89 mM Tris-borate, pH 8.0, 1 mM EDTA). The gel is dried and each
band is quantified using a phosphoimager.
DMS Methylation Protection Assay
[0142] Chemical footprinting assays are useful for assessing
quadruplex structure. Quadruplex structure is assessed by
determining which nucleotides in a nucleic acid are protected or
unprotected from chemical modification as a result of being
inaccessible or accessible, respectively, to the modifying reagent.
A DMS methylation assay is an example of a chemical footprinting
assay. In such an assay, bands from EMSA are isolated and subjected
to DMS-induced strand cleavage. Each band of interest is excised
from an electrophoretic mobility shift gel and soaked in 100 mM KCl
solution (300 .mu.l) for 6 hours at 4.degree. C. The solutions are
filtered (microcentrifuge) and 30,000 cpm (per reaction) of DNA
solution is diluted further with 100 mM KCl in 0.1.times.TE to a
total volume of 70 .mu.l (per reaction). Following the addition of
1 .mu.l salmon sperm DNA (0.1 .mu.g/.mu.l), the reaction mixture is
incubated with 1 .mu.l DMS solution (DMS:ethanol; 4:1; v:v) for a
period of time. Each reaction is quenched with 18 .mu.l of stop
buffer (b-mercaptoethanol:water:NaOAc (3 M); 1:6:7; v:v:v).
Following ethanol precipitation (twice) and piperidine cleavage,
the reactions are separated on a preparative gel (16%) and
visualized on a phosphoimager.
Polymerase Arrest Assay
[0143] An arrest assay includes a template nucleic acid, which may
comprise a quadruplex forming sequence, and a primer nucleic acid
which hybridizes to the template nucleic acid 5' of the
quadruplex-forming sequence. The primer is extended by a polymerase
(e.g., Taq polymerase), which advances from the primer along the
template nucleic acid. In this assay, a quadruplex structure can
block or arrest the advance of the enzyme, leading to shorter
transcription fragments. Also, the arrest assay may be conducted at
a variety of temperatures, including 45.degree. C. and 60.degree.
C., and at a variety of ion concentrations.
[0144] An example of the Taq polymerase stop assay is described in
Han, et al., Nucl. Acids Res. (1999) 27:537-542, which is a
modification of that used by Weitzmann, et al., J. Biol. Chem.
(1996) 271:20958-20964. Briefly, a reaction mixture of template DNA
(50 nM), Tris.HCl (50 mM), MgCl.sub.2 (10 mM), DTT (0.5 mM), EDTA
(0.1 mM), BSA (60 ng), and 5'-end-labeled quadruplex nucleic acid
(.about.18 nM) is heated to 90.degree. C. for 5 minutes and allowed
to cool to ambient temperature over 30 minutes. Taq Polymerase (1
.mu.l) is added to the reaction mixture, and the reaction is
maintained at a constant temperature for 30 minutes. Following the
addition of 10 .mu.l stop buffer (formamide (20 ml), 1 M NaOH (200
.mu.l), 0.5 M EDTA (400 .mu.l), and 10 mg bromophenol blue), the
reactions are separated on a preparative gel (12%) and visualized
on a phosphoimager. Adenine sequencing (indicated by "A" at the top
of the gel) is performed using double-stranded DNA Cycle Sequencing
System from Life Technologies. The general sequence for the
template strands is TCCAACTATGTATAC (SEQ ID
NO:19)-INSERT-TTAGCGACACGCAATTGCTATAGTGAGTCGTATTA (SEQ ID NO:20),
where "INSERT" refers to a nucleic acid sequence comprising a
quadruplex forming sequence (See e.g., Table 2). Bands on the gel
that exhibit slower mobility are indicative of quadruplex
formation.
High Throughput Polymerase Arrest Assay
[0145] A high throughput polymerase arrest assay has been
developed. The assay comprises contacting a template nucleic acid,
often DNA, with a primer, which also is often DNA; contacting the
primer/template complex with a compound described herein (also
referred to as a "test compound"); contacting the primer/template
complex with a polymerase; and separating reaction products. The
assay often includes the step of denaturing the primer/template
complex mixture and then renaturing the complex, which often is
carried out before a test molecule is added to the system. Multiple
assays often are carried out using varying concentrations of a test
compound, such that an IC.sub.50 value can be obtained, for
example. The reaction products often include extended primers of
different lengths. Where a test compound does not significantly
interact with a quadruplex structure in the template, the primer
often is extended to the end of the template.
[0146] Where a test compound significantly interacts with a
quadruplex structure in the template, the primer often is extended
only to the quadruplex structure in the template and no further.
Thus, the reaction mixture often includes at least two reaction
products when a test compound interacts with a quadruplex structure
in the template, one having a completely extended primer and one
having an incompletely extended primer, and these two reaction
products are separated. The products may be separated using any
convenient separation method, such as mass spectrometry and in one
embodiment, capillary electrophoresis.
[0147] The reaction products often are identified by detecting a
detectable label linked to the primer. The detectable label may be
non-covalently linked to the 5' end of the primer (e.g., a biotin
molecule covalently linked to the 5' end of the primer which is
non-covalently linked to an avidin molecule joined to a detectable
label). The detectable label may be joined to the primer at any
stage of the assay, sometimes before the primer is added to the
system, after the primer is extended, or after the products are
separated. The detectable label often is covalently linked to the
primer using a procedure selected based upon the nature of the
chemical groups in the detectable label.
[0148] Many methods for covalently linking detectable labels to
nucleic acids are available, such as chemically coupling an
allylamine-derivatized nucleotide to a succinimidyl-ester
derivative of a detectable label, and then generating a primer
using the labeled nucleotide. (See, e.g., Nature Biotech (2000)
18:345-348 and http address
info.med.yale.edu/genetics/ward/tavi/n_coupling.html). A spacer
(often between 5-16 carbon atoms long) sometimes is incorporated
between the detectable label and the nucleotide. Any convenient
detectable label may be utilized, including but not limited to a
radioactive isotope (e.g., .sup.125I, .sup.131I, .sup.35S,
.sup.32P, .sup.14C or .sup.3H); a light scattering label (e.g., a
spherical gold or silver label; Genicon Sciences Corporation, San
Diego, Calif. and U.S. Pat. No. 6,214,560); an enzymic or protein
label (e.g., GFP or peroxidase); or another chromogenic label or
dye sometimes is utilized. Often, a fluorescent label is utilized
(e.g., amino-methyl coumarin (AMCA); diethyl aminomethyl coumarin
(DEAC); cascade blue (CB); fluorescein isothiocyanate (FITC);
Oregon green (OG); Alexa 488 (A488); rhodamine green (RGr);
lanthanide chelate (e.g., europium), carboxy-rhodamine 6G (R6G);
tetramethyl rhodamine (TAMRA); Texas Red (TxR); Cy3; Cy3.5; Cy5,
Cy5.5 and carboxynaphtofluorescein (CNF), digoxigenin (DIG); and
2,4-dinitrophenyl (DNP)). Other fluorophores and attendant
excitation and emission wavelengths are described in Anantha, et
al., Biochemistry (1998) 37:2709-2714 and Qu & Chaires, Methods
Enzymol (2000) 321:353-369).
[0149] In an embodiment, a primer oligonucleotide covalently linked
to a fluorescent label is contacted with template DNA. The
resulting complex is contacted with a test molecule and then
contacted with a polymerase capable of extending the primer. The
reaction products then are separated and detected by capillary
electrophoresis. A longer primer sequence was used for practicing
this embodiment as compared to embodiments where the primer
includes no covalently-linked fluorophore or where capillary
electrophoresis is not utilized for separation. Deoxynucleotides
are added at any stage of the assay before the separation, often
when the primer is contacted with the template DNA. The template
DNA/primer complex often is denatured (e.g., by increasing the
temperature of the system) and then renatured (e.g., by cooling the
system) before a test compound is added).
Quadruplex Binding Assay
[0150] Generally, a 5'-fluorescent-labeled (FAM) primer (P45, 15
nM) was mixed with template DNA (15 nM) in a Tris-HCL buffer (15 mM
Tris, pH 7.5) containing 10 mM MgCl.sub.2, 0.1 mM EDTA and 0.1 mM
mixed deoxynucleotide triphosphates (dNTP's). In one example, the
FAM-P45 primer (5'-6FAM-AGTCTGACTGACTGTACGTAGCTAATACGACTCACTA
TAGCAATT-3') (SEQ ID NO. 17) and the c-Myc template DNA
(5'-TCCAACTATGTATACT
GGGGAGGGTGGGGAGGGTGGGGAAGGTTAGCGACACGCAATTGCTATAGTGAGTC
GTATTAGCTACGTACAGTCAGTCAGACT-3') (SEQ ID NO. 18) were synthesized
and HPLC purified by Applied Biosystems. The mixture was denatured
at 95.degree. C. for 5 minutes and, after cooling down to room
temperature, was incubated at 37.degree. C. for 15 minutes.
[0151] After cooling down to room temperature, 1 mM KCl.sub.2 and
the test compound (various concentrations) were added and the
mixture incubated for 15 minutes at room temperature. The primer
extension was performed by adding 10 mM KCl and Taq DNA Polymerase
(2.5 U/reaction, Promega) and incubating at 70.degree. C. for 30
minutes. The reaction was stopped by adding 1 .mu.l of the reaction
mixture to 10 .mu.l Hi-Di Formamide mixed and 0.25 .mu.l LIZ120
size standard. Hi-Di Formamide and LIZ120 size standard were
purchased from Applied Biosystems. The partially extended
quadruplex arrest product was between 61 or 62 bases long and the
full-length extended product was 99 bases long. The products were
separated and analyzed using capillary electrophoresis. Capillary
electrophoresis was performed using an ABI PRISM 3100-Avant Genetic
Analyzer. The assay was performed using compounds described above,
and .mu.M concentrations reported in Table 1 (Tables 1A-1F) are
concentrations at which 50% of the DNA was arrested in the assay
(i.e., the ratio of shorter partially extended DNA (arrested DNA)
to full-length extended DNA is 1:1).
Transcription Reporter Assay
[0152] In a transcription reporter assay, test quadruplex DNA is
coupled to a reporter system, such that a formation or
stabilization of a quadruplex structure can modulate a reporter
signal. An example of such a system is a reporter expression system
in which a polypeptide, such as luciferase or green fluorescent
protein (GFP), is expressed by a gene operably linked to the
potential quadruplex forming nucleic acid and expression of the
polypeptide can be detected. As used herein, the term "operably
linked" refers to a nucleotide sequence which is regulated by a
sequence comprising the potential quadruplex forming nucleic acid.
A sequence may be operably linked when it is on the same nucleic
acid as the quadruplex DNA, or on a different nucleic acid. An
exemplary luciferase reporter system is described herein.
[0153] A luciferase promoter assay described in He, et al., Science
(1998) 281:1509-1512 often is utilized for the study of quadruplex
formation. Specifically, a vector utilized for the assay is set
forth in reference 11 of the He, et al., document. In this assay,
HeLa cells are transfected using the lipofectamin 2000-based system
(Invitrogen) according to the manufacturer's protocol, using 0.1
.mu.g of pRL-TK (Renilla luciferase reporter plasmid) and 0.9 .mu.g
of the quadruplex-forming plasmid. Firefly and Renilla luciferase
activities are assayed using the Dual Luciferase Reporter Assay
System (Promega) in a 96-well plate format according to the
manufacturer's protocol.
Circular Dichroism Assay
[0154] Circular dichroism (CD) is utilized to determine whether
another molecule interacts with a quadruplex nucleic acid. CD is
particularly useful for determining whether a PNA or PNA-peptide
conjugate hybridizes with a quadruplex nucleic acid in vitro. PNA
probes are added to quadruplex DNA (5 .mu.M each) in a buffer
containing 10 mM potassium phosphate (pH 7.2) and 10 or 250 mM KCl
at 37.degree. C. and then allowed to stand for 5 minutes at the
same temperature before recording spectra. CD spectra are recorded
on a Jasco J-715 spectropolarimeter equipped with a
thermoelectrically controlled single cell holder. CD intensity
normally is detected between 220 nm and 320 nm and comparative
spectra for quadruplex DNA alone, PNA alone, and quadruplex DNA
with PNA are generated to determine the presence or absence of an
interaction (see, e.g., Datta, et al., JACS (2001) 123:9612-9619).
Spectra are arranged to represent the average of eight scans
recorded at 100 nm/min.
Fluorescence Binding Assay
[0155] An example of a fluorescence binding assay is a system that
includes a quadruplex nucleic acid, a signal molecule, and a test
molecule. The signal molecule generates a fluorescent signal when
bound to the quadruplex nucleic acid (e.g., N-methylmesoporphyrin
IX (NMM)), and the signal is altered when a test compound competes
with the signal molecule for binding to the quadruplex nucleic
acid. An alteration in the signal when test molecule is present as
compared to when test compound is not present identifies the test
compound as a quadruplex interacting compound.
[0156] 50 .mu.l of quadruplex nucleic acid or a nucleic acid not
capable of forming a quadruplex is added in 96-well plate. A test
compound also is added in varying concentrations. A typical assay
is carried out in 100 .mu.l of 20 mM HEPES buffer, pH 7.0, 140 mM
NaCl, and 100 mM KCl. 50 .mu.l of the signal molecule NMM then is
added for a final concentration of 3 .mu.M. NMM is obtained from
Frontier Scientific Inc, Logan, Utah. Fluorescence is measured at
an excitation wavelength of 420 nm and an emission wavelength of
660 nm using a FluoroStar 2000 fluorometer (BMG Labtechnologies,
Durham, N.C.). Fluorescence often is plotted as a function of
concentration of the test compound or quadruplex-targeted nucleic
acid and maximum fluorescent signals for NMM are assessed in the
absence of these molecules.
Cell Proliferation Assay
[0157] In a cancer cell proliferation assay, cell proliferation
rates are assessed as a function of different concentrations of
test compounds added to the cell culture medium. Any cancer cell
type can be utilized in the assay. In one embodiment, colon cancer
cells are cultured in vitro and test compounds are added to the
culture medium at varying concentrations. A useful colon cancer
cell line is colo320, which is a colon adenocarcinoma cell line
deposited with the National Institutes of Health as accession
number JCRB0225. Parameters for using such cells are available at
the http address cellbank.nihs.go.jp/cell/data/jcrb0225.htm.
[0158] Formulation of Compounds
[0159] As used herein, the term "pharmaceutically acceptable salts,
esters and amides" includes but are not limited to carboxylate
salts, amino acid addition salts, esters and amides of the
compounds, as well as the zwitterionic forms thereof, which are
known to those skilled in the art as suitable for use with humans
and animals. (See, e.g., Gerge, S. M., et al., "Pharmaceutical
Salts," J. Pharm. Sci. (1977) 66:1-19, which is incorporated herein
by reference.)
[0160] Any suitable formulation of the compounds described herein
can be prepared. In cases where compounds are sufficiently basic or
acidic to form stable nontoxic acid or base salts, administration
of the compounds as salts may be appropriate. Examples of
pharmaceutically acceptable salts are organic acid addition salts
formed with acids that form a physiological acceptable anion, for
example, tosylate, methanesulfonate, acetate, citrate, malonate,
tartarate, succinate, benzoate, ascorbate, .alpha.-ketoglutarate,
and .alpha.-glycerophosphate. Suitable inorganic salts may also be
formed, including hydrochloride, sulfate, nitrate, bicarbonate, and
carbonate salts. Pharmaceutically acceptable salts are obtained
using standard procedures well known in the art. For example,
pharmaceutically acceptable salts may be obtained by reacting a
sufficiently basic compound such as an amine with a suitable acid
affording a physiologically acceptable anion. Alkali metal (e.g.,
sodium, potassium or lithium) or alkaline earth metal (e.g.,
calcium) salts of carboxylic acids also are made.
[0161] A compound may be formulated as a pharmaceutical composition
and administered to a mammalian host in need of such treatment. In
one embodiment, the mammalian host is human. Any suitable route of
administration may be used, including but not limited to oral,
parenteral, intravenous, intramuscular, topical and subcutaneous
routes.
[0162] In one embodiment, a compound is administered systemically
(e.g., orally) in combination with a pharmaceutically acceptable
vehicle such as an inert diluent or an assimilable edible carrier.
They may be enclosed in hard or soft shell gelatin capsules,
compressed into tablets, or incorporated directly with the food of
the patient's diet. For oral therapeutic administration, the active
compound may be combined with one or more excipients and used in
the form of ingestible tablets, buccal tablets, troches, capsules,
elixirs, suspensions, syrups, wafers, and the like. Such
compositions and preparations should contain at least 0.1% of
active compound. The percentage of the compositions and
preparations may be varied and may conveniently be between about 2
to about 60% of the weight of a given unit dosage form. The amount
of active compound in such therapeutically useful compositions is
such that an effective dosage level will be obtained.
[0163] Tablets, troches, pills, capsules, and the like also may
contain the following: binders such as gum tragacanth, acacia, corn
starch or gelatin; excipients such as dicalcium phosphate; a
disintegrating agent such as corn starch, potato starch, alginic
acid and the like; a lubricant such as magnesium stearate; and a
sweetening agent such as sucrose, fructose, lactose or aspartame or
a flavoring agent such as peppermint, oil of wintergreen, or cherry
flavoring may be added. When the unit dosage form is a capsule, it
may contain, in addition to materials of the above type, a liquid
carrier, such as a vegetable oil or a polyethylene glycol. Various
other materials may be present as coatings or to otherwise modify
the physical form of the solid unit dosage form. For instance,
tablets, pills, or capsules may be coated with gelatin, wax,
shellac or sugar and the like. A syrup or elixir may contain the
active compound, sucrose or fructose as a sweetening agent, methyl
and propylparabens as preservatives, a dye and flavoring such as
cherry or orange flavor. Any material used in preparing any unit
dosage form is pharmaceutically acceptable and substantially
non-toxic in the amounts employed. In addition, the active compound
may be incorporated into sustained-release preparations and
devices.
[0164] The active compound also may be administered intravenously
or intraperitoneally by infusion or injection. Solutions of the
active compound or its salts may be prepared in a buffered
solution, often phosphate buffered saline, optionally mixed with a
nontoxic surfactant. Dispersions can also be prepared in glycerol,
liquid polyethylene glycols, triacetin, and mixtures thereof and in
oils. Under ordinary conditions of storage and use, these
preparations contain a preservative to prevent the growth of
microorganisms. The compound is sometimes prepared as a
polymatrix-containing formulation for such administration (e.g., a
liposome or microsome). Liposomes are described for example in U.S.
Pat. No. 5,703,055 (Felgner, et al.) and Gregoriadis, Liposome
Technology vols. I to III (2nd ed. 1993).
[0165] The pharmaceutical dosage forms suitable for injection or
infusion can include sterile aqueous solutions or dispersions or
sterile powders comprising the active ingredient that are adapted
for the extemporaneous preparation of sterile injectable or
infusible solutions or dispersions, optionally encapsulated in
liposomes. In all cases, the ultimate dosage form should be
sterile, fluid and stable under the conditions of manufacture and
storage. The liquid carrier or vehicle can be a solvent or liquid
dispersion medium comprising, for example, water, ethanol, a polyol
(for example, glycerol, propylene glycol, liquid polyethylene
glycols, and the like), vegetable oils, nontoxic glyceryl esters,
and suitable mixtures thereof. The proper fluidity can be
maintained, for example, by the formation of liposomes, by the
maintenance of the particle size in the case of dispersions or by
the use of surfactants. The prevention of the action of
microorganisms can be brought about by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
sorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars, buffers
or sodium chloride. Prolonged absorption of the injectable
compositions can be brought about by the use in the compositions of
agents delaying absorption, for example, aluminum monostearate and
gelatin.
[0166] Sterile injectable solutions are prepared by incorporating
the active compound in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required, followed by filter sterilization. In the case of sterile
powders for the preparation of sterile injectable solutions, the
preferred methods of preparation are vacuum drying and the freeze
drying techniques, which yield a powder of the active ingredient
plus any additional desired ingredient present in the previously
sterile-filtered solutions.
[0167] For topical administration, the present compounds may be
applied in liquid form. Compounds often are administered as
compositions or formulations, in combination with a
dermatologically acceptable carrier, which may be a solid or a
liquid. Examples of useful dermatological compositions used to
deliver compounds to the skin are known (see, e.g., Jacquet, et al.
(U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith,
et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No.
4,820,508).
[0168] Compounds may be formulated with a solid carrier, which
include finely divided solids such as talc, clay, microcrystalline
cellulose, silica, alumina and the like. Useful liquid carriers
include water, alcohols or glycols or water-alcohol/glycol blends,
in which the present compounds can be dissolved or dispersed at
effective levels, optionally with the aid of non-toxic surfactants.
Adjuvants such as fragrances and additional antimicrobial agents
can be added to optimize the properties for a given use. The
resultant liquid compositions can be applied from absorbent pads,
used to impregnate bandages and other dressings, or sprayed onto
the affected area using pump-type or aerosol sprayers. Thickeners
such as synthetic polymers, fatty acids, fatty acid salts and
esters, fatty alcohols, modified celluloses or modified mineral
materials can also be employed with liquid carriers to form
spreadable pastes, gels, ointments, soaps, and the like, for
application directly to the skin of the user.
[0169] Generally, the concentration of the compound in a liquid
composition often is from about 0.1 wt % to about 25 wt %,
sometimes from about 0.5 wt % to about 10 wt %. The concentration
in a semi-solid or solid composition such as a gel or a powder
often is about 0.1 wt % to about 5 wt %, sometimes about 0.5 wt %
to about 2.5 wt %. A compound composition may be prepared as a unit
dosage form, which is prepared according to conventional techniques
known in the pharmaceutical industry. In general terms, such
techniques include bringing a compound into association with
pharmaceutical carrier(s) and/or excipient(s) in liquid form or
finely divided solid form, or both, and then shaping the product if
required.
[0170] Table 3 shows various formulations which may be used with
compounds described herein. For example, a compound may be
formulated having dosages from 10 mg/mL to 20 mg/mL solution, using
the formulations herein. In Table 3, the designation "D5W" refers
to deionized water with 5% dextrose. Each component in each
formulation may be varied without affecting the activity of the
compound. In one example, the compound is formulated in a solution
comprising polyethylene glycol and propylene glycol in a buffer
solution such as a phosphate buffer.
TABLE-US-00009 TABLE 3 pH of the Compound (mL) + pH of the
formulated % Placebo Placebo solution Formulations (w/w) solution
(mL) solution (10 mg/mL) 1. Mannitol 4 35 ml + 35 mL 6.1 6.1
Sucrose 0.5 5% D5W solution 95.5 2. Mannitol 4 35 ml + 35 mL 6 5.8
50 mM PO.sub.4 buffer, pH = 6.0 96 3. Mannitol 4 35 ml + 35 mL 5 5
50 mM Citrate buffer, pH = 5.0 96 4. Mannitol 4 35 ml + 35 mL 6 6
5% D5W 96 5. Test compound (20 mg/mL) 1 35 ml + 35 mL 6.4 6.1 5%
D5W 99 6. PEG 300 7 5 ml + 5 mL N/A 5.80 Propylene glycol 9 5% D5W
84 7. PEG 300 7 5 ml + 5 mL N/A 5.8 Propylene glycol 9 50 mM
PO.sub.4 buffer, pH = 6.0 84 8. Mannitol 4 5 ml + 5 mL N/A 5.7 PEG
300 20 50 mM PO.sub.4 buffer, pH = 6.0 76 9. Mannitol 4 5 ml + 5 mL
N/A 5.8 Propylene glycol 10 50 mM PO.sub.4 buffer, pH = 6.0 86
[0171] The compound composition may be formulated into any dosage
form, such as tablets, capsules, gel capsules, liquid syrups, soft
gels, suppositories, and enemas. The compositions also may be
formulated as suspensions in aqueous, non-aqueous, or mixed media.
Aqueous suspensions may further contain substances which increase
viscosity, including for example, sodium carboxymethylcellulose,
sorbitol, and/or dextran. The suspension may also contain one or
more stabilizers.
[0172] The amount of the compound, or an active salt or derivative
thereof, required for use in treatment will vary not only with the
particular salt selected but also with the route of administration,
the nature of the condition being treated and the age and condition
of the patient and will be ultimately at the discretion of the
attendant physician or clinician.
[0173] Dosages
[0174] A useful compound dosage often is determined by assessing
its in vitro activity in a cell or tissue system and/or in vivo
activity in an animal system. For example, methods for
extrapolating an effective dosage in mice and other animals to
humans are known to the art (see, e.g., U.S. Pat. No. 4,938,949).
Such systems can be used for determining the LD.sub.50 (the dose
lethal to 50% of the population) and the ED.sub.50 (the dose
therapeutically effective in 50% of the population) of a compound.
The dose ratio between a toxic and therapeutic effect is the
therapeutic index and it can be expressed as the ratio
ED.sub.50/LD.sub.50. The compound dosage often lies within a range
of circulating concentrations for which the ED.sub.50 is associated
with little or no toxicity. The dosage may vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any compounds used in the methods
described herein, the therapeutically effective dose can be
estimated initially from cell culture assays. A dose sometimes is
formulated to achieve a circulating plasma concentration range
covering the IC.sub.50 (i.e., the concentration of the test
compound which achieves a half-maximal inhibition of symptoms) as
determined in in vitro assays, as such information often is used to
more accurately determine useful doses in humans. Levels in plasma
may be measured, for example, by high performance liquid
chromatography.
[0175] Another example of effective dose determination for a
subject is the ability to directly assay levels of "free" and
"bound" compound in the serum of the test subject. Such assays may
utilize antibody mimics and/or "biosensors" generated by molecular
imprinting techniques. The compound is used as a template, or
"imprinting molecule", to spatially organize polymerizable monomers
prior to their polymerization with catalytic reagents. Subsequent
removal of the imprinted molecule leaves a polymer matrix which
contains a repeated "negative image" of the compound and is able to
selectively rebind the molecule under biological assay conditions
(see, e.g., Ansell, et al., Current Opinion in Biotechnology (1996)
7:89-94 and in Shea, Trends in Polymer Science (1994)
2:166-173).
[0176] Such "imprinted" affinity matrixes are amenable to
ligand-binding assays, whereby the immobilized monoclonal antibody
component is replaced by an appropriately imprinted matrix (see,
e.g., Vlatakis, et al., Nature (1993) 361:645-647). Through the use
of isotope-labeling, "free" concentration of compound can be
readily monitored and used in calculations of IC.sub.50. Such
"imprinted" affinity matrixes can also be designed to include
fluorescent groups whose photon-emitting properties measurably
change upon local and selective binding of compound. These changes
can be readily assayed in real time using appropriate fiberoptic
devices, in turn allowing the dose in a test subject to be quickly
optimized based on its individual IC.sub.50. An example of such a
"biosensor" is discussed in Kriz, et al., Analytical Chemistry
(1995) 67:2142-2144.
[0177] Exemplary doses include milligram or microgram amounts of
the compound per kilogram of subject or sample weight, for example,
about 1 microgram per kilogram to about 500 milligrams per
kilogram, about 100 micrograms per kilogram to about 5 milligrams
per kilogram, or about 1 microgram per kilogram to about 50
micrograms per kilogram. It is understood that appropriate doses of
a small molecule depend upon the potency of the small molecule with
respect to the expression or activity to be modulated. When one or
more of these small molecules is to be administered to an animal
(e.g., a human) in order to modulate expression or activity of a
polypeptide or nucleic acid described herein, a physician,
veterinarian, or researcher may, for example, prescribe a
relatively low dose at first, subsequently increasing the dose
until an appropriate response is obtained. In addition, it is
understood that the specific dose level for any particular animal
subject will depend upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, gender, and diet of the subject, the time of
administration, the route of administration, the rate of excretion,
any drug combination, and the degree of expression or activity to
be modulated.
[0178] The following examples are offered to illustrate but not to
limit the invention.
EXAMPLES
[0179] The following are exemplary procedures for synthesizing
substituted quinobenzoxazines analogs.
Example 1
##STR00275##
[0181] Phenoxazine carboxylic acid (655 mg, 0.846 mmol) was
suspended in NMP (5 ml) and diisopropylethylamine (0.22 ml, 1.26
mmol). HBTU (481 mg, 1.268 mmol) was then added whilst maintaining
the temperature below 10.degree. C. After stirring for 1 h
anhydrous ammonia gas was bubbled into the reaction for
approximately 20 mins. The reaction was then stirred overnight,
followed by quenching with water. The resulting mixture was
extracted with dichloromethane (3.times.50 ml) which was dried and
evaporated to yield the amide (300 mg, 42%).
Example 2
##STR00276##
[0183] The amide (283 mg, 0.738 mmol) was suspended in anhydrous
NMP and diisopropylethylamine (0.19 ml, 1.2 mmol) was added.
2-Pyrazinepyrrolidine (165 mg, 1.1 mmol) was then added and the
reaction heated at 100.degree. C. for 5 h. A further 230 mg of
2-pyrazinepyrrolidine was then added and the reaction heated and
stirred overnight. Addition of water to the reaction yielded a
crude solid that was further purified by flash chromatography
(SiO.sub.2, 2% MeOH in dichloromethane) to yield 54 mg of the
pyrazine amide.
Example 3
##STR00277##
[0185] The pyrazine substituted annulated phenoxazine (53 mg,
0.1028 mmol), 2-aminoethylpyrrolidine (132 mg, 1.03 mmol) and
aluminum chloride (51 mg, 0.255 mmol) were added to dichloromethane
(1 ml) and stirred at room temperature under argon for 3 h. The
mixture was then evaporated to a residue and was then washed with
saturated aqueous sodium potassium tartaric acid. The resulting
mixture was extracted with 3.times.10 ml dichloromethane and the
extracts dried (Na.sub.2SO.sub.4) and evaporated. The compound was
then isolated using preparative thin layer chromatography
(Al.sub.2O.sub.3, 3% MeOH in dichloromethane) to yield the pyrazine
pyrrolidine amide (30 mg, 50%) as a yellow solid.
Example 4
##STR00278##
[0187] To a 250 mL roundbottom flask was added the
tetrafluoroketoester (20.0 g, 75.8 mmol), triethylorthoformate
(17.2 mL, 113.6 mmol) and acetic anhydride (14.3 mL, 151.6 mmol)
and the reaction mixture was heated to 145.degree. C. for 2 hours.
The reaction was allowed to cool to room temperature and placed on
high vacuum (ca 0.5 mm Hg) for 1 hour. The resulting oil was
dissolved in ethanol (200 mL) and 2-amino-4-chlorophenol (12.0 g,
83.4 mmol) was added at room temperature and the solution became
briefly clear and then product began to precipitate. The reaction
was allowed to stir for 4 hours and was then filtered and washed
with ethanol (200 mL) to afford the enamine as a yellow solid (22.0
g, 52.8 mmol).
Example 5
##STR00279##
[0189] To a solution of the enamine (22.0 g, 52.8 mmol) in dry DMF
(100 mL) was added potassium carbonate (8.4 g, 60.7 mmol) and the
mixture was heated to 120.degree. C., with constant stirring, for 2
hours. The mixture was allowed to cool to room temperature without
stirring and was allowed to remain at room temperature for an
additional hour. The crystalline solid was collected by filtration,
washing with water. Recrystallization from THF afforded the
difluoroester as a white crystalline solid (20.71 g).
Example 6
##STR00280##
[0191] Difluoroester (244 mg, 0.646 mmol) in anhydrous
dimethylacetamide (2 ml) was freeze thawed under nitrogen and then
zinc powder (200 mesh, 10 mg, 0.153 mg) and zinc cyanide (46 mg,
0.392 mmol) added, followed by Pd.sub.2(DBA).sub.3 (10 mg). The
reaction was stirred for 16 h and then a second batch of zinc (10
mg) and zinc cyanide (46 mg) was then added. The resulting mixture
was heated to 160.degree. C. for 6 h. The reaction was then cooled,
diluted with ethyl acetate and filtered through a celite pad.
Evaporation of the ethyl acetate followed by flash chromatography
(SiO.sub.2, 5% MeOH in dichloromethane) yielded the nitrile (38 mg)
as a brown solid.
Example 7
##STR00281##
[0193] The nitrile (55 mg, 0.1423 mmol) was suspended in anhydrous
NMP (1 ml) and diisopropylethylamine (0.30 ml, 0.172 mmol) added.
2-Pyrazinepyrrolidine (17 mg, 0.114 mmol) was then added and the
reaction heated at 100.degree. C. for 5 h. Addition of water
yielded a crude solid that was further purified by flash
chromatography (SiO.sub.2, 2% MeOH) in dichloromethane to yield 25
mg of the pyrazine nitrile
Example 8
##STR00282##
[0195] The pyrazine nitrile (94 mg, 0.19 mmol),
2-(aminoethyl)-1-methlypyrrolidine (41 uL, 0.19 mmol) and aluminum
chloride (17 mg, 0.13 mmol) were added to dichloromethane (2 ml)
and stirred at room temperature under argon for 16 h. The mixture
was then evaporated to a residue which was washed with saturated
aqueous sodium potassium tartaric acid. The mixture was then
extracted with 3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in dichloromethane) to yield the methylpyrazine nitrile 24 mg
as a yellow solid.
Example 9
##STR00283##
[0197] The pyrazine nitrile (91 mg, 0.18 mmol),
2-(aminoethyl)pyrrolidine (35 uL, 0.28 mmol) and aluminum chloride
(37 mg, 0.28 mmol) were added to dichloromethane (2 ml) and stirred
at room temperature under argon for 16 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was then extracted with
dichloromethane (3.times.10 ml) and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in dichloromethane) to yield the pyrazine nitrile (48 mg) as a
yellow solid.
Example 10
##STR00284##
[0199] The nitrile (204 mg, 0.06 mmol) was suspended in anhydrous
NMP (1 ml) and diisopropylethylamine (0.30 ml, 0.172 mmol) was
added. 2-BOC aminopyrrolidine (75 mg, 0.114 mmol) was then added
and the reaction heated at 100.degree. C. for 5 h. Addition of
water yielded a crude solid that was further purified by flash
chromatography (SiO.sub.2, 2% MeOH) in dichloromethane to yield 125
mg of the BOC nitrile.
Example 11
##STR00285##
[0201] The BOC nitrile (132 mg, 0.18 mmol), 2-morpholinoethylamine
(50 uL, 0.28 mmol) and aluminum chloride (37 mg, 0.28 mmol) were
added to dichloromethane (2 ml) and stirred at room temperature
under argon for 16 h. The mixture was then evaporated to a residue
which was washed with saturated aqueous sodium potassium tartaric
acid. The mixture was then extracted with 3.times.10 ml
dichloromethane and the extracts dried (Na.sub.2SO.sub.4) and
evaporated. The mixture was the dissolved in trifluoroacetic acid
(0.5 ml), stirred for 0.5 h then blown to a residue. The compound
was then isolated using preparative thin layer chromatography
(Al.sub.2O.sub.3, 3% MeOH in dichloromethane) to yield the
aminopyrrolidine nitrile (48 mg) as a yellow solid.
Example 12
##STR00286##
[0203] The nitrile (204 mg, 0.06 mmol) was suspended in anhydrous
NMP (1 ml) and diisopropylethylamine (0.30 ml, 0.172 mmol) was
added. 2-Isopropylpiperidine (75 mg, 0.114 mmol) was then added and
the reaction heated at 100.degree. C. for 5 h. Addition of water
yielded a crude solid that was further purified by flash
chromatography (SiO.sub.2, 2% MeOH) in dichloromethane to yield 155
mg of the isopropyl nitrile.
Example 13
##STR00287##
[0205] The isopropyl nitrile (126 mg, 0.18 mmol),
2-(aminoethyl)pyrrolidine (35 uL, 0.28 mmol) and aluminum chloride
(37 mg, 0.28 mmol) were added to dichloromethane (2 ml) and stirred
at room temperature under argon for 16 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was then extracted with
3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in dichloromethane) to yield the isopropyl pyrrolidine
nitrile, 76 mg as a yellow solid.
Example 14
##STR00288##
[0207] Ethylmalonate potassium salt (9.94 g, 58 mmol) was suspended
in acetonitrile, under argon, and cooled with stirring to 5.degree.
C. Magnesium chloride (7.58 g, 79.6 mmol) was then added in
portions, maintaining the temperature between 5-10.degree. C., and
stirred for a further 0.5 h before 2,3,4-trifluorobenzoyl chloride
(10.33 g, 53.1 mmol) in acetonitrile (20 ml) was added. The
reaction was then stirred for a further 5 mins. and triethylamine
(14.8 ml, 106 mmol) was added dropwise, so as to maintain a
temperature of 5-10.degree. C. The reaction was then allowed to
warm to room temperature and stirred for a further two hours before
quenching with 2M HCl (175 ml). The resulting mixture was extracted
with toluene (2.times.250 ml) and the extracts were then evaporated
to yield the keto ester (12.79 g, 98%) which was used without
further purification.
##STR00289##
[0208] Crude keto ester (5.3 g, 21.5 mmol), triethylorthoformate
(5.4 ml, 32.5 mmol) and acetic anhydride (4.1 ml, 43.4 mmol) were
mixed and heated to reflux for 2 h. The reaction was then cooled
and evaporated to yield the vinyl ether as a viscous oil (6.55 g,
100%) which was approximately 80% pure.
##STR00290##
[0209] The vinyl ether (6.45 g, 21.34 mmol) and 3-amino-2-napthol
(3.09 g, 19.41 mmol) were mixed in ethanol (20 ml and stirred at
room temperature for 40 minutes. The resulting mixture was filtered
and the solid washed with EtOH to yield the enamine as a greenish
brown solid (5.52 g, 68% yield) that was approximately 90%
pure.
Example 15
##STR00291##
[0211] The enamine (3.112 g, 7.49 mmol)) was added to DMF (15 ml)
and potassium carbonate (1.24 g, 8.97 mmol) and stirred and heated
to 100.degree. C. for 5 hr. Upon cooling the annulated phenoxazine
crystallized out of the reaction mixture. The reaction was filtered
and the solid was washed with water (50 ml) and then heated in
boiling MeOH. The resulting thick slurry was cooled and filtered to
yield a tan solid (1.77 g, 63%).
Example 16
##STR00292##
[0213] 2-Pyrazine-ethanol (0.35 ml, 2.85 mmol), annulated
phenoxazine (214 mg, 0.57 mmol), potassium carbonate (158 mg, 1.143
mmol) and NMP (1 ml) were mixed and heated at 100.degree. C. for 1
h. The reaction was then quenched in water and stirred overnight
which yielded a crude solid. Flash chromatography of the solid
(SiO2, 2% MeOH in Dichloromethane) yielded 91 mg (32%) of the
pyrazine substituted annulated phenoxazine as a yellow solid.
Example 17
##STR00293##
[0215] The pyrazine substituted annulated phenoxazine (43 mg,
0.08677 mmol), 2-(aminoethyl)-1-methlypyrrolidine (20 uL, 0.138
mmol) and aluminum chloride (17 mg, 0.13 mmol) were added to
dichloromethane (1 ml) and stirred at room temperature under argon
for 16 h. A further 20 mg of aluminum chloride was then added and
the mixture stirred for a further 6 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was then extracted with
3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in dichloromethane) to yield the pyrazine methylpyrrolidine
(20 mg, 40%) as a yellow solid.
Example 18
##STR00294##
[0217] The pyrazine substituted annulated phenoxazine (37 mg,
0.07466 mmol), 2-aminoethylpyrrolidine (15 uL, 0.118 mmol) and
aluminum chloride (20 mg, 0.15 mmol) were added to dichloromethane
(1 ml) and stirred at room temperature under argon for 16 h. The
mixture was then evaporated to a residue which was washed with
saturated aqueous sodium potassium tartaric acid. The mixture was
then extracted with 3.times.10 ml dichloromethane and the extracts
dried (Na.sub.2SO.sub.4) and evaporated. The compound was then
isolated using preparative thin layer chromatography
(Al.sub.2O.sub.3, 3% MeOH in dichloromethane) to yield the pyrazine
pyrrolidine (21 mg, 50%) as a yellow solid.
Example 19
##STR00295##
[0219] The annulated phenoxazine (218 mg, 0.581 mmol) 2-pyrazine
ethanol (0.5 ml, 4.07 mmol), potassium carbonate (400 mg, 2.9 mmol)
in 1 ml of anhydrous NMP were mixed and heated for 5.5 h at
100.degree. C. The reaction was then quenched in water and
extracted with dichloromethane (3.times.10 ml). The extract was
evaporated and purified by flash chromatography (SiO.sub.2, 1% MeOH
in dichloromethane) to yield 24 mg (11%) of the thiol as a yellow
solid.
Example 20
##STR00296##
[0221] The thiol (21 mg, 0.054 mmol), benzyl bromide (8 uL, 0.07
mmol) and triethylamine (10 ul, 0.072 mmol) were added to anhydrous
dichloromethane (1.5 ml) and stirred for 6 h at room temperature.
The mixture was then quenched with water, and the organics
extracted with dichloromethane (3.times.10 ml) and evaporated to a
residue. Preparative thin layer chromatography (SiO.sub.2, 1% MeOH
in dichloromethane) yielded the benzyl phenoxazine (20 mg, 80%) as
a yellow solid.
Example 21
##STR00297##
[0223] Benzyl phenoxazine (20 mg, 0.0417 mmol),
2-(2-aminoethyl)-1-methylpyrrolidine (12 ul, 0.083 mmol) and
aluminum chloride (11 mg, 0.0825 mmol) were mixed in anhydrous
dichloromethane (1 ml) and stirred for 1 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was then extracted with
3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was isolated using
preparative thin layer chromatography (Al.sub.2O.sub.3, 3% MeOH in
Dichloromethane) to yield the benzyl methylpyrrolidine (18 mg, 77%)
as a yellow solid.
Example 22
##STR00298##
[0225] The thiol (35 mg, 0.09 mmol),
3-(chloromethyl)-5-methylisoxazole (14 mg, 0.106 mmol) and
triethylamine (5 ul, 0.1076 mmol) were added to anhydrous
dichloromethane (1.5 ml) and stirred for 6 h at room temperature.
The mixture was quenched with water, the organics extracted with
dichloromethane (3.times.10 ml) and evaporated to a residue.
Preparative thin layer chromatography (SiO2, 1% MeOH in
dichloromethane) yielded the isoxazole phenoxazine (19 mg, 37%) as
a yellow solid.
Example 23
##STR00299##
[0227] Isoxazole phenoxazine (14 mg, 0.1181 mmol),
2-(2-aminoethyl)-1-methylpyrrolidine (20 ul, 0.138 mmol) and
aluminum chloride (25 mg, 0.1874 mmol) were mixed in anhydrous
dichloromethane (1 ml) and stirred for 1 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was extracted with
3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in Dichloromethane) to yield the isoxazole methylpyrrolidine
(19 mg, 77%) as a yellow solid.
Example 24
##STR00300##
[0229] The thiol (32 mg, 0.127 mmol), 4-bromomethylpyridine
hydrobromide (40 mg, 0.106 mmol) and triethylamine (32 ul, 0.2296
mmol) were added to anhydrous dichloromethane (1.5 ml) and stirred
for 6 h at room temperature. The mixture was quenched with water,
the organics extracted with dichloromethane (3.times.10 ml) and
evaporated to a residue. Preparative thin layer chromatography
(SiO.sub.2, 1% MeOH in dichloromethane) yielded the 4-pyridinyl
phenoxazine (13 mg, 22%) as a yellow solid.
Example 25
##STR00301##
[0231] 4-Pyridinyl phenoxazine (13 mg, 0.1181 mmol),
2-(2-aminoethyl)-1-methylpyrrolidine (22 ul, 0.1518 mmol) and
aluminum chloride (27 mg, 0.2025 mmol) were mixed in anhydrous
dichloromethane (1 ml) and stirred for 1 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was then extracted with
3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in dichloromethane) to yield the 4-pyridinyl methylpyrrolidine
(11 mg) as a yellow solid.
Example 26
##STR00302##
[0233] The thiol (30 mg, 0.127 mmol), 2-bromomethylpyridine
hydrobromide (24 mg, 0.077 mmol) and triethylamine (24 ul, 0.179
mmol) were added to anhydrous dichloromethane (1.5 ml) and stirred
for 6 h at room temperature. The mixture was quenched with water,
the organics extracted with dichloromethane (3.times.10 ml) and
evaporated to a residue. Preparative thin layer chromatography
(SiO2, 1% MeOH in dichloromethane) yielded the 2-pyridinyl
phenoxazine (28 mg, 69%) as a yellow solid.
Example 27
##STR00303##
[0235] 2-Pyridinyl phenoxazine (28 mg),
2-(2-aminoethyl)-1-methylpyrrolidine (17 ul, 0.1173 mmol) and
aluminum chloride (21 mg, 0.1575 mmol) were mixed in anhydrous
dichloromethane (1 ml) and stirred for 1 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was then extracted with
3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in dichloromethane) to yield the 2-pyridinyl methylpyrrolidine
(17.5 mg) as a yellow solid.
Example 28
##STR00304##
[0237] The vinyl ether (3.2 g, 10 mmol) and 3-amino-2-phenol (1.09
g, 10 mmol) were mixed in ethanol (10 ml) and stirred at room
temperature. The resulting mixture was filtered and the solid
washed with EtOH to yield the benzenl enamine (2.42 g, 72%
yield).
##STR00305##
[0238] The benzyl enamine (2.42 g, 7.49 mmol)) was added to DMF (10
ml) and potassium carbonate (1.24 g, 8.97 mmol) and stirred and
heated to 100.degree. C. for 5 hr. Upon cooling the phenoxazine
crystallized out of the reaction mixture (1.07 g, 63%).
##STR00306##
[0239] 2-Pyrazine-ethanol (0.42 ml, 3.4 mmol), phenoxazine (145 mg,
0.57 mmol), potassium carbonate (158 mg, 1.143 mmol) and NMP (1 ml)
were mixed and heated at 100.degree. C. for 1 h. The reaction was
then quenched in water and stirred overnight which yielded a crude
solid. Flash chromatography (SiO2, 2% MeOH in Dichloromethane)
yielded 182 mg (61%) of the pyrazine substituted phenoxazine as a
yellow solid.
Example 29
##STR00307##
[0241] 2-Pyridinyl phenoxazine (46 mg),
2-(2-aminoethyl)-1-methylpyrrolidine (20 ul, 0.13 mmol) and
aluminum chloride (21 mg, 0.1575 mmol) were mixed in anhydrous
dichloromethane (1 ml) and stirred for 1 h. The mixture was then
evaporated to a residue which was washed with saturated aqueous
sodium potassium tartaric acid. The mixture was then extracted with
3.times.10 ml dichloromethane and the extracts dried
(Na.sub.2SO.sub.4) and evaporated. The compound was then isolated
using preparative thin layer chromatography (Al.sub.2O.sub.3, 3%
MeOH in dichloromethane) to yield the 2-pyridinyl methylpyrollidine
(25 mg) as a yellow solid.
Example 30
##STR00308##
[0243] To a solution of 2,3,4,5-tetrafluorobenzoic acid (100 g, 510
mmol), in methylene chloride (0.5 L) was added oxalyl chloride (68
g, 540 mmol) and DMF (ca 3 drops) and the reaction mixture was
allowed to stir at room temperature overnight allowing for the
produced gasses to escape. The solvent was removed in vacuo and the
vessel was placed on high vacuum (ca 0.5 mm Hg) for 2 hours to
afford the acid chloride as a viscous oil (105 g) and was used in
the subsequent reaction without further purification.
##STR00309##
[0244] To a suspension of potassium ethyl malonate (97 g, 570 mmol)
and magnesium chloride (55 g, 570 mmol) in acetonitrile and the
suspension was chilled to 0.degree. C. To this suspension was added
the crude 2,3,4,5-benzoyl chloride (105 g, 520 mmol) over 5
minutes. Triethylamine was slowly added at a rate sufficient to
keep the reaction temperature below 10.degree. C. and the mixture
was allowed to warm to room temperature and was stirred overnight.
The solvent was removed in vacuo and replaced with toluene (300 mL)
and 1N HCl (500 mL) was added and the mixture was allowed to stir
for 1 hour. The organic layer was separated and washed with 1N HCl
(100 mL) and brine (100 mL) and dried over sodium sulfate,
filtering over a pad of silica gel (50.times.100 mm), eluting with
ethyl acetate. The solvent was removed in vacuo and the resulting
oil was dissolved in ethanol/water (9:1) and was allowed to
crystallize overnight. The resulting crystals were Isolated by
filtration, washing with ethanol/water (8:2) to afford the
ketoester (43.75 g, 166 mmol) as a white crystalline solid.
##STR00310##
[0245] To a 250 mL roundbottom flask was added the
tetrafluoroketoester (10.0 g, 37.9 mmol), triethylorthoformate (8.6
mL, 56.8 mmol) and acetic anhydride (7.15 mL, 75.8 mmol) and the
reaction mixture was heated to 145.degree. C. for 2 hours. The
reaction was allowed to cool to room temperature and placed on high
vacuum (ca 0.5 mm Hg) for 1 hour. The resulting oil was dissolved
in ethanol (100 mL) and 2-amino-5-chlorophenol (5.98 g, 41.7 mmol)
was added at room temperature and the solution became briefly clear
and then product began to precipitate. The reaction was allowed to
stir for 4 hours and was then filtered and washed with ethanol (100
mL) to afford the enamine as a yellow solid (12.45 g, 29.9
mmol).
Example 31
##STR00311##
[0247] To a solution of the enamine (12.45 g, 29.9 mmol) in dry DMF
(50 mL) was added potassium carbonate (4.94 g, 1.1 eq.) and the
mixture was heated to 120.degree. C., with constant stirring, for 2
hours. The mixture was allowed to cool to room temperature without
stirring and was allowed to remain at room temperature for an
additional hour. The crystalline solid was collected by filtration,
washing with water. Recrystallization from THF afforded the
difluoroester as a white crystalline solid (11.38 g).
Example 32
##STR00312##
[0249] To a solution of the difluoroester (2.0 g, 5.3 mmol) in
methylene chloride (10 mL) was added 1-(2-aminoethyl)pyrrolidine
(0.79 g, 6.9 mmol) followed by aluminum chloride (1.05 g, 8.0
mmol). The reaction mixture was allowed to stir at room temperature
for 1 hour then quenched with a concentrated solution of potassium
sodium tartrate (25 mL) and 1N NaOH (10 mL), allowing stirring to
continue for an additional hour. The mixture was diluted with
methylene chloride (100 mL) and further extracted 3 times with
methylene chloride (50 mL). The resulting organic layer was dried
over sodium sulfate and concentrated in vacuo. The resulting solid
was triturated from ethyl acetate to afford the amide as a tan
solid (2.0 g, 4.5 mmol).
Example 33
##STR00313##
[0251] To a microwave reactor tube was added the difluoroamide (60
mg, 0.13 mmol), 1-acetylpiperazine (26 mg, 0.2 mmol) and
1-methylpyrrolidine-2-one (0.5 mL) and the mixture was treat with
microwave radiation for 3 minutes (250.degree. C.). The mixture was
allowed to cool to room temperature and purified by mass-directed
liquid chromatography, separating the 6-isomer (2.8 mg) from the
7-isomer (39 mg). The isolated fractions were dried in vacuo to
afford the acetylated piperazine as the TFA salt.
Example 34
##STR00314##
[0253] To a solution of the difluoroester (2.0 g, 5.3 mmol) in
methylene chloride (10 mL) was added 1-(2-aminoethyl)pyrrolidine
(0.79 g, 6.9 mmol) followed by aluminum chloride (1.05 g, 8.0
mmol). The reaction mixture was allowed to stir at room temperature
for 1 hour then quenched with a concentrated solution of potassium
sodium tartrate (25 mL) and 1N NaOH (10 mL), allowing stirring to
continue for an additional hour. The mixture was diluted with
methylene chloride (100 mL) and further extracted 3 times with
methylene chloride (50 mL). The resulting organic layer was dried
over sodium sulfate and concentrated in vacuo. The resulting solid
was triturated from ethyl acetate to afford the amide as a tan
solid (1.85 g, 4.16 mmol).
Example 35
##STR00315##
[0255] To a microwave reactor tube was added the difluoroamide (60
mg, 0.13 mmol), tert-butoxycarbonyl piperazine (38 mg, 0.2 mmol)
and 1-methylpyrrolidine-2-one (0.5 mL) and the mixture was treat
with microwave radiation for 3 minutes (250.degree. C.). The
mixture was allowed to cool to room temperature and purified by
mass-directed liquid chromatography, separating the 6-isomer (0.8
mg) from the 7-isomer (7.9 mg). The isolated fractions were dried
in vacuo to afford the piperazine as the bis-TFA salt.
Example 36
##STR00316##
[0257] To a solution of the difluoroester (2.0 g, 5.3 mmol) in
methylene chloride (10 mL) was added 4-(2-aminoethyl)-morpholine
(0.79 g, 6.9 mmol) followed by aluminum chloride (1.05 g, 8.0
mmol). The reaction mixture was allowed to stir at room temperature
for 1 hour then quenched with a concentrated solution of potassium
sodium tartrate (25 mL) and 1N NaOH (10 mL), allowing stirring to
continue for an additional hour. The mixture was diluted with
methylene chloride (100 mL) and further extracted 3 times with
methylene chloride (50 mL). The resulting organic layer was dried
over sodium sulfate and concentrated in vacuo. The resulting solid
was triturated from ethyl acetate to afford the amide as a tan
solid (2.02 g, 4.38 mmol).
Example 37
##STR00317##
[0259] To a microwave reactor tube was added the difluoroamide (60
mg, 0.13 mmol), 1-acetylpiperazine (26 mg, 0.2 mmol) and
1-methylpyrrolidine-2-one (0.5 mL) and the mixture was treat with
microwave radiation for 3 minutes (250.degree. C.). The mixture was
allowed to cool to room temperature and purified by mass-directed
liquid chromatography, separating the 6-isomer (2.0 mg) from the
7-isomer (29.7 mg). The isolated fractions were dried in vacuo to
afford the acetylated piperazine as the TFA salt.
Example 38
##STR00318##
[0261] To a solution of the difluoroester (2.0 g, 5.3 mmol) in
methylene chloride (10 mL) was added 4-(2-aminoethyl)-morpholine
(0.79 g, 6.9 mmol) followed by aluminum chloride (1.05 g, 8.0
mmol). The reaction mixture was allowed to stir at room temperature
for 1 hour then quenched with a concentrated solution of potassium
sodium tartrate (25 mL) and 1N NaOH (10 mL), allowing stirring to
continue for an additional hour. The mixture was diluted with
methylene chloride (100 mL) and further extracted 3 times with
methylene chloride (50 mL). The resulting organic layer was dried
over sodium sulfate and concentrated in vacuo. The resulting solid
was triturated from ethyl acetate to afford the amide as a tan
solid (2.3 g, 4.99 mmol).
Example 39
##STR00319##
[0263] To a microwave reactor tube was added the difluoroamide (60
mg, 0.13 mmol), 1-acetylpiperazine (26 mg, 0.2 mmol) and
1-methylpyrrolidine-2-one (0.5 mL) and the mixture was treat with
microwave radiation for 3 minutes (250.degree. C.). The mixture was
allowed to cool to room temperature and purified by mass-directed
liquid chromatography, separating the 6-isomer (1.2 mg) from the
7-isomer (18 mg). The isolated fractions were dried in vacuo to
afford the acetylated piperazine as the TFA salt.
Example 40
Cell Proliferation and/or Cytotoxicity Assay
[0264] The antiproliferative effects of the present compounds may
be tested using a cell proliferation and/or cytotoxicity assay,
following protocols described below.
[0265] Cell culture. Human cervical epithelial cells (HeLa cells)
are obtained from American Type Culture Collection (Manassas, Va.).
Cells are grown in Eagle's minimum essential medium (MEM, Hyclone,
Utah) supplemented with 2 mM Glutamine, 0.1 mM nonessential amino
acid, 1 mM Na Pyruvate, 1.5 g/L NaHCO.sub.3, 50 mg/L gentamicin,
and 10% fetal bovine serum (Hyclone, USA) in a humidified
atmosphere of 5% CO.sub.2 at 37.degree. C.
[0266] MTS assays. Antiproliferative effects of anticancer drugs
are tested by the CellTiter 96 AQ.sub.ueous assay (Promega, WI),
which is a calorimetric assay for determining the number of viable
cells. (See, e.g., Wang, L., et al., Methods Cell Sci (1996)
18:249-255).
[0267] Generally, cells (2,000 to 5,000 cells/well) are seeded on
96 well flat bottom plates (Corning, N.Y.) in 100 .mu.l of culture
medium without any anticancer drug on day 0, and the culture medium
is exchanged for that contained anticancer drugs at various
concentrations on day 1. After incubation for 3 days under normal
growth conditions (on day 4), the monolayers are washed once in
PBS, and the medium is switched to 100 .mu.l of PBS in each of the
96 well plate. After mixing MTS and PMS at the ratio of 20:1, 20
.mu.l of MTS/PMS solution is added to each of the 96 well plate and
incubated for 4 hours in a humidified atmosphere of 5% CO.sub.2 at
37.degree. C. The absorbance was read at 490 nm using FLUOstar
Galaxy 96 well plate reader (BMG Labtechnologies, Germany).
Example 41
Measurement of mRNA Values in Cell Assays
[0268] Real-time quantitative PCR (QPCR) method may be used to
detect the changes of the target c-myc and the endogenous reference
GAPDH gene copies in the same tube. Generally, cells (15,000
cells/well) are seeded on 96 well flat bottom plates (Corning,
N.Y.) and incubated under normal growth conditions for overnight.
The next day, the culture medium is exchanged for that containing
anticancer drugs at various concentrations and incubated for 4 hrs
in a humidified atmosphere of 5% CO.sub.2 at 37.degree. C. Total
RNA (tRNA) is extracted using the RNeasy.TM. 96 Kit (QIAGEN, CA).
The concentration of the tRNA is determined by the RiboGreen RNA
Quantitation Reagent (Molecular Probes, OR).
[0269] A reverse-transcription (RT) reaction may be conducted using
50 ng of tRNA from each well in a 25 .mu.l reaction containing
1.times. TaqMan RT buffer, 2.5 uM random hexamers, 5.5 mM
MgCl.sub.2, 0.5 mM each deoxynucleoside triphosphate (dNTP), 30 U
MultiScribe Reverse Transcriptase, and 10 U RNase inhibitor. RT
reactions are incubated for 10 min at 25.degree. C.,
reverse-transcribed for 30 min at 48.degree. C., inactivated for 5
min at 95.degree. C., and placed at 4.degree. C. All RT reagents
may be purchased from Applied Biosystems, CA.
[0270] Real-Time QPCR reaction may be performed in a 50 .mu.l
reaction containing the 5 .mu.l of cDNA, 1.times. Universal PCR
Master Mix, 1.times. c-myc Pre-Developed Primers and Probe set, and
0.8.times.GAPDH Pre-Developed Primers and Probe set. Because of the
relative abundance of GAPDH gene in Hela, GAPDH primers and probe
concentration may be adjusted to get accurate threshold cycles
(C.sub.T) for both genes in the same tube. The threshold cycle
(C.sub.T) indicates the fractional cycle number at which the amount
of amplified target reaches a fixed threshold. By doing so, the
GAPDH amplification is stopped before it can limit the common
reactants available for amplification of the c-myc. The .DELTA.Rn
value represents the normalized reporter signal minus the baseline
signal. .DELTA.Rn increases during PCR as amplicon copy number
increases until the reaction approaches a plateau.
[0271] The c-myc probe is labeled with 6FAM.TM. dye-MGB and the
GAPDH probe is labeled with VIC.TM. dye-MGB. Preincubation is
performed for 2 min at 50.degree. C. to activate AmpErase UNG
enzyme and then for 10 min at 95.degree. C. to activate AmpliTaq
DNA Polymerase. DNA is amplified for 40 cycles of 15 sec at
95.degree. C. and 1 min at 60.degree. C. Human c-myc and GAPDH cDNA
are amplified, detected, and quantitated in real time using the ABI
Prism 7000 Sequence Detection system (Applied Biosystems, CA),
which is set to detect both 6-FAM and VIC reporter dyes
simultaneously.
[0272] The data may be analyzed using the ABI PRISM Sequence
Detection System and Microsoft Excel. Relative quantitation is done
using the standard curve and comparative C.sub.T method at the same
time, and both methods gave equivalent results. The cycle at which
the amplification plot crosses the C.sub.T is known to accurately
reflect relative mRNA values. (See, Heid, et al., Genome Res.
(1996) 6:986-994; Gibson, et al., Genome Res. (1996) 6:995-1001).
QPCR reactions are set up in triplicate at each cDNA sample and the
triplicate C.sub.T values are averaged. All reagents including
Pre-Developed Primers and probe set may be purchased from Applied
Biosystems, CA.
Example 42
In Vitro Characterization
[0273] Various methods were used for in vitro characterization of
the compounds of the present invention, including but not limited
to i) stop assays; ii) quadruplex/duplex competition assay; iii)
quadrome footprints; and iv) direct assay in the absence of a
competitor molecule.
[0274] Stop Assays. Stop assays are high throughput, first-pass
screens for detecting drugs that bind to and stabilize the target
G-quadruplex. Generally, DNA template oligonucleotide is created,
which contains the nucleotide sequence of the "target" quadruplex
against which drug screening is desired. A fluorescently labeled
primer DNA is then annealed to the 3' end of the template DNA. A
DNA polymerase such as Taq polymerase is then introduced to
synthesize a complementary strand of DNA by extending from the
fluorescently labeled primer. When the progress of the Taq
polymerase is unhindered, it synthesizes a full-length copy of the
template. Addition of a test drug that merely binds to duplex DNA
but does not bind selectively the quadruplex region results in a
decrease in synthesis of full length product and a concomitant
increase in variable-length DNA copies. If, however, the test drug
selectively binds to and stabilizes the quadruplex, the progress of
polymerase arrests only at the quadruplex, and a characteristic
"Stop Product" is synthesized.
[0275] Compounds are initially screened at a single concentration,
and "hits" are re-assayed over a range of doses to determine an
IC.sub.50 value (i.e., the concentration of drug required to
produce an arrest product/full-length product ratio of 1:1). These
products are visualized by capillary electrophoresis.
[0276] Quadruplex/Duplex Competitor Assay. The selectivity of
compounds for the target quadruplex sequence relative to duplex DNA
may be measured using a competition assay (i.e., "selectivity
screen"). This selectivity screen uses the stop assay as a reporter
system to measure the relative ability of an externally added DNA
sequence to compete with the target quadruplex structure formed in
the DNA template for binding of the drug. For example, the
competitors are the c-myc quadruplex sequence, which is identical
to the quadruplex sequence present in the template DNA; or a
plasmid DNA which mimics complex genomic duplex DNA. The degree to
which each competitor successfully "soaks up" drug in solution is
reflected by the quantitative decrease in synthesis of the stop
product. In this manner, the relative binding affinities of drug to
both the target quadruplex and duplex DNA are determined.
[0277] Quadrome Footprints. Compounds may also be evaluated for
their ability to bind to other native quadruplex structures of
biological relevance, including quadruplex control elements that
regulate a range of different oncogenes. The resulting data are
used to create a Quadrome footprint.
[0278] Direct Interaction Assay. Compounds may be evaluated for
their ability to interact directly with nucleic acids capable of
forming a quadruplex structure, wherein the nucleic acid is not a
telomeric nucleic acid. The assay may be performed in the same or
different vessels. For example, a compound may be contacted with
each nucleic acid in the same vessel. Alternatively, a compound may
be separately contacted with each of the nucleic acids tested in a
different vessel. A telomeric nucleic acid as used herein
represents a region of highly repetitive nucleic acid at the end of
a chromosome. As used herein, a direct interaction is measured
without the presence of a competitor nucleic acid.
[0279] An interaction between the compound and the nucleic acid may
be determined for example, by measuring IC.sub.50 values, which are
indicative of the binding and/or quadruplex stabilization. The
selectivity of interactions may be determined, for example, by
comparing measured IC.sub.50 values. For example, the lowest
IC.sub.50 values may be used to indicate a strong interaction
between the compound and the nucleic acid, while highest IC.sub.50
values show a poor interaction; thus, showing selectivity of
interaction. The reaction products may be characterized by
capillary electrophoresis.
Example 43
Direct Interaction Assay
[0280] Generally, a 5'-fluorescent-labeled (FAM) primer (P45, 15
nM) is mixed with template DNA (15 nM) in a Tris-HCL buffer (15 mM
Tris, pH 7.5) containing 10 mM MgCl.sub.2, 0.1 mM EDTA and 0.1 mM
mixed deoxynucleotide triphosphates (dNTP's). The mixture is
denatured at 95.degree. C. for 5 minutes and, after cooling down to
room temperature, is incubated at 37.degree. C. for 15 minutes.
After cooling down to room temperature, 1 mM KCl.sub.2 and the test
compound (various concentrations) are added and the mixture
incubated for 15 minutes at room temperature.
[0281] The primer extension is performed by adding 13 mM KCl and
Taq DNA Polymerase (2.5 U/reaction, Promega) and incubating at
70.degree. C. for 20 minutes. The reaction is stopped by adding 1
.mu.l of the reaction mixture to 10 .mu.l Hi-Di Formamide mixed and
0.25 .mu.l LIZ120 size standard. The method is repeated with the
addition of various concentrations of competitor nucleic acids at
the first step, along with the primer and template sequences. The
G-quadruplex binding ligand is added at the concentration
previously established to produce a 1:1 ratio of stop-product to
full-length product. A CC50 for each nucleic acid competitor is
defined as the concentration of competitor required to change the
ratio of arrest product to full-length product from 1:1 to 1:2. The
nucleic acid sequences of quadruplexes that may be used for this
assay are set forth in Table 4.
TABLE-US-00010 TABLE 4 (STOP TEMPLATES) TGFB3-81 (SEQ ID NO:21)
TATACGGGGTGGGGGAGGGAGGGATTAGCGACACGCAATTGCTATAGTGA
GTCGTATTAGCTACGTACAGTCAGTCAGACT HRAS-85 (SEQ ID NO:22)
TATACCGGGGCGGGGCGGGGGCGGGGGCTTAGCGACACGCAATTGCTATA
GTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT BCL2-97(full) (SEQ ID NO:23)
TAGGGGCGGGCGCGGGAGGAAGGGGGCGGGAGCGGGGCTGTTAGCGACAC
GCAATTGCTATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT HMGA-97 (SEQ ID
NO:24) TTAGAGAAGAGGGGAGGAGGAGGAGGAGAGGAGGAGGCGCTTAGCGACAC
GCAATTGCTATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT MYC99 (SEQ TD
NO:25) TCCAACTATGTATACTGGGGAGGGTGGGGAGGGTGGGGAAGGTTAGCGAC
ACGCAATTGCTATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT IMOTIF99 (SEQ ID
NO:26) TCCAACTATGTATACCCTTCCCCACCCTCCCCACCCTCCCCATTAGCGAC
ACGCAATTGCTATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT Humtel-95 (SEQ ID
NO:27) TCATATATGACTACTTAGGGTTAGGGTTAGGGTTAGGGTTACTGCCACGC
AATTGCTATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT SRC89 (SEQ ID NO:28)
ATGATCACCGGGAGGAGGAGGAAGGAGGAAGCGCGCTGCCACGCAATTGC
TATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT Primer: (45 MER) (SEQ ID
NO:29) AGTCTGACTGACTGTACGTAGCTAATACGACTCACTATAGCAATT
Example 44
Cytochrome P450 (CYP450) Inhibition Assay
[0282] The compounds of the present invention may be evaluated for
potential inhibitory activity against cytochrome P450 P450
isoenzymes. Generally, six reaction tubes with 100 .mu.L of a
solution containing 50 mM potassium phosphate, pH 7.4, 2.6 mM
NADP+, 6.6 mM glucose 6-phosphate, 0.8 U of glucose 6-phosphate
dehydrogenase/mL and 1:6 serial dilutions of the test compound are
prepared along with six tubes of 1:6 serial dilutions of a suitable
positive control inhibitor. The reactions are initiated by adding
100 .mu.L of a pre-warmed enzyme/substrate solution to the reaction
tubes. A zero time-point control reaction is prepared by adding 50
.mu.L of acetonitrile to 100 .mu.L of cofactor solution to
inactivate the enzymes, then adding 100 .mu.L of enzyme/substrate
solution. A control reaction with no inhibitor is also prepared.
After a suitable incubation at 37 C, the reactions are terminated
by the addition of 50 .mu.L of acetonitrile. The reactions are
analyzed for the metabolite forms of the probe substrate using
LC/MS/MS.
Example 45
Evaluation of Compound Efficacy in Tumor Suppression
[0283] An experiment for evaluating the efficacy of compounds of
the present invention in athymic nude mouse models of human
carcinoma is designed as follows. Male or female animals (mouse,
Sim) (NCR, nu/nu) aged five to six weeks and weighing more than 20
grams will be used. The animals are purposely bred and will be
experimentally naive at the outset of the study. Tumors will be
propagated either from injected cells or from the passage of tumor
fragments. Cell lines to be used include, but are not limited to,
MiaPaca, PC3, HCT116, HT29 and BT474.
[0284] Cell implantation. One to ten million cells suspended in 0.1
ml culture media with or without Matrigel (Collaborative Biomedical
Products, Inc, Bedford, Mass.) will be inoculated subcutaneously in
the right flank of sixty animals. There will only be one injection
per animal. Within 7-14 days of injection tumors will develop to a
study use size of approximately 1.0 cm.sup.3. A small subset
(<10/60) animals will be considered Donors and tumors will be
grown 10-28 days and to a size of 1.5 cm.sup.3 in order to be used
for serial transplantation. For estrogen dependent tumor lines
(i.e., BT474), female mice will have estrogen pellets implanted
subcutaneously between the shoulder blades via 10 gauge trocar
three days before cells or tumor fragments are
injected/implanted.
[0285] Fragment transplantation. Donor animals with be euthanized
and tumors surgically excised and cut into 2 mm.sup.3 size
fragments using aseptic technique. Animals to be implanted will be
lightly anesthetized with isoflurane. The area to implanted will be
cleansed with 70% alcohol and Betadine.RTM.. A single fragment will
then be implanted subcutaneously using a trocar.
[0286] Efficacy studies. Groups of 50-60 tumor bearing animals will
be randomly divided into three to eight groups containing 7 animals
each, as described in Table 5.
TABLE-US-00011 TABLE 5 Dose Number Number Solution Euthanized Group
of Males/ Dose Vol. Conc. on: No. Females Dose Level (.mu.L)
(mg/mL) Day 28-42 Negative Control 1 N = 7 * 250 all Positive
Control 2 N = 7 ** 10-400 IP 2 to 5 IP all 10-250 IV 2.5 to 5 IV
125-500 PO .ltoreq.10 PO Test Compound Groups 3-8 N = 7/grp 1 to 25
IP 10-400 IP 2.5 to 5 IP all <56 total 1 to 50 IV 10-250 IV 2.5
to 5 IV 50 to 200 PO 125-500 PO 10 PO * Vehicle/Diluent **
Commercially available anticancer compounds including, but not
limited to, Taxol, CPT11 and Gemcitabine will be used as positive
controls.
[0287] Dosing Procedure. Compounds will be administered QD, QOD,
Q3D or once weekly via IP, IV (lateral tail vein) or PO. Animals
will be dosed in a systematic order that distributes the time of
dosing similarly across all groups. For bolus IP and PO dosing,
animals will be manually restrained. For IV bolus dosing or short
term IV infusion (one minute), animals will be mechanically
restrained but not sedated. Disposable sterile syringes will be
used for each animal/dose.
Example 46
Evaluation of Maximum Tolerated Doses
[0288] An experiment for evaluating the maximum tolerate dose (MTD)
of compounds of the present invention is designed as follows.
Selection for animal models is as previously described in Example
45.
[0289] Acute Toxicity Studies. To determine the MTD after a single
dose, sixty naive animals will be randomly divided into groups
containing 10 animals (5 male and 5 female) and will receive either
one compound via two routes of administration or two compounds via
a single route of administration. A single 50 mg/kg IV dose has
been shown to be tolerated, and is used as the preliminary low dose
levels. The low dose for oral studies is based on projected
tolerability and will be adjusted downward if necessary. Designed
dose levels, dose volumes and dose solution concentration are
described in Table 6.
TABLE-US-00012 TABLE 6 Number Dose Number of Males Dose Solution
Euthanized Group and Dose Level Vol. Conc. on: No. Females (mg/kg)
(.mu.L) (mg/mL) Day 7 Test compound #1 1 N = 5 M 50 IV 250 IV 5 IV
all N = 5 F 100 PO 500 PO 5 PO Test compound #1 2 N = 5 M 75 IV 250
IV 8.25 IV all N = 5 F 200 PO 500 PO 10 PO Test compound #1 3 N = 5
M 100 IV 250 IV 10 IV all N = 5 F 300 PO 500 PO 15 PO Test compound
#2 4 N = 5 M 50 IV 250 IV 5 IV all N = 5 F 100 PO 500 PO 5 PO Test
compound #2 5 N = 5 M 75 IV 250 IV 8.25 IV all N = 5 F 200 PO 500
PO 10 PO Test compound #2 6 N = 5 M 100 IV 250 IV 10 IV all N = 5 F
300 PO 500 PO 15 PO
[0290] SubChronic Studies. To characterize dose-response
relationships following repeated dosing, twenty-five naive animals
will be randomly divided into groups containing 5 animals each as
described in Table 7. Each two week study will test only one
compound via a single routes of administration at an optimal dose
derived from data collected in prior acute toxicity studies.
TABLE-US-00013 TABLE 7 Number of Dose Number Group Males Dose Level
Dose Vol. Solution Conc. Euthanized on: No. or Females (mg/kg)
(.mu.L) (mg/mL) Day 14 1 N = 5 Negative 250 IV Depends on all
Control 500 PO Dose Level Test Compound 2 N = 5 As Determined in
250 IV Depends on all QD MTD Studies 500 PO Dose Level Test
Compound 3 N = 5 As Determined in 250 IV Depends on all QOD MTD
Studies 500 PO Dose Level Test Compound 4 N = 5 As Determined in
250 IV Depends on all Q3D MTD Studies 500 PO Dose Level Test
Compound 5 N = 5 As Determined in 250 IV Depends on all Q7D MTD
Studies 500 PO Dose Level
[0291] Dosing Procedure. Compounds will be administered QD, QOD,
Q3D or Q7D via IV (lateral tail vein) or PO. Animals will be dosed
in a systematic order that distributes the time of dosing similarly
across all groups. For PO dosing, animals will be manually
restrained. For IV bolus dosing or short term IV infusion (one
minute), animals will be mechanically restrained but not sedated.
Disposable sterile syringes will be used for each animal/dose.
Example 47
Evaluation of Pharmacokinetic Properties
[0292] Pharmacokinetic studies for evaluating pharmacokinetic
properties of the compounds herein are designed as follows. Male
animals (mouse, Balb/c or rat, SD) aged five to six weeks. For rat
models, rats weighing more than 200 grams will be used. Twenty
animals will randomly divided into 4 groups, as shown in Table 8.
One group with be untreated and samples taken to be used as a base
line. The other three groups will be and administered a single dose
of compounds by intravenous injection.
TABLE-US-00014 TABLE 8 Group No. of Time followed by injection No.
Animals (h) 1 2 Naive 2 6 .25, 2, 8 3 6 .5, 4, 12 4 6 1, 6, 24
[0293] Dosing Procedure. Compounds will be administered via IV
(lateral tail vein), IP or PO. Animals will be dosed in a
systematic order that distributes the time of dosing similarly
across all groups. For IP and PO dosing, animals will be manually
restrained. For IV bolus dosing or short term IV infusion (one
minute), animals will be mechanically restrained but not sedated.
Disposable sterile syringes will be used for each animal/dose.
[0294] Approximately 0.5 ml of blood will be collected from the
naive animals via cardiac puncture prior to the first dose Terminal
blood samples (0.5 ml) will be collected via cardiac puncture from
two animals per group per time point according to the above chart.
All samples will be placed in tubes containing lithium heparin as
anticoagulant and mixed immediately by inverting. They will be
centrifuged and the plasma flash frozen in liquid nitrogen, stored
at -70.degree. C. or greater and analyzed for drug levels.
Example 48
Determination of In Vitro Metabolic Stability in Hepatocytes
[0295] The protocol is designed to determine the stability of a new
chemical entity in the presence of hepatocytes (human, rat, dog,
monkey) in in vitro incubations. The test article will be incubated
with hepatocytes and suitable media for various times at 37.degree.
C. The reaction mixtures will be extracted and analyzed by LC/MS/MS
for the parent compound and anticipated metabolites. If applicable,
a half-life will be calculated for the consumption of the test
article. Metabolism controls will be run for comparison of the
half-life values with that obtained for the test article. The
metabolism controls are tolbutamide, desipramine and naloxone, and
these compounds have defined pharmacokinetics corresponding to low,
moderate and high in vivo clearance values, respectively.
[0296] Metabolic Stability Study. Generally, solutions of the test
compounds are prepared along with a cocktail solution of metabolism
controls that are intended to provide a reference for enzyme
activity. The reactions are initiated by combining these pre-warmed
solutions with hepatocyte suspensions and with a media control
solution. Control zero samples are taken from these reactions
immediately after initiation. Additional samples are taken at
appropriate time points. Each sample is immediately placed in a
terminating solution (acidified MeCN containing IS) to stop the
reaction. Hepatocyte blank suspensions and test compound standard
solutions are prepared.
[0297] Samples and standards for the test compound as well as
appropriate blanks are subjected to a custom sample preparation
procedure and analyzed for the parent and/or metabolite form of the
test compound using HPLC coupled with tandem mass spectrometry.
Samples and standards for the metabolism controls are subjected to
the analytical method described herein. Where Krebs Henseleit
buffer is added, the buffer is bubbled with 5% CO.sub.2 in air at
room temperature for 5-10 minutes before adding BSA to a final
concentration of 0.2% w/v. The volume of terminating solution and
the method of sample preparation will be determined for the test
article during method development.
[0298] Test Article/Media Solution. A solution of the test article
will be prepared by adding an appropriate volume of the stock
solution to 0.2% BSA in Krebs Henseleit buffer equilibrated with 5%
CO.sub.2 in air. The final concentration will be 20 .mu.M and the
final assay concentration at initiation of the reactions will be 10
.mu.M.
[0299] Metabolism Controls/Media Solution. A solution of
tolbutamide, desipramine and naloxone will be prepared by adding an
appropriate volume of each 10 mM stock solution to 0.2% BSA in
Krebs Henseleit buffer equilibrated with 5% CO.sub.2 in air. The
final concentration will be 20 .mu.M for each metabolism control
and the final assay concentration will be 10 .mu.M at initiation of
the reactions.
[0300] Hepatocyte Suspension Solution. The hepatocytes will be
thawed and isolated according to the vendor (Invitrotech, Inc.)
instructions. During the final step of the procedure, the viability
of the cells will be determined using the method of trypan blue
exclusion. Then, the hepatocytes will be resuspended with 0.2% BSA
in Krebs Henseleit buffer equilibrated with 5% CO.sub.2 in air so
the final concentration is 0.5 million viable cells/mL. The
concentration at the initiation of the reactions will be 0.25
million viable cells/mL.
[0301] Initiating Test Article Incubation. Equal volumes of the
test article solution prepared in step 2.1.3 will be dispensed into
four polypropylene scintillation vials. The vials are pre-warmed
for 5-10 minutes at 37.degree. C. with 95% humidity and 5%
CO.sub.2. Equal volumes of 0.2% BSA in Krebs Henseleit buffer
equilibrated with 5% CO.sub.2 in air will be added to two of the
vials and mixed thoroughly. Immediately after initiating the
reaction, a timer is started and a 100 .mu.L sample is removed from
each vial and placed into a 1.7-mL centrifuge tube containing a
suitable volume of terminating solution. These samples will serve
as media controls to check for non-enzymatic degradation and
non-specific binding to the vessel.
[0302] Equal volumes of the hepatocyte suspension prepared in step
2.1.5 will be added to two of the vials and mixed thoroughly.
Immediately after initiating the reaction, a timer is started and a
100 .mu.L sample is removed from each vial and placed into a 1.7-mL
centrifuge tube containing a suitable volume of terminating
solution. All vials are placed in an incubator maintained at
37.degree. C., 95% humidity and 5% CO.sub.2.
[0303] Initiating Metabolism Control Incubation. Equal volumes of
the metabolism control solution prepared in step 2.1.4 will be
dispensed into two polypropylene scintillation vials. The vials are
pre-warmed for 5-10 minutes at 37.degree. C. with 95% humidity and
5% CO.sub.2. Equal volumes of the hepatocyte suspension prepared in
step 2.1.5 will be added to each of the two vials and mixed
thoroughly. Immediately after initiating the reaction, a timer is
started and a 100 .mu.L sample is removed from each vial and placed
into a 1.7-mL centrifuge tube containing an equal volume of
terminating solution. All vials are placed in an incubator
maintained at 37.degree. C., 95% humidity and 5% CO.sub.2.
[0304] Sample Collection. The vials will be gently shaken and
samples (100 .mu.L) will be removed and placed into a 1.7-mL
centrifuge tube containing an appropriate volume of terminating
solution according to the following schedule: Test article samples
are taken after 5, 10, 15, 30, 60, 90 and 120 minutes; metabolism
control samples are taken after 30, 60, 90 and 120 minutes.
Immediately after removal of the samples, the vials are placed back
in the incubator until the last sample is collected.
[0305] Blank Preparation. A sample (100 .mu.L) of the hepatocyte
suspension will be added to an equal volume of 0.2% BSA in Krebs
Henseleit buffer and mixed thoroughly. A 100 .mu.L sample of this
solution will be removed and placed into a 1.7-mL centrifuge tube
containing the same volume of terminating solution used for the
test article reaction. A sample of the incubation medium (0.2% BSA
in Krebs Henseleit buffer) will be placed into a 1.7-mL centrifuge
tube containing the same volume of terminating solution used for
the test article reaction.
[0306] Sample Preparation and Analysis. All vials will be
centrifuged at 16,000 g for 3 minutes. The supernatants will be
placed into polypropylene autosampler vials and stored at 4.degree.
C. (<1 day) or -70.degree. C. (>1 day) until analysis. The
test article solutions will be analyzed using HPLC/MS/MS conditions
according to standard procedures. In one example, the following
HPLC conditions may be used: column (Phenomenex Synergi Hydro-RP,
100.0.times.2.0 mm, 5 .mu.m); guard column (Phenomenex C18,
4.0.times.2.0 mm, 5 .mu.m); flow rate (0.3 mL/min); column
temperature at 45.degree. C.; injection volume at 10 .mu.L; and
ambient autosampler temperature.
Example 49
Determination of In Vitro Metabolic Stability in Microsomes
[0307] The protocol is designed to determine the stability of a new
chemical entity in the presence of liver microsomes (human, rat,
dog, monkey) in in vitro incubations. The test article will be
incubated with microsomes and suitable media for various times at
37.degree. C. The reaction mixtures will be extracted and analyzed
by LC/MS/MS for the parent compound and anticipated metabolites. If
applicable, a half-life will be calculated for the consumption of
the test article. Metabolism controls will be run for comparison of
the half-life values with that obtained for the test article. The
metabolism controls are tolbutamide, desipramine and testosterone,
and these compounds have defined pharmacokinetics corresponding to
low, moderate and high in vivo clearance values, respectively.
[0308] Metabolic Stability Study. Generally, six pre-warmed
reaction vials with 100 .mu.L of a solution containing 50 mM
potassium phosphate, pH 7.4, 2.6 mM NADP.sup.+, 6.6 mM glucose
6-phosphate, 0.8 U/mL of glucose 6-phosphate dehydrogenase and 1,
10 or 50 .mu.M of the test compound are prepared. Similar reactions
with metabolic controls representing low (tolbutamide), moderate
(desipramine), and high (testosterone) clearance compounds are run
simultaneously with the same enzyme solution. The reactions are
initiated by adding 100 .mu.L of a pre-warmed enzyme solution and
incubated at 37.degree. C. The zero time-point reaction is prepared
by adding 50 .mu.L of acetonitrile (containing internal standard)
to the test compound/cofactor solution prior to adding the enzyme
solution. After 15, 30, 60, 90 and 120 minutes, a reaction tube is
removed from the water bath and the reaction is terminated with 50
.mu.L of acetonitrile containing internal standard. The reactions
are extracted and the samples are analyzed for the parent form of
the test compound and one metabolite using a C18 column with MS/MS
detection. Each assay is performed in duplicate.
[0309] Cofactor/Test compound Solution Concentrations. A stock
solution of 10 mM NCE will be prepared in 10% DMSO (v/v). For all
assays, a 2, 20 or 100 .mu.M solution of the test article will be
prepared in 50 mM potassium phosphate, pH 7.4, 2.6 mM NADP.sup.+,
6.6 mM glucose 6-phosphate and 0.8 U/mL of glucose 6-phosphate
dehydrogenase (cofactor solution).
[0310] Cofactor/Metabolism Control Solution Concentrations. Stock
solutions of the metabolism controls (tolbutamide, desipramine, and
testosterone) will be used to prepare a 6 .mu.M solution of the
metabolism control in cofactor solution described in step
[0311] Enzyme Solution Concentrations. The enzyme solutions will be
prepared by adding liver microsomes to 50 mM potassium phosphate,
pH 7.4, to a final concentration of 1 mg/mL. All microsomes were
purchased from XenoTech or InvitroTech, Inc.
[0312] Initiating the Reactions. All the reaction tubes will be
pre-warmed at 37.degree. C. in a water bath for about 3-5 minutes.
The zero time-point control reaction will be prepared for each
replicate by adding 50 .mu.L of acetonitrile containing 15.9 .mu.M
nebularine (internal standard) to 100 .mu.L of cofactor solution to
inactivate the enzymes, and then vortex mixing. The reactions will
be initiated by adding 100 .mu.L of the enzyme solution to each of
the tubes and vortex mixing. All the tubes, including the zero
time-point control, will be incubated in a 37.degree. C. water
bath. The final concentrations of all components in the tubes after
initiating the reactions are 50 mM potassium phosphate, pH 7.4, 1.3
mM NADP.sup.+, 3.3 mM glucose 6-phosphate, 0.4 U/mL of glucose
6-phosphate dehydrogenase, 0.5 mg/mL liver microsomes and 1, 10 or
50 .mu.M test article.
[0313] Terminating and Extracting the Reactions. After 15, 30, 60,
90 and 120 minutes at 37.degree. C., the reactions will be
terminated by the addition of 150 .mu.L of acetonitrile containing
15.9 .mu.M nebularine (internal standard). The zero time-point
control is removed from the water bath after 120 minutes. All vials
will be centrifuged at 16,000 g for 3 minutes. The supernatants
will be placed into polypropylene autosampler vials and stored at
4.degree. C. (<1 day) or -70.degree. C. (>1 day) until
analysis.
[0314] Analysis of Test Article Solutions. The test article
solutions will be analyzed using HPLC/MS/MS conditions according to
standard procedures, such as those described in Example 60.
Example 50
Bacterial Mutagenicity Test
[0315] This Mutagenicity Assessment assay (Ames Assay) evaluates
the potential of the test article extracts to induce histidine
(his) reversion in S. typhimurium (his- to his+) or tryptophan
(trp) reversion in E. coli (trp- to trp+) caused by base changes or
frameshift mutations in the genome of tester organisms.
[0316] Generally, a plate incorporation assay is conducted with
five strains of Salmonella typhimurium (TA97a, TA98, TA100, TA102,
and TA1535) and one strain of Escherichia coli (WP2-uvrA.sup.-) in
the presence and absence of an exogenous mammalian activation
system (S9). The test article was dissolved in 5% dextrose. A
series of dilutions are then prepared in saline just prior to
testing. A Range Finding Study is also conducted for this assay to
determine the appropriate doses for definitive mutagenicity
assessment.
[0317] Test Material Preparation
[0318] A stock solution of test article is prepared at 20.0 mg/mL
as follows: 1.0 g test article is added to 15.0 mL of 0.1 HCl for 1
minute. The test article is stirred for 15 minutes at room
temperature. Next 33.0 mL of deionized water is added and allowed
to stir for 30 minutes. The pH is then adjusted to 3.53. Lower
doses are prepared by dilution in 5% dextrose from this stock
immediately prior to use. To minimize any change of degradation,
the test article solutions are kept on ice after preparation and
until just prior to dosing procedures. The test article is
administered in vitro, through a solvent compatible with the test
system.
[0319] Genotypic Characterization of the Test Strains
[0320] Working stocks of test strains will be confirmed for
genotypic markers and acceptable spontaneous reversion rates. All
working stocks should demonstrate a requirement for histidine or
tryptophan (E. coli only). Additionally, the following
conformations will be made with each assay, as appropriate:
sensitivity to crystal violet due to the rfa wall mutation;
sensitivity to ultraviolet light due to the deletion of the uvrB
gene (uvrA in E. coli), resistance to ampicillin due to the
presence of the pKM101 plasmid; and resistance to tetracycline due
to the presence of the pAQ1 plasmid. Spontaneous reversion rates
for the strains will be determined using the negative controls.
[0321] Test articles that are water-soluble will be preferentially
dissolved in isotonic saline. Test articles that are not
water-soluble will be dissolved in Dimethylsulfoxide (DMSO). If
DMSO is anticipated to cause adverse reactions with the test
article, the test article will be suspended in
carboxymethylcellulose. In order to aid in dissolution, heating,
vigorous vortexing or alternative solvents may be employed.
[0322] Test System
[0323] This assay is conducted in accordance with the plate
incorporation methodology originally described by Ames (Ames et
al., Mutation Research (1975) 31:347-364) and updated by Maron and
Ames (Maron et al., Mutation Research (1983) 113:173-215). This
assay has historically been used to detect mutation in a gene of a
histidine requiring strain to produce a histidine independent
strain or concordantly, to detect mutation in a gene of a
tryptophan requiring strain to produce a tryptophan independent
strain. In addition, it has been shown to detect diverse classes of
chemical mutagens which produce heritable DNA mutations of a type
which are associated with adverse effects.
[0324] The Salmonella typhimurium strains to be used in this assay,
TA97a, TA98, TA100, and TA102 are described by Maron and Ames,
supra; Green et al., Mutation Research (1976) 38:33-42); and
Brusick et al., Mutation Research (1980) 76:169-190)). S.
typhimurium strain TA1535 and E. coli strain Wp2-uvrA.sup.- may be
obtained from American Type Culture Collection, Manassas, Va. (ATCC
numbers: 29629 and 49979, respectively). All working stocks of test
strains will be confirmed for genotypic markers and acceptable
reversion rates. Working stocks should demonstrate a requirement
for histidine or tryptophan (E. coli only).
[0325] Experimental Methods
[0326] Master plates of the tester strains are prepared from frozen
working stocks. To create working cultures for each bacterial
strain used in the assay, a single colony is transferred from the
master plate into Oxoid nutrient broth and incubated, with shaking,
at 37.+-.2.degree. C. until an optical density (at 650 nm) of
0.6-1.6 was reached. This overnight culture is used for the
mutagenicity test and for genotypic confirmation. Genotype tests
are performed as described in the protocol.
[0327] For both the dose range and mutagenicity test, a top agar
consisting of 0.6% Difco agar in 0.5% NaCl is melted and a solution
of 0.5 mM L-histidine/0.5 mM biotin or 0.5 mM L-tryptophan is added
to the melted top agar at a ratio of 10 mL per 100 mL agar. The
supplemented agar is aliquotted, 2 mL per tube and held at
45-47.degree. C. To prepare the top agar for treatment, 0.1 mL of
the test article or control, 0.1 mL of the bacterial culture and
0.5 mL of phosphate buffered saline are added to the molten agar.
The mixture is briefly vortexed and poured onto a room temperature
minimal glucose agar plate (1.5% Difco agar, 2% glucose, in
Vogel-Bonner medium E). Metabolic activation is provided by adding
0.5 mL of the S9 mix in place of the PBS. The plates are allowed to
harden and then incubated 48-72 hours at 37.+-.2.degree. C. All
plates are counted using an automatic image analysis system.
Negative control and test article treated plates were also examined
for the presence of a bacterial lawn.
[0328] Exogenous Metabolic Activation
[0329] The in vitro metabolic activation system used in this assay
is comprised of Sprague Dawley rat liver enzymes and a cofactor
pool. The enzymes are contained in a preparation of liver
microsomes (S9 fraction) from rates treated with Arochlor to induce
the production of enzymes capable of transforming chemicals to more
active forms. Immediately prior to use, the S9 is thawed and mixed
with a cofactor pool to contain 5% S9, 5 mM glucose 6-phosphate, 4
mM .beta.-nicotine-adenine dinucleotide phosphate, 8 mM MgCl.sub.2
and 33 mM KCl in a 200 mM phosphate buffer at pH 7.4.
[0330] Dose Levels and Replicates
[0331] The test article is tested in triplicate at five dose levels
(20.0, 10.0, 5.0, 2.5, and 1.25 mg/mL) along with appropriate
vehicle (5% dextrose) and positive controls in the dose range
assay. This is equivalent to 2.0, 1.0, 0.5, 0.25, and 0.125
mg/plate.
[0332] For the definitive assay, three dose levels are chosen
(10.0, 10.0, and 5.0 mg/mL), which is equivalent to 2.0, 1.0, and
0.5 mg/plate. All treatments, including negative and positive
control, are plated in triplicate against test strains TA97a, TA98,
TA100, TA102, TA1535, and WP2-uvrA.sup.- in the presence and
absence of metabolic activation. These doses are chosen based on
inducing a range of test article toxicity and maximizing the
applied dose.
[0333] Control Substances
[0334] Control substances may be prepared and used in the
mutagenicity assay as described in Table 9.
TABLE-US-00015 TABLE 9 Metabolic Control Strain Activation
Concentration ICR-191 Acridine TA97a No 1.0 .mu.g/plate
2-nitrofluorene A98 No 10.0 .mu.g/plate Sodium azide TA100 and
TA1535 No 1.5 .mu.g/plate 1-methyl-3-nitro-1- WP2-uvrA.sup.- No 4.0
.mu.g/plate nitrosognanidine 2-aminoanthracene all strains (except
Yes 10.0 .mu.g/plate TA1535) 2-aminoanthracene TA1535 Yes 1.6
.mu.g/plate
[0335] Negative (Vehicle) Control
[0336] Tester strains are plated with untreated dextrose solution
at the corresponding maximum concentration (0.1 mL), with and
without S9. These plates serve as the negative controls and provide
information regarding background lawn and revertant colony
formation.
[0337] Dose Range Assay
[0338] The initial dose range assay starts at the maximum
concentration of 2.0 mg/plate. The four lower doses to be tested
are diluted in a 1:2 dilution series.
[0339] Reverse Mutation Assay
[0340] Each separate bacterial strain, with and without S9, is
considered a separate experiment with its own concurrent positive
and vehicle controls. All plates are scored with an automated
colony counter and a printout of the data was made. The positive
controls consists of direct-acting mutagens and mutagens requiring
metabolic transformation. A two-fold or greater increase in
reversion rates is observed for all strains with the appropriate
positive control. The negative control article reversion rates for
each strain should be within or slightly below the expected ranges
from laboratory historical data. An induced positive result for any
strain would be demonstrated by at least a two-fold increase in the
number of revertant colonies per plate over the negative control
values.
Example 51
In Vitro Chromosome Aberration Assay in CHO Cells
[0341] The Chromosomal Aberration Assay is one of several in vitro
tests that can be used to screen materials for their potential
genetic toxicity. Chromosome aberrations are mutations which have
been associated with carcinogenesis. Therefore, the chromosome
aberration assay is relevant for testing potential mutagens and
carcinogens (Galloway et al., Environ. Mut. (1985) 7:1-51; Galloway
et al., Environ. Mut. (1987) 10:1-175). This Chromosome Aberration
Assay evaluates the potential of the test article extracts to
induce damage in Chinese Hamster Ovary Cells (CHO). This test will
be conducted in the presence and absence of an exogenous mammalian
activation system (S9) over three treatment periods. All negative
control treated preparations should demonstrate normal levels of
spontaneously occurring aberrations while positive control treated
cultures should demonstrate dramatic, dose dependent increases in
aberrant chromosomes.
[0342] This assay is designed to determine whether a test material
is clastogenic, i.e., whether it has the capacity to break
chromosomes. Clastogenicity is an important endpoint because it is
through chromosomal breakage and inappropriate rejoining that
certain oncogenes (e.g., myc) can be activated and certain tumor
suppressor genes (e.g., those suppressing retinoblastoma) can be
inactivated). In this test, mammalian Chinese Hamster Ovary (CHO)
cells are exposed to the test material and blocked in metaphase
using a spindle poison. Visualization of chromosomes is performed
microscopically after hypotonic swelling, fixing and staining the
treated CHO cells. Agents found to be capable of inducing
chromosome breakage have a high probability of being carcinogens
and also have the potential for inducing heritable chromosomal
defects.
[0343] The CHO-K.sub.1 cell line (ATCC number: CCL-61) is a proline
auxotroph with a modal chromosome number of 20 and a population
doubling time of 10-14 hours. This system has been shown to be
sensitive to the clastogenic activity of a variety of chemicals
(Preston et al., Mutation Res. (1981) 87:143-188). CHO cells were
grown and maintained in McCoy's 5A medium supplemented with 10%
fetal calf serum, 1% L-glutamine (2 mM), penicillin (100 units/mL),
and streptomycin (100 .mu.g/mL). Cultures are incubated in 5-7%
CO.sub.2 with loose caps in a humidified incubator at
37.+-.2.degree. C.
[0344] Test Procedures
[0345] A stock solution is prepared at 5 mg/mL. Lower doses are
prepared by dilution in 5% dextrose from this stock immediately
prior to use. To minimize any chance of degradation, the test
article solutions are kept on ice after preparation and until just
prior to dosing procedures.
[0346] Cells are seeded at approximately 1-1.5.times.10.sup.6 cells
per 75 cm.sup.2 tissue culture flask in 10 mL fresh medium one day
prior to treatment. For treatment, spent medium is replaced with
fresh growth medium and the test article extract, negative or
positive control is added to each flask. Positive controls are
dosed in 0.1 mL volumes to minimize vehicle toxicity. The test
article dilutions and negative control are dosed in 1 mL volumes.
Fresh medium is added to bring the total treatment volume to 10 mL.
For the portion of the test with metabolic activation, the S9
activation mix is added to serum free medium at 1.5%, (v/v) final
concentration. All treatments are carried out in duplicate. The
cells are incubated at 37.+-.2.degree. C. in the presence of the
test article extract, the S9 reaction mixture (metabolic activation
portion of the study only) and growth medium. The assay is divided
into three treatment periods: 3 hours, 3 hours with S9 activation,
and 20 hours.
[0347] After the treatment period, all flasks are evaluated
microscopically for gross manifestations of toxicity. i.e.,
morphological changes in cells or significant cell detachment. All
flasks are washed twice with phosphate buffered saline (PBS).
Normal growth medium containing 10% fetal bovine serum (FBS) is
added to the freshly washed cells and the flasks are returned to
the incubator for an additional 14.5-15.5 hours. Microscopic
evaluation is performed immediately prior to harvest. Two hours
prior to harvest, 1 .mu.g of colcemid is added (0.1 .mu.g/mL final
concentration) to all flasks to accumulate dividing cells.
[0348] The test article extracts are tested in duplicate at six
dose levels (0.5, 0.16, 0.05, 0.016, 0.005, and 0.0016 ml/mL final
concentration in culture) along with appropriate vehicle and
positive controls.
[0349] Metabolic Activation System
[0350] The use of a metabolic activation system is an important
aspect for evaluation of a test article, as some compounds exist
only in a promutagenic state. That is, they become mutagenic only
after being acted upon by an outside metabolic source. In vitro
test systems lack this ability to metabolize compounds unless an
outside system such as S9 is added.
[0351] The in vitro metabolic activation system used in this assay
is comprised of Sprague Dawley rat liver enzymes and an energy
producing system necessary for their function (NADP and isocitric
acid; core reaction mixture). The enzymes are contained in a
preparation of liver microsomes (S9 fraction) from rats treated
with Arochlor 1254 to induce enzymes capable of transforming
chemicals to more active forms. The S9 may be purchased from Moltox
(Boone, N.C.) and retained frozen at less than -70.degree. C. until
use. This S9 fraction is thawed immediately before use and added to
the core reaction mixture.
[0352] Cell Fixation, Staining and Scoring
[0353] Metaphase cells are collected by mitotic shake off, swollen
with 75 mM KCl, fixed in methanol:glacial acetic acid (3:1 v/v).
Cells are pipetted onto glass slides after resuspension in fresh
fixative and air dried. The slides are labeled with a blind code.
Three slides are prepared from each treatment flask.
[0354] Slides are stained with Giemsa and permanently mounted. All
slides are read under blind code with the exception of the high
dose positive controls, which are evaluated first to ensure the
aberration frequency was adequate. Two hundred cells per dose (100
from each of the duplicate flasks) are read from each of the doses.
One hundred cells are read from each of the high dose positive
controls in accordance with the following definitions and were
scored as such.
Chromatid Type
[0355] TG (Chromatid Gap): "Tid Gap". An achromatic (unstained)
region in one chromatid, the size of which is equal to or smaller
than the width of a chromatid. These are noted but not usually
included in final totals of aberrations, as they may not all be
true breaks.
[0356] IG (Isochromatid Gap): "Chromosome Gap". The gaps are at the
same locus in both sister chromatids. These are noted but are not
usually included in final totals of aberrations, as they may not
all be true breaks.
[0357] TB (Chromatid Break): An achromatic region in one chromatid,
larger than the width of a chromatid. The associated fragment may
be partially or completely displaced, or missing.
[0358] ID (Chromatid Deletion): Length of chromatid "cut" from
midregion of a chromatid resulting in a small fragment or ring
lying beside a shortened chromatid or a gap in the chromatid.
[0359] TR (Triradial): An exchange between two chromosomes, which
results in a three-armed configuration. May have an associated
acentric fragment.
[0360] QR (Quadriradial): The same as the triradial, but resulting
in a four-armed configuration.
[0361] CR (Complex Rearrangement): An exchange among more than two
chromosomes which is the result of several breaks and
exchanges.
[0362] TI (Chromatid Interchange): Exchange within a chromosome
involving one or both arms.
Chromosome Type
[0363] SB (Chromosome Break): Terminal deletion. Chromosome has a
clear break forming an abnormal (deleted) chromosome with an
acentric fragment that is dislocated and may remain associated or
may appear anywhere in the cell.
[0364] DM (Double Minute Fragment): Chromosome interstitial
deletion. These appear as small double "dots" or may be paired
rings. In some cases, they cannot be distinguished from acentric
fragments that result from exchanges or terminal deletions.
[0365] D (Dicentric): An exchange between two chromosomes that
results in a chromosome with two centromeres. This is often
associated with an acentric fragment in which it is classified as
Dicentric with Fragment (DF).
[0366] MC (Multi-centric Chromosome): An exchange among chromosomes
that results in a chromosome with more than two centromeres.
[0367] R (Ring): A chromosome that forms a circle containing a
centromere. This is often associated with an acentric fragment, in
which case it is classified as Ring with Fragment (RF). Acentric
rings are also included in this category.
[0368] Ab (Abnormal Monocentric Chromosome): This is a chromosome
whose morphology is abnormal for the karyotype, and often the
result of such things as a translocation or pericentric inversion.
Classification used if abnormally cannot be ascribed to, e.g., a
reciprocal translocation.
[0369] T (Translocation): Obvious transfer of material between two
chromosomes resulting in two abnormal chromosomes. When
identifiable, scored at "T", not as "2 Ab".
Other
[0370] SD (Severely Damaged Cell): A cell with 10 or more
aberrations of any type. A heavily damaged cell should be analyzed
to identify the type of aberrations and may not have 10 or more,
e.g., because of multiple fragments such as those found associated
with a tricentric.
[0371] PU (Pulverized Chromosome): Despiralized or fragmented
chromosome. This may simply be at a different stage of chromosome
condensation.
[0372] P (+ Pulverized Cell): More than one chromosome, up to the
whole nucleus, is "pulverized".
[0373] PP (Polyploid Cell): A cell containing multiple copies of
the haploid number of chromosomes. Polyploid cells are occasionally
observed in normal bone marrow or cell culture. These are recorded
but are not included in final totals of structural aberrations.
[0374] Control Substances
[0375] Control substances are prepared and used in this assay as
described in published reports. Positive controls which may be used
are: cyclophosphamide--High dose 15 .mu.g/mL; cyclophosphamide--Low
dose 5 .mu.g/mL; mitomycin C--High dose 1.0 .mu.g/mL; and citomycin
C--Low dose 0.25 .mu.g/mL. For negative (vehicle) control, the CHO
cells are treated with the 5% dextrose negative controls with and
without S9 activation. These treatments provide information
regarding background numbers of aberrant cells.
[0376] Assay Validity Evaluation and Statistical Analysis
[0377] The total number of aberrations (% CA) of the solvent
control culture(s) should fall within 1-14%. High dose positive
controls should produce a statistically significant increase in the
number of aberrations at the 95% confidence level (p<0.05) as
determined by statistical analysis. Analysis of Variance (ANOVA) is
used to identify significant differences between positive and
negative control groups or test article and negative control
groups. A difference is considered significant when the p value
obtained was less than 0.05.
Example 52
Safety and Tolerance Determination in Dogs
[0378] This study is designed to determine the safety and tolerance
of compounds at dose levels administered intravenously once daily
to beagle dogs for five consecutive days. Safety parameters are
monitored through observation, clinical pathology, and microscopic
histopathology assessments.
[0379] Experimental Design
[0380] Table 10 summarizes the study design. The study will be
conducted using three (3) test article and one (1) control article
group. The control article is the solution (5% dextrose in water)
used to dilute the test article prior to administration and was
administered at the same volume as the high dose. The test article
dosage levels for this study are approximately 12, 3.8, and 1.2
mg/kg. Test and control articles are administered once by
intravenous (IV) infusion over approximately a one hour period on
five consecutive days.
[0381] Blood samples for test article blood level analysis is taken
as follows (i.e., pk/tk sampling). Approximately 1.0 mL of blood is
taken from three male and three female dogs in the low dose group
at approximately 20 minutes and 40 minutes from the start of the
infusion, and then at the end of infusion (Time 0) and at 5, 10,
15, and 30 minutes, and 1, 2, 4, 8, 12, and 24 hours from the end
of the infusion after the first and fifth doses. Also, prior to and
immediately after Dose 1 and after Dose 5 for all animals, and for
recovery animals prior to necropsy, approximately 5-10 second ECG
tracings in a lead II configuration are obtained. Animals are
terminated one (1) or 15 days after the last dose. Blood for
hematology and clinical chemistry analysis is drawn pre-dose and
prior to euthanasia at termination. Following euthanasia, a
necropsy is performed to include collection of major organs for
microscopic evaluation.
TABLE-US-00016 TABLE 10 PRIMARY NO. RECOVERY ANIMALS (15 DAY) GROUP
DOSAGE (MALE/ NO. ANIMALS NO. ARTICLE .sup.a (MG/KG) FEMALE)
(MALE/FEMALE) 1 Control 0.0 3/3 1/1 2 Test Article 12.0 3/3 1/1 3
Test Article 3.8 3/3 1/1 4 Test Article 1.2 3/3 1/1 .sup.a
Delivered as an approximate 1 hour infusion
[0382] Test Methods
[0383] Animals are systematically assigned to groups as follows:
The heaviest dog for a sex is assigned to Group 1, the next
heaviest for that sex was assigned to Group 2, the next heaviest to
Group 3, the next heaviest to Group 4, then continue with Groups 2,
3, 4, and 1, then Groups 3, 4, 1, and 2, continuing with this
pattern until each group had a full complement of animals. The test
and control article are administered at each dosing as an
intravenous infusion into a cephalic or saphenous vein over
approximately one hour.
[0384] Animals are weighed daily prior to dosing and prior to
necropsy. All animals are observed for signs of pharmacological
activity, behavioral changes, and toxicity immediately and one hour
after dosing. Recovery animals are also observed once daily during
the recovery period. Prior to and immediately after Doses 1 and 5
for all animals, and for recovery animals prior to necropsy,
approximately five second ECG tracings in a lead II configuration
are obtained. These tracings are used to provide data for
interpretation of the rhythm and amplitude changes of the
QRS-complex and T-wave and to measure QT intervals on a number of
segments per tracing (approximately 5-10).
[0385] Blood Collection
[0386] PK/TK: Blood samples for test article blood level analysis
are taken. Approximately 1 mL of blood is taken from three males
and three females in the low dose group at approximately 20 minutes
and 40 minutes from the start of the infusion, and then at the end
of infusion (Time 0) and at 5, 10, 15, and 30 minutes, and 1, 2, 4,
8, 12, and 24 hours from the end of the infusion after the first
and fifth dose. Plasma (lithium heparin anticoagulant) samples are
prepared for analysis.
[0387] Clinical Pathology: After overnight fasting and prior to the
first dose (baseline; all animals) and then prior to each necropsy,
blood samples are taken for hematology and clinical chemistry. For
hematology assays, blood collected at baseline and prior to
necropsy (fasted) are analyzed for erythrocyte count, hematocrit,
MCH, leukocyte count, differential WC, MCHC, hemoglobin, MCV,
platelet count, PT, and APTT. For clinical chemistry assays, blood
collected at baseline and prior to necropsy (fasted) are tested
for: aspartate aminotransferase (ASP), globulin & A/G ratio,
Alanine aminotransferase (ALT), sodium, alkaline phosphatase,
potassium, gamma glutamyltransferase (GGT), chloride, glucose,
calcium, blood urea nitrogen (BUN), total bilirubin, creatinine,
inorganic phosphorus, total protein, cholesterol, albumin, and
triglycerides.
[0388] Necropsy
[0389] Following blood sample collection, primary treatment and
recovery group animals are sacrificed at their respective
termination times and are necropsied. Major organs are collected,
weighed, and preserved for microscopic evaluation. Necropsy
included examination of the cranial, thoracic, abdominal and pelvic
cavities, their viscera, the tissues, organs, and the carcass.
[0390] Statistical Methods
[0391] Statistical analysis of the clinical chemistry and
hematology values and organ and body weight data will be performed
to compare the test article groups to the control group. The
statistical methods used for the data will be selected as
appropriate: parametric data will be analyzed using a one way
Analysis of Variance, non-parametric data will be analyzed using
the Kurskai-Wallis test. A paired t-test will also be used to
compare baseline and post treatment clinical chemistry and
hematology values for each animal. Probability (p) values of 0.05
or less will be considered significant for all statistical
tests.
Example 53
Safety and Tolerance Study in Rats
[0392] This study determines the safety and tolerance of a test
compound at three dose levels administered intravenously once daily
to rats for five consecutive days. Safety parameters will be
monitored through observation, clinical pathology, and microscopic
histopathology assessments. Selected animals will also undergo
blood sample collection for pharmacokinetic/toxicokinetic
evaluation.
Experimental Methods
[0393] Table 11 summarizes the study design. The study is conducted
using three (3) test and one (1) control article groups. The high
and low test article groups and the control group will consist of
28 animals each and were used to assess tolerance. The medium test
article group will consist of 64 animals, of which 28 animals are
used to assess tolerance and 36 animals are used to determine the
level of test article in the blood at various time points after the
first and fifth doses in the PK/TK portion of the study. The
control article is the solution (5% dextrose in water; D5W) used to
dilute the test article prior to administration and is administered
at the same volume as the high dose test article group. The test
article dosage levels for this study are 24, 7.6, and 2.4 mg/kg.
Test and control articles are administered by intravenous (IV)
injection into a tail vein over one minute on five consecutive
days.
[0394] Blood samples for test article blood level analysis are
taken as follows. Approximately 0.3-0.5 mL of blood is taken from
three male and three female rats under anesthesia at each sample
time point of pre-dose and at the end of injection (Time 0) and at
approximately 0.08, 0.25, 0.5, 1, 2, 4, 8, 12, and 24 hours from
the end of the injection after the first and fifth doses. Animals
used to assess tolerance are terminated one day (for the primary
group) or 15 days (for the recovery group) after the last dose. At
termination of the tolerance test animals, blood for hematology and
clinical chemistry analysis is drawn prior to euthanasia and
following euthanasia. A necropsy is performed to include collection
of major organs for microscopic evaluation. The animals used for
the pk/tk blood sampling only to determine the level of test
article are euthanized after the final blood sample was collected
without any further sampling or observations.
TABLE-US-00017 TABLE 11 PRIMARY NO. RECOVERY ANIMALS (15 DAY) GROUP
DOSAGE (MALE/ NO. ANIMALS NO. ARTICLE .sup.a (MG/KG) FEMALE)
(MALE/FEMALE) 1 Control 0.0 3/3 1/1 2 Test Article 12.0 3/3 1/1 3
Test Article 3.8 3/3 1/1 4 Test Article 1.2 3/3 1/1 .sup.a
Delivered as an approximate 1 hour infusion
[0395] Test Methods
[0396] The test and control article are administered at each dosing
as an intravenous infusion into a tail vein over approximately one
minute. Animals are weighed daily prior to dosing and prior to
necropsy. All animals are observed for signs of pharmacological
activity, behavioral changes, and toxicity immediately and one hour
after dosing. Recovery animals are also observed once daily during
the recovery period. The control animals are dosed with
approximately 6 mL/kg of D5W. The high, mid, and low dose test
article animals are administered dosages of approximately 24 mg/kg,
7.6 mg/kg, and 2.4 mg/kg, respectively.
[0397] Blood Collection
[0398] PK/TK: Blood samples for test article blood level analysis
are taken. Utilizing 18 male and 18 female medium dose animals,
approximately 0.3-0.5 mL of blood is taken from three male and
three female rats under anesthesia at each sampling time point of
pre-dose and at the end of injection (Time 0), and at approximately
0.08, 0.25, 0.5, 1, 2, 4, 8, 12, and 24 hours from the end of the
injection after the first and fifth dose. Blood sampling is via
retro-orbital bleeding or cardiac puncture bleeding for an animal's
terminal sample. Plasma (lithium heparin anticoagulant) samples are
prepared for analysis. General procedures for chemical pathology,
necropsy, and histopathology, as well as statistical methods, such
as those previously described, are followed.
Example 54
Phosphorylated and Total p53 Assay Protocol
[0399] A phosphorylated and total p53 assay protocol is described
as follows. On Day 1, cells are seeded at 2.times.10.sup.6 cells/10
cm dish/10 mL medium. On day two, cells are treated as follows:
control=0.05% DMSO (5 .mu.l DMSO stock/10 ml medium); 1 .mu.M test
compound (1 .mu.l Stock (10 mM)/10 ml medium); 2 .mu.M test
compound (2 .mu.l Stock (10 mM)/10 ml medium); 3 .mu.M test
compound (3 .mu.l Stock (10 mM)/10 ml medium); 4 .mu.M test
compound (4 .mu.l Stock (10 mM)/10 ml medium) and 5 .mu.M test
compound (5 .mu.l Stock (10 mM)/10 ml medium).
[0400] On Day 3, cells are harvested and attached and floating
cells are collected. Cells are washed twice with PBS, counted and
collected at 4.times.10.sup.6 cells/sample. The cell pellet is
frozen at -80.degree. C. until further use. On the same day or on
Day 4, cells are extracted using a cell extraction buffer (3 mL
cell extraction buffer, 300 .mu.l protease inhibitor and 10 .mu.l
0.3M PMSF). To each sample is added 200 .mu.l Buffer, and the
solution is vortexed and set on ice for 30 minutes, and
subsequently vortexed after every 10 mins. The solution is then
centrifuged at 13,000 rpm for 10 min, and 100 .mu.l supernatant per
tube are aliquoted and stored at -80.degree. C.
[0401] Assay preparation (Day 5). An anti-rabbit IgG HRP solution
is prepared by diluting 10 .mu.l of 100.times. concentrate solution
with 1 ml HRP diluent for each 8-well strip. A wash buffer solution
is prepared by diluting the original vial (.times.25) using
distilled water to make a .times.1 solution. Dilutions of p53
standard solution or p53 total solution are prepared as described
in Table 12. To ensure complete reconstitution, standard 1 is mixed
gently and allowed to sit for 10 minutes at room temperature.
TABLE-US-00018 TABLE 12 Conc. Standard Soln. Dilution Buffer
Standard 1 100 Units/ml Reconstitute 1 Vial worth 0.7 ml of
standard Dil. Buffer* Standard 2 50 Units/ml 250 .mu.l of Standard
1 250 .mu.l Standard 3 25 Units/ml 250 .mu.l of Standard 2 250
.mu.l Standard 4 12.5 Units/ml 250 .mu.l of Standard 3 250 .mu.l
Standard 5 6.25 Units/ml 250 .mu.l of Standard 4 250 .mu.l Standard
6 3.12 Units/ml 250 .mu.l of Standard 5 250 .mu.l Standard 7 1.6
Units/ml 250 .mu.l of Standard 6 250 .mu.l Standard 8 0 250
.mu.l
[0402] Test Procedure. Allow all solution to reach RT and mix
gently before use. Take out and insert 8-well strips. Add 100 .mu.l
of standard dilution buffer to standard 8 well (0 ng/ml/well or 0
Units/well). Add nothing to the chromogen blank well. Add 100 .mu.l
of standard or diluted sample to the appropriate microtiter wells.
Generally, the sample should be diluted with standard dilution
buffer at least 1:10 or greater. Each sample is run in duplicates.
Gently tap the side of the plate to thoroughly mix. Cover plate
with plate cover and incubate for 2 hours at RT or o/n at 4 C. Wash
wells with 400 .mu.l working wash buffer 4 times. Let soak for
15-30 sec., and then aspirate the liquid. After washing, the plate
is inverted and tapped dry on absorbance tissue. Add 100 .mu.l of
anti-p53 [pS15] or anti-p53 (total) (detection antibody) to each
well except chromogen blank. Tap gently to mix; cover plate and
incubate 1 hour at RT. Aspirate solution from wells thoroughly.
[0403] Wash wells with 400 .mu.l working wash buffer four times.
Let soak for 15-30 sec., and then aspirate the liquid. After
washing, the plate is inverted and tapped try on absorbance tissue.
Add 100 .mu.l of anti-rabbit IgG HRP working soln. to each well
except chromogen blank. Cover plate and incubate 30 min at RT. Wash
wells with 400 .mu.l working wash buffer four times. Let soak for
15-30 sec., and then aspirate the liquid. After washing, the plate
is inverted and tapped try on absorbance tissue. Add 100 .mu.l of
TMB (stabilized chromogen substrate) to each well and incubate for
30 min. at RT in the dark. The color will change to blue. Add 100
.mu.l Stop soln. Tap plate gently to mix. The color should change
to yellow. Read the plate at A450 nm by setting chromogen blank
(=100 .mu.l TMB+100 .mu.l Stop soln) as blank. Read absorbance
within 2 hours of assay completion.
Example 55
Caspase-3/7 Assay Protocol
[0404] A Caspase-3/7 assay protocol is described as follows. On Day
1, seed 0.015.times.10.sup.6 HCT-116 cells/50 ul/well. Incubate o/n
in 37.degree. C. CO.sub.2 incubator. On Day 2, remove 25 ul of
medium from wells. Treat HCT-116 cells with 1, 3, and 5 uM test
compound. Treat positive control group with Staurosporin 0.01, 0.1,
1 uM. Keep six negative control wells treated with medium only (add
25 ul of diluted sample to appropriate wells). Incubate for 24 h at
37.degree. C. in a CO.sub.2 incubator. On Day 3, prepare Apo-ONE
Homogeneous Caspase-3/7 assay reagent (Promega) at 10 ul reagent/1
ml buffer. Add 50 ul of diluted reagent. Incubate one hour at room
temp. Measure fluorescence at 485/520.
Example 56
Annexin V-Alexa 488 Staining Protocol
[0405] An Annexin V-Alexa 488 staining protocol is described as
follows. Seed 1.5-2.0.times.10.sup.6 HCT-116 cells/10 cm dish/10 ml
medium. Incubate o/n or up to 24 hrs at 37.degree. C. in CO.sub.2
incubator. The following day, treat cells with 1, 2, 3, 4 and 5
.mu.M test compound. Keep one or two untreated plates (medium only)
as control plates. The following controls are used: untreated
samples (no Alexa or propidium iodide), controls treated with
propidium iodide or Alexa 488 only, and controls treated with both
Alexa 488 and propidium iodide. Harvest cells (collect attached as
well as floating cells). Wash cells twice with cold PBS. Re-suspend
cells in 1.times. Annexin binding buffer.
[0406] Count cells and dilute in 1.times. Annexin binding buffer to
.about.1.times.10.sup.6 cells/0.1 ml, preparing a sufficient volume
to have 100 .mu.l per assay. Add 5 .mu.l of the Annexin V conjugate
to each 100 .mu.l of cell suspension. Add 4 .mu.l of propidium
iodide solution (stock=1 mg/ml) to each 100 .mu.l of cell
suspension. Incubate sample at RT for 15 minutes. Add 400 .mu.l
Annexin binding buffer, mix gently and keep samples on ice. Analyze
stained cells immediately by flow cytometry.
Example 57
DNA Cell Cycle Analysis Protocol
[0407] A DNA cell cycle analysis protocol is described as follows.
Seed 1.5-2.0.times.10.sup.6 cells/10 cm dish (seed one extra dish
for unstained cells). Incubate cells in 37.degree. C. humidified 5%
CO.sub.2 incubator for 24 hours. For synchronizing cells in a low
growth state to make cells quiescent, remove media and rinse once
with serum-free media, add 10 ml of serum-free media to each dish.
Incubate the cells for 24 hr in a 37.degree. C. humidified 5%
CO.sub.2 incubator. Remove media and add treatment (diluted in
serum contained media, 10 ml): 1-5 .mu.M test compound plus
control. Incubate the cells for 24 hr in a 37.degree. C. humidified
5% CO.sub.2 incubator.
[0408] To trypsinize/isolate cells, remove treatment. Add 3 ml
trypsin/EDTA solution. Keep floating cells and combine with
attached cells. Incubate for 5 min in a 37.degree. C. humidified 5%
CO.sub.2 incubator. Add 3 ml media (containing FBS) to wells and
pipette into centrifuge tube. Centrifuge at 1000 rpm for 5 minutes.
Decant supernatant and re-suspend pellet in 2-3 ml PBS. Count cells
and wash cells once by putting 2.times.10.sup.6 cells/tube, adding
2 ml PBS and centrifuging at 1000 rpm for 5 minutes. Re-suspend
pelleted cells in 0.3 ml cold PBS.
[0409] To fix cells, gently add 0.7 ml ice cold 70% ethanol drop
wise to tube containing 0.3 ml of cell suspension in PBS while
vortexing. Leave on Ice for one hour (or up to a few days at 4 C).
Centrifuge at 1000 rpm for 5 minutes. Wash one time with cold PBS
(1-2 ml). Centrifuge at 1000 rpm for 5 minutes. Re-suspend cell
pellet in 0.25 ml cold PBS, add 5 .mu.l of 10 mg/ml RNAse A (the
final concentration being 0.2-0.5 mg/ml). Incubate at 37 C for 1
hour. Add 10 .mu.l of 1 mg/ml of propidium iodide solution in
deionized water (the final concentration being 10 .mu.l/ml), and
keep in the dark and at 4.degree. C. until analysis. Analyze on
FACS by reading on cytometer at 488 nm. Cells may be stained with
propidium iodide on the same day of analysis.
Example 58
##STR00320##
[0411] Fluoroquinolone ester (4.57 g) and 2-aminoethylpyrrolidine
(3.0 ml) under an atmosphere of nitrogen were dissolved in
dichloromethane (100 ml). With vigorous stirring, aluminum chloride
(2.80 g) was added and the reaction stirred at room temperature for
a further 2 h. The resulting mixture was washed with dilute sodium
hydroxide and the organic layer separated and dried. The residue
was recrystallized from methanol to yield the fluoroquinolone (5.24
g) as a white fluffy solid. .sup.1H NMR (CDCl.sub.3) .delta. 9.54
(bs, 1H), 9.25 (s, 1H), 7.9 (dd, 1H), 7.6 (dd, 1H), 7.2 (m, 3H),
3.7 (t, 2H), 2.91 (t, 2H), 1.80 (brm, 4H), 1.7 (brm, 4H).
Example 59
##STR00321##
[0413] Fluoroquinolone (40 mg), 4-hydroxypiperidine (0.05 ml),
diisopropylethylamineamine (0.05 ml) and N-methylpyrrolidine were
mixed and heated at 190.degree. C. for 15 min in a microwave
reactor. The reaction was cooled, evaporated to a residue and
purified on a reverse phase C18 column using gradient elution using
0.1% TFA in water and acetonitrile to yield 6 mg of product
M+1.sup.+ 475. .sup.1H NMR (CDCl.sub.3) .delta. 10.03 (t, 1H), 9.23
(s, 1H), 7.92 (d, 1H), 7.55 (d, 1H), 7.21 (m, 1H), 7.16 (dt, 1H),
7.11 (m, 2H), 3.94 (m, 1H), 3.65 (q, 2H), 3.52 (brm, 2H), 3.01 (dt,
2H), 2.76 (t, 2H), 2.62 (brm, 2H), 2.12 (btm, 2H), 1.18 (brm,
6H).
Example 60
##STR00322##
[0415] Fluoroquinolone (40 mg), cyclopropylmethylamine (0.05 ml),
diisopropylethylamineamine (0.05 ml) and N-methylpyrrolidine were
mixed and heated at 190.degree. C. for 15 min in a microwave
reactor. The reaction was cooled, evaporated to a residue and
purified on a reverse phase C18 column using gradient elution using
0.1% TFA in water and acetonitrile to yield 17 mg of product
M+1.sup.+ 445. .sup.1H NMR (CDCl.sub.3) .delta. 10.11 (brt, 1H),
9.14 (s, 1H), 7.88 (d, 1H), 7.52 (dd, 1H), 7.19 (dt, 1H), 7.12 (m,
2H), 6.82 (d, 1H), 4.62 (t, 1H), 3.63 (q, 2H), 3.14 (t, 2H), 2.77
(t, 2H), 2.64 (brs, 4H), 1.81 (brm, 4H), 1.18 (m, 1H), 0.64 (m,
2H), 0.40 (m, 2H).
Example 61
##STR00323##
[0417] Fluoroquinolone (40 mg), cyclopropylamine (0.05 ml),
diisopropylethylamineamine (0.05 ml) and N-methylpyrrolidine were
mixed and heated at 190.degree. C. for 15 min in a microwave
reactor. The reaction was cooled, evaporated to a residue and
purified on a reverse phase C18 column using gradient elution using
0.1% TFA in water and acetonitrile to yield 38 mg of product
M+1.sup.+ 445. .sup.1H NMR (CDCl.sub.3) .delta. 10.40 (t, 1H), 9.02
(s, 1H), 7.91 (d, 1H), 7.20 (m, 2H), 7.12 (m, 2H), 7.14 (m, 1H),
6.80 (m, 1H), 3.82 (m, 6H), 3.40 (m, 4H), 2.56 (m, 2H), 0.85 (m,
4H), 0.70 (m, 1H).
Example 62
##STR00324##
[0419] Fluoroquinolone (40 mg), 2-(methyamino)methylmidazole (0.05
ml), diisopropylethylamineamine (0.05 ml) and N-methylpyrrolidine
were mixed and heated at 190.degree. C. for 15 min in a microwave
reactor. The reaction was cooled, evaporated to a residue and
purified on a reverse phase C18 column using gradient elution using
0.1% TFA in water and acetonitrile to yield 11 mg of product
M+1.sup.+ 485. .sup.1H NMR (CDCl.sub.3) .delta. 9.2 (s, 1H), 7.86
(d, 1H), 7.53 (d, 1H), 7.37 (d, 2H), 7.31 (m, 1H), 7.16 (m, 1H),
7.06 (d, 1H), 6.83 (d, 1H), 4.92 (t, 1H), 4.53 (d, 2H), 3.61 (q,
2H), 3.4 (s, 3H) 2.74 (t, 2H), 2.6 (m, 4H), 1.80 (m, 4H).
Example 63
##STR00325##
[0421] Fluoroquinolone (40 mg), benzylamine (0.05 ml),
diisopropylethylamineamine (0.05 ml) and N-methylpyrrolidine were
mixed and heated at 190.degree. C. for 15 min in a microwave
reactor. The reaction was cooled, evaporated to a residue and
purified on a reverse phase C18 column using gradient elution using
0.1% TFA in water and acetonitrile to yield 5 mg of product
M+1.sup.+ 481. .sup.1H NMR (CDCl.sub.3) .delta. 10.08 (t, 1H), 9.17
(s, 1H), 7.86 (d, 1H), 7.53 (d, 1H), 7.37 (d, 2H), 7.31 (m, 1H),
7.16 (m, 1H), 7.06 (d, 1H), 6.83 (d, 1H), 4.92 (t, 1H), 4.53 (d,
2H), 3.61 (q, 2H), 2.74 (t, 2H), 2.6 (m, 4H), 1.80 (m, 4H).
Example 64
##STR00326##
[0423] Fluoroquinolone (40 mg), aqueous dimethylamine (0.2 ml),
diisopropylethylamineamine (0.05 ml) and N-methylpyrrolidine were
mixed and heated at 190.degree. C. for 15 min in a microwave
reactor. The reaction was cooled, evaporated to a residue and
purified on a reverse phase C18 column using gradient elution using
0.1% TFA in water and acetonitrile to yield 5 mg of product
M+1.sup.+ 419. .sup.1H NMR (CDCl.sub.3) .delta.), 9.17 (s, 1H),
7.86 (d, 1H), 7.53 (d, 1H), 7.37 (d, 2H), 7.31 (m, 1H), 7.16 (m,
1H), 7.06 (d, 1H), 6.83 (d, 1H), 3.1 (t, 2H), 2.8 (s, 6H) 2.6 (t,
2H), 1.60 (t, 2H).
Example 65
##STR00327##
[0425] Fluoroquinolone (40 mg), aqueous dimethylamine (0.2 ml),
diisopropylethylamineamine (0.05 ml) and N-methylpyrrolidine were
mixed and heated at 190.degree. C. for 15 min in a microwave
reactor. The reaction was cooled, evaporated to a residue and
purified on a reverse phase C18 column using gradient elution using
0.1% TFA in water and acetonitrile to yield 2.5 mg of product
M+1.sup.+ 461. .sup.1H NMR (CDCl.sub.3) .delta.), 9.17 (s, 1H),
7.86 (d, 1H), 7.53 (d, 1H), 7.37 (d, 2H), 7.31 (m, 1H), 7.16 (m,
1H), 7.06 (d, 1H), 6.83 (d, 1H), 3.2 (m, 1H), 3.1 (m, 2H), 2.7 (m,
3H), 2.2 (m, 2H), 2.0 (m, 1H), 1.8 (m, 1H), 1.5 (m, 1H).
[0426] It is understood that the foregoing detailed description and
accompanying examples are merely illustrative, and are not to be
taken as limitations upon the scope of the invention. Various
changes and modifications to the disclosed embodiments will be
apparent to those skilled in the art. Such changes and
modifications, including without limitation those relating to the
chemical structures, substituents, derivatives, intermediates,
syntheses, formulations and/or methods of use of the invention, may
be made without departing from the spirit and scope thereof. U.S.
patents and publications referenced herein are incorporated by
reference.
Sequence CWU 1
1
29127DNAHomo sapiens 1tggggagggt ggggagggtg gggaagg 27237DNAHomo
sapiens 2gggggggggg gggcgggggc gggggcgggg gaggggc 37357DNAHomo
sapiens 3ggggggggac gcgggagctg ggggagggct tggggccagg gcggggcgct
taggggg 57428DNAHomo sapiens 4aggaagggga gggccggggg gaggtggc
28522DNAHomo sapiens 5aggggcgggg cggggcgggg gc 22625DNAHomo sapiens
6gggaggaagg gggcgggagc ggggc 25732DNAHomo sapiens 7ggggggcggg
ggcgggcgca gggggagggg gc 32823DNAHomo sapiens 8cggggcgggg
cgggggcggg ggc 23946DNAHomo sapiens 9agaggaggag gaggtcacgg
aggaggagga gaaggaggag gaggaa 461012DNAHomo sapiens 10ggaggaggag ga
121138DNAHomo sapiens 11agagaagagg ggaggaggag gaggagagga ggaggcgc
381213DNAHomo sapiens 12ggagggggag ggg 131327DNAHomo sapiens
13aggagaagga ggaggtggag gaggagg 271433DNAHomo sapiens 14aggaggagga
gaatgcgagg aggagggagg aga 331536DNAHomo sapiens 15ggggcgggcc
gggggcgggg tcccggcggg gcggag 361627DNAHomo sapiens 16cgggaggagg
aggaaggagg aagcgcg 271745DNAHomo sapiensPrimer 17agtctgactg
actgtacgta gctaatacga ctcactatag caatt 451899DNAHomo sapiensPrimer
18tccaactatg tatactgggg agggtgggga gggtggggaa ggttagcgac acgcaattgc
60tatagtgagt cgtattagct acgtacagtc agtcagact 991915DNAHomo sapiens
19tccaactatg tatac 152035DNAHomo sapiens 20ttagcgacac gcaattgcta
tagtgagtcg tatta 352180DNAHomo sapiens 21tatacggggt gggggaggga
gggattagcg acacgcaatt gctatagtga gtcgtattag 60ctacgtacag tcagtcagac
802286DNAHomo sapiens 22ttataccggg gcggggcggg ggcgggggct tagcgacacg
caattgctat agtgagtcgt 60attagctacg tacagtcagt cagact 862397DNAHomo
sapiens 23taggggcggg cgcgggagga agggggcggg agcggggctg ttagcgacac
gcaattgcta 60tagtgagtcg tattagctac gtacagtcag tcagact 972497DNAHomo
sapiens 24ttagagaaga ggggaggagg aggaggagag gaggaggcgc ttagcgacac
gcaattgcta 60tagtgagtcg tattagctac gtacagtcag tcagact 972599DNAHomo
sapiens 25tccaactatg tatactgggg agggtgggga gggtggggaa ggttagcgac
acgcaattgc 60tatagtgagt cgtattagct acgtacagtc agtcagact
992699DNAHomo sapiens 26tccaactatg tatacccttc cccaccctcc ccaccctccc
cattagcgac acgcaattgc 60tatagtgagt cgtattagct acgtacagtc agtcagact
992795DNAHomo sapiens 27tcatatatga ctacttaggg ttagggttag ggttagggtt
actgccacgc aattgctata 60gtgagtcgta ttagctacgt acagtcagtc agact
952889DNAHomo sapiens 28atgatcaccg ggaggaggag gaaggaggaa gcgcgctgcc
acgcaattgc tatagtgagt 60cgtattagct acgtacagtc agtcagact
892945DNAHomo sapiensPrimer 29agtctgactg actgtacgta gctaatacga
ctcactatag caatt 45
* * * * *