U.S. patent application number 12/174215 was filed with the patent office on 2009-08-27 for modified cpg oligodeoxynucleotide with improved immunoregulatory function.
This patent application is currently assigned to Yonsei University. Invention is credited to Hyun Chul Cho, Soo Kie Kim, Seung Kyu Park, Su Jung Park.
Application Number | 20090214530 12/174215 |
Document ID | / |
Family ID | 34737983 |
Filed Date | 2009-08-27 |
United States Patent
Application |
20090214530 |
Kind Code |
A1 |
Kim; Soo Kie ; et
al. |
August 27, 2009 |
MODIFIED CpG OLIGODEOXYNUCLEOTIDE WITH IMPROVED IMMUNOREGULATORY
FUNCTION
Abstract
The present invention relates to a modified CpG
oligodeoxynucleotide (ODN) which is prepared by coupling a
consecutive sequence of deoxyribothymine (dT) to the 3'-terminus of
CpG ODN having immunoregularory function, thereby improving
immunoactivity of splenocytes, macrophages and peripheral
mononuclear cells, and therefore, can be effectively used as a
vaccine adjuvant for preventing and treating hepatitis B or an
anticancer agent. Since the phosphorothioate CpG ODN having the
consecutive sequence of dT at its 3'-terminus shows high activity
inducing Th-1 immune response and does not elicit in vivo toxicity
with guaranteeing its safety, it can be effectively used as a
vaccine adjuvant.
Inventors: |
Kim; Soo Kie; (Wonju-si,
KR) ; Park; Seung Kyu; (Suwon-si, KR) ; Park;
Su Jung; (Wonju-si, KR) ; Cho; Hyun Chul;
(Wonju-si, KR) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER;LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
Yonsei University
Seoul
KR
|
Family ID: |
34737983 |
Appl. No.: |
12/174215 |
Filed: |
July 16, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10920181 |
Aug 18, 2004 |
7408050 |
|
|
12174215 |
|
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/141.1; 514/44R |
Current CPC
Class: |
A61K 39/292 20130101;
A61K 39/12 20130101; A61P 1/16 20180101; A61P 35/00 20180101; A61K
39/39 20130101; A61K 2039/55561 20130101; C12N 2730/10134 20130101;
A61P 31/20 20180101; A61P 31/14 20180101; A61K 2039/55505
20130101 |
Class at
Publication: |
424/133.1 ;
514/44.R; 424/141.1 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; A61K 39/395 20060101 A61K039/395; A61P 35/00 20060101
A61P035/00 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 8, 2004 |
KR |
2004-1161 |
Claims
1-8. (canceled)
9. A method for treating cancer in a patient comprising: a)
administering to a patient a structurally modified
oligodeoxynucleotide (ODN) having immunoactivity and a CpG motif
and consisting of the nucleotide sequence of SEQ ID NO: 5, wherein
the ODN has a consecutive sequence of 4 deoxyribothymines (dT) at
the 3'-terminus of ODN, which is modified by changing the
phosphodiester bonds into phosphorothioated bonds; b) allowing the
composition to increase immunoactivity of splenocytes, macrophages
or peripheral blood mononuclear cells thereby treating the
cancer.
10. A method for treating cancer in a patient comprising: a)
administering to a patient a structurally modified
oligodeoxynucleotide (ODN) having immunoactivity and a CpG motif
and comprising the nucleotide sequence of SEQ ID NO: 5, wherein the
ODN has a consecutive sequence of 4 deoxyribothymines (dT) at the
3'-terminus of ODN, which is modified by changing the
phosphodiester bonds into phosphorothioated bonds; b) allowing the
composition to increase immunoactivity of splenocytes, macrophages
or peripheral blood mononuclear cells thereby treating the
cancer.
11. A method for increasing immunoactivity of splenocytes,
macrophages or peripheral blood mononuclear cells in a patient
comprising: a) administering to a patient a structurally modified
oligodeoxynucleotide (ODN) having immunoactivity and a CpG motif
and consisting the nucleotide sequence of SEQ ID NO: 5, wherein the
ODN has a consecutive sequence of 4 deoxyribothymines (dT) at the
3'-terminus of ODN, which is modified by changing the
phosphodiester bonds into phosphorothioated bonds; b) allowing the
composition to increase immunoactivity of splenocytes, macrophages
or peripheral blood mononuclear cells.
12. A method for increasing immunoactivity of splenocytes,
macrophages or peripheral blood mononuclear cells in a patient
comprising: a) administering to a patient a structurally modified
oligodeoxynucleotide (ODN) having immunoactivity and a CpG motif
and comprising the nucleotide sequence of SEQ ID NO: 5, wherein the
ODN has a consecutive sequence of 4 deoxyribothymines (dT) at the
3'-terminus of ODN, which is modified by changing the
phosphodiester bonds into phosphorothioated bonds; b) allowing the
composition to increase immunoactivity of splenocytes, macrophages
or peripheral blood mononuclear cells.
13. The method of claim 9, wherein the ODN is administered in
combination with a monoclonal antibody.
14. The method of claim 13, wherein the monoclonal antibody is
trastuzumab or rituximab.
15. The method of claim 9, wherein the patient has melanoma,
lymphoma, colon cancer, or breast cancer.
16. The method of claim 10, wherein the ODN is administered in
combination with a monoclonal antibody.
17. The method of claim 16, wherein the monoclonal antibody is
trastuzumab or rituximab.
18. The method of claim 10, wherein the patient has melanoma,
lymphoma, colon cancer, or breast cancer.
19. The method of claim 11, wherein the ODN is administered in
combination with a monoclonal antibody.
20. The method of claim 19, wherein the monoclonal antibody is
trastuzumab or rituximab.
21. The method of claim 11, wherein the patient has melanoma,
lymphoma, colon cancer, or breast cancer.
22. The method of claim 12, wherein the ODN is administered in
combination with a monoclonal antibody.
23. The method of claim 22, wherein the monoclonal antibody is
trastuzumab or rituximab.
24. The method of claim 12, wherein the patient has melanoma,
lymphoma, colon cancer, or breast cancer.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a modified CpG
oligodeoxynucleotide (ODN) with improved immunoregulatory
functions. In particular, the present invention relates to the
modified CpG ODN which is prepared by coupling a consecutive
sequence of deoxyribothymine (dT) to the 3'-terminus of CpG ODN
having immunoregularory function, leading to improved
immunoactivity of splenocytes, macrophages and peripheral
mononuclear cells, and therefore, can be effectively used as a
vaccine adjuvant for preventing and treating hepatitis B or an
anti-cancer agent.
BACKGROUND OF THE INVENTION
[0002] Vertebrate animals can suppress expression of CpG
dinucleotide in their genomic DNA sequence or have a cytosine
residue of the expressed CpG dinucleotide methylated (Krieg, Ann.
Rev. Immunol., 2002, 20, 709; McClelland & Ivarie, Nucleic
Acids Res. 1982, 23, 78). Meanwhile, a microbial CpG dinucleotide
is expressed at a normal rate and not methylated, and therefore it
enables to detect microbial infection in vertebrates using the
difference in the levels of the expressed CpG dinucleotide between
vertebrate animals and microorganisms.
[0003] A microbial genomic DNA is recognized by dendritic cells or
B cells expressing the TLR9 via toll-like receptor 9 (TLR9), a
pattern recognition receptor, and eventually activates an innate
immune system of a host cell. The innate immune system is endowed
with a mechanism for removing cancer cells as well as a self
defense mechanism against microbial or parasitic infections, and
thus it is expected to develop a carcinostatic immunological
adjuvant capable of inducing anti-cancer activity of an immune
system by properly modifying the CpG ODN.
[0004] Studies for activating immune system using the CpG ODN have
been actively progressed for the past few decades. The CpG ODN
contains at least four bases at both 5'- and 3'-termini with
reference to the CpG dinucleotide as the center, and immunoactivity
of the CpG ODN is characterized by the base sequence. The CpG ODN
is subdivided into two groups, K type and D type. K type ODN
stimulates myeloid lineage cells and B cells thus resulting in
their proliferation or secretion of immunoglobulin M or IL-6
(Klinman et al., Microbes Infect., 2002, 897-901). On the other
hand, D type ODN activates monocytes to be differentiated into
dendritic cells or stimulates natural killer cells to secrete IL-6
(Klinman et al., Eur. J. Immunol., 2002, 32, 2617-22; Gursel et
al., J. Leukoc. Biol., 71, 813-20, 2002). Further, the D type ODN
activates B220.sup.+ dendritic cells to produce IFN-.alpha. while
TLR9.sup.+ B220.sup.+ dendritic cells release IL-12 in response to
D type ODN. These results suggest that there might be several
pathways to improve immune activity of the CpG ODN by stimulating
specific immunocytes (Hemuni et al., J. Immunol., 2003, 170,
3059-3064; Kerkman et al., J. Immunol., 2003, 170, 4465-4474).
[0005] Various types of CpG ODNs have been designed to redirect the
pathologic condition such as infection, autoimmune disease and
cancer. Of these, the strategy toward the development of
immunotherapeutic CpG ODN against cancer can rely upon effector
cells mainly stimulated by CpG ODN. To augment cell-mediated
immunity using CpG ODN, the following two methods are commonly
exploited.
[0006] The first method is to augment a local or systemic immunity
via an activation of naive or professional dendritic cells. Cancer
cells down-regulate their antigen presentation capabilities to
escape an immune surveillance system of a host cell, thereby
enabling to survive in the host cell taking advantage of the fact
that host cytotoxic T cells are unable to recognize them. To solve
this problem, there has been developed a method that immunizes a
host with a strong immunogenic peptide in a cancer antigen together
with the CpG ODN as an immune adjuvant. By this method, the
dendritic cells with high antigen presentation activity can uptake
the peptide of cancer antigen and when activated by the CpG ODN,
leading to activating cytotoxic T cells. The activated cytotoxic T
cells can then effectively eliminate the cancer cells. It has been
reported that this method can kill RMA from a mouse (Stem et al.,
J. Immunol., 2002, 168, 6099-6105). IFN-.gamma. plays an important
role in these immune responses. Although this is not done through
activation of dendritic cells, it still enables to activate
anti-cancer immunity same as in the mechanism of dendritic cells by
rendering CpG ODN 2006 to directly work on B cells as well as to
increase the expression of a costimulator which can induce an
interaction between B and T cells (Jahrsdorfer et al., J. Leukoc.
Biol., 2001, 69, 8148).
[0007] The other method is to augment innate immunity via
activation of natural killer cells. It is possible to activate
cytotoxic T cells by activating dendritic cells by introducing a
cancer antigen from the outside, but it is essential to present the
cancer antigen on the surface of MHC class I molecule for eliciting
cytotoxicity from cytotoxic T cells. However, in many cases the
level of presenting caner antigens on the surface of cancer cells
is too low to elicit cytotoxicity from cytotoxic T cells, and
therefore the method for removing cancer cells by activating the
dendritic cells often becomes ineffective. To overcome this
limitation, it has been suggested to activate natural killer cells
which exert cytotoxicity regardless of cancer antigen presentation
on the surface of a cancer cell. Further, the activated natural
killer cells activate monocytes or macrophages, leading to
activation of antigen-independent anticancer immune system. It has
been reported that CpG ODN 1584 administration in vivo blocks the
metastasis of NK sensitive B16.F1 melanoma whereas CpG ODN 1826
injection effectively rejects NK resistant EL4 lymphoma in an in
vivo-mouse tumor model using the above method (Ballas et al., J.
Immunol., 2001, 167, 48784886). Further, when ODN 1826 was directly
injected into a tumorigenic lesion after induction of C26 colon
carcinoma mass in BALB/C mice, the size of the tumor was markedly
decreased. This data shows that peritumoral CpG ODN monotherapy
elicits a strong CD8 T cell response and innate effector mechanisms
that seem to act in concert to overcome unresponsiveness of the
immune system toward a growing tumor. (Heckelsmiller et al., J.
Immunol., 2002, 169, 3892-3899). In contrast, it is difficult to
eliminate the murine 38C13 B cell lymphoma in vivo by means of CpG
ODN monotherapy. However, if a monoclonal antibody specific to
38C13 lymphoma antigen is treated with the CpG ODN, the activated
natural killer cell is capable of efficiently removing 38C13
lymphoma by exerting antibody-dependent cell cytotoxicity
(Woodridge et al., Blood, 1997, 89, 2994-2998).
[0008] Meanwhile, humoral immunity against cancer can be induced by
using an antigen or an equivalent thereof together with the CpG ODN
as an immunostimulant. Trastuzumab and rituximab have been known as
commercial monoclonal antibodies specific to HER-2 protein
over-expressing cancer cell and non-Hodgkins B cell lymphoma,
respectively. Recently, the combination therapy with the CpG ODN
plus tumor antigen specific antibody demonstrated the potent tumor
rejection preclinically and is now entering into clinical trials.
(Jahrsdorfer et al., Sem. Oncol., 2003, 30, 476-482).
[0009] The CpG ODN has strong innate immunoactivity due to the
nucleotide sequences containing CpG dinucleotides present at 5'-
and 3'-termini. However, since the CpG ODN itself is of a wild-type
structure having no difference from a structure of in vivo DNA
molecule, it does not show any cytotoxicity. However, there is a
disadvantage in the CpG ODN that it is easily degraded in vivo due
to its wild-type structure, consequently leading to reducing
half-life of immunoactivity. Although it is possible to increase a
daily dosage of CpG ODN to overcome this drawback, it is not
economical. It has been reported that when a phosphodiester bond
known as a backbone of DNA molecule is changed into a
phosphorothioate bond during the synthesis of CpG ODN,
immunoactivity of the CpG ODN is amplified about 10 to 100-folds
(Sester et al., J. Immunol., 2000, 165, 41654173). However, this
method has the problems of bringing about cytotoxic effects to
immune cells as well as changes in immunoactivity of the CpG due to
a modification in backbone. Therefore, it is unclear whether this
method would be optimal to structural modification of CpG ODNs.
[0010] The CpG ODN shows species-specificity and there has been no
report that the CpG ODN shows a high immunoactivity in humans
comparable to that it has shown in experimental animals. Further,
since the action mechanism of CpG ODN is still unknown, it is hard
to develop potent immunotherapeutic CpG ODN to target human immune
cells. Consequently, there is very rare CpG ODN for a clinical
trial. These limitations necessitate the development of CpG ODN
either with superior immune-stimulating activity or lower side
effects comparing to the existent CpG ODN.
[0011] The present inventors devised the simple method to solve the
above problems. That is, a modified CpG ODN was prepared by
coupling a consecutive sequence of deoxyribothymine (dT) to the
3'-terminus of CpG ODN, thus improving immunoactivity of
splenocytes, macrophages and peripheral mononuclear cells, and
therefore, can be effectively used as a vaccine adjuvant for
preventing and treating hepatitis B or an anticancer agent.
SUMMARY OF THE INVENTION
[0012] Accordingly, an object of the present invention is to
provide a modified CpG ODN having an improved immunoregulatory
function.
[0013] Another object of the present invention is to provide a
vaccine adjuvant or an anti-cancer agent comprising a modified CpG
ODN as an effective ingredient.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The above and other objects and features of the present
invention will become apparent from the following description of
the invention, when taken in conjunction with the accompanying
drawings, wherein
[0015] FIG. 1 shows the results of examination whether the CpG ODN
of the present invention induces proliferation of BALB/C mouse
macrophages (A) and splenocytes (B) in vitro;
[0016] FIG. 2a shows the results of examination whether the CpG ODN
of the present invention induces expression of Th1 type cytokine
mRNA of Balb/c mouse peritoneal macrophages in vitro;
[0017] FIG. 2b shows the results of examining whether the CpG ODN
of the present invention induces expression of Th1 type cytokine
mRNA of BALB/C peritoneal macrophages in vivo;
TABLE-US-00001 M: maker; 1: no treatment; 2: 0.6 .mu.g/ml KSK-1; 3:
0.6 .mu.g/ml KSK-2; 4: 0.6 .mu.g/ml KSK-7; 5: 0.6 .mu.g/ml KSK-12;
6: 0.6 .mu.g/ml KSK-13; 7: 0.1 .mu.g/ml LPS
[0018] FIG. 3a shows the results of examining whether the CpG ODN
of the present invention induces expression of Th1 type cytokine
mRNA of BALB/C mouse splenocytes in vitro;
[0019] FIG. 3b shows the results of examining whether the CpG ODN
of the present invention induces expression of Th1 type cytokine
mRNA of BALB/C mouse splenocytes in vivo;
TABLE-US-00002 M: marker; 1: 0.6 .mu.g/ml CpG ODN; 2: 0.6 .mu.g/ml
KSK-1; 3: 0.6 .mu.g/ml KSK-2; 4: 0.6 .mu.g/ml KSK-7; 5: 0.6
.mu.g/ml KSK-12; 6: 0.6 .mu.g/ml KSK-13; 7: 0.1 .mu.g/ml LPS
[0020] FIG. 4a shows the results of examining whether the CpG ODN
of the present invention induces expression of B7.2 costimulatory
molecule of mouse peritoneal macrophages;
[0021] FIG. 4b shows the results of examining whether the CpG ODN
of the present invention induces expression of MHC Class I molecule
in mouse peritoneal macrophages;
[0022] FIG. 5a shows the results of examining whether the CpG ODN
of the present invention induces expression of B7.2 costimulatory
molecule in mouse splenocytes;
[0023] FIG. 5b shows the results of examining whether the CpG ODN
of the present invention induces expression of MHC Class I molecule
in mouse splenocytes;
[0024] FIG. 6a shows the lysis level of YAC-1 cell susceptible to a
natural killer cell when cytotoxicity of the natural killer cell
contained in splenocytes is augmented by treating the splenocytes
with the CpG ODN of the present invention;
[0025] FIG. 6b shows the lysis level of K562 cell susceptible to a
natural killer cell when cytotoxicity of the natural killer cell
contained in human peripheral blood mononuclear cells is augmented
by treating the human peripheral blood mononuclear cells with the
CpG ODN of the present invention;
[0026] FIG. 7 shows lung metastasis inhibitory effect of the CpG
ODN of the present invention on B16 melanoma tumor bearing
mice;
[0027] FIG. 8 shows the results of comparing survival prolongation
effects of various CpG ODNs on ELA metastasized-C57BL/6 mice;
and
[0028] FIG. 9 shows the results of cytotoxicity of natural killer
cells which are activated by the CpG ODN of the present
invention.
DETAILED DESCRIPTION OF THE INVENTION
[0029] The present invention provides a modified CpG ODN showing
immunoactivity and containing a CpG motif, wherein a consecutive
sequence of dT is coupled to the 3'-terminus of ODN.
[0030] Further, the present invention provides a use of the
modified CpG ODN as a vaccine adjuvant or an anti-cancer agent.
[0031] Hereinafter, the present invention is described in
detail.
[0032] The present invention relates to the modified CpG ODN which
is prepared by coupling a consecutive sequence of dT to the
3'-terminus of CpG ODN having immunoregularory function, leading to
improve the immunoactivity of splenocytes, macrophages and
peripheral blood mononuclear cells, and therefore, can be
effectively used as a vaccine adjuvant for preventing and treating
hepatitis B or an anti-cancer agent.
[0033] Hereinafter, the term "ODN" means an oligodeoxynucleotide
having 11 to 26 nucleotides in length which is capable of
activating an immune response. In particular, the term "CpG ODN"
means an oligodeoxynucleotide having a CpG motif (5'-purine purine
CpG pyrimidine pyrimidine-3') which shows immunoregularory
function. The term "a consecutive sequence of dT" means a form of
successively coupling at least 4 deoxyribothymines to the CpG ODN
by a phosphodiester bond.
[0034] The CpG ODNs used in the present invention are artificially
synthesized by MetaBion (Germany), wherein all phosphodiester bonds
are replaced by phosphorothioate bonds. After the synthesized CpG
ODNs are subjected to HPLC (high-pressure liquid chromatography)
and NAP purification procedures to maintain high purity, they are
provided in a freeze-dried state. The nucleotide sequences of the
CpG ODNs used in the present invention are shown in Table 1.
TABLE-US-00003 TABLE 1 SEQ ID No Nucleotide Name (Code name)
sequence (5' to 3') 1982 1 (KSK-1) TCCAGGACTTCTCTCAGGTT 1826 2
(KSK-2) TCCATGACGTTCCTGACGTT 2006fG6run 3 (KSK-7)
TCGTCGTTTTGTCGTTTTGTCGTTGGG GGG 2006 4 (KSK-12)
TCGTCGTTTTGTCGTTTTGTCGTT 2006f 5 (KSK-13)
TCGTCGTTTTCGTCGTCGTTTT
[0035] When a backbone of the ODN is formed by a natural
phosphodiester bond, it can be easily degraded by an attack of in
vivo nuclease. In order for the CpG ODN with anti-cancer
immunoactivity to exhibit a proper immunological effect, it is
essential to increase its dose or modify its structure to avoid the
above-mentioned attack by a nuclease. The CpG ODN of the present
invention has a structure where its backbone is formed by a
phosphorothioate bond, thus avoiding nuclease's attack while
extending its in vivo half-life. However, a safety problem, when
CpG ODN is administered in vivo, may be occurred in a non-specific
immune response caused by the phosphorothioate bond itself. Thus,
the present inventors examined the safety of the phosphorothioate
bond by administering 50 .mu.g of the CpG ODN having the
phosphorothioate bond, pre-treated with aluminum hydroxide, along
with other antigen such as gDE2t derived from CHO cell into a
mouse. The result showed that there was no abnormal finding such as
granuloma and necrosis at the injection site of the mouse, thus
proving the safety of CpG ODN having the phosphorothioate bond.
[0036] The CpG ODN of the present invention activates myeloid
lineaged cells to secrete proinflammatory and Th1 type cytokines,
and eventually augments anti-cancer immunity. CpG ODN candidates
were selected by primary screening using myeloid cell lines such as
U-937, RAW264.7 and THP-1. Since the above cell lines may elicit a
different immune response from primary cell lines to be targeted by
the CpG ODN of the present invention, the inventors of the present
invention examined the impact of the CpG ODN of the present
invention on fresh murine splenocytes and peritoneal macrophages.
The result showed that the CpG ODN significantly enhanced the
levels of TNF-.alpha., IL-6, IL-12 and IFN-.gamma. mRNA expression
and upregulated expression of MHC class II and B7.2 proteins on the
surface of macrophages. These results showed that the CpG ODN of
the present invention has a superior anti-cancer immunoactivity as
compared with the activity of control natural killer cells present
in mouse splenocytes and human peripheral blood mononuclear
cells.
[0037] Accordingly, the CpG ODN of the present invention can be
effectively used as a vaccine adjuvant, in particular, for
preventing and treating hepatitis B. Here, it is preferable to
administer an antigen for inducing an immune response and the CpG
ODN twice or three times at intervals of from 2 to 4 week with a
dose of ranging from 50 to 5,000 .mu.g/kg body weight,
respectively. Further, the ratio of the CpG ODN to the antigen is
preferable to be in the range of from 5:1 to 4:1. The antigen may
be immunized alone or together with aluminum hydroxide as a
pharmaceutically acceptable vaccine adjuvant, and can be
administered via an intramuscular injection or a subcutaneous
injection.
[0038] The following Examples are given for the purpose of
illustration only, and they should not be construed as limiting the
scope of the present invention.
EXAMPLES
Example 1
Preparation of CpG ODN Having a Consecutive Sequence of dT at
3'-terminus
[0039] CpG ODNs used in the present invention are artificially
synthesized by MetaBion (Germany), wherein all phosphodiester bonds
were replaced with phosphorothioate bonds. The synthesized CpG ODNs
provided to us was in a freeze-dried state which went through HPLC
(high-pressure liquid chromatography) and NAP purification
procedures to maintain high purity. The nucleotide sequences of the
CpG ODNs used in the present invention are shown in Table 1.
Example 2
Effect of CpG ODN on Proliferation of Mouse Splenocytes and
Macrophages
[0040] The CpG ODNs synthesized in Example 1, which are expected to
have anti-cancer immunoactivity, and the CpG ODNs, which have been
already confirmed to have anti-cancer immunoactivity, were
investigated whether they can induce cell proliferation when they
are applied to mouse splenocytes and peritoneal macrophages,
respectively, according to the following experiment.
[0041] 1.5 ml of 3% thioglycholate was injected into a peritoneal
cavity of BALB/C mouse. After 3 days of the injection, peritoneal
cavity of the mouse was washed with a phosphate buffer solution
supplemented with 2% fetal bovine serum and then collected. After
washing further with Hanks' Buffered Salt Solution(HBSS) buffer
solution twice, mouse peritoneal cavity macrophages were prepared
in Dulbecco's Modification of Eagle's Medium(DMEM) supplemented
with 10% fetal bovine serum.
[0042] Spleen was extracted from BALB/C mouse, homogenized into a
unit of monocyte, centrifuged at 2,000 rpm for 5 min and its
supernatant was discarded. A cell pellet was mixed with 0.84%
ammonium chloride for lysis of red blood cells and washed with RPMI
1640 twice to obtain mouse splenocytes.
[0043] After 5.times.10.sup.4 cells of the splenocytes and
macrophages prepared above were treated with 0.6 .mu.g/ml each of
KSK-1, KSK-2, KSK-7, KSK-12 and KSK-13, and 0.1 .mu.g/ml of LPS for
24, 48 and 72 hrs, respectively, they were cultured in RPMI 1640
supplemented with [.sup.3H] thymidine for 6 hrs. The activated
splenocytes were allowed to take in [.sup.3H] thymidine from the
medium during their proliferation. After removing the medium, the
splenocytes were washed with the same medium without [.sup.3H]
thymidine, and the amount of [.sup.3H] thymidine taken by the
splenocytes was measured using a radiation detector.
[0044] In (A) of FIG. 1, the CpG ODNs were treated for 72 hrs in
order to induce the proliferation of macrophages. KSK-13 among them
showed higher proliferation than other CpG ODNs including KSK-2
known as inducing the highest immunoactivity, and also showed a
statistically significant effect for inducing proliferation as
compared with that of a control (no treatment) or KSK-1, a non-CpG
ODN.
[0045] Further, as shown in (B) of FIG. 1, the effect of CpG ODN of
the present invention for inducing proliferation of mouse
splenocytes was significantly greater than that of other CpG ODNs
for mouse macrophages. In order to induce proliferation of
splenocytes, the splenocytes were treated with the CpG ODN for 48
hrs. When the CpG ODN was treated for 72 hrs, the proliferation
level of splenocytes was decreased. The effect of KSK-13 for
inducing proliferation of splenocytes showed a slightly lower mean
value than that of KSK-2, which is known effective in a mouse, but
the difference was statistically insignificant.
Example 3
Effect of CpG ODN on Th1 Type cytokine mRNA Expression of Mouse
Peritoneal Macrophages
[0046] Based on that KSK-13 can induce proliferation of mouse
peritoneal macrophages as shown in Example 2, the present inventors
investigated the mRNA expression of the proinflammatory or Th1 type
cytokine release induced by KSK-13. These cytokines may contribute
to anti-cancer immune defense. The detailed experimental methods
are as follows.
[0047] Mouse peritoneal macrophages were prepared same as in
Example 2. 1.times.10.sup.6 cells of macrophages were treated with
0.6 .mu.g/ml of CpG ODN for 12 hrs. Total RNA was isolated from the
treated cells using TRIzol.RTM. reagent (Life Technology), and its
concentration was determined by measuring its absorbance. RT-PCR
was carried out to synthesize cDNA using MMLV reverse transcriptase
(Promega) with 1 .mu.g of the total RNA as a template RNA. Then,
PCR was conducted using the synthesized cDNA as a template
according to the reaction conditions in Table 2 to amplify
TNF-.alpha., IL-6, IL-12 and IFN-.gamma., respectively.
TABLE-US-00004 TABLE 2 TNF-.alpha. IL-6 IL-12 IFN-.gamma. Reaction
95.degree. C., 1 cycle 95.degree. C., 1 cycle 95.degree. C., 1
cycle 95.degree. C., 1 cycle Conditions 5 min 5 min 5 min 5 min
95.degree. C., 30 cycle 95.degree. C., 35 cycle 95.degree. C., 30
cycle 95.degree. C., 33 cycle 50 sec 50 sec 60 sec 50 sec
53.degree. C., 55.degree. C., 65.degree. C., 60.degree. C., 50 sec
60 sec 60 sec 50 sec 72.degree. C., 72.degree. C., 72.degree. C.,
72.degree. C., 90 sec 90 sec 120 sec 90 sec 72.degree. C., 1 cycle
72.degree. C., 1 cycle 68.degree. C., 1 cycle 72.degree. C., 1
cycle 8 min 8 min 8 min 8 min
[0048] The resulting PCR products were analyzed on a 1% agarose gel
to compare the expression levels of each cytokine mRNA under each
reaction condition.
[0049] Further, .beta.-Actin, a constituitively expressed protein,
was used as a control to confirm whether a constant level of PCR
products are obtained in the above PCR reaction conditions and the
result showed that an equal level of PCR products were obtained in
each reaction condition thus showing that the difference in
thickness of PCR products visualized on the gel was not due to a
procedural error in cDNA preparation.
[0050] As shown in FIG. 2a, KSK-13 increased the levels of
TNF-.alpha., IL-6 and IL-12 mRNA expression in vitro, similar to
KSK-2 which highly activates immunocytes of a mouse. This
difference became greater in vivo thus suggesting that KSK-13
exerts anti-cancer immunoactivity under in vivo condition (FIG.
2b).
Example 4
Effect of CpG ODN on Th1 Type Cytokine mRNA Expression of Mouse
Splenocytes
[0051] It was found that KSK-13 can induce proliferation of mouse
splenocytes in Example 2. Thus, the present inventors investigated
the amount of cytokine secretion induced by KSK-13 which is
involved in anti-cancer immunity in these cells as follows.
[0052] Mouse splenocytes were prepared same as in Example 2.
1.times.10.sup.6 cells of splenocytes were treated with 0.6
.mu.g/ml of CpG ODN for 12 hrs. Total RNA was isolated from the
treated cells using TRIzol.RTM. reagent (Life Technology), and its
concentration was determined by measuring its absorbance. RT-PCR
was carried out to synthesize cDNA using MMLV reverse transcriptase
(Promega) with 1 .mu.g of the isolated RNA as a template. Then, PCR
was conducted using the synthesized cDNA as a template according to
the reaction conditions described in Table 2, to amplify
TNF-.alpha., IL-6, IL-12 and IFN-.gamma., respectively.
[0053] PCR products were analyzed on a 1% agarose gel to compare
the levels of each cytokine mRNA expression under each reaction
condition.
[0054] Further, .beta.-Actin, a constituitively expressed protein,
was used as a control to confirm whether a constant level of PCR
products are obtained in the above PCR reaction conditions and the
result showed that an equal level of PCR products were obtained in
each reaction condition thus showing that the difference in
thickness of PCR products visualized on the gel was not due to a
procedural error in cDNA preparation.
[0055] As shown in FIG. 3a, KSK-13 increased the levels of
TNF-.alpha., IL-6 and IL-12 mRNA expression in the splenocytes in
vitro, similar to KSK-2 which highly activates immunocytes of a
mouse. This difference became greater in vivo, thus suggesting that
KSK-13 exerts anti-cancer immunoactivity under in vivo condition
(FIG. 3b).
Example 5
Effect of CpG ODN on Expression of Signal Transfer Molecule of
Mouse Peritoneal Macrophages
[0056] To investigate whether KSK-13 capable of activating mouse
peritoneal macrophages in vitro can also activate them in vivo, the
following experiment was carried out.
[0057] The CpG ODN was injected into a peritoneal cavity of BALB/C
mouse with 3% thioglycolate. After 48 hrs of the injection, mouse
peritoneal macrophages were prepared same as in Example 2. The
cells were labeled with FITC-conjugated anti-B7.2 monoclonal
antibody or anti-MHC class II monoclonal antibody and analyzed
using a flow cytometer. In FIG. 4, a control means a non-treatment
group; KSK-1, KSK-2, KSK-7, KSK-12 and KSK-13 were treated at a
concentration of 0.6 .mu.g/ml, respectively; and LPS was treated at
a concentration of 0.1 .mu.g/ml.
[0058] B7.2 molecule is a supplementary stimulating molecule whose
expression level is increased when macrophages are activated. In
case of the non-treatment group, the expression level of B7.2
molecule in the peritoneal macrophages was 2.9% within the standard
deviation, but that of KSK-13 of the present invention was 14.2%.
This was an activation rate similar to the expression level of the
typical mouse CpG ODN, KSK-2 (i.e., 16.3%), or that of the human
CpG ODN, KSK-12 (i.e. 17.3%), and significantly different from that
of the non-CpG ODN, KSK-1 (i.e., 5.1%) (FIG. 4a).
[0059] MHC class II molecule plays a key role in antigen
presentation of macrophages, and its expression level becomes
increased together with B7.2 molecule when macrophages are
activated. In the non-treatment group, the expression level of MHC
class II molecule in the peritoneal macrophages was 26.5% within
the standard deviation, but that of KSK-13 of the present invention
was 33.7%. This was an activation rate similar to the expression
level of the typical mouse CpG ODN, KSK-2 (i.e. 35.8%), or that of
the human CpG ODN, KSK-12 (i.e. 30.2%), and significantly different
from that of the non-CpG ODN, KSK-1 (i.e., 25.0%) (FIG. 4b).
[0060] Given these results, it was found that KSK-13 of the present
invention could activate mouse peritoneal macrophages in vivo. The
increase in the expression levels of MHC class II and B7.2
molecules indicate that an antigen presentation ability of
peritoneal macrophages was activated, which proved the effect of
KSK-13 as an immune enhancing agent.
Example 6
Effect of CpG ODN on Expression of Signal Transfer Molecule of
Mouse Splenocytes
[0061] To investigate whether KSK-13 capable of activating mouse
splenocytes in vitro can also activate them in vivo, the following
experiment was carried out.
[0062] The CpG ODN was injected into a peritoneal cavity of BALB/C
mouse with 3% thioglycolate. After 48 hrs of the injection, mouse
splenocytes were prepared same as in Example 2. The cells were
labelled with FITC-conjugated anti-B7.2 monoclonal antibody or
anti-MHC class II monoclonal antibody and analyzed using a flow
cytometer.
[0063] In case of the non-treatment group, the expression level of
B7.2 molecule in the splenocytes was 2.8% within the standard
deviation, but that of KSK-13 of the present invention was 8.6%.
This was lower than the expression level of the typical mouse CpG
ODN, KSK-2 (i.e. 12.13%), but higher than that of the human CpG
ODN, KSK-12 (i.e. 6.85%). Further, it was significantly different
from the expression level of the non-CpG ODN, KSK-1 (i.e., 3.31%)
(FIG. 5a).
[0064] Further, in case of the non-treatment group, the expression
level of MHC class II molecule in the splenocytes was 15.5% within
the standard deviation, but that of KSK-13 of the present invention
was 22.8%. This was similar to the expression level of the typical
mouse CpG ODN, KSK-2 (i.e. 23.6%), higher than that of the human
CpG ODN, KSK-12 (i.e. 18.6%), and significantly different from that
of the non-CpG ODN, KSK-1 (i.e., 17.5%) (FIG. 5b).
[0065] These results suggested that KSK-13 of the present invention
can activate mouse splenocytes in vivo. The increase in the
expression levels of MHC class 11 and B7.2 molecules indicate that
an antigen presentation ability of B cell among the splenocytes was
activated, thus showing the effect of KSK-13 as a potent
immunostimulant.
Example 7
Effect of CpG ODN on Immunization of a Mouse with Hepatitis B
Surface Antigen
[0066] To investigate whether KSK-13 capable of activating mouse
splenocytes and peritoneal macrophages can act as a vaccine
adjuvant when a mouse is immunized with hepatitis B surface
antigen, the following experiment was carried out.
[0067] Thirteen experimental groups were constituted and 7 BALB/C
mice were assigned to each group. Each mouse was subcutaneously
injected at the abdominal region with 2.5 .mu.g hepatitis B surface
antigen together with a vaccine adjuvant as described in Table 3.
After the immunization was repeated twice at 1-week intervals
according to the same method described above, blood was collected.
A titer of anti-hepatitis B surface antigen antibody was determined
by indirect enzyme linked immunosorbent assay using the blood, and
the results are shown in Table 3.
TABLE-US-00005 TABLE 3 Experimental group Adjuvant Anti-HBsAgAb
(IgG) 1 No antigen 0 2 No adjuvant 200 3 Alum 200 4 KSK-1 800 5
KSK-2 12,800 6 KSK-7 800 7 KSK-12 12,800 8 KSK-13 12,800 9 KSK-2 +
alum 3,200 10 KSK-12 + alum 12,800 11 KSK-13 + alum 51,200 12 CFA*
12,800 13 CFA + alum 3,200
[0068] The titer was 800 in case of single immunization of
hepatitis B surface antigen, but it was increased 16-fold higher
(12,800) when KSK-1, KSK-12 and KSK-13 were co-administered with
recombinant HBs Ag, respectively. When injected together with alum,
which has been widely used in clinical trials, the effect of KSK-13
as a vaccine adjuvant was 4-fold higher than that of KSK-12 and
64-fold higher than that of KSK-2. Further, this effect of KSK-13
was equal to that of CFA (Complete Freund's Adjuvant). These
results suggested that KSK-13 can be effectively used as a vaccine
adjuvant with peptide antigen.
Example 8
Effect of CpG ODN on Anti-cancer Activity of Mouse Splenocytes
[0069] To investigate whether KSK-13 capable of activating mouse
splenocytes and peritoneal macrophages can activate the ability of
natural killer cells for removing cancer cells included in
splenocytes, the following experiment was carried out.
[0070] A phosphate buffer solution (control), or 10 .mu.g of KSK-2,
KSK-12 or KSK-13 was injected at a peritoneal cavity of BALB/C
mouse. After 18 hrs injection, a spleen was ablated from the mouse
and splenocytes were prepared therefrom. The splenocytes were
incubated in a culture plate for 2 hrs to be adhered to the wall,
and free cells (non-adherent cells) were transferred to a new
culture plate. The cells were treated with 1.0 .mu.g/ml of the same
kind of CpG ODN for 2 hrs, and then, co-incubated with
5.times.10.sup.3 cells of .sup.51Cr-labeled YAC-1 cells at a ratio
shown in FIG. 6. A supernatant was taken from the culture solution
and the amount of .sup.51Cr eluted into the solution was measured
by using a gamma counter.
[0071] FIG. 6a shows the lysis level of YAC-1 cell susceptible to a
natural killer cell when cytotoxicity of the natural killer cell
included in splenocytes was increased by treating the splenocytes
with KSK-13. Non-adherent splenocytes (effector cell, E) and YAC-1
cells (target cell, T) were mixed at a ratio of 100:1, 50:1, 25:1
and 12:1, respectively. In case of the control, although the number
of effector cells was increased up to the range from 12-fold to
100-fold higher than that of target cells, the lysis level of
target cell was not significant. In contrast, in case of KSK-13,
the lysis level of target cell increased up to about 3.5% as the
number of effector cells were increased. This was lower than the
lysis level of the typical mouse CpG ODN, KSK-2, but higher than
that of the human CpG ODN, KSK-12.
[0072] FIG. 6b showed the lysis level of K562 cell susceptible to a
natural killer cell. In the concrete, cytotoxicity of the natural
killer cell included in human peripheral blood mononuclear cells
(PBMC) was markedly augmented by treating the human PBMC with the
CpG ODN of the present invention. Human PBMC were prepared as
follows. Blood was collected from a healthy volunteer in a
heparin-coated test tube and centrifuged at 1,200 g for 10 min.
After a boundary layer region was harvested therefrom and
transferred to a new tube, it was diluted with an equal volume of
an isolating buffer solution (phosphate buffer solution containing
0.5% fetal bovine albumin and 1 mM EDTA). An equal volume of
Histopaque-1077 (Sigma) was poured into a new tube and the diluent
was gently added thereon. The tube was centrifuged at 1,200 g for
30 min. Peripheral mononuclear cells at the boundary layer were
collected in a new tube and resuspended in the isolating buffer
solution. The suspension was centrifuged at 210 g for 5 min to
discard a supernatant. The procedure was repeated three times.
[0073] The prepared peripheral mononuclear cells (effector cell, E)
were mixed with K562 cells (target cell, T) at a ratio of 50:1,
25:1 and 12:1 and cultured, respectively. In case of the control
and KSK-13, when they were mixed at a ratio of 25:1 and cultured,
cytotoxicity of natural killer cells included in the peripheral
blood mononuclear cells treated with KSK-13 already reached 65%,
but that of the control was only about 9%. Why there was little
difference in cytotocixity between the mixing ratio of 50:1 and
25:1 was because that cytotoxicity was sufficiently induced at the
mixing ratio of 25:1. Further, the results of FIGS. 6a and 6b
suggested that KSK-13 may be more effective in humans than in
mice.
Example 9
Anti-Cancer Activity
1) Effect on Inhibiting B16 Melanoma Lung Metastasis
[0074] All B16 melanoma cells were cultured in RPMI 1640
supplemented with 10% heat-inactivated FBS. 2.times.10.sup.5
melanoma cells (0.2 mL PBS) were injected into the lateral tail
vein of mice (Specific pathogen-free 78 week-old female C57BL/6)
I.V. Each CpG (10 .mu.g/mice) was administered into I.P. for
treatment of B16 metastasized mice (Day of Treatment:
1.sup.st3.sup.rd, 5.sup.th, 7.sup.th and 9.sup.th day) (FIG.
7).
2) Effect of Prolonging the Survival Rate of Mouse by Inhibiting
Local Metastasis of Cancer Cells
[0075] EL4 cells (T cell lymphoma, 2.times.10.sup.4) were
intravenously injected to 6 C57BL/6 mice per each group to
inoculate cancer cells. At 1, 3, 5, 7 and 9 days after the
injection, KSK-13 (10 .mu.g/mouse) was injected at a peritoneal
cavity of BALB/C mouse and survival rate of each mouse was
estimated. KSK-13 prolonged the survival rate of all 6 mice, in
particular, 2 of them survived after 60 days.
[0076] Further, this effect of KSK-13 for prolonging the survival
rate was repeatedly confirmed in the experiment using only KSK-13
CpG ODN with increasing the number of mice (FIG. 8)
3) Cytotoxicity of Natural Killer Cells Activated by CpG ODN
[0077] Monocytes were removed from human peripheral blood
mononuclear cells by negative selection and only B, T and natural
killer cells were used in the following experiment. Non-adherent
cells except for macrophages were separated from the mouse
splenocytes and used as effector cells. As a target cell working on
natural killer cells specifically, K562 cell line was used for
measurement of human NK (natural killer) cell cytotoxicity whereas
YAC-1 cell line was used for that of murine NK cell cytotoxicity.
Cytotoxicity of natural killer cells was measured by .sup.51Cr
release assay using the above effector and target cells (FIG.
9).
Example 10
Toxicity Test
[0078] 0.5 mg of KSK-13 was intramuscularly injected into gluteus
maximus or a deltoid muscle in six ICR mice. Two mice were injected
with KSK-13 twice at 2-week intervals. One of them was further
injected three additional times with KSK-13 at 2-week intervals
after one month from the primary injection.
[0079] After injection, mice were observed with regard to clinical
signs, physical examinations such as body weight and body
temperature, haematology and urinalysis for the period of 6 months.
The results showed that all tested animals survived, and there were
no striking aberrant clinical signs, changes in weights or other
toxic effects.
Preparation Example 1
Preparation of Vaccine
[0080] 1 mg of hepatitis B surface antigen, 10 mg of dT-labeled
oligodeoxynucleotide of the present invention, 1 mg of aluminum
hydroxide, 0.01 w/v % of thimerosal, a proper dose of potassium
dihydrogen phosphate and sodium hydrogen phosphate as a buffering
agent and an appropriate dose of sodium chloride were mixed in
distilled water and the mixture's pH was adjusted with hydrochloric
acid to prepare a vaccine.
[0081] While the embodiments of the subject invention have been
described and illustrated, it is obvious that various changes and
modifications can be made therein without departing from the spirit
of the present invention which should be limited only by the scope
of the appended claims.
Sequence CWU 1
1
5120DNAArtificial Sequencesynthetic non-CpG oligonucleotide with no
immunostimulatory effect 1tccaggactt ctctcaggtt 20 220DNAArtificial
Sequencesynthetic CpG oligonucleotide with a phosphorothioate
backboneeffective especially on mice 2tccatgacgt tcctgacgtt 20
330DNAArtificial Sequencesynthetic CpG oligonucleotide with a
phosphorothioate backbone and sixguanines on 3'-terminal of KSK-12
3tcgtcgtttt gtcgttttgt cgttgggggg 30 424DNAArtificial
Sequencesynthetic CpG oligonucleotide with a phosphorothioate
backboneeffective especially on human 4tcgtcgtttt gtcgttttgt cgtt
24 522DNAArtificial Sequencesynthetic CpG oligonucleotide with a
phosphorothioate backbone 5tcgtcgtttt cgtcgtcgtt tt 22
* * * * *