U.S. patent application number 12/301353 was filed with the patent office on 2009-08-20 for antitumor agent for thyroid cancer.
This patent application is currently assigned to Eisai R & D Management Co., Ltd.. Invention is credited to Junji Matsui.
Application Number | 20090209580 12/301353 |
Document ID | / |
Family ID | 38723413 |
Filed Date | 2009-08-20 |
United States Patent
Application |
20090209580 |
Kind Code |
A1 |
Matsui; Junji |
August 20, 2009 |
ANTITUMOR AGENT FOR THYROID CANCER
Abstract
The objective of the present invention is to provide a
pharmaceutical composition and a therapeutic method that are
specifically effective against at least one disease selected from
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide and analogs thereof are specifically effective
against at least one disease selected from multiple endocrine
neoplasia, type IIA, multiple endocrine neoplasia, type IIB,
familial medullary thyroid carcinoma, thyroid carcinoma, papillary
thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract.
Inventors: |
Matsui; Junji; (Ibaraki,
JP) |
Correspondence
Address: |
DARBY & DARBY P.C.
P.O. BOX 770, Church Street Station
New York
NY
10008-0770
US
|
Assignee: |
Eisai R & D Management Co.,
Ltd.
Tokyo
JP
|
Family ID: |
38723413 |
Appl. No.: |
12/301353 |
Filed: |
May 17, 2007 |
PCT Filed: |
May 17, 2007 |
PCT NO: |
PCT/JP2007/060560 |
371 Date: |
November 18, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60747570 |
May 18, 2006 |
|
|
|
Current U.S.
Class: |
514/312 ; 435/15;
435/6.16; 435/7.4; 546/153 |
Current CPC
Class: |
C12Q 2600/106 20130101;
A61P 43/00 20180101; C07D 215/22 20130101; C12Q 1/6886 20130101;
A61P 5/18 20180101; A61K 31/47 20130101; A61P 35/00 20180101; A61P
1/00 20180101 |
Class at
Publication: |
514/312 ;
546/153; 435/15; 435/6; 435/7.4 |
International
Class: |
A61K 31/47 20060101
A61K031/47; C07D 215/00 20060101 C07D215/00; C12Q 1/48 20060101
C12Q001/48; C12Q 1/68 20060101 C12Q001/68; G01N 33/573 20060101
G01N033/573 |
Claims
1. A therapeutic agent comprising an RET kinase inhibiting
substance for treating at least one disease selected from the group
consisting of multiple endocrine neoplasia, type IIA, multiple
endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract,
wherein said RET kinase inhibiting substance is a compound
represented by General Formula (I) ##STR00011## wherein, R.sup.1
represents a group represented by Formula
--V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents C.sub.1-6
alkylene group that may have a substituent; V.sup.2 represents a
single bond, an oxygen atom, a sulfur atom, carbonyl group,
sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00012## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
2. The therapeutic agent according to claim 1, wherein R.sup.1 is
C.sub.1-6 alkyl group (where, R.sup.1 may have at least one
substituent selected from the group consisting of 3-10-membered
non-aromatic heterocyclic group that may have C.sub.1-6 alkyl
group, hydroxyl group, C.sub.1-6 alkoxy group, amino group,
mono-C.sub.1-6 alkylamino group and di-C.sub.1-6 alkylamino
group).
3. The therapeutic agent according to claim 1, wherein R.sup.1 is
methyl group or group represented by any one of the following
Formulae ##STR00013## (wherein, R.sup.a3 represents methyl group;
R.sup.a1 represents a hydrogen atom or hydroxyl group; R.sup.a2
represents methoxy group, ethoxy group, 1-pyrrolidinyl group,
1-piperidinyl group, 4-morpholinyl group, dimethylamino group or
diethylamino group).
4. The therapeutic agent according to claim 1, wherein R.sup.1 is
methyl group or 2-methoxyethyl group.
5. The therapeutic agent according to claim 1, wherein R.sup.2
represents cyano group or group represented by Formula
--CONV.sup.a11V.sup.a12 (wherein, V.sup.a11 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent; V.sup.a12 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent).
6. The therapeutic agent according to claim 1, wherein R.sup.2 is
cyano group or group represented by Formula --CONHV.sup.a16
(wherein, V.sup.a16 represents a hydrogen atom, C.sub.1-6 alkyl
group, C.sub.3-8 cycloalkyl group, C.sub.1-6 alkoxy group or
C.sub.3-8 cycloalkoxy group, where V.sup.a16 may have at least one
substituent selected from the group consisting of a halogen atom,
cyano group, hydroxyl group and C.sub.1-6 alkoxy group).
7. The therapeutic agent according to claim 1, wherein R.sup.2 is a
group represented by Formula --CONHV.sup.a17 (wherein, V.sup.a17
represents a hydrogen atom, C.sub.1-6 alkyl group or C.sub.1-6
alkoxy group).
8. The therapeutic agent according to claim 1, wherein R.sup.2 is a
group represented by Formula --CONHV.sup.a18 (wherein, V.sup.a18
represents a hydrogen atom, methyl group or methoxy group).
9. The therapeutic agent according to claim 1, wherein Y.sup.1 is a
group represented by Formula ##STR00014## (wherein, R.sup.71
represents a hydrogen atom or a halogen atom).
10. The therapeutic agent according to claim 1, wherein R.sup.3 and
R.sup.4 is a hydrogen atom.
11. The therapeutic agent according to claim 1, wherein R.sup.5 is
a hydrogen atom, C.sub.1-6 alkyl group, C.sub.3-8 cycloalkyl group
or C.sub.6-10 aryl group (where, R.sup.5 may have at least one
substituent selected from the group consisting of a halogen atom
and methanesulfonyl group).
12. The therapeutic agent according to claim 1, wherein R.sup.5 is
methyl group, ethyl group or cyclopropyl group.
13. The therapeutic agent according to claim 1, wherein the RET
kinase inhibiting substance is at least one compound selected from
the group consisting of:
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-(4-fl-
uorophenyl)urea;
N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)-
phenyl)-N'-cyclopropylurea;
N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)-
oxy)phenyl)-N'-(4-fluorophenyl)urea;
N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl-
)oxy)phenyl)-N'-(4-fluorophenyl)urea;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)--
7-methoxy-6-quinolinecarboxamide;
N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phen-
oxy)-7-methoxy-6-quinolinecarboxamide;
N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-me-
thoxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-met-
hoxy-6-quinolinecarboxamide;
N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydro-
xypropyl)oxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quin-
olinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)--
6-quinolinecarboxamide;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quin-
olinecarboxamide;
N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N'-cycloprop-
ylurea;
N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)ami-
no)phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinec-
arboxamide;
4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2--
methoxyethoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-
-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino)
ethoxy)-6-quinolinecarboxamide;
4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quino-
linecarboxamide;
N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl-
)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-
-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3--
diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-d-
iethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2--
hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-h-
ydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-meth-
yl-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methy-
l-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-cyclo-
propylurea;
N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N'-(3-(me-
thylsulfonyl)phenyl)urea;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarbo-
xamide;
4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methox-
y-6-quinolinecarboxamide;
N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-
-methoxy-6-quinolinecarboxamide;
4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic
acid (2-cyanoethyl)amide; and
N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)--
N'-cyclopropylurea, a pharmacologically acceptable salt thereof or
a solvate thereof.
14. The therapeutic agent according to claim 1, wherein the RET
kinase inhibiting substance is at least one compound selected from
the group consisting of:
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide; and
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide, a pharmacologically acceptable salt thereof
or a solvate thereof.
15. The therapeutic agent according to claim 1, wherein the RET
kinase inhibiting substance is
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof.
16. The therapeutic agent according to claim 1, wherein the RET
kinase inhibiting substance is methanesulfonate of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide.
17. A therapeutic agent comprising an RET kinase inhibiting
substance for treating at least one disease selected from the group
consisting of multiple endocrine neoplasia, type IIA, multiple
endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract,
wherein said RET kinase inhibiting substance is at least one
compound selected from the group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
18. The therapeutic agent according to claim 1, wherein the disease
comprises a cell expressing mutant RET.
19. The therapeutic agent according to claim 18, wherein the mutant
RET comprises a mutation site where at least one amino acid
selected from the group consisting of amino acids at codons 321,
533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804,
806, 844, 883, 891 and 918 in the amino acid sequence represented
by SEQ ID NO: 2 or 4 is substituted with other amino acid.
20. The therapeutic agent according to claim 18, wherein the mutant
RET is a polypeptide encoded by RET gene rearranged with at least
one gene selected from the group consisting of H4 gene, RI.alpha.
gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS gene,
kinectin gene, PCM-1 gene and RFP gene.
21. A therapeutic agent comprising an RET kinase inhibiting
substance for treating thyroid carcinoma, wherein said RET kinase
inhibiting substance is a compound represented by General Formula
(I) ##STR00015## wherein, R.sup.1 represents a group represented by
Formula --V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents
C.sub.1-6 alkylene group that may have a substituent; V.sup.2
represents a single bond, an oxygen atom, a sulfur atom, carbonyl
group, sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00016## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
22. The therapeutic agent according to claim 21, wherein R.sup.1 is
C.sub.1-6 alkyl group (where, R.sup.1 may have at least one
substituent selected from the group consisting of 3-10-membered
non-aromatic heterocyclic group that may have C.sub.1-6 alkyl
group, hydroxyl group, C.sub.1-6 alkoxy group, amino group,
mono-C.sub.1-6 alkylamino group and di-C.sub.1-6 alkylamino
group).
23. The therapeutic agent according to claim 21, wherein R.sup.1 is
methyl group or group represented by any one of the following
Formulae ##STR00017## (wherein, R.sup.a3 represents methyl group;
R.sup.a1 represents a hydrogen atom or hydroxyl group; R.sup.a2
represents methoxy group, ethoxy group, 1-pyrrolidinyl group,
1-piperidinyl group, 4-morpholinyl group, dimethylamino group or
diethylamino group).
24. The therapeutic agent according to claim 21, wherein R.sup.1 is
methyl group or 2-methoxyethyl group.
25. The therapeutic agent according to claim 21, wherein R.sup.2
represents cyano group or group represented by Formula
--CONV.sup.a11V.sup.a12 (wherein, V.sup.a11 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent; V.sup.a12 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent).
26. The therapeutic agent according to claim 21, wherein R.sup.2 is
cyano group or group represented by Formula --CONHV.sup.a16
(wherein, V.sup.a16 represents a hydrogen atom, C.sub.1-6 alkyl
group, C.sub.3-8 cycloalkyl group, C.sub.1-6 alkoxy group or
C.sub.3-8 cycloalkoxy group, where V.sup.a16 may have at least one
substituent selected from the group consisting of a halogen atom,
cyano group, hydroxyl group and C.sub.1-6 alkoxy group).
27. The therapeutic agent according to claim 21, wherein R.sup.2 is
a group represented by Formula --CONHV.sup.a17 (wherein, V.sup.a17
represents a hydrogen atom, C.sub.1-6 alkyl group or C.sub.1-6
alkoxy group).
28. The therapeutic agent according to claim 21, wherein R.sup.2 is
a group represented by Formula --CONHV.sup.a18 (wherein, V.sup.a18
represents a hydrogen atom, methyl group or methoxy group).
29. The therapeutic agent according to claim 21, wherein Y.sup.1 is
a group represented by Formula ##STR00018## (wherein, R.sup.71
represents a hydrogen atom or a halogen atom).
30. The therapeutic agent according to claim 21, wherein R.sup.3
and R.sup.4 is a hydrogen atom.
31. The therapeutic agent according to claim 21, wherein R.sup.5 is
a hydrogen atom, C.sub.1-6 alkyl group, C.sub.3-8 cycloalkyl group
or C.sub.6-10 aryl group (where, R.sup.5 may have at least one
substituent selected from the group consisting of a halogen atom
and methanesulfonyl group).
32. The therapeutic agent according to claim 21, wherein R.sup.5 is
methyl group, ethyl group or cyclopropyl group.
33. The therapeutic agent according to claim 21, wherein the RET
kinase inhibiting substance is at least one compound selected from
the group consisting of:
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-(4-fl-
uorophenyl)urea;
N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)-
phenyl)-N'-cyclopropylurea;
N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)-
oxy)phenyl)-N'-(4-fluorophenyl)urea;
N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl-
)oxy)phenyl)-N'-(4-fluorophenyl)urea;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)--
7-methoxy-6-quinolinecarboxamide;
N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phen-
oxy)-7-methoxy-6-quinolinecarboxamide;
N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-me-
thoxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-met-
hoxy-6-quinolinecarboxamide;
N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydro-
xypropyl)oxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quin-
olinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)--
6-quinolinecarboxamide;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quin-
olinecarboxamide;
N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N'-cycloprop-
ylurea;
N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)ami-
no)phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinec-
arboxamide;
4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2--
methoxyethoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-
-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino)
ethoxy)-6-quinolinecarboxamide;
4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quino-
linecarboxamide;
N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl-
)amino) phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-
-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3--
diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-d-
iethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2--
hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-h-
ydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-meth-
yl-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methy-
l-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-cyclo-
propylurea;
N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N'-(3-(me-
thylsulfonyl)phenyl)urea;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarbo-
xamide;
4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methox-
y-6-quinolinecarboxamide;
N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-
-methoxy-6-quinolinecarboxamide;
4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic
acid (2-cyanoethyl)amide; and
N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)--
N'-cyclopropylurea, a pharmacologically acceptable salt thereof or
a solvate thereof.
34. The therapeutic agent according to claim 21, wherein the RET
kinase inhibiting substance is at least one compound selected from
the group consisting of:
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide; and
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide, a pharmacologically acceptable salt thereof
or a solvate thereof.
35. The therapeutic agent according to claim 21, wherein the RET
kinase inhibiting substance is
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof.
36. The therapeutic agent according to claim 21, wherein the RET
kinase inhibiting substance is methanesulfonate of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide.
37. A therapeutic agent comprising an RET kinase inhibiting
substance for treating thyroid carcinoma, wherein said RET kinase
inhibiting substance is at least one compound selected from the
group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
38. The therapeutic agent according to claim 21, wherein the
thyroid carcinoma comprises a cell expressing mutant RET.
39. The therapeutic agent according to claim 38, wherein the mutant
RET comprises a mutation site where at least one amino acid
selected from the group consisting of amino acids at codons 321,
533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804,
806, 844, 883, 891 and 918 in the amino acid sequence represented
by SEQ ID NO: 2 or 4 is substituted with other amino acid.
40. The therapeutic agent according to claim 38, wherein the mutant
RET is a polypeptide encoded by RET gene rearranged with at least
one gene selected from the group consisting of H4 gene, RI.alpha.
gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS gene,
kinectin gene, PCM-1 gene and RFP gene.
41. A pharmaceutical composition comprising an RET kinase
inhibiting substance for administering to an organism comprising a
cell expressing mutant RET, wherein said RET kinase inhibiting
substance is a compound represented by General Formula (I)
##STR00019## wherein, R.sup.1 represents a group represented by
Formula --V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents
C.sub.1-6 alkylene group that may have a substituent; V.sup.2
represents a single bond, an oxygen atom, a sulfur atom, carbonyl
group, sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00020## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
42. The pharmaceutical composition according to claim 41, wherein
R.sup.1 is C.sub.1-6 alkyl group (where, R.sup.1 may have at least
one substituent selected from the group consisting of 3-10-membered
non-aromatic heterocyclic group that may have C.sub.1-6 alkyl
group, hydroxyl group, C.sub.1-6 alkoxy group, amino group,
mono-C.sub.1-6 alkylamino group and di-C.sub.1-6 alkylamino
group).
43. The pharmaceutical composition according to claim 41, wherein
R.sup.1 is methyl group or group represented by any one of the
following Formulae ##STR00021## (wherein, R.sup.a3 represents
methyl group; R.sup.a1 represents a hydrogen atom or hydroxyl
group; R.sup.a2 represents methoxy group, ethoxy group,
1-pyrrolidinyl group, 1-piperidinyl group, 4-morpholinyl group,
dimethylamino group or diethylamino group).
44. The pharmaceutical composition according to claim 41, wherein
R.sup.1 is methyl group or 2-methoxyethyl group.
45. The pharmaceutical composition according to claim 41, wherein
R.sup.2 represents cyano group or group represented by Formula
--CONV.sup.a11V.sup.a12 (wherein, V.sup.a11 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent; V.sup.a12 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent).
46. The pharmaceutical composition according to claim 41, wherein
R.sup.2 is cyano group or group represented by Formula
--CONHV.sup.a16 (wherein, V.sup.a16 represents a hydrogen atom,
C.sub.1-6 alkyl group, C.sub.3-8 cycloalkyl group, C.sub.1-6 alkoxy
group or C.sub.3-8 cycloalkoxy group, where V.sup.a16 may have at
least one substituent selected from the group consisting of a
halogen atom, cyano group, hydroxyl group and C.sub.1-6 alkoxy
group).
47. The pharmaceutical composition according to claim 41, wherein
R.sup.2 is a group represented by Formula --CONHV.sup.a17 (wherein,
V.sup.a17 represents a hydrogen atom, C.sub.1-6 alkyl group or
C.sub.1-6 alkoxy group).
48. The pharmaceutical composition according to claim 41, wherein
R.sup.2 is a group represented by Formula --CONHV.sup.a18 (wherein,
V.sup.a18 represents a hydrogen atom, methyl group or methoxy
group).
49. The pharmaceutical composition according to claim 41, wherein
Y.sup.1 is a group represented by Formula ##STR00022## (wherein,
R.sup.71 represents a hydrogen atom or a halogen atom).
50. The pharmaceutical composition according to claim 41, wherein
R.sup.3 and R.sup.4 is a hydrogen atom.
51. The pharmaceutical composition according to claim 41, wherein
R.sup.5 is a hydrogen atom, C.sub.1-6 alkyl group, C.sub.3-8
cycloalkyl group or C.sub.6-10 aryl group (where, R.sup.5 may have
at least one substituent selected from the group consisting of a
halogen atom and methanesulfonyl group).
52. The pharmaceutical composition according to claim 41, wherein
R.sup.5 is methyl group, ethyl group or cyclopropyl group.
53. The pharmaceutical composition according to claim 41, wherein
the RET kinase inhibiting substance is at least one compound
selected from the group consisting of:
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-(4-fl-
uorophenyl)urea;
N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)-
phenyl)-N'-cyclopropylurea;
N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)-
oxy)phenyl)-N'-(4-fluorophenyl)urea;
N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl-
)oxy)phenyl)-N'-(4-fluorophenyl)urea;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)--
7-methoxy-6-quinolinecarboxamide;
N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phen-
oxy)-7-methoxy-6-quinolinecarboxamide;
N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-me-
thoxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-met-
hoxy-6-quinolinecarboxamide;
N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydro-
xypropyl)oxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quin-
olinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)--
6-quinolinecarboxamide;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quin-
olinecarboxamide;
N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N'-cycloprop-
ylurea;
N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)ami-
no)phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinec-
arboxamide;
4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2--
methoxyethoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-
-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino)
ethoxy)-6-quinolinecarboxamide;
4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quino-
linecarboxamide;
N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl-
)amino) phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-
-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3--
diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-d-
iethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2--
hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-h-
ydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-meth-
yl-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methy-
l-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-cyclo-
propylurea;
N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N'-(3-(me-
thylsulfonyl)phenyl)urea;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarbo-
xamide;
4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methox-
y-6-quinolinecarboxamide;
N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-
-methoxy-6-quinolinecarboxamide;
4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic
acid (2-cyanoethyl)amide; and
N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)--
N'-cyclopropylurea, a pharmacologically acceptable salt thereof or
a solvate thereof.
54. The pharmaceutical composition according to claim 41, wherein
the RET kinase inhibiting substance is at least one compound
selected from the group consisting of:
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide; and
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide, a pharmacologically acceptable salt thereof
or a solvate thereof.
55. The pharmaceutical composition according to claim 41, wherein
the RET kinase inhibiting substance is
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof.
56. The pharmaceutical composition according to claim 41, wherein
the RET kinase inhibiting substance is methanesulfonate of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide.
57. A pharmaceutical composition comprising an RET kinase
inhibiting substance for administering to an organism comprising a
cell expressing mutant RET, wherein said RET kinase inhibiting
substance is at least one compound selected from the group
consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
58. The pharmaceutical composition according to claim 41, wherein
the mutant RET comprises a mutation site where at least one amino
acid selected from the group consisting of amino acids at codons
321, 533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791,
804, 806, 844, 883, 891 and 918 in the amino acid sequence
represented by SEQ ID NO: 2 or 4 is substituted with other amino
acid.
59. The pharmaceutical composition according to claim 41, wherein
the mutant RET is a polypeptide encoded by RET gene rearranged with
at least one gene selected from the group consisting of H4 gene,
RI.alpha. gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS
gene, kinectin gene, PCM-1 gene and RFP gene.
60. The pharmaceutical composition according to claim 41, wherein
the organism is a patient suffering from at least one disease
selected from the group consisting of multiple endocrine neoplasia,
type IIA, multiple endocrine neoplasia, type IIB, familial
medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid
carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung
disease, pheochromocytoma, parathyroid hyperplasia and mucosal
neuromas of the gastrointestinal tract.
61. A method for treating at least one disease selected from the
group consisting of multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract, the
method comprising the step of administering an effective amount of
an RET kinase inhibiting substance to a patient, wherein said RET
kinase inhibiting substance is a compound represented by General
Formula (I) ##STR00023## wherein, R.sup.1 represents a group
represented by Formula --V.sup.1--V.sup.2--V.sup.3 (wherein,
V.sup.1 represents C.sub.1-6 alkylene group that may have a
substituent; V.sup.2 represents a single bond, an oxygen atom, a
sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group
represented by Formula --CONR.sup.6--, group represented by Formula
--SO.sub.2NR.sup.6--, group represented by Formula
--NR.sup.6SO.sub.2--, group represented by Formula --NR.sup.6CO--
or group represented by Formula --NR.sup.6-- (wherein, R.sup.6
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent or C.sub.3-8 cycloalkyl group that may have a
substituent); V.sup.3 represents a hydrogen atom, C.sub.1-6 alkyl
group that may have a substituent, C.sub.2-6 alkenyl group that may
have a substituent, C.sub.2-6 alkynyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.6-10 aryl group that may have a substituent,
5-10-membered heteroaryl group that may have a substituent or
3-10-membered non-aromatic heterocyclic group that may have a
substituent); R.sup.2 represents cyano group, C.sub.1-6 alkoxy
group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00024## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
62. A method for treating at least one disease selected from the
group consisting of multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract, the
method comprising the step of administering an effective amount of
an RET kinase inhibiting substance to a patient, wherein said RET
kinase inhibiting substance is at least one compound selected from
the group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
63. A method for treating thyroid carcinoma, comprising the step of
administering an effective amount of an RET kinase inhibiting
substance to a patient, wherein said RET kinase inhibiting
substance is a compound represented by General Formula (I)
##STR00025## wherein, R.sup.1 represents a group represented by
Formula --V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents
C.sub.1-6 alkylene group that may have a substituent; V.sup.2
represents a single bond, an oxygen atom, a sulfur atom, carbonyl
group, sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00026## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
64. A method for treating thyroid carcinoma, comprising the step of
administering an effective amount of an RET kinase inhibiting
substance to a patient, wherein said RET kinase inhibiting
substance is at least one compound selected from the group
consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
65. A method for treating a disease, comprising the step of
administering an effective amount of an RET kinase inhibiting
substance to an organism comprising a cell expressing mutant RET,
wherein said RET kinase inhibiting substance is a compound
represented by General Formula (I) ##STR00027## wherein, R.sup.1
represents a group represented by Formula
--V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents C.sub.1-6
alkylene group that may have a substituent; V.sup.2 represents a
single bond, an oxygen atom, a sulfur atom, carbonyl group,
sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00028## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
66. A method for treating a disease, comprising the step of
administering an effective amount of an RET kinase inhibiting
substance to an organism comprising a cell expressing mutant RET,
wherein said RET kinase inhibiting substance is at least one
compound selected from the group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
67-72. (canceled)
73. An RET kinase inhibiting substance for a therapeutic agent for
treating at least one disease selected from the group consisting of
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma,
papillary thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract, wherein said RET
kinase inhibiting substance is a compound represented by General
Formula (I) ##STR00029## wherein, R.sup.1 represents a group
represented by Formula --V.sup.1--V.sup.2--V.sup.3 (wherein,
V.sup.1 represents C.sub.1-6 alkylene group that may have a
substituent; V.sup.2 represents a single bond, an oxygen atom, a
sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group
represented by Formula --CONR.sup.6--, group represented by Formula
--SO.sub.2NR.sup.6--, group represented by Formula
--NR.sup.6SO.sub.2--, group represented by Formula --NR.sup.6CO--
or group represented by Formula --NR.sup.6-- (wherein, R.sup.6
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent or C.sub.3-8 cycloalkyl group that may have a
substituent); V.sup.3 represents a hydrogen atom, C.sub.1-6 alkyl
group that may have a substituent, C.sub.2-6 alkenyl group that may
have a substituent, C.sub.2-6 alkynyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.6-10 aryl group that may have a substituent,
5-10-membered heteroaryl group that may have a substituent or
3-10-membered non-aromatic heterocyclic group that may have a
substituent); R.sup.2 represents cyano group, C.sub.1-6 alkoxy
group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00030## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
74. An RET kinase inhibiting substance for a therapeutic agent for
treating at least one disease selected from the group consisting of
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma,
papillary thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract, wherein said RET
kinase inhibiting substance is at least one compound selected from
the group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
75. An RET kinase inhibiting substance for a therapeutic agent for
treating thyroid carcinoma, wherein said RET kinase inhibiting
substance is a compound represented by General Formula (I)
##STR00031## wherein, R.sup.1 represents a group represented by
Formula --V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents
C.sub.1-6 alkylene group that may have a substituent; V.sup.2
represents a single bond, an oxygen atom, a sulfur atom, carbonyl
group, sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00032## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
76. An RET kinase inhibiting substance for a therapeutic agent for
treating thyroid carcinoma, wherein said RET kinase inhibiting
substance is at least one compound selected from the group
consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
77. An RET kinase inhibiting substance for a pharmaceutical
composition comprising the RET kinase inhibiting substance for
administering to an organism comprising a cell expressing mutant
RET, wherein said RET kinase inhibiting substance is a compound
represented by General Formula (I) ##STR00033## wherein, R.sup.1
represents a group represented by Formula
--V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents C.sub.1-6
alkylene group that may have a substituent; V.sup.2 represents a
single bond, an oxygen atom, a sulfur atom, carbonyl group,
sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00034## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
78. An RET kinase inhibiting substance for a pharmaceutical
composition comprising the RET kinase inhibiting substance for
administering to an organism comprising a cell expressing mutant
RET, wherein said RET kinase inhibiting substance is at least one
compound selected from the group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
79. An RET kinase inhibitor comprising a compound represented by
General Formula (I) ##STR00035## wherein, R.sup.1 represents a
group represented by Formula --V.sup.1--V.sup.2--V.sup.3 (wherein,
V.sup.1 represents C.sub.1-6 alkylene group that may have a
substituent; V.sup.2 represents a single bond, an oxygen atom, a
sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group
represented by Formula --CONR.sup.6--, group represented by Formula
--SO.sub.2NR.sup.6--, group represented by Formula
--NR.sup.6SO.sub.2--, group represented by Formula --NR.sup.6CO--
or group represented by Formula --NR.sup.6-- (wherein, R.sup.6
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent or C.sub.3-8 cycloalkyl group that may have a
substituent); V.sup.3 represents a hydrogen atom, C.sub.1-6 alkyl
group that may have a substituent, C.sub.2-6 alkenyl group that may
have a substituent, C.sub.2-6 alkynyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.6-10 aryl group that may have a substituent,
5-10-membered heteroaryl group that may have a substituent or
3-10-membered non-aromatic heterocyclic group that may have a
substituent); R.sup.2 represents cyano group, C.sub.1-6 alkoxy
group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00036## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
80. An RET kinase inhibitor comprising at least one compound
selected from the group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
81. A method for predicting whether a patient is highly sensitive
to an RET kinase inhibiting substance, comprising the step of using
the presence or the absence of RET mutation in the cell as an
indication, wherein said RET kinase inhibiting substance is a
compound represented by General Formula (I) ##STR00037## wherein,
R.sup.1 represents a group represented by Formula
--V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents C.sub.1-6
alkylene group that may have a substituent; V.sup.2 represents a
single bond, an oxygen atom, a sulfur atom, carbonyl group,
sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent); R.sup.2 represents cyano group, C.sub.1-6
alkoxy group that may have a substituent, carboxyl group, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
represents a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.6-10 aryl group
that may have a substituent, 5-10-membered heteroaryl group that
may have a substituent or 3-10-membered non-aromatic heterocyclic
group that may have a substituent; V.sup.a12 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent); Y.sup.1 represents a group represented by Formula
##STR00038## (wherein, R.sup.7 and R.sup.8 each independently
represent a hydrogen atom, a halogen atom, cyano group, nitro
group, amino group, C.sub.1-6 alkyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.1-6 alkoxy group that may have a substituent,
C.sub.1-6 alkylthio group that may have a substituent, formyl
group, C.sub.2-7 acyl group that may have a substituent, C.sub.2-7
alkoxycarbonyl group that may have a substituent or group
represented by Formula --CONV.sup.d1V.sup.d2 (wherein, V.sup.d1 and
V.sup.d2 each independently represent a hydrogen atom or C.sub.1-6
alkyl group that may have a substituent); W.sup.1 and W.sup.2 each
independently represent a carbon atom or a nitrogen atom that may
have a substituent); R.sup.3 and R.sup.4 each independently
represent a hydrogen atom, C.sub.1-6 alkyl group that may have a
substituent, C.sub.2-6 alkenyl group that may have a substituent,
C.sub.2-6 alkynyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.2-7 acyl group
that may have a substituent or C.sub.2-7 alkoxycarbonyl group that
may have a substituent; and R.sup.5 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent, a pharmacologically acceptable salt thereof
or a solvate thereof.
82. The method according to claim 81, wherein R.sup.1 is C.sub.1-6
alkyl group (where, R.sup.1 may have at least one substituent
selected from the group consisting of 3-10-membered non-aromatic
heterocyclic group that may have C.sub.1-6 alkyl group, hydroxyl
group, C.sub.1-6 alkoxy group, amino group, mono-C.sub.1-6
alkylamino group and di-C.sub.1-6 alkylamino group).
83. The method according to claim 81, wherein R.sup.1 is methyl
group or group represented by any one of the following Formulae
##STR00039## (wherein, R.sup.a3 represents methyl group; R.sup.a1
represents a hydrogen atom or hydroxyl group; R.sup.a2 represents
methoxy group, ethoxy group, 1-pyrrolidinyl group, 1-piperidinyl
group, 4-morpholinyl group, dimethylamino group or diethylamino
group).
84. The method according to claim 81, wherein R.sup.1 is methyl
group or 2-methoxyethyl group.
85. The method according to claim 81, wherein R.sup.2 represents
cyano group or group represented by Formula --CONV.sup.a11V.sup.a12
(wherein, V.sup.a11 represents a hydrogen atom, C.sub.1-6 alkyl
group that may have a substituent, C.sub.2-6 alkenyl group that may
have a substituent, C.sub.2-6 alkynyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.6-10 aryl group that may have a substituent,
5-10-membered heteroaryl group that may have a substituent or
3-10-membered non-aromatic heterocyclic group that may have a
substituent; V.sup.a12 represents a hydrogen atom, C.sub.1-6 alkyl
group that may have a substituent, C.sub.2-6 alkenyl group that may
have a substituent, C.sub.2-6 alkynyl group that may have a
substituent, C.sub.3-8 cycloalkyl group that may have a
substituent, C.sub.6-10 aryl group that may have a substituent,
5-10-membered heteroaryl group that may have a substituent,
3-10-membered non-aromatic heterocyclic group that may have a
substituent, hydroxyl group, C.sub.1-6 alkoxy group that may have a
substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent).
86. The method according to claim 81, wherein R.sup.2 is cyano
group or group represented by Formula --CONHV.sup.a16 (wherein,
V.sup.a16 represents a hydrogen atom, C.sub.1-6 alkyl group,
C.sub.3-8 cycloalkyl group, C.sub.1-6 alkoxy group or C.sub.3-8
cycloalkoxy group, where V.sup.a16 may have at least one
substituent selected from the group consisting of a halogen atom,
cyano group, hydroxyl group and C.sub.1-6 alkoxy group).
87. The method according to claim 81, wherein R.sup.2 is a group
represented by Formula --CONHV.sup.a17 (wherein, V.sup.a17
represents a hydrogen atom, C.sub.1-6 alkyl group or C.sub.1-6
alkoxy group).
88. The method according to claim 81, wherein R.sup.2 is a group
represented by Formula --CONHV.sup.a18 (wherein, V.sup.a18
represents a hydrogen atom, methyl group or methoxy group).
89. The method according to claim 81, wherein Y.sup.1 is a group
represented by Formula ##STR00040## (wherein, R.sup.71 represents a
hydrogen atom or a halogen atom).
90. The method according to claim 81, wherein R.sup.3 and R.sup.4
is a hydrogen atom.
91. The method according to claim 81, wherein R.sup.5 is a hydrogen
atom, C.sub.1-6 alkyl group, C.sub.3-8 cycloalkyl group or
C.sub.6-10 aryl group (where, R.sup.5 may have at least one
substituent selected from the group consisting of a halogen atom
and methanesulfonyl group).
92. The method according to claim 81, wherein R.sup.5 is methyl
group, ethyl group or cyclopropyl group.
93. The method according to claim 81, wherein the RET kinase
inhibiting substance is at least one compound selected from the
group consisting of:
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-(4-fl-
uorophenyl)urea;
N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)-
phenyl)-N'-cyclopropylurea;
N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)-
oxy)phenyl)-N'-(4-fluorophenyl)urea;
N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl-
)oxy)phenyl)-N'-(4-fluorophenyl)urea;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)--
7-methoxy-6-quinolinecarboxamide;
N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phen-
oxy)-7-methoxy-6-quinolinecarboxamide;
N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-me-
thoxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-met-
hoxy-6-quinolinecarboxamide;
N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-
-6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydro-
xypropyl)oxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quin-
olinecarboxamide;
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)--
6-quinolinecarboxamide;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quin-
olinecarboxamide;
N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N'-cycloprop-
ylurea;
N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)ami-
no)phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinec-
arboxamide;
4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-meth-
oxy-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2--
methoxyethoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-
-quinolinecarboxamide;
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino)
ethoxy)-6-quinolinecarboxamide;
4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quino-
linecarboxamide;
N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl-
)amino) phenoxy)-7-methoxy-6-quinolinecarboxamide;
4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-
-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3--
diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-d-
iethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2--
hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-h-
ydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-meth-
yl-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methy-
l-4-piperidyl)methoxy)-6-quinolinecarboxamide;
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-cyclo-
propylurea;
N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N'-(3-(me-
thylsulfonyl)phenyl)urea;
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarbo-
xamide;
4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methox-
y-6-quinolinecarboxamide;
N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-
-methoxy-6-quinolinecarboxamide;
4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic
acid (2-cyanoethyl)amide; and
N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)--
N'-cyclopropylurea, a pharmacologically acceptable salt thereof or
a solvate thereof.
94. The method according to claim 81, wherein the RET kinase
inhibiting substance is at least one compound selected from the
group consisting of:
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide;
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide;
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide;
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide; and
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide, a pharmacologically acceptable salt thereof
or a solvate thereof.
95. The method according to claim 81, wherein the RET kinase
inhibiting substance is
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof.
96. The method according to claim 81, wherein the RET kinase
inhibiting substance is methanesulfonate of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide.
97. A method for predicting whether a patient is highly sensitive
to an RET kinase inhibiting substance, comprising the step of using
the presence or the absence of RET mutation in the cell as an
indication, wherein said RET kinase inhibiting substance is at
least one compound selected from the group consisting of:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide;
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea; and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
98. The method according to claim 81, wherein the RET mutation is
substitution of at least one amino acid selected from the group
consisting of amino acids at codons 321, 533, 609, 611, 618, 620,
630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918
in the amino acid sequence represented by SEQ ID NO: 2 or 4 with
other amino acid.
99. The method according to claim 81, wherein the RET mutation owes
to rearrangement of RET gene and at least one gene selected from
the group consisting of H4 gene, RI.alpha. gene, ELE1 gene, RFG5
gene, hTIF gene, RFG7 gene, ELKS gene, kinectin gene, PCM-1 gene
and RFP gene.
100. The method according to claim 81, wherein the patient is
suffering from at least one disease selected from the group
consisting of multiple endocrine neoplasia, type IIA, multiple
endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic
medullary thyroid carcinoma, Hirschsprung disease,
pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of
the gastrointestinal tract.
101. The method according to claim 81, wherein the prediction
comprises the steps of: determining the presence or the absence of
RET mutation in the cell; and predicting that the patient is highly
sensitive to the RET kinase inhibiting substance when mutant RET is
expressed in the cell.
102. The method according to claim 101, wherein the determination
of the presence or the absence of RET mutation in the cell is
carried out by dideoxynucleotide chain termination technique.
103. The method according to claim 101, wherein the determination
of the presence or the absence of RET mutation in the cell is
carried out by RT-PCR.
104. The method according to claim 101, wherein the determination
of the presence or the absence of RET mutation in the cell is
carried out by immunochemical technique.
105. The method according to claim 97, wherein the RET mutation is
substitution of at least one amino acid selected from the group
consisting of amino acids at codons 321, 533, 609, 611, 618, 620,
630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918
in the amino acid sequence represented by SEQ ID NO: 2 or 4 with
other amino acid.
106. The method according to claim 97, wherein the RET mutation
owes to rearrangement of RET gene and at least one gene selected
from the group consisting of H4 gene, RI.alpha. gene, ELE1 gene,
RFG5 gene, hTIF gene, RFG7 gene, ELKS gene, kinectin gene, PCM-1
gene and RFP gene.
107. The method according to claim 97, wherein the patient is
suffering from at least one disease selected from the group
consisting of multiple endocrine neoplasia, type IIA, multiple
endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic
medullary thyroid carcinoma, Hirschsprung disease,
pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of
the gastrointestinal tract.
108. The method according to claim 97, wherein the prediction
comprises the steps of: determining the presence or the absence of
RET mutation in the cell; and predicting that the patient is highly
sensitive to the RET kinase inhibiting substance when mutant RET is
expressed in the cell.
109. The method according to claim 108, wherein the determination
of the presence or the absence of RET mutation in the cell is
carried out by dideoxynucleotide chain termination technique.
110. The method according to claim 108, wherein the determination
of the presence or the absence of RET mutation in the cell is
carried out by RT-PCR.
111. The method according to claim 108, wherein the determination
of the presence or the absence of RET mutation in the cell is
carried out by immunochemical technique.
Description
CROSS REFERENCE TO PRIOR RELATED APPLICATIONS
[0001] This application is a U.S. national phase application under
35 U.S.C. .sctn. 371 of International Patent Application No.
PCT/JP2007/060560, filed on May 17, 2007, and claims the benefit of
U.S. Provisional Patent Application No. 60/747,570, filed on May
18, 2006, both of which are incorporated by reference herein. The
International Application was published in Japanese on Nov. 29,
2007, as International Publication No. WO 2007/136103 A1 under PCT
Article 21(2).
FIELD OF THE INVENTION
[0002] The present invention relates to a therapeutic agent and a
method containing a substance that inhibits RET kinase activity
(hereinafter, also referred to as an "RET kinase inhibiting
substance") for treating at least one disease selected from
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma,
papillary thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract, to use of an RET
kinase inhibiting substance for producing said therapeutic agent
and to an RET kinase inhibiting substance for said therapeutic
agent.
[0003] The present invention also relates to a therapeutic agent
and a method containing an RET kinase inhibiting substance for
treating thyroid carcinoma, to use of an RET kinase inhibiting
substance for producing said therapeutic agent and to an RET kinase
inhibiting substance for said therapeutic agent.
[0004] Moreover, the present invention relates to a pharmaceutical
composition containing an RET kinase inhibiting substance for
administering to an organism having a cell expressing mutant RET,
to a method for treating a disease including administration to an
organism having a cell expressing mutant RET, to use of an RET
kinase inhibiting substance for producing said pharmaceutical
composition and to an RET kinase inhibiting substance for said
pharmaceutical composition.
[0005] The present invention also relates to an RET kinase
inhibitor.
[0006] Furthermore, the present invention relates to a method for
predicting the effect of an RET kinase inhibiting substance on a
patient using the presence or the absence of RET mutation in the
cell as an indication.
BACKGROUND OF THE INVENTION
[0007] RET is one of the receptor tyrosine kinases and is a cell
surface molecule that transduces signals for cell growth and
differentiation.
[0008] RET mutation is known to be involved in diseases such as
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma, sporadic
medullary thyroid carcinoma, papillary thyroid carcinoma and
Hirschsprung disease. (Oncogene, 19, 5590-5597, 2000; Cancer
Research, 15, 7284-7290, 2002.) RET kinase inhibiting substance has
been suggested as a potentially effective therapeutic agent for
said diseases. (Oncogene, 19, 5590-5597, 2000; Cancer Research, 15,
7284-7290, 2002.)
[0009] Mutation of one of five cysteine residues at codons 609,
611, 618, 620 and 634 of RET is found in 93-98% of the patients
with multiple endocrine neoplasia, type IIA, where mutation at RET
codon 634 is found most frequently. (Cancer Research, 66,
1177-1180, 2006; Journal of Clinical Endocrinology and Metabolism,
88, 5438-5443, 2003.)
[0010] On the other hand, mutation M918T (mutation from methionine
to tyrosine at codon 918) of RET is found in 95% of the patients
with multiple endocrine neoplasia, type IIB. (Journal of Clinical
Endocrinology and Metabolism, 88, 5438-5443, 2003.)
[0011] Mutation at one of RET codons 609, 611, 618, 620, 634, 768,
790, 791, 804 and 891 is found in many of the patients with
familial medullary thyroid carcinoma. (Journal of Clinical
Endocrinology and Metabolism, 88, 5438-5443, 2003.)
[0012] All of these point mutations are known to cause constant
ligand-independent RET activation. (Cancer Research, 66, 1177-1180,
2006; Journal of Clinical Endocrinology and Metabolism, 88,
5438-5443, 2003.)
[0013] A syndrome of multiple endocrine neoplasia, type IIA is
characterized by medullary thyroid carcinoma, pheochromocytoma and
parathyroid hyperplasia whereas a syndrome of multiple endocrine
neoplasia, type IIB is associated with medullary thyroid carcinoma,
pheochromocytoma and mucosal neuromas of the gastrointestinal
tract. Chief symptom of syndrome of familial medullary thyroid
carcinoma is medullary thyroid carcinoma. (Journal of Clinical
Endocrinology and Metabolism, 89, 4142-4145, 2004.)
[0014] Point mutation of RET somatic cells is found in about 40% of
the patients with sporadic medullary thyroid carcinoma while
mutations are mostly found at codon 918. (Journal of Clinical
Endocrinology and Metabolism, 89, 5823-5827, 2004.)
[0015] Moreover, a fusion gene of RET gene and other gene, namely,
rearrangement of RET gene, is found in papillary thyroid carcinoma
due to chromosomal inversions or chromosomal translocation. The
fusion protein generated via RET gene rearrangement is known to
lead to ligand-independent dimerization and constant RET
activation. (Endocrinology, 145, 5448-5451, 2004.)
[0016] Hirschsprung disease is characterized by persistent
constipation and intestinal dilatation in newborns caused by
abnormal colonic nerve plexus. One of the causes of Hirschsprung
disease is known to be RET mutation. (Proceedings of the National
Academy of Sciences of the United States of America, 102,
8949-8954, 2005.)
[0017] RET mutation has been reported to cause scaffold-independent
proliferation and tumorigenesis in NIH3T3 cells. (Cancer Research,
15, 7284-7290, 2002.)
[0018] RET kinase inhibiting substance ZD6474 has been reported to
suppress scaffold-independent proliferation in NIH3T3 cells
transformed with mutant RET and inhibited tumor formation after
infusion of said cells into nude mice. (Cancer Research, 15,
7284-7290, 2002.)
[0019] RET kinase inhibiting substance BAY 43-9006 has been
reported to reduce the size of tumor in a model for subcutaneous
transplantation of human medullary thyroid carcinoma cell line
(TT). (Journal of the National Cancer Institute, 98, 326-334,
2006.)
[0020] Hence, RET kinase inhibiting substances are suggested to
induce cell growth inhibition for cells expressing mutant RET and
show antitumor effect against these tumor cells. RET kinase
inhibiting substances also appear to be effective against diseases
caused by RET mutation.
[0021] Thus, RET kinase inhibiting substances are expected to be
effective against multiple endocrine neoplasia, type IIA, multiple
endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia, mucosal neuromas of the gastrointestinal tract and
thyroid carcinoma.
[0022]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-q-
uinolinecarboxamide and analogs thereof are known as angiogenesis
inhibiting substances. (International Publication No. 02/32872,
pamphlet; International Publication No. 2004/080462, pamphlet;
International Publication No. 2005/063713, pamphlet.)
[0023] However, none has reported as to what
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide and analogs thereof have RET kinase-inhibiting
activity.
SUMMARY OF THE INVENTION
[0024] The present invention was achieved regarding the
circumstances described above and the problems to be solved by the
invention are to provide a therapeutic agent and a method for
treating at least one disease selected from multiple endocrine
neoplasia, type IIA, multiple endocrine neoplasia, type IIB,
familial medullary thyroid carcinoma, papillary thyroid carcinoma,
sporadic medullary thyroid carcinoma, Hirschsprung disease,
pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of
the gastrointestinal tract as well as thyroid carcinoma, and to
provide a pharmaceutical composition and a therapeutic method
highly effective for organisms including cells expressing mutant
RET. Another problem to be solved by the invention is to provide an
RET kinase inhibitor. Yet another problem to be solved by the
invention is to provide a method for predicting the effect of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide and analogs thereof.
[0025] In order to solve the above-mentioned problems, the present
inventors have gone through keen research and found that
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide has RET kinase-inhibiting activity and that
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide and analogs thereof are highly effective against at
least one disease selected from multiple endocrine neoplasia, type
IIA, multiple endocrine neoplasia, type IIB, familial medullary
thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary
thyroid carcinoma, Hirschsprung disease, pheochromocytoma,
parathyroid hyperplasia and mucosal neuromas of the
gastrointestinal tract as well as thyroid carcinoma. The present
inventors have also found that
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide and analogs thereof are highly effective for
organisms including cells expressing mutant RET and further found
that the effect of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quin-
olinecarboxamide and analogs thereof can be predicted using the
presence or the absence of RET mutation in the cell as an
indication.
[0026] Thus, the present invention relates to a therapeutic agent
containing an RET kinase inhibiting substance for treating at least
one disease selected from multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
[0027] It also relates to a therapeutic agent for treating thyroid
carcinoma, containing an RET kinase inhibiting substance.
[0028] It further relates to a pharmaceutical composition
containing an RET kinase inhibiting substance for administering to
an organism containing a cell expressing mutant RET.
[0029] It further relates to a method for treating at least one
disease selected from multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract, the
method including administering an effective amount of an RET kinase
inhibiting substance to a patient.
[0030] It further relates to a method for treating thyroid
carcinoma, including administering an effective amount of an RET
kinase inhibiting substance to a patient.
[0031] It further relates to a method for treating a disease,
including administering an effective amount of an RET kinase
inhibiting substance to an organism containing a cell expressing
mutant RET.
[0032] It further relates to use of an RET kinase inhibiting
substance for producing a therapeutic agent for treating at least
one disease selected from multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
[0033] It further relates to use of an RET kinase inhibiting
substance for producing a therapeutic agent for treating thyroid
carcinoma.
[0034] It further relates to use of an RET kinase inhibiting
substance for producing a pharmaceutical composition containing the
RET kinase inhibiting substance, for administering to an organism
containing a cell expressing mutant RET.
[0035] It further relates to an RET kinase inhibiting substance for
a therapeutic agent for treating at least one disease selected from
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma,
papillary thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract.
[0036] It further relates to an RET kinase inhibiting substance for
a therapeutic agent for treating thyroid carcinoma.
[0037] It further relates to an RET kinase inhibiting substance for
a pharmaceutical composition containing the RET kinase inhibiting
substance, for administering to an organism containing a cell
expressing mutant RET.
[0038] It further relates to a method for predicting whether a
patient is highly sensitive to an RET kinase inhibiting substance,
including using the presence or the absence of RET mutation in the
cell as an indication.
[0039] It further relates to a method for analyzing sensitivity of
a cell to an RET kinase inhibiting substance, including determining
the presence or the absence of RET mutation in the cell.
[0040] It further relates to a method for selecting a cell highly
sensitive to an RET kinase inhibiting substance, including
determining the presence or the absence of RET mutation in the
cell.
[0041] It further relates to a method for selecting a patient
highly sensitive to an RET kinase inhibiting substance, including
determining the presence or the absence of RET mutation in the
cell.
[0042] It further relates to a method for classifying a patient
according to the result obtained from an analysis of sensitivity of
the patient to an RET kinase inhibiting substance, including
determining the presence or the absence of RET mutation in the
cell.
[0043] It further relates to a method for selecting a patient
intended for administration of an RET kinase inhibiting substance,
including determining the presence or the absence of RET mutation
in the cell, and selecting a patient containing a cell expressing
mutant RET from the determination results.
[0044] It further relates to a method for predicting a therapeutic
effect of an RET kinase inhibiting substance on a patient,
including determining the presence or the absence of RET mutation
in a cell.
[0045] It further relates to a method for determining the presence
or the absence of RET mutation in the cell from a patient for
predicting the sensitivity of the patient to an RET kinase
inhibiting substance.
[0046] Said RET kinase inhibiting substance may be a compound
represented by General Formula (I)
##STR00001##
[wherein, R.sup.1 represents a group represented by Formula
--V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents C.sub.1-6
alkylene group that may have a substituent; V.sup.2 represents a
single bond, an oxygen atom, a sulfur atom, carbonyl group,
sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent);
[0047] R.sup.2 represents cyano group, C.sub.1-6 alkoxy group that
may have a substituent, carboxyl group, C.sub.2-7 alkoxycarbonyl
group that may have a substituent or group represented by Formula
--CONV.sup.a11V.sup.a12 (wherein, V.sup.a11 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent; V.sup.a12 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent);
[0048] Y.sup.1 represents a group represented by Formula
##STR00002##
(wherein, R.sup.7 and R.sup.8 each independently represent a
hydrogen atom, a halogen atom, cyano group, nitro group, amino
group, C.sub.1-6 alkyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.1-6 alkoxy
group that may have a substituent, C.sub.1-6 alkylthio group that
may have a substituent, formyl group, C.sub.2-7 acyl group that may
have a substituent, C.sub.2-7 alkoxycarbonyl group that may have a
substituent or group represented by Formula --CONV.sup.d1V.sup.d2
(wherein, V.sup.d1 and V.sup.d2 each independently represent a
hydrogen atom or C.sub.1-6 alkyl group that may have a
substituent);
[0049] W.sup.1 and W.sup.2 each independently represent a carbon
atom or a nitrogen atom that may have a substituent);
[0050] R.sup.3 and R.sup.4 each independently represent a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.2-7 acyl group that may have a
substituent or C.sub.2-7 alkoxycarbonyl group that may have a
substituent; and
[0051] R.sup.5 represents a hydrogen atom, C.sub.1-6 alkyl group
that may have a substituent, C.sub.2-6 alkenyl group that may have
a substituent, C.sub.2-6 alkynyl group that may have a substituent,
C.sub.3-8 cycloalkyl group that may have a substituent, C.sub.6-10
aryl group that may have a substituent, 5-10-membered heteroaryl
group that may have a substituent or 3-10-membered non-aromatic
heterocyclic group that may have a substituent],
a pharmacologically acceptable salt thereof or a solvate
thereof.
[0052] Moreover, the RET kinase inhibiting substance may be at
least one compound selected from
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid (2-diethylaminoethyl)amide,
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea and
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline, a pharmacologically acceptable salt thereof or a
solvate thereof.
[0053] The present invention further relates to an RET kinase
inhibitor containing the compound represented by General Formula
(I), a pharmacologically acceptable salt thereof or a solvate
thereof.
[0054] It further relates to an RET kinase inhibitor containing at
least one compound selected from [0055]
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide, [0056]
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea and [0057]
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline,
[0058] a pharmacologically acceptable salt thereof or a solvate
thereof.
[0059] The present invention also relates to a therapeutic agent
containing
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for treating at least one disease selected from
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma,
papillary thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract.
[0060] It further relates to a therapeutic agent containing
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for treating thyroid carcinoma.
[0061] It further relates to a pharmaceutical composition
containing
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for administering to an organism containing a cell
expressing mutant RET.
[0062] It further relates to a method for treating at least one
disease selected from multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract, the
method including administering an effective amount of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof to a patient.
[0063] It further relates to a method for treating thyroid
carcinoma, including administering an effective amount of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof to a patient.
[0064] It further relates to a method for treating a disease,
including administering an effective amount of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof to an organism containing a cell expressing mutant
RET.
[0065] It further relates to use of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for producing a therapeutic agent for treating at
least one disease selected from multiple endocrine neoplasia, type
IIA, multiple endocrine neoplasia, type IIB, familial medullary
thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary
thyroid carcinoma, Hirschsprung disease, pheochromocytoma,
parathyroid hyperplasia and mucosal neuromas of the
gastrointestinal tract.
[0066] It further relates to use of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for producing a therapeutic agent for treating
thyroid carcinoma.
[0067] It further relates to use of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for producing a pharmaceutical composition
containing an RET kinase inhibiting substance for administering to
an organism containing a cell expressing mutant RET.
[0068] It further relates to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for a therapeutic agent for treating at least one
disease selected from multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
[0069] It further relates to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for a therapeutic agent for treating thyroid
carcinoma.
[0070] It further relates to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof for a pharmaceutical composition containing an RET
kinase inhibiting substance for administering to an organism
containing a cell expressing mutant RET.
[0071] It further relates to a method for predicting whether a
patient is highly sensitive to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof, the method including using the presence or the
absence of RET mutation in the cell as an indication.
[0072] It further relates to a method for analyzing sensitivity of
a cell to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quin-
olinecarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof, the method including determining the presence or
the absence of RET mutation in the cell.
[0073] It further relates to a method for selecting a cell highly
sensitive to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof, the method including determining the presence or
the absence of RET mutation in the cell.
[0074] It further relates to a method for selecting a patient
highly sensitive to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof, the method including determining the presence or
the absence of RET mutation in the cell.
[0075] It further relates to a method for classifying a patient
according to the result obtained from an analysis of sensitivity of
the patient to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof, the method including determining the presence or
the absence of RET mutation in the cell.
[0076] It further relates to a method for selecting a patient
intended for administration of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof, the method including determining the presence or
the absence of RET mutation in the cell and selecting a patient
containing a cell expressing mutant RET from the determination
results.
[0077] It further relates to a method for predicting a therapeutic
effect of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quin-
olinecarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof on a patient, the method including determining the
presence or the absence of RET mutation in a cell.
[0078] It further relates to a method for determining the presence
or the absence of RET mutation in the cell from a patient, for
predicting the sensitivity of the patient to
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof.
[0079] It further relates to an RET kinase inhibitor containing
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof.
[0080] The present invention provides a therapeutic agent and a
method containing an RET kinase inhibiting substance for treating
at least one disease selected from multiple endocrine neoplasia,
type IIA, multiple endocrine neoplasia, type IIB, familial
medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic
medullary thyroid carcinoma, Hirschsprung disease,
pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of
the gastrointestinal tract, use of an RET kinase inhibiting
substance for producing said therapeutic agent and an RET kinase
inhibiting substance for said therapeutic agent.
[0081] The present invention also provides a therapeutic agent and
a method containing an RET kinase inhibiting substance for treating
thyroid carcinoma, use of an RET kinase inhibiting substance for
producing said therapeutic agent and an RET kinase inhibiting
substance for said therapeutic agent.
[0082] The present invention further provides a pharmaceutical
composition containing an RET kinase inhibiting substance for
administering to an organism having a cell expressing mutant RET, a
method for treating a disease including administering to an
organism having a cell expressing mutant RET, use of an RET kinase
inhibiting substance for producing said pharmaceutical composition
and an RET kinase inhibiting substance for said pharmaceutical
composition.
[0083] The present invention also provides an RET kinase
inhibitor.
[0084] In addition, the present invention provides a method for
predicting the effect of an RET kinase inhibiting substance.
[0085] More specifically, the effect of an RET kinase inhibiting
substance can be predicted by using the presence or the absence of
RET mutation in the cell as an indication.
[0086] Since the method according to the invention enables one to
predict the effect of the compound without administering the
compound to the patient, it has become possible to select a patient
who is expected to be more susceptible to the compound. Thus,
contribution to the patient's QOL has become possible.
BRIEF DESCRIPTION OF THE DRAWINGS
[0087] FIG. 1 shows an effect of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide on activations of RET kinase and Erk1/2 (indication
being phosphorylation) in human medullary thyroid carcinoma cell
line (TT) in culture. The leftmost lane is the determination of RET
kinase and Erk1/2 activations (indication being phosphorylation)
without addition of a test substance.
[0088] FIG. 2 shows an antitumor effect of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide in a model for subcutaneous transplantation of human
medullary thyroid carcinoma cell line (TT).
[0089] FIG. 3 shows an effect of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide on an RET kinase in a tumor tissue of a model for
subcutaneous transplantation of human medullary thyroid carcinoma
cell line (TT). (A) shows the effect on RET phosphorylation 2 hours
after oral administration of the test substance at each dosage (10,
30 or 100 mg/kg) while (B) shows the effect on RET phosphorylation
2, 8, 12 or 24 hours after administration of the test substance at
100 mg/kg.
DETAILED DESCRIPTION OF THE INVENTION
[0090] Hereinafter, embodiments of the present invention will be
described. The following embodiments illustrate the present
invention, which are not intended to limit the present invention.
The present invention may be carried out in various embodiments
without departing from the scope of the invention.
[0091] The documents, laid-open patent applications, patent
publications and other patent documents cited herein are hereby
incorporated by reference.
[0092] 1. Therapeutic Agent, Pharmaceutical Composition and
Therapeutic Method of the Invention
[0093] (1) RET
[0094] According to the present invention, RET is a protein encoded
by ret proto-oncogene, for example, a polypeptide composed of an
amino acid sequence represented by SEQ ID NO: 2 (GenBank Accession
No: NM.sub.--020975) or SEQ ID NO: 4 (GenBank Accession No:
NM.sub.--020630). The amino acid sequences represented by SEQ ID
NO: 2 and SEQ ID NO: 4 have lengths 1114aa and 1072aa,
respectively.
[0095] The ret proto-oncogene is, for example, a polynucleotide
181-3522 of the nucleotide sequence represented by SEQ ID NO: 1
(GenBank Accession No: NM.sub.--020975), or a polynucleotide
181-3396 of the nucleotide sequence represented by SEQ ID NO: 3
(GenBank Accession No: NM.sub.--020630).
[0096] Herein, these RETs may also be referred to as "wild-type
RETs".
[0097] (2) Mutant RET
[0098] According to the present invention, mutant RET is a
polypeptide containing a mutated version of the wild-type RET amino
acid sequence, for example, an amino acid sequence having one or
several amino acids deleted, substituted, added or varied by a
combination thereof in the amino acid sequence represented by SEQ
ID NO: 2 or 4. An example includes a polypeptide having RET kinase
activity. Preferably, mutant RET may be, for example, a polypeptide
having RET kinase activity and including an amino acid sequence
having one amino acid substituted in the amino acid sequence of
wild-type RET (e.g., the amino acid sequence represented by SEQ ID
NO: 2 or 4).
[0099] Herein, "RET kinase activity" refers to a capacity of RET to
phosphorylate a tyrosine residue of itself or other protein.
[0100] Examples of mutant RETs include polypeptides including the
sequences described in (i)-(xix) below.
[0101] (i) An amino acid sequence having glycine at 321 substituted
with other amino acid, preferably arginine, in the amino acid
sequence represented by SEQ ID NO: 2 or 4 (Journal of Endocrinology
Investigation, 28, 905-909, 2005.).
[0102] (ii) An amino acid sequence having glycine at 533
substituted with other amino acid, preferably cysteine, in the
amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of
Clinical Endocrinology and Metabolism, 88, 5438-5443, 2003.).
[0103] (iii) An amino acid sequence having cysteine at 609
substituted with other amino acid, preferably serine, in the amino
acid sequence represented by SEQ ID NO: 2 or 4 (Clin Endocrinol,
63, 676-682, 2005.).
[0104] (iv) An amino acid sequence having cysteine at 611
substituted with other amino acid, preferably serine, tyrosine or
phenylalanine, in the amino acid sequence represented by SEQ ID NO:
2 or 4 (European Journal of Human Genetics, 11, 364-368, 2003,
Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109,
2001.).
[0105] (v) An amino acid sequence having cysteine at 618
substituted with other amino acid, preferably arginine, serine,
glycine or phenylalanine, in the amino acid sequence represented by
SEQ ID NO: 2 or 4 (American Journal of Pathology, 168, 1262-1275,
2006, Journal of Clinical Endocrinology and Metabolism, 86,
1104-1109, 2001.).
[0106] (vi) An amino acid sequence having cysteine at 620
substituted with other amino acid, preferably arginine or serine,
in the amino acid sequence represented by SEQ ID NO: 2 or 4
(American Journal of Pathology, 168, 1262-1275, 2006, Journal of
Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).
[0107] (vii) An amino acid sequence having cysteine at 630
substituted with other amino acid, preferably arginine or tyrosine,
in the amino acid sequence represented by SEQ ID NO: 2 or 4
(Thyroid, 15, 668-671, 2005, Biochemical and Biophysical Research
Communications, 255, 587-590, 1999.).
[0108] (viii) An amino acid sequence having aspartic acid at 631
substituted with other amino acid, preferably tyrosine, glycine,
asparagine or alanine, in the amino acid sequence represented by
SEQ ID NO: 2 or 4 (Biochemical and Biophysical Research
Communications, 255, 587-590, 1999.).
[0109] (ix) An amino acid sequence having cysteine at 634
substituted with other amino acid, preferably arginine, glycine,
tyrosine, phenylalanine, serine or tryptophan, in the amino acid
sequence represented by SEQ ID NO: 2 or 4 (Biochemical and
Biophysical Research Communications, 255, 587-590, 1999, Journal of
Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001,
Biochemical and Biophysical Research Communications, 207,
1022-1028, 1995.).
[0110] (x) An amino acid sequence having glycine at 691 substituted
with other amino acid, preferably serine, in the amino acid
sequence represented by SEQ ID NO: 2 or 4 (Cancer Research, 66,
1177-1180, 2006.).
[0111] (xi) An amino acid sequence having glutamic acid at 768
substituted with other amino acid, preferably aspartic acid, in the
amino acid sequence represented by SEQ ID NO: 2 or 4 (Clinical
Chemistry, 50, 522-529, 2004, Journal of Clinical Endocrinology and
Metabolism, 86, 1104-1109, 2001.).
[0112] (xii) An amino acid sequence having leucine at 790
substituted with other amino acid, preferably phenylalanine, in the
amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of
Clinical Endocrinology and Metabolism, 83, 770-774, 1998, Journal
of Clinical Endocrinology and Metabolism, 86, 1104-1109,
2001.).
[0113] (xiii) An amino acid sequence having tyrosine at 791
substituted with other amino acid, preferably phenylalanine, in the
amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of
Clinical Endocrinology and Metabolism, 83, 770-774, 1998.).
[0114] (xiv) An amino acid sequence having valine at 804
substituted with other amino acid, preferably methionine, in the
amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of
Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).
[0115] (xv) An amino acid sequence having tyrosine at 806
substituted with other amino acid, preferably cysteine, in the
amino acid sequence represented by SEQ ID NO: 2 or 4 (Japanese
Journal of Cancer Research, 90, 1-5, 1999.).
[0116] (xvi) An amino acid sequence having arginine at 844
substituted with other amino acid, preferably leucine, in the amino
acid sequence represented by SEQ ID NO: 2 or 4 (Exp Clin Endocrinol
Diabetes, 108, 128-132, 2000.).
[0117] (xvii) An amino acid sequence having alanine at 883
substituted with other amino acid, preferably phenylalanine or
tyrosine, in the amino acid sequence represented by SEQ ID NO: 2 or
4 (European Journal of Endocrinology, 142, 573-575, 2000, Journal
of Clinical Endocrinology and Metabolism, 89, 5823-5827,
2004.).
[0118] (xviii) An amino acid sequence having serine at 891
substituted with other amino acid, preferably alanine, in the amino
acid sequence represented by SEQ ID NO: 2 or 4 (Journal of Clinical
Endocrinology and Metabolism, 89, 4142-4145, 2004.).
[0119] (xix) An amino acid sequence having methionine at 918
substituted with other amino acid, preferably threonine, in the
amino acid sequence represented by SEQ ID NO: 2 or 4 (Clinical
Cancer Research, 8, 457-463, 2002.).
[0120] In addition, mutant RETs may be those including at least one
of the substitutions indicated in (i)-(xix) above, specifically
those including mutation sites where at least one amino acid
selected from amino acids at codons 321, 533, 609, 611, 618, 620,
630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918
is substituted with other amino acid, in the amino acid sequence
represented by SEQ ID NO: 2 or 4. For example, a polypeptide
including an amino acid sequence containing a mutation site where
valine at position 804 is substituted with other amino acid and a
mutation site where tyrosine at position 806 is substituted with
other amino acid in the amino acid sequence represented by SEQ ID
NO: 2 is contained in mutant RET. Herein, the number and the
combination of the substitutions of (i)-(xix) above to be included
in mutant RET are not particularly limited.
[0121] According to the present invention, mutant RET is preferably
a polypeptide including a sequence represented by (iii), (iv), (v),
(vi), (ix), (xi), (xii), (xiii), (xiv), (xviii) or (xix) above,
more preferably a sequence represented by (ix) or (xix).
[0122] Herein, alphabetical notation of amino acids is expressed in
generally used three-letter or single-letter codes. The alphabet
preceding the number indicates single-letter code of the amino acid
to be substituted, the alphabet following the number indicates
single-letter code of the amino acid that replaces the original
amino acid, and the number indicates the position of the amino acid
in the amino acid sequence. For example, as indicated in (xix)
above, when methionine at position 918 is substituted with
threonine, it may be indicated as "M918T".
[0123] Moreover, the number following the codon may indicate the
position of the amino acid in the amino acid sequence. For example,
"an amino acid at codon 918" refers to 918th amino acid in the
amino acid sequence.
[0124] According to the present invention, mutant RET may be a
polypeptide having RET kinase activity and encoded by rearranged
gene between gene encoding wild-type RET (hereinafter, also
referred to as "RET gene") and other gene. Moreover, mutant RET of
the invention is, for example, a polypeptide having RET kinase
activity and encoded by a polynucleotide in which the
polynucleotide having the nucleotide sequence represented by SEQ ID
NO: 1 or 3 is partially rearranged with other gene. Furthermore,
mutant RET of the invention is, for example, a polypeptide having
RET kinase activity and encoded by a polynucleotide in which the
polynucleotide 181-3522 of SEQ ID NO: 1 or polynucleotide 181-3396
of SEQ ID NO: 3 is rearranged with other gene.
[0125] Herein, "gene rearrangement" refers to recombination between
genes that results in new gene.
[0126] Examples of mutant RETs include polypeptides of (i)-(xi)
below. Embodiments of gene rearrangement for the polypeptides of
(i)-(xi) below are described in the literature mentioned in
parentheses.
[0127] (i) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC1") between RET gene and H4 (also referred
to as CCDC6, coiled-coil domain containing 6 or D10S170; GenBank
Accession No: NM.sub.--005436) gene (European Journal of Cancer,
41, 816-821, 2005, Cell, 60, 557-563, 1990.).
[0128] (ii) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC2") between RET gene and RI.alpha. (also
referred to as PRKAR1A, cAMP-dependent regulatory type I alpha;
GenBank Accession No: NM.sub.--212471) gene (Eur J Endocrinology,
147, 741-745, 2002.).
[0129] (iii) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC3") between RET gene and ELE1 (also referred
to as NCOA4, nuclear receptor coactivator 4 or RFG; GenBank
Accession No: NM.sub.--005437) gene (European Journal of Cancer,
41, 816-821, 2005.).
[0130] (iv) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC4") between RET gene and ELE1 (also referred
to as NCOA4, nuclear receptor coactivator 4 or RFG; GenBank
Accession No: NM.sub.--005437) gene (Oncogene, 13, 1093-1097,
1996.).
[0131] (v) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC5") between RET gene and RFG5 (also referred
to as GOLGA5, golgin-84; GenBank Accession No: NM.sub.--005113)
gene (Cancer Research, 58, 198-203, 1998.).
[0132] (vi) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC6") between RET gene and hTIF (also referred
to as TRIM24, tripartite motif-containing 24 or PTC6; GenBank
Accession No: NM.sub.--003852) gene (Oncogene, 18, 4388-4393,
1999.).
[0133] (vii) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC7") between RET gene and RFG7 (also referred
to as TRIM33, tripartite motif-containing 33, PTC7; GenBank
Accession No: NM.sub.--033020) gene (Cancer Research, 60,
2786-2789, 2000.).
[0134] (viii) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PTC8") between RET gene and kinectin (also
referred to as KTN1, kinectin 1; GenBank Accession No:
NM.sub.--182926) gene (Cancer Research, 60, 7028-7032, 2000, Cancer
Research, 60, 2786-2789, 2000.).
[0135] (ix) A polypeptide encoded by a rearranged gene (also
referred to as "RET/ELKS") between RET gene and ELKS (also referred
to as RAB6IP2 or RAB6 interacting protein 2; GenBank Accession No:
NM.sub.--178037) gene (Genes Chromosomes Cancer, 25, 97-103,
1999.).
[0136] (x) A polypeptide encoded by a rearranged gene (also
referred to as "RET/PCM-1") between RET gene and PCM-1 (also
referred to as PCM1 or pericentriolar material 1; GenBank Accession
No: NM.sub.--006197) gene (Oncogene, 19, 4236-4242, 2000.).
[0137] (xi) A polypeptide encoded by a rearranged gene (also
referred to as "RFP-RET") between RET gene and gene RFP (also
referred to as ret finger protein; GenBank Accession No:
NM.sub.--006510) (Endocrinology, 145, 5448-5451, 2004.).
[0138] The presence or the absence of RET mutation can be verified
through analysis of sequence of RET gene or sequence of RET gene
transcript, i.e., mRNA. Analysis procedure may, for example, be
dideoxynucleotide chain termination method (Sanger et al. (1977),
Proc. Natl. Acad. Sci. USA 74: 5463). The sequence can be analyzed
using a suitable DNA sequencer.
[0139] Alternatively, the presence or the absence of RET mutation
may be analyzed, for example, by a technique such as in situ
hybridization, northern blot analysis, DNA microarray, RT-PCR or
SSCP-PCR (Single-Strand Conformation Polymorphism-PCR). These
techniques can be carried out according to routine procedures
(Clinical Cancer Research, 8, 457-463, 2002.).
[0140] The presence or the absence of RET mutation may also be
analyzed, for example, by an immunochemical method (e.g.,
immunohistochemical method, immunoprecipitation, western blot, flow
cytometry, ELISA, RIA, etc.). These techniques can be carried out
according to routine procedures.
[0141] The primer sequences for PCR to analyze the presence or the
absence of mutant RET can be designed according to a routine
procedure. For example, the primer sequences can be designed using
Primer Expression (Perkin-Elmer Applied Biosystems).
[0142] In order to analyze the presence or the absence of mutant
RET, for example, primers mentioned in Table 1 may be used. For
example, for analyzing RET/PTC1, polynucleotides having the
sequences represented by SEQ ID NOS: 5 and 6 can be employed as
primers.
TABLE-US-00001 TABLE 1 Mutant RET intended for analysis Primer 1
Primer 2 RET/PTC1 SEQ ID NO: 5 SEQ ID NO: 6 RET/PTC2 SEQ ID NO: 7
SEQ ID NO: 6 RET/PTC3 SEQ ID NO: 8 SEQ ID NO: 9 RET/PTC4 SEQ ID NO:
10 SEQ ID NO: 11 RET/PTC5 SEQ ID NO: 12 SEQ ID NO: 13 RET/PTC6 SEQ
ID NO: 12 SEQ ID NO: 14 RET/PTC7 SEQ ID NO: 12 SEQ ID NO: 15
RET/PTC8 SEQ ID NO: 12 SEQ ID NO: 16 RET/ELKS SEQ ID NO: 17 SEQ ID
NO: 18 RET/PCM-1 SEQ ID NO: 19 SEQ ID NO: 20
[0143] Table 1 indicates some of the exemplary primers for mutant
RETs intended for analysis.
[0144] The nucleotide sequences represented by SEQ ID NOS: 5-20 are
shown below.
TABLE-US-00002 ATT GTC ATC TCG CCG TTC SEQ ID NO: 5 TGC TTC AGG ACG
TTG AAC SEQ ID NO: 6 TAT CGC AGG AGA GAC TGT GAT SEQ ID NO: 7 TGG
AGA AGA GAG GCT GTA TC SEQ ID NO: 8 CGT TGC CTT GAC TTT TC SEQ ID
NO: 9 TGC CCC TTC AGT GTT CCT ACT SEQ ID NO: 10 CTT GAT AAC ACT GGC
AGG TT SEQ ID NO: 11 GAG GCG TTC TCT TTC AGC AT SEQ ID NO: 12 TGG
AAG AAC TTC GGC ATG AG SEQ ID NO: 13 GAA TTC ACA GCC ACC AAG TG SEQ
ID NO: 14 CTA CTT AGC TTT CCA AGT GG SEQ ID NO: 15 GGG ACA GAC ACC
TTT GGA AAT A SEQ ID NO: 16 GTTGAAGGAGTCCTTGACTG SEQ ID NO: 17
CTTTCAGCATCTTCACGG SEQ ID NO: 18 AGTGAAGTTTCTACCATCC SEQ ID NO: 19
GGCGTTCTCTTTCAGCATCT SEQ ID NO: 20
[0145] (3) Cell Expressing Mutant RET
[0146] According to the present invention, a cell expressing mutant
RET is preferably a cell from multiple endocrine neoplasia, type
IIA, multiple endocrine neoplasia, type IIB, familial medullary
thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary
thyroid carcinoma, Hirschsprung disease, pheochromocytoma,
parathyroid hyperplasia or mucosal neuromas of the gastrointestinal
tract. Alternatively, a cell expressing mutant RET, according to
the present invention, is preferably a cell from thyroid
carcinoma.
[0147] (4) RET Kinase Inhibiting Substance of the Invention
[0148] Herein, a "halogen atom" refers to a fluorine atom, a
chlorine atom, a bromine atom or an iodine atom.
[0149] Preferable examples of a "halogen atom" include a fluorine
atom and a chlorine atom.
[0150] Herein, "C.sub.1-6 alkyl group" refers to linear or branched
alkyl group with a carbon number of 1-6, specific examples being
methyl group, ethyl group, 1-propyl group (n-propyl group),
2-propyl group (i-propyl group), 2-methyl-1-propyl group (1-butyl
group), 2-methyl-2-propyl group (t-butyl group), 1-butyl group
(n-butyl group), 2-butyl group (s-butyl group), 1-pentyl group,
2-pentyl group, 3-pentyl group, 2-methyl-1-butyl group,
3-methyl-1-butyl group, 2-methyl-2-butyl group, 3-methyl-2-butyl
group, 2,2-dimethyl-1-propyl group, 1-hexyl group, 2-hexyl group,
3-hexyl group, 2-methyl-1-pentyl group, 3-methyl-1-pentyl group,
4-methyl-1-pentyl group, 2-methyl-2-pentyl group, 3-methyl-2-pentyl
group, 4-methyl-2-pentyl group, 2-methyl-3-pentyl group,
3-methyl-3-pentyl group, 2,3-dimethyl-1-butyl group,
3,3-dimethyl-1-butyl group, 2,2-dimethyl-1-butyl group,
2-ethyl-1-butyl group, 3,3-dimethyl-2-butyl group and
2,3-dimethyl-2-butyl group.
[0151] Preferable examples of "C.sub.1-6 alkyl group" include
methyl group, ethyl group, 1-propyl group, 2-propyl group,
2-methyl-1-propyl group, 2-methyl-2-propyl group, 1-butyl group and
2-butyl group.
[0152] Herein, "C.sub.1-6 alkylene group" refers to divalent group
derived from "C.sub.1-6 alkyl group" defined above by removing any
one hydrogen atom therefrom, and specific examples include
methylene group, 1,2-ethylene group, 1,1-ethylene group,
1,3-propylene group, tetramethylene group, pentamethylene group and
hexamethylene group.
[0153] Herein, "C.sub.2-6 alkenyl group" refers to linear or
branched alkenyl group having one double bond and a carbon number
of 2-6, and specific examples include ethenyl group (vinyl group),
1-propenyl group, 2-propenyl group (allyl group), 1-butenyl group,
2-butenyl group, 3-butenyl group, pentenyl group and hexenyl
group.
[0154] Herein, "C.sub.2-6 alkynyl group" refers to linear or
branched alkynyl group having one triple bond and a carbon number
of 2-6, and specific examples include ethinyl group, 1-propynyl
group, 2-propynyl group, 1-butynyl group, 2-butynyl group,
3-butynyl group, pentynyl group and hexynyl group.
[0155] Herein, "C.sub.3-8 cycloalkyl group" refers to monocyclic or
bicyclic saturated aliphatic hydrocarbon group with a carbon number
of 3-8, and specific examples include cyclopropyl group, cyclobutyl
group, cyclopentyl group, cyclohexyl group, cycloheptyl group,
cyclooctyl group, bicyclo[2.1.0]pentyl group, bicyclo[3.1.0]hexyl
group, bicyclo[2.1.1]hexyl group, bicyclo[4.1.0]heptyl group,
bicyclo[2.2.1]heptyl group (norbornyl group), bicyclo[3.3.0]octyl
group, bicyclo[3.2.1]octyl group and bicyclo[2.2.2]octyl group.
[0156] Preferable examples of "C.sub.3-8 cycloalkyl group" include
cyclopropyl group, cyclobutyl group and cyclopentyl group.
[0157] Herein, "C.sub.6-10 aryl group" refers to aromatic
hydrocarbon cyclic group with a carbon number of 6-10, and specific
examples include phenyl group, 1-naphthyl group, 2-naphthyl group,
indenyl group and azulenyl group.
[0158] A preferable example of "C.sub.6-10 aryl group" includes
phenyl group.
[0159] Herein, "a heteroatom" refers to a nitrogen atom, an oxygen
atom or a sulfur atom.
[0160] Herein, "5-10-membered heteroaryl group" refers to aromatic
cyclic group having 5-10 atoms forming the ring including 1-5
heteroatoms, and specific examples include furyl group, thienyl
group, pyrrolyl group, imidazolyl group, triazolyl group,
tetrazolyl group, thiazolyl group, pyrazolyl group, oxazolyl group,
isoxazolyl group, isothiazolyl group, furazanyl group, thiadiazolyl
group, oxadiazolyl group, pyridyl group, pyrazinyl group,
pyridazinyl group, pyrimidinyl group, triazinyl group, purinyl
group, pteridinyl group, quinolyl group, isoquinolyl group,
naphthyridinyl group, quinoxalinyl group, cinnolinyl group,
quinazolinyl group, phthalazinyl group, imidazopyridyl group,
imidazothiazolyl group, imidazoxazolyl group, benzothiazolyl group,
benzoxazolyl group, benzimidazolyl group, indolyl group, isoindolyl
group, indazolyl group, pyrrolopyridyl group, thienopyridyl group,
furopyridyl group, benzothiadiazolyl group, benzoxadiazolyl group,
pyridopyrimidinyl group, benzofuryl group, benzothienyl group and
thienofuryl group.
[0161] Preferable examples of "5-10-membered heteroaryl group"
include furyl group, thienyl group, pyrrolyl group, imidazolyl
group, thiazolyl group, pyrazolyl group, oxazolyl group, isoxazolyl
group, isothiazolyl group, pyridyl group and pyrimidinyl group.
[0162] Herein, "3-10-membered non-aromatic heterocyclic group":
[0163] (a) has 3-10 atoms forming the ring;
[0164] (b) has 1-2 heteroatoms included in the atoms forming the
ring;
[0165] (c) may include 1-2 double bonds in the ring;
[0166] (d) may have 1-3 carbonyl groups, sulfinyl groups or
sulfonyl groups in the ring; and
[0167] (e) is non-aromatic monocyclic or bicyclic group, where when
a nitrogen atom is included in the atoms forming the ring, the
nitrogen atom may have a binding hand.
[0168] Specific examples include aziridinyl group, azetidinyl
group, pyrrolidinyl group, piperidinyl group, azepanyl group,
azocinyl group, piperazinyl group, diazepanyl group, diazocanyl
group, diazabicyclo[2.2.1]heptyl group, morpholinyl group,
thiomorpholinyl group, 1,1-dioxothiomorpholinyl group, oxiranyl
group, oxetanyl group, tetrahydrofuryl group, dioxoranyl group,
tetrahydropyranyl group, dioxanyl group, tetrahydrothienyl group,
tetrahydrothiopyranyl group, oxazolidinyl group and thiazolidinyl
group.
[0169] Preferable examples of "3-10-membered non-aromatic
heterocyclic group" include aziridinyl group, azetidinyl group,
pyrrolidinyl group, piperidinyl group, azepanyl group, piperazinyl
group, diazepanyl group, morpholinyl group, thiomorpholinyl group,
1,1-dioxothiomorpholinyl group, tetrahydrofuryl group and
tetrahydropyranyl group.
[0170] Herein, "C.sub.1-6 alkoxy group" refers to group in which an
oxygen atom is bound to the terminal of "C.sub.1-6 alkyl group"
defined above, and specific examples include methoxy group, ethoxy
group, 1-propoxy group (n-propoxy group), 2-propoxy group
(1-propoxy group), 2-methyl-1-propoxy group (1-butoxy group),
2-methyl-2-propoxy group (t-butoxy group), 1-butoxy group (n-butoxy
group), 2-butoxy group (s-butoxy group), 1-pentyloxy group,
2-pentyloxy group, 3-pentyloxy group, 2-methyl-1-butoxy group,
3-methyl-1-butoxy group, 2-methyl-2-butoxy group, 3-methyl-2-butoxy
group, 2,2-dimethyl-1-propoxy group, 1-hexyloxy group, 2-hexyloxy
group, 3-hexyloxy group, 2-methyl-1-pentyloxy group,
3-methyl-1-pentyloxy group, 4-methyl-1-pentyloxy group,
2-methyl-2-pentyloxy group, 3-methyl-2-pentyloxy group,
4-methyl-2-pentyloxy group, 2-methyl-3-pentyloxy group,
3-methyl-3-pentyloxy group, 2,3-dimethyl-1-butoxy group,
3,3-dimethyl-1-butoxy group, 2,2-dimethyl-1-butoxy group,
2-ethyl-1-butoxy group, 3,3-dimethyl-2-butoxy group and
2,3-dimethyl-2-butoxy group.
[0171] Preferable examples of "C.sub.1-6 alkoxy group" include
methoxy group, ethoxy group, 1-propoxy group, 2-propoxy group,
2-methyl-1-propoxy group, 2-methyl-2-propoxy group, 1-butoxy group
and 2-butoxy group.
[0172] Herein, "C.sub.1-6 alkylthio group" refers to group in which
a sulfur atom is bound to the terminal of "C.sub.1-6 alkyl group"
defined above, and specific examples include methylthio group,
ethylthio group, 1-propylthio group (n-propylthio group),
2-propylthio group (i-propylthio group), 2-methyl-1-propylthio
group (1-butylthio group), 2-methyl-2-propylthio group (t-butylthio
group), 1-butylthio group (n-butylthio group), 2-butylthio group
(s-butylthio group), 1-pentylthio group, 2-pentylthio group,
3-pentylthio group, 2-methyl-1-butylthio group,
3-methyl-1-butylthio group, 2-methyl-2-butylthio group,
3-methyl-2-butylthio group, 2,2-dimethyl-1-propylthio group,
1-hexylthio group, 2-hexylthio group, 3-hexylthio group,
2-methyl-1-pentylthio group, 3-methyl-1-pentylthio group,
4-methyl-1-pentylthio group, 2-methyl-2-pentylthio group,
3-methyl-2-pentylthio group, 4-methyl-2-pentylthio group,
2-methyl-3-pentylthio group, 3-methyl-3-pentylthio group,
2,3-dimethyl-1-butylthio group, 3,3-dimethyl-1-butylthio group,
2,2-dimethyl-1-butylthio group, 2-ethyl-1-butylthio group,
3,3-dimethyl-2-butylthio group and 2,3-dimethyl-2-butylthio
group.
[0173] Preferable examples of "C.sub.1-6 alkylthio group" include
methylthio group, ethylthio group, 1-propylthio group (n-propylthio
group), 2-propylthio group (i-propylthio group),
2-methyl-1-propylthio group (1-butylthio group),
2-methyl-2-propylthio group (t-butylthio group), 1-butylthio group
(n-butylthio group) and 2-butylthio group (s-butylthio group).
[0174] Herein, "C.sub.3-8 cycloalkoxy group" refers to group in
which an oxygen atom is bound to the terminal of "C.sub.3-8
cycloalkyl group" defined above, and specific examples include
cyclopropoxy group, cyclobutoxy group, cyclopentyloxy group,
cyclohexyloxy group, cycloheptyloxy group, cyclooctyloxy group,
bicyclo[2.1.0]pentyloxy group, bicyclo[3.1.0]hexyloxy group,
bicyclo[2.1.1]hexyloxy group, bicyclo[4.1.0]heptyloxy group,
bicyclo[2.2.1]heptyloxy group (norbornyloxy group),
bicyclo[3.3.0]octyloxy group, bicyclo[3.2.1]octyloxy group and
bicyclo[2.2.2]octyloxy group.
[0175] Preferable examples of "C.sub.3-8 cycloalkoxy group" include
cyclopropoxy group, cyclobutoxy group and cyclopentyloxy group.
[0176] Herein, "mono-C.sub.1-6 alkylamino group" refers to group in
which a hydrogen atom in amino group is substituted with "C.sub.1-6
alkyl group" defined above, and specific examples include
methylamino group, ethylamino group, 1-propylamino group
(n-propylamino group), 2-propylamino group (i-propylamino group),
2-methyl-1-propylamino group (1-butylamino group),
2-methyl-2-propylamino group (t-butylamino group), 1-butylamino
group (n-butylamino group), 2-butylamino group (s-butylamino
group), 1-pentylamino group, 2-pentylamino group, 3-pentylamino
group, 2-methyl-1-butylamino group, 3-methyl-1-butylamino group,
2-methyl-2-butylamino group, 3-methyl-2-butylamino group,
2,2-dimethyl-1-propylamino group, 1-hexylamino group, 2-hexylamino
group, 3-hexylamino group, 2-methyl-1-pentylamino group,
3-methyl-1-pentylamino group, 4-methyl-1-pentylamino group,
2-methyl-2-pentylamino group, 3-methyl-2-pentylamino group,
4-methyl-2-pentylamino group, 2-methyl-3-pentylamino group,
3-methyl-3-pentylamino group, 2,3-dimethyl-1-butylamino group,
3,3-dimethyl-1-butylamino group, 2,2-dimethyl-1-butylamino group,
2-ethyl-1-butylamino group, 3,3-dimethyl-2-butylamino group and
2,3-dimethyl-2-butylamino group.
[0177] Herein, "di-C.sub.1-6 alkylamino group" refers to group in
which two hydrogen atoms in amino group are substituted with
identical or different "C.sub.1-6 alkyl group" defined above, and
specific examples include N,N-dimethylamino group, N,N-diethylamino
group, N,N-di-n-propylamino group, N,N-di-1-propylamino group,
N,N-di-n-butylamino group, N,N-di-1-butylamino group,
N,N-di-s-butylamino group, N,N-di-t-butylamino group,
N-ethyl-N-methylamino group, N-n-propyl-N-methylamino group,
N-1-propyl-N-methylamino group, N-n-butyl-N-methylamino group,
N-1-butyl-N-methylamino group, N-s-butyl-N-methylamino group and
N-t-butyl-N-methylamino group.
[0178] Herein, "C.sub.2-7 acyl group" refers to carbonyl group
bound with "C.sub.1-6 alkyl group" defined above, and specific
examples include acetyl group, propionyl group, isopropionyl group,
butyryl group, isobutyryl group, valeryl group, isovaleryl group
and pivaloyl group.
[0179] Herein, "C.sub.2-7 alkoxycarbonyl group" refers to carbonyl
group bound with "C.sub.1-6 alkoxy group" defined above, and
specific examples include methoxycarbonyl group, ethoxycarbonyl
group, 1-propyloxycarbonyl group, 2-propyloxycarbonyl group and
2-methyl-2-propoxy carbonyl group.
[0180] Herein, "that may have a substituent" means "that may have
one or more substituents at substitutable positions in any
combination", and specific examples of the substituent include a
halogen atom, hydroxyl group, thiol group, nitro group, cyano
group, formyl group, carboxyl group, amino group, silyl group,
methanesulfonyl group, C.sub.1-6 alkyl group, C.sub.2-6 alkenyl
group, C.sub.2-6 alkynyl group, C.sub.3-8 cycloalkyl group,
C.sub.6-10 aryl group, 5-10-membered heteroaryl group,
3-10-membered non-aromatic heterocyclic group, C.sub.1-6 alkoxy
group, C.sub.1-6 alkylthio group, C.sub.3-8 cycloalkoxy group,
mono-C.sub.1-6 alkylamino group, di-C.sub.1-6 alkylamino group,
C.sub.2-7 acyl group and C.sub.2-7 alkoxycarbonyl group. In this
case, C.sub.1-6 alkyl group, C.sub.2-6 alkenyl group, C.sub.2-6
alkynyl group, C.sub.3-8 cycloalkyl group, C.sub.6-10 aryl group,
5-10-membered heteroaryl group, 3-10-membered non-aromatic
heterocyclic group, C.sub.1-6 alkoxy group, C.sub.1-6 alkylthio
group, C.sub.3-8 cycloalkoxy group, mono-C.sub.1-6 alkylamino
group, di-C.sub.1-6 alkylamino group, C.sub.2-7 acyl group and
C.sub.2-7 alkoxycarbonyl group may each independently have 1-3
groups selected from the following substituent groups.
[0181] <Substituent Groups>
[0182] A halogen atom, hydroxyl group, thiol group, nitro group,
cyano group, C.sub.1-6 alkyl group, C.sub.3-8 cycloalkyl group,
C.sub.2-6 alkenyl group, C.sub.2-6 alkynyl group, C.sub.6-10 aryl
group, 5-10-membered heteroaryl group, 3-10-membered non-aromatic
heterocyclic group, C.sub.1-6 alkoxy group and C.sub.1-6 alkylthio
group.
[0183] According to the present invention, an RET kinase inhibiting
substance may, for example, be a compound represented by General
Formula (I)
##STR00003##
[0184] (i) R.sup.1
[0185] R.sup.1 represents a group represented by Formula
--V.sup.1--V.sup.2--V.sup.3 (wherein, V.sup.1 represents C.sub.1-6
alkylene group that may have a substituent; V.sup.2 represents a
single bond, an oxygen atom, a sulfur atom, carbonyl group,
sulfinyl group, sulfonyl group, group represented by Formula
--CONR.sup.6--, group represented by Formula --SO.sub.2NR.sup.6--,
group represented by Formula --NR.sup.6SO.sub.2--, group
represented by Formula --NR.sup.6CO-- or group represented by
Formula --NR.sup.6-- (wherein, R.sup.6 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent or C.sub.3-8
cycloalkyl group that may have a substituent); V.sup.3 represents a
hydrogen atom, C.sub.1-6 alkyl group that may have a substituent,
C.sub.2-6 alkenyl group that may have a substituent, C.sub.2-6
alkynyl group that may have a substituent, C.sub.3-8 cycloalkyl
group that may have a substituent, C.sub.6-10 aryl group that may
have a substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent).
[0186] A preferable example of R.sup.1 includes C.sub.1-6 alkyl
group. In this case, R.sup.1 may have a substituent selected from
3-10-membered non-aromatic heterocyclic group which may have
C.sub.1-6 alkyl group, hydroxyl group, C.sub.1-6 alkoxy group,
amino group, mono-C.sub.1-6 alkylamino group and di-C.sub.1-6
alkylamino group.
[0187] More preferable examples of R.sup.1 include methyl group and
group represented by any one of the following Formulae
##STR00004##
(wherein, R.sup.a3 represents methyl group; R.sup.a1 represents a
hydrogen atom or hydroxyl group; R.sup.a2 represents methoxy group,
ethoxy group, 1-pyrrolidinyl group, 1-piperidinyl group,
4-morpholinyl group, dimethylamino group or diethylamino
group).
[0188] Still more preferable examples of R.sup.1 include methyl
group and 2-methoxyethyl group.
[0189] (ii) R.sup.2
[0190] R.sup.2 represents cyano group, C.sub.1-6 alkoxy group that
may have a substituent, carboxyl group, C.sub.2-7 alkoxycarbonyl
group that may have a substituent or group represented by Formula
--CONV.sup.a11V.sup.a12 (wherein, V.sup.a11 represents a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent; V.sup.a12 represents a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent, 5-10-membered heteroaryl group that may have a
substituent, 3-10-membered non-aromatic heterocyclic group that may
have a substituent, hydroxyl group, C.sub.1-6 alkoxy group that may
have a substituent or C.sub.3-8 cycloalkoxy group that may have a
substituent).
[0191] Preferable examples of R.sup.2 include cyano group or group
represented by Formula --CONV.sup.a11V.sup.a12 (wherein, V.sup.a11
and V.sup.a12 have the same meaning as defined above).
[0192] More preferable examples of R.sup.2 include cyano group or
group represented by Formula --CONHV.sup.a16 (wherein, V.sup.a16
represents a hydrogen atom, C.sub.1-6 alkyl group, C.sub.3-8
cycloalkyl group, C.sub.1-6 alkoxy group or C.sub.3-8 cycloalkoxy
group, where V.sup.a16 may have a substituent selected from a
halogen atom, cyano group, hydroxyl group and C.sub.1-6 alkoxy
group).
[0193] Still more preferable example of R.sup.2 includes a group
represented by Formula --CONHV.sup.a17 (wherein, V.sup.a17
represents a hydrogen atom, C.sub.1-6 alkyl group or C.sub.1-6
alkoxy group).
[0194] The most preferable example of R.sup.2 includes a group
represented by Formula --CONHV.sup.a18 (wherein, V.sup.a18
represents a hydrogen atom, methyl group or methoxy group).
[0195] (iii) Y.sup.1
[0196] Y.sup.1 represents a group represented by Formula
##STR00005##
(wherein, R.sup.7 and R.sup.8 each independently represent a
hydrogen atom, a halogen atom, cyano group, nitro group, amino
group, C.sub.1-6 alkyl group that may have a substituent, C.sub.3-8
cycloalkyl group that may have a substituent, C.sub.1-6 alkoxy
group that may have a substituent, C.sub.1-6 alkylthio group that
may have a substituent, formyl group, C.sub.2-7 acyl group that may
have a substituent, C.sub.2-7 alkoxycarbonyl group that may have a
substituent or group represented by Formula --CONV.sup.d1V.sup.d2
(wherein, V.sup.d1 and V.sup.d2 each independently represent a
hydrogen atom or C.sub.1-6 alkyl group that may have a
substituent); and
[0197] W.sup.1 and W.sup.2 each independently represent a carbon
atom or a nitrogen atom that may have a substituent).
[0198] A preferable example of Y.sup.1 includes a group represented
by Formula
##STR00006##
(wherein, R.sup.71 represents a hydrogen atom or a halogen
atom).
[0199] (iv) R.sup.3 and R.sup.4
[0200] R.sup.3 and R.sup.4 each independently represent a hydrogen
atom, C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.2-7 acyl group that may have a
substituent or C.sub.2-7 alkoxycarbonyl group that may have a
substituent.
[0201] A preferable example of R.sup.3 and R.sup.4 includes a
hydrogen atom.
[0202] (v) R.sup.5
[0203] R.sup.5 represents a hydrogen atom, C.sub.1-6 alkyl group
that may have a substituent, C.sub.2-6 alkenyl group that may have
a substituent, C.sub.2-6 alkynyl group that may have a substituent,
C.sub.3-8 cycloalkyl group that may have a substituent, C.sub.6-10
aryl group that may have a substituent, 5-10-membered heteroaryl
group that may have a substituent or 3-10-membered non-aromatic
heterocyclic group that may have a substituent.
[0204] Preferable examples of R.sup.5 include a hydrogen atom,
C.sub.1-6 alkyl group that may have a substituent, C.sub.2-6
alkenyl group that may have a substituent, C.sub.2-6 alkynyl group
that may have a substituent, C.sub.3-8 cycloalkyl group that may
have a substituent, C.sub.6-10 aryl group that may have a
substituent or 3-10-membered non-aromatic heterocyclic group that
may have a substituent.
[0205] More preferable examples of R.sup.5 include a hydrogen atom,
C.sub.1-6 alkyl group, C.sub.3-8 cycloalkyl group and C.sub.6-10
aryl group (where R.sup.5 may have at least one substituent
selected from a halogen atom and methanesulfonyl group).
[0206] More preferable examples of R.sup.5 include methyl group,
ethyl group or cyclopropyl group.
[0207] Moreover, preferable examples of the compound represented by
General Formula (I) include: [0208]
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-(4-fl-
uorophenyl)urea; [0209]
N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)-
phenyl)-N'-cyclopropylurea; [0210]
N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)-
oxy)phenyl)-N'-(4-fluorophenyl)urea; [0211]
N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl-
)oxy)phenyl)-N'-(4-fluorophenyl)urea; [0212]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide; [0213]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide; [0214]
N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)--
7-methoxy-6-quinolinecarboxamide; [0215]
N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phen-
oxy)-7-methoxy-6-quinolinecarboxamide; [0216]
N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)pheno-
xy)-7-methoxy-6-quinolinecarboxamide; [0217]
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-me-
thoxy-6-quinolinecarboxamide; [0218]
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-met-
hoxy-6-quinolinecarboxamide; [0219]
N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-meth-
oxy-6-quinolinecarboxamide; [0220]
4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-
-6-quinolinecarboxamide; [0221]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-
-6-quinolinecarboxamide; [0222]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydro-
xypropyl)oxy-6-quinolinecarboxamide; [0223]
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide; [0224]
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide; [0225]
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide; [0226]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)--
6-quinolinecarboxamide; [0227]
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quin-
olinecarboxamide; [0228]
N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N'-cycloprop-
ylurea; [0229]
N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phen-
oxy)-7-methoxy-6-quinolinecarboxamide; [0230]
4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinec-
arboxamide; [0231]
4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-meth-
oxy-6-quinolinecarboxamide; [0232]
N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2--
methoxyethoxy)-6-quinolinecarboxamide; [0233]
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-
-quinolinecarboxamide; [0234]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino)
ethoxy)-6-quinolinecarboxamide; [0235]
4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quino-
linecarboxamide; [0236]
N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl-
)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide; [0237]
4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide; [0238]
4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydro-
xy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide; [0239]
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3--
diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide; [0240]
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-d-
iethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide; [0241]
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2--
hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide; [0242]
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-h-
ydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide; [0243]
N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-meth-
yl-4-piperidyl)methoxy)-6-quinolinecarboxamide; [0244]
N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methy-
l-4-piperidyl)methoxy)-6-quinolinecarboxamide; [0245]
N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N'-cyclo-
propylurea; [0246]
N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N'-(3-(me-
thylsulfonyl)phenyl)urea; [0247]
4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarbo-
xamide; [0248]
4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methoxy-6-qui-
nolinecarboxamide; [0249]
N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-
-methoxy-6-quinolinecarboxamide; [0250]
4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic
acid (2-cyanoethyl)amide; and [0251]
N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)--
N'-cyclopropylurea.
[0252] More preferable examples of the compound represented by
General Formula (I) include: [0253]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide; [0254]
4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarb-
oxamide; [0255]
N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-me-
thoxy-6-quinolinecarboxamide; [0256]
4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecar-
boxamide; and [0257]
N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy--
6-quinolinecarboxamide.
[0258] A still more preferable example of the compound represented
by General Formula (I) further includes
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide (see Formula (II)).
[0259] The most preferable example of the RET kinase inhibiting
substance includes methanesulfonate of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide.
##STR00007##
[0260] The compound represented by General Formula (I) can be
produced by a known method, for example, methods described in
International publication No. 02/32872 pamphlet (WO02/32872) and
International publication No. 2005/063713 pamphlet
(WO2005/063713).
[0261] In addition, an RET kinase inhibiting substance of the
invention is, for example:
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide (hereinafter, also
referred to as "SU11248"; Clinical Cancer Research, 9, 327-337,
2003, Journal of Medicinal Chemistry, 46: 1116-9, 2003, WO0/060814)
(see Formula (III))
##STR00008##
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea (hereinafter, also referred to as "KRN951"; WO02/088110)
(see Formula (IV))
##STR00009##
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline (hereinafter, also referred to as "AZD2171";
Cancer Research. 65:4389-400, 2005, WO00/47212) (see Formula
(V))
##STR00010##
[0262] SU11248, KRN951 and AZD2171 can be produced according to a
known method. They can be produced, for example, according to the
methods described in the respective literatures.
[0263] According to the present invention, the RET kinase
inhibiting substance may form a pharmacologically acceptable salt
with acid or base. According to the present invention, the RET
kinase inhibiting substance also includes such pharmacologically
acceptable salts. Examples of salts formed with acid include
inorganic acid salts such as hydrochloride, hydrobromate, sulfate
and phosphate, and organic acid salts such as formic acid, acetic
acid, lactic acid, succinic acid, fumaric acid, maleic acid, citric
acid, tartaric acid, stearic acid, benzoic acid, methanesulfonic
acid, benzenesulfonic acid, p-toluenesulfonic acid and
trifluoroacetic acid. Examples of salts formed with base include
alkali metal salts such as sodium salt and potassium salt, alkaline
earth metal salts such as calcium salt and magnesium salt, organic
base salts such as trimethylamine, triethylamine, pyridine,
picoline, dicyclohexylamine, N,N'-dibenzyl ethylenediamine,
arginine and lysine and ammonium salt.
[0264] Furthermore, according to the present invention, the RET
kinase inhibiting substance also includes, if any, solvates and
enantiomers of these compounds. Examples of solvates include
hydrates and nonhydrates, preferably hydrates. Examples of solvents
include water, alcohols (for example, methanol, ethanol,
n-propanol) and dimethylformamide.
[0265] Moreover, according to the present invention, the RET kinase
inhibiting substance may be crystalline or amorphous. If a
crystalline polymorph is present, it may be a single polymorph or a
mixture of polymorphs in any crystalline shape.
[0266] According to the present invention, the RET kinase
inhibiting substance includes RET kinase inhibiting substances
susceptible to metabolism such as oxidation, reduction, hydrolysis
and conjugation in vivo. The RET kinase inhibiting substance of the
invention also includes compounds that generate an RET kinase
inhibiting substance by undergoing metabolism such as oxidation,
reduction and hydrolysis in vivo.
[0267] The RET kinase inhibiting substance of the invention has
activity of inhibiting RET kinase activity (hereinafter, also
referred to as "RET kinase-inhibiting activity"). The inhibition
capacity of the RET kinase inhibiting substance of the invention is
not limited as long as it inhibits kinase activity of RET. Examples
of methods for determining the RET kinase-inhibiting activity of
the RET kinase inhibiting substance include cell free kinase assay,
western blotting, cell growth assay and viability assay. Examples
of the cell growth assay include tritium thymidine uptake method,
MTT method, XTT method (cell counting kit-8 (Dojindo
Laboratories)), AlamarBlue method, Neutral Red method, BrdU method,
Ki67 staining and PCNA staining. Examples of the viability assay
include TUNNEL staining, Caspase-3 cleavage detection and PARP
cleavage detection. These methods may be carried out according to
conventional techniques (Blood. 2005, 105, 2941-2948, Molecular
Cancer Therapeutics. 2005, 4, 787-798).
[0268] Hereinafter, an example of a method for determining RET
kinase-inhibiting activity will be described.
[0269] The RET kinase-inhibiting activity can be determined by cell
free kinase assay.
[0270] RET can be prepared by gene-engineering means according to a
conventional method. For example, according to the method of
Baculovirus Expression System, human recombinant GST fusion
protein, human recombinant histidine-tag fusion protein or the like
may be expressed in an insect cell (Spodoptera frugiperda 9 (Sf9)).
Furthermore, the expressed recombinant protein can be purified by
affinity chromatography (e.g., GSH-agarose (Sigma) or
Ni-NTH-agarose (Qiagen)). The purity and identification of the
protein can be confirmed by SDS-PAGE, silver staining and western
blotting using an antibody specific to RET.
[0271] The cell free kinase assay can be carried out as
follows.
[0272] First, to each well of a plate (e.g., 96-well, 384-well,
etc.), a mixed solution including 20 .mu.l of standard reaction
solution, 5 .mu.l of ATP solution, 5 .mu.l of the test substance,
and a mixed solution including 10 .mu.l of solution containing 50
ng of RET recombinant protein and 10 .mu.l of solution containing
125 ng of biotinylated Poly(Glu, Tyr).sub.4:1 can be added
sequentially.
[0273] This kinase reaction solution (50 .mu.l) may contain 60 mM
HEPES-NaOH (pH7.5), 3 mM MgCl.sub.2, 3 mM MnCl.sub.2, 3 .mu.M
Na-orthovanadate, 1.2 mM DTT, 50 .mu.g/ml PEG.sub.20000 and 1 .mu.M
ATP. In this case, the ATP labeled with a radioactive isotope such
as [.gamma.-.sup.32P]-ATP or [.gamma.-.sup.33P]-ATP may be
used.
[0274] The reaction solution may be incubated for a certain period
of time, and then 50 .mu.l of 2% (v/v) H.sub.3PO.sub.4 solution may
be added to terminate the reaction.
[0275] Each well may be subjected to an appropriate washing
procedure.
[0276] RET kinase-inhibiting activity can be assessed by
determining the amount of ATP incorporation. When the ATP labeled
with a radioactive isotope is used, the amount of ATP incorporation
can be assessed by determining radioactivity captured on the plate
with a scintillation counter.
[0277] According to this method, the RET kinase-inhibiting activity
of the compound can be assessed.
[0278] (5) Therapeutic Agent, Pharmaceutical Composition and
Therapeutic Method
[0279] The therapeutic agent of the invention containing an RET
kinase inhibiting substance is an agent for treating at least one
disease selected from multiple endocrine neoplasia, type IIA,
multiple endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
Moreover, the therapeutic agent of the invention containing an RET
kinase inhibiting substance is an agent for treating thyroid
carcinoma. Preferably, the therapeutic agent of the invention is
used for a disease including a cell expressing mutant RET.
[0280] The therapeutic agent of the invention may be administered
to a living organism, i.e., a mammal (e.g., human, rat, rabbit,
sheep, pig, bovine, cat, dog, monkey, etc.) that requires treatment
of the disease.
[0281] The pharmaceutical composition of the invention contains an
RET kinase inhibiting substance for administering to an organism
including a cell expressing mutant RET.
[0282] The pharmaceutical composition of the invention can be used
as a therapeutic agent for treating a disease expressing mutant
RET. Examples of diseases expressing mutant RET include multiple
endocrine neoplasia, type IIA, multiple endocrine neoplasia, type
IIB, familial medullary thyroid carcinoma, thyroid carcinoma,
papillary thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract.
[0283] The pharmaceutical composition of the invention may be
administered to a living organism, i.e., a mammal (e.g., human,
rat, rabbit, sheep, pig, bovine, cat, dog, monkey, etc.). According
to the present invention, said living organism includes a cell
expressing mutant RET.
[0284] According to the present invention, the therapeutic agent
contains an agent for improving prognosis of cancer, an agent for
preventing cancer recurrence or the like. The therapeutic agent for
treating cancer or tumor contains an antitumor agent, an agent for
suppressing cancer metastasis or the like.
[0285] The effect of treatment may be verified by observation of an
x-ray picture, CT or the like, by histopathological diagnosis of
biopsy, or from a disease marker value.
[0286] Where a therapeutic agent or a pharmaceutical composition of
the invention is used, the given dosage of the RET kinase
inhibiting substance differs depending on the degree of the
symptom, age, sex, weight and sensitivity difference of the
patient, administration mode, administration period, administration
interval, nature, prescription and the type of the pharmaceutical
formulation, and the type of the active element. Usually, but
without limitation, the dosage of the RET kinase inhibiting
substance is 0.1-1000 mg/day, preferably 0.5-100 mg/day, more
preferably 1-30 mg/day for an adult (weight 60 kg), which may be
administered once to three times a day.
[0287] Although the therapeutic agent or the pharmaceutical
composition containing the RET kinase inhibiting substance of the
invention as an active element may be used alone, it is usually
mixed with appropriate additives and made into a formulation.
[0288] Examples of such additive include excipients, binders,
lubricants, disintegrants, colorants, flavoring agents,
emulsifiers, surfactants, solubilizing agents, suspending agents,
tonicity agents, buffers, antiseptic agents, antioxidant agents,
stabilizers, absorption promoters and the like that are generally
used for medicine. If required, they may be used in combination.
Examples of such additive are as follows.
[0289] Excipients: lactose, sucrose, glucose, cornstarch, mannitol,
sorbitol, starch, alpha-starch, dextrin, crystalline cellulose,
light anhydrous silicic acid, aluminum silicate, calcium silicate,
magnesium aluminometasilicate and calcium hydrogen phosphate.
[0290] Binders: for example, polyvinyl alcohol, methyl cellulose,
ethyl cellulose, gum arabic, tragacanth, gelatin, shellac,
hydroxypropyl methylcellulose, hydroxypropylcellulose,
carboxymethylcellulose sodium, polyvinylpyrrolidone and
macrogol.
[0291] Lubricants: magnesium stearate, calcium stearate, sodium
stearyl fumarate, talc, polyethyleneglycol and colloid silica.
[0292] Disintegrants: crystalline cellulose, agar, gelatin, calcium
carbonate, sodium hydrogen carbonate, calcium citrate, dextrin,
pectin, low substituted hydroxypropylcellulose,
carboxymethylcellulose, carboxymethylcellulose calcium,
croscarmellose sodium, carboxymethyl starch and carboxymethyl
starch sodium.
[0293] Colorants: ferric oxide, yellow ferric oxide, carmine,
caramel, beta-carotene, titanium oxide, talc, riboflavin sodium
phosphate, yellow aluminum lake and the like that are approved as
additives in medicine.
[0294] Flavoring agents: cocoa powder, menthol, aromatic powder,
peppermint oil, camphor and cinnamon powder.
[0295] Emulsifiers or surfactants: stearyl triethanolamine, sodium
lauryl sulfate, laurylaminopropionate, lecithin, glycerine
monostearate, sucrose fatty acid ester and glycerine fatty acid
ester.
[0296] Solubilizing agents: polyethyleneglycol, propylene glycol,
benzyl benzoate, ethanol, cholesterol, triethanolamine, sodium
carbonate, sodium citrate, Polysorbate 80 and nicotine acid
amide.
[0297] Suspending agents: in addition to the surfactants mentioned
above, hydrophilic polymers such as polyvinyl alcohol,
polyvinylpyrrolidone, methylcellulose, hydroxymethylcellulose,
hydroxyethylcellulose and hydroxypropylcellulose.
[0298] Tonicity agents: glucose, sodium chloride, mannitol and
sorbitol.
[0299] Buffers: buffers made from phosphate, acetate, carbonate and
citrate.
[0300] Antiseptic agents: methylparaben, propylparaben,
chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic
acid and sorbic acid.
[0301] Antioxidant agents: hydrosulfate, ascorbic acid and
alpha-tocopherol.
[0302] Stabilizers: those generally used for medicine.
[0303] Absorption promoters: those generally used for medicine.
[0304] If required, components such as vitamins and amino acids may
be blended.
[0305] Examples of formulations include oral formulations such as
tablets, dispersant, granule, fine granule, capsule, syrup, lozenge
and inhaler; external formulations such as suppository, ointment,
eye ointment, poultice strip, eye-drops, nasal drops, eardrops,
skin patch and lotion; and injectable formulations.
[0306] The oral formulations mentioned above may be formulated by
appropriately combining the additives mentioned above. If
necessary, surface of these formulations may be coated.
[0307] The external formulations mentioned above may be formulated
by appropriately combining the additives mentioned above,
particularly excipients, binders, flavoring agents, emulsifiers,
surfactants, solubilizing agents, suspending agent, tonicity
agents, antiseptic agents, antioxidant agents, stabilizers and
absorption promoters.
[0308] The injectable formulations mentioned above may be
formulated by appropriately combining the additives mentioned
above, particularly emulsifiers, surfactants, solubilizing agents,
suspending agents, tonicity agents, buffers, antiseptic agents,
antioxidant agents, stabilizers and absorption promoters. The
injectable formulations may be used through means such as infusion,
intramuscular injection, subcutaneous injection, intradermal
injection and intravenous injection.
[0309] The present invention relates to a method for treating at
least one disease selected from multiple endocrine neoplasia, type
IIA, multiple endocrine neoplasia, type IIB, familial medullary
thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary
thyroid carcinoma, Hirschsprung disease, pheochromocytoma,
parathyroid hyperplasia and mucosal neuromas of the
gastrointestinal tract, the method including administering an
effective amount of an RET kinase inhibiting substance to a
patient. The present invention also relates to a method for
treating thyroid carcinoma, including administering an effective
amount of an RET kinase inhibiting substance to a patient.
[0310] The present invention further relates to a method for
treating a disease, including administering an effective amount of
an RET kinase inhibiting substance to an organism including a cell
expressing mutant RET. According to the present invention, said
disease is preferably at least one disease selected from multiple
endocrine neoplasia, type IIA, multiple endocrine neoplasia, type
IIB, familial medullary thyroid carcinoma, thyroid carcinoma,
papillary thyroid carcinoma, sporadic medullary thyroid carcinoma,
Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and
mucosal neuromas of the gastrointestinal tract.
[0311] According to the therapeutic method of the invention, the
route and the method for administering the RET kinase inhibiting
substance are not particularly limited and reference may be made to
the description of the therapeutic agent or the pharmaceutical
composition above.
[0312] The present invention includes use of an RET kinase
inhibiting substance for producing a therapeutic agent for treating
at least one disease selected from multiple endocrine neoplasia,
type IIA, multiple endocrine neoplasia, type IIB, familial
medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic
medullary thyroid carcinoma, Hirschsprung disease,
pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of
the gastrointestinal tract. The present invention also includes use
of an RET kinase inhibiting substance for producing a therapeutic
agent for treating thyroid carcinoma.
[0313] The present invention further includes use of an RET kinase
inhibiting substance for producing a pharmaceutical composition
containing the RET kinase inhibiting substance for administering to
an organism including a cell expressing mutant RET. As to the use
according to the invention, the pharmaceutical composition is
effective as an agent for treating at least one disease selected
from multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
[0314] The present invention includes an RET kinase inhibiting
substance for a therapeutic agent for treating at least one disease
selected from multiple endocrine neoplasia, type IIA, multiple
endocrine neoplasia, type IIB, familial medullary thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract. In
addition, the present invention includes an RET kinase inhibiting
substance for a therapeutic agent for treating thyroid
carcinoma.
[0315] Furthermore, the present invention includes an RET kinase
inhibiting substance for a pharmaceutical composition containing
the RET kinase inhibiting substance for administering to an
organism including a cell expressing mutant RET. According to the
present invention, said pharmaceutical composition is useful as a
therapeutic agent for treating at least one disease selected from
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
[0316] The present invention also provides an RET kinase inhibitor
containing the compound represented by General Formula (I), a
pharmacologically acceptable salt thereof or a solvate thereof.
[0317] The compound represented by General Formula (I) is as
mentioned above and preferably
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide.
[0318] The present invention further provides an RET kinase
inhibitor containing at least one compound selected from [0319]
5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrr-
ole-3-carboxylic acid(2-diethylaminoethyl)amide (SU11248), [0320]
N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N'-(5-methyl-3-isoxa-
zolyl)urea (KRN951) and [0321]
4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)pr-
opoxy]quinazoline (AZD2171), a pharmacologically acceptable salt
thereof or a solvate thereof.
[0322] The RET kinase-inhibiting activity of the RET kinase
inhibitor of the invention can be determined as described
above.
[0323] The compound may be used either alone or mixed with
appropriate additives mentioned above and made into a formulation
as the RET kinase inhibitor of the invention.
[0324] As to the usage and the dosage of the RET kinase inhibitor
of the invention, reference may be made to the description of the
therapeutic agent or the pharmaceutical composition above.
[0325] The present invention also includes use of at least one
compound selected from the compound represented by General Formula
(I), SU11248, KRN951 and AZD2171, a pharmacologically acceptable
salt thereof or a solvate thereof, for producing an RET kinase
inhibitor.
[0326] The present invention further includes a method for
inhibiting RET kinase with at least one compound selected from the
compound represented by General Formula (I), SU11248, KRN951 and
AZD2171, a pharmacologically acceptable salt thereof or a solvate
thereof. According to the method of the invention, the usage and
the dosage of the compound are not particularly limited and
reference may be made to the description of the therapeutic agent
or the pharmaceutical composition above.
[0327] 2. Method for Predicting Sensitivity
[0328] The present invention provides a method for predicting
whether or not a patient is highly sensitive to an RET kinase
inhibiting substance of the invention using the presence or the
absence of RET mutation in the cell as an indication. Therapeutic
effect of a RET kinase inhibiting substance is more prospective for
patients highly sensitive to said RET kinase inhibiting
substance.
[0329] According to the method of the invention, a patient is
preferably a patient suffering from at least one disease selected
from multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid
carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid
carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid
hyperplasia and mucosal neuromas of the gastrointestinal tract.
[0330] (1) Step of Determining the Presence or the Absence of RET
Mutation in the Cell
[0331] In this step, the cell is preferably taken from the patient.
The cell may be obtained, for example, by removing it from a
patient by a surgical procedure (e.g., biopsy, etc.). Preferably,
blood cells are used for genetic-variation-induced diseases such as
multiple endocrine neoplasia, type IIA, multiple endocrine
neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid
carcinoma, papillary thyroid carcinoma, Hirschsprung disease,
pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of
the gastrointestinal tract.
[0332] The presence or the absence of RET mutation can be
determined according to the method described above.
[0333] (2) Step of Predicting Whether or not Patient is Highly
Sensitive to RET Kinase Inhibiting Substance
[0334] In this step, whether a patient is highly sensitive to an
RET kinase inhibiting substance can be predicted preferably using
the presence or the absence of RET mutation in the cell determined
in (1) as an indication. Specifically, when the cell determined is
expressing mutant RET, the patient is judged to be highly sensitive
to the RET kinase inhibiting substance.
[0335] Another aspect of the invention is a method for analyzing
sensitivity of a cell to an RET kinase inhibiting substance using
the determination result in (1) as an indication. Specifically,
when the cell is expressing mutant RET based on the determination
results in (1), this cell is judged to be more sensitive to the RET
kinase inhibiting substance as compared to cells not expressing the
mutant RET.
[0336] Yet another aspect of the invention is a method for
selecting a cell or a patient highly sensitive to an RET kinase
inhibiting substance using the determination result in (1) as an
indication. Specifically, when a cell is expressing mutant RET as
determined from the results in (1), this cell or a patient having
this cell is judged to be highly sensitive to the RET kinase
inhibiting substance. Thus, such cell or such patient can be
selected as a cell or a patient highly sensitive to the RET kinase
inhibiting substance.
[0337] Still yet another aspect of the invention is a method for
classifying patients through analysis of sensitivity to an RET
kinase inhibiting substance using the determination result in (1)
as an indication. Specifically, according to the method of the
invention, sensitivity of patients to an RET kinase inhibiting
substance is analyzed based on the determination results in (1) as
described above, and the patients having the cell of interest can
be classified according to this result. For example, patients may
be classified into a group including cells expressing mutant RET
and a group without such cell. Alternatively, patients may be
classified into a group highly sensitive to an RET kinase
inhibiting substance and a group of others.
[0338] Still yet another aspect of the invention is a method for
selecting a patient for administering an RET kinase inhibiting
substance, the method including selecting a patient having a cell
expressing mutant RET based on the results from the determination
in (1). Patients having a cell expressing mutant RET can be a
target intended for administering the RET kinase inhibiting
substance.
[0339] Still yet another aspect of the invention is a method for
predicting the therapeutic effect of the RET kinase inhibiting
substance on a patient based on the results from the determination
in (1). According to the method of the invention, when the cell is
expressing mutant RET as determined from the results in (1), the
cell is judged to be highly sensitive to the RET kinase inhibiting
substance, and thus the therapeutic effect of this RET kinase
inhibiting substance is predicted be high on the cell or a patient
having this cell.
[0340] The present invention also relates to a method for
determining the presence or the absence of RET mutation in the cell
derived from a patient for predicting the sensitivity level of the
patient to the RET kinase inhibiting substance. This determination
method is as described in (1) above.
[0341] Determination of the presence or the absence of RET mutation
enables prediction of the sensitivity level of a patient to the RET
kinase inhibiting substance.
[0342] In this step, although the RET kinase inhibiting substance
is as described above, it is preferably
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide, a pharmacologically acceptable salt thereof or a
solvate thereof.
[0343] The method of the invention can be employed to predict the
level of the efficacy of the RET kinase inhibiting substance on a
patient before administering the RET kinase inhibiting substance to
the patient. Therefore, patients who are expected to be more
susceptible to the RET kinase inhibiting substance can be selected
for carrying out the treatment of the disease. Thus, the present
invention is highly effective in clinical respect.
[0344] The present invention provides a test kit for determining
the presence or the absence of RET mutation used for the method of
the invention. The test kit of the invention contains the reagents
mentioned above used for the determination. The test kit of the
invention allows prediction of whether or not a patient is highly
sensitive to the RET kinase inhibiting substance.
[0345] The present invention also relates to use of the test kit
for the prediction mentioned above.
[0346] Hereinafter, the present invention will be illustrated by
way of specific examples, although the invention should not be
limited thereto.
EXAMPLE 1
Determination of RET Kinase-Inhibiting Activity of RET Kinase
Inhibiting Substance
[0347] RET kinase-inhibiting activity of test substances were
tested by ProQinase (Freiburg, Germany, GmbH) upon our request. To
be more precise, RET kinase-inhibiting activity was determined as
follows.
[0348] 1. Expression and Purification of RET
[0349] RET was expressed as human recombinant GST fusion protein
(hereinafter, also referred to as "RET recombinant protein") in an
insect cell (Spodoptera frugiperda 9 (Sf9)) according to the method
of Baculovirus Expression System. The expressed RET recombinant
protein was purified by affinity chromatography using GSH-agarose
(Sigma) or Ni-NTH-agarose (Qiagen). The purity and identification
of the protein can be confirmed by SDS-PAGE silver staining and
western blotting using an antibody specific to RET.
[0350] 2. Determination of Inhibitory Activity to RET Kinase
Activity
[0351] First, to each well of streptavidin-coated 96-well
FlashPlate (Perkin Elmer/NEM), 20 .mu.l of standard reaction
solution, 5 .mu.l of ATP solution (diluted with H.sub.2O), 5 .mu.l
of the test substance (10% aqueous dimethylsulfoxide solution), and
a mixed solution including 10 .mu.l of solution containing 50 ng of
RET recombinant protein and 10 .mu.l of solution containing 125 ng
of biotinylated Poly(Glu, Tyr).sub.4:1 were added sequentially.
This kinase reaction solution (50 .mu.L) contained 60 mM HEPES-NaOH
(pH7.5), 3 mM MgCl.sub.2, 3 mM MnCl.sub.2, 3 .mu.M
Na-orthovanadate, 1.2 mM DTT, 50 .mu.g/ml PEG.sub.20000, and 1
.mu.M [.gamma.-.sup.33P]-ATP.
[0352]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-q-
uinolinecarboxamide (methanesulfonate),
6-[2-(methylcarbamoyl)phenylsulfanyl]-3-E-[2-(pyridine-2-yl)ethenyl]indaz-
ole (hereinafter, also referred to as "AG013736"), SU11248, KRN951
or AZD2171 was used as the test substance.
[0353]
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-q-
uinolinecarboxamide was produced according to the descriptions of
International publication No. 02/32872 pamphlet (WO02/32872) and
International publication No. 2005/063713 pamphlet
(WO2005/063713).
[0354] AG013736 was produced based on the description of
International publication No. 01/002369 pamphlet (WO01/002369).
SU11248 was produced based on the description of International
publication No. 01/060814 pamphlet (WO01/060814). KRN951 was
produced based on the description of International publication No.
02/088110 pamphlet (WO02/088110). AZD2171 was produced based on the
description of International publication No. 00/47212 pamphlet
(WO00/47212).
[0355] Next, the reaction solution was incubated at 30.degree. C.
for 80 minutes, after which 50 .mu.l of 2% (v/v) H.sub.3PO.sub.4
solution was added to terminate the reaction.
[0356] The 96-well plate was washed and aspirated twice with 200
.mu.l of 0.9% (w/v) NaCl solution.
[0357] The amount of .sup.33P.sub.i incorporation can be assessed
by determining the radioactivity on the plate with a microplate
scintillation counter (from Microbeta, Wallac).
[0358] The manipulation was performed with a BeckmanCoulter/Sagian
robotic system.
[0359] The concentration of the test substance required for
inhibiting RET kinase activity for 50% (IC.sub.50) was calculated
using specific radioactivity of .sup.33P at varying concentrations
(10 points ranging from 10 .mu.M to 0.0003 .mu.M) with Prism 3.03
(Windows, Graphpad, San Diego, Calif., USA).
[0360] In this case, the value obtained for the case where
substrate Poly(Glu, Tyr).sub.4:1 was solely added (without the
addition of RET recombinant protein) was assumed 0% while the value
obtained for the case where RET recombinant protein and substrate
Poly(Glu, Tyr).sub.4:1 were added (without the addition of the test
substance) was assumed 100%.
[0361] The kinase activity in the presence of the test substance at
each concentration was assessed as percentage of the value obtained
by subtracting the 0% value from the radioactivity value to the
value obtained by subtracting the 0% value from the 100% value.
Based on this percentage (%), the concentration of the test
substance required to inhibit RET kinase activity for 50%
(IC.sub.50) was calculated.
[0362] As a result,
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide was found to have RET kinase-inhibiting activity
(IC.sub.50=35 nM). In addition, SU11248, KRN951 and AZD2171 were
also found to have RET kinase-inhibiting activity (IC.sub.50=64, 92
and 75 nM, respectively). AG013736 had IC.sub.50 of 5600 nM.
Furthermore, the test substances differed in the level of RET
kinase-inhibiting activity.
EXAMPLE 2
Effect of RET Kinase Inhibiting Substance on Ligand-Independent RET
Phosphorylation in Human Medullary Thyroid Carcinoma Cell Line
(TT)
[0363] 1. Preparation of Cell Extract
[0364] Human medullary thyroid carcinoma cell line (TT, purchased
from ATCC) was suspended in RPMI1640 medium containing 15% FBS
(purchased from Sigma). TT is a cell expressing RET where cysteine
at codon 634 in the wild-type RET amino acid sequence is mutated
with tryptophan (Biochemical and Biophysical Research
Communications, 207, 1022-1028, 1995). Two mL of this cell
suspension per well (4.times.10.sup.5 cells/mL) was added to 6-well
cell culture plate (purchased from FALCON), and cultured in a 5%
CO.sub.2 incubator (37.degree. C.) overnight. After cultivation,
supernatant was removed from each well and 1.8 mL of RPMI1640
medium containing 15% FBS was added. Then, 0.2 mL of test substance
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide (methanesulfonate) (diluted in RPMI1640 medium
containing 15% FBS) dissolved in dimethylsulfoxide was added and
cultured in a 5% CO.sub.2 incubator (37.degree. C.) for an hour.
Supernatant was removed from each well, which was then washed with
400 .mu.L of PBS, and added with 100 .mu.L of solubilizing buffer
(50 mM Hepes (pH7.4), 150 mM NaCl, 10% (v/v) glycerol, 1% Triton
X-100, 1.5 mM MgCl.sub.2, 1 mM EDTA (pH 8.0), 100 mM NaF, 1 mM
PMSF, 10 .mu.g/mL Aprotinin, 50 .mu.g/mL Leupeptin, 1 .mu.g/mL
Pepstatin A and 1 mM Na.sub.3VO.sub.4). Cells in this solution were
harvested with a scraper and treated at 15,000 rpm and 4.degree. C.
for 15 minutes. SDS buffer was added to the supernatant and
subjected to treatment at 94.degree. C. for 5 minutes to solubilize
the protein, which was then prepared to 20 .mu.g/10 .mu.L as a cell
extract.
[0365] 2. Electrophoresis and Western Blotting
[0366] The cell extract (20 .mu.g/10 .mu.L) was subjected to
electrophoresis on 4-20% gradient polyacrylamide gel (purchased
from Daiichi Pure Chemicals), followed by transfer on a PVDF
membrane (purchased from Amersham pharmacia biotech) by a
conventional technique. Then, the transferred membrane was
immunoblotted using anti-RET antibody (anti-RET, purchased from
Cell Signaling), anti-phosphorylated RET antibody (anti-phospho RET
(Tyr 905), purchased from Cell Signaling), anti-Erk1/2 antibody
(anti-Erk1/2, purchased from Cell Signaling) or anti-phosphorylated
Erk1/2 antibody (anti-phospho-Erk1/2, purchased from Cell
Signaling) as primary antibody, and horse radish peroxidase-labeled
anti-rabbit IgG antibody (anti-rabbit IgG, HRP-linked Antibody
(purchased from Cell Signaling)) as secondary antibody. The
membrane was washed and then treated with Super Signal (purchased
from PIERCE) for color development.
[0367] RET autophosphorylation activity (%) of each lane was
determined assuming the absorbance of the well added with test
substance-free cell extract as 100% RET autophosphorylation
activity. RET autophosphorylation activity (%) was determined while
stepwisely varying the concentration of the test substance to
calculate the concentration of the test substance required for
inhibiting RET autophosphorylation activity for 50%
(IC.sub.50).
[0368] As a result,
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide inhibited RET phosphorylation in a
concentration-dependent manner (IC.sub.50=27 nM) (FIG. 1). In
addition,
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide was also found to inhibit phosphorylation of one of
the downstream molecule of RET, Erk1/2, which is associated with
cell growth signal, at a concentration similar to that for RET
kinase (FIG. 1).
EXAMPLE 3
Effect of RET Kinase Inhibiting Substance on Cell Growth of Human
Medullary Thyroid Carcinoma Cell Line (TT)
[0369] Human medullary thyroid carcinoma cell line (TT, purchased
from ATCC) was suspended in RPMI1640 medium containing 15% FBS
(purchased from Sigma). 0.1 mL per well of this cell suspension
(3.times.10.sup.4 cells/mL) was added to 96-well cell culture plate
(purchased from NUNC), and cultured in a 5% CO.sub.2 incubator
(37.degree. C.) overnight. After cultivation, 0.1 mL of test
substance
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide (methanesulfonate) diluted in RPMI1640 medium
containing 15% FBS was added to each well and further cultured in a
5% CO.sub.2 incubator (37.degree. C.) for 10 days. After
cultivation, 10 .mu.L of Cell Counting Kit-1 (purchased from
DOJINDO) was added to each well, treated in 5% CO.sub.2 incubator
(37.degree. C.) for color development and absorbance of each well
was determined with plate reader MTP-500 (Corona Electric) at
measurement wavelength of 415 nm and reference wavelength of 660
nm. Percentage (%) of the absorbance of each well with the test
substance was determined compared to the absorbance of well without
the test substance, based on which concentration of the test
substance required for inhibiting cell growth for 50% (IC.sub.50)
was calculated.
[0370] As a result,
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide was found to have inhibitory activity of IC.sub.50=78
nM against growth of human medullary thyroid carcinoma cell line
(TT).
EXAMPLE 4
Antitumor Effect of RET Kinase Inhibiting Substance in Model for
Subcutaneous Transplantation of Human Medullary Thyroid Carcinoma
Cell Line (TT)
[0371] Human medullary thyroid carcinoma cell line (TT, purchased
from ATCC) was cultured at 37.degree. C. in RPMI1640 (containing
15% FBS) in a 5% carbon dioxide incubator to about 80% confluence,
and cells were harvested with trypsin-EDTA according to a general
method. The cells were suspended in a phosphate buffer to prepare
1.times.10.sup.8 cells/mL suspension. 0.1 mL each of the resulting
cell suspension was subcutaneously transplanted to a nude mouse at
the side of its body (purchased from Charles River).
[0372] Once the tumor volume became approximately 100-200 mm.sup.3
after transplantation, the test substance
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide (methanesulfonate) was orally administered for 10
mg/kg, 30 mg/kg or 100 mg/kg, once a day, for four weeks. The major
and minor axes of tumors were measured with Digimatic caliper
(Mitsutoyo), and tumor volumes were calculated according to the
following formula.
Tumor Volume(TV)=Major axis of tumor (mm).times.(Minor axis of
tumor).sup.2 (mm.sup.2)/2
[0373] As a result,
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide was found to have dose-dependent antitumor effect in
the model for subcutaneous transplantation of human medullary
thyroid carcinoma cell line (TT) (FIG. 2).
EXAMPLE 5
Effect of RET Kinase Inhibiting Substance on RET Phosphorylation in
Model for Subcutaneous Transplantation of Human Medullary Thyroid
Carcinoma Cell Line (TT)
[0374] Human medullary thyroid carcinoma cell line (TT, purchased
from ATCC) was cultured at 37.degree. C. in RPMI1640 (containing
15% FBS) in a 5% carbon dioxide incubator to about 80% confluence,
and cells were harvested with trypsin-EDTA according to a general
method. The cells were suspended in a phosphate buffer to prepare
1.times.10.sup.8 cells/mL suspension. 0.1 mL each of the resulting
cell suspension was subcutaneously transplanted to a nude mouse at
the side of its body (purchased from Charles River).
[0375] Once the tumor volume became approximately 100-200 mm.sup.3
after transplantation, the test substance
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide (methanesulfonate) was orally administered for 10
mg/kg, 30 mg/kg or 100 mg/kg. Tumors were resected 2, 8, 12 or 24
hours after administration, to which solubilizing buffer (50 mM
Hepes (pH7.4), 150 mM NaCl, 10% (v/v) glycerol, 1% Triton X-100,
1.5 mM MgCl.sub.2, 1 mM EDTA (pH 8.0), 100 mM NaF, 1 mM PMSF, 10
.mu.g/mL Aprotinin, 50 .mu.g/mL Leupeptin, 1 .mu.g/mL Pepstatin A,
1 mM Na.sub.3VO.sub.4), 25 mM .beta.-glycerophosphate, and
phosphatase inhibitor cocktail II (SIGMA)) were added and
homogenized. Treatment at 15,000 rpm and 4.degree. C. for 15
minutes and addition of SDS buffer to the supernatant were followed
by treatment at 94.degree. C. for 5 minutes to solubilize protein
to 20 .mu.g/10 .mu.L to prepare cell extract. The cell extract was
subjected to electrophoresis and immunoblotting in the same manner
as in Example 2.
[0376] As a result,
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide was found to have RET autophosphorylation inhibitory
activity at the dose found to exert antitumor effect in the model
for subcutaneous transplantation of human medullary thyroid
carcinoma cell line (TT) (FIG. 3).
[0377] From these results, it was shown that the RET kinase
inhibiting substance of the invention was expected to be more
effective to organisms containing cells expressing mutant RET. The
RET kinase inhibiting substance of the invention was also
demonstrated to be useful as a therapeutic agent for treating at
least one disease selected from multiple endocrine neoplasia, type
IIA, multiple endocrine neoplasia, type IIB, familial medullary
thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary
thyroid carcinoma, Hirschsprung disease, pheochromocytoma,
parathyroid hyperplasia and mucosal neuromas of the
gastrointestinal tract as well as thyroid carcinoma.
REFERENCE EXAMPLE
[0378] Hereinafter, a method for producing a formulation of one of
the RET kinase inhibiting substances,
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide will be described as a reference example.
[0379] (Production of Pharmaceutical Composition)
[0380] (1) 1 mg Tablet
[0381] 24 g of crystal (C) of methanesulfonate of
4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinoli-
necarboxamide (hereinafter, also referred to as "crystal (C)",
which was produced according to the method described in Example 7
of WO2005/063713) and 192 g of light anhydrous silicic acid
(antigelling agent sold under the trade name of AEROSIL (registered
trademark) 200, Nippon Aerosil) were mixed with 20 L Super Mixer,
and then 1236 g of D-mannitol (excipient, Towa-Kasei), 720 g of
crystalline cellulose (excipient sold under the trade name of
Avicel PH101, Asahi Kasei) and 72 g of hydroxypropylcellulose
(binder sold under the trade name of HPC-L, Nippon Soda) were
further added and mixed together. Subsequently, a suitable amount
of anhydrous ethanol was added to obtain a granulated body
containing crystal (C). This granulated body was dried in a rack
dryer (60.degree. C.), and then size-regulated using Power Mill to
obtain granules. Together with the granules, 120 g of
croscarmellose sodium (disintegrant sold under the trade name of
Ac-Di-Sol, FMC International Inc.) and 36 g of sodium stearyl
fumarate (lubricant, JRS Pharma LP) were placed and mixed together
in a 20 L tumbler mixer, and molded with a tablet machine to obtain
tablets with a total mass of 100 mg per tablet. Furthermore, the
tablets were coated using aqueous 10% Opadry yellow (OPADRY
03F42069 YELLOW, Colorcon Japan) solution as a coating solution
with a tablet coating machine, thereby obtaining coated tablets
with a total mass of 105 mg per tablet.
[0382] (2) 10 mg Tablet
[0383] 60 g of crystal (C) and 192 g of light anhydrous silicic
acid (antigelling agent sold under the trade name of AEROSIL
(registered trademark) 200, Nippon Aerosil) were mixed with 20 L
Super Mixer, and then 1200 g of D-mannitol (excipient, Towa-Kasei),
720 g of crystalline cellulose (excipient sold under the trade name
of Avicel PH101, Asahi Kasei) and 72 g of hydroxypropylcellulose
(binder sold under the trade name of HPC-L, Nippon Soda) were
further added and mixed together. Subsequently, a suitable amount
of anhydrous ethanol was added to obtain a granulated body
containing crystal (C). This granulated body was dried in a rack
dryer (60.degree. C.), and then size-regulated using Power Mill to
obtain granules. Together with the granules, 120 g of
croscarmellose sodium (disintegrant sold under the trade name of
Ac-Di-Sol, FMC International Inc.) and 36 g of sodium stearyl
fumarate (lubricant, JRS Pharma LP) were placed and mixed together
in a 20 L tumbler mixer, and molded with a tablet machine to obtain
tablets with a total mass of 400 mg per tablet. Furthermore, the
tablets were coated using aqueous 10% Opadry yellow (OPADRY
03F42069 YELLOW, Colorcon Japan) solution as a coating solution
with a tablet coating machine, thereby obtaining coated tablets
with a total mass of 411 mg per tablet.
[0384] (3) 100 mg Tablet
[0385] 31.4 g of crystal (C) and 4 g of light anhydrous silicic
acid (antigelling agent sold under the trade name of AEROSIL
(registered trademark) 200, Nippon Aerosil) were mixed with 1 L
Super Mixer, and then 40.1 g of anhydrous calcium hydrogen
phosphate (excipient, Kyowa Chemical Industry), 10 g of low
substituted hydroxypropylcellulose (binder sold under the trade
name of L-HPC (LH-21), Shin-Etsu Chemical) and 3 g of
hydroxypropylcellulose (binder sold under the trade name of HPC-L,
Nippon Soda) were further added and mixed together. Subsequently, a
suitable amount of anhydrous ethanol was added to obtain a
granulated body containing crystal (C). This granulated body was
dried in a rack dryer (60.degree. C.), and then granulated using
Power Mill to obtain granules. Together with the granules, 10 g of
croscarmellose sodium (disintegrant sold under the trade name of
Ac-Di-Sol, FMC International Inc.) and 1.5 g of sodium stearyl
fumarate (lubricant, JRS Pharma LP) were mixed and molded with a
tablet machine to obtain tablets with a total mass of 400 mg per
tablet.
[0386] The present invention provides a therapeutic agent and a
method containing an RET kinase inhibiting substance for treating
at least one disease selected from multiple endocrine neoplasia,
type IIA, multiple endocrine neoplasia, type IIB, familial
medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic
medullary thyroid carcinoma, Hirschsprung disease,
pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of
the gastrointestinal tract, use of RET kinase inhibiting substance
for producing said therapeutic agent and an RET kinase inhibiting
substance for said therapeutic agent.
[0387] The present invention also provides a therapeutic agent and
a method containing an RET kinase inhibiting substance for treating
thyroid carcinoma, use of an RET kinase inhibiting substance for
producing said therapeutic agent and an RET kinase inhibiting
substance for said therapeutic agent.
[0388] Moreover, the present invention provides a pharmaceutical
composition containing an RET kinase inhibiting substance for
administering to an organism including a cell expressing mutant
RET, a method for treating a disease including administration to an
organism including a cell expressing mutant RET, use of RET kinase
inhibiting substance for producing said pharmaceutical composition
and an RET kinase inhibiting substance for said pharmaceutical
composition.
[0389] The present invention also provides an RET kinase
inhibitor.
[0390] Furthermore, the present invention provides a method for
predicting the effect of an RET kinase inhibiting substance.
[0391] More specifically, the effect of an RET kinase inhibiting
substance can be predicted using the presence or the absence of RET
mutation in the cell as an indication.
[0392] Since the method according to the invention enables one to
predict the effect of the compound without administering the
compound to the patient, it has become possible to select a patient
who is expected to be more susceptible to the compound. Thus,
contribution to the patient's QOL has become possible.
[0393] Sequence Listing Free Text
[0394] SEQ ID NOS: 5-20 Primers
Sequence CWU 1
1
2014757DNAHomo sapiens 1ccgaagcagg gcgcgcagca gcgctgagtg ccccggaacg
tgcgtcgcgc ccccagtgtc 60cgtcgcgtcc gccgcgcccc gggcggggat ggggcggcca
gactgagcgc cgcacccgcc 120atccagaccc gccggcccta gccgcagtcc
ctccagccgt ggccccagcg cgcacgggcg 180atggcgaagg cgacgtccgg
tgccgcgggg ctgcgtctgc tgttgctgct gctgctgccg 240ctgctaggca
aagtggcatt gggcctctac ttctcgaggg atgcttactg ggagaagctg
300tatgtggacc aggcggccgg cacgcccttg ctgtacgtcc atgccctgcg
ggacgcccct 360gaggaggtgc ccagcttccg cctgggccag catctctacg
gcacgtaccg cacacggctg 420catgagaaca actggatctg catccaggag
gacaccggcc tcctctacct taaccggagc 480ctggaccata gctcctggga
gaagctcagt gtccgcaacc gcggctttcc cctgctcacc 540gtctacctca
aggtcttcct gtcacccaca tcccttcgtg agggcgagtg ccagtggcca
600ggctgtgccc gcgtatactt ctccttcttc aacacctcct ttccagcctg
cagctccctc 660aagccccggg agctctgctt cccagagaca aggccctcct
tccgcattcg ggagaaccga 720cccccaggca ccttccacca gttccgcctg
ctgcctgtgc agttcttgtg ccccaacatc 780agcgtggcct acaggctcct
ggagggtgag ggtctgccct tccgctgcgc cccggacagc 840ctggaggtga
gcacgcgctg ggccctggac cgcgagcagc gggagaagta cgagctggtg
900gccgtgtgca ccgtgcacgc cggcgcgcgc gaggaggtgg tgatggtgcc
cttcccggtg 960accgtgtacg acgaggacga ctcggcgccc accttccccg
cgggcgtcga caccgccagc 1020gccgtggtgg agttcaagcg gaaggaggac
accgtggtgg ccacgctgcg tgtcttcgat 1080gcagacgtgg tacctgcatc
aggggagctg gtgaggcggt acacaagcac gctgctcccc 1140ggggacacct
gggcccagca gaccttccgg gtggaacact ggcccaacga gacctcggtc
1200caggccaacg gcagcttcgt gcgggcgacc gtacatgact ataggctggt
tctcaaccgg 1260aacctctcca tctcggagaa ccgcaccatg cagctggcgg
tgctggtcaa tgactcagac 1320ttccagggcc caggagcggg cgtcctcttg
ctccacttca acgtgtcggt gctgccggtc 1380agcctgcacc tgcccagtac
ctactccctc tccgtgagca ggagggctcg ccgatttgcc 1440cagatcggga
aagtctgtgt ggaaaactgc caggcattca gtggcatcaa cgtccagtac
1500aagctgcatt cctctggtgc caactgcagc acgctagggg tggtcacctc
agccgaggac 1560acctcgggga tcctgtttgt gaatgacacc aaggccctgc
ggcggcccaa gtgtgccgaa 1620cttcactaca tggtggtggc caccgaccag
cagacctcta ggcaggccca ggcccagctg 1680cttgtaacag tggaggggtc
atatgtggcc gaggaggcgg gctgccccct gtcctgtgca 1740gtcagcaaga
gacggctgga gtgtgaggag tgtggcggcc tgggctcccc aacaggcagg
1800tgtgagtgga ggcaaggaga tggcaaaggg atcaccagga acttctccac
ctgctctccc 1860agcaccaaga cctgccccga cggccactgc gatgttgtgg
agacccaaga catcaacatt 1920tgccctcagg actgcctccg gggcagcatt
gttgggggac acgagcctgg ggagccccgg 1980gggattaaag ctggctatgg
cacctgcaac tgcttccctg aggaggagaa gtgcttctgc 2040gagcccgaag
acatccagga tccactgtgc gacgagctgt gccgcacggt gatcgcagcc
2100gctgtcctct tctccttcat cgtctcggtg ctgctgtctg ccttctgcat
ccactgctac 2160cacaagtttg cccacaagcc acccatctcc tcagctgaga
tgaccttccg gaggcccgcc 2220caggccttcc cggtcagcta ctcctcttcc
ggtgcccgcc ggccctcgct ggactccatg 2280gagaaccagg tctccgtgga
tgccttcaag atcctggagg atccaaagtg ggaattccct 2340cggaagaact
tggttcttgg aaaaactcta ggagaaggcg aatttggaaa agtggtcaag
2400gcaacggcct tccatctgaa aggcagagca gggtacacca cggtggccgt
gaagatgctg 2460aaagagaacg cctccccgag tgagctgcga gacctgctgt
cagagttcaa cgtcctgaag 2520caggtcaacc acccacatgt catcaaattg
tatggggcct gcagccagga tggcccgctc 2580ctcctcatcg tggagtacgc
caaatacggc tccctgcggg gcttcctccg cgagagccgc 2640aaagtggggc
ctggctacct gggcagtgga ggcagccgca actccagctc cctggaccac
2700ccggatgagc gggccctcac catgggcgac ctcatctcat ttgcctggca
gatctcacag 2760gggatgcagt atctggccga gatgaagctc gttcatcggg
acttggcagc cagaaacatc 2820ctggtagctg aggggcggaa gatgaagatt
tcggatttcg gcttgtcccg agatgtttat 2880gaagaggatt cctacgtgaa
gaggagccag ggtcggattc cagttaaatg gatggcaatt 2940gaatcccttt
ttgatcatat ctacaccacg caaagtgatg tatggtcttt tggtgtcctg
3000ctgtgggaga tcgtgaccct agggggaaac ccctatcctg ggattcctcc
tgagcggctc 3060ttcaaccttc tgaagaccgg ccaccggatg gagaggccag
acaactgcag cgaggagatg 3120taccgcctga tgctgcaatg ctggaagcag
gagccggaca aaaggccggt gtttgcggac 3180atcagcaaag acctggagaa
gatgatggtt aagaggagag actacttgga ccttgcggcg 3240tccactccat
ctgactccct gatttatgac gacggcctct cagaggagga gacaccgctg
3300gtggactgta ataatgcccc cctccctcga gccctccctt ccacatggat
tgaaaacaaa 3360ctctatggca tgtcagaccc gaactggcct ggagagagtc
ctgtaccact cacgagagct 3420gatggcacta acactgggtt tccaagatat
ccaaatgata gtgtatatgc taactggatg 3480ctttcaccct cagcggcaaa
attaatggac acgtttgata gttaacattt ctttgtgaaa 3540ggtaatggac
tcacaagggg aagaaacatg ctgagaatgg aaagtctacc ggccctttct
3600ttgtgaacgt cacattggcc gagccgtgtt cagttcccag gtggcagact
cgtttttggt 3660agtttgtttt aacttccaag gtggttttac ttctgatagc
cggtgatttt ccctcctagc 3720agacatgcca caccgggtaa gagctctgag
tcttagtggt taagcattcc tttctcttca 3780gtgcccagca gcacccagtg
ttggtctgtg tccatcagtg accaccaaca ttctgtgttc 3840acatgtgtgg
gtccaacact tactacctgg tgtatgaaat tggacctgaa ctgttggatt
3900tttctagttg ccgccaaaca aggcaaaaaa atttaaacat gaagcacaca
cacaaaaaag 3960gcagtaggaa aaatgctggc cctgatgacc tgtccttatt
cagaatgaga gactgcgggg 4020ggggcctggg ggtagtgtca atgcccctcc
agggctggag gggaagaggg gccccgagga 4080tgggcctggg ctcagcattc
gagatcttga gaatgatttt tttttaatca tgcaaccttt 4140ccttaggaag
acatttggtt ttcatcatga ttaagatgat tcctagattt agcacaatgg
4200agagattcca tgccatcttt actatgtgga tggtggtatc agggaagagg
gctcacaaga 4260cacatttgtc ccccgggccc accacatcat cctcacgtgt
tcggtactga gcagccacta 4320cccctgatga gaacagtatg aagaaagggg
gctgttggag tcccagaatt gctgacagca 4380gaggctttgc tgctgtgaat
cccacctgcc accagcctgc agcacacccc acagccaagt 4440agaggcgaaa
gcagtggctc atcctacctg ttaggagcag gtagggcttg tactcacttt
4500aatttgaatc ttatcaactt actcataaag ggacaggcta gctagctgtg
ttagaagtag 4560caatgacaat gaccaaggac tgctacacct ctgattacaa
ttctgatgtg aaaaagatgg 4620tgtttggctc ttatagagcc tgtgtgaaag
gcccatggat cagctcttcc tgtgtttgta 4680atttaatgct gctacaaggt
gtttctgttt cttagattct gaccatgact cataagcttc 4740ttgtcattct tcattgc
475721114PRTHomo sapiens 2Met Ala Lys Ala Thr Ser Gly Ala Ala Gly
Leu Arg Leu Leu Leu Leu1 5 10 15Leu Leu Leu Pro Leu Leu Gly Lys Val
Ala Leu Gly Leu Tyr Phe Ser 20 25 30Arg Asp Ala Tyr Trp Glu Lys Leu
Tyr Val Asp Gln Ala Ala Gly Thr 35 40 45Pro Leu Leu Tyr Val His Ala
Leu Arg Asp Ala Pro Glu Glu Val Pro 50 55 60Ser Phe Arg Leu Gly Gln
His Leu Tyr Gly Thr Tyr Arg Thr Arg Leu65 70 75 80His Glu Asn Asn
Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu Tyr 85 90 95Leu Asn Arg
Ser Leu Asp His Ser Ser Trp Glu Lys Leu Ser Val Arg 100 105 110Asn
Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe Leu Ser 115 120
125Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro Gly Cys Ala Arg
130 135 140Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe Pro Ala Cys Ser
Ser Leu145 150 155 160Lys Pro Arg Glu Leu Cys Phe Pro Glu Thr Arg
Pro Ser Phe Arg Ile 165 170 175Arg Glu Asn Arg Pro Pro Gly Thr Phe
His Gln Phe Arg Leu Leu Pro 180 185 190Val Gln Phe Leu Cys Pro Asn
Ile Ser Val Ala Tyr Arg Leu Leu Glu 195 200 205Gly Glu Gly Leu Pro
Phe Arg Cys Ala Pro Asp Ser Leu Glu Val Ser 210 215 220Thr Arg Trp
Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu Val225 230 235
240Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu Val Val Met Val
245 250 255Pro Phe Pro Val Thr Val Tyr Asp Glu Asp Asp Ser Ala Pro
Thr Phe 260 265 270Pro Ala Gly Val Asp Thr Ala Ser Ala Val Val Glu
Phe Lys Arg Lys 275 280 285Glu Asp Thr Val Val Ala Thr Leu Arg Val
Phe Asp Ala Asp Val Val 290 295 300Pro Ala Ser Gly Glu Leu Val Arg
Arg Tyr Thr Ser Thr Leu Leu Pro305 310 315 320Gly Asp Thr Trp Ala
Gln Gln Thr Phe Arg Val Glu His Trp Pro Asn 325 330 335Glu Thr Ser
Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val His 340 345 350Asp
Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu Asn Arg 355 360
365Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp Phe Gln Gly Pro
370 375 380Gly Ala Gly Val Leu Leu Leu His Phe Asn Val Ser Val Leu
Pro Val385 390 395 400Ser Leu His Leu Pro Ser Thr Tyr Ser Leu Ser
Val Ser Arg Arg Ala 405 410 415Arg Arg Phe Ala Gln Ile Gly Lys Val
Cys Val Glu Asn Cys Gln Ala 420 425 430Phe Ser Gly Ile Asn Val Gln
Tyr Lys Leu His Ser Ser Gly Ala Asn 435 440 445Cys Ser Thr Leu Gly
Val Val Thr Ser Ala Glu Asp Thr Ser Gly Ile 450 455 460Leu Phe Val
Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala Glu465 470 475
480Leu His Tyr Met Val Val Ala Thr Asp Gln Gln Thr Ser Arg Gln Ala
485 490 495Gln Ala Gln Leu Leu Val Thr Val Glu Gly Ser Tyr Val Ala
Glu Glu 500 505 510Ala Gly Cys Pro Leu Ser Cys Ala Val Ser Lys Arg
Arg Leu Glu Cys 515 520 525Glu Glu Cys Gly Gly Leu Gly Ser Pro Thr
Gly Arg Cys Glu Trp Arg 530 535 540Gln Gly Asp Gly Lys Gly Ile Thr
Arg Asn Phe Ser Thr Cys Ser Pro545 550 555 560Ser Thr Lys Thr Cys
Pro Asp Gly His Cys Asp Val Val Glu Thr Gln 565 570 575Asp Ile Asn
Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val Gly 580 585 590Gly
His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr Gly Thr 595 600
605Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys Glu Pro Glu Asp
610 615 620Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys Arg Thr Val Ile
Ala Ala625 630 635 640Ala Val Leu Phe Ser Phe Ile Val Ser Val Leu
Leu Ser Ala Phe Cys 645 650 655Ile His Cys Tyr His Lys Phe Ala His
Lys Pro Pro Ile Ser Ser Ala 660 665 670Glu Met Thr Phe Arg Arg Pro
Ala Gln Ala Phe Pro Val Ser Tyr Ser 675 680 685Ser Ser Gly Ala Arg
Arg Pro Ser Leu Asp Ser Met Glu Asn Gln Val 690 695 700Ser Val Asp
Ala Phe Lys Ile Leu Glu Asp Pro Lys Trp Glu Phe Pro705 710 715
720Arg Lys Asn Leu Val Leu Gly Lys Thr Leu Gly Glu Gly Glu Phe Gly
725 730 735Lys Val Val Lys Ala Thr Ala Phe His Leu Lys Gly Arg Ala
Gly Tyr 740 745 750Thr Thr Val Ala Val Lys Met Leu Lys Glu Asn Ala
Ser Pro Ser Glu 755 760 765Leu Arg Asp Leu Leu Ser Glu Phe Asn Val
Leu Lys Gln Val Asn His 770 775 780Pro His Val Ile Lys Leu Tyr Gly
Ala Cys Ser Gln Asp Gly Pro Leu785 790 795 800Leu Leu Ile Val Glu
Tyr Ala Lys Tyr Gly Ser Leu Arg Gly Phe Leu 805 810 815Arg Glu Ser
Arg Lys Val Gly Pro Gly Tyr Leu Gly Ser Gly Gly Ser 820 825 830Arg
Asn Ser Ser Ser Leu Asp His Pro Asp Glu Arg Ala Leu Thr Met 835 840
845Gly Asp Leu Ile Ser Phe Ala Trp Gln Ile Ser Gln Gly Met Gln Tyr
850 855 860Leu Ala Glu Met Lys Leu Val His Arg Asp Leu Ala Ala Arg
Asn Ile865 870 875 880Leu Val Ala Glu Gly Arg Lys Met Lys Ile Ser
Asp Phe Gly Leu Ser 885 890 895Arg Asp Val Tyr Glu Glu Asp Ser Tyr
Val Lys Arg Ser Gln Gly Arg 900 905 910Ile Pro Val Lys Trp Met Ala
Ile Glu Ser Leu Phe Asp His Ile Tyr 915 920 925Thr Thr Gln Ser Asp
Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile 930 935 940Val Thr Leu
Gly Gly Asn Pro Tyr Pro Gly Ile Pro Pro Glu Arg Leu945 950 955
960Phe Asn Leu Leu Lys Thr Gly His Arg Met Glu Arg Pro Asp Asn Cys
965 970 975Ser Glu Glu Met Tyr Arg Leu Met Leu Gln Cys Trp Lys Gln
Glu Pro 980 985 990Asp Lys Arg Pro Val Phe Ala Asp Ile Ser Lys Asp
Leu Glu Lys Met 995 1000 1005Met Val Lys Arg Arg Asp Tyr Leu Asp
Leu Ala Ala Ser Thr Pro 1010 1015 1020Ser Asp Ser Leu Ile Tyr Asp
Asp Gly Leu Ser Glu Glu Glu Thr 1025 1030 1035Pro Leu Val Asp Cys
Asn Asn Ala Pro Leu Pro Arg Ala Leu Pro 1040 1045 1050Ser Thr Trp
Ile Glu Asn Lys Leu Tyr Gly Met Ser Asp Pro Asn 1055 1060 1065Trp
Pro Gly Glu Ser Pro Val Pro Leu Thr Arg Ala Asp Gly Thr 1070 1075
1080Asn Thr Gly Phe Pro Arg Tyr Pro Asn Asp Ser Val Tyr Ala Asn
1085 1090 1095Trp Met Leu Ser Pro Ser Ala Ala Lys Leu Met Asp Thr
Phe Asp 1100 1105 1110Ser34161DNAHomo sapiens 3ccgaagcagg
gcgcgcagca gcgctgagtg ccccggaacg tgcgtcgcgc ccccagtgtc 60cgtcgcgtcc
gccgcgcccc gggcggggat ggggcggcca gactgagcgc cgcacccgcc
120atccagaccc gccggcccta gccgcagtcc ctccagccgt ggccccagcg
cgcacgggcg 180atggcgaagg cgacgtccgg tgccgcgggg ctgcgtctgc
tgttgctgct gctgctgccg 240ctgctaggca aagtggcatt gggcctctac
ttctcgaggg atgcttactg ggagaagctg 300tatgtggacc aggcggccgg
cacgcccttg ctgtacgtcc atgccctgcg ggacgcccct 360gaggaggtgc
ccagcttccg cctgggccag catctctacg gcacgtaccg cacacggctg
420catgagaaca actggatctg catccaggag gacaccggcc tcctctacct
taaccggagc 480ctggaccata gctcctggga gaagctcagt gtccgcaacc
gcggctttcc cctgctcacc 540gtctacctca aggtcttcct gtcacccaca
tcccttcgtg agggcgagtg ccagtggcca 600ggctgtgccc gcgtatactt
ctccttcttc aacacctcct ttccagcctg cagctccctc 660aagccccggg
agctctgctt cccagagaca aggccctcct tccgcattcg ggagaaccga
720cccccaggca ccttccacca gttccgcctg ctgcctgtgc agttcttgtg
ccccaacatc 780agcgtggcct acaggctcct ggagggtgag ggtctgccct
tccgctgcgc cccggacagc 840ctggaggtga gcacgcgctg ggccctggac
cgcgagcagc gggagaagta cgagctggtg 900gccgtgtgca ccgtgcacgc
cggcgcgcgc gaggaggtgg tgatggtgcc cttcccggtg 960accgtgtacg
acgaggacga ctcggcgccc accttccccg cgggcgtcga caccgccagc
1020gccgtggtgg agttcaagcg gaaggaggac accgtggtgg ccacgctgcg
tgtcttcgat 1080gcagacgtgg tacctgcatc aggggagctg gtgaggcggt
acacaagcac gctgctcccc 1140ggggacacct gggcccagca gaccttccgg
gtggaacact ggcccaacga gacctcggtc 1200caggccaacg gcagcttcgt
gcgggcgacc gtacatgact ataggctggt tctcaaccgg 1260aacctctcca
tctcggagaa ccgcaccatg cagctggcgg tgctggtcaa tgactcagac
1320ttccagggcc caggagcggg cgtcctcttg ctccacttca acgtgtcggt
gctgccggtc 1380agcctgcacc tgcccagtac ctactccctc tccgtgagca
ggagggctcg ccgatttgcc 1440cagatcggga aagtctgtgt ggaaaactgc
caggcattca gtggcatcaa cgtccagtac 1500aagctgcatt cctctggtgc
caactgcagc acgctagggg tggtcacctc agccgaggac 1560acctcgggga
tcctgtttgt gaatgacacc aaggccctgc ggcggcccaa gtgtgccgaa
1620cttcactaca tggtggtggc caccgaccag cagacctcta ggcaggccca
ggcccagctg 1680cttgtaacag tggaggggtc atatgtggcc gaggaggcgg
gctgccccct gtcctgtgca 1740gtcagcaaga gacggctgga gtgtgaggag
tgtggcggcc tgggctcccc aacaggcagg 1800tgtgagtgga ggcaaggaga
tggcaaaggg atcaccagga acttctccac ctgctctccc 1860agcaccaaga
cctgccccga cggccactgc gatgttgtgg agacccaaga catcaacatt
1920tgccctcagg actgcctccg gggcagcatt gttgggggac acgagcctgg
ggagccccgg 1980gggattaaag ctggctatgg cacctgcaac tgcttccctg
aggaggagaa gtgcttctgc 2040gagcccgaag acatccagga tccactgtgc
gacgagctgt gccgcacggt gatcgcagcc 2100gctgtcctct tctccttcat
cgtctcggtg ctgctgtctg ccttctgcat ccactgctac 2160cacaagtttg
cccacaagcc acccatctcc tcagctgaga tgaccttccg gaggcccgcc
2220caggccttcc cggtcagcta ctcctcttcc ggtgcccgcc ggccctcgct
ggactccatg 2280gagaaccagg tctccgtgga tgccttcaag atcctggagg
atccaaagtg ggaattccct 2340cggaagaact tggttcttgg aaaaactcta
ggagaaggcg aatttggaaa agtggtcaag 2400gcaacggcct tccatctgaa
aggcagagca gggtacacca cggtggccgt gaagatgctg 2460aaagagaacg
cctccccgag tgagctgcga gacctgctgt cagagttcaa cgtcctgaag
2520caggtcaacc acccacatgt catcaaattg tatggggcct gcagccagga
tggcccgctc 2580ctcctcatcg tggagtacgc caaatacggc tccctgcggg
gcttcctccg cgagagccgc 2640aaagtggggc ctggctacct gggcagtgga
ggcagccgca actccagctc cctggaccac 2700ccggatgagc gggccctcac
catgggcgac ctcatctcat ttgcctggca gatctcacag 2760gggatgcagt
atctggccga gatgaagctc gttcatcggg acttggcagc cagaaacatc
2820ctggtagctg aggggcggaa gatgaagatt tcggatttcg gcttgtcccg
agatgtttat 2880gaagaggatt cctacgtgaa gaggagccag ggtcggattc
cagttaaatg gatggcaatt 2940gaatcccttt ttgatcatat ctacaccacg
caaagtgatg tatggtcttt tggtgtcctg 3000ctgtgggaga tcgtgaccct
agggggaaac ccctatcctg ggattcctcc tgagcggctc 3060ttcaaccttc
tgaagaccgg ccaccggatg gagaggccag acaactgcag cgaggagatg
3120taccgcctga tgctgcaatg ctggaagcag gagccggaca aaaggccggt
gtttgcggac 3180atcagcaaag acctggagaa gatgatggtt aagaggagag
actacttgga ccttgcggcg 3240tccactccat ctgactccct gatttatgac
gacggcctct cagaggagga gacaccgctg 3300gtggactgta ataatgcccc
cctccctcga gccctccctt ccacatggat tgaaaacaaa 3360ctctatggta
gaatttccca tgcatttact agattctagc
accgctgtcc cctctgcact 3420atccttcctc tctgtgatgc tttttaaaaa
tgtttctggt ctgaacaaaa ccaaagtctg 3480ctctgaacct ttttatttgt
aaatgtctga ctttgcatcc agtttacatt taggcattat 3540tgcaactatg
tttttctaaa aggaagtgaa aataagtgta attaccacat tgcccagcaa
3600cttaggatgg tagaggaaaa aacagatcag ggcggaactc tcaggggaga
ccaagaacag 3660gttgaataag gcgcttctgg ggtgggaatc aagtcatagt
acttctactt taactaagtg 3720gataaatata caaatctggg gaggtattca
gttgagaaag gagccaccag caccactcag 3780cctgcactgg gagcacagcc
aggttccccc agacccctcc tgggcaggca ggtgcctctc 3840agaggccacc
cggcactggc gagcagccac tggccaagcc tcagccccag tcccagccac
3900atgtcctcca tcaggggtag cgaggttgca ggagctggct ggccctggga
ggacgcaccc 3960ccactgctgt tttcacatcc tttcccttac ccaccttcag
gacggttgtc acttatgaag 4020tcagtgctaa agctggagca gttgcttttt
gaaagaacat ggtctgtggt gctgtggtct 4080tacaatggac agtaaatatg
gttcttgcca aaactccttc ttttgtcttt gattaaatac 4140tagaaattta
aaaaaaaaaa a 416141072PRTHomo sapiens 4Met Ala Lys Ala Thr Ser Gly
Ala Ala Gly Leu Arg Leu Leu Leu Leu1 5 10 15Leu Leu Leu Pro Leu Leu
Gly Lys Val Ala Leu Gly Leu Tyr Phe Ser 20 25 30Arg Asp Ala Tyr Trp
Glu Lys Leu Tyr Val Asp Gln Ala Ala Gly Thr 35 40 45Pro Leu Leu Tyr
Val His Ala Leu Arg Asp Ala Pro Glu Glu Val Pro 50 55 60Ser Phe Arg
Leu Gly Gln His Leu Tyr Gly Thr Tyr Arg Thr Arg Leu65 70 75 80His
Glu Asn Asn Trp Ile Cys Ile Gln Glu Asp Thr Gly Leu Leu Tyr 85 90
95Leu Asn Arg Ser Leu Asp His Ser Ser Trp Glu Lys Leu Ser Val Arg
100 105 110Asn Arg Gly Phe Pro Leu Leu Thr Val Tyr Leu Lys Val Phe
Leu Ser 115 120 125Pro Thr Ser Leu Arg Glu Gly Glu Cys Gln Trp Pro
Gly Cys Ala Arg 130 135 140Val Tyr Phe Ser Phe Phe Asn Thr Ser Phe
Pro Ala Cys Ser Ser Leu145 150 155 160Lys Pro Arg Glu Leu Cys Phe
Pro Glu Thr Arg Pro Ser Phe Arg Ile 165 170 175Arg Glu Asn Arg Pro
Pro Gly Thr Phe His Gln Phe Arg Leu Leu Pro 180 185 190Val Gln Phe
Leu Cys Pro Asn Ile Ser Val Ala Tyr Arg Leu Leu Glu 195 200 205Gly
Glu Gly Leu Pro Phe Arg Cys Ala Pro Asp Ser Leu Glu Val Ser 210 215
220Thr Arg Trp Ala Leu Asp Arg Glu Gln Arg Glu Lys Tyr Glu Leu
Val225 230 235 240Ala Val Cys Thr Val His Ala Gly Ala Arg Glu Glu
Val Val Met Val 245 250 255Pro Phe Pro Val Thr Val Tyr Asp Glu Asp
Asp Ser Ala Pro Thr Phe 260 265 270Pro Ala Gly Val Asp Thr Ala Ser
Ala Val Val Glu Phe Lys Arg Lys 275 280 285Glu Asp Thr Val Val Ala
Thr Leu Arg Val Phe Asp Ala Asp Val Val 290 295 300Pro Ala Ser Gly
Glu Leu Val Arg Arg Tyr Thr Ser Thr Leu Leu Pro305 310 315 320Gly
Asp Thr Trp Ala Gln Gln Thr Phe Arg Val Glu His Trp Pro Asn 325 330
335Glu Thr Ser Val Gln Ala Asn Gly Ser Phe Val Arg Ala Thr Val His
340 345 350Asp Tyr Arg Leu Val Leu Asn Arg Asn Leu Ser Ile Ser Glu
Asn Arg 355 360 365Thr Met Gln Leu Ala Val Leu Val Asn Asp Ser Asp
Phe Gln Gly Pro 370 375 380Gly Ala Gly Val Leu Leu Leu His Phe Asn
Val Ser Val Leu Pro Val385 390 395 400Ser Leu His Leu Pro Ser Thr
Tyr Ser Leu Ser Val Ser Arg Arg Ala 405 410 415Arg Arg Phe Ala Gln
Ile Gly Lys Val Cys Val Glu Asn Cys Gln Ala 420 425 430Phe Ser Gly
Ile Asn Val Gln Tyr Lys Leu His Ser Ser Gly Ala Asn 435 440 445Cys
Ser Thr Leu Gly Val Val Thr Ser Ala Glu Asp Thr Ser Gly Ile 450 455
460Leu Phe Val Asn Asp Thr Lys Ala Leu Arg Arg Pro Lys Cys Ala
Glu465 470 475 480Leu His Tyr Met Val Val Ala Thr Asp Gln Gln Thr
Ser Arg Gln Ala 485 490 495Gln Ala Gln Leu Leu Val Thr Val Glu Gly
Ser Tyr Val Ala Glu Glu 500 505 510Ala Gly Cys Pro Leu Ser Cys Ala
Val Ser Lys Arg Arg Leu Glu Cys 515 520 525Glu Glu Cys Gly Gly Leu
Gly Ser Pro Thr Gly Arg Cys Glu Trp Arg 530 535 540Gln Gly Asp Gly
Lys Gly Ile Thr Arg Asn Phe Ser Thr Cys Ser Pro545 550 555 560Ser
Thr Lys Thr Cys Pro Asp Gly His Cys Asp Val Val Glu Thr Gln 565 570
575Asp Ile Asn Ile Cys Pro Gln Asp Cys Leu Arg Gly Ser Ile Val Gly
580 585 590Gly His Glu Pro Gly Glu Pro Arg Gly Ile Lys Ala Gly Tyr
Gly Thr 595 600 605Cys Asn Cys Phe Pro Glu Glu Glu Lys Cys Phe Cys
Glu Pro Glu Asp 610 615 620Ile Gln Asp Pro Leu Cys Asp Glu Leu Cys
Arg Thr Val Ile Ala Ala625 630 635 640Ala Val Leu Phe Ser Phe Ile
Val Ser Val Leu Leu Ser Ala Phe Cys 645 650 655Ile His Cys Tyr His
Lys Phe Ala His Lys Pro Pro Ile Ser Ser Ala 660 665 670Glu Met Thr
Phe Arg Arg Pro Ala Gln Ala Phe Pro Val Ser Tyr Ser 675 680 685Ser
Ser Gly Ala Arg Arg Pro Ser Leu Asp Ser Met Glu Asn Gln Val 690 695
700Ser Val Asp Ala Phe Lys Ile Leu Glu Asp Pro Lys Trp Glu Phe
Pro705 710 715 720Arg Lys Asn Leu Val Leu Gly Lys Thr Leu Gly Glu
Gly Glu Phe Gly 725 730 735Lys Val Val Lys Ala Thr Ala Phe His Leu
Lys Gly Arg Ala Gly Tyr 740 745 750Thr Thr Val Ala Val Lys Met Leu
Lys Glu Asn Ala Ser Pro Ser Glu 755 760 765Leu Arg Asp Leu Leu Ser
Glu Phe Asn Val Leu Lys Gln Val Asn His 770 775 780Pro His Val Ile
Lys Leu Tyr Gly Ala Cys Ser Gln Asp Gly Pro Leu785 790 795 800Leu
Leu Ile Val Glu Tyr Ala Lys Tyr Gly Ser Leu Arg Gly Phe Leu 805 810
815Arg Glu Ser Arg Lys Val Gly Pro Gly Tyr Leu Gly Ser Gly Gly Ser
820 825 830Arg Asn Ser Ser Ser Leu Asp His Pro Asp Glu Arg Ala Leu
Thr Met 835 840 845Gly Asp Leu Ile Ser Phe Ala Trp Gln Ile Ser Gln
Gly Met Gln Tyr 850 855 860Leu Ala Glu Met Lys Leu Val His Arg Asp
Leu Ala Ala Arg Asn Ile865 870 875 880Leu Val Ala Glu Gly Arg Lys
Met Lys Ile Ser Asp Phe Gly Leu Ser 885 890 895Arg Asp Val Tyr Glu
Glu Asp Ser Tyr Val Lys Arg Ser Gln Gly Arg 900 905 910Ile Pro Val
Lys Trp Met Ala Ile Glu Ser Leu Phe Asp His Ile Tyr 915 920 925Thr
Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu Trp Glu Ile 930 935
940Val Thr Leu Gly Gly Asn Pro Tyr Pro Gly Ile Pro Pro Glu Arg
Leu945 950 955 960Phe Asn Leu Leu Lys Thr Gly His Arg Met Glu Arg
Pro Asp Asn Cys 965 970 975Ser Glu Glu Met Tyr Arg Leu Met Leu Gln
Cys Trp Lys Gln Glu Pro 980 985 990Asp Lys Arg Pro Val Phe Ala Asp
Ile Ser Lys Asp Leu Glu Lys Met 995 1000 1005Met Val Lys Arg Arg
Asp Tyr Leu Asp Leu Ala Ala Ser Thr Pro 1010 1015 1020Ser Asp Ser
Leu Ile Tyr Asp Asp Gly Leu Ser Glu Glu Glu Thr 1025 1030 1035Pro
Leu Val Asp Cys Asn Asn Ala Pro Leu Pro Arg Ala Leu Pro 1040 1045
1050Ser Thr Trp Ile Glu Asn Lys Leu Tyr Gly Arg Ile Ser His Ala
1055 1060 1065Phe Thr Arg Phe 1070518DNAArtificialprimer
5attgtcatct cgccgttc 18618DNAArtificialprimer 6tgcttcagga cgttgaac
18721DNAArtificialprimer 7tatcgcagga gagactgtga t
21820DNAArtificialprimer 8tggagaagag aggctgtatc
20917DNAArtificialprimer 9cgttgccttg acttttc
171021DNAArtificialprimer 10tgccccttca gtgttcctac t
211120DNAArtificialprimer 11cttgataaca ctggcaggtt
201220DNAArtificialprimer 12gaggcgttct ctttcagcat
201320DNAArtificialprimer 13tggaagaact tcggcatgag
201420DNAArtificialprimer 14gaattcacag ccaccaagtg
201520DNAArtificialprimer 15ctacttagct ttccaagtgg
201622DNAArtificialprimer 16gggacagaca cctttggaaa ta
221720DNAArtificialprimer 17gttgaaggag tccttgactg
201818DNAArtificialprimer 18ctttcagcat cttcacgg
181919DNAArtificialprimer 19agtgaagttt ctaccatcc
192020DNAArtificialprimer 20ggcgttctct ttcagcatct 20
* * * * *