Novel Centromeric Protein Shugoshin

Abstract

The present invention is to provide meiosis-specific novel kinetochore protein Sgo1 (shugoshin) derived from fission yeast Schizosaccharomyces pombe, and a homologue or paralogue thereof having a regulatory activity of chromosome segregation; and DNAs encoding them; as a factor ensuring the retention of unidirection and cohesion in sister centromere at meiosis I in cooperation with cohesin. To elucidate the proteins protecting Rec8 during anaphase, the present inventor screened in fission yeast genes for a gene that inhibits mitotic growth and prevents sister chromatid from the separation at anaphase, when co-expressed with Rec8. In this approach, meiosis-specific protein Sgo1 that protects (Shugo) centromeric Rec8 from the degradation at anaphase I was indentified. Further, a budding yeast Sgo1 homologue and a fission yeast mitotic paralogue Sgo2 were identified.

Description

[0001] This application is a divisional application of U.S. patent application Ser. No. 10/581,158 filed Jan. 30, 2007, which is national phase entry of International Application No. PCT/JP2004/017428 filed on Nov. 24, 2004, which claims priority benefit of Japanese Application No. JP 2003-401943 filed Dec. 1, 2003 and Japanese Application No. JP 2004-279450 filed Sep. 27, 2004, the contents of each of which are incorporated in their entireties.

TECHNICAL FIELD

[0002] The present invention relates to a protector protein Sgo1 (shugoshin) of cohesin Rec8 derived from fission yeast Schizosaccharomyces pombe, its homologue and paralogue having a regulatory activity of chromosome segregation, and DNAs encoding them.

BACKGROUND OF THE INVENTION

[0003] In eukaryotes, sister chromatid cohesion is established during S phase of cell cycle and. maintained throughout G2 until M phase. During mitosis, this cohesion is destroyed along the entire length of chromosome, allowing sister chromatid to segregate to the opposite sides of cell (equational division) and ensuring that each daughter cell receives one copy of each chromosome. In contrast, meiosis consists of two rounds of chromosome segregation following a single round of DNA replication, leading to the formation of four haploid gametes from one diploid germ cell. During meiosis I, homologous chromosomes (homologues) pair to recombine, forming chiasmata in which one sister chromatid from one homologue is covalently attached to a sister chromatid from the other homologue. Hence, in order for homologues to segregate at meiosis I, cohesion of sister chromatid is necessary to be dissociated along the chromosome arms to resolve chiasmata. However, sister chromatid cohesion is retained at centromere until meiosis II, and utilizes the residual centromeric cohesion when sister chromatid segregates, in the same manner as it does in mitosis. Thus, meiotic division requires sister chromatid cohesion to be dissociated in two steps. However, the molecular mechanism for protection of centromeric cohesion only during meiosis I and only at the centromere has remained to be elucidated (e.g., see Annu Rev Genet 35, 673-745 (2001)).

[0004] There are important clues as to the molecular nature of sister chromatid cohesion, and the mechanism dissociating sister chromatid cohesion at the onset of anaphase (e.g., see Annu Rev Genet 35, 673-745 (2001); Curr Opin Cell Biol 12, 297-301 (2000); Curr Biol 13, R104-14 (2003); Annu Rev Cell Dev Biol 17, 753-77 (2001); Genes Dev 16, 399-414 (2002>>. In various eukaryotes, sister chromatid cohesion depends on a multisubunit cohesin complex including Scc1 (Rad21 in fission yeast Schizosaccharomyces pombe). Anaphase promoting complex (APC)-dependent degradation of the securin, Cut2/Pds1, allows to dissociate the Cut1/Esp1 endopeptidase (separase), which in turn cleaves Rad21/Scc1, dissociating sister chromatid cohesion. During meiosis, the cohesion subunit Rad21/Scc1 is replaced with a meiotic counterpart, Rec8 (e.g., see Cell 98, 91-103 (1999); Mol. Cell. Biol. 19, 3515-3528 (1999); Nature 400, 461-4 (1999); Genes Dev 15, 1349-60 (2001); J Cell Biol 160, 657-70 (2003)). As Rec8 complex resides only at centromere after meiosis I and the depletion of Rec8 destroys centromeric cohesion, the presence of Rec8 at centromere has been thought to confer the persistence of cohesion throughout meiosis I (e.g., see Nat Cell Biol 1, E125-7 (1999)). Several lines of evidence suggest that Rec8 along chromosome arms is cleaved by separase at anaphase I while centromeric Rec8 is specifically protected until metaphase II (e.g., see Cell 103, 387-98 (2000); Embo J 22, 5643-53 (2003)). Budding yeast SP013 has been implicated in the protection of centromeric Rec8 (e.g., see Genes Dev 16, 1659-71 (2002); Genes Dev 16, 1672-81 (2002)), but SP013 is not centromeric and may function indirectly. Drosophila MEI-S332 is a protein residing at centromere, is required for the persistence of centromeric cohesion during meiosis I, and has features of a candidate protector of meiotic centromeric cohesion, although the details of such protection have so far not been elucidated (e.g., see Annu Rev Cell Dev Biol 17, 753-77 (2001); Cell 83, 247-256 (1995)). Despite the completion of genome sequencing projects on several organisms, no homologue of these proteins has emerged, preventing the formulation of .a generalized view of the protection. Concurrently, studies in fission yeast have illuminated the importance of pericentromeric heterochromatin for recruiting centromeric Rec8 complexes and ensuring centromeric cohesion during meiosis I (e.g., see Science 300, 1152-5 (2003)). However, pericentromeric heterochromatin cannot alone confer the specific protection of Rec8 at meiosis I toward meiosis II.

DISCLOSURE OF THE INVENTION

[0005] Almost all the eukaryotes including human propagate offsprings by sexual reproduction evolutionarily predominant with a mixture of genome. Meiosis that reduces chromosome number in half is a core part of the sexual reproduction mechanism. In somatic mitosis, two kinetochores of sister chromatid are caught by spindle microtuble extended from the opposite poles, and sister chromatid is evenly segregated to the both poles by concurrently dissolving the cohesion of arms and centromeres (equational division). In contrast, in meiosis I kinetochores of sister chromatids are caught by spindle microtuble extended from the same pole, and segregated to the same pole while retaining the cohesion at centromere (meiotic division). Next, for the first time in meiosis II the cohesion of centromere site of sister chromatid is dissolved, and separated toward one pole or the other of the two poles respectively, which culminates in the generation of accurate four haploid gametes. Meiosis-specific meiotic division is a modality of chromosome segregation conserved in almost all the eukaryotes, from yeast to human, however regulatory mechanism at the molecular level has remained enigmatic for a long time. The present inventor has demonstrated that meiosis-specific chromosome cohesion factor, cohesin plays an essential role in this regulation by using fission yeast (Nature 400, 461-4 (1999); Science 300, 1152-5 (2003); Nature 409, 359-363 (2001)). An object of the present invention is to provide meiosis-specific novel kinetochore protein Sgo1 (shugoshin) derived from fission yeast Schizosaccharomyces pombe, and a homologue or paralogue thereof having a regulatory activity of chromosome segregation; and DNAs encoding them; as a factor ensuring the retention of unidirection and cohesion in sister centromere at meiosis I in cooperation with cohesin.

[0006] Meiosis comprises two steps of specialized nuclear divisions for producing haploid gametes. To accomplish this, sister chromatid cohesion is necessary to be dissociated in a stepwise manner, first from chromosome arms at anaphase I and second from centromeres at anaphase II. In particular, the factors that protect centromeric cohesion during meiosis I have heretofore remained undissolved. To elucidate the proteins protecting Rec8 during anaphase, the present inventor screened in fission yeast genes for a gene that inhibits mitotic growth and prevents sister chromatid from the separation at anaphase, when co-expressed with Rec8. In this approach, meiosis-specific protein that is a protector of Rec8 in fission yeast and protects (Shugo) centromeric Rec8 from the degradation at anaphase I was indentified, and named Sgo1 (Shugoshin, a Japanese for "guardian spirit"). It was also identified that shugoshin plays an important role in mitotic chromosome segregation. and then identified a budding yeast Sg01 homologue and a fission yeast mitotic paralogue Sgo2. A marginal similarity between Sgo1 and Drosophila MEI-S332 was identified. and Sgo1 homologue in other eukaryotes was also identified. Shugoshin-like proteins in animal cells, which were predicted from the sequence, also have functional conservation with yeast shugoshin. The present invention has been thus completed based on this knowledge.

[0007] That is, the present invention relates to (1) a DNA encoding a following protein (a) or (b): (a) a protein consisting of an amino acid sequence shown in SEQ ID NO: 2, (b) a protein comprising an amino acid sequence where one or several amino acids are deleted. replaced or added in an amino acid sequence shown in SEQ ID NO: 2, and having a regulatory activity of chromosome segregation; (2) a DNA consisting of a base sequence shown in SEQ ID NO: 1 or a complementary sequence thereof; (3) a DNA containing part or whole of a base sequence shown in SEQ ID NO: 1 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; (4) a DNA hybridizing with the DNA according to "2" under stringent conditions and encoding a protein that has a regulatory activity of chromosome segregation; (5) a protein consisting of an amino acid sequence shown in SEQ ID NO: 2; and (6) a protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ ID NO: 2, and having a regulatory activity of chromosome segregation.

[0008] The present invention also relates to (7) a DNA encoding a following protein (a) or (b): (a) a protein consisting of an amino acid sequence shown in SEQ ID NO: 4, (b) a protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ ID NO: 4, and having a regulatory activity of chromosome segregation; (8) a DNA consisting of a base sequence shown in SEQ ID NO: 3 or a complementary sequence thereof; (9) a DNA containing part or whole of a base sequence shown in SEQ ID NO: 3 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; (10) a DNA hybridizing with the DNA according to "8" under stringent conditions and encoding a protein that has a regulatory activity of chromosome segregation; (11) a protein consisting of an amino acid sequence shown in SEQ ID NO: 4; and (12) a protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ 10 NO: 4, and having a regulatory activity of chromosome segregation.

[0009] The present invention further relates to (13) a DNA encoding a following protein (a) or (b): (a) a protein consisting of an amino acid sequence shown in SEQ ID NO: 6, (b) a protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ ID NO: 6, and having a regulatory activity of chromosome segregation; (14) a DNA consisting of a base sequence shown in SEQ ID NO: 5 or a complementary sequence thereof; (15) a DNA containing part or whole of a base sequence shown in SEQ ID NO: 5 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; (16) a DNA hybridizing with the DNA according to "14" under stringent conditions and encoding a protein that has a regulatory activity of chromosome segregation; (17) a protein consisting of an amino acid sequence shown in SEQ ID NO: 6; and (18) a protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ ID NO: 6, and having a regulatory activity of chromosome segregation.

[0010] The present invention still further relates to (19) a DNA encoding a following protein (a) or (b) that has a regulatory activity of chromosome segregation: (a) a protein consisting of an amino acid sequence shown in SEQ ID NO: 8, 10, 12, 14, 16, 18 or 20, (b) a protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ ID NO: 8, 10, 12, 14, 16, 18 or 20; (20) a DNA consisting of a base sequence shown in SEQ ID NO: 7, 9, 11, 13, 15, 17 or 19 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; (21) a DNA containing part or whole of a base sequence shown in SEQ ID NO: 7, 9, 11, 13, 15, 17 or 19 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; (22) a DNA hybridizing with the DNA according to "7", "9", "11", "13", "15", "17" or "19" under stringent conditions and encoding a protein that has a regulatory activity of chromosome segregation; (23) a protein consisting of an amino acid sequence shown in SEQ ID NO: 8, 10, 12, 14, 16, 18 or 20, and having a regulatory activity of chromosome segregation; and (24) a protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino amino acid sequence shown in SEQ ID NO: 8, 10, 12, 14, 16, 18 or 20, and having a regulatory activity of chromosome segregation.

[0011] Furthermore, the present invention relates to (25) a fusion protein in which the protein according to "5", "6", "11", "12", "23" or "24" is bound with a marker protein and/or a peptide tag; (26) an antibody specifically binding to the protein according to "5". "6", "11", "12", "23" or "24"; and (27) the antibody according to "26", which is a monoclonal antibody.

BRIEF DESCRIPTION OF DRAWINGS

[0012] FIG. 1 is a set of pictures showing that sister chromatids are not segregated during mitosis by co-expression of Sgo1 and Rec8 in the present invention. a.) The cen2-GFP strains expressing the genes indicated by endogenous promoters (a constitutive chromatin promoter for rad21+ or rec8+, and a thiamine-repressible promoter Pnmt1 for Sgo1+) were streaked on a thiamine-depleted plate. b.) Samples of Padh1-rec8+Pnmt1-sgo1+ cells cultured for 15 hours at 30.degree. C. after thiamine depletion. The non-segregation of cen2-GFP (asterisk) was identified in the septate junction cells. c.) The non-segregations of cen2-GFP were counted (n>100). d.) The Padh1-rec8+-GFP strains were cultured with or without the use of Pnmt1-sgo1+ in the same manner as (b). Samples of cells at interphase and anaphase are shown.

[0013] FIG. 2 is a set of pictures showing that sister chromatid segregation was undergone in mitosis by expression of non-cleavable Rec8. The plasmid pREP41-rec8-RDRD (expressing non-cleavable Rec8 (Embo J 22, 5643-53 (2003))) was integrated into the chromosome of cen2-GFP cell strains (+Rec8-RDRD), and the cells were streaked on plates with or without the presence of thiamine. The host strain cells (-Rec8-RDRD) were similarly cultured as a control. Note that Rec8-RDRD is expressed only on the thiamine-free plate. Samples of cells cultured in culture medium for 15 hours at 30.degree. C. after the depletion of thiamine.

[0014] FIG. 3 is a set of pictures showing that sgo1 of the present invention is required to protect Rec8 and thereby cohesion at centromeres arises during anaphase of meiosis I. a.) As for one of the homologues marked with cen2-GFP, segregation during meiosis was observed in wild-type and sgo1.DELTA. cells (n>170). A normal segregation pattern of cen2-GFP is illustrated (left). Samples of sgo1.DELTA. cells are shown (right). b.) Separation of sister cen2-GFP dots after meiosis I (mes1.DELTA.arrest) is evident in sgo1.DELTA. cells. c.) The Rec8-GFP signal was observed in the indicated cells at late anaphase I (n>30) and at prometaphase II (n>100), and the frequency of centromeric Rec8-GFP displayed in the cells was counted. The spindles were visualized by expressing CFP-Atb2 (a2-tubulin) (Curr Biol 11, 836-45 (2001)). d.) Rec8-GFP levels throughout the indicated chromosome sites in the arrested cells were measured prior to meiosis I (mei4.DELTA. arrest) by ChIP assay with the use of anti-GFP antibodies. The bottom panel shows Schizosaccharomyces pombe chromosome I schematically, and the primers (cnt, imr, dg, dh, lys1, mes1) were used there.

[0015] FIG. 4 is a set of pictures showing that Sgo1 of the present invention localizes at pericentromeric regions during meiosis I. a.) Synchronous meiosis of diploid pat1-114/pat1-114 cell strains (Embo J 22, 5643-53 (2003)) was sampled, meiotic nuclear division was monitored by DAPI staining, and the protein level of Sgo1 was detected by Western blotting with the use of anti-Sgo1 antibodies. b.) Sgo1 (green) was counterstained with tubulin (red) and DAPI (4'6'-diamidino-2-phenylindole) (blue) at the indicated stages in meiotic cells. c.) A sgo1+-GFP cell co-expressing mis6+-CFP was examined under fluorescence microscopy. Sgo1-GFP (green) and Mis6-CFP (red) are merged. d.) Sgo1-GFP levels throughout the indicated chromosome sites in cells arrested at metaphase I were measured by ChIP assay with the use of anti-GFP antibodies. The same primers as for FIG. 2d in synchronism with additional primers at mat (heterochromatin region at the mating type locus) and TAS (telomere associated sequence) were used. e.) Sgo1-GFP (green) was detected at metaphase I in the indicated cells that express CFP Atb2 to visualize spindles (red). f.) Rec8-HA was expressed with or without Sgo1-FLAG in proliferating cells, and the extracts were immunoprecipitated with anti-FLAG antibody. g.) A model for the action of shugoshin in meiosis. Shugoshin protects centromeric Rec8 complexes from cleaving by separase at the onset of anaphase I, thereby preserves the centromeric cohesion until meiosis II. Shugoshin is degraded depending on APC during anaphase II.

[0016] FIG. 5 is a set of pictures showing the time-dependent change of the expression levels of Sgo1 and Rec8 in synchronous culture of haploid pat1-114 cell strains (wt), and of cut1-206 or Prad21-slp1 cells. The expression of slp1+ (a fission yeast CDC20 homologue required for APC activation (Mol Cell Biol 17, 742-50 (1997))) was repressed during meiosis in Prad21-slp1 cells where slp1 promoter was replaced with rad21. Meiotic nuclear division was monitored by DAPI staining, and the protein levels of Sgo1, Rec8, and tubulin (control) were measured by western blotting with the use of anti-Sgo1, anti-Rec8 and anti-tubulin antibodies, respectively. Although cut1-206 cells together with normal kinetics led to Sgo1 degradation, Rec8 degradation was delayed. Prad21-slp1 cells showed delayed degradation of Sgo1 as well as Rec8. Arrowheads indicate a cleavage product of Rec8 by separase Cut1.

[0017] FIG. 6 is a set of pictures showing that ectopic expression of sgo1+ inhibits the growth of the cut1-206 mutant. Chromosomal sgo1+ promoter was replaced with Pnmt1 or Pnmt41 (a weaker version of Pnmt1), and the effect on the mitotic growth in cut1-206 temperature-sensitive cells was examined. The indicated cells were streaked on a plate without thiamine and cultured for 3 days at 28.degree. C. The cut1-206 cells moderately expressing Sgo1 by Pnmt1, arrested mitotic growth even at the permissive temperature, whereas cut1+ cells grew normally.

[0018] FIG. 7 is a set of pictures showing that Sgo2 of the present invention plays an important role in mitotic at centromere. a.) Serial dilutions of the indicated cultures were spotted onto YEA plates containing 0, 5 or 10 .mu.g/ml of TBZ, and cultured for 3 days at 30.degree. C. b.) The indicated strains were streaked on YEA plates and cultured for 3 days at 30.degree. C. c.) Sgo2-GFP (green) was detected at anaphase I in wild-types and in bub1.DELTA. cells that express CFP-Atb2 to visualize spindles (red). DNA was stained with Hoechst (blue). Wild-type cells at anaphase are also shown. d.) The sgo2+-GFP mis6+-HA cells were fixed and stained with anti-GFP and anti-HA antibodies. e.) Sgo2-GFP levels were measured throughout the indicated chromosome sites in cells arrested at prometaphase or in asynchronous cells by ChIP assay.

[0019] FIG. 8 is a set of pictures showing the results of analysis of budding yeast shugoshin ScSgo1 of the present invention. a.) Budding yeast ScSGO1-GFP diploids in proliferation were fixed with methanol and counterstained with DAPI. b.) ScSGO1-Myc NDC10-HA cells were fixed, and stained with DAPI and antibodies against Myc and HA. c.) ScSGO1-GFP diploids causing meiosis in culture medium were fixed with methanol and counterstained with DAPI. d.) Serial dilutions of the indicated cultures were spotted onto YPD plates containing 0 or 15 .mu.g/ml of benomyl. e.) Chromosome loss was analyzed in wild-types (wt) and Scsgo1.DELTA. mutants by a colony sectoring assay. The loss of nonessential chromosome fragments resulted in a red sector in a white colony. As a positive control, ubr1.DELTA. mutant was used (Nature 410, 955-9 (2001)). The frequency of sectoring colonies is shown at the bottom (n>120). f.) Samples of segregation of cenV-GFP in Scsgo1.DELTA. tetrads. The segregation patterns in tetrads were mostly classified as one of the three shown at the bottom. The each population (n=200) is also shown. g.) ScSGO1-Myc diploids were induced by synchronous meiosis and were examined the segregation of cenV-GFP marked on one of two homologues at meiosis I and meiosis II. Although most of the cells caused reductional segregation pattern at meiosis I (96%, n=207), the incidence of non-segregation was high at meiosis II (34%, n=322). h.) The cells marked with cenV-GFP on both homologues were induced to meiosis, and counterstained with anti-tubulin antibody and DAPI. Cells at late anaphase I were examined for cenV-GFP dots. ScSGO1-Myc cells frequently showed split cenV-GFP dots at either pair of sister chromatids (72%, n=138), while control wild-type cells did not (<2%, n=106).

[0020] FIG. 9 is a set of pictures showing sequences of the amino terminal coiled-coil regions and carboxyl terminal basic regions of shugoshin-like proteins in various organisms. The primary sequences of the amino terminal regions of Sgo1 are conserved in Schizosaccharomyces pombe (Sgo1 and Sgo2), budding yeast (ScSgo1) and Neurospora crassa (B23G1.060), while the sequences containing ME1-S332 in other species are not conserved, all presumably carry coiled-coil motif (predicted by COILS program (Science 252, 1162-4 (1991))). See the arrowheads, asterisks and circles in the pictures. The sequences in FIG. 9 respectively correspond to the following SEQ ID NOs: Sg01_Sp18: SEQ ID NO: 21; Sg02_Sp10: SEQ ID NO: 22; Sg01_Sc40: SEQ ID NO:23; B23GI.060_Nc19: SEQ ID NO: 24; Mei-S332_Dm2: SEQ ID NO: 25; Sg01_Sp277: SEQ ID NO: 26; Sg01_Sp569: SEQ ID NO: 27; Sg01_Sc364: SEQ ID NO: 28; B23GI.060_Nc464: SEQ ID NO: 29; Mei-S332_Dm367: SEQ ID NO: 30; C33H5.15_Ce: SEQ ID NO: 31; AT3G10440.1_At: SEQ ID NO: 32; AT5G04320.1_At: SEQ ID NO: 33; BAB29295.1_Mm: SEQ ID NO: 34; Tripin_Mm: SEQ ID NO:35; Q9BVA8_Hs: SEQ ID NO: 36; Tripin_Hs: SEQ ID NO: 37.

[0021] FIG. 10 is a picture showing the results of examination of sgo1 mutations that were generated within conserved regions. Both h+sgo1.DELTA. and h-sgo1.DELTA.cen2-GFP cells transformed with the indicated plasmid, were mixed on SPA plates and monitored for segregation of cen2-GFP at miosis II. A plasmid pREP81 bearing a weak version of the thiamine-repressible nmt1 promoter was used to express sgo1. Control cells carrying plasmid pREP81-sgo1 (wt) showed nearly 80% the segregation at meiosis II, whereas cells expressing non-segregation sgo1 allele showed random segregation (50% segregation). Any of the mutations tested, except a non-conserved site mutation 297TA, did not complement sgo1.DELTA. in this assay. The means of two independent experiments are shown (n>100).

[0022] FIG. 11 (a) is a picture showing schematic representation of the shugoshin family proteins. A predicted coiled-coil (red) and a conserved basic region (blue) exist in the N-terminal and C-terminal regions respectively. Further, FIG. 11 (b) is a picture showing the result of analysis in HeLa cell extracts by western blotting after transfection with siRNA.

[0023] FIG. 12 is a set of pictures showing the results that HeLa cells were stained (green) with antibody against hSgo1 or hSgo2 prepared from rabbit, concurrently stained with tubulin antibody and DAPI, and then respectively co-stained with spindle (red) and chromosome DNA (blue). Meanwhile, the cells were fixed with paraformaldehyde.

[0024] FIG. 13 is a set of pictures showing the results that HeLa cells at prometaphase and metaphase were stained with antibodies against hsgo1 or hSgo2 (green), and concurrently co-stained with antibodies against centromere protein CENP-A (a, c; red), antibodies against passenger protein Aurora B of chromosome localized within kinetochore from prophase to metaphase (b, d; red), and DAPI (blue). Both signals of hSgo1 and hSgo2 showed signals at the sites close to CENP-A dots on chromosome. From the above, it was revealed that both hsgo1 and hSgo2 are centromere proteins. Furthermore, both sites of Sgo1 and Aurora B were practically the same at prometaphase and metaphase, whereas Sgo2 was placed just outside Aurora B. From the above, it was revealed that both hsgo1 and hSgo2 are placed within kinetochore from prometaphase to metaphase.

[0025] FIG. 14 is a picture showing the results of RNAi experiments that targeted hsgo1 and hSgo2 respectively. The expressions in any proteins were significantly suppressed after 48 hours, thereby the cells arrested in mitosis (total in the figure) were accumulated. As the accumulation was dissolved by suppressing a spindle checkpoint factor BubR1 by RNAi, it was suggested that hSgo1 and hSgo2 directly or indirectly function during the process where spindle take kinetochore properly at centromeres.

[0026] FIG. 15 is a set of pictures showing the results, where RNAi experiments targeting hsgo1 was performed by using HeLa cells, and then the cells were mounted on a slide glass and stained with Giemsa. It was revealed that sister chromatid strongly adhered at centromere site in control cells; but in cells suppressed hsgo1, the adhesion at centromere site was weak, and easily detached by the experiment operation.

[0027] FIG. 16 is a set of pictures showing that Sgo1 and Bub1 are required for condensation at centromeres in mitosis. (a) By treatments with siRNA, chromosome spread was performed in mitotic HeLa cells stained with Giemsa. Representative spread is shown together with the occurrence rates. More than one hundred of the prophases and prometaphases were observed for each RNAi. An example of sister chromatid pair is magnified at the top. (b) After treatment with nocodazole for 4 hours, chromosome spread was observed in cells interfered with RNAi. Examples of the spread are shown with the frequency (n>100). (c) HeLa cells expressing Scc1-myc were fixed at 36 hours after the treatment with siRNAs. The cells were immunostained with anti-myc-antibody (green) and anti-centromere-antibody (ACA) (red). DNA was stained with DAPI (blue). (d) Rates of the cells showing Scc1-myc staining are shown. Cells expressing Scc1-myc in this cell line were less than 25%. Scale bar shows 10 .mu.m.

[0028] FIG. 17 is a set of pictures showing the results of RNAi experiments targeting Bub1, respectively. (A, B) RNAi experiments targeting Bub1 were performed respectively, and resulted in disappearance of the localization of both proteins, hSgo1 and hSgo2 at centromere. (C, D) As the localization of both proteins, hSgo1 and hSgo2 at centromere was normal in RNAi experiments targeting a control, BubR1; the significance of the results of Bub1 was ensured. It is shown that Bub1 and BubR1 are similar but different proteins, and the localization of hSgo1 and hSgo2 at centromere depends on Bub1 (A, B), but not on BubR1 (C, D).

[0029] FIG. 18 is a set of pictures showing the results that a clone in which cDNA of mouse shugoshin homologous gene (SEQ ID NOs: 21 and 23) is fused with GFP gene was generated by using retroviral vector, and expressed in human HeLa cells. It was revealed that any of the GFP fusion proteins is co-localized with human kinetochore protein Bub1 in mitosis. The appended drawings of the figures are presented to further describe the invention and to assist in its understanding through clarification of its various aspects.

BEST MODE OF CARRYING OUT THE INVENTION

[0030] As for a protein of the present invention, a protein Sgo1 (shugoshin) comprising an amino acid sequence shown in SEQ ID NO: 2 and having a regulatory activity of chromosome segregation; a protein comprising the amino acid sequence shown in SEQ ID NO: 2 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation; a paralogue Sgo2 of protein Sgo1 comprising an amino acid sequence shown in SEQ ID NO: 4 and having a regulatory activity of chromosome segregation; a protein comprising the amino acid sequence shown in SEQ ID NO: 4 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation; a Saccharomyces cerevisiae homologue ScSgo1 of protein Sgo1 comprising an amino acid sequence shown in SEQ ID NO: 6 and having a regulatory activity of chromosome segregation; a protein comprising the amino acid sequence shown in SEQ ID NO: 6 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation; a protein (NC) comprising an amino acid sequence shown in SEQ ID NO: 8 and having a Neurospora crassa-derived regulatory activity of chromosome segregation; a protein comprising the amino acid sequence shown in SEQ ID NO: 8 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation; a protein (At) comprising an amino acid sequence shown in SEQ ID NO: 10 or 12 and having a Arabidopsis-derived regulatory activity of chromosome segregation; a protein comprising the amino acid sequence shown in SEQ ID NO: 10 or 12 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation; a protein (Mm) comprising an amino acid sequence shown in SEQ ID NO: 14 or 16 and having a mouse-derived regulatory activity of chromosome segregation; a protein comprising the amino acid sequence shown in SEQ ID NO: 14 or 16 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation; a protein (Hs) comprising an amino acid sequence shown in SEQ ID NO: 18 or 20 and having a human-derived regulatory activity of chromosome segregation; and a protein comprising the amino acid sequence shown in SEQ ID NO: 18 or 20 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation; can be exemplified. Further, as for the regulatory activity of chromosome segregation described in the above, although it is not especially limited as long as the activities regulate chromosome segregation, for example, activities correctly regulating chromosome segregation of germ cells and/or of somatic cell division are preferable, and activities protecting (Shugo) the centromere of sister chromatid from the separation in meiosis I is more preferable. In addition, proteins of the present invention can be prepared by known methods based on DNA-sequence information and the like, and the derivations are not limited to yeast, mouse, human and the like. Furthermore, for example, Sgo1 (shugoshin) mutant that is a protein comprising an amino acid sequence shown in SEQ ID NO: 2 where one or several amino acids are deleted, replaced or added, and having a regulatory activity of chromosome segregation, can be prepared by ordinary methods such as known gene manipulation, point mutation and the like.

[0031] As for a DNA of the present invention, a DNA encoding a protein of the present invention that has a regulatory activity of chromosome segregation: a DNA derived from fission yeast Schizosaccharomyces pombe, comprising a base sequence shown in SEQ ID NO: 1 or 3 or a complementary sequence thereof; and a DNA containing part or whole of these sequences, encoding a protein that has a regulatory activity of chromosome segregation: a DNA derived from Saccharomyces cerevisiae, comprising a base sequence shown in SEQ ID NO: 5 or a complementary sequence thereof; and a DNA containing part or whole of these sequences, encoding a protein that has a regulatory activity of chromosome segregation: a DNA derived from Neurospora crassa, comprising a base sequence shown in SEQ ID NO: 7 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; and a DNA containing part or whole of these sequences, encoding a protein that has a regulatory activity of chromosome segregation: a DNA derived from Arabidopsis, comprising a base sequence shown in SEQ ID NO: 9 or 11 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; and a DNA containing part or whole of these sequences, encoding a protein that has a regulatory activity of chromosome segregation: a DNA derived from mouse, comprising a base sequence shown in SEQ ID NO: 13 or 15 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; and a DNA containing part or whole of these sequences, encoding a protein that has a regulatory activity of chromosome segregation: a DNA derived from human, comprising a base sequence shown in SEQ ID NO: 17 or 19 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation; and a DNA containing part or whole of these sequences, encoding a protein that has a regulatory activity of chromosome segregation: a DNA hybridizing with the above DNA under stringent conditions, encoding a protein that has a regulatory activity of chromosome segregation: and the like, can be exemplified.

[0032] These DNAs can be prepared by known methods based on DNA-sequence information, such as a gene or cDNA library of yeast, mouse, human and the like. Further, using a base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, or others or a complementary sequence thereof, or part or whole of these sequences as a probe, DNA libraries of yeast, mouse, human and the like are hybridized under stringent conditions, and the intended DNA encoding a protein that has a regulatory activity of chromosome segregation can be obtained by isolating the DNAs that hybridized with the probes. As for a condition of hybridization to obtain the DNA; hybridization at 42.degree. C., and washing treatment by a buffer containing 1.times.SSC and 0.1% SDS at 42.degree. C.; preferably hybridization at 65.degree. C., and washing treatment by a buffer containing 0.1.times.SSC and 0.1% SDS at 65.degree. C.; can be exemplified. Moreover, as for an element affecting the stringency of hybridization, there are various elements other than the above described temperature conditions, those skilled in the art can actualize the stringency equivalent to that of hybridization as exemplified in the above with an appropriate combination of various elements.

[0033] As for a fusion protein of the present invention, any protein can be used as long as the protein of the present invention is bound to a marker protein and/or a peptide tag, as for a marker protein, it is not especially limited but a conventionally known marker protein, for example, alkaline phosphatase, Fc region of antibody, HRP, GFP and the like can be exemplified. Further, as for a peptide tag of the present invention, conventionally known peptide tags such as Myc, His, FLAG and GST tags can be specifically exemplified. The fusion protein can be produced by ordinary methods; and is useful for purification of protein Sgo1 and the like by using the affinity of Ni-NTA and His tag, and for a reagent for study in the art.

[0034] As for an antibody specifically binding to a protein of the present invention, immunospecific antibodies such as monoclonal antibody, polyclonal antibody, chimeric antibody, single-stranded antibody, humanized antibody and the like, can be specifically exemplified. These antibodies can be produced by ordinary methods with the use of proteins such as the above-mentioned Sgo1 or part thereof as an antigen, and among them a monoclonal antibody is preferable in terms of specificity. Antibodies such as a monoclonal antibody are useful for elucidating the localization of Sgo1 and others in vivo.

[0035] The above-mentioned antibodies of the present invention can be generated with the use of common protocol by administering proteins of the present invention or fragments containing epitope thereof, or cells expressing the protein on their membrane surfaces, to animals (preferably non-human). For example, for preparation of a monoclonal antibody any method such as hybridoma (Nature 256, 495-497, 1975), trioma, human B cell hybridoma (Immunology Today 4, 72, 1983) and EBV-hybridoma (MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp. 77-96, Alan R. Liss, Inc., 1985), by which antibodies are generated from cultures of continuous cell lines, can be used.

[0036] To generate a single-stranded antibody against a protein of the present invention, a method for preparation of single-stranded antibody (U.S. Pat. No. 4,946,778) can be applied. Further, to express a humanized antibody, transgenic mouse or other mammals can be used, clones that express a protein of the present invention with the use of the above-mentioned antibody can be isolated/identified, and its polypeptide can be purified by affinity chromatography. Antibodies against peptide containing proteins of the present invention or antigen epitopes thereof can be possibly used for diagnosis and treatment of cancer, or of chromosome segregation diseases such as infertility or Down's syndrome using a regulatory factor of chromosome segregation as an index.

[0037] Functional analysis of a protein of the present invention can be performed by using fusion proteins fused with, for example; fluorescent substances such as FITC (fluorescein isocyanate) or tetramethyl rhodamine isocyanate; radioisotopes such as 125I, 32P, 14C, 35S or 3H; labelings with enzymes such as alkaline phosphatase, peroxidase, .beta.-galactosidase or phycoerythrin; fluorescence emission proteins such as green fluorescent protein (GFP); or the like, to antibodies such as the above-mentioned monoclonal antibodies. As an immunological assay method with the use of antibody of the present invention, methods such as RIA, ELISA, Fluorescent antibody method, Plaque forming cell assay, Spotting method, Hemagglutination testing, Ouchterlony method can be exemplified.

[0038] The present invention will be explained in detail in the following by referring to the examples, but the technical scope of the present invention will not be limited to these.

Example 1

Method

(Screening of Rec8 Protector)

[0039] The present inventor examined a gene that is toxic only when co-expressed with Rec8 in vegetative cells. The Rec8 encoding sequence that was fused with GFP was cloned into pREP82 (ura4+ marker) under the thiamine-repressible nmt1+ promoter, to construct pREP82-rec8+-GFP. A Schizosaccharomyces pombe cDNA library constructed by mRNA that was prepared from meiotic cells, and a pREP3 vector (nmt1+ promoter, LEU2+ marker) (Y. Akiyoshi and Y. W., unpublished) were used. The leu1 ura4-D18 cells carrying pREP82-rec8+-GFP were transformed with the cDNA library, spread on agar plates containing thiamine (promoter-off) and incubated for 3 days at 30.degree. C. The colonies were then replicated on two thiamine-free agar plates: one that contains uracil and 5'-fluoroortoic acid (5'-FOA) where only cells lacked the plasmid pREP82-rec8+-CFP can grow (thereby expresses a library clone alone), and the other that does not contain 5'-FOA (allows co-expression of rec8+-GFP and a library clone). The present inventor added Phloxine B, a drug that stains dead cells red, onto the both agar plates, thereby illuminated sick colonies. After incubation for two days, the colonies exhibiting sickness only on the co-expression agar plate were picked up, and the library-derived plasmids were recovered and analyzed.

(Schizosaccharomyces pombe Strains)

[0040] Deletion and tagging of GFP or FLAG to endogenous sgo1+ and sgo2+ were performed by a PCR-based gene targeting method (Yeast 14, 943-951 (1998)). By inserting GFP into the C-terminus of the PCR-amplified sgo1+-FLAG, sgo1+-FLAG-GFP was generated and integrated into the endogenous sgo1 locus. Further, a endogenous promoter of the sgo1+ was replaced with a nmt promoter to generate Pnmt-sgo1+ or Pnmt-sgo1+-FLAG-GFP by the PCR-based gene targeting method. The proteins tagged to Sgo1-GFP or Sgo1-FLAG was deleted depending on the purpose. A mei4.DELTA. mutation was used to arrest meiotic cells prior to meiosis I (close to late prophase in meiosis I), and a mes1 .DELTA. mutation was used to arrest after meiosis I, as described previously (Nature 400, 461-4 (1999)).

(Observation of Chromosomes Marked with GFP)

[0041] To observe the segregation patterns of homologues at meiosis I, h90 cells retaining cen2-GFP (Embo J 22, 2284-96 (2003)) were spotted on meiosis-inducing medium, SPA. To examine the segregation patterns of sister chromatids, opposite mating type cells, one marked with cen2-GFP and the other not marked, were mixed and spotted on SPA. After incubation for one day, the zygotes were monitored for GFP. Images were obtained under a microscope (Axioplan2, Zeiss) equipped with a cooled CCD camera (Quantix, Photometrics) and by using Metamorph software (Universal Imaging Corporation). Seven Z-sections for GFP signals were converted to single two-dimensional images by taking the maximum signal at each pixel position in the images.

(Chromatin Immunoprecipitation; ChIp)

[0042] Diploid sgo1+-FLAG-GFP was used for ChIP with Sgo1. To achieve a highly synchronous culture, the endogenous slp1+ promoter was replaced with the rad21+ promoter that is not active during meiosis, and the cells were arrested at metaphase I. The cells were incubated in nitrogen-depleted medium for 17 hours at 30.degree. C., and 60% the cells or less were arrested at metaphase I. For ChIP with Sgo2, nda3-KM311 sgo2+-GFP cells were proliferated at 30.degree. C., and then shifted to 18.degree. C. After incubation for 8 hours, most of the cells were arrested at metaphase. The cells were fixed with 3% para-formaldehyde for 30 minutes at 18.degree. C., and extracts were prepared. The DNA was broken to an average size of 400 bp, and the extracts were immunoprecipitated with rabbit anti-GFP antibodies (Clontech). DNAs prepared from the whole cell crude extracts, or immunoprecipitated chromatin fractions were analyzed by quantitative PCR, with a LightCycler or a Lightcycler-DNA Master SYBR Green I kit (Roche Molecular Biochemicals). Antibody-minus samples were used as controls in each experiment to explain the nonspecific binding in the ChIP fractions.

(Preparation of Anti-Sgo1 Antibodies)

[0043] Sgo1+ ORF was PCR-amplified from an Schizosaccharomyces pombe cDNA library, and inserted into plasmids pGEX4T-2 (Pharmacia Biotech) and pET-19b (Novagen) respectively to prepare recombinant proteins GST-Sgo1 and His-Sgo1. GST-Sgo1 was used to immunize rabbit, and the raised antibodies were purified by His-Sgo1 as described previously (Embo J 22, 5643-53 (2003)). Furthermore, for the purpose of analyzing proteins (SEQ ID NOs: 18 and 20; hSgo1 and hSgo2 respectively) encoding human shugoshin homologous gene (SEQ ID NOs: 17 and 19), part of hSgo1 and hSgo2 was expressed in E coli, and antibodies against hSgo1 and hSgo2 were produced by injecting the protein into rabbit.

(Immunostaining)

[0044] To stain endogenous Sgo1, wild-type diploid cells cultured for 5 hours in MM-N were fixed with 3% formaldehyde for 40 min at 30.degree. C., and stained by the method described previously (Embo J 22, 5643-53 (2003)). To stain Sgo2-GFP and Mis6-HA, logarithmically growing cells were used. Sgo1 was detected by using rabbit anti-Sgo1 antibody at 1:50 and Alexa488-conjugated anti-rabbit antibody (Molecular Probes) at 1:100. Tubulin was detected by using mouse anti-tubulin antibody TAT-1 (provided by Keith Gull) at 1:200 and Cy3-tagged anti-mouse antibody (Chemicon) at 1:2000. Cells were counterstained with DAPI to visualize DNA. The Sgo2-GFP was detected by using mouse anti-GFP antibody (Roche) at 1:50 and BODIPY FL-conjugated anti-mouse antibody (Molecular Probes) at 1:100. The Mis6-HA was detected by using rabbit anti-HA antibody Y-11 (Santa Cruz) at 1:50 and Alexa488-conjugated anti-rabbit antibody at 1:100. Cells were counterstained with DAPI to visualize DNA. Further, immunostaining was performed by using rabbit anti-hSgo1 antibody and rabbit anti-hSgo2 antibody in the same manner as the above.

(Communoprecipitation)

[0045] Padh-rec8+-3HA Pnmt41-sgo1+-FLAG-GFP strain cells and control Padh-rec8+-3HA strain cells were cultured without thiamine for 15 hours at 30.degree. C., collected, and the extracts were prepared. To liberate chromatin-bound proteins, the extracts were treated with DNase I. After clarifying the extracts by centrifugation, the Sgo1-FLAG-GFP protein was immunoprecipitated with anti-FLAG antibody M2 (Sigma). The Rec8-3HA and Sgo1-FLAG-GFP were detected by anti-HA antibody Y-11 and anti-FLAG antibody M2, respectively.

(Analysis of Budding Yeast)

[0046] All sample strains except those for chromosome loss assay are derivative of SK1 (Cell 98, 91-103 (1999)). The chromosome loss assay was performed as described previously (Nature 410, 955-9 (2001)). The ScSGO1 gene was deleted or epitope-tagged by using PCR generated cassettes (Yeast 14, 953-961 (1998)). Accurate gene targeting was checked by PCR. URA3-GFP dots marking chromosome V (cenV-GFP) were described previously (Cell 98, 91-103 (1999)). Sporulation was induced by culturing diploid cells at 30.degree. C. as described previously (Dev Cell 4, 535-48 (2003)). In situ immunofluorescence was performed as described previously (Dev Cell 4, 535-48 (2003)).

(Cell Culture)

[0047] HeLa cells were cultured in DMEM supplemented with 10% fetal bovine serum and 0.03% L-Glutamine. The HeLa cell strain expressing Scc1-myc was cultured with 200 .mu.g/ml of G418 (Invitrogen) and 100 .mu.g/ml of Hygromycin B (Wako). Expression of Scc1-myc was induced by incubation with 2 .mu.g/ml of Doxycyclin (Sigma) for 48 hours.

(Preparation of Anti-Human Sgo Antibody)

[0048] As the information for N-terminal amino acid sequence of human Sgo1 was not obtained from the databases, the present inventor cloned a cDNA fragment that was amplified from a cDNA library (BD Biosciences) with the use of primers recognizing the cloning site of .lamda.TriplEx: CTCGGGAAGCGCGCCATTGTG (SEQ ID NO: 38) and the DNA sequence corresponding to the numbers 237-242 in amino acid sequence of Q9BVA8: CCTGGCTGAATCAGCTTTGGTG (SEQ ID NO: 39). The Sequencing revealed that the Sgo1 mRNA encodes a protein having 527 amino acids. To obtain polyclonal antibodies against Sgo1, a cDNA fragment encoding the numbers 109-491 in amino acid sequence of Sgo1 was amplified and inserted into the reading frames of plasmids pGEX4T-2 (Amersham) and pET19b (Novagen) to produce GST-Sgo1 and His-Sgo1 respectively, and followed by immunization of a rabbit (QIAGEN) (performed according to the manufacturer's instructions). His-Sgo1 was affinity-purified on CNBr-activated sepharose (Amersham). Antibodies against Sgo2 were raised with GST-Sgo2 (amino acid numbers 331-631) and purified with His-Sgo2 in the same manner as the above.

(Immunofluorescence Microscopy and Chromosome Spreading)

[0049] Immunofluorescent staining was performed as described in the above, by using anti-human Sgo1 (1:1000), anti-human Sgo2 antiserum (1:10000), anti-Bub1 (1:1000, MBL), anti-BubR1 (1:1000, MBL), anti-CENP-A (1:1000, MBL), anti-Aurora B AIM-1 (1:1000, BD Biosciences) and anti-tubulin DM1A (1:1000, Sigma). Immunostaining of Scc1-myc was performed as described in the above, by using anti-myc CM-100 (1:1000, Gramsch Laboratories) and ACA (1:1000, provided from Dr. Yoshinari Takasaki). As a secondary antibody, Alexa Fluor 488 goat anti-rabbit antibody (1:1000, Molecular Probes), Cy3 conjugated anti-mouse antibody (1:1000, CHEMICON), and Cy3 conjugated donkey anti-human antibody (1:1000, Jackson ImmunoResearch Laboratories. Inc) were used. 3 .mu.g/ml of Hoechst 33342 or 0.5 .mu.g/ml of DAPI were used for counter staining. Images were taken by using SlideBook or MetaMorph software.

(Chromosome Spreading)

[0050] HeLa cells during mitosis were collected by mitotic shake-off and incubated with 330 nM of nocodazole for 0 up to 4 hours. Chromosome spreading was performed as described in the above.

(Immunoblotting)

[0051] HeLa cells were boiled with the sample buffer and resolved by SDS-polyacrylamide gel electrophoresis. Proteins were transferred to Immobilon-P membrane (Millipore), followed by blocking with 5% Skim milk (Nacalai) in TBST (150 mM of NaCl, 20 mM of Tris-HCl pH7.4, 0.05% Tween-20). Antibody incubations were performed in 0.1% skim milk TBST supplemented with anti-Sgo1 antibody (1:1000), anti-Sgo2 antibody (1:1000), anti-Bub1 antibody (1:500) and anti-tubulin antibody (1:3000). Blots were produced by ECL (Amersham).

(RNAi)

[0052] As a siRNA target sequence, hSgo1: AAGUCUACUGAUAAUGUCUUATT (SEQ ID NO:40) and hSgo2: AAGCACUACCACUUUGAAUAATT (SEQ ID NO:41), and human Sgo1: GUGAGCCUCUGUGAAUCAATT (SEQ ID NO:42) and human Sgo2: GCUCUCAUGAACAAUAACUTT (SEQ ID NO:43) were respectively selected on hSgo1RNA or hSgo2RNA. Furthermore, as a siRNA target sequence, GAGUGAUCACGAUUUCUAATT (SEQ ID NO: 44) was selected on other siRNA target sequence, Bub1 RNA; siRNA target sequence, AACGGGCAUUUGAAUAUGAAA (SEQ ID NO: 45, see JCS, 117, 1577-1589 (2004)) was selected at 2 sites on a spindle checkpoint factor BubR1 RNA. These sequences were synthesized as double strand, and introduced into cells by using oligofectamine (Invitrogen). Furthermore similarly, when producing HIV vector, HeLa cells were transfected with HIV plasmid vector, pMD.G (VSV-G env expressing plasmid), pMDLg/p.RRE (the third generation packaging plasmid) and pRSV Rev (Rev expressing plasmid) by calcium phosphate method, collected the culture supernatant 48 hours after the transfection, and condensed to use as a virus vector.

Example 2

Results

(Identification of Shugoshin Sgo1 in Fission Yeast)

[0053] The replacement of the mitotic cohesin, Rad21/Scc1, with the meiotic version, Rec8, is a prerequisite for protecting centromeric sister chromatid cohesion through anaphase of meiosis I ((Cell 103, 1155-68 (2000), Mol Cell Biol 23, 3965-73 (2003)). However, when Rec8 was expressed ectopically during mitosis, Rec8 was localized largely at centromeres but disappeared at anaphase, with sister chromatids segregating to opposite sides (FIGS. 1c and d). Moreover, the ectopic expression of non-cleavable Rec8 during mitosis (note that Rec8 is cleaved by separase Cut1 during meiosis (Embo J 22, 5643-53 (2003))) resulted in an inability to separate sister chromatids (see FIG. 2). Thus, in contrast to the situation during meiosis I, centromeric Rec8 is cleaved by separase during mitosis, and results in separation of sister chromatids. The present inventor thus postulated a meiosis I specific centromeric protector of Rec8 from these observations. To identify this factor, the present inventor searched for a gene that generates toxicity during mitotic growth only when co-expressed with Rec8. This screening identified a novel gene, sgo1+ (ORF: SPBP35G2.03C). The hindrance of growth by Sgo1 was significantly dependent on Rec8, as Sgo1 had little effect on growth when co-expressed with Rad21 (FIG. 1a). Co-expression of rec8+ and sgo1+ resulted in high frequency of the blocked nuclear division, as centromere-associated green fluorescent protein markers (cen2-GFP) segregated to the same side of a septated cell highly frequently (see Figs. b and c). To test the possibility that Sgo1 protects Rec8 from degradation at anaphase, the localization of Rec8 was examined in associated with Sgo1 expression, Rec8 tagged with GFP at its carboxyl terminus was expressed under the control of a constitutive adh1 promoter and induced Sgo1 by using a thiamine-repressible nmt1 promoter. Consequently it was found that the Rec8-GFP signal persisted through anaphase only when Sgo1 was co-expressed (FIG. 1d). As Sgo1 is expressed exclusively in meiosis (DNA micro array data (Nat Genet. 32, 143-7 (2002)), see below), it was found from the above-mentioned results, that Sgo1 is a protector of Rec8 during meiosis.

(Sgo1 Protects Centromeric Cohesion at Meiosis I)

[0054] To examine whether Sgo1 is actually required for the protection of Rec8 during meiosis, the entire ORF encoding sgo1+ was deleted, and the phenotype was examined. Sgo1.DELTA. cells are viable and showed normal vegetative growth, consistent with the concept that sgo1+ is a meiosis-specific gene. To examine the meiotic chromosome segregation of sgo1.DELTA. cells, centromere-linked sequences were marked with GFP (cen2-GFP) on only one of the two homologues in a zygote, and the segregation of the GFP dots were monitored during meiosis I. It was revealed that meiosis I emerged normally in sgo1.DELTA. cells, as sister chromatid pairs generally moved together to the same side of each zygote. Therefore, monopolar attachment was intact (FIG. 3a). Moreover, by marking cen2-GFP on both chromosomes, it was determined that accurate segregation was undergone with homologues at meiosis I (data not shown). However, sister chromatid pairs failed to segregate properly at meiosis II, non-segregation was caused in 50% of the cells or less (FIG. 3a). This value is consistent with random chromosome segregation at meiosis II.

[0055] To examine centromeric cohesion, cen2-GFP marked on both homologues was monitored in zygotes arrested prior to meiosis II via a mes1.DELTA. mutation. Supporting the above results, sgo1.DELTA. cells frequently showed precocious division of centromeres as split cen2-GFP signals prevailed in the dyad nuclei (FIG. 3b). Finally, it was examined whether protection of Rec8 at centromeres is dependent on Sgo1 by monitoring Rec8-GFP at late anaphase I and prometaphase II. While it is significant that Rec8 signals were centromeric in wild-type cells, the Rec8 signals had largely disappeared from the centromeres at these stages in sgo1.DELTA. cells (FIG. 3c). Although all phenotypes of sgo1.DELTA. cells are reminiscent of heterochromatin-deficient Schizosaccharomyces pombe, in which Rec8 localization to the pericentromeric regions is decreased and centromeric cohesion is lost during meiosis I, leading to random division at meiosis II (Science 300, 1152-5 (2003)). Chromatin binding by Rec8 was examined in cells arrested prior to meiosis I by using a chromatin immunoprecipitation (ChIP) assay. In marked contrast to heterochromatin-deficient cells, Rec8 localization was intact in sgo1.DELTA. cells at the pericentromeric regions as well as all other regions tested. These results suggest that the loss of centromeric Rec8 after meiosis I is caused not by an initial defect in Rec8 localization to centromeres but rather by a defect in the preservation of centromeric Rec8 during meiosis I. The above results indicated that the Cut1 separase becomes active at the onset of anaphase I and cleaves most chromosomal Rec8, leaving only centromeric Rec8 intact (Embo J 22, 5643-53 (2003)). These results indicated that Sgo1 plays an essential role in protecting centromeric cohesion throughout meiosis I by protecting cohesin Rec8 from separase cleavage.

(Sgo1 Localizes at Centromeres During Meiosis I)

[0056] To detect the Sgo1 protein, Sgo1-specific antibodies were produced, and the results of Western blotting indicated that Sgo1 is expressed only around at meiosis I (FIG. 4a). The results of immunofluorescence microscopy on cells at various stages of meiosis revealed that Sgo1 appears at late prophase of meiosis I and is fully localized as several punctuate dots by the point of metaphase I (FIG. 4b). These dots were co-localized with the Mis6 kinetochore protein (Cell 90, 131-143 (1997)), and indicated that Sgo1 is a centromere-associating protein (FIG. 4c). At the onset of anaphase I, Sgo1 signals decrease dramatically. It was found that Sgo1 remains undegraded at centromeres in APC-depleted cells arrested at metaphase I but undergoes normal degradation in separase-defective cells (FIG. 5), and indicated that Sgo1 degradation at anaphase I is regulated more directly by the APC rather than through separase. Although residual Sgo1 signals were detectable at the centromeres in early anaphase I, they disappeared completely by the end of anaphase I (FIG. 4b). This indicates that a substantial amount of Sgo1 is required at the onset of anaphase I when separase is fully activated. However, it is considered that the amounts of Sgo1 required are smaller and smaller as anaphase I progressed. This idea is tenable when the separase, activity is quickly down-regulated or when the access to chromosomes is prevented during anaphase I. Sgo1 never reappears during meiosis II (FIG. 4b), and which is consistent with the idea that Sgo1 is required for the protection of Red8 only during meiosis I.

[0057] The present inventor has already reported that Rec8 localization at pericentromeric regions is especially important for the persistence of centromeric cohesion throughout meiosis I (Science 300, 1152-5 (2003)). If Sgo1 is a centromeric protector of Rec8, then it might be expected to localize there as well. To test this possibility, Rec8 localization was delineated more precisely by using the ChIP assay. Sgo1 actually associated with pericentrmeric heterochromatin regions rather than with central core regions along the centromere sequences (FIG. 4d). As the results of immunoprecipitation experiments indicated that Sgo1 interacts with Rec8 complexes in vivo (FIG. 4f), the protection was carried out through close interaction. Concurrently, these results indicate that Sgo1 resides at pericentromeric regions and acts to protect centromeric Rec8 from the cleavage of separase at anaphase I (FIG. 4d). It was found that the localization of Rec8 does not depend on Sgo1, and vice versa (FIG. 3d, figure not shown). Actually, the Rec8 and the Sgo1 are in fact independently generated at pericentromeric regions, as for the localization, the Rec8 and the Sgo1 depend on heterochromatin and Bub1 kinase respectively (FIG. 4e). In contrast, Rec8 and Sgo1 are localized at centromeres in swi6.DELTA. (heterochromatin deficient) and bub1.DELTA. cells respectively (FIG. 4e). Thus by localizing independently, it can be ensured that Rec8 is protected only at centromeres not along the chromosomal arm regions.

[0058] Further, it is indicated that shugoshin shields Rec8 physically from the action of separase and counteracts the effects. On this point, even when the strong expression of Sgo1 dose not express Rec8, the mitotic growth was moderately disturbed (figure not shown); and even when the temperature is tolerated for cut1 allele, it was found that cut1 mutant was killed by moderate expression of Sgo1 (FIG. 6).

(Sgo2 is a Mitotic Sgo1 Paralogue in Fission Yeast)

[0059] By a conventional BLAST search of genome databases, the present inventor identified Sgo1-like proteins from Saccharomyces cerevisiae and Neurospora crassa, and indicated that Sgo1 is a conserved protein (see below). In the same search, a Schizosaccharomyces pombe Sgo1 paralogue which the present inventor named Sgo2, was also identified (ORF: SPAC15A10.15). The sgo2+ gene was disrupted, and it was identified that sgo2.DELTA. cells are viable but show sensitivity to the spindle destabilizing drug thiabendazole (TBZ) (FIG. 7a). As sgo1.DELTA. cells never show such a defect, this phenotype is remarkable. To investigate its cellular distribution, the endogenous sgo2+ gene was tagged with GFP. In proliferating cells, Sgo2-GFP was observed as two or three dots in the nucleus (FIG. 7d). However, Sgo2-GFP co-localized with the centromere protein Mis6 at metaphase and disappeared during anaphase (FIGS. 7c and d). The results of ChIP assays showed that Sgo2 chromatin association is detectable only on synchronous populations of mitotic cells, and that chromatin association is localized to the pericentromeric regions (FIG. 7e). By enhancing this localization, sgo2 deletion confers a dramatic defect to chromosome segregation when the heterochromatin-deficient swi6.DELTA. mutation was bound thereto, however which by itself impairs centromeric function slightly (Science 269, 1429-31 (1995)) (FIG. 7b). These results indicate that Sgo2 cooperates with centromeric heterochromatin factors to ensure chromosome segregation at mitosis. Moreover, it was found that sgo2.DELTA. cells have a modest increase (up to 15%) in non-segregation of homologues at meiosis I, and indicated that Sgo2 is also important for promoting proper meiosis I. However, the role of Sgo2 does not overlap with that of Sgo1, as sgo1.DELTA. neither causes an apparent defect at meiosis I (FIG. 3a) nor enhances a defect of sgo2 in meiosis.

(Shugoshin Localization Controlled by Bub1)

[0060] As centromeric Rec8 cannot be detected after meiosis I in fission yeast bub1 mutants, a conserved centromere-associated kinase Bub1 is considered to function in protecting Rec8 during meiosis, (Nat Cell Biol 3, 522-6 (2001)) (FIG. 3c). Although bub1 mutation has pleiotropic effects in meiotic chromosome segregation, it is considered that Sgo1 function can be targeted by Bub1 activity. To elucidate this problem, Sgo1-GFP signals were examined in bub1.DELTA. cells undergoing meiosis. Obviously, Bub1.DELTA. cells were almost completely devoid of accurate centromeric Sgo1-GFP signals, instead showed a diffuse fluorescence in the nucleus (FIG. 4e). Similar results were obtained by using the bub1-K762R point mutation that abolishes the kinase activity (Embo J 22, 1075-87 (2003)). Although substantial levels of Sgo1 protein were detected in meiotic bub1.DELTA. cells by Western blot analysis (figure not shown), Bub1 dose not influence protein stability of Sgo1. Thus, the kinase activity of Bub1 is required for incorporating Sgo1 to centromeres, and the observed defects in centromeric protection in bub1.DELTA. cells can be explained by impaired localization of Sgo1.

[0061] In parallel experiments, it was identified that mitotic Sgo2 localization at centromeres was similarly disturbed in bub1 mutants (FIG. 7c). It has been indicated that loss of Bub1 function causes centromeric function to be weakened (J Cell Biol 143, 1775-87 (1998)). In this regard, the bub1-K762R mutation shows co-lethality with swi6.DELTA., a mutation that also slightly impairs centromeric function via its role in pericentromeric heterochromatin formation. It was found that sgo2.DELTA. similarly shows co-lethality with swi6.DELTA. (FIG. 7b), and exhibits severe miss-segregation of chromosomes at mitosis (figure not shown). As the sgo2.DELTA. bub1.DELTA. double mutant showed no cumulative defects at all in growth or TBZ sensitivity (FIG. 7a), Sgo2 and Bub1 tandem function was confirmed to ensure chromosome segregation in mitosis by these genetic analyses. Taken all together, the above results revealed that the incorporation of Sgo1 and Sgo2 to centromeres is a crucial function of Bub1 kinase in meiosis and mitosis, respectively.

(Characteristics of a Budding Yeast Sgo1 Homologue)

[0062] The present inventor identified a single Sgo1 homologue, ScSgo1 in budding yeast (ORF: YOR073W), which has so far not been analyzed. The cellular localization of ScSgo1 was examined by tagging endogenous ScSGO1 with GFP. ScSgo1-GFP was detected mainly as a single dot in proliferating cells, but only in a limited subset of the population (FIG. 8a). Scsgo1-GFP was not detected during the G1/S period (i.e. in cells with no bud or a small bud) but appeared as a dot in G2/M (cells with a large bud and a single nucleus) and disappeared at anaphase (cells with a large bud and a stretched nucleus) (FIG. 8a). The dot is co-localized with Ndc10 kinetochore protein (FIG. 8b). During meiosis, ScSgo1-GFP was detected at the kinetochore only at metaphase I, but never during anaphase I or meiosis II (FIG. 8c). Thus, the pattern of ScSgo1 localization closely resembles that of SpSgo2 in mitosis and SpSgo1 in meiosis.

[0063] The ScSGO1 gene was disrupted to examine the function of ScSgo1. Although the Scsgo1.DELTA. cells were viable, they grew slowly and showed sensitivity to the spindle destabilizing drug benomyl (FIG. 8d), and indicated that centromeric function might be impaired. And then the chromosome loss rates in Scsgo1.DELTA. cells were compared with those in wild-type cells by a colony sectoring assay. Whereas 40% of the Scsgo1.DELTA. colonies contained red sectors (which indicate chromosome loss), less than 2% wild-type colonies contained such sectors (FIG. 8e). It was concluded that ScSgo1 plays a crucial role at centromeres to ensure mitotic chromosome segregation. At the onset of meiosis, Scsgo1.DELTA. cells showed significant defects that many cells are arrested with a single nucleus in the meiotic condition. However, among the leaked tetranucleate products of meiosis, the distribution pattern of cenV-GFP was consistent with proper segregation at meiosis I with the exception of random segregation at meiosis II (FIG. 8f). It was also found that tagging chromosomal ScSGO1 with 13Myc at its carboxyl terminus, which by itself causes no detectable defects in mitotic growth or meiosis I, resulted in impaired segregation at meiosis II (34% non-segregation indicates 68% random segregation)(FIG. 8g). Moreover, the ScSGO1-Myc cells showed frequent separation of sister centromeres at late meiotic anaphase I (FIG. 8h), indicated that centromeric cohesion was not properly protected. Concurrently, these results support the idea that ScSgo1 plays a crucial role in protecting centromeric cohesion throughout meiosis I, and meiosis II was ensured thereby as is the case with fission yeast Sgo1.

(Conservation of Shugoshin Among Eukaryotes)

[0064] BLAST searches identified only three Sgo1-like proteins, which were all in fungi: Schizosaccharomyces pombe Sgo2, Saccharomyces cerevisiae ScSgo1, and Neurospora crassa B23G1.060. As the two conserved regions were found in these proteins, the related proteins are searched under conditions of two block sequences by the BLOCK MAKER and MAST programs (Nucleic Acids Res 26, 309-12 (1998), Bioinformatics 14, 48-54 (1998)). This approach extracted several candidate proteins from various eukaryotes including fly, worm, plant, mouse and human (see SEQ ID Nos: 21-37; drosophila Dm, Ce, Arabidopsis At, mouse Mm and human Hs, respectively, in FIG. 9). Especially, this list includes Drosophila ME1-S332, which is previously characterized as a protein essential for preserving centromeric cohesion in meiosis (Cell 83, 247-256 (1995)), although the similarity score is marginal (E-value=10). All other proteins in the list show a short stretch of similarity in the carboxyl terminal basic regions, while the primary sequences in the first block are not conserved except that they all contain a putative coiled-coil. The space and sequences between these two blocks diverge among the proteins. As these blocks were previously identified to be important for ME1-S332 function (Genes Dev. 12, 3843-3856 (1998)), the importance of the conserved regions in Sgo1 was investigated. Several amino acids were changed individually to alanines in these similarity blocks and the function of the mutant proteins in vivo was examined (FIG. 10). It was found that three conserved amino acids known to be important for ME1-S332 function were also required for Sgo1 function (13N, 34V and 368S in ME1-S332; 29N, 501 and 294S in Sgo1) (marked as arrowheads in FIG. 9). Further, other conserved amino acids in the second block (293P, 296R, 298K, 299L and 300R in Sgo1) were also all required for Sgo1 function (asterisks in FIG. 9), and non-conserved residue 297T could be changed to alanine without impairing function (circle in FIG. 9). These results indicated that the marginal structural similarity observed among Schizosaccharomyces pombe Sgo1 and other proteins in various eukaryotes is important. Plants and mammals carry two shugoshin-like proteins, suggesting the possibility that the function of shugoshin diverges to complete mitosis and meiosis as in fission yeast.

(Proteins Encoding Human Shugoshin Homologous Gene are Specifically Localized at Centromeres in Mitosis)

[0065] The present inventor previously identified two putative human Sgo proteins, Sgo1 and Sgo2 in the database, although their overall sequence homology to known Sgo proteins in any species other than human is marginal (FIG. 11a). To examine whether these proteins identified in the database are actually human Sgo homologs, the present inventor examined the localization of the proteins. For this end, the present inventor cultured rabbit polyclonal antibodies against recombinant proteins that were produced in bacteria. The obtained Sgo1 antibodies detected an up to 70 kD band (predicted molecular weight is 60 kD) in the HeLa cell extracts, and the signal was significantly reduced when cells were treated with siRNA that targets Sgo1 mRNA (FIG. 11b). Similarly, Sgo2 antibodies detected an up to 120 kD band (predicted molecular weight is 145 kD), the signal was reduced in extracts obtained from cells treated with Sgo2 siRNA (FIG. 11b). These data indicate that both Sgo1 and Sgo2 are expressed at least in proliferating HeLa cells. Next, for the purpose of analyzing proteins (SEQ ID NOs: 18 and 20, respectively hSgo1 and hSgo2) encoding human shugoshin homologous gene (SEQ ID NOs: 17 and 19) that was presumed to be human Sgo homologues, part of hSgo1 and hSgo2 was expressed in E. coli, and antibodies against hSgo1 and hSgo2 were produced by injecting the protein into rabbit, HeLa cells were stained with the antibodies and concurrently with tublin antibodies and DAPI, and co-stained with spindle and chromosome DNA respectively, and the expression of hSgo1 and hSgo2 proteins that were both endogeneous in proliferating cells was examined. The results are shown in FIG. 12. As shown in FIG. 12, both signals of hsgo1 and hSgo2 were also observed as dots on chromosomes from prometaphase to metaphase. As a result of the immunostaining, it was identified that both proteins, hsgo1 and hSgo2 are specifically localized at centromeres at mitotic phase. Further, HeLa cells at prometaphase and metaphase were stained with antibodies against hsgo1 or hSgo2; concurrently co-stained with antibodies against centromere protein CENP-A, and DAPI; and examined the expression of hsgo1 and hSgo2 proteins. The results are shown in FIG. 13. As shown in FIG. 13, both signals of hSgo1 and hSgo2 were observed at sites close to CENP-A dots on chromosomes. As a result of the above, it was revealed that both hsgo1 and hSgo2 are centromere proteins. Further, to examine this possibility, Aurora B, which is a passenger protein of chromosome known to be localized within kinetochore from prophase to metaphase, was stained. The sites of Sgo1 and Aurora B were practically the same at prometaphase and metaphase, whereas Sgo2 was placed just outside Aurora B (see FIG. 13). As a result of the above, it was revealed that both hsgo1 and hSgo2 are placed within kinetochores from prometaphase to metaphase. Representative views of sister kinetochore are magnified on the right. Scale bar is 10 .mu.m.

(Proteins Encoding Human Shugoshin Homologous Gene are Specifically Localized at Centromeres in Mitosis and Play an Important Role to Progress Chromosome Segregation)

[0066] RNAi experiments targeting hsgo1 and hSgo2 were performed respectively. The results are shown in FIG. 14. As a result, the expressions in any proteins were significantly suppressed 48 hours later, the cells arrested in mitosis (total, in figure) were accumulated as indicated in FIG. 14. As described above, it was strongly suggested that any protein localized at centromeres in mitosis plays an important role for progressing chromosome segregation. As the accumulation was dissolved by suppressing a spindle checkpoint factor BubR1 by RNAi, it was suggested that hsgo1 and hSgo2 are directly or indirectly function during the process where spindle properly takes the kinetochore at centromeres as described below.

[0067] Further, the cells for which RNAi experiments targeting hsgo1 was performed by using HeLa cells were mounted on a slide glass and stained with Giemsa. The results are shown in FIG. 15. It was revealed that sister chromatid at prophase strongly adhered at centromere site in control cells where RNAi was not performed; while in cells suppressing hsgo1 expression, where RNAi was performed, the adhesion was weak at centromere site, and easily detached. Consequently, it was demonstrated that hsgo1 has an important role to maintain the strong cohesion at centromere site in mitosis in proliferating cells. Mitotic cells where Sgo1 protein knockdown was performed by RNAi experiments were collected, and the chromosomes were spread to observe chromosome structure directly. In control cells, sister chromatids were resolved along the arm regions but showed the primary constriction at centromeres (FIG. 16a i). Amazingly, in Sgo1-depleted cells, sister chromatids were often separated along the whole chromosome length (FIG. 16a iii). In samples where sister chromatids stayed densely close, although sister chromatids did not indicate the primary constriction (FIG. 16a iv), this suggests that centromeric cohesion was lost selectively. Nocodazole treatment activates the spindle checkpoint; thereby the cell cycle is arrested at prometaphase. Such prolonged arrest in M phase causes the complete separation of the connectivity from the chromosomal arm regions. For this reason, sister chromatids are only connected at centromeres, and form `Xshaped` chromosome (FIG. 16b, control). As expected, nocodazole-treatment caused the complete separation of sister chromatids along the chromosome length in Sgo1 RNAi cells (up to 97%) (FIGS. 16c and d). Consequently, it was demonstrated that hSgo1 plays an important role to maintain the strong cohesion at chromosomal centromere site in mitosis in proliferating cells.

[0068] RNAi experiments targeting Bub1 were performed respectively. The results are shown in FIG. 17. Consequently, the localization of either protein of the hsgo1 and hSgo2 to centromere was disappeared. This result means that the conclusion, "localization of shugoshin to centromere depends on Bub1 kinase", which was found in yeast by the present inventor, is also conserved in higher organisms.

[0069] Next, clone where cDNA of mouse shugoshin homologous genes (SEQ ID NOs: 21 and 23) was fused with GFP gene was produced by using retroviral vector and expressed in human HeLa cells. The results are shown in FIG. 18. Consequently, it was revealed that any of the GFP fusion proteins are also co-localized with human kinetochore protein Bub1 in mitosis.

[0070] The analysis of the above hsgo1 and hSgo2 and the analysis results obtained with the use of mouse shugoshin homologous genes were strongly suggested that shugoshin-like protein in animal cells, which were predicted from the sequence, also have functional conservation with yeast shugoshin.

INDUSTRIAL APPLICABILITY

[0071] Shugoshin of the present invention that is a regulatory factor of chromosome segregation widely conserved in eukaryotic cells, can be advantageously used for studies on the induction mechanism of cancer in somatic division, the chromosome segregation diseases such as infertility or Down's syndrome in meiotic division, and the like besides on the elucidation of mechanism in chromosome segregation.

Sequence CWU 1

1

451960DNAyeast 1atgaactttc aatttataaa ttcaaatata aacaatgaag ataaattgcc gatggagtcg 60ttgaaaaaga aatttttaaa acaaaatcgt gaaattataa aaataaatac tcagctttct 120ataaaaatta gagaatctga aaacgaaatt caagatttga tacaagaaaa tttcactttg 180aaaagttatt tggttaaact tgaagctcga tttcgcaatc aatctcaaac tgaggacttg 240ttaaaaaact tctttcctga gatacaaacc attcacaaaa agatttcaca agtgcaaagt 300ttactgaaga ttatagagaa aaagtgttca tcagatttcc tcgaagcgaa tgtaaaaagt 360caatttacaa cctgtgaaaa taaagattcg aaagaagatt atcagatttt gcataataaa 420cgcttggagt atgtatcatt taatgatgaa cttaaaagtc tcgaaacagg gcaaccattg 480tattgttttc aagatttcca aaaaaaagtc catggtcctc cggctctatc tgaaaaacct 540ggaaaatgta tattaaaaga taaaaccaat gcccacgtaa acaaaatacc acaagatgag 600gtgaattact cattgccgca aaaaaatatc accatctttt caaaggaatt aaaagaaaac 660gaatttgaat ccatcaacga gggcgaaact gaagaagaaa aggctaaaac atcaaatgtt 720tgtgtttgta ttccttgtaa aagtgctgaa cagataactg accttaaagg acaagcaacc 780ggagacagct ccccatgtga ttttgaagaa tctcaaccaa ggattaatgg acgtgaaaaa 840ctaagacgat cagtcaaagt gataaactat gcaataccca gtttgcgaac taaactacga 900cgagactttg acttaccatc tgatagaaaa cgcaaacgac atcccagagg caaagcataa 9602319PRTyeast 2Met Asn Phe Gln Phe Ile Asn Ser Asn Ile Asn Asn Glu Asp Lys Leu1 5 10 15Pro Met Glu Ser Leu Lys Lys Lys Phe Leu Lys Gln Asn Arg Glu Ile 20 25 30Ile Lys Ile Asn Thr Gln Leu Ser Ile Lys Ile Arg Glu Ser Glu Asn 35 40 45Glu Ile Gln Asp Leu Ile Gln Glu Asn Phe Thr Leu Lys Ser Tyr Leu 50 55 60Val Lys Leu Glu Ala Arg Phe Arg Asn Gln Ser Gln Thr Glu Asp Leu65 70 75 80Leu Lys Asn Phe Phe Pro Glu Ile Gln Thr Ile His Lys Lys Ile Ser 85 90 95Gln Val Gln Ser Leu Leu Lys Ile Ile Glu Lys Lys Cys Ser Ser Asp 100 105 110Phe Leu Glu Ala Asn Val Lys Ser Gln Phe Thr Thr Cys Glu Asn Lys 115 120 125Asp Ser Lys Glu Asp Tyr Gln Ile Leu His Asn Lys Arg Leu Glu Tyr 130 135 140Val Ser Phe Asn Asp Glu Leu Lys Ser Leu Glu Thr Gly Gln Pro Leu145 150 155 160Tyr Cys Phe Gln Asp Phe Gln Lys Lys Val His Gly Pro Pro Ala Leu 165 170 175Ser Glu Lys Pro Gly Lys Cys Ile Leu Lys Asp Lys Thr Asn Ala His 180 185 190Val Asn Lys Ile Pro Gln Asp Glu Val Asn Tyr Ser Leu Pro Gln Lys 195 200 205Asn Ile Thr Ile Phe Ser Lys Glu Leu Lys Glu Asn Glu Phe Glu Ser 210 215 220Ile Asn Glu Gly Glu Thr Glu Glu Glu Lys Ala Lys Thr Ser Asn Val225 230 235 240Cys Val Cys Ile Pro Cys Lys Ser Ala Glu Gln Ile Thr Asp Leu Lys 245 250 255Gly Gln Ala Thr Gly Asp Ser Ser Pro Cys Asp Phe Glu Glu Ser Gln 260 265 270Pro Arg Ile Asn Gly Arg Glu Lys Leu Arg Arg Ser Val Lys Val Ile 275 280 285Asn Tyr Ala Ile Pro Ser Leu Arg Thr Lys Leu Arg Arg Asp Phe Asp 290 295 300Leu Pro Ser Asp Arg Lys Arg Lys Arg His Pro Arg Gly Lys Ala305 310 31531944DNAyeast 3atgtcgaaag catctctttc cccgaacgta gaagacttga aaaaaaagca aattcgacag 60tataaggaaa ttatacgaat aagcaaggca caatcaatta gaattaaaga attgcagtta 120gaaaatgaac ggttgctttc ggaaaatatc gatttgagga ctacagcgat aaacttggaa 180gagcaactcg aaaccgtgca aaacgaaaac gaagaaaaca aaacaaagtt agctgcatta 240cttaatcgat ttcatgaaga aacagataat tttttatcaa aattaagtct ttgtcagcaa 300gaaatacaag acaccttcaa accagtggag gctaacttag cttacgatgt cgatacggat 360tctgaagacc ttgacgagga atccgtcgtg aaagataccg aagaaataat tgagcaagct 420cagcatgatg tttccttacg aaatttaagt ggaatagagg atgaaaatat aattgatgac 480ggagaaactg ctataaatga acaaaaaaaa agagaagcta atgttttttc cgacacgcaa 540tcagcacctc agctaaaatc cggcaaagcc ctcccagctg attttgaaaa tccttacaat 600ctatccaatt cgaaacctgt aaataataat aatgaagata gagttgaagc ggttacttct 660gaaaataaat ctatcgattc tgctcctcag gaaaaaaatc atgaatacga aatcgttagt 720ccaaaatcat tatccaacaa aattaataat caagcagctg cacaaagaag aaccgaagaa 780gataatgcaa atggagttgc tcaagaagaa aatgagggtt cacaagaagc tcattttcat 840agcagaatac aatctgatac agtaatacaa agtacaccca ctaaacggaa atgggacgtt 900gacattcaaa ataaacaaat taatctggct tctgcagcta ccaatgttac cggttatgta 960tcggagaccg atagtcgccc caatcgcgca aactctttgg attctgctgt ccttcttgtg 1020caatcttcaa ataaaagtaa ccgaaatggg catcatattt cagatcctaa tttaaatagc 1080tccatatcgt tgaagtttgc gcctgaagat actgcgcata attcattaac ttcacaagag 1140aatgttgggc ctcaggttac gacgacttct ctgtcaaata tgactgttgc tgaatctcct 1200cgtacagaca ctccaaggga aataaacggg ttagtagact cttctgtcac taatgggaac 1260gaaaaatttt ctgtagaaat aatgaatgac tctaacaaaa ttggactgaa tcctaaatct 1320tttaccgacg aagagcggga aattttaaca ctttttcgaa atcctcccat gagactgtca 1380agtgaacctc catcttcaaa tggattttca atagcccatc ccaataattc tccgttacgt 1440ccgccatcgc tacaaggaat attgaatgct gaagatcgac cttacgaaat tgagccgtca 1500cgtagctcct ttgctaccaa cgatacgggc tcctataata atttggaact tctgtcatct 1560gtaacgaatt tgaaatcccc taatgagaac gatcgtgtga cgaaaactca gtcgcgaaga 1620gaaacaaaag tgaaaaggcg aagaaaagct cggattcaag aaacttctga agaaagtaca 1680gtagtcaatg agccaaatga aaaacctgat ggaaggagcc gaagggaacg gaaaaaggtt 1740aattacgctt tgcctggatt aaggacgaaa ttaagacgga atttcgattt accttcagat 1800catgtaaaag ctaaaaaaac gagacgtgct cctaagaact ctgagaatga ttcagctacc 1860aaaacagaaa ccgcaaacat tacttctgaa gcacccacta cttcagaagt aacccttgaa 1920aactccgaaa cccttaattt gtaa 19444647PRTyeast 4Met Ser Lys Ala Ser Leu Ser Pro Asn Val Glu Asp Leu Lys Lys Lys1 5 10 15Gln Ile Arg Gln Tyr Lys Glu Ile Ile Arg Ile Ser Lys Ala Gln Ser 20 25 30Ile Arg Ile Lys Glu Leu Gln Leu Glu Asn Glu Arg Leu Leu Ser Glu 35 40 45Asn Ile Asp Leu Arg Thr Thr Ala Ile Asn Leu Glu Glu Gln Leu Glu 50 55 60Thr Val Gln Asn Glu Asn Glu Glu Asn Lys Thr Lys Leu Ala Ala Leu65 70 75 80Leu Asn Arg Phe His Glu Glu Thr Asp Asn Phe Leu Ser Lys Leu Ser 85 90 95Leu Cys Gln Gln Glu Ile Gln Asp Thr Phe Lys Pro Val Glu Ala Asn 100 105 110Leu Ala Tyr Asp Val Asp Thr Asp Ser Glu Asp Leu Asp Glu Glu Ser 115 120 125Val Val Lys Asp Thr Glu Glu Ile Ile Glu Gln Ala Gln His Asp Val 130 135 140Ser Leu Arg Asn Leu Ser Gly Ile Glu Asp Glu Asn Ile Ile Asp Asp145 150 155 160Gly Glu Thr Ala Ile Asn Glu Gln Lys Lys Arg Glu Ala Asn Val Phe 165 170 175Ser Asp Thr Gln Ser Ala Pro Gln Leu Lys Ser Gly Lys Ala Leu Pro 180 185 190Ala Asp Phe Glu Asn Pro Tyr Asn Leu Ser Asn Ser Lys Pro Val Asn 195 200 205Asn Asn Asn Glu Asp Arg Val Glu Ala Val Thr Ser Glu Asn Lys Ser 210 215 220Ile Asp Ser Ala Pro Gln Glu Lys Asn His Glu Tyr Glu Ile Val Ser225 230 235 240Pro Lys Ser Leu Ser Asn Lys Ile Asn Asn Gln Ala Ala Ala Gln Arg 245 250 255Arg Thr Glu Glu Asp Asn Ala Asn Gly Val Ala Gln Glu Glu Asn Glu 260 265 270Gly Ser Gln Glu Ala His Phe His Ser Arg Ile Gln Ser Asp Thr Val 275 280 285Ile Gln Ser Thr Pro Thr Lys Arg Lys Trp Asp Val Asp Ile Gln Asn 290 295 300Lys Gln Ile Asn Leu Ala Ser Ala Ala Thr Asn Val Thr Gly Tyr Val305 310 315 320Ser Glu Thr Asp Ser Arg Pro Asn Arg Ala Asn Ser Leu Asp Ser Ala 325 330 335Val Leu Leu Val Gln Ser Ser Asn Lys Ser Asn Arg Asn Gly His His 340 345 350Ile Ser Asp Pro Asn Leu Asn Ser Ser Ile Ser Leu Lys Phe Ala Pro 355 360 365Glu Asp Thr Ala His Asn Ser Leu Thr Ser Gln Glu Asn Val Gly Pro 370 375 380Gln Val Thr Thr Thr Ser Leu Ser Asn Met Thr Val Ala Glu Ser Pro385 390 395 400Arg Thr Asp Thr Pro Arg Glu Ile Asn Gly Leu Val Asp Ser Ser Val 405 410 415Thr Asn Gly Asn Glu Lys Phe Ser Val Glu Ile Met Asn Asp Ser Asn 420 425 430Lys Ile Gly Leu Asn Pro Lys Ser Phe Thr Asp Glu Glu Arg Glu Ile 435 440 445Leu Thr Leu Phe Arg Asn Pro Pro Met Arg Leu Ser Ser Glu Pro Pro 450 455 460Ser Ser Asn Gly Phe Ser Ile Ala His Pro Asn Asn Ser Pro Leu Arg465 470 475 480Pro Pro Ser Leu Gln Gly Ile Leu Asn Ala Glu Asp Arg Pro Tyr Glu 485 490 495Ile Glu Pro Ser Arg Ser Ser Phe Ala Thr Asn Asp Thr Gly Ser Tyr 500 505 510Asn Asn Leu Glu Leu Leu Ser Ser Val Thr Asn Leu Lys Ser Pro Asn 515 520 525Glu Asn Asp Arg Val Thr Lys Thr Gln Ser Arg Arg Glu Thr Lys Val 530 535 540Lys Arg Arg Arg Lys Ala Arg Ile Gln Glu Thr Ser Glu Glu Ser Thr545 550 555 560Val Val Asn Glu Pro Asn Glu Lys Pro Asp Gly Arg Ser Arg Arg Glu 565 570 575Arg Lys Lys Val Asn Tyr Ala Leu Pro Gly Leu Arg Thr Lys Leu Arg 580 585 590Arg Asn Phe Asp Leu Pro Ser Asp His Val Lys Ala Lys Lys Thr Arg 595 600 605Arg Ala Pro Lys Asn Ser Glu Asn Asp Ser Ala Thr Lys Thr Glu Thr 610 615 620Ala Asn Ile Thr Ser Glu Ala Pro Thr Thr Ser Glu Val Thr Leu Glu625 630 635 640Asn Ser Glu Thr Leu Asn Leu 64551773DNAyeast 5atgccgaaga gaaaaattgc tcctaacaag gaaagcagca ggcgtacggt ctcccacgat 60gatttaaccc cacaaataca agaatttcaa aacctaatgg atctcgaatc gcaaaaagtg 120gaaaacatca gacagtcgta ttcgaggcaa aactccctgc tggccaagga taactccata 180ttaaaaatta aagttaatag cttggaaaaa aaaataagcc agctggtaca agaaaacgtg 240actctacgat ctaaaacctc tataagcgaa gctatctaca gggaacggtt aagtaatcaa 300ctacaagtca ttgaaaacgg tattattcaa agatttgacg aaatttttta tatgtttgag 360aacgtacgta aaaacgaaaa tttgcccagt tcgagcttaa gaacaatgtt gaagagaacg 420agttccaggt caagatcatg ctcattgtca tcacccacat actcaaaaag ttacactagg 480ttatcaaatc acgagaataa cctgtcgcat gaatcaagtt ttaacaagga cgatggtcca 540gatcttgagc ctaaggctaa aaaaaggaag agttctaggc ggcaatctat gtttgtatcc 600acgagtttag aacctgaaga cgaaaccggt gaaaacgaac ccatgatgga aaattcctct 660gtagaggtac cggcagaatc acacgagtct gcgcaagtgg aggaaacaat agatgcctta 720aaccctgaag aggaaaatag cgattctgtc agtaatttta ccaattcaat tatagaatac 780tccataccag aggagaatcc gacagaaccc gagcattcat cttctaaact agaaatattc 840aatgacagta caaatatgct aagtacagtg ccgtcaaatc ctttgccgtt gcctttacca 900ggcccatccg caactttacc tactaccact agcgatgctt caacggtcta tccttcatca 960agttcttcta ctaattctca tccaaagacc aaaattaagc attccatgaa gccgcctagg 1020atagaactga agaaaaaggt tattgacgaa gtcatgcccg taagtaacat gagcagcaac 1080agcgaaatat catttacgag aactagaaga actcgtggta aagctgtaga ttacactttg 1140ccttctttaa gagccaaaat gaggaggcct tcagaaaaac ttgtggatgc tactactgtg 1200attgatatac atgatctaca ggtttccaag agaaatcggg aaacttcaca taaaaggaaa 1260agtttatccc aagattcaat acccgacgaa ccgcaattga gagaagtcgt cgtctcaaag 1320gattatggaa ctccaaaagg gaaaaaaacg gaagatgaaa tacacgagga taccgctcat 1380ctaatgacca cttccaacaa caacagcaac aacaaaaacg aaaaaaaact aactagcaac 1440aatagcccta aaaaatcgtc gcctttactt gacattacaa ataaatcgga gaataagaaa 1500aagtcaacaa gaactaaaaa attgttcaaa aatgcaattg tcaataattt atctgatgaa 1560aattctacta cgcgaccctc caagtcgtca aagggaacca gtaataataa caacaattac 1620aacaatttcg acaataacaa ttcaaacatt aataatgtta ataataaatc tgttagcttt 1680agactaaatg aagatgattt agcagtattt gatttatttg gaaatggtaa ggcagtgaaa 1740catcaaccaa aaacatatcg caccaaaaaa tga 17736590PRTyeast 6Met Pro Lys Arg Lys Ile Ala Pro Asn Lys Glu Ser Ser Arg Arg Thr1 5 10 15Val Ser His Asp Asp Leu Thr Pro Gln Ile Gln Glu Phe Gln Asn Leu 20 25 30Met Asp Leu Glu Ser Gln Lys Val Glu Asn Ile Arg Gln Ser Tyr Ser 35 40 45Arg Gln Asn Ser Leu Leu Ala Lys Asp Asn Ser Ile Leu Lys Ile Lys 50 55 60Val Asn Ser Leu Glu Lys Lys Ile Ser Gln Leu Val Gln Glu Asn Val65 70 75 80Thr Leu Arg Ser Lys Thr Ser Ile Ser Glu Ala Ile Tyr Arg Glu Arg 85 90 95Leu Ser Asn Gln Leu Gln Val Ile Glu Asn Gly Ile Ile Gln Arg Phe 100 105 110Asp Glu Ile Phe Tyr Met Phe Glu Asn Val Arg Lys Asn Glu Asn Leu 115 120 125Pro Ser Ser Ser Leu Arg Thr Met Leu Lys Arg Thr Ser Ser Arg Ser 130 135 140Arg Ser Cys Ser Leu Ser Ser Pro Thr Tyr Ser Lys Ser Tyr Thr Arg145 150 155 160Leu Ser Asn His Glu Asn Asn Leu Ser His Glu Ser Ser Phe Asn Lys 165 170 175Asp Asp Gly Pro Asp Leu Glu Pro Lys Ala Lys Lys Arg Lys Ser Ser 180 185 190Arg Arg Gln Ser Met Phe Val Ser Thr Ser Leu Glu Pro Glu Asp Glu 195 200 205Thr Gly Glu Asn Glu Pro Met Met Glu Asn Ser Ser Val Glu Val Pro 210 215 220Ala Glu Ser His Glu Ser Ala Gln Val Glu Glu Thr Ile Asp Ala Leu225 230 235 240Asn Pro Glu Glu Glu Asn Ser Asp Ser Val Ser Asn Phe Thr Asn Ser 245 250 255Ile Ile Glu Tyr Ser Ile Pro Glu Glu Asn Pro Thr Glu Pro Glu His 260 265 270Ser Ser Ser Lys Leu Glu Ile Phe Asn Asp Ser Thr Asn Met Leu Ser 275 280 285Thr Val Pro Ser Asn Pro Leu Pro Leu Pro Leu Pro Gly Pro Ser Ala 290 295 300Thr Leu Pro Thr Thr Thr Ser Asp Ala Ser Thr Val Tyr Pro Ser Ser305 310 315 320Ser Ser Ser Thr Asn Ser His Pro Lys Thr Lys Ile Lys His Ser Met 325 330 335Lys Pro Pro Arg Ile Glu Leu Lys Lys Lys Val Ile Asp Glu Val Met 340 345 350Pro Val Ser Asn Met Ser Ser Asn Ser Glu Ile Ser Phe Thr Arg Thr 355 360 365Arg Arg Thr Arg Gly Lys Ala Val Asp Tyr Thr Leu Pro Ser Leu Arg 370 375 380Ala Lys Met Arg Arg Pro Ser Glu Lys Leu Val Asp Ala Thr Thr Val385 390 395 400Ile Asp Ile His Asp Leu Gln Val Ser Lys Arg Asn Arg Glu Thr Ser 405 410 415His Lys Arg Lys Ser Leu Ser Gln Asp Ser Ile Pro Asp Glu Pro Gln 420 425 430Leu Arg Glu Val Val Val Ser Lys Asp Tyr Gly Thr Pro Lys Gly Lys 435 440 445Lys Thr Glu Asp Glu Ile His Glu Asp Thr Ala His Leu Met Thr Thr 450 455 460Ser Asn Asn Asn Ser Asn Asn Lys Asn Glu Lys Lys Leu Thr Ser Asn465 470 475 480Asn Ser Pro Lys Lys Ser Ser Pro Leu Leu Asp Ile Thr Asn Lys Ser 485 490 495Glu Asn Lys Lys Lys Ser Thr Arg Thr Lys Lys Leu Phe Lys Asn Ala 500 505 510Ile Val Asn Asn Leu Ser Asp Glu Asn Ser Thr Thr Arg Pro Ser Lys 515 520 525Ser Ser Lys Gly Thr Ser Asn Asn Asn Asn Asn Tyr Asn Asn Phe Asp 530 535 540Asn Asn Asn Ser Asn Ile Asn Asn Val Asn Asn Lys Ser Val Ser Phe545 550 555 560Arg Leu Asn Glu Asp Asp Leu Ala Val Phe Asp Leu Phe Gly Asn Gly 565 570 575Lys Ala Val Lys His Gln Pro Lys Thr Tyr Arg Thr Lys Lys 580 585 59072325DNANeurospora crassa 7atggcccgcc tcaacgaaca agccatgtcg tctgtcgcgt tgtcaacaga caatctcgag 60ctcctgcgta ggaagttcct cagacaaaac agagatattg ctcgagtcaa ttccacacag 120tcactccgta tccgtgggtt ggagaatgaa tgcgctcgtt tgctgtcgga aaacctcgaa 180ctccgtggtc aggtcttgcg cctcgaaaag gagctccaag acaacgctgc gcgaagggtg 240gccgatcatg cgctcgaggt caaggccaag atggagacgc agttggcgga actcagttcg 300ctgctggcaa gcttagggga gccgccctcg aagcggcgcc tttcagaaga gaggcgatac 360gcgcagcctc gaccgagcgt tcaccggagc cctcccttac gaagagcacg ccaggaggcc 420gaccaggaac tactggctga gcaggaagga aggctaccgc cgatatacga gaacaagacg 480tatgcgcgag ccacaatgaa cagtgaagaa atcctggcgc tgtgcatgca ggcagacgat 540tcgaatgact cgccagatat cggaccgccg ccagtatcta ggtttgtcga ggatgatatg 600gtcatacctt gttcaccatc gccaaacaag aacgccgagg ctgaagaaac ggaaactacc 660gagcaagtgg aagagagccc tagggctctt caagtaccgc cgtcattatc gccgcctaaa 720ctggactacg acaggagacc aaacatgatc ctattcagcc

cacccaaaga atcgagagtg 780gcagaaccct ccaaaatgtt cagtccccct ccgatggaac caccgaaaca gtccacatcg 840gctgtaccga gtgagacaat acgagcaggc ctcaagcgaa agttgaacgg cgacaaccaa 900aacgaaccca acaaggcaac caagcttcaa caaggaaagg agaatggcaa tgagactggg 960atcaagaaag gactctctgc ccgcgacccg cacaagagga aaagcatcaa agagaccgca 1020acgaaaccga gagccccgct gtcagcaaag agcacgaacg agcacattgt ctctccgaag 1080aagccggcga agccccacca agtggccgac gattttaagc cggtgaaggt gcacaaggcg 1140tcaaagggta aagagaaagt cgacctgccc gctccggaca agaagtcagc agtagaagaa 1200acgcaaggaa attctacgtc ggcattcacg aaagtcgaga tcctcccgcc ggctctggaa 1260cctactcctg aagttgcaga gattcctgaa accgatattc tgatcacacc tggaacacca 1320gagcgcgcct ctgaaagcac tgttgtgacc cacgataccc cgccgccagc ccacatttca 1380tccaatggag agacgtcgcg gcctagcagg cgtgctagag cggctatcag ctatacagag 1440cccaatctgc gcgacaagat gcgacgaccg accaaagagc tctttgatgc cgtttctggg 1500gagggcaagt tcctacacag gccgacatcg caacagcaac agcagcaacg caagggcgac 1560gagtcagcac cgacgtcagt tagcaaggtc aaggtcgagc catcgccggc ggtggatata 1620agtagtctga ccagcagtgc gctgtttgaa aaagagaagg agaaggaacc acagccggat 1680gaaggaatat tatctccaaa cggcatcctc ccaagctcag tagacctggg aaggagaaga 1740cgcgcctcat ccttctctac tgcagcccct gcaatgacaa ttccttcggt ccaagaacaa 1800tcaactctaa acctcccagc cgcggacgag accgatgaaa acgccgcggt cgaggctcag 1860attcagaagg agctgagtaa tagtattaca acacggccca ggggtggaaa ggggaggcaa 1920tcaatgagcc gttccgtacc cacgatccca acagaaaatt acgagcacga ggacgcacaa 1980ctctcgacga actcagcctc ggtggatctt tacgactttg ctagttgtgc gtctccggat 2040agcgcagcac cccagctaga agcgactacc ggcgatgttc ctgttaataa gaaggcaccc 2100aaaggttcaa gaagagcgtc ctcagctgct tcgaccgaga caacagcaac agcatccgca 2160aagccaagat cttcccgaaa aagggcttcg atgctggtgc cgaagaaaag cttgtgggct 2220gaagagttag cgcaggagga agaggatgag gaagatgtcg gcaatgacag tggcgggtcc 2280ttgtccaagg ggagggcctc gaggaggaga agcatgatgc tttga 23258774PRTNeurospora crassa 8Met Ala Arg Leu Asn Glu Gln Ala Met Ser Ser Val Ala Leu Ser Thr1 5 10 15Asp Asn Leu Glu Leu Leu Arg Arg Lys Phe Leu Arg Gln Asn Arg Asp 20 25 30Ile Ala Arg Val Asn Ser Thr Gln Ser Leu Arg Ile Arg Gly Leu Glu 35 40 45Asn Glu Cys Ala Arg Leu Leu Ser Glu Asn Leu Glu Leu Arg Gly Gln 50 55 60Val Leu Arg Leu Glu Lys Glu Leu Gln Asp Asn Ala Ala Arg Arg Val65 70 75 80Ala Asp His Ala Leu Glu Val Lys Ala Lys Met Glu Thr Gln Leu Ala 85 90 95Glu Leu Ser Ser Leu Leu Ala Ser Leu Gly Glu Pro Pro Ser Lys Arg 100 105 110Arg Leu Ser Glu Glu Arg Arg Tyr Ala Gln Pro Arg Pro Ser Val His 115 120 125Arg Ser Pro Pro Leu Arg Arg Ala Arg Gln Glu Ala Asp Gln Glu Leu 130 135 140Leu Ala Glu Gln Glu Gly Arg Leu Pro Pro Ile Tyr Glu Asn Lys Thr145 150 155 160Tyr Ala Arg Ala Thr Met Asn Ser Glu Glu Ile Leu Ala Leu Cys Met 165 170 175Gln Ala Asp Asp Ser Asn Asp Ser Pro Asp Ile Gly Pro Pro Pro Val 180 185 190Ser Arg Phe Val Glu Asp Asp Met Val Ile Pro Cys Ser Pro Ser Pro 195 200 205Asn Lys Asn Ala Glu Ala Glu Glu Thr Glu Thr Thr Glu Gln Val Glu 210 215 220Glu Ser Pro Arg Ala Leu Gln Val Pro Pro Ser Leu Ser Pro Pro Lys225 230 235 240Leu Asp Tyr Asp Arg Arg Pro Asn Met Ile Leu Phe Ser Pro Pro Lys 245 250 255Glu Ser Arg Val Ala Glu Pro Ser Lys Met Phe Ser Pro Pro Pro Met 260 265 270Glu Pro Pro Lys Gln Ser Thr Ser Ala Val Pro Ser Glu Thr Ile Arg 275 280 285Ala Gly Leu Lys Arg Lys Leu Asn Gly Asp Asn Gln Asn Glu Pro Asn 290 295 300Lys Ala Thr Lys Leu Gln Gln Gly Lys Glu Asn Gly Asn Glu Thr Gly305 310 315 320Ile Lys Lys Gly Leu Ser Ala Arg Asp Pro His Lys Arg Lys Ser Ile 325 330 335Lys Glu Thr Ala Thr Lys Pro Arg Ala Pro Leu Ser Ala Lys Ser Thr 340 345 350Asn Glu His Ile Val Ser Pro Lys Lys Pro Ala Lys Pro His Gln Val 355 360 365Ala Asp Asp Phe Lys Pro Val Lys Val His Lys Ala Ser Lys Gly Lys 370 375 380Glu Lys Val Asp Leu Pro Ala Pro Asp Lys Lys Ser Ala Val Glu Glu385 390 395 400Thr Gln Gly Asn Ser Thr Ser Ala Phe Thr Lys Val Glu Ile Leu Pro 405 410 415Pro Ala Leu Glu Pro Thr Pro Glu Val Ala Glu Ile Pro Glu Thr Asp 420 425 430Ile Leu Ile Thr Pro Gly Thr Pro Glu Arg Ala Ser Glu Ser Thr Val 435 440 445Val Thr His Asp Thr Pro Pro Pro Ala His Ile Ser Ser Asn Gly Glu 450 455 460Thr Ser Arg Pro Ser Arg Arg Ala Arg Ala Ala Ile Ser Tyr Thr Glu465 470 475 480Pro Asn Leu Arg Asp Lys Met Arg Arg Pro Thr Lys Glu Leu Phe Asp 485 490 495Ala Val Ser Gly Glu Gly Lys Phe Leu His Arg Pro Thr Ser Gln Gln 500 505 510Gln Gln Gln Gln Arg Lys Gly Asp Glu Ser Ala Pro Thr Ser Val Ser 515 520 525Lys Val Lys Val Glu Pro Ser Pro Ala Val Asp Ile Ser Ser Leu Thr 530 535 540Ser Ser Ala Leu Phe Glu Lys Glu Lys Glu Lys Glu Pro Gln Pro Asp545 550 555 560Glu Gly Ile Leu Ser Pro Asn Gly Ile Leu Pro Ser Ser Val Asp Leu 565 570 575Gly Arg Arg Arg Arg Ala Ser Ser Phe Ser Thr Ala Ala Pro Ala Met 580 585 590Thr Ile Pro Ser Val Gln Glu Gln Ser Thr Leu Asn Leu Pro Ala Ala 595 600 605Asp Glu Thr Asp Glu Asn Ala Ala Val Glu Ala Gln Ile Gln Lys Glu 610 615 620Leu Ser Asn Ser Ile Thr Thr Arg Pro Arg Gly Gly Lys Gly Arg Gln625 630 635 640Ser Met Ser Arg Ser Val Pro Thr Ile Pro Thr Glu Asn Tyr Glu His 645 650 655Glu Asp Ala Gln Leu Ser Thr Asn Ser Ala Ser Val Asp Leu Tyr Asp 660 665 670Phe Ala Ser Cys Ala Ser Pro Asp Ser Ala Ala Pro Gln Leu Glu Ala 675 680 685Thr Thr Gly Asp Val Pro Val Asn Lys Lys Ala Pro Lys Gly Ser Arg 690 695 700Arg Ala Ser Ser Ala Ala Ser Thr Glu Thr Thr Ala Thr Ala Ser Ala705 710 715 720Lys Pro Arg Ser Ser Arg Lys Arg Ala Ser Met Leu Val Pro Lys Lys 725 730 735Ser Leu Trp Ala Glu Glu Leu Ala Gln Glu Glu Glu Asp Glu Glu Asp 740 745 750Val Gly Asn Asp Ser Gly Gly Ser Leu Ser Lys Gly Arg Ala Ser Arg 755 760 765Arg Arg Ser Met Met Leu 77091671DNAArabidopsis thaliana 9atggttcgag cgacggttct gaatgtcggt gatcacgcca gtgaaggtgt gcgtactaac 60aaagctaaag gagagaaaat ggttctggaa cctccgatga acagtgcaca aagacgaaag 120ttgggggata ttactaattt gcagaatcag aagaatctaa tgaatcaggg agcgaagcat 180cagcaacaag ctatattaat ctcttctaaa gaaaacgctg aaaatcttca aaaggcactg 240agaaattctt ctgaaaacac aaagctgatg aaagtcgtca tggagagaga tggaatcaaa 300agtgatctga agaaacttag gattgaattt cagaaggttc aagaacagaa tttgctactt 360gcccaggcta acactcgtat cttggcgctg aaggtacttc agcacgaact tggttgcaag 420aatgggttag tcatggccag gaaaatgctg cttaaggctc aagcaaatgc ttgtggtggg 480gcttgcaaaa cctttcagcc aaatgatgca gatcatgagc atgcttccgg gagctccaac 540gctaactcat tgcaaagaaa tgagaaagcc aacagtaaaa ggagagtttc tggaaggaag 600aatcccgcca attccgaggt attagatata attggcagat cgggagagac atgtcagatg 660gaagacaaca ttgacaacaa gaagttggtc tctgatagtg acaatgatgc tgaaaaccat 720ataaatgaca atgtccaaag caaaagatat tgtgcaggaa gacagagtag cagttctaag 780actcgagaag ccagccaaac agaaaccttg caaaaggtgg ttgacgccaa agaaattaag 840ggggatgcaa ggttttcttt gacaaagcat tctgactggt taaaatctca agaacctgag 900ccatctgaaa gcctatacga gtcaaggttc cctttgagaa ggcgttctgc ccggttaaaa 960tctcaagaac ctgagccatc tgaaagcttc catgactcaa tagagacaac caagaggagg 1020aggtcggcaa taaggtctgc tatgtttaat atccaagagc tgggcgttat tcaaaacttg 1080aacggtttac ctgatgatca agagattgct gcaaaggcca gatgctctgc acgtgaacag 1140tctaccgggt ctaaacccga agcagtagaa ccacatgaca caaaagagat aatcgggaaa 1200agcaggatat ctttgagaag acagtctgcg aggtttaatt tccaagagct gggcgtgact 1260gaaaacttga atggtccaca tgatgatcaa acgattgctg caaatgccag atgctgtgca 1320agtgaacagt ctatcgggtc taaacccgaa gcagtagaac cacatgacat tgaagagaga 1380atcgggaaaa tcagagtctc ttcaagaaga caatctgcaa acattgaaac tccgagagcc 1440atcaaagaac ctgcaaatcc gcctttgcat gatgacaatg ttgaggagtc tagtcagata 1500tcatgttcag tttcaatgga gcttaaaaga gaatcaaaga agaaaccaac aggcgacgaa 1560tcagaggaaa tgagaaaaac aactgttgga agaccttcaa ggcaagctgc tgaaaaaatc 1620aaatcgtaca aggaaccttc acttaaggag aagatgcgag ggggcttctg a 167110556PRTArabidopsis thaliana 10Met Val Arg Ala Thr Val Leu Asn Val Gly Asp His Ala Ser Glu Gly1 5 10 15Val Arg Thr Asn Lys Ala Lys Gly Glu Lys Met Val Leu Glu Pro Pro 20 25 30Met Asn Ser Ala Gln Arg Arg Lys Leu Gly Asp Ile Thr Asn Leu Gln 35 40 45Asn Gln Lys Asn Leu Met Asn Gln Gly Ala Lys His Gln Gln Gln Ala 50 55 60Ile Leu Ile Ser Ser Lys Glu Asn Ala Glu Asn Leu Gln Lys Ala Leu65 70 75 80Arg Asn Ser Ser Glu Asn Thr Lys Leu Met Lys Val Val Met Glu Arg 85 90 95Asp Gly Ile Lys Ser Asp Leu Lys Lys Leu Arg Ile Glu Phe Gln Lys 100 105 110Val Gln Glu Gln Asn Leu Leu Leu Ala Gln Ala Asn Thr Arg Ile Leu 115 120 125Ala Leu Lys Val Leu Gln His Glu Leu Gly Cys Lys Asn Gly Leu Val 130 135 140Met Ala Arg Lys Met Leu Leu Lys Ala Gln Ala Asn Ala Cys Gly Gly145 150 155 160Ala Cys Lys Thr Phe Gln Pro Asn Asp Ala Asp His Glu His Ala Ser 165 170 175Gly Ser Ser Asn Ala Asn Ser Leu Gln Arg Asn Glu Lys Ala Asn Ser 180 185 190Lys Arg Arg Val Ser Gly Arg Lys Asn Pro Ala Asn Ser Glu Val Leu 195 200 205Asp Ile Ile Gly Arg Ser Gly Glu Thr Cys Gln Met Glu Asp Asn Ile 210 215 220Asp Asn Lys Lys Leu Val Ser Asp Ser Asp Asn Asp Ala Glu Asn His225 230 235 240Ile Asn Asp Asn Val Gln Ser Lys Arg Tyr Cys Ala Gly Arg Gln Ser 245 250 255Ser Ser Ser Lys Thr Arg Glu Ala Ser Gln Thr Glu Thr Leu Gln Lys 260 265 270Val Val Asp Ala Lys Glu Ile Lys Gly Asp Ala Arg Phe Ser Leu Thr 275 280 285Lys His Ser Asp Trp Leu Lys Ser Gln Glu Pro Glu Pro Ser Glu Ser 290 295 300Leu Tyr Glu Ser Arg Phe Pro Leu Arg Arg Arg Ser Ala Arg Leu Lys305 310 315 320Ser Gln Glu Pro Glu Pro Ser Glu Ser Phe His Asp Ser Ile Glu Thr 325 330 335Thr Lys Arg Arg Arg Ser Ala Ile Arg Ser Ala Met Phe Asn Ile Gln 340 345 350Glu Leu Gly Val Ile Gln Asn Leu Asn Gly Leu Pro Asp Asp Gln Glu 355 360 365Ile Ala Ala Lys Ala Arg Cys Ser Ala Arg Glu Gln Ser Thr Gly Ser 370 375 380Lys Pro Glu Ala Val Glu Pro His Asp Thr Lys Glu Ile Ile Gly Lys385 390 395 400Ser Arg Ile Ser Leu Arg Arg Gln Ser Ala Arg Phe Asn Phe Gln Glu 405 410 415Leu Gly Val Thr Glu Asn Leu Asn Gly Pro His Asp Asp Gln Thr Ile 420 425 430Ala Ala Asn Ala Arg Cys Cys Ala Ser Glu Gln Ser Ile Gly Ser Lys 435 440 445Pro Glu Ala Val Glu Pro His Asp Ile Glu Glu Arg Ile Gly Lys Ile 450 455 460Arg Val Ser Ser Arg Arg Gln Ser Ala Asn Ile Glu Thr Pro Arg Ala465 470 475 480Ile Lys Glu Pro Ala Asn Pro Pro Leu His Asp Asp Asn Val Glu Glu 485 490 495Ser Ser Gln Ile Ser Cys Ser Val Ser Met Glu Leu Lys Arg Glu Ser 500 505 510Lys Lys Lys Pro Thr Gly Asp Glu Ser Glu Glu Met Arg Lys Thr Thr 515 520 525Val Gly Arg Pro Ser Arg Gln Ala Ala Glu Lys Ile Lys Ser Tyr Lys 530 535 540Glu Pro Ser Leu Lys Glu Lys Met Arg Gly Gly Phe545 550 555111341DNAArabidopsis thaliana 11atggataaag aagagacgca gcagaaggaa aatatgctat tctcttccca ggaatatgct 60gcaaagcttc aaaaggcatt tcctcttcac tttaatcttg aaaacatgac actgatgaaa 120gctctagcac accgaaataa actcgtcgag ttgagcggta ttgagattca gaaactgagg 180attaacttac ggagtgtgca ggaaaagaat ttgcagcttg ctcaggcaaa cagtcagatg 240ttagcgctca aggatctcca gcatgaactt ggctgcaaga atgctttact taaagtcaag 300aaacatcttg aggagcaagt acttccacgt acacatcatg aatcgaaaga caaggtttca 360gcaagcgctt ctgatgggga ttgcaaatcc tttcaggtgc atgacataaa acataaagat 420accaagagaa agcgaacaac aaggataaaa tcttcagtaa gtgccgacgt caagccaata 480cctgtgaatg attctaacag taaagctaac cgtaaaagaa gagtttctgg agtaatagat 540actactggta ttcccgaaga gatctgtcag actgaagatg acattgataa gggggttgtc 600tctcgagggg taaaccaaga tattgacaat gttgtcaaca agaagtttgt tcctgatgca 660gcaaacccgg taaaagagag tgtgcatcgc aagaggcaat gtacacgaag gcaatctacc 720agatttgatg ttcaagaaac taaacaaacg gaaaagttgc ttgagatgga tggtgccaaa 780gaaagtaaag aaaccgcaag cttctctttg agaagacggt ctgctcggtt aaggcacgaa 840gaagctgaac catgtaaaag cttacatgag ggagacgaag tcagggagac aatcaagagg 900agaagagtct ctttaagact gtctgcaagg tttgatatac aagaaccgca tgtgactgaa 960acctcgaatg ctgacgatgc aagaagcata gtaatcgaag aatctgctgg atcaagatcg 1020gaatctgtag aaccatccga aagcaggcat gaaacaaaag agataacccg gaaacgcagt 1080ttctcaacga gaagacaatc aacaaagggt aaatctcaaa ccgatgaagc cattaaagaa 1140atagcgacag acccatcttt ggtcaacacc atagttcaag agtgtgatca ggaaacagaa 1200tcaaaggata agcctaaagc tgatgaaaac gaagggatga caagaagatc atctgtggga 1260agaccatcga gacatgccgc agagaaagtc caatcataca gagaagtctc acttagagta 1320aagatgcgac gaaaatgcta a 134112446PRTArabidopsis thaliana 12Met Asp Lys Glu Glu Thr Gln Gln Lys Glu Asn Met Leu Phe Ser Ser1 5 10 15Gln Glu Tyr Ala Ala Lys Leu Gln Lys Ala Phe Pro Leu His Phe Asn 20 25 30Leu Glu Asn Met Thr Leu Met Lys Ala Leu Ala His Arg Asn Lys Leu 35 40 45Val Glu Leu Ser Gly Ile Glu Ile Gln Lys Leu Arg Ile Asn Leu Arg 50 55 60Ser Val Gln Glu Lys Asn Leu Gln Leu Ala Gln Ala Asn Ser Gln Met65 70 75 80Leu Ala Leu Lys Asp Leu Gln His Glu Leu Gly Cys Lys Asn Ala Leu 85 90 95Leu Lys Val Lys Lys His Leu Glu Glu Gln Val Leu Pro Arg Thr His 100 105 110His Glu Ser Lys Asp Lys Val Ser Ala Ser Ala Ser Asp Gly Asp Cys 115 120 125Lys Ser Phe Gln Val His Asp Ile Lys His Lys Asp Thr Lys Arg Lys 130 135 140Arg Thr Thr Arg Ile Lys Ser Ser Val Ser Ala Asp Val Lys Pro Ile145 150 155 160Pro Val Asn Asp Ser Asn Ser Lys Ala Asn Arg Lys Arg Arg Val Ser 165 170 175Gly Val Ile Asp Thr Thr Gly Ile Pro Glu Glu Ile Cys Gln Thr Glu 180 185 190Asp Asp Ile Asp Lys Gly Val Val Ser Arg Gly Val Asn Gln Asp Ile 195 200 205Asp Asn Val Val Asn Lys Lys Phe Val Pro Asp Ala Ala Asn Pro Val 210 215 220Lys Glu Ser Val His Arg Lys Arg Gln Cys Thr Arg Arg Gln Ser Thr225 230 235 240Arg Phe Asp Val Gln Glu Thr Lys Gln Thr Glu Lys Leu Leu Glu Met 245 250 255Asp Gly Ala Lys Glu Ser Lys Glu Thr Ala Ser Phe Ser Leu Arg Arg 260 265 270Arg Ser Ala Arg Leu Arg His Glu Glu Ala Glu Pro Cys Lys Ser Leu 275 280 285His Glu Gly Asp Glu Val Arg Glu Thr Ile Lys Arg Arg Arg Val Ser 290 295 300Leu Arg Leu Ser Ala Arg Phe Asp Ile Gln Glu Pro His Val Thr Glu305 310 315 320Thr Ser Asn Ala Asp Asp Ala Arg Ser Ile Val Ile Glu Glu Ser Ala 325 330 335Gly Ser Arg Ser Glu Ser Val Glu Pro Ser Glu Ser Arg His Glu Thr 340 345 350Lys Glu Ile Thr Arg Lys Arg Ser Phe Ser Thr Arg Arg Gln Ser Thr 355

360 365Lys Gly Lys Ser Gln Thr Asp Glu Ala Ile Lys Glu Ile Ala Thr Asp 370 375 380Pro Ser Leu Val Asn Thr Ile Val Gln Glu Cys Asp Gln Glu Thr Glu385 390 395 400Ser Lys Asp Lys Pro Lys Ala Asp Glu Asn Glu Gly Met Thr Arg Arg 405 410 415Ser Ser Val Gly Arg Pro Ser Arg His Ala Ala Glu Lys Val Gln Ser 420 425 430Tyr Arg Glu Val Ser Leu Arg Val Lys Met Arg Arg Lys Cys 435 440 445131554DNAmouse 13atggctaagg aaaggtgtca gaaaaggtcc tttcaagata cccttgaaga cattaagaat 60cgaatgaaag aaaaaaggaa taaaaatttg gcggggattg ggaaacgcaa gtcctttatt 120gttgcaccgg gccaagtacc cactaacact gctacactac tgagatatta ccaagataac 180aacaggttgt tagtcttggc tttggaaaat gagaaatcca aagtgagaga agcacaggat 240gtcatcctgc aactgagaaa agaatgctac taccttactt gtcagctgta tgcattgaaa 300gagaagctaa cttcccgaca aagtgaagaa actactcaga actggaaagg acgtccctca 360gacgtggtct ccagcattga caatacgacc agggacttgt cagggaagtc cttacagcaa 420attgctgttg aagaaactga ttgtccttac caaaccacag aaccaagtcc tgctgttact 480ccagagacac agggttgcga ttttgattca ggtaaagttg agtctactga tgaagtctta 540cccagaacta tatctatccg tcgccattta aggaaagatt ttagtaatat aagccactcc 600acgactttgg aggattgtaa agccagtcca agagtggcac agtctctgga agttaaagga 660agtagatgta gagaagtaac cgtaaccctg cacagacttg aaaatgtttg tctgtggaac 720aaagaccaaa ttagcttatg ttctagactg attaacccag caaagattac tgaaacagaa 780gtcattttat catctaaacc tgaacaaata gaaagcaagc ataaacgtgc acgaaaaaga 840agagcagagc aaagaagaac caagcagaga tgcaaatcaa aatcctcatt gaggagtaag 900gggaacaaaa acaaagataa gcagggttta ccccctacta cactggatgg aggtattggt 960tcctgtgatg cttacgattt taatctaaaa gggacggtcc accccacccc tttccgacaa 1020aaaatgaaca atggctgcaa caaagaaacg gatagcagca actcagaagt gagtgacctc 1080gaatgcagta cctctgagga tgagtctgat gacctctacc tgcctccctc caagcgcttg 1140cgagactaca gagagtcaga gagagcagtt accaggcctc ggtctaaaag aggacttcag 1200tacccagatg ggaaagagag gaaggaggtg ctgccatcta cagctcctac tggtatccca 1260cctgagactc aagagtcacc tcgttgtagc ctaaaggatg tcaccaatat cctgcagtgt 1320cctagagtga agatcaggaa gccttctctg cctccaaagc ggcgtgaaga cagcccagca 1380gtggctctga ctaaacgcag gtgtagcacc atcaaaagct ataaagagcc aacactcgct 1440tcaaagctaa gaagagggga ccctttcacg gacttgtgtt tcttgaattc tcctattttc 1500aagcagaaaa ggggtatgag atgtcctaaa agaagaacca agcaaacaca gtaa 155414517PRTmosue 14Met Ala Lys Glu Arg Cys Gln Lys Arg Ser Phe Gln Asp Thr Leu Glu1 5 10 15Asp Ile Lys Asn Arg Met Lys Glu Lys Arg Asn Lys Asn Leu Ala Gly 20 25 30Ile Gly Lys Arg Lys Ser Phe Ile Val Ala Pro Gly Gln Val Pro Thr 35 40 45Asn Thr Ala Thr Leu Leu Arg Tyr Tyr Gln Asp Asn Asn Arg Leu Leu 50 55 60Val Leu Ala Leu Glu Asn Glu Lys Ser Lys Val Arg Glu Ala Gln Asp65 70 75 80Val Ile Leu Gln Leu Arg Lys Glu Cys Tyr Tyr Leu Thr Cys Gln Leu 85 90 95Tyr Ala Leu Lys Glu Lys Leu Thr Ser Arg Gln Ser Glu Glu Thr Thr 100 105 110Gln Asn Trp Lys Gly Arg Pro Ser Asp Val Val Ser Ser Ile Asp Asn 115 120 125Thr Thr Arg Asp Leu Ser Gly Lys Ser Leu Gln Gln Ile Ala Val Glu 130 135 140Glu Thr Asp Cys Pro Tyr Gln Thr Thr Glu Pro Ser Pro Ala Val Thr145 150 155 160Pro Glu Thr Gln Gly Cys Asp Phe Asp Ser Gly Lys Val Glu Ser Thr 165 170 175Asp Glu Val Leu Pro Arg Thr Ile Ser Ile Arg Arg His Leu Arg Lys 180 185 190Asp Phe Ser Asn Ile Ser His Ser Thr Thr Leu Glu Asp Cys Lys Ala 195 200 205Ser Pro Arg Val Ala Gln Ser Leu Glu Val Lys Gly Ser Arg Cys Arg 210 215 220Glu Val Thr Val Thr Leu His Arg Leu Glu Asn Val Cys Leu Trp Asn225 230 235 240Lys Asp Gln Ile Ser Leu Cys Ser Arg Leu Ile Asn Pro Ala Lys Ile 245 250 255Thr Glu Thr Glu Val Ile Leu Ser Ser Lys Pro Glu Gln Ile Glu Ser 260 265 270Lys His Lys Arg Ala Arg Lys Arg Arg Ala Glu Gln Arg Arg Thr Lys 275 280 285Gln Arg Cys Lys Ser Lys Ser Ser Leu Arg Ser Lys Gly Asn Lys Asn 290 295 300Lys Asp Lys Gln Gly Leu Pro Pro Thr Thr Leu Asp Gly Gly Ile Gly305 310 315 320Ser Cys Asp Ala Tyr Asp Phe Asn Leu Lys Gly Thr Val His Pro Thr 325 330 335Pro Phe Arg Gln Lys Met Asn Asn Gly Cys Asn Lys Glu Thr Asp Ser 340 345 350Ser Asn Ser Glu Val Ser Asp Leu Glu Cys Ser Thr Ser Glu Asp Glu 355 360 365Ser Asp Asp Leu Tyr Leu Pro Pro Ser Lys Arg Leu Arg Asp Tyr Arg 370 375 380Glu Ser Glu Arg Ala Val Thr Arg Pro Arg Ser Lys Arg Gly Leu Gln385 390 395 400Tyr Pro Asp Gly Lys Glu Arg Lys Glu Val Leu Pro Ser Thr Ala Pro 405 410 415Thr Gly Ile Pro Pro Glu Thr Gln Glu Ser Pro Arg Cys Ser Leu Lys 420 425 430Asp Val Thr Asn Ile Leu Gln Cys Pro Arg Val Lys Ile Arg Lys Pro 435 440 445Ser Leu Pro Pro Lys Arg Arg Glu Asp Ser Pro Ala Val Ala Leu Thr 450 455 460Lys Arg Arg Cys Ser Thr Ile Lys Ser Tyr Lys Glu Pro Thr Leu Ala465 470 475 480Ser Lys Leu Arg Arg Gly Asp Pro Phe Thr Asp Leu Cys Phe Leu Asn 485 490 495Ser Pro Ile Phe Lys Gln Lys Arg Gly Met Arg Cys Pro Lys Arg Arg 500 505 510Thr Lys Gln Thr Gln 515153495DNAmouse 15atggagtacc cagggataaa agttgacact gttacctctg gaattcagag acgagtgaag 60ggcagaattg caaagacaaa tttgaatgtt tctcttgctt caaagatcaa agcaaaaata 120ttaaacaatt cttctatttt caagatctct ctaaagcaca acaacagagc attagcgcgg 180gcccttagta aagagaaaga gaattctcga agaattacta ccgaaaagat gcaattacag 240aaagaagtag agaaactgaa ttttgagaat acctttcttc gcttaaagtt aaataccttg 300aataagaagc ttgtagaaat agaatcgcat gtgagcaatg atttgttaac tgcaattgaa 360ataagcagtc tttctgagtt ccaccaaggt tcttttctcc tgtcagctac caagaaacaa 420aggaacagta agcagtgcaa gcctgcgcat cttccatatg caagagttct gttaacttca 480gaaaatgatg atgatgatgg tgctgatgat aaatggcaga caaagtgtaa caacagaact 540atatcaaaga cctcacctga tagtacctct tcagtatcaa gacaaccttc atccttacat 600cagtgcaatt tgaaagcatt ccctcctaaa gaagataatc agaagacatg tgggtcaggt 660catttagaac atacttcaag tgttgatata cttcctaatg agagccactc agatcaaagt 720cctaagagtt ctctgagtga gatgaaaact gctccatctc ccagcctcag aagggaaaaa 780ttatcacatg gtaatgtgac tatgaggaag aagtgtgtgt cttcaactcc agacattctg 840tatgtgacag atttagatca ccaaccaact tcaagtccag gatcaaattg gaataatgag 900atacatggtc atactaatga aaccagcaat aacacgcaaa gaaatgccga gtgttttctt 960gacttacctt ctgagtcttc cagtgagcct gacgcaaagc gcatggagct agtgcagaag 1020aacaccgata gctttcactt ccagaaaact gtatatgatg ccgctgatat ggagttaact 1080gctactgaca taggcaagat tgtagcagtt tcaaaaagca agaaaaatca aaataagaaa 1140aaggcagact gtagaaagga gactttcaga aaagtgaaag gtgcaagctc tgataaaaag 1200agagaaagct caaagagaga atgtaaagat ggttcagaag taggtgctga ggaagaggct 1260gatgcagcca gagcagaaag aggcgctggt gtcctggatg gcagagggga ttcagaagag 1320ccaaactgca tttccagtac tgagcagcca tctcaggtaa acacgcaaaa gaaaagaacc 1380ctccagaaca gctcagatca ggagaacatt caaaatacga agaggaggca aacatatacg 1440acagatgagc aagaggaaac aaaccctttc tccagacatt cagtcaaatt tcttcaagat 1500ggtaaatttg atctgtgtca gaaaacccta catcataatt taagtaagcc ttctcgacag 1560acatttgtga ttcgtaagtc agaaaaagat aacttatttc caaatcaaga agataaagac 1620accatttctg aaaacctaga agttacaaat gaatttcata tagatgatct ttccatcgaa 1680gctaatgaaa atgtatgtga ccatgagact cagacaatgt tggacttgaa aaagtctgtc 1740agtgctcaac aaaatcaaac aaaaataaat aagactaagc agaaaataaa tcgaaggaca 1800aaaataattt ctgtcatgag ccaagtatat gaggacaatg ataaagatat tcacgtccta 1860gaaaaagaca actttccctt tcatacccaa gcaaataaag aaaccaccag tggaaaccta 1920gaaagttcaa aagaatttga atcacctctt cttttcacaa gagacaacgg aagcttacgt 1980gactgtaaga cccagaatgt tctggatctg cacaagcaaa ttcctgatct ataccctgat 2040cggaatgagt cccagattag caaaatccct aggcaaaaag taaatcgcaa gacagaagta 2100atttctggag tgaaatgttt tagtaatgac caaggtgttc attgctcaga aaaggataag 2160tctttgttac tacaaaagga taaagacttc ccaggaactt taaaagactt aagtgagttt 2220gatacgcctg ctttttgtaa caaagatagt gcaaagtcgt gtgattataa gtctgaaatg 2280ctcttggggt tgaaaaaaca tgaccctaat atgcaacctg cttgtcaaga tgattcaaaa 2340gcaggtaaga aacttagaca aaaggtaaat cgaaaaacag aaataatttc taaaatcacc 2400caaatacatg aaaatgatag aggaagtaca catgactcat taaataagaa gctctgtcag 2460aaggttaata tatcaaaaat catttctcaa atgaaccaaa tatatgagac tattaatgaa 2520gatggaaatg gctttaaaag ctctatcaaa gattgcgaag atattaaaag ttgtgacttt 2580ggggaaatca acagtaataa aaaggaaaat tatgatccaa ttcaagatcc ttgcacactg 2640gttaaaaaaa caaagagaaa gggatcatgt aaagcaggga gcagtttggc aggagctaag 2700aacaggtgtg gtttgcagtt aacagactct tcccaggtac agtctgtccc cttagactct 2760ggcttaagac accatccaaa cgaagcagat tctggtcctg gagagcagac taacctgcca 2820aagatgcaga aacaaagcgc tgggaggtca ctgggagatg ctttctctgt gagtctggga 2880aaagaaggaa gccgcccagc caaagcagtt agtaaaatga cacccaaatc aaagaagaga 2940aagctccctc tcggttgttc tcctgaaacc cacgggacgg tggagataac acccaacact 3000gacctcgcta aggctgttga ctcccaacag actgagaagg agaactattt ggagaaggag 3060aaaattgcca agaggaagcc agatttttgt acaaaggtgt tgaaaccttt atctgagaca 3120tgttcatcta acataaagaa ttcttccttg gacagtatgt gtaagagttc gctacctttg 3180agtatttctt ctagaaaaac cctgatgctg gaagaaagtt cttccctgga gagtacatgc 3240atctttcaag taggtgatgc cgctcatgag aagataacga caggcacacg taatccccac 3300cacaggacac agaagtcgac accgggtagc agaacgtccc tggtcttggt ggataccagt 3360tctgtttcag ataccaaccc tgctaacccc gagaatgagt cagaagggca gtcttcacac 3420ccaatgagaa ggaaaagaca gtgcgtccct ctcaacctga cagagccaag ccttagaagc 3480aagatgagga gataa 3495161164PRTmouse 16Met Glu Tyr Pro Gly Ile Lys Val Asp Thr Val Thr Ser Gly Ile Gln1 5 10 15Arg Arg Val Lys Gly Arg Ile Ala Lys Thr Asn Leu Asn Val Ser Leu 20 25 30Ala Ser Lys Ile Lys Ala Lys Ile Leu Asn Asn Ser Ser Ile Phe Lys 35 40 45Ile Ser Leu Lys His Asn Asn Arg Ala Leu Ala Arg Ala Leu Ser Lys 50 55 60Glu Lys Glu Asn Ser Arg Arg Ile Thr Thr Glu Lys Met Gln Leu Gln65 70 75 80Lys Glu Val Glu Lys Leu Asn Phe Glu Asn Thr Phe Leu Arg Leu Lys 85 90 95Leu Asn Thr Leu Asn Lys Lys Leu Val Glu Ile Glu Ser His Val Ser 100 105 110Asn Asp Leu Leu Thr Ala Ile Glu Ile Ser Ser Leu Ser Glu Phe His 115 120 125Gln Gly Ser Phe Leu Leu Ser Ala Thr Lys Lys Gln Arg Asn Ser Lys 130 135 140Gln Cys Lys Pro Ala His Leu Pro Tyr Ala Arg Val Leu Leu Thr Ser145 150 155 160Glu Asn Asp Asp Asp Asp Gly Ala Asp Asp Lys Trp Gln Thr Lys Cys 165 170 175Asn Asn Arg Thr Ile Ser Lys Thr Ser Pro Asp Ser Thr Ser Ser Val 180 185 190Ser Arg Gln Pro Ser Ser Leu His Gln Cys Asn Leu Lys Ala Phe Pro 195 200 205Pro Lys Glu Asp Asn Gln Lys Thr Cys Gly Ser Gly His Leu Glu His 210 215 220Thr Ser Ser Val Asp Ile Leu Pro Asn Glu Ser His Ser Asp Gln Ser225 230 235 240Pro Lys Ser Ser Leu Ser Glu Met Lys Thr Ala Pro Ser Pro Ser Leu 245 250 255Arg Arg Glu Lys Leu Ser His Gly Asn Val Thr Met Arg Lys Lys Cys 260 265 270Val Ser Ser Thr Pro Asp Ile Leu Tyr Val Thr Asp Leu Asp His Gln 275 280 285Pro Thr Ser Ser Pro Gly Ser Asn Trp Asn Asn Glu Ile His Gly His 290 295 300Thr Asn Glu Thr Ser Asn Asn Thr Gln Arg Asn Ala Glu Cys Phe Leu305 310 315 320Asp Leu Pro Ser Glu Ser Ser Ser Glu Pro Asp Ala Lys Arg Met Glu 325 330 335Leu Val Gln Lys Asn Thr Asp Ser Phe His Phe Gln Lys Thr Val Tyr 340 345 350Asp Ala Ala Asp Met Glu Leu Thr Ala Thr Asp Ile Gly Lys Ile Val 355 360 365Ala Val Ser Lys Ser Lys Lys Asn Gln Asn Lys Lys Lys Ala Asp Cys 370 375 380Arg Lys Glu Thr Phe Arg Lys Val Lys Gly Ala Ser Ser Asp Lys Lys385 390 395 400Arg Glu Ser Ser Lys Arg Glu Cys Lys Asp Gly Ser Glu Val Gly Ala 405 410 415Glu Glu Glu Ala Asp Ala Ala Arg Ala Glu Arg Gly Ala Gly Val Leu 420 425 430Asp Gly Arg Gly Asp Ser Glu Glu Pro Asn Cys Ile Ser Ser Thr Glu 435 440 445Gln Pro Ser Gln Val Asn Thr Gln Lys Lys Arg Thr Leu Gln Asn Ser 450 455 460Ser Asp Gln Glu Asn Ile Gln Asn Thr Lys Arg Arg Gln Thr Tyr Thr465 470 475 480Thr Asp Glu Gln Glu Glu Thr Asn Pro Phe Ser Arg His Ser Val Lys 485 490 495Phe Leu Gln Asp Gly Lys Phe Asp Leu Cys Gln Lys Thr Leu His His 500 505 510Asn Leu Ser Lys Pro Ser Arg Gln Thr Phe Val Ile Arg Lys Ser Glu 515 520 525Lys Asp Asn Leu Phe Pro Asn Gln Glu Asp Lys Asp Thr Ile Ser Glu 530 535 540Asn Leu Glu Val Thr Asn Glu Phe His Ile Asp Asp Leu Ser Ile Glu545 550 555 560Ala Asn Glu Asn Val Cys Asp His Glu Thr Gln Thr Met Leu Asp Leu 565 570 575Lys Lys Ser Val Ser Ala Gln Gln Asn Gln Thr Lys Ile Asn Lys Thr 580 585 590Lys Gln Lys Ile Asn Arg Arg Thr Lys Ile Ile Ser Val Met Ser Gln 595 600 605Val Tyr Glu Asp Asn Asp Lys Asp Ile His Val Leu Glu Lys Asp Asn 610 615 620Phe Pro Phe His Thr Gln Ala Asn Lys Glu Thr Thr Ser Gly Asn Leu625 630 635 640Glu Ser Ser Lys Glu Phe Glu Ser Pro Leu Leu Phe Thr Arg Asp Asn 645 650 655Gly Ser Leu Arg Asp Cys Lys Thr Gln Asn Val Leu Asp Leu His Lys 660 665 670Gln Ile Pro Asp Leu Tyr Pro Asp Arg Asn Glu Ser Gln Ile Ser Lys 675 680 685Ile Pro Arg Gln Lys Val Asn Arg Lys Thr Glu Val Ile Ser Gly Val 690 695 700Lys Cys Phe Ser Asn Asp Gln Gly Val His Cys Ser Glu Lys Asp Lys705 710 715 720Ser Leu Leu Leu Gln Lys Asp Lys Asp Phe Pro Gly Thr Leu Lys Asp 725 730 735Leu Ser Glu Phe Asp Thr Pro Ala Phe Cys Asn Lys Asp Ser Ala Lys 740 745 750Ser Cys Asp Tyr Lys Ser Glu Met Leu Leu Gly Leu Lys Lys His Asp 755 760 765Pro Asn Met Gln Pro Ala Cys Gln Asp Asp Ser Lys Ala Gly Lys Lys 770 775 780Leu Arg Gln Lys Val Asn Arg Lys Thr Glu Ile Ile Ser Lys Ile Thr785 790 795 800Gln Ile His Glu Asn Asp Arg Gly Ser Thr His Asp Ser Leu Asn Lys 805 810 815Lys Leu Cys Gln Lys Val Asn Ile Ser Lys Ile Ile Ser Gln Met Asn 820 825 830Gln Ile Tyr Glu Thr Ile Asn Glu Asp Gly Asn Gly Phe Lys Ser Ser 835 840 845Ile Lys Asp Cys Glu Asp Ile Lys Ser Cys Asp Phe Gly Glu Ile Asn 850 855 860Ser Asn Lys Lys Glu Asn Tyr Asp Pro Ile Gln Asp Pro Cys Thr Leu865 870 875 880Val Lys Lys Thr Lys Arg Lys Gly Ser Cys Lys Ala Gly Ser Ser Leu 885 890 895Ala Gly Ala Lys Asn Arg Cys Gly Leu Gln Leu Thr Asp Ser Ser Gln 900 905 910Val Gln Ser Val Pro Leu Asp Ser Gly Leu Arg His His Pro Asn Glu 915 920 925Ala Asp Ser Gly Pro Gly Glu Gln Thr Asn Leu Pro Lys Met Gln Lys 930 935 940Gln Ser Ala Gly Arg Ser Leu Gly Asp Ala Phe Ser Val Ser Leu Gly945 950 955 960Lys Glu Gly Ser Arg Pro Ala Lys Ala Val Ser Lys Met Thr Pro Lys 965 970 975Ser Lys Lys Arg Lys Leu Pro Leu Gly Cys Ser Pro Glu Thr His Gly 980 985 990Thr Val Glu Ile Thr Pro Asn Thr Asp Leu Ala Lys Ala Val Asp Ser 995 1000 1005Gln Gln Thr Glu Lys Glu Asn Tyr Leu Glu Lys Glu Lys Ile Ala 1010 1015

1020Lys Arg Lys Pro Asp Phe Cys Thr Lys Val Leu Lys Pro Leu Ser 1025 1030 1035Glu Thr Cys Ser Ser Asn Ile Lys Asn Ser Ser Leu Asp Ser Met 1040 1045 1050Cys Lys Ser Ser Leu Pro Leu Ser Ile Ser Ser Arg Lys Thr Leu 1055 1060 1065Met Leu Glu Glu Ser Ser Ser Leu Glu Ser Thr Cys Ile Phe Gln 1070 1075 1080Val Gly Asp Ala Ala His Glu Lys Ile Thr Thr Gly Thr Arg Asn 1085 1090 1095Pro His His Arg Thr Gln Lys Ser Thr Pro Gly Ser Arg Thr Ser 1100 1105 1110Leu Val Leu Val Asp Thr Ser Ser Val Ser Asp Thr Asn Pro Ala 1115 1120 1125Asn Pro Glu Asn Glu Ser Glu Gly Gln Ser Ser His Pro Met Arg 1130 1135 1140Arg Lys Arg Gln Cys Val Pro Leu Asn Leu Thr Glu Pro Ser Leu 1145 1150 1155Arg Ser Lys Met Arg Arg 1160171584DNAHomo sapiens 17atggccaagg aaagatgcct gaaaaagtcc tttcaagata gtcttgaaga cataaagaag 60cgaatgaaag agaaaaggaa taaaaacttg gcagagattg gcaaacgcag gtcttttata 120gctgcaccat gccaaataat caccaacact tctacactgc tgaaaaatta ccaagacaac 180aacaaaatgt tagttttagc tttggaaaat gaaaaatcca aagtgaaaga agcccaagat 240atcatcctac agctgagaaa agaatgttac tatctcacat gtcagctata tgcattgaaa 300ggaaaactta catcacaaca aacagtagaa cctgctcaga accaggaaat atgttcctct 360ggaatggacc ccaatagtga tgacagctcc agaaatttat ttgtgaagga tttaccgcaa 420attcctcttg aagaaactga acttccagga caaggagaat catttcaaat agaagatcag 480atacctacta ttcctcaaga cacactggga gttgattttg attcaggtga agctaagtct 540actgataatg tcttacctag aactgtatct gttcgtagca gtttaaagaa acattgtaac 600agtatatgtc agtttgatag cttggatgat tttgaaacca gtcatttggc agggaagtct 660tttgaattcg aaagagttgg atttttagac ccactagtaa acatgcacat acctgaaaat 720gtacaacaca atgcttgtca atggagcaag gaccaagtta acttatcacc aaagctgatt 780cagccaggaa cgtttactaa aacaaaagaa gacattttag aatctaaatc tgaacaaact 840aaaagtaagc aaagagatac acaagaaaga aaaagagaag agaaaagaaa agctaacagg 900agaaaatcaa aacgtatgtc aaaatataaa gagaataaaa gcgaaaataa aaaaactgtt 960ccccaaaaaa aaatgcacaa atctgtcagt tccaatgatg cttacaattt taatttggaa 1020gagggtgttc atcttactcc tttccgacaa aaagtgagca atgactctaa tagagaagaa 1080aacaacgagt ctgaagtgag cctctgtgaa tcaagtggtt caggagatga ttccgatgac 1140ctctatttgc ccacttgcaa gtacattcag aatcccacga gcaattcaga tagaccagtc 1200accaggcctc tagctaaaag agcactgaaa tacacagatg aaaaagagac ggagggttct 1260aagccaacaa aaactcctac cactacacca cctgaaactc agcagtcacc tcatcttagc 1320ctgaaggata tcaccaatgt ctccttgtat cctgttgtga aaatcagaag actttctctt 1380tctccaaaaa agaataaagc aagcccagca gtggctctgc ctaaacgtag gtgcacagcc 1440agcgtgaact ataaggagcc caccctcgct tcgaaactga gaagagggga cccttttaca 1500gatttgtgtt ttttgaattc tcctattttc aagcagaaaa aggatttgag acgttctaaa 1560aaaagtatga aacaaataca atga 158418527PRTHomo sapiens 18Met Ala Lys Glu Arg Cys Leu Lys Lys Ser Phe Gln Asp Ser Leu Glu1 5 10 15Asp Ile Lys Lys Arg Met Lys Glu Lys Arg Asn Lys Asn Leu Ala Glu 20 25 30Ile Gly Lys Arg Arg Ser Phe Ile Ala Ala Pro Cys Gln Ile Ile Thr 35 40 45Asn Thr Ser Thr Leu Leu Lys Asn Tyr Gln Asp Asn Asn Lys Met Leu 50 55 60Val Leu Ala Leu Glu Asn Glu Lys Ser Lys Val Lys Glu Ala Gln Asp65 70 75 80Ile Ile Leu Gln Leu Arg Lys Glu Cys Tyr Tyr Leu Thr Cys Gln Leu 85 90 95Tyr Ala Leu Lys Gly Lys Leu Thr Ser Gln Gln Thr Val Glu Pro Ala 100 105 110Gln Asn Gln Glu Ile Cys Ser Ser Gly Met Asp Pro Asn Ser Asp Asp 115 120 125Ser Ser Arg Asn Leu Phe Val Lys Asp Leu Pro Gln Ile Pro Leu Glu 130 135 140Glu Thr Glu Leu Pro Gly Gln Gly Glu Ser Phe Gln Ile Glu Asp Gln145 150 155 160Ile Pro Thr Ile Pro Gln Asp Thr Leu Gly Val Asp Phe Asp Ser Gly 165 170 175Glu Ala Lys Ser Thr Asp Asn Val Leu Pro Arg Thr Val Ser Val Arg 180 185 190Ser Ser Leu Lys Lys His Cys Asn Ser Ile Cys Gln Phe Asp Ser Leu 195 200 205Asp Asp Phe Glu Thr Ser His Leu Ala Gly Lys Ser Phe Glu Phe Glu 210 215 220Arg Val Gly Phe Leu Asp Pro Leu Val Asn Met His Ile Pro Glu Asn225 230 235 240Val Gln His Asn Ala Cys Gln Trp Ser Lys Asp Gln Val Asn Leu Ser 245 250 255Pro Lys Leu Ile Gln Pro Gly Thr Phe Thr Lys Thr Lys Glu Asp Ile 260 265 270Leu Glu Ser Lys Ser Glu Gln Thr Lys Ser Lys Gln Arg Asp Thr Gln 275 280 285Glu Arg Lys Arg Glu Glu Lys Arg Lys Ala Asn Arg Arg Lys Ser Lys 290 295 300Arg Met Ser Lys Tyr Lys Glu Asn Lys Ser Glu Asn Lys Lys Thr Val305 310 315 320Pro Gln Lys Lys Met His Lys Ser Val Ser Ser Asn Asp Ala Tyr Asn 325 330 335Phe Asn Leu Glu Glu Gly Val His Leu Thr Pro Phe Arg Gln Lys Val 340 345 350Ser Asn Asp Ser Asn Arg Glu Glu Asn Asn Glu Ser Glu Val Ser Leu 355 360 365Cys Glu Ser Ser Gly Ser Gly Asp Asp Ser Asp Asp Leu Tyr Leu Pro 370 375 380Thr Cys Lys Tyr Ile Gln Asn Pro Thr Ser Asn Ser Asp Arg Pro Val385 390 395 400Thr Arg Pro Leu Ala Lys Arg Ala Leu Lys Tyr Thr Asp Glu Lys Glu 405 410 415Thr Glu Gly Ser Lys Pro Thr Lys Thr Pro Thr Thr Thr Pro Pro Glu 420 425 430Thr Gln Gln Ser Pro His Leu Ser Leu Lys Asp Ile Thr Asn Val Ser 435 440 445Leu Tyr Pro Val Val Lys Ile Arg Arg Leu Ser Leu Ser Pro Lys Lys 450 455 460Asn Lys Ala Ser Pro Ala Val Ala Leu Pro Lys Arg Arg Cys Thr Ala465 470 475 480Ser Val Asn Tyr Lys Glu Pro Thr Leu Ala Ser Lys Leu Arg Arg Gly 485 490 495Asp Pro Phe Thr Asp Leu Cys Phe Leu Asn Ser Pro Ile Phe Lys Gln 500 505 510Lys Lys Asp Leu Arg Arg Ser Lys Lys Ser Met Lys Gln Ile Gln 515 520 525193798DNAHomo sapiens 19atggagtgcc cagtgatgga aactggctca ctttttacct caggaattaa gagacatttg 60aaagacaaaa gaatttcaaa gactactaag ttgaatgttt ctcttgcttc aaaaataaaa 120acaaaaatac taaataattc ttctattttc aaaatatctt taaagcacaa caacagggca 180ttagctcagg ctcttagtag agaaaaagag aattctcgaa gaattacaac tgaaaagatg 240ctattgcaaa aagaagtaga gaaactgaat tttgagaaca catttcttcg cctaaagcta 300aataacttga ataagaagct tatagacata gaagctctca tgaacaataa cttgataact 360gcaactgaaa tgagcagtct ttctgagttc catcagagtt cctttctact gtcagctagc 420aagaagaaac gagttagtaa acagtgcaag ttgatgcgtc ttccatttgc aagggttcca 480ttaacttcaa atgatgatga agatgaagat aaagagaaaa tgcagtgtga caacaatatt 540aaatcaaaga cattacctga tattccctct tcaggatcaa caacacaacc tttatcaact 600caggataatt cggaagtgtt atttcttaaa gaaaataatc aaaatgtata tggtttagat 660gattcagaac atatttcttc tatagttgat gtacctccca gagaaagcca ttcccactca 720gaccaaagtt ctaagacttc tctaatgagt gagatgagaa acgcccagtc tattggccgc 780agatgggaga aaccatctcc tagtaatgtg actgaaagga agaagcgtgg gtcatcttgg 840gaatcaaata atctttctgc agacactccc tgtgcaacag ttttagataa acaacacatt 900tcaagtccag aattaaattg caataatgag ataaatggtc atactaatga aacaaatact 960gaaatgcaaa gaaataaaca ggatcttcct ggcttatctt ctgagtctgc cagagaacct 1020aatgcagagt gcatgaatca aattgaggat aatgatgact ttcaattgca gaaaactgtg 1080tatgatgctg acatggattt aactgctagt gaagtcagca aaattgtcac agtctcaaca 1140ggcattaaaa agaaaagtaa taaaaaaaca aatgaacatg gaatgaaaac tttcagaaaa 1200gtgaaagatt ccagctctga aaaaaagaga gaaagatcaa agagacagtt taaaaatagt 1260tcagatgtcg atattgggga aaagattgaa aacaggacag aaagatctga tgtcctggat 1320ggcaaaaggg gtgcagaaga tcccggtttt attttcaata atgaacagct ggctcagatg 1380aatgaacagc tggctcaggt gaatgaacta aagaaaatga cccttcaaac tggctttgaa 1440caaggtgaca gagaaaatgt actgtgtaat aaaaaggaga aaagaataac aaatgagcaa 1500gaggaaacat actctttatc ccaaagttca ggtaaatttc accaggagag taaatttgat 1560aagggtcaga attccctaac ttgtaataaa agtaaagctt ctagacagac atttgtgatt 1620cacaaattag aaaaagataa cttactccca aaccaaaagg ataaagtaac catttatgaa 1680aacctagacg tcacaaatga atttcacaca gccaatcttt ccaccaaaga taatggaaat 1740ttatgtgatt atgggaccca caatatattg gatttgaaaa agtatgtcac tgatattcaa 1800ccctcagagc aaaatgaatc aaacattaat aagcttagaa agaaagtaaa ccggaagaca 1860gaaataattt ctggaatgaa ccacatgtat gaagataatg ataaagatgt ggtgcatggc 1920ctaaaaaaag gtaatttttt tttcaaaacc caagaggata aagaacctat ctctgaaaac 1980atagaagttt ccaaagagct tcaaatccca gctctttcta ctagagataa tgaaaatcaa 2040tgtgactata ggacccagaa tgtgttgggt ttgcaaaagc agatcaccaa tatgtacccc 2100gttcagcaaa atgaatcaaa agttaataag aagcttaggc agaaagtaaa tcggaagaca 2160gaaataattt ctgaagtgaa tcatttagat aatgacaaaa gtatagaata cacagttaaa 2220agtcactcac tctttttaac gcaaaaagat aaggaaataa tccccggaaa cctagaagac 2280ccaagtgagt ttgaaacacc tgctctttct accaaagata gtggaaacct gtatgattct 2340gagattcaaa atgttttggg ggtgaaacat ggccatgata tgcaacctgc ttgtcaaaat 2400gattcaaaaa taggtaagaa gcctagacta aatgtatgtc aaaagtcaga aataattcct 2460gaaaccaacc aaatatatga gaatgataac aaaggtgtac atgacctaga aaaagataac 2520ttcttctctc taaccccaaa ggataaagaa acaatttctg aaaatctaca agtcacaaat 2580gaatttcaaa cagttgatct tctcatcaaa gataatggaa atttatgtga ttatgacacc 2640cagaatatat tggagttgaa aaagtatgtt actgatagga aatctgctga gcaaaatgaa 2700tcaaaaataa ataagctcag gaataaagtg aattggaaga cagaaataat ttctgaaatg 2760aaccagatat atgaggataa tgataaagat gcacatgtcc aagaaagcta tacaaaagat 2820cttgatttta aagtaaataa atctaaacaa aaacttgaat gccaagacat tatcaataaa 2880cactatatgg aagtcaacag taatgaaaag gaaagttgtg atcaaatttt agattcctac 2940aaagtagtta aaaaacgtaa gaaagaatca tcatgcaagg caaagaacat tttgacaaaa 3000gctaagaaca aacttgcttc acagttaaca gaatcttcac agacatctat ctccttagaa 3060tctgatttaa aacatattac tagtgaagca gattctgatc caggaaaccc agttgaacta 3120tgtaagactc agaagcaaag cactaccact ttgaataaaa aagatctccc ttttgtggaa 3180gaaataaaag aaggagagtg tcaggttaaa aaggtaaata aaatgacatc taagtcaaag 3240aaaaggaaga cctccataga tccttctcca gagagccatg aagtaatgga aagaatactt 3300gacagcgttc agggaaagtc tactgtatct gaacaagctg ataaggaaaa caatttggag 3360aatgagaaaa tggtcaaaaa taagccagac ttttacacaa aggcatttag atctttgtct 3420gagatacatt cacctaacat acaagattct tcctttgaca gtgttcgtga aggtttagta 3480cctttgagcg tttcttctgg taaaaatgtg ataataaaag aaaattttgc cttggagtgc 3540tccccagcct ttcaagtaag tgatgatgag catgagaaga tgaacaagat gaaatttaaa 3600gtcaaccgga gaacccaaaa atcaggaata ggtgatagac cattacagga cttgtcaaat 3660accagttttg tttcaaataa cactgctgaa tctgaaaata agtcagaaga tctatcttca 3720gaacggacaa gcagaagaag aaggtgtact cctttctatt ttaaagagcc aagcctcaga 3780gacaagatga gaagatga 3798201265PRTHomo sapiens 20Met Glu Cys Pro Val Met Glu Thr Gly Ser Leu Phe Thr Ser Gly Ile1 5 10 15Lys Arg His Leu Lys Asp Lys Arg Ile Ser Lys Thr Thr Lys Leu Asn 20 25 30Val Ser Leu Ala Ser Lys Ile Lys Thr Lys Ile Leu Asn Asn Ser Ser 35 40 45Ile Phe Lys Ile Ser Leu Lys His Asn Asn Arg Ala Leu Ala Gln Ala 50 55 60Leu Ser Arg Glu Lys Glu Asn Ser Arg Arg Ile Thr Thr Glu Lys Met65 70 75 80Leu Leu Gln Lys Glu Val Glu Lys Leu Asn Phe Glu Asn Thr Phe Leu 85 90 95Arg Leu Lys Leu Asn Asn Leu Asn Lys Lys Leu Ile Asp Ile Glu Ala 100 105 110Leu Met Asn Asn Asn Leu Ile Thr Ala Ile Glu Met Ser Ser Leu Ser 115 120 125Glu Phe His Gln Ser Ser Phe Leu Leu Ser Ala Ser Lys Lys Lys Arg 130 135 140Ile Ser Lys Gln Cys Lys Leu Met Arg Leu Pro Phe Ala Arg Val Pro145 150 155 160Leu Thr Ser Asn Asp Asp Glu Asp Glu Asp Lys Glu Lys Met Gln Cys 165 170 175Asp Asn Asn Ile Lys Ser Lys Thr Leu Pro Asp Ile Pro Ser Ser Gly 180 185 190Arg Thr Thr Gln Pro Leu Ser Thr Gln Asp Asn Ser Gly Val Leu Phe 195 200 205Leu Lys Glu Asn Asn Gln His Val Tyr Gly Leu Asp Asp Ser Glu His 210 215 220Ile Ser Ser Ile Val Asp Val Pro Pro Arg Glu Ser His Ser His Ser225 230 235 240Asp Gln Ser Ser Lys Thr Ser Leu Met Ser Glu Met Arg Asn Ala Gln 245 250 255Ser Ile Gly Arg Arg Trp Glu Lys Pro Ser Pro Ser Asn Val Thr Glu 260 265 270Arg Lys Lys Arg Gly Ser Ser Trp Glu Ser Asn Asn Leu Ser Ala Asp 275 280 285Thr Pro Cys Ala Thr Val Leu Asp Lys Gln His Ile Ser Ser Pro Glu 290 295 300Leu Asn Cys Asn Asn Glu Ile Asn Gly His Thr Asn Glu Thr Asn Thr305 310 315 320Glu Met Gln Arg Asn Lys Gln Asp Leu Pro Gly Leu Ser Ser Glu Ser 325 330 335Ala Arg Glu Pro Asn Ala Glu Cys Met Asn Gln Ile Glu Asp Asn Asp 340 345 350Asp Phe Gln Leu Gln Lys Thr Val Tyr Asp Ala Asp Met Asp Leu Thr 355 360 365Ala Ser Glu Val Ser Lys Ile Val Thr Val Ser Thr Gly Ile Lys Lys 370 375 380Lys Ser Asn Lys Lys Thr Asn Glu His Gly Met Lys Thr Phe Arg Lys385 390 395 400Val Lys Asp Ser Ser Ser Glu Lys Lys Arg Glu Arg Ser Lys Arg Gln 405 410 415Phe Lys Asn Ser Ser Asp Val Asp Ile Gly Glu Lys Ile Glu Asn Arg 420 425 430Thr Glu Arg Ser Asp Val Leu Asp Gly Lys Arg Gly Ala Glu Asp Pro 435 440 445Gly Leu Phe Phe Asn Asn Glu Gln Leu Ala Gln Met Asn Glu Gln Leu 450 455 460Ala Gln Val Asn Glu Leu Lys Lys Met Thr Leu Gln Thr Gly Phe Glu465 470 475 480Gln Gly Asp Arg Glu Asn Val Leu Cys Asn Lys Lys Glu Lys Arg Val 485 490 495Thr Asn Glu Gln Glu Glu Thr Tyr Ser Leu Ser Gln Ser Ser Gly Lys 500 505 510Phe His Gln Glu Ser Lys Phe Asp Lys Gly Gln Asn Ser Leu Thr Cys 515 520 525Asn Lys Ser Lys Ala Ser Arg Gln Thr Phe Val Ile His Lys Leu Glu 530 535 540Lys Asp Asn Leu Leu Pro Asn Gln Lys Asp Lys Val Thr Ile Tyr Glu545 550 555 560Asn Leu Asp Val Thr Asn Glu Phe His Thr Ala Asn Leu Ser Thr Lys 565 570 575Asp Asn Gly Asn Leu Cys Asp Tyr Gly Thr His Asn Ile Leu Asp Leu 580 585 590Lys Lys Tyr Val Thr Asp Ile Gln Pro Ser Glu Gln Asn Glu Ser Asn 595 600 605Ile Asn Lys Leu Arg Lys Lys Val Asn Arg Lys Thr Glu Ile Ile Ser 610 615 620Gly Met Asn His Met Tyr Glu Asp Asn Asp Lys Asp Val Val His Gly625 630 635 640Leu Lys Lys Gly Asn Phe Phe Phe Lys Thr Gln Glu Asp Lys Glu Pro 645 650 655Ile Ser Glu Ser Ile Glu Val Ser Lys Glu Leu Gln Ile Pro Ala Leu 660 665 670Ser Thr Arg Asp Asn Glu Asn Gln Cys Asp Tyr Arg Thr Gln Asn Val 675 680 685Leu Gly Leu Gln Lys Gln Ile Thr Asn Met Tyr Pro Val Gln Gln Asn 690 695 700Glu Ser Lys Val Asn Lys Lys Leu Arg Gln Lys Val Asn Arg Lys Thr705 710 715 720Glu Ile Ile Ser Glu Val Asn His Leu Asp Asn Asp Lys Ser Ile Glu 725 730 735Tyr Thr Val Lys Ser His Ser Leu Phe Leu Thr Gln Lys Asp Lys Glu 740 745 750Ile Ile Pro Gly Asn Leu Glu Asp Pro Ser Glu Phe Glu Thr Pro Ala 755 760 765Leu Ser Thr Lys Asp Ser Gly Asn Leu Tyr Asp Ser Glu Ile Gln Asn 770 775 780Val Leu Gly Val Lys His Gly His Asp Met Gln Pro Ala Cys Gln Asn785 790 795 800Asp Ser Lys Ile Gly Lys Lys Pro Arg Leu Asn Val Cys Gln Lys Ser 805 810 815Glu Ile Ile Pro Glu Thr Asn Gln Ile Tyr Glu Asn Asp Asn Lys Gly 820 825 830Val His Asp Leu Glu Lys Asp Asn Phe Phe Ser Leu Thr Pro Lys Asp 835 840 845Lys Glu Thr Ile Ser Glu Asn Leu Gln Val Thr Asn Glu Phe Gln Thr 850 855 860Val Asp Leu Leu Ile Lys Asp Asn Gly Asn Leu Cys Asp Tyr Asp Thr865 870 875 880Gln Asn Ile Leu Glu Leu Lys Lys Tyr Val Thr Asp Arg Lys Ser Ala 885

890 895Glu Gln Asn Glu Ser Lys Ile Asn Lys Leu Arg Asn Lys Val Asn Trp 900 905 910Lys Thr Glu Ile Ile Ser Glu Met Asn Gln Ile Tyr Glu Asp Asn Asp 915 920 925Lys Asp Ala His Val Gln Glu Ser Tyr Thr Lys Asp Leu Asp Phe Lys 930 935 940Val Asn Lys Ser Lys Gln Lys Leu Glu Cys Gln Asp Ile Ile Asn Lys945 950 955 960His Tyr Met Glu Val Asn Ser Asn Glu Lys Glu Ser Cys Asp Gln Ile 965 970 975Leu Asp Ser Tyr Lys Val Val Lys Lys Arg Lys Lys Glu Ser Ser Cys 980 985 990Lys Ala Lys Asn Ile Leu Thr Lys Ala Lys Asn Lys Leu Ala Ser Gln 995 1000 1005Leu Thr Glu Ser Ser Gln Thr Ser Ile Ser Leu Glu Ser Asp Leu 1010 1015 1020Lys His Ile Thr Ser Glu Ala Asp Ser Asp Pro Gly Asn Pro Val 1025 1030 1035Glu Leu Cys Lys Thr Gln Lys Gln Ser Thr Thr Thr Leu Asn Lys 1040 1045 1050Lys Asp Leu Pro Phe Val Glu Glu Ile Lys Glu Gly Glu Cys Gln 1055 1060 1065Val Lys Lys Val Asn Lys Met Thr Ser Lys Ser Lys Lys Arg Lys 1070 1075 1080Thr Ser Ile Asp Pro Ser Pro Glu Ser His Glu Val Met Glu Arg 1085 1090 1095Ile Leu Asp Ser Val Gln Gly Lys Ser Thr Val Ser Glu Gln Ala 1100 1105 1110Asp Lys Glu Asn Asn Leu Glu Asn Glu Lys Met Val Lys Asn Lys 1115 1120 1125Pro Asp Phe Tyr Thr Lys Ala Phe Arg Ser Leu Ser Glu Ile His 1130 1135 1140Ser Pro Asn Ile Gln Asp Ser Ser Phe Asp Ser Val Arg Glu Gly 1145 1150 1155Leu Val Pro Leu Ser Val Ser Ser Gly Lys Asn Val Ile Ile Lys 1160 1165 1170Glu Asn Phe Ala Leu Glu Cys Ser Pro Ala Phe Gln Val Ser Asp 1175 1180 1185Asp Glu His Glu Lys Met Asn Lys Met Lys Phe Lys Val Asn Arg 1190 1195 1200Arg Thr Gln Lys Ser Gly Ile Gly Asp Arg Pro Leu Gln Asp Leu 1205 1210 1215Ser Asn Thr Ser Phe Val Ser Asn Asn Thr Ala Glu Ser Glu Asn 1220 1225 1230Lys Ser Glu Asp Leu Ser Ser Glu Arg Thr Ser Arg Arg Arg Arg 1235 1240 1245Cys Thr Pro Phe Tyr Phe Lys Glu Pro Ser Leu Arg Asp Lys Met 1250 1255 1260Arg Arg 12652145PRTyeast 21Met Glu Ser Leu Lys Lys Lys Phe Leu Lys Gln Asn Arg Glu Ile Ile1 5 10 15Lys Ile Asn Thr Gln Leu Ser Ile Lys Ile Arg Glu Ser Glu Asn Glu 20 25 30Ile Gln Asp Leu Ile Gln Glu Asn Phe Thr Leu Lys Ser 35 40 452245PRTyeast 22Val Glu Asp Leu Lys Lys Lys Gln Ile Arg Gln Tyr Lys Glu Ile Ile1 5 10 15Arg Ile Ser Lys Ala Gln Ser Ile Arg Ile Lys Glu Leu Gln Leu Glu 20 25 30Asn Glu Arg Leu Leu Ser Glu Asn Ile Asp Leu Arg Thr 35 40 452345PRTyeast 23Val Glu Asn Ile Arg Gln Ser Tyr Ser Arg Gln Asn Ser Leu Leu Ala1 5 10 15Lys Asp Asn Ser Ile Leu Lys Ile Lys Val Asn Ser Leu Glu Lys Lys 20 25 30Ile Ser Gln Leu Val Gln Glu Asn Val Thr Leu Arg Ser 35 40 452445PRTNeurospora crassa 24Leu Glu Leu Leu Arg Arg Lys Phe Leu Arg Gln Asn Arg Asp Ile Ala1 5 10 15Arg Val Asn Ser Thr Gln Ser Leu Arg Ile Arg Gly Leu Glu Asn Glu 20 25 30Cys Ala Arg Leu Leu Ser Glu Asn Leu Glu Leu Arg Gly 35 40 452545PRTDactylicapnos macrocapnos 25Gly Ser Lys Val Glu Gln Gln Tyr Lys Leu Leu Asn Ala Glu Leu Met1 5 10 15Asp Gln Val Gln Lys Gln Arg Leu Glu Ile Gly Glu Tyr Arg Lys Arg 20 25 30Val Ile Ser Leu Glu Arg Glu Ile Met Asp Ile Arg Glu 35 40 452627PRTyeast 26Gly Arg Glu Lys Leu Arg Arg Ser Val Lys Val Ile Asn Tyr Ala Ile1 5 10 15Pro Ser Leu Arg Thr Lys Leu Arg Arg Asp Phe 20 252727PRTyeast 27Pro Asp Gly Arg Ser Arg Arg Glu Arg Lys Lys Val Asn Tyr Ala Leu1 5 10 15Pro Gly Leu Arg Thr Lys Leu Arg Arg Asn Phe 20 252828PRTyeast 28Ser Phe Thr Arg Thr Arg Arg Thr Arg Gly Lys Ala Val Asp Tyr Thr1 5 10 15Leu Pro Ser Leu Arg Ala Lys Met Arg Arg Pro Ser 20 252928PRTNeurospora crassa 29Glu Thr Ser Arg Pro Ser Arg Arg Ala Arg Ala Ala Ile Ser Tyr Thr1 5 10 15Glu Pro Asn Leu Arg Asp Lys Met Arg Arg Pro Thr 20 253027PRTDactylicapnos macrocapnos 30Asn Ser Ala Arg Pro Ser Arg Ser Cys Arg Pro Thr Ser Leu Val Glu1 5 10 15Pro Ser Leu Lys Asn Lys Leu Arg Asn Gly Ser 20 253128PRTCaenorhabditis elegans 31Thr Val Arg Arg Gln Arg Ser Ala Lys Met Asn Ile Lys Ser Leu Lys1 5 10 15Glu Pro Ser Gly Lys Asp Lys Leu Arg Arg Pro Gly 20 253229PRTArabidopsis thaliana 32Thr Val Gly Arg Pro Ser Arg Gln Ala Ala Glu Lys Ile Lys Ser Tyr1 5 10 15Lys Glu Pro Ser Leu Lys Glu Lys Met Arg Gly Gly Phe 20 253329PRTArabidopsis thaliana 33Ser Val Gly Arg Pro Ser Arg His Ala Ala Glu Lys Val Gln Ser Tyr1 5 10 15Arg Glu Val Ser Leu Arg Val Lys Met Arg Arg Lys Cys 20 253428PRTmouse 34Ala Val Ala Leu Thr Lys Arg Arg Cys Ser Thr Ile Lys Ser Tyr Lys1 5 10 15Glu Pro Thr Leu Ala Ser Lys Leu Arg Arg Gly Asp 20 253525PRTmouse 35His Pro Met Arg Arg Lys Arg Gln Cys Val Pro Leu Asn Leu Thr Glu1 5 10 15Pro Ser Leu Arg Ser Lys Met Arg Arg 20 253628PRTHomo sapiens 36Ala Val Ala Leu Pro Lys Arg Arg Cys Thr Ala Ser Val Asn Tyr Lys1 5 10 15Glu Pro Thr Leu Ala Ser Lys Leu Arg Arg Gly Asp 20 253726PRTHomo sapiens 37Ser Glu Arg Thr Ser Arg Arg Arg Arg Cys Thr Pro Phe Tyr Phe Lys1 5 10 15Glu Pro Ser Leu Arg Asp Lys Met Arg Arg 20 253821DNAArtificial Sequence?TriplEx 38ctcgggaagc gcgccattgt g 213922DNAHomo sapiens 39cctggctgaa tcagctttgg tg 224023DNAArtificialhSgo1 40aagucuacug auaaugucuu att 234123DNAArtificial SequencehSgo2 41aagcacuacc acuuugaaua att 234221DNAArtificial SequencehSgo1 42gugagccucu gugaaucaat t 21 4321DNAArtificial SequencehSgo2 43gcucucauga acaauaacut t 21 4421DNAArtificial SequencesiRNA,Target1 44gagugaucac gauuucuaat t 21 4521DNAArtificial SequencesiRNA,Target2 45aacgggcauu ugaauaugaa a 21

Claims

1. An isolated DNA encoding a protein consisting of an amino acid sequence shown in SEQ ID NO: 18.

2. An isolated DNA encoding a protein comprising an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ ID NO: 18, and having a regulatory activity of chromosome segregation.

3. An isolated DNA consisting of a base sequence shown in SEQ ID NO: 17 or a complementary sequence thereof.

4. An isolated DNA containing part or whole of a base sequence shown in SEQ ID NO: 17 or a complementary sequence thereof, and encoding a protein that has a regulatory activity of chromosome segregation.

5. An isolated DNA hybridizing with the DNA according to claim 3 under stringent conditions and encoding a protein that has a regulatory activity of chromosome segregation.

6. An isolated protein consisting of an amino acid sequence shown in SEQ ID NO: 18.

7. An isolated protein consisting of an amino acid sequence where one or several amino acids are deleted, replaced or added in an amino acid sequence shown in SEQ ID NO: 18, and having a regulatory activity of chromosome segregation.

8. An isolated protein encoded by a DNA hybridizing with the antisense strand of a DNA encoding the protein according to claim 6 under stringent conditions.

9. A fusion protein in which the protein according to claim 6 is bound with a marker protein and/or a peptide tag.

10. A fusion protein in which the protein according to claim 7 is bound with a marker protein and/or a peptide tag.

11. A fusion protein in which the protein according to claim 8 is bound with a marker protein and/or a peptide tag.

12. An antibody specifically binding to the protein according to claim 6.

13. An antibody specifically binding to the protein according to claim 7.

14. An antibody specifically binding to the protein according to claim 8.

15. The antibody according to claim 12, which is a monoclonal antibody.

16. The antibody according to claim 13, which is a monoclonal antibody.

17. The antibody according to claim 14, which is a monoclonal antibody.