U.S. patent application number 12/358088 was filed with the patent office on 2009-08-13 for inhibition stat-1.
Invention is credited to Markus Hecker, Andreas H. Wagner.
Application Number | 20090203767 12/358088 |
Document ID | / |
Family ID | 7701323 |
Filed Date | 2009-08-13 |
United States Patent
Application |
20090203767 |
Kind Code |
A1 |
Hecker; Markus ; et
al. |
August 13, 2009 |
INHIBITION STAT-1
Abstract
The present invention relates to inhibitors of the transcription
factor STAT-1, their use as therapeutic means as well as their use
for the prevention or therapy of cardio-vascular complications like
restenosis after percutaneous angioplasty or stenosis of venous
bypasses, the graft versus host reaction, the
ischemia/refusion-related damage in the context of surgical
interventions and organ transplantation respectively, immunological
hypersensitivity reactions, in particular the allergic rhinitis,
the drug and food allergies, in particular urticaria and celiac
disease (sprue), contact eczema and the immune complex diseases, in
particular alveolitis, arthritis, glomerulonephritis and allergic
vasculitis, inflammatory chondro- and osteopathies, in particular
arthrosis, gout, ostitis and osteomyelitis, polyneuritis as well as
acute and subacute respectively, infection contingent and in
particular post-infectious inflammatory diseases, in particular
bronchitis, endocarditis, hepatitis, myocarditis, nephritis,
pericarditis, peritonitis and pancreatitis, including the septic
shock.
Inventors: |
Hecker; Markus; (Gottingen,
DE) ; Wagner; Andreas H.; (Gottingen, DE) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE., SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
7701323 |
Appl. No.: |
12/358088 |
Filed: |
January 22, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10491758 |
Oct 12, 2004 |
7485628 |
|
|
PCT/DE02/03748 |
Oct 2, 2002 |
|
|
|
12358088 |
|
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61P 19/06 20180101;
A61K 38/00 20130101; A61P 9/10 20180101; A61P 19/02 20180101; A61P
25/00 20180101; A61P 21/00 20180101; A61P 31/04 20180101; A61P 1/18
20180101; A61P 19/00 20180101; A61P 37/06 20180101; A61P 13/12
20180101; C12N 2310/111 20130101; A61P 1/16 20180101; A61P 11/02
20180101; A61P 29/00 20180101; A61K 48/00 20130101; A61P 9/00
20180101; A61P 11/00 20180101; A61P 17/04 20180101; A61P 37/00
20180101; A61P 17/00 20180101; A61P 7/00 20180101; A61P 37/08
20180101; A61P 43/00 20180101; A61P 1/04 20180101; C12N 15/113
20130101; C12N 2310/13 20130101 |
Class at
Publication: |
514/44.A |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; A61P 9/00 20060101 A61P009/00 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 4, 2001 |
DE |
101 48 886.6 |
Claims
1. A method for the prevention or therapy of a disease state
associated with STAT-1 activity comprising administering to a
subject in need thereof a double-stranded DNA-oligonucleotide, a
single stranded antisense-oligonucleotide, an antisense-expression
vector or a double-stranded RNA-interference-oligonucleotide that
inhibits STAT-1 activity.
2. The method according to claim 1, wherein the disease state is
cardio-vascular complications like restenosis after percutaneous
angioplasty or stenosis of venous bypasses, the graft versus host
reaction, the ischemia/refusion-related damage in the context of
surgical interventions and organ transplantation respectively,
immunological hypersensitivity reactions, in particular the
allergic rhinitis, the drug and food allergies, in particular
urticaria and celiac disease (sprue), contact eczema and the immune
complex diseases, in particular alveolitis, arthritis,
glomerulonephritis and allergic vasculitis, inflammatory chondro-
and osteopathies, in particular arthrosis, gout, ostitis and
osteomyelitis, polyneuritis as well as acute and subacute
respectively, infection contingent and in particular
post-infectious inflammatory diseases, in particular bronchitis,
endocarditis, hepatitis, myocarditis, nephritis, pericarditis,
peritonitis or pancreatitis, including the septic shock.
3. The method of claim 1, wherein said double-stranded
DNA-oligonucleotide is administered.
4. The method of claim 1, wherein said single stranded
antisense-oligonucleotide is administered.
5. The method of claim 1, wherein said antisense-expression vector
is administered.
6. The method of claim 5, wherein the vector is a plasmid
vector.
7. The method of claim 1, wherein said double-stranded
RNA-interference-oligonucleotide is administered.
8. The method of claim 1, wherein said double-stranded
DNA-oligonucleotide, said single stranded
antisense-oligonucleotide, said antisense-expression vector or said
double-stranded RNA-interference-oligonucleotide is administered by
injection, catheter, suppository, aerosol, trocar, projectile,
pluronic gel or polymer.
9. The method of claim 1, further comprising ex vivo administration
of said double-stranded DNA-oligonucleotide, said single stranded
antisense-oligonucleotide, said antisense-expression vector or said
double-stranded RNA-interference-oligonucleotide.
10. The method of claim 1, wherein administering brings said
double-stranded DNA-oligonucleotide, said a single stranded
antisense-oligonucleotide, said antisense-expression vector or said
double-stranded RNA-interference-oligonucleotide into contact with
an endothelial cell, an epithelial cell, a leukocyte, a smooth
muscle cell, a keratinocyte or a fibroblast.
Description
[0001] The present invention relates to the use of inhibitors of
the transcription factor STAT-1 for the manufacture of a medicament
for the prevention or therapy of cardio-vascular complications like
restenosis after percutaneous angioplasty or stenosis of venous
bypasses, the graft versus host reaction, the
ischemia/refusion-related damage in the context of surgical
interventions and organ transplantation respectively, immunological
hypersensitivity reactions, in particular the allergic rhinitis,
the drug and food allergies, in particular urticaria and celiac
disease (sprue), contact eczema and the immune complex diseases, in
particular alveolitis, arthritis, glomerulonephritis and allergic
vasculitis, inflammatory chondro- and osteopathies, in particular
arthrosis, gout, ostitis and osteomyelitis, polyneuritis as well as
acute and subacute respectively, infection contingent and in
particular post-infectious inflammatory diseases, in particular
bronchitis, endocarditis, hepatitis, myocarditis, nephritis,
pericarditis, peritonitis and pancreatitis, including the septic
shock.
[0002] It is a major aim of the decipherment of the human genome to
identify morbid genes (due to the mode of action of their products)
and morbid changes in the structure of these genes (polymorphisms)
respectively and to assign them to a disease pattern. Therefore a
causally determined therapy for most diseases has come into reach
if it is accepted that these are caused by a defined number of gene
products being expressed too strongly, too weakly or deficiently.
In fact the usually singular genetic defect (monogenetic diseases)
is already known for a set of hereditary diseases (e.g. cystic
fibrosis) whereas the situation for other diseases (e.g.
hypertension) turns out to be considerably more complex. The latter
are obviously not the result of a single but multiple genetic
defects (polygenetic disease) predetermining the affected persons
to develop the disease in coincidence of certain environmental
factors. Albeit this constraint the targeted intervention in the
expression of one or multiple genes affords the opportunity of a
cause- and not only a symptom-based therapy.
[0003] Transcription factors are DNA-binding proteins that attach
to the promoter region of one or multiple genes inside the cell
nucleus thereby regulating their expression, i.e. the regeneration
of the proteins these genes are coding for. Besides the
physiologically important role of controlling developmental and
differentiation processes in the human body, transcription factors
display a high potential for eliciting a disease particularly if
they activate the gene expression at a wrong point of time. In
addition (possibly the same) transcription factors can block genes
with a protective function und act predisposing for the formation
of a disease. Insofar the in the following described principle of
an anti-transcription factor therapy aims at the inhibition of
morbid genes and the activation of protective genes in
contrast.
[0004] Inflammation is a defence reaction of the organism and its
tissues against damaging stimuli aiming at the remediation of the
damage or at least its local limitation and at abolishing the cause
of damage (e.g. invaded bacteria or foreign substances). The
elicitors of an inflammation can be micro-organisms (bacteria,
viruses, fungi or parasites), foreign substances (pollen, crystals
of asbestos or silicates), destruction of the tissue by mechanical
impairment, chemical noxa and physical influences as well as
elicitors from the body itself (collapsing tumour cells, extravasal
blood, autoimmune reactions) or crystals of intra-bodily
precipitated substances (uric acid, calcium oxalate and calcium
phosphate, cholesterol).
[0005] The rapid activation of mastocytes (inside the tissue) or of
basophile granulocytes in the blood is an example for the tripping
of a very strong acute-inflammatory response and is discriminatory
for immunological hypersensitivity reactions of the immediate type
(humoral allergy type I). If the organism got into contact with an
antigen (or an allergen, respectively, in the case of
hypersensitivity) already beforehand B-lymphocytes had been
sensitised as a reaction to this. The B-lymphocytes transform into
plasmocytes in cooperation with previously sensitised CD4-positive
type 2 T-helper cells (Th2 cells) and start producing antibodies of
the IgE-type against the antigen. During this differentiation
process the co-stimulation of the B-lymphocytes via the
CD40-receptor by the Th2-cells expressing the respective ligand
(CD154) is of crucial importance. When the antigen-loaded
IgE-antibodies bind to the respective receptors (type
Fc.sub..epsilon.) on the mastocytes these start to release
different mediators of inflammation especially histamine,
interleukin-8, leukotrienes and tumour necrosis factor-.alpha.
(TNF.alpha.). Consequence of which is the attraction of
professional inflammatory cells especially of eosinophile and
neutrophile granulocytes and monocytes but also of T-lymphocytes
on-the-spot (chemotaxis). At the same time a histamine dependent
vasodilatation and increase of permeability of the endothelial
cells coating the interior vascular wall takes place. Due to the
vascular dilatation the flow velocity decreases facilitating the
establishment of the physical contact between the attracted
leukocytes and the endothelial cells. These endothelial cells being
exposed to cytokines (e.g. TNF.alpha.) and thereby already
activated display an intensified expression of selectins on their
luminal surface (e.g. E-selectin) causing a rolling along the
endothelial cells of the leukocytes and thereby the activation of
further adhesion molecules (integrins; e.g. intercellular adhesion
molecule-1 [ICAM-1] or vascular cell adhesion molecule-1 [VCAM-1]).
The leukocytes can now adhere to the vascular wall (margination)
and the histamine-related increase in permeability (loosening of
the union of endothelial cells) favours their migration into the
extravasal space (diapedese). At the same time augmented amounts of
protein rich fluid (inflammatory exudate) attain the interstitial
space forming an oedema. Circumjacent nerve endings are irritated
by the increasing pressure in the tissue and by further mediators
generated by the inflammatory cells and trigger pains making the
damage of the tissue aware.
[0006] The granulocytes which have migrated to the site of
inflammation and the monocytes which have re-differentiated into
macrophages attempt to eliminate the causers of the inflammation by
phagocytosis and lysis respectively thereby triggering the release
of inter alia proteolytic enzymes and oxygen radicals that may
damage also the surrounding tissue. In particular the activation of
the macrophages can account in many ways for the fact (e.g. by the
release of further cytokines like interleukin-1.beta. or
interleukin-6) that the entire organism is involved by the
primarily local inflammatory response in terms of an acute phase
response. Representative characteristics of an acute phase response
are fatigue, lassitude and fever, an increased release of
leukocytes from the bone marrow (leukocytosis), the detection of
acute phase proteins in the blood (e.g. C-reactive protein), the
stimulation of the immune system as well as weight loss due to a
changed status of the metabolism.
[0007] If the cause of the inflammation can be eliminated the
process of wound healing falls into line with the destroyed tissue
being repaired. At best this amounts to an entire re-establishment
(restitutio ad integrum), whereas bigger lesions or an excessive
production of connective tissue (especially collagen) result in the
formation of a scar which is possibly associated with considerable
dysfunctions depending on the affected tissue. If the cause cannot
be eliminated at once (foreign substances or wound infection) the
wound healing is delayed at simultaneous increase of the
immigration and activity of the phagocytes bringing about the doom
of the tissue (necrosis) up to the formation of cavities (abscess).
The result is almost always a scarred re-structuring of the tissue
with a respective loss of function. If the local limitation of the
inflammation which is derived from the causative agent does not
succeed, the inflammation spreads over the entire organism via the
lymphatic system. The consequence is a sepsis with a possibly fatal
upshot (septic shock).
[0008] Wound healing is also interfered with if the inflammatory
and the healing process are in balance. The result is a chronic
inflammation which may be fibrosing (excessive synthesis of
collagen) or granulomatous (organisation of inflammatory cells into
a granulation tissue) and usually brings about a continuous
destruction and increasing constraint of functionality of the
affected tissue respectively.
[0009] Besides the depicted common inflammatory response which may
degenerate chronically there are inflammatory diseases that exhibit
both common grounds and distinct differences with regard to the
underlying pathogenesis. Two inflammatory diseases of such kind are
for example complications after cardio-surgical interventions and
the immunological hypersensitivity reactions which more space in
this specification is dedicated to because of their enormous
clinical relevance.
[0010] The balloon-tipped catheter based mechanical dilatation
(percutaneous angioplasty) and the bypassing of
arteriosclerotically stenosed arteries by means of venous bypasses
respectively still constitute the therapies of choice in patients
with coronary and peripheral circulatory disorders respectively in
order to provide protection against an imminent infarction or organ
failure. But the rate of re-occlusion (restenosis) of the arteries
which were mechanically dilated and (in the majority of cases)
treated with a metallic vascular support (stent) appears
unacceptably high with 20-50% within 6 months. Also the rate of
re-occlusion of aortocoronary and peripheral venous bypasses
respectively with 50-70% after 5 years is more than dissatisfactory
for the treated patients in particular against the background of
the risk around the procedure and the postoperative risk
respectively. Presumably because of the damage of the vascular wall
(hereby both the endothelial and the smooth muscle cells being
affected) the restenosis after angioplasty shows particularly in
the early stage a pronounced inflammatory component being
characterised inter alia by the infiltration of the vascular wall
with professional inflammatory cells (above all monocytes and
T-lymphocytes). The fibro-proliferating stenosis formation (intimal
hyperplasia) in aortocoronary and peripheral venous bypasses
respectively seems to be based also on a inflammatory reaction
which in particular is caused by mechanical and physical noxa. It
has been known for a long time also that the so called
ischemia/refusion-related damage in the context of surgical
interventions or organ transplantations is accompanied by an
inflammatory-based tissue damage in which the interaction between
endothelial cells and professional inflammatory cells (above all
granulocytes but also monocytes and T-cells) as well as the release
of tissue damaging substances (oxygen radicals, cytokines) play a
quite crucial role.
[0011] In connection with the mentioned cardio-vascular
complications it is important that there are protective mechanisms,
above all in the endothelial and smooth muscle cells of the
vascular wall, which help to limit the extent of the inflammatory
response and the subsequent adaptive re-structuring of the tissue.
To this for example belongs the synthesis of nitric oxide (NO) by
the NO-synthase in the endothelial cells. NO, probably featuring
the endogenous antagonist of the oxygen radical superoxide,
inhibits inter alia the expression of pro-inflammatory chemokines
(e.g. monocyte chemoattractant protein-1, MCP-1) and of adhesion
molecules (e.g. ICAM-1) in endothelial cells, the expression of
receptors for growth factors in smooth muscle cells (e.g.
endothelin B-receptor) as well as the release of growth factors
from leukocytes. Insofar it is easy to comprehend that a mechanical
damage just as a functional damage of the endothelium (e.g. by a
cytokine-induced reduction of the expression of the NO-synthase in
these cells) counteract the processes of inflammation and
subsequent fibro-proliferating re-structuring of the vascular wall
which form the basis for the mentioned cardio-vascular
complications.
[0012] All previous attempts to check the restenosis after
angioplasty medicamentously have not achieved the desired effect in
the majority of patients. At present two local principles of
therapy are favoured: the already approved vascular brachytherapy,
a method for checking the cell growth by short-time radioactive
irradiation of the dilated vascular section and the drug-eluting
stents which are still in the clinical trial. This method comprises
polymer coated stents which are "impregnated" by growth inhibiting
medicaments (cytostatic and immunosuppressive agents) and release
them slowly during a period of several weeks. Most recent clinical
studies prove that both therapeutic approaches are not exempt from
to some extent serious problems (e.g. in-stent-thrombosis running
the danger of an infarction) despite of encouraging results at the
beginning.
[0013] Besides the already delineated immunological type
I-incompatibility reaction there are in principle four other forms
of allergy and dysfunctions in the immune regulation respectively.
The type I-reaction itself can in principal be sorted into two
phases after allergisation was accomplished: the rapid release and
regeneration of vascularly active inflammatory mediators from
IgE-spiked mastocytes and the late reaction which is mediated by
the attracted eosinophile and neutrophile granulocytes. The
complete type I-reaction can take place either locally or
systemically in dependence on the exposure to the allergen.
Allergens in the respiratory air elicit reactions in the
respiratory tract, typically accompanied by mucosal oedemas and
hypersecretion (allergic rhinopathy, hay fever) as well as
bronchospasm (asthma) whereas allergens in the nourishment elicit
gastrointestinal symptoms like nausea, vomitus and diarrhoea. The
skin reacts on allergens with itching and urticaria as well as
atopic dermatitis (neurodermatitis) But if the allergen gains
direct access to the bloodstream (e.g. infusion of blood products,
medicaments) or if the exposure to the allergen is especially
strong, a systemic immediate reaction results possibly entailing a
life-threatening decrease of the blood pressure (anaphylactic
shock).
[0014] In the case of the type II-reaction antigenically active
cells (e.g. extraneous blood cells) or extracellular proteins (e.g.
medicament-induced changes at the surface of a cell naturally
produced in the body) take centre stage. After allergisation the
second contact leads to the production of allergen-specific
antibodies of the IgG- and IgM-type which bind to the allergenic
cell in great quantities (opsonisation). Hereby the complement
system (formation of a membrane attacking complex) and a special
subpopulation of lymphocytes, the natural killer cells (NK-cells),
are activated. The result is a destruction of the allergenic cell
by cytolysis. A similar reaction is elicited when auto-antibodies
attach to structures that are naturally produced in the body such
as the basal membrane of the glomerular capillaries and thereby
eliciting a rapidly progressive glomerulonephritis with imminent
renal insufficiency. Besides the type 1 T-helper cells (Th1-cells,
see below) the activated NK-cells are the main producers of
interferon-.gamma., a cytokine that massively intensifies the
inflammatory response in particular by the activation of
macrophages.
[0015] The type III-reaction is characterised by the formation and
deposition of immune-complexes (antigen-antibody-complexes) with
subsequent activation of the complement system and phagocytes
(granulocytes, macrophages). They circulate in the blood and
successively deposit mainly in the capillaries of the renal
glomeruli but also in the joints or in the skin. The hereby
elicited inflammatory response may bring about a (immune-complex-)
glomerulonephritis, pains in the joints as well as urticaria.
Infections can also elicit a systemic type III-reaction if the
immune system fails to eliminate the causative agent (e.g.
streptococci). Representative local type III-reactions are the so
called Arthus-reaction in the skin after an immunisation or the
exogenous allergic alveolitis in the case of deposition of
antigen-antibody-complexes in the lung (e.g. bird-breeder's lung).
The systemic lupus erythematodes is a type III-reaction as well but
in terms of an autoimmune disease due to the formation of
auto-antibodies.
[0016] In contrast to the hypersensitivity reactions mentioned
before the type IV-reaction is not humoral but cell constrained and
reaches its maximum usually not until after several days (delayed
type of reaction or delayed type hypersensitivity). Elicitors are
mainly proteins, invaded foreign organisms (bacteria, viruses,
fungi and parasites), other foreign proteins (e.g. wheat-derived
gliadin in the case of celiac disease) as well as haptens
(medicaments, metals [e.g. nickel in the case of contact
dermatitis], cosmetics and plant components). The primary rejection
of transplanted organs is also a type IV-reaction. The antigen is
phygocytised by (tissue) macrophages, processed and presented to
naive T-helper cells (CD4-positive); the allergisation of the
T-helper cells takes several days. At the second contact the in
such a way sensitised T-helper cells alter in Th1-cells; thereby
the CD154-mediated co-stimulation of the antigen-presenting cell
(this one expresses the CD40-receptor) plays an important role
because this signalling pathway triggers the release of
interleukin-12 from the macrophages. Interleukin-12 initiates the
differentiation and proliferation of the T-helper cells. The
Th1-cells on their part excite the formation of monocytes in the
bone marrow by certain growth factors (e.g. GM-CSF), recruit these
by means of certain chemokines (e.g. MIF) and activate them by the
release of IFN.gamma.. The hence resulting very strong inflammatory
response may destroy tissue normally produced in the body (e.g.
tuberculosis) or transplanted tissue in a large scale. Moreover
CD8-positive cytotoxic T-cells are involved in the transplant
rejection (cytolysis) with the CD8-positive cytotoxic T-cells being
able to recognise their target (the foreign cell surface) and to
"arm" themselves accordingly only by a preceding
antigen-presentation like the CD4-positive Th1-cells.
[0017] A dysfunction of the immune regulation similar to a type
IV-reaction forms the basis for e.g. the rheumatoid arthritis or
the multiple sclerosis (auto-reactive Th1-cells) as well as for
diabetes mellitus (auto-reactive cytotoxic T-cells). T-cells being
directed against certain antigens of the causative agent (e.g.
streptococci) which cross-react with auto-antigens (produced in the
body; molecular mimicry) might potentially play a role at these
autoimmune diseases besides bacterial super-antigens (e.g. the
causative agent of TBC) and the according genetic predisposition
(MHC-proteins, Th1/Th2-imbalance). In contrast, type V-reactions
may be evoked inter alia by activating or blocking auto-antibodies
of hormone--(e.g. thyrotropin in the case of Basedow's disease) or
neurotransmitter-receptors (e.g. acetylcholine in the case of
myasthenia gravis).
[0018] Comparable with the transplant rejection--yet in the reverse
sense--is the graft versus host disease (GVHD) which appears in the
course of allogenic bone marrow transplantations (between
genetically non identical individuals) in about 40% of the
recipients. During the acute-phase lasting up to three months the
T-cells of the donor which have been transfused with the stem cells
attack the host organism. The resulting possibly severe
inflammation response becomes manifest preferably in the skin, the
gastrointestinal tract and in the liver.
[0019] For the treatment of acute inflammatory diseases in
dependence on to the assumed cause usually non-steroidal
antiphlogistics (NSAIDs, inter alia inhibition of the synthesis of
prostaglandins) and/or anti-infectious agents (devitalisation of
bacteria, fungi or parasites) and antiviral chemotherapeutics
respectively, contingently also glucocorticoids (general inhibitors
of gene expression) in a local application, are utilised. In the
case of severe or chronically recurring inflammatory diseases
glucocorticoids or immunosuppressive agents (inhibition of the
T-cell-activation) or cytostatics such as methotrexate are
systemically administered. This also applies to the transplantation
of organs and bone marrow respectively. Despite of their
undisputable therapeutic effect a systemic administration of the
mentioned pharmaceuticals can evoke severe side effects especially
when permanently used. So for example up to 25% of the patients who
take methotrexate for 2 or more years develop a severe cirrhosis of
the liver. More recent active agents that are used in particular
with chronically recurring inflammatory diseases block the
pro-inflammatory effect of TNF.alpha.: antibodies directed against
the cytokine itself and its receptor respectively, low-molecular
antagonists of the receptor as well as a recombinantly produced,
soluble receptor protein that traps the cytokine. But there is a
growing number of indications for an increased incidence of
infectious diseases during the therapy with the receptor protein
(inter alia tuberculosis), and about 40% of the patients do not
seem to respond to the therapy at all (non-responder). Also for the
approved humanised TNF.alpha.-antibody there are according warning
notices concerning the incidence of infections ranging up to sepsis
2-4 years after the start of the therapy. Moreover both active
agents are contraindicated during an acute incident. In addition
low-molecular antagonists of the receptor are approved for
leukotrienes which are mainly used in the therapy of asthma as well
as inhibitors of the cyclooxigenase-2, a new group of non-steroidal
antiphlogistics (NSAIDs) with considerably reduced gastrointestinal
side effects in comparison to the classical NSAIDs. Moreover there
is a series of further--usually humanised--antibodies or
antisense-oligonucleotide based approaches against adhesion
molecules of leukocytes and endothelial cells respectively,
cytokine receptors of T-helper cells or IgE-antibodies which are
residing in different phases of the clinical trial. To refrain from
the glucocorticoids and the anti-infectious agents as a group, the
mentioned pharmaceuticals have in common to be directed
specifically against a target molecule which is of relevance for
the therapy.
[0020] The present invention is therefore based on the problem to
provide substances for the prevention or therapy of cardio-vascular
complications like restenosis after percutaneous angioplasty or
stenosis of venous bypasses, the graft versus host reaction, the
ischemia/refusion-related damage in the context of surgical
interventions and organ transplantation respectively, immunological
hypersensitivity reactions, in particular the allergic rhinitis,
the drug and food allergies, in particular urticaria and celiac
disease (sprue), contact eczema and the immune complex diseases, in
particular alveolitis, arthritis, glomerulonephritis and allergic
vasculitis, inflammatory chondro- and osteopathies, in particular
arthrosis, gout, ostitis and osteomyelitis, polyneuritis as well as
acute and subacute respectively, infection contingent and in
particular post-infectious inflammatory diseases, in particular
bronchitis, endocarditis, hepatitis, myocarditis, nephritis,
pericarditis, peritonitis and pancreatitis, including the septic
shock which constitute a broader (knowingly not mono-specific) and
thereby a potentially more effective therapeutic approach.
[0021] The problem is solved by the subject-matter defined by the
patent claims.
[0022] The invention is elucidated by the following figures in
greater detail:
[0023] FIG. 1 shows the inhibition of the cytokine-stimulated
expression of CD40 (a, c, d and e), E-selectin and MCP-1 (a) and of
the CD40-ligand-induction of the interleukin-12p40-expression (b)
in cultivated human endothelial cells by neutralisation of the
transcription factor STAT-1 by means of an according
cis-element-decoy (SEQ ID NO: 33). (a) Representative
RT-PCR-analysis of the E-selectin, MCP-1 and CD40 mRNA-expression
(in addition the densitometric analysis ("intensity") specified in
% of the stimulated control and referring to the internal standard
EF-1) in endothelial cells which had been pre-incubated with a
STAT-1 (SEQ ID NO: 33) or NF-.kappa.B cis-element decoy (10 .mu.M)
for 4 hours and subsequently incubated with 100 U/ml tumour
necrosis factor-.alpha. and 1000 U/ml interferon-.gamma. for 9
hours. (b) Representative RT-PCR-analysis of the mRNA-expression of
interleukin-12p40 (in addition the densitometric analysis
("intensity") specified in % of the stimulated control and
referring to the internal standard rp132) in endothelial cells
which had been pre-incubated with a STAT-1 cis-element decoy (10
.mu.M; SEQ ID NO: 33) for 4 hours and subsequently incubated with
about 670000 P3xTB.A7-cells/ml (these mouse myeloma cells stably
express the human CD40-ligand CD154) and 1000 U/ml
interferon-.gamma. for 12 hours. (c) Representative RT-PCR-analysis
of the CD40 mRNA-expression (in addition the densitometric analysis
("intensity") specified in % of the stimulated control and
referring to the internal standard EF-1) in endothelial cells which
had been pre-incubated with a STAT-1 cis-element decoy (SEQ ID NO:
33) or the respective control oligonucleotide (STAT-1-25mut) for 4
hours (concentration 10 .mu.M) and subsequently incubated with 100
U/ml tumour necrosis factor-.alpha. and 1000 U/ml
interferon-.gamma. for 9 hours. (d) Statistical summary of 5
independent experiments on the effect of the STAT-1 cis element
decoys (SEQ ID NO: 33) on the cytokine-stimulated CD40
mRNA-expression the cultivated endothelial cells (*p<0.05 versus
the stimulated control cells). (e) Representative
western-blot-analysis in addition to the densitometric analysis
("intensity" specified in % of the stimulated control and referring
to the internal standard .beta.-actin) of the effect of the STAT-1
cis element decoys (SEQ ID NO: 33) on the cytokine-stimulated CD40
protein-expression the cultivated endothelial cells after 24 hours.
Comparable results were obtained in further experiments.
[0024] FIG. 2 shows the inhibition of the cytokine-induced
expression of the CD40 gene in human cultivated endothelial cells
by the antisense-oligonucleotide based down regulation of the
expression of the transcription factor STAT-1. (a) Expression of
the CD40- and STAT-1-protein respectively under resting conditions
and after incubation of the cells with 100 U/ml tumour necrosis
factor-.alpha. and 1000 U/ml interferon-.gamma. for 14 hours. The
left panel of the picture shows the statistical summary of 2-4
experiments with different batches of cells, the right panel of the
picture shows each a representative western-blot-analysis in
addition to the densitometric analysis ("intensity") specified in %
of the non-stimulated control and referring to the internal
standard .beta.-actin (*p<0.05 versus the non-stimulated control
cells). (b) Comparable inhibition of the CD40- and STAT-1-protein
expression in stimulated endothelial cells by a pre-treatment with
a STAT-1-antisense-oligonucleotide (1 .mu.M; SEQ ID NO: 33) for 24
hours. Summary of 2 experiments (left panel of the picture;
*p<0.05 versus the stimulated control cells) and representative
western-blot-analysis (right panel of the picture).
[0025] FIG. 3 shows the inhibition of the expression of the
transcription factor IRF-1 in the monocyte-cell-line THP-1 (a) as
well as of the inducible isoform of the NO-synthase in cultivated
human smooth muscle-cells (b) by the neutralisation of the
transcription factor STAT-1 by means of a respective cis-element
decoy (SEQ ID NO: 33). (a) Representative western-blot-analysis in
addition to the densitometric analysis ("intensity") specified in %
of the stimulated control and referring to the internal standard
0-actin. The cultivated THP-1-cells were pre-incubated with the
cis-element decoy (10 .mu.M) for 4 hours and subsequently incubated
with 100 U/ml tumour necrosis factor-.alpha. and 1000 U/ml
interferon-.gamma. for 3 hours. (b) Left panel of the picture:
statistical summary of 3 experiments with different batches of
cultivated human smooth muscle cells which had been pre-incubated
with a STAT-1 (SEQ ID NO: 33), a NF-.kappa.B or a GATA-2
cis-element decoy (10 .mu.M) for 4 hours and subsequently incubated
with 1000 U/ml interferon-.gamma., 60 U/ml interleukin-1.beta., 100
U/ml tumour necrosis factor-.alpha. and 1 .mu.g/ml of a bacterial
lipopolysaccharide for 9 hours. RT-PCR-analysis of the
mRNA-expression for the inducible isoform of the NO-synthase
(*p<0.05 versus the stimulated cells=100%). Right panel of the
picture: statistical summary of 3 experiments with different
batches of cells and representative western-blot-analysis of the
inhibition of the cytokine-stimulated expression of the NO-synthase
protein (after 20 hours of exposition) by pre-incubation with the
STAT-1 (SEQ ID NO: 33) and NF-.kappa.B cis-element decoy
respectively (*p<0.05 versus the stimulated cells=100%).
[0026] FIG. 4 shows the neutralisation of endogenous STAT-1 in
extracts of cell nuclei of the monocyte-cell-line THP1 by different
cis-element decoys (SEQ ID NO: 17, 25, 29, 31, 33, 35, 37, 39 and
the mutated control-oligonucleotides STAT-1-19mut and
STAT-1-25mut). Representative EMSA-analysis. Cultivated THP-1 cells
were incubated with 100 U/ml tumour necrosis factor-.alpha. and
1000 U/ml interferon-.gamma. for 3 hours and subsequently used for
the preparation of nuclear extracts. The nuclear extract of the
cells was co-incubated with the [.sup.32P]-labelled double stranded
SIE-oligonucleotide (Santa Cruz Biotochnologie, Heidelberg,
Germany) and the respective cis-element-decoys and
control-oligonucleotides respectively at room temperature for 20
minutes and was subsequently subjected to the electrophoretic
mobility shift-analysis.
[0027] FIG. 5 shows the effect of selected STAT-1 cis-element
decoys (SEQ ID NO: 17, 31, 35, 37) on the expression of E-selectin
and MCP-1 mRNA in human smooth muscle cells from the thymus vein.
The cultivated cells (passage 2) were pre-incubated with the
respective cis-element decoys (10 .mu.M) for 4 hours and
subsequently incubated with 100 U/ml tumour necrosis factor-.alpha.
and 1000 U/ml interferon-.gamma. for 9 hours. Representative
RT-PCR-analysis, comparable results were obtained in further
experiments.
[0028] FIG. 6 schematically shows the structure of the
STAT-1-antisense-expression vector pCI/Stat1 AS in terms of a gene
map.
[0029] FIG. 7 shows the result of the neutralisation of STAT-1 in
human cultivated endothelial cells by different cis-element decoys
(SEQ ID NO: 17, 19, 27, 33 and 39). Representative EMSA-analysis in
addition to the densitometric analysis ("intensity"). The
cultivated endothelial cells were incubated with the
decoy-oligonucleotides (10 .mu.mol/l) for 4 hours and subsequently
stimulated with 100 U/ml tumour necrosis factor-.alpha. and 1000
U/ml interferon-.gamma. for 30 min. For the EMSA-analysis nuclear
extracts of the stimulated cells and the [.sup.32P]-labelled double
stranded SIE-oligonucleotide (Santa Cruz Biotechnologie,
Heidelberg, Germany) were used.
[0030] FIG. 8 shows the histological analysis of the effect of a
STAT-1 decoy-oligonucleotide (STAT-icons, 10 nmol, SEQ ID NO: 19)
but not of a mutated control-oligonucleotide (STAT-1mut, 10 nmol,
SEQ ID NO: 61) on the DNCB-induced contact-dermatitis in male
guinea pigs (original .times.400, typical result of 17 examined
guinea pigs in total).
[0031] The inventors have characterised the transcription factors
which take part in the cytokine-mediated increase of the expression
of pro-inflammatory gene products (CD40, E-selectin, inducible
isoform of the NO-synthase, interleukin-12 [p40], MCP-1) in human
endothelial- and smooth muscle cells as well as in monocytes.
Thereby it could be shown that there is a synergism between the
transcription factors nuclear factor .kappa.B (NF-.kappa.B) and the
signal transducer and activator of transcription-1 (STAT-1) in the
case of the stimulation of the cultivated endothelial cells with
TNF.alpha. and CD154 respectively in combination with IFN.gamma..
The same holds true for the cultivated smooth muscle cells and
monocytes respectively.
[0032] IFN.gamma. alone was able to increase the expression of CD40
in human endothelial cells but not the one of E-selectin or
interleukin-12. For the expression of those two gene products which
are hardly and non-constitutively respectively expressed in
endothelial cells a simultaneous stimulation of the cells with
TNF.alpha.: (E-selectin) and CD154 (interleukin-12) respectively is
essential. Furthermore the de novo expression of an additional
transcription factor, the interferon regulatory factor-1 (IRF-1),
is necessary for the IFN.gamma.-mediated increase of the expression
of CD40 but not of E-selectin in the endothelial cells and
monocytes. In the scope of these analyses it could be shown that
the IRF-1-protein expression is considerably weaker in the case of
the mono-stimulation of the cells with IFN.gamma. and in particular
with TNF.alpha. than in the presence of both cytokines. According
to this the transcription factors NF-.kappa.KB and STAT-1 act
synergistically in the case of the transcription of the IRF-1 gene,
too (Ohmori et al., J. Biol. Chem., (1997), 272, 14899).
[0033] STAT-1 (GenBank Accession Number NM007315 and XM010893 and
http://transfac.gbf.de/cgi-bin/qt/getEntry.p1?t0149 respectively)
belongs to a group of transcription factors which comprises at
least 6 members. The product of the STAT-1 gene is expressed
constitutively by most of the cells but usually exists as an
inactive monomeric protein (91 kDa) in the cytoplasm. The
tyrosine-phosphorylation of this p91-subunit and the subsequent
association (dimerisation) of two of such p91-subunits (called
STAT-1.alpha.) enables the transport of the from now on active
transcription factor into the nucleus of the cell. A
hetero-dimerisation with the p84-subunit of STAT-1.beta.
(differentially spliced product of the same gene) is also possible.
The phosphorylation of the constitutively existing subunits occurs
via cytoplasmic janus-kinases in dependency of the stimulus. So
both janus-kinases (Jak1 and Jak2) are stimulated by IFN.alpha.
(recruited better to the interferon receptor); on the contrary, the
most important stimulus in terms of (patho)physiology for the
activation of STAT-1, IFN.gamma., only stimulates Jak2. Different
growth factors and peptide hormones (e.g. angiotensin II) activate
STAT-1 as well; besides the intrinsic (growth factor)
receptor-tyrosine-kinases also a mitogen-activated protein kinase
(MAP-kinase) plays a role at this. In contrast to STAT-1.alpha.
STAT-1.beta. has no transactivating, i.e. the gene expression
stimulating, activity.
[0034] STAT-1 takes part in the expression of a series of
potentially pro-inflammatory gene products in leukocytes,
endothelial cells and smooth muscle cells whereby the activation of
the transcription factor usually occurs in an IFN.gamma.-dependent
way. An exception is in particular the STAT-1-dependent expression
of interleukin-6 in angiotensin II-stimulated smooth vascular
muscle cells (Schieffer et al., Circ. Res. (2000), 87, 1195).
[0035] One aspect of the present invention relates to the use of
inhibitors of the activity of the transcription factor STAT-1 for
the manufacture of a medicament for the prevention or therapy of
cardio-vascular complications like restenosis after percutaneous
angioplasty or stenosis of venous bypasses, the graft versus host
reaction, the ischemia/refusion-related damage in the context of
surgical interventions and organ transplantation respectively,
immunological hypersensitivity reactions, in particular the
allergic rhinitis, the drug and food allergies, in particular
urticaria and celiac disease (sprue), contact eczema and the immune
complex diseases, in particular alveolitis, arthritis,
glomerulonephritis and allergic vasculitis, inflammatory chondro-
and osteopathies, in particular arthrosis, gout, ostitis and
osteomyelitis, polyneuritis as well as acute and subacute
respectively, infection contingent and in particular
post-infectious inflammatory diseases, in particular bronchitis,
endocarditis, hepatitis, myocarditis, nephritis, pericarditis,
peritonitis and pancreatitis, including the septic shock, for the
attenuation of the STAT-1-dependent expression of pro-inflammatory
gene products in the scope of inflammatory responses.
[0036] Proteins, including also STAT-1, can be inhibited in their
activity in very different ways. So e.g. anti-STAT-1-antibodies as
well as natural or synthetic substances can be used which reduce
the STAT-1-interaction with the DNA, i.e. reducing the
transactivation activity. Further the signalling pathways (Jak1,
Jak2, receptor tyrosine-kinases, MAP-kinases), which lead to the
activation of STAT-1, could be inhibited. Preferred methods for the
specific inhibition of the activity of STAT-1 are: [0037] 1. The
neutralisation of the activated transcription factor by a
decoy-oligonucleotide, [0038] 2. the inhibition of the
STAT-1-protein expression by means of an antisense-oligonucleotide,
[0039] 3. the inhibition of the STAT-1-protein expression by means
of an antisense-expression vector, and [0040] 4. the inhibition of
the STAT-1-protein expression by the application of double stranded
RNA-oligonucleotides (dsRNA-interference).
[0041] The herein used terms "decoy-oligonucleotide" or
"cis-element decoy" refer to a double stranded DNA-molecule and a
double stranded DNA-oligonucleotide respectively. Both DNA-strands
exhibit a complementary sequence. In the present invention the
cis-element decoy exhibits a sequence which is in accordance or
similar to the natural STAT-1 core binding-sequence in the genome
and which is bound by the transcription factor STAT-1 inside the
cell. Thus the cis-element decoy acts as a molecule for the
competitive inhibition (better neutralisation) of STAT-1.
[0042] A preferred method for the specific inhibition of the
STAT-1-activity is the use of double stranded DNA-oligonucleotides,
also called cis-element decoy or decoy-oligonucleotide, containing
a binding site for STAT-1. The exogenous supply of a great number
of transcription factor binding sites to a cell, in particular in a
much higher number then present in the genome, generates a
situation in which the majority of a certain transcription factor
binds specifically to the respective cis-element decoy and not to
its endogenous target binding site. This approach for the
inhibition of the binding of transcription factors to their
endogenous binding site is also called squelching. Squelching (or
better neutralisation) of transcription factors using cis-element
decoys was applied successfully to inhibit the growth of cells.
Hereby DNA-fragments were used which contained the specific
transcription factor binding site of the transcription factor E2F
(Morishita et al., PNAS (1995) 92, 5855).
[0043] The sequence of a nucleic acid which is used for the
prevention of the binding of the transcription factor STAT-1 is
e.g. the sequence which STAT-1 naturally binds to inside the cell.
STAT-1 binds specifically to the motive with the sequence
5'-NNNSANTTCCGGGAANTGNSN-3' in which the denotation is as follows:
N=A, T, C or G and S=C or G. The exact consensus with the
underlined bases and the distance between these bases are
imperative for an effective binding of STAT-1. Therefore the
cis-element decoy according to the invention may exhibit the
following 11-mer consensus-core binding sequence: 5'-NTTNCBGDAAN-3'
(SEQ ID NO: 1) in which the denotation is as follows: B=C, G or T,
D=A, G or T and N=A, T, C or G. Furthermore the cis-element decoy
can be larger than the 11-mer core binding site and be elongated at
the 5'-end and/or at the 3'-end. According mutations in the region
of the core binding sequence lead to the deprivation of the binding
of STAT-1 to the decoy-oligonucleotide.
[0044] Since the cis-element decoy is a double stranded nucleic
acid the DNA-oligonucleotide according to the invention comprises
not only the sense- or forward-sequence but also the complementary
antisense- or reverse-sequence. Preferred DNA-oligonucleotides
according to the invention exhibit an 11-mer core binding sequence
for STAT-1:
TABLE-US-00001 5'-ATTACCGGAAG-3', (SEQ ID NO: 3) 5'-ATTCCGGTAAG-3',
(SEQ ID NO: 5) 5'-ATTCCTGGAAG-3', (SEQ ID NO: 7) 5'-ATTCCTGTAAG-3',
(SEQ ID NO: 9) 5'-GTTCCAGGAAC-3', (SEQ ID NO: 11)
5'-GTTCCCGGAAG-3', (SEQ ID NO: 13) 5'-GTTCCGGGAAC-3', (SEQ ID NO:
15)
whereas the respective complementary sequences are not depicted
here. But the cis-element decoy can also exhibit a sequence
differing from the previous sequence and be longer than an
11-mer.
[0045] Particularly preferred are the following sequences:
TABLE-US-00002 (SEQ ID NO: 17): 5'-TGTGAATTACCGGAAGTGAGA-3',
21-mer, 2 binding sites, (SEQ ID NO: 19): 5'-TGTGAATTACCGGAAGTG-3',
18-mer, 2 binding sites, (SEQ ID NO: 21):
5'-AGTCAGTTCCAGGAACTGACT-3', 21-mer, 2 binding sites, (SEQ ID NO:
23): 5'-ATGTGAGTTCCCGGAAGTGAACT-3', 23-mer, 2 binding sites, (SEQ
ID NO: 25): 5'-ACAGTTCCGGGAACTGTC-3', 19-mer, 2 binding sites, (SEQ
ID NO: 27): 5'-GACAGTTCCGGGAACTGTC-3', 19-mer, 2 binding sites,
(SEQ ID NO: 29): 5'-GTGTATTCCGGTAAGTGA-3', 18-mer, 2 binding sites,
(SEQ ID NO: 31): 5'-TTATGTGAATTCCTGGAAGTG-3', 21-mer, 2 binding
sites, (SEQ ID NO: 33): 5'-CATGTTATGCATATTCCTGTAAGTG-3', 25-mer, 2
binding sites, (SEQ ID NO: 35): 5'-TGTGAATTCCTGTAAGTGAGA-3',
21-mer, 2 binding sites, (SEQ ID NO: 37): 5'-TGCATATTCCTGTAAGTG-3',
18-mer, 2 binding sites, (SEQ ID NO: 39): 5'-ATATTCCTGTAAGTG-3',
15-mer, 2 binding sites.
[0046] The remark "2 binding sites" thereby relates to the sense-
and antisense-strand. This listing of the preferred sequences is
not limiting. It is obvious for a person skilled in the art that a
multiplicity of sequences can be used as inhibitors for STAT-1 as
long as they exhibit the previously denoted conditions of the
11-mer consensus core binding sequence and an affinity to
STAT-1.
[0047] The affinity of the binding of a nucleic acid sequence to
STAT-1 can be assessed by the use of the electrophoretic mobility
shift assay (EMSA) (Sambrook et al. (1989), Molecular Cloning. Cold
Spring Harbor Laboratory Press; Krezesz et al. (1999), FEBS Lett.
453, 191). This test system is suited for the quality control of
nucleic acids which are intended for the use in the method of the
present invention, or for the determination of the optimal length
of a binding site. It is also suited for the identification of
other sequences which are bound by STAT-1. For an EMSA, intended
for the isolation of new binding sites, purified or recombinantly
expressed versions of STAT-1 are most suitable which are applied in
several alternating rounds of PCR-amplifications and a selection by
EMSA (Thiesen and Bach (1990), Nucleic Acids Res. 18, 3203).
[0048] Genes known for encompassing STAT-1 binding sites in their
promoter or enhancer regions or in the case of genes where there is
already functional evidence for the importance of STAT-1 in their
expression and which are therefore presumable targets for the
specific squelching by the method of the present invention, are
besides the CD40-, E-selectin-, inducible NO-synthase-, the
interleukin-12 (p40)- and the MCP-1-gene further pro-inflammatory
genes, e.g. IFN.gamma. itself, the cytokine interleukin-6, the
adhesion molecules ICAM-1, PECAM-1 (platelet endothelial cell
adhesion molecule-1), RANTES (regulated upon activation, normal
T-cell expressed, presumed secreted; solubly secreted by
T-lymphocytes) and VCAM-1, the chemokines interleukin-8, IP-10
(interferon-inducible protein-10) and Mig (monokine induced by
gamma-interferon) as well as the MHC-proteins I and II. Thereby it
does not matter whether the expression of these genes is regulated
by STAT-1 directly or indirectly (e.g. via the STAT-1-dependent
expression of IRF-1)
[0049] If a decoy-oligonucleotide according to the invention
against STAT-1 but not a respective control-oligonucleotide in
human endothelial cells is used, the cytokine-induced expression of
CD40 (both in the mono-stimulation with IFN.gamma. and in the
combination of IFN.gamma. and TNF.alpha.) is considerably inhibited
by more than 50%. This holds true also for the expression of
E-selectin and MCP-1 and interleukin-12 (p40) respectively if the
stimulation of the cells takes place with IFN.gamma. and TNF.alpha.
and CD154 respectively. According to this an elimination of the
STAT-1-activity brings about a highly significant inhibition of the
expression of a group of pro-inflammatory gene products in human
endothelial cells. Insofar one is to figure on a significant
reduction of the endothelium-leukocyte-interaction (E-selectin,
MCP-1), but also of the interaction of antigen-presenting cells
(e.g. macrophages and B-lymphocytes) with T-lymphocytes (CD40,
interleukin-12) in the scope of inflammatory diseases in the case
of this therapeutic approach. Analogously this also holds true for
the shown reduction of the cytokine-induced IRF-1-expression in the
THP-1-monocytes (and thereby of the downstream expression of
IRF-1-dependent genes) as well as of the cytokine-induced
expression of the mentioned gene products including the inducible
NO-synthase in the human smooth muscle cells.
[0050] The method of the present invention modulates the
transcription of a gene or of genes in such a way that the gene or
the genes, e.g. E-selectin, is/are not or less expressed. A
lessened or suppressed expression in the scope of the present
invention means that the rate of transcription is decreased in
comparison to cells which are not treated with a double stranded
DNA-oligonucleotide according to the present invention. Such a
decrease can be determined e.g. by northern-blot-analysis (Sambrook
et al., 1989) or RT-PCR (Sambrook et al., 1989). Usually such a
decrease is at least a 2-fold, in particular at least a 5-fold,
particularly at least a 10-fold decrease. The loss of activation
can be achieved e.g. if STAT-1 acts on a certain gene as a
transcriptional activator and therefore the squelching of the
activator leads to the loss of the expression of the target
gene.
[0051] Furthermore the method of the present invention facilitates
the release of inhibition of the expression of a gene as far as the
expression is blocked by a constitutively active or (after a
respective stimulation of the cell) by an activated transcription
factor. An example for this is the release of inhibition of the
expression of the prepro-endothelin-1-gene in native endothelial
cells of the V. jugularis of the rabbit by a cis-element decoy
against the transcription factor CCAAT/enhancer binding protein
(Lauth et al., J. Mol. Med. (2000), 78, 441). By this means the
inhibition of the expression of genes can be released whose
products exert a protective effect e.g. against inflammatory
diseases. So, e.g. the endothelial isoform of the NO-synthase,
whose product NO plays a crucial role within the suppression of the
expression of pro-inflammatory adhesion molecules and chemokines in
endothelial cells, is down regulated by IFN.gamma.
(Rosenkranz-Weiss et al. (1994), J. Clin. Invest. 93, 1875). A
cis-element decoy against STAT-1 can reverse this undesired effect
by inhibiting the binding of STAT-1 to the according binding site
in the promoter of the endothelial NO-synthase gene.
[0052] The cis-element decoy according to the present invention, in
a preferred embodiment contains one or more, preferentially 1, 2,
3, 4 or 5, particularly preferred 1 or 2 binding sites being bound
by STAT-1 specifically. The nucleic acids may be generated
synthetically, by enzymatic methods or in cells. The single methods
are state of the art and known to a person skilled in the art.
[0053] The length of the double stranded DNA-oligonucleotide is at
least as long as a used sequence which specifically binds STAT-1.
Usually the used double stranded DNA-oligonucleotide has a length
between about 11-65, preferentially between about 13-28 and
particularly preferred between 16-23 bp.
[0054] Oligonucleotides are usually rapidly degraded by endo- and
exonucleases, especially by DNases and RNases in the cell.
Therefore the DNA-oligonucleotides may be modified to stabilise
them against the degradation so that a high concentration of the
oligonucleotides is maintained in the cell during a longer period
of time. Usually such a stabilisation can be obtained by the
introduction of one or more modified internucleotide bonds.
[0055] A successfully stabilised DNA-oligonucleotide does not
necessarily contain a modification at each internucleotide bond.
Preferably the internucleotide bonds at the respective ends of both
oligonucleotides of the cis-element decoy are modified. Thereby the
last six, five, four, three, two or the last or one or more
internucleotide bonds within the last six internucleotide bonds can
be modified. Further different modifications of the internucleotide
bonds can be inserted into the nucleic acid and the thereby
emerging double stranded DNA-oligonucleotides can be assayed for
the sequence specific binding to STAT-1 using the routine EMSA-test
system. This test system allows the determination of the binding
constant of the cis-element decoy and therefore the determination
whether the affinity was changed by the modification. Modified
cis-element decoys which still show a sufficient binding can be
selected whereby a sufficient binding means at least about 50% or
at least about 75%, and particularly preferred about 100% of the
binding of the unmodified nucleic acid.
[0056] Cis-element decoys with modified internucleotide bonds which
still show a sufficient binding can be tested if they are more
stable in the cell than the unmodified cis-element decoys. The
cells "transfected" with the cis-element decoys according to the
invention are assayed for the amount of the still available
cis-element decoys at different time points. Thereby preferably a
cis-element decoy labelled with a fluorescent dye-stuff (e.g.
Texas-red) or a cis-element decoy labelled radioactively (e.g.
.sup.32P) is used with a subsequent digital fluorescence microscopy
and autoradiography or scintigraphy respectively. A successfully
modified cis-element decoy has a half-life in the cell which is
higher than the half-life of an unmodified cis-element decoy,
preferably of at least about 48 hours, more preferred of at least
about 4 days, most preferred of at least about 7 days.
[0057] Suitable modified internucleotide bonds are summarised in
Uhlmann and Peyman ((1990) Chem. Rev. 90, 544). Modified
internucleotide-phosphate-residues and/or non phosphorus-bridges in
a nucleic acid which may be used in a method according to the
present invention contain e.g. methylphosphonate, phosphorothioate,
phosphorodithioate, phosphoramidate, phosphate-ester, whereas
non-phosphorus internucleotide-analogues contain e.g.
siloxane-bridges, carbonate-bridges, carboxymethylester-bridges,
acetamidate-bridges and/or thioether-bridges. In the case of the
use of phosphorothioate-modified internucleotide bonds they
preferably should not lie between the bases cytosine and guanine
since that may lead to an activation of the target cells of the
cis-element decoy.
[0058] A further embodiment of the invention is the stabilisation
of nucleic acids by the insertion of structural characteristics
into the nucleic acids which increase the half-life of the nucleic
acid. Such structures containing hairpin- and bell-shaped DNA, are
disclosed in U.S. Pat. No. 5,683,985. At the same time, modified
internucleotide-phosphate-residues and/or non-phosphorus-bridges
can be introduced together with the mentioned structures. The
thereby resulting nucleic acids can be assayed in the above
described test system for binding and stability.
[0059] The core binding sequence may not only be present in a
cis-element decoy but also in a vector. In a preferred embodiment
the vector is a plasmid vector and in particular a plasmid vector
which is able to replicate autosomally thereby increasing the
stability of the introduced double stranded nucleic acid.
[0060] A cis-element decoy of the present invention is quickly
taken up into the cell. A sufficient uptake is characterised by the
modulation of the expression of one or more genes which are subject
to a control by STAT-1. The cis-element decoy of the present
invention preferably modulates the transcription of a gene or of
genes after about 4 hours after contacting the cell, more preferred
after about 2 hours, after about 1 hour, after about 30 minutes and
most preferred after about 10 minutes. A typical mixture being used
in such an experiment contains 10 .mu.mol/l cis-element decoy.
[0061] Furthermore the present invention relates to a method for
the modulation of the transcription of at least one gene in cells
taking part in the inflammatory events, particularly in endothelial
cells, epithelial cells, leukocytes, smooth muscle cells,
keratinocytes or fibroblasts, comprising the step of contacting the
mentioned cells with a mixture containing one or more double
stranded nucleic acids according to the invention which are able to
bind sequence-specifically to the transcription factor STAT-1. A
preferred method is e.g. the ex vivo treatment of a donation of
bone marrow containing T-lymphocytes prior to the introduction into
the recipient's body.
[0062] Furthermore the cis-element decoys according to the
invention can be administered to the patients in a composition or
be used in the method according to the invention. The composition
(in the following called mixture) containing the cis-element decoys
according to the invention is brought into contact with the target
cells (e.g. endothelial cells, epithelial cells, leukocytes, smooth
muscle cells, keratinocytes or fibroblasts). The aim of this
contacting is the transfer of the cis-element decoys, which bind
STAT-1, into the target cell (i.e. the cell which expresses
pro-inflammatory gene products in a STAT-1-dependent manner).
Therefore modifications of nucleic acids and/or additives or
auxiliary substances known to be improving the penetration of the
membrane can be used in the scope of the present invention (Uhlmann
and Peyman (1990), Chem. Rev. 90, 544).
[0063] In a preferred embodiment the mixture according to the
invention contains only nucleic acid and buffer. A suitable
concentration of the cis-element decoys resides in the range of at
least 0.1 to 100 .mu.M, preferably at 10 .mu.M, thereby one or more
suitable buffers being added. One example of such buffers is
Ringer's-solution containing 145 mmol/l Na.sup.+, 5 mmol/l K.sup.+,
156 mmol/l Cl.sup.-, 2 mmol/l Ca.sup.2+, 1 mmol/l Mg.sup.2+, 10
mmol/l HEPES, 10 mmol/l D-glucose, pH 7.4.
[0064] In a further embodiment of the invention the mixture
additionally contains at least one additive and/or auxiliary
substance. Additives and/or auxiliary substances like lipid,
cationic lipid, polymers, liposomes, nanoparticles, nucleic
acid-aptameres, peptides and proteins which are DNA-bound or
synthetic peptide-DNA-molecules are intended in order to (i)
increase e.g. the introduction of nucleic acids into the cell, in
order to (ii) target the mixture only to a sub-group of cells, in
order to (iii) inhibit the degradation of the nucleic acid in the
cell, in order to (iv) facilitate the storage of the mixture of the
nucleic acids prior to their use. Examples for peptides and
proteins or synthetic peptide-DNA-molecules are e.g. antibodies,
fragments of antibodies, ligands, adhesion molecules which may all
of them be modified or unmodified.
[0065] Additives that stabilise the cis-element decoys inside the
cell are e.g. nucleic acid-condensing substances like cationic
polymers, poly-L-lysine or polyethyleneimine.
[0066] The mixture which is used in the method of the present
invention is preferentially applied locally by injection, catheter,
suppository, aerosols (nasal and oral spray respectively,
inhalation), trocars, projectiles, pluronic gels, polymers with a
sustained release of medicaments, or any other device facilitating
the local access. The ex vivo use of the mixture, used in the
method of the present invention, allows a local access, too.
[0067] But the inhibition of the STAT-1 activity can not only be
inhibited on protein level in the previously described methods but
can be accomplished already before or during the translation of the
transcription factor protein. Therefore it is a further aspect of
the present invention to provide an inhibitor of the STAT-1-protein
expression as a therapeutic agent. This inhibitor is preferentially
a single stranded nucleic acid molecule, a so called
antisense-oligonucleotide. Antisense-oligonucleotides can inhibit
the synthesis of a target gene on three different levels, during
the transcription (prevention of the hnRNA-synthesis), during the
processing (splicing) of the hnRNA resulting in the mRNA and during
the translation of the mRNA into protein at the ribosomes. The
method for the inhibition of the expression of genes by means of
antisense-oligonucleotides is state of the art and well-known to
persons skilled in the art. A single stranded nucleic acid molecule
with any sequence can be used as an antisense-oligonucleotide as
long as the antisense-oligonucleotide is able to inhibit the
STAT-1-protein expression. Preferentially the
antisense-oligonucleotide used in the method according to the
present invention against STAT-1 has the sequence
5'-TACCACTGAGACATCCTGCCAC-3' (SEQ ID NO:41) and bridges the start
codon. Further preferred sequences for antisense-oligonucleotides
are 5'-AACATCATTGGCACGCAG-3' (SEQ ID NO: 42) and
5'-GTGAACCTGCTCCAG-3' (SEQ ID NO: 43). The
antisense-oligonucleotide can be a single stranded DNA-molecule, an
RNA-molecule or a DNA/RNA-hybrid-molecule. The
antisense-oligonucleotide can furthermore exhibit one or more
modified internucleotide bonds, e.g. as described previously for
the cis-element decoy. In the case of an antisense-oligonucleotide
which is stabilised by phosphothioate-modified internucleotide
bonds it is to be considered in particular that between the bases
cytosine and guanine no phosphorothioate-modified internucleotide
bonds are inserted because this leads to an IFN.gamma.-similar
activation of--in particular--immune-competent cells (e.g.
endothelial cells) and would therefore, at least partly, foil the
desired therapeutic effect.
[0068] The antisense-oligonucleotides according to the invention
can also be used in a composition and be administered to the
patients. The composition can be made up of stabilising additives
or auxiliary substances facilitating e.g. the introduction of the
antisense-oligonucleotides into the cell, targeting the composition
to only one subgroup of cells, preventing e.g. the degradation of
the antisense-oligonucleotides inside the cell, or facilitating
e.g. the storage of the antisense-oligonucleotide prior to use.
[0069] The antisense-oligonucleotide can not only be administered
as a single stranded nucleic acid molecule but can also be present
in a vector. In a preferred embodiment the vector is a plasmid
vector and in particular a plasmid vector which is able to
replicate autosomally thereby increasing the stability of the
introduced single stranded nucleic acid.
[0070] A further aspect of the present invention is therefore an
antisense-expression vector being expressed inside the target cells
by them after transfection and specifically inhibiting the STAT-1
expression. Thereby any available eukaryotic expression vectors
according to the state of the art may be concerned. Preferably the
pCI-plasmid of the company Promega (Catalogue No. E1731, GenBank
Accession Number U47119) is concerned, in which e.g. a 2350 bp
comprising segment of the STAT-1 gene (-121 to +2229, GenBank
Accession Number XM010893) has been cloned in the opposite
direction (3'.fwdarw.5'). This segment of the STAT-1 gene is
flanked by two EcoRI restriction sites and contains a XhoI
restriction site. Its expression is subjected to the control of the
CMV-promoter. The entire plasmid (termed pCI/Stat1 AS) comprises
6365 bp.
[0071] As described in Fire (1999), Trends Genet. 15, 358, and
Elbashir et al. (2001), Nature 411, 494, furthermore the
dsRNA-interference is a preferred method for the inhibition of the
STAT-1 activity on the level of the translation of the mRNA into
the transcription factor protein. In the case of this method an
RNA-double strand comprising exactly 21 nucleotides--whose sequence
is identical with a segment of the coding mRNA of the target
protein (STAT-1)--is introduced into the cell. Subsequently a
complex of proteins not being known in detail by now is formed
which cleaves specifically the target mRNA thereby preventing its
translation. Longer RNA-double strands cannot be used because they
elicit a response in the target cells which is comparable to the
reaction of the cells to a (viral) infection and would insofar foil
the desired therapeutic effect. Usually the
dsRNA-interference-oligonucleotide exhibits one or more
internucleotide bonds, e.g. as described previously for the
cis-element decoy.
[0072] The mixture containing the
dsRNA-interference-oligonucleotides according to the invention is
brought into contact with the target cells (e.g. endothelial cells,
epithelial cells, leukocytes, smooth muscle cells, keratinocytes or
fibroblasts). Thereby usually additives or auxiliary substances
known to be improving the penetration of the membrane are used
(Uhlmann and Peyman (1990), Chem. Rev. 90, 544).
[0073] The following figures and examples serve only for
illustration and do not limit the scope of the invention in any
respect.
1. Cell Culture
[0074] Human endothelial cells were isolated from the veins of the
umbilical cord by treatment with 1.6 U/ml dispase in HEPES-modified
tyrode-solution for 30 min. at 37.degree. C. and were cultivated on
gelatine-coated 6-well-tissue culture dishes (2 mg/ml gelatine in
0.1 M HCl for 30 min. at room temperature) in 1.5 ml M199 medium
(Gibco Life Technologies, Karlsruhe, Germany), containing 20%
foetal calf serum, 50 U/ml penicillin, 50 .mu.g/ml streptomycin, 10
U/ml nystatin, 5 mM HEPES and 5 mM TES, 1 .mu.g/ml heparin and 40
.mu.g/ml endothelial growth factor. They were identified by their
typical paving stone morphology, positive immune staining for the
von Willebrandt-factor (vWF) and by fluorimetric detection (FACS)
of PECAM-1 (CD31) as well as negative immune staining for
smooth-muscular .alpha.-actin (Krzesz et al. (1999), FEBS Lett.
453, 191).
[0075] The human monocyte-cell line TBP-1 (ATCC TIB 202) was
cultivated in RPMI 1640 medium (Life Technologies) containing 10%
foetal calf serum, 50 U/ml penicillin, 50 .mu.g/ml streptomycin and
10 U/ml nystatin. The human smooth muscle cells were isolated from
dissected thymus veins by means of the explant-technology (Krzesz
et al. (1999), FEBS Lett. 453, 191) and cultivated on
gelatine-coated 6-well-tissue culture dishes (see above) in 1.5 ml
Dulbecco's modified eagle medium, containing 15% foetal calf serum,
50 U/ml penicillin, 50 .mu.g/ml streptomycin and 10 U/ml nystatin.
They were identified by positive immune staining for smooth
muscular .alpha.-actin.
2. RT-PCR-Analysis
[0076] The endothelial total-RNA was isolated with the Qiagen
RNeasy kit (Qiagen, Hilden, Germany) followed by a cDNA-synthesis
with a maximum of 3 .mu.g RNA and 200 U Superscript.TM. II reverse
transcriptase (Life Technologies) in a total volume of 20 .mu.l
according to the manufacturers protocol. For the adjustment of the
cDNA-loading 5 .mu.l (about 75 ng cDNA) of the resulting
cDNA-solution and the primer pair (Gibco) for the elongation factor
1 (EF-1)-PCR with 1 U Taq DNA polymerase (Gibco) were used in a
total volume of 50 .mu.l. EF-1 served as an internal standard for
the PCR. The PCR-products were separated on 1.5% agarose-gels
containing 0.1% ethidium bromide and the intensity of the bands was
determined densitometrically with a CCD-camera system and the
One-Dscan gel analysis-software of Scanalytics (Billerica, Mass.,
USA) in order to adjust the volume of the cDNA in the following
PCR-analysis.
[0077] All PCR-reactions were performed separately for each primer
pair in a Hybaid OmnE Thermocycler (AWG; Heidelberg, Germany). The
individual PCR-conditions for the cDNA of human endothelial cells
from the umbilical cord were as follows: CD40 (product size 381 bp,
25 cycles, annealing temperature 60.degree. C., (forward primer)
5'-CAGAGTTCACTGAAACGGAATGCC-3' (SEQ ID NO: 44), (reverse primer)
5'-TGCCTGCCTGTTGCACAACC-3' (SEQ ID NO: 45)); E-selectin (product
size 304 bp, 33 cycles, annealing temperature 60.degree. C.,
(forward primer) 5'-AGCAAGGCATGATGTTAACC-3' (SEQ ID NO: 46),
(reverse primer) 5'-GCATTCCTCTCTTCCAGAGC-3' (SEQ ID NO: 47)); EF-1
(product size 220 bp, 22 cycles, annealing temperature 55.degree.
C., (forward primer) 5'-TCTTAATCAGTGGTGGAAG-3' (SEQ ID NO: 48),
(reverse primer) 5'-TTTGGTCAAGTTGTTTCC-3' (SEQ ID NO: 49));
IL-12p40 (product size 281 bp, 30 cycles, annealing temperature
62.degree. C., (forward primer) 5'-GTACTCCACATTCCTACTTCTC-3' (SEQ
ID NO: 50), (reverse primer) 5'-TTTGGGTCTATTCCGTTGTGTC-3' (SEQ ID
NO: 51)); rp132 (product size 368 bp, 20 cycles, annealing
temperature 60.degree. C., (forward primer)
5'-GTTCATCCGGCACCAGTCAG-3' (SEQ ID NO: 52), (reverse primer)
5'-ACGTGCACATGAGCTGCCTAC-3' (SEQ ID NO: 53); MCP-1 (product size
330 bp, 22 cycles, annealing temperature 63.degree. C., (forward
primer) 5'-GCGGATCCCCTCCAGCATGAAAGTCTCT-3' (SEQ ID NO: 54),
(reverse primer) 5'-ACGAATTCTTCTTGGGTTGTGGAGTGAG-3' (SEQ ID NO:
55).
3. Electrophoretic Mobility Shift Assay (EMSA)
[0078] The nuclear extracts and [.sup.32P]-labelled double stranded
consensus-oligonucleotides (Santa Cruz Biotechnologie, Heidelberg,
Germany), non-denaturing polyacrylamide-gel electrophoresis,
autoradiography and supershift-analysis were performed as described
in Krzesz et al. (1999), FEBS Lett. 453, 191. Thereby a double
stranded DNA-oligonucleotide was used having the following single
stranded sequence (the core binding sequence is underlined): SIE,
5'-GTGCATTTCCCGTAAATCTTGTC-3' (SEQ ID NO: 56). For the analysis of
the extrusion of endogenous STAT-1 in nuclear extracts of
cytokine-stimulated THP-1-cells (pre-monocytous human cell line) by
the various cis-element decoys, a ratio of 30:1 (STAT-1 cis-element
decoy: [.sup.32P]-labelled SEE oligonucleotide (11 fmol)) was
chosen in the EMSA-binding approach.
4. Decoy-Oligonucleotide-Technique
[0079] Double stranded decoy-oligonucleotides were generated with
the complementary single stranded phosphorothioate-linked
oligonucleotides (Eurogentec, Koln, Germany) as described in Krzesz
et al. (1999), FEBS Lett. 453, 191. The cultivated human
endothelial cells were pre-incubated at a concentration of 10 .mu.M
of the respective decoy-oligonucleotide for 4 hours. These were the
conditions which were already previously optimised, based on the
EMSA and RT-PCR-analysis. After this, the decoy-oligonucleotide
containing medium was usually replaced by fresh medium. The single
stranded sequences of the oligonucleotide were as follows (the
underlined letters indicate phosphorothioate-linked bases, each of
them in 5'-3' direction):
TABLE-US-00003 (SEQ ID NO: 57) GATA-2, CACTTGATAACAGAAAGTGATAACTCT
(SEQ ID NO: 58) NF-.kappa.B, AGTTGAGGGGACTTTCCCAGGC; (SEQ ID NO:
33) STAT-1, CATGTTATGCATATTCCTGTAAGTG; (SEQ ID NO: 59)
STAT-1-19mut, GACAGTGCAGTGAACTGTC; (SEQ ID NO: 60) STAT-1-25mut,
CATGTTATGCAGACCGTAGTAAGTG.
5. Antisense-Oligonucleotide (ODN)-Technique
[0080] For an antisense-approach 100 ml OPTI-MEM.RTM.I culture
medium was spiked with 15 .mu.l lipofectin (Gibco Life Technologie,
Karlsruhe, Germany) and incubated at room temperature (RT) for 45
minutes (solution A). Subsequently the antisense-ODN (Eurogentec,
Koln, Germany) was added to a final concentration of 0.5 .mu.M in
100 .mu.L OPTI-MEM.RTM.I culture medium (solution B). After pooling
the solutions A and B a further incubation for 15 minutes (RT)
followed. At the start of the experiments 0.8 ml of the
conventional cell culture medium of the culture of the endothelial
cells (without heparin and endothelial growth factor) were added to
an Eppendorf-tube containing the lipofectin-antisense-ODN-complexes
and the cell culture medium of the culture of endothelial cells was
replaced by the antisense-lipofectin-medium. The
antisense-lipofectin-medium was removed after 4 hours and replaced
by a fresh cell culture medium (with heparin and endothelial growth
factor). The sequence of the STAT-1-antisense-ODN was
5'-T*A*CCA*C*T*G*A*G*A*C*A*T*CC*T*GCC*A*C-3' (*
phosphorothioate-modified base; SEQ ID NO: 41).
6. Western Blot-Analysis
[0081] The human endothelial cells from the umbilical cord and
smooth muscle cells from the thymus vein were cracked by subsequent
freezing in liquid nitrogen and thawing at 37.degree. C.
(thermoblock, Kleinfelden, Germany) for five times. Protein
extracts were prepared as described in Hecker et al. (1994),
Biochem J. 299, 247. 20-30 .mu.g protein were separated by means of
a 10% polyacrylamide gel electrophoresis under denaturing
conditions in the presence of SDS following the standard protocol
and transferred to a BioTrace.TM. polyvinylidene fluoride transfer
membrane (Pall Corporation, Ro.beta.dorf, Germany). The following
primary antibodies were used for the immunological protein
detection: CD40 protein (polyclonal, 1:2000 dilution, Research
Diagnostics Inc., Flanders N.J., USA), STAT-1 protein (monoclonal,
1:5000 dilution, BD Transduction Laboratories, Heidelberg,
Germany), IRF-1 protein (polyclonal, 1:2000 dilution, Santa Cruz
Biotechnology, Heidelberg, Germany), iNOS protein (polyclonal,
1:3000 dilution, BD Transduction Laboratories, Heidelberg,
Germany). The protein bands were detected after the addition of a
peroxidase-linked anti-rabbit-IgG and--in the case of the use of
the monoclonal primary antibody--by a respective anti-mouse-IgG
(1:3000, Sigma, Deisenhofen, Germany) respectively by means of the
chemiluminescence method (SuperSignal Chemiluminescent Substrate;
Pierce Chemical, Rockford, Ill., USA) and a subsequent
autoradiography (Hyperfilm.TM. MP, Amersham Pharmacia, Biotech,
Buckinghamshireiii, England). The loading and the transfer of equal
protein amounts was shown after "stripping" of the transfer
membrane (5 minutes 0.2 N NaOH, followed by washing with H.sub.2O
for 3.times.10 minutes) by the detection of equal protein bands of
.beta.-actin with a monoclonal primary antibody and a
peroxidase-linked anti-mouse IgG (both from Sigma-Aldrich, 1:3000
dilution).
7. Statistical Analysis
[0082] If not indicated differently all data in the figures and
text are denoted as a mean value SEM of n experiments. The
statistical evaluation was performed with the students t-test for
unpaired data with a p-value<0.05 which was considered as
statistically significant.
8. Detection of the Effect of Decoy-Oligonucleotides by
Experimentation on Animals
8.1 Mouse
[0083] For the detection of the efficiency of the
decoy-oligonucleotide-based therapeutic approach developed in the
present application an animal experiment related
proof-of-concept-study in the mouse with 8-10 animals per group was
performed for the indication of an antigen-induced arthritis (for
the model see Henzgen et al., Exp. Toxicol. Pathol. (1996), 48,
255). A single application of 0.25 nmol of the
STAT-1-decoy-oligonucleotide (SEQ ID NO: 33) directly into the
joint (intra-articular injection) reduced high significantly the
antigen-induced swelling of the joint (by 35%), the intensity of
the inflammatory response (by 70%), the articular destruction (by
80%), the total arthritis-score (by 70%) and the concentration of
pro-inflammatory cytokines in the serum (e.g. interleukin-6 by 80%)
during a period of 3-14 days. In contrast, the respective
control-oligonucleotide had no therapeutic effect.
[0084] Furthermore it was noteworthy in this study that the contact
dermatitis (type-IV-reaction) which was elicited in the skin 14
days after the induction of the arthritis--thereby the antigen is
once more injected subcutaneously into the animals--was also high
significantly inhibited (by 35%) in the decoy-oligonucleotide
treated mice.
8.2 Guinea Pig
[0085] After allergisation of the guinea pigs for two times
(Hartley, male, 350 g body weight) during a period of 7 days (on
day 1 in one ear, on day 2 in the other ear with 50 .mu.l of a 10%
DNCB-solution in 50% acetone/50% olive oil each; on day 7 a boost
in the skin of the neck with 15 .mu.l of a 2% DNCB-solution in 95%
acetone/5% olive oil) the contact dermatitis is elicited by a
re-application of 2,4-dinitrochorobenzol (DNCB; 10 .mu.l of a 0.5%
solution of DNCB in 95% acetone/5% olive oil) on day 13 on one and
more areas being of about 1 cm.sup.2 in size respectively on the
shaved backs of the animals and assessed macroscopically and
histologically 24 hours later. The contact dermatitis induced in
such a way is histologically (Giemsa-staining) characterised by a
pronounced formation of oedema and spongiosis in the area of the
epidermis, an increase of apoptotic cells as well as massive
infiltration by leukocytes (FIG. 8). The intradermal application of
a STAT-1-decoy-oligonucleotide (SEQ ID NO: 19) but not of a mutated
control-oligonucleotide (5'-TGTGGACCGTAGGAAGTG-3', SEQ ID NO: 61) 1
hour before the final DNCB-exposition led to a clear reduction of
the mentioned histological parameters, i.e. in total to a
significant attenuation of the inflammatory response.
Sequence CWU 1
1
62111DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 1nttncbgdaa n 11211DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
2ntthcvgnaa n 11311DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 3attaccggaa g 11411DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
4cttccggtaa t 11511DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 5attccggtaa g 11611DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
6cttaccggaa t 11711DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 7attcctggaa g 11811DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
8cttccaggaa t 11911DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 9attcctgtaa g 111011DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
10cttacaggaa t 111111DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 11gttccaggaa c
111211DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 12gttcctggaa c 111311DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
13gttcccggaa g 111411DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 14cttccgggaa c
111511DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 15gttccgggaa c 111611DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
16gttcccggaa c 111721DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 17tgtgaattac cggaagtgag a
211821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 18tctcacttcc ggtaattcac a 211918DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
19tgtgaattac cggaagtg 182018DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 20cacttccggt aattcaca
182121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 21agtcagttcc aggaactgac t 212221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
22agtcagttcc tggaactgac t 212323DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 23atgtgagttc ccggaagtga act
232423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 24agttcacttc cgggaactca cat 232518DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
25acagttccgg gaactgtc 182618DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 26gacagttccc ggaactga
182719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 27gacagttccg ggaactgtc 192819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
28gacagttccc ggaactgtc 192918DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 29gtgtattccg gtaagtga
183018DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 30tcacttaccg gaatacac 183121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
31ttatgtgaat tcctggaagt g 213221DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 32cacttccagg aattcacata a
213325DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 33catgttatgc atattcctgt aagtg 253425DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
34cacttacagg aatatgcata acatg 253521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
35tgtgaattcc tgtaagtgag a 213621DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 36tctcacttac aggaattcac a
213718DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 37tgcatattcc tgtaagtg 183818DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
38cacttacagg aatatgca 183915DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 39atattcctgt aagtg
154015DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 40cacttacagg aatat 154122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
41taccactgag acatcctgcc ac 224218DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 42aacatcattg gcacgcag
184315DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 43gtgaacctgc tccag 154424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
44cagagttcac tgaaacggaa tgcc 244520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
45tgcctgcctg ttgcacaacc 204620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 46agcaaggcat gatgttaacc
204720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 47gcattcctct cttccagagc 204819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
48tcttaatcag tggtggaag 194918DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 49tttggtcaag ttgtttcc
185022DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 50gtactccaca ttcctacttc tc 225122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
51tttgggtcta ttccgttgtg tc 225220DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 52gttcatccgg caccagtcag
205321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 53acgtgcacat gagctgccta c 215428DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
54gcggatcccc tccagcatga aagtctct 285528DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
55acgaattctt cttgggttgt ggagtgag 285623DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
56gtgcatttcc cgtaaatctt gtc 235727DNAArtificial SequenceDescription
of Artificial Sequence Synthetic Primer 57cacttgataa cagaaagtga
taactct 275822DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Primer 58agttgagggg actttcccag gc
225919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 59gacagtgcag tgaactgtc 196025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
60catgttatgc agaccgtagt aagtg 256118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
61tgtggaccgt aggaagtg 186221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 62nnnsanttcc gggaantgns n
21
* * * * *
References