U.S. patent application number 12/135247 was filed with the patent office on 2009-08-13 for trans-splicing mediated photodynamic therapy.
This patent application is currently assigned to VIRXSYS CORPORATION. Invention is credited to Carl R. Merril, Lloyd G. Mitchell, Edward Otto.
Application Number | 20090203143 12/135247 |
Document ID | / |
Family ID | 34273484 |
Filed Date | 2009-08-13 |
United States Patent
Application |
20090203143 |
Kind Code |
A1 |
Mitchell; Lloyd G. ; et
al. |
August 13, 2009 |
TRANS-SPLICING MEDIATED PHOTODYNAMIC THERAPY
Abstract
The present invention provides methods and compositions for
conferring selective death on cells expressing a specific target
precursor messenger RNA (selective target pre-mRNA). The
compositions of the invention include pre-trans-splicing molecules
(PTMs) designed to interact with a target precursor messenger RNA
molecule (target pre-mRNA) expressed within a cell and mediate a
trans-splicing reaction resulting in the generation of a novel
chimeric mRNA molecule (chimeric mRNA) capable of encoding a light
producing protein or enzyme. Cell death is further mediated by the
presence of a photosensitizer which upon photoactivation produces
cytotoxicity.
Inventors: |
Mitchell; Lloyd G.;
(Bethesda, MD) ; Otto; Edward; (Great Falls,
VA) ; Merril; Carl R.; (Bethesda, MD) |
Correspondence
Address: |
Saul Ewing LLP (Baltimore);Attn: Patent Docket Clerk
Lockwood Place, 500 East Pratt Street, Suite 900
Baltimore
MD
21202
US
|
Assignee: |
VIRXSYS CORPORATION
Gaithersburg
MD
|
Family ID: |
34273484 |
Appl. No.: |
12/135247 |
Filed: |
June 9, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10658617 |
Sep 9, 2003 |
7399753 |
|
|
12135247 |
|
|
|
|
Current U.S.
Class: |
435/471 ;
435/252.33; 536/23.2 |
Current CPC
Class: |
C12N 15/10 20130101;
C12N 2840/445 20130101; C12N 15/1086 20130101; C12N 2310/111
20130101; C12N 2320/33 20130101; C12N 15/1027 20130101; C12N 15/113
20130101; C12N 2310/3519 20130101; C12N 15/111 20130101; C12N
2310/11 20130101 |
Class at
Publication: |
435/471 ;
536/23.2; 435/252.33 |
International
Class: |
C12N 15/87 20060101
C12N015/87; C12N 15/11 20060101 C12N015/11; C12N 1/21 20060101
C12N001/21 |
Claims
1. A nucleic acid molecule comprising: (a) one or more target
binding domains that target binding of the nucleic acid molecule to
a target pre-mRNA expressed within the cell; (b) a 3' splice region
comprising a 3' splice acceptor site; (c) a spacer region that
separates the 3' splice region from the target binding domain; and
(d) a nucleotide sequence encoding a light producing protein or
enzyme to be trans-spliced to the target pre-mRNA; wherein said
nucleic acid molecule is recognized by nuclear splicing components
within the cell and wherein the light producing protein or enzyme
activates a cytotoxic photosensitizer that causes cell death.
2. The cell of claim 1 wherein the 3' splice region further
comprises a branch point and a pyrimidine tract.
3. A nucleic acid molecule comprising: (a) one or more target
binding domains that target binding of the nucleic acid molecule to
a target pre-mRNA expressed within the cell; (b) a 5' splice site;
(c) a spacer region that separates the 5' splice site from the
target binding domain; and (d) a nucleotide sequence encoding a
light producing protein or enzyme to be trans-spliced to the target
pre-mRNA; wherein said nucleic acid molecule is recognized by
nuclear splicing components within the cell and wherein the light
producing protein or enzyme activates a cytotoxic photosensitizer
that causes cell death.
4. The nucleic acid of claim 1 or 2 wherein the nucleic acid
molecule further comprises a 5' donor site.
5. An isolated cell comprising nucleic acid molecule wherein said
nucleic acid molecule comprises: (a) one or more target binding
domains, wherein at least one target binding domain is more than
about 100 nucleotides in length, that target binding of the nucleic
acid molecule to a target pre-mRNA expressed within the cell; (b) a
3' splice region comprising a 3' splice acceptor site; (c) a spacer
region that separates the 3' splice region from the target binding
domain; and (d) a nucleotide sequence encoding a light producing
protein or enzyme to be trans-spliced to the target pre-mRNA;
wherein said nucleic acid molecule is recognized by nuclear
splicing components within the cell and wherein the light producing
protein or enzyme activates a cytotoxic photosensitizer that causes
cell death.
6. The cell of claim 5 wherein the 3' splice region further
comprises a branch point and a pyrimidine tract.
7. An isolated cell comprising a nucleic acid molecule wherein said
nucleic acid molecule comprises: (a) one or more target binding
domains, wherein at least one target binding domain is more than
about 100 nucleotides in length, that target binding of the nucleic
acid molecule to a target pre-mRNA expressed within the cell; (b) a
5' splice site; (c) a spacer region that separates the 5' splice
site from the target binding domain; and (d) a nucleotide sequence
encoding a light producing protein or enzyme to be trans-spliced to
the target pre-mRNA; wherein said nucleic acid molecule is
recognized by nuclear splicing components within the cell and
wherein the light producing protein or enzyme activates a cytotoxic
photosensitizer that causes cell death.
8. The cell of claim 5 or 6 wherein the nucleic acid molecule
further comprises a 5' donor site.
9. A method of producing a chimeric mRNA molecule in a cell wherein
said chimeric molecule expresses a light producing protein or
enzyme comprising contacting a target pre-mRNA expressed in the
cell with a nucleic acid molecule recognized by nuclear splicing
components wherein said nucleic acid molecule comprises: (a) one or
more target binding domains more than about 100 nucleotides in
length that target binding of the nucleic acid molecule to a target
pa e-mRNA expressed within the cell; (b) a 3' splice region
comprising a 3' splice acceptor site; (c) a spacer region that
separates the 3' splice region from the target binding domain; and
(d) a nucleotide sequence encoding a light producing protein or
enzyme to be trans-spliced to the target pre-mRNA; under conditions
in which a portion of the nucleic acid molecule is trans-spliced to
a portion of the target pre-m RNA to form a chimeric mRNA within
the cell wherein the light producing protein or enzyme activates a
cytotoxic photosensitizer that causes cell death.
10. The method of claim 5 wherein said 3' splice region further
comprises a branch point and a pyrimidine tract.
11. A method of producing a chimeric mRNA molecule in a cell
wherein said chimeric molecule expresses a light producing protein
or enzyme comprising contacting a target pre-mRNA expressed within
the cell with a nucleic acid molecule recognized by nuclear
splicing components wherein said nucleic acid molecule comprises:
(a) one or more target binding domains, wherein at least one target
binding domain is more than about 100 nucleotides in length, that
target binding of the nucleic acid molecule to a target pre-mRNA
expressed within the cell; (b) a 5' splice site; (c) a spacer
region that separates the 5' splice site from the target binding
domain; and (d) a nucleotide sequence encoding a light producing
protein or enzyme to be trans-spliced to the target pre-mRNA; under
conditions in which a portion of the nucleic acid molecule is
trans-spliced to a portion of the target pre-mRNA to form a
chimeric mRNA within the cell wherein the light producing protein
or enzyme activates a cytotoxic photosensitizer that causes cell
death.
12. The method of claim 9 or 10 wherein the nucleic acid molecule
further comprises a 5' donor site.
13. A method for targeting cell death comprising: (i) contacting
said cell with a nucleic acid molecule wherein said nucleic acid
molecule comprises: a) one or more target binding domains, wherein
at least one target binding domain is more than about 100
nucleotides in length, that target binding of the nucleic acid
molecule to a target pre-mRNA expressed within the cell; b) a 3'
region comprising a 3' splice acceptor site; c) a spacer region
that separates the 3' splice region from the target binding domain;
and d) a nucleotide sequence encoding a light producing protein
enzyme to be trans-spliced to the target pre-mRNA; wherein said
nucleic acid molecule is recognized by nuclear splicing components
within the cell; and (ii) placing a photosensitizer in close enough
proximity to the cell to permit activation of the photosensitizer
by the light producing enzyme, wherein said activation results in
cell death.
14. The method of claim 13 wherein said 3' splice region further
comprises a branch point and a pyrimidine tract.
15. A method for targeting cell death comprising (i) contacting
said cell with a nucleic acid molecule wherein said nucleic acid
molecule comprises: a) one or more target binding domains, wherein
at least one target binding domain is more than about 100
nucleotides in length, that target binding of the nucleic acid
molecule to a target pre-mRNA expressed within the cell; b) a 5'
splice site; c) a spacer region that separates the 3' splice region
from the target binding domain; and d) a nucleotide sequence
encoding a light producing protein enzyme to be trans-spliced to
the target pre-mRNA; wherein said nucleic acid molecule is
recognized by nuclear splicing components within the cell; and (ii)
placing a photosensitizer in close enough proximity to the cell to
permit activation of the photosensitizer by the light producing
enzyme, wherein said activation results in cell death.
16. The method of claim 13 or 14 wherein the nucleic acid molecule
further comprises a 5' donor site.
17. The method of claim 13, 14 or 15 further comprising contacting
said cell with a substrate specific for the light producing protein
or enzyme.
18. The method of claim 17 further comprising contacting said cell
with a substrate specific for the light producing protein or
enzyme.
Description
1. INTRODUCTION
[0001] The present invention provides methods and compositions for
conferring selective death on cells expressing a specific target
precursor messenger RNA (selective target pre-mRNA). The
compositions of the invention include pre-trans-splicing molecules
(PTMs) designed to interact with a target precursor messenger RNA
molecule (target pre-mRNA) expressed within a cell and mediate a
trans-splicing reaction resulting in the generation of a novel
chimeric mRNA molecule (chimeric mRNA) capable of encoding a light
producing protein or enzyme. Cell death is further mediated by the
presence of a photosensitizer which upon photoactivation produces
cytotoxicity.
[0002] The methods and compositions of the invention may be used to
treat a variety of different diseases where the goal is selective
destruction of one or more specific cell types. For example, the
present invention provides methods and compositions for conferring
selective cell death on cancer cells expressing a specific target
precursor messenger RNA molecules (cancer cell selective target
pre-mRNAs). Such compositions include pre-trans-splicing molecules
(PTMs) designed to interact with one or more cancer cell selective
target pre-mRNA and mediate a trans-splicing reaction resulting in
the generation of novel chimeric mRNA molecules (chimeric mRNA)
capable of encoding a light producing protein or an enzyme that
catalyzes the conversion of a substrate in a light producing
chemical reaction. Alternatively, the present invention may be
utilized to confer selective cell death on cells infected with a
pathogenic microorganism. In such instances, PTMs are designed to
interact with one or more target pre-mRNA encoded by the pathogenic
microorganism, or induced within the cells of a subject infected
with a pathogenic microorganism and encode a light producing
protein or enzyme. Upon successful trans-splicing between the
target pre-mRNA and the PTM, the light producing protein or enzyme
is expressed thereby providing the required complementing activity
necessary for activation of a cytotoxic photosensitizer.
2. BACKGROUND OF THE INVENTION
[0003] DNA sequences in the chromosome are transcribed into
pre-mRNAs which contain coding regions (exons) and generally also
contain intervening non-coding regions (introns). Introns are
removed from pre-mRNAs in a precise process referred to as
splicing. In most cases, the splicing reaction occurs within the
same pre-mRNA molecule, which is termed cis-splicing. Splicing
between two independently transcribed pre-mRNAs is termed
trans-splicing. Trans-splicing was first discovered in trypanosomes
(Sutton & Boothroyd, 1986, Cell 47:527; Murphy et al., 1986,
Cell 47:517) and subsequently in nematodes (Krause & Hirsh,
1987, Cell 49:753); flatworms (Rajkovic et al., 1990, Proc. Nat'l.
Acad. Sci. USA, 87:8879; Davis et al., 1995, J. Biol. Chem.
270:21813) and in plant mitochondria (Malek et al., 1997, Proc.
Nat'l. Acad. Sci. USA 94:553). In the parasite Trypanosoma brucei,
all mRNAs acquire a splice leader (SL) RNA at their 5' termini by
trans-splicing. A 5' leader sequence is also trans-spliced onto
some genes in Caenorhabditis elegans. This mechanism is appropriate
for adding a single common sequence to many different
transcripts.
[0004] The mechanism of spliced leader trans-splicing, which is
nearly identical to that of conventional cis-splicing, proceeds via
two phosphoryl transfer reactions. The first causes the formation
of a 2'-5' phosphodiester bond producing a `Y` shaped branched
intermediate, equivalent to the lariat intermediate in
cis-splicing. The second reaction, exon ligation, proceeds as in
conventional cis-splicing. In addition, sequences at the 3' splice
site and some of the snRNPs which catalyze the trans-splicing
reaction, closely resemble their counterparts involved in
cis-splicing.
[0005] Trans-splicing may also refer to a different process, where
an intron of one pre-mRNA interacts with an intron of a second
pre-mRNA, enhancing the recombination of splice sites between two
conventional pre-mRNAs. This type of trans-splicing was postulated
to account for transcripts encoding a human immunoglobulin variable
region sequence linked to the endogenous constant region in a
transgenic mouse (Shimizu et al., 1989, Proc. Nat'l. Acad. Sci. USA
86:8020). In addition, trans-splicing of c-myb pre-RNA has been
demonstrated (Vellard, M. et al. Proc. Nat'l. Acad. Sci., 1992
89:25112515), trans-spliced RNA transcripts from SV40 have been
detected in cultured cells and nuclear extracts (Eul et al., 1995,
EMBO. J. 14:3226) and more recently, the transcript from the p450
gene in human liver has been shown to be trans-spliced (Finta et
al., 2002, J. Biol Chem 22:5882-5890). However, in general,
naturally occurring trans-splicing of mammalian pre-mRNAs is
thought to be an exceedingly rare event.
[0006] In vitro trans-splicing has been used as a model system to
examine the mechanism of splicing by several groups (Konarska &
Sharp, 1985, Cell 46:165-171 Solnick, 1985, Cell 42:157; Chiara
& Reed, 1995, Nature 375:510). Reasonably efficient
trans-splicing (30% of cis-spliced analog) was achieved between
RNAs capable of base pairing to each other, splicing of RNAs not
tethered by base pairing was further diminished by a factor of 10.
Other in vitro trans-splicing reactions not requiring obvious
RNA-RNA interactions among the substrates were observed by Chiara
& Reed (1995, Nature 375:510), Bruzik J. P. & Maniatis, T.
(1992, Nature 360:692) and Bruzik J. P. and Maniatis, T., (1995,
Proc. Nat'l. Acad. Sci. USA 92:7056-7059). These reactions occur at
relatively low frequencies and require specialized elements, such
as a downstream 5' splice site or exonic splicing enhancers.
[0007] U.S. Pat. Nos. 6,083,702, 6,013,487 and 6,280,978 describe
the use of PTMs to mediate a trans-splicing reaction by contacting
a target precursor mRNA to generate novel chimeric mRNAs. The
resulting RNA can encode any gene product including a protein of
therapeutic value to the cell or host organism, a toxin, such as
Diptheria toxin subunit A, which causes killing of the specific
cells or a novel protein not normally present in cells. The PTMs
can also be engineered for the production of chimeric proteins
including those encoding reporter molecules useful to image gene
expression in vivo in real time or to add peptide affinity
purification tags which can be used to purify and identify
proteinse expressed in a specific cell type.
[0008] Photodynamic therapy-(PDT) of cancer uses light excitation
of a photosensitive substance to produce oxygen-related cytotoxic
intermediates, such as single toxygen or free radicals (Dougherty
et al., 1993, Photochem. Photobiol. 58:895-900; Hopper et al.,
2000, Lancet Oncol. 1:212-219; Ochsner et al., 1997, J. Photochem.
Photobiol. B. Biol 39:1-18, Fuchs et al., 1998, Biol. Med.
24:835-847). For example, the use of CL4 for the excitation of the
photosensitizer hypercin has been used for the in vitro
inactivation of the equine infectious anemia virus (Carpenter, S.
et al. 1994, Proc. Natl. Acad. Sci. USA 91:12273-12277).
Additionally, Theodossis et al., described the in vitro
photodynamic effect of rosebengal activated by intracellular
generation of light generated by the oxidation of the
chemiluminescent substrate luciferin, in luciferase-transfected
Nlli 3T3 murine fibroblasts (Theodossis et al., 2003, Cancer
Research 63:1818-1821).
[0009] PDT involves the use of two individual components that
combine to induce cytotoxicity in an oxygen dependent manner. The
first component of PDT is a photosensitizer molecule that usually
enters cells and/or tissues non-specifically. The second component
involves the localized administration of light of a specific
wavelength that is capable of activating the photosensitizer. Once
activated the photosensitizer transfers energy from the light to
molecular oxygen, thereby generating reactive oxygen species (ROS),
such as singlet oxygen and free radicals. Such ROS mediate cellular
toxicity. Photo sensitizers may also undergo photochemical
reactions that do not use oxygen as an intermediate, such as
compounds that result in photoaddition to DNA. As used herein, the
term photosensitizer includes, but is not limited to, other
chemicals that are activated upon exposure to light. Such
photosensitizers are known to those skilled in the art and the
examples set forth herein are non-limiting.
[0010] Although photodynamic therapy use is desirable because of
its limited side effects, its main disadvantages are the poor
accessibility of light to certain tissues and the problem of
restricting the delivery of light primarily to the target cells.
The present invention provides methods and compositions for
targeted expression of light producing enzymes in the desired cell
types and in cells that otherwise are inaccessible to light,
thereby providing a method for use of photodynamic therapy for the
specific destruction of targeted cells. Specifically, the invention
provides PTM molecules that are designed to interact with one or
more cell selective target pre-mRNA species and mediate
trans-splicing reactions resulting in the generation of chimeric
mRNA molecules capable of encoding light producing enzyme or
protein. The expression of the light producing enzyme or protein
permits activation of a co-localized photosensitizer leading to
death of the selected cell. The present invention provides a system
for targeting cancer cell destruction. In addition, the invention
provides a system for targeting selective cell death to cells
infected with pathogenic microorganisms, or, cell death in
instances where the activity of a particular cell type leads to
disease.
3. SUMMARY OF THE INVENTION
[0011] The present invention provides methods and compositions for
conferring selective death on cells expressing a specific target
precursor messenger RNA (selective target pre-mRNAs). The
compositions of the invention include pre-trans-splicing molecules
(PTMs) designed to interact with one or more selective target
pre-mRNA and mediate a trans-splicing reaction resulting in the
generation of novel chimeric mRNA molecules (chimeric mRNA) capable
of encoding light producing proteins or enzymes. Light producing
proteins include those molecules capable of photoactivating a
photosensitizer sufficient to result in formation of cytotoxic
intermediates, including cytotoxic oxygen related-intermediates.
Light producing proteins include those capable of fluorescence,
FRET (fluorescent resonance energy transfer), and phosphorescence.
Upon successful trans-splicing between the target pre-mRNA and the
PTM, the light producing proteins or enzymes are expressed thereby
providing the activity necessary for activation of the
photosensitizer. Such activation leads to cell death, thereby
targeting selective destruction of specific cells (FIG. 1A).
[0012] The present invention provides methods and compositions for
conferring selective death on cancer cells expressing specific
target precursor messenger RNA molecules (cancer cell selective
target pre-mRNAs). The compositions of the invention PTMs are
designed to interact with one or more cancer cell selective target
pre-mRNA and mediate trans-splicing reactions resulting in the
generation of novel chimeric mRNA molecules (chimeric mRNA) capable
of encoding a light producing protein or enzyme. The portion of the
target pre-mRNA trans-spliced to the PTM provides the signal
sequences necessary for translation of the chimeric mRNA molecule.
The portion of the PTM trans-spliced to the target pre-mRNA
provides sequences encoding light producing enzymes that provide
essential activity necessary for activation of cytotoxic
photosensitizers.
[0013] The methods and compositions of the invention provide a
means for selective destruction of cancer cells within a tumor.
Since the viability of tumor cells relies on the supply of
nutrients via the bloodstream, targeting of cells of the vascular
system may also be used to treat cancer. In such instances, the
selective target pre-mRNA is a pre-mRNA expressed in the cells in
newly created regions of the vascular system. Thus, the present
invention provides methods and compositions for treating a variety
of different cancers including but not limited to, breast,
prostate, bladder, pancreatic or liver cancer.
[0014] In addition the present invention provides methods and
compositions for conferring selective death on cells expressing
mRNAs produced by a pathogenic infectious agent. In such instances
the PTM is designed to interact with one or more target pre-mRNAs
produced by the pathogenic infective agent. The portion of the
target pre-mRNA produced by, or in response to, the pathogen and
trans-spliced to the PTM provides the signal sequences necessary
for translation of the chimeric molecule. The portion of the PTM
trans-spliced to the target pre-mRNA provides sequences encoding
the light producing proteins or enzymes that provide an essential
activity necessary for activation of a cytotoxic photosensitizer.
The methods and compositions of the invention may be utilized for
selective destruction of infected cells.
[0015] In yet another embodiment of the invention, the methods and
compositions of the invention may be used for conferring cell death
in a subject where the activity of that cell leads to a disease
state, for example, an immune or hormonal disorder.
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1A. Schematic representation of trans-splicing mediated
photodynamic therapy.
[0017] FIG. 1B. Schematic representation of different
trans-splicing reactions. (a) Trans-splicing reactions between the
target pre-mRNA 5' splice site and PTMs 3' splice site; (b)
trans-splicing reactions between the target pre-mRNA 3' splice site
and PTM's 5' splice site and (c) replacement of internal exon by
double trans-splicing reaction in which the PTM carries both 3' and
5' splice sites, each of which trans-splice into a corresponding
target pre-mRNA splice site. BD, binding domains; BP, branch point
sequence; PPT, polypyrimidine tract and ss, splice sites.
[0018] FIG. 2. Schematic diagrams of the pre-mRNA targets; (a) HPV
type 16 (b) pHCG6 and (c) EGFR.
[0019] FIG. 3. Schematic diagrams of a prototype PTM and splice
mutants showing the important structural elements of trans-splicing
domain. BD, binding domain; BP, branchpoint and PPT, polypyrimidine
tract. Unique restriction sites in the trans-splicing domain are
indicated.
[0020] FIG. 4. Illustration of safety mechanism. (a) Schematic
diagram of the safety PTM showing the intra-molecular base-paired
stem-loop structure designed to cover the 3' splice elements from
splicing factors. (b) Diagram of a safety PTM in open configuration
after binding to the p-HCG6 pre-mRNA target.
[0021] FIG. 5A. Trans-splicing mediated mRNA repair and production
of functional protein. FIG. 5B. In situ staining for .beta.-Gal
activity following co-transfection in 293T cells (unselected).
Cells transfected with (a) defective lacZ target alone, and (b)
cotransfected with target and PTM.
[0022] FIG. 6. Pre-mRNA target that is designed to express part of
the synthetic Renilla luciferase sequence, coupled to the coding
sequences for E7 and sequences immediately upstream of E7 from the
human papilloma virus (HPV).
[0023] FIG. 7. Pre-trans-splicing molecule (PTM) designed to base
pair with the target intron and trans-splice in the 3' luciferase
"exon."
[0024] FIG. 8. Repair model showing the binding of PTM to the
target pre-mRNA and restoration of luciferase activity by
trans-splicing.
[0025] FIG. 9. RT-PCR analysis of total RNA using target and PTM
specific primers that produced the expected trans-spliced (435 bp)
product only in cells that contain both target and PTM but not in
controls (target, PTM alone and target-splice mutant PTM).
[0026] FIG. 10. Direct sequencing of the RT-PCR product confirms
the accurate trans-splicing between the target and PTM.
[0027] FIG. 11. Co-transfection of a specific target with Luc-PTM
13 resulted in the repair and restoration of Renilla luciferase
function that is on the order of 4-logs over background. No
luciferase activity above background was detected in controls or
with splice mutant PTMs suggesting that the restoration of
luciferase function is due to trans-splicing.
[0028] FIG. 12. Schematic drawings of Luc-PTM13, Luc-PTM14 and the
splice mutant used for the study.
[0029] FIG. 13. Repair of human papilloma virus target pre-mRNA by
trans-splicing in HEK293T cells.
[0030] FIG. 14. Repair of human papilloma virus target pre-mRNA by
trans-splicing and restoration of luciferase function in HEK293T
cells.
[0031] FIG. 15. Schematic of luciferase firefly pre-trans-splicing
molecules.
[0032] FIG. 16. Trans-splicing strategy to target the expression of
human papilloma
[0033] FIG. 17. Luciferase expression with and without target.
[0034] FIG. 18. Schematic of Renilla luciferase pre-trans-splicing
molecule.
[0035] FIG. 19. Trans-splicing strategy to target the expression of
human papilloma virus employs Renilla 5' "exon" replacement.
[0036] FIG. 20. Schematic diagrams of hemi-reporter model targets
and PTMs used for targeting of gene expression. The mini-gene
pre-mRNA targets consisting of 5' portion of humanized Renilla
luciferase (hRluc) to act as a "5' exon" coupled to the E6-E7
intron region and adjacent E7 coding sequence of human papilloma
virus (HPVI6).
[0037] FIG. 21. Evaluation of trans-splicing efficiency at the RNA
level.
[0038] FIG. 22. Evaluation of trans-splicing efficiency at the
functional level. The efficiency of trans-splicing mediated mRNA
repair and restoration of Luciferase function was confirmed by
assaying for enzymatic activity.
[0039] FIG. 23. In vivo expression of a light producing enzyme
using trans-splicing. The full length PTM (Luc-PTM27) contains the
complete coding sequence for humanized Renilla Luciferase (hRL)
minus the AUG start codon. The trans-splicing domain consists of a
strong 3' splice element (including a yeast consensus branch point
(BP), a long pyrimidine tract (PPT) and a 3' acceptor site), a
spacer sequence and a 80 nucleotide binding domain (BD)
complementary to the 3' end of the intron between exons E6 and E7
of human papilloma virus (HPV-16) (FIG. 24A). Schematic
illustration of trans-splicing mediated restoration of Luciferase
function is shown in FIG. 24 B.
[0040] FIG. 24. Trans-splicing mediated mRNA repair and restoration
of Renilla Luciferase activity in 293T cells.
[0041] FIG. 25. Luciferase splice mutant PTM constructed to
determine whether the restoration of Luciferase function is due to
RNA trans-splicing. FIG. 26A, structure of a full-length PTM
(functional PTM); FIG. 26B, structure of a splice-mutant PTM The
splice mutant PTM is a derivative of Luc-PTM38 in which the 3'
splice elements such as BP, PPT and the acceptor AG dinucleotide
were modified by PCR mutagenesis and were confirmed by
sequencing.
[0042] FIG. 26. Restoration of Luciferase function is due to RNA
trans-splicing.
[0043] FIG. 27. In vivo expression of a light producing enzyme.
[0044] FIG. 28. In vivo expression of a light producing enzyme
following IV PTM delivery.
5. DETAILED DESCRIPTION OF THE INVENTION
[0045] The present invention provides methods and compositions for
conferring PTM mediated cell death on cells expressing a specific
target precursor messenger RNA molecules. The target precursor
messenger RNA molecules may be those selectively expressed in
cancer cells, or alternatively, the RNA molecules may be those
encoded by infectious agents such as bacteria, parasites, fungi or
viruses. Target pre-mRNAs also include those cellular pre-mRNAs
induced during or in response to bacterial, parasitic, fungal or
viral infection, or, pre-mRNAs wherein expression of said pre-mRNA
is associated with a specific disease or disorder. The compositions
of the invention include pre-trans-splicing molecules (PTMs)
designed to interact with one or more cancer cell selective target
pre-mRNAs, or target pre-mRNAs encoded by an infectious agent, and
mediate trans-splicing reactions resulting in the generation of a
novel chimeric mRNA molecules (chimeric mRNA) encoding light
producing proteins or enzymes capable of activating cytotoxic photo
sensitizers. Specifically, the PTMs of the invention are designed
to encode light producing proteins or enzymes that are required for
activation of photosensitizers which upon activation produce
cytotoxic intermediates, including oxygen-related cytotoxic
intermediates. The methods and compositions of the invention may be
used to target expression of a light producing protein or enzyme to
cancer cells or cells infected with a pathogenic agent thereby
providing a method for selective destruction of cancer cells or
cells infected with an infectious agent. Alternatively, the methods
and compositions may be used to target cell death to a specific
cell type based on the expression of cell-type specific mRNA.
5.1. Structure of the Pre-Trans-Splicing Molecules
[0046] The compositions of the invention include PTMs designed to
interact with one or more selective target pre-mRNA molecule such
as, for example, cancer cell selective target pre-mRNA, target
pre-mRNA molecules encoded by an infectious agent, target cellular
pre-mRNAs induced by an infectious microorganism, or target
pre-mRNAs where the expression of said pre-mRNA is associated with
a disease or disorder. Such RNAs are designed to mediate
trans-splicing reactions resulting in the generation of novel
chimeric mRNA molecules (chimeric mRNAs). The novel chimeric mRNA
is designed to encode a light producing protein or enzyme capable
of activating a cytotoxic photosensitizer. Such activation leads to
cell death. The compositions of the invention provide a means for
conferring selective death on cells expressing a specific target
premRNA. The PTMs comprising (i) one or more target binding domains
that targets binding of the PTM to a specific pre-mRNA target (ii)
a 3' splice region that includes a 3' splice acceptor site and/or
5' splice donor site; and (iii) a nucleotide sequence capable of
encoding a light producing protein or enzyme.
[0047] In some instances, the PTMs of the invention may further
comprise one or more spacer regions that separate the RNA splice
site from the target binding domains and/or a safety sequence. The
structure of PTMs is described in detail in U.S. Pat. Nos.
6,013,487; 6,083,702; 6,280,978 and in co-pending U.S. patent
application Ser. Nos. 09/756,095; 09/756,096; 09/756,097; the
disclosures of which are incorporated by reference herein.
[0048] The target-binding domain of the PTM may contain multiple
binding domains which are complementary to and in anti-sense
orientation to the targeted region of the target specific pre-mRNA,
e.g., a cancer selective pre-mRNA or a pre-mRNA encoded by a
pathogenic microorganism. As used herein, a target binding
domain(s) is defined as any sequence that confers specificity of
binding and anchors the pre-mRNA closely in space so that the
spliceosome processing machinery of the nucleus can trans-splice a
portion of the PTM to a portion of the pre-mRNA. The target binding
domains may comprise up to several thousand nucleotides. In
preferred embodiments of the invention the binding domains may
comprise at least 10 to 30 and up to several hundred nucleotides.
The specificity of the PTM may be increased significantly by
increasing the length of the target binding domain. In addition,
although the target binding domain may be "linear" it is understood
that the RNA may fold to form secondary structures that may
stabilize the complex by preventing activation of the PTM splice
site until the binding domain has encountered its target thereby
increasing the efficiency of splicing. Absolute complementarity
with the targeted cell selective pre-mRNA, although preferred, is
not required. A sequence "complementary" to a portion of an RNA, as
referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a
stable duplex. The ability to hybridize will depend on both the
degree of complementarity and the length of the nucleic acid (See,
for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory
Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.). Generally, the longer the hybridizing nucleic acid,
the more base mismatches with an RNA it may contain and still form
a stable duplex. One skilled in the art can ascertain a tolerable
degree of mismatch or length of duplex by use of standard
procedures to determine the stability of the hybridized
complex.
[0049] In an embodiment of the invention, the target binding domain
of the PTM will contain sequences which are complementary to and in
anti-sense orientation to a cancer cell selective target pre-mRNA
molecules where the goal is to target expression of a light
producing protein or enzyme to cancer cells thereby targeting
cancer cell destruction. For example, PTM binding sites may be
engineered to bind to any target pre-mRNA where the expression of
the target pre-mRNA is associated with a proliferative disorder or
disease. Such target pre-mRNAs are characterized as those pre-mRNAs
expressed in cancer cells but which are either absent or expressed
in low levels in their normal cell counterparts. Such target
pre-mRNAs include, for example, the .beta.-chorionic gonadotropin 6
pre-mRNA, the epidermal growth factor receptor pre-mRNA, E2F-1
premRNA or telomerase pre mRNA each of which are known to be over
expressed in tumor cells and prostate specific G-protein coupled
receptor (PSGR) pre-mRNA which is known to be over expressed in
prostate cancer.
[0050] The methods and compositions of the present invention may be
designed to target any pre-mRNA known to be differentially
expressed in cancer cells but not normal cells. Additionally,
techniques well known to those of skill in the art may be used to
identify novel genes differentially expressed in cancer cells but
not their normal counterpart. Such techniques include, for example,
the use of cDNA microarrays to identify differentially expressed
genes in cancer cells. (See, Ausebel et al., 2003, Current
Protocols in Molecular Biology, John Wiley & Sons, Inc.,
Chapter 25).
[0051] In yet another embodiment of the invention, the target
binding domain of the PTM will contain sequences which are
complementary to and in anti-sense orientation to specific target
pre-mRNA molecules encoded by an infectious agent where the goal is
to target expression of a light producing protein or enzyme to
cells infected with the agent thereby targeting infected cell
destruction. For example, PTM binding sites may be engineered to
bind to any target pre-mRNA where the expression of the target
pre-mRNA is associated with a viral, bacterial, fungal or parasitic
disease, for example.
[0052] Binding may also be achieved through other mechanisms, for
example, through triple helix formation or protein/nucleic acid
interactions such as those in which the PTM is engineered to
recognize a specific RNA binding protein, e.g., a protein bound to
a specific target pre-mRNA. Alternatively, the PTMs of the
invention may be designed to recognize secondary structures, such
as for example, hairpin structures resulting from intramolecular
base pairing between nucleotides within an RNA molecule.
[0053] As indicated above, the PTM molecules of the invention are
also designed to contain a 3' splice region that may include a
branchpoint, pyrimidine tract and a 3' splice acceptor AG site
and/or a 5' splice donor site. Consensus sequences for the 5'
splice donor site and the 3' splice region used in RNA splicing are
well known in the art (See, Moore, et al, 1993, The RNA World, Cold
Spring Harbor Laboratory Press, p. 303-358). In addition, modified
consensus sequences that maintain the ability to function as 5'
donor splice sites and 3' splice regions may be used in the
practice of the invention. Briefly, the 5' splice site consensus
sequence is AG/GURAGU (SEQ. I.D. No. 1) (where A=adenosine,
U=uracil, G=guanine, C=cytosine, R=purine and /=the splice site).
The 3' splice site consists of three separate sequence elements:
the branchpoint or branch site, a polypyrimidine tract and the 3'
consensus sequence (YAG). The branchpoint consensus sequence in
mammals is YNYURAC (SEQ. I.D. No. 2) (Y=pyrimidine). The underlined
A is the site of branch formation. A polypyrimidine tract is
located between the branchpoint and the splice site acceptor and is
important for efficient branchpoint utilization and 3' splice site
recognition.
[0054] Recently, pre-RNA introns beginning with the dinucleotide AU
and ending with the dinucleotide AC have been identified and
referred to as U12 introns. U12 intron sequences as well as any
sequences that function as splice acceptor/donor sequences may also
be used in PTMs.
[0055] A spacer region to separate the RNA splice site from the
target binding domain may also be included in the PTM. The spacer
region may have additional features such as sequences that enhance
trans-splicing to the target pre-mRNA. In a specific embodiment of
the invention, initiation codon(s) and pre-mature termination
codons may be incorporated into the PTMs of the invention as a
mechanism for targeting selective degradation of unspliced RNAs
thereby preventing translation and expression of unspliced RNAs
from the nucleus into the cytoplasm. (See, Kim et al., 2001 Science
293:1832-1836)
[0056] In a preferred embodiment of the invention, a "safety" is
also incorporated into the spacer, binding domain, or elsewhere in
the PTM to prevent non-specific trans-splicing. This is a region of
the PTM that covers elements of the 3' and/or 5' splice site of the
PTM by relatively weak complementarity, preventing non-specific
trans-splicing. The PTM is designed in such a way that upon
hybridization of the binding/targeting portions) of the PTM, the 3'
and/or 5' splice site is uncovered and becomes fully active.
[0057] The "safety" consists of one or more complementary stretches
of cis-sequence (or could be a second, separate, strand of nucleic
acid) which weakly binds to one or both sides of the PTM
branchpoint, pyrimidine tract, 3' splice site and/or 5' splice site
(splicing elements), or could bind to parts of the splicing
elements themselves. This "safety" binding prevents the splicing
elements from being active (e.g., block U2 snRNP, U1, or other
splicing factors from attaching to the PTM splice site recognition
elements). The binding of the "safety" may be disrupted by the
binding of the target binding region of the PTM to the target
pre-mRNA, thus exposing and activating the PTM splicing elements
(making them available to trans-splice into the target
pre-mRNA).
[0058] A nucleotide sequence encoding a translatable protein
capable of producing a light producing enzyme or protein is
included in the PTM of the invention. Such enzymes are capable of
producing light in the presence of substrate. Such proteins include
but are not limited to bioluminescent and fluorescent molecules.
Bioluminescent molecules include but are not limited to firefly,
Renilla or bacterialluciferase. Fluorescent molecules include, for
example, green fluorescent protein or red fluorescent protein. FIG.
3 is a representation of a prototype PTM designed to express a
luciferase light producing enzyme. FIG. 4 illustrates a PTM
encoding luciferase including a safety mechanism.
[0059] Additional features can be added to the PTM molecule either
after, or before, the nucleotide sequence encoding the light
producing enzyme. Such features include polyadenylation signals, S'
splice sequences capable of enhancing splicing, additional binding
regions or additional splice sites. Stop codons or other elements
in the region between the binding domain and the splice site may be
added to prevent unspliced premRNA expression. In another
embodiment of the invention, PTMs can be generated with a second
anti-sense binding domain downstream from the nucleotide sequences
encoding a translatable protein to promote binding to the 3' target
intron or exon and to block the fixed authentic cis-5' splice site
(US and/or VI binding sites). Further elements such as a 3' hairpin
structure, circularized RNA, sequences that promote or facilitate
nuclear localization and spliceosomal incorporation, and stability
may be incorporated.
[0060] Sequences referred to as exonic splicing enhancers may also
be included in the structure of the synthetic PTMs. Transacting
splicing factors, namely the serine/argininerich (SR) proteins,
have been shown to interact with such exonic splicing enhancers and
modulate splicing (See, Tacke et al., 1999, Curr. Opin. Cell Biol.
11:358-362; Tian et al., 2001, 1. Biological Chemistry
276:33833-33839; Fu, 1995, RNA 1:663-680). Nuclear localization
signals may also be included in the PTM molecule (Dingwell and
Laskey, 1986, Ann. Rev. Cell Biol. 2:367-390; Dingwell and Laskey,
1991, Trends in Biochem. Sci. 16:478-481). Such nuclear
localization signals can be used to enhance the transport of
synthetic PTMs into the nucleus where trans-splicing occurs. In
addition, sequences maybe used that enhance the retention of PTMs
in the nucleus (Boelans et al., 1995 RNA 1:273-83; Good et al.,
1997 Gene Ther. 4:45-54).
[0061] When using synthetic PTMs, the PTMs of the invention can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization to
the target mRNA, transport into the cell, etc. For example,
modification of a PTM to reduce the overall charge can enhance the
cellular uptake of the molecule. In addition modifications can be
made to reduce susceptibility to nuclease or chemical degradation.
The nucleic acid molecules may be synthesized in such a way as to
be conjugated to another molecule such as a peptides (e.g., for
targeting host cell receptors in vivo), or an agent facilitating
transport across the cell membrane (See, e.g., Letsinger et al.,
1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al.,
1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No.
WO88/09810, published Dec. 15, 1988) or the blood-brain barrier
(see, e.g., PCT Publication No. WO89110134, published Apr. 25,
1988), hybridization-triggered cleavage agents (see, e.g., Krol et
al., 1988, BioTechniques 6:958-976) or intercalating agents (See,
e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the nucleic
acid molecules may be conjugated to another molecule, e.g., a
peptide, hybridization triggered cross-linking agent, transport
agent, hybridization-triggered cleavage agent, etc.
[0062] Various other well-known modifications to the nucleic acid
molecules can be introduced as a means of increasing stability and
half-life. Possible modifications include, but are not limited to,
the addition of flanking sequences of ribonucleotides to the 5'
and/or 3' ends of the molecule. In some circumstances where
increased stability is desired, nucleic acids having modified
internucleoside linkages such as 2'-0-methylation may be preferred.
Nucleic acids containing modified internucleoside linkages may be
synthesized using reagents and methods that are well known in the
art (See, Uhlmann et al., 1990, Chem. Rev. 90:543-584; Schneider et
al., 1990, Tetrahedron Lett. 31:335 and references cited
therein).
[0063] Synthetic PTMs of the present invention are preferably
modified in such a way as to increase their stability. Since RNA
molecules are sensitive to cleavage by cellular ribonucleases, it
may be preferable to use as the competitive inhibitor a chemically
modified oligonucleotide (or combination of oligonucleotides) that
mimics the action of the RNA binding sequence but is less sensitive
to nuclease degradation. In addition, the synthetic PTMs can be
produced as nuclease resistant circular molecules with enhanced
stability (Puttaraju et al., 1995, Nucleic Acids Symposium Series
No. 33:49-51; Puttaraju et al., 1993, Nucleic Acid Research
21:4253-4258). Other modifications may also be required, for
example to enhance binding, to enhance cellular uptake, to improve
pharmacology or pharmacokinetics or to improve other
pharmaceutically desirable characteristics.
[0064] Modifications, which may be made to the structure of the
synthetic PTMs include but are not limited to backbone
modifications such as use of: (i) phosphorothioates (X or Y or W or
Z=S or any combination of two or more with the remainder as 0).
e.g. Y=S (Stein, C. A, et al., 1988, Nucleic Acids Res.,
16:3209-3221), X=S (Cosstick, R, et al., 1989, Tetrahedron Letters,
30, 4693-4696), Y and Z=S (Brill, W. K.-D., et al., 1989, 1 Amer.
Chem. Soc., 111:2321-2322); (ii) methylphosphonates (e.g. Z=methyl
(Miller, P. S., et al., 1980, 1 Biol. Chem., 255:9659-9665); (iii)
phosphoramidates (Z=N-(alkyl).sub.2 e.g. alkyl methyl, ethyl,
butyl) (Z=morpholine or piperazine) (Agrawal, S., et al., 1988,
Proc. Natl. Acad. Sci. USA 85:7079-7083) (X or W=NH) (Mag, M., et
al., 1988, Nucleic Acids Res., 16:3525-3543); (iv) phosphotriesters
(Z=O-alkyl e.g. methyl, ethyl, etc) (Miller, P. S., et al., 1982,
Biochemistry, 21:54685474); and (v) phosphorus-free linkages (e.g.
carbamate, acetamidate, acetate) (Gait, M. L, et al., 1974, J.
Chem. Soc. Perkin I, 1684-1686; Gait, M. J., et al., 1979, J. Chem.
Soc. Perkin 1, 1389-1394). See also, Sazani et al., 1974, Nucleic
Acids Research 29:39653974.
[0065] In addition, sugar modifications may be incorporated into
the PTMs of the invention. Such modifications include but are not
limited to the use of: (i) 2' ribonucleosides (R=H); (ii)
2'-0-methylated nucleosides (R=OMe) (Sproat, B. S., et al., 1989,
Nucleic Acids Res., 17:3373-3386); and (iii)
2'-fluoro-2'-ribonucleosides (R=F) (Krug, A., et al., 1989,
Nucleosides and Nucleotides, 8:1473-1483).
[0066] Further, base modifications that may be made to the PTMs,
including but not limited to use of: (i) pyrimidine derivatives
substituted in the 5-position (e.g. methyl, bromo, fluoro etc) or
replacing a carbonyl group by an amino group (Piccirilli, J. A, et
al., 1990, Nature, 343:33-37); (ii) purine derivatives lacking
specific nitrogen atoms (e.g. 7-deaza adenine, hypoxanthine) or
functionalized in the 8-position (e.g. 8-azido adenine, 8-bromo
adenine) (for a review see Jones, A S., 1979, Int. J. Biolog.
Macromolecules, 1: 194-207).
[0067] In addition, the PTMs may be covalently linked to reactive
functional groups, such as: (i) psoralens (Miller, P. S., et al.,
1988, Nucleic Acids Res., Special Pub. No. 20, 113-114),
phenanthrolines (Sun, J-S., et al., 1988, Biochemistry,
27:6039-6045), mustards (Vlassov, V. V., et al., 1988, Gene"
72:313-322) (irreversible cross-linking agents with or without the
need for co-reagents); (ii) acridine (intercalating agents)
(Helene, C; et al., 1985, Biochimie, 67:777-783); (iii) thiol
derivatives (reversible disulphide formation with proteins)
(Connolly, B. A, and Newman, P. C., 1989, Nucleic Acids Res.,
17:4957-4974); (iv) aldehydes (Schiffs base formation); (v) azido,
bromo groups (UV cross-linking); or (vi) ellipticines (photolytic
cross-linking) (Perrouault, L., et al., 1990, Nature,
344:358-360).
[0068] In an embodiment of the invention, oligonucleotide mimetics
in which the sugar and internucleoside linkage, i.e., the backbone
of the nucleotide units, are replaced with novel groups can be
used. For example, one such oligonucleotide mimetic which has been
shown to bind with a higher affinity to DNA and RNA than natural
oligonucleotides is referred to as a peptide nucleic acid (PNA)
(for review see, Uhlmann, E. 1998, Biol. Chem. 379:1045-52). Thus,
PNA may be incorporated into synthetic PTMs to increase their
stability and/or binding affinity for the target pre-mRNA.
[0069] In another embodiment of the invention synthetic PTMs may
covalently linked to lipophilic groups or other reagents capable of
improving uptake by cells. For example, the PTM molecules may be
covalently linked to: (i) cholesterol (Letsinger, R. L., et al.,
1989, Proc. Natl. Acad. Sci. USA, 86:6553-6556); (ii) polyamines
(Lemaitre, M., et al-1987, Proc. Natl. Acad. Sci, USA, 84:648-652);
other soluble polymers (e.g. polyethylene glycol) to improve the
efficiently with which the PTMs are delivered to a cell. In
addition, combinations of the above identified modifications may be
utilized to increase the stability and delivery of PTMs into the
target cell.
5.2. Synthesis of the Trans-Splicing Molecules
[0070] The nucleic acid molecules of the invention can be RNA or
DNA or derivatives or modified versions thereof, single-stranded or
double-stranded. By nucleic acid is meant a PTM molecule or a
nucleic acid molecule encoding a PTM molecule, whether composed of
deoxyribonucleotides or ribonucleotides, and whether composed of
phosphodiester linkages or modified linkages. The term nucleic acid
also specifically includes nucleic acids composed of bases other
than the five biologically occurring bases (adenine, guanine,
thymine, cytosine and uracil).
[0071] The RNA and DNA molecules of the invention can be prepared
by any method known in the art for the synthesis of DNA and RNA
molecules. For example, the nucleic acids may be chemically
synthesized using commercially available reagents and synthesizers
by methods that are well known in the art (Gait, 1985,
Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford,
England). Alternatively, RNA molecules can be generated by in vitro
and in vivo transcription of DNA sequences encoding the RNA
molecule. Such DNA sequences can be incorporated into a wide
variety of vectors which incorporate suitable RNA polymerase
promoters such as the T7 or SP6 polymerase. RNAs may be produced in
high yield via in vitro transcription using plasmids such as SPS65
(Promega Corporation, Madison, Wis.). In addition, RNA
amplification methods such as Q-P amplification can be utilized to
produce RNAs.
[0072] The nucleic acid molecules can be modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to
improve stability of the molecule, hybridization, transport into
the cell, etc. For example, modification of a PTM to reduce the
overall charge can enhance the cellular uptake of the molecule. In
addition modifications can be made to reduce susceptibility to
nuclease degradation. The nucleic acid molecules may include other
appended groups such as peptides (e.g., for targeting host cell
receptors in vivo), or agents facilitating transport across the
cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad.
Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad.
Sci. 84:648-652; PCT Publication No. WO88/09810, published Dec. 15,
1988) or the blood-brain barrier (see, e.g., PCT Publication No.
WO89/10134, published Apr. 25, 1988), hybridization-triggered
cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques
6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm.
Res. 5:539-549). To this end, the nucleic acid molecules may be
conjugated to another molecule, e.g., a peptide, hybridization
triggered cross-linking agent, transport agent,
hybridization-triggered cleavage agent, etc. Various other
well-known modifications to the nucleic acid molecules can be
introduced as a means of increasing intracellular stability and
half-life. Possible modifications include, but are not limited to,
the addition of flanking sequences of ribo- or deoxy-nucleotides to
the 5' and/or 3' ends of the molecule. In some circumstances where
increased stability is desired, nucleic acids having modified
internucleoside linkages such as 2'-O-methylation may be preferred.
Nucleic acids containing modified internucleoside linkages may be
synthesized using reagents and methods that are well known in the
art (see, Uhlmann et al., 1990, Chem. Rev. 90:543-584; Schneider et
al., 1990, Tetrahedron Lett. 31:335 and references sited
therein).
[0073] The nucleic acids may be purified by any suitable means, as
are well known in the art. For example, the nucleic acids can be
purified by reverse phase chromatography or gel electrophoresis. Of
course, the skilled artisan will recognize that the method of
purification will depend in part on the size and charge of the
nucleic acid to be purified.
[0074] In instances where a nucleic acid molecule encoding a PTM is
utilized, cloning techniques known in the art may be used for
cloning of the nucleic acid molecule into an expression vector.
Methods commonly known in the art of recombinant DNA technology
which can be used are described in Ausubel et al. (eds.), 1993,
Current Protocols in Molecular Biology, John Wiley & Sons, NY;
and Kriegler, 1990, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY.
[0075] The DNA encoding the PTM of interest may be recombinantly
engineered into a variety of host vector systems that also provide
for replication of the DNA in large scale and contain the necessary
elements for directing the transcription of the PTM. The use of
such a construct to transfect target cells in the patient will
result in the transcription of sufficient amounts of PTMs that will
form complementary base pairs with the endogenously expressed
pre-mRNA targets and thereby facilitate a trans-splicing reaction
between the complexed nucleic acid molecules. For example, a vector
can be introduced in vivo such that it is taken up by a cell and
directs the transcription of the PTM molecule. Such a vector can
remain episomal or become chromosomally integrated, as long as it
can be transcribed to produce the desired RNA. Such vectors can be
constructed by recombinant DNA technology methods standard in the
art.
[0076] Vectors encoding the PTM of interest can be plasmid, viral,
or others known in the art, used for replication and expression in
mammalian cells. Expression of the sequence encoding the PTM can be
regulated by any promoter known in the art to act in mammalian,
preferably human cells. Such promoters can be inducible or
constitutive. Such promoters include but are not limited to: the
SV40 early promoter region (Benoist, C. and Chambon, P. 1981,
Nature 290:304-310), the promoter contained in the 3' long terminal
repeat of Rous sarcoma virus (Yamamoto et at., 1980, Cell
22:787-797), the herpes thymidine kinase promoter (Wagner et al.,
1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory
sequences of the metallothionein gene (Brinster et al., 1982,
Nature 296:39-42), the viral CMV promoter, the human chorionic
gonadotropin-B promoter (Hollenberg et al., 1994, Mol. Cell.
Endocrinology 106:111-119), etc. Any type of plasmid, cosmid, YAC
or viral vector can be used to prepare the recombinant DNA
construct which can be introduced directly into the tissue site.
Alternatively, viral vectors can be used which selectively infect
the desired target cell.
[0077] In a specific embodiment, the vectors encoding the PTM(s) of
interest include recombinant conditionally replicative viruses that
have been genetically engineered to replicate in cancer cells,
tumor vasculature or in cells infected with pathogenic organisms.
These PTM(s) are designed to interact with pre-mRNA(s) selectively
expressed in cells permissive for viral replication and mediate a
trans-splicing reaction resulting in the production of light
producing proteins or enzymes that activate a photosensitizer and
induce cell death. These PTMs may be used to enhance the potency of
cell killing of conditionally replicating viruses. Alternatively,
these PTMs may be used as a fail-safe mechanism to limit the
replication and spread of conditionally replicating viruses.
[0078] In a specific embodiment of the invention recombinant
conditionally replicative adenoviruses designed to express PTMs
encoding a light producing protein or enzyme may be utilized to
target selective cell death. These conditionally replicating
adenoviruses may be engineered to selectively replicate in cancer
cells, endothelial cells of tumor vasculature or in cells infected
with a pathogenic microorganism by abrogation of viral functions
essential for replication in normal cells (Bischoff et al. 1996.
Science 274: 373376), or by transcriptional regulation of viral
genes essential for replication by cells elective promoters
(Hallenbeck et al., 1999 Human Gene Therapy 10:1721-1733).
[0079] In a specific embodiment of the invention, the conditionally
replicative adenoviruses encoding the PTM(s) of interest may be
engineered to alter the mechanism of the virus/cell interaction
thereby targeting selective adenovirus infection to a specific cell
type of interest, i.e., a cancer cell or infected cell. For
example, the structure of the adenovirus receptor binding
components, such as the viral capsid, may be genetically engineered
to promote specific interactions between engineered capsids and
target cell surface molecules expressed in the target cell. For
example, a receptor binding ligand can be linked to a capsid
protein through genetic engineering of the capsid gene.
Alternatively, biospecific chemical conjugates may be linked to the
adenovirus particles. (See, Adenoviral Vectors for Gene Therapy,
Curiel and Douglas, eds. 2002, Academic Press).
[0080] In a specific embodiment of the invention, the PTM(s) of
interest may be encoded by recombinant conditionally replicative
adenoviruses engineered to express PTM(s) that mediate
trans-splicing to pre-mRNAs selectively expressed in cancer or
infected cells to produce adenoviral protein(s) essential for viral
replication. The recombinant adenovirus is thus engineered to
encode PTMs capable of producing upon trans-splicing both (i) a
light producing enzyme and (ii) an adenovirus protein.
Alternatively, a single PTM may be designed to express an
adenovirus/light producing enzyme fusion protein, wherein the
adenovirus portion of the fusion protein retains its ability to
provide complementing activity and the light producing enzyme
portion retains its ability to generate light. Such recombinant
adenoviruses may be generated using a variety of different cloning
methods known to those of skill in the art including those
described in U.S. patent application Ser. No. 10/434,727, which is
incorporated herein in its entirety, and in Adenoviral Vectors for
Gene Therapy, Curiel and Douglas, eds. 2002, Academic Press and
Ausubel et al. (eds.), 1993, Current Protocols in Molecular
Biology, John Wiley & Sons, N.Y.; and Kriegler, 1990, Gene
Transfer and Expression, A Laboratory Manual, Stockton Press, N.Y.
In preferred embodiments of the invention, the adenoviruses are
type 2, 5, 9 or 35 adenoviruses.
[0081] For both in vitro or homologous recombination, transfection
methods that may be utilized for the delivery of a nucleic acid
molecule into the complementing cell include methods such as
electroporation, lipofection, or calcium phosphate mediated
transfection. The recombinant adenovirus may then isolated through
plaque purification.
[0082] In addition, methods for adenoviral preparation based on
homologous recombination of two plasmids using yeast artificial
chromosomes or bacteria may also be utilized to generate the
recombinant adenoviruses of the invention. U.S. patents disclosing
preparation of recombinant adenoviruses include: U.S. Pat. Nos.
5,962,313; 5,962,311; 5,952,221; 5,932,210; 5,928,944; 5,922,576;
5,919,676; 5,891,690; 5,885,808; 5,880,102; 5,877,011; 5,871,982;
5,869,037; 5,858,351; 5,851,806; 5,843,742; 5,837,484; 5,820,868;
5,789,390; 5,756,283; 5,747,072; 5,731,172; 5,700,470; 5,670,488;
5,616,326; 5,589,377; 5,585,362; and 5,354,678. Other references of
interest include Berkner, et al. (1983, Nucleic Acids Res. 11,
6003-6020); Bett, et al. (1994, Proc. Natl. Acad. Sci. USA, 91,
8802-6); Chartier, et al. (1996, J. Virol. 70, 4805-4810); Crouz et
et al. (1997, Proc. Natl. Acad. Sci. USA, 94, 1414-1419); Gilardi
et al. (1990, FEBS Lett. 267, 60-2); He, et al. (1998, Proc. Natl.
Acad. Sci. USA, 95, 2509-2514); Ketner, et al. (1994, Proc. Natl.
Acad. Sci. USA, 91, 6186-6190; Miyake, et al. (1996, Proc. Natl.
Acad. Sci. USA, 93, 1320-1324); and Rosenfeld, et al. (1991,
Science. 252, 431-4).
5.3. Uses and Administration of Trans-Splicing Molecules
[0083] The compositions and methods of the present invention will
have a variety of different applications including targeting of
cell lysis to cancer cells or cells infected with or adjacent to an
infectious agent. The methods of the invention comprise contacting
a cell, or tissue of a host, with a PTM of the invention or a
nucleic acid molecule encoding such a PTM. If the target pre-mRNA
is expressed in the cell, a trans-splicing reaction will occur
resulting in the production of a chimeric mRNA molecule capable of
encoding a light emitting protein or enzyme that produces light in
the presence of substrate. In addition, the cell is further
contacted with a photosensitizer wherein co-localization of the
photosensitizer, the light producing enzyme and substrate, results
in production of cytotoxic substances, such as oxygen-related
intermediates. Such photosensitizers include, but are not limited
to rose bengal, hypercin, haematoporphyrin (HPD) porfimer sodium,
benzoporphyrin derivative monoacid ring A (BPD-MA),
metatetrahydroxyphenylchlorin (MTHPC), 5-amino1evulinec acid
(5-ALA), 5-ALAmethylester, 5-ALA benzylester, 5-ALA hexylester, tin
ethyl tipurpurin (SnEt2), boronate protoporphyin,
2-(1-hexyloxyethyl)-2-devinyl pyropheophorbide-alpha (HPPH),
lutetium texaphyrin, phthalocyanine-4 and taporphin sodium. Since
each photosensitizer is stimulated by a specific wavelength of
light, the selection of photosensitizer to be used will depend on
the wavelength of light produced by the protein or light producing
enzyme/substrate reaction. Other substances can be activated or
precipitated by light, including metal salts, such as silver
nitrate and others which are well known in the photographic arts.
Toxicity can by mediated directly by the metal itself, or
indirectly by acting as a co-factor in an enzymatic reaction, or by
activation of the metal by externally applied neutrons (Merril,
1990 Nature 343:779-80).
[0084] Various delivery systems are known and can be used to
transfer the compositions of the invention into cells, e.g.
encapsulation in liposomes, microparticles, microcapsules,
recombinant cells capable of expressing the composition,
receptormediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol.
Chem. 262:4429-4432), construction of a nucleic acid as part of a
virus or other vector, injection of DNA, electroporation, calcium
phosphate mediated transfection, etc.
[0085] Any of the methods for gene delivery into a host cell
available in the art can be used according to the present
invention. For general reviews of the methods of gene delivery see
Strauss, M. and Barranger, lA., 1997, Concepts in Gene Therapy, by
Walter de Gruyter & Co., Berlin; Goldspiel et al, 1993,
Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95;
Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 33:573596;
Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993,
Ann. Rev. Biochem. 62:191-217; 1993, TIBTECH 11(5):155-215.
Exemplary methods are described below.
[0086] In a specific embodiment, the nucleic acid is directly
administered in vivo, where it is expressed to produce the PTM.
This can be accomplished by any of numerous methods known in the
art, e.g., by constructing it as part of an appropriate nucleic
acid expression vector and administering it so that it becomes
intracellular, e.g. by infection using a defective or attenuated
viral vector (see U.S. Pat. No. 4,980,286), or by direct injection
of naked DNA, or by use of microparticle bombardment (e.g., a gene
gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or transfecting agents, encapsulation in liposomes,
microparticles, or microcapsules, or by administering it in linkage
to a peptide which is known to enter the nucleus, by administering
it in linkage to a ligand subject to receptor-mediated endocytosis
(see e.g., Wu and Wu, 1987, 1. Biol. Chem. 262:4429-4432).
[0087] In a specific embodiment, an adenoviral vector that contains
the PTM can be used. For example, a adenoviral vector can be
utilized that has been modified to delete adenoviral sequences that
are not necessary for packaging of the viral genome and which
expresses a PTM capable of expressing a light producing enzyme upon
trans-splicing. Alternatively, lentiviral, retroviral or
adeno-associated viral vectors, among others can be used for gene
delivery to cells or tissues. (See, Kozarsky and Wilson, 1993,
Current Opinion in Genetics and Development 3:499-503 for a review
of adenovirus-based gene delivery).
[0088] Another approach to PTM delivery into a cell involves
transferring the PTM to cells in tissue culture by such methods as
electroporation, lipofection, calcium phosphate mediated
transfection, or viral infection.
[0089] The present invention also provides for compositions
comprising an effective amount of a PTM or a nucleic acid encoding
a PTM, and an acceptable carrier. In a specific embodiment, the
term "pharmaceutically acceptable" means approved by a regulatory
agency of the Federal or a state government or listed in the U.S.
Pharmacopeia or other generally recognized pharmacopeia for use in
animals, and more particularly in humans. The term "carrier" refers
to a diluent, adjuvant, excipient, or vehicle with which the PTM is
administered. Examples of suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical sciences" by E. W.
Martin.
[0090] In specific embodiments, pharmaceutical compositions are
administered: (1) in diseases or disorders involving the expression
of a cancer selective target pre-mRNA, e.g., tumor cells; (2) in
diseases or disorders where cells are infected with an infectious
agent and express a target pre-mRNA encoded by or produced in
reaction to the presence of infectious agent or (3) diseases or
disorders arising from the activity of a specific cell type.
[0091] In a specific embodiment, it may be desirable to administer
the pharmaceutical compositions of the invention locally to the
area in need of treatment, e.g., the site of the tumor. This may be
achieved by, for example, and not by way of limitation, inhalation,
local infusion during surgery, topical application, e.g., in
conjunction with a wound dressing after surgery, by injection, by
means of a catheter, by means of a suppository, or by means of an
implant, said implant being of a porous, non-porous, or gelatinous
material, including membranes, such as sialastic membranes, or
fibers. Other control release drug delivery systems, such as
nanoparticles, matrices such as controlled-releasepolymers, hydro
gels.
[0092] The methods of the invention comprise administration of both
(i) the PTMs of the invention, i.e., those PTMs capable of
expressing a light producing protein or enzyme, (ii) when an enzyme
is utilized, an enzyme substrate and (iii) a photosensitizer
wherein co-localization of cells expressing the light producing
protein or enzyme/substrate and the photosensitizer results in
activation of the photosensitizer. Such activation will result in
production of cytotoxic oxygen-related intermediates capable of
mediating cell death.
[0093] The extent of cytotoxicity is multifunctional and will
depend on the type of photosensitizer used, its location, the dose
administered, the total dose of light, oxygen availability and the
time between administration of the photosensitizer and light
exposure. Such parameters can be determined using procedures well
known to those of skill in the art.
[0094] The PTMs of the invention will be administered in amounts
which are effective to produce the desired effect in the targeted
cell, e.g., cell lysis. Effective dosages of the PTMs can be
determined through procedures well known to those in the art which
address such parameters as biological half-life, bioavailability
and toxicity. In addition, the presence of substrate is required
for enzyme mediated generation of light.
[0095] In addition, photo sensitizers are administered in amounts
which are effective to produce the desired effect in the targeted
cell, e.g., cell lysis. Effective dosages of the photo sensitizers
can also be determined through procedures well known to those in
the art which address such parameters as biological half-life,
bioavailability and toxicity.
[0096] The amount of the composition of the invention which will be
effective will depend on the nature of the disease or disorder
being treated, and can be determined by standard clinical
techniques. In addition, in vitro assays may optionally be employed
to help identify optimal dosage ranges.
[0097] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described
herein will become apparent to those skilled in the art from the
foregoing description and accompanying Figures. Such modifications
are intended to fall within the scope of the appended claims.
Various references are cited herein, the disclosure of which are
incorporated by reference in their entireties.
6. Example
Trans-Splicing of Luciferase into Exogenously Expressed Genes
[0098] The following example describes the production of PTMs
designed to encode a light producing enzyme.
6.1. Materials and Methods
6.1.1. Design and Construction of PTMs
[0099] The binding domain of PTMs can be assembled from either PCR
products or annealed oligonucleotides. The coding sequence for
firefly luciferase is generated by PCR or directly cloning from
commercially available plasmid cDNA (Promega). To reduce the
possibility of self-expression of the PTM prior to trans-splicing,
the initiator AUG codon may be eliminated from the coding sequence
during PCR amplification or cloning. As an example Luc-PTM 1, shown
in FIG. 3, consists of an antisense target binding domain of
100-200 nt complementary to .beta.-HCG6 intron 1, a spacer
sequence, a yeast branchpoint consensus sequence (UACUAAC) (SEQ.
I.D. No. 3), an extensive polypyrimidine tract (12-15 pyrimidines),
a 3' acceptor site (AG dinucleotide) followed by the complete
coding for firefly luciferase minus the initiator codon. One or
more nucleotides may be added or removed to insert the coding
sequence into the proper reading frame, so that upon
trans-splicing, the luciferase gene will be in the translational
frame with the remaining exons of the target pre-mRNA. Unique
restriction sites are placed between each of the PTM elements,
facilitating the replacement of individual elements. In addition,
the binding domain may contain alternate sites that initiate
transcription out of frame from the reporter gene thereby
preventing translation and expression of unspliced PTMs.
[0100] Optimization of PTMs. A number of approaches can be taken to
improve the characteristics of luciferase PTMs as described
below.
[0101] Binding domain: Several different forms of binding domain
can be utilized. Using lacZ as a pre-screening model (FIG. 5) it
was demonstrated that some PTMs with longer binding domains
trans-spliced with higher frequency to the intended target pre-mRNA
compared to PTMs with shorter binding domain (Puttaraju et al.,
2001 Molecular Therapy 4:105-14). This data suggest that location,
length and number of binding domains may increase the interaction
of the PTM with the target. The increased interaction between the
target and PTM can enhance both the efficiency and specificity of
trans-splicing reaction.
[0102] Initially, PTMs with binding domains spanning 50-200
nucleotides are constructed and assayed. Safety PTMs with stem loop
binding domains may also be produced. Based on the efficiency of
the trans-splicing reactions, if necessary, binding domains longer
than this (200-400 nt) can be utilized. Binding domains can also be
designed to target different regions of the same intron, e.g.
binding domains close to the donor vs. the acceptor site, or
binding domains targeted to completely different introns.
[0103] Screening for PTM cis-splicing: To reduce the possibility of
cis-splicing in the trans-splicing domain (TSD) of the PTM prior to
target binding, TSD sequences are analyzed for the presence of
potential 5' and 3' cryptic splice sites (GU-AG and AT-AC, U12 type
introns) prior to construction of the binding domain. This is
especially important for the linear binding domain PTMs (see below)
because their intended splice sites may be available for binding
splicing factors at all times. For each instance of single sites in
the Binding Domain (ED) or spacer that could potentially be used as
a cryptic 5' splice site are usually altered from GT to AT or other
nucleotide combination with lowered potential to act as a 5' splice
donor. For each situation a single site in the TSD that could
potentially be used as a 3' cryptic splice site is usually altered
from TAG/G to TTGC. The PTM can be screened by RT-PCR to check for
the presence of major products (cis or trans) of unexpected size.
PTM coding sequences may also be screened and altered if necessary
in a similar manner to add or alter splicing enhancers or other
sequences which can modulate splicing.
[0104] 3' splice elements. 3' splice elements including the
branchpoint (BP), the polypyrimidine tract (PPT) and a 3' acceptor
site (AG dinucleotide) may also be included. Trans-splicing can be
modulated by changing the sequence of the BP and the length and
composition of the PPT. A yeast consensus branchpoint sequence
UACUAAC (SEQ. I.D. No. 4) provides a greater rate of trans-splicing
in mammalian cells (Puttaraju et al., 1999 Nature Biotechnology
17:246-52).
[0105] Modulating specificity with "safety" stems. Initial
experiments can be performed with "linear" PTMs to maximize the
trans-splicing efficiency. Linear PTMs have a binding domain
designed to exist predominately in a single stranded configuration
to maximize base pairing to target and trans-splicing efficiency.
To achieve a higher degree of targeting specificity and
trans-splicing, the trans-splicing domain is designed to include
intra-molecular stems (termed `safety PTM`) designed to mask the 3'
splicing elements carried in the PTM from spliceosomal components
prior to target binding. Base pairing between free portions of the
PTM binding domain with the target is thought to facilitate the
unwinding of the safety stem, allowing the splicing factors access
to bind to the splice site and initiate trans-splicing. A schematic
drawing of the safety mechanism is illustrated in FIG. 4. An array
of safety PTM designs are constructed and tested by varying the
strength of the safety stem and assessing trans-splicing efficiency
and specificity. For example, a safety PTM targeting the CFTR
pre-mRNA has been designed with equivalent efficiency in
trans-splicing as its parental PTM with improved specificity
(Mansfield et al, 2000 Gene Therapy 7:1885-95).
[0106] Untranslated regions. Modification of 3' UTR and RNA
processing signals are also carried out to increase RNA processing
and stability. To increase the stability of trans-spliced messages
and ultimately the level of luciferase activity, alternative
polyadenylation signals may be engineered in the 3' untranslated
sequence. To maximize the efficiency of 3' end cleavage and
polyadenylation of trans-spliced mRNA, each PTM construct can be
modified by including GT rich sequences (consensus YGTGTTYY) (SEQ.
I.D. No. 5) downstream of the poly-A signal. This consensus,
initially identified in herpes simplex virus genes, has been shown
to be present in a large number of mammalian genes. Other
modifications are also possible.
[0107] 6.1.2. Cell Models
[0108] The PTM modifications described above are tested in the
following cell based models. HPV infected/expressing cell lines
including CaSki and SiHa cells are cervical cancer cell lines that
express high and low levels of HPV RNA, respectively. .beta.-HCG6
cell lines include H1299 which is a lung adenocarcinoma cell line
that expresses low levels of target transcript. JEG-3 is a
coriocarcinoma cell line that expresses considerably higher levels
of B-HCG6 mRNAs. EGFR expressing cell lines include A431, an
epidermoid carcinoma cell line that over expresses EGFR and MCF7;
an epithelial breast cancer cell line is used extensively in cancer
research. In addition, Eccles et al., has published on a variety of
tumor cell lines that have expressed varying levels of EGFR
(0-Charoenrat et al, 2000 Int J. Cancer 86:307-17).
6.1.3. Assaying for Trans-Splicing
Targeting Endogenous Transcripts
[0109] Cells are transfected with PTM plasmids using Lipofectamine
or TransFast reagents. Trans-splicing efficiency and specificity is
assessed by performing luciferase activity assays and RT-PCR
analysis of cells (transiently transfected or neomycin selected
populations).
[0110] Luciferase activity assays. Trans-splicing mediated
luciferase activity is initially monitored in cell extracts using
luciferase assay reagents (Promega). If necessary, dual reporters
are used as a means to measure the specificity of trans-splicing.
This approach provides an internal control that is useful to
account for the experimental variations caused by differences in
cell viability, transfection efficiency, and cell lysis efficiency.
The studies are performed with luciferase based PTMs including, for
example, firefly and Renilla luciferases. Each marker has distinct
kinetics and emission spectra, dissimilar structure and different
substrate requirements, properties that make it possible to
selectively discriminate between their respective bioluminescent
reactions. Controls are performed to exclude the possibility that
chimeric products between luciferase and targets are not being
generated by recombination events.
[0111] Transfected cells are imaged using a CCD low-light
monitoring system. In addition, trans-splicing efficiency at the
RNA level is determined by real time quantitative RT-PCR analysis
of total RNA samples using target and PTM specific primers.
[0112] It may be more efficient to initially select the best PTM
candidates for the premRNA targets, using cell lines that express
the target RNA from a stable integrated minigene construct. The
advantages of this system include the following: (i) the cell lines
express target RNA from a genomic locus recapitulating the
endogenous system, (ii) the cells are easy to transfect, and (iii)
high levels of target transcript is produced, making it quicker and
easier to assess differences in efficiency and specificity between
PTMs. Cell lines that express different levels of the target
pre-mRNA or use inducible promoters to modulate expression level
may also be used. Inducible promoters will facilitate the
determination of sensitivity of trans-splicing and correlation of
target mRNA concentration to luciferase signal.
[0113] A simple pre-screening model based on the p-galactosidase
repair model (Puttaraju et al., 2001 Mol. Ther. 4:105-14) (FIG. 5A)
can also be utilized. This system involves the insertion of the
target introns from B-HCG6, HPV or EGFR into a mutant luciferase
gene. The target is established in a stable cell line or
cotransfected with PTMs. Efficiency will be quickly assessed by
RT-PCR and luciferase activity assays. This type of system has
proved extremely useful as a pre-screen for PTM binding domain
sequences (Puttaraju et al., 2001 Mol. Ther. 4:105-14).
Alternatively, libraries with greater complexities may be screened
using methods described in the provision patent application U.S.
60/420,498 filed on 10/23/2002.
7. Example
Luciferase Model for Trans-Splicing
[0114] To evaluate the potential use of spliceosome mediated RNA
trans-splicing for expression of a light producing enzyme or
protein, a luciferase model was developed. To quantify the level of
luciferase generated by trans-splicing in cells and small animal
models, a pre-mRNA target was constructed that expressed part of
the synthetic Renilla or Firefly luciferase sequence, coupled to
the coding sequences for HPV E7 and the sequence of HPV immediate
upstream of E7 from the human papilloma virus (HPV) (FIG. 6). The
chimeric pre-mRNA target undergoes normal cis-splicing to produce
an mRNA but no luciferase activity. A pre-trans-splicing molecule
(PTM) was engineered that should base pair with the target intron
and trans-splice the 3' luciferase `exon`, into the target
producing full length luciferase mRNA capable of producing
luciferase activity (FIGS. 7 and 8). This PTM (Luc-PTM13) contains
an 80 bp targeting domain that is complementary to intron 1 of HPV
mRNA, a branchpoint (UACUAAC) (SEQ. I.D. No. 6) and polypyrimidine
tract, AG dinucleotide acceptor followed by 3' hemi luciferase
`exon`. This region was selected based on the results targeting
this clinically relevant splice site in HPV mRNA, where as high as
70% trans-splicing efficiency was achieved in cell culture models.
A splice mutant was also constructed by deleting both the
branchpoint and polypyrimidine sequences. Using these constructs,
accurate trans-splicing of luciferase PTM13 (Luc-PTM13) into
HPV-LucT1 target in human cells was demonstrated. Human embryonic
kidney cells were transfected with either target, PTM alone as
controls or co-transfected with both target and PTM expression
plasmids. In a separate transfection target and splice mutant PTM
were co-transfected. RT-PCR analysis of total RNA using target and
PTM specific primers produced the expected trans-spliced (435 bp)
product only in cells that contained both target and PTM but not in
controls (target, PTM alone and target+splice mutant PTM) (FIG.
9).
[0115] Direct sequence of this RT-PCR product confirmed the
accurate trans-splicing between the target and PTM (FIG. 10). The
efficiency of trans-splicing mediated restoration of function was
confirmed at the protein level by assaying for luciferase activity.
The results are summarized in FIG. 11. Co-transfection of a
specific target with Luc-PTM13 resulted in the repair and
restoration of luciferase function that is on the order of 4-logs
over the background. No luciferase activity above background was
detected in controls or with splice mutant PTM suggesting that the
restoration of luciferase function is due to trans-splicing (FIG.
11).
[0116] In a parallel study, PTMs that trans-splice complete
luciferase coding (minus the 1st ATG codon) into the /3-HCG6
pre-mRNA target were constructed. Preliminary results suggest that
these PTMs are self-expressing. This was not overly surprising
because these PTMs may be using one of the internal methionines
contained in the coding sequence of luciferase for translation. To
circumvent this the following approaches may be taken: (1)
conversion of the methionines at amino acid position 8 and 27, for
example, of luciferase coding sequence to isolucine; (2) adding a
nuclear retention signal (U6 snRNA) at the 5' end to prevent PTM
export prior to trans-splicing, and (3) designing PTMs such that
they would initiate translation out-of-frame if the PTMs are
exported into the cytoplasm without undergoing trans-splicing.
8. Example
Expression of Light Producing Enzymes in Cells Using Synthetic PTM
RNA
8.1. Materials and Methods
8.1.1. In Vitro Transcription and Purification of RNA
[0117] Template DNA: Plasmids, pc3.1Luc-PTM13, pc3.1Luc-PTM14 and
pc3.1Luc-13-BP/PPT (splice mutant PTM) containing T7 promoter were
digested with Hind III restriction enzyme at 37.degree. C. The
products were extracted with buffered phenol followed by chloroform
or purified using Qiaquick PCR purification kit (Qiagen). The DNA
was recovered by ethanol precipitation and washed twice with 70%
ethanol, air dried for 5 minutes, re-suspended with sterile water
and used for in vitro transcription.
[0118] In vitro transcription: In vitro transcription was performed
in 20/-11 reaction using mMESSAGE mMACHINE high yield capped RNA
transcription kit for capped RNA following manufacturers protocol
(Ambion) and 1 ug of linearized plasmid DNA template. The reactions
were incubated at 37.degree. C. for 2-3 hours and the DNA template
was destroyed by adding 1/-11 of DNase 1 (2U//-1I) and continuing
the incubation at 37.degree. C. for an additional 45 minutes. The
poly A tail (-150-200 nt) was added to the in vitro transcribed RNA
using poly A tailing kit (Ambion) by incubating the reaction with
E. coli poly A polymerase and ATP by incubating at 37.degree. C.
for 60 minutes. Reactions were terminated by placing the tubes on
ice and the RNAs were purified as described below.
[0119] RNA Purification: In vitro transcribed, poly A tailed RNA
was purified using MEGAclear purification kit (Ambion) which is
designed to remove unincorporated free nucleotides, short
oligonucleotides, proteins and salts from RNA. Briefly, RNA was
bound to the filter cartridge, washed with washing buffer and
eluted with a low salt buffer.
8.1.2. Synthetic RNA Transfections
[0120] The day before transfection, 1.times.106 293T cells were
plated in 60 mm tissue culture plate with 5 ml of DMEM growth
medium supplemented with 10% FBS. Cells were incubated at
37.degree. C. in a CO2 incubator for 12-14 hours or until the cells
are .about.70-80% confluent. Before transfection, the cells were
washed with 2 ml Opti-MEM 1 reduced serum medium. The RNA-Lipid
complexes were prepared by adding 1.7 ml of Opti-MEM 1 into 2 ml
tube followed by 8 .mu.l of DMRIE-C transfection reagent
(Invitrogen) and mixed briefly. To the above mix, known amount of
the in vitro transcribed, poly A tailed and purified RNA was added,
vortexed briefly and immediately added drop wise on to the cells.
The cells were incubated for 4 hours at 37.degree. C. and then the
transfection medium was replaced with complete growth medium (DMEM
with 10% FBS). After incubating for an additional 24-48 hours, the
plates were rinsed with PBS once, cells harvested and total RNA was
isolated using MasterPure RNA purification kit (Epicenter
Technologies, Madison, Wis.). Contaminating DNA in the RNA
preparation was removed by treating with DNase I at 37.degree. C.
for 30-45 minutes and the product RNA was purified as recommended
in the kit.
8.1.3. Reverse Transcription and Polymerase-Chain Reaction
CRT-PCR)
[0121] Total RNA (2.5 .mu.g) from the transfections was converted
to cDNA using the MMLV reverse transcriptase enzyme (Promega) in a
25 .mu.l reaction following the manufacturers protocol with the
addition of 50 units RNase Inhibitor (Invitrogen) and 200 ng Luc-1
1R PTM specific primer (5' AAGCTTTTACTGCTCGTTCTTCAGCACGC) (SEQ.
I.D. No. 7). cDNA synthesis reactions were incubated at 42.degree.
C. for 60 minutes followed by incubation at 95.degree. C. for 5
minutes. This cDNA template was used for PCR reactions. PCR
amplifications were performed using 100 ng of primers and 1 .mu.l
template (RT reaction) per 50 .mu.l PCR reaction. A typical
reaction contained .about.25 ng of cDNA template, 100 ng of
primers: Luc-33R (5'-CAGGGTCGGACTCGATGAAC) (SEQ. I.D. No. 8) and
Luc-34F, 5'-GGATATCGCCCTGATCAAGAG) (SEQ. I.D. No. 9) 1X REDTaq PCR
buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCI, 1.1 mM MnCl.sub.2 and
0.1% gelatin), 200 .mu.M dNTPs and 1.5 units of REDTaq DNA
polymerase (Sigma, Saint Louis, Mo.). PCR reactions were performed
with an initial pre-heating at 94.degree. C. for 2 minutes 30
seconds followed by 25-30 cycles of 94.degree. C. for 30 seconds
(denaturation), 60.degree. C. for 36 seconds (annealing) and
72.degree. C. for 1 minute (extension) followed by a final
extension at 72.degree. C. for 7 minutes. The PCR products were
then analyzed on a 2% agarose gel and the DNA bands were visualized
by staining with ethidium bromide.
8.1.4. Assay for Renilla Luciferase Activity
[0122] 48 hours post-transfection the cells were rinsed once with
IX phosphate buffered saline (PBS) and harvested following the
standard procedures. The cell pellet was re-suspending in 100 .mu.l
of lysis buffer, lysed and Renilla Luciferase activity was measured
by the Renilla Luciferase assay system (Promega, Madison, Wis.,
USA) using a Turner 20/20TD luminometer.
8.2. Results
[0123] Using in vitro synthesized PTM RNA as genetic material, it
was demonstrated that synthetic PTMs could be utilized for gene
expression of light producing enzymes in human cells. As described
above, to quantify the level of synthetic Renilla luciferase
activity generated by trans-splicing, a synthetic Renilla
luciferase model system was developed. (See FIG. 8). To demonstrate
the use of synthetic PTMs, Luc-PTM 13, LucPTM 14,
Luc-13.about.BP/PPT (FIG. 12) and the HPV-Luciferase chimeric
target (HPVLucT1) RNAs (capped and poly A tailed) were synthesized
using bacteriophage T7 RNA polymerase in vitro. Contaminating DNA
was destroyed by treating with RNase free DNase 1, the RNA was
purified and used for transfections. The transfections were
performed as described above using DIMRE-C reagent. 48 hours
post-transfection, total cellular RNA was isolated using MasterPure
RNA isolation kit and analyzed by RT-PCR using target (Luc-34F) and
PTM (Luc-33R) specific primers as described above. As shown in FIG.
13, no product was detected with RNA samples from mock, target or
PTM alone control transfections (lanes 1-4). RNA from cells that
were co-transfected with the HPV-luciferase target and a functional
PTM produced a specific 298 bp product (FIG. 13, lanes 6 and 7). No
such product was detected with RNA from cells that were
co-transfected with target and splice mutant PTM
(Luc13.DELTA.PB/PPT), which does not contain a functional 3' splice
site (no branchpoint and polypyrimidine tract) (lane 5). These
results not only demonstrate the importance of both the branchpoint
and the pyrimidine tract for trans-splicing but also confirm that
the production of the 298-bp product is due to trans-splicing. The
accuracy of trans-splicing between HPV-LucT1 target pre-mRNA and
Luc-PTM13 and Luc-PTM14 was confirmed by direct sequencing of the
RT-PCR product.
[0124] The efficiency of trans-splicing mediated mRNA repair and
restoration of synthetic Renilla luciferase function was confirmed
by assaying for enzymatic activity. As shown in FIG. 14, the
synthetic Renilla luciferase activity in target or PTM alone
control transfections is essentially at the background level that
is observed in mock transfection. Co-transfection with a specific
HPV-Iuciferase target (HPV-LucT1) along with Luc-PTM13 or Luc-PTM14
resulted in the repair of the target pre-mRNA and restored
synthetic Renilla luciferase activity to a level that is 2000-fold
over the background observed with a splice mutant PTM under similar
experimental conditions. These results demonstrated the successful
use of synthetic PTMs for targeting expression of light producing
enzymes.
9. Example
Expression of Light Producing Enzymes Through 3' Exon
Replacement
[0125] The PTM contains the complete coding of firefly luciferase
minus the AUG start codon. The trans-splicing domain consists of a
set of strong 3' splice elements (including a yeast consensus
branchpoint, a long pyrimidine tract and a 3' acceptor site), a
spacer sequence and a 125 nucleotide binding domain complementary
to the 3' end of the intron between exons E6 and E7 of human
papilloma virus (HPV) (FIG. 15). The trans-splicing model for this
PTM is shown in FIG. 16. To prevent PTM translation in the absence
of trans-splicing a number of methionines in the 5' end of the PTM
coding were modified. This was carried out by site directed
mutagenesis in which methionines were converted to codons that were
considered conservative substitutions (based on amino acid
alignments with other luciferase genes).
[0126] One potential problem is that in some instances the PTM
itself may be translated. Since the 3' exon replacement luciferase
PTMs include the complete luciferase coding (minus the AUG
initiator codon) and not a fragment of the full-length eDNA (as is
the case with most previous PTMs) there could be a problem with
un-spliced PTM being exported into cytoplasm and translation in the
absence of trans-splicing. Thus, a Renilla luciferase based PTM
that can perform 5' exon replacement was generated. This form of
PTM has the potential advantage of reduced PTM translation since
the constructs can be engineered without a polyA signal. In the
absence of this signal the RNA cannot be properly processed and
translated.
[0127] The structure of the Renilla luciferase 5' exon replacement
PTM is shown in FIG. 18. It consists of the full coding for Renilla
luciferase split into two "exons", separated by a mini-intron. The
trans-splicing domain contains a consensus 5' donor site, a short
spacer sequence and a binding domain complementary to the 3' end of
the intron between exons E6 and E7 of the human papilloma virus
(HPV). The trans-splicing model for this PTM is shown in FIG.
19.
[0128] Firefly luciferase PTMs were cotransfected with or without a
HPV mini-gene target (see FIG. 16) in 293T cells. Cells were
harvested after 48 hours and assayed for luciferase activity. These
experiments showed that samples with target produced .about.2 fold
higher activity indicating that trans-splicing was occurring with
the mini-gene target and that there was reduced translation of the
PTM (see FIG. 17).
10. Example
Hemi-Reportermodel Targets and PTMs
[0129] FIG. 20 depicts the hemi-reporter model targets and PTMs
used for expression of light producing enzymes. The mini-gene
pre-mRNA targets consists of the 5' portion of humanized Renilla
luciferase (hRluc) which acts as a "5' exon", coupled to the E6-E7
intron region and adjacent E7 coding sequence of human papilloma
virus (HPV16).
[0130] As depicted in FIG. 20, PTMs consisting of the remainder of
the light producing enzyme were engineered to repair the mRNA and
restore function. Several PTMs were constructed consisting of a
"binding domain" complementary to the HPV target intron, a 3'
splice site (consisting of a BP, PPT and acceptor AG nucleotide),
and the remainder hRL sequence as a 3' exon. The only difference
between the PTMs is the size of the "3' exon" which ranged from 255
nt to 50 nt. Through its binding domain, the PTM is expected to
base pair and co-localize with the target pre-mRNA. This
facilitates trans-splicing between the splice sites of the target
"5' exon" and the "3' exon" of the PTM, repairing the target mRNA
and producing enzymatic activity.
[0131] To compare the trans-splicing efficiency of PTMI14, PTM28
and PTM37, human embryonic kidney (293T) cells were transfected
with target and with the PTMs described above. 48 hours
post-transfection, total cellular RNA was isolated and analyzed by
RT-PCR using a target and a PTM specific primer. Based on a
semiquantitative estimation, Luc-PTM28 and Luc-PTM37 showed more
efficient transsplicing (.about.2-4 fold) compared to Luc-PTM14
(FIG. 21). Here, a smaller PTMs trans-spliced more efficiently than
the larger PTMs.
[0132] The efficiency of trans-splicing mediated mRNA repair and
restoration of Luciferase function was confirmed by assaying for
enzymatic activity. As demonstrated in FIG. 22, Luciferase activity
in target or PTM alone control transfections is essentially at the
background level that is observed in mock transfection.
Co-transfection with a specific HPV-Iuciferase hemi-reporter
target, HPV-LucT1, HPV-LucT2 or HPVLucT3 along with Luc-PTM14,
Luc-PTM28 or Luc-PTM37, respectively, resulted in the efficient
repair of pre-mRNA targets and restored luciferase activity on the
order of 3-4 logs over background (FIG. 22). Luciferase activity
produced by Luc-PTM37 is .about.3 fold higher compared to
Luc-PTM14.
11. Example
Targeting Gene Expression Using Full-Length PTMs Encoding a Light
Producing Enzyme
[0133] The full length PTM (Luc-PTM27) contains the complete coding
sequence for humanized Renilla Luciferase (hRL) minus the AUG start
codon. The trans-splicing domain consists of a strong 3' splice
element (including a yeast consensus branch point (BP), a long
pyrimidine tract (PPT) and a 3' acceptor site), a spacer sequence
and a 80 nucleotide binding domain (BD) complementary to the 3' end
of the intron between exons E6 and E7 of human papilloma virus
(HPV-16) (FIG. 23A). Schematic illustration of trans-splicing
mediated restoration of Luciferase function is shown in FIG.
23B.
[0134] Full-length PTM was co-transfected with or without a HPV
mini-gene target into 293 cells. Cells were harvested 48 hr
post-transfection and assayed for luciferase activity. The results
depicted in FIG. 24 demonstrate that cells with target produced
.about.3 fold higher luciferase activity indicating the proper
trans-splicing between the HPV minigene target and the PTM. The
results also indicate that this particular PTM (in the absence of
target) does express the light producing enzyme which may be partly
due to (i) direct translation of the PTM, (ii) PTM cis-splicing and
translation or (iii) non-specific trans-splicing.
[0135] A Luciferase splice mutant PTM was constructed to determine
whether the restoration of Luciferase function is due to RNA
trans-splicing (FIG. 25B). The PTM is a derivative of Luc-PTM38
(FIG. 25A) in which the 3' splice elements such as BP, PPT and the
acceptor AG dinucleotide were modified by PCR mutagenesis and were
confirmed by sequencing.
[0136] 293T cells were co-transfected with or without HPV mini-gene
target along with either a functional or splice mutant PTM. Cells
were harvested after 48 hours and assayed for Luciferase function.
As depicted in FIG. 26, the Luciferase activity in cells
transfected with splice mutant PTM and with or without HPV
mini-gene target are similar to the background observed with mock
transfection. In contrast, cells that were co-transfected with
Luc-PTM38 (functional PTM) and with target produced .about.4-5 fold
more Luciferase activity compared to PTM38 alone.
12. Example
Targeting of Gene Expression of Gene Expression
[0137] The results described below demonstrate the successful in
vivo target expression of light producing enzymes through
spliceosome mediated RNA trans-splicing. The experimental results
described below indicate the successful development of PTMs that
can target and trans-splice sequences encoding a light producing
enzyme into an endogenous pre-mRNA of interest, including those
associated with diseases such as infectious diseases and
proliferative, neurological and metabolic disorders, thereby
producing a chimeric mRNA encoding the light producing enzyme
through Spliceosome mediated RNA trans-splicing. This approach
provides methods for targeting expression of a light producing
enzyme to a specific cell type.
[0138] A pre-mRNA target was constructed that had the 5' part of
hRluc sequence, coupled to the coding sequence for human papilloma
virus (HPV) E6 & E7 and the intronic sequences immediately
upstream. Cis-splicing of HPV-LucTI does not produce any hRluc
activity. Several PTMs carrying the remaining hRluc sequence as a
3' exon were genetically engineered. Through its targeting domain,
the PTM base pairs with the HPV-LucT1 intron facilitating the
trans-splicing of the 3' luciferase exon, thereby repairing the
pre-mRNA target and subsequently restoring enzymatic activity. The
PTMs contain a targeting domain that is complementary to the intron
in HPV-LucTI, a branch point (BP), pyrimidine tract (Py) and a 3'
splice acceptor site. For in vivo applications, PTMs were complexed
with transferrinpolyethylineamine (Tf-PEI) (Hildebrandt, I. et al.,
2002, Molecular Therapy 5:S421).
[0139] To test in vivo targeting of gene expression,
2.5.times.106293T cells were transfected with PTM 14, target or
target+PTM 14 (1 0 ug/plate) on Day 1. The ratio of PTM to target
was 1:1. On Day 2, cells were washed with PBS and 1.times.106 cells
were injected subcutaneously into a mouse. On Day 3, cells within
the mice were imaged by use of a cooled CCD camera immediately
after injection of Coe1enterazine substrate via tail vein (Bhaumik
& Gambhir, 2002, Proc. Natl. Acad. Sci. USA 99:377-382). As
depicted in FIG. 27, no signal was detected in cells transfected
with target (T) or PTM (P) alone. In contrast, cells co-transfected
with target and PTM produced high signal levels (T+P). The results
clearly indicate successful RNA trans-splicing to target gene
expression in vivo.
[0140] In a second experiment, 2.5.times.10.sup.6 N2a cells were
transiently transfected with HPV-LucTI target plasmid (10 .mu.g) on
Day 1. On Day 2, cells were washed with PBS and
.about.5.times.10.sup.6 cells were implanted into 3-4 week old nude
mice. Following implantation, 50 ug of Luc-PTM-14 conjugated with
transferring-polyethylineamine (Tf-PEI) was then injected into the
mouse via the tail vein. On Day 3, 80 ug of Coelenterazine
substrate was injected via tail vein and the mice were imaged
immediately for 5 min using a cooled CCD camera. As depicted in
FIG. 28 tumors expressing HPV-LucT1 pre-mRNA target produced
signals that were statistically significant (P<0.05)., In
contrast, no signal was detected with N2a control tumor. The
results depicted in FIG. 28 demonstrate targeting of gene
expression in vivo following IV PTM delivery into target cells.
[0141] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described
herein will become apparent to those skilled in the art from the
foregoing description and accompanying Figures. Such modifications
are intended to fall within the scope of the appended claims.
Various references are cited herein, the disclosure of which are
incorporated by reference in their entireties.
Sequence CWU 1
1
2118RNAArtificialChemically Synthesized 1agguragu
827RNAArtificialChemically Synthesized 2ynyurac
737RNAArtificialChemically Synthesized 3uacuaac
747RNAArtificialChemically Synthesized 4uacuaac
758DNAArtificialChemically Synthesized 5ygtgttyy
867RNAArtificialChemically Synthesized 6uacuaac
7729DNAArtificialChemically Synthesized 7aagcttttac tgctcgttct
tcagcacgc 29820DNAArtificialChemically Synthesized 8cagggtcgga
ctcgatgaac 20921DNAArtificialChemically Synthesized 9ggatatcgcc
ctgatcaaga g 21106DNAArtificialChemically Synthesized 10gctagc
6116RNAArtificialChemically Synthesized 11ccgcgg
61247DNAArtificialChemically Synthesized 12tactaactgg tacctcttct
tttttttttg atatcctgca gggcggc 47136DNAArtificialChemically
Synthesized 13gctagc 6146RNAArtificialChemically Synthesized
14ccgcgg 61547DNAArtificialChemically Synthesized 15tactaactgg
tacctcttct tttttttttg atatcctgca gggcggc
471665DNAArtificialChemically Synthesized 16ctcctggcct cgcgagatcc
ctctcgttaa gggaggcaag cccgacgtcg tccagattgt 60ccgca
65176DNAArtificialChemically Synthesized 17ctgcag
61871DNAArtificialChemically Synthesized 18ccgcggaaca ttattataac
gttgctcgaa tactaactgg tacctcttct tttttttttg 60atatcctgca g
711922DNAArtificialChemically Synthesized 19ctcgagcacc gatatcgtaa
ct 222036DNAArtificialChemically Synthesized 20tactaactct
cttctttttt ttttgataac caggct 362135DNAArtificialChemically
Synthesized 21gaacacctca ctacatacat aacagttaac ccgct 35
* * * * *