U.S. patent application number 12/357474 was filed with the patent office on 2009-08-13 for nucleotide sequences of a new class of diverged delta-9 stearoyl-acp desaturase genes.
This patent application is currently assigned to E.I. DU PONT DE NEMOURS AND COMPANY. Invention is credited to John R. Booth, Rebecca E. Cahoon, William D. Hitz, Anthony J. Kinney, Narendra S. Yadav.
Application Number | 20090203142 12/357474 |
Document ID | / |
Family ID | 22851321 |
Filed Date | 2009-08-13 |
United States Patent
Application |
20090203142 |
Kind Code |
A1 |
Booth; John R. ; et
al. |
August 13, 2009 |
NUCLEOTIDE SEQUENCES OF A NEW CLASS OF DIVERGED DELTA-9
STEAROYL-ACP DESATURASE GENES
Abstract
An isolated nucleic acid fragment encoding a diverged delta-9
fatty acid desaturase is disclosed. Also the construction of a
chimeric gene encoding all or a portion of the diverged delta-9
fatty acid desaturase is disclosed, in sense or antisense
orientation, wherein expression of the chimeric gene results in
production of altered levels of the diverged delta-9 fatty acid
desaturase in a transformed host cell.
Inventors: |
Booth; John R.; (Boothwyn,
PA) ; Cahoon; Rebecca E.; (Lincoln, NE) ;
Hitz; William D.; (Wilmington, DE) ; Kinney; Anthony
J.; (Wilmington, DE) ; Yadav; Narendra S.;
(Wilmington, DE) |
Correspondence
Address: |
E I DU PONT DE NEMOURS AND COMPANY;LEGAL PATENT RECORDS CENTER
BARLEY MILL PLAZA 25/1122B, 4417 LANCASTER PIKE
WILMINGTON
DE
19805
US
|
Assignee: |
E.I. DU PONT DE NEMOURS AND
COMPANY
|
Family ID: |
22851321 |
Appl. No.: |
12/357474 |
Filed: |
January 22, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10981293 |
Nov 4, 2004 |
7498427 |
|
|
12357474 |
|
|
|
|
09934900 |
Aug 22, 2001 |
|
|
|
10981293 |
|
|
|
|
60226996 |
Aug 22, 2000 |
|
|
|
Current U.S.
Class: |
435/468 ;
435/320.1; 506/9; 536/23.2 |
Current CPC
Class: |
C12N 9/0083
20130101 |
Class at
Publication: |
435/468 ;
536/23.2; 435/320.1; 506/9 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C07H 21/04 20060101 C07H021/04; C12N 15/63 20060101
C12N015/63; C40B 30/04 20060101 C40B030/04 |
Claims
1. An isolated polynucleotide comprising: (a) a nucleotide sequence
encoding a polypeptide having delta-9 fatty acid desaturase
activity that has at least 80% identity based on the Clustal method
of alignment when compared to a polypeptide selected from the group
consisting of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, or 16; or (b) the
complement of (a).
2-5. (canceled)
6. A chimeric construct comprising the isolated polynucleotide of
claim 1 operably linked to at least one suitable regulatory
sequence.
7-9. (canceled)
10. A method of obtaining a nucleic acid fragment encoding a
delta-9 fatty acid desaturase polypeptide comprising the steps of:
(a) probing a cDNA or genomic library with an isolated
polynucleotide comprising at least one of 30 contiguous nucleotides
derived from a nucleotide sequence selected from the group
consisting of SEQ ID NO:1 and/or a complement of the nucleotide
sequence; (b) identifying a DNA clone that hybridizes with the
isolated polynucleotide; (c) isolating the identified DNA clone;
and (d) sequencing a cDNA or genomic fragment that comprises the
isolated DNA clone.
11. A method of obtaining a nucleic acid fragment encoding a
delta-9 fatty acid desaturase polypeptide comprising the steps of:
(a) probing a cDNA or genomic library with an isolated
polynucleotide comprising at least one of 30 contiguous nucleotides
derived from a nucleotide sequence selected from the group
consisting of SEQ ID NO:1, 3, 5, 7, 9, 11, 13, or 15 and/or a
complement of such nucleotide sequences; (b) identifying a DNA
clone that hybridizes with the isolated polynucleotide; (c)
isolating the identified DNA clone; (d) inserting the DNA clone
into a plasmid suitable for expression in a bacterial or yeast
cell; and (e) assaying for delta-9 desaturase activity or
alterations in fatty acid composition of the host cell.
12. A method of identifying an isolated polynucleotide that encodes
a delta-9 fatty acid desaturase comprising the steps of: (a)
determining an amino acid sequence of the polypeptide encoded by
the isolated DNA; (b) determining if the amino acid sequence
comprises at least two amino acid sequences selected from the group
consisting of HSMPPEK corresponding to amino acids 67-73 of SEQ ID
NO:2, LPLLKPVE corresponding to amino acids 89-96 of SEQ ID NO:2,
EYFVVLVGDM corresponding to amino acids 132-141 of SEQ ID NO:2,
EKTV corresponding to amino acids 205-208 of SEQ ID NO:2, GMDPGT
corresponding to amino acids 215-220 of SEQ ID NO:2,
NNPYLGFVYTSFQERAT corresponding to amino acids 222-238 of SEQ ID
NO:2, VLAR corresponding to amino acids 256-259 of SEQ ID NO:2,
RIVE corresponding to amino acids 277-280 of SEQ ID NO:2, ITMPAHL
corresponding to amino acids 302-308 of SEQ ID NO:2, or DFVCGLA
corresponding to amino acids 364-370 of SEQ ID NO:2.
13. A method of identifying an isolated polynucleotide that encodes
a delta-9 fatty acid desaturase comprising the steps of: (a)
determining the polypeptide sequence of claim 10, 11, or 12; (b)
determining that the amino acid sequence of the polypeptide does
not contain at least one of the following amino acid sequences
KEIPDDYFWLVGDMITEEALPTYQTMLNT corresponding to positions 116-145 of
SEQ ID NO:23; or DYADILEFLVGRWK corresponding to positions 324-337
of SEQ ID NO:23.
14. A method of altering the level of expression of a delta-9 fatty
acid desaturase in a host cell comprising: (a) transforming a host
cell with the chimeric gene of claim 6; and (b) growing the
transformed host cell produced in step (a) under conditions that
are suitable for expression of the chimeric construct wherein
expression of the chimeric construct results in production of
altered levels of a delta-9 fatty acid desaturase in the
transformed host cell.
15. A method of altering the level of expression of a delta-9 fatty
acid desaturase in a host cell comprising: (a) transforming a host
cell with the chimeric construct of claim 6; and (b) growing the
transformed host cell produced in step (a) under conditions that
are suitable for expression of the chimeric construct wherein
expression of the chimeric gene results in production of altered
levels of a delta-9 fatty acid desaturase in the transformed host
cell.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/226,996, filed Aug. 22, 2000, the entire
contents of which are herein incorporated by reference.
FIELD OF THE INVENTION
[0002] This invention is relates to the field of plant molecular
biology and, in particular, to nucleic acid fragments encoding a
diverged delta-9 fatty acid desaturase in plants and seeds.
BACKGROUND OF THE INVENTION
[0003] Soybean oil accounts for about 70% of the 14 billion pounds
of edible oil consumed in the United States and is a major edible
oil worldwide. It is used in baking, frying, salad dressing,
margarine, and a multitude of processed foods. In 1987/88 60
million acres of soybean were planted in the U.S. Soybean is the
lowest-cost producer of vegetable oil, which is a by-product of
soybean meal. Soybean is agronomically well-adapted to many parts
of the U.S. Machinery and facilities for harvesting, storing, and
crushing are widely available across the U.S. Soybean products are
also a major element of foreign trade since 30 million metric tons
of soybeans, 25 million metric tons of soybean meal, and 1 billion
pounds of soybean oil were exported in 1987/88. Nevertheless,
increased foreign competition has lead to recent declines in
soybean acreage and production. The low cost and ready availability
of soybean oil provides an excellent opportunity to upgrade this
commodity oil into higher value specialty oils to both add value to
soybean crop for the U.S. farmer and enhance U.S. trade.
[0004] Soybean oil derived from commercial varieties is composed
primarily of 11% palmitic (16:0), 4% stearic (18:0), 24% oleic
(18:1), 54% linoleic (18:2) and 7% linolenic (18:3) acids. Palmitic
and stearic acids are, respectively, 16- and 18-carbon-long
saturated fatty acids. Oleic, linoleic and linolenic are
18-carbon-long unsaturated fatty acids containing one, two and
three double bonds, respectively. Oleic acid is also referred to as
a monounsaturated fatty acid, while linoleic and linolenic acids
are also referred to as polyunsaturated fatty acids. The specific
performance and health attributes of edible oils is determined
largely by their fatty acid composition.
[0005] Soybean oil is high in saturated fatty acids when compared
to other sources of vegetable oil and contains a low proportion of
oleic acid, relative to the total fatty acid content of the soybean
seed. These characteristics do not meet important health needs as
defined by the American Heart Association.
[0006] More recent research efforts have examined the role that
monounsaturated fatty acid plays in reducing the risk of coronary
heart disease. In the past, it was believed that monounsaturates,
in contrast to saturates and polyunsaturates, had no effect on
serum cholesterol and coronary heart disease risk. Several recent
human clinical studies suggest that diets high in monounsaturated
fat may reduce the "bad" (low-density lipoprotein) cholesterol
while maintaining the "good" (high-density lipoprotein)
cholesterol. [See Mattson et al. (1985) Journal of Lipid Research
26:194-202, Grundy (1986) New England Journal of Medicine
314:745-748, and Mensink et al. (1987) The Lancet 1:122-125, all
collectively herein incorporated by reference.] These results
corroborate previous epidemiological studies of people living in
Mediterranean countries where a relatively high intake of
monounsaturated fat and low consumption of saturated fat correspond
with low coronary heart disease mortality. [Keys, A., Seven
Countries: A Multivariate Analysis of Death and Coronary Heart
Disease, Cambridge: Harvard University Press, 1980, herein
incorporated by reference.] The significance of monounsaturated fat
in the diet was further confirmed by international researchers from
seven countries at the Second Colloquim on Monounsaturated Fats
held Feb. 26, 1987, in Bethesda, Md., and sponsored by the National
Heart, Lung and Blood Institutes [Report, Monounsaturates Use Said
to Lower Several Major Risk Factors, Food Chemical News, Mar. 2,
1987, p. 44, herein incorporated by reference].
[0007] Soybean oil is also relatively high in polyunsaturated fatty
acids--at levels in far excess of our essential dietary
requirement. These fatty acids oxidize readily to give off-flavors
and result in reduced performance associated with unprocessed
soybean oil. The stability and flavor of soybean oil is improved by
hydrogenation, which chemically reduces the double bonds. However,
the need for this processing reduces the economic attractiveness of
soybean oil.
[0008] A soybean oil low in total saturates and polyunsaturates and
high in monounsaturate would provide significant health benefits to
the United States population, as well as, economic benefit to oil
processors. Soybean varieties which produce seeds containing the
improved oil will also produce valuable meal as animal feed.
[0009] Another type of differentiated soybean oil is an edible fat
for confectionary uses. More than 2 billion pounds of cocoa butter,
the most expensive edible oil, are produced worldwide. The U.S.
imports several hundred million dollars worth of cocoa butter
annually. The high and volatile prices and uncertain supply of
cocoa butter have encouraged the development of cocoa butter
substitutes. The fatty acid composition of cocoa butter is 26%
palmitic, 34% stearic, 35% oleic and 3% linoleic acids. About 72%
of cocoa butter's triglycerides have the structure in which
saturated fatty acids occupy positions 1 and 3 and oleic acid
occupies position 2. Cocoa butter's unique fatty acid composition
and distribution on the triglyceride molecule confer on it
properties eminently suitable for confectionary end-uses: it is
brittle below 27.degree. C. and depending on its crystalline state,
melts sharply at 25-30.degree. C. or 35-36.degree. C. Consequently,
it is hard and non-greasy at ordinary temperatures and melts very
sharply in the mouth. It is also extremely resistant to rancidity.
For these reasons, producing soybean oil with increased levels of
stearic acid, especially in soybean lines containing
higher-than-normal levels of palmitic acid, and reduced levels of
unsaturated fatty acids is expected to produce a cocoa butter
substitute in soybean. This will add value to oil and food
processors as well as reduce the foreign import of certain tropical
oils.
[0010] Only recently have serious efforts been made to improve the
quality of soybean oil through plant breeding, especially
mutagenesis, and a wide range of fatty acid composition has been
discovered in experimental lines of soybean (Table 1). These
findings (as well as those with other oilcrops) suggest that the
fatty acid composition of soybean oil can be significantly modified
without affecting the agronomic performance of a soybean plant.
However, there is no soybean mutant line with levels of saturates
less than those present in commercial canola, the major competitor
to soybean oil as a "healthy" oil.
TABLE-US-00001 TABLE 1 Range of Fatty Acid Percentages Produced by
Soybean Mutants Range of Fatty Acids Percentages Palmitic Acid 6-28
Stearic Acid 3-30 Oleic Acid 17-50 Linoleic Acid 35-60 Linolenic
Acid 3-12
[0011] There are serious limitations to using mutagenesis to alter
fatty acid composition. It is unlikely to discover mutations a)
that result in a dominant ("gain-of-function") phenotype, b) in
genes that are essential for plant growth, and c) in an enzyme that
is not rate-limiting and that is encoded by more than one gene.
Even when some of the desired mutations are available in soybean
mutant lines their introgression into elite lines by traditional
breeding techniques will be slow and expensive, since the desired
oil compositions in soybean are most likely to involve several
recessive genes.
[0012] Recent molecular and cellular biology techniques offer the
potential for overcoming some of the limitations of the mutagenesis
approach, including the need for extensive breeding. Particularly
useful technologies are: a) seed-specific expression of foreign
genes in transgenic plants [see Goldberg et al. (1989) Cell
56:149-160], b) use of antisense RNA to inhibit plant target genes
in a dominant and tissue-specific manner [see van der Krol et al.
(1988) Gene 72:45-50], c) transfer of foreign genes into elite
commercial varieties of commercial oilcrops, such as soybean [Chee
et al. (1989) Plant Physiol. 91:1212-1218; Christou et al. (1989)
Proc. Natl. Acad. Sci. U.S.A. 86:7500-7504; Hinchee et al. (1988)
Bio/Technology 6:915-922; EPO publication 0 301 749 A2], rapeseed
[De Block et al. (1989) Plant Physiol. 91:694-701], and sunflower
[Everett et al. (1987) Bio/Technology 5:1201-1204], and d) use of
genes as restriction fragment length polymorphism (RFLP) markers in
a breeding program, which makes introgression of recessive traits
into elite lines rapid and less expensive [Tanksley et al. (1989)
Bio/Technology 7:257-264]. However, application of each of these
technologies requires identification and isolation of
commercially-important genes.
[0013] Oil biosynthesis in plants has been fairly well-studied [see
Harwood (1989) in Critical Reviews in Plant Sciences, Vol.
8(1):1-43]. The biosynthesis of palmitic, stearic and oleic acids
occur in the plastids by the interplay of three key enzymes of the
"ACP track": palmitoyl-ACP elongase, stearoyl-ACP desaturase and
acyl-ACP thioesterase. Stearoyl-ACP desaturase introduces the first
double bond on stearoyl-ACP to form oleoyl-ACP. It is pivotal in
determining the degree of unsaturation in vegetable oils. Because
of its key position in fatty acid biosynthesis it is expected to be
an important regulatory step. While the enzyme's natural substrate
is stearoyl-ACP, it has been shown that it can, like its
counterpart in yeast and mammalian cells, desaturate stearoyl-CoA,
albeit poorly [McKeon et al. (1982) J. Biol. Chem.
257:12141-12147]. The fatty acids synthesized in the plastid are
exported as acyl-CoA to the cytoplasm. At least three different
glycerol acylating enzymes (glycerol-3-P acyltransferase,
1-acyl-glycerol-3-P acyltransferase and diacylglycerol
acyltransferase) incorporate the acyl moieties from the cytoplasm
into triglycerides during oil biosynthesis. These acyltransferases
show a strong, but not absolute, preference for incorporating
saturated fatty acids at positions 1 and 3 and monounsaturated
fatty acid at position 2 of the triglyceride. Thus, altering the
fatty acid composition of the acyl pool will drive by mass action a
corresponding change in the fatty acid composition of the oil.
Furthermore, there is experimental evidence that, because of this
specificity, given the correct composition of fatty acids, plants
can produce cocoa butter substitutes [Bafor et al. (1990) JAOCS
67:217-225].
[0014] Based on the above discussion, one approach to altering the
levels of stearic and oleic acids in vegetable oils is by altering
their levels in the cytoplasmic acyl-CoA pool used for oil
biosynthesis. There are two ways of doing this genetically: a)
altering the biosynthesis of stearic and oleic acids in the plastid
by modulating the levels of stearoyl-ACP desaturase in seeds
through either overexpression or antisense inhibition of its gene,
and b) converting stearoyl-CoA to oleoyl-CoA in the cytoplasm
through the expression of the stearoyl-ACP desaturase in the
cytoplasm.
[0015] In order to use antisense inhibition of stearoyl-ACP
desaturase in the seed, it is essential to isolate the gene(s) or
cDNA(s) encoding the target enzyme(s) in the seed, since antisense
inhibition requires a high-degree of complementarity between the
antisense RNA and the target gene that is expected to be absent in
stearoyl-ACP desaturase genes from other species.
[0016] The purification and nucleotide sequences of mammalian
microsomal stearoyl-CoA desaturases have been published [Thiede et
al. (1986) J. Biol. Chem. 262:13230-13235; Ntambi et al. (1988) J.
Biol. Chem. 263:17291-17300; Kaestner et al. (1989) J. Biol. Chem.
264:14755-14761]. However, the plant enzyme differs from them in
being soluble, in utilizing a different electron donor, and in its
substrate-specificities. The purification and the nucleotide
sequences for animal enzymes do not teach how to purify the plant
enzyme or isolate a plant gene. The purification of stearoyl-ACP
desaturase was reported from safflower seeds [McKeon et al. (1982)
J. Biol. Chem. 257:12141-12147]. However, this purification scheme
was not useful for soybean, either because the desaturases are
different or because of the presence of other proteins such as the
soybean seed storage proteins in seed extracts.
[0017] The rat liver stearoyl-CoA desaturase protein has been
expressed in E. coli [Strittmatter et al. (1988) J. Biol. Chem.
263:2532-2535] but, as mentioned above, its substrate specificity
and electron donors are quite distinct from that of the plant.
[0018] Plant stearoyl-ACP desaturase cDNAs have been cloned from
soybean [U.S. Pat. No. 5,760,206, the disclosure of which is hereby
incorporated by reference], safflower [Thompson et al. (1991) Proc.
Natl. Acad. Sci. 88:2578], castor [Shanklin and Somerville (1991)
Proc. Natl. Acad. Sci. 88:2510-2514], and cucumber [Shanklin et al.
(1991) Plant Physiol. 97:467-468]. Kutzon et al. [(1992) Proc.
Natl. Acad. Sci. 89:2624-2648] have reported that rapeseed
stearoyl-ACP desaturase when expressed in Brassica rapa and B. napa
in an antisense orientation can result in increase in 18:0 level in
transgenic seeds. All of the reported genes have 59-80% identity to
each other at the nucleotide and polypeptide level.
[0019] U.S. Pat. No. 5,723,595, issued to Thompson et al. on Mar.
3, 1998, describes stearoyl-ACP desaturases from castor and
safflower.
[0020] U.S. Pat. No. 5,443,974, issued to Hitz et al., on Aug. 22,
1995, describes soybean stearoyl-ACP desaturase.
[0021] U.S. Pat. No. 5,760,206, issued to Hitz et al, on Jun. 2,
1998, describes soybean stearoyl-ACP desaturase.
SUMMARY OF THE INVENTION
[0022] The present invention concerns an isolated polynucleotide
comprising a nucleotide sequence selected from the group consisting
of: (a) a nucleotide sequence encoding a polypeptide having delta-9
fatty acid desaturase activity that has at least 80%, 85%, 90%, or
95% identity based on the Clustal method of alignment when compared
to a polypeptide selected from the group consisting of SEQ ID NO:2,
4, 6, 8, 10, 12, 14, or 16, or (b) the complement of the nucleotide
sequence.
[0023] In a second embodiment, it is preferred that the isolated
polynucleotide of the claimed invention comprises a nucleotide
sequence which comprises a nucleic acid sequence selected from the
group consisting of SEQ ID NO:1, 3, 5, 7, 9, 11, 13, or that codes
for a polypeptide selected from the group consisting of SEQ ID
NO:2, 4, 6, 8, 10, 12, 14, or 16.
[0024] In a third embodiment, this invention relates to a chimeric
gene comprising an isolated polynucleotide of the present invention
operably linked to at least one suitable regulatory sequence.
[0025] In a fourth embodiment, the present invention concerns an
isolated host cell comprising a chimeric construct of the present
invention or an isolated polynucleotide of the present invention.
The host cell may be eukaryotic, such as a yeast or a plant cell,
or prokaryotic, such as a bacterial cell.
[0026] In a fifth embodiment, the invention also relates to a
process for producing an isolated host cell comprising a chimeric
construct of the present invention or an isolated polynucleotide of
the present invention, the process comprising either transforming
or transfecting an isolated compatible host cell with a chimeric
gene or isolated polynucleotide of the present invention.
[0027] In a sixth embodiment, the invention concerns a diverged
delta-9 stearoyl desaturase polypeptide of at least 400 amino acids
comprising at least 80% identity based on the Clustal method of
alignment compared to a polypeptide selected from the group
consisting of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, or 16.
[0028] In an seventh embodiment, the invention relates to a method
of selecting an isolated polynucleotide that affects the level of
expression of a diverged delta-9 stearoyl desaturase polypeptide or
enzyme activity in a host cell, preferably a plant cell, the method
comprising the steps of: (a) constructing an isolated
polynucleotide of the present invention or an isolated chimeric
construct of the present invention; (b) introducing the isolated
polynucleotide or the isolated chimeric construct into a host cell;
(c) measuring the level of the diverged delta-9 stearoyl desaturase
polypeptide or enzyme activity in the host cell containing the
isolated polynucleotide; and (d) comparing the level of the
diverged delta-9 stearoyl desaturase polypeptide or enzyme activity
in the host cell containing the isolated polynucleotide with the
level of the diverged delta-9 stearoyl desaturase polypeptide or
enzyme activity in the host cell that does not contain the isolated
polynucleotide.
[0029] In an eighth embodiment, the invention concerns a method of
obtaining a nucleic acid fragment encoding a substantial portion of
a diverged delta-9 stearoyl desaturase polypeptide, preferably a
plant diverged delta-9 stearoyl desaturase polypeptide, comprising
the steps of: synthesizing an oligonucleotide primer comprising a
nucleotide sequence of at least one of 30 (preferably at least one
of 40, most preferably at least one of 60) contiguous nucleotides
derived from a nucleotide sequence selected from the group
consisting of SEQ ID NO:1, 3, 5, 7, 9, 11, 13, or 15, and the
complement of such nucleotide sequences; and amplifying a nucleic
acid fragment (preferably a cDNA inserted in a cloning vector)
using the oligonucleotide primer. The amplified nucleic acid
fragment preferably will encode a substantial portion of a diverged
delta-9 stearoyl desaturase amino acid sequence.
[0030] In a ninth embodiment, this invention relates to a method of
obtaining a nucleic acid fragment encoding all or a substantial
portion of the amino acid sequence encoding a diverged delta-9
stearoyl desaturase polypeptide comprising the steps of: probing a
cDNA or genomic library with an isolated polynucleotide of the
present invention; identifying a DNA clone that hybridizes with an
isolated polynucleotide of the present invention; isolating the
identified DNA clone; and sequencing the cDNA or genomic fragment
that comprises the isolated DNA clone.
[0031] In a tenth embodiment, this invention relates to a method of
obtaining a nucleic acid fragment encoding all or a substantial
portion of the amino acid sequence encoding a diverged delta-9
stearoyl desaturase polypeptide comprising the steps of: probing a
cDNA or genomic library with an isolated polynucleotide of the
present invention; identifying a DNA clone that hybridizes with an
isolated polynucleotide of the present invention; isolating the
identified DNA clone; introducing said clone into a construct for
expression in a bacteria or yeast; and assaying for delta-9
desaturase activity in the bacteria or yeast.
[0032] In an eleventh embodiment, this invention relates to a
method of identifying an isolated polynucleotide that encodes a
delta-9 fatty acid desaturase comprising the steps of: determining
an amino acid sequence of the polypeptide encoded by the isolated
DNA; determining if the amino acid sequence comprises at least two
amino acid sequences selected from the group consisting of HSMPPEK
corresponding to amino acids 67-73 of SEQ ID NO:2, LPLLKPVE
corresponding to amino acids 89-96 of SEQ ID NO:2, EYFVVLVGDM
corresponding to amino acids 132-141 of SEQ ID NO:2, EKTV
corresponding to amino acids 205-208 of SEQ ID NO:2, GMDPGT
corresponding to amino acids 215-220 of SEQ ID NO:2,
NNPYLGFVYTSFQERAT corresponding to amino acids 222-238 of SEQ ID
NO:2, VLAR corresponding to amino acids 256-259 of SEQ ID NO:2,
RIVE corresponding to amino acids 277-280 of SEQ ID NO:2, ITMPAHL
corresponding to amino acids 302-308 of SEQ ID NO:2, or DFVCGLA
corresponding to amino acids 364-370 of SEQ ID NO:2.
[0033] In an twelfth embodiment, this invention relates to a method
of identifying an isolated polynucleotide that encodes a delta-9
fatty acid desaturase comprising the steps of: determining the
polypeptide sequence by one of the aforementioned methods;
determining that the amino acid sequence of the polypeptide does
not contain at least one of the following amino acid sequences
KEIPDDYFWLVGDMITEEALPTYQTMLNT corresponding to positions 116-145 of
SEQ ID NO:23; or DYADILEFLVGRWK corresponding to positions 324-337
of SEQ ID NO:23.
[0034] In an thirteenth embodiment, this invention relates to a
method of altering the level of expression of a diverged delta-9
fatty acid desaturase in a host cell comprising: (a) transforming a
host cell with a chimeric construct of the present invention; and
(b) growing the transformed host cell under conditions that are
suitable for expression of the chimeric construct wherein
expression of the chimeric construct results in production of
altered levels of the a diverged delta-9 fatty acid desaturase in
the transformed host cell.
BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTINGS
[0035] The invention can be more fully understood from the
following detailed description and the accompanying drawings and
Sequence Listing which form a part of this application.
[0036] FIG. 1 shows a comparison of the amino acid stearoyl-ACP
desaturase sequences of the soybean enzyme [SEQ ID NO:2], corn [SEQ
ID NOs:10 and 12], rice [SEQ ID NOs:14 and 16], to the lupine [gi
4704824, SEQ ID NO:17], jojoba [gi 267036, SEQ ID NO:20],
Arabidopsis [gi 6957724, SEQ ID NO:21], flax [gi 3355632, SEQ ID
NO:22], and to the soybean stearoyl-ACP desaturase [SEQ ID NO:23]
found in U.S. Pat. No. 5,760,206.
[0037] Table 2 lists the polypeptides that are described herein,
the designation of the cDNA clones that comprise the nucleic acid
fragments encoding polypeptides representing all or a substantial
portion of these polypeptides, and the corresponding identifier
(SEQ ID NO:) as used in the attached Sequence Listing. The sequence
descriptions and Sequence Listing attached hereto comply with the
rules governing nucleotide and/or amino acid sequence disclosures
in patent applications as set forth in 37 C.F.R.
.sctn.1.821-1.825.
TABLE-US-00002 TABLE 2 Diverged Delta-9 Fatty Acid Desaturase SEQ
ID NO: (Amino Protein Clone Designation (Nucleotide) Acid) Soybean
[Glycine max] se6.pk0026.a8 1 2 Corn [Zea mays] cbn10.pk0061.a3 3 4
Corn [Zea mays] contig of: 5 6 cen7f.pk001.k12 cpd1c.pk012.n9
cpd1c.pk014.l18 p0103.ciaad81r p0106.cjlpm88r Rice [Oryza sativa]
rds1c.pk007.g19 7 8 Corn [Zea mays] cbn10.pk0061.a3:fis 9 10 Corn
[Zea mays] cpd1c.pk014.l18:fis 11 12 Rice [Oryza sativa]
rds1c.pk007.g19:fis 13 14 Rice [Oryza sativa] rsl1n.pk008.j18:fis
15 16
[0038] The Sequence Listing contains the one letter code for
nucleotide sequence characters and the three letter codes for amino
acids as defined in conformity with the IUPAC-IUBMB standards
described in Nucleic Acids Res. 13:3021-3030 (1985) and in the
Biochemical J. 219 (No. 2):345-373 (1984) which are herein
incorporated by reference. The symbols and format used for
nucleotide and amino acid sequence data comply with the rules set
forth in 37 C.F.R. .sctn.1.822.
DETAILED DESCRIPTION OF THE INVENTION
[0039] A new diverged class of delta-9 steroyl desaturases are
disclosed herein. These desaturases were obtained from soybean,
corn, and rice and are less than 60% identical to the previously
characterized class. This new diverged class of delta-9 steroyl
desaturases still performs the substantially identical biochemical
function in plants as the previously characterized class. In
addition, evidence is presented to show that the new class of
desaturases may play a more important role in regulating fatty acid
synthesis than the previous class.
[0040] The terms "diverged delta-9 fatty acid desaturase",
"diverged delta-9 stearoyl desaturase", or "diverged delta-9
desaturase" are used interchangeably herein and include, but are
not limited to, all plant delta-9 stearoyl desaturases that are
less than 60% identical to the previously characterized delta-9
stearoyl desaturases (PCT Publication Nos. WO 91/13972 and WO
91/18985). This new diverged class of delta-9 steroyl desaturases
still performs the substantially identical biochemical function in
plants as the previously characterized class, namely the
introduction of a double bond between carbon atoms 9 and 10 of
stearoyl-ACP to form oleoyl-ACP.
[0041] In the context of this disclosure, a number of terms shall
be utilized. The terms "polynucleotide", "polynucleotide sequence",
"nucleic acid sequence", and "nucleic acid fragment"/"isolated
nucleic acid fragment" are used interchangeably herein. These terms
encompass nucleotide sequences and the like. A polynucleotide may
be a polymer of RNA or DNA that is single- or double-stranded, that
optionally contains synthetic, non-natural or altered nucleotide
bases. A polynucleotide in the form of a polymer of DNA may be
comprised of one or more segments of cDNA, genomic DNA, synthetic
DNA, or mixtures thereof. An isolated polynucleotide of the present
invention may include at least one of 30 contiguous nucleotides,
preferably at least one of 40 contiguous nucleotides, most
preferably one of at least 60 contiguous nucleotides derived from
SEQ ID NO:1, 3, 5, 7, 9, 11, 13, or 15, or the complement of such
sequences.
[0042] The term "isolated" polynucleotide refers to a
polynucleotide that is substantially free from other nucleic acid
sequences, such as and not limited to other chromosomal and
extrachromosomal DNA and RNA. Isolated polynucleotides may be
purified from a host cell in which they naturally occur.
Conventional nucleic acid purification methods known to skilled
artisans may be used to obtain isolated polynucleotides. The term
also embraces recombinant polynucleotides and chemically
synthesized polynucleotides. Nucleotides (usually found in their
5'-monophosphate form) are referred to by their single letter
designation as follows: "A" for adenylate or deoxyadenylate (for
RNA or DNA, respectively), "C" for cytidylate or deoxycytidylate,
"G" for guanylate or deoxyguanylate, "U" for uridylate, "T" for
deoxythymidylate, "R" for purines (A or G), "Y" for pyrimidines (C
or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and
"N" for any nucleotide.
[0043] The term "host" refers to any organism, or cell thereof,
whether human or non-human into which a recombinant construct can
be stably or transiently introduced in order to alter gene
expression in the host.
[0044] The term "recombinant" means, for example, that a nucleic
acid sequence is made by an artificial combination of two otherwise
separated segments of sequence, e.g., by chemical synthesis or by
the manipulation of isolated nucleic acids by genetic engineering
techniques.
[0045] As used herein, "contig" refers to a nucleotide sequence
that is assembled from two or more constituent nucleotide sequences
that share common or overlapping regions of sequence homology. For
example, the nucleotide sequences of two or more nucleic acid
fragments can be compared and aligned in order to identify common
or overlapping sequences. Where common or overlapping sequences
exist between two or more nucleic acid fragments, the sequences
(and thus their corresponding nucleic acid fragments) can be
assembled into a single contiguous nucleotide sequence.
[0046] As used herein, "substantially similar" refers to nucleic
acid fragments wherein changes in one or more nucleotide bases
results in substitution of one or more amino acids, but do not
affect the functional properties of the polypeptide encoded by the
nucleotide sequence. "Substantially similar" also refers to nucleic
acid fragments wherein changes in one or more nucleotide bases does
not affect the ability of the nucleic acid fragment to mediate
alteration of gene expression by gene silencing through for example
antisense or co-suppression technology. "Substantially similar"
also refers to modifications of the nucleic acid fragments of the
instant invention such as deletion or insertion of one or more
nucleotides that do not substantially affect the functional
properties of the resulting transcript vis-a-vis the ability to
mediate gene silencing or alteration of the functional properties
of the resulting protein molecule. It is therefore understood that
the invention encompasses more than the specific exemplary
nucleotide or amino acid sequences and includes functional
equivalents thereof. The terms "substantially similar" and
"corresponding substantially" are used interchangeably herein.
[0047] Substantially similar nucleic acid fragments may be selected
by screening nucleic acid fragments representing subfragments or
modifications of the nucleic acid fragments of the instant
invention, wherein one or more nucleotides are substituted, deleted
and/or inserted, for their ability to affect the level of the
polypeptide encoded by the unmodified nucleic acid fragment in a
plant or plant cell. For example, a substantially similar nucleic
acid fragment representing at least one of 30 contiguous
nucleotides derived from the instant nucleic acid fragment can be
constructed and introduced into a plant or plant cell. The level of
the polypeptide encoded by the unmodified nucleic acid fragment
present in a plant or plant cell exposed to the substantially
similar nucleic fragment can then be compared to the level of the
polypeptide in a plant or plant cell that is not exposed to the
substantially similar nucleic acid fragment.
[0048] For example, it is well known in the art that antisense
suppression and co-suppression of gene expression may be
accomplished using nucleic acid fragments representing less than
the entire coding region of a gene, and by using nucleic acid
fragments that do not share 100% sequence identity with the gene to
be suppressed. In a preferred embodiment, it has been found that
suitable nucleic sequences and their reverse complement can be used
to alter the expression of any homologous, endogensous RNA which is
in proximity to the suitable nucleic acid and its reverse
complement. This is described in greater detail in Applicant's
Assignee's co-pending provisional application having Application
No. 60/213,961 filed Jun. 23, 2000, the disclosure of which is
hereby incorporated by reference.
[0049] In addition, alterations in a nucleic acid fragment which
result in the production of a chemically equivalent amino acid at a
given site, but do not effect the functional properties of the
encoded polypeptide, are well known in the art. Thus, a codon for
the amino acid alanine, a hydrophobic amino acid, may be
substituted by a codon encoding another less hydrophobic residue,
such as glycine, or a more hydrophobic residue, such as valine,
leucine, or isoleucine. Similarly, changes which result in
substitution of one negatively charged residue for another, such as
aspartic acid for glutamic acid, or one positively charged residue
for another, such as lysine for arginine, can also be expected to
produce a functionally equivalent product. Nucleotide changes which
result in alteration of the N-terminal and C-terminal portions of
the polypeptide molecule would also not be expected to alter the
activity of the polypeptide. Each of the proposed modifications is
well within the routine skill in the art, as is determination of
retention of biological activity of the encoded products.
Consequently, an isolated polynucleotide comprising a nucleotide
sequence of at least one of 30 (preferably at least one of 40, most
preferably at least one of 60) contiguous nucleotides derived from
a nucleotide sequence selected from the group consisting of SEQ ID
NO:1, 3, 5, 7, 9, 11, 13, or 15, and the complement of such
nucleotide sequences may be used in methods of selecting an
isolated polynucleotide that affects the expression of a diverged
delta-9 stearoyl desaturase polypeptide in a host cell. A method of
selecting an isolated polynucleotide that affects the level of
expression of a polypeptide in a virus or in a host cell
(eukaryotic, such as plant or yeast, prokaryotic such as bacterial)
may comprise the steps of: constructing an isolated polynucleotide
of the present invention or an isolated chimeric gene of the
present invention; introducing the isolated polynucleotide or the
isolated chimeric gene into a host cell; measuring the level of a
polypeptide or enzyme activity in the host cell containing the
isolated polynucleotide; and comparing the level of a polypeptide
or enzyme activity in the host cell containing the isolated
polynucleotide with the level of a polypeptide or enzyme activity
in a host cell that does not contain the isolated
polynucleotide.
[0050] Moreover, substantially similar nucleic acid fragments may
also be characterized by their ability to hybridize. Estimates of
such homology are provided by either DNA-DNA or DNA-RNA
hybridization under conditions of stringency as is well understood
by those skilled in the art (Hames and Higgins, Eds. (1985) Nucleic
Acid Hybridisation, IRL Press, Oxford, U.K.). Stringency conditions
can be adjusted to screen for moderately similar fragments, such as
homologous sequences from distantly related organisms, to highly
similar fragments, such as genes that duplicate functional enzymes
from closely related organisms. Post-hybridization washes determine
stringency conditions. One set of preferred conditions uses a
series of washes starting with 6.times.SSC, 0.5% SDS at room
temperature for 15 min, then repeated with 2.times.SSC, 0.5% SDS at
45.degree. C. for 30 min, and then repeated twice with
0.2.times.SSC, 0.5% SDS at 50.degree. C. for 30 min. A more
preferred set of stringent conditions uses higher temperatures in
which the washes are identical to those above except for the
temperature of the final two 30 min washes in 0.2.times.SSC, 0.5%
SDS was increased to 60.degree. C. Another preferred set of highly
stringent conditions uses two final washes in 0.1.times.SSC, 0.1%
SDS at 65.degree. C.
[0051] Substantially similar nucleic acid fragments of the instant
invention may also be characterized by the percent identity of the
amino acid sequences that they encode to the amino acid sequences
disclosed herein, as determined by algorithms commonly employed by
those skilled in this art. Suitable nucleic acid fragments
(isolated polynucleotides of the present invention) encode
polypeptides that are at least about 70% identical, preferably at
least about 80% identical to the amino acid sequences reported
herein. Preferred nucleic acid fragments encode amino acid
sequences that are about 85% identical to the amino acid sequences
reported herein. More preferred nucleic acid fragments encode amino
acid sequences that are at least about 90% identical to the amino
acid sequences reported herein. Most preferred are nucleic acid
fragments that encode amino acid sequences that are at least about
95% identical to the amino acid sequences reported herein. Suitable
nucleic acid fragments not only have the above identities but
typically encode a polypeptide having at least 50 amino acids,
preferably at least 100 amino acids, more preferably at least 150
amino acids, still more preferably at least 200 amino acids, and
most preferably at least 250 amino acids. Sequence alignments and
percent identity calculations were performed using the Megalign
program of the LASERGENE bioinformatics computing suite (DNASTAR
Inc., Madison, Wis.). Multiple alignment of the sequences was
performed using the Clustal method of alignment (Higgins and Sharp
(1989) CABIOS. 5:151-153) with the default parameters (GAP
PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise
alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3,
WINDOW=5 and DIAGONALS SAVED=5.
[0052] It should be appreciated by one skilled in the art that
genes encoding delta-9 desaturases can be identified in a number of
ways. Conserved sequence motifs such as HSMPPEK corresponding to
amino acids 67-73 of SEQ ID NO:2, LPLLKPVE corresponding to amino
acids 89-96 of SEQ ID NO:2, EYFVVLVGDM corresponding to amino acids
132-141 of SEQ ID NO:2, EKTV corresponding to amino acids 205-208
of SEQ ID NO:2, GMDPGT corresponding to amino acids 215-220 of SEQ
ID NO:2, NNPYLGFVYTSFQERAT corresponding to amino acids 222-238 of
SEQ ID NO:2, VLAR corresponding to amino acids 256-259 of SEQ ID
NO:2, RIVE corresponding to amino acids 277-280 of SEQ ID NO:2,
ITMPAHL corresponding to amino acids 302-308 of SEQ ID NO:2, or
DFVCGLA corresponding to amino acids 364-370 of SEQ ID NO:2, can be
used once several members of a diverged class are identified (as is
the case in the present invention). In addition one can use
hybridization, sequencing, and electronic alignment to aid the
identification of gene candidates. These approaches can be coupled
to assay of the polypeptide activity in bacterial, yeast, or plant
host cells. Stable transgenic plants would provide a preferred
method of determining the identity of a nucleic acid sequence
encoding a delta-9 desaturase.
[0053] A "substantial portion" of an amino acid or nucleotide
sequence comprises an amino acid or a nucleotide sequence that is
sufficient to afford putative identification of the protein or gene
that the amino acid or nucleotide sequence comprises. Amino acid
and nucleotide sequences can be evaluated either manually by one
skilled in the art, or by using computer-based sequence comparison
and identification tools that employ algorithms such as BLAST
(Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol.
Biol. 215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/). In
general, a sequence of ten or more contiguous amino acids or thirty
or more contiguous nucleotides is necessary in order to putatively
identify a polypeptide or nucleic acid sequence as homologous to a
known protein or gene. Moreover, with respect to nucleotide
sequences, gene-specific oligonucleotide probes comprising 30 or
more contiguous nucleotides may be used in sequence-dependent
methods of gene identification (e.g., Southern hybridization) and
isolation (e.g., in situ hybridization of bacterial colonies or
bacteriophage plaques). In addition, short oligonucleotides of 12
or more nucleotides may be used as amplification primers in PCR in
order to obtain a particular nucleic acid fragment comprising the
primers. Accordingly, a "substantial portion" of a nucleotide
sequence comprises a nucleotide sequence that will afford specific
identification and/or isolation of a nucleic acid fragment
comprising the sequence. The instant specification teaches amino
acid and nucleotide sequences encoding polypeptides that comprise
one or more particular plant proteins. The skilled artisan, having
the benefit of the sequences as reported herein, may now use all or
a substantial portion of the disclosed sequences for purposes known
to those skilled in this art. Accordingly, the instant invention
comprises the complete sequences as reported in the accompanying
Sequence Listing, as well as substantial portions of those
sequences as defined above.
[0054] "Codon degeneracy" refers to divergence in the genetic code
permitting variation of the nucleotide sequence without effecting
the amino acid sequence of an encoded polypeptide. Accordingly, the
instant invention relates to any nucleic acid fragment comprising a
nucleotide sequence that encodes all or a substantial portion of
the amino acid sequences set forth herein. The skilled artisan is
well aware of the "codon-bias" exhibited by a specific host cell in
usage of nucleotide codons to specify a given amino acid.
Therefore, when synthesizing a nucleic acid fragment for improved
expression in a host cell, it is desirable to design the nucleic
acid fragment such that its frequency of codon usage approaches the
frequency of preferred codon usage of the host cell.
[0055] "Synthetic nucleic acid fragments" can be assembled from
oligonucleotide building blocks that are chemically synthesized
using procedures known to those skilled in the art. These building
blocks are ligated and annealed to form larger nucleic acid
fragments which may then be enzymatically assembled to construct
the entire desired nucleic acid fragment. "Chemically synthesized",
as related to a nucleic acid fragment, means that the component
nucleotides were assembled in vitro. Manual chemical synthesis of
nucleic acid fragments may be accomplished using well established
procedures, or automated chemical synthesis can be performed using
one of a number of commercially available machines. Accordingly,
the nucleic acid fragments can be tailored for optimal gene
expression based on optimization of the nucleotide sequence to
reflect the codon bias of the host cell. The skilled artisan
appreciates the likelihood of successful gene expression if codon
usage is biased towards those codons favored by the host.
Determination of preferred codons can be based on a survey of genes
derived from the host cell where sequence information is
available.
[0056] "Gene" refers to a nucleic acid fragment that expresses a
specific protein, including regulatory sequences preceding (5'
non-coding sequences) and following (3' non-coding sequences) the
coding sequence. "Native gene" refers to a gene as found in nature
with its own regulatory sequences. "Chimeric gene" refers any gene
that is not a native gene, comprising regulatory and coding
sequences that are not found together in nature. Accordingly, a
chimeric gene may comprise regulatory sequences and coding
sequences that are derived from different sources, or regulatory
sequences and coding sequences derived from the same source, but
arranged in a manner different than that found in nature.
"Endogenous gene" refers to a native gene in its natural location
in the genome of an organism. A "foreign-gene" refers to a gene not
normally found in the host organism, but that is introduced into
the host organism by gene transfer. Foreign genes can comprise
native genes inserted into a non-native organism, or chimeric
genes. A "transgene" is a gene that has been introduced into the
genome by a transformation procedure.
[0057] "Coding sequence" refers to a nucleotide sequence that codes
for a specific amino acid sequence. "Regulatory sequences" refer to
nucleotide sequences located upstream (5' non-coding sequences),
within, or downstream (3' non-coding sequences) of a coding
sequence, and which influence the transcription, RNA processing or
stability, or translation of the associated coding sequence.
Regulatory sequences may include promoters, translation leader
sequences, introns, and polyadenylation recognition sequences.
[0058] "Promoter" refers to a nucleotide sequence capable of
controlling the expression of a coding sequence or functional RNA.
In general, a coding sequence is located 3' to a promoter sequence.
The promoter sequence consists of proximal and more distal upstream
elements, the latter elements often referred to as enhancers.
Accordingly, an "enhancer" is a nucleotide sequence which can
stimulate promoter activity and may be an innate element of the
promoter or a heterologous element inserted to enhance the level or
tissue-specificity of a promoter. Promoters may be derived in their
entirety from a native gene, or may be composed of different
elements derived from different promoters found in nature, or may
even comprise synthetic nucleotide segments. It is understood by
those skilled in the art that different promoters may direct the
expression of a gene in different tissues or cell types, or at
different stages of development, or in response to different
environmental conditions. Promoters which cause a nucleic acid
fragment to be expressed in most cell types at most times are
commonly referred to as "constitutive promoters". New promoters of
various types useful in plant cells are constantly being
discovered; numerous examples may be found in the compilation by
Okamuro and Goldberg (1989) Biochemistry of Plants 15:1-82. It is
further recognized that since in most cases the exact boundaries of
regulatory sequences have not been completely defined, nucleic acid
fragments of different lengths may have identical promoter
activity.
[0059] "Translation leader sequence" refers to a nucleotide
sequence located between the promoter sequence of a gene and the
coding sequence. The translation leader sequence is present in the
fully processed mRNA upstream of the translation start sequence.
The translation leader sequence may affect processing of the
primary transcript to mRNA, mRNA stability or translation
efficiency. Examples of translation leader sequences have been
described (Turner and Foster (1995) Mol. Biotechnol.
3:225-236).
[0060] "3' non-coding sequences" refer to nucleotide sequences
located downstream of a coding sequence and include polyadenylation
recognition sequences and other sequences encoding regulatory
signals capable of affecting mRNA processing or gene expression.
The polyadenylation signal is usually characterized by affecting
the addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. The use of different 3' non-coding sequences is
exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
[0061] "RNA transcript" refers to the product resulting from RNA
polymerase-catalyzed transcription of a DNA sequence. When the RNA
transcript is a perfect complementary copy of the DNA sequence, it
is referred to as the primary transcript or it may be a RNA
sequence derived from posttranscriptional processing of the primary
transcript and is referred to as the mature RNA. "Messenger RNA
(mRNA)" refers to the RNA that is without introns and that can be
translated into polypeptides by the cell. "cDNA" refers to DNA that
is complementary to and derived from an mRNA template. The cDNA can
be single-stranded or converted to double stranded form using, for
example, the Klenow fragment of DNA polymerase I. "Sense-RNA"
refers to an RNA transcript that includes the mRNA and so can be
translated into a polypeptide by the cell. "Antisense RNA" refers
to an RNA transcript that is complementary to all or part of a
target primary transcript or mRNA and that blocks the expression of
a target gene (see U.S. Pat. No. 5,107,065, incorporated herein by
reference). The complementarity of an antisense RNA may be with any
part of the specific nucleotide sequence, i.e., at the 5'
non-coding sequence, 3' non coding sequence, introns, or the coding
sequence. "Functional RNA" refers to sense RNA, antisense RNA,
ribozyme RNA, or other RNA that may not be translated but yet has
an effect on cellular processes.
[0062] The term "operably linked" refers to the association of two
or more nucleic acid fragments on a single polynucleotide so that
the function of one is affected by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of affecting the expression of that coding sequence (i.e.,
that the coding sequence is under the transcriptional control of
the promoter). Coding sequences can be operably linked to
regulatory sequences in sense or antisense orientation.
[0063] An "intron" is an intervening sequence in a gene that does
not encode a portion of the protein sequence. Thus, such sequences
are transcribed into RNA but are then excised and are not
translated. The term is also used for the excised RNA sequences. An
"exon" is a portion of the sequence of a gene that is transcribed
and is found in the mature messenger RNA derived from the gene, but
is not necessarily a part of the sequence that encodes the final
gene product.
[0064] The term "expression", as used herein, refers to the
production of a functional end-product. Expression of a gene
involves transcription of the gene and translation of the mRNA into
a precursor or mature protein. "Antisense inhibition" refers to the
production of antisense RNA transcripts capable of suppressing the
expression of the target protein. "Overexpression" refers to the
production of a gene product in transgenic organisms that exceeds
levels of production in normal or non-transformed organisms.
"Co-suppression" refers to the production of sense RNA transcripts
capable of suppressing the expression of identical or substantially
similar foreign or endogenous genes (U.S. Pat. No. 5,231,020, the
disclosure of which is hereby incorporated by reference).
[0065] A "protein" or "polypeptide" is a chain of amino acids
arranged in a specific order determined by the coding sequence in a
polynucleotide encoding the polypeptide. Each protein or
polypeptide has a unique function.
[0066] "Altered levels" or "altered expression" refers to the
production of gene product(s) in transgenic organisms in amounts or
proportions that differ from that of normal or non-transformed
organisms.
[0067] "Null mutant" as used herein refers to a host cell which
either does not express a certain polypeptide or expresses a
polypeptide which is inactive or does not have any detectable
expected enzymatic function.
[0068] "Mature protein" or the term "mature" when used in
describing a protein refers to a post-translationally processed
polypeptide; i.e., one from which any pre- or propeptides present
in the primary translation product have been removed. "Precursor
protein" or the term "precursor" when used in describing a protein
refers to the primary product of translation of mRNA; i.e., with
pre- and propeptides still present. Pre- and propeptides may be but
are not limited to intracellular localization signals.
[0069] A "chloroplast transit peptide" is an amino acid sequence
which is translated in conjunction with a protein and directs the
protein to the chloroplast or other plastid types present in the
cell in which the protein is made. "Chloroplast transit sequence"
refers to a nucleotide sequence that encodes a chloroplast transit
peptide. A "signal peptide" is an amino acid sequence which is
translated in conjunction with a protein and directs the protein to
the secretory system (Chrispeels (1991) Ann. Rev. Plant Phys. Plant
Mol. Biol. 42:21-53). If the protein is to be directed to a
vacuole, a vacuolar targeting signal (supra) can further be added,
or if to the endoplasmic reticulum, an endoplasmic reticulum
retention signal (supra) may be added. If the protein is to be
directed to the nucleus, any signal peptide present should be
removed and instead a nuclear localization signal included (Raikhel
(1992) Plant Phys. 100:1627-1632).
[0070] The present invention describes a nucleic acid fragment that
encodes a diverged delta-9 fatty acid desaturase. This enzyme
catalyzes the introduction of a double bond between carbon atoms 9
and 10 of stearoyl-ACP to form oleoyl-ACP. It can also convert
stearoyl-CoA into oleoyl-CoA, albeit with reduced efficiency.
Transfer of the nucleic acid fragment of the invention, or a part
thereof that encodes a functional enzyme, with suitable regulatory
sequences into a living cell will result in the production or
over-production of stearoyl-ACP desaturase, which in the presence
of an appropriate electron donor, such as ferredoxin, may result in
an increased level of unsaturation in cellular lipids, including
oil, in tissues when the enzyme is absent or rate-limiting.
[0071] "Transformation" refers to the transfer of a nucleic acid
fragment into the genome of a host organism, resulting in
genetically stable inheritance. Host organisms containing the
transformed nucleic acid fragments are referred to as "transgenic"
organisms. Examples of methods of plant transformation include
Agrobacterium-mediated transformation (De Blaere et al. (1987)
Meth. Enzymol. 143:277) and particle-accelerated or "gene gun"
transformation technology (Klein et al. (1987) Nature (London)
327:70-73; U.S. Pat. No. 4,945,050, incorporated herein by
reference). Thus, isolated polynucleotides of the present invention
can be incorporated into recombinant constructs, typically DNA
constructs, capable of introduction into and replication in a host
cell. Such a construct can be a vector that includes a replication
system and sequences that are capable of transcription and
translation of a polypeptide-encoding sequence in a given host
cell. A number of vectors suitable for stable transfection of plant
cells or for the establishment of transgenic plants have been
described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory
Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for
Plant Molecular Biology, Academic Press, 1989; and Flevin et al.,
Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990.
Typically, plant expression vectors include, for example, one or
more cloned plant genes under the transcriptional control of 5' and
3' regulatory sequences and a dominant selectable marker. Such
plant expression vectors also can contain a promoter regulatory
region (e.g., a regulatory region controlling inducible or
constitutive, environmentally- or developmentally-regulated, or
cell- or tissue-specific expression), a transcription initiation
start site, a ribosome binding site, an RNA processing signal, a
transcription termination site, and/or a polyadenylation
signal.
[0072] Standard recombinant DNA and molecular cloning techniques
used herein are well known in the art and are described more fully
in Sambrook et al. Molecular Cloning: A Laboratory Manual; Cold
Spring Harbor Laboratory Press: Cold Spring Harbor, 1989
(hereinafter "Maniatis").
[0073] "PCR" or "polymerase chain reaction" is well known by those
skilled in the art as a technique used for the amplification of
specific DNA segments (U.S. Pat. Nos. 4,683,195 and 4,800,159).
[0074] The present invention concerns an isolated polynucleotide
comprising a nucleotide sequence selected from the group consisting
of: (a) first nucleotide sequence encoding a polypeptide of at
least 400 amino acids having at least 80% identity based on the
Clustal method of alignment when compared to a polypeptide selected
from the group consisting of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, or
16, or (b) a second nucleotide sequence comprising the complement
of the first nucleotide sequence.
[0075] Preferably, the first nucleotide sequence comprises a
nucleic acid sequence selected from the group consisting of SEQ ID
NO:1, 3, 5, 7, 9, 11, 13, or 15, that codes for the polypeptide
selected from the group consisting of SEQ ID NO:2, 4, 6, 8, 10, 12,
14, or 16.
[0076] Nucleic acid fragments encoding at least a portion of
several diverged delta-9 fatty acid desaturases have been isolated
and identified by comparison of random plant cDNA sequences to
public databases containing nucleotide and protein sequences using
the BLAST algorithms well known to those skilled in the art. The
nucleic acid fragments of the instant invention may be used to
isolate cDNAs and genes encoding homologous proteins from the same
or other plant species. Isolation of homologous genes using
sequence-dependent protocols is well known in the art. Examples of
sequence-dependent protocols include, but are not limited to,
methods of nucleic acid hybridization, and methods of DNA and RNA
amplification as exemplified by various uses of nucleic acid
amplification technologies (e.g., polymerase chain reaction, ligase
chain reaction).
[0077] For example, genes encoding other diverged delta-9 stearoyl
desaturases, either as cDNAs or genomic DNAs, could be isolated
directly by using all or a portion of the instant nucleic acid
fragments as DNA hybridization probes to screen libraries from any
desired plant employing methodology well known to those skilled in
the art. Specific oligonucleotide probes based upon the instant
nucleic acid sequences can be designed and synthesized by methods
known in the art (Maniatis). Moreover, an entire sequence can be
used directly to synthesize DNA probes by methods known to the
skilled artisan such as random primer DNA labeling, nick
translation, end-labeling techniques, or RNA probes using available
in vitro transcription systems. In addition, specific primers can
be designed and used to amplify a part or all of the instant
sequences. The resulting amplification products can be labeled
directly during amplification reactions or labeled after
amplification reactions, and used as probes to isolate full length
cDNA or genomic fragments under conditions of appropriate
stringency.
[0078] In addition, two short segments of the instant nucleic acid
fragments may be used in polymerase chain reaction protocols to
amplify longer nucleic acid fragments encoding homologous genes
from DNA or RNA. The polymerase chain reaction may also be
performed on a library of cloned nucleic acid fragments wherein the
sequence of one primer is derived from the instant nucleic acid
fragments, and the sequence of the other primer takes advantage of
the presence of the polyadenylic acid tracts to the 3' end of the
mRNA precursor encoding plant genes. Alternatively, the second
primer sequence may be based upon sequences derived from the
cloning vector. For example, the skilled artisan can follow the
RACE protocol (Frohman et al. (1988) Proc. Natl. Acad. Sci. USA
85:8998-9002) to generate cDNAs by using PCR to amplify copies of
the region between a single point in the transcript and the 3' or
5' end. Primers oriented in the 3' and 5' directions can be
designed from the instant sequences. Using commercially available
3' RACE or 5' RACE systems (BRL), specific 3' or 5' cDNA fragments
can be isolated (Ohara et al. (1989) Proc. Natl. Acad. Sci. USA
86:5673-5677; Loh et al. (1989) Science 243:217-220). Products
generated by the 3' and 5' RACE procedures can be combined to
generate full-length cDNAs (Frohman and Martin (1989) Techniques
1:165). Consequently, a polynucleotide comprising a nucleotide
sequence of at least one of 30 (preferably one of at least 40, most
preferably one of at least 60) contiguous nucleotides derived from
a nucleotide sequence selected from the group consisting of SEQ ID
NO:1, 3, 5, 7, 9, 11, 13, or 15 and the complement of such
nucleotide sequences may be used in such methods to obtain a
nucleic acid fragment encoding a substantial portion of an amino
acid sequence of a polypeptide.
[0079] The present invention relates to a method of obtaining a
nucleic acid fragment encoding a substantial portion of a diverged
delta-9 stearoyl desaturase polypeptide, preferably a substantial
portion of a plant diverged delta-9 stearoyl desaturase
polypeptide, comprising the steps of: synthesizing an
oligonucleotide primer comprising a nucleotide sequence of at least
one of 30 (preferably at least one of 40, most preferably at least
one of 60) contiguous nucleotides derived from a nucleotide
sequence selected from the group consisting of SEQ ID NO:1, 3, 5,
7, 9, 11, 13, or 15, and the complement of such nucleotide
sequences; and amplifying a nucleic acid fragment (preferably a
cDNA inserted in a cloning vector) using the oligonucleotide
primer. The amplified nucleic acid fragment preferably will encode
a portion of a diverged delta-9 stearoyl desaturase
polypeptide.
[0080] Availability of the instant nucleotide and deduced amino
acid sequences facilitates immunological screening of cDNA
expression libraries. Synthetic peptides representing portions of
the instant amino acid sequences may be synthesized. These peptides
can be used to immunize animals to produce polyclonal or monoclonal
antibodies with specificity for peptides or proteins comprising the
amino acid sequences. These antibodies can be then be used to
screen cDNA expression libraries to isolate full-length cDNA clones
of interest (Lerner (1984) Adv. Immunol. 36:1-34; Maniatis).
[0081] In another embodiment, this invention concerns viruses and
host cells comprising either the chimeric constructs of the
invention as described herein or an isolated polynucleotide of the
invention as described herein. Examples of host cells which can be
used to practice the invention include, but are not limited to,
yeast, bacteria, and plants.
[0082] As was noted above, the nucleic acid fragments of the
instant invention may be used to create transgenic plants in which
the disclosed polypeptides are present at higher or lower levels
than normal or in cell types or developmental stages in which they
are not normally found. This would have the effect of altering the
level of mono-, poly- and unsaturated fatty acids in those
cells.
[0083] Overexpression of the proteins of the instant invention may
be accomplished by first constructing a chimeric gene in which the
coding region is operably linked to a promoter capable of directing
expression of a gene in the desired tissues at the desired stage of
development. The chimeric gene may comprise promoter sequences and
translation leader sequences derived from the same genes. 3'
Non-coding sequences encoding transcription termination signals may
also be provided. The instant chimeric gene may also comprise one
or more introns in order to facilitate gene expression.
[0084] The terms "chimeric construct", "recombinant construct",
"expression construct" and "recombinant expression construct" are
used interchangeably herein. Such construct may be itself or may be
used in conjunction with a vector. If a vector is used then the
choice of vector is dependent upon the method that will be used to
transform host plants as is well known to those skilled in the art.
For example, a plasmid vector can be used. The skilled artisan is
well aware of the genetic elements that must be present on the
plasmid vector in order to successfully transform, select and
propagate host cells containing the chimeric gene. The skilled
artisan will also recognize that different independent
transformation events will result in different levels and patterns
of expression (Jones et al. (1985) EMBO J. 4:2411-2418; De Almeida
et al. (1989) Mol. Gen. Genetics 218:78-86), and thus that multiple
events must be screened in order to obtain lines displaying the
desired expression level and pattern. Such screening may be
accomplished by Southern analysis of DNA, Northern analysis of mRNA
expression, Western analysis of protein expression, or phenotypic
analysis.
[0085] For some applications it may be useful to direct the instant
polypeptides to different cellular compartments, or to facilitate
its secretion from the cell. It is thus envisioned that the
chimeric gene described above may be further supplemented by
directing the coding sequence to encode the instant polypeptides
with appropriate intracellular targeting sequences such as transit
sequences (Keegstra (1989) Cell 56:247-253), signal sequences or
sequences encoding endoplasmic reticulum localization (Chrispeels
(1991) Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21-53), or nuclear
localization signals (Raikhel (1992) Plant Phys. 100:1627-1632)
with or without removing targeting sequences that are already
present. While the references cited give examples of each of these,
the list is not exhaustive and more targeting signals of use may be
discovered in the future.
[0086] It may also be desirable to reduce or eliminate expression
of genes encoding the instant polypeptides in plants for some
applications. In order to accomplish this, a chimeric construct
designed for co-suppression of the instant polypeptide can be
constructed by linking a gene or gene fragment encoding that
polypeptide to plant promoter sequences. Alternatively, a chimeric
construct designed to express antisense RNA for all or part of the
instant nucleic acid fragment can be constructed by linking the
gene or gene fragment in reverse orientation to plant promoter
sequences. Either the co-suppression or antisense chimeric
constructs could be introduced into plants via transformation
wherein expression of the corresponding endogenous genes are
reduced or eliminated. In a preferred embodiment, it has been found
that suitable nucleic sequences and their reverse complement can be
used to alter the expression of any homologous, endogenous RNA
which is in proximity to the suitable nucleic acid and its reverse
complement. This is described in greater detail in Applicant's
Assignee's co-pending provisional application having Application
No. 60/213,961 filed Jun. 23, 2000, the disclosure of which is
hereby incorporated by reference.
[0087] Molecular genetic solutions to the generation of plants with
altered gene expression have a decided advantage over more
traditional plant breeding approaches. Changes in plant phenotypes
can be produced by specifically inhibiting expression of one or
more genes by antisense inhibition or cosuppression (U.S. Pat. Nos.
5,190,931, 5,107,065 and 5,283,323). An antisense or cosuppression
construct would act as a dominant negative regulator of gene
activity. While conventional mutations can yield negative
regulation of gene activity these effects are most likely
recessive. The dominant negative regulation available with a
transgenic approach may be advantageous from a breeding
perspective. In addition, the ability to restrict the expression of
a specific phenotype to the reproductive tissues of the plant by
the use of tissue specific promoters may confer agronomic
advantages relative to conventional mutations which may have an
effect in all tissues in which a mutant gene is ordinarily
expressed.
[0088] The person skilled in the art will know that special
considerations are associated with the use of antisense or
cosuppression technologies in order to reduce expression of
particular genes. For example, the proper level of expression of
sense or antisense genes may require the use of different chimeric
genes utilizing different regulatory elements known to the skilled
artisan. Once transgenic plants are obtained by one of the methods
described above, it will be necessary to screen individual
transgenics for those that most effectively display the desired
phenotype. Accordingly, the skilled artisan will develop methods
for screening large numbers of transformants. The nature of these
screens will generally be chosen on practical grounds. For example,
one can screen by looking for changes in gene expression by using
antibodies specific for the protein encoded by the gene being
suppressed, or one could establish assays that specifically measure
enzyme activity. A preferred method will be one which allows large
numbers of samples to be processed rapidly, since it will be
expected that a large number of transformants will be negative for
the desired phenotype.
[0089] In another embodiment, the present invention concerns a
polypeptide of at least 400 amino acids that has at least 80%
identity based on the Clustal method of alignment when compared to
a polypeptide selected from the group consisting of SEQ ID NO:2, 4,
6, 8, 10, 12, 14, or 16.
[0090] The instant polypeptides (or portions thereof) may be
produced in heterologous host cells, particularly in the cells of
microbial hosts, and can be used to prepare antibodies to these
proteins by methods well known to those skilled in the art. The
antibodies are useful for detecting the polypeptides of the instant
invention in situ in cells or in vitro in cell extracts. Preferred
heterologous host cells for production of the instant polypeptides
are microbial hosts. Microbial expression systems and expression
vectors containing regulatory sequences that direct high level
expression of foreign proteins are well known to those skilled in
the art. Any of these could be used to make a chimeric construct
for production of the instant polypeptides. This chimeric construct
could then be introduced into appropriate microorganisms via
transformation to provide high level expression of the encoded
diverged delta-9 fatty acid desaturase. An example of a vector for
high level expression of the instant polypeptides in a bacterial
host is provided (Example 6).
[0091] All or a substantial portion of the polynucleotides of the
instant invention may also be used as probes for genetically and
physically mapping the genes that they are a part of, and used as
markers for traits linked to those genes. Such information may be
useful in plant breeding in order to develop lines with desired
phenotypes. For example, the instant nucleic acid fragments may be
used as restriction fragment length polymorphism (RFLP) markers.
Southern blots (Maniatis) of restriction-digested plant genomic DNA
may be probed with the nucleic acid fragments of the instant
invention. The resulting banding patterns may then be subjected to
genetic analyses using computer programs such as MapMaker (Lander
et al. (1987) Genomics 1:174-181) in order to construct a genetic
map. In addition, the nucleic acid fragments of the instant
invention may be used to probe Southern blots containing
restriction endonuclease-treated genomic DNAs of a set of
individuals representing parent and progeny of a defined genetic
cross. Segregation of the DNA polymorphisms is noted and used to
calculate the position of the instant nucleic acid sequence in the
genetic map previously obtained using this population (Botstein et
al. (1980) Am. J. Hum. Genet. 32:314-331).
[0092] The production and use of plant gene-derived probes for use
in genetic mapping is described in Bernatzky and Tanksley (1986)
Plant Mol. Biol. Reporter 4:37-41. Numerous publications describe
genetic mapping of specific cDNA clones using the methodology
outlined above or variations thereof. For example, F2 intercross
populations, backcross populations, randomly mated populations,
near isogenic lines, and other sets of individuals may be used for
mapping. Such methodologies are well known to those skilled in the
art.
[0093] Nucleic acid probes derived from the instant nucleic acid
sequences may also be used for physical mapping (i.e., placement of
sequences on physical maps; see Hoheisel et al. in: Nonmammalian
Genomic Analysis: A Practical Guide, Academic press 1996, pp.
319-346, and references cited therein).
[0094] In another embodiment, nucleic acid probes derived from the
instant nucleic acid sequences may be used in direct fluorescence
in situ hybridization (FISH) mapping (Trask (1991) Trends Genet.
7:149-154). Although current methods of FISH mapping favor use of
large clones (several to several hundred KB; see Laan et al. (1995)
Genome Res. 5:13-20), improvements in sensitivity may allow
performance of FISH mapping using shorter probes.
[0095] A variety of nucleic acid amplification-based methods of
genetic and physical mapping may be carried out using the instant
nucleic acid sequences. Examples include allele-specific
amplification (Kazazian (1989) J. Lab. Clin. Med. 11:95-96),
polymorphism of PCR-amplified fragments (CAPS; Sheffield et al.
(1993) Genomics 16:325-332), allele-specific ligation (Landegren et
al. (1988) Science 241:1077-1080), nucleotide extension reactions
(Sokolov (1990) Nucleic Acid Res. 18:3671), Radiation Hybrid
Mapping (Walter et al. (1997) Nat. Genet. 7:22-28) and Happy
Mapping (Dear and Cook (1989) Nucleic Acid Res. 17:6795-6807). For
these methods, the sequence of a nucleic acid fragment is used to
design and produce primer pairs for use in the amplification
reaction or in primer extension reactions. The design of such
primers is well known to those skilled in the art. In methods
employing PCR-based genetic mapping, it may be necessary to
identify DNA sequence differences between the parents of the
mapping cross in the region corresponding to the instant nucleic
acid sequence. This, however, is generally not necessary for
mapping methods.
[0096] Loss of function mutant phenotypes may be identified for the
instant cDNA clones either by targeted gene disruption protocols or
by identifying specific mutants for these genes contained in a
maize population carrying mutations in all possible genes
(Ballinger and Benzer (1989) Proc. Natl. Acad. Sci. USA
86:9402-9406; Koes et al. (1995) Proc. Natl. Acad. Sci. USA
92:8149-8153; Bensen et al. (1995) Plant Cell 7:75-84). The latter
approach may be accomplished in two ways. First, short segments of
the instant nucleic acid fragments may be used in polymerase chain
reaction protocols in conjunction with a mutation tag sequence
primer on DNAs prepared from a population of plants in which
Mutator transposons or some other mutation-causing DNA element has
been introduced (see Bensen, supra). The amplification of a
specific DNA fragment with these primers indicates the insertion of
the mutation tag element in or near the plant gene encoding the
instant polypeptides. Alternatively, the instant nucleic acid
fragment may be used as a hybridization probe against PCR
amplification products generated from the mutation population using
the mutation tag sequence primer in conjunction with an arbitrary
genomic site primer, such as that for a restriction enzyme
site-anchored synthetic adaptor. With either method, a plant
containing a mutation in the endogenous gene encoding the instant
polypeptides can be identified and obtained. This mutant plant can
then be used to determine or confirm the natural function of the
instant polypeptides disclosed herein.
[0097] Methods for assaying delta-9 fatty acid desaturase
activities in E. coli have been previously described (U.S. Pat.
Nos. 5,443,974 and 5,760,206). Fatty acid analysis of oil samples
is performed by gas chromatography. Briefly, fatty acid (FA)
determination was done from a total of 300-400 mg of tissue
lyophilized for 24 hours. The tissue was then ground using a
FastPrep mill (Bio101) at 4.5 speed and 20 seconds in the presence
of 0.5 ml of 2.5% Sulfuric Acid+97.5% Methanol and Heptadecanoic
acid (17:0, stock 10 mg/ml in Tuloene) as an external standard.
Thereafter, another 0.5 ml 2.5% Sulfuric Acid+97.5% Methanol was
used to wash each tube and incubate in 95.degree. C. for 1 hour for
transesterification. The tubes were removed from the water bath and
allowed to cool down to room temperature. FAs were extracted in one
volume of heptane:H.sub.2O (1:1) and cleared by centrifugation. The
supernatant (50 ul) containing the fatty acid methyl esters were
loaded into a Hewlett Packard 6890 gas chromatograph fitted with a
30 m.times.0.32 mm Omegawax column and the separated peaks were
analyzed and characterized.
EXAMPLES
[0098] The present invention is further defined in the following
Examples, in which parts and percentages are by weight and degrees
are Celsius, unless otherwise stated. It should be understood that
these Examples, while indicating preferred embodiments of the
invention, are given by way of illustration only. From the above
discussion and these Examples, one skilled in the art can ascertain
the essential characteristics of this invention, and without
departing from the spirit and scope thereof, can make various
changes and modifications of the invention to adapt it to various
usages and conditions. Thus, various modifications of the invention
in addition to those shown and described herein will be apparent to
those skilled in the art from the foregoing description. Such
modifications are also intended to fall within the scope of the
appended claims.
[0099] The disclosure of each reference set forth herein is
incorporated herein by reference in its entirety.
Example 1
Composition of cDNA Libraries; Isolation and Sequencing of cDNA
Clones
[0100] cDNA libraries representing mRNAs from various soybean,
corn, and rice tissues were prepared. The characteristics of the
libraries are described below.
TABLE-US-00003 TABLE 3 cDNA Libraries from Soybean, Corn, and Rice
Library Description Clone se6 Soybean Embryo, 26 Days After
se6.pk0026.a8 Flowering cbn10 Corn Developing Kernel (Embryo and
cbn10.pk0061.a3 Endosperm); 10 Days After Pollination
cbn10.pk0061.a3:fis cpd1c Corn (Zea mays L.) pooled BMS treated
cpd1c.pk014.l18 with chemicals related to protein kinases
cpd1c.pk014.l18:fis rds1c Rice (Oryza sativa, YM) developing
rds1c.pk007.g19 seeds 1 rds1c.pk007.g19:fis rsl1n Rice (Oryza
sativa, YM) 15 day old rsl1n.pk008.j18:fis seedling normalized
[0101] cDNA libraries may be prepared by any one of many methods
available. For example, the cDNAs may be introduced into plasmid
vectors by first preparing the cDNA libraries in Uni-ZAP.TM. XR
vectors according to the manufacturer's protocol (Stratagene
Cloning Systems, La Jolla, Calif.). The Uni-ZAP.TM. XR libraries
are converted into plasmid libraries according to the protocol
provided by Stratagene. Upon conversion, cDNA inserts will be
contained in the plasmid vector pBluescript. In addition, the cDNAs
may be introduced directly into precut Bluescript II SK(+) vectors
(Stratagene) using T4 DNA ligase (New England Biolabs), followed by
transfection into DH10B cells according to the manufacturer's
protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid
vectors, plasmid DNAs are prepared from randomly picked bacterial
colonies containing recombinant pBluescript plasmids, or the insert
cDNA sequences are amplified via polymerase chain reaction using
primers specific for vector sequences flanking the inserted cDNA
sequences. Amplified insert DNAs or plasmid DNAs are sequenced in
dye-primer sequencing reactions to generate partial cDNA sequences
(expressed sequence tags or "ESTs"; see Adams et al., (1991)
Science 252:1651-1656). The resulting ESTs are analyzed using a
Perkin Elmer Model 377 fluorescent sequencer.
[0102] Full-insert sequence (FIS) data is generated utilizing a
modified transposition protocol. Clones identified for FIS are
recovered from archived glycerol stocks as single colonies, and
plasmid DNAs are isolated via alkaline lysis. Isolated DNA
templates are reacted with vector primed M13 forward and reverse
oligonucleotides in a PCR-based sequencing reaction and loaded onto
automated sequencers. Confirmation of clone identification is
performed by sequence alignment to the original EST sequence from
which the FIS request is made.
[0103] Confirmed templates are transposed via the Primer Island
transposition kit (PE Applied Biosystems, Foster City, Calif.)
which is based upon the Saccharomyces cerevisiae Ty1 transposable
element (Devine and Boeke (1994) Nucleic Acids Res. 22:3765-3772).
The in vitro transposition system places unique binding sites
randomly throughout a population of large DNA molecules. The
transposed DNA is then used to transform DH10B electro-competent
cells (Gibco BRL/Life Technologies, Rockville, Md.) via
electroporation. The transposable element contains an additional
selectable marker (named DHFR; Fling and Richards (1983) Nucleic
Acids Res. 11:5147-5158), allowing for dual selection on agar
plates of only those subclones containing the integrated
transposon. Multiple subclones are randomly selected from each
transposition reaction, plasmid DNAs are prepared via alkaline
lysis, and templates are sequenced (ABI Prism dye-terminator
ReadyReaction mix) outward from the transposition event site,
utilizing unique primers specific to the binding sites within the
transposon.
[0104] Sequence data is collected (ABI Prism Collections) and
assembled using Phred/Phrap (P. Green, University of Washington,
Seattle). Phrep/Phrap is a public domain software program which
re-reads the ABI sequence data, re-calls the bases, assigns quality
values, and writes the base calls and quality values into editable
output files. The Phrap sequence assembly program uses these
quality values to increase the accuracy of the assembled sequence
contigs. Assemblies are viewed by the Consed sequence editor (D.
Gordon, University of Washington, Seattle).
Example 2
Identification of cDNA Clones
[0105] cDNA clones encoding a diverged delta-9 fatty acid
desaturase were identified by conducting BLAST (Basic Local
Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol.
215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/) searches for
similarity to sequences contained in the BLAST "nr" database
(comprising all non-redundant GenBank CDS translations, sequences
derived from the 3-dimensional structure Brookhaven Protein Data
Bank, the last major release of the SWISS-PROT protein sequence
database, EMBL, and DDBJ databases). The cDNA sequences obtained in
Example 1 were analyzed for similarity to all publicly available
DNA sequences contained in the "nr" database using the BLASTN
algorithm provided by the National Center for Biotechnology
Information (NCBI). The DNA sequences were translated in all
reading frames and compared for similarity to all publicly
available protein sequences contained in the "nr" database using
the BLASTX algorithm (Gish and States (1993) Nat. Genet. 3:266-272)
provided by the NCBI. For convenience, the P-value (probability) of
observing a match of a cDNA sequence to a sequence contained in the
searched databases merely by chance as calculated by BLAST are
reported herein as "pLog" values, which represent the negative of
the logarithm of the reported P-value. Accordingly, the greater the
pLog value, the greater the likelihood that the cDNA sequence and
the BLAST "hit" represent homologous proteins.
[0106] ESTs submitted for analysis are compared to the genbank
database as described above. ESTs that contain sequences more 5- or
3-prime can be found by using the BLASTn algorithm (Altschul et al
(1997) Nucleic Acids Res. 25:3389-3402.) against the Du Pont
proprietary database comparing nucleotide sequences that share
common or overlapping regions of sequence homology. Where common or
overlapping sequences exist between two or more nucleic acid
fragments, the sequences can be assembled into a single contiguous
nucleotide sequence, thus extending the original fragment in either
the 5 or 3 prime direction. Once the most 5-prime EST is
identified, its complete sequence can be determined by Full Insert
Sequencing as described in Example 1. Homologous genes belonging to
different species can be found by comparing the amino acid sequence
of a known gene (from either a proprietary source or a public
database) against an EST database using the tBLASTn algorithm. The
tBLASTn algorithm searches an amino acid query against a nucleotide
database that is translated in all 6 reading frames. This search
allows for differences in nucleotide codon usage between different
species, and for codon degeneracy.
Example 3
Characterization of cDNA Clones Encoding a Diverged Delta-9, or
Stearoyl-ACP, Desaturase
[0107] The BLASTX search using the EST sequences from clones listed
in Table 3 revealed similarity of the polypeptides encoded by the
cDNAs to a diverged delta-9, or stearoyl-ACP, desaturase from
lupine (Lupinus luteus), cucumber (Cucumis sativus), Arabidopsis
(Arabidopsis thaliana), jojoba (Simmondsia chinensis), Arabidopsis
(Arabidopsis thaliana), and flax (Linum usitatissimum) (NCBI
General Identifier Nos. gi 4704824, gi 417820, gi 7523660, gi
267036, gi 6957724, and gi 3355632 respectively). Shown in Table 4
are the BLAST results for individual ESTs ("EST"), the sequences of
the entire cDNA inserts comprising the indicated cDNA clones
("FIS"), the sequences of contigs assembled from two or more ESTs
("Contig"), sequences of contigs assembled from an FIS and one or
more ESTs ("Contig*"), or sequences encoding an entire protein
derived from an FIS, a contig, or an FIS and PCR ("CGS"):
TABLE-US-00004 TABLE 4 BLAST Results for Sequences Encoding
Polypeptides Homologous to a Diverged Delta-9, or Stearoyl-ACP,
Desaturase Clone Status BLAST pLog gi # se6.pk0026.a8 CGS 254.00
4704824 cbn10.pk0061.a3 EST 2.52 4704824 cpd1c.pk014.l18 contig
107.00 417820 rds1c.pk007.g19 EST 33.04 7523660 cbn10.pk0061.a3:fis
CGS 113.00 267036 cpd1c.pk014.l18:fis CGS 149.00 4704824
rds1c.pk007.g19:fis FIS 60.52 6957724 rsl1n.pk008.j18:fis CGS
147.00 3355632
[0108] FIG. 1 presents an alignment of the amino acid sequences set
forth in SEQ ID NO:2, 10, 12, 14, and 16, and the lupine, jojoba,
Arabidopsis, and flax sequences (SEQ ID NO:17, 20, 21, and 22) and
the original soybean delta-9 desaturase presented in U.S. Pat. No.
5,760,206 (SEQ ID NO:23). The data in Table 5 represents a
calculation of the percent identity of the amino acid sequences set
forth in SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, and 16, and the lupine,
cucumber, Arabidopsis, jojoba, Arabidopsis, and flax sequences (SEQ
ID NOs:17, 18, 19, 20, 21, and 22; NCBI General Identifier Nos. gi
4704824, gi 417820, gi 7523660, gi 267036, gi 6957724, and gi
3355632 respectively).
TABLE-US-00005 TABLE 5 Percent Identity of Polypeptides Homologous
to a Diverged Delta-9, or Stearoyl-ACP, Desaturase SEQ ID NO.
Percent Identity gi # 2 77.6% 4704824 4 16.4% 4704824 6 62.3%
417820 8 59.5% 7523660 10 49.2% 267036 12 64.2% 4704824 14 50.2%
6957724 16 64.0% 3355632
[0109] Sequence alignments and percent identity calculations were
performed using the Megalign program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
Multiple alignment of the sequences was performed using the Clustal
method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153)
with the default parameters (GAP PENALTY=10, GAP LENGTH
PENALTY=10). Default parameters for pairwise alignments using the
Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5. Sequence alignments and BLAST scores and probabilities
indicate that the nucleic acid fragments comprising the instant
cDNA clones encode a substantial portion of a diverged delta-9, or
stearoyl-ACP, desaturase. Confirmation of the biochemical identity
of each clone is accomplished according to methods well known to
those skilled in the art (U.S. Pat. No. 5,760,206).
Example 4
Expression of Chimeric Constructs in Monocot Cells
[0110] A chimeric construct comprising a cDNA encoding the instant
polypeptides in sense orientation with respect to the maize 27 kD
zein promoter that is located 5' to the cDNA fragment, and the 10
kD zein 3' end that is located 3' to the cDNA fragment, can be
constructed. The cDNA fragment of this gene may be generated by
polymerase chain reaction (PCR) of the cDNA clone using appropriate
oligonucleotide primers. Cloning sites (NcoI or SmaI) can be
incorporated into the oligonucleotides to provide proper
orientation of the DNA fragment when inserted into the digested
vector pML103 as described below. Amplification is then performed
in a standard PCR. The amplified DNA is then digested with
restriction enzymes NcoI and SmaI and fractionated on an agarose
gel. The appropriate band can be isolated from the gel and combined
with a 4.9 kb NcoI-SmaI fragment of the plasmid pML103. Plasmid
pML103 has been deposited under the terms of the Budapest Treaty at
ATCC (American Type Culture Collection, 10801 University Blvd.,
Manassas, Va. 20110-2209), and bears accession number ATCC 97366.
The DNA segment from pML103 contains a 1.05 kb SalI-NcoI promoter
fragment of the maize 27 kD zein gene and a 0.96 kb SmaI-SalI
fragment from the 3' end of the maize 10 kD zein gene in the vector
pGem9Zf(+) (Promega). Vector and insert DNA can be ligated at
15.degree. C. overnight, essentially as described (Maniatis). The
ligated DNA may then be used to transform E. coli XL1-Blue
(Epicurian Coli XL-1 Blue.TM.; Stratagene). Bacterial transformants
can be screened by restriction enzyme digestion of plasmid DNA and
limited nucleotide sequence analysis using the dideoxy chain
termination method (Sequenase.TM. DNA Sequencing Kit; U.S.
Biochemical). The resulting plasmid construct would comprise a
chimeric construct encoding, in the 5' to 3' direction, the maize
27 kD zein promoter, a cDNA fragment encoding the instant
polypeptides, and the 10 kD zein 3' region.
[0111] The chimeric construct described above can then be
introduced into corn cells by the following procedure. Immature
corn embryos can be dissected from developing caryopses derived
from crosses of the inbred corn lines H99 and LH132. The embryos
are isolated 10 to 11 days after pollination when they are 1.0 to
1.5 mm long. The embryos are then placed with the axis-side facing
down and in contact with agarose-solidified N6 medium (Chu et al.
(1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the
dark at 27.degree. C. Friable embryogenic callus consisting of
undifferentiated masses of cells with somatic proembryoids and
embryoids borne on suspensor structures proliferates from the
scutellum of these immature embryos. The embryogenic callus
isolated from the primary explant can be cultured on N6 medium and
sub-cultured on this medium every 2 to 3 weeks.
[0112] The plasmid, p35S/Ac (obtained from Dr. Peter Eckes, Hoechst
Ag, Frankfurt, Germany) may be used in transformation experiments
in order to provide for a selectable marker. This plasmid contains
the Pat gene (see European Patent Publication 0 242 236) which
encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT
confers resistance to herbicidal glutamine synthetase inhibitors
such as phosphinothricin. The pat gene in p35S/Ac is under the
control of the 35S promoter from Cauliflower Mosaic Virus (Odell et
al. (1985) Nature 313:810-812) and the 3' region of the nopaline
synthase gene from the T-DNA of the Ti plasmid of Agrobacterium
tumefaciens.
[0113] The particle bombardment method (Klein et al. (1987) Nature
327:70-73) may be used to transfer genes to the callus culture
cells. According to this method, gold particles (1 .mu.m in
diameter) are coated with DNA using the following technique. Ten
.mu.g of plasmid DNAs are added to 50 .mu.L of a suspension of gold
particles (60 mg per mL). Calcium chloride (50 .mu.L of a 2.5 M
solution) and spermidine free base (20 .mu.L of a 1.0 M solution)
are added to the particles. The suspension is vortexed during the
addition of these solutions. After 10 minutes, the tubes are
briefly centrifuged (5 sec at 15,000 rpm) and the supernatant
removed. The particles are resuspended in 200 .mu.L of absolute
ethanol, centrifuged again and the supernatant removed. The ethanol
rinse is performed again and the particles resuspended in a final
volume of 30 .mu.L of ethanol. An aliquot (5 .mu.L) of the
DNA-coated gold particles can be placed in the center of a
Kapton.TM. flying disc (Bio-Rad Labs). The particles are then
accelerated into the corn tissue with a Biolistic.TM. PDS-1000/He
(Bio-Rad Instruments, Hercules Calif.), using a helium pressure of
1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0
cm.
[0114] For bombardment, the embryogenic tissue is placed on filter
paper over agarose-solidified N6 medium. The tissue is arranged as
a thin lawn and covered a circular area of about 5 cm in diameter.
The petri dish containing the tissue can be placed in the chamber
of the PDS-1000/He approximately 8 cm from the stopping screen. The
air in the chamber is then evacuated to a vacuum of 28 inches of
Hg. The macrocarrier is accelerated with a helium shock wave using
a rupture membrane that bursts when the He pressure in the shock
tube reaches 1000 psi.
[0115] Seven days after bombardment the tissue can be transferred
to N6 medium that contains gluphosinate (2 mg per liter) and lacks
casein or proline. The tissue continues to grow slowly on this
medium. After an additional 2 weeks the tissue can be transferred
to fresh N6 medium containing gluphosinate. After 6 weeks, areas of
about 1 cm in diameter of actively growing callus can be identified
on some of the plates containing the glufosinate-supplemented
medium. These calli may continue to grow when sub-cultured on the
selective medium.
[0116] Plants can be regenerated from the transgenic callus by
first transferring clusters of tissue to N6 medium supplemented
with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be
transferred to regeneration medium (Fromm et al. (1990)
Bio/Technology 8:833-839).
Example 5
Expression of Chimeric Constructs in Dicot Cells
[0117] A seed-specific expression cassette composed of the promoter
and transcription terminator from the gene encoding the .beta.
subunit of the seed storage protein phaseolin from the bean
Phaseolus vulgaris (Doyle et al. (1986) J. Biol. Chem.
261:9228-9238) can be used for expression of the instant
polypeptides in transformed soybean. The phaseolin cassette
includes about 500 nucleotides upstream (5') from the translation
initiation codon and about 1650 nucleotides downstream (3') from
the translation stop codon of phaseolin. Between the 5' and 3'
regions are the unique restriction endonuclease sites Nco I (which
includes the ATG translation initiation codon), Sma I, Kpn I and
Xba I. The entire cassette is flanked by Hind III sites.
[0118] The cDNA fragment of this gene may be generated by
polymerase chain reaction (PCR) of the cDNA clone using appropriate
oligonucleotide primers. Cloning sites can be incorporated into the
oligonucleotides to provide proper orientation of the DNA fragment
when inserted into the expression vector. Amplification is then
performed as described above, and the isolated fragment is inserted
into a pUC18 vector carrying the seed expression cassette.
[0119] Soybean embryos may then be transformed with the expression
vector comprising sequences encoding the instant polypeptides. To
induce somatic embryos, cotyledons, 3-5 mm in length dissected from
surface sterilized, immature seeds of the soybean cultivar A2872,
can be cultured in the light or dark at 26.degree. C. on an
appropriate agar medium for 6-10 weeks. Somatic embryos which
produce secondary embryos are then excised and placed into a
suitable liquid medium. After repeated selection for clusters of
somatic embryos which multiplied as early, globular staged embryos,
the suspensions are maintained as described below.
[0120] Soybean embryogenic suspension cultures can be maintained in
35 mL liquid media on a rotary shaker, 150 rpm, at 26.degree. C.
with florescent lights on a 16:8 hour day/night schedule. Cultures
are subcultured every two weeks by inoculating approximately 35 mg
of tissue into 35 mL of liquid medium.
[0121] Soybean embryogenic suspension cultures may then be
transformed by the method of particle gun bombardment (Klein et al.
(1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A
DuPont Biolistic.TM. PDS1000/HE instrument (helium retrofit) can be
used for these transformations.
[0122] A selectable marker gene which can be used to facilitate
soybean transformation is a chimeric construct composed of the 35S
promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature
313:810-812), the hygromycin phosphotransferase gene from plasmid
pJR225 (from E. coli; Gritz et al. (1983) Gene 25:179-188) and the
3' region of the nopaline synthase gene from the T-DNA of the Ti
plasmid of Agrobacterium tumefaciens. The seed expression cassette
comprising the phaseolin 5' region, the fragment encoding the
instant polypeptides and the phaseolin 3' region can be isolated as
a restriction fragment. This fragment can then be inserted into a
unique restriction site of the vector carrying the marker gene.
[0123] To 50 .mu.L of a 60 mg/mL 1 .mu.m gold particle suspension
is added (in order): 5 .mu.L DNA (1 .mu.g/.mu.L), 20 .mu.l
spermidine (0.1 M), and 50 .mu.L CaCl.sub.2 (2.5 M). The particle
preparation is then agitated for three minutes, spun in a microfuge
for 10 seconds and the supernatant removed. The DNA-coated
particles are then washed once in 400 .mu.L 70% ethanol and
resuspended in 40 .mu.L of anhydrous ethanol. The DNA/particle
suspension can be sonicated three times for one second each. Five
.mu.L of the DNA-coated gold particles are then loaded on each
macro carrier disk.
[0124] Approximately 300-400 mg of a two-week-old suspension
culture is placed in an empty 60.times.15 mm petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue are
normally bombarded. Membrane rupture pressure is set at 1100 psi
and the chamber is evacuated to a vacuum of 28 inches mercury. The
tissue is placed approximately 3.5 inches away from the retaining
screen and bombarded three times. Following bombardment, the tissue
can be divided in half and placed back into liquid and cultured as
described above.
[0125] Five to seven days post bombardment, the liquid media may be
exchanged with fresh media, and eleven to twelve days post
bombardment with fresh media containing 50 mg/mL hygromycin. This
selective media can be refreshed weekly. Seven to eight weeks post
bombardment, green, transformed tissue may be observed growing from
untransformed, necrotic embryogenic clusters. Isolated green tissue
is removed and inoculated into individual flasks to generate new,
clonally propagated, transformed embryogenic suspension cultures.
Each new line may be treated as an independent transformation
event. These suspensions can then be subcultured and maintained as
clusters of immature embryos or regenerated into whole plants by
maturation and germination of individual somatic embryos.
Example 6
Expression of Chimeric Constructs in Microbial Cells
[0126] The cDNAs encoding the instant polypeptides can be inserted
into the T7 E. coli expression vector pBT430. This vector is a
derivative of pET-3a (Rosenberg et al. (1987) Gene 56:125-135)
which employs the bacteriophage T7 RNA polymerase/T7 promoter
system. Plasmid pBT430 was constructed by first destroying the EcoR
I and Hind III sites in pET-3a at their original positions. An
oligonucleotide adaptor containing EcoR I and Hind III sites was
inserted at the BamH I site of pET-3a. This created pET-3aM with
additional unique cloning sites for insertion of genes into the
expression vector. Then, the Nde I site at the position of
translation initiation was converted to an Nco I site using
oligonucleotide-directed mutagenesis. The DNA sequence of pET-3aM
in this region, 5'-CATATGG, was converted to 5'-CCCATGG in
pBT430.
[0127] Plasmid DNA containing a cDNA may be appropriately digested
to release a nucleic acid fragment encoding the protein. This
fragment may then be purified on a 1% low melting agarose gel.
Buffer and agarose contain 10 .mu.g/ml ethidium bromide for
visualization of the DNA fragment. The fragment can then be
purified from the agarose gel by digestion with GELase.TM.
(Epicentre Technologies, Madison, Wis.) according to the
manufacturer's instructions, ethanol precipitated, dried and
resuspended in 20 .mu.L of water. Appropriate oligonucleotide
adapters may be ligated to the fragment using T4 DNA ligase (New
England Biolabs (NEB), Beverly, Mass.). The fragment containing the
ligated adapters can be purified from the excess adapters using low
melting agarose as described above. The vector pBT430 is digested,
dephosphorylated with alkaline phosphatase (NEB) and deproteinized
with phenol/chloroform as described above. The prepared vector
pBT430 and fragment can then be ligated at 16.degree. C. for 15
hours followed by transformation into DH5 electrocompetent cells
(GIBCO BRL). Transformants can be selected on agar plates
containing LB media and 100 .mu.g/mL ampicillin. Transformants
containing the gene encoding the instant polypeptides are then
screened for the correct orientation with respect to the T7
promoter by restriction enzyme analysis.
[0128] For high level expression, a plasmid clone with the cDNA
insert in the correct orientation relative to the T7 promoter can
be transformed into E. coli strain BL21 (DE3) (Studier et al.
(1986) J. Mol. Biol. 189:113-130). Cultures are grown in LB medium
containing ampicillin (100 mg/L) at 25.degree. C. At an optical
density at 600 nm of approximately 1, IPTG
(isopropylthio-.beta.-galactoside, the inducer) can be added to a
final concentration of 0.4 mM and incubation can be continued for 3
h at 25.degree.. Cells are then harvested by centrifugation and
re-suspended in 50 .mu.L of 50 mM Tris-HCl at pH 8.0 containing 0.1
mM DTT and 0.2 mM phenyl methylsulfonyl fluoride. A small amount of
1 mm glass beads can be added and the mixture sonicated 3 times for
about 5 seconds each time with a microprobe sonicator. The mixture
is centrifuged and the protein concentration of the supernatant
determined. One .mu.g of protein from the soluble fraction of the
culture can be separated by SDS-polyacrylamide gel electrophoresis.
Gels can be observed for protein bands migrating at the expected
molecular weight.
Example 7
Transformation of Somatic Soybean Embryo Cultures
[0129] Soybean embryogenic suspension cultures were maintained in
35 ml liquid media (SB55 or SBP6) on a rotary shaker, 150 rpm, at
28.degree. C. with mixed fluorescent and incandescent lights on a
16:8 h day/night schedule. Cultures were subcultured every four
weeks by inoculating approximately 35 mg of tissue into 35 ml of
liquid medium.
TABLE-US-00006 TABLE 6 Stock Solutions (g/L): MS Sulfate 100X Stock
MgSO.sub.4 7H.sub.2O 37.0 MnSO.sub.4 H.sub.2O 1.69 ZnSO.sub.4
7H.sub.2O 0.86 CuSO.sub.4 5H.sub.2O 0.0025 MS Halides 100X Stock
CaCl.sub.2 2H.sub.2O 44.0 Kl 0.083 CoCl.sub.2 6H.sub.20 0.00125
KH.sub.2PO.sub.4 17.0 H.sub.3BO.sub.3 0.62 Na.sub.2MoO.sub.4
2H.sub.2O 0.025 MS FeEDTA 100X Stock Na.sub.2EDTA 3.724 FeSO.sub.4
7H.sub.2O 2.784 B5 Vitamin Stock 10 g m-inositol 100 mg nicotinic
acid 100 mg pyridoxine HCl 1 g thiamine SB55 (per Liter, pH 5.7) 10
mL each MS stocks 1 mL B5 Vitamin stock 0.8 g NH.sub.4NO.sub.3
3.033 g KNO.sub.3 1 mL 2,4-D (10 mg/mL stock) 60 g sucrose 0.667 g
asparagine SBP6 same as SB55 except 0.5 mL 2,4-D SB103 (per Liter,
pH 5.7) 1X MS Salts 6% maltose 750 mg MgCl.sub.2 0.2% Gelrite
SB71-1 (per Liter, pH 5.7) 1X B5 salts 1 ml B5 vitamin stock 3%
sucrose 750 mg MgCl.sub.2 0.2% Gelrite
[0130] Soybean embryogenic suspension cultures were transformed
with pTC3 by the method of particle gun bombardment (Kline et al.
(1987) Nature 327:70). A DuPont Biolistic PDS1000/HE instrument
(helium retrofit) was used for these transformations.
[0131] To 50 ml of a 60 mg/ml 1 mm gold particle suspension was
added (in order); 5 .mu.l DNA (1 .mu.g/.mu.l), 20 .mu.l spermidine
(0.1 M), and 50 .mu.l CaCl.sub.2 (2.5 M). The particle preparation
was agitated for 3 min, spun in a microfuge for 10 sec and the
supernatant removed. The DNA-coated particles were then washed once
in 400 .mu.l 70% ethanol and are suspended in 40 .mu.l of anhydrous
ethanol. The DNA/particle suspension was sonicated three times for
1 sec each. Five .mu.l of the DNA-coated gold particles were then
loaded on each macro carrier disk.
[0132] Approximately 300-400 mg of a four week old suspension
culture was placed in an empty 60.times.15 mm petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue were
normally bombarded. Membrane rupture pressure was set at 1000 psi
and the chamber was evacuated to a vacuum of 28 inches of mercury.
The tissue was placed approximately 3.5 inches away from the
retaining screen and bombarded three times. Following bombardment,
the tissue was placed back into liquid and cultured as described
above.
[0133] Eleven days post bombardment, the liquid media was exchanged
with fresh SB55 containing 50 mg/ml hygromycin. The selective media
was refreshed weekly. Seven weeks post bombardment, green,
transformed tissue was observed growing from untransformed,
necrotic embryogenic clusters. Isolated green tissue was removed
and inoculated into individual flasks to generate new, clonally
propagated, transformed embryogenic suspension cultures. Thus each
new line was treated as independent transformation event. These
suspensions can then be maintained as suspensions of embryos
clustered in an immature developmental stage through subculture or
regenerated into whole plants by maturation and germination of
individual somatic embryos.
[0134] Independent lines of transformed embryogenic clusters are
removed from liquid culture and placed on a solid agar media
(SB103) containing no hormones or antibiotics. Embryos are cultured
for four weeks at 26.degree. C. with mixed fluorescent and
incandescent lights on a 16:8 h day/night schedule. During this
period, individual embryos are removed from the clusters and
screened for alterations in their fatty acid compositions (Example
8). Co-suppression of Fad2 results in a reduction of
polyunsaturated fatty acids and an increase in oleic acid content.
Co-suppression of the delta-9 desaturases of the instant invention
result in an increase in the accumulation of stearic acid (18:0
fatty acid).
Example 8
The Phenotype of Transgenic Soybean Somatic Embryos is Predictive
of Seed Phenotypes from Resultant Regenerated Plants
[0135] Mature somatic soybean embryos are a good model for zygotic
embryos. While in the globular embryo state in liquid culture,
somatic soybean embryos contain very low amounts of triacylglycerol
or storage proteins typical of maturing, zygotic soybean embryos.
At this developmental stage, the ratio of total triacylglyceride to
total polar lipid (phospholipids and glycolipid) is about 1:4, as
is typical of zygotic soybean embryos at the developmental stage
from which the somatic embryo culture was initiated. At the
globular stage as well, the mRNAs for the prominent seed proteins,
.alpha.' subunit of .beta.-conglycinin, kunitz trypsin inhibitor 3,
and seed lectin are essentially absent. Upon transfer to
hormone-free media to allow differentiation to the maturing somatic
embryo state, triacylglycerol becomes the most abundant lipid
class. As well, mRNAs for .alpha.'-subunit of .beta.-conglycinin,
kunitz trypsin inhibitor 3 and seed lectin become very abundant
messages in the total mRNA population. On this basis somatic
soybean embryo system behaves very similarly to maturing zygotic
soybean embryos in vivo, and is therefore a good and rapid model
system for analyzing the phenotypic effects of modifying the
expression of genes in the fatty acid biosynthesis pathway.
[0136] Most importantly, the model system is also predictive of the
fatty acid composition of seeds from plants derived from transgenic
embryos. This is illustrated with two different antisense
constructs in two different types of experiment that were
constructed following the protocols set forth in the PCT
Publication Nos. WO 93/11245 and WO 94/11516. Liquid culture
globular embryos were transformed with a chimeric gene comprising a
soybean microsomal .DELTA..sup.15 desaturase as described in PCT
Publication No. WO 93/11245 which was published on Jun. 10, 1993,
the disclosure of which is hereby incorporated by reference
(experiment 1,) or a soybean microsomal .DELTA..sup.12 desaturase
as described in PCT Publication No. WO 94/11516 which was published
on May 26, 1994, the disclosure of which is hereby incorporated by
reference (experiment 2). Both gene constructs were introduced in
antisense orientation under the control of a seed-specific promoter
(.beta.-conglycinin promoter) and gave rise to mature embryos. The
fatty acid content of mature somatic embryos from lines transformed
with vector only (control) and the vector containing the antisense
chimeric genes as well as of seeds of plants regenerated from them
was determined.
[0137] One set of embryos from each line was analyzed for fatty
acid content and another set of embryos from that same line was
regenerated into plants. Fatty acid analysis of single embryos was
determined either by direct trans-esterification of individual
seeds in 0.5 mL of methanolic H.sub.2SO.sub.4 (2.5%) or by hexane
extraction of bulk seed samples followed by trans-esterification of
an aliquot in 0.8 mL of 1% sodium methoxide in methanol. Fatty acid
methyl esters were extracted from the methanolic solutions into
hexane after the addition of an equal volume of water. In all
cases, if there was a reduced 18:3 content in a transgenic embryo
line when compared to an untransformed control, then a
corresponding reduction in 18:3 content was also observed in the
segregating seeds of the plant derived from that transformed line
(Table 7).
TABLE-US-00007 TABLE 7 Percent 18:3 Content Of Embryos and Seeds of
Control and .DELTA..sup.15 Antisense Construct Transgenic Soybean
Lines Embryo Average Seed Average Transformant Line (SD, n = 10)
(SD, n = 10) Control 12.1 (2.6) 8.9 (0.8) .DELTA..sup.15 antisense,
line 1 5.6 (1.2) 4.3 (1.6) .DELTA..sup.15 antisense, line 2 8.9
(2.2) 2.5 (1.8) .DELTA..sup.15 antisense, line 3 7.3 (1.1) 4.9
(1.9) .DELTA..sup.15 antisense, line 4 7.0 (1.9) 2.4 (1.7)
.DELTA..sup.15 antisense, line 5 8.5 (1.9) 4.5 (2.2) .DELTA..sup.15
antisense, line 6 7.6 (1.6) 4.6 (1.6) *[Seeds which were
segregating with wild-type phenotype and without a copy of the
transgene are not included in these averages]
[0138] In addition, different lines containing the same antisense
construct, were used for fatty acid analysis in somatic embryos and
for regeneration into plants. About 55% of the transformed embryo
lines showed an increased 18:1 content when compared with control
lines (Table 8). Soybean seeds, of plants regenerated from
different somatic embryo lines containing the same antisense
construct, had a similar frequency (53%) of high oleate
transformants as the somatic embryos (Table 8). On occasion, an
embryo line may be chimeric. That is, 10-70% of the embryos in a
line may not contain the transgene. The remaining embryos that do
contain the transgene, have been found in all cases to be clonal.
In such a case, plants with both wild type and transgenic
phenotypes may be regenerated from a single, transgenic line, even
if most of the embryos analyzed from that line had a transgenic
phenotype. An example of this is shown in Table 9, in which, of 5
plants regenerated from a single embryo line, 3 have a high oleic
phenotype and two were wild type. In most cases, all the plants
regenerated from a single transgenic line will have seeds
containing the transgene. Thus, it was concluded that an altered
fatty acid phenotype observed in a transgenic, mature somatic
embryo line is predictive of an altered fatty acid composition of
seeds of plants derived from that line.
TABLE-US-00008 TABLE 8 Oleate Levels in Somatic Embryos and Seeds
of Regenerated Soybeans Transformed With, or Without,
.DELTA..sup.12 Desaturase Antisense Construct # of # of Lines with
Average* Vector Lines High 18:1 %18:1 Somatic embryos: Control 19 0
12.0 .DELTA..sup.12 antisense 20 11 35.3 Seeds of regenerated
plants: Control 6 0 18.2 .DELTA..sup.12 antisense 17 9 44.4
*average 18:1 of transgenics is the average of all embryos or seeds
transformed with the .DELTA..sup.12 antisense construct in which at
least one embryo or seed from that line had an 18:1 content greater
than 2 standard deviations from the control value (12.0 in embryos,
18.2 in seeds). The control average is the average of embryos or
seeds which do not contain any transgenic DNA but have been treated
in an identical manner to the transgenics.
TABLE-US-00009 TABLE 9 Analysis of Seeds From Five Independent
Plants Segregating From Plant Line 4 Plant # Average seed 18:1%
Highest seed 18:1% 1 18.0 26.3 2 33.6 72.1 7 13.6 21.2 9 32.9 57.3
11 24.5 41.7
[0139] Mean of 15-20 seeds from 5 different plants regenerated from
a single embryo line. Only plants # 2, 9 and 11 have seeds with a
high 18:1 phenotype.
Example 9
Suppression in Soybean of Fad2 by ELVISLIVES Complementary
Region
[0140] Cosuppression of plant genes is covered in a U.S.
provisional patent application 60/213,961 filed on Jun. 23, 2000,
and nationally filed in the USPTO as application Ser. No.
09/887,194 on Jun. 22, 2001, the contents of which are hereby
incorporated by reference. Constructs have now been made which have
"synthetic complementary regions" (SCR). Since complementary
regions from Fad 2 can successfully suppress a thioesterase target,
and a Cer3 complementary region can suppress Fad2, it was deduced
that it may be possible to use any complementary sequence to reduce
the expression of a target. In this example the target sequence is
placed between complementary sequences that are not known to be
part of any biologically derived gene or genome (i.e. sequences
that are "synthetic" or conjured up from the mind of the inventor).
The target DNA would therefore be in the sense or antisense
orientation and the complementary RNA would be unrelated to any
known nucleic acid sequence. It is possible to design a standard
"suppression vector" into which pieces of any target gene for
suppression could be dropped. The plasmids pKS106, pKS124, and
pKS133 exemplify this. One skilled in the art will appreciate that
all of the plasmid vectors contain antibiotic selection genes such
as, but not limited to, hygromycin phosphotransferase with
promoters such as the T7 inducible promoter.
[0141] pKS106 uses the beta-conglycinin promoter while the pKS124
and 133 plasmids use the Kti promoter, both of these promoters
exhibit strong tissue specific expression in the seeds of soybean.
pKS106 uses a 3' termination region from the phaseolin gene, and
pKS124 and 133 use a Kti 3' termination region. pKS106 and 124 have
single copies of the 36 nucleotide Eagl-ELVISLIVES sequence
surrounding a NotI site (the amino acids given in parentheses are
back-translated from the complementary strand): SEQ ID NO:24.
TABLE-US-00010 EagI E L V I S L I V E S NotI CGGCCG GAG CTG GTC ATC
TCG CTC ATC GTC GAG TCG GCGGCCGC (S) (E) (V) (I) (L) (S) (I) (V)
(L) (E) EagI CGA CTC GAC GAT GAG CGA GAT GAC CAG CTC CGGCCG pKS 133
has 2X copies of ELVISLIVES surrounding the NotI site: SEQ ID NO:25
EagI E L V I S L I V E S EagI E L V I S
cggccggagctggtcatctcgctcatcgtcgagtcg gcggccg gagctggtcatctcg L I V
E S NotI (S)(E (V)(I)(L)(S)(I)(V)(L)(E) EagI ctcatcgtcgagtcg
gcggccgc cgactcgacgatgagcgagatgaccagctc cggccgc
(S)(E)(V)(I)(L)(S)(I)(V)(L)(E) EagI cgactcgacgatgagcgagatgaccagctc
cggccg
[0142] The idea is that the single EL linker (SCR) can be
duplicated to increase stem lengths in increments of approximately
40 nucleotides. A series of vectors will cover the SCR lengths
between 40 bp and the 300 bp. Various target gene lengths are also
under evaluation. It is believed that certain combinations of
target lengths and complementary region lengths will give optimum
suppression of the target, although preliminary results would
indicate that the suppression phenomenon works well over a wide
range of sizes and sequences. It is also believed that the lengths
and ratios providing optimum suppression may vary somewhat given
different target sequences and/or complementary regions.
[0143] The efficiency of Fad2 suppression using 1XEL (pKS132) was
compared to Fad2 suppression using the 2XEL (pKS136) construct.
Hygromycin resistant lines of soybean embryos were isolated from
independent transformation experiments with pKS132 and pKS136. Out
of 98 lines containing pKS132, 69% displayed the high oleic
phenotype. Out of 54 lines containing pKS136, 70% displayed the
high oleic acid phenotype. Thus, both 1X and 2XEL constructs
efficiently suppressed the Fad2 target gene.
Example 10
Suppression the Diverged Delta-9 Desaturase Results in High
Stearate Phenotypes
[0144] The two soybean delta-9 desaturase genes previously
identified, designated pDS 1 and 2 (U.S. Pat. Nos. 5,443,974 and
5,760,206) share a high degree of homology to other known delta-9
desaturase genes such as castor and safflower (U.S. Pat. No.
5,723,595). The genes of the present invention have less than 65%
amino acid sequence identity to these previously described plant
delta-9 desaturase polypeptides. All of the soybean delta-9
desaturase genes were placed into E. coli and shown to have delta-9
desaturase activity. To test if the three genes had comparable
activities in vivo, transgenic plants were constructed.
[0145] Delta-9 desaturase enzymes introduce a double bond into
stearic acid to form oleic acid. Inhibition of this activity should
result in an increase in stearic acid content and a correlative
reduction in unsaturated fatty acids in the oil. An antisense
construct of pDS1 (pKS6) was made using the entire coding region in
reverse orientation inserted into the SmaI/XbaI site of pCST2 (PCT
Publication No. WO 94/11516, published May 26, 1994) behind a
beta-conglycinin promoter. A cosuppression construct was made
(pRB1) where the HindIII fragment containing the beta-conglycinin
promoter and the phaseolin 3' terminator from pAW35 (U.S. Pat. No.
5,952,544) was inserted into the HindIII site of pML18 (PCT
Publication No. WO 94/11516, published May 26, 1994) to form pBS19.
The coding region of pDS1 was inserted into the Not I site of pBS19
to form pRB1. Finally, a cosuppression construct was made using
pDS3 (pBS68, SEQ ID NO:26) by placing approximately 950 basepairs
of pDS3 in the sense orientation between 2XEL complementary regions
as described in Example 9 (the pDS region of pBS68 is from
positions 6054-6611 linked to 1-411 of SEQ ID NO:26). The construct
has a Kti3 promoter (position 3260-5348 of SEQ ID NO:26), a Kti3
terminator (position 523-725 of SEQ ID NO:26), and hygromycin
selection (position 1920-880 of SEQ ID NO:26). Soybean
transformations were done as previously described (Example 7), and
soybean embryo tissue was assayed. As outlined in Example 8,
soybean embryo tissue is representative of seed tissues when seed
specific promoters such as beta-conglycinin or Kti3 are used.
[0146] The results shown in Table 10 demonstrate that pDS3 is as
good, or better, than pDS1 at increasing stearic acid content in
oils when cosuppressed in plant tissue. On average there is a
7.4-fold increase in 18:0 content with pDS3 (pBS68) versus 4.5 for
the cosuppressed pDS1. Antisense or cosuppression gave similar
results. The tranformants that showed the highest levels of stearic
acid are shown in the "best" columns.
TABLE-US-00011 TABLE 10 18:0 Content of Wild Type and Transgenic
High 18:0 Soybean Somatic Embryos wild high # of type 18:0 fold
best best fold high 18:0 (s.d.) (s.d.) increase 18:0 increase
events pKS6 3.6 (0.8) 16.7 (5.6) 4.6x 34.5 9.6x 40 pRB1 3.4 (0.5)
15.4 (3.7) 4.5x 20.6 6.1x 10 pBS68 2.5 (0.8) 18.6 (6.9) 7.4x 29.1
11.6x 10
[0147] These results confirm that the diverged delta-9 desaturase
sequences do encode functional enzymes. Furthermore, pDS3 may be
the dominant activity found in soybeans. The conserved sequence
elements KEIPDDYFWLVGDMITEEALPTYQTMLNT corresponding to positions
116-145 of SEQ ID NO:23; and DYADILEFLVGRWK corresponding to
positions 324-337 of SEQ ID NO:23 from the Thompson patent (U.S.
Pat. No. 5,723,595) that are claimed to be indicative of delta-9
desaturases are not conserved in the diverged sequences of the
instant invention. Therefore, the sequences of the instant
invention define a new functional class of plant delta-9 desaturase
genes.
Sequence CWU 1
1
2611560DNAGlycine max 1gaggcgttgg atctggcact cgttttgctg tggctgctct
ctgaaactga aagcgaagca 60gcagccactg aaaagcagaa aacaaaggga aagaacaagc
ttagccatgc tgagtattat 120attcaaggaa ttcgtcaagt acaatagaca
cgtaatcaaa accatgcaga tacgaacctg 180ccactccatc accacccaaa
cccttccaca acttccgtgt tcttctagaa aagcccacca 240ccgccacctt
cttccgccgt taaacgctgc ggtttccgcg gcgccgttca aagcccggaa
300ggcccactca atgcctccag aaaagaaaga aattttcaag tccttggagg
gatgggcctc 360ggagtgggtc ctaccgctgc tgaagcccgt ggagcaatgc
tggcagccac aaaacttcct 420ccctgacccc tcccttccgc atgaagagtt
cagccatcag gtgaaggagc ttcgcgaacg 480cactaaagag ttacctgatg
agtactttgt ggtgctggtg ggtgatatgg tcaccgagga 540cgcgcttccc
acttaccaga ccatgatcaa caaccttgat ggagtgaaag atgacagcgg
600cacgagcccg agcccgtggg ccgtgtggac ccgggcctgg accgccgagg
aaaacagaca 660cggggatctg ctcagaactt atttgtatct ctctgggagg
gttgacatgg ctaaggtcga 720aaagaccgta cattacctca tttcagctgg
catggaccct gggacagaca acaacccata 780tttggggttt gtgtacacgt
cattccaaga gcgagcaaca tttgtggcgc acgggaacac 840ggctcggctc
gcgaaggagg gcggggatcc agtgctggcg cgcctatgcg ggaccatcgc
900agcggacgag aagcggcacg agaacgcgta ctcaagaatc gtggagaagc
ttctggaagt 960ggaccccacc ggggcaatgg tggccatagg gaacatgatg
gagaagaaga tcacgatgcc 1020ggcgcacctt atgtacgatg gggatgaccc
caggctattc gagcactact ccgctgtggc 1080gcagcgcata ggcgtgtaca
ccgccaacga ctacgcagac atcttggagt ttctcgttga 1140acggtggaga
ttggagaagc ttgaaggatt gatggctgag gggaagcggg cgcaggattt
1200cgtgtgtggg ttggcgccga ggattaggag gttgcaagaa cgcgctgatg
agcgagcgcg 1260taagatgaag aagcatcatg gcgttaagtt cagttggatt
ttcaataaag aattgctttt 1320gtgaaatttc agttaagact taagagataa
gagatagagg tcaacgtgag tcaacaggtt 1380tttggctttg tgactatttt
gagtttttgt ttgtaggtgg catttttagt acgaataatg 1440aacaatttaa
catggattgc gtgtaatgga cattgttgga tccatggttg ttgttctggt
1500ggatacacaa ccagtaggac ttttttgttg taacgtttgg cttgcatatt
agcttagctt 15602405PRTGlycine max 2Met Leu Ser Ile Ile Phe Lys Glu
Phe Val Lys Tyr Asn Arg His Val1 5 10 15Ile Lys Thr Met Gln Ile Arg
Thr Cys His Ser Ile Thr Thr Gln Thr 20 25 30Leu Pro Gln Leu Pro Cys
Ser Ser Arg Lys Ala His His Arg His Leu 35 40 45Leu Pro Pro Leu Asn
Ala Ala Val Ser Ala Ala Pro Phe Lys Ala Arg 50 55 60Lys Ala His Ser
Met Pro Pro Glu Lys Lys Glu Ile Phe Lys Ser Leu65 70 75 80Glu Gly
Trp Ala Ser Glu Trp Val Leu Pro Leu Leu Lys Pro Val Glu 85 90 95Gln
Cys Trp Gln Pro Gln Asn Phe Leu Pro Asp Pro Ser Leu Pro His 100 105
110Glu Glu Phe Ser His Gln Val Lys Glu Leu Arg Glu Arg Thr Lys Glu
115 120 125Leu Pro Asp Glu Tyr Phe Val Val Leu Val Gly Asp Met Val
Thr Glu 130 135 140Asp Ala Leu Pro Thr Tyr Gln Thr Met Ile Asn Asn
Leu Asp Gly Val145 150 155 160Lys Asp Asp Ser Gly Thr Ser Pro Ser
Pro Trp Ala Val Trp Thr Arg 165 170 175Ala Trp Thr Ala Glu Glu Asn
Arg His Gly Asp Leu Leu Arg Thr Tyr 180 185 190Leu Tyr Leu Ser Gly
Arg Val Asp Met Ala Lys Val Glu Lys Thr Val 195 200 205His Tyr Leu
Ile Ser Ala Gly Met Asp Pro Gly Thr Asp Asn Asn Pro 210 215 220Tyr
Leu Gly Phe Val Tyr Thr Ser Phe Gln Glu Arg Ala Thr Phe Val225 230
235 240Ala His Gly Asn Thr Ala Arg Leu Ala Lys Glu Gly Gly Asp Pro
Val 245 250 255Leu Ala Arg Leu Cys Gly Thr Ile Ala Ala Asp Glu Lys
Arg His Glu 260 265 270Asn Ala Tyr Ser Arg Ile Val Glu Lys Leu Leu
Glu Val Asp Pro Thr 275 280 285Gly Ala Met Val Ala Ile Gly Asn Met
Met Glu Lys Lys Ile Thr Met 290 295 300Pro Ala His Leu Met Tyr Asp
Gly Asp Asp Pro Arg Leu Phe Glu His305 310 315 320Tyr Ser Ala Val
Ala Gln Arg Ile Gly Val Tyr Thr Ala Asn Asp Tyr 325 330 335Ala Asp
Ile Leu Glu Phe Leu Val Glu Arg Trp Arg Leu Glu Lys Leu 340 345
350Glu Gly Leu Met Ala Glu Gly Lys Arg Ala Gln Asp Phe Val Cys Gly
355 360 365Leu Ala Pro Arg Ile Arg Arg Leu Gln Glu Arg Ala Asp Glu
Arg Ala 370 375 380Arg Lys Met Lys Lys His His Gly Val Lys Phe Ser
Trp Ile Phe Asn385 390 395 400Lys Glu Leu Leu Leu 4053563DNAZea
maysunsure(308)n = a, c, g or t 3agcgaccaaa cccgggcacc tcgtctagct
cgccttccat ttcgtccctt cctattcata 60ctaccttcta cgagtttgag cagccatggc
ggcaacaaca ccactgcttg ctgtggctgg 120acatggagta tcctacaaac
cagcaaatgc taaagacagc tactactgct tcaaatttgc 180atcatcggca
agaacaagag tcaccctccc acagatcatc cactggaggt gcaggagcag
240tcatagcagc acggggacca cgaccatggc cgtccctgtc ctcaagcggc
gggagaagca 300ggacgaanag caggaatgga tggggtacct ggccccggag
aagctggagg tgctagcaca 360cctggagccg tgggcggagg cgcacgtgct
gccgctgctg aagcccgcgg aggagggtgg 420aaccgtcgga catctccgga
ccggcgcgct ggcgacangg ctcacaccgt gccgcaactc 480gcnccggggg
caantgccga cccactgggt gctggtggna natatacgag gaggctgcca
540gtcanagcgn ccaacgntca ggg 5634110PRTZea maysUNSURE(75)Xaa = any
amino acid 4Met Ala Ala Thr Thr Pro Leu Leu Ala Val Ala Gly His Gly
Val Ser1 5 10 15Tyr Lys Pro Ala Asn Ala Lys Asp Ser Tyr Tyr Cys Phe
Lys Phe Ala 20 25 30Ser Ser Ala Arg Thr Arg Val Thr Leu Pro Gln Ile
Ile His Trp Arg 35 40 45Cys Arg Ser Ser His Ser Ser Thr Gly Thr Thr
Thr Met Ala Val Pro 50 55 60Val Leu Lys Arg Arg Glu Lys Gln Asp Glu
Xaa Gln Glu Trp Met Gly65 70 75 80Tyr Leu Ala Pro Glu Lys Leu Glu
Val Leu Ala His Leu Glu Pro Trp 85 90 95Ala Glu Ala His Val Leu Pro
Leu Leu Lys Pro Ala Glu Glu 100 105 1105880DNAZea mays 5cgtcggcacg
agcggcacga gctcgtgccg cgtccactcc acagtcaccc accgccgcct 60cctccagcgt
ccggcccgta cgccgcgcag ccaacccagc gggcacgatg caggcccacg
120gcatcgccat ccgcgcccgc gggccggtgg cggcgacgca ggcccccgcg
cgccgacggc 180aatgccgcgt gtctgcggcg gcggtcggcg cgcccgccgc
gcgcgcccgc gtgacgcact 240cgatgccgcc ggagaaggcg gaggtgttcc
gctcgctgga gggctgggcg gcgcggtcgc 300tgctgccgct gctcaagccc
gtggaggagt gctggcagcc ggcggacttc ctcccggact 360cctcgtccga
gatgttcggg cacgaggtcc gcgagctgcg cgcccgcgcc gcggggctcc
420ccgacgagta cttcgtcgtg ctcgtgggcg acatggtcac ggaagaggcg
ctgcccacgt 480accagaccat gatcaacacg ctcgacggcg tccgcgacga
gaccggcgcc agcaactgcc 540cctgggcggt ctggacgcgc gcctggaccg
ccgaggagaa ccgccacggc gacatcctcg 600gcaagtacat gtacctatcc
ggccgcgtcg acatgcgcat ggtcgagaag accgtccagt 660acctcatcgg
ctccggcatg gatcccggaa cggagaacaa cccgtacctg ggcttcgtgt
720acacgagctt ccaggagcgc gcgacggccg tctcgcacgg caacaccgcg
cggctcccca 780gggcgcacgg ggacgacttc ttggcgcgcg cctgcgggac
caaccgccgc caacaagaaa 840cgaaacaaaa cgggttaagg ggcatcctcc
aagaagttgg 8806257PRTZea mays 6Met Gln Ala His Gly Ile Ala Ile Arg
Ala Arg Gly Pro Val Ala Ala1 5 10 15Thr Gln Ala Pro Ala Arg Arg Arg
Gln Cys Arg Val Ser Ala Ala Ala 20 25 30Val Gly Ala Pro Ala Ala Arg
Ala Arg Val Thr His Ser Met Pro Pro 35 40 45Glu Lys Ala Glu Val Phe
Arg Ser Leu Glu Gly Trp Ala Ala Arg Ser 50 55 60Leu Leu Pro Leu Leu
Lys Pro Val Glu Glu Cys Trp Gln Pro Ala Asp65 70 75 80Phe Leu Pro
Asp Ser Ser Ser Glu Met Phe Gly His Glu Val Arg Glu 85 90 95Leu Arg
Ala Arg Ala Ala Gly Leu Pro Asp Glu Tyr Phe Val Val Leu 100 105
110Val Gly Asp Met Val Thr Glu Glu Ala Leu Pro Thr Tyr Gln Thr Met
115 120 125Ile Asn Thr Leu Asp Gly Val Arg Asp Glu Thr Gly Ala Ser
Asn Cys 130 135 140Pro Trp Ala Val Trp Thr Arg Ala Trp Thr Ala Glu
Glu Asn Arg His145 150 155 160Gly Asp Ile Leu Gly Lys Tyr Met Tyr
Leu Ser Gly Arg Val Asp Met 165 170 175Arg Met Val Glu Lys Thr Val
Gln Tyr Leu Ile Gly Ser Gly Met Asp 180 185 190Pro Gly Thr Glu Asn
Asn Pro Tyr Leu Gly Phe Val Tyr Thr Ser Phe 195 200 205Gln Glu Arg
Ala Thr Ala Val Ser His Gly Asn Thr Ala Arg Leu Pro 210 215 220Arg
Ala His Gly Asp Asp Phe Leu Ala Arg Ala Cys Gly Thr Asn Arg225 230
235 240Arg Gln Gln Glu Thr Lys Gln Asn Gly Leu Arg Gly Ile Leu Gln
Glu 245 250 255Val7463DNAOryza sativaunsure(334)n = a, c, g or t
7gtacctctcc ggccgcttcg acatggccga ggtggagcgc gccgtgcacc gcctcatccg
60ctccggcatg gccgtcgacc cgccgtgcag cccgtaccac gccttcgtct acacggcgtt
120ccaggagcgc gccacggcgg tcgcccacgg caacacggcg cggctggtcg
gcgcgcgagg 180gcacggcgac gccgccctcg cccgcgtctg cggcaccgtc
gccgccgacg agaagcggca 240cgaggccgcc tacacccgca tcgtctccag
gctcctcgag gccgacccgg acgccggcgt 300gcgcgcggtg gcgcgcatgc
tacggcgagg ggtnccccaa tgccgaactn ggcccatnct 360ccgacggccg
ccgcgacgac ctctaacgcc tgcgtcggtg tcccctccgc cgaagcaggg
420ccgggacgta nagngnggtc ggantaactg gntcaatccg tcn 4638111PRTOryza
sativa 8Tyr Leu Ser Gly Arg Phe Asp Met Ala Glu Val Glu Arg Ala Val
His1 5 10 15Arg Leu Ile Arg Ser Gly Met Ala Val Asp Pro Pro Cys Ser
Pro Tyr 20 25 30His Ala Phe Val Tyr Thr Ala Phe Gln Glu Arg Ala Thr
Ala Val Ala 35 40 45His Gly Asn Thr Ala Arg Leu Val Gly Ala Arg Gly
His Gly Asp Ala 50 55 60Ala Leu Ala Arg Val Cys Gly Thr Val Ala Ala
Asp Glu Lys Arg His65 70 75 80Glu Ala Ala Tyr Thr Arg Ile Val Ser
Arg Leu Leu Glu Ala Asp Pro 85 90 95Asp Ala Gly Val Arg Ala Val Ala
Arg Met Leu Arg Arg Gly Val 100 105 11091483DNAZea mays 9gcacgagagc
gaccaaaccc gggcacctcg tctagctcgc cttccatttc gtcccttcct 60attcatacta
ccttctacga gtttgagcag ccatggcggc aacaacacca ctgcttgctg
120tggctggaca tggagtatcc tacaaaccag caaatgctaa agacagctac
tactgcttca 180aatttgcatc atcggcaaga acaagagtca ccctcccaca
gatcatccac tggaggtgca 240ggagcagtca tagcagcacg gggaccacga
ccatggccgt ccctgtcctc aagcggcggg 300agaagcagga cgaagagcag
gaatggatgg ggtacctggc cccggagaag ctggaggtgc 360tagcacacct
ggagccgtgg gcggaggcgc acgtgctgcc gctgctgaag cccgcggagg
420aggcgtggca gccgtcggac atgctcccgg acccggcggc gctgggcgac
gagggcttcc 480acgacgcgtg ccgcgagctc cgcgcgcggg cggccagcgt
gcccgacgcc cacctggtgt 540gcctggtggg caacatgatc actgaggagg
ccctgcccac gtaccagagc gtgcctaacc 600gcttcgaggc cgtgcgcgac
ctcaccggcg ccgactccac cgcctgggcg cgctggatcc 660gcggctggtc
cgccgaggag aaccgccacg gcgacgccct cagccactac atgtacctct
720cgggccgcgt cgacatgcgc caggtcgacc gcaccgtgca ccgcctcatc
gcctccggca 780tggccatgaa cgccgccagg agcccctacc acggcttcat
ctacgtcgct ttccaggagc 840gcgccaccgc catctcgcac ggcaacatgg
cgcggcacgt cggcgcgcac ggcgaccacg 900tgctcgcccg cgtatgcggc
gccatcatgg ccgacgagaa gcgccacgag accgcataca 960cccgcatcgt
cgccaagctc ttcgaggtcg acccggacgc ggccgtgcgc gcgctcggct
1020acatgatgcg ccaccggatc accatgccgg cagcgctcat gaccgacggc
cgcgacgccc 1080acctctacgc ccactacgcc gccgccgcgc agcagaccgg
cgtgtacact gcgtctgact 1140accgaagcat cctggagcac ctcatacggc
agtggcgcgt ggaggagctc gcggcggggc 1200tctccggcga ggggaggcgc
gcgcgggact acgtgtgcgg gctgccgcac aagatccgga 1260ggatggagga
gaaggcccat gacagggcgg cccagaccca gaaaaagccc acgtctgtcc
1320cgtttagctg gatcttcgat agatccgtca atgtcgtgat tccgtaattt
tcctcaaaaa 1380aaattgagaa tcaggttatg cttagaggtg cattcactgt
tgtgtggatt atccttgcaa 1440taaaaaaaca acgccttgcg ggtgaaaaaa
aaaaaaaaaa aaa 148310424PRTZea mays 10Met Ala Ala Thr Thr Pro Leu
Leu Ala Val Ala Gly His Gly Val Ser1 5 10 15Tyr Lys Pro Ala Asn Ala
Lys Asp Ser Tyr Tyr Cys Phe Lys Phe Ala 20 25 30Ser Ser Ala Arg Thr
Arg Val Thr Leu Pro Gln Ile Ile His Trp Arg 35 40 45Cys Arg Ser Ser
His Ser Ser Thr Gly Thr Thr Thr Met Ala Val Pro 50 55 60Val Leu Lys
Arg Arg Glu Lys Gln Asp Glu Glu Gln Glu Trp Met Gly65 70 75 80Tyr
Leu Ala Pro Glu Lys Leu Glu Val Leu Ala His Leu Glu Pro Trp 85 90
95Ala Glu Ala His Val Leu Pro Leu Leu Lys Pro Ala Glu Glu Ala Trp
100 105 110Gln Pro Ser Asp Met Leu Pro Asp Pro Ala Ala Leu Gly Asp
Glu Gly 115 120 125Phe His Asp Ala Cys Arg Glu Leu Arg Ala Arg Ala
Ala Ser Val Pro 130 135 140Asp Ala His Leu Val Cys Leu Val Gly Asn
Met Ile Thr Glu Glu Ala145 150 155 160Leu Pro Thr Tyr Gln Ser Val
Pro Asn Arg Phe Glu Ala Val Arg Asp 165 170 175Leu Thr Gly Ala Asp
Ser Thr Ala Trp Ala Arg Trp Ile Arg Gly Trp 180 185 190Ser Ala Glu
Glu Asn Arg His Gly Asp Ala Leu Ser His Tyr Met Tyr 195 200 205Leu
Ser Gly Arg Val Asp Met Arg Gln Val Asp Arg Thr Val His Arg 210 215
220Leu Ile Ala Ser Gly Met Ala Met Asn Ala Ala Arg Ser Pro Tyr
His225 230 235 240Gly Phe Ile Tyr Val Ala Phe Gln Glu Arg Ala Thr
Ala Ile Ser His 245 250 255Gly Asn Met Ala Arg His Val Gly Ala His
Gly Asp His Val Leu Ala 260 265 270Arg Val Cys Gly Ala Ile Met Ala
Asp Glu Lys Arg His Glu Thr Ala 275 280 285Tyr Thr Arg Ile Val Ala
Lys Leu Phe Glu Val Asp Pro Asp Ala Ala 290 295 300Val Arg Ala Leu
Gly Tyr Met Met Arg His Arg Ile Thr Met Pro Ala305 310 315 320Ala
Leu Met Thr Asp Gly Arg Asp Ala His Leu Tyr Ala His Tyr Ala 325 330
335Ala Ala Ala Gln Gln Thr Gly Val Tyr Thr Ala Ser Asp Tyr Arg Ser
340 345 350Ile Leu Glu His Leu Ile Arg Gln Trp Arg Val Glu Glu Leu
Ala Ala 355 360 365Gly Leu Ser Gly Glu Gly Arg Arg Ala Arg Asp Tyr
Val Cys Gly Leu 370 375 380Pro His Lys Ile Arg Arg Met Glu Glu Lys
Ala His Asp Arg Ala Ala385 390 395 400Gln Thr Gln Lys Lys Pro Thr
Ser Val Pro Phe Ser Trp Ile Phe Asp 405 410 415Arg Ser Val Asn Val
Val Ile Pro 420111415DNAZea mays 11gcacgagcgg cacgagcggc acgagctcgt
gccgcgtcca ctccacagtc acccaccgcc 60gcctcctcca gcgtccggcc cgtacgccgc
gcagccaacc cagcgggcac gatgcaggcc 120cacggcatcg ccatccgcgc
ccgcgggccg gtggcggcga cgcaggcccc cgcgcgccga 180cggcaatgcc
gcgtgtctgc ggcggcggtc ggcgcgcccg ccgcgcgcgc ccgcgtgacg
240cactcgatgc cgccggagaa ggcggaggtg ttccgctcgc tggagggctg
ggcggcgcgg 300tcgctgctgc ctctgctcaa gcccgtggag gagtgctggc
agccggcgga cttcctcccg 360gactcctcgt ccgagatgtt cgggcacgag
gtccgcgagc tgcgcgcccg cgccgcgggg 420ctccccgacg agtacttcgt
cgtgctcgtg ggcgacatgg tcacggaaga ggcgctgccc 480acgtaccaga
ccatgatcaa cacgctcgac ggcgtccgcg acgagaccgg cgccagcaac
540tgcccctggg cggtctggac gcgcgcctgg accgccgagg agaaccgcca
cggcgacatc 600ctcggcaagt acatgtacct atccggccgc gtcgacatgc
gcatggtcga gaagaccgtc 660cagtacctca tcggctccgg catggatccc
ggaacggaga acaacccgta cctgggcttc 720gtgtacacga gcttccagga
gcgcgcgacg gccgtctcgc acggcaacac cgcgcggctc 780gccagggcgc
acggggacga cgtcctggcg cgcgcctgcg gcaccatcgc cgccgacgag
840aagcggcacg agacggcgta cgggcgcatc gtcgagcagc tgctgcagct
ggacccggag 900ggcgccgtgc tcgccgtcgc ggacatgatg cgcaagcgga
tcaccatgcc cgcgcacctc 960atgcacgacg gccgcgacat ggacctgttc
gagcacttcg ccgccgtcgc ccagcgcctc 1020ggcgtgtaca ccgcccggga
ctacgcggac atcgtcgagt tccttgtcaa gcggtggaag 1080ctggagacac
tggagagcgg gctctccggc gagggccgca gggccaggga cttcgtctgc
1140gggctcgcgc cgaggatgcg ccgggccgcg gagcgcgccg aggacagggc
caagaaggac 1200gagcccagga tggtcaagtt cagctggatc tttgataggg
aagccgttgt ttaggcactt 1260gttgctaact gtgatatgtg ctcagatcat
gtcgctagct gtcagtgtct ttgtcacatt 1320gtgtttatgt gtttgaaatg
ccgtaagagt gtttttttcc tgctattatc acaaaattct 1380gcagaaatat
atgttctaaa aaaaaaaaaa aaaaa 141512380PRTZea mays 12Met Gln Ala His
Gly Ile Ala Ile Arg Ala Arg Gly Pro Val Ala Ala1 5 10 15Thr Gln Ala
Pro Ala Arg Arg Arg Gln Cys Arg Val Ser Ala Ala Ala 20 25 30Val Gly
Ala Pro Ala Ala Arg Ala Arg Val Thr His Ser Met Pro Pro 35 40 45Glu
Lys Ala Glu Val Phe Arg Ser Leu Glu Gly Trp Ala Ala Arg
Ser 50 55 60Leu Leu Pro Leu Leu Lys Pro Val Glu Glu Cys Trp Gln Pro
Ala Asp65 70 75 80Phe Leu Pro Asp Ser Ser Ser Glu Met Phe Gly His
Glu Val Arg Glu 85 90 95Leu Arg Ala Arg Ala Ala Gly Leu Pro Asp Glu
Tyr Phe Val Val Leu 100 105 110Val Gly Asp Met Val Thr Glu Glu Ala
Leu Pro Thr Tyr Gln Thr Met 115 120 125Ile Asn Thr Leu Asp Gly Val
Arg Asp Glu Thr Gly Ala Ser Asn Cys 130 135 140Pro Trp Ala Val Trp
Thr Arg Ala Trp Thr Ala Glu Glu Asn Arg His145 150 155 160Gly Asp
Ile Leu Gly Lys Tyr Met Tyr Leu Ser Gly Arg Val Asp Met 165 170
175Arg Met Val Glu Lys Thr Val Gln Tyr Leu Ile Gly Ser Gly Met Asp
180 185 190Pro Gly Thr Glu Asn Asn Pro Tyr Leu Gly Phe Val Tyr Thr
Ser Phe 195 200 205Gln Glu Arg Ala Thr Ala Val Ser His Gly Asn Thr
Ala Arg Leu Ala 210 215 220Arg Ala His Gly Asp Asp Val Leu Ala Arg
Ala Cys Gly Thr Ile Ala225 230 235 240Ala Asp Glu Lys Arg His Glu
Thr Ala Tyr Gly Arg Ile Val Glu Gln 245 250 255Leu Leu Gln Leu Asp
Pro Glu Gly Ala Val Leu Ala Val Ala Asp Met 260 265 270Met Arg Lys
Arg Ile Thr Met Pro Ala His Leu Met His Asp Gly Arg 275 280 285Asp
Met Asp Leu Phe Glu His Phe Ala Ala Val Ala Gln Arg Leu Gly 290 295
300Val Tyr Thr Ala Arg Asp Tyr Ala Asp Ile Val Glu Phe Leu Val
Lys305 310 315 320Arg Trp Lys Leu Glu Thr Leu Glu Ser Gly Leu Ser
Gly Glu Gly Arg 325 330 335Arg Ala Arg Asp Phe Val Cys Gly Leu Ala
Pro Arg Met Arg Arg Ala 340 345 350Ala Glu Arg Ala Glu Asp Arg Ala
Lys Lys Asp Glu Pro Arg Met Val 355 360 365Lys Phe Ser Trp Ile Phe
Asp Arg Glu Ala Val Val 370 375 38013773DNAOryza sativa
13gcaccaggta cctctccggc cgcttcgaca tggccgaggt ggagcgcgcc gtgcaccgcc
60tcatccgctc cggcatggcc gtcgacccgc cgtgcagccc gtaccacgcc ttcgtctaca
120cggcgttcca ggagcgcgcc acggcggtcg cccacggcaa cacggcgcgg
ctggtcggcg 180cgcgagggca cggcgacgcc gccctcgccc gcgtctgcgg
caccgtcgcc gccgacgaga 240agcggcacga ggccgcctac acccgcatcg
tctccaggct cctcgaggcc gacccggacg 300ccggcgtgcg cgcggtggcg
cgcatgctac ggcgaggggt cgccatgccg acctcgccca 360tctccgacgg
ccgccgcgac gacctctacg cctgcgtcgt gtccctcgcc gagcaggccg
420ggacgtacac ggtgtcggac tactgctcca tcgtcgagca cctggtgcgg
gagtggcgcg 480tggaggagct cgcggcgggg ctctccggcg aagggcggcg
cgcgcgggac tacgtgtgcg 540agctgccgca gaagatccgg aggatgaagg
agaaggccca tgagagggcg gtcaaggccc 600agaagaagcc catcagcatc
ccgattaatt ggatatttga taggcacgtc agtgtcatgc 660tgccctaatt
taattaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
720aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa
77314219PRTOryza sativa 14Tyr Leu Ser Gly Arg Phe Asp Met Ala Glu
Val Glu Arg Ala Val His1 5 10 15Arg Leu Ile Arg Ser Gly Met Ala Val
Asp Pro Pro Cys Ser Pro Tyr 20 25 30His Ala Phe Val Tyr Thr Ala Phe
Gln Glu Arg Ala Thr Ala Val Ala 35 40 45His Gly Asn Thr Ala Arg Leu
Val Gly Ala Arg Gly His Gly Asp Ala 50 55 60Ala Leu Ala Arg Val Cys
Gly Thr Val Ala Ala Asp Glu Lys Arg His65 70 75 80Glu Ala Ala Tyr
Thr Arg Ile Val Ser Arg Leu Leu Glu Ala Asp Pro 85 90 95Asp Ala Gly
Val Arg Ala Val Ala Arg Met Leu Arg Arg Gly Val Ala 100 105 110Met
Pro Thr Ser Pro Ile Ser Asp Gly Arg Arg Asp Asp Leu Tyr Ala 115 120
125Cys Val Val Ser Leu Ala Glu Gln Ala Gly Thr Tyr Thr Val Ser Asp
130 135 140Tyr Cys Ser Ile Val Glu His Leu Val Arg Glu Trp Arg Val
Glu Glu145 150 155 160Leu Ala Ala Gly Leu Ser Gly Glu Gly Arg Arg
Ala Arg Asp Tyr Val 165 170 175Cys Glu Leu Pro Gln Lys Ile Arg Arg
Met Lys Glu Lys Ala His Glu 180 185 190Arg Ala Val Lys Ala Gln Lys
Lys Pro Ile Ser Ile Pro Ile Asn Trp 195 200 205Ile Phe Asp Arg His
Val Ser Val Met Leu Pro 210 215151318DNAOryza sativa 15gcacgagaac
tagctactgt agttgactga cagtgatagt ggcagtcatg caggtcgtgg 60gaaccgtgcg
tgtcagtggc tgcggcgcgg tggtggcgcc ctcgcgccgg cagtgccgcg
120tgtccgcggc ggtgctgacg gccgcggaga cggcgacggc gacgcggcgc
cgcgtgacgc 180actcgatgcc gccggagaag gcggaggtgt tccggtcgct
ggaagggtgg gcgaggtcgt 240cgctgctgcc gctgctcaag cccgtggagg
agtgctggca gccgacggac ttcctgccgg 300actcgtcgtc ggagatgttc
gagcaccagg tccacgagct ccgcgcgcgc gccgcggggc 360tccccgacga
gtacttcgtc gtgctggtcg gggacatgat taccgaggag gcgctgccga
420cgtaccagac catgatcaac acgctcgacg gcgtccgcga cgagaccggc
gccagcgcct 480gcccctgggc cgtctggacg cgcacctgga ccgccgagga
gaaccgccac ggcgacatcc 540tcggcaagta catgtacctc tccggccgcg
tcgacatgcg catggtcgag aagaccgtcc 600agtacctcat cggctccggc
atggatccgg ggacggagaa caacccgtac ctggggttcg 660tgtacaccag
cttccaggag cgcgcgacgg ccgtgtcgca cgggaacacg gcgcgcctcg
720ccagggcgca cggggacgac gtcctggcgc gcacctgcgg caccatcgcc
gccgacgaga 780agcggcacga gacggcgtac gggcgcatcg tggagcagct
gctgcggctc gacccggacg 840gcgccatgct cgccatcgcc gacatgatgc
acaagcggat caccatgccc gcgcacctca 900tgcacgacgg ccgcgacatg
aacctgttcg accacttcgc cgccgtggcg cagcgcctca 960acgtctacac
cgcgcgcgac tacgccgaca tcgtcgagtt cctcgtcaag cggtggaagc
1020tggagaccct ggagactggg ctctccggcg agggccggag ggcccgggac
ttcgtgtgcg 1080ggctcgcgaa gaggatgcgg cgggccgcgg agcgggctga
ggacagggct aagaaggatg 1140agcagaggaa ggtcaagttc agctggatct
atgataggga agtgattgtc tagtttaact 1200tgtcttggtt gaattctgaa
ttcccagtcc tagatgatca tgccatttcg ttatcatctc 1260tgttcttgtg
ttctctttgc aatgcagtaa attggtaata aaaaaaaaaa aaaaaaaa
131816381PRTOryza sativa 16Met Gln Val Val Gly Thr Val Arg Val Ser
Gly Cys Gly Ala Val Val1 5 10 15Ala Pro Ser Arg Arg Gln Cys Arg Val
Ser Ala Ala Val Leu Thr Ala 20 25 30Ala Glu Thr Ala Thr Ala Thr Arg
Arg Arg Val Thr His Ser Met Pro 35 40 45Pro Glu Lys Ala Glu Val Phe
Arg Ser Leu Glu Gly Trp Ala Arg Ser 50 55 60Ser Leu Leu Pro Leu Leu
Lys Pro Val Glu Glu Cys Trp Gln Pro Thr65 70 75 80Asp Phe Leu Pro
Asp Ser Ser Ser Glu Met Phe Glu His Gln Val His 85 90 95Glu Leu Arg
Ala Arg Ala Ala Gly Leu Pro Asp Glu Tyr Phe Val Val 100 105 110Leu
Val Gly Asp Met Ile Thr Glu Glu Ala Leu Pro Thr Tyr Gln Thr 115 120
125Met Ile Asn Thr Leu Asp Gly Val Arg Asp Glu Thr Gly Ala Ser Ala
130 135 140Cys Pro Trp Ala Val Trp Thr Arg Thr Trp Thr Ala Glu Glu
Asn Arg145 150 155 160His Gly Asp Ile Leu Gly Lys Tyr Met Tyr Leu
Ser Gly Arg Val Asp 165 170 175Met Arg Met Val Glu Lys Thr Val Gln
Tyr Leu Ile Gly Ser Gly Met 180 185 190Asp Pro Gly Thr Glu Asn Asn
Pro Tyr Leu Gly Phe Val Tyr Thr Ser 195 200 205Phe Gln Glu Arg Ala
Thr Ala Val Ser His Gly Asn Thr Ala Arg Leu 210 215 220Ala Arg Ala
His Gly Asp Asp Val Leu Ala Arg Thr Cys Gly Thr Ile225 230 235
240Ala Ala Asp Glu Lys Arg His Glu Thr Ala Tyr Gly Arg Ile Val Glu
245 250 255Gln Leu Leu Arg Leu Asp Pro Asp Gly Ala Met Leu Ala Ile
Ala Asp 260 265 270Met Met His Lys Arg Ile Thr Met Pro Ala His Leu
Met His Asp Gly 275 280 285Arg Asp Met Asn Leu Phe Asp His Phe Ala
Ala Val Ala Gln Arg Leu 290 295 300Asn Val Tyr Thr Ala Arg Asp Tyr
Ala Asp Ile Val Glu Phe Leu Val305 310 315 320Lys Arg Trp Lys Leu
Glu Thr Leu Glu Thr Gly Leu Ser Gly Glu Gly 325 330 335Arg Arg Ala
Arg Asp Phe Val Cys Gly Leu Ala Lys Arg Met Arg Arg 340 345 350Ala
Ala Glu Arg Ala Glu Asp Arg Ala Lys Lys Asp Glu Gln Arg Lys 355 360
365Val Lys Phe Ser Trp Ile Tyr Asp Arg Glu Val Ile Val 370 375
38017384PRTLupinus luteus 17Met Gln Ile Gln Thr Cys Tyr Ser Ile Arg
Ile Gln Ile Leu Pro Leu1 5 10 15Pro Trp Ala Arg Arg Thr Gly Arg His
Lys Met Leu Pro Pro Ile Ala 20 25 30Ala Ile Ser Ala Thr Pro Pro Ser
Leu Lys Ser Pro Lys Thr His Ser 35 40 45Met Pro Pro Glu Lys Ile Glu
Ile Phe Lys Ser Leu Glu Ser Trp Ala 50 55 60Ser Gln Ser Val Leu Pro
Leu Leu Lys Pro Val Glu Gln Cys Trp Gln65 70 75 80Pro Gln Glu Phe
Val Pro Asp Ser Ser Leu Pro Phe Gly Asp Phe Thr 85 90 95Asp Gln Val
Lys Ala Leu Arg Asp Arg Thr Ala Glu Leu Pro Glu Glu 100 105 110Tyr
Phe Val Val Leu Val Gly Asp Met Ile Thr Glu Asp Ala Leu Pro 115 120
125Thr Tyr Gln Ser Met Ile Asn Asn Leu Asp Gly Val Arg Asp Glu Thr
130 135 140Gly Ser Ser Pro Ser Pro Trp Ala Leu Trp Thr Arg Ala Trp
Thr Ala145 150 155 160Glu Glu Lys Arg His Gly Asp Leu Leu Arg Thr
Tyr Leu Tyr Leu Ser 165 170 175Gly Arg Val Asp Met Lys Lys Ile Glu
Lys Thr Val Gln Tyr Leu Ile 180 185 190Gly Ser Gly Met Asp Pro Gly
Thr Glu Asn Asn Pro Tyr Leu Gly Phe 195 200 205Val Tyr Thr Ser Phe
Gln Glu Arg Ala Thr Phe Val Ser His Gly Asn 210 215 220Thr Ala Arg
Leu Ala Lys Glu Gly Gly Asp Pro Val Leu Ala Arg Ile225 230 235
240Cys Gly Thr Ile Ala Ala Asp Glu Lys Arg His Glu Asn Ala Tyr Ser
245 250 255Arg Ile Val Glu Lys Leu Leu Glu Leu Asp Pro Thr Gly Ala
Met Val 260 265 270Ala Ile Gly Asp Met Met Gln Lys Lys Ile Thr Met
Pro Ala His Leu 275 280 285Met Tyr Asp Gly Glu Asp Pro Lys Leu Phe
Asp His Phe Ser Ala Val 290 295 300Ala Gln Arg Met Gly Val Tyr Thr
Ala Asn Asp Tyr Ala Asp Ile Leu305 310 315 320Glu Phe Leu Ile Gly
Arg Trp Arg Leu Glu Lys Val Gln Asp Leu Lys 325 330 335Asp Glu Gly
Lys Lys Ala Gln Asp Phe Val Cys Gly Leu Ala Pro Arg 340 345 350Ile
Arg Arg Leu Gln Glu Arg Ala Asp Glu Arg Ala Arg Lys Met Lys 355 360
365Pro His Ala Val Lys Phe Ser Trp Ile Phe Asn Lys Glu Ile Ile Leu
370 375 38018396PRTCucumis sativus 18Met Ala Leu Lys Phe His Pro
Leu Thr Ser Gln Ser Pro Lys Leu Pro1 5 10 15Ser Phe Arg Met Pro Gln
Leu Ala Ser Leu Arg Ser Pro Lys Phe Val 20 25 30Met Ala Ser Thr Leu
Arg Ser Thr Ser Arg Glu Val Glu Thr Leu Lys 35 40 45Lys Pro Phe Met
Pro Pro Arg Glu Val His Leu Gln Val Thr His Ser 50 55 60Met Pro Pro
Gln Lys Met Glu Ile Phe Lys Ser Leu Glu Asp Trp Ala65 70 75 80Glu
Glu Asn Leu Leu Val His Leu Lys Pro Val Glu Arg Cys Trp Gln 85 90
95Pro Gln Asp Phe Leu Pro Asp Ser Ala Phe Glu Gly Phe His Glu Gln
100 105 110Val Arg Glu Leu Arg Glu Arg Ala Lys Glu Leu Pro Asp Glu
Tyr Phe 115 120 125Val Val Leu Val Gly Asp Met Ile Thr Glu Glu Ala
Leu Pro Thr Tyr 130 135 140Gln Thr Met Leu Asn Thr Leu Asp Gly Val
Arg Asp Glu Thr Gly Ala145 150 155 160Ser Pro Thr Pro Trp Ala Ile
Trp Thr Arg Ala Trp Thr Ala Glu Glu 165 170 175Asn Arg His Gly Asp
Leu Leu Asn Lys Tyr Leu Tyr Leu Ser Gly Arg 180 185 190Val Asp Met
Arg Gln Val Glu Lys Thr Ile Gln Tyr Leu Ile Gly Ser 195 200 205Gly
Met Asp Pro Arg Thr Glu Asn Asn Pro Tyr Leu Gly Phe Ile Tyr 210 215
220Thr Ser Phe Gln Glu Arg Ala Thr Phe Ile Ser His Gly Asn Thr
Ala225 230 235 240Arg Leu Ala Lys Glu His Gly Asp Ile Lys Leu Ala
Gln Ile Cys Gly 245 250 255Thr Ile Thr Ala Asp Glu Lys Arg His Glu
Thr Ala Tyr Thr Lys Ile 260 265 270Val Glu Lys Leu Phe Glu Ile Asp
Pro Glu Gly Thr Val Ile Ala Phe 275 280 285Glu Glu Met Met Arg Lys
Lys Val Ser Met Pro Ala His Leu Met Tyr 290 295 300Asp Gly Arg Asp
Asp Asn Leu Phe His His Phe Ser Ala Val Ala Gln305 310 315 320Arg
Leu Gly Val Tyr Thr Ala Lys Asp Tyr Ala Asp Ile Leu Glu Phe 325 330
335Leu Val Gly Arg Trp Lys Val Glu Ser Leu Thr Gly Leu Ser Gly Glu
340 345 350Gly Gln Lys Ala Gln Asp Tyr Val Cys Ala Leu Pro Ala Arg
Ile Arg 355 360 365Lys Leu Glu Glu Arg Ala Gln Gly Arg Ala Lys Glu
Gly Pro Thr Ile 370 375 380Pro Phe Ser Trp Ile Phe Asp Arg Gln Val
Lys Leu385 390 39519374PRTArabidopsis thaliana 19Met Pro Ser Pro
Ser Thr Phe Leu Ala Ser Arg Pro Arg Gly Pro Ala1 5 10 15Lys Ile Ser
Ala Val Ala Ala Pro Val Arg Pro Ala Leu Lys His Gln 20 25 30Asn Lys
Ile His Thr Met Pro Pro Glu Lys Met Glu Ile Phe Lys Ser 35 40 45Leu
Asp Gly Trp Ala Lys Asp Gln Ile Leu Pro Leu Leu Lys Pro Val 50 55
60Asp Gln Cys Trp Gln Pro Ala Ser Phe Leu Pro Asp Pro Ala Leu Pro65
70 75 80Phe Ser Glu Phe Thr Asp Gln Val Arg Glu Leu Arg Glu Arg Thr
Ala 85 90 95Ser Leu Pro Asp Glu Tyr Phe Val Val Leu Val Gly Asp Met
Ile Thr 100 105 110Glu Asp Ala Leu Pro Thr Tyr Gln Thr Met Ile Asn
Thr Leu Asp Gly 115 120 125Val Arg Asp Glu Thr Gly Ala Ser Glu Ser
Ala Trp Ala Ser Trp Thr 130 135 140Arg Ala Trp Thr Ala Glu Glu Asn
Arg His Gly Asp Leu Leu Arg Thr145 150 155 160Tyr Leu Tyr Leu Ser
Gly Arg Val Asp Met Leu Met Val Glu Arg Thr 165 170 175Val Gln His
Leu Ile Gly Ser Gly Met Asp Pro Gly Thr Glu Asn Asn 180 185 190Pro
Tyr Leu Gly Phe Val Tyr Thr Ser Phe Gln Glu Arg Ala Thr Phe 195 200
205Val Ser His Gly Asn Thr Ala Arg Leu Ala Lys Ser Ala Gly Asp Pro
210 215 220Val Leu Ala Arg Ile Cys Gly Thr Ile Ala Ala Asp Glu Lys
Arg His225 230 235 240Glu Asn Ala Tyr Val Arg Ile Val Glu Lys Leu
Leu Glu Ile Asp Pro 245 250 255Asn Gly Ala Val Ser Ala Val Ala Asp
Met Met Arg Lys Lys Ile Thr 260 265 270Met Pro Ala His Leu Met Thr
Asp Gly Arg Asp Pro Met Leu Phe Glu 275 280 285His Phe Ser Ala Val
Ala Gln Arg Leu Glu Val Tyr Thr Ala Asp Asp 290 295 300Tyr Ala Asp
Ile Leu Glu Phe Leu Val Gly Arg Trp Arg Leu Glu Lys305 310 315
320Leu Glu Gly Leu Thr Gly Glu Gly Gln Arg Ala Gln Glu Phe Val Cys
325 330 335Gly Leu Ala Gln Arg Ile Arg Arg Leu Gln Glu Arg Ala Asp
Glu Arg 340 345 350Ala Lys Lys Leu Lys Lys Thr His Glu Val Cys Phe
Ser Trp Ile Phe 355 360 365Asp Lys Gln Ile Ser Val
37020398PRTSimmondsia chinensis 20Met Ala Leu Lys Leu His His Thr
Ala Phe Asn Pro Ser Met Ala Val1 5 10 15Thr Ser Ser Gly Leu Pro Arg
Ser Tyr His Leu Arg Ser His Arg Val
20 25 30Phe Met Ala Ser Ser Thr Ile Gly Ile Thr Ser Lys Glu Ile Pro
Asn 35 40 45Ala Lys Lys Pro His Met Pro Pro Arg Glu Ala His Val Gln
Lys Thr 50 55 60His Ser Met Pro Pro Gln Lys Ile Glu Ile Phe Lys Ser
Leu Glu Gly65 70 75 80Trp Ala Glu Glu Asn Val Leu Val His Leu Lys
Pro Val Glu Lys Cys 85 90 95Trp Gln Pro Gln Asp Phe Leu Pro Asp Pro
Ala Ser Glu Gly Phe Met 100 105 110Asp Gln Val Lys Glu Leu Arg Glu
Arg Thr Lys Glu Ile Pro Asp Glu 115 120 125Tyr Leu Val Val Leu Val
Gly Asp Met Ile Thr Glu Glu Ala Leu Pro 130 135 140Thr Tyr Gln Thr
Met Leu Asn Thr Leu Asp Gly Val Arg Asp Glu Thr145 150 155 160Gly
Ala Ser Leu Thr Ser Trp Ala Ile Trp Thr Arg Ala Trp Thr Ala 165 170
175Glu Glu Asn Arg His Gly Asp Leu Leu Asn Lys Tyr Leu Tyr Leu Thr
180 185 190Gly Arg Val Asp Met Lys Gln Ile Glu Lys Thr Ile Gln Tyr
Leu Ile 195 200 205Gly Ser Gly Met Asp Pro Arg Ser Glu Asn Asn Pro
Tyr Leu Gly Phe 210 215 220Ile Tyr Thr Ser Phe Gln Glu Arg Ala Thr
Phe Ile Ser His Gly Asn225 230 235 240Thr Ala Arg Leu Ala Lys Asp
His Gly Asp Phe Gln Leu Ala Gln Val 245 250 255Cys Gly Ile Ile Ala
Ala Asp Glu Lys Arg His Glu Thr Ala Tyr Thr 260 265 270Lys Ile Val
Glu Lys Leu Phe Glu Ile Asp Pro Asp Gly Ala Val Leu 275 280 285Ala
Leu Ala Asp Met Met Arg Lys Lys Val Ser Met Pro Ala His Leu 290 295
300Met Tyr Asp Gly Lys Asp Asp Asn Leu Phe Glu Asn Tyr Ser Ala
Val305 310 315 320Ala Gln Gln Ile Gly Val Tyr Thr Ala Lys Asp Tyr
Ala Asp Ile Leu 325 330 335Glu His Leu Val Asn Arg Trp Lys Val Glu
Asn Leu Met Gly Leu Ser 340 345 350Gly Glu Gly His Lys Ala Gln Asp
Phe Val Cys Gly Leu Ala Pro Arg 355 360 365Ile Arg Lys Leu Gly Glu
Arg Ala Gln Ser Leu Ser Lys Pro Val Ser 370 375 380Leu Val Pro Phe
Ser Trp Ile Phe Asn Lys Glu Leu Lys Val385 390
39521411PRTArabidopsis thaliana 21Met Ala Leu Leu Leu Asn Ser Thr
Ile Thr Val Ala Met Lys Gln Asn1 5 10 15Pro Leu Val Ala Val Ser Phe
Pro Arg Thr Thr Cys Leu Gly Ser Ser 20 25 30Phe Ser Pro Pro Arg Leu
Leu Arg Val Ser Cys Val Ala Thr Asn Pro 35 40 45Ser Lys Thr Ser Glu
Glu Thr Asp Lys Lys Lys Phe Arg Pro Ile Lys 50 55 60Glu Val Pro Asn
Gln Val Thr His Thr Ile Thr Gln Glu Lys Leu Glu65 70 75 80Ile Phe
Lys Ser Met Glu Asn Trp Ala Gln Glu Asn Leu Leu Ser Tyr 85 90 95Leu
Lys Pro Val Glu Ala Ser Trp Gln Pro Gln Asp Phe Leu Pro Glu 100 105
110Thr Asn Asp Glu Asp Arg Phe Tyr Glu Gln Val Lys Glu Leu Arg Asp
115 120 125Arg Thr Lys Glu Ile Pro Asp Asp Tyr Phe Val Val Leu Val
Gly Asp 130 135 140Met Ile Thr Glu Glu Ala Leu Pro Thr Tyr Gln Thr
Thr Leu Asn Thr145 150 155 160Leu Asp Gly Val Lys Asp Glu Thr Gly
Gly Ser Leu Thr Pro Trp Ala 165 170 175Val Trp Val Arg Ala Trp Thr
Ala Glu Glu Asn Arg His Gly Asp Leu 180 185 190Leu Asn Lys Tyr Leu
Tyr Leu Ser Gly Arg Val Asp Met Arg His Val 195 200 205Glu Lys Thr
Ile Gln Tyr Leu Ile Gly Ser Gly Met Asp Ser Lys Phe 210 215 220Glu
Asn Asn Pro Tyr Asn Gly Phe Ile Tyr Thr Ser Phe Gln Glu Arg225 230
235 240Ala Thr Phe Ile Ser His Gly Asn Thr Ala Lys Leu Ala Thr Thr
Tyr 245 250 255Gly Asp Thr Thr Leu Ala Lys Ile Cys Gly Thr Ile Ala
Ala Asp Glu 260 265 270Lys Arg His Glu Thr Ala Tyr Thr Arg Ile Val
Glu Lys Leu Phe Glu 275 280 285Ile Asp Pro Asp Gly Thr Val Gln Ala
Leu Ala Ser Met Met Arg Lys 290 295 300Arg Ile Thr Met Pro Ala His
Leu Met His Asp Gly Arg Asp Asp Asp305 310 315 320Leu Phe Asp His
Tyr Ala Ala Val Ala Gln Arg Ile Gly Val Tyr Thr 325 330 335Ala Thr
Asp Tyr Ala Gly Ile Leu Glu Phe Leu Leu Arg Arg Trp Glu 340 345
350Val Glu Lys Leu Gly Met Gly Leu Ser Gly Glu Gly Arg Arg Ala Gln
355 360 365Asp Tyr Leu Cys Thr Leu Pro Gln Arg Ile Arg Arg Leu Glu
Glu Arg 370 375 380Ala Asn Asp Arg Val Lys Leu Ala Ser Lys Ser Lys
Pro Ser Val Ser385 390 395 400Phe Ser Trp Ile Tyr Gly Arg Glu Val
Glu Leu 405 41022396PRTLinum usitatissimum 22Met Ala Leu Lys Leu
Asn Pro Val Thr Thr Phe Pro Ser Thr Arg Ser1 5 10 15Leu Asn Asn Phe
Ser Ser Arg Ser Pro Arg Thr Phe Leu Met Ala Ala 20 25 30Ser Thr Phe
Asn Ser Thr Ser Thr Lys Glu Ala Glu Lys Leu Lys Lys 35 40 45Ser His
Gly Pro Pro Lys Glu Val His Met Gln Val Thr His Ser Met 50 55 60Pro
Pro Gln Lys Leu Glu Ile Phe Lys Ser Leu Glu Gly Trp Ala Glu65 70 75
80Asp Val Leu Leu Pro His Leu Lys Pro Val Glu Lys Cys Trp Gln Pro
85 90 95Gln Asp Phe Leu Pro Glu Pro Glu Ser Asp Gly Phe Glu Glu Gln
Val 100 105 110Lys Glu Leu Arg Ala Arg Ala Lys Glu Leu Pro Asp Asp
Tyr Phe Val 115 120 125Val Leu Val Gly Asp Met Ile Thr Glu Glu Ala
Leu Pro Thr Tyr Gln 130 135 140Thr Met Leu Asn Thr Leu Asp Gly Val
Arg Asp Glu Thr Gly Ala Ser145 150 155 160Leu Thr Pro Trp Ala Ile
Trp Thr Arg Ala Trp Thr Ala Glu Glu Asn 165 170 175Arg His Gly Asp
Leu Leu Asn Lys Tyr Leu Tyr Leu Ser Gly Arg Val 180 185 190Asp Met
Arg Gln Ile Glu Lys Thr Ile Gln Tyr Leu Ile Gly Ser Gly 195 200
205Met Asp Pro Lys Thr Glu Asn Asn Pro Tyr Leu Gly Phe Ile Tyr Thr
210 215 220Ser Phe Gln Glu Arg Ala Thr Phe Ile Ser His Gly Asn Thr
Ala Arg225 230 235 240Leu Ala Lys Asp His Gly Asp Met Lys Leu Ala
Gln Ile Cys Gly Ile 245 250 255Ile Ala Ala Asp Glu Lys Arg His Glu
Thr Ala Tyr Thr Lys Ile Val 260 265 270Glu Lys Leu Phe Glu Ile Asp
Pro Asp Gly Thr Val Leu Ala Leu Ala 275 280 285Asp Met Met Arg Lys
Lys Ile Ser Met Pro Ala His Leu Met Tyr Asp 290 295 300Gly Glu Asp
Asp Asn Leu Phe Asp Asn Tyr Ser Ser Val Ala Gln Arg305 310 315
320Ile Gly Val Tyr Thr Ala Lys Asp Tyr Ala Asp Ile Leu Glu Phe Leu
325 330 335Val Gly Arg Trp Lys Val Asp Ala Phe Thr Gly Leu Ser Gly
Glu Gly 340 345 350Asn Lys Ala Gln Asp Phe Val Cys Gly Leu Pro Ala
Arg Ile Arg Lys 355 360 365Leu Glu Glu Arg Ala Ala Gly Arg Ala Lys
Gln Thr Ser Lys Ser Val 370 375 380Pro Phe Ser Trp Ile Phe Ser Arg
Glu Leu Val Leu385 390 39523391PRTGlycine max 23Met Ala Leu Arg Leu
Asn Pro Ile Pro Thr Gln Thr Phe Ser Leu Pro1 5 10 15Gln Met Pro Ser
Leu Arg Ser Pro Arg Phe Arg Met Ala Ser Thr Leu 20 25 30Arg Ser Gly
Ser Lys Glu Val Glu Asn Ile Lys Lys Pro Phe Thr Pro 35 40 45Pro Arg
Glu Val His Val Gln Val Thr His Ser Met Pro Pro Gln Lys 50 55 60Ile
Glu Ile Phe Lys Ser Leu Glu Asp Trp Ala Asp Gln Asn Ile Leu65 70 75
80Thr His Leu Lys Pro Val Glu Lys Cys Trp Gln Pro Gln Asp Phe Leu
85 90 95Pro Asp Pro Ser Ser Asp Gly Phe Glu Glu Gln Val Lys Glu Leu
Arg 100 105 110Glu Arg Ala Lys Glu Ile Pro Asp Asp Tyr Phe Val Val
Leu Val Gly 115 120 125Asp Met Ile Thr Glu Glu Ala Leu Pro Thr Tyr
Gln Thr Met Leu Asn 130 135 140Thr Leu Asp Gly Val Arg Asp Glu Thr
Gly Ala Ser Leu Thr Ser Trp145 150 155 160Ala Ile Trp Thr Arg Ala
Trp Thr Ala Glu Glu Asn Arg His Gly Asp 165 170 175Leu Leu Asn Lys
Tyr Leu Tyr Leu Ser Gly Arg Val Asp Met Lys Gln 180 185 190Ile Glu
Lys Thr Ile Gln Tyr Leu Ile Gly Ser Gly Met Asp Pro Arg 195 200
205Thr Glu Asn Ser Pro Tyr Leu Gly Phe Ile Tyr Thr Ser Phe Gln Glu
210 215 220Arg Ala Thr Phe Ile Ser His Gly Asn Thr Ala Arg Leu Ala
Lys Glu225 230 235 240His Gly Asp Ile Lys Leu Ala Gln Ile Cys Gly
Met Ile Ala Ser Asp 245 250 255Glu Lys Arg His Glu Thr Ala Tyr Thr
Lys Ile Val Glu Lys Leu Phe 260 265 270Glu Val Asp Pro Asp Gly Thr
Val Met Ala Phe Ala Asp Met Met Arg 275 280 285Lys Lys Ile Ala Met
Pro Ala His Leu Met Tyr Asp Gly Arg Asp Asp 290 295 300Asn Leu Phe
Asp Asn Tyr Ser Ala Val Ala Gln Arg Ile Gly Val Tyr305 310 315
320Thr Ala Lys Asp Tyr Ala Asp Ile Leu Glu Phe Leu Val Gly Arg Trp
325 330 335Lys Val Glu Gln Leu Thr Gly Leu Ser Gly Glu Gly Arg Lys
Ala Gln 340 345 350Glu Tyr Val Cys Gly Leu Pro Pro Arg Ile Arg Arg
Leu Glu Glu Arg 355 360 365Ala Gln Ala Arg Gly Lys Glu Ser Ser Thr
Leu Lys Phe Ser Trp Ile 370 375 380His Asp Arg Glu Val Leu Leu385
3902480DNAArtificial SequenceDescription of Artificial Sequence
ELVISLIVES complementary region of pKS106 and pKS124 24cggccggagc
tggtcatctc gctcatcgtc gagtcggcgg ccgccgactc gacgatgagc 60gagatgacca
gctccggccg 8025154DNAArtificial SequenceDescription of Artificial
Sequence ELVISLIVES complementary region of pKS133 25cggccggagc
tggtcatctc gctcatcgtc gagtcggcgg ccggagctgg tcatctcgct 60catcgtcgag
tcggcggccg ccgactcgac gatgagcgag atgaccagct ccggccgccg
120actcgacgat gagcgagatg accagctccg gccg 154266611DNAPlasmid
pBS68Unsure(4436)..(4436)n = A, C, G, or T 26cgcgcctatg cgggaccatc
gcagcggacg agaagcggca cgagaacgcg tactcaagaa 60tcgtggagaa gcttctggaa
gtggacccca ccggggcaat ggtggccata gggaacatga 120tggagaagaa
gatcacgatg ccggcgcacc ttatgtacga tggggatgac cccaggctat
180tcgagcacta ctccgctgtg gcgcagcgca taggcgtgta caccgccaac
gactacgcag 240acatcttgga tttctcgttg acggtgaaga ttggagaagc
ttgaaggatt gatgcctgag 300gggaagcggg ccccaggatt tccgtgtgtg
ggttgccccc gaggattagg aggttccaag 360aacgcgctga tgagcgagcg
cgtaagatga agaagcatca tgccgttaag ttcagttgga 420ttttcaataa
agaattgctt ttgtgagcgg ccgccgactc gacgatgagc gagatgacca
480gctccggccg ccgactcgac gatgagcgag atgaccagct ccggccgcga
cacaagtgtg 540agagtactaa ataaatgctt tggttgtacg aaatcattac
actaaataaa ataatcaaag 600cttatatatg ccttccgcta aggccgaatg
caaagaaatt ggttctttct cgttatcttt 660tgccactttt actagtacgt
attaattact acttaatcat ctttgtttac ggctcattat 720atccgtcgac
ggcgcgcccg atcatccgga tatagttcct cctttcagca aaaaacccct
780caagacccgt ttagaggccc caaggggtta tgctagttat tgctcagcgg
tggcagcagc 840caactcagct tcctttcggg ctttgttagc agccggatcg
atccaagctg tacctcacta 900ttcctttgcc ctcggacgag tgctggggcg
tcggtttcca ctatcggcga gtacttctac 960acagccatcg gtccagacgg
ccgcgcttct gcgggcgatt tgtgtacgcc cgacagtccc 1020ggctccggat
cggacgattg cgtcgcatcg accctgcgcc caagctgcat catcgaaatt
1080gccgtcaacc aagctctgat agagttggtc aagaccaatg cggagcatat
acgcccggag 1140ccgcggcgat cctgcaagct ccggatgcct ccgctcgaag
tagcgcgtct gctgctccat 1200acaagccaac cacggcctcc agaagaagat
gttggcgacc tcgtattggg aatccccgaa 1260catcgcctcg ctccagtcaa
tgaccgctgt tatgcggcca ttgtccgtca ggacattgtt 1320ggagccgaaa
tccgcgtgca cgaggtgccg gacttcgggg cagtcctcgg cccaaagcat
1380cagctcatcg agagcctgcg cgacggacgc actgacggtg tcgtccatca
cagtttgcca 1440gtgatacaca tggggatcag caatcgcgca tatgaaatca
cgccatgtag tgtattgacc 1500gattccttgc ggtccgaatg ggccgaaccc
gctcgtctgg ctaagatcgg ccgcagcgat 1560cgcatccata gcctccgcga
ccggctgcag aacagcgggc agttcggttt caggcaggtc 1620ttgcaacgtg
acaccctgtg cacggcggga gatgcaatag gtcaggctct cgctgaattc
1680cccaatgtca agcacttccg gaatcgggag cgcggccgat gcaaagtgcc
gataaacata 1740acgatctttg tagaaaccat cggcgcagct atttacccgc
aggacatatc cacgccctcc 1800tacatcgaag ctgaaagcac gagattcttc
gccctccgag agctgcatca ggtcggagac 1860gctgtcgaac ttttcgatca
gaaacttctc gacagacgtc gcggtgagtt caggcttttc 1920catgggtata
tctccttctt aaagttaaac aaaattattt ctagagggaa accgttgtgg
1980tctccctata gtgagtcgta ttaatttcgc gggatcgaga tctgatcaac
ctgcattaat 2040gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg
gcgctcttcc gcttcctcgc 2100tcactgactc gctgcgctcg gtcgttcggc
tgcggcgagc ggtatcagct cactcaaagg 2160cggtaatacg gttatccaca
gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 2220gccagcaaaa
ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
2280gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga
aacccgacag 2340gactataaag ataccaggcg tttccccctg gaagctccct
cgtgcgctct cctgttccga 2400ccctgccgct taccggatac ctgtccgcct
ttctcccttc gggaagcgtg gcgctttctc 2460aatgctcacg ctgtaggtat
ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 2520tgcacgaacc
ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt
2580ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac
aggattagca 2640gagcgaggta tgtaggcggt gctacagagt tcttgaagtg
gtggcctaac tacggctaca 2700ctagaaggac agtatttggt atctgcgctc
tgctgaagcc agttaccttc ggaaaaagag 2760ttggtagctc ttgatccggc
aaacaaacca ccgctggtag cggtggtttt tttgtttgca 2820agcagcagat
tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
2880ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg
acattaacct 2940ataaaaatag gcgtatcacg aggccctttc gtctcgcgcg
tttcggtgat gacggtgaaa 3000acctctgaca catgcagctc ccggagacgg
tcacagcttg tctgtaagcg gatgccggga 3060gcagacaagc ccgtcagggc
gcgtcagcgg gtgttggcgg gtgtcggggc tggcttaact 3120atgcggcatc
agagcagatt gtactgagag tgcaccatat ggacatattg tcgttagaac
3180gcggctacaa ttaatacata accttatgta tcatacacat acgatttagg
tgacactata 3240gaacggcgcg ccaagcttgg atcctcgaag agaagggtta
ataacacatt ttttaacatt 3300tttaacacaa attttagtta tttaaaaatt
tattaaaaaa tttaaaataa gaagaggaac 3360tctttaaata aatctaactt
acaaaattta tgatttttaa taagttttca ccaataaaaa 3420atgtcataaa
aatatgttaa aaagtatatt atcaatattc tctttatgat aaataaaaag
3480aaaaaaaaaa taaaagttaa gtgaaaatga gattgaagtg actttaggtg
tgtataaata 3540tatcaacccc gccaacaatt tatttaatcc aaatatattg
aagtatatta ttccatagcc 3600tttatttatt tatatattta ttatataaaa
gctttatttg ttctaggttg ttcatgaaat 3660atttttttgg ttttatctcc
gttgtaagaa aatcatgtgc tttgtgtcgc cactcactat 3720tgcagctttt
tcatgcattg gtcagattga cggttgattg tatttttgtt ttttatggtt
3780ttgtgttatg acttaagtct tcatctcttt atctcttcat caggtttgat
ggttacctaa 3840tatggtccat gggtacatgc atggttaaat taggtggcca
actttgttgt gaacgataga 3900atttttttta tattaagtaa actattttta
tattatgaaa taataataaa aaaaatattt 3960tatcattatt aacaaaatca
tattagttaa tttgttaact ctataataaa agaaatactg 4020taacattcac
attacatggt aacatctttc caccctttca tttgtttttt gtttgatgac
4080tttttttctt gtttaaattt atttcccttc ttttaaattt ggaatacatt
atcatcatat 4140ataaactaaa atactaaaaa caggattaca caaatgataa
ataataacac aaatatttat 4200aaatctagct gcaatatatt taaactagct
atatcgatat tgtaaaataa aactagctgc 4260attgatactg ataaaaaaat
atcatgtgct ttctggactg atgatgcagt atacttttga 4320cattgccttt
attttatttt tcagaaaagc tttcttagtt ctgggttctt cattatttgt
4380ttcccatctc cattgtgaat tgaatcattt gcttcgtgtc acaaatacaa
tttagntagg 4440tacatgcatt ggtcagattc acggtttatt atgtcatgac
ttaagttcat ggtagtacat 4500tacctgccac gcatgcatta tattggttag
atttgatagg caaatttggt tgtcaacaat 4560ataaatataa ataatgtttt
tatattacga aataacagtg atcaaaacaa acagttttat 4620ctttattaac
aagattttgt ttttgtttga tgacgttttt taatgtttac gctttccccc
4680ttcttttgaa tttagaacac tttatcatca taaaatcaaa tactaaaaaa
attacatatt 4740tcataaataa taacacaaat atttttaaaa aatctgaaat
aataatgaac aatattacat 4800attatcacga aaattcatta ataaaaatat
tatataaata aaatgtaata gtagttatat 4860gtaggaaaaa agtactgcac
gcataatata tacaaaaaga ttaaaatgaa ctattataaa 4920taataacact
aaattaatgg tgaatcatat caaaataatg aaaaagtaaa taaaatttgt
4980aattaacttc tatatgtatt acacacacaa ataataaata atagtaaaaa
aaattatgat 5040aaatatttac catctcataa gatatttaaa ataatgataa
aaatatagat tattttttat 5100gcaactagct agccaaaaag agaacacggg
tatatataaa aagagtacct ttaaattcta 5160ctgtacttcc tttattcctg
acgtttttat atcaagtgga catacgtgaa gattttaatt 5220atcagtctaa
atatttcatt agcacttaat acttttctgt tttattccta tcctataagt
5280agtcccgatt ctcccaacat tgcttattca cacaactaac taagaaagtc
ttccatagcc 5340ccccaagcgg ccggagctgg tcatctcgct catcgtcgag
tcggcggccg gagctggtca 5400tctcgctcat cgtcgagtcg gcggccgctg
agtgattgct cacgagtgtg gtcaccatgc 5460cttcagcaag taccaatggg
ttgatgatgt tgtgggtttg acccttcact caacactttt 5520agtcccttat
ttctcatgga aaataagcca tcgccgccat cactccaaca caggttccct
5580tgaccgtgat gaagtgtttg tcccaaaacc aaaatccaaa gttgcatggt
tttccaagta 5640cttaaacaac cctctaggaa gggctgtttc tcttctcgtc
acactcacaa tagggtggcc 5700tatgtattta gccttcaatg tctctggtag
accctatgat agttttgcaa gccactacca 5760cccttatgct cccatatatt
ctaaccgtga gaggcttctg atctatgtct ctgatgttgc 5820tttgttttct
gtgacttact ctctctaccg tgttgcaacc ctgaaagggt tggtttggct
5880gctatgtgtt tatggggtgc ctttgctcat tgtgaacggt tttcttgtga
ctatcacata 5940tttgcagcac acacactttg ccttgcctca ttacgattca
tcagaatggg actggctgaa 6000gggagctttg gcaactatgg acagagatta
agcggccgca tgcctccaga aaagaaagaa 6060attttcaagt ccttggaggg
atgggcctcg gagtgggtcc taccgctgct gaagcccgtg 6120gagcaatgct
ggcagccaca aaacttcctc cctgacccct cccttccgca tgaagagttc
6180agccatcagg tgaaggagct tcgcgaacgc actaaagagt tacctgatga
gtactttgtg 6240gtgctggtgg gtgatatggt caccgaggac gcgcttccca
cttaccagac catgatcaac 6300aaccttgatg gagtgaaaga tgacagcggc
acgagcccga gcccgtgggc cgtgtggacc 6360cgggcctgga ccgccgagga
aaacagacac ggggatctgc tcagaactta tttgtatctc 6420tctgggaggg
ttgacatggc taaggtcgaa aagaccgtac attacctcat ttcagctggc
6480atggaccctg ggacagacaa caacccatat ttggggtttg tgtacacgtc
attccaagag 6540cgagcaacat ttgtggcgca cgggaacacg gctcggctcg
cgaaggaggg cggggatcca 6600gtgctggcgc g 6611
* * * * *
References