U.S. patent application number 12/337322 was filed with the patent office on 2009-07-30 for organic compounds.
Invention is credited to Christophe Barthe, Pascale Cony-Makhoul, Amie Corbin, Sven De Vos, Brian Jay Druker, Harald Gschaidmeier, Michael Hallek, Andreas Hochhaus, Dieter Hoelzer, Wolf-Karsten Hofmann, Phillip Koeffler, Sebastian Kreil, Francois-Xavier Mahon, Martin Muller, Oliver Gerhard Ottmann, Markus Warmuth.
Application Number | 20090191606 12/337322 |
Document ID | / |
Family ID | 29552935 |
Filed Date | 2009-07-30 |
United States Patent
Application |
20090191606 |
Kind Code |
A1 |
Barthe; Christophe ; et
al. |
July 30, 2009 |
ORGANIC COMPOUNDS
Abstract
The present invention relates to isolated polypeptides which
comprise an amino acid sequence consisting of a mutated functional
Abl kinase domain, said mutated functional kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1 -ylmethyl)-benzamide or a salt thereof, to the use of
such polypeptides to screen for compounds which inhibit the
tyrosine kinase activity of such polypeptides, to nucleic acid
molecules encoding such polypeptides, to recombinant vectors and
host cells comprising such nucleic acid molecules and to the use of
such nucleic acid molecules in the production of such polypeptides
for use in screening for compounds which inhibit the tyrosine
kinase activity of such polypeptides.
Inventors: |
Barthe; Christophe;
(Merignac, FR) ; Cony-Makhoul; Pascale; (Annecy,
FR) ; Corbin; Amie; (Portland, OR) ; De Vos;
Sven; (Santa Monica, CA) ; Druker; Brian Jay;
(Portland, OR) ; Gschaidmeier; Harald; (Nurnberg,
DE) ; Hallek; Michael; (Schondorf, DE) ;
Hochhaus; Andreas; (Mannheim, DE) ; Hoelzer;
Dieter; (Frankfurt/Main, DE) ; Hofmann;
Wolf-Karsten; (Goldbach, DE) ; Koeffler; Phillip;
(Los Angeles, CA) ; Kreil; Sebastian; (Mannheim,
DE) ; Mahon; Francois-Xavier; (Bordeaux, FR) ;
Muller; Martin; (Heidelberg, DE) ; Ottmann; Oliver
Gerhard; (Frankfurt/Main, DE) ; Warmuth; Markus;
(Starnberg, DE) |
Correspondence
Address: |
NOVARTIS;CORPORATE INTELLECTUAL PROPERTY
ONE HEALTH PLAZA 104/3
EAST HANOVER
NJ
07936-1080
US
|
Family ID: |
29552935 |
Appl. No.: |
12/337322 |
Filed: |
December 17, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11343891 |
Jan 31, 2006 |
|
|
|
12337322 |
|
|
|
|
10263480 |
Oct 3, 2002 |
|
|
|
11343891 |
|
|
|
|
60327387 |
Oct 5, 2001 |
|
|
|
Current U.S.
Class: |
435/194 ;
435/320.1; 435/325; 536/23.2 |
Current CPC
Class: |
C12N 9/12 20130101; C12Q
1/6886 20130101; G01N 2333/82 20130101; C07K 14/82 20130101; C12Q
2600/106 20130101; G01N 33/57426 20130101; C12Q 1/485 20130101 |
Class at
Publication: |
435/194 ;
536/23.2; 435/320.1; 435/325 |
International
Class: |
C12N 9/12 20060101
C12N009/12; C07H 21/00 20060101 C07H021/00; C12N 15/63 20060101
C12N015/63; C12N 5/10 20060101 C12N005/10 |
Claims
1. An isolated polypeptide which comprises a mutated functional Abl
kinase domain that is resistant to inhibition of its tyrosine
kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
2. An isolated polypeptide according to claim 1, wherein the
mutated functional AbI kinase domain comprises the amino acid
sequence of the native human Abl kinase domain or an essentially
similar sequence thereof in which at least one amino acid is
replaced by another amino acid.
3. An isolated polypeptide according to claim 2, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Leu248, Glu255, Lys271, Glu286, Met290, Thr315,
Tyr320, Asn322, Glu373, His375 and Ala380 is replaced by another
amino acid.
4. An isolated polypeptide according to claim 3, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Leu248, Glu255, Lys271, Glu286, Met290, Tyr320,
Asn322, Glu373, His375 and Ala380 is replaced by another amino
acid.
5. An isolated polypeptide according to claim 4, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Leu248, Lys271, Glu286, Met290, Tyr320, Asn322,
Glu373, His375 and Ala380 is replaced by another amino acid.
6. An isolated polypeptide according to claim 3, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Glu255, Thr315 and Ala380 is replaced by another
amino acid.
7. An isolated polypeptide according to claim 6, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof at least one amino acid
selected from Glu255 and Ala380 is replaced by another amino
acid.
8. An isolated polypeptide according to claim 2, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof a single amino acid is
replaced by another amino acid.
9. An isolated polypeptide according to claim 7, wherein in the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof. Glu255 is replaced by another
amino acid.
10. An isolated polypeptide according to claim 3, wherein the amino
acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains at least one amino
acid mutation selected from Glu255Val, Glu255Lys, Thr315Val,
Thr315Leu, Thr315Met, Thr315Gln, Thr315Phe and Ala38Thr.
11. An isolated polypeptide according to claim 10, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains at least one amino
acid mutation selected from Glu255Val, Thr315Val, Thr315Leu,
Thr315Met, Thr315Gln, Thr315Phe and Ala380Thr.
12. An isolated polypeptide according to claim 11, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains at least one amino
acid mutation selected from Thr315Leu, Thr315Met, Thr315Gln and
Thr315Phe.
13. An isolated polypeptide according to claim 10, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains a single amino acid
mutation.
14. An isolated polypeptide according to claim 11, wherein the
amino acid sequence of the native human Abl kinase domain or an
essentially similar sequence thereof contains the amino acid
mutation Glu255Val.
15. An isolated polypeptide according to claim 2, wherein the amino
acid sequence of the native human Abl kinase domain consists of
amino acids 229-500 of SEQ ID NO:2.
16. An isolated polypeptide according to claim 2, which is a
Bcr-Abl tyrosine kinase.
17. Use of a polypeptide according to claim 2 to screen for
compounds which inhibit the tyrosine kinase activity of said
polypeptide.
18. An isolated nucleic acid molecule comprising a nucleotide
sequence that encodes a polypeptide according to claim 2.
19. Use of a nucleic acid molecule according to claim 18 in the
production of a polypeptide according to claim 2 for use in
screening for compounds which inhibit the tyrosine kinase activity
of said polypeptide.
20. A recombinant vector comprising a nucleic acid molecule
according to claim 18.
21. A recombinant vector according to claim 20, which is a
recombinant expression vector.
22. A host cell comprising a recombinant vector according to claim
20.
Description
[0001] This application is a Continuation Application of Ser. No.
11/343,891, filed Jan. 31, 2006, which is a Continuation
Application of Ser. No. 10/263,480, filed Oct. 3, 2002, which
claims benefit of Provisional Application No. 60/327,387, filed
Oct. 5, 2001.
FIELD OF THE INVENTION
[0002] This invention relates to isolated polypeptides which
comprise an amino acid sequence consisting of a mutated functional
Abl kinase domain, said mutated functional kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof, to the use of such
polypeptides to screen for compounds which inhibit the tyrosine
kinase activity of such polypeptides, to nucleic acid molecules
encoding such polypeptides, to recombinant vectors and host cells
comprising such nucleic acid molecules and to the use of such
nucleic acid molecules in the production of such polypeptides for
use in screening for compounds which inhibit the tyrosine kinase
activity of such polypeptides.
BACKGROUND OF THE INVENTION
[0003] Bcr-Abl, a constitutively activated tyrosine kinase
resulting from the formation of the Philadelphia chromosome [Nowell
P. C. and Hungerford D. A., Science 132, 1497 (1960)] by reciprocal
translocation between the long arms of chromosomes 9 and 22 [Rowley
J. D., Nature 243, 290-293 (1973)], has been established as the
characteristic molecular abnormality present in virtually all cases
of chronic myeloid leukemia (CML) and up to 20 percent of adult
acute lymphoblastic leukemia (ALL) [Faderl S. et al., N Engl J Med
341, 164-172 (1999); Sawyers C. L., N Engl J Med 340, 1330-1340
(1999)]. Bcr-Abl is sufficient to cause CML in mice [Daley G. Q. et
al., Science 247, 824-830 (1990)] and its transforming capacity is
absolutely dependent on tyrosine kinase activity [Lugo T. G. et
al., Science 247, 1079 (1990)]. The compound
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide (hereinafter also referred to as
"STI571"; STI571 is described in EP 0 564 409 and, in the form of
the methane sulfonate salt, in WO 99/03854), a competitive
inhibitor at the ATP-binding site of Bcr-Abl, as well as of the
receptor for platelet-derived growth factor, and c-kit tyrosine
kinase [Lugo T. G. et al., Science 247, 1079 (1990)], has been
shown to be capable of very rapidly reversing the clinical and
hematological abnormalities of CML in chronic phase and in blast
crisis as well as of Ph-chromosome-positive (Ph+) acute
lymphoblastic leukemia (Ph+ ALL) [Druker B. J. et al., N Engl J Med
344, 1031-1037 (2001); Druker B. J. et al., N Engl J Med 344,
1038-1042 (2001)]. Whereas almost all chronic phase CML patients
durably respond, remissions in CML blast crisis and Ph+ ALL are
transient, and most patients relapse after several months, despite
continued therapy with STI571 [Druker B. J. et al., N Engl J Med
344, 1038-1042 (2001)]. The mechanism of resistance to STI571 is
subject of intense research.
[0004] It was now surprisingly found that mutations present in the
kinase domain of the Bcr-Abl gene of patients suffering from CML or
Ph+ ALL account for the biological resistance of these patients
towards STI571 treatment in that said mutations lead to resistance
of the Bcr-Abl tyrosine kinase towards inhibition by STI571.
[0005] These findings are extremely valuable in e.g. finding new
compounds or combinations of compounds which are capable to
overcome resistance towards treatment with STI571. Moreover,
knowledge of such mutations is also very useful in the diagnosis of
Ph+ leukemias in that it allows e.g. the detection of
drug-resistant clones before clinical relapse of the patient.
DEFINITIONS
[0006] Within the context of this disclosure the following
expressions, terms and abbreviations have the meanings as defined
below:
[0007] In the expression "a mutated functional Abl kinase domain",
the part "mutated Abl kinase domain" refers to the native human Abl
kinase domain containing mutations including amino acid exchanges,
amino acid deletions and/or amino acid additions.
[0008] In the expression "a mutated functional Abl kinase domain",
the term "functional" indicates that the respective kinase domain
possesses tyrosine kinase activity. Preferably, the kinase activity
of the mutated functional Abl kinase domain is in the range of that
of the native human Abl kinase domain.
[0009] In the expression "a mutated functional Abl kinase domain
being resistant to inhibition of its tyrosine kinase activity by
STI571 or a salt thereof", the term "resistant" means that STI571
inhibits the respective mutated functional Abl kinase domain with
an IC.sub.50 that is higher than that of the native human Abl
kinase domain, i.e. higher than about 0.025 .mu.M, preferably
higher than about 0.15 .mu.M, more preferably higher than about
0.25 .mu.M, most preferably higher than about 5 .mu.M.
[0010] In the expression "amino acid sequence of the native human
Abl kinase domain or an essentially similar sequence thereof, the
part "or an essentially similar sequence thereof" refers to the
amino acid sequence of the native human Abl kinase domain
containing mutations, including amino acid exchanges, amino acid
deletions and/or amino acid additions, that are not essential for
the functionality of the kinase and its resistance to inhibition by
STI571 or a salt thereof within the meaning of the term
"functional" and "resistant" as defined hereinabove.
[0011] The expression "replaced by another amino acid" refers to
the replacement of a certain natural amino acid by another natural
amino acid.
[0012] The names of the amino acids are either written out or the
one letter or three letter codes are used. Mutations are referred
to by accepted nomenclature, e.g. "Ala380Thr" or "380
Ala.fwdarw.Thr" both indicating that alanine at position 380 is
replaced by threonine.
[0013] SEQ ID NO:1 represents the cDNA coding for the native human
Abl protein (human c-abl mRNA; GenBank Accession No.: X16416).
[0014] SEQ ID NO:2 represents the amino acid sequence of the native
human Abl protein (human c-Abl; SwissProt Acc. No.: P00519).
[0015] Unless indicated otherwise, the number given for a certain
amino acid refers to the numbering of the amino acids in SEQ ID
NO:2. In an amino acid sequence that is essentially similar to the
amino acid sequence of the native human Abl kinase domain within
the meaning as defined above, the amino acids are numbered in
accordance with the numbering of the amino acids in SEQ ID
NO:2.
[0016] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring).
[0017] A "host cell", refers to a prokaryotic or eukaryotic cell
that contains heterologous DNA that has been introduced into the
cell by any means, e.g., electroporation, calcium phosphate
precipitation, microinjection, transformation, viral infection, and
the like.
DESCRIPTION OF THE INVENTION
[0018] In practicing the present invention, many conventional
techniques in molecular biology, microbiology, and recombinant DNA
are used. These techniques are well known and are explained in, for
example, Current Protocols in Molecular Biology, Volumes I, II, and
III, 1997 (F. M. Ausubel ed.); Sambrook et al., 1989, Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.; DNA Cloning: A
Practical Approach, Volumes I and II, 1985 (D. N. Glover ed.);
Oligonucleotide Synthesis, 1984 (M. L. Gait ed.); Nucleic Acid
Hybridization, 1985, (Hames and Higgins); Transcription and
Translation, 1984 (Hames and Higgins eds.); Animal Cell Culture,
1986 (R. I. Freshney ed.); Immobilized Cells and Enzymes, 1986 (IRL
Press); Perbal, 1984, A Practical Guide to Molecular Cloning; the
series, Methods in Enzymology (Academic Press, Inc.); Gene Transfer
Vectors for Mammalian Cells, 1987 (J. H. Miller and M. P. Calos
eds., Cold Spring Harbor Laboratory); and Methods in Enzymology
Vol. 154 and Vol. 155 (Wu and Grossman, and Wu, eds.,
respectively).
[0019] In particular, the polypeptides of the present invention can
be produced by recombinant DNA technology using techniques
well-known in the art. Methods which are well known to those
skilled in the art can be used to construct expression vectors
containing the sequences encoding the polypeptides of the invention
and appropriate transcriptional/translational control signals. A
variety of host-expression vector systems can be utilized to
express the polypeptides of the invention.
[0020] (1) The invention relates to an isolated polypeptide which
comprises a mutated functional Abl kinase domain that is resistant
to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0021] (2) The invention further relates in particular to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
in which at least one amino acid is replaced by another amino acid,
said mutated functional Abl kinase domain being resistant to
inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0022] (3) The invention especially relates to an isolated
polypeptide which comprises a mutated functional Abl kinase domain
comprising the amino acid sequence of the native human Abl kinase
domain or an essentially similar sequence thereof in which at least
one amino acid selected from Leu248, Glu255, Lys271, Glu286,
Met290, Thr315, Tyr320, Asn322, Glu373, His375 and Ala380 is
replaced by another amino acid, said mutated functional Abl kinase
domain being resistant to inhibition of its tyrosine kinase
activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0023] (4) A preferred embodiment of the invention relates to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
in which at least one amino acid selected from Leu248, Glu255,
Lys271, Glu286, Met290, Tyr320, Asn322, Glu373, His375 and Ala380
is replaced by another amino acid, said mutated functional Abl
kinase domain being resistant to inhibition of its tyrosine kinase
activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0024] (5) Another preferred embodiment of the invention relates to
an isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
in which at least one amino acid selected from Leu248, Lys271,
Glu286, Met290, Tyr320, Asn322, Glu373, His375 and Ala380 is
replaced by another amino acid, said mutated functional Abl kinase
domain being resistant to inhibition of its tyrosine kinase
activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0025] (6) Another especially preferred embodiment of the invention
relates to an isolated polypeptide which comprises a mutated
functional Abl kinase domain comprising the amino acid sequence of
the native human Abl kinase domain or an essentially similar
sequence thereof in which at least one amino acid selected from
Glu255, Thr315 and Ala380 is replaced by another amino acid, said
mutated functional Abl kinase domain being resistant to inhibition
of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0026] (7) Another very preferred embodiment of the invention
relates to an isolated polypeptide which comprises a mutated
functional Abl kinase domain comprising the amino acid sequence of
the native human Abl kinase domain or an essentially similar
sequence thereof in which at least one amino acid selected from
Glu255 and Ala380 is replaced by another amino acid, said mutated
functional Abl kinase domain being resistant to inhibition of its
tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0027] (8) Most preferably the invention relates to an isolated
polypeptide according to any one of the preceding paragraphs
(2)-(7), wherein in the amino acid sequence of the native human Abl
kinase domain or an essentially similar sequence thereof a single
amino acid is replaced by another amino acid.
[0028] (9) The invention relates very especially preferred to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
in which Glu255 is replaced by another amino acid, said mutated
functional Abl kinase domain being resistant to inhibition of its
tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0029] (10) Most especially preferred the invention relates to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
that contains at least one amino acid mutation selected from
Glu255Val, Glu255Lys, Thr315Val, Thr315Leu, Thr315Met, Thr315Gln,
Thr315Phe and Ala380Thr, said mutated functional Abl kinase domain
being resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0030] (11) In a further very preferred embodiment the invention
relates to an isolated polypeptide which comprises a mutated
functional Abl kinase domain comprising the amino acid sequence of
the native human Abl kinase domain or an essentially similar
sequence thereof that contains at least one amino acid mutation
selected from Glu255Val, Thr315Val, Thr315Leu, Thr315Met,
Thr315Gln, Thr315Phe and Ala380Thr, said mutated functional Abl
kinase domain being resistant to inhibition of its tyrosine kinase
activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0031] (12) In another especially preferred embodiment the
invention relates to an isolated polypeptide which comprises a
mutated functional Abl kinase domain comprising the amino acid
sequence of the native human Abl kinase domain or an essentially
similar sequence thereof that contains at least one amino acid
mutation selected from Thr315Leu, Thr315Met, Thr315Gln and
Thr315Phe, said mutated functional Abl kinase domain being
resistant to inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0032] (13) Most preferably the invention relates to an isolated
polypeptide according to any one of the preceding paragraphs
(10)-(12), wherein the amino acid sequence of the native human Abl
kinase domain or an essentially similar sequence thereof contains a
single amino acid mutation.
[0033] (14) Preferred above all the invention relates to an
isolated polypeptide which comprises a mutated functional Abl
kinase domain comprising the amino acid sequence of the native
human Abl kinase domain or an essentially similar sequence thereof
that contains the amino acid mutation Glu255Val, said mutated
functional Abl kinase domain being resistant to inhibition of its
tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0034] (15) In a preferred embodiment the invention relates to an
isolated polypeptide according to any one of the preceding
paragraphs (2)-(14), wherein the amino acid sequence of the native
human Abl kinase domain consists of amino acids 229-500 of SEQ ID
NO:2.
[0035] (16) In another preferred embodiment the invention relates
to an isolated polypeptide according to any one of the preceding
paragraphs (2)-(15), said isolated polypeptide being a Bcr-Abl
tyrosine kinase.
[0036] (17) In yet another preferred embodiment the invention
relates to the use of an isolated polypeptide of any one of the
preceding paragraphs (2) to (16) to screen for compounds which
inhibit the tyrosine kinase activity of said polypeptide.
[0037] (18) The invention also relates to an isolated nucleic acid
molecule comprising a nucleotide sequence that encodes a
polypeptide according to any one of the preceding paragraphs
(2)-(16).
[0038] (19) The invention further relates to the use of a nucleic
acid molecule of the preceding paragraph (18) in the production of
a polypeptide of any one of the preceding paragraphs (2) to (16)
for use in screening for compounds which inhibit the tyrosine
kinase activity of said polypeptide.
[0039] (20) The invention also relates to a recombinant vector
comprising a nucleic acid molecule according to the preceding
paragraph (18).
[0040] (21) The invention further relates especially to a
recombinant vector according to the preceding paragraph (20), which
is a recombinant expression vector.
[0041] (22) The invention also relates to a host cell comprising a
recombinant vector according to the preceding paragraph (20) or
(21).
[0042] Preferably the invention relates to an isolated polypeptide
which comprises a mutated functional Abl kinase domain comprising
the amino acid sequence of the native human Abl kinase domain in
which at least one amino acid is replaced by another amino acid,
said mutated functional Abl kinase domain being resistant to
inhibition of its tyrosine kinase activity by
N-[4-methyl-3-(4-pyridin-3-yl-pyrimidin-2-ylamino)-phenyl]-4-(4-methyl-pi-
perazin-1-ylmethyl)-benzamide or a salt thereof.
[0043] Most preferred are the mutations described herein, which are
present in patients who suffer from Philadelphia
chromosome-positive leukemia and are resistant against treatment
with STI571.
[0044] A preferred salt of STI571 is the methane sulfonate salt
described in WO 99/03854.
[0045] Screening for compounds which inhibit the tyrosine kinase
activity of the polypeptides of the invention may be done for
example by using an isolated polypeptide of the invention in any in
vitro tyrosine kinase phosphorylation assay known in the art and
determining the potential of a compound to inhibit the tyrosine
kinase activity of a polypeptide of the invention in such an
assay.
[0046] High-throughput screening assays known in the art may be
used to screen large compound libraries for compounds which inhibit
the tyrosine kinase activity of the polypeptides of the
invention.
[0047] Besides the random screening of large compound libraries,
the polypeptides of the present invention may also be used in the
following screening approach: The 3-dimensional structure of a
polypeptide of the invention is determined by e.g. X-ray
crystallography. The atomic coordinates of a polypeptide of the
invention are then used to design a potential inhibitor. Said
potential inhibitor is then synthesized and tested for its ability
to inhibit the tyrosine kinase activity of the polypeptide of the
invention in any in vitro tyrosine kinase phosphorylation
assay.
EXAMPLES
[0048] The following Examples serve to illustrate the invention
without limiting its scope.
Example 1
Methods
Plasmids and Site Directed Mutagenesis:
[0049] The hybrid cDNA coding for HckAblSH1 was cloned by
amplifying the respective DNA fragments from pUC.DELTA.Ndel/XbalHck
[Warmuth M. et al., J. Biol. Chem. 272, 33260-70 (1997)] and
pcDNA3bcr-abl. These fragments were ligated blunt end to yield
pUC.DELTA.Ndel/XbalhckablSH1. Because of its relatively small size
when compared to Bcr-Abl or c-Abl, this construct, hckAblSH1,
allowed to introduce point mutations into the kinase domain of Abl
by a one step cloning procedure. Point mutations were introduced
into hckablSH1 using the QuickChange site directed mutagenesis
protocol from Stratagene (La Jolla, Calif.). In order to introduce
point mutations into Bcr-Abl, a Kpnl/Eco 47III-subfragment of
Bcr-Abl containing the sequence coding for Bcr-Abl's kinase domain
was cloned into pUC.DELTA.Ndel/Xbal engineered by site directed
mutagenesis to contain an Eco47III site in the polylinker. After
introduction of point mutations, this fragment was first recloned
into pcDNA3abl. Thereafter, the 5' part of abl up to the Kpnl site
was substituted by Bcr coding sequences using a Kpnl-fragment from
pcDNA3bcr-abl. All mutations were confirmed by sequencing. For
expression in Cos7 and 32D cells cDNAs were cloned into pApuro.
Cell Lines:
[0050] Parental 32D cells as well as 32D cells expressing Bcr-Abl
and mutants thereof (32Dp21) were grown in Iscove's modified
dulbeccos media (IMDM) supplemented with 10% FBS. COS7 cells were
cultured in Dulbecco's modified eagle medium (DMEM) containing 4,5
g/l glucose) and supplemented with 10% FBS. All media and FBS were
purchased from Gibco Life Technologies, Inc, Karlsruhe,
Germany.
Transfection of Cells:
[0051] Cos7 cells were transfected using Effecten.RTM. transfection
reagent as to the guidelines of the manufacturer (Quiagen, Hilden,
Germany). 32D cells were transfected by electroporation. Puromycin
was used for selection at a concentration of 1 .mu.g/ml.
Cell Lysis:
[0052] Cos7 cells were lysed as described recently [Warmuth M. et
al., J. Biol. Chem. 272, 33260-70 (1997)]. For lysis, exponentially
growing 32D cells were harvested and washed twice in cold PBS. For
experiments evaluating the activity profile of STI571, cells were
incubated with the indicated concentrations of inhibitor or with
DMSO at a density of 5.times.10.sup.6 cells/ml for 1.5-2h. 10.sup.7
cells were lysed in 100 .mu.l of lysis buffer containing 1% NP-40,
20 mM Tris(pH 8,0), 50 mM NaCl, and 10 mM EDTA, 1 mM
phenylmethylsulfonylfluorid, 10 .mu.g/ml aprotinin, 10 .mu.g/ml
leupeptin, and 2 mM sodium orthovanadate. After resuspension in
lysis buffer, cells were incubated for 25 min on ice. Finally,
unsoluble material was removed by centrifugation at 15,000 g.
Clarified lysates were checked for protein concentrations using a
BioRad protein assay.
Immunoprecipitation:
[0053] For immunoprecipitation 150 .mu.l of standardized 32D cell
lysate was diluted by addition of 450 .mu.l of incubation buffer
containing 20 mM Tris(pH 8,0), 50 mM NaCl, and 10 mM EDTA, 1 mM
phenylmethylsulfonylfluorid, 10 .mu.g/ml aprotinin, 10 .mu.g/ml
leupeptin, and 2 mM sodium orthovanadate and incubated with 5 .mu.g
of the indicated antibodies for 2 hours on a overhead rotor at
4.degree. C. Sepharose A beads (Pharmacia Biotech Inc., Freiburg,
Germany) were prepared by washing twice in IP buffer [0,1% NP-40,
20 mM Tris(pH 8,0), 50 mM NaCl, and 10 mM EDTA, 1 mM
phenylmethylsulfonylfluorid, 10 .mu.g/ml aprotinin, 10 .mu.g/ml
leupeptin, and 2 mM sodium orthovanadate] and added to each sample
for 2 additional hours. Finally, the immunoprepicitates were washed
three times in IP buffer, subsequently boiled in 2.times. sample
buffer and prepared for SDS-PAGE.
Gel Electrophoresis and Immunoblotting:
[0054] Gel electrophoresis and immunoblotting were performed as
described [Danhauser-Riedl S. et al., Cancer Res. 56, 3589-96
(1996); Warmuth M. et al., J. Biol. Chem. 272, 33260-70 (1997)]
with some minor modifications. Proteins were routinely blotted on
nitrocellulose membranes (Schleicher & Schuell, Dassel,
Germany). Membranes were blocked in 5% milk powder for 1 h. Primary
and secondary antibodies were diluted 1:500 to 1:5000 in TBS
containing 1% milk powder. Proteins were detected using the ECL or
ECL Plus detection system as recommended by the manufacturer
(Amersham, Braunschweig, Germany).
Detection of Apoptosis by Flow Cytometry:
[0055] For assessing apoptosis induced by the various kinase
inhibitors, cells were incubated with the indicated concentrations
of STI571 at a density of 5.times.10.sup.4 per ml. Apoptosis was
routinely assessed by measuring the binding of FITC-conjugated
Annexin V to the membranes of apoptosing cells. About
5.times.10.sup.4 cells were taken at the indicated time points and
washed once in PBS. Thereafter, cells were resuspended in 195 .mu.l
of Annexin V binding buffer and 5 .mu.l of Annexin V-FITC (Bender
MedSystems Diagnostics, Vienna, Austria) were added. Cells were
mixed and incubated at room temperature for 10-20 min. Afterwards,
cells were pelleted again, washed once and resuspended in 190 .mu.l
of Annexin V binding buffer. 10 .mu.l of a 20 .mu.g/ml propidium
iodide stock solution were added and the ratio of Annexin
V-positive to negative cells was determined by FACS-analysis using
a Coulter EPICS XL 4-color cytometer.
Results:
[0056] Mutations to either Valine (V), Leucine (L), Isoleucine (I),
Methionine (M), Glutamine (Q) or Phenylalanine (F) at position 315
and to either Serine (S), Cysteine (C) or Threonine (T) at position
380 were generated in a hybrid kinase, HckAblSH1, consisting of the
SH2 and SH3 domain of Hck and the SH1/kinase domain of Abl. When
expressed in Cos7 cells, these hybrid kinases and all mutants at
position 315 and 380 showed a high spontaneous kinase activity,
proving that these positions are not critical for ATP binding
(Table 1). In marked contrast, when tested for inhibition by
STI571, no inhibition was seen with up to 10 .mu.M of compound for
the mutants T315L, T315I, T315M, T315Q and T315F (Table 1), whereas
HckAblSH1 wild-type (wt) could be inhibited with similar kinetics
by STI571 as were found for Bcr-Abl (IC50 cellular tyrosine
phosphorylation (IC50.sub.CTP) approx. 0.5 .mu.M). The mutants
T315V and A380T retained some partial sensitivity but IC50.sub.CTP
values were still higher than 10 .mu.M. In contrast, the mutants
A380S and A380C displayed sensitivity to STI571, which was
comparable to HckAblSH1 wt (see Table 1 for summary).
TABLE-US-00001 TABLE 1 Influence of mutations of T315 and A380 of
HckAblSH1 on kinase activity and inhibiton by STI571 kinase
activity Inhibition by STI571 T315V +++ IC50 > 10 T315L +++ CR
T315I +++ CR T315M ++++ CR T315Q ++ CR T315F ++ CR A380C +++ NS
A380S +++ NS A380T + IC50 > 10 All data based on inhibiton of
cellular tyrosine phosphorylation of transiently transfected Cos7
cells determined by Western blot analysis using the monoclonal
.alpha.-phosphotyrosine antibody PY99. IC50 values were determined
using scion image software. Complete remission (CR) was defined as
no detectable reduction of cellular tyrosine phosphrylation by 10
.mu.M STI571. NS (normal sensitivity) = inhibtion with similar
kinetics as HckAblSH1 wt.
[0057] Our data identify positions 315 and 380 as critical
gatekeepers for the binding pocket of STI571, which contribute to
define the sensitivity of individual protein kinases towards
STI571. For example, the STI571-insensitive receptor tyrosine
kinase Flt-3, which has high homology to the c-Kit and the PDGF-R
kinases, has a phenylalanine at the position homologous to T315,
which would, based on our data, not be in accordance with STI571
binding. In a similar way, the resistance of most other kinases
tested with STI571 could be explained.
[0058] In order to investigate whether and to what degree some of
the above described point mutations of the gatekeeper position T315
are able to induce biological resistance towards STI571 we
introduced into full length Bcr-Abl the mutations T315V, T315L,
T3151, T315M, T315Q and T315F. When expressed in Cos7 cells all
mutants displayed kinase activity close to or similar to wild-type
Bcr-Abl (Bcr-ABLwt). If tested for inhibition by STI571, identical
results were obtained as described for the corresponding mutations
in HckAblSH1 (Table 2). Similar to Bcr-Ablwt, expression of these
mutants in 32D, an IL-3-dependent, hematopoietic cell line of
murine origin, gave rise to cell lines growing IL-3 independently.
Exposure of 32 DBcr-Ablwt cells to 1 or 10 .mu.M STI571 lead to a
rapid stop of proliferation and induction of apoptotic cell death
in more than 90% of cells. On the contrary, if T315 mutant Bcr-Abl
kinases, for example T315, were expressed the block in
proliferation and the induction of apoptosis caused by 1 .mu.M
STI571 were completely abolished (Table 2) and the effects of
STI571 seen at 10 .mu.M were reduced to levels found in control
experiments using parental 32D cells grown in the presence of IL-3.
Phosphotyrosine blots of samples of cells expressing either wt or
mutant Bcr-Abl proteins confirmed that mutations at position 315
completely abolished the effect of STI571 on Abl auto- and
substrate phosphorylation, with the exception of T315V which was
still to some degree inhibited by STI571 but displayed a similar
biological phenotype as the other mutants (Table 2). This suggests
that the reminder biological activity of STI571 at 10 .mu.M was
rather due to cytotoxicity than to a reminder sensitivity of the
mutants or cross-reaction of STI571 with another tyrosine kinase.
In summary, all mutations lifted the IC50 for inhibition of
proliferation (IC50.sub.IOP) from 0.09 to approximately 7.5 .mu.M
and for inhibition of survival (IC50.sub.IOS) from 0.5 to more than
10 .mu.M (Table 2). Taken together, these data show that mutations
of "molecular gatekeeper" positions as described above are able to
confer complete biological resistance towards STI571 in a cell
culture model.
TABLE-US-00002 TABLE 2 Biochemical and biological characterization
of mutations of T315 in Bcr-Abl to amino acids with longer side
chains IC50 (.mu.M) Induction IC50 cellular of factor- (.mu.M)
tyrosine independent IC50 (.mu.M) prolif- kinase phosphorylation
growth apoptosis eration mutant activity Cos7 32D in 32D 32D 32D
(32D) <10 7.5 wt +++ 0.25 0.25 yes 0.5 0.09 T315V +++ >10
>10 yes >10 7.5 T315L ++++ c.r. c.r. yes >10 7.5 T315I +++
c.r. c.r. yes >10 7.5 T315M ++++ c.r. c.r. yes >10 7.5 T315Q
+++ c.r. c.r. yes >10 7.5 T315F +++ c.r. c.r. yes >10 7.5
c.r.: complete remission (no detectable reduction of cellular
tyrosine phosphrylation by 10 .mu.M STI571)
Example 2
[0059] STI571 inhibits the Abl tyrosine kinase with an IC.sub.50 of
0.025 .mu.M for purified Bcr-Abl and c-Abl but not the fms or the
Src family kinases. The mechanism of inhibition is through
competitive inhibition of ATP binding. To better understand the
mechanism of specificity of the tyrosine kinase inhibitor the Abl
kinase was compared to a model of the Lck kinase domain. This model
predicts the following sites are critical for STI571 association:
L248, Y320, N322, E373, H375 and A380. Each of these residues were
changed to the corresponding residue in Src or fms and IC.sub.50
values for STI571 with each mutant were determined. L248A and H375L
yielded kinase inactive mutants, Y320K, N322S, E373N and A380G had
IC.sub.50 values identical to wild type Abl. A380T, however,
demonstrated an IC.sub.50 of 0.34 .mu.M suggesting that STI571
bound less efficiently when a larger residue replaced the alanine.
Recent crystallization of the Abl kinase domain with a related
inhibitor shows that the configuration of the activation loop of
the Abl kinase domain differs significantly from that of the Src
family kinases. This structure identifies K271, E286, M290, T315,
M318 and D381 as critical contacts of STI571. All of these residues
are conserved between Src and Abl. The last two of these bind
STI571 via their peptide backbone, thus mutants in these residues
cannot be created. The remainder of the residues were mutated to
residues lacking the potential for hydrogen bonding and IC.sub.50
values were determined. K271R, E286L and M290A were kinase
inactive. T315V had an IC.sub.50 value of 0.35 .mu.M, which is
consistent with the crystal structure of the Abl kinase domain
which predicts that the side chain of T315 forms a critical
hydrogen bond with STI571.
Example 3
[0060] A group of 32 patients who are either refractory to
treatment with STI571 or who relapsed whilst being treated were
investigated. The median duration of therapy was 95 days; prior to
STI571 treatment, two patients were in chronic phase, nine in
accelerated phase, 20 in myeloid and, and one in lymphoid blast
crisis of the disease. Reverse transcriptase-polymerase chain
reaction (RT-PCR) products specific for the Bcr-Abl tyrosine kinase
domain were sequenced (Heminested RT-PCR was performed to amplify
the sequence specifically coding for the Bcr-Abl tyrosine kinase:
1.sup.st step B2B ACAGAATTCCGCTGACCATCAATAAG and
A7-AGACGTCGGACTTGATGGAGAACT; 2.sup.nd step FA4+
AAGCGCAACAAGCCCACTGTCTAT and A7-).
[0061] An acquired A.fwdarw.T point mutation at position 58802
(GeneBank accession number U07563, locus HSABLGR3)--which results
in a Glu255Val substitution--was detected in one patient.
Restriction analysis of cDNA and genomic DNA (RT-PCR and genomic
PCR were performed using primers A4+ TCACCACGCTCCATTATCCA, A4-
CTTCCACACGCTCTCGTACA; Mnl I restriction digest of PCR products;
removal of an Mnl I restriction site as the result of the point
mutation A58802T) was used to confirm the presence of the mutation
and to track it during the course of treatment. Only wild-type Abl
sequence was present before the STI571 therapy. The patient was
treated with STI571 in late chronic phase, went into complete
hematologic remission, but progressed to blast crisis after five
months. Reactivation of Bcr-Abl was confirmed by Crkl
immunoblotting [K. Senechal, Mol. Cell. Biol. 18, 5082 (1998)]. The
relative proportion of phosphorylated Crkl (reflecting active
Bcr-Abl) was 49% before STI571 therapy, 24% at day 27, 28% at day
83, and 77% at the time of clinical resistance at day 166. The
biological significance of the Glu255Val change is determined by an
Abl autophosphorylation assay. STI571 inhibits wild-type Abl with
an IC.sub.50 of 0.025 .mu.M. The mutation leads to a virtual
insensitivity to STI571, with an IC.sub.50 of >5 .mu.M.
Example 4
[0062] The Bcr-Abl kinase domain from cells obtained from 12 CML
and Ph+ acute leukemia patients who relapsed while receiving STI571
was sequenced. A functional point-mutation in the kinase domain in
one case was identified. This was a G.fwdarw.A change that results
in a Glu.fwdarw.Lys substitution at position 255 of Abl.
Example 5
Patients and Sample Preparation
[0063] Thirty bone marrow samples from 21 patients with Ph+ ALL who
were enrolled into consecutive "Phase II study to determine the
safety and anti-leukemic effect of STI571 in adult patients with
Ph+ acute leukemias" were analyzed. According to the study
protocol, these patients had relapsed ALL or were refractory after
at least 2 cycles of standard chemotherapy. From all of the
patients samples were obtained before beginning STI571 treatment:
13 of these samples were from individuals who later were classified
as good responders to STI571 (Nos. 1-13, sensitive, S) including 12
patients with hematological complete remission (CR) and one patient
with partial remission (PR) but complete peripheral hematological
recovery (No. 1). Eight samples were collected from individuals who
later were found not to respond to STI571 (Nos. 14-21, primarily
resistant, R) including 6 patients without any hematological
response, one with cytoreduction in the bone marrow but persistent
peripheral leukemic cells (No. 20) and another with PR but
incomplete peripheral hematological recovery (No. 16). Matched bone
marrow samples from 9 patients (Nos. 1-5 and Nos. 14-17) were also
obtained while they were on treatment with STI571. Mononuclear
cells were separated by density gradient centrifugation through
Ficoll-Hypaque (Biochrom, Berlin, Germany). Total RNA was extracted
using the acid guanidium/phenol/chloroform method with minor
modifications [Puissant C. and Houdebine L. M., Biotechniques 8,
148-149 (1990)]. Only samples with leukemic blast cell infiltration
of more than 80% were included into the analysis.
Reverse Transcription Polymerase Chain Reaction and Sequencing
Analysis
[0064] One microgram of total RNA was used for reverse
transcription (RT) by Superscript II RT (Life Technologies, Grand
Island, N.Y.) according to standard protocols. Primers specific for
the ATP binding site of ABL including the "loop" were designed
using gene bank information GI6382056: ATP-F 5'-GCG CM CM GCC CAC
TGT CT-3'; ATP-R 5'-GCA CTC CCT CAG GTA GTC CA-3' and LOOP-F 5'-TGG
ACT ACC TGA GGG AGT GC-3'; LOOP-R 5'-CGG TAG TCC TTC TCT AGC
AGC-3'. Oligonucleotides were synthesized by Life Technologies.
Polymerase chain reaction (PCR) was performed as described
previously [Hofmann W. K. et al., Leuk. Res. 25, 333-338 (2001)]
using an annealing temperature of 58.degree. C. PCR-products were
separated on a 2% agarose gel containing 0.3 mg/ml ethidium bromide
and purified using the QIAquick purification system (Qiagen,
Valencia, Calif.) according to the manufacturers protocol. The
purified DNA was directly sequenced in both directions (sense and
antisense) by the ABI PRISM dye terminator cycle sequencing
reaction (Perkin-Elmer, Foster, Calif.).
Results:
[0065] Analysis of the sequence of the ATP binding site revealed a
single point mutation at nucleotide 1127 (GI6382056) changing a G
to an A resulting in a substitution at codon 255 of Lys (mutant)
for a Glu (wild-type). This mutation was found in 6 samples from
patients after they were treated with STI571 (Nos. 1, 2, 4, 5, 15,
16) but mutations were not found in any other sample including the
matched samples from the patients before beginning treatment with
STI571 (Table 3). The change was verified by sequencing from both
the sense and antisense directions. In addition, one sample (No.
17) from a patient with an aberrant cALL had a single point
mutation at nucleotide 1308 changing a C to T resulting in a
substitution at codon 315 of isoleucine (mutant) for a threonine
(wild-type). This sample was unusual because the cells also
expressed CD33, a cell surface protein expressed on myeloid
cells.
[0066] Our data strongly suggest that E255K developed during
treatment with STI571. Our analysis of matched samples found, that
none of the samples from untreated patients (including sensitive
patients and those with primary resistance) had this mutation. In
contrast, six of 9 samples (67%) from these patients undergoing
treatment with STI571 had this substitution at E255. The overall
frequency of mutations in the ATP binding site was 7 of 9 (78%) in
our paired bone marrow samples from patients undergoing therapy
with STI571.
TABLE-US-00003 TABLE 3 Matched bone marrow samples: Development of
mutations in the region coding for the ATP binding site of ABL
during treatment of Ph+ ALL with STI571. ABS ABS status prior to
status after treatment Response to treatment No. Diagnosis with
STI571 STI571 with STI571 1 Ph+ cALL Wild type PR E255K 2 Ph+ cALL
Wild type CR E255K 3 Ph+ cALL Wild type CR Wild type 4 Ph+ cALL
Wild type CR E255K 5 Ph+ cALL Wild type CR E255K 14 Ph+ cALL Wild
type no Wild type 15 Ph+ cALL Wild type no E255K 16 Ph+ pre B-ALL
Wild type PR E255K 17 Ph+ cALL, CD33+ Wild type no T315I ABS, ATP
binding site; PR, partial remission; CR, complete remission; Ph+
cALL, Philadelphia chromosome positive common ALL (CD10+).
Sequence CWU 1
1
213393DNAHomo sapiensCDS(1)..(3393) 1atg ttg gag atc tgc ctg aag
ctg gtg ggc tgc aaa tcc aag aag ggg 48Met Leu Glu Ile Cys Leu Lys
Leu Val Gly Cys Lys Ser Lys Lys Gly1 5 10 15ctg tcc tcg tcc tcc agc
tgt tat ctg gaa gaa gcc ctt cag cgg cca 96Leu Ser Ser Ser Ser Ser
Cys Tyr Leu Glu Glu Ala Leu Gln Arg Pro20 25 30gta gca tct gac ttt
gag cct cag ggt ctg agt gaa gcc gct cgt tgg 144Val Ala Ser Asp Phe
Glu Pro Gln Gly Leu Ser Glu Ala Ala Arg Trp35 40 45aac tcc aag gaa
aac ctt ctc gct gga ccc agt gaa aat gac ccc aac 192Asn Ser Lys Glu
Asn Leu Leu Ala Gly Pro Ser Glu Asn Asp Pro Asn50 55 60ctt ttc gtt
gca ctg tat gat ttt gtg gcc agt gga gat aac act cta 240Leu Phe Val
Ala Leu Tyr Asp Phe Val Ala Ser Gly Asp Asn Thr Leu65 70 75 80agc
ata act aaa ggt gaa aag ctc cgg gtc tta ggc tat aat cac aat 288Ser
Ile Thr Lys Gly Glu Lys Leu Arg Val Leu Gly Tyr Asn His Asn85 90
95ggg gaa tgg tgt gaa gcc caa acc aaa aat ggc caa ggc tgg gtc cca
336Gly Glu Trp Cys Glu Ala Gln Thr Lys Asn Gly Gln Gly Trp Val
Pro100 105 110agc aac tac atc acg cca gtc aac agt ctg gag aaa cac
tcc tgg tac 384Ser Asn Tyr Ile Thr Pro Val Asn Ser Leu Glu Lys His
Ser Trp Tyr115 120 125cat ggg cct gtg tcc cgc aat gcc gct gag tat
ctg ctg agc agc ggg 432His Gly Pro Val Ser Arg Asn Ala Ala Glu Tyr
Leu Leu Ser Ser Gly130 135 140atc aat ggc agc ttc ttg gtg cgt gag
agt gag agc agt cct ggc cag 480Ile Asn Gly Ser Phe Leu Val Arg Glu
Ser Glu Ser Ser Pro Gly Gln145 150 155 160agg tcc atc tcg ctg aga
tac gaa ggg agg gtg tac cat tac agg atc 528Arg Ser Ile Ser Leu Arg
Tyr Glu Gly Arg Val Tyr His Tyr Arg Ile165 170 175aac act gct tct
gat ggc aag ctc tac gtc tcc tcc gag agc cgc ttc 576Asn Thr Ala Ser
Asp Gly Lys Leu Tyr Val Ser Ser Glu Ser Arg Phe180 185 190aac acc
ctg gcc gag ttg gtt cat cat cat tca acg gtg gcc gac ggg 624Asn Thr
Leu Ala Glu Leu Val His His His Ser Thr Val Ala Asp Gly195 200
205ctc atc acc acg ctc cat tat cca gcc cca aag cgc aac aag ccc act
672Leu Ile Thr Thr Leu His Tyr Pro Ala Pro Lys Arg Asn Lys Pro
Thr210 215 220gtc tat ggt gtg tcc ccc aac tac gac aag tgg gag atg
gaa cgc acg 720Val Tyr Gly Val Ser Pro Asn Tyr Asp Lys Trp Glu Met
Glu Arg Thr225 230 235 240gac atc acc atg aag cac aag ctg ggc ggg
ggc cag tac ggg gag gtg 768Asp Ile Thr Met Lys His Lys Leu Gly Gly
Gly Gln Tyr Gly Glu Val245 250 255tac gag ggc gtg tgg aag aaa tac
agc ctg acg gtg gcc gtg aag acc 816Tyr Glu Gly Val Trp Lys Lys Tyr
Ser Leu Thr Val Ala Val Lys Thr260 265 270ttg aag gag gac acc atg
gag gtg gaa gag ttc ttg aaa gaa gct gca 864Leu Lys Glu Asp Thr Met
Glu Val Glu Glu Phe Leu Lys Glu Ala Ala275 280 285gtc atg aaa gag
atc aaa cac cct aac ctg gtg cag ctc ctt ggg gtc 912Val Met Lys Glu
Ile Lys His Pro Asn Leu Val Gln Leu Leu Gly Val290 295 300tgc acc
cgg gag ccc ccg ttc tat atc atc act gag ttc atg acc tac 960Cys Thr
Arg Glu Pro Pro Phe Tyr Ile Ile Thr Glu Phe Met Thr Tyr305 310 315
320ggg aac ctc ctg gac tac ctg agg gag tgc aac cgg cag gag gtg aac
1008Gly Asn Leu Leu Asp Tyr Leu Arg Glu Cys Asn Arg Gln Glu Val
Asn325 330 335gcc gtg gtg ctg ctg tac atg gcc act cag atc tcg tca
gcc atg gag 1056Ala Val Val Leu Leu Tyr Met Ala Thr Gln Ile Ser Ser
Ala Met Glu340 345 350tac ctg gag aag aaa aac ttc atc cac aga gat
ctt gct gcc cga aac 1104Tyr Leu Glu Lys Lys Asn Phe Ile His Arg Asp
Leu Ala Ala Arg Asn355 360 365tgc ctg gta ggg gag aac cac ttg gtg
aag gta gct gat ttt ggc ctg 1152Cys Leu Val Gly Glu Asn His Leu Val
Lys Val Ala Asp Phe Gly Leu370 375 380agc agg ttg atg aca ggg gac
acc tac aca gcc cat gct gga gcc aag 1200Ser Arg Leu Met Thr Gly Asp
Thr Tyr Thr Ala His Ala Gly Ala Lys385 390 395 400ttc ccc atc aaa
tgg act gca ccc gag agc ctg gcc tac aac aag ttc 1248Phe Pro Ile Lys
Trp Thr Ala Pro Glu Ser Leu Ala Tyr Asn Lys Phe405 410 415tcc atc
aag tcc gac gtc tgg gca ttt gga gta ttg ctt tgg gaa att 1296Ser Ile
Lys Ser Asp Val Trp Ala Phe Gly Val Leu Leu Trp Glu Ile420 425
430gct acc tat ggc atg tcc cct tac ccg gga att gac ctg tcc cag gtg
1344Ala Thr Tyr Gly Met Ser Pro Tyr Pro Gly Ile Asp Leu Ser Gln
Val435 440 445tat gag ctg cta gag aag gac tac cgc atg gag cgc cca
gaa ggc tgc 1392Tyr Glu Leu Leu Glu Lys Asp Tyr Arg Met Glu Arg Pro
Glu Gly Cys450 455 460cca gag aag gtc tat gaa ctc atg cga gca tgt
tgg cag tgg aat ccc 1440Pro Glu Lys Val Tyr Glu Leu Met Arg Ala Cys
Trp Gln Trp Asn Pro465 470 475 480tct gac cgg ccc tcc ttt gct gaa
atc cac caa gcc ttt gaa aca atg 1488Ser Asp Arg Pro Ser Phe Ala Glu
Ile His Gln Ala Phe Glu Thr Met485 490 495ttc cag gaa tcc agt atc
tca gac gaa gtg gaa aag gag ctg ggg aaa 1536Phe Gln Glu Ser Ser Ile
Ser Asp Glu Val Glu Lys Glu Leu Gly Lys500 505 510caa ggc gtc cgt
ggg gct gtg agt acc ttg ctg cag gcc cca gag ctg 1584Gln Gly Val Arg
Gly Ala Val Ser Thr Leu Leu Gln Ala Pro Glu Leu515 520 525ccc acc
aag acg agg acc tcc agg aga gct gca gag cac aga gac acc 1632Pro Thr
Lys Thr Arg Thr Ser Arg Arg Ala Ala Glu His Arg Asp Thr530 535
540act gac gtg cct gag atg cct cac tcc aag ggc cag gga gag agc gat
1680Thr Asp Val Pro Glu Met Pro His Ser Lys Gly Gln Gly Glu Ser
Asp545 550 555 560cct ctg gac cat gag cct gcc gtg tct cca ttg ctc
cct cga aaa gag 1728Pro Leu Asp His Glu Pro Ala Val Ser Pro Leu Leu
Pro Arg Lys Glu565 570 575cga ggt ccc ccg gag ggc ggc ctg aat gaa
gat gag cgc ctt ctc ccc 1776Arg Gly Pro Pro Glu Gly Gly Leu Asn Glu
Asp Glu Arg Leu Leu Pro580 585 590aaa gac aaa aag acc aac ttg ttc
agc gcc ttg atc aag aag aag aag 1824Lys Asp Lys Lys Thr Asn Leu Phe
Ser Ala Leu Ile Lys Lys Lys Lys595 600 605aag aca gcc cca acc cct
ccc aaa cgc agc agc tcc ttc cgg gag atg 1872Lys Thr Ala Pro Thr Pro
Pro Lys Arg Ser Ser Ser Phe Arg Glu Met610 615 620gac ggc cag ccg
gag cgc aga ggg gcc ggc gag gaa gag ggc cga gac 1920Asp Gly Gln Pro
Glu Arg Arg Gly Ala Gly Glu Glu Glu Gly Arg Asp625 630 635 640atc
agc aac ggg gca ctg gct ttc acc ccc ttg gac aca gct gac cca 1968Ile
Ser Asn Gly Ala Leu Ala Phe Thr Pro Leu Asp Thr Ala Asp Pro645 650
655gcc aag tcc cca aag ccc agc aat ggg gct ggg gtc ccc aat gga gcc
2016Ala Lys Ser Pro Lys Pro Ser Asn Gly Ala Gly Val Pro Asn Gly
Ala660 665 670ctc cgg gag tcc ggg ggc tca ggc ttc cgg tct ccc cac
ctg tgg aag 2064Leu Arg Glu Ser Gly Gly Ser Gly Phe Arg Ser Pro His
Leu Trp Lys675 680 685aag tcc agc acg ctg acc agc agc cgc cta gcc
acc ggc gag gag gag 2112Lys Ser Ser Thr Leu Thr Ser Ser Arg Leu Ala
Thr Gly Glu Glu Glu690 695 700ggc ggt ggc agc tcc agc aag cgc ttc
ctg cgc tct tgc tcc gcc tcc 2160Gly Gly Gly Ser Ser Ser Lys Arg Phe
Leu Arg Ser Cys Ser Ala Ser705 710 715 720tgc gtt ccc cat ggg gcc
aag gac acg gag tgg agg tca gtc acg ctg 2208Cys Val Pro His Gly Ala
Lys Asp Thr Glu Trp Arg Ser Val Thr Leu725 730 735cct cgg gac ttg
cag tcc acg gga aga cag ttt gac tcg tcc aca ttt 2256Pro Arg Asp Leu
Gln Ser Thr Gly Arg Gln Phe Asp Ser Ser Thr Phe740 745 750gga ggg
cac aaa agt gag aag ccg gct ctg cct cgg aag agg gca ggg 2304Gly Gly
His Lys Ser Glu Lys Pro Ala Leu Pro Arg Lys Arg Ala Gly755 760
765gag aac agg tct gac cag gtg acc cga ggc aca gta acg cct ccc ccc
2352Glu Asn Arg Ser Asp Gln Val Thr Arg Gly Thr Val Thr Pro Pro
Pro770 775 780agg ctg gtg aaa aag aat gag gaa gct gct gat gag gtc
ttc aaa gac 2400Arg Leu Val Lys Lys Asn Glu Glu Ala Ala Asp Glu Val
Phe Lys Asp785 790 795 800atc atg gag tcc agc ccg ggc tcc agc ccg
ccc aac ctg act cca aaa 2448Ile Met Glu Ser Ser Pro Gly Ser Ser Pro
Pro Asn Leu Thr Pro Lys805 810 815ccc ctc cgg cgg cag gtc acc gtg
gcc cct gcc tcg ggc ctc ccc cac 2496Pro Leu Arg Arg Gln Val Thr Val
Ala Pro Ala Ser Gly Leu Pro His820 825 830aag gaa gaa gct gaa aag
ggc agt gcc tta ggg acc cct gct gca gct 2544Lys Glu Glu Ala Glu Lys
Gly Ser Ala Leu Gly Thr Pro Ala Ala Ala835 840 845gag cca gtg acc
ccc acc agc aaa gca ggc tca ggt gca cca ggg ggc 2592Glu Pro Val Thr
Pro Thr Ser Lys Ala Gly Ser Gly Ala Pro Gly Gly850 855 860acc agc
aag ggc ccc gcc gag gag tcc aga gtg agg agg cac aag cac 2640Thr Ser
Lys Gly Pro Ala Glu Glu Ser Arg Val Arg Arg His Lys His865 870 875
880tcc tct gag tcg cca ggg agg gac aag ggg aaa ttg tcc agg ctc aaa
2688Ser Ser Glu Ser Pro Gly Arg Asp Lys Gly Lys Leu Ser Arg Leu
Lys885 890 895cct gcc ccg ccg ccc cca cca gca gcc tct gca ggg aag
gct gga gga 2736Pro Ala Pro Pro Pro Pro Pro Ala Ala Ser Ala Gly Lys
Ala Gly Gly900 905 910aag ccc tcg cag agc ccg agc cag gag gcg gcc
ggg gag gca gtc ctg 2784Lys Pro Ser Gln Ser Pro Ser Gln Glu Ala Ala
Gly Glu Ala Val Leu915 920 925ggc gca aag aca aaa gcc acg agt ctg
gtt gat gct gtg aac agt gac 2832Gly Ala Lys Thr Lys Ala Thr Ser Leu
Val Asp Ala Val Asn Ser Asp930 935 940gct gcc aag ccc agc cag ccg
gga gag ggc ctc aaa aag ccc gtg ctc 2880Ala Ala Lys Pro Ser Gln Pro
Gly Glu Gly Leu Lys Lys Pro Val Leu945 950 955 960ccg gcc act cca
aag cca cag tcc gcc aag ccg tcg ggg acc ccc atc 2928Pro Ala Thr Pro
Lys Pro Gln Ser Ala Lys Pro Ser Gly Thr Pro Ile965 970 975agc cca
gcc ccc gtt ccc tcc acg ttg cca tca gca tcc tcg gcc ctg 2976Ser Pro
Ala Pro Val Pro Ser Thr Leu Pro Ser Ala Ser Ser Ala Leu980 985
990gca ggg gac cag ccg tct tcc act gcc ttc atc cct ctc ata tca acc
3024Ala Gly Asp Gln Pro Ser Ser Thr Ala Phe Ile Pro Leu Ile Ser
Thr995 1000 1005cga gtg tct ctt cgg aaa acc cgc cag cct cca gag cgg
atc gcc 3069Arg Val Ser Leu Arg Lys Thr Arg Gln Pro Pro Glu Arg Ile
Ala1010 1015 1020agc ggc gcc atc acc aag ggc gtg gtc ctg gac agc
acc gag gcg 3114Ser Gly Ala Ile Thr Lys Gly Val Val Leu Asp Ser Thr
Glu Ala1025 1030 1035ctg tgc ctc gcc atc tct agg aac tcc gag cag
atg gcc agc cac 3159Leu Cys Leu Ala Ile Ser Arg Asn Ser Glu Gln Met
Ala Ser His1040 1045 1050agc gca gtg ctg gag gcc ggc aaa aac ctc
tac acg ttc tgc gtg 3204Ser Ala Val Leu Glu Ala Gly Lys Asn Leu Tyr
Thr Phe Cys Val1055 1060 1065agc tat gtg gat tcc atc cag caa atg
agg aac aag ttt gcc ttc 3249Ser Tyr Val Asp Ser Ile Gln Gln Met Arg
Asn Lys Phe Ala Phe1070 1075 1080cga gag gcc atc aac aaa ctg gag
aat aat ctc cgg gag ctt cag 3294Arg Glu Ala Ile Asn Lys Leu Glu Asn
Asn Leu Arg Glu Leu Gln1085 1090 1095atc tgc ccg gcg aca gca ggc
agt ggt ccg gcg gcc act cag gac 3339Ile Cys Pro Ala Thr Ala Gly Ser
Gly Pro Ala Ala Thr Gln Asp1100 1105 1110ttc agc aag ctc ctc agt
tcg gtg aag gaa atc agt gac ata gtg 3384Phe Ser Lys Leu Leu Ser Ser
Val Lys Glu Ile Ser Asp Ile Val1115 1120 1125cag agg tag 3393Gln
Arg113021130PRTHomo sapiens 2Met Leu Glu Ile Cys Leu Lys Leu Val
Gly Cys Lys Ser Lys Lys Gly1 5 10 15Leu Ser Ser Ser Ser Ser Cys Tyr
Leu Glu Glu Ala Leu Gln Arg Pro20 25 30Val Ala Ser Asp Phe Glu Pro
Gln Gly Leu Ser Glu Ala Ala Arg Trp35 40 45Asn Ser Lys Glu Asn Leu
Leu Ala Gly Pro Ser Glu Asn Asp Pro Asn50 55 60Leu Phe Val Ala Leu
Tyr Asp Phe Val Ala Ser Gly Asp Asn Thr Leu65 70 75 80Ser Ile Thr
Lys Gly Glu Lys Leu Arg Val Leu Gly Tyr Asn His Asn85 90 95Gly Glu
Trp Cys Glu Ala Gln Thr Lys Asn Gly Gln Gly Trp Val Pro100 105
110Ser Asn Tyr Ile Thr Pro Val Asn Ser Leu Glu Lys His Ser Trp
Tyr115 120 125His Gly Pro Val Ser Arg Asn Ala Ala Glu Tyr Leu Leu
Ser Ser Gly130 135 140Ile Asn Gly Ser Phe Leu Val Arg Glu Ser Glu
Ser Ser Pro Gly Gln145 150 155 160Arg Ser Ile Ser Leu Arg Tyr Glu
Gly Arg Val Tyr His Tyr Arg Ile165 170 175Asn Thr Ala Ser Asp Gly
Lys Leu Tyr Val Ser Ser Glu Ser Arg Phe180 185 190Asn Thr Leu Ala
Glu Leu Val His His His Ser Thr Val Ala Asp Gly195 200 205Leu Ile
Thr Thr Leu His Tyr Pro Ala Pro Lys Arg Asn Lys Pro Thr210 215
220Val Tyr Gly Val Ser Pro Asn Tyr Asp Lys Trp Glu Met Glu Arg
Thr225 230 235 240Asp Ile Thr Met Lys His Lys Leu Gly Gly Gly Gln
Tyr Gly Glu Val245 250 255Tyr Glu Gly Val Trp Lys Lys Tyr Ser Leu
Thr Val Ala Val Lys Thr260 265 270Leu Lys Glu Asp Thr Met Glu Val
Glu Glu Phe Leu Lys Glu Ala Ala275 280 285Val Met Lys Glu Ile Lys
His Pro Asn Leu Val Gln Leu Leu Gly Val290 295 300Cys Thr Arg Glu
Pro Pro Phe Tyr Ile Ile Thr Glu Phe Met Thr Tyr305 310 315 320Gly
Asn Leu Leu Asp Tyr Leu Arg Glu Cys Asn Arg Gln Glu Val Asn325 330
335Ala Val Val Leu Leu Tyr Met Ala Thr Gln Ile Ser Ser Ala Met
Glu340 345 350Tyr Leu Glu Lys Lys Asn Phe Ile His Arg Asp Leu Ala
Ala Arg Asn355 360 365Cys Leu Val Gly Glu Asn His Leu Val Lys Val
Ala Asp Phe Gly Leu370 375 380Ser Arg Leu Met Thr Gly Asp Thr Tyr
Thr Ala His Ala Gly Ala Lys385 390 395 400Phe Pro Ile Lys Trp Thr
Ala Pro Glu Ser Leu Ala Tyr Asn Lys Phe405 410 415Ser Ile Lys Ser
Asp Val Trp Ala Phe Gly Val Leu Leu Trp Glu Ile420 425 430Ala Thr
Tyr Gly Met Ser Pro Tyr Pro Gly Ile Asp Leu Ser Gln Val435 440
445Tyr Glu Leu Leu Glu Lys Asp Tyr Arg Met Glu Arg Pro Glu Gly
Cys450 455 460Pro Glu Lys Val Tyr Glu Leu Met Arg Ala Cys Trp Gln
Trp Asn Pro465 470 475 480Ser Asp Arg Pro Ser Phe Ala Glu Ile His
Gln Ala Phe Glu Thr Met485 490 495Phe Gln Glu Ser Ser Ile Ser Asp
Glu Val Glu Lys Glu Leu Gly Lys500 505 510Gln Gly Val Arg Gly Ala
Val Ser Thr Leu Leu Gln Ala Pro Glu Leu515 520 525Pro Thr Lys Thr
Arg Thr Ser Arg Arg Ala Ala Glu His Arg Asp Thr530 535 540Thr Asp
Val Pro Glu Met Pro His Ser Lys Gly Gln Gly Glu Ser Asp545 550 555
560Pro Leu Asp His Glu Pro Ala Val Ser Pro Leu Leu Pro Arg Lys
Glu565 570 575Arg Gly Pro Pro Glu Gly Gly Leu Asn Glu Asp Glu Arg
Leu Leu Pro580 585 590Lys Asp Lys Lys Thr Asn Leu Phe Ser Ala Leu
Ile Lys Lys Lys Lys595 600 605Lys Thr Ala Pro Thr Pro Pro Lys Arg
Ser Ser Ser Phe Arg Glu Met610 615 620Asp Gly Gln Pro Glu Arg Arg
Gly Ala Gly Glu Glu Glu Gly Arg Asp625 630 635 640Ile Ser Asn Gly
Ala Leu Ala Phe Thr Pro Leu Asp Thr Ala Asp Pro645 650 655Ala Lys
Ser Pro Lys Pro Ser Asn Gly Ala Gly Val Pro Asn Gly Ala660 665
670Leu Arg Glu Ser Gly Gly Ser Gly Phe Arg Ser Pro His Leu Trp
Lys675 680 685Lys Ser Ser Thr Leu Thr Ser Ser Arg Leu Ala Thr Gly
Glu Glu Glu690 695 700Gly Gly Gly Ser Ser Ser Lys Arg Phe Leu Arg
Ser Cys Ser Ala Ser705 710 715 720Cys Val Pro His Gly Ala Lys Asp
Thr Glu Trp Arg Ser Val Thr Leu725 730 735Pro Arg Asp Leu Gln Ser
Thr Gly Arg Gln Phe Asp Ser Ser Thr Phe740 745 750Gly Gly His Lys
Ser Glu Lys Pro Ala Leu Pro
Arg Lys Arg Ala Gly755 760 765Glu Asn Arg Ser Asp Gln Val Thr Arg
Gly Thr Val Thr Pro Pro Pro770 775 780Arg Leu Val Lys Lys Asn Glu
Glu Ala Ala Asp Glu Val Phe Lys Asp785 790 795 800Ile Met Glu Ser
Ser Pro Gly Ser Ser Pro Pro Asn Leu Thr Pro Lys805 810 815Pro Leu
Arg Arg Gln Val Thr Val Ala Pro Ala Ser Gly Leu Pro His820 825
830Lys Glu Glu Ala Glu Lys Gly Ser Ala Leu Gly Thr Pro Ala Ala
Ala835 840 845Glu Pro Val Thr Pro Thr Ser Lys Ala Gly Ser Gly Ala
Pro Gly Gly850 855 860Thr Ser Lys Gly Pro Ala Glu Glu Ser Arg Val
Arg Arg His Lys His865 870 875 880Ser Ser Glu Ser Pro Gly Arg Asp
Lys Gly Lys Leu Ser Arg Leu Lys885 890 895Pro Ala Pro Pro Pro Pro
Pro Ala Ala Ser Ala Gly Lys Ala Gly Gly900 905 910Lys Pro Ser Gln
Ser Pro Ser Gln Glu Ala Ala Gly Glu Ala Val Leu915 920 925Gly Ala
Lys Thr Lys Ala Thr Ser Leu Val Asp Ala Val Asn Ser Asp930 935
940Ala Ala Lys Pro Ser Gln Pro Gly Glu Gly Leu Lys Lys Pro Val
Leu945 950 955 960Pro Ala Thr Pro Lys Pro Gln Ser Ala Lys Pro Ser
Gly Thr Pro Ile965 970 975Ser Pro Ala Pro Val Pro Ser Thr Leu Pro
Ser Ala Ser Ser Ala Leu980 985 990Ala Gly Asp Gln Pro Ser Ser Thr
Ala Phe Ile Pro Leu Ile Ser Thr995 1000 1005Arg Val Ser Leu Arg Lys
Thr Arg Gln Pro Pro Glu Arg Ile Ala1010 1015 1020Ser Gly Ala Ile
Thr Lys Gly Val Val Leu Asp Ser Thr Glu Ala1025 1030 1035Leu Cys
Leu Ala Ile Ser Arg Asn Ser Glu Gln Met Ala Ser His1040 1045
1050Ser Ala Val Leu Glu Ala Gly Lys Asn Leu Tyr Thr Phe Cys Val1055
1060 1065Ser Tyr Val Asp Ser Ile Gln Gln Met Arg Asn Lys Phe Ala
Phe1070 1075 1080Arg Glu Ala Ile Asn Lys Leu Glu Asn Asn Leu Arg
Glu Leu Gln1085 1090 1095Ile Cys Pro Ala Thr Ala Gly Ser Gly Pro
Ala Ala Thr Gln Asp1100 1105 1110Phe Ser Lys Leu Leu Ser Ser Val
Lys Glu Ile Ser Asp Ile Val1115 1120 1125Gln Arg1130
* * * * *