U.S. patent application number 12/292683 was filed with the patent office on 2009-07-30 for antibody fragment-targeted immunoliposomes for systemic gene delivery.
This patent application is currently assigned to SynerGene Therapeutics, Inc.. Invention is credited to William Alexander, Esther H. Chang, Cheng-Cheng Huang, WenHua Tang, Liang Xu.
Application Number | 20090191261 12/292683 |
Document ID | / |
Family ID | 22394769 |
Filed Date | 2009-07-30 |
United States Patent
Application |
20090191261 |
Kind Code |
A1 |
Xu; Liang ; et al. |
July 30, 2009 |
Antibody fragment-targeted immunoliposomes for systemic gene
delivery
Abstract
Nucleic acid-immunoliposome compositions useful as therapeutic
agents are disclosed. These compositions preferably comprise (i)
cationic liposomes, (ii) a single chain antibody fragment which
binds to a transferrin receptor, and (iii) a nucleic acid encoding
a wild type p53. These compositions target cells which express
transferrin receptors, e.g., cancer cells. These compositions can
be used therapeutically to treat persons or animals who have
cancer, e.g., head and neck cancer, breast cancer or prostate
cancer.
Inventors: |
Xu; Liang; (Ann Arbor,
MI) ; Huang; Cheng-Cheng; (Fairfax, VA) ;
Alexander; William; (Rockville, MD) ; Tang;
WenHua; (Ann Arbor, MI) ; Chang; Esther H.;
(Potomac, MD) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
SynerGene Therapeutics,
Inc.
Washington
DC
Georgetown University
Washington
DC
|
Family ID: |
22394769 |
Appl. No.: |
12/292683 |
Filed: |
November 24, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09914046 |
Oct 1, 2001 |
7479276 |
|
|
PCT/US00/04392 |
Feb 22, 2000 |
|
|
|
12292683 |
|
|
|
|
60121133 |
Feb 22, 1999 |
|
|
|
Current U.S.
Class: |
424/450 ;
424/178.1 |
Current CPC
Class: |
A61P 35/00 20180101;
A61K 9/0019 20130101; C12N 2810/859 20130101; C12N 2810/85
20130101; C12N 15/86 20130101; C12N 2710/10343 20130101; A61K
47/6849 20170801; A61K 47/6913 20170801; A61K 9/1271 20130101; A61K
48/0008 20130101; A61K 9/1272 20130101 |
Class at
Publication: |
424/450 ;
424/178.1 |
International
Class: |
A61K 9/127 20060101
A61K009/127; A61K 39/395 20060101 A61K039/395 |
Claims
1. A method of delivering a nucleic acid molecule to an animal,
comprising administering to said animal a therapeutically effective
amount of a nucleic acid-cationic immunoliposome complex comprising
(i) a cationic liposome, (ii) an scFv antibody fragment, and (iii)
a nucleic acid, wherein said nucleic acid-cationic immunoliposome
complex is prepared by a method comprising: (a) preparing said
antibody fragment; (b) directly conjugating said antibody fragment
to said cationic liposome to form a cationic immunoliposome,
wherein said conjugation occurs via a sulfur atom which was part of
a sulfhydryl group at the carboxy terminus on said antibody
fragment prior to said conjugation; and (c) mixing said cationic
immunoliposome with said nucleic acid to form said nucleic
acid-cationic immunoliposome complex; wherein said antibody
fragment and said cationic liposome are present at a protein:lipid
ratio (w:w) in the range of 1:10 to 1:40 and wherein said nucleic
acid and said cationic liposome are present at a nucleic acid:lipid
(1 g:nmol) ratio in the range of 1:6 to 1:20.
2. The method of claim 1, wherein said complex is administered
systemically.
3. The method of claim 1, wherein said complex is administered
intravenously.
4. The method of claim 1, wherein said antibody fragment is capable
of binding to a transferrin receptor.
5. The method of claim 1, wherein said nucleic acid is DNA.
6. The method of claim 1, wherein said nucleic acid encodes a wild
type p53.
7. The method of claim 1, wherein said sulfur atom is part of a
cysteine residue.
8. The method of claim 1, wherein said antibody fragment is
covalently bound to dioleoylphosphatidylethanolamine (DOPE) linked
to 4-(p maleimidophenyl)butyrate (MPB) or other sulfhydryl reacting
group.
9. The method of claim 1, wherein said complex comprises a cationic
liposome, an antibody fragment capable of binding to a transferrin
receptor and a nucleic acid complex encoding a wild type p53.
10. The method of claim 1, wherein said cationic liposome comprises
a cationic lipid and a neutral or helper lipid, and wherein said
cationic lipid is dioleoyltrimethylammonium-propane (DOTAP) or
dimethyldioctadecylammonium bromide (DDAB), and said neutral or
helper lipid is dioleoylphosphatidylethanolamine (DOPE) and/or
cholesterol.
11. The method of claim 1, wherein said neutral or helper lipid
comprises dioleoylphosphatidylethanolamine (DOPE).
12. The method of claim 1, wherein said antibody fragment and said
cationic liposome are present at a protein:lipid ratio (w:w) in the
range of 1:10 to 1:20.
13. The method of claim 1, wherein said antibody fragment is a
transferrin single chain antibody fragment (TfRscFv).
14. The method of claim 1, wherein said antibody fragment is a
transferrin single chain antibody fragment (TfRscFv), said antibody
fragment and said cationic liposome are present at a protein:lipid
ratio (w:w) in the range of 1:10 to 1:20.
15. The method of claim 1, wherein said nucleic acid and said
cationic liposome are present at a nucleic acid:lipid (.mu.g:nmol)
ratio in the range of 1:10 to 1:14.
16. The method of claim 1, wherein said animal is a human.
17. The method of claim 1, wherein said animal has cancer.
18. A method of delivering a nucleic acid molecule to an animal,
comprising administering to said animal a therapeutically effective
amount of a nucleic acid-cationic immunoliposome complex comprising
(i) a cationic liposome, (ii) an scFv antibody fragment, and (iii)
a nucleic acid, wherein said nucleic acid-cationic immunoliposome
complex is prepared by a method comprising: (a) preparing said
antibody fragment; (b) directly conjugating said antibody fragment
to said cationic liposome to form a cationic immunoliposome,
wherein said conjugation occurs via a sulfur atom which was part of
a sulfhydryl group at the carboxy terminus on said antibody
fragment prior to said conjugation; and (c) mixing said cationic
immunoliposome with said nucleic acid to form said nucleic
acid-cationic immunoliposome complex; wherein said antibody
fragment and said cationic liposome are present at a protein:lipid
ratio (w:w) in the range of 1:10 to 1:20 and wherein said nucleic
acid and said cationic liposome are present at a nucleic acid:lipid
(.mu.g:nmol) ratio in the range of 1:10 to 1:14.
19. The method of claim 18, wherein said antibody fragment is a
transferrin single chain antibody fragment (TfRscFv), and said
nucleic acid encodes a wild type p53.
20. The method of claim 19, wherein the animal is a human that has
cancer.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 09/914,046, filed Oct. 1, 2001. application Ser. No. 09/914,046
is a National Phase Filing under 35 U.S.C. .sctn. 371 of
International Application No. PCT/US00/04392, filed Feb. 22, 2000,
which published in the English language as WO 00/50008, on Aug. 31,
2000, and which claims the benefit of U.S. Application No.
60/121,133, filed Feb. 22, 1999. The disclosures of each of these
applications are hereby incorporated by reference herein in their
entireties.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention provides methods for the preparation of
antibody fragment-targeted liposomes ("immunoliposomes"), including
lipid-tagged antibody fragment-targeted liposomes, methods for in
vitro transfection using the immunoliposomes, and methods for
systemic gene delivery in vivo. The liposomes of the present
invention are useful for carrying out targeted gene delivery and
efficient gene expression after systemic administration. The
specificity of the delivery system is derived from the targeting
antibody fragments.
[0004] 2. Background Art
[0005] An ideal therapeutic for cancer would be one that
selectively targets a cellular pathway responsible for the tumor
phenotype and which is nontoxic to normal cells. While cancer
treatments involving gene therapy have substantial promise, there
are many issues that need to be addressed before this promise can
be realized. Perhaps foremost among the issues associated with
macromolecular treatments is the efficient delivery of the
therapeutic molecules to the site(s) in the body where they are
needed. A variety of delivery systems (a.k.a. "vectors") have been
tried including viruses and liposomes. The ideal delivery vehicle
would be one that could be systemically (as opposed to locally)
administered and which would thereafter selectively target tumor
cells wherever they occur in the body.
[0006] The infectivity that makes viruses attractive as delivery
vectors also poses their greatest drawback. Consequently, a
significant amount of attention has been directed towards non-viral
vectors for the delivery of molecular therapeutics. The liposome
approach offers a number of advantages over viral methodologies for
gene delivery. Most significantly, since liposomes are not
infectious agents capable of self-replication, they pose no risk of
transmission to other individuals. Targeting cancer cells via
liposomes can be achieved by modifying the liposomes so that they
selectively deliver their contents to tumor cells. There now exists
a significant knowledge base regarding specific molecules that
reside on the exterior surfaces of certain cancer cells. Such cell
surface molecules can be used to target liposomes to tumor cells,
because the molecules that reside upon the exterior of tumor cells
differ from those on normal cells.
[0007] The publications and other materials used herein to
illuminate the background of the invention or provide additional
details respecting the practice, are incorporated by reference.
[0008] Current somatic gene therapy approaches employ either viral
or non-viral vector systems. Many viral vectors allow high gene
transfer efficiency but are deficient in certain areas (Ledley F D,
et al. Hum. Gene Ther. (1995) 6:1129-1144). Non-viral gene transfer
vectors circumvent some of the problems associated with using viral
vectors. Progress has been made toward developing non-viral,
pharmaceutical formulations of genes for in vivo human therapy,
particularly cationic liposome-mediated gene transfer systems
(Massing U, et al., Int. J. Clin. Pharmacol. Ther. (1997)
35:87-90). Features of cationic liposomes that make them versatile
and attractive for DNA delivery include: simplicity of preparation;
the ability to complex large amounts of DNA; versatility in use
with any type and size of DNA or RNA; the ability to transfect many
different types of cells, including non-dividing cells; and lack of
immunogenicity or biohazardous activity (Felgner P L, et al., Ann.
NY Acad. Sci. (1995) 772:126-139; Lewis J G, et al., Proc. Natl.
Acad. Sci. USA (1996) 93:3176-3181). More importantly from the
perspective of human cancer therapy, cationic liposomes have been
proven to be safe and efficient for in vivo gene delivery (Aoki K
et al., Cancer Res. (1997) 55:3810-3816; Thierry A R, Proc. Natl.
Acad. Sci. USA (1997) 92:9742-9746). More than thirty clinical
trials are now underway using cationic liposomes for gene therapy
(Zhang W et al., Adv. Pharmacology (1997) 32:289-333; RAC Committee
Report: Human Gene Therapy Protocols-December 1998), and liposomes
for delivery of small molecule therapeutics (e.g., antifungal and
conventional chemotherapeutic agents) are already on the market
(Allen T M, et al., Drugs (1997) 54 Suppl 4:8-14).
[0009] The transfection efficiency of cationic liposomes can be
dramatically increased when they bear a ligand recognized by a cell
surface receptor. Receptor-mediated endocytosis represents a highly
efficient internalization pathway present in eukaryotic surface
(Cristiano R J, et al., Cancer Gene Ther. (1996) 3:49-57, Cheng P
W, Hum. Gene Ther. (1996) 7:275-282). The presence of a ligand on a
liposome facilitates the entry of DNA into cells through initial
binding of ligand by its receptor on the cell surface followed by
internalization of the bound complex. A variety of ligands have
been examined for their liposome-targeting ability, including
transferrin and folate (Lee R J, et al., J. Biol. Chem. (1996)
271:8481-8487). Transferrin receptors (TfR) levels are elevated in
various types of cancer cells including prostate cancers, even
those prostate cell lines derived from human lymph node and bone
metastases (Keer H N et al., J. Urol. (1990) 143:381-385);
Chackal-Roy M et al., J. Clin. Invest. (1989) 84:43-50; Rossi M C,
et al., Proc. Natl. Acad. Sci. USA (1992) 89:6197-6201; Grayhack J
T, et al., J. Urol. (1979) 121:295-299). Elevated TfR levels also
correlate with the aggressive or proliferative ability of tumor
cells (Elliot R L, et al., Ann. NY Acad. Sci. (1993) 698:159-166).
Therefore, TfR levels are considered to be useful as a prognostic
tumor marker, and TfR is a potential target for drug delivery in
the therapy of malignant cells (Miyamoto T, et al., Int. J. Oral
Maxillofac. Surg. (1994) 23:430-433: Thorstensen K, et al., Scand.
J. Clin. Lab. Invest. Suppl. (1993) 215:113-120). In our
laboratory, we have prepared transferrin-complexed cationic
liposomes with tumor cell transfection efficiencies in SCCHN of
60%-70%, as compared to only 5-20% by cationic liposomes without
ligand (Xu L, et al., Hum. Gene Ther. (1997) 8:467-475).
[0010] In addition to the use of ligands that are recognized by
receptors on tumor cells, specific antibodies can also be attached
to the liposome surface (Allen T M et al., (1995) Stealth
Liposomes, pp. 233-244) enabling them to be directed to specific
tumor surface antigens (including but not limited to receptors)
(Allen T M, Biochim. Biophys. Acta (1995) 1237:99-108). These
"immunoliposomes," especially the sterically stabilized
immunoliposomes, can deliver therapeutic drugs to a specific target
cell population (Allen T M, et al., (1995) Stealth Liposomes, pp.
233-244). Park, et al. (Park J W, et al., Proc. Natl. Acad. Sci.
USA (1995) 92:1327-1331) found that anti-HER-2 monoclonal antibody
(Mab) Fab fragments conjugated to liposomes could bind specifically
to HER-2 overexpressing breast cancer cell line SK-BR-3. The
immunoliposomes were found to be internalized efficiently by
receptor-mediated endocytosis via the coated pit pathway and also
possibly by membrane fusion. Moreover, the anchoring of anti-HER-2
Fab fragments enhanced their inhibitory effects. Doxorubicin-loaded
anti-HER-2 immunoliposomes also showed significant and specific
cytotoxicity against target cells in vitro and in vivo (Park J W,
et al., Proc. Natl. Acad. Sci. USA (1995) 92:1327-1331). In
addition, Suzuki et al., (Suzuki S, et al., Br. J. Cancer (1997)
76:83-89) used an anti-transferrin receptor monoclonal antibody
conjugated immunoliposome to deliver doxorubicin more effectively
in human leukemia cells in vitro. Huwyler et al. (Huwyler J, et
al., Proc. Natl. Acad. Sci. USA (1996) 93:14164-14169) used
anti-TfR monoclonal antibody immunoliposome to deliver daunomycin
to rat glioma (RT2) cells in vivo. This PEGylated immunoliposome
resulted in a lower concentration of the drug in normal tissues and
organs. These studies demonstrated the utility of immunoliposomes
for tumor-targeting drug delivery. It should be noted that the
immunoliposome complexes used by Suzuki et al. and Huwyler et al.
differ from those of the invention described herein in that they
are anionic liposomes and that the methods used by Suzuki et al.
and Huwyler et al. are not capable of delivering nucleic acids.
Single-Chain Antibody Fragments
[0011] Progress in biotechnology has allowed the derivation of
specific recognition domains from Mab (Poon R Y, (1997)
Biotechnology International: International Developments in the
Biotechnology Industry, pp. 113-128). The recombination of the
variable regions of heavy and light chains and their integration
into a single polypeptide provides the possibility of employing
single-chain antibody derivatives (designated scFv) for targeting
purposes. Retroviral vectors engineered to display scFv directed
against carcinoembryonic antigen, HER-2, CD34, melanoma associated
antigen and transferrin receptor have been developed (Jiang A, et
al., J. Virol. (1998) 72:10148-10156, Konishi H, et al., Hum. Gene
Ther. (1994) 9:235-248: Martin F, et al., Hum. Gene Ther. (1998)
9:737-746). These scFv directed viruses have been shown to target,
bind to and infect specifically the cell types expressing the
particular antigen. Moreover, at least in the case of the
carcinoembryonic antigen, scFv was shown to have the same cellular
specificity as the parental antibody (Nicholson I C, Mol. Immunol.
(1997) 34:1157-1165).
[0012] The combination of cationic liposome-gene transfer and
immunoliposome techniques appears to be a promising system for
targeted gene delivery.
BRIEF SUMMARY OF THE INVENTION
[0013] We constructed a variety of immunoliposomes that are capable
of tumor-targeted, systemic delivery of nucleic acids for use in
human gene therapy. Based upon the data given in the Examples below
these immunoliposome-DNA complexes incorporating the TfRscFv are
capable of producing a much higher level of transfection efficiency
than the same liposome-DNA complex bearing the complete Tf
molecule. Therefore, in one aspect of the invention the
immunoliposomes of the invention can be used to produce a kit for
high efficiency transfection of various mammalian cell types that
express the transferrin receptor. In one aspect of the invention,
we constructed an scFv protein with a lipid tag such that the lipid
is added naturally by the bacterial cell to allow easy
incorporation of the scFv into liposomes while also avoiding
chemical reactions which can inactivate the scFv.
[0014] The lipid-tagged scFv-immunoliposomes are prepared basically
by two methods: a lipid-film solubilization method and a direct
anchoring method. The lipid-film solubilization method is modified
from the detergent dialysis method, which was described by
Laukkanen M L, et al., (Laukkanen M L, et al., Biochemistry (1994)
33:11664-11670) and de Kruif et al., (de Kruif et al., FEBS Lett.
(1996) 399:232-236) for neutral or anionic liposomes, with the
methods of both hereby incorporated by reference. This method is
suitable for attaching lipid-tagged scFv to cationic liposomes as
well. In the lipid-film solubilization method, the lipids in
chloroform are evaporated under reduced pressure to obtain a dry
lipid film in a glass round-bottom flask. The lipid film is then
solubilized with 0.5-4%, preferably 1%, n-octyl .beta.-D-glucoside
(OG) containing the lipid-modified scFv and vortexed. After
dilution with sterile water, the solution is briefly sonicated to
clarity.
[0015] The second method for attaching lipid-tagged antibodies or
antibody fragments is the direct anchoring method that is
specifically useful for attaching the E. coli lipoprotein
N-terminal 9 amino acids to an scFv (lpp-scFv) or other
lipid-modified antibody or fragments and attaching these to
preformed liposomes. For attaching the scFv to preformed liposomes,
the lipid-modified scFv in 1% OG is added to preformed liposomes
while vortexing, at volume ratios from 1:3 to 1:10. The mixture is
vortexed for approximately a further 5-10 minutes to obtain a clear
solution of scFv-immunoliposomes. The remaining OG and the
uncomplexed scFv can be eliminated by chromatography, although they
will not interfere very much with the subsequent usage. Separation
experiments, i.e., ultrafiltration with Centricon-100 (Amicon),
Ficoll-400 floatation (Shen D F, et al., Biochim. Biophys. Acta
(1982) 689: 31-37), or Sepharose CL-4B (Pharmacia) chromatography,
demonstrated that virtually all the lipid-tagged scFv molecules
added have been attached or anchored to the cationic liposomes.
This is an improvement over the much lower attachment rate of
lpp-scFv to neutral or anionic liposomes. Therefore, this
improvement makes it unnecessary to include a further purification
step to remove the unattached scFv.
[0016] Any antibodies, antibody fragments, or other peptide/protein
ligands that can be modified to have one or more lipid-tags on the
surface are useful in the present invention. Other
lipid-modification methods include directly conjugating a lipid
chain to an antibody or fragment, as described in Liposome
Technology, 2nd Ed., Gregoriadis, G., Ed., CRC Press, Boca Raton,
Fla., 1992.
[0017] In another aspect of the invention a cysteine was added at
the C-terminus of the scFv sequence and the protein was expressed
in the inclusion bodies of E. coli, then refolded to produce active
scFv. The C-terminal cysteine provided a free sulfhydryl group to
facilitate the conjugation of the scFv to liposomes. There are two
strategies which can be used in the conjugation process. 1)
Pre-linking method: The first step is to conjugate the scFv-SH with
the cationic liposome which contains a maleimidyl group or other
sulfhydryl-reacting group, to make the scFv-liposome. The nucleic
acids are then added to the scFv-liposome to form the
scFv-liposome-DNA complex. The pre-linking is designated since scFv
is linked before DNA complexing. 2) Post-linking method: This
strategy is to complex the cationic liposome with nucleic acids
first to form a condensed structure. The scFv-SH is then linked
onto the surface of DNA-liposome complex to produce
scFv-liposome-DNA. The post-linking is designated since scFv is
linked after DNA complexing. The post-linking strategy ensures that
100% of scFv linked are on the surface of the complex, accessible
to receptor binding. Therefore, this method can make a better use
of the targeting ligand scFv and a better controlled inside
structure of the complex.
[0018] The nucleic acid-immunoliposome complexes, regardless of
whether the antibody or antibody fragment is lipid tagged or
conjugated to the liposome, can be used therapeutically. Preferably
the complexes are targeted to a site of interest, preferably to a
cell which is a cancer cell, more preferably to a cell expressing a
transferrin receptor. The targeting agent is the antibody or
antibody fragment which preferably binds to a transferrin receptor.
The nucleic acid is the therapeutic agent and is preferably a DNA
molecule and more preferably encodes a wild type p53 molecule. The
nucleic acid-immunoliposome complexes, preferably in a therapeutic
composition, can be administered systemically, preferably
intravenously.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0019] FIG. 1 show scFv TfR lipid-tag construction.
[0020] FIG. 2 shows a Western blot analysis of
scFv-liposome-targeted p53 expression in vivo in tumor xenografts
with systemic administration.
[0021] FIG. 3 shows pCMVp53 and pCMVpRO constructs.
[0022] FIG. 4 shows p53-3'Ad construction.
[0023] FIG. 5 shows construction of scFvTfR-cysteine with a His
tag.
[0024] FIG. 6 shows construction of scFvTfR-cysteine without a His
tag.
[0025] FIG. 7 shows construction of scFvTfR-cysteine with a
cellulose binding domain (CBD) tag and with an S-tag.
[0026] FIG. 8 shows a Coomassie Blue stained SDS-polyacrylamide gel
of purified TfRscFv protein produced by the conjugation method.
[0027] FIG. 9 shows a Western blot analysis of conjugation method
produced TfRscFv-liposome-targeted p53 expression in vivo in tumor
xenografts with systemic administration.
DETAILED DESCRIPTION OF THE INVENTION
[0028] The invention is directed to immunoliposomes and methods of
making and using these immunoliposomes. A variety of embodiments
are disclosed including immunoliposomes with different tags and
various methods with which to attach the scFv to the liposomes. The
immunoliposomes may include lipid tags or be linked through a
reducing group, which in a preferred embodiment is a free
sulfhydryl.
[0029] Mutant forms of the tumor suppressor gene p53 have been
associated with more than 50% of human cancers, including 15-50% of
breast and 25-70% of metastatic prostate cancers. Abnormalities in
p53 also correlate with poor prognosis in various types of
malignancies. Therefore, the capability to systemically deliver and
target gene therapy specifically to tumors to efficiently restore
wtp53 function will be an important therapeutic modality in cancer
treatment. Thus the immunoliposomes produced by the method of this
invention will be useful as an effective new cancer therapeutic
modality not just for restoration of wtp53 function but also as a
tumor targeted systemic delivery vehicle for other therapeutic
genes.
[0030] The invention is illustrated by the following Examples.
Example 1
Construction and Expression of Biosynthetically Lipid-Tagged
scFv
1. Construction of the Expression Vector for TfRscFv
[0031] To construct the expression vector, we used the vector pLP1
which contains an amino acid linker sequence between the E. coli
lipoprotein signal peptide (ssLPP) and the scFv cloning site (de
Kruif et al., FEBS Lett. (1996) 399:232-236). This vector contains
both c-myc and His.sub.6 tag sequences that can be used for
purification and detection of the expressed scFv (FIG. 1).
[0032] We obtained a plasmid expression vector, pDFH2T-vecOK, which
contains the single chain fragment for the 5E9 (Haynes et al., J.
Immunol. (1981) 127:347-351) antibody linked to a DNA binding
protein, which recognizes the human transferrin receptor (TfR).
This vector also contains the sequence for a DNA binding protein,
and there are no unique restriction enzyme sites flanking the scFv
sequence in pDFH2T-vecOK. Therefore, we cloned the
VH-linker-V.kappa. scFv by PCR amplification of the desired
fragment using a 5' primer (5' GGCCCATGGAGGTGCAGCTGGTGG 3' (SEQ ID
NO:1)) (RB551) containing an NcoI site and a 3' primer (RB552) (5'
CCGGAATTCGCGGCCGCTTTTATCTCCAGCTTGGTC 3' (SEQ ID NO:2) containing a
NotI site. The PCR amplification using primers RB551 and RB552
amplified the scFv for TfR from pDFH2T-vecOK from the Met at base
81 to Lys at base 821. The pLP1 vector also contains sequences for
the E. coli lipoprotein signal peptide (ssLPP) and the E. coli
lipoprotein N-terminal 9 amino acids (LPP), as described by
Laukkanen M L, et al., (Laukkanen M L, et al., Biochemistry (1994)
33:11664-11670) and de Kruif et al (de Kruif et al., FEBS Lett.
(1996) 399:232-236). The insertion of these sequences will lead to
fatty acid acylation of the expressed signal in the E. coli host
and its insertion into the bacterial membrane. The vector also has
a non-critical 10 amino acid linker sequence to increase the space
between the lipid-tag site and the scFv. Purification of the lipid
modified scFv sequence from the bacterial membrane results in an
active molecule that can be attached or inserted into
liposomes.
2. Expression and Purification of the TfRscFv
[0033] We transformed E. coli expression host SF110 F' with the
expression vector constructed above. While the host cell is not
critical it is preferred that it contain expressed lac repressor. A
number of clones were selected and the one that produces the best
yield of scFv was chosen. The lipid-modified scFv (lpp-scFv) was
isolated from the bacterial membrane using Triton X-100 as
described by de Kruif et al., (de Kruif et al., FEBS Lett. (1996)
399:232-236). For purification a single colony was resuspended in
200 .mu.l LB containing 5% glucose and the appropriate antibiotics.
The mixture was plated onto two 90 mm LB agar plates containing 5%
glucose and the appropriate antibiotics and grown overnight. The
next day, the cells were washed from the plates and used to
inoculate a total of 5 liters of LB containing 0.1% glucose and the
appropriate antibiotics. The cultures were grown at 25EC, at 200
rpm for 6 hours until the OD.sub.600 reached 0.5 to 0.7. IPTG was
added to a final concentration of 1 mM and the cultures were
further incubated overnight. The next day, the bacterial cultures
were collected by centrifugation and lysed in 200 ml lysis buffer
at room temperature for 30 minutes. The sample was sonicated at 28
watts for 5 minutes with cooling on ice. The lysis buffer contains
20 mM HEPES pH 7.4 to 7.9, 0.5 M NaCl, 10% glycerol, and 0.1 mM
PMSF. The only deviations from the cited protocol include washing
and elution of metal affinity columns in buffer containing 20 mM
HEPES pH 7.4 to 7.9, 0.5 M NaCl, 10% glycerol, 0.1 mM PMSF, 1%
n-octyl .beta.-D-glucoside (OG), and 10% glycerol containing 20 and
200 mM imidazole, respectively. The eluted samples of lpp-scFv were
analyzed by SDS-PAGE and Western Blot using anti-c-myc antibody 9E
10 which confirmed that the purified scFv showed a band of the size
of about 30 kDa.
Example 2
Preparation of Lipid-Tagged ScFv-Immunoliposomes by a Lipid-Film
Solubilization Method
[0034] This example discloses a detailed procedure of lipid-film
solubilization method to prepare lipid-tagged scFv-immunoliposomes.
5 .mu.mol lipids (DOTAP/DOPE, 1:1 molar ratio) in chloroform are
evaporated under reduced pressure to obtain a dry lipid film in a
glass round-bottom flask. To the lipid film is added 0.5 ml 1% OG,
20 mM HEPES, 150 mM NaCl, pH 7.4, containing the lipid-modified
scFv. This is incubated 10-20 minutes at room temperature and then
vortexed to solubilize the lipid membrane. 2 ml sterile water is
then added to dilute the scFv-lipid mixture. The solution is
briefly sonicated to clarity in a bath-type sonicator at 20.degree.
C. The scFv-liposome is a clear solution with a limited amount of
detergent OG left. The OG and the uncomplexed scFv can be
eliminated by chromatography with Sepharose CL-4B or Sephacryl
S500, even though they do not interfere a lot with the subsequent
use.
Example 3
Preparation of Lipid-Tagged ScFv-Immunoliposomes by a Direct
Anchoring Method
[0035] This example provides a direct anchoring method to prepare
lipid-tagged scFv-immunoliposomes. 20 .mu.mol lipids (LipA-H, see
below for compositions and ratios) prepared as dry lipid film in a
glass round-bottom flask is added to 10 ml pure water and sonicated
in a bath-type sonicator for 10-30 min at room temperature (LipA,
B, C) or at 65.degree. C. (LipD, E, G, H, or any composition with
Cholesterol (Chol)). The cationic liposomes prepared are clear
solutions, their compositions and ratios are as follows:
TABLE-US-00001 LipA DOTAP/DOPE 1:1 molar ratio LipB DDAB/DOPE 1:1
molar ratio LipC DDAB/DOPE 1:2 molar ratio LipD DOTAP/Chol 1:1
molar ratio LipE DDAB/Chol 1:1 molar ratio LipG DOTAP/DOPE/Chol
2:1:1 molar ratio LipH DDAB/DOPE/Chol 2:1:1 molar ratio
[0036] For attaching the scFv to preformed liposomes, the
lipid-modified scFv (Ipp-scFv) in 20 mM HEPES, 150 mM NaCl, pH 7.4,
containing 1% OG is added to preformed liposomes while vortexing,
at volume ratios from 1:3 to 1:10. The mixture is vortexed for a
further 1 to 5 min to get a clear solution of scFv-immunoliposomes.
The remaining OG and the uncomplexed scFv can be eliminated by
chromatography, although they do not interfere very much with the
subsequent usage. Separation experiments, i.e., ultrafiltration
with Centricon-100 (Amicon), Ficoll-400 floatation (Shen D F, et
al., Biochim Biophys Acta (1982) 689:31-37), or Sepharose CL-4B
(Pharmacia) chromatography, demonstrated that virtually all the
lipid-tagged scFv added have been attached or anchored to the
cationic liposomes. This is in contrast to the much lower
attachment rate of Ipp-scFv to neutral or anionic liposomes.
Therefore, it is unnecessary to have a further purification step to
get rid of the unattached scFv.
Example 4
Immunoreactivity of Lipid-tagged scFv-immunoliposomes Revealed by
ELISA, FACS and Immunofluorescence
[0037] This example provides the characterization of the anti-TfR
scFv-immunoliposomes with respect to their ability of binding to
the TfR(+) cells. The human prostate cancer cell line DU145 and the
human squamous cell carcinoma of head and neck cell line JSQ-3
served as the TfR+ target cells for these studies.
[0038] Indirect cellular enzyme-linked immunosorbent assay (ELISA)
was employed to determine the immunoreactivity of the Ipp-scFv
before and after attachment to liposomes. Confluent JSQ-3 cells in
96-well plates were fixed with 0.5% glutaraldehyde in PBS for 10
min at room temperature. The plate was blocked with 5% fetal bovine
serum (FBS) in PBS at 30.degree. C. for 30 min. The Ipp-scFv,
scFv-immunoliposomes and liposomes were added to wells in duplicate
and incubated at 4.degree. C. overnight. After three PBS-washes, an
anti-c-myc monoclonal antibody was added to each well in 3% FBS in
PBS and incubated at 37.degree. C. for 60 min. After three
PBS-washes, HRP-labeled goat-anti-mouse IgG (Sigma) diluted in 3%
FBS was added to each well and incubated for 30 min at 37.degree.
C. The plate was washed three times with PBS and 100 .mu.l
substrate 0.4 mg/ml OPD in citrate phosphate buffer (Sigma) was
added to each well. The color-development was stopped by adding 100
.mu.l 2 M sulfuric acid to each well. The plate was read by an
ELISA plate reader (Molecular Devices Corp.) at 490 nm. Indirect
cellular ELISA demonstrated that the anti-TfR scFv retained its
immunoreactivity after incorporation into the liposome complex
(Table 1).
TABLE-US-00002 TABLE 1 Binding of anti-TfR scFv-liposomes to JSQ-3
cells* Lip(A) only 0.142 .+-. 0.036 scFv-LipA1 1.134 .+-. 0.038
scFv-LipA2 1.386 .+-. 0.004 lpp-scFv 0.766 .+-. 0.009 *ELISA,
OD.sub.490, Mean .+-. SD scFv-LipA1: by lipid-film solubilization
method. scFv-LipA2: by direct anchoring method.
[0039] For FACS analysis, anti-TfR scFv-Lip(A), was incubated at
4.degree. C. with JSQ-3 and DU145 cells, then with FITC-labeled
sheep anti-mouse IgG, also at 4.degree. C. Incubation of JSQ-3
cells with the scFv-Lip(A) resulted in a fluorescence shift
identical to that observed with the unattached free anti-TfR
lpp-scFv antibody, demonstrating a significant amount of binding to
the target cells. In contrast, the untargeted liposome demonstrated
very low binding to the cells. Similar results were observed with
prostate tumor cell line DU145. Here also, the scFv-Lip(A) complex
demonstrated clear, substantial binding to the tumor cells, as
compared to the untargeted Lip(A). The FACS data is summarized in
Table 2, where the fluorescence shift is indicated as the percent
of the cells displaying fluorescence above the threshold level
(percent of positive cells). In these studies also, the level of
binding to the cells, represented by the percent of positive cells,
was similar to that of the unattached free scFv further indicating
that incorporation into the liposome complex did not inactivate the
immunological activity of the anti-TfR lpp-scFv. It should be noted
that the liposome preparation used for these initial experiments
with DU145 was that optimized for JSQ-3 cells. Therefore, the
binding of the scFv-targeted liposome complex to the prostate tumor
cells can be further enhanced by the use of the liposome complex
optimized for this cell type.
TABLE-US-00003 TABLE 2 FACS Analysis of TfRscFv-liposome Binding to
JSQ-3 and DU145 JSQ-3 DU145 Transfected by % Positive Mean.sup.a %
Positive Mean.sup.a Untransfected 3.46 4.07 2.22 3.40 Lip(A) 9.69
6.26 4.51 4.07 scFv-LipA1 86.38 19.8 50.19 12.40 scFv-LipA2 89.58
21.30 39.52 11.1 Free lpp-scFv 85.09 21.30 78.09 18.40 HB21.sup.b
99.44 69.80 98.70 64.90 .sup.aMean of the relative fluorescence
.sup.bParental monoclonal antibody of the anti-TfR scFv
[0040] Indirect immunofluorescence staining with scFv-liposome
(where Lip(A) had been labeled with rhodamine-DOPE) and
FITC-labeled anti-mouse IgG following anti-c-myc antibody,
confirmed the binding of the scFv-targeted liposome complex to the
JSQ-3 cells. The concurrence of the red and green fluorescence in
the transfected cells demonstrates that the anti-TfR scFv
(indicated by the FITC-labeled anti-c-myc antibody as green
fluorescence) does indeed direct the rhodamine-labeled Lip(A) to
the cells. Moreover, the high level of cellular binding of the
scFv-Lip(A) system is demonstrated by the large percentage of
red/green double-positive fluorescent cells.
Example 5
Optimization of scFv-immunoliposome Mediated Gene Transfection of
Target Cells In Vitro
[0041] We determined the in vitro transfection efficiency of the
anti-TfR scFv-Lip(A) complex in JSQ-3 cells using
.beta.-galactosidase as the reporter gene. In these studies the
reporter construct used contained the .beta.-galactosidase gene
under the control of the CMV promoter (pCMVb), the same promoter
used in pCMVp53 (FIG. 3). The level of .beta.-Gal expression in the
transfected cells (correlating with the transfection efficiency)
was assessed by .beta.-Gal enzymatic assay (Xu L, et al., Hum. Gene
Ther. (1997) 8:467-475). As shown in Table 3, the attachment of the
anti-TfR scFv to the Lip(A) resulted in a doubling of the enzyme
activity in the scFv-Lip(A)-pCMVb transfected cells, as compared to
the untargeted liposome complex. This level of expression was also
found to be virtually identical to that observed when transferrin
itself was used as the targeting ligand (Tf-Lip(A)-pCMVb).
Moreover, this increase in gene expression was shown to be reporter
gene DNA dose dependent. Table 4 shows the optimization of
scFv-liposome mediated transfection of JSQ-3 cells.
TABLE-US-00004 TABLE 3 Transfection of JSQ-3 Cells by Anti-TfR
scFv-liposomes* DNA (.mu.g/well) Lip(A) only Tf-Lip(A) scFV-LipA1
scFv-LipA2 1.0 475 1031 997 1221 0.5 601 981 811 854 0.25 266 503
578 471 0.125 130 262 215 236 *milliunits/mg protein,
.beta.-galactosidase equivalent, .beta.-Gal enzymatic assay
scFv-LipA1: by lipid-film solubilization method scFv-LipA2: by
direct anchoring method
TABLE-US-00005 TABLE 4 Optimization of scFv-liposome transfection
to JSQ-3* DNA/Lip Lip(A) scFv- scFv- scFv- scFv- scFv- (.mu.g/nmol)
only LipA1 LipA2 LipB LipD LipG 1/8 1.559 2.793 2.642 1.827 0.874
0.648 1/10 1.776 2.846 2.83 2.268 1.606 1.283 1/12 1.868 2.772
2.815 2.175 1.257 1.416 1/14 1.451 3.031 2.797 2.31 1.78 1.656
*.beta.-Gal enzymatic assay, OD.sub.405 scFv-LipA1: by lipid-film
solubilization method scFv-LipA2: by direct anchoring method
Example 6
scFv-immunoliposome Mediated p53 Gene Transfection Target to Tumor
Cells Causing Sensitization to Chemotherapeutic Agents
[0042] 1. Anti-TfR scFv Facilitated Liposome-Mediated wtp53 Gene
Transfection In Vitro
[0043] The expression of exogenous wtp53 in JSQ-3 tumor cells
transfected with the anti-TfR scFv-targeted Lip(A)-p53-3'Ad was
assessed by co-transfection of an expression plasmid (pBP100) which
contains the luciferase reporter gene under the control of a p53
responsive promoter (Chen L, et al., Proc. Natl. Acad. Sci. USA
(1998) 95:195-200). Consequently, the higher the level of exogenous
wt p53 expression (representing the scFv-Lip(A)-p53-3'Ad
transfection efficiency), the higher the level of luciferase
activity. This luciferase enzyme activity is expressed as relative
light units (RLU). As was demonstrated above with the .beta.-gal
reporter gene, the addition of the anti-TfR scFv as the targeting
agent to the Lip(A)-p53-3'Ad complex resulted in a significant
increase in transfection efficiency and wtp53 protein expression
(as expressed by RLU of Luciferase activity) over the untargeted
Lip(A)-p53-3'Ad complex (Table 5). Once again, the level of p53
expression in the scFv-Lip(A)-p53-3'Ad transfected cells was
similar to that observed when transferrin itself was used as the
targeting ligand (LipT(A)-p53-3'Ad). Therefore, these findings
indicate that the anti-TfR single-chain antibody strategy is a
useful method of targeting the cationic liposome complex, and
delivering a biologically active wtp53 gene, to tumor cells.
TABLE-US-00006 TABLE 5 In Vitro p53 Expression Mediated by
Different Liposomes in JSQ-3 cells Transfected by RLU* Medium +
p53-3'Ad + pBP100 158 Lip(A) + p53-3'Ad + pBP100 4073 LipT(A) +
p53-3'Ad + pBP100 7566 scFv-Lip(A1) + p53-3'Ad + pBP100 6441
*Relative light units per well
2. Anti-TfR scFv-Immunoliposome Mediated p53 Gene Restoration
Sensitized the Tumor Cells to the Cytotoxicity of Cisplatin
(CDDP).
[0044] For the p53-induced apoptosis study, mouse melanoma cell
line B16 was transfected with anti-TfR scFv-immunoliposome
complexed with p53-3'Ad (FIG. 4) or pCMVpRo plasmid (FIG. 3) DNA
(scFv-Lip(A)-p53 and scFv-Lip(A)-pRo, respectively) at a dose of 5
.mu.g DNA/2.times.10.sup.5 cells in 2 sets of 6-well plates. For
comparison, transferrin-liposome-DNA (LipT-p53 or LipT-pRo) were
also transfected at a dose of 5 .mu.g DNA/2.times.10.sup.5 cells.
24 hours later, CDDP was added to one set of plates to 10 .mu.M
final concentration. 24 and 48 hours after the drug was added, both
the attached and floating cells were collected for apoptosis
staining. The cells were stained with an Annexin V-FITC Kit
(Trevigen, Inc., Gaithersburg, Md.) according to manufacturer's
protocol. Annexin V is a lipocortin, a naturally occurring blood
protein and anti-coagulant. The stained cells were analyzed on a
FACStar cytometer (Becton and Dickinson). Table 6 summarizes the
results of the apoptosis analysis.
TABLE-US-00007 TABLE 6 Apoptosis of B16 Cells Induced by Liposomal
p53-gene Restoration and CDDP* 24 hours 48 hours Transfected by
-CDDP +CDDP -CDDP +CDDP Untransfected 0.22 4.4 6.33 20.11 LipA-p53
15.9 26.7 15.02 26.52 scFv-LipA-p53 13.9 38.4 34.94 43.7
scFv-LipA-pRo 8.1 19.9 24.14 37.59 Tf-LipA-p53 22.4 29.5 34.47 31.7
Tf-LipA-pRo 14.1 12.6 14.00 25.34 *% of apoptotic cells (Annexin
V-FITC positive)
[0045] Without CDDP there was no increase in the percent of
apoptotic cells induced at 24 hours by the addition of the scFv
ligand as compared to the amount induced by the liposome complex
alone. However, by 48 hours, there is a greater than 2-fold
increase in the percent of apoptotic cells by the addition of the
targeting scFv to the lipoplex. With CDDP there is a significant
increase in apoptotic cells (approximately 1.5-fold) even at 24
hours as compared to the untargeted liposome complex. More
significantly, this increase in apoptotic cells in combination with
CDDP is more pronounced using the scFv to the Tf receptor as the
targeting ligand than using the Tf molecule itself. This increase
correlates with transfection efficiency.
Example 7
scFv-immunoliposome-targeted wtp53 Gene Delivery and Expression In
Vivo with Systemic Administration
[0046] To examine the ability of the anti-TfR scFv containing
liposomes to deliver wtp53 specifically to tumor tissue in vivo,
scFv-Lip(A)-p53-3'Ad (FIG. 4) or the untargeted Lip(A)-p53-3'Ad
(FIG. 4) was injected intravenously into nude mice bearing JSQ-3
subcutaneous xenograft tumors. Two days after injection, the tumors
were excised and protein isolated from liver and skin, as well as
the tumor, for Western blot analysis (Xu L, et al., Hum. Gene Ther.
(1997) 8:467-475). Equal amounts of protein (100 .mu.g, as
determined by concentration) were loaded in each lane. As shown in
FIG. 2, the tumor from the mouse systemically treated with the
scFv-Lip(A)-p53-3'Ad complex, labeled scFv-Lip(A)-p53 in FIG. 2,
displayed a very intense p53 signal as well as the additional lower
band indicative of a high level of expression of the exogenous
wtp53, while only the lower expression of the endogenous mouse p53
is evident in both the skin and the liver. In contrast, as would be
expected based upon our earlier results, a significantly lower
level of exogenous p53 expression is evident in the tumor isolated
from the untargeted Lip(A)-p53-3'Ad injected mouse, labeled
Lip(A)-p53 in FIG. 2. Therefore, the liposome complex targeted by
our new and unique anti-TfR lpp-scFv ligand can clearly deliver
exogenous genes selectively to the tumor in vivo. These results
demonstrate the potential of this new way of efficiently targeting
systemically delivered, cationic liposome complexes specifically to
tumors in vivo.
Example 8
Construction and Purification of TfRscFv with a 3'Cysteine for Use
in the Conjugation Method
[0047] In the absence of a lipid tag, another method was devised to
attach the purified TfRscFv protein to the lipoplex. This approach
entails the conjugation of the single chain protein to cationic
liposomes via a reducible group such as a sulfhydryl group. In the
preferred embodiment a cysteine residue is added at the 3' end of
the TfRscFv protein. Reduction of this cysteine results in a free
sulfhydryl group which is capable of being conjugated to cationic
liposomes, thus targeting the lipoplex to cells expressing the
transferrin receptor. While the following examples use cysteine as
the reducible group it is obvious that other similar reducing
groups would also work with this method.
1. Construction
[0048] A. Construction of an Expression Vector Containing a
3'Cysteine with a Histidine Tag for Use in the Conjugation Method
of Producing TfRscFv Immunoliposomes
[0049] As in Example 1, the VH-linker-V.kappa. scFv for the TfR was
obtained from plasmid expression vector, pDFH2T-vecOK (described in
Example 1). Using a 5' primer (5' GGCCCATGGAGGTGC AGCTGGTGG 3' (SEQ
ID NO:3)) for PCR amplification, an NcoI site was introduced into
pDFH2T-vecOK. The nucleotide sequence for the cysteine residue as
well as a NotI restriction site was introduced using a 3' primer
(5' GGCGCGGCCGCGCATTTTATCTCCAGCTTG 3' (SEQ ID NO:4)). The PCR
product was cloned into NcoI and NotI sites of the commercial
vector pET26b(+) (Novagen). This vector also contains, 5' of the
NcoI site, the pelB leader signal sequence. The presence of this
sequence in the expression vector allows transport of the protein
to the periplasmic space. To aid in purification of the protein,
the pET26b(+) vector also contains a Histidine tag sequence 3' of
the NotI site (FIG. 5).
[0050] B. Construction of an Expression Vector Containing a 3'
Cysteine without a Histidine Tag for Use in the Conjugation Method
of Producing TfRscFv Immunoliposomes
[0051] For human use as a therapeutic delivery vehicle, it is
preferable that the TfRscFv be produced without the Histidine tag.
Therefore, the construct described in Example 8, section 1. A, was
modified to eliminate this tag in the final protein product. To
accomplish this, the same 5' primer as described above (in Example
8, section 1. A) was used. However, a different 3' primer was used.
In addition to the nucleotide sequence for the cysteine residue and
the NotI restriction site, this primer
(5=GGCGCGGCCGCTCAGCATTTTATCTCCAGCTTG 3=(SEQ ID NO:5)), introduced a
DNA stop codon adjacent to the cysteine sequence and before the
NotI site (FIG. 6). Thus, the protein product of this construct
will not contain the His-tag.
[0052] C. Construction of an Expression Vector Containing a
3'Cysteine with a 5'CBD.TM.Tag for Use in the Conjugation Method of
Producing TfRscFv Immunoliposomes
[0053] A third alternative construct containing a cysteine residue
for linkage to the cationic lipoplex using the conjugation method
was also made. For this construct (FIG. 7), the same two primers
described above in Example 8, section 1. B, were used. Thus no
His-tag would be present in the protein product. However, the PCR
product of these reactions was cloned into a different vector,
pET37b(+) (Novagen). This vector contains a cellulose binding
domain tag (CBD.theta.-tag) and an S-tag, both 5' of the NcoI site
in the vector. The CBD-tag sequence encodes a cellulose binding
domain derived from a microbial cellulase. Thus, the presence of
this tag enables the use of cellulose-based supports for highly
specific, low cost affinity purification of the protein product.
The presence of the S-tag present in this construct allows for easy
detection of the protein product on Western blots and for easy
enzymatic quantitation of protein amounts.
2. Purification of the TfRscFv containing the Cysteine Residue
[0054] The commercially available E. coli expression host BL21
(DE3), which contains the expressed lac repressor, was transformed
with an expression vector (all three were used individually)
described above in Example 8, section 1. A number of clones were
selected and the ones that produced the best yield of TfRscFv were
chosen. Purification of the protein from the construct described
above in Example 8, section 1. A, with the histidine tag is given
in detail as an example, although the same method is used for
purification of the cysteine containing TfRscFv protein from all
three constructs described in Example 8, section 1. The majority of
the TfRscFv protein (approximately 90%) was found not to be soluble
but to be contained within the inclusion bodies. Therefore, the
TfRscFv containing the cysteine-linker was purified from the
inclusion bodies as follows. A single clone was inoculated into
5-10 ml LB containing 50 .mu.g/ml Kanamycin, and grown at
37.degree. C., and 250 rpm to an OD.sub.600 of 0.5B0.7 (4-5 hrs).
30 ml of the mini culture was pelleted, suspended in LB broth,
added to 1 L LB containing 50 .mu.g/ml Kanamycin and incubated at
37.degree. C. and 250 rpm, to an OD.sub.600 of 0.5B0.7 (4-5 hrs).
To induce expression of the TfRscFv protein, IPTG at a final
concentration of 1 mM was added to the culture at this time and
incubation continued for an additional 4 hrs. This time was
determined to yield the maximum level of protein expression. The
bacterial cultures were then collected by centrifugation and lysed
in 100 ml of cold 20 mM Tris-HCl, pH 7.5, containing 100 .mu.g/ml
lysozyme, at 30.degree. C. for 15 minutes. The sample was sonicated
at 10 watts for 5 minutes (in 30 second bursts) with cooling on
ice. The inclusion bodies were isolated by centrifugation at 13,000
g for 15 minutes. The resulting pellet was washed three times in
cold 20 mM Tris-HCl buffer, pH 7.5. The purity and quantity of the
inclusion bodies were determined by SDS-polyacrylamide gel
electrophoresis before solubilization.
[0055] The isolated inclusion bodies were dissolved in 100 mM
Tris-HCl, pH 8.0 containing 6 M guanidine-HCl and 200 mM NaCl (6 M
GuHCl buffer) and centrifuged at 12,300 g for 15 minutes to remove
insoluble debris. 2-mercaptoethanol was added to the supernatant to
a final concentration equal to approximately 50 molar fold of the
protein concentration and the mixture incubated with rotation for 1
hour at room temperature. The presence of such a high concentration
of guanidine-HCl and the reducing agent results in a totally
unfolded protein. Refolding of the TfRscFv protein was accomplished
by dialysis at 4.degree. C. against decreasing concentrations of
guanidine-HCl in the absence of 2-mercaptoethanol. Dialysis was
performed for 24 hours each against the following concentrations of
guanidine-HCl in 100 mM Tris-HCl, pH 8.0 and 200 mM NaCl: 6 M, 3 M,
2 M, 1 M and 0.5 M. The last dialysis was against three changes of
just 100 mM Tris-HCl, pH 8.0 and 200 mM NaCl. The fourth dialysis
solution (of 1 M guanidine-HCl) also contained 2 mM glutathione
(oxidized form) and 500 mM L-arginine. These reagents allow the
partially refolded protein to form the proper disulfide bonds to
produce the correct protein conformation. The solution was
clarified by centrifugation at 13000 g to remove aggregates. The
sample was concentrated approximately 1.5 fold using the Centrplus
centrifugal filter (Amicon) at 3000 g for 90 min. SDS-PAGE showed a
single band of the solubilized cysteine containing TfRscFv with a
molecular weight of approximately 28-30 kDa containing only minor
contaminants (FIG. 8).
Example 9
Preparation of scFv-Liposomes by the Conjugation Method
[0056] 1. Reduction of scFv
[0057] The purified TfRscFv was reduced by DTT to obtain monomer
scFv-SH as follows: To scFv in HBS (10 mM HEPES, 150 mM NaCl, pH
7.4) was added 1 M DTT to a final concentration of 1-50 mM. After
rotation at room temperature for 5-10 min, the protein was desalted
on a 10-DG column (Bio-Rad). The free --SH group was measured by
5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB, Ellman's reagent) (G.
L. Ellman (1959) Arch. Biochem. Biophys. 82:70-77. P. W. Riddles,
R. L. Blakeley, B. Zeruer (1993) Methods Enzymol. 91:49-60) and
calculated as --SH/protein molar ratio, or number of free --SH per
scFv molecule (Table 7). The results indicate that 1-10 mM DTT is
appropriate for the scFv reduction.
TABLE-US-00008 TABLE 7 Reduction of TfRscFv DTT Concentration (mM)
--SH/scFv molar ratio 0 0.15 1 0.45 10 1.94 20 2.26 50 3.03
2. Liposome Preparation
[0058] 4-(p-maleimidophenyl)butyrate-DOPE (MPB-DOPE) (Avanti Polar
Lipids) is included in the seven liposome formulations described in
Example 3, to a 5-8% molar of total lipids. The MPB-liposomes were
prepared the same way as described in Example 3. Other liposome
preparation methods can also be used to prepare the cationic
liposomes. For example, the ethanol injection method modified from
that described by Campbell M J (Biotechniques 1995 June;
18(6):1027-32) was used successfully in the present invention. In
brief, all lipids were solubilized in ethanol and mixed, injected
into vortexing pure water of 50-60.degree. C. with a Hamilton
syringe. The solution was vortexed for a further 10-15 min. The
final concentration was 1-2 mM total lipids. The ethanol injection
method is faster, easier and more robust. 1 M HEPES, pH 7.5 (pH
7.0-8.0) was added to a final concentration of 10-20 mM. Since we
have found that the maleimide group is not stable in aqueous
solution with pH>7, the liposomes should be prepared in water
(pH 5-6.5). The pH can be adjusted to 7.0-8.0 before linking to
scFv-SH with 1 M HEPES buffer, pH 7.0-8.0, to facilitate the
post-coating reaction.
3. Preparation of scFv-Liposome-DNA Complexes
[0059] A. Pre-Linking Method
[0060] scFv-SH was added to MPB-liposome at a protein/lipid (w/w)
ratio of 1/5-1/40, preferably 1/10-1/20. The solution was mixed by
gentle rotation for 30 min at room temperature to yield scFv-Lip.
The scFv-Lip was used without purification although it can be
purified by Sepharose CL-4B column chromatography. Plasmid DNA was
diluted in water and added to the scFv-Lip at a DNA/lipid
(.mu.g/nmol) ratio of 1/6-1/20, preferably 1/10-1/14. The solution
was mixed well for 5-15 min by inversion several times to produce
scFv-Lip-DNA complex. scFv-Lip-DNA was used without purification
although it can be purified by Sepharose CL-4B column
chromatography. 80-100% of the scFv was found to be conjugated to
the liposome.
[0061] B. Post-Linking Method
[0062] Plasmid DNA was diluted in water and was added to the
MPB-liposome at a DNA/lipid (.mu.g/nmol) ratio of 1/6-1/20,
preferably 1/10-1/14. The solution was mixed well for 5-15 min by
inversion several times to produce an MPB-Lip-DNA complex. scFv-SH
was then added to the complex at a protein/lipid (w/w) ratio of
1/5-1/40, preferably 1/10-1/20. The solution was mixed by gentle
rotation for 30 min at room temperature, to produce the final
scFv-Lip-DNA complex. The scFv-Lip-DNA was used without
purification although it can be purified by Sepharose CL-4B column
chromatography. 80-100% of the scFv was found to be conjugated to
the liposome.
[0063] 4. For intravenous injection, a 50% dextrose solution was
added to the scFv-Lip-DNA to a final concentration of 5%.
Example 10
Immunoreactivity of Cysteine Containing TfRscFv-Immunoliposomes by
the ELISA Assay
[0064] This example provides the characterization of the
anti-TfRscFv-immunoliposomes produced by the conjugation method of
this invention with respect to their ability to bind to TfR(+)
cells in vitro. Human squamous cell carcinoma of head and neck cell
line JSQ-3 served as the TfR(+) target cells for these studies.
[0065] As previously described in Example 4, indirect cellular
enzyme-linked immunosorbent assay (ELISA) was employed to determine
the immunoreactivity of the TfRscFv before and after conjugation to
liposomes. Confluent JSQ-3 cells in 96-well plates were fixed with
0.5% glutaraldehyde in PBS for 10 min at room temperature. The
plate was blocked with 5% fetal bovine serum (FBS) in PBS at
30.degree. C. for 30 min. The cysteine containing TfRscFv alone,
this TfRscFv conjugated to cationic liposomes
(TfRscFv-immunoliposomes) and untargeted liposomes were added to
wells in triplicate. An anti-transferrin receptor monoclonal
antibody (Hb21, obtained from David Fitzgerald, NIH) was used in
one series of wells as a positive control. The plate was incubated
at 4.degree. C. overnight. The wells were washed three times with
PBS, and an anti-His monoclonal antibody (Qiagen) was added to each
well (except for those receiving the antibody positive control) in
3% FBS in PBS and incubated at 37.degree. C. for 60 min. After
three PBS washes, HRP-labeled goat-anti-mouse IgG (Sigma) diluted
in 3% FBS was added to each well and incubated for 30 min at
37.degree. C. The plate was washed three times with PBS and 100
.mu.l substrate 0.4 mg/ml OPD in citrate phosphate buffer (Sigma)
was added to each well. The color-development was stopped by adding
100 .mu.l 2 M sulfuric acid to each well. The plate was read on an
ELISA plate reader (Molecular Devices Corp.) at 490 nm.
[0066] Indirect cellular ELISA clearly demonstrated that the
anti-TfR scFv containing a C-terminal cysteine maintained its
immunoreactivity. The OD.sub.490 values increased with increasing
amounts of TfRscFv protein, rising from 0.060.+-.0.0035 with 0.6
.mu.g of protein, to 0.100.+-.0.0038 at 1.5 .mu.g and
0.132.+-.0.0031 with 3 .mu.g of TfRscFv. Moreover, this TfRscFv
protein appears to have even greater binding activity than the
parental Hb21 anti-transferrin receptor antibody used as a positive
control. The OD.sub.490 for the highest concentration of the Hb21
(100 .mu.l) was approximately 2-4 fold less (0.033.+-.0.0086).
[0067] The indirect cellular ELISA assay was also performed after
the same TfRscFv protein was incorporated via the conjugation
method of the invention (Example 9) into two different liposome
complexes (Lip(A) and Lip(B)) to demonstrate the universality of
this method with cationic liposomes. Both the pre- and post-linking
conjugation methods of liposome preparation detailed in Example 9
were used. As shown in Table 8, the immunoreactivity of the TfRscFv
prepared by the conjugation method is not lost through complexing
to either of the two liposome compositions. This was true for both
pre- and post-linking methods used to produce the immunoliposome
complex. The TfRscFv-targeted lipoplexes also demonstrated binding
to the cells. This binding was significantly higher than that of
the liposome without the TfRscFv, suggesting that this binding is
in fact mediated through the attachment of the TfRscFv to the
transferrin receptor on the cells.
TABLE-US-00009 TABLE 8 Binding of TfRscFv-immunoliposomes Prepared
by theConjugation Method to JSQ-3 Cells In Vitro* DNA:Lipid Ratio
OD.sub.490 Lip(B)-DNA 1:10 0.088 TfRscFv-Lip(A)-DNA by Pre- 1:10
0.152 .+-. 0.016 TfRscFv-Lip(A)-DNA by Pre- 1:12 0.166 .+-. 0.009
TfRscFv-Lip(A)-DNA by Post- 1:12 0.168 .+-. 0.006
TfRscFv-Lip(B)-DNA by Pre- 1:12 0.139 .+-. 0.012 TfRscFv only --
0.235 *ELISA, OD.sub.490, Mean .+-. SD (triplicate readings except
for Lip(B)-DNA) Pre- = Pre-linking Conjugation Method Post- =
Post-linking Conjugation Method
Example 11
Conjugated TfRscFv-immunoliposome Mediated Gene Transfection of
Target Cells In Vitro
[0068] We determined the in vitro transfection efficiency of the
TfRscFv-liposome complex, prepared by the conjugation method, in
cells using the plasmid pLuc, which contains the firefly luciferase
gene under control of the CMV promoter as the reporter gene. To
demonstrate the universality of the TfRscFv as a targeting ligand,
here also, as in Example 10, two separate liposome compositions
(Lip(A) and Lip(B)) were conjugated to the TfRscFv protein. Human
breast cancer cell line MDA-MB-435 and human squamous cell
carcinoma of the head and neck cell line JSQ-3 were used in these
studies. The in vitro transfection was performed in 24-well plates
(Xu L, et al., Hum. Gene Ther. (1999) 10:2941-2952). The
transfection solutions were added to the cells in the presence of
10% serum. 24 hr later the cells were washed and lysed to measure
the luciferase activity and protein concentration. The results are
expressed as 10.sup.3 relative light units (RLU) per .mu.g protein
in the lysate, as shown in Tables 9A and 9B.
TABLE-US-00010 TABLE 9A Conjugated TfRscFv-immunoliposome Mediated
Transfection In Vitro.sup.# Luciferase Activity (.times.10.sup.3
RLU/.mu.g protein) MDA-MB-435 JSQ-3 LipA 106 377 Tf-LipA 284 640
scFv-LipA* 560 1160 scFv-LipA** 660 1210 scFv-LipA (1/10).sup.@ --
1315 scFv-LipA (1/20).sup.@ -- 751 .sup.#Mean of duplicates
*Containing 5% MPB-DOPE **Containing 7% MPB-DOPE .sup.@Ratio of
scFv/lipids (w/w)
TABLE-US-00011 TABLE 9B In Vitro Transfection Activity of
Conjugated TfRscFv-Immunoliposome-DNA Complexes Prepared for
Systemic Administration Luciferase Activity (.times.10.sup.3
RLU/.mu.g protein) MDA-MB-435 JSQ-3 scFv-LipA-pLuc (pre-linking)*
58.4 675 scFv-LipA-pLuc (pre-linking)** 45.6 513 scFv-LipB-pLuc
(pre-linking)* 51.4 415 scFv-LipA-pLuc (post-linking)* 58.1 856
scFv-LipA-pLuc (post-linking)** 45.3 343 scFv-LipB-pLuc
(post-linking)* 47.2 237 *Containing 5% MPB-DOPE **Containing 7%
MPB-DOPE
[0069] The results show that the cysteine containing
TfRscFv-immunoliposomes prepared by the conjugation method have
very high transfection activity in vitro, 3-6 fold higher than the
untargeted liposomes and 2-3 fold higher than the
transferrin-targeted liposomes. This was true for both liposome
compositions and both human tumor cell lines. Thus, they still
retain their immunoreactivity and can bind to their target
receptor. Based upon Table 9A, the scFv-liposomes can also be used
as efficient gene transfection reagents in vitro, and are much more
efficient than commercially available cationic liposomes
(DOTAP/DOPE and DDAB/DOPE) and transferrin-liposomes. The
TfRscFv-immunoliposomes disclosed in the present invention can be
used for an efficient in vitro gene transfection kit useful for the
transfection of mammalian cells with transferrin receptors.
[0070] The TfRscFv is a smaller molecule than transferrin itself.
Thus, the resulting complex is more compact and more easily taken
up by the cells giving a higher transfection efficiency.
[0071] These results are also advantageous for the use of the
TfRscFv immunoliposome for systemic delivery for human use. The
smaller size allows increased access to the tumor cells through the
small capillaries. Most significantly, the TfRscFv is not a human
blood product as is the Tf molecule. Therefore, the concerns and
technical problems associated with the use of transferrin itself
for human therapy are avoided.
Example 12
Conjugated TfRscFv-Immunoliposome Mediated Expression of Wild-type
p53 in a Nude Mouse Xenograft Model Following Systemic Delivery
[0072] In this example the ability of the TfRscFv, produced by the
conjugation method of this invention, to direct a lipoplex carrying
the wild-type p53 (wtp53) gene preferentially to tumor cells in
vivo after systemic delivery is demonstrated. To demonstrate the
universality of the TfRscFv as a targeting ligand, here also, as in
Example 10, two separate liposome compositions (Lip(A) and Lip(B))
were complexed to the cysteine-containing TfRscFv protein by the
conjugation method. Only the pre-linking method of conjugation as
detailed in Example 9 was used in this study. 2.5.times.10.sup.6
MDA-MB-435 human breast cancer cells were subcutaneously injected
into 4-6 wk old female athymic nude mice. 1.1.times.10.sup.7 DU145
human prostate cancer cells suspended in Matrigel.RTM. collagen
basement membrane (Collaborative Biomedical Products) were also
subcutaneously injected into 4-6 week old female athymic nude mice
and tumors were allowed to develop. Animals bearing tumors of
between 50-200 mm.sup.3 were used in the study (1 animal/sample
tested). Conjugated TfRscFv immunoliposomes carrying the wtp53
gene, as well as untargeted Lip(B)-p53 and wtp53 naked DNA were
intravenously injected into the tail vein of the animals. As an
additional control, conjugated TfRscFv-Lip(A) carrying the empty
vector in place of the p53 containing vector was also injected into
a mouse. As described in Example 7, approximately 60 hours
post-injection, the animals were sacrificed and the tumors, as well
as the liver, were excised. Protein was isolated from the tissues
and 100 .mu.g of each sample (as determined by protein
concentration assay) was run on a 10% polyacrylamide gel for
Western blot analysis using an anti-p53 monoclonal antibody. In
both of these tumor types the endogenous mouse and the exogenous
human p53 migrate at the same position. The results here mirror
those described in Example 7. As shown in FIG. 9, both the DU145
and MDA-MB-435 tumors from the animals intravenously injected with
the TfRscFv-Lip(A)-pCMVp53 lipoplex or the TfRscFv-Lip(B)-pCMVp53
lipoplex prepared by the conjugation method displayed a high level
of expression of exogenous wtp53, as indicated by the intense p53
signal and an additional lower band, with the best expression in
the DU145 tumors. While it appears that in both tumor types the
Lip(A) composition was somewhat better than the Lip(B), both
liposome compositions worked demonstrating the universality of this
method. Only the endogenous mouse p53 protein was evident in the
liver of these animals. In contrast, only the endogenous mouse p53
protein was evident in the tumors excised from the mice injected
with the conjugated TfRscFv-Lip(B) carrying the empty vector or the
naked wtp53 DNA. A small increase in p53 expression also was
observed in the DU145 tumor with the untargeted Lip(B)-p53. Thus,
the conjugated TfRscFv-immunoliposomes delivered the wtp53 gene
preferentially to the tumors, as desired. It is also significant
that this tumor targeting was evident in two different tumor types,
indicating the general usefulness of the method of this invention.
Therefore, the methods of this invention described in the preceding
Examples generate a TfRscFv protein that not only retains its
ability to bind to cationic liposomes but is still immunologically
active preserving its ability to bind to the transferrin receptor
in vitro and in vivo, thus fulfilling our objective of producing a
tumor-specific, targeted immunoliposome for gene therapy.
[0073] While the invention has been disclosed in this patent
application by reference to the details of preferred embodiments of
the invention, it is to be understood that the disclosure is
intended in an illustrative rather than in a limiting sense, as it
is contemplated that modifications will readily occur to those
skilled in the art, within the spirit of the invention and the
scope of the appended claims.
Sequence CWU 1
1
5124DNAArtificial SequenceSynthetic Primer 1ggcccatgga ggtgcagctg
gtgg 24236DNAArtificial SequenceSynthetic Primer 2ccggaattcg
cggccgcttt tatctccagc ttggtc 36324DNAArtificial SequenceSynthetic
Primer 3ggcccatgga ggtgcagctg gtgg 24430DNAArtificial
SequenceSynthetic Primer 4ggcgcggccg cgcattttat ctccagcttg
30533DNAArtificial SequenceSynthetic Primer 5ggcgcggccg ctcagcattt
tatctccagc ttg 33
* * * * *