U.S. patent application number 11/877130 was filed with the patent office on 2009-07-30 for method of error reduction in nucleic acid populations.
Invention is credited to Peter J. Belshaw, Francesco Cerrina, James H. Kaysen, Kathryn Richmond, Michael R. Sussman.
Application Number | 20090188793 11/877130 |
Document ID | / |
Family ID | 27766234 |
Filed Date | 2009-07-30 |
United States Patent
Application |
20090188793 |
Kind Code |
A1 |
Sussman; Michael R. ; et
al. |
July 30, 2009 |
Method of Error Reduction in Nucleic Acid Populations
Abstract
A method is disclosed for the direct synthesis of double
stranded DNA molecules of a variety of sizes and with any desired
sequence. The DNA molecule to be synthesis is logically broken up
into smaller overlapping DNA segments. A maskless microarray
synthesizer is used to make a DNA microarray on a substrate in
which each element or feature of the array is populated by DNA of a
one of the overlapping DNA segments. The complement of each segment
is also made in the microarray. The DNA segments are released from
the substrate and held under conditions favoring hybridization of
DNA, under which conditions the segments will hybridize to form
duplexes. The duplexes are then separated using a DNA binding agent
which hinds to improperly formed DNA helixes to remove errors form
the set of DNA molecules. The segments can then be hybridized to
each other to assemble the larger target DNA sequence.
Inventors: |
Sussman; Michael R.;
(Madison, WI) ; Cerrina; Francesco; (Madison,
WI) ; Belshaw; Peter J.; (Madison, WI) ;
Kaysen; James H.; (Madison, WI) ; Richmond;
Kathryn; (Madison, WI) |
Correspondence
Address: |
QUARLES & BRADY LLP
33 E. MAIN ST, SUITE 900, P.O. BOX 2113
MADISON
WI
53701-2113
US
|
Family ID: |
27766234 |
Appl. No.: |
11/877130 |
Filed: |
October 23, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10376720 |
Feb 28, 2003 |
7303872 |
|
|
11877130 |
|
|
|
|
60360563 |
Feb 28, 2002 |
|
|
|
Current U.S.
Class: |
204/450 ;
536/25.4 |
Current CPC
Class: |
C12N 15/10 20130101;
C12N 15/101 20130101 |
Class at
Publication: |
204/450 ;
536/25.4 |
International
Class: |
C07H 21/04 20060101
C07H021/04 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with United States government
support awarded by the following agency: DOD ARPA Grant #:
N39998-01-2-7070. The United States has certain rights in this
invention.
Claims
1. A method for separation of DNA molecules of correct sequence
away from DNA molecule of incorrect sequence, the method comprising
the steps of (a) exposing a solution of double stranded DNA
molecules to a DNA binding agent which will binds selectively to
duplex DNA molecules having a sequence mismatch between its duplex
strands; and (b) separating the DNA molecules to which the DNA
binding agent bound from those DNA molecules to which the DNA
binding agent did not bind.
2. A method as claimed in claim 1 wherein before the exposing step,
the method includes the step of permitting single stranded DNA
strands to hybridize to other single DNA stands.
3. A method as claimed in claim 1 wherein the separation is
performed by affinity binding the DNA binding agent at a fixed
location.
4. A method as claimed in claim 1 wherein the separation is
performed by electrophoresis.
5. A method as claimed in claim 1 wherein the DNA binding agent is
MutS.
6. A method as claimed in claim 1 wherein the steps (a) and (b) are
performed repetitively until a desired level of purity of correct
sequence is achieved.
7. A method for separating out duplex DNA molecules having a
sequence error in a pool of duplex DNA molecules the majority of
which are of a correct sequence, the method comprising the steps of
(a) denaturing the duplex. DNA molecules; (b) permitting the DNA
molecules to hybridize to form new DNA duplex molecules; (c)
exposing the duplex DNA molecules to a DNA binding agent that binds
selectively to DNA molecules having an irregularity in the topology
of the DNA duplex; and (d) separating the DNA molecules by
separation out of those DNA molecules to which the DNA binding
agent bound.
8. A method as claimed in claim 7 wherein the separation is
performed by affinity binding the DNA binding agent at a fixed
location.
9. A method as claimed in claim 7 wherein the separation is
performed by electrophoresis.
10. A method as claimed in claim 7 wherein the DNA binding agent is
MutS.
11. A method as claimed in claim 7 wherein steps (a) through (d)
are repeated multiple times until a desired level of purity of DNA
of correct sequence is obtained.
12. A method for making DNA sequences of defined sequence
comprising the steps of (a) making a microarray of single stranded
DNA probes, the probes constructed so that each probe has a
complementary portion that is partially complementary to another
probe on the microarray and further constructed so that for each
set of probes a complete complementary set of probes is
constructed; (b) releasing the single stranded DNA probes from the
microarray; (c) cooling the single stranded probes so that DNA
duplexes are formed which are mainly formed of probes hybridized to
their complete complementary probe; (d) exposing the DNA duplexes
to a DNA binding agent which will selectively bind to a DNA duplex
which has an irregularity in its topographical shape; (e)
separating out the DNA duplexes to which the DNA binding agent
bound; (f) denaturing the DNA duplexes to released the single
stranded DNA probes from the DNA duplexes; (g) cooling the DNA
duplexes under conditions which favor at least some of the single
stranded DNA probes binding to the probes to which they are only
partially complementary to form DNA complexes which are double
stranded in at least some part; and (h) extending the DNA complexes
thus made to add a second DNA strand to remaining single stranded
parts of the DNA complexes.
13. A method as claimed in claim 12 wherein the separation is
performed by affinity binding the DNA binding agent at a fixed
location.
14. A method as claimed in claim 12 wherein the DNA binding agent
is MutS
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of US Provisional
Application No. 60/360,563 filed. Feb. 28, 2002.
BACKGROUND OF THE INVENTION
[0003] This invention pertains generally to the field of biology
and particularly to techniques and apparatus for the manufacture of
DNA molecules of defined or desired sequences. The manufacture of
DNA molecules also makes possible the synthesis of any desired
peptides, proteins or assemblies of proteins and nucleic acids as
may be desired.
[0004] Using the techniques of recombinant DNA chemistry, it is now
common for DNA sequences to be replicated and amplified from nature
and for those sequences to then be disassembled into component
parts which are then recombined or reassembled into new DNA
sequences. While it is now both possible and common for short DNA
sequences, referred to a oligonucleotides, to be directly
synthesized from individual nucleosides, it has been thought to be
generally impractical to directly construct large segments or
assemblies of DNA sequences larger than about 400 base pairs. As a
consequence, larger segments of DNA are generally constructed from
component parts and segments which can be purchased, cloned or
synthesized individually and then assembled into the DNA molecule
desired.
[0005] For example, if an expression vector is desired to express a
new protein in a selected host, the scientist can often purchase a
generic expression vector from a molecular biology supply company
and then clone or synthesize the protein coding region for the gene
sought to be expressed. The coding region must be ligated into the
vector in such a manner and in the correct location and orientation
such that the vector will be effective to express the desired
protein in the host. The purchaser of the vector must also examine
the sequence of the vector to make sure no other DNA component of
the vector has other properties that might be detrimental to the
experiment the purchaser wishes to run. Thus, the difficulty in
constructing any new desired larger DNA construct is dependent on
what similar constructs, or what components of the construct, can
be purchased or obtained from public sources, and how much
information is available about the sequences of those
components.
[0006] A novel methodology to construct and assemble newly designed
DNA sequences of indefinite length has been developed based on the
use of DNA constructed in DNA microarrays. A DNA microarray is made
up of a plurality of sets of single stranded DNA probes arranged on
a substrate. The sets of probes are identical in nucleotide
sequence but different in sequence from other sets of probes. A
technique has been described for the in situ synthesis of DNA
microarrays that is adapted for the manufacturing of customized
arrays. Published PCT patent application WO99/4281.3 and U.S. Pat.
No. 6,375,903 describe a method for making such arrays in which the
light is selectively directed to the array being synthesized by a
high density micromirror array under software control from a
computer. Since the micromirror array is operated totally under
software control, the making of complex and expensive
photolithographic masks is avoided in its entirety. It has been
previously proposed that such custom microarrays can be used to
provide the single stranded DNA segments necessary and sufficient
to assemble double stranded DNA molecules of indeterminate length.
In PCT published patent application WO 02/095073, the disclosure of
which is hereby incorporated by reference, this process is set
forth. In short, using that approach, short segments of single
stranded DNA are made on the microarray and designed such that a
portion of each probe is complementary to two other
oligonucleotides in another set on the array. In theory then, when
the oligonucleotides are released from the substrate of the array,
the DNA segments will self-assemble into the complete desired DNA
molecule as each complementary segment hybridizes to its
complement.
[0007] A complexity arises from this general approach to DNA
synthesis that no synthetic or biochemical processes are ever
completely efficient and accurate. Thus it is inevitable that there
will be occasional deletion and substitution errors in the DNA
segments made by this process. To facilitate the practical
synthesis of longer DNA molecules on interest and of good quality,
methods must be developed to purify the DNA sequences of interest
from those artifacts that arise through various sorts of errors and
inefficiencies in the probe synthesis and assembly process.
BRIEF SUMMARY OF THE INVENTION
[0008] The present invention is summarized in a method for
separation of DNA molecules of correct sequence away from DNA
molecule of incorrect sequence, the method including the steps of
exposing a solution of double stranded DNA molecules to a DNA
binding agent which will binds selectively to duplex DNA molecules
having a topographical irregularity; and separating the DNA
molecules to which the DNA binding agent bound from those DNA
molecules to which the DNA binding agent did not bind.
[0009] This invention makes practical the construction to order of
DNA constructs of virtually any size with minimal err. This frees
the experimenter who wishes to perform experiments on DNA or on
gene expression from the constraints of working with commercially
available vectors or genetic elements. Instead, DNA sequences can
be invented on a computer and fabricated for the first time and in
a short time period using this microarray based technique.
[0010] The present invention is also directed to a method for
separating out DNA duplexes carrying a minority sequence from a
pool of such sequences carrying a majority sequence. This method
includes the steps of denaturing the duplex DNA molecules;
permitting the DNA molecules to hybridize to form new DNA duplex
molecules; exposing the duplex DNA molecules to a DNA binding agent
that binds selectively to DNA molecules having an irregularity in
the topology of the DNA duplex; and separating the DNA molecules by
separation out of those DNA molecules to which the DNA binding
agent bound.
[0011] Further objects, features and advantages of the invention
will be apparent from the following detailed description when taken
in conjunction with the accompanying drawings.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0012] FIG. 1 illustrates schematically the approach of the present
invention.
[0013] FIG. 2 illustrates schematically other steps in the approach
of the present invention.
[0014] FIG. 3 illustrates schematically the concept of removing DNA
of incorrect sequence from a pool of DNA sequences.
[0015] FIG. 4 illustrates the procedure used in the one of the
examples below.
[0016] FIG. 5 illustrates the duplexes assembled from
oligonucleotides in one of the examples below.
DETAILED DESCRIPTION OF THE INVENTION
[0017] In one embodiment, the present invention originated as a
method for reducing the amount of error produced during the
synthesis of double stranded oligonucleotides. We refer to this
method as "coincidence filtering." The term "coincidence filter" is
borrowed from electronics and optical physics, where a coincidence
filter is used to filter for light or energy signals that are
coincident. Here the is used to refer to a process which
selectively permits to pass through the process only those DNA
segments with are coincident, or which have no unpaired or
mis-paired nucleotides. This process removes from the nucleic acid
populations those nucleic acids that have mismatches or deletions
internally within them. The overall process also includes a method
to selectively filter out any double stranded DNA molecules which
have a correct, matched sequence but have a sequence that is
different from the sequence of the majority of DNA sequences in the
population of DNA molecules made.
[0018] The method of the present invention arose out of efforts to
make a general purpose DNA synthesis process using the massively
parallel DNA fabrication capabilities of the maskless DNA synthesis
instrument, of the type described in U.S. Pat. No. 6,375,903, the
disclosure of which is also incorporated herein by reference. The
maskless array synthesizer permits many single stranded DNA probes
to be fabricated in parallel in a short time, under computer
control. This technology permits the manufacture in a few hours of
a custom DNA microarray in which the single stranded DNA probes in
the array can be of any arbitrary DNA sequence. The microarray is
arranged in features where all the probes in a given feature are of
the same DNA sequence, which can differ from the sequence of the
probes in any other feature. This technology permits the synthesis
of tens to hundreds of thousands of different features in a single
microarray, each feature composed of DNA probes of 20 to 150
nucleotides in length, in a matter of hours. Here, the microarray
synthesis instrument is used as a massively parallel generator of
single stranded DNA segments, and the process described here is
concerned with assembling those segments into a long piece of DNA
while eliminating errors in the synthesis process.
[0019] The technology described in the previously mentioned PCT
published application WO 02/095073 already envisions the use of the
massively parallel DNA synthesis capability of the maskless array
synthesizer to be used to make very long DNA sequences of interest.
The present invention is directed toward processes for solving,
among other things, the following problem. Consider that every step
in the addition of nucleotides to the DNA probes in the microarray
is 99% efficient and accurate. That level of efficiency would mean
that for every 100 nucleotides added, one nucleotide is either not
added at all or is added in the wrong place. This rate of error
would mean that if the DNA segments are all 25-mers, or composed of
oligonucleotides 25 nucleotides in length, one out of every four
probes, on average, would have an error in it. While the actual
efficiency can, in reality, be made higher than 99%, the error rate
cannot even be zero. Some number of the probes will have an error.
The error can be any of the following: a failure to add a
nucleotide, i.e. a deletion; an addition of a nucleotide in an
incorrect location, i.e. an addition; a complete misplacement of
one nucleotide for another, i.e. a substitution; or a chemical
modification of a nucleotide. The purification process should
therefore be arranged so as to remove from the population sequences
made during the hybridization process as many as possible of the
probes that contain an error, regardless of the type of error. The
method described here will do that. It should be understood that
while this process in designed and intended to solve this specific
problem of DNA purification and separation in the context of using
the microarray technique for DNA synthesis, this same process will
be useful in any other DNA synthesis procedures in which it is
desired to ultimately obtain copies of a single DNA molecule of
interest.
[0020] Referring to FIG. 1, it was first thought, and described in
the specification of WO 02/095073, that the assembly of the target
DNA would be performed in a single step after the probes are
released from the substrate of the microarray. That concept is
illustrated in the left-hand illustration in FIG. 1. Using this
basic approach, the DNA sequence of the probes in each feature
overlaps partially the DNA sequence in the probes of two other
features. Here, an addition to that strategy is contemplated. Here,
it is suggested that on the microarray both the sense and antisense
strand of every segment of DNA be constructed on the microarray. In
other words, for each of the features on the array in, somewhere
else on the array is a feature in which the probes have the exact
complementary sequence. This might seem wasteful of DNA synthesis
capacity, since this cuts the theoretical yield from a single
microarray by one-half. However, since the capacity of this method
of DNA synthesis is quite large, this waste is not significant, and
the advantage of this strategy will become apparent in a
moment.
[0021] Once the microarray with complementary sequence probes is
made, the probes are released from the substrate. If one heats the
solution of DNA strands thus made and then permits the solution to
cool slowly, each probe will have the opportunity to find and
hybridize to its exact complement. This is illustrated in the
right-hand side of FIG. 1. Thus a large number of double stranded
oligonucleotides are created, each equal in length to the length of
the probes fabricated on the microarray. At this point, the double
stranded DNA oligonucleotides do not self-assemble into a larger
DNA molecule but instead are simply short double stranded DNA
segments.
[0022] This population of double stranded oligonucleotides will
include some double stranded segments that have errors in them on
one or the other of their single strand. Again, the most common
errors will be of three kinds, a deletion, an addition or a
substitution. If one assumes only that the errors are rare, each
single strand that has an error in it will be most likely to
hybridize to a complementary strand that does not have a perfectly
complementary sequence. It will be exceedingly unlikely that for
any probe fabricated with an error that the complementary strand
for that probe will have been fabricated with an exactly
complementary error. Thus for the double stranded DNA segments that
were just created, the ones that have errors will have a mismatched
nucleotide. This mismatch in sequence, whether it is a deletion,
addition or substitution, will cause a topographical irregularity
in the double stranded DNA. In simple words, the double stranded
DNA molecule will have a bump or bulge in it caused by an extra of
a mismatched nucleotide. Notice in FIG. 5, intending to illustrate
some of the DNA strands used in the examples below, that the
deletion of a single nucleotide causes a topographical irregularity
in the double stranded DNA, as the non-matching nucleotide is
pushed out of the orderly double helix of the DNA. This same
topographical irregularity occurs whether the error is a deletion,
an insertion or a substitution. In each of these cases, the
nucleotides in the two DNA strands do not align, as they should. As
a first step, the process described here is intended to filter or
separate out the double stranded DNA molecules that have a base
pair mismatch from those that are perfectly matched. In that way,
double stranded DNA segments having errors on either stand will be
eliminated from the population.
[0023] This process is illustrated schematically in FIG. 2. At the
top of FIG. 2, in the step labeled 10, the single stranded DNA
segments have been formed and released from the substrate on which
they were made. The single stranded DNA has been formed into double
stranded duplexes. The errors are indicated by the letter X. Where
there is an error, that strand will hybridize to a strand that is
complementary, but which does not have the same error. Then the
duplexes formed are exposed to a DNA binding agent that selectively
binds to DNA of improper helical shape. The preferred embodiment of
such an agent is MutS, a bacterial protein associated with
intracellular DNA correction mechanisms. MutS will preferentially
bind to DNA that has an improper bump or loop in it caused by a
strand mismatch. The DNA duplexes that have the binding agent
adhered to them are then removed from the total population or pool
of DNA duplexes. This is conveniently done by then doing a
separation of the total pool of DNA duplexes using an affinity
separation for the DNA binding agent. Referring to FIG. 2, the step
labeled 20 refers to the step of annealing the single stranded
probes into duplexes. The step labeled 30 refers to the step of
applying the binding agent, such as MutS, and separating out the
duplexes to which the binding agent binds. The step 30 may not be
completely efficient in a single performance and it may be
desirable to perform the steps 20 and 30 recursively as many times
as appropriate to purify the duplexes to a desired degree of
absence of error sequences.
[0024] It is still necessary at this point to assemble the short
duplex DNA segments into the entire desired target DNA. This can be
done a number of ways, Shown in FIG. 2 is the concept of using
ligase chain reaction (LCR) or polymerase chain reaction (PCR) to
complete defined sequences. Another approach is to heat the
duplexes, to denature them, and then cool the solution more quickly
than in the previous step of short duplex formation. The single DNA
stands will again hybridize, but not all of them will rehybridize
with the short complementary probes. Remember that each single DNA
strand has two DNA stands, other than its exact complement, to
which it may hybridize. These other strands are the original DNA
probes that were constructed to have a sequence which overlaps the
complement of the first strand. So some of the singe strands will
now hybridize to the one-half complement strands. DNA polymerase
can be used to fill out the partially double stranded/partially
single stranded complexes thus made, and the step can be repeated
again, as many times as necessary, until the large target DNA
molecule is assembled.
[0025] Note that once the large DNA duplex molecules have been
assembled, it is still possible to use the coincidence filter
technique to remove erroneous sequences, assuming only that most of
the sequences are correct. If one considers a pool of longer double
stranded DNA molecules, most of which are correct in sequence and
matching on both strands. To consider the worst case, let us assume
that an error, which again could be a deletion, an insertion or a
substitution, happened to occur on a part of a single strand which
did not hybridize to a complement and then the single stand was
extended using a DNA polymerase. The DNA polymerase will fill in
the matching nucleotides based on the template on the single
strand, and thus will fill in a complement to the error. The double
stranded DNA will not at this point exhibit an improper DNA helix
topology, since the two strands of that molecule are complementary.
To filter out these errors, the process is to take all of these
longer DNA strands, again heat them to denature them, and again
cool them quickly. It is highly unlikely that the strand containing
the error will again hybridize to the complementary strand having
its same error. Instead, it is far more likely that the strand
containing the error will mate to a correct complementary strand,
not having the error, thus introducing a conformation irregularity
in the duplex formed at the point of the error. The same thing will
happen to the complementary strand. Then it is again possible to
expose the duplexes to the binding agent, such as MutS, and remove
from the pool those duplex molecules to which the MutS will bind.
Again this step can be repeatedly recursively until a desired level
of statistical purity is achieved.
[0026] FIG. 3 illustrates general concept of "filtering" a pool of
DNA strands to remove the errors using the DNA binding agent, such
as MutS. An affinity column is prepared with bound MutS available
to bind to the DNA strands. The pool of duplex DNA strands are
exposed to the affinity column, and those strand which have an
irregularity in their helical conformation will bind to the column.
The DNA duplexes which are correct in sequence will have no
irregularity, do not bind to MutS, and thus pass through the column
without binding. Note that there are other methods to select out
complexes formed by the binding of the DNA binding agent to the
improperly formed DNA duplex. For example, duplex DNA with a
binding agent attached migrates through a gel or viscous fluid
slower than DNA without the binding agent attached. This permits
electrophoresis or liquid chromatography to be used to separate out
the DNA with the binding agent attached from the rest of the DNA in
a pool.
[0027] The main requirements for the DNA binding agent for use in
this process is that it binds preferentially to double stranded DNA
having a sequence mismatch between its two strands. The preferred
agent is MutS, a bacterial protein. MutS from Thermus aquaticus can
be purchase commercially from the Epicenter Corporation, Madison,
Wis., Catalog No. SP72100 and SP72250. The gene sequence for the
protein is also known and published in Biswas and Hsieh, Jour.
Biol. Chem. 271:5040-5048 (1996) and is available in GenBank,
accession number U33117. It is therefore readily possible for those
of skill in the art to use conventional gene expression vectors
transformed into bacteria in culture to produce this protein as
well. Another molecule which might be used as the DNA binding agent
in this process is CEL1 endonuclease from celery which has a high
specificity for insertions, deletions and base substitution
mismatches and can detect two polymorphisms which are five
nucleotides apart form each other. It is also possible to design
and synthesize small organic molecules which will bind to specific
nucleotide mismatches, such as dimeric napthyridine 1, a synthetic
ligand that binds to a. G-G mismatch. A cocktail of such ligands
which, in combination, recognize all possible mismatches could
replace MutS. Other protein agents that can differentiate between
matched and unmatched duplexes could also be used. For example, the
T7 endonuclease I will specifically cleave a DNA strand at a
mismatch, and it would be possible to use this enzyme as a
catalytic destroyer of mismatched sequences or to inactivate the
cleavage function of this enzyme for use in this process as a
mismatch binding agent. T4 endonuclease VII will specifically bind
and cleave DNA at duplex mismatches and a mutant version of this
enzyme has already been engineered that lacks the nuclease activity
but retains the ability to bind mutant duplex DNA molecules. Golz
and Kemper, Nucleic Acids Research, 27:e7 (1999). SP nuclease is a
highly active nuclease from spinach that incises all mismatches
except those containing a guanine residue, and this enzyme could
also be engineered to remove the cleavage activity or used
directly. Two or more of these binding agents could be combined to
either provide further stringency to the filtration or to cover all
types of sequence errors if one agent does not bind to all possible
mismatches.
[0028] It is understood that the invention is not confined to the
particular embodiments set forth herein as illustrative, but
embraces all such modified forms thereof as come within the scope
of the following claims.
EXAMPLES
1. General Protocol for the Synthesis of Double Stranded DNA
Sequences
Prophetic
[0029] The synthesis of protected diamine linker and photolabile
nucleotide succinates is described in detail in WO 02/095073 which
has been incorporated by reference and hence need not be discussed
further here.
[0030] Preparation of Slides and Oligonucleotide Synthesis (Base
Labile Linker)
[0031] Microscope slides are prepared as described by Singh-Gasson
et. al, Nature Biotechnology 17, 974-978 (1999) yielding a glass
surface derivatized with a linker bearing a free alcohol at the
terminus. This slide is soaked in an 0.6 M solution of
carbonyldiimidazole in dry dichloromethane (6 hours), washed with
dry dichloromethane, followed by soaking in a solution
MeNPOC-protected diamine (0.4 M) for 12 hours. The slide is then
washed with dichloromethane to yield surfaces with secondary capped
by the photolabile protecting group MeNPOC. In the first 4 cycles
of synthesis, the maskless array synthesizer will photo-deprotect
the secondary amines in the appropriate array elements for
attachment of each of the protected nucleotide-3'-succinates with
the coupling reagent
O-Benzotriazole-N,N'N'-tetramethyluronium-hexafluoro-phosphate
(HBTU) in DMF. Unreacted free amines are subsequently capped with
acetic anhydride in pyridine. Once the 3'-nucleotides have been
attached to the surface subsequent deprotection and elongation
cycles are conducted as described in Singh-Gasson et. al. Nature
Biotechnology, 17, 974-978 (1999) and as also described in
Published PCT patent application WO99/42813.
Gene Synthesis
[0032] In this example, the maskless array synthesizer is used to
conduct the synthesis of oligonucleotide fragments on a glass
slide. Following release of the oligonucleotide fragments from the
slide, the fragments will be assembled into a long double stranded
DNA of defined sequence by self assembly and the polymerase chain
reaction (PCR), ligase chain reaction (LCR) or both.
[0033] For the purpose of this example we consider the synthesis of
a double stranded DNA fragment of 420 base pairs in length, of an
arbitrary but defined sequence. The target sequence is divided into
20 overlapping 40-mer oligonucleotides. Of the 20 oligonucleotides
or segments, 10 are designated for each strand of the target
sequence, and the segments are designed to that that they can self
assemble into the full length sequence by virtue of the
3'-overhangs of 20 bases on either strand. Software is used to
select virtual oligonucleotides from the target sequence and to
divide the available array element on the chip evenly for the
synthesis of the 20 oligonucleotide fragments. After the synthesis
is completed as described above, the slide is incubated with a
minimal volume of concentrated ammonium hydroxide and heated to
55.degree. C. for 4 hours, to cleave the oligonucleotides from the
surface of the slide and to remove all protecting groups from the
bases. The solution is concentrated to dryness in a Speedvac,
redissolved in 50 uL of T4 polynucleotide kinase buffer (Promega)
and the 5'-hydroxyls of the oligonucleotides are phosphorylated
with 20 U of T4-polynucleotide kinase (Promega) at 37.degree. C.
for 2 hours. The resulting mixture of phosphorylated
oligonucleotides is separated by size on an 8% denaturing
polyacrylamide gel electrophoresis. The band corresponding to the
full length 40 mer oligonucleotides is excised from the gel and the
mixture of oligonucleotides is purified from the gel by freeze/thaw
and elution (detailed protocols for each of these procedures can be
found in Short Protocols in Molecular Biology 4th edition F. M.
Ausubel et. al. Eds. 1999). The purified oligonucleotides are
dissolved in LCR buffer (Stratagene) containing 8 U of Pfu DNA
ligase (Stratagene). The result of that process is that the
individual oligonucleotides are annealed and ligated together to
produce a full length DNA sequence by thermal cycling (94.degree.
C.-1 min; 40 cycles of: 55.degree. C. for 90 sec, 70.degree. C.)
for 90 sec, 95.degree. C. for 30 sec; 55.degree. C. for 2 min,
72.degree. C. for 2 min). The full-length oligonucleotide is
subsequently amplified by PCR using standard protocols from the LCR
reaction using 2 20-mer oligonucleotide primers that are
complementary to the 3' overhangs in this example.
[0034] The above detailed description of a gene synthesis protocol
is provided as an example for practicing the invention. There are
many possible variations on this protocol using LCR, PCR or both to
anneal and amplify the oligonucleotides into a longer double
stranded DNA sequence (Kneidinger et al., BioTechniques, 30,
248-249 (2001); Withers-Martinez et al., Protein Eng. 12, 1113-1120
(1999); Casimiro et al., Structure (London), 5, 1407-1412 (1997);
Holowachuk et al., PCR Methods Appl. 1995, 4, 299-302 (1995);
Prodromou et al., Protein Eng. 5, 827-829 (1992); Engels, Angew.
Chem., 101, 733-52 (1989)). The precise details of this protocol
can be altered by a practitioner skilled in the art to optimize the
efficiency of the process in a variety of obvious ways such as
altering the linker chemistry, the length of the oligonucleotides,
the codon usage in each oligonucleotide and thus the hybridization
properties of the sequences, the number of oligonucleotides used
for construction of each segment, the conditions of the LCR and/or
PCR assembly reactions etc. The DNA segments need not be all of the
same length, but can be of any desired length within the limits of
the quality of segments that can be produced by a given instrument
with particular chemistry.
2. Use of Coincidence Filtering
Performed
[0035] General Protocol
[0036] In one embodiment of the present invention, DNA
oligonucleotides from 20 to 200 bases are synthesized by any
method. When the sequence of interest is produced, its anti-sense
complement stand is also produced. The sense and anti-sense strands
are first denatured by heating to 95.degree. C., then slowly cooled
and allowed to anneal. The double-stranded oligonucleotides are
then incubated with a protein or proteins that bind or cleaves
oligonucleotides containing base mismatches or deletions (e.g.,
bacterial MutS). The protein retains or alters the error-containing
oligonucleotides while the error-free oligonucleotides are free for
further use. The double-stranded oligonucleotides may be then
further treated with enzymes to eliminate any remaining errors or
single strands. As noted above, mismatches may be located and
eliminated by other methods.
[0037] Oligonucleotides
[0038] The oligonucleotide sequence was derived from the green
fluorescent protein UV gene contained in the plasmid pGFPuv
(GenBank accession # U62636). This sequence was chosen because of
GFP's as usefulness a reporter gene in future bioassays. Non-mutant
or wild-type (wt) anti-sense strands were 5' end-labeled with the
fluorescent dye Cy5. Mutant anti-sense strands containing either a
deletion or C to A substitution at position 20 were 5' end-labeled
with fluorescein. Oligonucleotides were obtained from Operon Inc.,
Alameda Calif.
TABLE-US-00001 GFPuv 351-390 MP 81.7.degree. C. Sense
GTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAG Anti-
CTTCACCCTCTCCACTGACAGAAAATTTGTGCCCATTAAC sense Anti-del
CTTCACCCTCTCCACTGACGAAAATTTGTGCCCATTAAC 20 Anti
CTTCACCCTCTCCACTGAAAGAAAATTTGTGCCCATTAAC C > A
[0039] Annealing
[0040] In a typical reaction 80 pmols of unlabeled sense strand
were mixed with 40 pmols of Cy5 labeled anti-sense strand and 40
pmols of fluorescein labeled mutant strand (del20 or C>A) in
1.times. Muts buffer (10 mM Tris-HCl pH 8.8, 5 mM MgCl.sub.2, 0.1%
TritonX-100). The mixture was annealed in a thermocycler after
being first denatured at 95.degree. C. for 5 minutes. The mixture
was then cooled at 0.2.degree. C./sec until temperature reaches
25.degree. C. The duplex DNA thus created is illustrated in FIG.
5.
[0041] Binding Reaction
[0042] 2 or 6 .mu.g of MutS.sub.t protein (Epicenter Technologies,
Madison, Wis.) was added to the annealed oligonucleotides. The
mixture was then incubated at 37.degree. C. for 30 minutes.
[0043] Loading dye (Promega 6.times.) was added to reactions. The
entire reaction was loaded onto 6% TBE-PAGE gel amended to be 5 mM
MgCl.sub.2. (The running buffer of 1.times.TBE was amended to be 5
mM MgCl.sub.2). The electrophoresis was run at 120 volts for 3
hours. Analysis was done on a Molecular Dynamics STORM 860 on both
blue (Fluorescein) and red (Cy5) lasers. Molecular Dynamics
ImageQuant software was used to quantitate the results.
[0044] Results
[0045] The wild-type (wt) sense strand was annealed with a 50/50
mix of Cy5 labeled wt anti-sense strand and Fluorescein labeled
anti-sense strand containing a deletion at the 20 position. The
MutS protein forms a shifted DNA protein complex. The MutS protein
preferentially binds the fluorescein labeled double-stranded
oligonucleotide containing the deletion at the 20 position (del
20). This result was revealed by the much darker MutS/DNA complex
band in the Fluorescein channel on the resulting gel. Protease K
was added to the lane digesting away the MutS protein and this
digestion eliminated the shifted band, proving the shift was due to
protein binding.
[0046] To prove that DNA binding by MutS is specific for
double-stranded oligonucleotides containing an error, we tried to
compete the DNA off the MutS protein with a tenfold molar excess of
either unlabeled double-stranded wild-type oligonucleotide (wt) or
an unlabeled double-stranded oligonucleotide with a deletion at the
20 position (del20). The results revealed that that a tenfold
excess does not cause any type of shifted band in the absence of
MutS (No MutS), and with 6 .mu.g of MutS protein, a tenfold excess
of wt oligonucleotide doesn't compete away the DNA/MutS complex. At
the same time, a tenfold excess of the del20 oligonucleotides did
compete away the DNA/MutS complex. This indicates that MutS binding
is specific for oligonucleotides with errors.
[0047] When producing oligonucleotides using an oligonucleotide
synthesizer the most common error is a deletion caused by the
failure too remove a blocking group or the failure to couple a
base. This experiment showed that MutS protein binds
oligonucleotides with a deletion mutation (del20) more efficiently
than an oligonucleotide with a A to C mismatch in the middle, as
indicated by the darker shifted band in the del 20 lanes runon a
gel. In this experiment, the DNA complex showed up in both the Cy5
and Fluorescein lanes because the sense strand was also Cy5
labeled.
[0048] Conclusions
[0049] The production of double-stranded oligonucleotides allows us
to detect and eliminate errors using mismatch specific proteins,
such as MutS. The binding of MutS is specific for double-stranded
oligonucleotides containing errors. Error containing
oligonucleotides can be detected even in a vast excess of non-error
containing oligonucleotides. The most common type of error (a
deletion) is preferentially detected.
[0050] An experiment was conducted to verify the ability of MutS to
remove mutant oligonucleotide duplexes from a pool of correct
sequences. The oligonucleotides were selected again from the green
fluorescent protein native sequence, in this case GFPuv bases
numbered 649 to 717, a 68mer. A mutant type. 68mer was also created
with the deletion of base 33, a T. In a first trial, 22.2 .mu.l
containing 2.5 nmoles each of sense and antisense of the correct
sequence was placed in a reaction with 1.times.Taq buffer and 1.5
mM MgCl.sub.2. The reaction was denatured by heating to 95.degree.
C. fort 5 minutes followed by annealing by decreasing the
temperature 0.1.degree. C. per second until the reaction reached
25.degree. C. A similar reaction was run in parallel with both
wild-type and mutant oligonucleotides combined, the mutant
oligonucleotides being spiked in at 0.25 nmoles of the total of
0.25 nmoles of antisense DNA. The two reaction mixtures were each
split in halves and incubated with or without MutS. This reaction
used 11.1 .mu.l duplex DNA solution containing 1.25 nmoles. DNA
duplex, 2 .mu.l 75 mM MgCl.sub.2, 13.9 .mu.l water, and either (a)
3 .mu.l MutS protein (2 .mu.g/.mu.l or 0.067 nmole) or, in
substitution, (1) 3 .mu.g water, for a total reaction volume of 30
.mu.l. The solutions were raised to 37.degree. C. for 30 minutes.
Then the entire solutions were loaded into 2.5% agarose gels
amended to be 5 mM MgCl.sub.2, and run with a buffer that is
1.times.TBE with 5 mM MgCl.sub.2. After electrophoresis, the gel
was stained with ethidium bromide. The bands on the gel were
analyzed and found to be shifted and unshifted. The unshifted bands
were cut out of the gel and the DNA was gel purified using a Qiagen
gel purification kit Aliquots of the DNA recovered were cloned into
a Topo-TA plasmid, transformed into E coli HB101 cells and plated.
Minipreps were prepared from the colonies, DNA recovered and that
DNA was sequences. The results of the sequencing analysis was that
for the reaction in which the MutS was not included, 30% of the
clones were the wild-type or correct sequence, while for the
reaction in which the MutS was included, 58% of the clones were the
wild-type or correct sequence. This represents a 93% increase in
the number of correct wild-type clones in the population. The
reason why the percentage of mutant clones so high, when only 10%
of the input DNA was intentionally mutant may be due to lack of
purity of the oligonucleotides as purchased. But the purification
effect is still evident in the data.
[0051] Assembly of Sequences with Errors
[0052] This experiment was performed to perform a functional assay,
looking at expression of the green fluorescent protein to assess
error filtering and to try assembly smaller probes into larger DNA
assemblies with error sequences being present. The concept was to
see if the PCR process would select against the remaining mutant
duplexes.
[0053] The DNA used in this example were phosphorylated
oligonucleotides spanning bases 445 to 585 lf the GFPuv sequence.
The top and bottom (complementary) stands were made from three
40mers and one 20mer. Within the assembled fragment is a unique
restriction site for the enzymes NcoI and BsrGI. The protocol used
was to assemble 0.47 nmole of each primer in a total volume of 15
.mu.l in a reaction also including 4 .mu.l of 10.times.Pfu DNA
ligase buffer, 2 .mu.l Pfu DNA ligase (4.mu./.mu.l) and 19 .mu.l
water to make a total volume of 40 .mu.l. Ligase chain reactions
were run with a temperature profile of 1 minute at 95.degree. C.,
then 40 cycles of 55.degree. C. for 90 seconds, 70.degree. C. for
90 seconds and 95.degree. C. for 30 seconds, followed by 55.degree.
C. for 2 minutes and 70.degree. C. for two minutes.
[0054] To perform the experiments, the reaction mixtures were split
into halves, for a total volume of 20 .mu.l, to which was added 5
.mu.l of 75 mM MgCl.sub.2, 5 .mu.l of 10.times. ligase buffer, 22.5
.mu.l MutS protein (2 .mu.g/.mu.l) or 22.5 .mu.l water, and 22.5
.mu.l water for a total volume or 75 .mu.l. The assembled reactions
thus each had 0.0235 nmole assembled DNA duplex and 45 .mu.g MutS
protein, which acts as a dimer in recognizing and binding to DNA
mismatches. The reaction was put at 50.degree. C. for 30 minutes.
The total volume was then load onto a 2.5% agarose gel amended to
be 5 nM MgCl.sub.2, with a running buffer of 1.times.TBE plus 5 mM
MgCl.sub.2, and run. After electrophoresis, the gel was stained
with ethidium bromide and the unshifted bands were cut out of the
gel. The DNA was purified using a Qiagen gel purification kit. The
DNA was then amplified using the outmost primers. The DNA was
digested with NocI and BsrGI and gel purified. The DNA was ligated
into pGVPuv-NcoI-BsrGI and transformed into HB101 cells. This
process is illustrated in FIG. 4.
[0055] The results of this example were that over 95% of the
colonies glowed under UV illumination, after scanning over 750
colonies from both the MutS containing and the MutS negative
replicates. Controls with a plasmid not containing GFP did not glow
and positive controls with an intact pGFPuv cassette also all
glowed. Another negative control using the pGVPuv-NcoI-BsrGI
plasmid with no insert also exhibited no glow. This result was
somewhat surprising unless (1) multiple deletions or inserts
negated the creation of a frameshift or (2) the PCR was biased
against amplification of duplexes with mutations. To determine and
quantitate the number of possible silent mutations present in the
clones, a subset was grown and their DNA was extracted and
sequenced. The sequencing reactions revealed that 81% of the
colonies from MutS negative pool had the wild-type sequence while
19% harbored the mutant sequence, and all the mutations were
substitutions. Of the colonies from the MutS containing reactions,
all tested exhibited the wild type or correct sequence. This
sequence was confirmed by duplicate sequencing of each colony.
[0056] This result demonstrates that a DNA binding agent can
successfully be used to separate out minority error sequences from
a pool of DNA duplexes created in an LCR reaction. While the GOP
functional assay was not diagnostic, the binding of DNA by the MutS
was a useful tool in purifying the DNA pool for the desired
sequences.
Sequence CWU 1
1
4140DNAArtificialSynthetic Oligonucleotide 1gttaatgggc acaaattttc
tgtcagtgga gagggtgaag 40240DNAArtificialSynthetic Oligonucleotide
2cttcaccctc tccactgaca gaaaatttgt gcccattaac
40339DNAArtificialSynthetic Oligonucleotide 3cttcaccctc tccactgacg
aaaatttgtg cccattaac 39440DNAArtificialSynthetic Oligonucleotide
4cttcaccctc tccactgaaa gaaaatttgt gcccattaac 40
* * * * *