U.S. patent application number 12/274999 was filed with the patent office on 2009-07-23 for insect chymotrypsin and inhibitors thereof.
This patent application is currently assigned to Hexima Limited. Invention is credited to Marilyn Anne Anderson, Kerry Michelle Dunse, Robyn Louise Heath.
Application Number | 20090188010 12/274999 |
Document ID | / |
Family ID | 33310988 |
Filed Date | 2009-07-23 |
United States Patent
Application |
20090188010 |
Kind Code |
A1 |
Dunse; Kerry Michelle ; et
al. |
July 23, 2009 |
Insect Chymotrypsin and Inhibitors Thereof
Abstract
The present invention relates generally to a novel chymotrypsin
that exhibits resistance to a plant serine proteinase inhibitor.
More particularly, the present invention provides a chymotrypsin
which is up-regulated in the gut of Helicoverpa armigera and
Helicoverpa punctigera insect larvae when fed the serine proteinase
inhibitors of Nicotiana alata. The novel chymotrypsin represents,
therefore, a target for the identification of antagonists including
inhibitors which are proposed to be useful in the control of
Helicoverpa spp. populations that have become resistant to serine
proteinase inhibitors produced in plants. The antagonists of the
chymotrypsin may be topically applied to the plants or, when in
proteinaceous form, may be produced by genetic means in plant
cells. The antagonists may act at the level of gene expression or
protein activity.
Inventors: |
Dunse; Kerry Michelle;
(Coburg North, AU) ; Heath; Robyn Louise; (Clifton
Hill, AU) ; Anderson; Marilyn Anne; (Keilor,
AU) |
Correspondence
Address: |
GREENLEE WINNER AND SULLIVAN P C
4875 PEARL EAST CIRCLE, SUITE 200
BOULDER
CO
80301
US
|
Assignee: |
Hexima Limited
Melbourne
AU
|
Family ID: |
33310988 |
Appl. No.: |
12/274999 |
Filed: |
November 20, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10554237 |
Aug 4, 2006 |
7462695 |
|
|
PCT/AU04/00524 |
Apr 23, 2004 |
|
|
|
12274999 |
|
|
|
|
60465054 |
Apr 23, 2003 |
|
|
|
Current U.S.
Class: |
800/314 ; 435/18;
435/213; 435/320.1; 435/348; 530/370; 530/387.9; 536/23.2;
800/298 |
Current CPC
Class: |
Y02A 40/162 20180101;
A01N 61/00 20130101; C07K 16/40 20130101; A01N 37/46 20130101; C12N
9/6427 20130101; C12N 15/8286 20130101; Y02A 40/146 20180101; A01N
63/10 20200101 |
Class at
Publication: |
800/314 ;
536/23.2; 435/320.1; 435/348; 435/213; 800/298; 435/18; 530/370;
530/387.9 |
International
Class: |
C12N 9/76 20060101
C12N009/76; C07H 21/04 20060101 C07H021/04; C12N 15/63 20060101
C12N015/63; C12N 5/10 20060101 C12N005/10; A01H 5/00 20060101
A01H005/00; C12Q 1/34 20060101 C12Q001/34; C07K 14/415 20060101
C07K014/415; C07K 16/00 20060101 C07K016/00 |
Claims
1. An isolated nucleic acid molecule comprising a sequence encoding
a chymotrypsin from Helicoverpa spp. or a variant, derivative,
homolog or analog of said chymotrypsin, wherein said chymotrypsin
exhibits resistance to a proteinase inhibitor (PI) from Nicotiana
alata, said chymotrypsin comprising the amino acid sequence set
forth in SEQ ID NO:2 or an amino acid sequence having at least 75%
similarity to SEQ ID NO:2 after optimal alignment.
2. The isolated nucleic acid molecule of claim 1, wherein the
nucleotide sequence encodes an amino acid sequence set forth in SEQ
ID NO:2.
3. The isolated nucleic acid molecule of claim 1, wherein the
sequence is as set forth in SEQ ID NO:4 or SEQ ID NO:6 or a
nucleotide sequence having at least about 75% identity to SEQ ID
NO:4 or SEQ ID NO:6 after optimal alignment or a nucleotide
sequence capable of hybridizing to SEQ ID NO:4 or SEQ ID NO:6 or
its complementary form under low stringency conditions.
4. The isolated nucleic acid molecule of claim 3, comprising the
sequence set forth in SEQ ID NO:4.
5. The isolated nucleic acid molecule of claim 1, encoding a
variant of the chymotrypsin wherein the variant is an N-terminal
signal sequence comprising the amino acid sequence set forth in SEQ
ID NO:3 or an amino acid sequence having at least about 75%
similarity to SEQ ID NO:3 after optimal alignment.
6. The isolated nucleic acid molecule of claim 1, wherein the
sequence is set forth in SEQ ID NO:5 or a nucleotide sequence
having at least 75% identity to SEQ ID NO:5 after optimal alignment
or a nucleotide sequence capable of hybridizing to SEQ ID NO:5 or
its complementary form under low stringency conditions.
7. The isolated nucleic acid molecule of claim 1 encoding a variant
of the chymotrypsin wherein the variant comprises an amino acid
residue other than arginine at position 192.
8. The isolated nucleic acid molecule of claim 7, wherein the
variant comprises a glutamine residue at position 192.
9. A vector comprising a nucleic acid molecule of claim 1.
10. The vector of claim 9 wherein the vector is an expression
vector.
11. The vector of claim 9, wherein the expression vector is
operable in a prokaryotic cell.
12. The vector of claim 1, wherein the expression vector is
operable in a eukaryotic cell.
13. The vector of claim 12, wherein the eukaryotic cell is an
insect cell.
14. The vector of claim 13, wherein the vector is a baculovirus
vector.
15. A genetically modified cell comprising the nucleic acid
molecule of claim 1.
16. An isolated chymotrypsin from Helicoverpa spp., wherein said
chymotrypsin exhibits resistance to a protease inhibitor from
Nicotiana alata or a variant, derivative, homolog or analog of said
chymotrypsin, wherein the isolated chymotrypsin comprises the amino
acid sequence set forth in SEQ ID NO:2 or an amino acid sequence
having at least about 75% similarity to SEQ ID NO:2 after optimal
alignment.
17. The isolated chymotrypsin of claim 16 comprising the amino acid
sequence set forth in SEQ ID NO:2.
18. The isolated chymotrypsin of claim 17 encoded by a nucleotide
sequence having at least about 75% identity to SEQ ID NO:4 or SEQ
ID NO:6 after optimal alignment or a nucleotide sequence capable of
hybridizing to SEQ ID NO:4 or SEQ ID NO:6 or its complementary form
under low stringency conditions.
19. The isolated chymotrypsin of claim 18 encoded by the nucleotide
sequence set forth in SEQ ID NO:1.
20. The isolated chymotrypsin of claim 16, wherein the variant
comprises an N-terminal signal sequence.
21. The isolated chymotrypsin of claim 20 wherein the signal
sequence comprises the amino acid sequence as set forth in SEQ ID
NO:3 or an amino acid sequence having at least 75% similarity
thereto after optimal alignment.
22. The isolated chymotrypsin of claim 16, wherein the variant
comprises an amino acid other than arginine at position 192.
23. The isolated chymotrypsin of claim 16, wherein the variant
comprises a glutamine at position 192.
24. A plant comprising cells genetically modified to produce an
antagonist of chymotrypsin-HpCh5, wherein said antagonist comprises
the amino acid sequence of SEQ ID NO:81 or an antagonist of
chymotrypsin-HpCh5 with at least about 75% sequence identity
thereto.
25. The genetically modified plant of claim 24, wherein the plant
is a monocotyledonous plant.
26. The genetically modified plant of claim 24, wherein the plant
is a dicotyledonous plant.
27. The genetically modified plant of claim 24, wherein the plant
is cotton, sweet corn, tomato, tobacco, pimiento, potato,
sunflower, citrus, plum, sorghum, leek, soybean, alfalfa, bean,
pidgeon pea, chick pea, artichoke, curcurbit, lettuce, Dianthus,
geranium, cape gooseberry, maize, flax, linseed, alfalfa, lupin,
broad bean, garden pea, peanut, canola, snapdragon, cherry,
sunflower, marigold, Helichrysum, wheat, barley, oat, triticale,
carrot, onion, orchid, rose or petunia.
28. The genetically modified plant of claim 27, wherein the plant
is a cotton plant.
29. The genetically modified plant of claim 24 comprising a nucleic
acid molecule encoding Pot1A and/or Pot1B.
30. Seeds or other reproductive material from the plant of claim
24.
31. A method for isolating and separating individual isoforms of
chymotrypsin, said method consisting of: (i) affinity
chromatography of insect gut extracts initially with benzamidine
sepharose to bind trypsins; (ii) further affinity chromatography of
the unbound proteins using immobilized N. alata serine proteinase
inhibitor C1 to bind all NaPI inhibitable chymotypsins followed by
eluting bound proteins to produce an eluate; and (iii) affinity
chromatography of the eluate from (ii) with immobilized PotI and
PotII or chymostatin to bind the remainder, followed by elution of
bound NaPI-insensitive chymotrypsins using 8 M urea.
32. A method for screening for an antagonist of a NaPI-insensitive
chymotrypsin from Helicoverpa spp, said method comprising
contacting said chymotrypsin with a potential antagonist and
measuring chymotrypsin activity in the presence and absence of the
potential antagonist, whereby an antagonist is identified when
chymotrypsin activity is less in the presence than in the absence
of the potential antagonist.
33. An isolated antagonist identified by the method of claim
32.
34. An isolated proteinase inhibitor comprising an amino acid
sequence having at least 75% similarity to SEQ ID NO:81 after
optimal alignment.
35. An isolated antibody specific to the isolated proteinase
inhibition of claim 34.
36. A composition comprising the antagonist of claim 34.
37. The composition of claim 26, wherein said composition comprises
an insecticidal amount of the isolated proteinase inhibitor of
claim 34.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 10/554,237, filed Aug. 4, 2006, which application was filed
under 35 U.S.C. 371 based on PCT/AU2004/000524, filed Apr. 23,
2004, which application claims benefit of U.S. Provisional
Application 60/465,054, filed Apr. 23, 2003, all of which are
incorporated by reference to the extent there is no inconsistency
with the present disclosure.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to a novel
chymotrypsin that exhibits resistance to a plant serine proteinase
inhibitor. More particularly, the present invention provides a
chymotrypsin which is up-regulated in the gut of Helicoverpa
armigera and Helicoverpa punctigera insect larvae when fed the
serine proteinase inhibitors of Nicotiana alata. The novel
chymotrypsin represents, therefore, a target for the identification
of antagonists including inhibitors which are proposed to be useful
in the control of Helicoverpa spp. populations that have become
resistant to serine proteinase inhibitors produced in plants. The
antagonists of the chymotrypsin may be topically applied to the
plants or, when in proteinaceous form, may be produced by genetic
means in plant cells. The antagonists may act at the level of gene
expression or protein activity.
[0004] 2. Description of the Prior Art
[0005] Bibliographic details of the publications referred to in
this specification are also collected at the end of the
description.
[0006] Reference to any prior art in this specification is not, and
should not be taken as, an acknowledgment or any form of suggestion
that this prior art forms part of the common general knowledge in
any country.
[0007] Female reproductive tissues and wounded leaves of the
ornamental tobacco, Nicotiana alata amass high levels of serine
proteinase inhibitors (PIs) for protection against pests and
pathogens (Atkinson et al., The Plant Cell 5: 203-213, 1993). These
6 kDa PIs accumulate in the vacuole (Miller et al., Plant Cell 11:
1499-1508, 1999) and are derived in vivo from the
post-translational modification of a 40.3 kDa precursor protein.
The precursor of the PI protein (referred to as "NaPI") is composed
of six repeated regions of high sequence identity (FIG. 1) each
with a potential PI reactive site. Processing of the six-repeat
precursor protein unexpectedly occurs at sites located within,
rather than between the repeated regions. Complete removal of the
linker sequence (Glu-Glu-Lys-Lys-Asn) [SEQ ID NO:1] contained
within each repeated region, generates five contiguous 6 kDa
inhibitors (C1 and T1-T4) and a novel two-chain chymotrypsin
inhibitor (C2) formed by disulphide bond linkage of N-terminal and
C-terminal peptide fragments (Heath et al., European Journal of
Biochemistry 230(1): 25-257, 1995; Lee et al., Nature Structural
Biology 6(6): 526-530, 1999). The structures of C1, T1-T4 and C2
have been solved using .sup.1H-NMR techniques (Nielson et al., J.
Mol. Biol. 242: 231-243, 1994; Nielson et al., Biochemistry 34:
14304-14311, 1995; Lee et al., 1999, supra).
[0008] Nicotiana alata also has a second gene related to NaPI that
encodes a closely related precursor protein with four rather than
six repeated domains (Miller et al., Plant Mol. Biol. 42: 329-333,
2000). This precursor is also processed in vivo resulting in the
release of three contiguous 6 kDa inhibitors (C1, T4 and T5) and
the two-chain inhibitor C2 (FIG. 1). Three of the inhibitors (C1,
C2 and T4) are identical to those released from the six-domain
precursor. Related multidomain precursors have been described for
other solanaceous plants including N. tabacum (Balandin et al.,
Plant Mol. Biol. 27: 1197-1204, 1995), N. glutinosa (Choi et al.,
Biochim. et Biophys. Acta 1492: 211-215, 2000), L. esculentum
(Taylor et al., Plant Mol. Biol. 23:1005-1014, 1993) and Capsicum
annum (Moura and Ryan, Plant Physiol. 126: 289-298, 2001; Antcheva
et al., Protein Sci. 10: 2280-2290, 2001).
[0009] Several groups have reported on the affect of serine
proteinase inhibitors on the activity of the digestive proteases of
insects and have suggested that they are produced by plants for
protection against the damaging affects of insect pests and
microorganisms (Ryan, Annu. Rev. Phytopathol. 28: 425-449, 1990;
Gatehouse et al., In: Plant Genetic Manipulation for Crop
Protection, Biotech. in Agriculture No. 7, Eds. Gatehouse, Hilder
& Boulter, International U.K., pp. 155-181, 1992). Insects that
are specialist feeders on a particular host plant are generally
resistant to the serine PIs produced by that plant, but are
sensitive to PIs produced by non-hosts (Broadway and Villani,
Entomol. Expo. Appl. 76: 303-312, 1995; Broadway, J. Insect.
Physiol. 41: 107-116, 1995). There is interest, therefore, in
transferring genes encoding serine PIs from non-hosts into crop
plants to enhance insect resistance and to decrease reliance on
chemical pesticides. Recently, however, several groups have
reported on the ability of certain insects to change the relative
proportions of proteolytic enzymes in their midgut following
ingestion of high levels of PIs (Broadway, 1995, supra; Jongsma et
al., Proc. Nat. Acad. Sci. USA 92(17): 8041-8045, 1995a). Broadway
(1995, supra), for example, found that certain lepidopteran insects
produce two broad classes of trypsin like proteases, one of which
is insensitive to PIs from cabbage leaves. After ingestion of the
cabbage PIs the insects increased production of the trypsin class
not affected by the PIs and thus were able to grow and develop
unhindered. Jongsma and coworkers (1995, supra) made a similar
observation with Spodoptera exigua larvae fed on PIs from potato
(PotII) and tobacco. The factors that regulate the secretion of
these proteases under these conditions are not known.
[0010] These studies indicate that PIs specific for only one or two
of the range of proteinases in an insect gut will be of limited use
for long term plant protection. The gene encoding the N. alata PI
has a potential advantage over other plant PIs for the enhancement
of insect resistance in transgenic plants. Most plant serine PIs
contain only one or two inhibitory domains, whereas the N. alata PI
precursors have four or six (FIG. 1). Thus, there is potential to
engineer the individual domains of the N. alata PI to provide
inhibitory activity against several proteinases in the insect gut.
The midgut proteases of several Lepidoptera, Coleoptera and
Orthoptera have been partially characterized. In most Lepidopteran
species the endoproteinase activity is due primarily to serine
proteinases (trypsin, chymotrypsin and/or elastase) and cysteine
and metalloproteinases are not detectable (Christeller et al.,
Insect Biochem. Molecul. Biol. 22:.sub.--735-746, 1992; Terra and
Ferreira, Comp. Biochem. Physiol. 109:1-62, 1994; Xu and Qin, J.
Econ. Entomol. 87: 334-338, 1994; Lee and Anstee, Insect. Biochem.
Molec. Biol. 25: 63-71, 1995a; Johnston et al., Insect Biochem. 21:
389-397, 1991; Johnston et al., Insect Biochem. Molec. Biol. 25(3):
375-383, 1995). Exopeptidase and leucineaminopeptidase have also
been identified (Christeller et al., 1992, supra; Lee and Anstee,
Insect. Biochem. Molec. Biol. 25(1): 49-61, 1995b).
[0011] The mechanism of action of PIs on insects is only partially
understood. Three responses have been described:-- [0012] (i)
Severe retardation of growth without a decrease in gut proteolytic
activity. Broadway and Duffey (J. Insect Physiol. 32: 673-680,
1986a; Broadway and Duffey, J. Insect Physiol. 32: 827-833, 1986b)
found that insects fed on PIs had remarkably reduced growth rates
that were not associated with a decrease in the total proteolytic
activity in the gut. Indeed the gut proteolytic activity often
increased. They suggested that a feedback mechanism was operating
that led to hyperproduction of proteases, that led in turn to a
depletion of essential sulphur containing amino acids. This
phenomenon has been recorded for other insects after chronic
ingestion of PIs (Burgess et al., Entomol. Exp. App. 61: 123-130,
1991; De Leo et al., Plant Physiol. 118: 997-1004, 1998; Markwick
et al., J. Economic Entomology 91 (6): 1265-76, 1998). [0013] (ii)
Severe retardation of growth with a decrease in gut proteolytic
activity. Broadway (1995, supra) found that the lepidopteran
species, Agrotis ipsilon (black cutworm) had reduced growth and
delayed pupation after exposure to soybean trypsin inhibitor and
did not respond by secreting Pi-insensitive proteases. These
insects had up to a 70% reduction in total gut proteolytic
activity. Codling moth larvae (Lepidoptera: Tortricidae) fed on
`elastase inhibitors` were also retarded in growth and development
that was associated with diminished elastase activity in the gut
(Markwick et al., Journal of Economic Entomology 88(1): 33-39,
1995). [0014] (iii) No effect on growth--change in the complement
of gut proteinases. Some insects can compensate for the inhibition
of one group of proteinases by inducing a new proteinase activity.
The genomes of lepidopteran insects contain genes for a range of
serine proteases and insects can modify the expression of specific
isozymes to suit dietary components (Bown, et al., Insect Biochem.
Molec. Biol. 27: 625-638, 1997; Broadway, J. Insect. Physiol.
43(9): 855-874, 1997). Changes in the complement of gut trypsins
and chymotrypsins have been detected using Northern blot analysis
on RNA from H. armigera (Bown, et al., 1997, supra; Gatehouse, et
al., Insect Biochem. Molecul. Biol. 27: 929-944, 1997), H. zea and
Agrotis ipsilon (Mazumdar-Leighton and Broadway, Insect Biochem.
Mol. Biol. 31: 645-657, 2001a; Mazumdar-Leighton and Broadway,
Insect Biochem. Mol. Biol. 31:633-644, 2001b). Corresponding
changes at the protein level have also been observed using
electrophoretic separation of isozymes for H. armigera (Harsulkar,
et al., Plant Physiol. 121: 497-506, 1999; Patankar, et al., Insect
Biochem. & Mol. Biol. 31: 453-464, 2001), Spodoptera frugiperda
(Paulillo, et al., J. Econ. Entomol. 93:892-896, 2000), H. zea and
Trichoplusia ni (Broadway, Arch. Insect Biochem. Physiol. 32(1):
39-53, 1996). Sometimes specific isozymes have been up-regulated,
and occasionally proteases previously undetected have been
observed.
[0015] Recently, Mazumdar-Leighton and Broadway (2001a, supra)
demonstrated that the production of PI-insensitive trypsins in H.
zea is regulated at the transcriptional level and can be abolished
using the transcriptional regulator actinomycin. Broadway and
colleagues examined changes in gut trypsin and chymotrypsin
activity after H. zea and Trichoplusia ni larvae were fed for 48 h
on artificial diet containing 1% SBTI (Broadway, 1996, supra).
Trypsin activity increased after SBTI consumption and protease
banding patterns on zymograms indicated a change in the relative
complement of proteases. The researchers showed in vitro that SBTI
could inhibit 74% of the trypsin activity in gut extracts from
control larvae, but only 3% of the gut trypsin activity in larvae
that had consumed SBTI. They suggested the new protease bands (one
new band for H. zea and 6 new bands for T. ni) on the zymograms may
be SBTI-insensitive trypsins or SBTI-insensitive chymotrypsins and
concluded that the production of these new proteases was enhanced
by the ingestion of SBTI. Further studies using Northern blot
analysis showed that consumption of SBTI resulted in
transcriptional induction of mRNAs encoding trypsins and
chymotrypsins by H. zea and Agrotis ipsilon (Mazumdar-Leighton and
Broadway, 2001a, supra; Mazumdar-Leighton and Broadway, 2001 b,
supra), although it was not determined if these proteases were
SBTI-insensitive.
[0016] The novel trypsin transcript induced in H. zea after
ingestion of SBTI was designated HzT15 (Mazumdar-Leighton and
Broadway, 2001b, supra). Recently, the first insect digestive
enzyme insensitive to several proteinase inhibitors was purified
from the gut of H. zea and corresponds to the protein encoded by
HzT15 (Volpicella et al., Eur. J. Biochem. 270: 10-19, 2003). The
authors identified several differences in charge distribution
across the surface of the structural model of this PI-insensitive
trypsin relative to the PI inhibitable trypsins, but were unable to
identify the structural changes that led to resistance.
[0017] Until recently, chymotrypsins were assumed to contribute
relatively little to protein digestion in Lepidoptera and
consequently most biochemical studies focused on characterization
of the trypsins. This problem arose due to the initial use of
synthetic substrates that worked well with mammalian chymotrypsins,
but not at all or poorly with the Lepidopteran enzymes.
Lepidopteran chymotrypsins prefer synthetic substrates with at
least four amino acids to occupy the S1-S4 binding subsites on the
enzyme, whereas mammalian trypsins are active on shorter substrates
with one amino acid that is specific for the S1 binding subsite.
That is, the insect chymotrypsins appear to have an extended
substrate binding site requiring at least four amino acids for
efficient catalysis. Recent studies have shown that chymotrypsins
do respond to PI ingestion and are worthy of more detailed
investigation. When larvae from H. armigera were fed on diets
consisting of either potato proteinase inhibitor II, soybean
trypsin inhibitor, aprotin (trypsin inhibitor) or potato proteinase
inhibitor I, levels of chymotrypsin mRNA increased in all cases
while trypsin mRNA decreased (Gatehouse et al., 1997, supra). Other
reports also mention upregulation of chymotrypsins in preference to
trypsins (Bown et al., 1997, supra; Wu et al., Molecular Breeding
3: 371-380, 1997). Mazumdar-Leighton and Broadway (2001a, supra)
assayed chymotrypsin activity in the gut of H. zea larvae and found
that SBTI inhibited 95% of the chymotrypsin from the gut of control
insects but only 35% of activity from the gut of insects that had
prior exposure to SBTI in the diet.
[0018] Hence, consumption of proteinase inhibitors can lead to a
drastic change in the complement of gut proteases which allows
insects to adapt to the diet and survive. Changes in the complement
of proteases after exposure to PIs have been detected in insects
fed on both artificial diets and transgenic plants. The triggers
that regulate these changes are still unknown and the responses
vary with the species, the PI and its concentration, and the base
diet. It is unclear why some inhibitors induce this response and
others do not. It is clear, however, that some larvae are
genetically pre-adapted to PIs, since prior exposure to a specific
inhibitor is not necessary for an insect to be resistant (Broadway,
1996, supra).
[0019] There is a need to identify and investigate novel insect
proteinases which are insensitive to PIs and to use these to screen
for antagonists of the proteinases in order to develop agents
useful in controlling insect growth, maintenance, development
and/or survival.
SUMMARY OF THE INVENTION
[0020] Throughout this specification, unless the context requires
otherwise, the word "comprise", or variations such as "comprises"
or "comprising", will be understood to imply the inclusion of a
stated element or integer or group of elements or integers but not
the exclusion of any other element or integer or group of elements
or integers.
[0021] Nucleotide and amino acid sequences are referred to by a
sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond
numerically to the sequence identifiers <400>1 (SEQ ID NO:1),
<400>2 (SEQ ID NO:2), etc. A summary of the sequence
identifiers is provided in Table 1. A sequence listing is provided
at the end of the specification.
[0022] The present invention provides a novel chymotrypsin from
Helicoverpa spp. referred to herein as "HpCh5". Reference to
"HpCh5" includes all variants, derivatives, homologs and analogs as
well as members of a HpCh5 family of chymotrypsins. Examples of
variants of HpCh5 include proteinase inhibitor (PI) sensitive
forms. Such sensitive forms may carry inter alia a substitution of
the arginine at position 192 to an asparagine or glutamine. This
substitution is referred to herein as "R192N/Q" using single amino
acid nomenclature or "Arg 192 Asn/Gln" using three letter amino
acid code. Other derivatives of HpF5 include the signal sequence of
HpF5.
[0023] The HpCh5 chymotrypsin is encoded by a nucleotide sequence
referred to as "HpF5". Again, reference to "HpF5" includes
variants, homologs and analogs thereof. The term "HpF5" encompasses
both a genomic sequence as well as a cDNA sequence. The amino acid
sequence of HpCh5 is set forth in SEQ ID NO:2. The amino acid
sequence of the N-terminal activation peptide is shown in SEQ ID
NO:3. The nucleotide sequence of the coding region of HpF5 is set
forth in SEQ ID NO:4 with the nucleotide sequence encoding the
activation peptide is shown in SEQ ID NO:5 and its entire 5'-3'
sequence shown in SEQ ID NO:6. HpCh5 is generally characterized by
being substantially insensitive to inhibition by a PI from N.
alata.
[0024] Variants and homologs of HpCh5 include molecules having at
least 75% amino acid identity to SEQ ID NO:2 after optimal
alignment. Variants and homologs of HpF5 include nucleotide
sequences having at least about 75% similarity to SEQ ID NO:4 or
SEQ ID NO:6 after optimal alignment or a nucleotide sequence
capable of hybridizing to SEQ ID NO:4 or SEQ ID NO:6 or its
complementary form under low stringency conditions.
[0025] Accordingly, one aspect of the present invention provides an
isolated nucleic acid molecule comprising a sequence of nucleotides
encoding a chymotrypsin from Helicoverpa ssp. or a variant,
derivative, homolog or analog of said chymotrypsin, wherein said
chymotrypsin exhibits resistance to a PI from N. alata.
[0026] Another aspect of the present invention provides an isolated
chymotrypsin from Helicoverpa ssp. wherein said chymotrypsin
exhibits resistance to a PI from N. alata or a variant, derivative,
homolog or analog of said chymotrypsin.
[0027] The present invention provides compounds which inhibit HpCh5
or its variants and homologs or members of the HpCh5 chymotrypsin
family or which inhibit expression of the HpF5 gene or its variants
and homologs.
[0028] The compounds may be chemical type compounds such as those
sprayed or provided to plants or genetic type molecules which may
be either topically applied or generated in plant cells. The HpCh5
or HpF5 antagonists may also be a modified form of an existing
plant PI.
[0029] The present invention provides, therefore, methods for
inhibiting insect infestation of a plant or for retarding insect
growth and development by the application or dispersement of an
antagonist of HpCh5 activity or HpF5 gene expression.
[0030] The antagonists include compounds which bind to and inhibit
HpCh5 as well as antisense or sense nucleic acid molecules
generated by a plant cell and then ingested by an insect.
[0031] Reference to an "antagonist" includes reference to an
inhibitor.
[0032] The present invention further provides genetically modified
plants which are engineered to produce a HpCh5 or HpF5 antagonist.
Reference to a "plant" includes a monocotyledonous or
dicotyledonous plant and may be a plant regenerated from
genetically transformed callus or tissue or progeny of such a
plant. The present invention further provides seeds and other
reproductive material from the genetically modified plants of the
present invention.
[0033] Plants contemplated herein include cotton, sweet corn,
tomato, tobacco, piniento, potato, sunflower, citrus, plums,
sorghum, leeks, soybean, alfalfa, beans, pidgeon peas, chick peas,
artichokes, curcurbits, lettuce, Dianthus (an ornamental plant) and
geraniums, cape gooseberry, maize, flax and linseed, alfalfa,
lupins, broad beans, garden peas, peanuts, canola, snapdragons,
cherry, sunflower, pot marigolds, Helichrysum (an ornamental
plant), wheat, barley, oats, triticale, carrots, onions orchids,
roses and/or petunias.
[0034] The present invention further provides nucleic acid
molecules which encode potato-derived protenase inhibitors such as
but not limited to Pot1A and Pot1B or their homologs or derivatives
as well as transgenic plants comprising and capable of expressing
same.
[0035] Yet another aspect of the present invention contemplates a
method for screening for an inhibitor of an insect chymotrypsin
which is insensitive to inhibition by NaPI such as HpCh5. Such a
method generally involves testing for chymotryptic activity in the
presence of potential inhibitors. The assay is conveniently
contacted in vitro although the use of H. argmigera and/or H.
punctiga is also encompassed by the present invention. An isolated
inhibitor identified by the subject assay is also contemplated by
the present invention.
[0036] A summary of sequence identifiers used throughout the
subject specification is provided in Table 1.
TABLE-US-00001 TABLE 1 Summary of sequence identifiers SEQUENCE ID
NO: DESCRIPTION 1 linker sequence 2 Amino acid sequence of HpCh5
[FIG. 12] 3 Amino acid sequence of the activation peptide of HpCh5
[FIG. 12] 4 Nucleotide sequence of coding region of mature
chymotrypsin domain of HpF5 [FIG. 12] 5 Nucleotide sequence of
activation peptide of HpF5 [FIG. 12] 6 Nucleotide sequence encoding
activation peptide and HpCh5 mature chymotrypsin domain together
with 3' UTR [FIG. 12] 7 BamHI oligonucleotide primer 8 HindIII
oligonucleotide primer 9 N-terminal sequence of NaPI-insensitive
chymotrypsin HpCh5 [Table 7, FIG. 11B] 10 Fw2ResChy primer [Table
7, FIG. 11B] 11 FwResChym primer [Table 7, FIG. 11B] 12
Hc35PQE-60-Fw primer 13 Hc35PQE-60-Rv primer 14 gene specific sense
primer 15 gene specific antisense primer 16 StPotIA sense primer 17
StPotIB sense primer 18 StPotIA/B antisense primer 19 FWBacRECH1
(5'-3') primer 20 FWBacRECH2 (5'-3') primer 21 RvRECH (3'-5')
primer 22 N-terminal amino acid sequence of six domain PI precursor
from N. alata [FIG. 1C] 23 Amino acid sequence of C1 peptide from
six domain PI precursor from N. alata [FIG. 1C] 24 Amino acid
sequence of T1 peptide from six domain PI precursor from N. alata
[FIG. 1C] 25 Amino acid sequence of T2 and T3 peptides from six
domain PI precursor from N. alata [FIG. 1C] 26 Amino acid sequence
of T4 peptide from six domain PI precursor from N. alata [FIG. 1C]
27 C-terminal amino acid sequence of six domain PI precursor from
N. alata [FIG. 1C] 28-31 Amino acid sequence of peptide fragment of
Helicoverpa punctigera chymotrypsin [FIG. 5B] 32 Amino acid
sequence of chymotrypsin from H. armigera (CAA72966) [FIG. 7] 33
Amino acid sequence of chymotrypsin from H. armigera (CAA72959)
[FIG. 7] 34 Amino acid sequence of chymotrypsin from H. armigera
(CAA72960) [FIG. 7] 35 Amino acid sequence of chymotrypsin from H.
armigera (CAA72958) [FIG. 7] 36 Amino acid sequence of chymotrypsin
from H. armigera (CAA72952) [FIG. 7] 37 Amino acid sequence of
chymotrypsin from H. armigera (CAA72951) [FIG. 7] 38 FWG1 primer
[FIG. 8] 39 RVG4 primer [FIG. 8] 40 Y79Fw primer [FIG. 8] 41 Y72Fw
primer [FIG. 8] 42 Y72Rv primer [FIG. 8] 43 Amino acid sequence of
H. punctigera chymotrypsin (F1Apcr) [FIG. 9] 44 Amino acid sequence
of H. punctigera chymotrypsin (F1Bpcr) [FIG. 9] 45 Amino acid
sequence of H. punctigera chymotrypsin (F2Bpcr) [FIG. 9] 46 Amino
acid sequence ofH. punctigera chymotrypsin (F3pcr) [FIG. 9] 47
Amino acid sequence of H. punctigera chymotrypsin (F4pcr) [FIG. 9]
48 Amino acid sequence of chymotrypsin from H. punctigera (HpCh1AI)
[FIG. 10] 49 Amino acid sequence of chymotrypsin from H. punctigera
(HpCh1BI) [FIG. 10] 50 Amino acid sequence of chymotrypsin from H.
punctigera (HpCh2A) [FIG. 10] 51 Amino acid sequence of
chymotrypsin from H. punctigera (HpCh2B) [FIG. 10] 52 Amino acid
sequence of chymotrypsin from H. punctigera (HpCh3A) [FIG. 10] 53
Amino acid sequence of chymotrypsin from H. punctigera (HpCh4I)
[FIG. 10] 54 Amino acid sequence of chymotrypsin from H. punctigera
(HpCh4II) [FIG. 10] 55 Amino acid sequence of peptide from H.
punctigera chymotrypsin (Rech1a) [FIG. 11A] 56 Amino acid sequence
of peptide from H. punctigera chymotrypsin (Rech1b) [FIG. 11A] 57
Amino acid sequence of peptide from H. punctigera chymotrypsin
(Family1a) [FIG. 11A] 58 Amino acid sequence of peptide from H.
punctigera chymotrypsin (Family1b) [FIG. 11A] 59 Amino acid
sequence of peptide from H. punctigera chymotrypsin (Family2b)
[FIG. 11A] 60 Amino acid sequence of peptide from H. punctigera
chymotrypsin (Family2a) [FIG. 11A] 61 Amino acid sequence of
peptide from H. punctigera chymotrypsin (Family3) [FIG. 11A] 62
Amino acid sequence of peptide from H. punctigera chymotrypsin
(Family4) [FIG. 11A] 63 Amino acid sequence of H. punctigera
chymotrypsin (HpCh1AI) [FIG. 13] 64 Amino acid sequence of H.
punctigera chymotrypsin (HpCh1BI) [FIG. 13] 65 Amino acid sequence
of H. punctigera chymotrypsin (HpCh2B) [FIG. 13] 66 Amino acid
sequence of H. punctigera chymotrypsin (HpCh2A) [FIG. 13] 67 Amino
acid sequence of H. punctigera chymotrypsin (HpCh3) [FIG. 13] 68
Amino acid sequence of H. punctigera chymotrypsin (HpCh4I) [FIG.
13] 69 Amino acid sequence of H. punctigera chymotrypsin (HpCh5)
[FIG. 13] 70 Amino acid sequence of human brain trypsin (TrypsinIV)
[FIG. 13] 71 Amino acid sequence of chymotrypsin from H. armigera
[FIG. 14] 72 Amino acid sequence of chymotrypsin from H. punctigera
[FIG. 14] 73 Amino acid sequence of bovine chymotrypsin B (BOV CHB)
[FIG. 15] 74 Amino acid sequence of bovine chymotrypsin A (BOV CHA)
[FIG. 15] 75 Amino acid sequence from H. punctigera (HpCh2A) [FIG.
15] 76 Amino acid sequence from H. punctigera (HpCh5) [FIG. 15] 77
Amino acid sequence of potato inhibitor I family (PotI) {StPotIB}
[FIG. 24] 78 Amino acid sequence of potato inhibitor I family
(PotI) {X67950} [FIG. 24] 79 Amino acid sequence of potato
inhibitor I family (PotI) {R01052} [FIG. 24] 80 Amino acid sequence
of potato inhibitor I family (PotI) {M17108} [FIG. 24] 81 Amino
acid sequence of potato inhibitor I family (PotI) {StPotIA} [FIG.
24] 82 Amino acid sequence of potato inhibitor I family (PotI)
{K03290} [FIG. 24] 83 Amino acid sequence of potato inhibitor I
family (PotI) {Z12619} [FIG. 24] 84 Amino acid sequence of potato
inhibitor I family (PotI) {X78988} [FIG. 24] 85 Amino acid sequence
of potato inhibitor I family (PotI) {EILXCH} [FIG. 24] 86
Nucleotide sequence encoding endoplasmic reticulum peptide [FIG.
28] 87 Amino acid sequence of endoplasmic reticulum peptide [FIG.
28] 88 Nucleotide sequence of FwBacRECH1 primer [FIG. 28] 89
Nucleotide sequence of FwBacRECH2 primer [FIG. 28] 90 Nucleotide
sequence of HpF5 to which DNA encoding endoplasmic reticulum signal
is to be added [FIG. 28] 91 Amino acid sequence of HpCh5 to which
endoplasmic reticulum signal is to be added [FIG. 28] 92 Nucleotide
sequence of RvRECH primer [FIG. 28] 93 Amino acid sequence of
HpCHY1 [FIG. 4C]
BRIEF DESCRIPTION OF THE FIGURES
[0037] FIG. 1 is a graphical representation showing temperature
stability of baculovirus expressed H. punctigera chymotrypsin.
Bovine chymotrypsin (.diamond-solid.) and HpF5 (.tangle-solidup.)
in 50 mM Na acetate were compared by incubating 100 .mu.L aliquots
at 5.degree. C. intervals between 40.degree. C. and 70.degree. C.
After chilling the heated samples on ice, duplicate activity assays
were performed by incubating 10 .mu.L of bc or 50 .mu.L of HpF5
with substrate at 30.degree. C. Residual activity was presented as
a percentage of the activity of the untreated control.
[0038] FIG. 2 is a graphical representation showing growth of H.
punctigera larvae fed on either low protein haricot bean artificial
diet or cotton leaf artificial diet, in the presence or absence of
0.26% (w/v) NaPIs. Weight gain (mg) was monitored for 21 days.
Larvae grew at a similar rate on both artificial diets and growth
was retarded in the presence of NaPIs. (A) Growth of larvae. (B)
Relative size of larvae at 21 days after feeding on cotton
artificial diet, in the presence or absence of 0.26% NaPIs. Only
five of the 20 larvae fed on NaPI survived and all five weighed
less than control larvae after 21 days. (C) The effect of NaPIs on
gut trypsin and chymotrypsin activity. When each H. punctigera
larva reached the late fourth/early fifth instar stage of
development, the gut was removed and gut extract prepared prior to
assays for trypsin and chymotrypsin activity. Extracts from
individual larvae fed on control cotton-leaf artificial diet (CC)
are indicated in grey and larvae fed on the same diet containing
0.26% ((w/v)) NaPI (NC) are indicated in black. Only four test
larvae survived to fifth instar, whereas most control larvae
survived. All assays were performed in duplicate. Trypsin activity
was determined using BAPNA substrate and chymotrypsin activity with
SAAPFpNA substrate. Units of activity are expressed as change in
absorbance at 405 nm/min/mg gut extract protein (+standard
deviation). Trypsin activity was almost abolished, relative to
controls, in extracts from NaPI-fed larvae, while chymotrypsin
activity was low in two of the four NaPI-fed larvae. (D) The effect
of NaPIs on trypsin and chymotrypsin activity in the frass. Frass
was collected from each larva fed on the cotton leaf artificial
diet and faecal extracts were prepared. Trypsin and chymotrypsin
activity in extracts from larvae fed on the control diet (CC) are
indicated in grey and larvae fed on the same diet containing 0.26%
((w/v)) NaPI (NC) are indicated in black. Note that frass of larvae
CC16 and NC13 were included in this analysis but excluded from FIG.
2C because the gut were damaged during preparation of extracts. All
assays were performed in duplicate. Trypsin activity was determined
using BAPNA substrate and chymotrypsin activity with SAAPFpNA
substrate. Units of activity are expressed as change in absorbance
at 405 nm/min/mg faecal extract protein (.+-.standard deviation).
Negligible trypsin activity was evident in extracts from NaPI-fed
larvae, while chymotrypsin activity was elevated, relative to
controls. (E) Levels of trypsin in the frass of control and NaPI
fed larvae. Frass extracts were analysed on 15% ((w/v)) SDS-PAGE
and transferred to nitrocellulose. The nitrocellulose filter was
probed with rabbit anti-HpTRY1 serum (1 in 2000 dilution) as the
primary antibody, followed by the secondary antibody, donkey
anti-rabbit IgG-horse radish peroxidase conjugate (1 in 2000
dilution). Immuno-reactive proteins were visualized using Enhanced
Chemiluminescence (ECL) reagents and HyperfilmECL X-ray film. The
trypsin in the frass of larvae that consumed NaPIs (NC) was
significantly increased relative to controls (upper panel) but
inactive (lower panel), presumably because it was in complex with
the NaPIs. In comparison, trypsin was active in the frass of the
control larvae (CC) even though the amount present was below the
detection level of the antibody. (F) Production of NaPI-insensitive
proteases in the gut of NaPI fed larvae. The gut extracts of the
larvae were subjected to inhibition assays to identity
NaPI-insensitive trypsins and chymotrypsins. Each extract was
pre-incubated for 30 min at 30.degree. C. in the presence or
absence of 80 nM NaPI inhibitor (T1 monomer for trypsin assays and
C1 monomer for chymotrypsin assays), prior to the addition of
substrate to initiate the reaction. Results from extracts assayed
without inhibitor are indicated in grey (control larvae) and black
(NaPI-fed larvae). Results from extracts assayed with inhibitor are
stippled. All assays were performed in duplicate. Units of activity
are expressed as substrate hydrolysis at 405 nm/min/mg extract
protein (+standard deviation). (A) Inhibition of trypsin activity
by T1. Trypsin activity was determined using BAPNA substrate. (B)
Inhibition of chymotrypsin activity by C1. Chymotrypsin activity
was determined with SAAPFpNA substrate. T1 almost totally inhibited
trypsin activity in the extracts of control larvae, indicating
these larvae did not produce NaPI-insensitive trypsins. The
extracts from NaPI-fed larvae contained negligible trypsin
activity, but this activity could not be inhibited by T1. C1 did
not inhibit chymotrypsin activity in the extracts of six control
larvae and only partially inhibited the gut chymotrypsins in the
rest of the controls indicating the control insects contained a
C1-insensitive chymotrypsin. Most of the chymotrypsin activity in
extracts from NaPI-fed larvae can be attributed to NaPI-insensitive
chymotrypsins. When extracts from control and NaPI-fed larvae were
pre-incubated with 80 nM chymostatin, all chymotrypsin activity was
abolished.
[0039] FIG. 3 is a graphical representation showing the effect of
various proteinase inhibitors on the chymotrypsin activity in
unfractionated gut extracts from H. punctigera. Proteinase
inhibitors were mixed with 1 .mu.g of protein from an
unfractionated gut extract before incubation with the chymotrypsin
substrate N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide. Inhibition is
expressed as a percentage of the total activity in the control
samples.
[0040] FIG. 4 is a photographic representation showing purification
and N-terminal sequence of an NaPI inhibitable chymotrypsin from H.
punctigera gut. (A and B) Protein gel analysis of fractions at
various stages of purification using an affinity column with
immobilized C1 inhibitor (FIG. 1). (A) 15% ((w/v))
SDS-polyacrylamide gel loaded with (a) unfractionated gut extract
(b) and (c) unbound proteins. (B) 12.5% (w/v) SDS-polyacrylamide
gel loaded with (d) wash fraction (e) protein bound to the C1
column. (C) N-terminal sequence of the .about.24 kDa protein in
lane (e).
[0041] FIG. 5 is a diagrammatic representation showing purification
and N-terminal sequence of an NaPI-insensitive chymotrypsin from H.
punctigera. (A) PVDF blot of chymotrypsin (i) eluted from potato
inhibitor column. Potato Inhibitor II (ii) and potato inhibitor I
(iii) both co-eluted from the matrix under denaturing conditions.
(B) N-terminal amino acid sequence obtained from PVDF blot. Rech1a
was the most abundant of the four sequences obtained.
[0042] FIG. 6 is a graphical representation showing the effect of
pH and a range of substrates on the activity of the
NaPI-insensitive chymotrypsin from H. punctigera midgut. SA.sub.2
PF-pNA, N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide; SA.sub.2PL-pNA,
N-succinyl-Ala-Ala-Pro-Leu-p-nitroanilide; MA.sub.2PM-pNA,
N-methoxysuccinyl-Ala-Ala-Pro-Met-p-nitroanilide.
[0043] FIG. 7 is a diagrammatic representation showing the design
of oligonucleotide primers for amplification of chymotrypsins from
H. punctigera. An alignment of chymotrypsins from Helicoverpa
armigera predicted from DNA sequences in the GenBank database. NCBI
protein database accession numbers are left of the sequences.
Regions corresponding to the oligonucleotide primers are boxed and
the direction of amplification are indicated by arrows.
[0044] FIG. 8 is a diagrammatic representation showing
oligonucleotide sequences used in RT-PCR amplification of
Helicoverpa chymotrypsins.
[0045] FIG. 9 is a diagrammatic representation showing PCR products
from amplification of cDNAs encoding H. punctigera chymotrypsins.
PCR amplification of cDNA prepared from gut mRNA yielded partial
sequence for five distinct chymotrypsins. The translated sequence
is aligned and the region corresponding to the PCR primers is
boxed.
[0046] FIG. 10 is a diagrammatic representation showing alignment
of predicted amino acid sequence of chymotrypsins from H.
punctigera. The catalytic residues are marked by a solid triangle
(). The highly conserved active site motifs are highlighted with
grey. The dipeptide R-I (.dwnarw..dwnarw.), conserved among all
chymotrypsins is the site for the proposed cleavage of the
activation peptide by trypsin. The residues that lie in the
substrate binding pocket and confer substrate specificity are
indicated by the symbols , .sctn., #. The cysteine (.cndot.)
residues are highly conserved among all chymotrypsins.
[0047] FIG. 11 is a diagrammatic representation showing design of
oligonucleotide primers for amplification of cDNA encoding the
NaPI-insensitive chymotrypsins from H. punctigera. (A) Comparison
of the N-terminal sequence of two NaPI-insensitive chymotrypsins
with Helicoverpa chymotrypsins predicted from the cDNA clones. The
unique regions F1 and F2 are shaded. (B) Oligonucleotide primers
complementary to unique regions at the N-terminus of the
insensitive chymotrypsin.
[0048] FIG. 12 is a diagrammatic representation showing nucleotide
sequence and deduced amino acid sequence from the cDNA encoding the
insensitive chymotrypsin. The nucleotide sequence of the
insensitive chymotrypsin cDNA and deduced amino acid sequence. The
amino acid sequence obtained from N-terminal sequence of purified
protein is shaded in grey. The putative site for endoproteolytic
cleavage by trypsin is shown by the arrow. The double underlined
regions in the nucleotide sequence refer to the positions of the
degenerate primers used for PCR amplification. The polyadenylation
signal sequence is single underlined and an asterisk marks the stop
codon. The deduced amino acid sequence of the putative activation
peptide is numbered -40 to -1 followed by the mature domain (+1).
The three amino acids that correspond to the catalytic residues are
marked by the symbol #. The chymotrypsin substrate specificity
residue, serine, located at the base of the primary
substrate-binding pocket is marked with the symbol .sctn..
[0049] FIG. 13 is a representation showing alignment of H.
punctigera chymotrypsin families showing sequence identity.
ClustalW alignment of members from the five families of H.
punctigera chymotrypsins. Protein sequence is given in single
letter code. Identical amino acids are coloured black, similar
amino acids are grey. Amino acids are numbered on the right and
gaps have been introduced to maximize the alignment. The
NaPI-insensitive chymotrypsins are members of family 5 and are
characterized by a unique arginine residue (arrowed) at position
185. Human trypsin IV also contains an arginine residue (arrowed)
in a similar position.
[0050] FIG. 14 is a representation showing alignment of the H.
punctigera NaPI-insensitive chymotrypsin with a homolog from H.
armigera that also has an arginine residue at position 185.
[0051] FIG. 15 is a representation showing the deduced protein
sequences for the insensitive (HpCh5) and sensitive (HpCh2A)
chymotrypsins from H. punctigera aligned to the bovine chymotrypsin
isoforms A and B. H. punctigera chymotrypsins HpCh2A and HpCh5 were
aligned to the bovine chymotrypsin isoforms A and B using ClustalW.
The numbering system (excluding gaps) is according to the
nomenclature of Greer, Proteins 7: 317-34, 1990 used for bovine
chymotrypsin. Dots throughout the sequences represent conserved
residues. The regions shaded in grey designate residues that form
surface loops that are involved in recognition and binding of
substrates or inhibitors. The primary substrate-binding pocket is
formed by the regions labeled S1A, S1B and S1C. The S1' site is
formed by loops 35 and 60. Black boxes mark residues in the HpF5
sequence that differ significantly to amino acids in the
corresponding positions in other chymotrypsins. Using the Greer,
1990, supra nomenclature these residues are Asp36, Arg 63, Thr72,
Pro 83, Gly 109, Ileu 120, Glu insertion between 129 and 130, Glu
134, Ser145, Arg 192 and Pro 207. The boxed amino acids are removed
from bovine chymotrypsins by autocatalytic cleavage that results in
the formation of .alpha.-chymotrypsin.
[0052] FIG. 16 is a diagrammatic representation showing several
surface loops in the structural model of H. punctigera chymotrypsin
HpCh2A are larger than the cognate loops in bovine chymotrypsin.
The structural model of H. punctigera F2A chymotrypsin (grey) was
superimposed onto the structure of alpha-chymotrypsin from Bos
taurus (black). Surface loops 60, 35, and 142 that are implicated
in substrate recognition are larger in the insect chymotrypsin
model. The chymotrypsin substrate specificity residue, serine 189,
positioned at the base of the primary substrate-binding pocket is
viewed as a space filled representation of the van der Waals
radius.
[0053] FIG. 17 is a representation showing glutamine 192 (Greer,
1990, supra nomenclature, FIG. 15) of the sensitive chymotrypsin
HpCh2A appears easily accommodated when modeled in complex with C1.
Structural model of the sensitive chymotrypsin HpCh2A (grey) in
complex with the proteinase inhibitor C1 (black). The side chain of
glutamine 192 is arrowed The residues of C1 in the vicinity of Gln
192 are represented in stick configuration (black).
[0054] FIG. 18 is a diagrammatic representation showing comparison
of the environment surrounding residue 192 of the sensitive and
insensitive chymotrypsin complexed to C1. Enlarged view of the
boxed area shown in FIG. 17. Arginine 192 of the insensitive
chymotrypsin (B) appears to clash with residues of the C1
inhibitor, in contrast there is no apparent conflict with glutamine
192 of the sensitive chymotrypsin (A).
[0055] FIG. 19 is a diagrammatic representation showing the
environment surrounding arginine 192 when the insensitive
chymotrypsin is complexed to the Type 1 potato proteinase inhibitor
(PotIB, FIG. 24). (A) Structural model of the insensitive
chymotrypsin HpCh5 (grey) in complex with the potato type I
proteinase inhibitor PotI (black). (B) Enlarged view of the region
around Arg 192 (boxed area in B). The side chain of arginine 192 is
labeled. The residues of PotI in the vicinity of Arg 192 are
represented in stick configuration (black).
[0056] FIG. 20 is a photographic representation showing expression
of the chymotrypsin clone HpF2B in E. coli cells for the production
of a polyclonal antibody. (A) The separation of total cell lysates
taken at time points 0-5 hr after induction of HpCh2B on a 12.5%
(w/v) SDS-PAGE gel stained with Coomassie Blue. The lanes are
marked by the number of hours after induction and the arrow
indicates the position of the induced protein with the correct
predicted molecular mass. (B) Panel 1: Bacterially expressed HpCh2B
purified on Talon resin (BD Biosciences Clontech), separated on a
15% (w/v) SDS-PAGE gel and stained with Coomassie Blue. Panel 2:
Identical sample to Panel 1 transferred to nitrocellulose and
immunostained with anti-HpCh2B antibodies. (C) Decreasing amounts
(200, 150, 100, 75, 50, 25, 20, 10, 0 ng) of bacterially expressed
chymotrypsin HpCh2B separated by SDS-PAGE and stained with silver
and a protein blot of an identical gel probed with
anti-chymotrypsin HpCh2B antibodies (1/2500). The H. punctigera
antibody had a detection limit of 20 ng of bacterially expressed
protein.
[0057] FIG. 21 is a photographic representation showing specificity
of antibodies raised against bacterially expressed NaPI-insensitive
(HpCh5) and sensitive (HpCh2B) chymotrypsins from H. punctigera.
Bacterially expressed NaPI-insensitive (R) and sensitive (C)
chymotrypsins were separated by SDS-PAGE on 12.5% (w/v)
polyacrylamide gels and (A) stained with Coomassie Blue, (B)
immunoblotted with an .alpha.-His tag antibody, (C) immunoblotted
with the antibody to the HpCh2B chymotrypsin (.alpha.-RC), and (D)
immunoblotted with the antibody to the HpCh5 chymotrypsin
(.alpha.-SC).
[0058] FIG. 22 are representations showing purification of PotI
from potato tubers. PotI was purified from potato tubers (Russet
Burbank) by acid extraction, ammonium sulphate precipitation and
gel filtration. (A) SDS-PAGE stained with silver. lane 1: molecular
size markers (kDa), lane 2: pooled PotI containing fractions from
G-75 column, lane 3: immunoblot of lane 2 using an antibody raised
in rabbits to a commercial preparation of PotI (Calbiochem) linked
to keyhole limpet hemocyanin. PotI was identified as a single band
with an approximate mass of 6 kDa. (B) RP-HPLC of pooled G-75
fractions from A. Peaks 1, 2 and 3 are PotI isoforms, peak 4 is a
contaminating protein.
[0059] FIG. 23 is a graphical representation showing growth of H.
armigera larvae on artificial diet containing NaPI and PotI. Growth
of H. armigera larvae fed on a cotton leaf artificial diet in the
presence or absence of 0.26% (w/v) NaPI or 0.26% (w/v) NaPI plus
0.26% (w/v) PotI. The PotI was purified from potato tubers (var
Russet Burbank), see FIG. 22. Twenty five larvae were used on each
diet. The weight of the larvae was measured at days 7, 10, 12, 14
and 17 post egg hatch. At day 17, larvae fed NaPI alone were 84% of
the control and larvae fed NaPI and PotI were 34% of the control.
Two larvae fed on the control diet died, seven larvae fed the NaPI
diet died and six larvae fed on the NaPI plus PotI diet died.
[0060] FIG. 24 is a representation showing the alignment of
predicted amino acid sequence of StPotIA and StPotIB with members
of the potato Inhibitor I family. ClustalW alignment of several
members of the Potato Inhibitor I family. X67950: potato cDNA,
(Beuning and Christeller, Plant Physiol 102: 1061, 1993), P01052:
potato protein (Richardson and Cossins, FEBS Letters, 52: 161,
1975), M17108: potato genomic sequence (Cleveland et al., Plant
Mol. Biol. 8: 199-207, 1987), K03290: tomato (Graham et al., J.
Biol. Chem., 260: 6555-6560, 1985) Z12619: tobacco (Lindhorst et
al., Plant Mol. Biol. 21: 985-992, 1993), X78988: maize (Jose
Cordero et al., Plant J. 6: 141-150, 1994), EILXCH: leech (See
Muller et al., Hoppe-Seyler's Z. Physiol. Chem. 358: 1105-1117,
1977). * P1 reactive site. Both StPotIA and StPotIB are similar to
other family members from potato. However, StPotIA has an
additional four amino acids at position 41 to 44 that are also
found in a wound induced PotI from tomato (K03290). StPotIB has a
methionine at the P1 site which is common for potato isolates.
StPotIA has an alanine at the P1 site which has not been reported
for PotI isolates from potato, but is present in a PotI isolate
from maize (X78988).
[0061] FIG. 25 is a graphical representation showing purification
of E. coli expressed StPotIA and StPotIB. StPot1A and StPotIB were
purified using the N-terminal HIS tag fused to StPot1A and StPotIB
and a metal affinity resin followed by RP-HPLC. Profile after
separation by RP-HPLC. Protein was eluted with a linear gradient of
0-100% Buffer B (80% (v/v) acetonitrile, 0.1% (v/v) TFA) at a
flow-rate of 1 ml/min over 60 min. (A) StPotIA, (B) StPotIB.
StPotIA eluted in one major peak at 36 min retention time (60%
Buffer B) and StPotIB eluted in one major peak at 25 min retention
time (42% Buffer B). The peaks were analyzed by SDS-PAGE and
stained with silver (insert in A). Lane 1 is StPotIA (pk1), lane 2
is StPotIB (pk2) and lane 3 is purified PotI from potato tubers.
StPotIA and StPotIB have a different apparent mobility (10 kDa) to
a mix of Pot1 isoforms isolated from tubers (6 kDa), due to the
additional HIS-tag epitope at the N terminus.
[0062] FIG. 26 is a graphical representation showing inhibition of
NaPI-insensitive chymotrypsin by bacterially expressed StPotIA and
StPotIB. Inhibition of the NaPI-insensitive chymotrypsin from the
gut of H. punctigera with purified PotI. (A) substrate SA.sub.2
PFpNA, development time 30 min, (B) substrate SA.sub.2PLpNA, 30 min
incubation. Mix of PotI isoforms from potato tuber (circle),
StPotIA (square), StPotIB (triangle). StPotIA, StPotIB and the PotI
from potato tubers were good inhibitors of the NaPI-insensitive
chymotrypsin.
[0063] FIG. 27 is a graphical representation showing growth of H.
armigera larvae on transgenic cotton expressing NaPI and PotI.
Transgenic cotton cv Coker 315 was used in bioassays with H.
armigera. Thirty larvae were fed leaves of either the control
untransformed Coker 315, transgenic line 1 (NaPI), transgenic line
2 (StPot1A) or transgenic plant 3 (NaPI X StPot1A). The weight of
the larvae was measured at day 7 post-egg hatch. (A) Growth of
larvae. At day 7, larvae fed leaves expressing NaPI were 86% of the
weight of the control larvae fed untransformed leaves. Larvae fed
leaves expressing StPotIA were 92% of the control and larvae fed
leaves expressing both NaPI and StPotIA were 46% of the control.
(B) The effect of ingestion of NaPI and PotI on gut trypsin and
chymotrypsin activity. Gut from the larvae in each experiment were
pooled and extracts prepared. All assays were performed in
duplicate. Trypsin activity (black) was determined using BAPNA
substrate and chymotrypsin activity (grey) with SA.sub.2 PFpNA
substrate. Units of activity are expressed as change in absorbance
at 405 nm/min/ug gut extract protein. Trypsin activity was reduced,
relative to the control, in the extracts from larvae fed leaves
expressing NaPI and NaPI+StPotIA. Chymotrypsin activity was
elevated in extracts from larvae fed leaves expressing NaPI or
NaPI+StPotIA and reduced in extracts from larvae fed StPotIA
alone.
[0064] FIG. 28 diagrammatic representation showing the nucleotide
sequence and deduced amino acid sequence from the HpF5 cDNA
encoding the NaPI-insensitive chymotrypsin and the location of the
oligonucleotide primers used to add an endoplasmic reticulum
sequence to HpCh5. The FwBacRECH1 primer was used to add the first
half of the ER signal sequence as well as a silent mutation,
changing A to G to destroy the BamHI cut site. The FwBacRECH2
primer added the remainder of the coding sequence for the ER signal
as well as a BamHI cut site to the 3' end of the sequence. The ER
signal was added before the hexahistidine tag to enable
purification of the expressed protein by metal affinity
chromatography after cellular processing. The added amino acids are
shaded in grey.
[0065] FIG. 29 is a photographic representation showing expression
of the chymotrypsin clone HpF5 in baculovirus infected insect
cells. Expressed proteins were separated on 12.5% (w/v) SDS-PAGE
gels and subjected to immunoblots with the .alpha.-HpCh5-antibody
(A) RCDNA. Production of HpCh5 by HIGH FIVE (trademark) insect
cells transfected with 20 .mu.l of bacmid DNA. Controls;
(pFastBacVector) insect cells transfected with bacmid DNA
transposed with pFastBac vector without the HpF5insert; (blue
colony) insect cells transfected with untransposed bacmid DNA;
(cells alone) untransfected insect cells; (Cellfectin) insect cells
treated with CELFECTIN (registered trademark) alone; The positive
control, + is bacterially expressed HpCh5 with a hexahistidine tag.
(B) Production of HpCh5 by HIGH FIVE (trademark) insect cells
infected with virus. RC 24, 48 and 72. Medium collected 24, 48 and
72 hours after infection with HpF5 recombinant virus. Controls 24,
48 and 72. Medium from cells treated with virus prepared from
nontransfected bachmid (blue colony) for 24, 48 and 72 hours.
Positive control is bacterially expressed HpCh5 with a
hexahistidine tag.
DETAILED DESCRIPTION OF THE INVENTION
[0066] The present invention is predicated in part on the
identification and cloning of a novel insect chymotrypsin molecule
termed "HpCh5". cDNA encoding HpCh5 is referred to herein as
"HpF5". The isolation of this molecule permits the identification
and design of a range of products which are useful in controlling
the growth, development and/or overall biological fitness of
Helicoverpa spp. and other insects. These products generally act as
antagonists of HpCh5 function or HpF5 gene expression and are
useful as insect control agents.
[0067] The amino acid sequence of HpCh5 is set forth in SEQ ID
NO:2. The nucleotide sequence of HpF5 is set forth in SEQ ID NOs:4
and 6.
[0068] Reference herein to "HpCh5" should be understood as a
reference to all forms of HpCh5 including, for example, any peptide
isoforms which arise from alternative splicing of HpF5 mRNA,
mutants or polymorphic variants of HpCh5, any post-translation
modified forms of HpCh5 or any non-post-translational modified
forms of HpCh5 as well as any homolog in other insect species or
strains. The term "HpCh5" also encompasses members in a HpCh5
family of chymotrypsin molecules. To the extent that it is not
specified, reference herein to HpCh5 includes derivatives,
homologs, analogs, chemical equivalents and mimetics thereof.
Reference to HpCh5 also refers to any variant having at least 75%
amino acid identity to SEQ ID NO:2 after optimal alignment.
Examples of variants of HpCh5 include PI-sensitive variants such as
those inter alia having an Arg 192 Gln or Arg 192 Asn substitution.
Other variants include the N-terminal signal sequence of HpCh5 as
defined in SEQ ID NO:3 and which is encoded by the nucleotide
sequence set forth in SEQ ID NO:5. Such variants include a signal
sequence comprising an amino acid sequence having at least about
75% similarity to SEQ ID NO:3 after optimal alignment or encoded by
a nucleotide sequence having at least about 75% identity to SEQ ID
NO:5 or a nucleotide sequence capable of hybridizing to SEQ ID NO:5
after optimal alignment.
[0069] Reference to "HpF5" should be understood as reference to all
forms of HpF5 including any cDNA isoform, genomic forms, mutants
and polymorphic variants of HpF5 as well as any homologs from other
species or strains of insect. The term "HpF5" also encompasses
members of a HpF5 family of genes which encode HpCh5 or HpCh5-type
chymotrypsins. To the extent that it is not specified, reference
herein to HpF5 includes derivatives of HpF5 as well as a nucleotide
sequence having at least about 75% identity to SEQ ID NO:4 or SEQ
ID NO:6 or a nucleotide sequence capable of hybridizing to SEQ ID
NO:4 or SEQ ID NO:6 or its complementary form under low stringency
conditions. The signal sequence of HpF5 as defined in SEQ ID NO:3
and encoded by SEQ ID NO:5 also encompasses variants thereof. As
indicated above, such variants include a signal sequence having at
least about 75% similarity to SEQ ID NO:3 after optimal alignment
and/or being encoded by a nucleotide sequence capable of
hybridizing to SEQ ID NO:5 under low stringency conditions and/or a
nucleotide sequence having at least about 75% identity to SEQ ID
NO:5 after optimal alignment.
[0070] Before describing the present invention detail, it is to be
understood that unless otherwise indicated, the subject invention
is not limited to specific formulations of components,
manufacturing methods, administration regimens, or the like, as
such may vary. It is also to be understood that the terminology
used herein is for the purpose of describing particular embodiments
only and is not intended to be limiting.
[0071] It must be noted that, as used in the subject specification,
the singular forms "a", "an" and "the" include plural aspects
unless the context clearly dictates otherwise. Thus, for example,
reference to an "agent" or "antagonist" includes a single agent or
antagonist as well as two or more agents or antagonists and so
forth.
[0072] In describing and claiming the present invention, the
following terminology is used in accordance with the definitions
set forth below.
[0073] The terms "compound", "agent", "active agent" and "active"
are used interchangeably herein to refer to a chemical compound
which inhibits the activity of HpCh5 or the expression of a genomic
gene corresponding to HpF5. The terms also encompass agriculturally
or horticultural active ingredients of those active agents
specifically mentioned herein including but not limited to salts,
esters, amides, prodrugs, active metabolites, analogs and the like.
When the term "compound", "agent", "active agent" or "active" is
used, then it is to be understood that this includes the agent per
se as well as agriculturally or horticulturally acceptable,
physiologically active salts, esters, amides, prodrugs,
metabolites, analogs, etc. The term "compound" is not to be
construed as a chemical compound only but extends to peptides,
polypeptides and proteins as well as genetic molecules such as RNA,
DNA and chemical analogs thereof.
[0074] The present invention contemplates, therefore, compounds
useful in down-regulating the activity of HpCh5 or down-regulating
expression of a genomic gene corresponding to HpCh5. The term
"down-regulating" encompasses inhibition of HpCh5 activity. The
inhibition of HpCh5 or reduction in its levels has the effect of
reducing or retarding the growth of the insect. The inhibition of
HpCh5 activity or HpF5 gene expression may occur by producing an
inhibitor in a plant which is then consumed by the insect or the
inhibitor may be topically applied to a plant or sprayed or
otherwise dispersed to insects or a source of insects. In this
regard, the plant may produce a nucleic acid molecule that
interferes with HpF5 expression when consumed by the insect.
Alternatively, the plant may produce a PI capable of inhibiting
HpCh5. Still in a further alternative, the HpCh5 inhibitor is a
non-proteinaceous chemical applied to the surface of a plant or
taken up by the root system of a plant. Reference herein to a
"plant" is not to exclude trees or cultured tissues (e.g. callus)
from a plant (or tree).
[0075] Reference to compounds, agents and actives also includes
combinations of compounds, agents or actives. Such combinations may
be formulated in multi-part agricultural or horticultural
compositions which are admixed together prior to dispersement or
given sequentially.
[0076] The terms "effective amount", "insecticidal effective
amount" and "insect-static effective amount" of an agent as used
herein mean a sufficient amount of the agent to reduce or retard
insect growth and development and/or to kill or inhibit the
insect.
[0077] By "agriculturally acceptable" or "horticulturally
acceptable" carrier, excipient or diluent is meant a vehicle
comprised of a material that is not environmentally or otherwise
undesirable to a plant or non-target insect. Carriers may include
excipients and other additives such as diluents, detergents,
coloring agents, wetting or emulsifying agents, pH buffering
agents, preservatives, and the like.
[0078] The terms "treating" and "treatment" as used herein in
relation to plants or eradication of insects refer to reduction in
severity of symptoms of insect infestation of a plant or the
application of the agents to a group of insects resulting in
retardation of their growth, development or biological fitness or
wellbeing.
[0079] The compounds of the present invention may be large or small
molecules, nucleic acid molecules (including antisense or sense
molecules), peptides, polypeptides or proteins or hybrid molecules
such as RNAi- or siRNA-complexes, ribozymes or DNAzymes.
[0080] The term "nucleic acid molecule" is also encompassed by the
expression "genetic molecule" and includes hairpin constructs such
as those which include RNAi-mediated post-transcriptional gene
silencing or methylation-mediated silencing.
[0081] Accordingly, one aspect of the present invention provides an
isolated nucleic acid molecule or derivative, homolog or analog
thereof comprising a nucleotide sequence encoding a novel
chymotrypsin protein or a derivative, homolog or mimetic thereof
wherein said chymotrypsin is insensitive to a PI of N. alata.
[0082] More particularly, the present invention is directed to a
nucleic acid molecule or derivative, homolog or analog thereof
comprising a nucleotide sequence encoding, or a nucleotide sequence
complementary to a nucleotide sequence encoding, an amino acid
sequence substantially as set forth in SEQ ID NO:2 or a derivative,
homolog or mimetic thereof or having at least about 75% or greater
identity to SEQ ID NO:2 after optimal alignment or a nucleotide
sequence set forth in SEQ ID NO:4 or SEQ ID NO:6 or a nucleotide
sequence having at least about 75% similarity or greater to SEQ ID
NO:4 or SEQ ID NO:6 or a nucleotide sequence capable of hybridizing
to SEQ ID NO:4 or SEQ ID NO:6 or its complementary form under low
stringency conditions.
[0083] Another aspect of the present invention provides an isolated
chymotrypsin Helicoverpa ssp. wherein said chymotrypsin exhibits
resistance to a PI from N. alata or a variant, derivative, homolog
or analog of said chymotrypsin.
[0084] More particularly, the isolated chymotrypsin comprises an
amino acid sequence set forth in SEQ ID NO:2 or an amino acid
sequence having at least about 75% similarity to SEQ ID NO:2 after
optimal alignment.
[0085] The term "similarity" as used herein includes exact identity
between compared sequences at the nucleotide or amino acid level.
Where there is non-identity at the nucleotide level, "similarity"
includes differences between sequences which result in different
amino acids that are nevertheless related to each other at the
structural, functional, biochemical and/or conformational levels.
Where there is non-identity at the amino acid level, "similarity"
includes amino acids that are nevertheless related to each other at
the structural, functional, biochemical and/or conformational
levels. In a particularly preferred embodiment, nucleotide and
amino acid sequence comparisons are made at the level of identity
rather than similarity.
[0086] Terms used to describe sequence relationships between two or
more polynucleotides or polypeptides include "reference sequence",
"comparison window", "sequence similarity", "sequence identity",
"percentage of sequence similarity", "percentage of sequence
identity", "substantially similar" and "substantial identity". A
"reference sequence" is at least 12 but frequently 15 to 18 and
often at least 25 or above, such as 30 monomer units, inclusive of
nucleotides and amino acid residues, in length. Because two
polynucleotides may each comprise (1) a sequence (i.e. only a
portion of the complete polynucleotide sequence) that is similar
between the two polynucleotides, and (2) a sequence that is
divergent between the two polynucleotides, sequence comparisons
between two (or more) polynucleotides are typically performed by
comparing sequences of the two polynucleotides over a "comparison
window" to identify and compare local regions of sequence
similarity. A "comparison window" refers to a conceptual segment of
typically 12 contiguous residues that is compared to a reference
sequence. The comparison window may comprise additions or deletions
(i.e. gaps) of about 20% or less as compared to the reference
sequence (which does not comprise additions or deletions) for
optimal alignment of the two sequences. Optimal alignment of
sequences for aligning a comparison window may be conducted by
computerized implementations of algorithms (GAP, BESTFIT, FASTA,
and TFASTA in the Wisconsin Genetics Software Package Release 7.0,
Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or
by inspection and the best alignment (i.e. resulting in the highest
percentage homology over the comparison window) generated by any of
the various methods selected. Reference also may be made to the
BLAST family of programs as, for example, disclosed by Altschul et
al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion
of sequence analysis can be found in Unit 19.3 of Ausubel et al.
("Current Protocols in Molecular Biology" John Wiley & Sons
Inc, 1994-1998, Chapter 15, 1998).
[0087] The terms "sequence similarity" and "sequence identity" as
used herein refers to the extent that sequences are identical or
functionally or structurally similar on a nucleotide-by-nucleotide
basis or an amino acid-by-amino acid basis over a window of
comparison. Thus, a "percentage of sequence identity", for example,
is calculated by comparing two optimally aligned sequences over the
window of comparison, determining the number of positions at which
the identical nucleic acid base (e.g. A, T, C, G, I) or the
identical amino acid residue (e.g. Ala, Pro, Ser, Thr, Gly, Val,
Leu, Ile, Phe, Tyr, Trp, Lys, Arg, H is, Asp, Glu, Asn, Gln, Cys
and Met) occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison (i.e., the window
size), and multiplying the result by 100 to yield the percentage of
sequence identity. For the purposes of the present invention,
"sequence identity" will be understood to mean the "match
percentage" calculated by the DNASIS computer program (Version 2.5
for windows; available from Hitachi Software engineering Co., Ltd.,
South San Francisco, Calif., USA) using standard defaults as used
in the reference manual accompanying the software. Similar comments
apply in relation to sequence similarity. The term "similarity" is
particularly useful to describe amino acid sequence comparisons.
The term "identity" is particularly useful to describe nucleotide
sequence comparisons.
[0088] Reference to at least about 75% identity or 75% similarity
includes percentage identities and similarities greater than 75%
such as 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and
100%.
[0089] Reference herein to a low stringency means from at least
about 0 to at least about 15% (v/v) formamide (including 1%, 2%,
3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% 11%, 12%, 13% and 14% (v/v)
formamide) and from at least about 1 M to at least about 2 M salt
for hybridization, and at least about 1 M to at least about 2 M
salt for washing conditions. Generally, low stringency is at from
about 25-30.degree. C. to about 42.degree. C. The temperature may
be altered and higher temperatures used to replace formamide and/or
to give alternative stringency conditions. Alternative stringency
conditions may be applied where necessary, such as medium
stringency, which includes and encompasses from at least about 16%
(v/v) to at least about 30% (v/v) formamide and from at least about
0.5 M to at least about 0.9 M salt for hybridization, and at least
about 0.5 M to at least about 0.9 M salt for washing conditions, or
high stringency, which includes and encompasses from at least about
31% (v/v) to at least about 50% (v/v) formamide and from at least
about 0.01 M to at least about 0.15 M salt for hybridization, and
at least about 0.01 M to at least about 0.15 M salt for washing
conditions. In general, washing is carried out T.sub.m=69.3+0.41
(G+C) % (Marmur and Doty, J. Mol. Biol. 5: 109, 1962). However, the
T.sub.m of a duplex DNA decreases by 1.degree. C. with every
increase of 1% in the number of mismatch base pairs (Bonner and
Laskey, Eur. J. Biochem. 46: 83, 1974). Formamide is optional in
these hybridization conditions. Accordingly, particularly preferred
levels of stringency are defined as follows: low stringency is
6.times.SSC buffer, 0.1% (w/v) SDS at 25-42.degree. C.; a moderate
stringency is 2.times.SSC buffer, 0.1% (w/v) SDS at a temperature
in the range 20.degree. C. to 65.degree. C.; high stringency is
0.1.times.SSC buffer, 0.1% (w/v) SDS at a temperature of at least
65.degree. C.
[0090] A further aspect of the present invention contemplates a
nucleic acid molecule or derivative, homolog or analog thereof
comprising a nucleotide sequence substantially as set forth in SEQ
ID NO:4 or SEQ ID NO:6 or a nucleotide sequence having at least 75%
or greater similarity to SEQ ID NO:4 or SEQ ID NO:6 or a
derivative, homolog or analog thereof, or capable of hybridizing to
SEQ ID NO:4 or SEQ ID NO:6 or its complementary form under low
stringency conditions and which encodes an amino acid sequence
substantially as set forth in SEQ ID NO:2 or a derivative, homolog
or mimetic thereof or having at least 75% or greater identity to
SEQ ID NO:2 after optimal alignment which nucleic acid molecule
encodes a chymotrypsin which is insensitive to a proteinaceous
inhibitor of N. alata.
[0091] Yet another aspect of the present invention contemplates
nucleic acid molecule comprising a sequence of nucleotides
substantially as set forth in SEQ ID NO:4 or SEQ ID NO:6. The
nucleic acid molecule encoding HpCh5 is preferably a sequence of
deoxyribonucleic acids such as a cDNA sequence or a genomic
sequence. A genomic sequence may also comprise exons or introns. A
genomic sequence may also include a promoter region or other
regulatory regions. The present invention further contemplates
isolated introns and exons of HpF5 such as those involved in
genetic networking within a plant cell.
[0092] The nucleic acid molecule according to this aspect of the
invention corresponds herein to HpF5. This cDNA has been
determined, in accordance with the present invention, to encode a
protein that defines a new family of chymotrypsins, family 5,
within the group of chymotrypsin gene families, and this protein is
referred to herein as HpCh5. Reference to "HpF5" also includes a
genomic form of the gene. Within the Helicoverpa punctigera
chymotrypsin gene families, there are varying levels of homology as
shown in Table 2. Family 5 is exemplified by HpF5, and is most
similar to family 2A at 73% and least similar to family 4 at
<20%. Without intending to limit the instant invention in any
way, HpCh5 is exemplified by two unique stretches of sequence in
the N-terminal (F1 and F2) and by six amino acid substitutions
relative to NaPI sensitive chymotrypsins. Five of these
substitutions did not appear to fall into functionally significant
regions, whereas the sixth substitution is associated with one of
the .beta.-strands that forms a wall of the primary
substrate-binding pocket. The location of this substitution and
conversion to an arginine, from glutamine, is highly unusual for
the S1 domain that is predominantly lined with non-polar residues
that define chymotrypsin specificity
TABLE-US-00002 TABLE 2 Percentage protein sequence identity between
members of the H. punctigera chmotrypsin gene family
##STR00001##
[0093] The present invention provides, therefore, an isolated
protein having chymotrypsin activity which is not substantially
inhibited by a PI from N. alata. Accordingly, another aspect of the
present invention is directed to an isolated protein selected from
the list consisting of: [0094] (i) a novel chymotrypsin protein or
a derivative, homolog or mimetic thereof wherein said chymotrypsin
is insensitive to the proteinase inhibitors of N. alata; [0095]
(ii) a protein having an amino acid sequence substantially as set
forth in SEQ ID NO:2 or a derivative, homolog or mimetic thereof or
having at least 75% or greater identity to SEQ ID NO:2 after
optimal alignment; [0096] (iii) a protein encoded by a sequence of
nucleotides substantially as set forth in SEQ ID NO:4 or SEQ ID
NO:6 or a derivative, homolog or analog thereof or a nucleotide
sequence having at least 75% similarity to SEQ ID NO:4 or SEQ ID
NO:6 or a sequence encoding an amino acid sequence substantially as
set forth in SEQ ID NO:2 or a derivative, homolog or mimetic
thereof or having at least 75% or greater similarity to SEQ ID NO:2
after optimal alignment; [0097] (iv) a protein encoded by a nucleic
acid molecule or derivative, homolog or analog thereof comprising a
nucleotide sequence substantially as set forth in SEQ ID NO:4 or
SEQ ID NO:6 or a derivative, homolog or analog thereof, or capable
of hybridizing to SEQ ID NO:4 or SEQ ID NO:6 under low stringency
conditions and which encodes an amino acid sequence substantially
as set forth in SEQ ID NO:2 or a derivative, homolog or mimetic
thereof or having at least 75% or greater similarity to SEQ ID NO:2
after optimal alignment. [0098] (v) a novel chymotrypsin protein or
a derivative, homolog or mimetic thereof that has an arginine
substituted for an asparagine or glutamine in the primary
substrate-binding pocket.
[0099] The present invention discloses the amino acid, and
corresponding cDNA sequence of a novel chymotrypsin that is
insensitive to the Type II serine proteinase inhibitors produced by
solanaceous species such as N. alata. Therefore, this may be used
as a target for agents to control insects carrying this insensitive
proteinase. A number of compounds have been shown to inhibit the
activity of HpCh5, and a list of these compounds as preferred
embodiments is found in Table 3.
TABLE-US-00003 TABLE 3 Effect of various proteinase inhibitors on
the activity of the NaPI-insensitive chymotrypsins from H.
punctigera and bovine chymotrypsin Maximum concentration IC50
tested % Inhibition Insen- Insensitive BC Insen- sitive Inhibitor
.mu.M .mu.M sitive BC .mu.M BC .mu.M NaPI 10 4 0% 100% >10 0.04
Chymostatin 0.05 0.1 100% 100% 0.004 0.004 Pot I 5 5 100% 100% 0.12
0.02 Bowman 10 5 100% 100% 0.24 0.06 Birk Lima bean >20 5 89%
100% 3 0.2 SBTI >20 >20 82% 94% 33 13 PMSF 1000 2000 100%
100% 33 13 Leupeptin >4000 >4000 96% 52% 140 2400 SBTI,
soybean trypsin inhibitor; PMSF, phenylmethyl sulphonyl fluoride;
Bowman Birk, soybean Bowman Birk inhibitor; lima bean, lima bean
trypsin inhibitor (Sigma); Pot I, potato proteinase inhibitor Type
I. Bovine chymotrypsin (BC).
[0100] Without limiting the mode of action of any of these
compounds to any one activity, 3-D modeling is used to investigate
the binding ability of PotI and the peptide encoded by the C1
domain of NaPI to both NaPI-insensitive and NaPI-sensitive insect
chymotrypsins.
[0101] The deduced amino acid sequences from the cDNA clones HpF2A
(NaPI-sensitive) and HpF5 (NaPI-insensitive) were modeled on the
structures of the Solenopsis invicta (fire ant) and Bos taurus
(cow) chymotrypsins obtained from the Research Collaboratory for
Structural Bioinformatics (RCSB) Protein Data Bank. The Helicoverpa
chymotrypsins are predicted to adopt similar structures to those
reported for all the chymotrypsin structures available in the data
bank. The modeled structures have the classic serine protease fold
consisting of two, six-stranded anti-parallel beta barrels with the
catalytic triad located between the two domains. Certain surface
loops are cleaved in the mammalian chymotrypsins (loop 142), but
remain intact within insect chymotrypsins. Therefore, the fire ant
chymotrypsin structure (Botos et al., J. Mol. Biol. 298: 895-901,
2000) was required to help refine the orientation of these surface
loops in the Helicoverpa chymotrypsin models. Two surface loops, 60
and 142 are considerably larger in the H. punctigera chymotrypsins
(FIGS. 15, 16).
[0102] C1 was modeled in complex with NaPI-sensitive and
NaPI-insensitive chymotrypsins to investigate what residues in the
NaPI-insensitive chymotrypsin might be involved in the loss of
inhibitor binding. The structure of the chymotrypsin inhibitor C1
was previously determined by .sup.1H NMR (Nielson et al., 1994,
supra) but has not been determined in a proteinase complex.
Therefore the related proteinase inhibitor PCI-1 from Solanum
tuberosum in complex with Proteinase B from Streptomyces griseus
(Greenblatt et al., J. Mol. Biol. 205: 201, 1989) provided an
appropriate basis guiding the alignment of the complexes. Energy
minimization of the C1-chymotrypsin complexes revealed Arg192
(chymotrypsin numbering system) as the only likely candidate to
cause such resistance from a possible 24 putative contact residues.
The NaPI-insensitive chymotrypsin containing the Arg192 (Greer
nomenclature, Greer, Proteins 7:317-34, 1990. FIG. 15) residue in
complex with C1 could not be properly energy minimized due to
steric contacts between Arg192 and C1 whereas the Gln192 residue in
the Na-PI sensitive chymotrypsin in complex with C1 caused no such
problems due to its much smaller size. FIG. 17 shows a close up
view of the binding region surrounding Gln192 in the C1-HpF2A
chymotrypsin complex. It is clear that Gln192 is not in conflict
with any regions on the inhibitor molecule. However, comparison to
the cognate Arg residue in the C1-HpCh5 chymotrypsin model
demonstrates there is not enough space to accommodate this much
larger residue (FIG. 18) making contact with Thr5 and Ala9 in C1.
Furthermore, modeling the StPot1A inhibitor into HpCh5 revealed
that the NaPI-insensitive chymotrypsin could accommodate the Arg192
residue consistent with the inhibition of this chymotrypsin by
StPot1A (FIG. 19).
[0103] In summary, the NaPI-insensitive chymotrypsin from
Helicoverpa species has an arginine in place of an asparagine or
glutamine at position 192 that extends into the S1 binding pocket
and appears to interfere with C1 binding. Furthermore, it is clear
that this Arg residue does not interfere with PotI binding,
consistent with the observation that PotI is a much more efficient
inhibitor of insect chymotrypsins than the NaPI inhibitors. Large
quantities of the PotI inhibitor were purified from potato tubers
(FIG. 22) to evaluate the combined effect of NaPI and PotI on the
growth of H. armigera larvae (FIG. 23). Bioassays confirmed that
PotI significantly enhances the activity of the NaPI inhibitors.
Caterpillars fed NaPI and PotI in combination (0.26 and 0.34%
(w/v), respectively) were 34% the size of control larvae at the
fifth instar stage of development whereas caterpillars feeding on
NaPIs alone were about 84% the size of the controls.
[0104] Therefore, another aspect of the present invention provides
a method for modulating activity of the HpCh5 or a homolog or
variant thereof in an insect, said method comprising contacting the
HpCh5 protein or its homolog or variant with an effective amount of
an agent for a time and under conditions sufficient to decrease or
increase HpCh5 activity.
[0105] Yet another aspect of the present invention provides a
method for modulating expression of HpF5 or homolog or variant in
an insect, said method comprising contacting HpF5 or its homolog or
variant with an effective amount of an agent for a time and under
conditions sufficient to decrease or increase HpF5 expression.
[0106] The preferred insects targeted in accordance with these and
other aspects are species of Helicoverpa and other Lepidopteran
species. In addition, plants to be protected include those
sensitive to H. armigera, H. punctigera, H. zea and H. virescens.
Such plants include the H. armigera sensitive plants such as
cotton, sweet corn, tomato, tobacco, piniento, potato, sunflower,
citrus, plums, sorghum, leeks, soybean, alfalfa, beans, pidgeon
peas, chick peas, artichokes, curcurbits, lettuce, Dianthus (an
ornamental plant), geraniums, cape gooseberry, maize, flax and
linseed, alfalfa, lupins, broad beans, garden peas, peanuts,
canola, snapdragons, cherry, sunflower, pot marigolds and
Helichrysum (an ornamental plant)
[0107] Other plants contemplated herein include cereals (such as
wheat, barley, oats, triticale, etc.), horticultural plants (e.g.
apples, carrots, onions, etc.), ornamental plants (such as orchids,
roses, petunias, etc.) and trees.
[0108] The present invention contemplates, therefore, methods of
screening for compounds which inhibit or act as antagonists of
HpCh5 activity or HpF5 gene expression. For example, one method
involves contacting a candidate compound with HpCh5. The screening
procedure includes assaying (i) for the presence of a complex
between the compound and HpCh5, or (ii) an alteration in the
expression levels of HpF5 cDNA or genomic DNA. One form of assay
involves competitive binding assays. In such competitive binding
assays, HpCh5 is typically labeled. Free HpCh5 is separated from
any putative complex and the amount of free (i.e. uncomplexed)
label is a measure of the binding of the agent being tested to bind
to HpCh5. One may also measure the amount of bound, rather than
free, HpCh5. It is also possible to label the compound rather than
HpCh5 and to measure the amount of compound binding to target in
the presence and in the absence of the compound being tested. Such
compounds may inhibit HpCh5. A similar approach may be adopted for
compounds which bind to and inhibit HpF5 or mRNA transcripts
thereof.
[0109] Another technique for agent screening provides high
throughput screening for compounds having suitable binding affinity
to HpCh5 and is described in detail in Geysen (International Patent
Publication No. WO 84/03564). Briefly stated, large numbers of
different small peptide test compounds are synthesized on a solid
substrate, such as plastic pins or some other surface. The peptide
test compounds are reacted with HpCh5 and washed. Bound HpCh5
molecules are then detected by methods well known in the art. This
method may be adapted for screening for non-peptide, chemical
entities. This aspect, therefore, extends to combinatorial
approaches including phage display to screen for HpCh5
antagonists.
[0110] Purified HpCh5 can be coated directly onto plates for use in
the aforementioned agent screening techniques. However,
non-neutralizing antibodies to HpCh5 may also be used to immobilize
HpCh5 on the solid phase. Live animals such as H. armigera and/or
H. punctigera may also be used in feeding trials to find potential
inhibitors.
[0111] The present invention also contemplates the use of
competitive agent screening assays in which neutralizing antibodies
capable of specifically binding HpCh5 compete with a test compound
for binding to HpCh5 or fragments thereof. In this manner, the
antibodies can be used to detect the presence of any peptide which
shares one or more antigenic determinants of HpCh5.
[0112] Yet another useful source of analogs of compounds which are
chemically modified may be used to induce feed-back inhibition of
biochemical or genetic pathways for generating authentic HpCh5.
[0113] Analogs of HpCh5 contemplated herein include but are not
limited to modification to side chains, incorporating of unnatural
amino acids and/or their derivatives during peptide, polypeptide or
protein synthesis and the use of crosslinkers and other methods
which impose conformational constraints on HpCh5.
[0114] Examples of side chain modifications of HpCh5 contemplated
by the present invention include modifications of amino groups such
as by reductive alkylation by reaction with an aldehyde followed by
reduction with NaBH.sub.4; amidination with methylacetimidate;
acylation with acetic anhydride; carbamoylation of amino groups
with cyanate; trinitrobenzylation of amino groups with
2,4,6-trinitrobenzene sulphonic acid (TNBS); acylation of amino
groups with succinic anhydride and tetrahydrophthalic anhydride;
and pyridoxylation of lysine with pyridoxal-5-phosphate followed by
reduction with NaBH.sub.4.
[0115] The guanidine group of arginine residues may be modified by
the formation of heterocyclic condensation products with reagents
such as 2,3-butanedione, phenylglyoxal and glyoxal.
[0116] The carboxyl group may be modified by carbodiimide
activation via O-acylisourea formation followed by subsequent
derivitization, for example, to a corresponding amide.
[0117] Sulphydryl groups may be modified by methods such as
carboxymethylation with iodoacetic acid or iodoacetamide; performic
acid oxidation to cysteic acid; formation of a mixed disulphides
with other thiol compounds; reaction with maleimide, maleic
anhydride or other substituted maleimide; formation of mercurial
derivatives using 4-chloromercuribenzoate,
4-chloromercuriphenylsulphonic acid, phenylmercury chloride,
2-chloromercuri-4-nitrophenol and other mercurials; carbamoylation
with cyanate at alkaline pH.
[0118] Tryptophan residues may be modified by, for example,
oxidation with N-bromosuccinimide or alkylation of the indole ring
with 2-hydroxy-5-nitrobenzyl bromide or sulphonyl halides. Tyrosine
residues on the other hand, may be altered by nitration with
tetranitromethane to form a 3-nitrotyrosine derivative.
[0119] Modification of the imidazole ring of a histidine residue
may be accomplished by alkylation with iodoacetic acid derivatives
or N-carbethoxylation with diethylpyrocarbonate.
[0120] Examples of incorporating unnatural amino acids and
derivatives during peptide synthesis include, but are not limited
to, use of norleucine, 4-amino butyric acid,
4-amino-3-hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid,
t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine,
4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or
D-isomers of amino acids. A list of unnatural amino acid,
contemplated herein is shown in Table 4.
TABLE-US-00004 TABLE 4 Codes for non-conventional amino acids
Non-conventional Non-conventional amino acid Code amino acid Code
.alpha.-aminobutyric acid Abu L-N-methylalanine Nmala
.alpha.-amino-.alpha.-methylbutyrate Mgabu L-N-methylarginine Nmarg
aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate
L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib
L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine
Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine
Chexa L-Nmethylhistidine Nmhis cyclopentylalanine Cpen
L-N-methylisolleucine Nmile D-alanine Dal L-N-methylleucine Nmleu
D-arginine Darg L-N-methyllysine Nmlys D-aspartic acid Dasp
L-N-methylmethionine Nmmet D-cysteine Dcys L-N-methylnorleucine
Nmnle D-glutamine Dgln L-N-methylnorvaline Nmnva D-glutamic acid
Dglu L-N-methylornithine Nmorn D-histidine Dhis
L-N-methylphenylalanine Nmphe D-isoleucine Dile L-N-methylproline
Nmpro D-leucine Dleu L-N-methylserine Nmser D-lysine Dlys
L-N-methylthreonine Nmthr D-methionine Dmet L-N-methyltryptophan
Nmtrp D-ornithine Dorn L-N-methyltyrosine Nmtyr D-phenylalanine
Dphe L-N-methylvaline Nmval D-proline Dpro L-N-methylethylglycine
Nmetg D-serine Dser L-N-methyl-t-butylglycine Nmtbug D-threonine
Dthr L-norleucine Nle D-tryptophan Dtrp L-norvaline Nva D-tyrosine
Dtyr .alpha.-methyl-aminoisobutyrate Maib D-valine Dval
.alpha.-methyl-.gamma.-aminobutyrate Mgabu D-.alpha.-methylalanine
Dmala .alpha.-methylcyclohexylalanine Mchexa
D-.alpha.-methylarginine Dmarg .alpha.-methylcylcopentylalanine
Mcpen D-.alpha.-methylasparagine Dmasn
.alpha.-methyl-.alpha.-napthylalanine Manap
D-.alpha.-methylaspartate Dmasp .alpha.-methylpenicillamine Mpen
D-.alpha.-methylcysteine Dmcys N-(4-aminobutyl)glycine Nglu
D-.alpha.-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg
D-.alpha.-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn
D-.alpha.-methylisoleucine Dmile N-amino-.alpha.-methylbutyrate
Nmaabu D-.alpha.-methylleucine Dmleu .alpha.-napthylalanine Anap
D-.alpha.-methyllysine Dmlys N-benzylglycine Nphe
D-.alpha.-methylmethionine Dmmet N-(2-carbamylethyl)glycine Ngln
D-.alpha.-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn
D-.alpha.-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine Nglu
D-.alpha.-methylproline Dmpro N-(carboxymethyl)glycine Nasp
D-.alpha.-methylserine Dmser N-cyclobutylglycine Ncbut
D-.alpha.-methylthreonine Dmthr N-cycloheptylglycine Nchep
D-.alpha.-methyltryptophan Dmtrp N-cyclohexylglycine Nchex
D-.alpha.-methyltyrosine Dmty N-cyclodecylglycine Ncdec
D-.alpha.-methylvaline Dmval N-cylcododecylglycine Ncdod
D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct
D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro
D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund
D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm
D-N-methylcysteine Dnmcys N-(3,3-diphenylpropyl)glycine Nbhe
D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg
D-N-methylglutamate Dnmglu N-(1-hydroxyethyl)glycine Nthr
D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser
D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis
D-N-methylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp
D-N-methyllysine Dnmlys N-methyl-.gamma.-aminobutyrate Nmgabu
N-methylcyclohexylalanine Nmchexa D-N- Dnmmet D-N-methylornithine
Dnmorn methylmethionine N-methylglycine Nala
N-methylcyclopentylalanine Nmcpen N-methylaminoisobutyrate Nmaib
D-N-methylphenylalanine Dnmphe N-(1-methylpropyl)glycine Nile
D-N-methylproline Dnmpro N-(2-methylpropyl)glycine Nleu
D-N-methylserine Dnmser D-N-methyltryptophan Dnmtrp
D-N-methylthreonine Dnmthr D-N-methyltyrosine Dnmtyr
N-(1-methylethyl)glycine Nval D-N-methylvaline Dnmval
N-methyla-napthylalanine Nmanap .gamma.-aminobutyric acid Gabu
N-methylpenicillamine Nmpen L-t-butylglycine Tbug
N-(p-hydroxyphenyl)glycine Nhtyr L-ethylglycine Etg
N-(thiomethyl)glycine Ncys L-homophenylalanine Hphe penicillamine
Pen L-.alpha.-methylarginine Marg L-.alpha.-methylalanine Mala
L-.alpha.-methylaspartate Masp L-.alpha.-methylasparagine Masn
L-.alpha.-methylcysteine Mcys L-.alpha.-methyl-t-butylglycine Mtbug
L-.alpha.-methylglutamine Mgln L-methylethylglycine Metg
L-.alpha.-methylhistidine Mhis L-.alpha.-methylglutamate Mglu
L-.alpha.-methylisoleucine Mile L-.alpha.-methylhomophenylalanine
Mhphe L-.alpha.-methylleucine Mleu N-(2-methylthioethyl)glycine
Nmet L-.alpha.-methylmethionine Mmet L-.alpha.-methyllysine Mlys
L-.alpha.-methylnorvaline Mnva L-.alpha.-methylnorleucine Mnle
L-.alpha.-methylphenylalanine Mphe L-.alpha.-methylornithine Morn
L-.alpha.-methylserine Mser L-.alpha.-methylproline Mpro
L-.alpha.-methyltryptophan Mtrp L-.alpha.-methylthreonine Mthr
L-.alpha.-methylvaline Mval L-.alpha.-methyltyrosine Mtyr
N-(N-(2,2-diphenylethyl)carbamylmethyl)glycine Nnbhm
L-N-methylhomophenylalanine Nmhphe 1-carboxy-1-(2,2-diphenyl- Nmbc
N-(N-(3,3-diphenylpropyl)carbamylmethyl)glycine Nnbhe
ethylamino)cyclopropane
[0121] Crosslinkers can be used, for example, to stabilize 3D
conformations, using homo-bifunctional crosslinkers such as the
bifunctional imido esters having (CH.sub.2).sub.n spacer groups
with n=1 to n=6, glutaraldehyde, N-hydroxysuccinimide esters and
hetero-bifunctional reagents which usually contain an
amino-reactive moiety such as N-hydroxysuccinimide and another
group specific-reactive moiety such as maleimido or dithio moiety
(SH) or carbodiimide (COOH). In addition, peptides can be
conformationally constrained by, for example, incorporation of
C.sub..alpha. and N.sub..alpha.-methylamino acids, introduction of
double bonds between C.sub..alpha. and C.sub..beta. atoms of amino
acids and the formation of cyclic peptides or analogs by
introducing covalent bonds such as forming an amide bond between
the N and C termini, between two side chains or between a side
chain and the N or C terminus.
[0122] Such analogs, especially if they retain activity or even the
HpCL5 molecule itself may have indistinct applications such as in
washing powder or as in a stain removal formulation.
[0123] Another aspect of the present invention contemplates any
compound which binds or otherwise interacts with HpCh5 or its
derivatives or variants or which induces feed-back inhibition of
HpCh5 synthesis resulting in down-regulation of HpCh5 activity or
levels.
[0124] The present invention is also useful for screening for other
compounds which reduce expression of HpF5. A variety of agent
screening techniques may be employed such as those described herein
and in International Publication No. WO 97/02048.
[0125] A compound antagonist includes a variant of HpCh5 such as a
variant comprising an analog amino acid residue as indicated above.
In one embodiment, the target is the HpCh5 polypeptide. The term
"polypeptide" refers to a polymer of amino acids and its equivalent
and does not refer to a specific length of the product, thus,
peptides, oligopeptides and proteins are included within the
definition of a polypeptide. This term also does not exclude
modifications of the polypeptide, for example, glycosylations,
aceylations, phosphorylations and the like. Included within the
definition are, for example, polypeptides containing one or more
analogs of an amino acid (including, for example, unnatural amino
acids such as those given in Table 4) or polypeptides with
substituted linkages.
[0126] A substance identified as an antagonist of HpCh5 function or
HpF5 gene activity may be a peptide or non-peptide in nature.
Non-peptide "small molecules" are often preferred for many
agricultural or horticultural purposes due to their perceived
stability.
[0127] There are several steps commonly taken in the design of a
mimetic-type antagonist of HpCh5 from a compound. First, the
particular parts of the compound that are critical and/or important
in determining the target property are determined. In the case of a
peptide, this can be done by systematically varying the amino acid
residues in the peptide, e.g. by substituting each residue in turn.
Alanine scans of peptides are commonly used to refine such peptide
motifs. These parts or residues constituting the active region of
the compound are known as its "agrichemicaphore".
[0128] Once the agrichemicaphore has been found, its structure is
modeled according to its physical properties, e.g. stereochemistry,
bonding, size and/or charge, using data from a range of sources,
e.g. spectroscopic techniques, x-ray diffraction data and NMR.
Computational analysis, similarity mapping (which models the charge
and/or volume of a agrichemicaphore, rather than the bonding
between atoms) and other techniques can be used in this modeling
process.
[0129] In a variant of this approach, the three-dimensional
structure of HpCh5 and a compound binding it. This can be
especially useful where HpCh5 or its antagonist change conformation
on binding, allowing the model to take account of this in the
design of the mimetic. Modeling can be used to generate inhibitors
which interact with the linear sequence or a three-dimensional
configuration.
[0130] A template molecule is then selected onto which chemical
groups which mimic the pharmacophore can be grafted. The template
molecule and the chemical groups grafted onto it can conveniently
be selected so that the agrichemicaphore is easy to synthesize and
is likely to be agriculturally or horticulturally acceptable.
Alternatively, where the agrichemicaphore is peptide-based, further
stability can be achieved by cyclizing the peptide, increasing its
rigidity. The agrichemicaphore or agrichemicaphores found by this
approach can then be screened to see whether they have HpCh5
antagonistic property, or to what extent they exhibit it. Further
optimization or modification can then be carried out to arrive at
one or more final agents for testing.
[0131] Yet another aspect of the present invention provides a
method for detecting an agent capable of binding or otherwise
associating with a HpCh5 binding site or functional equivalent
thereof said method involving the use of in-silico 3-D modeling to
identify compounds that bind to HpCh5 and specifically, are not
interfered with by Arginine 192.
[0132] The goal of rational HpCh5 antagonist design is to produce
structural analogs of HpCh5 or of small molecules with which HpCh5
interacts (e.g. an antagonist or inhibitor) in order to fashion
agents which are, for example, more inhibitory of HpCh5. See, e.g.
Hodgson (Bio/Technology 9: 19-21, 1991). In one approach, one first
determines the three-dimensional structure of HpCh5 by x-ray
crystallography, by computer modeling or, most typically, by a
combination of approaches. Useful information regarding the
structure of a polypeptide may also be gained by modeling based on
the structure of chymotrypsins. An example of rational drug design
is the development of HIV protease inhibitors (Erickson et al.,
Science 249: 527-533, 1990). In addition, target molecules may be
analyzed by an alanine scan (Wells, Methods Enzymol. 202:
2699-2705, 1991). In this technique, an amino acid residue is
replaced by Ala and its effect on the peptide's activity is
determined. Each of the amino acid residues of the peptide is
analyzed in this manner to determine the important regions of the
peptide.
[0133] In addition, compounds including antagonists may be directed
to particular locations or regions or domains or HpCh5.
[0134] It is also possible to isolate a HpCh5-specific antibody and
then to solve its crystal structure. In principle, this approach
yields an agricore upon which subsequent agent design can be based.
It is possible to bypass protein crystallography altogether by
generating anti-idiotypic antibodies (anti-ids) to a functional
antibody. As a mirror image of a mirror image, the binding site of
the anti-ids is expected to be an analog of the original receptor.
The anti-id could then be used to identify and isolate peptides
from banks of chemically or biologically produced banks of
peptides. Selected peptides would then act as the
agrichemicaphore.
[0135] Chymotrypsin clone HpF2B is expressed in E. coli fused to a
six histidine (6.H) tag at the C-terminus and is purified to
homogeneity on Talon metal affinity resin (FIG. 20) for injection
into a rabbit for production of polyclonal antibodies. N-terminal
sequencing of the purified product confirmed the expression of the
chymotrypsin HpCh2B. After the fourth boost with antigen, the serum
is collected and tested on protein blots of bacterially expressed
protein and unfractionated gut extracts. The antibody detected the
full-length recombinant chymotrypsin at a dilution of 1 in 2500 as
well as several break-down products. Unfractionated gut extract and
a sample of protein bound to the C1 affinity column were also
stained with the anti-HpCh2B antibody which detected the mature
native form of the enzyme.
[0136] Purified 6H.HpCh2B is used to test the detection limit of
anti-HpCh2B antibody by comparison of immunoblots to silver stained
SDS-PAGE gels. The antibody detected 20 ng of bacterially expressed
chymotrypsinogen and also recognized the mature form of the native
chymotrypsin isolated from gut of H. punctigera.
[0137] The cDNA (HpF5) encoding the NaPI-insensitive chymotrypsin
(HpCh5) is expressed in E. coli in a similar manner except the
six-histidine tag is fused to the N-terminus of the expressed
protein. The polyclonal antiserum that is raised against the
bacterially expressed chymotrypsin HpCh2B did not cross react with
bacterially expressed NaPI-insensitive chymotrypsin (HpCh5) on
protein blots (FIG. 21). Likewise the antiserum raised against
HpCh5 did not bind to HpCh2B. This indicates that these antisera
can be used to specifically distinguish between and monitor levels
of the NaPI-insensitive and sensitive chymotrypsins in
unfractionated gut extracts
[0138] Accordingly, still another aspect of the present invention
is directed to antibodies to HpCh5 and HpCh2B including catalytic
antibodies.
[0139] In another aspect of the present invention, a method is
provided for the isolation of and separation of individual isoforms
of chymotrypsin, said method consisting of: [0140] (i) affinity
chromatography of insect gut extracts initially with
benzamidine-sepharose to bind trypsins; [0141] (ii) further
affinity chromatography of the unbound proteins using immobilized
N. alata serine proteinase inhibitor C1 to bind all NaPI
inhibitable chymotypsins; and [0142] (iii) affinity chromatography
of the eluate from (ii) with immobilized PotI and PotII or
chymostatin to bind the remainder. The putative NaPI-insensitive
chymotrypsins are then eluted with 8 M urea.
[0143] The present invention extends to a genetic approach to
down-regulating expression of an HpF5 or its homologs or variants.
Such an approach uses nucleic acid molecules or molecules having a
genetic component (e.g. RNAi) to induce pre- or
post-transcriptional gene silencing.
[0144] The terms "nucleic acids", "nucleotide" and "polynucleotide"
include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers,
both sense and antisense strands, and may be chemically or
biochemically modified or may contain non-natural or derivatized
nucleotide bases, as will be readily appreciated by those skilled
in the art. Such modifications include, for example, labels,
methylation, substitution of one or more of the naturally occurring
nucleotides with an analog (such as the morpholine ring),
internucleotide modifications such as uncharged linkages (e.g.
methyl phosphonates, phosphotriesters, phosphoamidates, carbamates,
etc.), charged linkages (e.g. phosphorothioates,
phosphorodithioates, etc.), pendent moieties (e.g. polypeptides),
intercalators (e.g. acridine, psoralen, etc.), chelators,
alkylators and modified linkages (e.g. .alpha.-anomeric nucleic
acids, etc.). Also included are synthetic molecules that mimic
polynucleotides in their ability to bind to a designated sequence
via hydrogen binding and other chemical interactions. Such
molecules are known in the art and include, for example, those in
which peptide linkages substitute for phosphate linkages in the
backbone of the molecule.
[0145] Antisense polynucleotide sequences, for example, are useful
in silencing transcripts of HpF5. Furthermore, polynucleotide
vectors containing all or a portion of HpF5 gene locus may be
placed under the control of a promoter in either the sense or
antisense orientation and introduced into a cell. Expression of
such a sense or antisense construct within a cell interferes with
target transcription and/or translation. Furthermore,
co-suppression (i.e. using sense-suppression) and mechanisms to
induce RNAi or siRNA may also be employed. Alternatively, antisense
or sense molecules may be directly administered. In this latter
embodiment, the antisense or sense molecules may be formulated in a
composition and then administered by any number of means to target
cells.
[0146] A variation on antisense and sense molecules involves the
use of morpholinos, which are oligonucleotides composed of
morpholine nucleotide derivatives and phosphorodiamidate linkages
(for example, Summerton and Weller, Antisense and Nucleic Acid Drug
Development 7: 187-195, 1997). Such compounds are injected into
embryos and the effect of interference with mRNA is observed.
[0147] In one embodiment, the present invention employs compounds
such as oligonucleotides and similar species for use in modulating
the function or effect of nucleic acid molecules encoding HpCh5,
i.e. the oligonucleotides induce transcriptional or
post-transcriptional gene silencing. This is accomplished by
providing oligonucleotides which specifically hybridize with one or
more nucleic acid molecules encoding the inhibitor. The
oligonucleotides may be provided directly to a cell or generated
within the cell. As used herein, the terms "target nucleic acid"
and "nucleic acid molecule encoding HpCh5" have been used for
convenience to encompass DNA encoding the inhibitor, RNA (including
pre-mRNA and mRNA or portions thereof) transcribed from such DNA,
and also cDNA derived from such RNA. The hybridization of a
compound of the subject invention with its target nucleic acid is
generally referred to as "antisense". Consequently, the preferred
mechanism believed to be included in the practice of some preferred
embodiments of the invention is referred to herein as "antisense
inhibition." Such antisense inhibition is typically based upon
hydrogen bonding-based hybridization of oligonucleotide strands or
segments such that at least one strand or segment is cleaved,
degraded, or otherwise rendered inoperable. In this regard, it is
presently preferred to target specific nucleic acid molecules and
their functions for such antisense inhibition.
[0148] The functions of DNA to be interfered with can include
replication and transcription. Replication and transcription, for
example, can be from an endogenous cellular template, a vector, a
plasmid construct or otherwise. The functions of RNA to be
interfered with can include functions such as translocation of the
RNA to a site of protein translation, translocation of the RNA to
sites within the cell which are distant from the site of RNA
synthesis, translation of protein from the RNA, splicing of the RNA
to yield one or more RNA species, and catalytic activity or complex
formation involving the RNA which may be engaged in or facilitated
by the RNA.
[0149] In the context of this invention, "hybridization" means the
pairing of complementary strands of oligomeric compounds. In the
present invention, the preferred mechanism of pairing involves
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases (nucleobases) of the strands of oligomeric
compounds. For example, adenine and thymine are complementary
nucleobases which pair through the formation of hydrogen bonds.
Hybridization can occur under varying circumstances.
[0150] An antisense compound is specifically hybridizable when
binding of the compound to the target nucleic acid interferes with
the normal function of the target nucleic acid to cause a loss of
activity, and there is a sufficient degree of complementarity to
avoid non-specific binding of the antisense compound to non-target
nucleic acid sequences under conditions in which specific binding
is desired.
[0151] "Complementary" as used herein, refers to the capacity for
precise pairing between two nucleobases of an oligomeric compound.
For example, if a nucleobase at a certain position of an
oligonucleotide (an oligomeric compound), is capable of hydrogen
bonding with a nucleobase at a certain position of a target nucleic
acid, said target nucleic acid being a DNA, RNA, or oligonucleotide
molecule, then the position of hydrogen bonding between the
oligonucleotide and the target nucleic acid is considered to be a
complementary position. The oligonucleotide and the further DNA,
RNA, or oligonucleotide molecule are complementary to each other
when a sufficient number of complementary positions in each
molecule are occupied by nucleobases which can hydrogen bond with
each other. Thus, "specifically hybridizable" and "complementary"
are terms which are used to indicate a sufficient degree of precise
pairing or complementarity over a sufficient number of nucleobases
such that stable and specific binding occurs between the
oligonucleotide and a target nucleic acid.
[0152] According to the present invention, compounds include
antisense oligomeric compounds, antisense oligonucleotides,
ribozymes, external guide sequence (EGS) oligonucleotides,
alternate splicers, primers, probes, and other oligomeric compounds
which hybridize to at least a portion of the target nucleic acid.
As such, these compounds may be introduced in the form of
single-stranded, double-stranded, circular or hairpin oligomeric
compounds and may contain structural elements such as internal or
terminal bulges or loops. Once introduced to a system, the
compounds of the invention may elicit the action of one or more
enzymes or structural proteins to effect modification of the target
nucleic acid. One non-limiting example of such an enzyme is RNAse
H, a cellular endonuclease which cleaves the RNA strand of an
RNA:DNA duplex. It is known in the art that single-stranded
antisense compounds which are "DNA-like" elicit RNAse H. Activation
of RNase H, therefore, results in cleavage of the RNA target,
thereby greatly enhancing the efficiency of
oligonucleotide-mediated inhibition of gene expression. Similar
roles have been postulated for other ribonucleases such as those in
the RNase III and ribonuclease L family of enzymes.
[0153] While the preferred form of antisense compound is a
single-stranded antisense oligonucleotide, in many species the
introduction of double-stranded structures, such as double-stranded
RNA (dsRNA) molecules, has been shown to induce potent and specific
antisense-mediated reduction of the function of a gene or its
associated gene products.
[0154] In the context of the subject invention, the term
"oligomeric compound" refers to a polymer or oligomer comprising a
plurality of monomeric units. In the context of this invention, the
term "oligonucleotide" refers to an oligomer or polymer of
ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics,
chimeras, analogs and homologs thereof. This term includes
oligonucleotides composed of naturally occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
oligonucleotides having non-naturally occurring portions which
function similarly. Such modified or substituted oligonucleotides
are often preferred over native forms because of desirable
properties such as, for example, enhanced cellular uptake, enhanced
affinity for a target nucleic acid and increased stability in the
presence of nucleases.
[0155] While oligonucleotides are a preferred form of the compounds
of this invention, the present invention comprehends other families
of compounds as well, including but not limited to oligonucleotide
analogs and mimetics such as those herein described.
[0156] The open reading frame (ORF) or "coding region" which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is a region
which may be effectively targeted. Within the context of the
present invention, one region is the intragenic region encompassing
the translation initiation or termination codon of the open reading
frame (ORF) of a gene.
[0157] Other target regions include the 5' untranslated region
(5'UTR), known in the art to refer to the portion of an mRNA in the
5' direction from the translation initiation codon, and thus
including nucleotides between the 5' cap site and the translation
initiation codon of an mRNA (or corresponding nucleotides on the
gene), and the 3' untranslated region (3'UTR), known in the art to
refer to the portion of an mRNA in the 3' direction from the
translation termination codon, and thus including nucleotides
between the translation termination codon and 3' end of an mRNA (or
corresponding nucleotides on the gene). The 5' cap site of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap
site. It is also preferred to target the 5' cap region.
[0158] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns",
which are excised from a transcript before it is translated. The
remaining (and, therefore, translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence.
Targeting splice sites, i.e. intron-exon junctions or exon-intron
junctions, may also be particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred target sites. mRNA transcripts
produced via the process of splicing of two (or more) mRNAs from
different gene sources are known as "fusion transcripts". It is
also known that introns can be effectively targeted using antisense
compounds targeted to, for example, DNA or pre-mRNA.
[0159] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn, the respective ends of this
linear polymeric compound can be further joined to form a circular
compound, however, linear compounds are generally preferred. In
addition, linear compounds may have internal nucleobase
complementarity and may, therefore, fold in a manner as to produce
a fully or partially double-stranded compound. Within
oligonucleotides, the phosphate groups are commonly referred to as
forming the internucleoside backbone of the oligonucleotide. The
normal linkage or backbone of RNA and DNA is a 3' to 5'
phosphodiester linkage.
[0160] For topical delivery of antisense compounds, these
oligonucleotides may contain modified backbones or non-natural
internucleoside linkages. As defined in this specification,
oligonucleotides having modified backbones include those that
retain a phosphorus atom in the backbone and those that do not have
a phosphorus atom in the backbone. For the purposes of this
specification, and as sometimes referenced in the art, modified
oligonucleotides that do not have a phosphorus atom in their
internucleoside backbone can also be considered to be
oligonucleosides.
[0161] Preferred modified oligonucleotide backbones containing a
phosphorus atom therein include, for example, phosphorothioates,
chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates
including 3'-alkylene phosphonates, 5'-alkylene phosphonates and
chiral phosphonates, phosphinates, phosphoramidates including
3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and boranophosphates
having normal 3'-5' linkages, 2'-5' linked analogs of these, and
those having inverted polarity wherein one or more internucleotide
linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred
oligonucleotides having inverted polarity comprise a single 3' to
3' linkage at the 3'-most internucleotide linkage i.e. a single
inverted nucleoside residue which may be abasic (the nucleobase is
missing or has a hydroxyl group in place thereof). Various salts,
mixed salts and free acid forms are also included.
[0162] In an alternative embodiment, genetic constructs including
DNA "vaccines" are used to generate antisense or sense molecules in
plant cells. Furthermore, many of the preferred features described
above are appropriate for sense nucleic acid molecules.
[0163] A further aspect of the present invention relates to a
method for control of insect populations, said method comprising
administering to insects an effective amount of an agent for a time
and under conditions sufficient to inhibit the expression of HpF5
or sufficient to inhibit the activity of HpCh5, wherein said
modulation results in reduction of the biological fitness of said
insects.
[0164] In one preferred embodiment of the present invention, the
agent is one that can bind to the primary substrate binding pocket
of HpCh5, and not be interfered with by the arginine residue found
at position 192.
[0165] Reference to a "reduction of biological fitness" should be
understood to be changes in the insect including, but not limited
to, changes in body mass and/or viability. Preferably, these
changes are understood as reductions in both body mass and/or
viability. A reduction in biological fitness, therefore, includes a
reduction in their growth and development.
[0166] In yet another aspect the present invention provides a
method for detecting an agent capable of modulating the function of
HpCh5 or functional equivalent or derivative thereof, said method
comprising administering to an insect containing said HpCh5 or
functional equivalent or derivative thereof with a putative agent
and detecting an altered activity phenotype associated with
modulation of function of HpCh5 or its functional equivalent or
derivative.
[0167] Reference to "administration" of the modulator to HpCh5
refers to delivery of the modulating agent in any convenient means.
In the agricultural setting this is likely to include, but not be
limited to:-- [0168] (i) the delivery of the agent as the active
ingredient in a spray or powder formulation; or [0169] (ii) the
production of the agent either as a protein or the product of a
metabolic pathway in a plant.
[0170] In a preferred embodiment of the invention, the
administration of the agent is via the introduction of a nucleic
acid encoding said agent into a plant for subsequent expression and
production of the agent. Another preferred embodiment is the
formulation of a spray or powder with said agent as the active
ingredient.
[0171] "Introduction" of the agent is to be understood to cover all
means known to those in the art of making genetic changes in a
plant. These include, but are not limited to plant transformation
methods such as particle bombardment, Agrobacterium-mediated
transformation, electroporation and viral transfection;
plant-breeding techniques and mutagenesis of native plant
genes.
[0172] Accordingly, in the context of the present invention,
nucleic acid molecules encoding an antisense or sense form of HpF5
or encoding an inhibitor of HpCh5 activity or HpF5 expression is
operably linked to a promoter, generally in a vector or other
suitable medium for introduction to a plant genome. Alternatively,
an existing Pi may be cloned and modified to render it active
against HpCh5.
[0173] The present invention further provides a genetically
modified plant comprising cells which are capable of producing an
antagonist of HpCh5 or HpF5 gene expression. In one particularly
useful example, cotton or other crop plants are engineered to
produce PotI or a combination of PotI and NaPI. Reference herein to
"PotI" and "NaPI" includes reference to derivatives, variants and
homologs including modifications to one or more domains in PotI or
NaPI.
[0174] Reference herein to a "promoter" is to be taken in its
broadest context and includes the transcriptional regulatory
sequences of a classical genomic gene, including the TATA box which
is required for accurate transcription initiation, with or without
a CCAAT box sequence and additional regulatory elements (i.e.
upstream activating sequences, enhancers and silencers) which alter
gene expression in response to developmental and/or external
stimuli, or in a tissue-specific manner. A promoter is usually, but
not necessarily, positioned upstream or 5', or a structural gene
region, the expression of which it regulates. Furthermore, the
regulatory elements comprising a promoter are usually positioned
within 2 kb of the start site of transcription of the gene.
[0175] In the present context, the term "promoter" is also used to
describe a synthetic or fusion molecule, or derivative which
confers, activates or enhances expression of a nucleic acid
molecule in a cell.
[0176] Preferred promoters may contain additional copies of one or
more specific regulatory elements, to further enhance expression of
the sense molecule and/or to alter the spatial expression and/or
temporal expression of said sense molecule. For example, regulatory
elements which confer copper inducibility may be placed adjacent to
a heterologous promoter sequence driving expression of a sense
molecule, thereby conferring copper inducibility on the expression
of said molecules.
[0177] Placing a nucleic acid molecule under the regulatory control
of a promoter sequence means positioning the said molecule such
that expression is controlled by the promoter sequence. Promoters
are generally positioned 5' (upstream) to the genes that they
control. In the construction of heterologous promoter/structural
gene combinations, it is generally preferred to position the
promoter at a distance from the gene transcription start site that
is approximately the same as the distance between that promoter and
the gene it controls in its natural setting, i.e. the gene from
which the promoter is derived. As is known in the art, some
variation in this distance can be accommodated without loss of
promoter function. Similarly, the preferred positioning of a
regulatory sequence element with respect to a heterologous gene to
be placed under its control is defined by the positioning of the
element in its natural setting, i.e. the genes from which it is
derived. Again, as is known in the art, some variation in this
distance can also occur.
[0178] The promoter may regulate the expression of HpF5 or its
variant or homolog constitutively, or differentially with respect
to cell, the tissue or organ in which expression occurs or, with
respect to the developmental stage at which expression occurs, or
in response to external stimuli such as physiological stresses, or
pathogens, or metal ions, amongst others.
[0179] Preferably, the promoter is capable of regulating expression
of a nucleic acid molecule in a plant cell, tissue or organ, at
least during the period of time over which the target gene is
expressed therein and more preferably also immediately preceding
the commencement of detectable expression of the HpF5gene in said
cell, tissue or organ.
[0180] Accordingly, strong constitutive promoters are particularly
useful for the purposes of the present invention or promoters which
may be induced by virus infection or the commencement of HpF5 gene
expression.
[0181] Plant-operable promoters are particularly preferred for use
in the construct of the present invention. Examples of suitable
promoters include pCaMV 35S (Fang et al., Plant Cell 1: 141-150,
1989), PGEL1 (Hajdukiewicz et al., Plant Mol. Biol. 25: 989-994,
1994), class III chitinase (Samac and Shah, Plant Cell 3:
1063-1072, 1991), pin2 (Keil et al., EMBO J. 8: 1323-1330, 1989),
PEP carboxylase (Pathirana et al., Plant J. 12: 293-304, 1997; MAP
kinase (Schoenbeck et al., Molec. Plant-Microbe Interact, 1999),
MSV (Legavre et al., In: Vth International Congress of Plant
Molecular Biology, Singapore, 1997), pltp (Hsu et al., Plant Sci.
143: 63-70, 1999), pmpi (Cordero et al., In: General Meeting of the
International Program on Rice Biotechnology of the Rockefeller
Foundation, Malacca, Malaysia, 1997) or glutamin synthase
(Pujade-Renaud et al., Plant Physiol. Biochem. 35: 85-93,
1997).
[0182] In the present context, the terms "in operable connection
with" or "operably under the control" or similar shall be taken to
indicate that expression of the nucleic acid molecule is under the
control of the promoter sequence with which it is spatially
connected; in a cell, tissue, organ or whole plant.
[0183] The construct preferably contains additional regulatory
elements for efficient transcription, for example, a transcription
termination sequence.
[0184] The term "terminator" refers to a DNA sequence at the end of
a transcriptional unit which signals termination of transcription.
Terminators are 3'-non-translated DNA sequences generally
containing a polyadenylation signal, which facilitates the addition
of polyadenylate sequences to the 3'-end of a primary transcript.
Terminators active in plant cells are known and described in the
literature. They may be isolated from bacteria, fungi, viruses,
animals and/or plants or synthesized de novo.
[0185] As with promoter sequences, the terminator may be any
terminator sequence which is operable in the cells, tissues or
organs in which it is intended to be used.
[0186] Examples of terminators particularly suitable for use in the
synthetic genes of the present invention include the SV40
polyadenylation signal, the HSV TK polyadenylation signal, the CYC1
terminator, ADH terminator, SPA terminator, nopaline synthase (NOS)
gene terminator of Agrobacterium tumefaciens, the terminator of the
cauliflower mosaic virus (CaMV) 35S gene, the zein gene terminator
from Zea mays, the Rubisco small subunit gene (SSU) gene terminator
sequences, subclover stunt virus (SCSV) gene sequence terminators,
any rho-independent E. Coli terminator, or the lacZ alpha
terminator, amongst others.
[0187] In a particularly preferred embodiment, the terminator is
the SV40 polyadenylation signal or the HSV TK polyadenylation
signal which are operable in animal cells, tissues and organs,
octopine synthase (OCS) or nopaline synthase (NOS) terminator
active in plant cells, tissue or organs, or the lacZ alpha
terminator which is active in prokaryotic cells.
[0188] Those skilled in the art will be aware of additional
terminator sequences which may be suitable for use in performing
the invention. Such sequences may readily be used without any undue
experimentation.
[0189] Means for introducing (i.e. transfecting or transforming)
cells with the constructs are well-known to those skilled in the
art.
[0190] The constructs described supra are capable of being modified
further, for example, by the inclusion of marker nucleotide
sequences encoding a detectable marker enzyme or a functional
analogue or derivative thereof, to facilitate detection of the
synthetic gene in a cell, tissue or organ in which it is expressed.
According to this embodiment, the marker nucleotide sequences will
be present in a translatable format and be expressed.
[0191] Those skilled in the art will be aware of how to produce the
constructs described herein and of the requirements for obtaining
the expression thereof, when so desired, in a specific cell or
cell-type under the conditions desired. In particular, it will be
known to those skilled in the art that the genetic manipulations
required to perform the present invention may require the
propagation of a genetic construct described herein or a derivative
thereof in a prokaryotic cell such as an E. coli cell or a plant
cell or an animal cell.
[0192] The constructs of the present invention may be introduced to
a suitable cell, tissue or organ without modification as linear
DNA, optionally contained within a suitable carrier, such as a
cell, virus particle or liposome, amongst others. To produce a
genetic construct, a nucleic acid (e.g. HpF5) is inserted into a
suitable vector or episome molecule, such as a bacteriophage
vector, viral vector or a plasmid, cosmid or artificial chromosome
vector which is capable of being maintained and/or replicated
and/or expressed in the host cell, tissue or organ into which it is
subsequently introduced.
[0193] Accordingly, a further aspect of the invention provides a
genetic construct which at least comprises a genetic element as
herein described and one or more origins of replication and/or
selectable marker gene sequences.
[0194] Usually, an origin of replication or a selectable marker
gene suitable for use in bacteria is physically-separated from
those genetic sequences contained in the genetic construct which
are intended to be expressed or transferred to a plant cell, or
integrated into the genome of a plant cell.
[0195] As used herein, the term "selectable marker gene" includes
any gene which confers a phenotype on a cell on which it is
expressed to facilitate the identification and/or selection of
cells which are transfected or transformed with a genetic construct
of the invention or a derivative thereof.
[0196] Suitable selectable marker genes contemplated herein include
the ampicillin-resistance gene (Amp.sup.r), tetracycline-resistance
gene (Tc.sup.r), bacterial kanamycin-resistance gene (Kan.sup.r),
the zeocin resistance gene (Zeocin is a drug of the bleomycin
family which is trade mark of InVitrogen Corporation), the AURI-C
gene which confers resistance to the antibiotic aureobasidin A,
phosphinothricin-resistance gene, neomycin phosphotransferase gen
(nptII), hygromycin-resistance gene, .beta.-glucuronidase (GUS)
gene, chloramphenicol acetyltransferase (CAT) gene, green
fluorescent protein-encoding gene or the luciferase gene, amongst
others.
[0197] Preferably, the selectable marker gene is the nptII gene or
Kan.sup.r gene or green fluorescent protein (GFP)-encoding
gene.
[0198] Those skilled in the art will be aware of other selectable
marker genes useful in the performance of the present invention and
the subject invention is not limited by the nature of the
selectable marker gene.
[0199] The present invention extends to all genetic constructs
essentially as described herein, which include further genetic
sequences intended for the maintenance and/or replication of said
genetic construct in prokaryotes or eukaryotes and/or the
integration of said genetic construct or a part thereof into the
genome of a eukaryotic cell or organism.
[0200] Standard methods described supra may be used to introduce
the constructs into the cell, tissue or organ, for example,
liposome-mediated transfection or transformation, transformation of
cells with attenuated virus particles or bacterial cells, cell
mating, transformation or transfection procedures known to those
skilled in the art.
[0201] Additional means for introducing recombinant DNA into plant
tissue or cells include, but are not limited to, transformation
using CaCl.sub.2 and variations thereof, direct DNA uptake into
protoplasts, PEG-mediated uptake to protoplasts, microparticle
bombardment, electroporation, microinjection of DNA, microparticle
bombardment of tissue explant or cells, vacuum-infiltration of
tissue with nucleic acid, or in the case of plants, T-DNA-mediated
transfer from Agrobacterium to the plant tissue.
[0202] For microparticle bombardment of cells, a microparticle is
propelled into a cell to produce a transformed cell. Any suitable
ballistic cell transformation methodology and apparatus can be used
in performing the present invention. Exemplary apparatus and
procedures are disclosed by Stomp et al. (U.S. Pat. No. 5,122,466)
and Sanford and Wolf (U.S. Pat. No. 4,945,050). When using
ballistic transformation procedures, the genetic construct may
incorporate a plasmid capable of replicating in the cell to be
transformed.
[0203] Examples of microparticles suitable for use in such systems
include 1 to 5 .mu.m gold spheres. The DNA construct may be
deposited on the microparticle by any suitable technique, such as
by precipitation.
[0204] In a further embodiment of the present invention, the
genetic constructs described herein are adapted for integration
into the genome of a cell in which it is expressed. Those skilled
in the art will be aware that, in order to achieve integration of a
genetic sequence or genetic construct into the genome of a host
cell, certain additional genetic sequences may be required. In the
case of plants, left and right border sequences from the T-DNA of
the Agrobacterium tumefaciens Ti plasmid will generally be
required.
[0205] The present invention further extends to an isolated cell,
tissue or organ comprising the constructs or parts thereof. The
present invention extends further to regenerated tissues, organs
and whole organisms derived from said cells, tissues and organs and
to propagules and progeny thereof as well as seeds and other
reproductive material.
[0206] For example, plants may be regenerated from transformed
plant cells or tissues or organs on hormone-containing media and
the regenerated plants may take a variety of forms, such as
chimeras of transformed cells and non-transformed cells; clonal
transformants (e.g. all cells transformed to contain the expression
cassette); grafts of transformed and untransformed tissue (e.g. a
transformed root stock grafted to an untransformed scion in citrus
species). Transformed plants may be propagated by a variety of
means, such as by clonal propagation or classical breeding
techniques. For example, first generation (or T1) transformed
plants may be selfed to give homozygous second generation (or T2)
transformed plants, and the T2 plants further propagated through
classical breeding techniques.
[0207] Plants contemplated herein include cotton, sweet corn,
tomato, tobacco, piniento, potato, sunflower, citrus, plums,
sorghum, leeks, soybean, alfalfa, beans, pidgeon peas, chick peas,
artichokes, curcurbits, lettuce, Dianthus (an ornamental plant),
geraniums, cape gooseberry, maize, flax and linseed, lupins, broad
beans, garden peas, peanuts, canola, snapdragons, cherry,
sunflower, pot marigolds, Helichrysum (an ornamental plant), wheat,
barley, oats, triticale, carrots, onions, orchids, roses and
petunias
[0208] Another aspect of the present invention relates to the
insensitive chymotrypsin as a selectable marker for the
transformation of insects. At present, methods for the germ-line
transformation of insects involves injection of insect embryos with
a genetic construct comprising a transposable element, the gene of
interest and a selectable marker. Somatic transformation of insects
can also be achieved using viral vectors that include the gene of
interest and a selectable marker (Peloquin et al., J. Cot. Sci. 5:
114-120, 2001). Presently, most insect transformation is done using
white-eye mutants of the insect, to allow the detection of the
commonly used selectable markers. Typically, selectable markers are
genes that complement the white-eye mutation or Enhanced Green
Fluorescent Protein (EGFP). In Drosophila, the white eye mutation
is caused by mutant alleles such as the .omega..sup.1118 allele.
These individuals can be returned to normal (red) eye pigmentation
via the introduction of an allele conferring normal eye
pigmentation such as white (Lidholm et al., Genetics 134: 859-868,
1993) or miniwhite (Lozovskaya et al., Genetics 142: 173-177,
1996). The reversion of .quadrature..sup.1118 mutants to normal eye
pigmentation acts as the marker for introduction of the vector. In
a similar way, EGFP has been used to indicate the presence of a
vector. Again, insects with non-pigmented eyes are used, and EGFP
expression is detected in the eyes of these insects (Hediger et
al., Insect Mol. Biol. 10:113-119, 2001).
[0209] The selectable markers commonly used in the art require
dissection of the insects to examine the eyes for either
pigmentation or EGFP fluorescence, which is time consuming and
requires destructive sampling of the insects. The present invention
provides a means for the selection of transformed individuals
without the need for insect dissection or inspection of individual
insects. This would allow the recovery of live transformants and
provides a non-laborious means of screening large numbers of
putative transformants at one time. In addition, the present
invention provides a means for the selection of transformants that
does not rely on the availability of white-eye mutants.
[0210] The present invention contemplates the use of HpF5 or a
derivative, homolog or analog thereof encoding a NaPI-insensitive
chymotrypsin, as a selectable marker in an insect transformation
vector. This vector, comprising HpF5, would have utility for the
selection of transformants for any insect that is susceptible to
the C1 serine proteinase inhibitor of N. alata. The contemplated
insects may be naturally resistant to C1, or may be
NaPI-susceptible mutants or genetically modified NaPI susceptible
strains of naturally NaPI-resistant insects. In a particularly
preferred embodiment of the invention the insect host of the said
vector would be Lepidopteran.
[0211] HpF5 or a derivative, homolog or analog thereof encoding an
NaPI-insensitive chymotrypsin could be incorporated into any insect
transformation vector using common molecular biology techniques
known to those in the art. Upon transformation the insect would
transcribe HpF5 and produce HpCh5, the NaPI-insensitive
chymotrypsin. Transformed individuals could then be selected by
incorporation of the C1 proteinase inhibitor of N. alata into the
diet of the insects. In this case individuals that did not carry
the insensitive chymotrypsin encoded by HpF5 in the vector would
die, and those that did carry the vector encoding HpF5 would be
insensitive to C1.
[0212] Accordingly the present invention provides insect
transformation vectors including baculovirus vectors comprising
HpF5 or a derivative, homolog or analog thereof, as a selectable
marker. The vector may be used for any purpose in the insect.
Non-limiting examples include: gene cloning, gene expression and
gene knockouts. Specific examples of insect transformation vectors
into which HpF5 could be incorporated as a selectable marker
include, but are not limited to: those that utilize the piggyBac
mobilizable element (Hediger et al., 2001, supra); P-element based
vectors (Cripps et al., J. Cell Biol. 126: 689-699, 1994); hobo
element based vectors (Lozovskaya et al., 1996, supra); mariner
element based vectors (Lidholm et al., 1993, supra); and viral
vectors such as pTE/3'2J (Peloquin et al., 2001, supra).
[0213] The present invention is further described by the following
non-limiting Examples.
Example 1
Effect of Ingestion of the N. alata Proteinase Inhibitors on Growth
and Development of Helicoverpa Species
[0214] The effect of the N. alata PIs examined on the digestive
enzymes and the growth and development of Helicoverpa punctigera
and Helicoverpa armigera larvae (Heath et al., J. Insect Physiol.
43: 833-842, 1997). The PIs suppressed total gut protease activity
by 73% in an in vitro assay using .sup.14C-casein as substrate.
When incorporated into an artificial diet the PIs retarded the
growth and development of both H. punctigera (Heath et al., 1997,
supra) (FIGS. 2A and 2B) and H. armigera. Similar results are
obtained when larvae from both species were fed on transgenic
tobacco (N. tabacum) expressing the N. alata PIs at levels of
0.2%-0.5% soluble protein (Heath et al., 1997, supra).
[0215] Ingestion of NaPIs (C1, C2 and T1-T4) changes the relative
activity of the trypsins and chymotrypsins in the gut and faeces of
H. punctigera larvae. Trypsin activity in the gut and the faeces is
substantially lowered or abolished after exposure to NaPIs, whereas
chymotrypsin activity is often unaffected or enhanced (FIGS. 2C and
2D). The lack of trypsin activity in the faeces of the NaPI fed
larvae was not due to decreased production of trypsin. Indeed
protein blots were used to demonstrate that these insects had
overproduced trypsin in response to the PIs, but it had been
totally inactivated (FIG. 2E).
[0216] Interestingly, the chymotrypsin produced after ingestion of
NaPIs was not inhibitable by the NaPIs, whereas some of the
chymotrypsin produced by control insects (not exposed to NaPIs) was
inhibitable (FIG. 2F). In control insects the degree of inhibition
varied between individuals, and ranged from about 75% to no
inhibition at all. This suggested that Helicoverpa larvae produce
different classes of chymotrypsins; some that are inhibitable by
the NaPIs (PI-sensitive) and some that are not inhibitable
(PI-insensitive). Thus, it appears ingestion of NaPIs inhibits the
trypsin activity in the gut of Helicoverpa larvae, but larvae may
not be severely impacted if they produce NaPI-insensitive
chymotrypsins. In a subsequent experiment, the gut contents were
removed from H. punctigera larvae that had been raised on a haricot
bean diet without added proteinase inhibitors. The gut chymotrypsin
activity was inhibited about 80% by the NaPI inhibitors (C1, C2,
T1-T4) and 70% by C1 alone (FIG. 3). The Bowman Birk and trypsin
inhibitors from Soybean and the lima bean trypsin inhibitor also
failed to abolish all the chymotrysin activity, whereas activity
was totally inhibited by the potato PotI inhibitor and chymostatin.
Using this information a series of affinity columns were prepared
for identification and purification of the NaPI-insensitive and
-sensitive chymotrypsins from the gut of H. punctigera larvae.
Bioassays with Helicoverpa Larvae on Artificial Diets
Haricot Bean Diet
[0217] Helicoverpa punctigera larvae were raised on artificial
diets based on Haricot beans (Teakle et al., Journal of
Invertebrate Pathology 46: 166-173, 1985). One litre of diet was
composed of 58.5 g Haricot beans, 14 g agar, 700 ml water, 35 g
Tortula yeast, 50 g wheatgerm, 3.5 g ascorbic acid, 1.1 g sorbic
acid, 2.2 g p-hydroxybenzoic acid methyl ester, 0.2 g ampicillin,
0.2 g streptomycin, 16 mg prochloraz. The beans were soaked
overnight in water, drained and homogenized to a fine paste.
Wheatgerm, yeast and 300 ml of water were added. The agar was
dissolved in 400 mL of boiling water and added to the mixture. The
mixture was cooled to 50.degree. C. before the addition of the
remaining ingredients. The blended diet was poured into trays and
after setting was used immediately or stored at -20.degree. C. for
no longer than two weeks. The test diet was supplemented with the
NaPI (0.26% (w/v)) and the control diet had an equivalent amount of
casein. Twenty newly emerged neonates were added to each diet and
mortality was recorded every two days. Weight gain was recorded at
the sixth day and then every second day thereafter. The larvae were
reared in 1.5 ml eppendorf microfuge tubes (one larva/tube) until
day eight when they were transferred to individual plastic
containers with lids (SOLO.TM. plastic portion cups, 28 mL). Larvae
were fed small amounts of diet (40 mg) initially that was replaced
as required to provide a continuous supply. The larvae were kept in
a temperature controlled room at 25.+-.1.degree. C., 16:8
(L:D).
Cotton Leaf Diet
[0218] Cotton leaf artificial diet was prepared from fresh young
leaves from cotton plants (cultivar Coker 315) which were grown in
an insect-free and insecticide-free temperature controlled cabinet
at 26.degree. C. (.+-.2.degree. C.) with a light regime of 16:8
(L:D). Following picking, the leaves were immediately frozen in
liquid nitrogen and freeze dried. After drying, the leaves were
ground to a fine powder in a mortar and pestle. The cotton leaf
artificial diet was prepared in the same manner as haricot bean
artificial diet using a recipe modified from potato leaf artificial
diet (Gatehouse et al., J. Insect Physiol. 45 (6), 545-558, 1999).
One hundred grams of cotton leaf artificial diet contained 3 g of
cotton leaf powder, 0.08 mL linseed oil, 2 g yeast, 0.016 mL
wheatgerm oil, 2.4 g wheat germ, 0.028 g ampicillin, 3.2 g ascorbic
acid, 0.028 g streptomycin, 0.08 g sorbic acid, 3.2 g agar, 0.16 g
paraben (mould inhibitor) plus NaPI or casein to required %
((w/v)).
Preparation of Individual Gut and Frass Extracts
[0219] All work was performed at 4.degree. C. Each gut was
dissected from the larva and placed in a 1.5 mL microfuge tube
containing 500 .mu.L of ice-cold 10 mM Tris-HCl, pH 8. Gut and
contents were homogenized using a micropestle (Eppendorf).
Insoluble material was removed by centrifugation at 13,000 g for 4
min and the supernatant was stored at -80.degree. C. Frass extracts
were prepared in the same manner using 200 mg frass/mL buffer.
Total protein concentration was determined using the Bradford
method (Bradford, Anal Biochem 72: 248-254, 1976) with reagents
from Bio-Rad and BSA as a standard.
Trypsin and Chymotrypsin Activity
[0220] Gut proteinase activity was determined at pH 10 in 50 mM
3-(cyclohexylamino)-1-propanesulfonic acid (CAPS buffer) using the
chromogenic substrate N-benzoyl-DL-arginine-p-nitroanilide (BApNA)
for trypsin and
N-succinyl-L-alanine-alanine-proline-phenylalanine-p-nitroanilide
(SA.sub.2 PFpNA) for chymotrypsin activity. Substrates were freshly
prepared as 1 mM solutions in 10% ((w/v)) N,N-dimethylformamide
(DMF), 50 mM CAPS buffer, pH 10. The assays were performed in
duplicate or triplicate following the method of Heath et al, Eur.
J. Biochem. 230 (1): 250-257. Blanks, without enzyme, were used to
account for any spontaneous breakdown of substrates. The release of
p-nitroanilide was recorded at 405 nm after 30 min at 30.degree. C.
on a SpectraMax 250 microtitre plate reader (Molecular
Devices).
Inhibition of Trypsin and Chymotrypsin Activity by NaPI
[0221] Trypsin and chymotrypsin inhibition assays were conducted
using the standard trypsin and chymotrypsin assays described above
except samples were pre-incubated with T1 or C1 inhibitor (80 nM)
for 30 min at 30.degree. C. prior to the addition of substrate to
initiate the reaction. NaPI monomers T1 and C1 were HPLC purified
as described by Heath et al., 1999, supra.
Chymotrypsin Assays in the Presence and Absence of Proteinase
Inhibitors
Preparation of Gut Extracts
[0222] Fourth-instar larvae were killed using ethyl-acetate prior
the removal of individual gut which were then homogenized in a
mortar and pestle in an equal amount [(w/v)] of 50 mM Tris-HCl, pH
8.0 containing 100 .mu.M benzamidine. Insoluble material was
removed by centrifugation at 20,000 rpm for 15 min at 4.degree. C.
and total protein concentration determined using the Bradford
method (Bradford, Anal Biochem 72: 248-254, 1976) with reagents
from BioRad and BSA as a standard.
Assays
[0223] Unfractionated gut extract containing approximately 1 .mu.g
of buffer soluble protein was added to 10 .mu.L CAPS buffer (0.5 M,
3-[cyclohexylamino]-1-propane-sulfonic acid, pH 10) and made to a
final volume of 100 .mu.L in individual wells of a 96 well
microtiter plate. Proteinase inhibitors were added over a range of
concentrations and incubated for 15 min at 25.degree. C. Bovine
chymotrypsin (100 ng) was used as a positive control, both for
activity and inhibition. The chromogenic artificial substrate
SAAPFpNA (N-Succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine
4-nitroanilide) was then added to a final concentration of 1 mM and
hydrolysis of the substrate was measured at 405 nm using the
SpectraMax 250 microtiter plate reader (Molecular Devices).
Proteinase Inhibitors
[0224] Lima bean trypsin inhibitor (LBTI), soybean trypsin
inhibitor (SBTI), soybean Bowman-Birk inhibitor (SBBI) and
chymostatin were all purchased from Sigma-Aldrich Pty.Ltd. Potato
Inhibitor I was purchased from Calbiochem-Novabiochem or purified
from potato tubers (Example 6). A crude mixture of Potato inhibitor
I and II was also obtained from potatoes. N. alata proteinase
inhibitors (NaPIs) were purified as described by Atkinson et al.,
1993, supra and Heath et al., 1995, supra. The chymotrypsin
inhibitor C1 was purified from bacterial expression cultures. The
purity of the inhibitors was assessed by SDS-PAGE and silver
staining.
Example 2
Isolation of NAPI Sensitive and Insensitive Chymotrypsins from H.
punctigera Gut
[0225] Most published work on Helicoverpa chymotrypsins has focused
on cDNA clones or the measurement of enzyme activity in
unfractionated gut extracts. There are few reports on purification
of chymotrypsins from Helicoverpa or other lepidopteran species.
Johnston and coworkers (1995, supra) described partial purification
of chymotrypsins from H. armigera that employed ion exchange
techniques. Peterson and coworkers (Insect Biochem. Mol. Biol. 25:
765-774, 1995) purified a chymotrysin from the midgut of the
lepidopteran Manduca sexta by affinity chromatography on tryptophan
methyl ester and Valiatis et al., Insect Biochemistry and Molecular
Biology 29: 405-415, 1999 used immobilized potato proteinase
inhibitor I (PotI) to isolate a chymotrypsin from the Western
Spruce budworm. No one has described a procedure that separates
individual chymotrypsin isozymes from one another and there is no
description of the isolation of two chymotrypsins from a single
species where one isozyme is inhibitable by a certain proteinase
inhibitor while another is not inhibitable.
Preparation of Pure Enzymes and N-Terminal Sequencing
[0226] The midgut was dissected from 80 fourth instar larvae and
buffer soluble extracts were prepared. The gut extract was depleted
of trypsins by repeated passage through a benzamidine-Sepharose
affinity column. The unbound protein was collected and applied to
an affinity column composed of the immobilized chymotrypsin
inhibitor C1 (FIG. 1) that had been produced using a bacterial
expression system. This column was expected to specifically bind
NaPI-sensitive chymotrysins. Proteins that did not bind to this
column were applied to a third affinity column composed of either
immobilized Potato Type I (PotI) and Type II inhibitors (PotII) or
chymostatin. This column was designed to capture the chymotrypsins
that did not bind to the C1 column, that is, the NaPI-insensitive
chymotrypsins. Proteins that bound to the affinity columns were
eluted with 8 M urea and were subjected to electrophoresis through
an SDS-polyacrylamide gel before transfer to a PVDF membrane for
N-terminal sequencing (FIGS. 4 and 5).
[0227] About 30 amino acids of N-terminal sequence were obtained
that confirmed that the proteins were indeed chymotrypsins, and
that the sensitive and insensitive chymotrypsins were products of
different genes (FIGS. 4 and 5).
Preparation of NaPI-Insensitive Chymotrypsin Depleted of Trypsins
and NaPI Sensitive Chymotrypsins for Biochemical Analysis
[0228] The midgut was dissected from 100 fourth instar larvae and
buffer soluble extracts were prepared. The gut extract was depleted
of NaPI-sensitive proteases by passage through an affinity column
composed of immobilized NaPI protein (C1, C2, T1-T4). All trypsins
and NaPI-sensitive chymotrypsins bound to the column and the
NaPI-insensitive chymotrypsin was unbound. This preparation of
unbound material was used to study the pH optimum, substrate
preference and effect of a range of proteinase inhibitors on the
activity of the NaPI-insensitive proteinase. The effect of pH on
activity of the insensitive chymotrypsins is illustrated in FIG. 6.
The enzyme is inactive below pH6 and is most active at pH10-12
consistent with its role in the alkaline midgut of larvae. The best
substrate for enzyme assays was determined using seven different
commercial substrates. The best substrate was
N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (sAAPF-pNA) followed by
N-succinyl-Ala-Ala-Pro-Leu-p-nitroanilide (sAAPL-pNA) and
N-methoxysuccinyl-Ala-Ala-Pro-Met-p-nitroanilide (mAAPM-pNA).
N-succinyl-Ala-Ala-Ala-p-nitroanilide (sAAA-pNA), benzoyl-tyr-p-NA,
Ac-Pro-Leu-Ser-p-NA and Ac-Asn-Gly-Ile-Pro-p-NA were not
substrates.
[0229] Several proteinase inhibitors were tested for their ability
to inhibit the activity of the insensitive chymotrypsins. The
buffer used for all assays was 500 mM CAPS, 75 mM NaCl, 2.5 mM
MgCl.sub.2 at pH 10. The inhibitors were preincubated with 100 ng
of bovine chymotrypsin or the amount of the gut chymotrypsin
required to produce the same absorbance as 100 ng of bovine
chymotrypsin (note that the Helicoverpa enzyme has been depleted of
trypsins and sensitive chymotrypsins, but still contains other gut
proteins) for 30 min at 30.degree. C. before the addition of
substrate. The incubation was continued for a further 30 min at
room temperature before absorbance was measured at 405 nm. PotI was
the best of the proteinaceous inhibitors and NaPI did not inhibit
(Table 3).
Experimental Protocols
Benzamidine Column
[0230] Benzamidine-agarose (1 mL; was purchased from ICN
Biomedicals) and contained 35 umoles benzamidine per ml of gel.
Production of the C1-Affinity Column
[0231] DNA encoding the C1 domain of NaPI (FIG. 1, Atkinson et al.,
1993, supra) was amplified from the pNa-PI-2-cDNA (Atkinson et al.,
1993, supra) using oligonucleotide primers that incorporated BamH1
(5' GACCAGCCGGATCCGATCGGATAT GCACCAAC) [SEQ ID NO:7] and HindIII
(3' GGAGCCAAGCCAAGCTTTGAACGCG GGCAAACTC) [SEQ ID NO:8] sites for
cloning into a pQE expression vector (Qiagen). The PCR product was
sub-cloned into the pCR (registered trademark) 2.1-TOPO vector
(Invitrogen) then excised with BamH1 and HindIII and ligated into
the pQE-30 vector. The expression vector incorporated a
hexahistidine tag at the N-terminus of the expressed protein for
metal affinity purification. The C1/pQE-30 construct was
transformed into the chemically competent E. coli strain M15
(Qiagen) prepared according to the method of Inoue et al., Gene 96:
23-28, 1990. Bacterial expression cultures were grown and induced
according to the procedures outlined in the QiaExpress manual
(Qiagen). Expression of the 6H.C1 recombinant protein was achieved
by induction with 1 mM of IPTG. Samples (1 ml) were removed from
the culture at hourly intervals, collected by centrifugation and
resuspended in 1.times.SDS loading buffer (100 .mu.L) for SDS-PAGE
analysis.
[0232] Recombinant C1 inhibitor was purified under denaturing
conditions using Talon Metal Affinity Resin (2 mL) (BD Biosciences
Clontech) according to the manufacturer's protocol. C1 was eluted
from the affinity matrix and examined using SDS-PAGE to confirm
purity. Subsequent rounds of expression were conducted under the
same conditions and C1 from a total of 2 L of culture was purified
using the Talon resin. After washing to remove unbound proteins the
C1 inhibitor remained bound to the Talon resin which was then used
as the affinity column to purify chymotrypsins from gut
preparations.
Potato Inhibitor I and Potato Inhibitor II Affinity Column
[0233] Cyanogen bromide-activated Sepharose 4B (1 g) was swollen
and washed according to the manufacturer's protocol. A mixture of
potato I and II Inhibitors (10 mg) was dissolved in coupling buffer
[0.1 M NaHCO.sub.3, 0.5 M NaCl, pH 8.3], combined with the gel
suspension and incubated over night at 4.degree. C. in an
end-over-end mixer. The gel was rinsed several times in blocking
buffer [0.1 M Tris-HCl, pH 8.0] to remove excess ligand. Following
the washes the conjugated Sepharose was mixed with fresh blocking
buffer and incubated overnight at 4.degree. C. The gel slurry was
transferred to a column (Amersham Biosciences) and washed
alternately (.times.3) with five column volumes of coupling buffer
then five column volumes of rinse buffer [0.1 M NaOAc, 0.5 M NaCl,
pH 4.0]. Finally the matrix was extensively washed with coupling
buffer and stored in 20% (v/v) ethanol at 4.degree. C.
Chymostatin Affinity Column
[0234] Chymostatin (Sigma-Aldrich) was immobilized on EAH
Sepharose-4B (1.5 ml; Sigma-Aldrich) according to the
manufacturer's instructions. Chymostatin (10 mg) was dissolved in
500 .mu.L of glacial acetic acid then 1 mL of distilled water was
added and the pH adjusted to 4.5 with dilute NaOH. The gel
suspension and chymostatin solution were combined before EDC
[N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide] was slowly added
to a final concentration of 0.1 M. The gel suspension was mixed
overnight at 4.degree. C. before the gel was washed with Milli-Q
filtered water to remove excess ligand and unreacted carbodiimide
and the gel matrix was stored at 4.degree. C. in 20%
[(v/v)]ethanol.
Purification of NaPI-Sensitive and Insensitive Chymotrypsins
[0235] Eighty gut from fifth instar larvae that had been stored at
-80.degree. C. were homogenized using a mortar and pestle in 10 ml
of gut extraction buffer (20 mM CAPS pH 10, 350 mM NaCl). The gut
extract was centrifuged at 15,000 g for 15 min at 4.degree. C. and
the supernatant was filtered through a syringe filter (0.45 .mu.M;
Millipore) then briefly stored on ice before application to the
benzamidine affinity column.
[0236] The filtered gut extract was passed through the benzamidine
column five times to remove the trypsins. The unbound fraction (10
mL) was passed through the C1 affinity column (.times.3) before the
column was washed with 20 mL of extraction buffer and bound
proteins were eluted with 8 M urea, pH 8.0 (5 mL). Proteins that
did not bind to the C1 column were applied to the Potato Inhibitor
I and II affinity column prior to washing with 10 column volumes of
buffer [20 mM CAPS pH 10, 0.5 M NaCl] and elution of bound proteins
with 8 M urea, pH 8.0 (5 mL).
Analysis of Affinity Purified Gut Proteins: SDS-PAGE
[0237] Samples of gut proteins (5-10 .mu.g) were concentrated using
TCA precipitation and resuspended in 0.2 M NaOH (10 .mu.L).
SDS-PAGE sample buffer (50 mM Tris-HCl, pH 6.8, 2% (w/v) SDS, 10%
(v/v) glycerol, 5% (v/v) .quadrature.-mercaptoethanol, 0.1% (w/v)]
bromophenol blue) was added and samples were heated to 100.degree.
C. for 5 min prior to separation on 12.5% (w/v) reducing
polyacrylamide gels using the MiniProtean II Electrophoresis
apparatus (Bio-Rad) at 200 Volts. Broad range or peptide molecular
size markers (Bio-Rad) were used to estimate relative molecular
masses. Following electrophoresis the proteins were visualized by
staining with Coomassie Brilliant Blue R-250 (0.1% (w/v) in 40%
(v/v) methanol, 10% (v/v) acetic acid) for 60 min followed by
destaining in 40% (v/v) methanol, 10% (v/v) acetic acid or were
transferred to either nitrocellulose (0.22 .mu.M pore size; Micron
Separations Inc.) or Sequi-Blot Polyvinylidene Fluoride membrane
(PVDF; Bio-Rad).
Immunoblotting and N-Terminal Sequencing
[0238] After electrophoresis gels were equilibrated in transfer
buffer (192 mM glycine, 48 mM Tris-base, 20% (v/v) methanol) for 10
min prior to the transfer of proteins to a nitrocellulose membrane
(0.22 .mu.M pore size; Micron Separations Inc.) using the Mini
Trans-Blot apparatus (BioRad) at 100 V for 60 min. Membranes were
briefly washed in TBS (20 mM Tris-HCl, 150 mM NaCl, pH 7.5) then
stained with amido black (1:50 dilution of 0.1% (w/v) amido black,
40% (v/v) methanol, 10% (v/v) acetic acid) to confirm transfer of
the proteins and to visualize the molecular size markers. Blots
were then blocked by incubation with 3% (w/v) skim milk powder
(Dutchjug) in TBST [0.1% (w/v) Tween-20 in TBS] for 1 h at RT,
followed by a 1 h incubation with the .quadrature.-chymotrypsin
antibody (HpCH2B; 1:5000 dilution in 3% (w/v) skim milk powder in
TBST). The nitrocellulose blots were then rinsed three times (5
min) in TBST and incubated for 1 hour at RT with the secondary
antibody (anti-rabbit IgG conjugated to horseradish peroxidase
diluted 1:5000 in TBST; Amersham Biosciences). Membranes were
washed three times (5 min) with TBST and immunoreactive proteins
were visualized with Enhanced Chemiluminescence (ECL) reagents and
Hyperfilm ECL X-ray film (Amersham Biosciences) according to the
manufacturer's instructions.
[0239] To obtain N-terminal sequence, samples were transferred to
Sequi-Blot PVDF membrane (BioRad) equilibrated in electroblotting
buffer (10 mM CAPS, 10% (v/v) methanol, 0.01% (w/v) SDS, pH 11)
using the Mini Trans-Blot cell (BioRad) at 100 V for 45 minutes.
Following transfer, the membrane was briefly rinsed in Milli-Q
water, stained with Coomassie Brilliant Blue (0.1% Coomassie Blue
R-250, 1% (v/v) acetic acid, 40% (v/v) methanol) and then destained
(50% (v/v) methanol). Finally the membrane was rinsed with water
and dried before excision of the appropriate proteins for
N-terminal sequencing.
Example 3
Cloning cDNAs Encoding Gut Chymotrypsins from H. punctigera
[0240] cDNAs encoding the H. punctigera chymotrypsins were obtained
using two approaches. Both approaches employed PCR amplification of
cDNA produced from midgut mRNA extracted from H. punctigera larvae
at the late fourth and early fifth instar stage of development.
Isolation of Chymotrypsin Clones Using Oligonucleotides
Complimentary to Highly Conserved Regions in H. armigera
Chymotrypsins
[0241] Bown and colleagues (1997, supra) have described several
cDNA clones encoding H. armigera chymotrypsins. FIG. 7 shows the
predicted proteins and the regions complementary to the
oligonucleotides (FIG. 8) chosen for PCR amplification of
chymotrypsin cDNAs from H. punctigera. The PCR products were cloned
and sequenced, and five distinct chymotrypsin sequences were
obtained (F1Apcr, F1Bpcr, F2 Bpcr, F3 pcr and F4 pcr, FIG. 9).
These PCR products were used to screen a cDNA library prepared from
midgut mRNA isolated from late fourth instar and early fifth instar
larvae. Seven distinct cDNA clones were isolated encoding
chymotrypsins that were divided into four families based on
sequence identity (FIG. 10, Table 2). These chymotrypsins share
high sequence identity with the H. armigera chymotrysins described
by Bown et al., 1997, supra and with the small number of
chymotrypsin sequences reported for H. virescens and H. zea (Table
6). The chymotrypsins encoded by the full length clones presented
in FIG. 10 characteristically encode zymogens of approximately
292-295 amino acids, including putative amino-terminal signal
peptides of 16-17 residues predicted by the signal peptide
prediction program PSORTII. The presence of the residues IVGG
(positions 62-65) at the N-terminus of several active chymotrypsins
results in the prediction of activation peptides ranging from 35-44
residues in length on the zymogens predicted from the cDNA clones.
Furthermore these activation peptides consistently have the
dipeptide arginine-isoleucine at their C-termini suggesting a role
for trypsin in activating the chymotrypsins. The sequence
identities for the mature domains of each translated protein are
presented in Table 2. Family 4 was most divergent with less than
20% identity with the other families, while families 2 and 3 shared
most similarity with scores of about 85%. The N-terminal sequence
obtained from the NaPI inhibitable chymotrypsin (FIG. 4) matched
the N-terminal sequence predicted from the cDNA clones encoding
chymotrypsins from family 2. The N-terminal sequence of the
NaPI-insensitive chymotrypsins was not represented in the 4
families of chymotrypsins represented by the cDNA clones.
TABLE-US-00005 TABLE 5 Protein sequence identity (%) between
members of the H. punctigera chymotrypsin gene family (mature
chymotrypsin domain only) ##STR00002##
TABLE-US-00006 TABLE 6 H. punctigera chymotrypsins are closely
related to chymotrypsins from other Helicoverpa species % amino
Helicoverpa acid punctigera GenBank sequence chymotrypsins
accession Species identity HpCh1AI Y12273 Helicoverpa. 92 armigera
AF237417 Heliothis virescens 86 HpCh1BI Y12273 H. armigera 91
AF237417 H. virescens 88 HpCh2A Y12287 H. armigera 97 Y12280 H.
armigera 95 Y12281 H. armigera 95 AF233734 H. zea 94 HpCh2B Y12287
H. armigera 92 Y12280 H. armigera 91 Y12281 H. armigera 90 HpCh3
Y12279 H. armigera 96 Y12287 H. armigera 82 HpCh4I Y12272 H.
armigera 89 HpCh5 AAO75039 Spodoptera 80 frugiperda Y12281 H.
armigera 74
[0242] Protein sequences most similar to H. punctigera were
obtained using the BLAST search engine. Genbank accession numbers
are listed. The mature activated proteins were compared and
percentage of protein sequence identity determined.
[0243] The N-terminal region of the insensitive chymotrypsins had
two unique stretches of sequence, designated F1 and F2 that were
used to design oligonucleotides for PCR amplification of DNA
encoding one of the insensitive chymotrypsins (FIG. 11) A 641 bp
fragment of DNA was obtained with the F1 oligonucleotide that
encompassed most of the protein-coding region. This PCR product was
used to screen for a full length clone in the H. punctigera midgut
library. Approximately 0.2% of the 50,000 plaques screened
hybridized strongly to the PCR product. Ten plaques were selected
and a full length clone was identified and sequenced (FIG. 12). The
921 bp clone had an open reading frame of 828 bp and residues 41-76
of the deduced protein were an identical match to the N-terminal
sequence obtained from the purified protein (FIG. 12). The clone
lacked the 5'signal peptide sequence, but comparison to the other
chymotrypsin clones indicated the activation peptide was full
length. The active enzyme is predicted to be 236aa in length, with
a mass of 24.2 kDa. Protein sequence homology was determined by
comparing the mature domains of each of the H. punctigera cDNAs.
Family 2 and family 3 were most similar to HpCh5 (Rech1a), with
about 72 and 70% identity respectively. Family 1 members shared
53-57% identity while Family 4 had about 20% identity with HpCh5.
Comprehensive Blast searches at the NCBI facility of both
translated and protein databases produced no significant matches.
The insensitive chymotrypsin belongs to a new family of Helicoverpa
chymotrypsins designated Family 5 (FIG. 13). A blast search
performed on a Helicoverpa armigera midgut EST database matched a
clone with over 97% sequence identity and 100% sequence similarity
FIG. 14.
[0244] Bovine chymotrypsins A and B and the NaPI-sensitive
chymotrypsin (HpCh2A) were compared to the insensitive chymotrypsin
(HpCh5) to identify regions of variability that may be involved in
low affinity binding to C1 (FIG. 15).
[0245] Ten substitutions identified in the alignment did not appear
to fall into functionally significant regions, whereas the eleventh
substitution was associated with one of the .beta.-strands that
forms a wall of the primary substrate-binding pocket. The location
of this substitution and conversion to an arginine is highly
unusual for the S1 domain that is predominantly lined with
non-polar residues that define chymotrypsin specificity.
Experimental Protocols
Preparation of RNA
[0246] Fifty late fourth and early fifth instar larvae were cold
anaesthetized before the gut was removed and snap frozen in liquid
nitrogen. The 50 gut were ground to a fine powder in the presence
of liquid N.sub.2 using a mortar and pestle and were stored at
-70.degree. C. The gut tissue (100 mg) was added to 1 mL of TRIZOL
(trademark) reagent (Life Technologies) and total RNA was purified
and quantified according to the manufacturer's protocol.
RT-PCR Amplification of Chymotrypsin Genes
[0247] Chymotrypsin genes from Helicoverpa armigera were aligned
using ClustalW and regions of high conservation were identified for
design of chymotrypsin specific primers. Primers were individually
designed to the H. armigera clone (CAA72951) due to the high level
of divergence to the other chymotrypsin sequences. Forward primers
were used in combination with RVG4 to amplify the gene fragments
using reverse transcriptase polymerase chain reaction (RT-PCR;
Superscript Preamplification System, Gibco BRL) with the protocols
supplied. The PCR products were gel purified (Qiagen gel extraction
kit), sub-cloned into TOPO PCR2.1 TA cloning vector (Invitrogen)
and transformed into chemically competent E. coli XL1-Blue cells
(Stratagene) prepared according to the method of (Inoue et al.,
1990, supra). Plasmid DNA was prepared using the QIAprep
(registered trademark) Spin Miniprep Kit (Qiagen).
Production and Screening of a H. Punctigera Gut cDNA Library:
Library Preparation
[0248] PolyA+ mRNA was isolated from the RNA (1.0 mg) using
conventional protocols. A biotinylated oligonucleotide (dT) primer
that binds to the polyA tail tags the transcripts that are
subsequently captured on streptavidin paramagnetic particles
(PolyATract (registered trademark), mRNA Isolation Systems,
Promega). Purified mRNA (5 .mu.g) was used to construct a cDNA
library with the Lambda ZAP-cDNA synthesis kit and the Zap-cDNA
GigapackIII Gold packaging extract (Stratagene) following the
manufacturer's instructions. The amplified library titre was
2.8.times.10.sup.10 pfu/mL.
Labeling Probes
[0249] RT-PCR products (50 ng) were individually labelled with
[.quadrature.-.sup.32P] dCTP (Amersham Life Sciences) using the
MEGAPRIME (trademark) DNA labeling system labeling (Amersham Life
Sciences). Unincorporated radiolabeled nucleotides were removed
using the Micro Bio-spin P-30 chromatography columns (BioRad)
according to the manufacturer's protocol. The double stranded
labelled probes were denatured by boiling (5 min), cooled on ice,
and then added to the hybridization solution (as below).
Screening the cDNA Library
[0250] The primary screen was performed using ten (15 cm) Petri
dishes per probe, with about 50,000 phage per plate. Preparation of
the plates for subsequent plaque lifts and treatment of the
membranes prior to hybridization was performed according to
instructions provided with the Lambda Zap cDNA synthesis kit
(Stratagene). The membranes (Hybond-N; Amersham Biosciences) were
prehybridized in 50 ml of 2.times.PIPES (0.8 M NaCl, 16 mM
piperazine-1,4-bis(2-ethanesulphonic acid) pH 6.5) 50% (v/v)
formamide, 0.5% (w/v) SDS and 100 .mu.g/mL Herring sperm DNA
(Boehringer Manningham) at 42.degree. C. for 3 hours. Following
prehyridization, the incubation solution was replaced with 50 ml of
50% (v/v) formamide, 2.times.PIPES buffer, 0.5% (w/v) SDS and 100
.mu.g/mL denatured herring sperm DNA containing the labeled probe
and left overnight at 42.degree. C. The hybridization membranes
were washed three times in 2.times.SSPE/0.1% (w/v) SDS at room
temperature and twice in 0.2.times.SSPE/0.1% (w/v) SDS at room
temperature, before they were blotted on 3 mm Whatman paper and
exposed to X-ray film (Kodak XAR-5) for 48 hours at -70.degree. C.
with intensifying screens.
[0251] Due to crowding and hence overlapping between positive
clones and non-specific plaques a secondary screen was conducted to
isolate individual clones. Two 8.5 cm plates each with 50 plaques
were used for each probe. The secondary screen was conducted as
described for the primary screen.
[0252] At least 50 positive plaques of varying intensities were
selected from each screen probed with an individual RT-PCR product.
Each plaque was transferred to a 1.5 mL microfuge tube containing 1
mL of SM buffer (0.1 M NaCl, 8 mM MgSO.sub.4.7H.sub.2O, 50 mM
Tris-HCl, pH 7.5, 0.01% (w/v) gelatin) and chloroform (20 .mu.L)
and stored at 4.degree. C. Initially 10 plaques for each probe were
excised and converted into pBluescriptII SK(-) phagemids using the
ExAssist/SOLR system (Stratagene). The excised phagemids were
transformed into the chemically competent E. coli strain XL1-Blue
cells and plasmid DNA was prepared and sequenced.
DNA Sequencing and Analysis
[0253] The cDNA clones were grouped on the basis of restriction
fragment patterns obtained using combinations of the endonucleases
BamHI, XhoII, KpnI, SacI, SacII, and SalI (Promega). RT-PCR
products and cDNA inserts were sequenced in both directions using
M13 universal primers at either Micromon sequencing facility at
Monash University (Melbourne) or SUPAMAC at the Royal Prince Alfred
Hospital in Sydney. The sequence data was edited using the BioEdit
v5.0.9.1 software written by Tom Hall, North Carolina State
University freely available at the web address:
www.mbio.ncsu.edu/BioEdit/bioedit.html. Sequence homologies were
assessed using the BLASTN search facility at National Centre for
Biotechnology Information (NCBI) and further multiple sequence
alignments were performed using ClustalW version 1.4. at the
Network Protein Sequence Analysis facility (NPSA;
http://npsa-pbil.ibcp.fr/cgi-bin/align_clustalw.pl) (Combet et al.,
TIBS. 25:147-150, 2000).
[0254] The web based program `PSORT II` available at the Human
Genome Centre at the University of Tokyo
(http://psort.nibb.ac.jp/form2.html), was used to predict signal
peptide cleavage points. UTRscan was used to detect functional
elements in the 3' untranslated regions of the cDNA clones [Pesole,
Trends Genet, 15: 378, 1999].
(http://bighost.area.ba.cnr.it/BIG/UTRScan/).
Isolation of a Partial cDNA Clone Encoding a NaPI-Insensitive
Chymotrypsin
[0255] A sample of RNA previously purified for the production of
the cDNA library was thawed and used as template for the following
RT-PCR reaction. Two 5' degenerate primers (5) were designed to
unique regions of the N-terminal amino acid sequence and used in
combination with the 3' primer RVG4. First strand cDNA synthesis
was achieved using the SuperScriptII Preamplification system from
Stratagene and was followed by PCR amplification of the target cDNA
using the Perkin Elmer thermocycler [25 cycles for 1 min at
94.degree. C., 1 min at 48.degree. C. and 1 min at 72.degree. C.
then 7 mins at 72.degree. C.]. PCR products were separated on 1%
(w/v) agarose gel (SEAKEM (registered trademark); BioWhittaker
Molecular Applications) and a band of approximately 650 bp was
excised and purified using the Concert purification system (Gibco).
The partial cDNA was cloned into the TOPO PCR2.1-TA vector
(Invitrogen) and transformed into E. coli strain XL-BL1
(Stratagene).
Isolation of the Insensitive Chymotrypsin cDNA Clone
[0256] The cDNA library prepared from fourth instar larval gut was
screened using a partial fragment cloned according to the
techniques described above
Example 4
Homology Modeling of the H. punctigera Chymotrypsins
[0257] The deduced amino acid sequences from the cDNA clones HpF2B
(sensitive) and HpF5 (insensitive) were modeled on the structures
of the Bos taurus (bovine) and fire ant chymotrypsins, obtained
from the Research Collaboratory for Structural Bioinformatics
(RCSB) Protein Data Bank site (http://www.rcsb.org/pdb/). The
Helicoverpa chymotrypsins are predicted to adopt similar structures
to those reported for all the chymotrypsin structures available in
the PDB databank. The modeled structure consists of the classic
serine protease fold consisting of two, six-stranded anti-parallel
.beta. barrels with the catalytic triad located between the two
domains. Two surface loops, 60 and 142 are considerably larger in
the H. punctigera chymotrypsins (FIGS. 15 and 16). Due to the
limitations of modelling, a small amount of ambiguity was present
in several surface loops, some of which are cleaved in mammalian
chymotrypsins (loop 142), but remain intact within insect
chymotrypsins. The only reported crystal structure of an insect
chymotrypsin is from the fire ant, Soenopsis invicta (Botos et al.,
Journal of Molecular Biology 298: 895-901, 2000) and this was used
to help refine the orientation of the surface loops on the model of
the Helicoverpa chymotrypsin.
[0258] C1 was modeled in complex with sensitive and insensitive
chymotrypsins to investigate whether substitution of glutamine (or
asparagine) 192 (Greer nomenclature, FIG. 15) with an arginine
would affect the binding capacity of the Helicoverpa chymotrypsins.
The structure of the chymotrypsin inhibitor (C1) was previously
determined by .sup.1H NMR (Nielson et al., 1994, supra). No
structures of C1 complexes have been solved and therefore the
related proteinase inhibitor PCI-1 from Solanum tuberosum in
complex with Proteinase B from Streptomyces griseus (Greenblatt et
al., 1989, supra) provided a basis for structural modeling. FIG. 17
illustrates the binding region surrounding Gln 192 in the C1-HpF2B
chymotrypsin complex. The predicted model of HpF2B and C1 shows
that glutamine 192 is not in conflict with any regions on the
inhibitor molecule. Comparison to the cognate arginine residue in
the insensitive chymotrypsin however suggests there is limited
space to accommodate this much larger residue (FIG. 18). The
modeling viewing program `Spdbv`, predicted Arg 192 to be in direct
conflict with threonine 5 of C1. PotI has been identified as a
strong inhibitor of the insensitive chymotrypsin from H. punctigera
and was, therefore, modelled in complex with the insensitive
chymotrypsin (FIG. 19). Unlike C1, PotI easily accommodates
arginine 192 upon binding to the insensitive chymotrypsin.
[0259] In summary, the NaPI-insensitive chymotrypsin from
Helicoverpa species has an arginine in place of an asparagine or
glutamine at position 192 that extends into the S1 binding pocket
and appears to interfere with C1 binding. Furthermore, it is clear
that this arginine residue does not interfere with PotI binding,
consistent with the observation that PotI is a much more efficient
inhibitor of insect chymotrypsins than the NaPI inhibitors.
Example 5
Production and Characterization of Polyclonal Antisera to the NaPI
Inhibitable and NaPI-Insensitive Chymotrypsins from H.
punctigera
[0260] Chymotrypsin clone HpF2B was expressed in E. coli fused to a
six histidine (6.H) tag at the C-terminus and was purified to
homogeneity on Talon metal affinity resin (FIG. 20) for injection
into a rabbit for production of polyclonal antibodies. N-terminal
sequencing of the purified product confirmed the expression of the
NaPI inhibitable chymotrypsin (HpCh2B). After the fourth boost with
antigen, the serum was collected and tested on protein blots of
bacterially expressed protein and unfractionated gut extracts. The
antibody detected the full-length recombinant chymotrypsin at a
dilution of 1 in 2500 as well as several break-down products.
Unfractionated gut extract and a sample of protein bound to the C1
affinity column were also stained with the anti-HpCh2B antibody
which detected the mature native form of the enzyme.
[0261] Purified 6H.HpCh2B was used to test the detection limit of
anti-HpCh2B antibody by comparison of immunoblots to silver stained
SDS-PAGE gels. The antibody detected 20 ng of bacterially expressed
chymotrypsinogen and also recognized the mature form of the native
chymotrypsin isolated from gut of H. punctigera.
[0262] The cDNA (HpF5) encoding the NaPI-insensitive chymotrypsin
(HpCh5) was expressed in E. coli in a similar manner except the
six.histidine tag was fused to the N-terminus of the expressed
protein. The polyclonal antiserum that was raised against the
bacterially expressed NaPI inhibitable chymotrypsin (HpCh2B) did
not cross-react with bacterially expressed NaPI-insensitive
chymotrypsin (HpCh5) on protein blots (FIG. 21). Likewise the
antiserum raised against HpCh5 did not bind to HpCh2B. This
indicates that these antisera can be used to specifically
distinguish between and monitor levels of the NaPI-insensitive and
sensitive chymotrypsins in unfractionated gut extracts.
Experimental Protocols
Preparation of Antigen for Immunization
[0263] The cDNA clone `HpF2B` which encodes an NaPI sensitive
chymotrypsin (FIG. 11) was amplified by polymerase chain reaction
(PCR) using two oligonucleotides (Table 7) that incorporated NcoI
and BglII restriction sites at the 5' and 3' ends of the cDNA
respectively.
TABLE-US-00007 TABLE 7 Degenerate primers designed to two unique
regions in the N-terminus of the insensitive chymotrypsin protein.
Primer positions are shown in the amino acid sequence by matching
typeface N-terminal sequence of NaPI-insensitive chymo- trypsin
IVGGSLSSVGQIPYQAGLVIDLAGGQAVCGGSLISA [SEQ ID NO:9] Primer Name
Oligonucleotide sequence 5'-3' Fw2ResChy TC(AGCT) GT(AGCT) GG(AGCT)
CA(AG) AT(ACT) CC [SEQ ID NO:10] FwResChym GT(AGCT) AT(ACT) GA(CT)
CT(AGCT) GC(AGCT) GG(AGCT) GG [SEQ ID NO:11]
TABLE-US-00008 TABLE 8 PCR amplification primers for bacterial
expression of chymotrypsin HpF2B Restriction Primer Name site
Sequence 5' Hc35PQE- NcoI TTA ACC ATG GTG ATC GAC 60Fw CTC [SEQ ID
NO:12] Hc35PQE- Bg/II GAT GAG ATC TGA GAC GTT 60Rv GGT TG [SEQ ID
NO:13]
[0264] The amplified region consisted of the pro-peptide and mature
domain of the chymotrypsinogen, but lacked the putative secretion
signal. Digests using NcoI and BglII enzymes (Promega) were
performed on the PCR amplified product and the pQE-60 expression
vector (Qiagen). The pQE-60 vector provides a His-tag at the
C-terminus of the expressed protein. Each restriction digest was
purified using WIZARD (registered trademark) DNA clean up system
(Promega) and the vector and chymotrypsin insert were subsequently
ligated using standard molecular biology techniques (Sambrook and
Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, 3rd edition 2001) The ligation mix was heated at
65.degree. C. for 10 min before being transformed into the E. coli
strain XL1-Blue. Plasmid DNA was prepared for sequencing and
subsequent transformation into the E. coli cell line M15 (Qiagen)
using the QIAPREP (registered trademark) Spin Miniprep Kit
(Qiagen).
[0265] Expression and purification of the recombinant
chymotrypsinogen was performed under denaturing conditions
according to the methods detailed in the QiaExpress manual
(Qiagen). The purity of the expressed chymotrypsinogen was assessed
by SDS-PAGE and the identity of the recombinant protein confirmed
by N-terminal sequencing. Preparation of the chymotrypsin for
injection consisted of removal of the urea by dialysis against 50
mM Tris-HCl pH 8.0. During this process most of the protein
aggregated. The aggregated protein was collected by centrifugation
and resuspended in 1 mL of 50 mM Tris-HCl, pH 8.0 for injection.
The protein concentration was approximated by the comparison of a
10 .mu.L sub-sample to a series of bovine trypsin standards (Sigma)
using SDS-PAGE and Coomassie staining.
[0266] The cDNA clone `HpF5` which encodes the NaPI-insensitive
chymotrypsin (FIG. 12) was PCR amplified essentially as described
for clone HpF2B above except the forward primer (FwpMaIRECH)
incorporated a Histidine tag at the N-terminus of the expressed
protein and the reverse primer (RvRECH) contained a stop codon and
thus prevented incorporation of a Histidine tag at the C-terminus
from the pQE-60 expression vector.
Example 6
Bioassays with PotI Inhibitor and Helicoverpa Larvae
[0267] Large quantities of the PotI inhibitor were purified from
potato tubers to evaluate the combined effect of NaPI and PotI on
the growth of H. armigera larvae. Bioassays confirmed that addition
of PotI significantly enhances the activity of the NaPI inhibitors.
Caterpillars fed NaPI and PotI in combination (0.26 and 0.34%
(w/v), respectively) were 34% the size of control larvae at the
fifth instar stage of development whereas caterpillars feeding on
NaPIs alone were about 84% the size of the controls. Based on these
results we decided to clone genes encoding the PotI inhibitors for
transfer into cotton plants. Two PotI genes (PotIA and PotIB) were
isolated using mRNA isolated from potato tubers and wounded potato
leaves. These cDNA clones were used to construct vectors for
bacterial expression of the PotI proteins. The bacterially produced
PotI proteins totally inhibited the NaPI-insensitive chymotrypsin
isolated from H. punctigera larvae. Both PotI genes were
incorporated into constructs for cotton transformation. Purified
PotI inhibitor from potato tubers was used to generate specific
antibodies that were used to monitor levels of PotI produced by
transgenic plants.
Experimental Protocols
[0268] Purification of PotI Inhibitor from Potato Tubers
[0269] Potato tubers (2 Kg, Solanum tuberosum var Russet Burbank)
were diced and soaked overnight at 4.degree. C. in two litres of 50
mM H.sub.2SO.sub.4. The tissue was homogenized in a blender and
insoluble material was removed by filtration through two layers of
Miracloth followed by centrifugation (13,000 rpm, 15 min, 4.degree.
C.). The supernatant was adjusted to pH 7.8 with 10 M NaOH, heated
for 30 min in boiling water and cooled before precipitated material
was separated by centrifugation (13,000 rpm, 12 min, 4.degree. C.).
Soluble proteins were precipitated with ammonium sulphate (80%
saturation), collected by centrifugation and redissolved in gel
filtration buffer (150 mM KCl, 10 mM Tris-HCl, pH 8) before they
were applied to a Sephadex G75 column (85.times.2.54 cm). Elution
fractions (50 mL) containing PotI were identified using
SDS-polyacrylamide gel electrophoresis and inhibition assays with
bovine chymotrypsin. PotI containing fractions were pooled,
dialysed and freeze dried. The protein in these pooled fractions
was examined by reverse phase-HPLC on a system Gold HPLC (Beckman,
Fullerton, Calif.) coupled to a 166 detector (Beckman). The
analytical RP-HPLC was conducted on a Brownlee Aquapore RP300 C8
column (4.6.times.100 mm; Perkin-Elmer). The protein was eluted
with a linear gradient of 0-100% (v/v) buffer B (60%[v/v]
acetonitrile in 0.089% [v/v] trifluoroacetic acid) at a flow rate
of 1 mL min-1 over 40 min (FIG. 22). The identity of the PotI
proteins was confirmed by N-terminal sequencing and mass
spectrometry and at least two PotI isoforms were identified.
Growth of H. armigera Larvae on Artificial Diet Containing NaPI and
PotI
[0270] PotI protein isolated from potato tubers and NaPI peptides
isolated from N. alata stigmas, were incorporated into a cotton
leaf based artificial diet and fed to H. armigera neonates (FIG.
23). PotI had an additive affect on larval growth. Larvae fed NaPI
only were inhibited in growth by 16% compared to control larvae
while larvae fed both NaPI and PotI were inhibited in growth by 75%
compared to control larvae (FIG. 23).
Isolation of cDNAs Encoding Potato Proteinase Inhibitor 1
(Pot1)
[0271] Potato proteinase inhibitor I cDNA was synthesized using
reverse transcriptase-PCR and total RNA from potato tubers or
wounded potato leaves. First strand cDNA was prepared using
Thermoscript RT-PCR with Oligo (dT).sub.20 primers (Life
Technologies). PotI cDNA sequences were subsequently amplified
using gene specific primers 5'CGG-GAT-CCA-TGG-AGT-CAA-AGT-TTG-C-3'
[SEQ ID NO:14] (sense) and 5'-GCG-TCG-ACG-CTT-AAG-CCA-CCC-TAG-G-3'
[SEQ ID NO:15] (antisense) that were designed to anneal to the 5'
and 3' ends of the open reading frame of the published PotI genomic
sequence M17108 (Cleveland et al., Plant Mol. Biol. 8:199-207,
1987) and included restriction sites Bam HI and Sal I
respectively.
[0272] Two PotI homologs were isolated. StPotIA was derived from
wounded leaf RNA and StPotIB was derived from tuber RNA. StPotIA
and StPotIB cDNA share 92.6% nucleic acid sequence identity and
share 86% amino acid sequence identity (FIG. 25).
[0273] The predicted amino acid sequence and comparison to other
members of the Potato Inhibitor I family are presented in FIG. 24.
StPotIB is very similar to published PotI sequences from potato
tuber and shares a methionine at the P1 reactive site. In contrast,
StPotIA contains an alanine residue at P1 and also has an
additional four amino acids at positions 41 to 44. Additional amino
acids in this position have not been reported for other potato PotI
isolates although they have been found in a wound induced PotI from
tomato.
Expression of StPotIA and StPotIB in E. coli
[0274] DNA encoding PotI without the endoplasmic reticulum signal
sequence (amino acids 37-111 in StPotIA and 37-107 in StPotIB) was
amplified by PCR. Primers used were
5'-CGG-GAT-CCA-AGG-AAT-CGG-AAT-CTG-3' [SEQ ID NO:16] (StPotIA
sense), 5'-CGG-GAT-CCA-AGG-AAT-TTG-AAT-GC-3' [SEQ ID NO:17]
(StPotIB sense) and 5'-CGA-GCT-CTT-AAG-CCA-CCC-TAG-G-3' [SEQ ID
NO:18] (StPotIA/B antisense). PCR products were initially cloned
into the pGEM T-Easy vector (Promega) before they were excised with
BamHI and SacI and ligated into the bacterial expression vector
pQE30 (Qiagen) which provides a 6.times.His-tag at the N-terminus
of the expressed protein.
[0275] The His-tagged PotI proteins were expressed in E. Coli
(BR21DE3 Codon Plus strain (Stratagene) for StPotIA and M15 strain
(Qiagen) for StPotIB). Cells were induced with 1 mM IPTG, harvested
by centrifugation and lysed in 8 M urea, 0.1 M NaH.sub.2PO.sub.4,
0.01 M Tris-HCl, pH 8.0. Cell debris was removed by centrifugation
at 10,000 g for 5 min and the His-tagged PotI was purified from the
supernatant by metal-affinity chromatography on Talon resin
(Clontech). Bound protein was eluted from the resin with 8 M urea,
0.1 M NaH.sub.2PO.sub.4, 0.01 M Tris-Cl, pH 4.0 and elution was
monitored by SDS-PAGE. The StPotIA and StPotIB proteins were
purified further by RP-HPLC (FIG. 25) their identity was confirmed
by N-terminal sequencing and mass spectrometry.
Inhibition of the NaPI-Insensitive Chymotrypsins from H. punctigera
by StPotIA and StPotIB
[0276] The inhibitory activity of StPotIA and StPotIB against the
NaPI-insensitive chymotrypsins from H. punctigera was determined by
preincubating the NaPI-insensitive protease (10 .mu.L) with varying
amounts of StPotIA and StPotIB (0-600 nM) in 133 mM CAPS buffer, pH
10.0 at 30.degree. C. in 96 well microtitre plates. After the 30
min preincubation, the incubation was started by the addition of
substrate (SA.sub.2 PFpNA, SA.sub.2PLpNA or SA.sub.2PMpNA) to a
final concentration of 1 mM in a final volume of 100 .mu.L.
Absorbance was measured at 405 nm after 30 or 60 min.
[0277] StPotIA, StPotIB and the mix of PotI isoforms isolated from
potato tuber inhibited the NaPI-insensitive chymotrypsin in the
Helicoverpa punctigera gut extract (FIG. 26). At least 75% of
SA.sub.2 PFpNA or SA.sub.2PLpNA hydrolysis by the NaPI-insensitive
chymotrypsin was inhibited by the addition of 300 nM of StPotIA,
StPotIB or a mix of PotI isoforms isolated from tuber. Inhibition
of SA.sub.2PMpNA hydrolysis was lower (40%).
Production of Transgenic Cotton Expressing NaPI and StPotIA
[0278] Two gene constructs (pHEX2 and pHEX6) were prepared for
transformation of cotton (Gossypium hirsutum). pHEX2 consists of a
35S promoter driving the NaPI gene with a 35S terminator, inserted
into the binary vector pBIN 19 (Bevan, Nucl. Acids Research, 12:
8711-8721, 1984). pHEX6 consists of a 35S promoter driving the
StPotIA gene with a 35S terminator inserted into the binary vector
pBIN 19.
[0279] Transgenic cotton was produced using the method of Umbek et
al., Biotechnology, 5: 263-266, 1987) with modifications. Hypocotyl
sections of cotton Cv Coker 315 were co-cultivated with
Agrobacterium tumefaciens strain LBA 4404 containing the required
binary vector. Callus was induced on media consisting of MS salts,
B5 vitamins, 3% glucose, 0.9 g/L MgCl.sub.2 (hexahydrate), 1.9 g/L
potassium nitrate, 2 g/L Gelrite, 0.1 mg/L Kinetin, 0.1 mg/L 2,4-D,
500 mg/L carbenicillin, 35 mg/L Kanamycin. Embryogenic callus was
induced by growing the callus on the same media but without
hormones. Embryos were excised and incubated on media in petri
dishes (Stewart and Hsu, Planta 137: 113-117, 1977). Germinated
embryos that had produced roots and true leaves were transferred to
containers for further development and then transferred to soil and
grown in a growth cabinet at 27.degree. C.
Production of Transgenic Cotton Expressing NaPI and StPotIA
[0280] To produce plants expressing both genes, pollen from a
transgenic line expressing NaPI was used to pollinate a flower from
a plant expressing StPotIA and the seed collected. One progeny
plant (plant 3) was identified as expressing both genes by
immunoblot analysis.
[0281] Leaves from plant 3 were used in a bioassay with H. armigera
(FIG. 27). While expression of either NaPI or StPotIA in the leaves
only resulted in a small inhibition of larval growth compared to
the control, expression of both proteins had a synergistic effect
on larval growth.
Example 7
Baculovirus Expression of HpCH5
Addition of the Signal Peptide Sequence to HpCH5
[0282] While the HpF5 clone encoded the entire chymotrypsinogen
sequence of HpCh5 with the activation domain it did not encode the
signal peptide required for correct targeting of the protein to the
endoplasmic reticulum (ER). For baculovirus expression, an ER
signal sequence was added to the HpF5cDNA using two overlapping
oligonucleotides corresponding to the 19 amino acids of the ER
signal peptide from HpCh2A (FIG. 10). The ER signal sequence was
added to the preactivation and mature domains of HpCh5 in a
two-step PCR (Table 9).
TABLE-US-00009 TABLE 9 PCR amplification primers for addition of an
ER signal sequence to HpCh5 Primer Sequence FWBacRECH1 TTG GCT TTC
GCC GCG GTC GTC TCC (5'-3') GCG AGG AAC GGG TCC C [SEQ ID NO:19]
FWBacRECH2 GGA TCC ATG AAA CTC TTG GCT GTG (5'-3') ACT CTA TTG GCT
TTC G [SEQ ID NO:20] RvRECH (3'-5') G ATC AAC GGC CAG CTC TAA AAG
CTT [SEQ ID NO:21]
[0283] The first PCR used primers FwBacRECH1 and RvRECH with the
HpF5 cDNA template to add the first half of the ER signal sequence.
The second PCR used FwBacRECH2 together with RvRECH and the product
of the first PCR reaction as template. At each step, the
amplification products were purified after electrophoresis on 0.7%
(w/v) agarose gels before they were used for subsequent PCRs.
Cloning of HpF5/ER into pFastBac Vector
[0284] The HpF5 cDNA with the ER signal sequence (HpF5/ER) was
subcloned into the pCR (registered trademark)-2.1 TOPO vector
(Invitrogen) and was sequenced at the Micromon, DNA sequencing
facility, Monash University, Victoria, Australia. Recombinants with
the correct sequence were digested with EcoRI and gel purified
before they were digested with BamHI and HindIII and ligated into
the pFastBac vector (Invitrogen) and transformed into E. coli XL1
Blue cells.
Transposition of pFastBac/HpF5/ER Construct into E. coli DH10Bac
Cells
[0285] E. coli XL1 Blue cells were screened for the presence of the
HpF5/ER cDNA in the pFastBac vector (pFastBac/HpF5/ER) by PCR and
restriction digest. Minipreps were performed on positive
transformants. E. coli DH10Bac competent cells containing bacmid
DNA and the helper plasmid required for transposition of HpF5/ER to
the bacmid DNA were thawed on ice. Approximately 1 ng of
pFastBac/HpF5/ER recombinant plasmid was added to the cells (150
.mu.L) and after gently mixing the mixture was transferred to a
pre-chilled GENE PULSER.RTM./E. COLI.TM. pulser cuvette. The
cuvette was placed in the electroporation apparatus (BioRad) and a
pulse of 1.7 Amps was applied. LB (1 mL) was then added and the
sample was transferred to a 10 mL capped tube and allowed to
recover on a shaking incubator (190 rpm) at 37.degree. C. for 4
hours. A sample was withdrawn and serially diluted (10.sup.-1,
10.sup.-2, and 10.sup.-3) using LB medium before 100 .mu.L of each
dilution was spread evenly onto LB agar plates containing 50
.mu.g/mL kanamycin, 7 .mu.g/mL gentiamicin, 10 .mu.g/mL
tetracycline, 100 .mu.g/mL
5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside (X-Gal) and
40 .mu.g/mL IPTG prior to incubation for 48 hours at 37.degree. C.
A pFastBac vector with no insert was treated the same way and used
as a control.
Isolation of Recombinant Bacmid DNA
[0286] Recombination between the pFastBac/HpF5/ER vector and the
bacmid DNA was detected by the presence of white colonies as
opposed to blue colonies, indicating a disruption in the
lacZ.alpha. gene. To confirm the recombination was stable, the
colonies were restreaked on selective media and incubated for 24
hours. White colonies were used to inoculate 10 mL LB media
containing 50 .mu.g/mL kanamycin, 7 .mu.g/mL gentiamicin and 10
.mu.g/mL tetracycline for isolation of the recombinant bacmid DNA.
The same procedure was performed with a blue colony (not
recombinant) selected as a control. Cells were grown overnight at
37.degree. C. with shaking at 190 rpm. Cultures were centrifuged at
14,000.times.g for 5 min. The supernatant was discarded and the
pellet was resuspend in 0.3 ml of Solution I (15 mM Tris-HCl, pH
8.0, 10 mM EDTA, 100 .mu.g/mL RNase A]. Solution II (0.2 N NaOH, 1%
(w/v) SDS) was then added and gently mix and incubated at room
temperature for 5 min. Potassium acetate (0.3 mL, 3 M, pH 5.5) was
slowly added and the samples were placed on ice for 10 min before,
they were centrifuged for 10 min at 14,000.times.g to remove the
thick white precipitate. The supernatant was then transferred to a
1.5 mL microfuge tube containing 0.8 ml absolute isopropanol and
was mixed by inversion. After 10 min on ice samples were
centrifuged for 15 min at 14,000.times.g at room temperature. The
supernatant was removed and pellet was washed twice with 0.5 mL of
70% (v/v) ethanol. The sample was then centrifuged for 5 min at
14,000.times.g at room temperature before the 70% (v/v) ethanol was
removed and the DNA pellet was air dried. The DNA was then
dissolved in 60 .mu.L TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0)
and stored at -20.degree. C. until needed. The bacmid was examined
by electrophoresis on a 0.5% (w/v) agarose gel prepared in TAE (40
mM Tris-acetate, 1 mM EDTA, pH 8) buffer at 23 V for 12 hours with
.lamda. DNA/HindIII Fragment markers (MBI Fragments). The bacmid
was also screened using PCR with M13 Forward and reverse
primers.
Transfection of HIGH FIVE.TM. Cells with Recombinant Bacmid DNA
[0287] Approximately 9.times.10.sup.5 HIGH FIVE.TM. insect cells
were placed into a 35-mm well in a 6-well plate (NUNCLON.TM.
.DELTA. Surface) in 2 ml of EX-CELL.TM. 405 media with 50 units/mL
penicillin and 50 .mu.g/mL streptomycin (JRH Biosciences). Cells
were left at 27.degree. C. for 1 hour to allow them to attach to
the plate. Two solutions were prepared for each transfection each
adding a different amount of bacmid miniprep (5, 10 or 20 .mu.L);
Solution A: mini-prep of bacmid DNA into 100 .mu.L EX-CELL.TM. 405
media without antibiotics, and Solution B: 6 .mu.L of
CELLFECTIN.TM. Reagent (Gibco BRL) into 100 .mu.L EX-CELL.TM. 405
media without antibiotics. Solutions A and B were combined and
incubated for 1 hour at room temperature followed by 0.8 mL of
selection free media added. After the cells had attached to the
plate, they were washed once with 2 mL media without antibiotics.
The media was removed from cells and was replaced with the DNA
containing solution. Cells were incubated for 5 hours in a
27.degree. C. incubator before the transfection mixture was
aspirated and replaced with 2 mL of media containing antibiotics.
Cells were incubated further at 27.degree. C. for up to 72
hours.
[0288] After 24, 48 and 72 hours, 2 mL of the supernatant was
transferred to a 10 mL sterile capped tube and centrifuged for 5
min at 500.times.g. The virus-containing supernatant was
transferred to a fresh tube and stored at 4.degree. C., protected
from light until required.
Infection of Insect Cells with Recombinant Baculovirus
Particles
[0289] Two 10 mL cultures were set up for each transfection. Each
culture was infected with 100 .mu.l of harvested virus
(.about.2.times.10.sup.7 pfu/mL). Infected cells were harvested at
24, 48, and 72 hours. These samples were later analyzed for protein
expression by immunoblot analysis with the anti-HpCh5 antibody.
Example 8
Baculovirus Expression of HPCH5
Primer Design for ER Signal Sequence
[0290] The original HpF5 cDNA clone did not encode an ER signal
sequence. While the ER signal sequence was not required for
bacterial expression it was essential for baculovirus expression.
An ER signal sequence was thus constructed using the DNA sequence
from chymotrypsin family 2A which is most closely related to the
chymotrypsin family 5.
[0291] The sequence was added using PCR reactions with two primers
encoding part of the ER signal sequence. The FwBacRECH1 primer had
a silent mutation to remove the BamHI restriction digest site and
encoded half the ER signal sequence. The FwBacRECH2 primer encoded
the remainder of the ER signal sequence and introduced a BamHI
restriction site (FIG. 28).
Amplification and Ligation of HpCh5 into the pFastBac Vector
[0292] PCR using primers the FwBacRECH1 and RvRECH and HpF5cDNA as
the template yielded a product of .about.900 bp. A second PCR using
this PCR product together with FwBacRECH2 and RvRECH primers was
performed to yield a product of .about.930 bp that encoded the
HpCh5 protein with an ER signal sequence. The amplified product was
subcloned into pCR (registered trademark)-2.1 TOPO vector
(Invitrogen) before transfection into TOP10 competent cells.
Colonies were screened for the presence of insert using M13 forward
and reverse primers. Restriction digests of the isolated plasmids
with EcoRI then subsequently with BamHI and HindIII yielded a
product of the expected size of .about.930 bp.
[0293] The .about.930 bp fragment was subsequently ligated into the
pFastBac vector to create pFastBac/HpF5/ER. The presence of the
HpF5 cDNA insert in the pFastBac vector was confirmed by
restriction digests with BamHI and HindIII and PCR using FwBacRECH2
and RVRECH primers (Table 9). Plasmids containing the insert were
sent to Micromon for DNA sequencing.
Analysis of Bacmid DNA
[0294] The transfection of the recombinant pFastBac vector into
DH10Bac cells resulted in the transposition of the HpF5 insert into
the bacmid DNA. Recombinant bacmid DNA was isolated from the
transfected cells and was separated on a 0.5% (w/v) agarose
gel.
[0295] The bacmid was checked for the HpF5 cDNA insert by PCR
analysis with M13 forward and reverse primers. The expected
.about.3300 bp fragment was further analysed using the primers to
HpF5/ER cDNA and M13 to ensure the insert was in the correct
orientation. The positive bacmid DNA was subsequently used for the
transfection of insect cells.
Virus Formation and Production of HpCh5 in the Baculovirus
Expression System
[0296] Three different concentrations of bacmid DNA were used to
transfect the insect cells for production of baculovirus. After
transfection, the cells were incubated at 27.degree. C. for 72
hours before the culture medium containing the virus was collected.
The medium was tested by immunoblot analysis with the .alpha.-HpCh5
antibodies for the production of HpCh5 protein, which indicated
virus was being produced (FIG. 29A). Many controls were used to
monitor the transfection. These included pFastBac vector alone,
transfection of DNA from a blue colony, incubation of cells with
CELLFECTIN.RTM. alone and non-transfected cells (FIG. 29A). The
medium containing virus was used in a subsequent experiment to
infect more insect cells on a larger scale and a time course was
performed over a 72 hour period to monitor the regulation of HpCh5
expression (FIG. 29B).
[0297] Those skilled in the art will appreciate that the invention
described herein is susceptible to variations and modifications
other than those specifically described. It is to be understood
that the invention includes all such variations and modifications.
The invention also includes all of the steps, features,
compositions and compounds referred to or indicated in this
specification, individually or collectively, and any and all
combinations of any two or more of said steps or features.
BIBLIOGRAPHY
[0298] Altschul et al., Nucl. Acids Res. 25: 3389-3402, 1997 [0299]
Antcheva et al., Protein Sci. 10: 2280-2290, 2001 [0300] Atkinson
et al., The Plant Cell 5: 203-213, 1993 [0301] Ausubel et al.,
"Current Protocols in Molecular Biology" John Wiley & Sons Inc,
1994-1998, Chapter 15, 1998 [0302] Balandin et al., Plant Mol.
Biol. 27:1197-1204, 1995 [0303] Beuning and Christeller, Plant
Physiol 102: 1061, 1993 [0304] Bevan, Nucl. Acids Research, 12:
8711-8721, 1984 [0305] Bonner and Laskey, Eur. J. Biochem. 46: 83,
1974 [0306] Botos et al., J. Mol. Biol. 298: 895-901, 2000 [0307]
Botos et al., Journal of Molecular Biology 298: 895-901, 2000
[0308] Bown, et al., Insect Biochem. Molec. Biol. 27: 625-638, 1997
[0309] Bradford, Anal Biochem 72: 248-254, 1976 [0310] Broadway and
Duffey, J. Insect Physiol. 32: 673-680, 1986a [0311] Broadway and
Duffey, J. Insect Physiol. 32: 827-833, 1986b [0312] Broadway and
Villani, Entomol. Expo. Appl. 76: 303-312, 1995 [0313] Broadway,
Arch. Insect Biochem. Physiol. 32(1): 39-53, 1996 [0314] Broadway,
J. Insect. Physiol. 41: 107-116, 1995 [0315] Broadway, J. Insect.
Physiol. 43(9): 855-874, 1997 [0316] Burgess et al., Entomol. Exp.
App. 61: 123-130, 1991 [0317] Choi et al., Biochim. et Biophys.
Acta 1492: 211-215, 2000 [0318] Christeller et al., Insect Biochem.
Molecul. Biol. 22:.sub.--735-746, 1992 [0319] Cleveland et al.,
Plant Mol. Biol. 8:199-207, 1987 [0320] Combet et al., TIBS.
25:147-150, 2000 [0321] Cordero et al., In: General Meeting of the
International Program on Rice Biotechnology of the Rockefeller
Foundation, Malacca, Malaysia, 1997 [0322] Cripps et al., J. Cell
Biol. 126: 689-699, 1994 [0323] De Leo et al., Plant Physiol. 118:
997-1004, 1998 [0324] Erickson et al., Science 249: 527-533, 1990
[0325] Fang et al., Plant Cell 1: 141-150, 1989 [0326] Gatehouse et
al., In: Plant Genetic Manipulation for Crop Protection, Biotech.
in Agriculture No. 7, Eds. Gatehouse, Hilder & Boulter,
International U.K., pp. 155-181, 1992 [0327] Gatehouse et al., J.
Insect Physiol. 45 (6), 545-558, 1999 [0328] Gatehouse, et al.,
Insect Biochem. Molecul. Biol. 27: 929-944, 1997 [0329] Graham et
al., J. Biol. Chem., 260: 6555-6560, 1985 [0330] Greenblatt et al.,
J. Mol. Biol. 205: 201, 1989 [0331] Greer, Proteins 7: 317-34, 1990
[0332] Hajdukiewicz et al., Plant Mol. Biol. 25: 989-994, 1994
[0333] Harsulkar, et al., Plant Physiol. 121: 497-506, 1999 [0334]
Heath et al., European Journal of Biochemistry 230(1): 250-257,
1995 [0335] Heath et al., J. Insect Physiol. 43: 833-842, 1997
[0336] Hediger et al., Insect Mol. Biol. 10: 113-119, 2001 [0337]
Hsu et al., Plant Sci. 143: 63-70, 1999 [0338] Johnston et al.,
Insect Biochem. 21: 389-397, 1991 [0339] Johnston et al., Insect
Biochem. Molec. Biol. 25(3): 375-383, 1995 [0340] Jongsma et al.,
Proc. Nat. Acad. Sci. USA 92(17): 8041-8045, 1995a [0341] Jose
Cordero et al., Plant J. 6: 141-150, 1994 [0342] Keil et al., EMBO
J. 8:1323-1330, 1989 [0343] Lee and Anstee, Insect. Biochem. Molec.
Biol. 25(1): 49-61, 1995b [0344] Lee and Anstee, Insect. Biochem.
Molec. Biol. 25: 63-71, 1995a [0345] Lee et al., Nature Structural
Biology 6(6): 526-530, 1999 [0346] Legavre et al., In: Vth
International Congress of Plant Molecular Biology, Singapore, 1997
[0347] Lidholm et al., Genetics 134: 859-868, 1993 [0348] Lindhorst
et al., Plant Mol. Biol. 21: 985-992, 1993 [0349] Lozovskaya et
al., Genetics 142: 173-177, 1996 [0350] Markwick et al., J.
Economic Entomology 91 (6): 1265-76, 1998 [0351] Markwick et al.,
J. Economic Entomology 88(1): 33-39, 1995 [0352] Marmur and Doty,
J. Mol. Biol. 5:109, 1962 [0353] Mazumdar-Leighton and Broadway,
Insect Biochem. Mol. Biol. 31: 645-657, 2001a [0354]
Mazumdar-Leighton and Broadway, Insect Biochem. Mol. Biol.
31:633-644, 2001b [0355] Miller et al., Plant Cell 11: 1499-1508,
1999 [0356] Miller et al., Plant Mol. Biol. 42: 329-333, 2000
[0357] Moura and Ryan, Plant Physiol. 126: 289-298, 2001 [0358]
Nielson et al., Biochemistry 34: 14304-14311, 1995 [0359] Nielson
et al., J. Mol. Biol. 242: 231-243, 1994 [0360] Patankar, et al.,
Insect Biochem. & Mol. Biol. 31: 453-464, 2001 [0361] Pathirana
et al., Plant J. 12: 293-304, 1997 [0362] Paulillo, et al., J.
Econ. Entomol. 93:892-896, 2000 [0363] Peloquin et al., J. Cot.
Sci. 5:114-120, 2001 [0364] Pesole, Trends Genet, 15: 378, 1999
[0365] Peterson et al., Insect Biochem. Mol. Biol. 25: 765-774,
1995 [0366] Pujade-Renaud et al., Plant Physiol. Biochem. 35:
85-93, 1997 [0367] Richardson and Cossins, FEBS Letters, 52:161,
1975 [0368] Ryan, Annu. Rev. Phytopathol. 28:425-449, 1990 [0369]
Samac and Shah, Plant Cell 3:1063-1072, 1991 [0370] Schoenbeck et
al., Molec. Plant-Microbe Interact, 1999 [0371] Seemuller et al.,
Hoppe-Seyler's Z. Physiol. Chem. 358:1105-1117, 1977 [0372] Stewart
and Hsu, Planta 137:113-117, 1977 [0373] Summerton and Weller,
Antisense and Nucleic Acid Drug Development 7: 187-195, 1997 [0374]
Taylor et al., Plant Mol. Biol. 23:1005-1014, 1993 [0375] Teakle et
al., Journal of Invertebrate Pathology 46:166-173, 1985 [0376]
Terra and Ferreira, Comp. Biochem. Physiol. 109:1-62, 1994 [0377]
Valiatis et al., Insect Biochemistry and Molecular Biology 29:
405-415, 1999 [0378] Volpicella et al., Eur. J. Biochem. 270:10-19,
2003 [0379] Wells, Methods Enzymol. 202: 2699-2705, 1991 [0380] Wu
et al., Molecular Breeding 3: 371-380, 1997 [0381] Xu and Qin, J.
Econ. Entomol. 87: 334-338, 1994
Sequence CWU 1
1
9315PRTartificial sequenceSynthetic construct linker sequence 1Glu
Glu Lys Lys Asn1 52219PRTHelicoverpa sp 2Ile Val Gly Gly Ser Leu
Ser Ser Val Gly Gln Ile Pro Tyr Gln Ala1 5 10 15Gly Leu Val Ile Asp
Leu Ala Gly Gly Gln Ala Val Cys Gly Gly Ser20 25 30Leu Ile Ser Ala
Ser Arg Val Leu Thr Ala Ala His Cys Trp Phe Asp35 40 45Gly Gln Asn
Gln Ala Trp Arg Phe Thr Val Val Leu Val Met His Gly50 55 60Ser Trp
Thr Pro Ser Leu Ile Arg Asn Asp Val Ala Val Ile Arg Leu65 70 75
80Gly Thr Asn Val Ala Thr Ser Asn Thr Ile Ala Ile Ile Ala Leu Pro85
90 95Ser Gly Ser Gln Ile Asn Glu Asn Phe Ala Gly Glu Thr Ala Leu
Ala100 105 110Ser Gly Phe Gly Leu Thr Ser Asp Thr Gly Ser Ile Ser
Ser Asn Gln115 120 125Ala Leu Ser His Val Asn Leu Pro Val Ile Thr
Asn Ala Val Cys Arg130 135 140Asn Ser Phe Pro Leu Leu Ile Gln Asp
Ser Asn Ile Cys Thr Ser Gly145 150 155 160Ala Asn Gly Arg Ser Thr
Cys Arg Gly Asp Ser Gly Gly Pro Leu Val165 170 175Val Thr Arg Asn
Asn Arg Pro Leu Leu Ile Gly Ile Thr Ser Phe Gly180 185 190Ser Ala
Arg Gly Cys Gln Val Gly Ser Pro Ala Ala Phe Ala Arg Val195 200
205Thr Ser Tyr Ile Ser Trp Ile Asn Gly Gln Leu210
215340PRTHelicoverpa sp 3Val His Leu Glu Asp Ser Ile Asp Leu Glu
Asp Ile Thr Ala Trp Gly1 5 10 15Tyr Leu Thr Lys Phe Gly Ile Pro Glu
Ala Glu Lys Ile Arg Asn Ala20 25 30Glu Glu Ala Ser Ser Ala Ser
Arg35 404708DNAHelicoverpa sp 4atcgtcggtg gttcattgtc cagtgtcgga
cagatccctt accaggctgg tctcgtcatt 60gacttagcag gtggccaggc tgtctgcgga
ggctccctga tcagcgcttc ccgcgtactg 120accgctgctc actgctggtt
cgacggccaa aaccaggcct ggagattcac cgttgttctt 180ggttccacca
ccttgttctc tggcggtacc agaatcccta catccaatgt tgttatgcac
240ggaagctgga ctcctagcct tatccgtaac gatgttgccg taatcagatt
gggcaccaac 300gtagcaacct caaacaccat tgccatcatc gctctaccca
gcggcagcca gatcaacgag 360aacttcgccg gtgaaaccgc cctcgcctcc
ggcttcggtc tcaccagtga caccggcagc 420atctccagca accaggctct
gagccacgtc aacctgccag tgatcaccaa cgctgtgtgc 480agaaattcat
tccccctgct gatccaggac tctaacattt gcaccagcgg tgccaacggc
540aggagcactt gccgcggtga ctccggcggt cctctcgtcg tcaccaggaa
caacagacca 600ctcttgatcg gtatcacctc tttcggatct gcccgcggtt
gccaagttgg atctcccgct 660gccttcgcca gagtcacctc ttacatcagc
tggatcaacg gccagctc 7085120DNAHelicoverpa sp 5gttcacctcg aggattctat
tgatctggaa gatattaccg cttggggata cctcaccaaa 60ttcggtattc cagaagctga
gaaaatccgc aacgctgaag aagctagctc tgctagcagg 1206921DNAHelicoverpa
sp 6gttcacctcg aggattctat tgatctggaa gatattaccg cttggggata
cctcaccaaa 60ttcggtattc cagaagctga gaaaatccgc aacgctgaag aagctagctc
tgctagcagg 120atcgtcggtg gttcattgtc cagtgtcgga cagatccctt
accaggctgg tctcgtcatt 180gacttagcag gtggccaggc tgtctgcgga
ggctccctga tcagcgcttc ccgcgtactg 240accgctgctc actgctggtt
cgacggccaa aaccaggcct ggagattcac cgttgttctt 300ggttccacca
ccttgttctc tggcggtacc agaatcccta catccaatgt tgttatgcac
360ggaagctgga ctcctagcct tatccgtaac gatgttgccg taatcagatt
gggcaccaac 420gtagcaacct caaacaccat tgccatcatc gctctaccca
gcggcagcca gatcaacgag 480aacttcgccg gtgaaaccgc cctcgcctcc
ggcttcggtc tcaccagtga caccggcagc 540atctccagca accaggctct
gagccacgtc aacctgccag tgatcaccaa cgctgtgtgc 600agaaattcat
tccccctgct gatccaggac tctaacattt gcaccagcgg tgccaacggc
660aggagcactt gccgcggtga ctccggcggt cctctcgtcg tcaccaggaa
caacagacca 720ctcttgatcg gtatcacctc tttcggatct gcccgcggtt
gccaagttgg atctcccgct 780gccttcgcca gagtcacctc ttacatcagc
tggatcaacg gccagctcta aaatatcgaa 840cattttgcca tatctacaga
gatattttga aatacgttaa tttaaataaa tattttattt 900attcaaaaaa
aaaaaaaaaa a 921732DNAartificial sequenceSynthetic construct BamHI
oligonucleotide primer 7gaccagccgg atccgatcgg atatgcacca ac
32834DNAartificial sequenceSynthetic construct HindIII
oligonucleotide primer 8ggagccaagc caagctttga acgcgggcaa actc
34936PRTartificial sequenceSynthetic construct N-terminal sequence
of resistant chymotrypsin 9Ile Val Gly Gly Ser Leu Ser Ser Val Gly
Gln Ile Pro Tyr Gln Ala1 5 10 15Gly Leu Val Ile Asp Leu Ala Gly Gly
Gln Ala Val Cys Gly Gly Ser20 25 30Leu Ile Ser
Ala351029DNAartificial sequenceSynthetic construct Fw2ResChy primer
10tcagctgtag ctggagctca agatactcc 291135DNAartificial
sequenceSynthetic construct FwResChym primer 11gtagctatac
tgactctagc tgcagctgga gctgg 351221DNAartificial sequenceSynthetic
construct Hc35PQE-6-Fw primer 12ttaaccatgg tgatcgacct c
211323DNAartificial sequenceSynthetic construct Hc35PQ-60-Rv primer
13gatgagatct gagacgttgg ttg 231425DNAartificial sequenceSynthetic
construct gene specific sense primer 14cgggatccat ggagtcaaag tttgc
251525DNAartificial sequenceSynthetic construct gene specific
antisense primer 15gcgtcgacgc ttaagccacc ctagg 251624DNAartificial
sequenceSynthetic construct StPOTIA sense primer 16cgggatccaa
ggaatcggaa tctg 241723DNAartificial sequenceSynthetic construct
StPOTIB sense primer 17cgggatccaa ggaatttgaa tgc
231822DNAartificial sequenceSynthetic construct StPOTIA/B antisense
primer 18cgagctctta agccacccta gg 221940DNAartificial
sequenceSynthetic construct FWBacRECHI (5'-3') primer 19ttggctttcg
ccgcggtcgt ctccgcgagg aacgggtccc 402040DNAartificial
sequenceSynthetic construct FWBacRECH2 (5'-3') primer 20ggatccatga
aactcttggc tgtgactcta ttggctttcg 402125DNAartificial
sequenceSynthetic construct RvRECH (3'-5') primer 21gatcaacggc
cagctctaaa agctt 252253PRTNicotiana alata 22Met Ala Val His Arg Val
Ser Phe Leu Ala Leu Leu Leu Leu Phe Gly1 5 10 15Met Ser Leu Leu Val
Ser Asn Val Glu His Ala Asp Ala Lys Ala Cys20 25 30Thr Leu Asn Cys
Asp Pro Arg Ile Ala Tyr Gly Val Cys Pro Arg Ser35 40 45Glu Glu Lys
Lys Asn502358PRTNicotiana alata 23Asp Arg Ile Cys Thr Asn Cys Cys
Ala Gly Thr Lys Gly Cys Lys Tyr1 5 10 15Phe Ser Asp Asp Gly Thr Phe
Val Cys Glu Gly Glu Ser Asp Pro Arg20 25 30Asn Pro Lys Ala Cys Thr
Leu Asn Cys Asp Pro Arg Ile Ala Tyr Gly35 40 45Val Cys Pro Arg Ser
Glu Glu Lys Lys Asn50 552458PRTNicotiana alata 24Asp Arg Ile Cys
Thr Asn Cys Cys Ala Gly Thr Lys Gly Cys Lys Tyr1 5 10 15Phe Ser Asp
Asp Gly Thr Phe Val Cys Glu Gly Glu Ser Asp Pro Arg20 25 30Asn Pro
Lys Ala Cys Pro Arg Asn Cys Asp Pro Arg Ile Ala Tyr Gly35 40 45Ile
Cys Pro Leu Ala Glu Glu Lys Lys Asn50 552558PRTNicotiana alata
25Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly Lys Lys Gly Cys Lys Tyr1
5 10 15Phe Ser Asp Asp Gly Thr Phe Val Cys Glu Gly Glu Ser Asp Pro
Lys20 25 30Asn Pro Lys Ala Cys Pro Arg Asn Cys Asp Gly Arg Ile Ala
Tyr Gly35 40 45Ile Cys Pro Leu Ser Glu Glu Lys Lys Asn50
552658PRTNicotiana alata 26Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly
Lys Lys Gly Cys Lys Tyr1 5 10 15Phe Ser Asp Asp Gly Thr Phe Val Cys
Glu Gly Glu Ser Asp Pro Arg20 25 30Asn Pro Lys Ala Cys Pro Arg Asn
Cys Asp Gly Arg Ile Ala Tyr Gly35 40 45Ile Cys Pro Leu Ser Glu Glu
Lys Lys Asn50 552754PRTNicotiana alata 27Asp Arg Ile Cys Thr Asn
Cys Cys Ala Gly Lys Lys Gly Cys Lys Tyr1 5 10 15Phe Ser Asp Asp Gly
Thr Phe Ile Cys Glu Gly Glu Ser Glu Tyr Ala20 25 30Ser Lys Val Asp
Glu Tyr Val Gly Glu Val Glu Asn Asp Leu Gln Lys35 40 45Ser Lys Val
Ala Val Ser502836PRTHelicoverpa sp 28Ile Val Gly Gly Ser Leu Ser
Ser Val Gly Gln Ile Pro Tyr Gln Ala1 5 10 15Gly Leu Val Ile Asp Leu
Ala Gly Gly Gln Ala Val Cys Gly Gly Ser20 25 30Leu Ile Ser
Ala352929PRTHelicoverpa sp 29Ile Val Gly Gly Ser Ile Ser Ser Ile
Gly Gln Ile Pro Tyr Gly Ala1 5 10 15Gly Leu Val Ile Asp Phe Ala Gly
Gly Gln Ala Val Cys20 253029PRTHelicoverpa sp 30Ile Val Gly Gly Ser
Thr Ser Ser Val Gly Gln Phe Pro Tyr Gln Ala1 5 10 15Gly Leu Leu Ala
Ser Phe Ala Gly Gly Gln Ala Val Cys20 253129PRTHelicoverpa sp 31Ile
Val Gly Gly Ser Val Thr Thr Leu Asp Ala Tyr Pro Thr Ile Ala1 5 10
15Gly Leu Val Tyr Asn Phe Ala Gly Gly Gln Ala Val Cys20
2532295PRTHelicoverpa armigera 32Met Lys Leu Leu Ala Val Thr Leu
Leu Ala Phe Ala Ala Val Val Ser1 5 10 15Ala Arg Asn Ile Asp Leu Glu
Asp Val Ile Asp Leu Glu Asp Ile Thr20 25 30Ala Tyr Asp Tyr His Thr
Lys Ile Gly Ile Pro Leu Ala Glu Lys Ile35 40 45Arg Ala Ala Glu Glu
Glu Ala Glu Arg Asn Pro Ser Arg Ile Val Gly50 55 60Gly Ser Thr Ser
Ser Leu Gly Ala Phe Pro Tyr Gln Ala Gly Leu Leu65 70 75 80Ala Thr
Phe Ala Ser Gly Gln Gly Val Cys Gly Gly Ser Leu Leu Asn85 90 95Asn
Arg Arg Val Leu Thr Ala Ala His Cys Trp Phe Asp Gly Arg Asn100 105
110Gln Ala Arg Ser Phe Thr Val Val Leu Gly Ser Val Arg Leu Phe
Ser115 120 125Gly Gly Thr Arg Leu Asn Thr Ala Ser Val Val Met His
Gly Ser Trp130 135 140Asn Pro Asn Leu Ile Arg Asn Asp Ile Ala Met
Ile Asn Leu Pro Ser145 150 155 160Asn Val Ala Thr Ser Gly Asn Ile
Ala Pro Ile Ala Leu Pro Ser Gly165 170 175Asn Glu Leu Asn Asn Asn
Phe Asn Gly Ala Thr Ala Val Ala Ser Gly180 185 190Phe Gly Leu Ala
Arg Asp Gly Gly Ser Val Asp Gly Asn Leu Arg His195 200 205Val Asn
Leu Pro Val Ile Thr Asn Ala Val Cys Thr Val Ser Phe Pro210 215
220Gly Ile Ile Gln Ser Ser Asn Ile Cys Thr Ser Gly Ala Asn Gly
Arg225 230 235 240Ser Thr Cys Gln Gly Asp Ser Gly Gly Pro Leu Val
Val Thr Ser Asn245 250 255Asn Arg Arg Ile Leu Ile Gly Val Thr Ser
Phe Gly Ser Ala Arg Gly260 265 270Cys Gln Val Gly Ser Pro Ala Ala
Phe Ala Arg Val Thr Ser Phe Ile275 280 285Ser Trp Ile Asn Gln Arg
Leu290 29533292PRTHelicoverpa armigera 33Leu Ala Val Thr Leu Leu
Ala Phe Ala Ala Val Val Ser Ala Arg Asn1 5 10 15Ile Asp Leu Glu Asp
Val Ile Asp Leu Glu Asp Ile Thr Ala Tyr Asp20 25 30Tyr His Thr Lys
Ile Gly Ile Pro Leu Ala Glu Lys Ile Arg Ala Ala35 40 45Glu Glu Glu
Ala Glu Arg Asn Pro Ser Arg Ile Val Gly Gly Ser Thr50 55 60Ser Ser
Leu Gly Ala Phe Pro Tyr Gln Ala Gly Leu Leu Ala Thr Phe65 70 75
80Ala Ser Gly Gln Gly Val Cys Gly Gly Ser Leu Leu Asn Asn Arg Arg85
90 95Val Leu Thr Ala Ala His Cys Trp Phe Asp Gly Arg Asn Gln Ala
Arg100 105 110Ser Phe Thr Val Val Leu Gly Ser Val Arg Leu Phe Ser
Gly Gly Thr115 120 125Arg Leu Asn Thr Ala Ser Val Val Met His Gly
Ser Trp Asn Pro Asn130 135 140Leu Ile Arg Asn Asp Ile Ala Met Ile
Asn Leu Pro Ser Asn Val Ala145 150 155 160Thr Ser Gly Asn Ile Ala
Pro Ile Ala Leu Pro Ser Gly Asn Glu Leu165 170 175Asn Asn Asn Phe
Asn Gly Ala Thr Ala Val Ala Ser Gly Phe Gly Leu180 185 190Ala Arg
Asp Gly Gly Ser Val Asp Gly Asn Leu Arg His Val Asn Leu195 200
205Pro Val Ile Thr Asn Ala Val Cys Thr Val Ser Phe Pro Gly Ile
Ile210 215 220Gln Ser Ser Asn Ile Cys Thr Ser Gly Ala Asn Gly Arg
Gly Thr Cys225 230 235 240Gln Gly Asp Ser Gly Gly Pro Leu Val Val
Thr Ser Asn Asn Arg Arg245 250 255Ile Leu Ile Gly Val Thr Pro Phe
Gly Ser Ala Arg Gly Cys Gln Val260 265 270Gly Ser Pro Ala Ala Phe
Ala Arg Val Thr Ser Phe Ile Ser Trp Ile275 280 285Asn Gln Arg
Leu29034295PRTHelicoverpa armigera 34Met Lys Leu Leu Ala Val Thr
Leu Leu Ala Phe Ala Ala Ile Val Ser1 5 10 15Ala Arg Asn Ile Asp Leu
Glu Asp Val Ile Asp Leu Glu Asp Ile Thr20 25 30Ala Tyr Asp Tyr His
Thr Lys Ile Gly Ile Pro Leu Ala Glu Lys Ile35 40 45Arg Ala Ala Glu
Glu Glu Ala Glu Arg Asn Pro Ser Arg Ile Val Gly50 55 60Gly Ser Ile
Ser Ser Leu Gly Ala Phe Pro Tyr Gln Ala Gly Leu Leu65 70 75 80Ala
Thr Phe Ala Ser Gly Gln Gly Val Cys Gly Gly Ser Leu Leu Asn85 90
95Asn Arg Arg Val Leu Thr Ala Ala His Cys Trp Phe Asp Gly Arg
Asn100 105 110Gln Ala Arg Ser Phe Thr Val Val Leu Gly Ser Val Arg
Leu Phe Ser115 120 125Gly Gly Thr Arg Leu Asn Thr Ala Ser Val Val
Met His Gly Ser Trp130 135 140Asn Pro Asn Leu Ile Arg Asn Asp Ile
Ala Ile Ile Asn Leu Pro Ser145 150 155 160Asn Val Ala Thr Ser Gly
Asn Ile Ala Pro Ile Ala Leu Pro Ser Gly165 170 175Asn Glu Leu Asn
Asn Asn Phe Asn Gly Ala Thr Ala Val Ala Ser Gly180 185 190Phe Gly
Leu Ala Asn Asp Gly Gly Ser Val Asp Gly Asn Leu Arg His195 200
205Val Asn Leu Pro Val Ile Thr Asn Ala Val Cys Thr Val Ser Phe
Pro210 215 220Gly Ile Ile Gln Ser Ser Asn Ile Cys Thr Ser Gly Ala
Asn Gly Arg225 230 235 240Ser Thr Cys Gln Gly Asp Ser Gly Gly Pro
Leu Val Val Thr Ser Asn245 250 255Asn Arg Arg Ile Leu Ile Gly Val
Thr Ser Phe Gly Ser Ala Arg Gly260 265 270Cys Gln Val Gly Ser Pro
Ala Ala Phe Ala Arg Val Thr Ser Phe Ile275 280 285Ser Trp Ile Asn
Asn Leu Leu290 29535276PRTHelicoverpa armigera 35Ile Asn His Glu
Ala Val Val Asp Leu Glu Asp Ile Thr Ala Tyr Gly1 5 10 15Tyr His Thr
Lys Val Gly Ile Pro Leu Ala Glu Glu Ile Arg Ile Ala20 25 30Glu Leu
Glu Ala Ser Arg Asn Pro Ser Arg Ile Val Gly Gly Ser Ser35 40 45Ala
Ser Leu Gly Gln Phe Pro Tyr Gln Ala Gly Leu Leu Ile Asn Leu50 55
60Pro Leu Gly Gln Ser Val Cys Gly Gly Ser Leu Leu Asn Gln Arg Arg65
70 75 80Val Leu Thr Ala Ala His Cys Trp Phe Asp Gly Arg Asn Gln Ala
Asn85 90 95Ser Leu Thr Val Ile Leu Gly Ser Ile Asn Leu Tyr Phe Gly
Gly Thr100 105 110Arg Leu Asn Ser Asn Ser Val Val Met His Gly Ser
Trp Asn Pro Asn115 120 125Leu Ile Arg Asn Asp Ile Ala Ile Ile Asn
Leu Pro Ser Asn Val Gly130 135 140Thr Ser Asn Asn Ile Ala Pro Ile
Ala Leu Pro Ser Gly Asn Glu Leu145 150 155 160Asn Asn Gln Phe Ala
Gly Phe Thr Ala Thr Ala Ser Gly Phe Gly Arg165 170 175Thr Arg Asp
Gly Gly Ser Val Ser Pro Thr Leu Asn His Val Asn Leu180 185 190Pro
Val Ile Thr Asn Asn Val Cys Trp Gln Ser Phe Pro Leu Tyr Ile195 200
205Gln Ser Ser Asn Ile Cys Thr Ser Gly Ala Asn Gly Arg Ser Thr
Cys210 215 220Gln Gly Asp Ser Gly Gly Pro Leu Val Val Thr Ser Asn
Asn Arg Arg225 230 235 240Ile Leu Ile Gly Val Thr Ser Phe Gly Ser
Asp Arg Gly Cys Gln Val245 250 255Gly Ala Pro Ala Ala Phe Ala Arg
Val Thr Ser Tyr Ile Ser Trp Ile260 265 270Asn Gln Arg
Leu27536292PRTHelicoverpa armigera 36Met Lys Leu Phe Leu Gly Val
Cys Leu Thr Leu Ala Val Ala Val Ser1 5 10 15Ala Val Glu Ile Ala Thr
Pro Asp Ala Asp Ser Pro Val Phe Gly Tyr20 25
30His Ala Lys Phe Gly Ile Ala Glu Ala Ala Arg Ile Lys Ser Ala Glu35
40 45Glu Val Gln Ser Phe Asn Gly Gln Arg Ile Val Gly Gly Ser Ile
Thr50 55 60Asn Ile Ala Asn Val Pro Tyr Gln Ala Gly Leu Val Ile Thr
Ile Phe65 70 75 80Ile Phe Gln Ser Val Cys Gly Ala Ser Leu Ile Ser
His Asn Arg Leu85 90 95Val Thr Ala Ala His Cys Lys Ser Asp Gly Val
Leu Thr Ala Asn Ser100 105 110Phe Thr Val Val Leu Gly Ser Asn Thr
Leu Phe Phe Gly Gly Thr Arg115 120 125Ile Asn Thr Asn Asp Val Val
Met His Pro Asn Trp Asn Pro Asn Thr130 135 140Ala Ala Asn Asp Ile
Ala Val Leu Arg Ile Ser Ser Val Ser Phe Ser145 150 155 160Asn Val
Ile Gln Pro Ile Ala Leu Pro Ser Gly Asp Glu Leu Asn Asn165 170
175Leu Phe Val Gly Ala Asn Ala Leu Ala Ser Gly Phe Gly Arg Thr
Ser180 185 190Asp Ser Gly Ser Ile Gly Thr Asn Gln Gln Leu Ser Ser
Val Thr Ile195 200 205Pro Val Ile Thr Asn Ala Gln Cys Ala Ala Val
Tyr Gly Ser Gly Phe210 215 220Val His Ala Ser Asn Ile Cys Thr Ser
Gly Ala Gly Gly Lys Gly Thr225 230 235 240Cys Asn Gly Asp Ser Gly
Gly Pro Leu Ala Val Asp Ser Asn Asn Arg245 250 255Lys Ile Leu Ile
Gly Val Thr Ser Tyr Gly Ala Gln Ala Gly Cys Ala260 265 270Ala Gly
Phe Pro Ala Ala Phe Ala Arg Val Thr Ser Phe Val Asp Trp275 280
285Val Gln Ser Gln29037257PRTHelicoverpa armigera 37His Asn Lys Trp
Val Leu Thr Ala Ala His Cys Leu Ala Asn Arg Ile1 5 10 15Thr Phe Val
Val Arg Phe Gly Leu Thr Asn Leu Thr Arg Pro Glu Ile20 25 30Leu Val
Glu Ser Ala Asn Lys Tyr Ile His Pro Asp Tyr Asp Glu Ile35 40 45Arg
Ala Gly Val Gln Thr Ala Asp Leu Ala Leu Val Gly Leu Asp His50 55
60His Ile Glu Tyr Ser Ala Asn Val Gln Pro Ser Arg Leu Met Ser Ser65
70 75 80Ala Gln Lys Asn Ile Asn Tyr Glu Gly Ile Gln Met Ile Val Ser
Gly85 90 95Phe Gly Arg Thr Asp Asp Leu Trp Asn Gly Gly Ala Ala Ser
Glu Ile100 105 110Leu Leu Trp Val Tyr Gln Arg Gly Val Ser Asn Glu
Glu Cys Leu Arg115 120 125Trp Tyr Pro Thr Ser Gln Val Ile Lys Glu
Glu Thr Ile Cys Ala Gly130 135 140Tyr Trp Asp Asn Pro Ser Gln Ser
Ser Cys Gln Gly Asp Ser Gly Gly145 150 155 160Pro Leu Thr Ile Ile
Asp Ala Asp Gly Glu Arg Thr Gln Val Gly Ile165 170 175Val Ser Phe
Gly Ser Thr Ala Gly Cys Asn Ser Pro Phe Pro Ser Gly180 185 190Tyr
Val Arg Pro Gly His Tyr His Asp Trp Phe Thr Glu Val Thr Gly195 200
205Ile Asn Phe Asp Trp Asp Ser Asp Ala Ile Ile Pro Gly Ser Ser
Glu210 215 220Ser Glu Glu Asp Gly Ser Asn Pro Ser Ser Glu Glu Asp
Ala Gly Ser225 230 235 240Pro Pro Ser Glu Glu Glu Glu Ala Pro Glu
Lys Val Arg Val Val Glu245 250 255Tyr3819DNAartificial
sequenceSynthetic construct FWG1 primer 38tcccttacca ggcgctgtc
193918DNAartificial sequenceSynthetic construct RVG4 primer
39tctggcgaag gcagcagg 184020DNAartificial sequenceSynthetic
construct Y79Fw primer 40ctgctagcct cggacaattc 204120DNAartificial
sequenceSynthetic construct Y72Fw primer 41ctggagtgca gactgctgac
204220DNAartificial sequenceSynthetic construct Y72Rv primer
42ggatgatggc gtcgctgtcc 2043213PRTHelicoverpa punctigera 43Pro Tyr
Gln Ala Gly Leu Val Ile Thr Ile Phe Ile Phe Gln Ser Val1 5 10 15Cys
Gly Ala Ser Leu Ile Pro His Asn Arg Leu Val Thr Ala Ala His20 25
30Cys Lys Ser Asp Gly Val Leu Thr Ala Asn Ser Phe Thr Val Val Leu35
40 45Gly Ser Asn Thr Leu Phe Phe Gly Gly Thr Arg Ile Asn Thr Asn
Asp50 55 60Val Val Met His Pro Asn Trp Asn Pro Ser Thr Ala Ala Asn
Asp Ile65 70 75 80Ala Val Met Arg Ile Ser Ser Val Ser Phe Ser Asn
Val Ile Gln Pro85 90 95Ile Ala Leu Pro Ser Gly Asp Glu Leu Asn Asn
Leu Phe Val Gly Ala100 105 110Asn Ala Leu Ala Ser Gly Phe Gly Arg
Thr Ser Asp Gly Gly Ser Ile115 120 125Gly Ser Asn Gln Gln Val Ser
Ser Val Thr Ile Pro Val Ile Thr Asn130 135 140Asp Glu Cys Ala Ala
Val Tyr Gly Ser Ala Phe Val His Ser Ser Asn145 150 155 160Ile Cys
Thr Ser Gly Ala Gly Gly Lys Gly Thr Cys Asn Gly Asp Ser165 170
175Gly Gly Pro Leu Ala Ile Asp Ser Asn Asn Glu Lys Ile Leu Ile
Gly180 185 190Val Thr Ser Tyr Gly Ala Gln Ala Gly Cys Ala Ala Gly
Leu Pro Ala195 200 205Ala Phe Ala Arg Lys21044213PRTHelicoverpa
punctigera 44Pro Tyr Gln Ala Gly Leu Val Ile Thr Ile Phe Ile Phe
Gln Ser Val1 5 10 15Cys Gly Ala Ser Leu Ile Ser His Asn Arg Leu Val
Thr Ala Ala His20 25 30Cys Lys Phe Asp Gly Val Met Thr Ala Asn Ser
Phe Thr Val Val Leu35 40 45Gly Ser Asn Thr Leu Phe Phe Gly Gly Thr
Arg Ile Asn Thr Asn Asp50 55 60Val Val Met His Pro Asn Trp Asn Pro
Ser Thr Val Ala Asn Asp Ile65 70 75 80Ala Val Ile Arg Ile Ser Ser
Ile Val Phe Asn Asn Val Ile Gln Pro85 90 95Ile Ala Leu Pro Ser Gly
Asp Glu Leu Asn Asn Leu Phe Val Gly Ala100 105 110Asn Ala Leu Ala
Ser Gly Phe Gly Arg Thr Ser Asp Ser Gly Gly Ile115 120 125Gly Thr
Asn Gln Gln Leu Ser Ser Val Thr Ile Pro Val Ile Thr Asn130 135
140Ala Glu Cys Ala Ala Val Tyr Gly Pro Ala Phe Val His Asp Thr
Asn145 150 155 160Ile Cys Thr Ser Gly Ala Gly Gly Lys Gly Thr Cys
Asn Gly Asp Ser165 170 175Gly Gly Pro Leu Ala Val Asp Ser Asn Asp
Lys Lys Ile Leu Ile Gly180 185 190Val Thr Ser Tyr Gly Ala Ala Asp
Gly Cys Ala Ala Gly Phe Pro Ala195 200 205Ala Ser Pro Glu
Arg21045177PRTHelicoverpa punctigera 45Pro Tyr Gln Ala Gly Leu Leu
Ala Asn Phe Ala Ser Gly Gln Gly Val1 5 10 15Cys Gly Gly Ser Leu Leu
Asn Gln Arg Arg Val Leu Thr Ala Ala His20 25 30Cys Trp Phe Asp Gly
Arg Asn Gln Ala Arg Ser Phe Thr Val Val Leu35 40 45Gly Ser Val Arg
Leu Phe Ser Gly Gly Thr Arg Leu Asp Thr Ala Ser50 55 60Val Val Met
His Gly Ser Trp Asn Pro Asn Leu Ile Arg Asn Asp Ile65 70 75 80Ala
Met Ile Asn Leu Pro Ser Asn Val Ala Thr Ser Gly Asn Ile Ala85 90
95Pro Ile Ala Leu Pro Ser Gly Asn Glu Leu Asn Asn Asn Phe Asn
Gly100 105 110Ala Thr Ala Thr Ala Ser Gly Phe Gly Leu Ala Arg Asp
Gly Gly Ser115 120 125Val Asp Gly Asn Leu Arg His Val Asn Leu Pro
Val Ile Thr Asn Ala130 135 140Val Cys Thr Val Ser Phe Pro Gly Ile
Ile Gln Ser Ser Asn Ile Cys145 150 155 160Thr Ser Gly Ala Asn Gly
Arg Ser Thr Cys Gln Gly Asp Ser Gly Gly165 170
175Pro46217PRTHelicoverpa punctigera 46Ser Ala Ser Leu Gly Gln Phe
Pro Tyr Gln Ala Gly Leu Leu Ile Asn1 5 10 15Leu Pro Leu Gly Gln Ser
Val Cys Gly Gly Ser Leu Leu Asn Gln Arg20 25 30Arg Val Leu Thr Ala
Ala His Cys Trp Phe Asp Gly Arg Asn Gln Ala35 40 45Thr Ser Leu Thr
Val Ile Leu Gly Ser Ile Asn Leu Phe Phe Gly Gly50 55 60Thr Arg Leu
Asn Ser Asn Ser Val Val Met His Gly Ser Trp Asn Pro65 70 75 80Asn
Leu Ile Arg Asn Asp Ile Ala Ile Ile Asn Leu Pro Ser Asn Val85 90
95Gly Thr Ser Gly Asn Ile Ala Pro Ile Ala Leu Pro Ser Gly Asn
Glu100 105 110Leu Asn Asn Gln Phe Ala Gly Phe Thr Ala Thr Ala Ser
Gly Phe Gly115 120 125Leu Thr Arg Asp Gly Gly Asn Val Ser Pro Thr
Leu Asn His Val Asn130 135 140Leu Pro Val Ile Thr Asn Asn Val Cys
Trp Gln Ser Phe Pro Leu Tyr145 150 155 160Ile Gln Ser Thr Asn Ile
Cys Thr Ser Gly Ala Asn Gly Arg Gly Thr165 170 175Cys Gln Gly Asp
Ser Gly Gly Pro Leu Val Val Thr Ser Asn Asn Arg180 185 190Arg Ile
Leu Ile Gly Val Thr Ser Phe Gly Ser Asp Arg Gly Cys Gln195 200
205Val Gly Ala Pro Ala Ala Phe Ala Arg210 21547170PRTHelicoverpa
punctigera 47Ser Gly Val Gln Thr Ala Asp Leu Ala Leu Val Gly Leu
Asp Gln Glu1 5 10 15Ile Glu Tyr Ser Ala Asn Val Gln Pro Ser Arg Leu
Met Ser Ser Ala20 25 30Gln Lys Asn Ile Asn Tyr Glu Gly Ile Gln Met
Ile Val Ser Gly Phe35 40 45Gly Arg Thr Asp Asp Leu Trp Asn Gly Gly
Ala Ala Ser Glu Ile Leu50 55 60Leu Trp Val Tyr Gln Arg Gly Val Ser
Asn Glu Glu Cys Leu Arg Trp65 70 75 80Tyr Pro Thr Ser Gln Val Ile
Lys Glu Gln Thr Ile Cys Ala Gly Tyr85 90 95Trp Asp Asn Pro Ser Gln
Ser Ser Cys Gln Gly Asp Ser Gly Gly Pro100 105 110Leu Thr Ile Ile
Asp Ala Asp Gly Glu Arg Thr Gln Val Gly Ile Val115 120 125Ser Phe
Gly Ser Thr Ala Gly Cys Asn Ser Pro Phe Pro Ser Gly Tyr130 135
140Val Arg Pro Gly His Tyr His Asp Trp Phe Thr Glu Val Thr Gly
Ile145 150 155 160Asn Phe Asp Trp Asp Ser Asp Ala Ile Ile165
17048279PRTHelicoverpa punctigera 48Ala Val Ser Ala Val Glu Ile Gly
Thr Pro Asp Ala Asp Ser Pro Val1 5 10 15Phe Gly Tyr His Ala Lys Phe
Gly Ile Pro Glu Ala Ala Arg Ile Lys20 25 30Ser Ala Glu Glu Val Gln
Ser Phe Asn Gly Gln Arg Ile Val Gly Gly35 40 45Ser Ile Thr Asp Ile
Ala Asn Val Pro Tyr Gln Ala Gly Leu Val Ile50 55 60Thr Ile Phe Ile
Phe Gln Ser Val Cys Gly Ala Ser Leu Ile Ser His65 70 75 80Asn Arg
Leu Val Thr Ala Ala His Cys Lys Ser Asp Gly Val Leu Thr85 90 95Ala
Asn Ser Phe Thr Val Val Leu Gly Ser Asn Thr Leu Phe Phe Gly100 105
110Gly Thr Arg Ile Asn Thr Asn Asp Val Val Met His Pro Asn Trp
Asn115 120 125Pro Ser Thr Ala Ala Asn Asp Ile Ala Val Met Arg Ile
Ser Ser Val130 135 140Ser Phe Ser Asn Val Ile Gln Pro Ile Ala Leu
Pro Ser Gly Asp Glu145 150 155 160Leu Asn Asn Leu Phe Val Gly Ala
Asn Ala Leu Ala Ser Gly Phe Gly165 170 175Arg Thr Ser Asp Gly Gly
Ser Ile Gly Ser Asn Gln Gln Val Ser Ser180 185 190Val Thr Ile Pro
Val Ile Thr Asn Asp Glu Cys Ala Ala Val Tyr Gly195 200 205Ser Ala
Phe Val His Ser Ser Asn Ile Cys Thr Ser Gly Ala Gly Gly210 215
220Lys Gly Thr Cys Asn Gly Asp Ser Gly Gly Pro Leu Ala Val Asp
Ser225 230 235 240Asn Asn Glu Lys Ile Leu Ile Gly Val Thr Ser Tyr
Gly Ala Gln Ala245 250 255Gly Cys Ala Val Gly Leu Pro Ala Ala Phe
Ala Arg Val Thr Ser Phe260 265 270Val Ser Trp Val Gln Ser
Gln27549292PRTHelicoverpa punctigera 49Met Lys Leu Phe Leu Gly Val
Cys Leu Ala Leu Ala Val Ala Val Ser1 5 10 15Ala Val Glu Ile Gly Thr
Pro Glu Ala Gly Ser Pro Val Phe Gly Tyr20 25 30His Ala Lys Phe Gly
Ile Ala Glu Ala Ala Arg Ile Lys Ser Ala Glu35 40 45Glu Val Gln Ser
Phe Asn Gly Gln Arg Ile Val Gly Gly Ser Ile Thr50 55 60Asn Ile Ala
Asn Val Pro Tyr Gln Ala Gly Leu Val Ile Thr Ile Phe65 70 75 80Ile
Phe Gln Ser Val Cys Gly Ala Ser Leu Ile Ser His Asn Arg Leu85 90
95Val Thr Ala Ala His Cys Lys Phe Asp Gly Val Met Thr Ala Asn
Ser100 105 110Phe Thr Val Val Leu Gly Ser Asn Thr Leu Phe Phe Gly
Gly Thr Arg115 120 125Ile Asn Thr Asn Asp Val Val Met His Pro Asn
Trp Asn Pro Ser Thr130 135 140Val Ala Asn Asp Ile Ala Val Ile Arg
Ile Ser Ser Ile Val Tyr Asn145 150 155 160Asn Val Ile Gln Pro Ile
Ala Leu Pro Ser Gly Asp Glu Leu Asp Asn165 170 175Leu Phe Val Gly
Ala Asn Ala Leu Ala Ser Gly Phe Gly Arg Thr Ser180 185 190Asp Ser
Gly Gly Ile Gly Thr Asn Gln Gln Leu Ser Ser Val Thr Ile195 200
205Pro Val Ile Thr Asn Ala Glu Cys Ala Ala Val Tyr Gly Pro Ala
Phe210 215 220Val His Asp Thr Asn Ile Cys Thr Ser Gly Ala Gly Gly
Lys Gly Thr225 230 235 240Cys Asn Gly Asp Ser Gly Gly Pro Leu Ala
Val Asp Ser Asn Asp Lys245 250 255Lys Ile Leu Ile Gly Val Thr Ser
Tyr Gly Ala Ala Asp Gly Cys Ala260 265 270Ala Gly Phe Pro Ala Ala
Phe Ala Arg Val Thr Ser Phe Val Ser Trp275 280 285Val Gln Ser
Gln29050295PRTHelicoverpa punctigera 50Met Lys Leu Leu Ala Val Thr
Leu Leu Ala Phe Ala Ala Val Val Ser1 5 10 15Ala Arg Asn Ile Asp Leu
Glu Asp Val Ile Asp Leu Glu Asp Ile Thr20 25 30Ala Tyr Asp Tyr His
Thr Lys Ile Gly Ile Pro Leu Ala Glu Glu Ile35 40 45Arg Ala Ala Glu
Glu Glu Ala Glu Arg Asp Pro Ser Arg Ile Val Gly50 55 60Gly Ser Thr
Ser Ser Leu Gly Ala Phe Pro Tyr Gln Ala Gly Leu Leu65 70 75 80Ala
Asn Phe Ala Ser Gly Gln Gly Val Cys Gly Gly Ser Leu Leu Asn85 90
95Gln Arg Arg Val Leu Thr Ala Ala His Cys Trp Phe Asp Gly Arg
Asn100 105 110Gln Ala Arg Ser Phe Thr Val Val Leu Gly Ser Val Arg
Leu Phe Ser115 120 125Gly Gly Thr Arg Leu Asp Thr Ala Ser Val Val
Met His Gly Ser Trp130 135 140Asn Pro Asn Leu Ile Arg Asn Asp Ile
Ala Met Ile Asn Leu Pro Ser145 150 155 160Asn Val Ala Thr Ser Gly
Asn Ile Ala Pro Ile Ala Leu Pro Ser Gly165 170 175Asn Glu Leu Asn
Asn Asn Phe Asn Gly Ala Thr Ala Thr Ala Ser Gly180 185 190Phe Gly
Leu Ala Arg Asp Gly Gly Ser Val Asp Gly Asn Leu Arg His195 200
205Val Asn Leu Pro Val Ile Thr Asn Ala Val Cys Thr Val Ser Phe
Pro210 215 220Gly Ile Ile Gln Ser Ser Asn Ile Cys Thr Ser Gly Ala
Asn Gly Arg225 230 235 240Ser Thr Cys Gln Gly Asp Ser Gly Gly Pro
Leu Val Val Asn Ser Asn245 250 255Asn Arg Arg Ile Leu Ile Gly Val
Thr Ser Phe Gly Ser Ala Arg Gly260 265 270Cys Gln Val Gly Ser Pro
Ala Ala Phe Ala Arg Val Thr Ser Phe Ile275 280 285Ser Trp Ile Asn
Gln Arg Leu290 29551295PRTHelicoverpa punctigera 51Met Lys Leu Leu
Ala Val Thr Leu Leu Ala Phe Ala Ala Val Val Ser1 5 10 15Ala Arg Asn
Ile Asp Leu Glu Asp Val Ile Asp Leu Glu Asp Ile Thr20 25 30Ala Tyr
Asp Tyr His Thr Lys Ile Gly Ile Pro Leu Ala Glu Lys Ile35 40 45Arg
Ala Ala Glu Glu Glu Ala Glu Arg Asn Pro Ser Arg Ile Val Gly50 55
60Gly Ser Thr Ser Ser Leu Gly Ala Phe Pro Tyr Gln Ala Gly Leu Leu65
70 75 80Ala Ser Phe Ala Ser Gly Gln Gly Val Cys Gly Gly Ser Leu Leu
Asn85 90 95Val Arg Arg Val Leu Thr Ala Ala His Cys Trp Phe Asp Gly
Arg Asn100 105 110Gln Ala Arg Ser Phe Thr Val Val Leu Gly Ser Val
Arg Leu Tyr Ser115 120 125Gly Gly Thr Arg Leu Asn Thr Ala Ser Val
Val Met His Gly Ser Trp130
135 140Asn Pro Asn Leu Val Arg Asn Asp Ile Ala Met Ile Asn Leu Pro
Ser145 150 155 160Asn Val Ala Thr Ser Gly Asn Ile Ala Pro Ile Ala
Leu Pro Ser Gly165 170 175Asn Glu Leu Asn Asn Gln Phe Ala Gly Ala
Thr Ala Thr Ala Ser Gly180 185 190Phe Gly Leu Ala Arg Asp Gly Gly
Val Ile Asp Gly Asn Leu Arg His195 200 205Val Asn Leu Pro Val Ile
Thr Asn Ala Val Cys Ser Gln Ser Phe Pro210 215 220Gly Leu Ile Gln
Ala Ser Asn Val Cys Thr Ser Gly Ala Asn Gly Arg225 230 235 240Ser
Thr Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Val Asn Ser Asn245 250
255Asn Arg Arg Ile Leu Ile Gly Val Thr Ser Phe Gly Ser Ala Arg
Gly260 265 270Cys Gln Val Gly Ser Pro Ala Ala Phe Ala Arg Val Ser
Ser Tyr Ile275 280 285Ser Trp Ile Asn Gln Arg Leu290
29552234PRTHelicoverpa punctigera 52Ile Val Gly Gly Ser Ser Ala Ser
Leu Gly Gln Phe Pro Tyr Gln Ala1 5 10 15Gly Leu Leu Ile Asn Leu Pro
Leu Gly Gln Ser Val Cys Gly Gly Ser20 25 30Leu Leu Asn Gln Arg Arg
Val Leu Thr Ala Ala His Cys Trp Phe Asp35 40 45Gly Arg Asn Gln Ala
Thr Ser Leu Thr Val Ile Leu Gly Ser Ile Asn50 55 60Leu Phe Phe Gly
Gly Thr Arg Leu Asn Ser Asn Ser Val Val Met Gln65 70 75 80Gly Ser
Trp Asn Pro Asn Leu Ile Arg Asn Asp Ile Ala Ile Ile Asn85 90 95Leu
Pro Ser Asn Val Gly Thr Ser Gly Asn Ile Ala Pro Ile Ala Leu100 105
110Pro Ser Gly Asn Glu Leu Asn Asn Gln Phe Ala Gly Phe Thr Ala
Thr115 120 125Ala Ser Gly Phe Gly Leu Thr Arg Asp Gly Gly Asn Val
Ser Pro Thr130 135 140Leu Asn His Val Asn Leu Pro Val Ile Thr Asn
Asn Val Cys Trp Gln145 150 155 160Ser Phe Pro Leu Tyr Ile Gln Ser
Thr Asn Ile Cys Thr Ser Gly Ala165 170 175Asn Gly Arg Gly Thr Cys
Gln Gly Asp Ser Gly Gly Pro Leu Val Val180 185 190Thr Ser Asn Asn
Arg Arg Ile Leu Ile Gly Val Thr Ser Phe Gly Ser195 200 205Asp Arg
Gly Cys Gln Val Gly Ala Pro Ala Ala Phe Ala Arg Val Thr210 215
220Ser Tyr Ile Ser Trp Ile Asn Gln Arg Leu225
23053296PRTHelicoverpa punctigera 53Met Ala Ala Ala Tyr Leu Leu Gly
Leu Leu Phe Val Leu Gly Tyr Val1 5 10 15Gln Gly Gly Leu Leu Asn Ala
Asp Pro Ala Ile Ile Glu Asp Leu Arg20 25 30Asp Ala Glu Phe Ser Ser
Gly Ser Arg Ile Val Ala Gly Trp Pro Ala35 40 45Val Glu Gly Gln Ile
Pro Tyr Gln Gly Ser Leu Arg Met Val Ser Ala50 55 60Ile Gly Gly Val
Ser Ser Cys Gly Cys Ser Leu Ile His Asn Lys Trp65 70 75 80Val Leu
Thr Ala Ala His Cys Leu Ala Asn Arg Ile Thr Phe Val Val85 90 95Arg
Phe Gly Leu Thr Asn Leu Thr Arg Pro Glu Ile Leu Val Glu Ser100 105
110Thr Asn Lys Tyr Ile His Pro Glu Tyr Asp Glu Ile Arg Ala Gly
Val115 120 125Gln Thr Ala Asp Leu Ala Leu Val Gly Leu Asp His Glu
Ile Glu Tyr130 135 140Ser Ala Asn Val Gln Pro Ser Arg Leu Met Ser
Ser Ala Gln Lys Asn145 150 155 160Ile Asn Tyr Glu Gly Ile Gln Met
Ile Val Ser Gly Phe Gly Arg Thr165 170 175Asp Asp Leu Trp Asn Gly
Gly Ala Ala Ser Glu Ile Leu Leu Trp Val180 185 190Tyr Gln Arg Gly
Val Ser Asn Glu Glu Cys Leu Arg Trp Tyr Pro Thr195 200 205Ser Gln
Val Ile Lys Glu Gln Thr Ile Cys Ala Gly Tyr Trp Asp Asn210 215
220Pro Ser Gln Ser Ser Cys Gln Gly Asp Ser Gly Gly Pro Leu Thr
Ile225 230 235 240Ile Asp Ala Asp Gly Glu Arg Thr Gln Ser Arg Tyr
Cys Glu Leu Arg245 250 255Ile His Cys Trp Asn Ala Ala His Ser Pro
Gln Gly Tyr Val Arg Pro260 265 270Gly His Tyr His Asp Trp Phe Thr
Glu Val Thr Gly Ile Asn Phe Asp275 280 285Trp Asp Ser Asp Ala Ile
Ile Pro290 29554365PRTHelicoverpa punctigera 54Met Ala Ala Ala Tyr
Leu Leu Gly Leu Leu Phe Val Leu Gly Tyr Val1 5 10 15Gln Gly Gly Leu
Leu Asn Ala Asp Pro Ala Ile Ile Glu Asp Leu Arg20 25 30Asp Ala Glu
Phe Ser Ser Phe Ser Arg Ile Val Ala Gly Trp Pro Ala35 40 45Val Glu
Gly Gln Ile Pro Tyr Gln Gly Ser Leu Arg Met Val Ser Ala50 55 60Ile
Gly Gly Val Ser Ser Cys Gly Cys Ser Leu Ile His Asn Lys Trp65 70 75
80Val Leu Thr Ala Ala His Cys Leu Ala Asn Arg Ile Thr Phe Val Val85
90 95Arg Phe Gly Leu Thr Asn Leu Thr Arg Pro Glu Ile Leu Val Glu
Ser100 105 110Thr Asn Lys Tyr Ile His Pro Glu Tyr Asp Glu Ile Arg
Ala Gly Val115 120 125Gln Thr Ala Asp Leu Ala Leu Val Gly Leu Asp
Gln Glu Ile Glu Tyr130 135 140Ser Ala Asn Val Gln Pro Ser Arg Leu
Met Ser Ser Ala Gln Lys Asn145 150 155 160Ile Asn Tyr Glu Gly Ile
Gln Met Ile Val Ser Gly Phe Gly Arg Thr165 170 175Asp Asp Leu Trp
Asn Gly Gly Ala Ala Ser Glu Ile Leu Leu Trp Val180 185 190Tyr Gln
Arg Gly Val Ser Asn Glu Glu Cys Leu Arg Trp Tyr Pro Thr195 200
205Ser Gln Val Ile Lys Glu Gln Thr Ile Cys Ala Gly Tyr Trp Asp
Asn210 215 220Pro Ser Gln Ser Ser Cys Gln Gly Asp Ser Gly Gly Pro
Leu Thr Ile225 230 235 240Ile Asp Ala Asp Gly Glu Arg Thr Gln Val
Gly Ile Val Ser Ser Asp245 250 255Pro Leu Leu Asp Ala Thr Val His
Ser Pro Arg Val Thr Ser Pro Gly260 265 270His Tyr His Asp Gly His
Arg Gly Asp Arg His Gln Leu Arg Leu Gly275 280 285Gln Arg Arg His
Tyr Pro Asp Ser Ser Glu Ser Ser Leu Arg Ala Ala290 295 300Ile Leu
Pro Leu Glu Ser Ser Arg Ala Phe Ile Arg Arg Asn Gln Ser305 310 315
320Ser Phe Arg Gly Gly Leu Cys Gln Pro Pro Arg Phe Pro Thr Arg
Thr325 330 335Val Pro Thr His Leu Pro Arg Arg Thr Leu Ala Ala Pro
Pro Ser Glu340 345 350Glu Glu Glu Ala Pro Glu Lys Val Arg Val Val
Glu Tyr355 360 3655536PRTHelicoverpa punctigera 55Ile Val Gly Gly
Ser Leu Ser Ser Val Gly Gln Ile Pro Tyr Gln Ala1 5 10 15Gly Leu Val
Ile Asp Leu Ala Gly Gly Gln Ala Val Cys Gly Gly Ser20 25 30Leu Ile
Ser Ala355630PRTHelicoverpa punctigera 56Ile Val Gly Gly Ser Thr
Ser Ser Val Gly Gln Phe Pro Tyr Gln Ala1 5 10 15Gly Leu Leu Ala Ser
Phe Ala Gly Gly Gln Ala Val Cys Gly20 25 305737PRTHelicoverpa
punctigera 57Ile Val Gly Gly Ser Ile Thr Asp Ile Ala Asn Val Pro
Tyr Gln Ala1 5 10 15Gly Leu Val Ile Thr Ile Phe Ile Phe Gln Ser Val
Cys Gly Ala Ser20 25 30Leu Ile Ser His Asn355837PRTHelicoverpa
punctigera 58Ile Val Gly Gly Ser Ile Thr Asn Ile Ala Asn Val Pro
Tyr Gln Ala1 5 10 15Gly Leu Val Ile Thr Ile Phe Ile Phe Gln Ser Val
Cys Gly Ala Ser20 25 30Leu Ile Ser His Asn355937PRTHelicoverpa
punctigera 59Ile Val Gly Gly Ser Thr Ser Ser Leu Gly Ala Phe Pro
Tyr Gln Ala1 5 10 15Gly Leu Leu Ala Ser Phe Ala Ser Gly Gln Gly Val
Cys Gly Gly Ser20 25 30Leu Leu Asn Val Arg356037PRTHelicoverpa
punctigera 60Ile Val Gly Gly Ser Thr Ser Ser Leu Gly Ala Phe Pro
Tyr Gln Ala1 5 10 15Gly Leu Leu Ala Asn Phe Ala Ser Gly Gln Gly Val
Cys Gly Gly Ser20 25 30Leu Leu Asn Gln Arg356137PRTHelicoverpa
punctigera 61Ile Val Gly Gly Ser Ser Ala Ser Leu Gly Gln Phe Pro
Tyr Gln Ala1 5 10 15Gly Leu Ser Leu Ile Tyr Ser Gly Gln Ser Val Cys
Gly Gly Ser Leu20 25 30Leu Asn Gln Arg Arg356237PRTHelicoverpa
punctigera 62Ile Val Ala Gly Trp Pro Ala Val Glu Gly Gln Ile Pro
Tyr Gln Gly1 5 10 15Ser Leu Arg Met Val Ser Ala Ile Gly Gly Val Ser
Ser Cys Gly Cys20 25 30Ser Leu Ile His Asn3563235PRTHelicoverpa
punctigera 63Ile Val Gly Gly Ser Ile Thr Asp Ile Ala Asn Val Pro
Tyr Gln Ala1 5 10 15Gly Leu Val Ile Thr Ile Phe Ile Phe Gln Ser Val
Cys Gly Ala Ser20 25 30Leu Ile Ser His Asn Arg Leu Val Thr Ala Ala
His Cys Lys Ser Asp35 40 45Gly Val Leu Thr Ala Asn Ser Phe Thr Val
Val Leu Gly Ser Asn Thr50 55 60Leu Phe Phe Gly Gly Thr Arg Ile Asn
Thr Asn Asp Val Val Met His65 70 75 80Pro Asn Trp Asn Pro Ser Thr
Ala Ala Asn Asp Ile Ala Val Met Arg85 90 95Ile Ser Ser Val Ser Phe
Ser Asn Val Ile Gln Pro Ile Ala Leu Pro100 105 110Ser Gly Asp Glu
Leu Asn Asn Leu Phe Val Gly Ala Asn Ala Leu Ala115 120 125Phe Gly
Phe Gly Arg Thr Ser Asp Gly Gly Ser Ile Gly Ser Asn Gln130 135
140Gln Val Ser Ser Val Thr Ile Pro Val Ile Thr Asn Asp Glu Cys
Ala145 150 155 160Ala Val Tyr Gly Ser Ala Phe Val His Ser Ser Asn
Ile Cys Thr Ser165 170 175Gly Ala Gly Gly Lys Gly Thr Cys Asn Gly
Asp Ser Gly Gly Pro Leu180 185 190Ala Ile Asp Ser Asn Asn Glu Lys
Ile Leu Ile Gly Val Thr Ser Tyr195 200 205Gly Ala Gln Ala Gly Cys
Ala Ala Gly Leu Pro Ala Ala Phe Ala Arg210 215 220Val Thr Ser Phe
Val Ser Trp Val Gln Ser Gln225 230 23564235PRTHelicoverpa
punctigera 64Ile Val Gly Gly Ser Ile Thr Asn Ile Ala Asn Val Pro
Tyr Gln Ala1 5 10 15Gly Leu Val Ile Thr Ile Phe Ile Phe Gln Ser Val
Cys Gly Ala Ser20 25 30Leu Ile Ser His Asn Arg Leu Val Thr Ala Ala
His Cys Lys Phe Asp35 40 45Gly Val Met Thr Ala Asn Ser Phe Thr Val
Val Leu Gly Ser Asn Thr50 55 60Leu Phe Phe Gly Gly Thr Arg Ile Asn
Thr Asn Asp Val Val Met His65 70 75 80Pro Asn Trp Asn Pro Ser Thr
Val Ala Asn Asp Ile Ala Val Ile Arg85 90 95Ile Ser Ser Ile Val Tyr
Asn Asn Val Ile Gln Pro Ile Ala Leu Pro100 105 110Ser Gly Asp Glu
Leu Asp Asn Leu Phe Val Gly Ala Asn Ala Leu Ala115 120 125Ser Gly
Phe Gly Arg Thr Ser Asp Ser Gly Gly Ile Gly Thr Asn Gln130 135
140Gln Leu Ser Ser Val Thr Ile Pro Val Ile Thr Asn Ala Glu Cys
Ala145 150 155 160Ala Val Tyr Gly Pro Ala Phe Val His Asp Thr Asn
Ile Cys Thr Ser165 170 175Gly Ala Gly Gly Lys Gly Thr Cys Asn Gly
Asp Ser Gly Gly Pro Leu180 185 190Ala Val Asp Ser Asn Asp Lys Lys
Ile Leu Ile Gly Val Thr Ser Tyr195 200 205Gly Ala Ala Asp Gly Cys
Ala Ala Gly Phe Pro Ala Ala Phe Ala Arg210 215 220Val Thr Ser Phe
Val Ser Trp Val Gln Ser Gln225 230 23565234PRTHelicoverpa
punctigera 65Ile Val Gly Gly Ser Thr Ser Ser Leu Gly Ala Phe Pro
Tyr Gln Ala1 5 10 15Gly Leu Leu Ala Ser Phe Ala Ser Gly Gln Gly Val
Cys Gly Gly Ser20 25 30Leu Leu Asn Val Arg Arg Val Leu Thr Ala Ala
His Cys Trp Phe Asp35 40 45Gly Arg Asn Gln Ala Arg Ser Phe Thr Val
Val Leu Gly Ser Val Arg50 55 60Leu Tyr Ser Gly Gly Thr Arg Leu Asn
Thr Ala Ser Val Val Met His65 70 75 80Gly Ser Trp Asn Pro Asn Leu
Val Arg Asn Asp Ile Ala Met Ile Asn85 90 95Leu Pro Ser Asn Val Ala
Thr Ser Gly Asn Ile Ala Pro Ile Ala Leu100 105 110Pro Ser Gly Asn
Glu Leu Asn Asn Gln Phe Ala Gly Ala Thr Ala Thr115 120 125Ala Ser
Gly Phe Gly Leu Ala Arg Asp Gly Gly Val Ile Asp Gly Asn130 135
140Leu Arg His Val Asn Leu Pro Val Ile Thr Asn Ala Val Cys Ser
Gln145 150 155 160Ser Phe Pro Gly Leu Ile Gln Ala Ser Asn Val Cys
Thr Ser Gly Ala165 170 175Asn Gly Arg Ser Thr Cys Gln Gly Asp Ser
Gly Gly Pro Leu Val Val180 185 190Asn Ser Asn Asn Arg Arg Ile Leu
Ile Gly Val Thr Ser Phe Gly Ser195 200 205Ala Arg Gly Cys Gln Val
Gly Ser Pro Ala Ala Phe Ala Arg Val Ser210 215 220Ser Tyr Ile Ser
Trp Ile Asn Gln Arg Leu225 23066234PRTHelicoverpa punctigera 66Ile
Val Gly Gly Ser Thr Ser Ser Leu Gly Ala Phe Pro Tyr Gln Ala1 5 10
15Gly Leu Leu Ala Asn Phe Ala Ser Gly Gln Gly Val Cys Gly Gly Ser20
25 30Leu Leu Asn Gln Arg Arg Val Leu Thr Ala Ala His Cys Trp Phe
Asp35 40 45Gly Arg Asn Gln Ala Arg Ser Phe Thr Val Val Leu Gly Ser
Val Arg50 55 60Leu Phe Ser Gly Gly Thr Arg Leu Asp Thr Ala Ser Val
Val Met His65 70 75 80Gly Ser Trp Asn Pro Asn Leu Ile Arg Asn Asp
Ile Ala Met Ile Asn85 90 95Leu Pro Ser Asn Val Ala Thr Ser Gly Asn
Ile Ala Pro Ile Ala Leu100 105 110Pro Ser Gly Asn Glu Leu Asn Asn
Asn Phe Asn Gly Ala Thr Ala Thr115 120 125Ala Ser Gly Phe Gly Leu
Ala Arg Asp Gly Gly Ser Val Asp Gly Asn130 135 140Leu Arg His Val
Asn Leu Pro Val Ile Thr Asn Ala Val Cys Thr Val145 150 155 160Ser
Phe Pro Gly Ile Ile Gln Ser Ser Asn Ile Cys Thr Ser Gly Ala165 170
175Asn Gly Arg Ser Thr Cys Gln Gly Asp Ser Gly Gly Pro Leu Val
Val180 185 190Asn Ser Asn Asn Arg Arg Ile Leu Ile Gly Val Thr Ser
Phe Gly Ser195 200 205Ala Arg Gly Cys Gln Val Gly Ser Pro Ala Ala
Phe Ala Arg Val Thr210 215 220Ser Phe Ile Ser Trp Ile Asn Gln Arg
Leu225 23067282PRTHelicoverpa punctigera 67Ile Val Gly Gly Ser Ser
Ala Ser Leu Gly Gln Phe Pro Tyr Gln Ala1 5 10 15Gly Leu Ser Leu Ile
Tyr Ser Gly Gln Ser Val Cys Gly Gly Ser Leu20 25 30Leu Asn Gln Arg
Arg Val Leu Thr Ala Ala His Cys Trp Phe Asp Gly35 40 45Ile Val Ala
Gly Trp Pro Ala Val Glu Gly Gln Ile Pro Tyr Gln Gly50 55 60Ser Leu
Arg Met Val Ser Ala Ile Gly Gly Val Ser Ser Cys Gly Cys65 70 75
80Ser Leu Ile His Asn Lys Trp Val Leu Thr Ala Ala His Cys Leu Ala85
90 95Asn Arg Asn Gln Ala Thr Ser Leu Thr Val Ile Leu Gly Ser Ile
Asn100 105 110Leu Phe Phe Gly Gly Thr Arg Leu Asn Ser Asn Ser Val
Val Met His115 120 125Gly Ser Trp Asn Pro Asn Leu Ile Arg Asn Asp
Ile Ala Ile Ile Asn130 135 140Leu Pro Ser Asn Val Gly Thr Ser Gly
Asn Ile Ala Pro Ile Ala Leu145 150 155 160Pro Ser Gly Asn Glu Leu
Asn Asn Gln Phe Ala Gly Phe Thr Ala Thr165 170 175Ala Ser Gly Phe
Gly Leu Thr Arg Asp Gly Gly Asn Val Ser Pro Thr180 185 190Leu Asn
His Val Asn Leu Pro Val Ile Thr Asn Asn Val Cys Trp Gln195 200
205Ser Phe Pro Leu Tyr Ile Gln Ser Thr Asn Ile Cys Thr Ser Gly
Ala210 215 220Asn Gly Arg Gly Thr Cys Gln Gly Asp Ser Gly Gly Pro
Leu Val Val225 230 235 240Thr Ser Asn Asn Arg Arg Ile Leu Ile Gly
Val Thr Ser Phe Gly Ser245 250 255Asp Arg Gly Cys Gln Val Gly Ala
Pro Ala Ala Phe Ala Arg Val Thr260 265 270Ser Tyr Ile Ser Trp Ile
Asn Gln Arg Leu275 28068256PRTHelicoverpa punctigera 68Ile Val Ala
Gly Trp Pro Ala Val Glu Gly Gln Ile Pro Tyr Gln Gly1 5 10 15Ser Leu
Arg Met Val Ser Ala Ile Gly Gly Val Ser Ser Cys Gly
Cys20 25 30Ser Leu Ile His Asn Lys Trp Val Leu Thr Ala Ala His Cys
Leu Ala35 40 45Asn Arg Ile Thr Phe Val Val Arg Phe Gly Leu Thr Asn
Leu Thr Arg50 55 60Pro Glu Ile Leu Val Glu Ser Thr Asn Lys Tyr Ile
His Pro Glu Tyr65 70 75 80Asp Glu Ile Arg Ala Gly Val Gln Thr Ala
Asp Leu Ala Leu Val Gly85 90 95Leu Asp His Glu Ile Glu Tyr Ser Ala
Asn Val Gln Pro Ser Arg Leu100 105 110Met Ser Ser Ala Gln Lys Asn
Ile Asn Tyr Glu Gly Ile Gln Met Ile115 120 125Val Ser Gly Phe Gly
Arg Thr Asp Asp Leu Trp Asn Gly Gly Ala Ala130 135 140Ser Glu Ile
Leu Leu Trp Val Tyr Gln Arg Gly Val Ser Asn Glu Glu145 150 155
160Cys Leu Arg Trp Tyr Pro Thr Ser Gln Val Ile Lys Glu Gln Thr
Ile165 170 175Cys Ala Gly Tyr Trp Asp Asn Pro Ser Gln Ser Ser Cys
Gln Gly Asp180 185 190Ser Gly Gly Pro Leu Thr Ile Ile Asp Ala Asp
Gly Glu Arg Thr Gln195 200 205Ser Arg Tyr Cys Glu Leu Arg Ile His
Cys Trp Asn Ala Thr Ala His210 215 220Ser Pro Gln Gly Tyr Val Arg
Pro Gly His Tyr His Asp Trp Phe Thr225 230 235 240Glu Val Thr Gly
Ile Asn Phe Asp Trp Asp Ser Asp Ala Ile Ile Pro245 250
25569236PRTHelicoverpa punctigera 69Ile Val Gly Gly Ser Leu Ser Ser
Val Gly Gln Ile Pro Tyr Gln Ala1 5 10 15Gly Leu Val Ile Asp Leu Ala
Gly Gly Gln Ala Val Cys Gly Gly Ser20 25 30Leu Ile Ser Ala Ser Arg
Val Leu Thr Ala Ala His Cys Trp Phe Asp35 40 45Gly Gln Asn Gln Ala
Trp Arg Phe Thr Val Val Leu Gly Ser Thr Thr50 55 60Leu Phe Ser Gly
Gly Thr Arg Ile Pro Thr Ser Asn Val Val Met His65 70 75 80Gly Ser
Trp Thr Pro Ser Leu Ile Arg Asn Asp Val Ala Val Ile Arg85 90 95Leu
Gly Thr Asn Val Ala Thr Ser Asn Thr Ile Ala Ile Ile Ala Leu100 105
110Pro Ser Gly Ser Gln Ile Asn Glu Asn Phe Ala Gly Glu Thr Ala
Leu115 120 125Ala Ser Gly Phe Gly Leu Thr Ser Asp Thr Gly Ser Ile
Ser Ser Asn130 135 140Gln Ala Leu Ser His Val Asn Leu Pro Val Ile
Thr Asn Ala Val Cys145 150 155 160Arg Asn Ser Phe Pro Leu Leu Ile
Gln Asp Ser Asn Ile Cys Thr Ser165 170 175Gly Ala Asn Gly Arg Ser
Thr Cys Arg Gly Asp Ser Gly Gly Pro Leu180 185 190Val Val Thr Arg
Asn Asn Arg Pro Leu Leu Ile Gly Ile Thr Ser Phe195 200 205Gly Ser
Ala Arg Gly Cys Gln Val Gly Ser Pro Ala Ala Phe Ala Arg210 215
220Val Thr Ser Tyr Ile Ser Trp Ile Asn Gly Gln Leu225 230
23570224PRTHomo sapiens 70Ile Val Gly Gly Tyr Thr Cys Glu Glu Asn
Ser Leu Pro Tyr Gln Val1 5 10 15Ser Leu Asn Ser Gly Ser His Phe Cys
Gly Gly Ser Leu Ile Ser Glu20 25 30Gln Trp Val Val Ser Ala Ala His
Cys Tyr Lys Thr Arg Ile Gln Val35 40 45Arg Leu Gly Glu His Asn Ile
Lys Val Leu Glu Gly Asn Glu Gln Phe50 55 60Ile Asn Ala Ala Lys Ile
Ile Arg His Pro Lys Tyr Asn Arg Asp Thr65 70 75 80Leu Asp Asn Asp
Ile Met Leu Ile Lys Leu Ser Ser Pro Ala Val Ile85 90 95Asn Ala Arg
Val Ser Thr Ile Ser Leu Pro Thr Ala Pro Pro Ala Ala100 105 110Gly
Thr Glu Cys Leu Ile Ser Gly Trp Gly Asn Thr Leu Ser Phe Gly115 120
125Ala Asp Tyr Pro Asp Glu Leu Lys Cys Leu Asp Ala Pro Val Leu
Thr130 135 140Gln Ala Glu Cys Lys Ala Ser Tyr Pro Gly Lys Ile Thr
Asn Ser Met145 150 155 160Phe Cys Val Gly Phe Leu Glu Gly Gly Lys
Asp Ser Cys Gln Arg Asp165 170 175Ser Gly Gly Pro Val Val Cys Asn
Gly Gln Leu Gln Gly Val Val Ser180 185 190Trp Gly His Gly Cys Ala
Trp Lys Asn Arg Pro Gly Val Tyr Thr Lys195 200 205Val Tyr Asn Tyr
Val Asp Trp Ile Lys Asp Thr Ile Ala Ala Asn Ser210 215
22071275PRTHelicoverpa armigera 71Val His Leu Glu Asp Ser Ile Asp
Leu Glu Asp Ile Thr Ala Trp Gly1 5 10 15Tyr Leu Thr Lys Phe Gly Ile
Pro Glu Ala Glu Lys Ile Arg Asn Ala20 25 30Glu Glu Ala Ser Ser Ala
Ser Arg Ile Val Gly Gly Ser Leu Ser Ser35 40 45Leu Gly Gln Ile Pro
Tyr Gln Ala Gly Leu Val Ile Asp Leu Ser Gly50 55 60Gly Gln Ala Val
Cys Gly Gly Ser Leu Ile Ser Ala Ser Arg Val Leu65 70 75 80Thr Ala
Ala His Cys Trp Phe Asp Gly Gln Asn Gln Ala Trp Arg Phe85 90 95Thr
Val Val Leu Gly Ser Thr Thr Leu Phe Ser Gly Gly Thr Arg Ile100 105
110Ala Thr Ser Asn Val Val Met His Gly Ser Trp Thr Pro Ser Leu
Ile115 120 125Arg Asn Asp Val Ala Val Ile Arg Leu Gly Thr Asn Val
Gly Thr Ser130 135 140Asn Thr Ile Ala Ile Ile Ala Leu Pro Ser Gly
Ser Gln Ile Asn Glu145 150 155 160Asn Phe Ala Gly Glu Thr Ala Leu
Ala Ser Gly Phe Gly Leu Thr Ser165 170 175Asp Ser Gly Ser Ile Ser
Ser Asn Gln Ala Leu Ser His Val Asn Leu180 185 190Pro Val Ile Thr
Asn Ala Val Cys Arg Ser Ser Phe Pro Leu Leu Ile195 200 205Gln Asp
Ser Asn Ile Cys Thr Ser Gly Ala Asn Gly Arg Ser Thr Cys210 215
220Arg Gly Asp Ser Gly Gly Pro Leu Val Val Thr Arg Asn Ser Arg
Pro225 230 235 240Leu Leu Ile Gly Ile Thr Ser Phe Gly Ser Ala Arg
Gly Cys Gln Val245 250 255Gly Ser Pro Ala Ala Phe Ala Arg Val Thr
Ser Tyr Ile Ser Trp Ile260 265 270Asn Gly Gln27572275PRTHelicoverpa
punctigera 72Val His Leu Glu Asp Ser Ile Asp Leu Glu Asp Ile Thr
Ala Trp Gly1 5 10 15Tyr Leu Thr Lys Phe Gly Ile Pro Glu Ala Glu Lys
Ile Arg Asn Ala20 25 30Glu Glu Ala Ser Ser Ala Ser Arg Ile Val Gly
Gly Ser Leu Ser Ser35 40 45Leu Gly Gln Ile Pro Tyr Gln Ala Gly Leu
Val Ile Asp Leu Ala Gly50 55 60Gly Gln Ala Val Cys Gly Gly Ser Leu
Ile Ser Ala Ser Arg Val Leu65 70 75 80Thr Ala Ala His Cys Trp Phe
Asp Gly Gln Asn Gln Ala Trp Arg Phe85 90 95Thr Val Val Leu Gly Ser
Thr Thr Leu Phe Ser Gly Gly Thr Arg Ile100 105 110Pro Thr Ser Asn
Val Val Met His Gly Ser Trp Thr Pro Ser Leu Ile115 120 125Arg Asn
Asp Val Ala Val Ile Arg Leu Gly Thr Asn Val Gly Thr Ser130 135
140Asn Thr Ile Ala Ile Ile Ala Leu Pro Ser Gly Ser Gln Ile Asn
Glu145 150 155 160Asn Phe Ala Gly Glu Thr Ala Leu Ala Ser Gly Phe
Gly Leu Thr Ser165 170 175Asp Thr Gly Ser Ile Ser Ser Asn Gln Ala
Leu Ser His Val Asn Leu180 185 190Pro Val Ile Thr Asn Ala Val Cys
Arg Asn Ser Phe Pro Leu Leu Ile195 200 205Gln Asp Ser Asn Ile Cys
Thr Ser Gly Ala Asn Gly Arg Ser Thr Cys210 215 220Arg Gly Asp Ser
Gly Gly Pro Leu Val Val Thr Arg Asn Asn Arg Pro225 230 235 240Leu
Leu Ile Gly Ile Thr Ser Phe Gly Ser Ala Arg Gly Cys Gln Val245 250
255Gly Ser Pro Ala Ala Phe Ala Arg Val Thr Ser Tyr Ile Ser Trp
Ile260 265 270Asn Gly Gln27573230PRTbovine 73Ile Val Asn Gly Glu
Asp Ala Val Pro Gly Ser Trp Pro Trp Gln Val1 5 10 15Ser Leu Gln Asp
Ser Thr Gly Phe His Phe Cys Gly Gly Ser Leu Ile20 25 30Ser Glu Asp
Trp Val Val Thr Ala Ala His Cys Gly Val Thr Thr Ser35 40 45Asp Val
Val Val Ala Gly Glu Phe Asp Gln Gly Ser Ser Ser Glu Lys50 55 60Ile
Gln Lys Leu Lys Ile Ala Lys Val Phe Lys Asn Ser Lys Tyr Asn65 70 75
80Ser Leu Thr Ile Asn Asn Asp Ile Thr Leu Leu Lys Leu Ala Thr Pro85
90 95Ala Gln Phe Ser Glu Thr Val Ser Ala Val Cys Leu Pro Ser Ala
Asp100 105 110Glu Asp Phe Pro Ala Gly Met Leu Cys Ala Thr Thr Gly
Trp Gly Lys115 120 125Thr Lys Tyr Asn Ala Leu Lys Thr Pro Asp Lys
Leu Gln Gln Ala Thr130 135 140Leu Pro Ile Val Ser Asn Thr Asp Cys
Arg Lys Tyr Trp Gly Ser Arg145 150 155 160Val Thr Asp Val Met Ile
Cys Ala Gly Ala Ser Gly Val Ser Ser Cys165 170 175Met Gly Asp Ser
Gly Gly Pro Leu Val Cys Gln Lys Asn Gly Ala Trp180 185 190Thr Leu
Ala Gly Ile Val Ser Trp Gly Ser Ser Thr Cys Ser Thr Ser195 200
205Thr Pro Ala Val Tyr Ala Arg Val Thr Ala Leu Met Pro Trp Val
Gln210 215 220Glu Thr Leu Ala Ala Asn225 23074230PRTbovine 74Ile
Val Asn Gly Glu Glu Ala Val Pro Gly Ser Trp Pro Trp Gln Val1 5 10
15Ser Leu Gln Asp Lys Thr Gly Phe His Phe Cys Gly Gly Ser Leu Ile20
25 30Asn Glu Asn Trp Val Val Thr Ala Ala His Cys Gly Val Thr Thr
Ser35 40 45Asp Val Val Val Ala Gly Glu Phe Asp Gln Gly Leu Glu Thr
Glu Asp50 55 60Thr Gln Val Leu Lys Ile Gly Lys Val Phe Lys Asn Pro
Lys Phe Ser65 70 75 80Ile Leu Thr Val Arg Asn Asp Ile Thr Leu Leu
Lys Leu Ser Thr Ala85 90 95Ala Ser Phe Ser Gln Thr Val Ser Ala Val
Cys Leu Pro Ser Ala Ser100 105 110Asp Asp Phe Ala Ala Gly Thr Thr
Cys Val Thr Thr Gly Trp Gly Leu115 120 125Thr Arg Tyr Thr Asn Ala
Asn Thr Pro Asp Arg Leu Gln Gln Ala Ser130 135 140Leu Pro Leu Leu
Ser Asn Thr Asn Cys Lys Lys Tyr Trp Gly Thr Lys145 150 155 160Ile
Lys Asp Ala Met Ile Cys Ala Gly Ala Ser Gly Val Ser Ser Cys165 170
175Met Gly Asp Ser Gly Gly Pro Leu Val Cys Lys Gln Asn Gly Ala
Trp180 185 190Thr Leu Val Gly Ile Val Ser Trp Gly Ser Ser Thr Cys
Ser Thr Ser195 200 205Thr Pro Gly Val Tyr Ala Arg Val Thr Ala Leu
Val Asn Trp Val Gln210 215 220Gln Thr Leu Ala Ala Asn225
23075237PRTHelicoverpa punctigera 75Ile Val Gly Gly Ser Thr Ser Ser
Leu Gly Ala Phe Pro Tyr Gln Ala1 5 10 15Gly Leu Leu Ala Ser Phe Ala
Ser Gly Gln Gly Val Cys Gly Gly Ser20 25 30Leu Leu Asn Val Arg Arg
Val Leu Thr Ala Ala His Cys Trp Phe Asp35 40 45Gly Arg Asn Gln Ala
Arg Ser Phe Thr Val Val Leu Gly Ser Val Arg50 55 60Leu Tyr Ser Gly
Gly Thr Arg Leu Asn Thr Ala Ser Val Val Met His65 70 75 80Gly Ser
Trp Asn Pro Asn Leu Val Arg Thr Ile Asn Asn Asp Ile Ala85 90 95Met
Ile Asn Leu Pro Ser Asn Val Ala Thr Ser Gly Asn Ile Ala Pro100 105
110Ile Ala Leu Pro Ser Gly Asn Glu Leu Asn Asn Gln Phe Ala Gly
Ala115 120 125Thr Ala Thr Ala Ser Gly Phe Gly Leu Ala Arg Asp Gly
Gly Val Ile130 135 140Asp Gly Asn Leu Arg His Val Asn Leu Pro Val
Ile Thr Asn Ala Val145 150 155 160Cys Ser Gln Ser Phe Pro Gly Leu
Ile Gln Ala Ser Asn Val Cys Thr165 170 175Ser Gly Ala Asn Gly Arg
Ser Thr Cys Gln Gly Gly Asp Ser Gly Gly180 185 190Pro Leu Val Asn
Ser Asn Asn Arg Arg Ile Leu Ile Gly Val Thr Ser195 200 205Phe Gly
Ser Ala Arg Gly Cys Gln Val Gly Ser Pro Ala Ala Phe Ala210 215
220Arg Val Ser Ser Tyr Ile Ser Trp Ile Asn Gln Arg Leu225 230
23576236PRTHelicoverpa punctigera 76Ile Val Gly Gly Ser Leu Ser Ser
Val Gly Gln Ile Pro Tyr Gln Ala1 5 10 15Gly Leu Val Ile Asp Leu Ala
Gly Gly Gln Ala Val Cys Gly Gly Ser20 25 30Leu Leu Ser Ala Ser Arg
Val Leu Thr Ala Ala His Cys Trp Phe Asp35 40 45Gly Gln Asn Gln Ala
Trp Arg Phe Thr Val Val Leu Gly Ser Thr Thr50 55 60Leu Phe Ser Gly
Gly Thr Arg Leu Asn Ile Pro Ser Ser Asn Met His65 70 75 80Gly Ser
Trp Asn Pro Ser Leu Ile Arg Asn Asp Val Ala Val Ile Arg85 90 95Leu
Gly Thr Asn Val Ala Thr Ser Asn Thr Ile Ala Ile Ile Ala Leu100 105
110Pro Ser Gly Ser Gln Ile Asn Glu Asn Phe Ala Gly Glu Thr Ala
Leu115 120 125Ala Ser Gly Phe Gly Leu Thr Ser Tyr Thr Gly Ser Ile
Ser Ser Asn130 135 140Gln Ala Leu Ser His Val Asn Leu Pro Val Ile
Thr Asn Ala Val Cys145 150 155 160Arg Asn Ser Phe Ser Leu Leu Ile
Gln Asp Ser Asn Ile Cys Thr Ser165 170 175Gly Ala Asn Gly Arg Ser
Thr Cys Arg Gly Asp Ser Gly Gly Pro Leu180 185 190Val Val Thr Arg
Asn Asn Arg Pro Leu Leu Ile Gly Val Thr Ser Phe195 200 205Gly Ser
Ala Arg Gly Cys Gln Val Gly Ser Pro Ala Ala Phe Ala Arg210 215
220Val Thr Ser Tyr Ile Ser Trp Ile Asn Gly Gln Leu225 230
23577107PRTpotato 77Met Glu Ser Lys Phe Ala His Ile Ile Val Phe Phe
Leu Leu Ala Thr1 5 10 15Ser Phe Glu Thr Leu Met Ala Arg Lys Glu Ser
Asp Gly Pro Glu Val20 25 30Ile Glu Leu Leu Lys Glu Phe Glu Cys Asn
Gly Lys Gln Phe Trp Pro35 40 45Glu Leu Ile Gly Val Pro Thr Lys Leu
Ala Lys Glu Ile Ile Glu Lys50 55 60Glu Asn Ser Leu Ile Asn Asn Val
Gln Ile Leu Leu Asn Gly Ser Pro65 70 75 80Val Thr Met Asp Tyr Arg
Cys Asn Arg Val Arg Leu Phe Asp Asn Ile85 90 95Leu Gly Ser Val Val
Gln Ile Pro Arg Val Ala100 10578107PRTpotato 78Met Glu Ser Lys Phe
Ala His Ile Ile Val Phe Phe Leu Leu Ala Thr1 5 10 15Ser Phe Glu Thr
Leu Leu Ala Arg Lys Glu Ser Asp Gly Pro Glu Val20 25 30Ile Glu Leu
Leu Lys Glu Phe Glu Cys Asn Gly Lys Gln Phe Trp Pro35 40 45Glu Leu
Ile Gly Val Pro Thr Lys Leu Ala Lys Glu Ile Ile Glu Lys50 55 60Glu
Asn Ser Leu Ile Asn Asn Val Gln Ile Leu Leu Asn Gly Ser Pro65 70 75
80Val Ala Met Asp Tyr Arg Cys Asn Arg Val Arg Leu Phe Asp Asn Ile85
90 95Leu Gly Ser Val Val Gln Ile Pro Arg Val Ala100
1057971PRTpotato 79Lys Glu Phe Glu Cys Asp Gly Lys Leu Gln Trp Pro
Glu Leu Ile Gly1 5 10 15Val Pro Thr Lys Leu Ala Lys Glu Ile Ile Glu
Lys Gln Asn Ser Leu20 25 30Ile Ser Asn Val His Ile Leu Leu Asn Gly
Ser Pro Val Thr Met Asp35 40 45Phe Arg Cys Asn Arg Val Arg Leu Phe
Asp Asp Ile Leu Gly Ser Val50 55 60Val Gln Ile Pro Arg Val Ala65
7080106PRTpotato 80Met Glu Ser Lys Phe Ala His Ile Ile Val Phe Phe
Leu Leu Ala Thr1 5 10 15Ser Phe Glu Thr Leu Leu Ala Arg Lys Glu Ser
Asp Gly Pro Glu Val20 25 30Ile Glu Leu Gln Lys Glu Phe Glu Cys Asn
Gly Lys Gln Arg Trp Pro35 40 45Glu Leu Ile Gly Val Pro Thr Lys Leu
Ala Lys Gly Ile Ile Glu Lys50 55 60Glu Asn Ser Leu Ile Thr Asn Val
Gln Ile Leu Leu Asn Gly Ser Pro65 70 75 80Val Thr Met Asp Tyr Arg
Ser Asn Arg Val Arg Leu Phe Asp Asn Ile85 90 95Leu Gly Asp Val Val
Gln Ile Pro Arg Val100 10581111PRTpotato 81Met Glu Ser Lys Phe Ala
His Ile Ile Val Phe Phe Leu Leu Ala Thr1 5 10 15Ser Phe Glu Thr Leu
Met Ala Arg Lys Glu Gly Asp Gly Ser Glu Val20 25 30Ile Lys Leu Leu
Lys Glu Ser Glu Ser Glu Ser Trp Cys Lys Gly Lys35 40 45Gln Phe Trp
Pro Glu Leu Ile Gly Val
Pro Thr Lys Leu Ala Lys Glu50 55 60Ile Ile Glu Lys Glu Asn Pro Ser
Ile Asn Asp Val Pro Ile Ile Leu65 70 75 80Asn Gly Thr Pro Val Pro
Ala Asp Phe Arg Cys Asn Arg Val Arg Leu85 90 95Phe Asp Asn Ile Leu
Gly Asp Val Val Gln Ile Pro Arg Val Ala100 105 11082111PRTpotato
82Met Glu Ser Lys Phe Ala His Ile Ile Val Phe Phe Leu Leu Ala Thr1
5 10 15Ser Phe Glu Thr Leu Met Ala Arg Lys Glu Ile Asp Gly Pro Glu
Val20 25 30Ile Glu Leu Leu Lys Glu Phe Asp Ser Asn Leu Met Cys Glu
Gly Lys35 40 45Gln Met Trp Pro Glu Leu Ile Gly Val Pro Thr Lys Leu
Ala Lys Glu50 55 60Ile Ile Glu Lys Glu Asn Pro Ser Ile Thr Asn Ile
Pro Ile Leu Leu65 70 75 80Ser Gly Ser Pro Ile Thr Leu Asp Tyr Leu
Cys Asp Arg Val Arg Leu85 90 95Phe Asp Asn Ile Leu Gly Phe Val Val
Gln Met Pro Val Val Thr100 105 11083107PRTpotato 83Met Val Lys Phe
Ala His Val Val Ala Phe Leu Leu Leu Ala Ser Leu1 5 10 15Ile Gln Pro
Leu Thr Ala Arg Asp Leu Glu Ile Asn Val Leu Gln Leu20 25 30Asp Val
Ser Gln Ser Gly Cys Pro Gly Val Thr Lys Glu Arg Trp Pro35 40 45Glu
Leu Leu Gly Thr Pro Ala Lys Phe Ala Met Gln Ile Ile Gln Lys50 55
60Glu Asn Pro Lys Leu Thr Asn Val Gln Thr Ile Leu Asn Gly Gly Pro65
70 75 80Val Thr Glu Asp Leu Arg Cys Asn Arg Val Arg Leu Phe Val Asn
Val85 90 95Leu Asp Phe Ile Val Gln Thr Pro Gln Ile Gly100
1058473PRTpotato 84Met Ser Ser Thr Glu Cys Gly Gly Gly Gly Gly Gly
Ala Lys Thr Ser1 5 10 15Trp Pro Glu Val Val Gly Leu Ser Val Glu Asp
Ala Lys Lys Val Ile20 25 30Leu Lys Asp Lys Pro Asp Ala Asp Ile Val
Val Leu Pro Val Gly Ser35 40 45Val Val Thr Ala Asp Tyr Arg Pro Asn
Arg Val Arg Ile Phe Val Asp50 55 60Ile Val Ala Gln Thr Pro His Ile
Gly65 708570PRTpotato 85Thr Glu Phe Gly Ser Glu Leu Lys Ser Phe Pro
Glu Val Val Gly Lys1 5 10 15Thr Val Asp Gln Ala Arg Glu Tyr Phe Thr
Leu His Tyr Pro Gln Tyr20 25 30Asp Val Tyr Phe Leu Pro Glu Gly Ser
Pro Val Thr Leu Asp Leu Arg35 40 45Tyr Asn Arg Val Arg Val Phe Tyr
Asn Pro Gly Thr Asn Val Val Asn50 55 60His Val Pro His Val Gly65
708660DNApotato 86ggatccatga aactcttggc tgtgactcta ttggctttcg
ccgcggtcgt ctccgcgagg 608718PRTpotato 87Met Lys Leu Leu Ala Val Thr
Leu Leu Ala Phe Ala Ala Val Val Ser1 5 10 15Ala
Arg8840DNAartificial sequenceSynthetic construct FwBacRECH2 primer
88ggatccatga aactcttggc tgtgactcta ttggctttcg 408940DNAartificial
sequenceSynthetic construct FwBacRECH2 primer 89ttggctttcg
ccgcggtcgt ctccgcgagg aacgggtccc 4090864DNAHelicoverpa sp
90aacggatccc accatcacca tcaccatgtt cacctcgagg attctattga tctggaagat
60attaccgctt ggggatacct caccaaattc ggtattccag aagctgagaa aatccgcaac
120gctgaagaag ctagctctgc tagcaggatc gtcggtggtt cattgtccag
tgtcggacag 180atcccttacc aggctggtct cgtcattgac ttagcaggtg
gccaggctgt ctgcggaggc 240tccctgatca gcgcttcccg cgtactgacc
gctgctcact gctggttcga cggccaaaac 300caggcctgga gattcaccgt
tgttcttggt tccaccacct tgttctctgg cggtaccaga 360atccctacat
ccaatgttgt tatgcacgga agctggactc ctagccttat ccgtaacgat
420gttgccgtaa tcagattggg caccaacgta gcaacctcaa acaccattgc
catcatcgct 480ctacccagcg gcagccagat caacgagaac ttcgccggtg
aaaccgccct cgcctccggc 540ttcggtctca ccagtgacac cggcagcatc
tccagcaacc aggctctgag ccacgtcaac 600ctgccagtga tcaccaacgc
tgtgtgcaga aattcattcc ccctgctgat ccaggactct 660aacatttgca
ccagcggtgc caacggcagg agcacttgcc gcggtgactc cggcggtcct
720ctcgtcgtca ccaggaacaa cagaccactc ttgatcggta tcacctcttt
cggatctgcc 780cgcggttgcc aagttggatc tcccgctgcc ttcgccagag
tcacctctta catcagctgg 840atcaacggcc agctctaaaa gctt
86491287PRTHelicoverpa sp 91Asn Gly Ser His His His His His His Val
His Leu Glu Asp Ser Ile1 5 10 15Asp Leu Glu Asp Ile Thr Ala Trp Gly
Tyr Leu Thr Lys Phe Gly Ile20 25 30Pro Glu Ala Glu Lys Ile Arg Asn
Ala Glu Glu Ala Ser Ser Ala Ser35 40 45Arg Ile Val Gly Gly Ser Leu
Ser Ser Val Gly Gln Ile Pro Tyr Gln50 55 60Ala Gly Leu Val Ile Asp
Leu Ala Gly Gly Gln Ala Val Cys Gly Gly65 70 75 80Ser Leu Ile Ser
Ala Ser Arg Val Leu Thr Ala Ala His Cys Trp Phe85 90 95Asp Gly Gln
Asn Gln Ala Trp Arg Phe Thr Val Val Leu Gly Ser Thr100 105 110Thr
Leu Phe Ser Gly Gly Thr Arg Ile Pro Thr Ser Asn Val Val Met115 120
125His Gly Ser Trp Thr Pro Ser Leu Ile Arg Asn Asp Val Ala Val
Ile130 135 140Arg Leu Gly Thr Asn Val Ala Thr Ser Asn Thr Ile Ala
Ile Ile Ala145 150 155 160Leu Pro Ser Gly Ser Gln Ile Asn Glu Asn
Phe Ala Gly Glu Thr Ala165 170 175Leu Ala Ser Gly Phe Gly Leu Thr
Ser Asp Thr Gly Ser Ile Ser Ser180 185 190Asn Gln Ala Leu Ser His
Val Asn Leu Pro Val Ile Thr Asn Ala Val195 200 205Cys Arg Asn Ser
Phe Pro Leu Leu Ile Gln Asp Ser Asn Ile Cys Thr210 215 220Ser Gly
Ala Asn Gly Arg Ser Thr Cys Arg Gly Asp Ser Gly Gly Pro225 230 235
240Leu Val Val Thr Arg Asn Asn Arg Pro Leu Leu Ile Gly Ile Thr
Ser245 250 255Phe Gly Ser Ala Arg Gly Cys Gln Val Gly Ser Pro Ala
Ala Phe Ala260 265 270Arg Val Thr Ser Tyr Ile Ser Trp Ile Asn Gly
Gln Leu Lys Leu275 280 2859225DNAartificial sequenceSynthetic
construct RvRECH primer 92gatcaacggc cagctctaaa agctt
259315PRTHelicoverpa sp 93Ile Val Gly Gly Ser Thr Ser Ser Leu Gly
Ala Thr Pro Tyr Gln1 5 10 15
* * * * *
References