U.S. patent application number 12/402957 was filed with the patent office on 2009-07-16 for insect resistant coton plants and methods of detecting the same.
This patent application is currently assigned to SYNGENTA PARTICIPATIONS AG. Invention is credited to David Vincent Negrotto, Frank Arthur Shotkoski, Wenjin Yu.
Application Number | 20090181399 12/402957 |
Document ID | / |
Family ID | 34652417 |
Filed Date | 2009-07-16 |
United States Patent
Application |
20090181399 |
Kind Code |
A1 |
Negrotto; David Vincent ; et
al. |
July 16, 2009 |
INSECT RESISTANT COTON PLANTS AND METHODS OF DETECTING THE SAME
Abstract
The present application relates to an insect resistant
transgenic cotton event designated COT202. The application also
relates to polynucleotides which are characteristic of the COT202
event, plants comprising said polynucleotides, and methods of
detecting the COT202 event.
Inventors: |
Negrotto; David Vincent;
(Research Triangle Park, NC) ; Shotkoski; Frank
Arthur; (Ithaca, NY) ; Yu; Wenjin; (Cary,
NC) |
Correspondence
Address: |
SYNGENTA BIOTECHNOLOGY, INC.;PATENT DEPARTMENT
3054 CORNWALLIS ROAD, P.O. BOX 12257
RESEARCH TRIANGLE PARK
NC
27709-2257
US
|
Assignee: |
SYNGENTA PARTICIPATIONS AG
Research Triangle Park
NC
|
Family ID: |
34652417 |
Appl. No.: |
12/402957 |
Filed: |
March 12, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10580596 |
May 25, 2006 |
7521550 |
|
|
PCT/EP2004/012662 |
Nov 9, 2004 |
|
|
|
12402957 |
|
|
|
|
60526112 |
Dec 1, 2003 |
|
|
|
Current U.S.
Class: |
435/6.15 |
Current CPC
Class: |
C12Q 1/6895 20130101;
C12N 15/8286 20130101; C07K 14/415 20130101; Y02A 40/146 20180101;
Y02A 40/162 20180101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of detecting plant material derived from the COT202
event comprising: (a) obtaining a sample for analysis; (b)
providing DNA from the sample; (c) providing a first primer and a
second designed to bind to a polynucleotide comprising the sequence
of SEQ ID NO: 1 or SEQ ID NO: 2 when said polynucleotide is single
stranded; (d) amplifying the region which lies between the sites at
which the primers bind; and (e) detecting the presence of the
amplification product; whereby the presence of the amplification
product is indicative that the sample is derived from the COT202
event.
2. The method according to claim 1 wherein the first primer has the
sequence of SEQ ID NO: 3 and the second primer has the sequence of
SEQ ID NO: 4.
3. A method of detecting plant material derived from the COT202
event comprising: (a) obtaining a sample for analysis; (b)
providing a probe designed to bind to the complement of a
polynucleotide comprising the sequence of SEQ ID NO: 1 or SEQ ID
NO: 2 when said polynucleotide is single stranded; (c) hybridising
said probe with the sample; and (d) detecting whether the probe has
hybridised; whereby the hybridisation of the probe is indicative
that the sample is derived from the COT202 event.
4. The method according to claim 3 wherein the sequence of the
probe is selected from the group comprising SEQ ID NO: 7 and SEQ ID
NO: 8.
5. The method according to claim 3 wherein the probe hybridises to
the sample under stringent hybridisation conditions.
6. A kit of parts comprising a means for detecting the presence in
a sample of plant material derived from event COT202.
7. The kit of parts according to claim 6 comprising a means for
detecting the presence in a sample of a polynucleotide comprising
the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a protein encoded
by said polynucleotide.
Description
[0001] This is a divisional of U.S. patent application Ser. No.
10/580,596 filed May 25, 2006, which is a .sctn.371 of
PCT/EP2004/012662, filed Nov. 9, 2004, and published Jun. 16, 2005,
as WO 05/054479, which claims priority to U.S. Provisional
Application No. 60/526,112, filed Dec. 1, 2003, which is hereby
incorporated by reference in its entirety.
[0002] The present invention relates to genetic engineering of
plants and in particular to an insect resistant transgenic cotton
plant. Specifically, the invention relates to a cotton plant
designated COT202 which comprises a VIP3A gene. It also relates to
methods of detecting material derived from the plant.
[0003] Plant pests are a major factor in the loss of the world's
important agricultural crops. About $8 billion is lost every year
in the U.S. due to infestations of plants by non-mammalian pests
including insects. In addition to losses in field crops, insect
pests are also a burden to vegetable and fruit growers, to
producers of ornamental flowers, and to home gardeners.
[0004] Insect pests are mainly controlled by intensive applications
of chemical pesticides, which are active through inhibition of
insect growth, prevention of insect feeding or reproduction, or
cause death. Good control of insect pests can thus be reached, but
these chemicals can sometimes also affect other, beneficial
insects. Another problem resulting from the wide use of chemical
pesticides is the appearance of resistant insect varieties. This
has been partially alleviated by various resistance management
practices, but there is an increasing need for alternative pest
control agents. Biological pest control agents, such as Bacillus
thuringiensis strains expressing pesticidal toxins like
.delta.-endotoxins, have also been applied to crop plants with
satisfactory results, offering an alternative or compliment to
chemical pesticides. The genes coding for some of these
.delta.-endotoxins have been isolated and their expression in
heterologous hosts has been shown to provide another tool for the
control of economically important insect pests. In particular, the
expression of insecticidal toxins such as Bacillus thuringiensis
.delta.-endotoxins in transgenic plants, has provided efficient
protection against selected insect pests, and transgenic plants
expressing such toxins have been commercialised, allowing farmers
to reduce applications of chemical insect control agents.
[0005] Recently, a new family of insecticidal proteins produced by
Bacillus sp. during the vegetative stages of growth (vegetative
insecticidal proteins (VIPs)) has been identified. U.S. Pat. Nos.
5,877,012, 6,107,279, and 6,137,033 describe vip3A toxin genes
isolated from Bacillus species. The VIP3A toxins possess
insecticidal activity against a wide spectrum of lepidopteran
insects including but not limited to fall armyworm, Spodoptera
frugiperda, black cutworm, Agrotis ipsilon, sugarcane borer,
Diatraea saccharalis, and lesser cornstalk borer, Elasmopalpus
lignosellus, and when expressed in transgenic plants, for example
cotton, confer protection on the plant from insect feeding
damage.
[0006] The cotton family, genus Gossypium, a member of the
Malvaceae, consists of 39 species, of which Gossypium hirsutum is
the most commonly cultivated species. Three other species are also
cultivated: G. arboreum, G. barbadense, and G. herbaceum. These
cultivated species are grown primarily for the seed hairs that are
made into textiles. Cotton is suitable as a textile fibre because
the mature dry hairs twist in such a way that fine strong threads
can be spun from them. Other products, such as cottonseed oil,
cake, and cotton linters are by-products of fibre production.
[0007] Damage to cotton crops by insect pests throughout the world
results in a significant yield loss each year. Effective control of
these pests to minimise yield loss is of great economic importance.
Examples of insect pests of cotton include Beet armyworm
(Spodoptera exigua), Boll weevil (Anthonomus grandis grandis),
Cabbage looper (Trichoplusia ni), Clouded plant bug (Neurocolpus
nubilus), Cotton aphid (Aphis gossypii), Cotton bollworm
(Heliocoverpa zea), Cutworms (Feltia subterranea, Peridroma saucia,
Agrotis ipsilon), European corn borer (Ostrinia nubilalis), Fall
armyworm (Spodoptera frugiperda), Seedling thrips (Frankliniella
spp.), Soybean looper (Pseudoplusia includens), Stink bugs (Nezara
viridula, Acrosternum hilare, Euschistus servus), Tarnished plant
bug (Lygus lineolaris), Tobacco budworm (Heliothis virescens) and
Whiteflies (Trialeurodes abutilonea, Bemisia tabaci).
[0008] Transformation and regeneration of cotton plants is now a
well-established procedure, typically based on Agrobacterium
tumefaciens mediated transfer of foreign DNA into cotton plant
parts and regeneration of said plant parts in tissue culture into
fully fertile, transgenic cotton plants.
[0009] There exists a requirement to generate a cotton plant that
is insect resistant so that yield loss through damage to cotton
crops by insect pests is reduced. An insect resistant cotton plant
could reduce the need to apply chemical pesticides, which may be
detrimental to other, beneficial insects and the environment.
Further, it is desirable to provide an insect resistant plant that
comprises a VIP gene, as an alternative to transgenic plants
comprising crystal proteins from Bacillus thuringiensis. This may
be of use in insect resistance management.
[0010] Therefore, the present invention relates to an insect
resistant transgenic cotton event, designated COT202. It also
relates to methods of detecting plant material derived therefrom.
"COT202 event" in the context of this application refers to the
original insecticidal transgenic cotton plant described herein.
"Insecticidal" as used herein refers to any inhibitory effect on an
insect, including but not limited to reduced feeding, retarded
growth, reduced fecundity, paralysis or death. "Fecundity"
comprises all aspects related to reproduction such as reproductive
ability, reproductive frequency and number of offspring. Also
embraced by this invention is any plant material derived from the
COT202 event, including seeds.
[0011] The COT202 event exhibits a novel genotype comprising at
least one expression cassette. The cassette comprises a suitable
promoter for expression in plants operably linked to a gene that
encodes a VIP3A insecticidal toxin, useful in controlling a wide
spectrum of lepidopteran insect pests, and a suitable
polyadenylation signal. Suitable promoters may be isolated from,
inter alia, plants. Numerous plant promoters have been isolated and
characterised including constitutive, switchable and/or tissue
specific promoters. Suitable promoters may be selected from the
following, non-limiting group: CaMV35S, FMV35S, Ubiquitin, Act2,
NOS, OCS, Cestrum yellow leaf curl virus promoter, Patatin, E9,
alcA/alcR switch, GST switch, RMS switch, oleosin, Gelvin, ribulose
bisphosphate carboxylase-oxygenase small sub-unit, actin 7, MR7
promoter (maize), Gos 9 (rice), GOS2 promoters, MasOcs (or super
promoter), RolD promoter (Agrobacterium rhizogenes), SuperMAS
promoter, and Suc2 promoter (Arabidopsis). In one embodiment of the
present invention, the promoter is the Ubiquitin promoter, UBQ3,
from Arabidopsis thaliana. Additional elements such as enhancer
sequences may also be incorporated into the expression cassette in
order to boost levels of gene expression, for example
transcriptional or translational enhancers, such as tobacco etch
virus (TEV) translation activator, CaMV35S enhancer, and FMV35S
enhancer. Alternatively it may be desirable to include a targeting
sequence, for example, to direct transportation of the VIP3A toxin
to a particular cellular compartment. For example if it is desired
to provide the protein outside of the cell then an extracellular
targeting sequence may be ligated to the polynucleotide encoding
the VIP protein. Other examples of targeting include targeting to a
specific intracellular organelle or compartment, for example to the
endoplasmic reticulum using a `KDEL` retention sequence. Numerous
polyadenylation signals have been isolated and characterised.
Examples of suitable polyadenylation signals functional in plants
include that from the nopaline synthase gene (nos) of Agrobacterium
tumefaciens, from the proteinase inhibitor II gene and from the
alpha-tubulin gene (EP-A 652,286). In one embodiment of the present
invention, the polyadenylation signal is that from the nos gene of
Agrobacterium tumefaciens.
[0012] According to the invention, the polynucleotide encoding the
VIP3A protein may also be codon-optimised or otherwise altered to
enhance for example, transcription once it is incorporated into
plant material. Such codon optimisation may also be used to alter
the predicted secondary structure of the RNA transcript produced in
any transformed cell, or to destroy cryptic RNA instability
elements present in the unaltered transcript, thereby increasing
the stability and/or availability of the transcript in the
transformed cell (Abler and Green (1996) Plant Molecular Biology
(32) pp. 63-78).
[0013] In a precursor to the COT202 event, a second cassette is
present that comprises a gene which, when expressed, can be used as
a selectable marker. Numerous selectable markers have been
characterised, including some that confer tolerance to antibiotics
and others that confer tolerance to herbicides. Examples of
suitable selectable marker genes include those that confer
tolerance to hygromycin, kanamycin or gentamycin. Further suitable
selectable markers include genes that confer resistance to
herbicides such as glyphosate-based herbicides or resistance to
toxins such as eutypine. Other forms of selection are also
available such as hormone based selection systems such as the Multi
Auto Transformation (MAT) system of Hiroyrasu Ebinuma et al. (1997)
PNAS Vol. 94 pp. 2117-2121; visual selection systems which use the
known green fluorescence protein, .beta. glucoronidase; and any
other selection system such as mannose isomerase (Positech.TM.),
xylose isomerase and 2-deoxyglucose (2-DOG). In one embodiment of
the present invention, the selectable marker gene is one that
confers tolerance to hygromycin. This second expression cassette is
useful for selecting transformants during and following plant
transformation. Optionally, it may be segregated away from the
COT202 event precursor after transformation to leave the COT202
event itself. The COT202 event per se does not comprise a
selectable marker cassette. Further expression cassettes are
optionally comprised in the COT202 event. For example these may
provide other desirable benefits such as herbicide resistance.
[0014] The expression cassettes may be introduced into the plant on
the same or different plasmids. If the expression cassettes are
present on the same plasmid and introduced into the plant via an
Agrobacterium-mediated transformation method, they may be present
within the same or different T-DNA regions. In one embodiment of
the present invention, two expression cassettes are present on
different T-DNA regions within the same plasmid.
[0015] According to the first aspect of the invention, there is
provided a polynucleotide comprising at least 17 contiguous
nucleotides from the 26-nucleotide sequence of SEQ ID NO: 1. In one
embodiment said polynucleotide comprises at least 18 contiguous
nucleotides from SEQ ID NO: 1. In a further embodiment said
polynucleotide comprises at least 20 contiguous nucleotides from
SEQ ID NO: 1. In a still further embodiment said polynucleotide
comprises at least 22 contiguous nucleotides from SEQ ID NO: 1. In
a further embodiment said polynucleotide comprises at least 23
contiguous nucleotides from SEQ ID NO: 1. In yet a further
embodiment said polynucleotide comprises at least 24 contiguous
nucleotides from SEQ ID NO: 1. In a further embodiment said
polynucleotide comprises at least 25 contiguous nucleotides from
SEQ ID NO: 1. In a still further embodiment there is provided a
polynucleotide comprising the sequence of SEQ ID NO: 1.
[0016] In a further aspect of the invention, there is provided a
polynucleotide comprising at least 17 contiguous nucleotides from
the 26-nucleotide sequence of SEQ ID NO: 2. In one embodiment said
polynucleotide comprises at least 18 contiguous nucleotides from
SEQ ID NO: 2. In a further embodiment said polynucleotide comprises
at least 20 contiguous nucleotides from SEQ ID NO: 2. In a still
further embodiment said polynucleotide comprises at least 22
contiguous nucleotides from SEQ ID NO: 2. In a further embodiment
said polynucleotide comprises at least 23 contiguous nucleotides
from SEQ ID NO: 2. In yet a further embodiment said polynucleotide
comprises at least 24 contiguous nucleotides from SEQ ID NO: 2. In
a further embodiment said polynucleotide comprises at least 25
contiguous nucleotides from SEQ ID NO: 2. In a still further
embodiment there is provided a polynucleotide comprising the
sequence of SEQ ID NO: 2.
[0017] In a further aspect of the present invention there is
provided a polynucleotide as described above further comprising the
sequence of SEQ ID NO: 7. In a further aspect of the present
invention there is provided a polynucleotide as described above
further comprising the sequence of SEQ ID NO: 8.
[0018] In another aspect of the present invention there is provided
a plant comprising a polynucleotide which comprises at least 17
contiguous nucleotides of SEQ ID NO: 1 and/or SEQ ID NO: 2. In one
embodiment said plant comprises at least 18 contiguous nucleotides
of SEQ ID NO: 1 and/or SEQ ID NO: 2. In a further embodiment said
plant comprises at least 20 contiguous nucleotides of SEQ ID NO: 1
and/or SEQ ID NO: 2. In a further embodiment said plant comprises
at least 22 contiguous nucleotides of SEQ ID NO: 1 and/or SEQ ID
NO: 2. In a further embodiment said plant comprises at least 23
contiguous nucleotides of SEQ ID NO: 1 and/or SEQ ID NO: 2. In a
still further embodiment said plant comprises at least 24
contiguous nucleotides of SEQ ID NO: 1 and/or SEQ ID NO: 2. In a
further embodiment said plant comprises at least 25 contiguous
nucleotides of SEQ ID NO: 1 and/or SEQ ID NO: 2. In yet a further
embodiment said plant comprises the sequence of SEQ ID NO: 1 and/or
SEQ ID NO: 2. In a further embodiment, said plant additionally
comprises the sequence of SEQ ID NO: 7. In a further embodiment
still, said plant additionally comprises the sequence of SEQ ID NO:
8. In one embodiment of the present invention, said plant is a
cotton plant. In a further embodiment, said plant is an
insecticidal cotton plant which is the COT202 event, or a plant
derived therefrom.
[0019] The skilled man is familiar with plant transformation
methods. In particular, two principal techniques have been
characterised across a wide range of plant species: transformation
by Agrobacterium and transformation by direct DNA transfer.
[0020] Agrobacterium-mediated transformation is a commonly used
method for transformation of dicotyledonous plants. The foreign DNA
to be introduced into the plant is cloned into a binary vector in
between left and right border consensus sequences. This is the
T-DNA region. The binary vector is transferred into an
Agrobacterium cell, which is subsequently used to infect plant
tissue. The T-DNA region of the vector comprising the foreign DNA
is inserted into the plant genome. The marker gene cassette and
trait gene cassette may be present on the same T-DNA region,
different T-DNA regions in the same vector, or even different T-DNA
regions in different vectors. In one embodiment of the present
invention, the cassettes are present on different T-DNA regions in
the same vector.
[0021] Alternatively, direct DNA transfer can be used to introduce
the DNA directly into a plant cell. One suitable method of direct
transfer may be bombardment of plant cells with a vector comprising
the DNA for insertion using a particle gun (particle-mediated
biolistic transformation); another established method, `whiskers`,
involves coating the DNA onto silicon carbide fibres onto which
cells are impaled. Other methods for transforming plant cells
include protoplast transformation (optionally in the presence of
polyethylene glycols); sonication of plant tissues, cells or
protoplasts in a medium comprising the polynucleotide or vector;
micro-insertion of the polynucleotide or vector into plant material
(optionally employing the known silicon carbide "whiskers"
technique), electroporation and the like.
[0022] Following transformation, transgenic plants must be
regenerated from the transformed plant tissue, and progeny
possessing the foreign DNA selected using an appropriate marker
such as resistance to hygromycin. The skilled man is familiar with
the composition of suitable regeneration media. The selectable
marker can be segregated away from transgenic events by
conventional plant breeding methods, thus resulting in, for
example, the COT202 event.
[0023] A plant of the invention, as described herein, has an
insecticidal effect on insects from one or more species from the
group comprising Heliothis sp., Helicoverpa sp. and Spodoptera sp.
which may infest it. "Infest" as used herein refers to attack,
colonisation, feeding or damage in any way by one or more insects.
Thus, for example, the plant of the present invention will provide
a self-defence mechanism against infestation by pest insects such
as Helicoverpa zea (cotton boll worm). As a result, a reduced
number of insecticide sprays are required during the cultivation of
said plant compared to a non-transgenic cotton plant of the same
variety and yield loss through insect pests is kept at a minimal
level.
[0024] The present invention is not limited to the COT202 event
itself, but is further extended to include any plant material
derived therefrom, including seeds in so far as they contain at
least one of the present inventive polynucleotides. The present
invention includes, but is not limited to plants that are derived
from a breeding cross with the COT202 event or a derivative
therefrom by conventional breeding or other methods. The invention
also includes plant material derived from the COT202 event that may
comprise additional, modified or fewer polynucleotide sequences
compared to the COT202 event or exhibit other phenotypic
characteristics. For example it may be desirable to transform plant
material derived from the COT202 event to generate a new event that
possesses an additional trait, such as a second insect resistance
gene. This process is known as gene stacking. The second insect
resistance gene may encode, for example insecticidal lectins,
insecticidal protease inhibitors and insecticidal proteins derived
from species of the Bacillus thuringiensis, Xenorhabdus
nematophilus, or Photorabdus luminescens. In one aspect, the second
insect resistance gene encodes an insecticidal gene from Bacillus
thuringiensis. Preferably, the second insect resistance gene
encodes a Cry gene from the bacterium Bacillus thuringiensis, which
Cry gene produces a toxin with a different mode of action or
binding site in the insect gut to VIP for the control of different
insect species. The Cry gene may, for example, be Cry 1 Ab.
[0025] The present invention further provides plant material
derived from the COT202 event which possesses an additional trait
such as herbicide resistance, nematode resistance or fungal
resistance. In one embodiment, said additional trait is herbicide
resistance. The herbicide resistance trait may be provided, for
example, by a herbicide degradation enzyme, or a target-site
specific resistant enzyme. In a further embodiment, said herbicide
resistance trait provides resistance to a herbicide which comprises
glyphosate acid or an agriculturally acceptable salt thereof. In a
further embodiment still, said herbicide resistance trait is
provided by a gene encoding EPSP synthase or a mutant thereof.
[0026] The present invention further provides a method of
controlling insects comprising providing the COT202 event or plant
material derived from the COT202 event at a locus where said
insects feed. The invention yet further provides a method of
controlling insects comprising providing the COT202 event or plant
material derived from the COT202 event at a locus where said
insects feed, and applying other agrochemicals to said plant
material such as herbicides, fungicides and other insecticidal
compounds including other insecticidal proteins. Examples of
possible insecticidal compounds include insecticidal lectins,
insecticidal protease inhibitors and insecticidal proteins derived
from species of the Bacillus thuringiensis, Xenorhabdus
nematophilus, or Photorabdus luminescens. Examples of possible
chemicals include pyrethroids, carbamates, imidacloprid,
organochlorines, and macromolecules such as spinosad, abamectin or
emamectin.
[0027] According to yet a further aspect of the present invention,
there is provided a method of detecting the COT202 event or plant
material derived from the COT202 transgenic event comprising
obtaining a sample for analysis; extracting DNA from the sample;
providing a pair of primers designed to bind to a polynucleotide
comprising at least 17 contiguous nucleotides of SEQ ID NO: 1
and/or SEQ ID NO: 2; amplifying the region which lies between the
sites at which the primers bind; and detecting the presence of the
amplification product. Suitable pairs of primers for use in this
method of detection can be designed using parameters well known to
those skilled in the art of molecular biology now that SEQ ID NOs 1
and 2 are made available. For example, one or both primers of the
pair may be designed to be vector-specific, trait gene specific,
promoter specific, and/or specific to the sequence of the junction
between the inserted DNA and the genomic DNA. Preferably one of the
primers is designed to be specific to the inserted sequence, and
the other primer specific to the genomic DNA upstream or downstream
of the insertion site. In one embodiment, the sequence of said
primers is depicted as SEQ ID NO: 3 and SEQ ID NO: 4.
[0028] In an embodiment of the present invention, the region
amplified by said method (the `amplicon`) is between 100 and 1000
base pairs in length. In a further embodiment the amplicon is
between 100 and 400 base pairs in length. In a still further
embodiment the amplicon is 181 base pairs in length. In a further
embodiment the amplicon is produced using the above method in
conjunction with the primers of the sequence of SEQ ID NO: 3 and
SEQ ID NO: 4, and is 181 base pairs in length. These primers are
specific for the COT202 event.
[0029] Alternative primers which may be used in combination to
detect the COT202 event include SEQ ID NOs 13 and 14 which are
specific for the COT202 event and produce an 86 bp amplicon, and
SEQ ID NOs 5 and 6 which are specific for the VIP gene and produce
a 556 bp amplicon.
[0030] There are many amplification methods that may be used in
accordance with this aspect of the invention. The underlying
principle, a known technique to those skilled in the art, is the
polymerase chain reaction (PCR). The amplification product from a
PCR reaction may be visualised by staining with ethidium bromide
and excitation with UV light, typically after size separation using
agarose gel electrophoresis.
[0031] An embodiment of the present invention employs variations of
the PCR principle such as TaqMan.TM.. This involves labelling at
least one of the primers involved in the amplification process with
a fluorescent dye. When unbound, the primer adopts a conformation
such that no fluorescence can be detected. However, when the primer
is bound to a piece of DNA, the conformation changes and
fluorescence can be detected. In this way, the amplification
process can be monitored in real-time, the intensity of
fluorescence corresponding directly to the level of amplification.
Suitable primers for use in TaqMan.TM. PCR are depicted as SEQ ID
NOs 13 to 15. These may be used in conjunction with internal
control primers such as those depicted as SEQ ID NOs 10 to 12.
TaqMan.TM. analysis may be useful for example, for detecting the
presence of the COT202 event in a background of wild type cotton,
or for detecting the adventitious presence of COT202 in other
germplasm. Further embodiments of the present invention include,
but are not limited to, RACE PCR.
[0032] A further embodiment of the present invention involves the
use of multiplex PCR for distinguishing between homozygous COT202
plant material and heterozygous COT202 plant material. This is
known to those skilled in the art as zygosity testing, and involves
the use of three PCR primers which bind to specific parts of the
cotton genome and/or inserted DNA. The presence or absence of each
of two amplification products of particular sizes indicates whether
the test sample is heterozygous or homozygous for COT202. Suitable
primers for use in such a zygosity test are depicted as SEQ ID NOs
16 to 18.
[0033] In another aspect of the invention there is provided a
method of detecting plant material derived from the COT202 event
comprising obtaining a sample for analysis; providing a probe
designed to bind to the complement of a polynucleotide which
comprises at least 17 contiguous nucleotides of SEQ ID NO: 1 and/or
SEQ ID NO: 2 when said polynucleotide is single stranded;
hybridising said probe with the sample; and detecting whether the
probe has hybridised. In one embodiment, said probe comprises the
sequence of SEQ ID NO: 1 and/or SEQ ID NO: 2. In an embodiment of
the present invention there is provided a method of detecting plant
material derived from the COT202 event using a probe comprising SEQ
ID NO: 7 or SEQ ID NO: 8. In one embodiment, said probe comprises
SEQ ID NO: 7. In a further embodiment, said probe consists of SEQ
ID NO: 7. In one embodiment, said probe comprises SEQ ID NO: 8. In
a further embodiment, said probe consists of SEQ ID NO: 8. The
probe may be, for example, a PCR product or restriction digestion
fragment. In a further embodiment, the probe as described herein
may be tagged with a fluorescent, radioactive, enzymatic or other
suitable label to enable hybridisation to be detected. The skilled
man will know how to design suitable probes, now that he has the
benefit of the present disclosure.
[0034] In a further embodiment of the present invention, there is
provided a method of hybridising a probe to the sample under
stringent conditions and detecting whether the probe has
hybridised. Stringent hybridisation conditions are well known to
the skilled man and comprise, for example: hybridisation at a
temperature of about 60.degree. C. in a solution containing
6.times.SSC, 0.01% SDS and 0.25% skimmed milk powder, followed by
rinsing at the same temperature in a solution containing
1.times.SSC and 0.1% SDS. More stringent hybridisation conditions
may comprise: hybridisation at a temperature of about 65.degree. C.
in a solution containing 6.times.SSC, 0.01% SDS and 0.25% skimmed
milk powder, followed by rinsing at the same temperature in a
solution containing 0.2.times.SSC and 0.1% SDS.
[0035] Suitable techniques for detecting plant material derived
from the COT202 event based on the hybridisation principle include,
but are not limited to Southern Blots, Northern Blots and in-situ
hybridisation. The skilled man is familiar with techniques such as
these. Typically, they involve incubating a probe with a sample,
washing to remove unbound probe, and detecting whether the probe
has hybridised. Said detection method is dependent on the type of
tag attached to the probe--for example, a radioactively labelled
probe can be detected by exposure to and development of x-ray film.
Alternatively, an enzymatically labelled probe may be detected by
conversion of a substrate to effect a colour change.
[0036] In a further aspect of the invention there is provided a
method of detecting plant material derived from the COT202 event
comprising obtaining a sample for analysis; providing an antibody
or binding protein designed to bind to a VIP protein contained
within a plant comprising at least 17 contiguous nucleotides from
SEQ ID NO: 1 and/or SEQ ID NO: 2; incubating said antibody or
binding protein with the sample; and detecting whether the antibody
or binding protein has bound. In one embodiment of the present
invention said VIP protein comprises the sequence of SEQ ID NO:
9.
[0037] Suitable methods of detecting plant material derived from
the COT202 event based on said antibody binding include, but are
not limited to Western Blots, Enzyme-Linked ImmunoSorbent Assays
(ELISA) and SELDI mass spectrometry. The skilled man is familiar
with these immunological techniques. Typical steps include
incubating a sample with an antibody that binds to the VIP protein,
washing to remove unbound antibody, and detecting whether the
antibody has bound. Many such detection methods are based on
enzymatic reactions--for example the antibody may be tagged with an
enzyme such as horse radish peroxidase, and on application of a
suitable substrate, a colour change detected. Suitable antibodies
may be monoclonal or polyclonal.
[0038] In another aspect of the invention there is provided a
method of detecting plant material derived from the COT202 event
comprising obtaining a sample for analysis; making a protein
extract of the sample; providing a test strip designed to detect
the presence of a VIP protein present within the sample; incubating
the test strip with the sample; and detecting whether VIP protein
is present. In one embodiment of the present invention said VIP
protein comprises the sequence of SEQ ID NO: 9.
[0039] An alternative antibody-based detection method for COT202
uses of dipsticks or test strips. Typical steps include incubating
a test strip with a sample and observing the presence or absence of
coloured bands on the test strip. The coloured bands are indicative
of the presence of a protein in the sample. Such dipstick or test
strip tests are protein specific, and may be used for rapid testing
of samples in the field.
[0040] In a further aspect of the present invention there is
provided a method of detecting plant material derived from the
COT202 event comprising obtaining a sample for analysis; subjecting
one or more insects of the species Spodoptera frugiperda
(susceptible to VIP3A) to the sample; subjecting one or more
insects of species Ostrinia nubilalis (not susceptible to VIP3A) to
the sample as a control; detecting whether the sample has an
insecticidal effect on insects from each species; and comparing the
results with an authentic COT202 bioassay profile. The results are
compared against an authentic COT202 bioassay profile that is
produced using insects of the same condition (including insect age
and culture conditions) which have been subjected to the same dose
and type of COT202 plant material (including plant age, plant
variety and tissue type) and where the insecticidal effect is
detected the same length of time after subjecting the insects to
the COT202 sample. Detection of an insecticidal effect may be, for
example, an assessment of insect mortality, or of the growth stage
of the insects. Spodoptera frugiperda is a positive control for
COT202 as it is susceptible to a suitable dose of VIP3A, while
Ostrinia nubilalis is a negative control for COT202 as it is not
susceptible to a suitable dose of VIP3A. Alternative insect species
that are either susceptible or not susceptible to VIP3A may be
substituted in an assay as described above as appropriate, provided
that the results are compared against an authentic profile
generated using the same insect species.
[0041] In one embodiment of the invention, the method of detecting
plant material derived from the COT202 event includes but is not
limited to leaf-feeding bioassays in which a leaf or other suitable
plant part from the COT202 event or any plant material derived from
the COT202 event, is infested with one or more pest insects.
Detection may be through assessment of damage to the leaf or plant
part after set time periods, assessment of mortality or another
insecticidal effect on the insects. Alternative plant parts which
may be used for such bioassays include bolls and squares. Such
bioassays may, for example, be carried out in the laboratory,
field, or glasshouse, and may be subject to natural or artificial
insect infestation.
[0042] In another aspect of the invention, there is provided a kit
of parts comprising a means for detecting the presence in a sample
of plant material derived from the COT202 event. Preferably, said
kit of parts comprises a means for detecting the presence in a
sample of a polynucleotide comprising at least 17 contiguous
nucleotides from the sequence of SEQ ID NO: 1 and/or SEQ ID NO: 2,
or a protein encoded by a polynucleotide as described above, or a
VIP protein. In an embodiment of the present invention, said kit of
parts may comprise DNA amplification-detection technology such as
PCR or TaqMan.TM.. In a further embodiment of the present
invention, said kit of parts may comprise probe
hybridisation-detection technology such as Southern Blots, Northern
Blots or in-situ Hybridisation. In another embodiment of the
present invention, said kit of parts may comprise antibody
binding-detection technology such as Western Blots, ELISA's, SELDI
mass spectrometry or test strips. In a further embodiment of the
present invention, said kit of parts may comprise insect
bioassay-detection technology such as leaf feeding bioassays or
mortality bioassays. Each of these detection technologies may be
used as described above. In a further embodiment of the present
invention, said kit of parts may comprise any combination of the
afore-mentioned detection technologies. In a still further
embodiment, said kit of parts may comprise in the form of
instructions one or more of the methods described above.
[0043] According to the present invention, there is provided the
use of one or more of the polynucleotides of the invention as
described above for detecting the COT202 event. In one embodiment,
said polynucleotides may be used in a method for detecting the
COT202 event as described above.
EXAMPLES
[0044] The invention will be further apparent from the following
non-limiting examples in conjunction with the associated sequence
listings as described below: [0045] SEQ ID NO 1: Polynucleotide
sequence which extends across the junction where the 5' end of the
COT202 insert is inserted into the cotton genome in event COT202.
[0046] SEQ ID NO 2: Polynucleotide sequence which extends across
the junction where the 3' end of the COT202 insert is inserted into
the cotton genome in event COT202. [0047] SEQ ID NOs 3-6:
Polynucleotide sequences suitable for use as primers in the
detection of the COT202 event. [0048] SEQ ID NOs 7-8:
Polynucleotide sequences suitable for use as probes in the
detection of the COT202 event. [0049] SEQ ID NO 9: Amino acid
sequence of the VIP3A toxin protein. [0050] SEQ ID NOs 10-15:
Polynucleotide sequences suitable for use as TaqMan.TM. primers in
the detection of the COT202 event. [0051] SEQ ID NOs 16-18:
Polynucleotide sequences suitable for use as primers in the
detection of the COT202 event via zygosity testing.
Example 1
Cloning and Transformation
[0052] 1.1 Vector Cloning
[0053] Standard gene cloning techniques of restriction digestion
and ligation of fragments from in-house vectors were used to
construct the transformation vector, pNOV103. The vector included a
selectable marker cassette comprising a Ubiquitin (UBQ3) promoter,
the UBQ3 intron, a gene sequence which encodes a protein conferring
resistance to hygromycin, and a nos polyadenylation sequence. The
vector also included the expression cassette of the target gene,
which cassette comprised a Ubiquitin (UBQ3) promoter, the UBQ3
intron, a sequence encoding the VIP3A gene that had been codon
optimised for expression in maize, and a nos polyadenylation
sequence. The selectable marker cassette and VIP3A containing
cassette were cloned between the left and right border sequences
within different T-DNA regions of vector pNOV103. The vector also
comprised a gene conferring resistance to an antibiotic, kanamycin,
for prokaryotic selection.
[0054] The vector was transformed into Agrobacterium tumefaciens
strain GV3101 using standard Agrobacterium transformation
techniques, and transformed cells selected through their resistance
to kanamycin.
[0055] 1.2 Plant Transformation
[0056] The COT202 event was produced by Agrobacterium-mediated
transformation of Gossypium hirsutum L. cv Coker 312.
[0057] Coker 312 seeds were sown in the glasshouse. Tender petioles
were cut from 3 to 5 weeks old plants, and sterilized by immersion
in 70% ethanol. The petioles were then immersed in a 5% Clorox+2
ml/L Tween 20 solution for 20 minutes. Petioles were washed 3 times
in ddH.sub.2O. The ends of petioles were cut off, and petioles
transferred to petiole pre-culture medium (4.3 g/L MS salts,
200.times.B5 vitamins, 30 g/L glucose, 2.4 g/L phytogel, pH 7.0)
and allowed to pre-culture in the light at 30.degree. C. for 3
days.
[0058] 2 ml cultures of Agrobacterium containing the pNOV103
construct were grown overnight in appropriate antibiotics and then
diluted with liquid MMS1 medium (4.3 g/L MS salts, 200.times.B5
vitamins, 0.05 mg/L 2,4-D, 0.1 mg/L kinetin, 30 g/L glucose, pH
6.5) to an OD.sub.660 of between 0.1 and 0.2.
[0059] The ends were cut off the petioles and placed in 3 to 5 ml
of bacterial solution in a sterile petri dish. Once in the
solution, the petioles were cut lengthwise and then cut into 2 cm
sections. After the petiole explants had soaked in bacterial
solution for 5 to 10 minutes, they were transferred to co-culture
plates, and allowed to co-culture at 24.degree. C. for 48 hours
under low light intensity. Co-cultured explants were transferred to
MMS1 medium (recipe as for MMS1 liquid medium, additionally with
2.4 g/L phytogel) containing 500 mg/L Cefotaxime and 10 mg/L
Hygromycin, and incubated at 30.degree. C. under a light cycle of
16 hours light and 8 hours dark. Explants were transferred to fresh
medium after 2 weeks, and every 4 to 6 weeks thereafter until
callus was formed.
[0060] Once calli were the size of a garden pea, they were removed
from the explants and transferred to fresh MMS1 medium containing
500 mg/L Cefotaxime and 10 mg/L Hygromycin, and maintained in
tissue culture by subculturing every 4 weeks as appropriate.
[0061] 1.5 g callus tissue was broken up thoroughly and placed in a
50 ml Erlenmeyer flask containing 10 ml of liquid MMS2 medium (4.3
g/L MS salts, 200.times.B5 vitamins, 1.9 g/L KNO.sub.3, 30 g/L
glucose, pH 6.5). The suspended callus was shaken at 100 rpm in the
light at 30.degree. C. until small white slightly round cell
clusters were visible. These clusters indicate that the tissue is
embryogenic. The suspension culture cells were rinsed 3 times in
MMS2 liquid medium, resuspended and plated onto solid MMS2 medium
(recipe as per liquid MMS2 medium, additionally with 2.4 g/L
phytogel). Once plated, excess liquid MMS2 medium was removed, and
the plates incubated at 30.degree. C. in the light. Plates were
checked for somatic embryo development each week. Somatic embryos
formed within 1 to 2 months. Somatic embryos were transferred to EG
(embryoid germination) medium (10.times.EG stock (consisting of
1.times.10 L pack of Musashige and Skoog Modified Basal Salt
Mixture (Sigma), 19 g KNO3, 50 ml 200.times.B5 vitamins, water to 1
L), 1 g/L glutamine, 0.5 g/L asparagine, recipe), and sub-cultured
to fresh EG medium every 3 to 4 weeks.
[0062] Once somatic embryos turned green and were larger than 2 cm,
they were plated root down in EG medium. At all stages of
regeneration, growing plantlets were prevented from reaching the
lids or sides of their containers. Germinated embryos with 1 to 2
true leaves were transferred to EG medium in 175 ml Greiners.
Strong plantlets with true leaves were transferred to sterile peat
plugs expanded with dH.sub.2O in 175 ml Greiners and transferred to
a growth cabinet under conditions of 14 hours daylight at
30.degree. C. and 10 hours darkness at 20.degree. C. Thereafter,
plantlets were transplanted into pots and grown in the
glasshouse.
[0063] 1.3 Identification and Selection of Transgenics
[0064] Putative transgenic plants were screened by PCR for the
presence of the VIP3A gene. Positive events were identified and
screened using insect bioassays for insecticidal activity against
Fall Armyworm (Spodoptera frugiperda) (see Example 7). Insecticidal
lines were characterized for copy number by TaqMan.TM. analysis
(see Example 2). T1 seed from several events were observed in a
field trial for insect resistance and agronomic quality. Two
events, COT202 and COT203, were chosen based on having a single
copy of the transgene, good protein expression as identified by
ELISA (see Example 4), good insecticidal activity against Cotton
Boll Worm (Helicoverpa zea) and field performance. The hygromycin
selectable marker cassette was segregated away using conventional
plant breeding to result in the COT202 event and the COT203
event.
[0065] 1.4 Verification of Sequence of COT202
[0066] Genomic DNA was isolated from the COT202 event. This was
used in the sequencing of the junctions of the DNA insertion site
with the cotton genomic DNA in the COT202 event, using standard DNA
sequencing techniques.
Example 2
COT202 Event Specific Detection via TaqMan.TM.
[0067] 2.1 DNA Extraction
[0068] DNA was extracted from leaf tissue using the Wizard.TM.
Magnetic 96 DNA Plant System (Promega, #FF3760), according to the
manufacturers instructions, with an additional step at the
beginning of the protocol: following grinding of the leaf material,
0.9 ml Cotton Extraction Buffer (0.2M Tris pH 8.0, 50 mM EDTA,
0.25M NaCl, 0.1% v/v 2-mercaptoethanol, 2.5% w/v
polyvinyl-pyrrolidone) was added to each well, the plant tissue
resuspended and the plate centrifuged at 4,000 rpm (2755 g) for 10
minutes. After aspirating and discarding the supernatant, 300 ul
Lysis Buffer A (Promega) was added and the manufacturers protocol
was followed from this point. This procedure resulted in
approximately 85 ul of purified genomic DNA at a concentration of
approximately 10 ng/ul.
[0069] 2.2 TaqMan.TM. PCR Reactions
[0070] TaqMan.TM. PCR reactions were setup using a standard
reaction mix comprising: [0071] 5 ul 2.times. Jumpstart Master Mix
for Q-PCR (Sigma, #P2893), supplemented with 15 mM MgCl.sub.2 and
200 nM Strata-ROX [0072] 0.2 ul 50.times. FAM primer/probe mix
[0073] 0.2 ul 50.times. VIC primer/probe mix [0074] 1.6 ul
Water.
[0075] 50.times. primer/probe mixes comprised 45 ul of each primer
at a concentration of 1 mM, 50 ul of the probe at a concentration
of 100 uM and 860 ul nuclease free water, and were stored in an
amber tube at 4.degree. C. Examples of suitable primer/probe
sequence combinations which were used are:
TABLE-US-00001 Primer Name Primer Sequence 5'-3' SEQ ID GhCHI2b-F
GGTCCCTGGATACGGTGTCA SEQ ID NO: 10 Forward GhCHI2b-R
TTGAGGGTTGGATCCTTTGC SEQ ID NO: 11 Reverse GhCHI2bNEW-VIC
CACCAACATCATCAATGGTGGCATCG SEQ ID NO: 12 Probe (5' label = VIC, 3'
label = TAMRA) COT202-F GGAATGTGGCGAATGGTGAT SEQ ID NO: 13 Forward
COT202-R TGTCGTTTCCCGCCTTCA SEQ ID NO: 14 Reverse COT202-FAM
CAAATTGCCCATTTCATTCATCCAAAAGC SEQ ID NO: 15 Probe (5' label = FAM,
3' label = TAMRA)
[0076] 7 ul of master mix was dispensed into each well of a
384-well TaqMan.TM. assay plate. 3 ul DNA template was added to the
appropriate wells. 3 ul of copy control dilution series was added
to specific wells as a control. The reactions were run in an
ABI7900HT (Applied Biosystems) using the following cycling
conditions:
TABLE-US-00002 Step Temperature Time 1 50.degree. C. 2 min 2
95.degree. C. 10 min 3 95.degree. C. 15 sec 4 60.degree. C. 1 min 5
Goto step 3, repeat 40 times
[0077] Data was analysed using SDS2.0 version A, software (Applied
Biosystems).
Example 3
COT202 Detection via Multiplex PCR Zygosity Test
[0078] 3.1 Genomic DNA Extraction
[0079] Genomic DNA from COT202 was extracted as described in
Example 2.1.
[0080] 3.2 Multiplex PCR
[0081] PCR primers were designed to bind to cotton genomic DNA
sequence upstream of the site at which the COT202 cassette inserted
(SEQ ID NO: 16); the cotton genomic DNA sequence downstream of the
site at which the COT202 cassette inserted (SEQ ID NO: 17); and the
COT202 cassette sequence itself (SEQ ID NO: 18). A 25 ul PCR
reaction was set up for each sample to be tested as follows: [0082]
1.times. JumpState ReadyMix REDTaq PCR (Sigma P-1107) [0083] 0.5 uM
primer 1 (SEQ ID NO: 16) [0084] 0.5 uM primer 2 (SEQ ID NO: 17)
[0085] 0.5 uM primer 3 (SEQ ID NO: 18) [0086] 0.2% BSA [0087] 20 ng
genomic DNA [0088] ddH2O to 25 ul
[0089] The PCR reactions were heated in a thermocycler at
94.degree. C. for 5 minutes, followed by 30 cycles as follows:
94.degree. C. for 30 seconds, 55.degree. C. for 45 seconds,
72.degree. C. for 1 minute. The reaction was completed by heating
at 72.degree. C. for 5 minutes.
[0090] 3.3 Analysis
[0091] PCR reactions were run on an agarose gel, and DNA bands
visualised under UV light after staining with ethidium bromide. The
presence of 2 bands indicated that the sample was from a COT202
heterozygote plant; 1 band of 181 bp in size indicated that the
sample was from a COT202 homozygote plant; and 1 band of
approximately 400 bp in size indicated that the sample was from a
homozygote wild type cotton plant.
[0092] 3.4 COT202 Detection via Standard PCR
[0093] As an alternative to the multiplex PCR, the COT202 event can
be detected in a simple PCR reaction using the primers depicted as
SEQ ID NO: 3 and 4, SEQ ID NO: 13 and 14, or SEQ ID NO: 16 and 18.
The composition of the PCR reaction mixture is the same as
described in example 3.2 above. The PCR reactions are heated in a
thermocycler at 94.degree. C. for 5 minutes, followed by 30 cycles
as follows: 94.degree. C. for 30 seconds, 55.degree. C. for 30
seconds, 72.degree. C. for 20 seconds. The reaction is completed by
heating at 72.degree. C. for 5 minutes. A DNA fragment of 181 bp,
86 bp or 181 bp in size respectively indicates the presence of the
COT202 event.
Example 4
COT202 Detection via Southern Blot
[0094] 4.1 DNA Extraction for Use in Southern Blotting
[0095] Approximately 2 to 3 g fresh weight of young leaf tissue was
ground in a chilled mortar and pestle to a fine powder and added to
15 ml of ice-cold Nuclei extraction buffer (0.35M glucose, 0.1 M
Tris-HCl pH8, 50 mM Na.sub.2EDTA, 2% Polyvinyl-pyrrolidone-10, 0.1%
ascorbic acid, 0.2% B-mercaptoethanol) in a labelled tube. The
sample was incubated on ice for 15-20 minutes. The tube was mixed
gently and centrifuged at 2700 g for 20 minutes at 4.degree. C. The
supernatant was discarded and 8 ml of nuclei lysis buffer (0.14M
sorbitol, 0.22M Tris-Cl pH8, 0.8M NaCl, 0.22M Na.sub.2EDTA, 0.8%
w/v CTAB, 1% Sarkosyl, 1% Polyvinyl-pyrrolidone-10, 0.1% ascorbic
acid, 0.2% B-mercaptoethanol, 5 .mu.g/ml proteinase K) was added.
After mixing, the tubes were incubated at 65.degree. C. for 30
minutes. 10 ml chloroform was added, and the tube mixed gently by
inversion until an emulsion formed followed by centrifugation at
4600 rpm for 10 minutes at room temperature.
[0096] The aqueous layer was removed into a new tube containing 10
.mu.l RNase A (10 mg sigma R4642), and the tube incubated for 30
minutes at 37.degree. C. The chloroform and centrifugation steps
were repeated once. The aqueous layer was removed into a new tube
containing 10 ml propan-2-ol. After approximately 15 minutes
incubation at room temperature, a gelatinous precipitate was
observed in the middle of the tube. The tube was mixed gently to
precipitate out the DNA. The DNA was spooled out using a sterile
loop into a falcon tube containing 70% ethanol. The DNA was
air-dried to remove the ethanol and resuspended in 200-400 .mu.l
TE.
[0097] 4.2 Alternative Method for DNA Extraction
[0098] 2-3 young cotton leaves (approximately 1 g fresh weight) are
ground to a paste in a mortar and pestle at room temperature, with
2 ml of grinding buffer (100 mM NaOAc pH 4.8, 50 mM EDTA pH8.0, 500
mM NaCl, 2% PVP (10,000 MW), 1.4 % SDS) and a little sand. The
ground tissue is transferred to a 15 ml falcon tube, and the
remnants in the mortar rinsed with 1 ml of grinding buffer into the
tube. The sample is incubated at 65.degree. C. for 15 minutes,
shaking occasionally. 4 ml 10M ammonium acetate is added, and the
sample mixed well and incubated at 65.degree. C. for 10 minutes to
precipitate proteins. The samples are incubated at room temperature
at 4600 rpm for 10 minutes. The aqueous phase is transferred to a
fresh 15 ml tube.
[0099] 0.6 volumes of cold isopropanol are added and the sample is
incubated at room temperature for approximately 30 minutes. After
mixing by slowly inverting the tube several times, the DNA is
spooled out and dissolved in 500 ul TE. 10 ul of 10 mg/ml RNAse are
added and incubated for 15 minutes at room temperature. Following
extraction with 500 ul of phenol:chloroform:isoamyl alcohol
(25:24:1), the sample is mixed gently and centrifuged at 13000 rpm
for 5 min.
[0100] The supernatant is transferred to a fresh tube using a fine
Pasteur pipette and re-extracted with chloroform:isoamyl alcohol
(24:1) as above. The supernatant is transferred to fresh tubes,
1/10 volume 3M NaOAc (pH4.8) added and mixed, and then one volume
cold isopropanol is added. The sample may be incubated at room
temperature for up to 30 minutes to precipitate the DNA. The DNA is
spooled out and resuspended in 70% ethanol. The DNA is air-dried to
remove the ethanol and resuspended in 200 ul water.
[0101] 4.3 Restriction Enzyme Digests
[0102] The DNA was quantified using a spectrophotometer and running
out on a gel. Suitable enzyme digests were prepared using 5 ug DNA
per digest in a total volume of 40 ul. Digests included HindIII,
XmaI, BamHI, NheI, and SacI, both alone and in combination. In
particular, a HindIII and XmaI double digest was used to detect the
intactness of the VIP3A gene; a NheI digest was used to detect
VIP3A locus number. Digests were incubated for 6 hours at the
appropriate temperature for each enzyme.
[0103] 4.4 Gel Electrophoresis
[0104] Bromophenol blue loading dye was added to each sample from
4.2 above, and each sample loaded on a 0.8% TBE agarose gel. The
gel was run at 50 volts overnight.
[0105] After running, the gel was washed in 0.25M HCl for 10
minutes to depurinate the DNA, incubated in denaturing solution
(0.5M NaOH, 1.5M NaCl) with gentle agitation for 30 minutes, rinsed
with distilled water and then incubated in neutralising solution
(0.5M Tris, 1.5M NaCl) for 30 minutes.
[0106] A Southern Blot was prepared as follows: A glass plate was
placed over a tray containing 20.times.SSC and a strip of 3M paper
was placed onto the glass plate such that both ends dipped into the
20.times.SSC solution (to act as a wick). A piece of 3M paper the
same size as the gel was placed on the wick, and the gel placed on
this. Strips of nescofilm were laid around the edges of the gel to
form a seal. A Hybond membrane was placed on top of the gel,
followed by two further pieces of 3M paper. Throughout the assembly
of the blot, care was taken to ensure that no air bubbles were
trapped between the membrane, gel and 3M paper. A 5 cm-10 cm stack
of absorbent paper towels was placed on top of the 3M paper and
held in place with a weight.
[0107] The DNA was allowed to transfer to the Hybond membrane
overnight. After transfer the Southern Blot stack was disassembled
and the DNA was bound to the membrane via UV cross-linking.
[0108] 4.5 Hybridisation
[0109] A suitable DNA probe was prepared by PCR or restriction
digest of binary plasmid. 25 ng probe DNA in 45 ul TE was boiled
for 5 minutes, placed on ice for 5 minutes then transferred to a
Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After
addition of 5 ul P32-labelled dCTP to the Rediprime tube, the probe
was incubated at 37.degree. C. for 1 hour. The probe was purified
by centrifugation through a microspin G-50 column (Amersham
Pharmacia Biotech, #27-5330-01) according to the manufacturers
instructions to remove unincorporated dNTPs. The activity of the
probe was measured roughly by comparing the amount of radioactive
component remaining in the column to the amount in the sample tube,
with a ratio of at least 50:50 being acceptable. The Hybond
membrane was pre-hybridised by wetting with 40 ml pre-warmed
Rapid-Hyb buffer (Amersham-Pharmacia), at 65.degree. C. for 30
minutes. The labelled probe was boiled for 5 minutes, and placed on
ice for 5 minutes. An appropriate amount of probe (1 million counts
per 1 ml pre-hybridisation buffer) was added to the
pre-hybridisation buffer and hybridisation occurred at 65.degree.
C. overnight. The following day, the hybridisation buffer was
discarded, and following a rinse with 50 ml 2.times.SSC/1% SDS
solution the membrane washed in 150 ml 2.times.SSC/1% SDS solution
at 65.degree. C. for 30-45 minutes. This process was repeated twice
with 0.1.times.SSC/1% SDS solution. The membrane was exposed to a
phosphor screen or X-ray film to detect where the probe had
bound.
Example 5
COT202 Detection via ELISA
[0110] 5.1 Protein Extraction
[0111] Cotton tissue for analysis was harvested and frozen at
-70.degree. C. Fresh tissue was ground to a fine powder and weighed
into a labelled polypropylene tube. Extraction buffer (100 mM Tris,
100 mM Sodium Borate, 5 mM MgCl, 0.05% Tween 20, 0.2% Sodium
Ascorbate, Water, pH 7.8, 1 mM AEBSF, 0.001 mM Leupeptin) was added
to the sample in a ratio of 2:1 (volume extraction buffer:sample
fresh weight) for fresh tissue or 30:1 (volume extraction
buffer:sample dry weight) for lyophilised tissue. The sample was
vortexed and homogenised using a Brinkman PT 10/35 Polytron
equipped with a PTA 10TS foam-reducing generator, until the mixture
became liquefied. Extracts were centrifuged at 10,000.times.g for
15 minutes. The protein extract supernatant was stored at
2-8.degree. C.
[0112] 5.2 ELISA Protocol
[0113] The ELISA procedure used standard techniques as follows. A
96-well plate was soaked in ethanol for 2 hours, and air-dried. The
plate was coated with 50 ul goat anti-VIP3A antibody per well and
incubated overnight at 2-8.degree. C. After washing three times
with 1.times.ELISA wash solution (100 mM Tris, 0.5% Tween-20, 75 mM
NaCl, pH8.5), the plate was dried briefly by tapping upside down on
a paper towel. 150 ul blocking solution (10 mM NaPO.sub.4, 140 mM
NaCl, 1% BSA, 0.02% Sodium Azide, titrated to pH7.4 with monobasic
NaPi and dibasic NaPi) was added to each well followed by
incubation at room temperature for 45 minutes. The plate was washed
3 times as described above.
[0114] VIP3A standards and protein extract samples were applied to
appropriate wells of the plate in triplicate, 50 ul total volume
per well. The plate was incubated at 2-8.degree. C. for 1 hour 30
minutes, followed by room temperature for a further 30 minutes. The
plate was washed three times with ELISA wash solution, and then
incubated at 35-39.degree. C. for 1 hour with 50 ul rabbit
anti-VIP3A antibody per well. The plate was washed three times with
ELISA wash solution, and incubated at room temperature for 30
minutes with 50 ul donkey anti-rabbit alkaline phosphatase per
well. Following a further three washes with ELISA wash solution, 50
ul phosphatase substrate solution was added per well and the plate
incubated for 30 minutes at room temperature. The reaction was
stopped by addition of 50 ul 3M NaOH per well. The absorbance of
the solution in each well was measured at 405 nm using a Ceres 900C
multiwell plate reader and the results analysed using KC3 Curve
fitting software (Bio-Tek Instruments Inc.). The concentration of
VIP3A in the samples was calculated by reference to the VIP3A
protein standards.
Example 6
COT202 Detection Via DipStick
[0115] 6.1 Protein Extraction
[0116] A piece of leaf tissue approximately 2 cm.sup.2 was placed
in a tube containing extraction buffer. A plastic stirrer was used
to extract protein from the tissue, by cutting into and mascerating
the tissue.
[0117] 6.2 Dipstick Test
[0118] A test strip was placed into the tube and incubated for 5 to
10 minutes for the result to develop. The test strip comprised a
first band at which anti-VIP3A antibody was bound, and a second
band at which a control antibody was bound. After incubation, a
double red line in the result window of the test strip indicated
that VIP3A was present. The lower line indicated the presence of
VIP3A protein while the upper line was a control indicating that
the assay was working correctly.
Example 7
COT202 Detection Via Insect Bioassay
[0119] 7.1 Leaf Biosassays
[0120] Leaf assays were performed on Fall Army Worm (Spodoptera
frugiperda), Cotton Boll Worm (Helicoverpa zea) and Tobacco Budworm
(Heliothis virescens) as follows: Pads were soaked with 300 ul to
500 ul distilled water and placed into Gelman dishes. Leaf pieces
measuring between approximately 0.5 square inches and 0.75 square
inches were excised from cotton plants 8 to 12 inches in height,
and placed on the pads. Between 8 and 10 insect larvae were placed
in each dish and a lid fitted. The dishes were incubated at
28.degree. C. On the third and sixth days after infestation, damage
to the leaf in each dish was scored and compared with the control
plants.
[0121] 7.2 Boll Bioassays
[0122] Four absorbent pads were saturated with water and placed
inside a large plastic cup. Three extra thick glass filters, each
soaked with 100 ul distilled water, were placed in a smaller
plastic cup, which was then seated inside the larger cup. A 1.25
inch long boll was excised, immersed in 10 mg/ml to 20 mg/ml
Nystatin and placed on the filters in the small cup. 50 insect
larvae were placed on the square or boll and a lid attached to the
larger cup. The squares or bolls were re-infested with 50 more
larvae after 7 days.
[0123] The experiment was incubated at room temperature for
approximately 3 weeks. The bolls were then cut open to determine
damage. Damage to the boll was compared to the control samples.
[0124] 7.3 Lyophilised Leaf Bioassays
[0125] Bioassays using freeze-dried leaf tissue were performed on
Heliothis virescens as follows:
[0126] Terminal leaves were snap-frozen on dry-ice at time of
picking and lyophilised overnight. The freeze dried tissue was
ground in a mortar and pestle to a fine powder and resuspended in
0.2% agar solution to make an 8% (0.08 g/ml) suspension of leaf
powder. The suspension was overlaid on top of artificial insect
diet in 96-well plates and left to dry. A single neonate insect
larva was introduced into each well and the plates sealed. The
plates were incubated at 28.degree. C. On the sixth day after
infestation, larval mortality was scored and compared with control
samples.
Example 8
COT202 Field Trials
[0127] 8.1 Field Trial Design
[0128] The efficacy of the COT202 event against Heliothis virescens
(Tobacco Bud Worm) and Helicoverpa zea (Cotton Boll Worm) was
tested by conducting field trials at three locations in the US,
namely Leland (Miss.), Quitman (Ga.) and Beasley (Tex.). Trials in
each location were set up using a randomised complete block design,
with four entry plots comprising four rows of 40 feet in length and
four repetitions per trial. Seed was planted to obtain a plant
stand of approximately 3 plants per foot of row length. Each field
trial included non transgenic Coker 312 plants for control
purposes, and two other transgenic events designated event A and
event B for comparison purposes.
[0129] 8.2 Field Trial Assessment
[0130] An assessment of the natural insect populations was made at
each trial location at the first white flower stage, approximately
80 days after planting. Where insect pressure was below the US
economic threshold of 10% damage, artificial infestation of Cotton
Boll Worm and Tobacco Bud Worm was made. The artificial infestation
method was designed to obtain a rate of 10 eggs per foot per insect
species. Assessment of damage to cotton squares and bolls was made
by visual inspection of 50 fruiting forms per plot at 5-7 days
after artificial infestation. When relying on a natural
infestation, damage ratings were made when the non transgenic Coker
312 control plants showed fruiting form damage above the economic
threshold level of 10% in all control plots.
[0131] 8.3 Field Trial Results
[0132] The results presented below show percentage damage to cotton
squares and bolls at each field trial location, for each plant
category. The data below represents an average of 200 fruiting
forms (squares or bolls) per event per trial. [0133] Location:
Leland, Miss.
TABLE-US-00003 [0133] Square Damage Boll damage Control 77 No data
COT202 event 6.6 No data Event A 3.6 No data Event B 29.6 No
data
[0134] Location: Quitman, Ga.
TABLE-US-00004 [0134] Square Damage Boll damage Control 80 52
COT202 event 2 0 Event A 1.5 0 Event B 24.5 2
[0135] Location: Beasley, Tex., USA
TABLE-US-00005 [0135] Square Damage Boll damage Control 24.4 13.2
COT202 event 4 2 Event A 2 1.2 Event C 5.2 3.2
Sequence CWU 1
1
18126DNAArtificial SequenceCOT202 nucleotide motif 1aacaaacaca
aaatcttttc accagt 26226DNAArtificial SequenceCOT202 nucleotide
motif 2ttcccgcctt cagattttct gcaaca 26323DNAArtificial
SequenceCOT202 nucleotide motif 3ggtgtccatc gggtagtcca taa
23424DNAArtificial SequenceCOT202 nucleotide motif 4tctatgttac
tagatcggga attg 24520DNAArtificial SequenceCOT202 nucleotide motif
5gatcggggtc aggaaggtct 20620DNAArtificial SequenceCOT202 nucleotide
motif 6cagcatcatg aacgagcact 207290DNAArtificial SequenceCOT202
nucleotide motif 7gacaaggaca gcttgagcga ggtgatctac ggcgacatgg
acaagctgct gtgtccggac 60cagagcgagc aaatctacta caccaacaac atcgtgttcc
cgaacgagta cgtgatcacc 120aagatcgact tcaccaagaa gatgaagacc
ctgcgctacg aggtgaccgc caacttctac 180gacagcagca ccggcgagat
cgacctgaac aagaagaagg tggagagcag cgaggccgag 240taccgcaccc
tgagcgcgaa cgacgacggc gtctacatgc cactgggcgt 29084382DNAArtificial
SequenceCOT202 nucleotide motif 8gatttggagc caagtctcat aaacgccatt
gtggaagaaa gtcttgagtt ggtggtaatg 60taacagagta gtaagaacag agaagagaga
gagtgtgaga tacatgaatt gtcgggcaac 120aaaaatcctg aacatcttat
tttagcaaag agaaagagtt ccgagtctgt agcagaagag 180tgaggagaaa
tttaagctct tggacttgtg aattgttccg cctcttgaat acttcttcaa
240tcctcatata ttcttcttct atgttacctg aaaaccggca tttaatctcg
cgggtttatt 300ccggttcaac attttttttg ttttgagtta ttatctgggc
ttaataacgc aggcctgaaa 360taaattcaag gcccaactgt tttttttttt
aagaagttgc tgttaaaaaa aaaaaaaggg 420aattaacaac aacaacaaaa
aaagataaag aaaataataa caattacttt aattgtagac 480taaaaaaaca
tagattttat catgaaaaaa agagaaaaga aataaaaact tggatcaaaa
540aaaaacatac agatcttcta attattaact tttcttaaaa attaggtcct
ttttcccaac 600aattaggttt agagttttgg aattaaacca aaaagattgt
tctaaaaaat actcaaattt 660ggtagataag tttccttatt ttaattagtc
aatggtagat actttttttt cttttcttta 720ttagagtaga ttagaatctt
ttatgccaag tattgataaa ttaaatcaag aagataaact 780atcataatca
acatgaaatt aaaagaaaaa tctcatatat agtattagta ttctctatat
840atattatgat tgcttattct taatgggttg ggttaaccaa gacatagtct
taatggaaag 900aatctttttt gaactttttc cttattgatt aaattcttct
atagaaaaga aagaaattat 960ttgaggaaaa gtatatacaa aaagaaaaat
agaaaaatgt cagtgaagca gatgtaatgg 1020atgacctaat ccaaccacca
ccataggatg tttctacttg agtcggtctt ttaaaaacgc 1080acggtggaaa
atatgacacg tatcatatga ttccttcctt tagtttcgtg ataataatcc
1140tcaactgata tcttcctttt tttgttttgg ctaaagatat tttattctca
ttaatagaaa 1200agacggtttt gggcttttgg tttgcgatat aaagaagacc
ttcgtgtgga agataataat 1260tcatcctttc gtctttttct gactcttcaa
tctctcccaa agcctaaagc gatctctgca 1320aatctctcgc gactctctct
ttcaaggtat attttctgat tctttttgtt tttgattcgt 1380atctgatctc
caatttttgt tatgtggatt attgaatctt ttgtataaat tgcttttgac
1440aatattgttc gtttcgtcaa tccagcttct aaattttgtc ctgattacta
agatatcgat 1500tcgtagtgtt tacatctgtg taatttcttg cttgattgtg
aaattaggat tttcaaggac 1560gatctattca atttttgtgt tttctttgtt
cgattctctc tgttttaggt ttcttatgtt 1620tagatccgtt tctctttggt
gttgttttga tttctcttac ggcttttgat ttggtatatg 1680ttcgctgatt
ggtttctact tgttctattg ttttatttca ggtggatcca ccatgaacaa
1740gaacaacacc aagctgagca cccgcgccct gccgagcttc atcgactact
tcaacggcat 1800ctacggcttc gccaccggca tcaaggacat catgaacatg
atcttcaaga ccgacaccgg 1860cggcgacctg accctggacg agatcctgaa
gaaccagcag ctgctgaacg acatcagcgg 1920caagctggac ggcgtgaacg
gcagcctgaa cgacctgatc gcccagggca acctgaacac 1980cgagctgagc
aaggagatcc ttaagatcgc caacgagcag aaccaggtgc tgaacgacgt
2040gaacaacaag ctggacgcca tcaacaccat gctgcgcgtg tacctgccga
agatcaccag 2100catgctgagc gacgtgatga agcagaacta cgccctgagc
ctgcagatcg agtacctgag 2160caagcagctg caggagatca gcgacaagct
ggacatcatc aacgtgaacg tcctgatcaa 2220cagcaccctg accgagatca
ccccggccta ccagcgcatc aagtacgtga acgagaagtt 2280cgaagagctg
accttcgcca ccgagaccag cagcaaggtg aagaaggacg gcagcccggc
2340cgacatcctg gacgagctga ccgagctgac cgagctggcg aagagcgtga
ccaagaacga 2400cgtggacggc ttcgagttct acctgaacac cttccacgac
gtgatggtgg gcaacaacct 2460gttcggccgc agcgccctga agaccgccag
cgagctgatc accaaggaga acgtgaagac 2520cagcggcagc gaggtgggca
acgtgtacaa cttcctgatc gtgctgaccg ccctgcaggc 2580ccaggccttc
ctgaccctga ccacctgtcg caagctgctg ggcctggccg acatcgacta
2640caccagcatc atgaacgagc acttgaacaa ggagaaggag gagttccgcg
tgaacatcct 2700gccgaccctg agcaacacct tcagcaaccc gaactacgcc
aaggtgaagg gcagcgacga 2760ggacgccaag atgatcgtgg aggctaagcc
gggccacgcg ttgatcggct tcgagatcag 2820caacgacagc atcaccgtgc
tgaaggtgta cgaggccaag ctgaagcaga actaccaggt 2880ggacaaggac
agcttgagcg aggtgatcta cggcgacatg gacaagctgc tgtgtccgga
2940ccagagcgag caaatctact acaccaacaa catcgtgttc ccgaacgagt
acgtgatcac 3000caagatcgac ttcaccaaga agatgaagac cctgcgctac
gaggtgaccg ccaacttcta 3060cgacagcagc accggcgaga tcgacctgaa
caagaagaag gtggagagca gcgaggccga 3120gtaccgcacc ctgagcgcga
acgacgacgg cgtctacatg ccactgggcg tgatcagcga 3180gaccttcctg
accccgatca acggctttgg cctgcaggcc gacgagaaca gccgcctgat
3240caccctgacc tgtaagagct acctgcgcga gctgctgcta gccaccgacc
tgagcaacaa 3300ggagaccaag ctgatcgtgc caccgagcgg cttcatcagc
aacatcgtgg agaacggcag 3360catcgaggag gacaacctgg agccgtggaa
ggccaacaac aagaacgcct acgtggacca 3420caccggcggc gtgaacggca
ccaaggccct gtacgtgcac aaggacggcg gcatcagcca 3480gttcatcggc
gacaagctga agccgaagac cgagtacgtg atccagtaca ccgtgaaggg
3540caagccatcg attcacctga aggacgagaa caccggctac atccactacg
aggacaccaa 3600caacaacctg gaggactacc agaccatcaa caagcgcttc
accaccggca ccgacctgaa 3660gggcgtgtac ctgatcctga agagccagaa
cggcgacgag gcctggggcg acaacttcat 3720catcctggag atcagcccga
gcgagaagct gctgagcccg gagctgatca acaccaacaa 3780ctggaccagc
accggcagca ccaacatcag cggcaacacc ctgaccctgt accagggcgg
3840ccgcggcatc ctgaagcaga acctgcagct ggacagcttc agcacctacc
gcgtgtactt 3900cagcgtgagc ggcgacgcca acgtgcgcat ccgcaactcc
cgcgaggtgc tgttcgagaa 3960gaggtacatg agcggcgcca aggacgtgag
cgagatgttc accaccaagt tcgagaagga 4020caacttctac atcgagctga
gccagggcaa caacctgtac ggcggcccga tcgtgcactt 4080ctacgacgtg
agcatcaagt aggagctcta gatccccgga atttccccga tcgttcaaac
4140atttggcaat aaagtttctt aagattgaat cctgttgccg gtcttgcgat
gattatcata 4200taatttctgt tgaattacgt taagcatgta ataattaaca
tgtaatgcat gacgttattt 4260atgagatggg tttttatgat tagagtcccg
caattataca tttaatacgc gatagaaaac 4320aaaatatagc gcgcaaacta
ggataaatta tcgcgcgcgg tgtcatctat gttactagat 4380cg
43829789PRTArtificial SequenceVIP3A protein motif 9Met Asn Lys Asn
Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe1 5 10 15Ile Asp Tyr
Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp20 25 30Ile Met
Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu35 40 45Asp
Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys50 55
60Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn65
70 75 80Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu
Gln85 90 95Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile
Asn Thr100 105 110Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met
Leu Ser Asp Val115 120 125Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln
Ile Glu Tyr Leu Ser Lys130 135 140Gln Leu Gln Glu Ile Ser Asp Lys
Leu Asp Ile Ile Asn Val Asn Val145 150 155 160Leu Ile Asn Ser Thr
Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile165 170 175Lys Tyr Val
Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr180 185 190Ser
Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu195 200
205Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp
Val210 215 220Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val
Met Val Gly225 230 235 240Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys
Thr Ala Ser Glu Leu Ile245 250 255Thr Lys Glu Asn Val Lys Thr Ser
Gly Ser Glu Val Gly Asn Val Tyr260 265 270Asn Phe Leu Ile Val Leu
Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr275 280 285Leu Thr Thr Cys
Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr290 295 300Ser Ile
Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val305 310 315
320Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr
Ala325 330 335Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val
Glu Ala Lys340 345 350Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser
Asn Asp Ser Ile Thr355 360 365Val Leu Lys Val Tyr Glu Ala Lys Leu
Lys Gln Asn Tyr Gln Val Asp370 375 380Lys Asp Ser Leu Ser Glu Val
Ile Tyr Gly Asp Met Asp Lys Leu Leu385 390 395 400Cys Pro Asp Gln
Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe405 410 415Pro Asn
Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys420 425
430Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr
Gly435 440 445Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu
Ala Glu Tyr450 455 460Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr
Met Pro Leu Gly Val465 470 475 480Ile Ser Glu Thr Phe Leu Thr Pro
Ile Asn Gly Phe Gly Leu Gln Ala485 490 495Asp Glu Asn Ser Arg Leu
Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg500 505 510Glu Leu Leu Leu
Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile515 520 525Val Pro
Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile530 535
540Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala
Tyr545 550 555 560Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala
Leu Tyr Val His565 570 575Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly
Asp Lys Leu Lys Pro Lys580 585 590Thr Glu Tyr Val Ile Gln Tyr Thr
Val Lys Gly Lys Pro Ser Ile His595 600 605Leu Lys Asp Glu Asn Thr
Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn610 615 620Asn Leu Glu Asp
Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr625 630 635 640Asp
Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu645 650
655Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu
Lys660 665 670Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr
Ser Thr Gly675 680 685Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu
Tyr Gln Gly Gly Arg690 695 700Gly Ile Leu Lys Gln Asn Leu Gln Leu
Asp Ser Phe Ser Thr Tyr Arg705 710 715 720Val Tyr Phe Ser Val Ser
Gly Asp Ala Asn Val Arg Ile Arg Asn Ser725 730 735Arg Glu Val Leu
Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val740 745 750Ser Glu
Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu755 760
765Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe
Tyr770 775 780Asp Val Ser Ile Lys7851020DNAArtificial
SequenceCOT202 nucleotide motif 10ggtccctgga tacggtgtca
201120DNAArtificial SequenceCOT202 nucleotide motif 11ttgagggttg
gatcctttgc 201226DNAArtificial SequenceCOT202 nucleotide motif
12caccaacatc atcaatggtg gcatcg 261320DNAArtificial SequenceCOT202
nucleotide motif 13ggaatgtggc gaatggtgat 201418DNAArtificial
SequenceCOT202 nucleotide motif 14tgtcgtttcc cgccttca
181529DNAArtificial SequenceCOT202 nucleotide motif 15caaattgccc
atttcattca tccaaaagc 291623DNAArtificial SequenceCOT202 nucleotide
motif 16ggtgtccatc gggtagtcca taa 231724DNAArtificial
SequenceCOT202 nucleotide motif 17tgagtaggag atgtaagttg gcgc
241824DNAArtificial SequenceCOT202 nucleotide motif 18tctatgttac
tagatcggga attg 24
* * * * *