U.S. patent application number 11/662506 was filed with the patent office on 2009-07-02 for small interfering rnas that efficiently inhibit viral expression and methods of use thereof.
This patent application is currently assigned to SomaGenics Inc.. Invention is credited to Heine Ilves, Brian H. Johnston, Roger L. Kaspar, Attila A. Seyhan, Alexander V. Vlassov.
Application Number | 20090170794 11/662506 |
Document ID | / |
Family ID | 36060681 |
Filed Date | 2009-07-02 |
United States Patent
Application |
20090170794 |
Kind Code |
A1 |
Kaspar; Roger L. ; et
al. |
July 2, 2009 |
Small interfering rnas that efficiently inhibit viral expression
and methods of use thereof
Abstract
The invention provides methods, compositions, and kits
comprising small interfering RNA (shRNA or siRNA) which are useful
for inhibition of viralmediated gene expression. Small interfering
RNAs as described herein may be used in methods of treatment of HCV
infection. ShRNA and siRNA constructs that target the internal
ribosome entry site (IRES) sequence of HCV are described.
Inventors: |
Kaspar; Roger L.; (Santa
Cruz, CA) ; Ilves; Heine; (Santa Cruz, CA) ;
Seyhan; Attila A.; (Lafayette, CO) ; Vlassov;
Alexander V.; (Santa Cruz, CA) ; Johnston; Brian
H.; (Scotts Valley, CA) |
Correspondence
Address: |
WILMERHALE/BOSTON
60 STATE STREET
BOSTON
MA
02109
US
|
Assignee: |
SomaGenics Inc.
Santa Cruz
CA
|
Family ID: |
36060681 |
Appl. No.: |
11/662506 |
Filed: |
September 12, 2005 |
PCT Filed: |
September 12, 2005 |
PCT NO: |
PCT/US05/32768 |
371 Date: |
October 12, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60608574 |
Sep 10, 2004 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/235.1; 536/24.5 |
Current CPC
Class: |
A61P 31/14 20180101;
C12N 2770/24211 20130101; A61P 1/16 20180101; C12N 15/1131
20130101; C12N 2310/53 20130101; C12N 2310/14 20130101; C12N
2770/36111 20130101; C12N 2310/111 20130101 |
Class at
Publication: |
514/44 ;
435/235.1; 536/24.5 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C12N 7/01 20060101 C12N007/01; C07H 21/02 20060101
C07H021/02 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made in part during work supported by
grant no. 5R43AI056611 from the National Institutes of Health. The
government may have certain rights in the invention.
Claims
1. A method of inhibiting gene expression in a virus, comprising
introducing a small interfering RNA into a virus-containing cell,
wherein said small interfering RNA comprises a sequence that is at
least partially complementary to a polynucleotide sequence of the
virus, wherein interaction of said at least partially complementary
sequence of the small interfering RNA with said polynucleotide
sequence of the virus results in inhibition of gene expression in
the virus.
2. A method according to claim 1, wherein the small interfering RNA
is a shRNA.
3. A method according to claim 1, wherein the small interfering RNA
is an siRNA.
4. A method according to any of claims 1-3, wherein the small
interfering RNA recognizes a viral sequence of about 19 to about 30
nucleotides.
5. A method according to claim 1, wherein the virus is a hepatitis
C virus.
6. A method according to claim 5, wherein the small interfering RNA
interacts with a sequence within the internal ribosome entry site
(IRES) sequence of the hepatitis C virus.
7. A method according to claim 6, wherein the IRES sequence
comprises the sequence depicted in SEQ ID NO:11.
8. A method according to claim 7, wherein the small interfering RNA
recognizes a sequence of about 19 to about 30 nucleotides within
the region depicted in SEQ ID NO:26.
9. A method according to any of claims 5-8, wherein the small
interfering RNA is a shRNA.
10. A method according to claim 9, wherein the shRNA comprises a
sequence selected from the group consisting of SEQ ID NO:12, SEQ ID
NO:17, SEQ ID NO:18, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID
NO:33.
11. A method according to claim 10, wherein the shRNA has the
sequence depicted in SEQ ID NO:12.
12. A method according to any of claim 5-8, wherein the small
interfering RNA is a siRNA.
13. A method according to claim 12, wherein the siRNA comprises a
sequence selected from the group consisting of SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID
NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
14. A method of treating a viral infection in a mammal, said method
comprising administering to the mammal a composition comprising a
therapeutically effective amount of a small interfering RNA that
comprises a sequence that is at least partially complementary to a
polynucleotide sequence of the virus, wherein interaction of said
at least partially complementary sequence of the small interfering
RNA with said polynucleotide sequence of the virus results in
inhibition of gene expression in the virus.
15. A method according to claim 14, wherein the small interfering
RNA is an shRNA.
16. A method according to claim 14, wherein the small interfering
RNA is an siRNA.
17. A method according to any of claims 14-16, wherein the small
interfering RNA recognizes a viral sequence of about 19 to about 30
nucleotides.
18. A method according to claim 14, wherein said mammal is a human
and the viral infection comprises a hepatitis C virus.
19. A method according to claim 18, wherein the small interfering
RNA comprises a sequence that is at least partially complementary
to a polynucleotide sequence within the IRES sequence of the
hepatitis C virus.
20. A method according to claim 19, wherein the IRES sequence
comprises the sequence depicted in SEQ ID NO:11.
21. A method according to claim 20, wherein the small interfering
RNA binds recognizes a sequence of about 19 to about 30 nucleotides
within the region depicted in SEQ ID NO:26.
22. A method according to any of claims 18-21, wherein the small
interfering RNA is an shRNA.
23. A method according to claim 22, wherein the shRNA comprises a
sequence selected from the group consisting of SEQ ID NO:12, SEQ ID
NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ
ID NO:22, SEQ NO: 23, SEQ ID NO:24, and SEQ ID NO:25, SEQ ID NO:27,
SEQ ID NO:32, and SEQ ID NO:33.
24. A method according to claim 23, wherein the shRNA has the
sequence depicted in SEQ ID NO:12.
25. A method according to any of claim 18-21, wherein the small
interfering RNA is a siRNA.
26. A method according to claim 25, wherein the siRNA comprises a
sequence selected from the group consisting of SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, and
SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
27. A composition comprising a shRNA comprising a sequence selected
from the group consisting of SEQ ID NO:12, SEQ ID NO:17, SEQ ID
NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ
NO: 23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and
SEQ ID NO:33.
28. A composition comprising a siRNA comprising a sequence selected
from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID
NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID NO:25, and
SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
29. A pharmaceutical composition comprising a shRNA according to
claim 27 and a pharmaceutically acceptable excipient.
30. A pharmaceutical composition comprising a siRNA according to
claim 28 and a pharmaceutically acceptable excipient.
31. A kit comprising a shRNA and instructions for use in a method
according to any of claims 1, 5-8, 14, and 18-21.
32. A kit according to claim 31, wherein the shRNA comprises a
sequence selected from the group consisting of SEQ ID NO:12, SEQ ID
NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ
ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ
ID NO:32, and SEQ ID NO:33.
33. A kit comprising a siRNA and instructions for use in a method
according to any of claims 1, 5-8, 14, and 18-21.
34. A kit according to claim 33, wherein the siRNA comprises a
sequence selected from the group consisting of SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID
NO:25, and SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
35. A method according to claim 18, wherein said hepatitis C virus
is genotype 1a.
36. A method according to claim 14, wherein said mammal is a human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. .sctn.
119 of U.S. Provisional Application No. 60/608,574, filed Sep. 10,
2004, which is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0003] The invention relates to inhibition of viral gene
expression, for example, hepatitis C IRES-mediated gene expression,
with small interfering RNA (shRNA and siRNA).
BACKGROUND OF THE INVENTION
[0004] Treatment and prevention of Hepatitis C virus (HCV)
infections remains a major challenge for controlling this worldwide
health problem; existing therapies are only partially effective and
no vaccine is currently available. Hepatitis C(HCV) virus infects
more than 170 million people worldwide and is the leading cause of
liver transplants. Existing treatments, including ribavirin and
pegylated interferon alpha, are effective only in approximately 50
percent of patients and have substantial side effects. The
development of more effective HCV treatments is hampered by the
lack of a good small animal model, the inability to stably culture
the virus in tissue culture cells, and the high viral mutation rate
[1-3]. The availability of an HCV replicon system has allowed the
study of HCV replication, host-cell interactions and evaluation of
anti-viral agents, and more recently, a transgenic chimeric
humanized mouse liver model was developed that allows full HCV
infection [4-7]. Moreover, the use of in vivo imaging of HCV
IRES-dependent reporter systems has facilitated efficient
evaluation of delivery and inhibition by anti-HCV agents in mouse
liver over multiple timepoints using the same animals [8].
[0005] RNA interference is an evolutionarily conserved pathway that
leads to down-regulation of gene expression. The discovery that
synthetic short interfering RNAs (siRNAs) of .about.19-29 bp can
effectively inhibit gene expression in mammalian cells and animals
without activating an immune response has led to a flurry of
activity to develop these inhibitors as therapeutics [9]. Chemical
stabilization of siRNAs results in increased serum half life [10],
suggesting that intravenous administration may achieve positive
therapeutic outcomes if delivery issues can be overcome.
Furthermore, small hairpin RNAs (shRNA) have also shown robust
inhibition of target genes in mammalian cells and can be easily
expressed from bacteriophage (e.g. T7, T3 or SP6) or mammalian (pol
III such as U6 or H1 or polII) promoters, making them excellent
candidates for viral delivery [11].
[0006] A substantial effort has been made to find effective nucleic
acid-based inhibitors against HCV, as existing treatments are not
fully effective (reviewed in [4, 12]). These efforts include
traditional antisense oligonucleotides, phosphorodiamidate
morpholino oligomers [8], ribozymes and more recently siRNAs. A
number of research groups have shown that siRNAs can effectively
target HCV in human tissue culture cells [13-19] and in animal
systems [20]. However, there have not been reports of the effects
of shRNAs in animals.
BRIEF SUMMARY OF THE INVENTION
[0007] The invention provides methods, compositions, and kits for
inhibition of IRES-mediated gene expression in a virus.
[0008] For the inhibitory RNA sequences listed in FIG. 4A, a
complementary sequence is implied, as are sequences unrelated to
the target that may be appended one or both ends of each strand,
for example the 3' ends, as will be familiar to one skilled in the
art. The inhibitory (antisense recognition) sequences shown in FIG.
4A and in Table 1 can be incorporated into either shRNA or siRNA.
In the cse of shRNA, the sequence shown is additionally linked to
its complementary sequence by a loop comprised of nucleotide
residues usually unrelated to the target. An example of such a loop
is shown in the shRNA sequences depicted FIGS. 1B and 1C. In the
case of both siRNAs and shRNAs, the strand complementary to the
target generally is completely complementary, but in some
embodiments may contain mismatches (see, for example, SEE SEQ ID
NOS: 13,14, and 15), and can be adjusted in sequence to match
various genetic variants or phenotypes of the virus being targeted.
The strand homologous to the target can differ in about 0 to 5
sites by having mismatches, insertions, or deletions of from about
1 to about 5 nucleotides, as is the case for example with natural
microRNAs.
[0009] In one aspect, the invention provides a composition
comprising at least one small interfering RNA which is at least
partially complementary and capable of interacting with a
polynucleotide sequence of a virus, wherein inhibition of viral
gene expression results from the interaction of the small
interfering RNA with the viral target sequence. In one embodiment,
the composition comprises at least one shRNA, for example,
comprising, consisting of, or consisting essentially of a sequence
selected from the group consisting of SEQ ID NO:12, SEQ ID NO:16,
SEQ ID NO:17, and SEQ ID NO:18, or comprising or consisting
essentially of a sequence selected from the group consisting of SEQ
ID NO:27, SEQ ID NO:32, and SEQ ID NO:33. In one embodiment, the
shRNA comprises, consists of, or consists essentially of the
sequence depicted in SEQ ID NO:12. In another embodiment, the
composition comprises at least one siRNA. In one embodiment, the
composition comprises at least one siRNA or shRNA, for example,
comprising or consisting essentially of a sequence selected from
the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:23, SEQ ID NO:24, SEQ ID
NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33. In some
embodiments, the small interfering RNA, e.g., shRNA or siRNA,
interacts with a viral sequence of about 19 to about 30
nucleotides, or about 19 to about 25 nucleotides, for example, any
of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
nucleotides. In some embodiments, the small interfering RNA binds
to a hepatitis C virus sequence. In one embodiment, the small
interfering RNA binds to a sequence within the internal ribosome
entry site (IRES) sequence of a hepatitis C virus, preferably to
the sequence depicted in SEQ ID NO:26 (residues 344-374 of SEQ ID
NO:11). In one embodiment, the hepatitis C virus is HCV genotype
1a. In some embodiments, compositions of the invention comprise a
pharmaceutically acceptable excipient, for example, water or
saline, and optionally are provided in a therapeutically effective
amount. In one embodiment, the composition is a pharmaceutical
composition comprising, consisting of, or consisting essentially of
at least one shRNA or siRNA as described herein and a
pharmaceutically acceptable excipient.
[0010] In another aspect, the invention provides a kit comprising
any of the compositions described above, and optionally further
comprising instructions for use in a method of inhibiting gene
expression in a virus or treating a viral infection in an
individual as described herein. In one embodiment, the kit is for
use in a method for treating HCV infection in an individual, such
as a human, and comprises an shRNA comprising, consisting of, or
consisting essentially of a sequence selected from the group
consisting of SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:17, SEQ ID
NO:18, or comprising or consisting essentially of a sequence
selected from the group consisting of SEQ ID NO:27, SEQ ID NO:32,
and SEQ ID NO:33 or an siRNA comprising or consisting essentially
of a sequence selected from the group consisting of SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID
NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and
SEQ ID NO:33, and optionally further comprises instructions for use
in a method of inhibiting gene expression in a hepatitis C virus,
such as HCV genotype 1a, or instructions for use in a method of
treating a hepatitis C (such as HCV genotype 1a) viral infection in
an individual, such as a human.
[0011] In another aspect, the invention provides a method for
treatment of a viral infection in an individual, such as a mammal,
for example, a human, comprising administering to the individual a
therapeutically effective amount of a small interfering RNA, such
as shRNA or siRNA, that is at least partially complementary to and
capable of binding to a polynucleotide sequence of the virus and a
pharmaceutically acceptable excipient, wherein binding of the small
interfering RNA to the viral polynucleotide sequence inhibits gene
expression in the virus. In one embodiment, the viral infection
comprises a hepatitis C virus, such as HCV genotype 1a. In some
embodiments, the virus is selected from the group consisting of
hepatitis C genotypes 1a, 1b, 2a, and 2b. In some embodiments, the
small interfering RNA comprises, consists of, or consists
essentially of any of the shRNA or siRNA sequences described herein
as well as sequences located within 5 nt of one of the siRNA or
shRNA sequences described herein. In some embodiments, the small
interfering RNA binds to a viral sequence of about 19 to about 30
nucleotides, or about 19 to about 25 nucleotides, for example, any
of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
nucleotides. In one embodiment, the virus is a hepatitis C virus,
such as HCV genotype 1a. In one embodiment, the small interfering
RNA binds to a sequence of about 19 to about 25 nucleotides within
the IRES region of HCV 1a depicted in SEQ ID NO:26. Treatment may
include therapy (e.g., amelioration or decrease in at least one
symptom of infection) or cure. In some embodiments, the shRNA is
administered parenterally, for example, by intravenous
injection.
[0012] In another aspect, the invention provides a method of
inhibiting gene expression in a virus, comprising contacting the
virus with a small interfering RNA or introducing a small
interfering RNA into a virus-containing cell, wherein the small
interfering RNA, e.g., shRNA or siRNA, contains a sequence that is
at least partially complementary to a polynucleotide sequence of
the virus and capable of inhibiting viralgene expression, for
example, by inducing cleavage of viral polynucleotide sequences. In
some embodiments, the small interfering RNA comprises, consists of,
or consists essentially of any of the shRNA or siRNA sequences
described herein. In some embodiments, the small interfering RNA
binds to a viral sequence of about 19 to about 30 nucleotides, or
about 19 to about 25 nucleotides, for example, any of about 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In one
embodiment, the virus is a hepatitis C virus, such as HCV 1a. In
one embodiment, the small interfering RNA binds to a sequence of
about 19 to about 30 nucleotides within the IRES region of HCV
genotype 1a depicted in SEQ ID NO:26 as well as sequences located
within 5 nt of one of the siRNA or shRNA sequences described
herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1. Inhibition of HCV IRES-dependent gene expression in
293FT tissue culture cells. FIG. 1A depicts the IRES nucleotide
sequence of Hepatitis C genotype 1a (see GenBank accession
#AJ242654). Sequence 344-374, the target region of many of the
inhibitors described herein, is underlined. Various regions
(indicated in bold) have been successfully targeted by inhibitors,
including Heptazyme ribozyme (www.sirna.com; positions 189-207),
Chiron 5U5 siRNA [25] (positions 286-304), ISIS 14803
phosphorothioate antisense oligonucleotide [34] (positions
330-349), Mizusawa 331 siRNA [15] (positions 322-340) and a
phosphorodiamidate morpholino oligomer [8, 35] (positions 344-363).
A more complete list of siRNAs that have been tested to
down-regulate the HCV IRES and other HCV elements can be found in
[2, 3]. FIG. 1B depicts RNA sequences of shRNA HCVa-wt and mutated
variants thereof resulting from pol III transcription from a U6
promoter of corresponding DNA templates. Two base pairs
(underlined) of HCVa-wt were altered to create versions of HCVa-wt
containing 1 (HCVSNP1 or HCVSNP2) or 2 mismatches (HCVa-mut) shRNAs
as shown. FIG. 1C depicts the sequences of shRNAs HCVb-wt, HCVc-wt,
and HCVd-wt. FIG. 1D depicts the secondary structure of the HCV
IRES with indicated target sites for shRNA HCVa-wt, HCVb-wt,
HCVc-wt, and HCVd-wt. FIG. 1E schematically depicts the pcDNA3/HCV
IRES dual luciferase reporter construct used to produce the HCV
IRES target as well as the EMCV IRES control, which has the IRES
from encephalomyocarditis virus replacing the HCV IRES and
therefore lacks any target for the HCV-directed shRNAs. In each
case, firefly luciferase expression is dependent on initiation of
translation from the IRES sequence, whereas Renilla luciferase is
expressed in a cap-dependent manner. FIG. 1F depicts the results of
a screen of shRNAs for the ability to inhibit HCV IRES-mediated
gene expression in 293FT cells. 293FT cells were cotransfected with
pCDNA3/HCV IRES dual luciferase reporter construct, pSEAP2 (as a
transfection and specificity control), and an shRNA (at 1 nM) in a
well of a 24-well tissue culture plate. Plasmid pUC18 was added to
provide a total of 800 ng nucleic acid per well. 48 hours
post-transfection, cells were lysed and firefly luciferase activity
was measured by a luminometer. All data are the results of
individual, independent experiments performed in triplicate, and
normalized to SEAP.
[0014] FIG. 2. Specificity and potency of inhibition of HCV
IRES-mediated gene expression by shRNAs in 293FT cells. 293FT cells
were cotransfected with dual luciferase reporter and SEAP
expressing plasmids as well as 1 pmole of in vitro-transcribed
shRNAs. FIG. 2A depicts inhibition of HCV-IRES driven gene
expression. The target plasmid was pCDNA3/HCV IRES dual luciferase
reporter (HCV IRES, as shown in FIG. 1E). pUC18 plasmid was added
to the transfection mix to give a final total nucleic acid
concentration of 800 ng per transfection per well (24-well tissue
culture plates). 48 hours later, supernatant was removed for SEAP
analysis, then cells were lysed and firefly and renilla (not shown)
luciferase activity measured as described in Example 1. Firefly
luciferase and SEAP activities were normalized to 100. FIG. 2B
shows that HCVa-wt shRNA does not inhibit a similar target lacking
the HCV IRES. Cells were transfected as in FIG. 2A except that
pCDNA3/EMCV dual luciferase reporter (EMCV IRES) was used as target
in place of pCDNA3/HCV. The data are presented as luciferase
activity divided by SEAP activity normalized to 100. FIG. 2C shows
the effect of single-base mismatches on potency of shRNAs.
Experimental conditions were as described in FIG. 2A. SNP1 and SNP2
contain mutated base pairs as shown in FIG. 1B. FIG. 2D shows dose
response of inhibition of HCV-IRES-driven gene expression by
HCVa-wt and mutated (HCVa-mut) or control (229) shRNAs.
Experimental conditions were as described in FIG. 2A. The data are
represented as luciferase divided by SEAP normalized to 100. All
data are the results of individual, independent experiments
performed in triplicate. FIG. 2E shows dose response of HCVa-wt,
HCVa-mut), and 229 shRNAs on gene expression from dual-luciferase
reporter lacking shRNA target sites. The procedure was as described
in FIG. 2D except target was firefly luciferase driven by EMCV IRES
instead of HCV IRES. FIG. 2F shows that shRNAs cause destruction of
target RNA. A northern blot analysis of co-transfected 293FT cells
was performed as follows: 10 .mu.g of total RNA isolated from cells
transfected with no inhibitor (lane 1), 229 (lane 2) HCVa-wt (lane
3), or HCVa-mut (lane 4) were separated by denaturing gel
electrophoresis, transferred to membrane and hybridized
sequentially to .sup.32P-labeled fLuc, SEAP, or elongation factor
1A (EF1A) cDNA probes. The RNA blot was exposed to a storage
phosphor screen for visualization and quantitation (BioRad FX
Molecular Imager).
[0015] FIG. 3. Inhibition of HCV IRES-mediated gene expression by
HCV shRNAs in the human hepatocyte cell line Huh7. Inhibition was
measured as described in FIG. 2D except that Huh7 cells were used.
FIG. 3A depicts dose response to HCVa-wt and HCVa-mut shRNAs. FIG.
3B shows that HCVa-wt shRNA does not inhibit a similar target
lacking the HCV IRES. Cells were transfected as in FIG. 3A except
that pCDNA3/EMCV IRES dual luciferase reporter (EMCV IRES) was
added in place of pCDNA3/HCV IRES dual luciferase reporter (HCV
IRES). All data are presented as luciferase activity divided by
SEAP. All data were generated from individual, independent
experiments performed in triplicate.
[0016] FIG. 4. Inhibitory efficacy of in vitro-transcribed versions
of all seven possible 19-bp shRNAs and synthetic siRNAs contained
within the 25 nt-target site for HCV genotype 1a (SEQ ID NO:26).
FIG. 4A depicts sequences of the 19 bp viral recognition sequences
of siRNAs and shRNAs and analysis of their purity on 10% native
polyacrylamide gel stained with ethidium bromide. siRNAs: sense and
antisense strands contained 3'-UU overhangs; shRNAs: loop sequences
and 3',5'-end overhangs were identical to the ones in 25 bp shRNAs.
FIG. 4B: RNA inhibitors assayed for inhibition of HCV IRES-mediated
gene expression at concentration 1 nM in 293 FT cells. FIG. 4C:
Same as FIG. 4B, but inhibitors were assayed at 0.1 nM in 293 FT
cells.
[0017] FIG. 5. Inhibition of HCV IRES-mediated reporter gene
expression in mice. Dual luciferase HCV IRES reporter plasmid (10
.mu.g) and SEAP (added to control for injection efficiency and
nonspecific inhibition) were co-injected into the tail veins of
mice as described in Example 1 with 100 .mu.g of the indicated HCV
shRNA or control 229 shRNA) directly or in the form of 100 .mu.g of
pol III expression plasmids expressing shRNA (or pUC18 plasmid as
control). At various time-points (24, 36, 48, 60, 72, 84 and 100
hours) post-injection, luciferin was administered
intraperitoneally, and the mice were imaged using the IVIS in vivo
imaging system (representative mice from 84 hour timepoint are
shown in FIG. 5A) and quantitated using ImageQuant software (shown
in FIG. 5B for direct RNA delivery). Each time-point represents the
average of 4-5 mice. At the 96 hour time-point, the mice were bled
and the amount of SEAP activity determined by pNPP assay as
described in Example 1. The quantitated data are presented as
luciferase divided by SEAP activity, normalized to pUC18 control
mice (100%, no error bars shown on pUC18 control for clarity; error
bars are similar to the others shown).
[0018] FIG. 6. Comparison of shRNA and phosphorodiamidate
morpholino oligomer inhibition of HCV IRES-mediated reporter gene
expression in mice. Mice were co-injected as described in FIG. 5
with dual luciferase HCV IRES reporter plasmid and pSEAP with 100
.mu.g of the indicated HCV shRNA inhibitors or 1 nmole of a
morpholino oligonucleotide previously shown to inhibit HCV IRES
expression construct [8]. The mice were imaged at various times
(12, 24, 48, and 144 hr) post-treatment. The data shown are for the
48 hour timepoint. The quantitated data are presented as luciferase
and SEAP activities, normalized to pUC18 control (no addition)
mice. The results presented are from 3-5 mice per construct.
[0019] FIG. 7. Inhibition of replication-proficient GFP-expressing
Semliki Forest virus (SFV-GFP-VA7) by shRNA targeting the nsp-1
gene. BHK-21 cells were transiently transfected with plasmids
expressing the inhibitor. Twenty four hours after transfection,
cells were infected with 10 .mu.l of virus (multiplicity of
infection (MOI) sufficient for .about.100% infection) and assayed
for virus-mediated GFP expression by flow cytometry 24 h after
infection. The level of siRNA-mediated suppression is .about.35%.
Labels: Nsp 1. shRNA targeting Nsp-1 gene (nsp-1#2); empty vector,
pU6; naive, uninfected BHK cells.
[0020] FIG. 8. Inhibition of replication-deficient SFV
(SFV-PD713P-GFP) by shRNAs. BHK-21 cells were transiently
transfected with plasmids expressing the inhibitor. Forty-six hours
after transfection, cells were infected with SFV-GFP virus at an
MOI of 5 with 8% PEG in serum-free media for 1 h. Then complete
media was added and cells were incubated at 37.degree. C.
overnight. Cells were analyzed by flow cytometry at 9, 24, 32, 99,
and 125 hours after infection. For clarity, only three time points
are shown (9, 24 and 32 hours). The amount of inhibition of each
shRNA was normalized to capsid shRNA. Capsid mRNA is not present in
this SFV-GFP replication-deficient virus and therefore capsid shRNA
should have no effect on GFP expression. The transfection
efficiency for the shRNA expression constructs for this experiment
was .about.70%, suggesting that actual viral inhibition is
significantly higher than the levels indicated. The fifth set of
bars (Mixed) refers to a mixture of shRNAs targeting nsp 1-4 and
capsid.
[0021] FIG. 9. Inhibition of an HCV replicon system in Huh7 cells
by HCVa-wt shRNA and HCVa-mut shRNA as well as a irrelevant control
shRNA (229); dose response. The antiviral activity of test
compounds was assayed in the stably HCV RNA-replicating cell line,
AVA5, derived by transfection of the human hepatoblastoma cell
line, Huh7 (Blight, et al. (2000) Science 290:1972). RNA-based
inhibitors were co-transfected with DsRed expression plasmid into
.about.80 percent confluent cultures and HCV RNA levels were
assessed 48 hours after transfection using dot blot hybridization.
Assays were conducted in triplicate cultures. A total of 4-6
untreated control cultures, and triplicate cultures treated with
10, 3, and 1 IU/ml a-interferon (active antiviral with no
cytotoxicity), and 100, 10, and 1 uM ribavirin (no antiviral
activity and cytotoxic) served as positive antiviral and toxicity
controls. The transfection efficiency was estimated by fluorescence
microscopy (DsRed expression). Both HCV and b-actin RNA levels in
triplicate treated cultures were determined as a percentage of the
mean levels of RNA detected in untreated cultures (6 total).
b-actin RNA levels are used both as a measure of toxicity, and to
normalize the amount of cellular RNA in each sample. A level of 30%
or less HCV RNA (relative to control cultures) is considered to be
a positive antiviral effect, and a level of 50% or less b-actin RNA
(relative to control cultures) is considered to be a cytotoxic
effect. Cytotoxicity is measured using an established neutral red
dye uptake assay (Korba, B. E. and J. L. Gerin (1992). Use of a
standardized cell culture assay to determine activities of
nucleoside analogs against hepatitis B virus replication (Antivir.
Res. 19:55-70).
DETAILED DESCRIPTION OF THE INVENTION
[0022] The invention provides compositions, methods, and kits for
inhibiting viral gene expression and/or treating a viral infection
in a mammal.
[0023] RNA interference offers the potential of a novel therapeutic
approach for treating viral infections. The invention provides
small interfering RNAs (e.g., shRNAs and siRNAs) that target viral
sequences and inhibit (i.e., reduce or eliminate) viral gene
expression, and methods of using small interfering RNAs for
treatment of a viral infection in a mammal, such as a human. In
some embodiments, the small interfering RNA constructs of the
invention inhibit gene expression in a virus by inducing cleavage
of viral polynucleotide sequences within or near the target
sequence that is recognized by the antisense sequence of the small
interfering RNA.
[0024] As used herein, "small interfering RNA" refers to an RNA
construct that contains one or more short sequences that are at
least partially complementary and capable of interacting with a
polynucleotide sequence of a virus. Interaction may be in the form
of a direct binding between complementary (antisense) sequences of
the small interfering RNA and polynucleotide sequences of the viral
target, or in the form of an indirect interaction via enzymatic
machinery (e.g., a protein complex) that allows the antisense
sequence of the small interfering RNA to recognize the target
sequence. Often, recognition of the target sequence by the small
interfering RNA results in cleavage of viral sequences within or
near the target site that is recognized by the recognition
(antisense) sequence of the small interfering RNA. The small
interfering RNA may be comprised exclusively of ribonucleotide
residues or may contain one or more modified residues, particularly
at the ends or on the sense strand. The term "small interfering
RNA" as used herein encompasses shRNA and siRNA, both of which are
understood and known to those in the art to refer to RNA constructs
with particular characteristics and types of configurations.
[0025] As used herein, "shRNA" refers to an RNA sequence comprising
a double-stranded region and a loop region at one end forming a
hairpin loop. The double-stranded region is typically about 19 to
about 29 nucleotides in length, and the loop region is typically
about 2 to about 10 nucleotides in length. One of our preferred
shRNAs, HCVa-wt shRNA, has a 25-bp double-stranded region (SEQ ID
#12), a 10-nt loop, a GG extension on the 5' end, and a UU
extension on the 3' end.
[0026] As used herein, "siRNA" refers to an RNA molecule comprising
a double stranded region a 3' overhang of nonhomologous residues at
each end. The double-stranded region is typically about 18 to about
30 nucleotides in length, and the overhang may be of any length of
nonhomologous residues, but a 2 nucleotide overhang is preferred.
One of our preferred siRNAs, HCVa-wt siRNA, has a 25-bp
double-stranded region (SEQ ID #12), and a UU extension on each 3'
end.
[0027] In one embodiment, a small interfering RNA as described
herein comprises a sequence complementary to a sequence of the
internal ribosome entry site (IRES) element of hepatitis C ("HCV").
In one embodiment, the virus is HCV genotype 1a.
[0028] SiRNA gene inhibition has been shown to robustly inhibit
gene expression in a number of mammalian systems. Due to its high
level of secondary structure, the HCV IRES has been suggested to be
a poor target for si/shRNAs. Mizusawa recently reported, however,
successful targeting of the HCV IRES in 293 and Huh7 tissue culture
cells, reporting 50 and 74 percent knock-down of gene expression,
respectively. Similarly, Seo and coworkers [25] reported the
ability of 100 nM siRNA to inhibit HCV replication (.about.85%
knockdown) in 5-2 Huh7 cells. We have demonstrated that small
interfering RNAs (shRNAs and siRNAs) directed against the 3' end of
the HCV IRES, including and downstream of the AUG translation start
site, induce 96 percent knockdown of HCV IRES-dependent luciferase
expression at 0.3 nM in 293FT cells and 75% knockdown at 0.1 nM in
Huh7 cells (see FIGS. 2D and 3A). Furthermore, direct delivery of
shRNA to mouse liver was shown to potently inhibit HCV
IRES-dependent reporter expression. This is the first demonstration
of RNAi-mediated gene inhibition in an animal model following
direct delivery of an RNA hairpin (not expressed in vivo from a
plasmid or viral vector). The effectiveness of shRNA delivered
directly to mouse liver following hydrodynamic injection was
surprising in view of the high levels of nucleases found in blood.
The observation that these shRNAs effectively knocked down gene
expression in liver indicates that these shRNA inhibitors (1) are
very potent and not needed at high levels in mouse liver to cause
gene inhibition, (2) are delivered very rapidly to the liver before
they can be cleaved by nucleases, or (3) are inherently much more
stable to nuclease degradation than linear RNA (or a combination of
these characteristics).
[0029] Recent reports suggest that in vitro-synthesized transcripts
from bacteriophage promoters potently induce interferon alpha and
beta due to the presence of an unnatural 5' triphosphate [26].
Furthermore, shRNAs expressed from pol III expression vectors may
also induce IFN [27]. How this interferon induction would affect
use of shRNAs in a clinical setting for HCV infection is unclear.
Current HCV therapy includes treatment with interferon alpha,
suggesting that if interferon is induced by shRNA, it may have a
positive effect. To date, no interferon-related side effects have
been reported in animals following administration of RNAi [3].
Additional concerns have been raised regarding off-target effects
of siRNA as well as potential cytotoxic effects when RNAi is
delivered by lentiviral vectors [28]. As with other pharmaceutics,
proper testing of several potential agents will be required to
identify those having the highest activities and screen for those
that have unacceptable off-target effects.
[0030] The IRES region in the HCV 5'-UTR is highly conserved
(92-100% identical [15, 29-31]) and has several segments that
appear to be invariant, making the IRES a prime target for nucleic
acid-based inhibitors. The region around the AUG translation
initiation codon is particularly highly conserved, being invariant
at positions +8 to -65 (with the exception of a single nucleotide
variation at position -2) over 81 isolates from various
geographical locations [32]. Despite the conservation of sequence
in the IRES motif, it is unlikely that targeting a single sequence,
even if highly conserved, will be sufficient to prevent escape
mutants. RNA viruses are notorious for their high mutation rates
due to the high error rate of the RNA polymerase and the lack of
proofreading activity. On average, each time HCV RNA is replicated
one error is incorporated into the new strand. This error rate is
compounded by the prodigious production of viral particles in an
active infection (approximately a trillion per day in a chronically
infected patient) [33]. Therefore, it is likely that several
conserved sites will need to be targeted or, alternatively, shRNAs
should be used as a component of a combination treatment, such as
with ribaviran and pegylated interferon. It should be noted that a
single mismatch does not completely block shRNA activity (see FIG.
2D); thus each shRNA may have some activity against a limited
number of mutations.
[0031] McCaffrey and colleagues recently reported that a
phosphorodiamidate morpholino oligonucleotide directed against a
conserved HCV IRES site at the AUG translation initiation site
potently inhibits reporter gene expression [8]. We used the same
morpholino inhibitor for comparison against the shRNA inhibition.
Both the morpholine and the shRNA targeting this site potently and
robustly inhibited IRES-dependent gene expression. Four mutations
in the morpholino were required to block activity, whereas two
changes in the shRNA were sufficient, suggesting greater shRNA
specificity. This potential advantage, coupled with the lack of
unnatural residues in the shRNA inhibitor and presumably fewer
resultant side effects, are balanced by the increased stability of
the morpholino oligomer.
[0032] We used a dual reporter luciferase plasmid where firefly
luciferase (fLuc) expression was dependent on the HCV IRES [24].
Expression of the upstream renilla luciferase is not HCV
IRES-dependent and is translated in a Cap-dependent process. Direct
transfection of HCV IRES shRNAs, or alternatively shRNAs expressed
from polIII-promoter vectors, efficiently blocked HCV IRES-mediated
fLuc expression in human 293FT and Huh7 cells. Control shRNAs
containing a double mutation had little or no effect on fLuc
expression, and shRNAs containing only a single mutation showed
partial inhibition. These shRNAs were also evaluated in a mouse
model where DNA constructs were delivered to cells in the liver by
hydrodynamic transfection via the tail vein. The dual luciferase
expression plasmid, the shRNAs, and secreted alkaline phosphatase
plasmid were used to transfect cells in the liver, and the animals
were imaged at time points over 12 to 96 hours In vivo imaging
revealed that HCV IRES shRNA directly, or alternatively expressed
from a polIII-plasmid vector, inhibited HCV IRES-dependent reporter
gene expression; mutant or irrelevant shRNAs had little or no
effect. These results suggest that shRNAs, delivered as RNA or
expressed from viral or nonviral vectors, are useful as effective
antivirals for the control of HCV and related viruses.
[0033] Assay of three additional shRNAs targeting different sites
on HCV IRES domain IV revealed another potent shRNA, HCVd-wt, whose
target position is shifted 6 nt from that of HCVa-wt. HCVb-wt and
HCVc-wt were much less efficient inhibitors.
[0034] To further investigate local sequence effects on potency,
seven in vitro-transcribed shRNA constructs comprising a 19 bp
sequence complementary to a sequence of the HCV IRES and the
corresponding synthetic siRNA comprising the same 19 bp sequences,
targeting all possible positions within the 31-bp site of HCV1a
(344-374), were assayed for inhibitory activity. A 25-bp synthetic
siRNA corresponding to HCVa-wt shRNA was also tested. All of them
exhibited a high level of activity. In general, siRNAs were more
potent than shRNAs. The most potent, HCVd-wt was effective at 1 nM
(>90% inhibition), 0.1 nM (.about.90% inhibition) and even 0.01
mM concentration (.about.40% inhibition). Thus, 19-25 bp shRNAs and
siRNAs designed to target the region 344-374 on the HCV IRES are
generally potent, with some local differences.
[0035] Effects of size and sequence of loop region of the shRNA
were also investigated. The loop region of the shRNA stem-loop can
be as small as 2-3 nt and does not have a clear upper limit on
size; as a practical matter it is usually between 4 and 9 nt and of
a sequence that does not cause unintended effects, such as being
complementary to a non-target gene. Highly structured loop
sequences such as the GNRA tetraloop are acceptable. The loop can
be at either end of the molecule; that is, the sense strand can be
either 5' or 3' relative to the loop. Also, a noncomplementary
duplex region (approx. 1-6 bp, for example, 4 CG bps) can be placed
between the targeting duplex and the loop, for example to serve as
a "CG clamp" to strengthen duplex formation. At least 19 bp of
target-complementary duplex are needed if a noncomplementary duplex
is used.
[0036] The 3' end is preferred to have a non-target-complementary
2-nt overhang, most often UU or dTdT, but it can be any nucleotide
including chemically modified nucleotides for enhanced nuclease
resistance. In other (less preferred) embodiments, there is one or
zero nucleotides overhanging on the 3' end.
[0037] The 5' end can have a noncomplementary extension as with the
two Gs shown in FIG. 1B, or a GAAAAAA sequence (not shown), or only
one or zero nucleotides extending beyond the target-complementary,
duplex region. In the sequence shown in FIG. 1B, the two 5' G's are
included primarily for ease of transcription from a T7
promoter.
[0038] Other changes that are encompassed by the invention are
length variations between about 19 and about 30 bp for the target
complementary duplex region, small shifts in the sequence targeted
(preferably 0 to about 2 nt, but shifts as large as about 10 nt in
either direction along the target may lie within the targetable
region). Similarly, mismatches are also tolerated: about 1 to about
2 in the antisense strand and about 1 to about 9 in the sense
strand (the latter destabilizing the hairpin duplex but not
affecting the strength of binding of the antisense strand to the
target; the number tolerated depends partly on the length of the
target-complementary duplex. We have successfully used 7 G-U
mismatches within a 29-bp target-complementary duplex region. Note
that the two mutations shown in FIG. 1B largely abrogated
inhibition, but other mutants having mutations in other positions,
particularly if they are closely spaced and/or near the end, may be
better tolerated. All these suggested tolerable variations are
known in the art or demonstrated in the instant application.
Methods of the Invention
[0039] The invention provides methods of inhibiting gene expression
in a virus, comprising contacting the virus with a small
interfering RNA, such as a shRNA or siRNA as described herein that
comprises a sequence that is at least partially complementary and
capable of interacting with a polynucleotide sequence of the virus.
In some embodiments, contacting the virus comprises introducing the
small interfering RNA into a cell that contains the virus, i.e., a
virus infected cell. "Inhibiting gene expression" as used herein
refers to a reduction (i.e., decrease in level) or elimination of
expression of at least one gene of a virus. In some embodiments,
inhibition of gene expression is accomplished by cleavage of the
viral target sequence to which the small interfering RNA binds.
[0040] The invention provides methods for treating a viral
infection in a mammal, comprising administering to the mammal a
composition comprising a therapeutically effective amount of a
small interfering RNA, such as a shRNA or siRNA as described herein
that comprises a sequence that is at least partially complementary
and capable of interacting with a polynucleotide sequence of the
virus. In some embodiments, the mammal is human. In one embodiment,
the mammal is a human and the viral infection is a HCV infection,
such as an infection with HCV genotype 1a, and the small
interfering RNA comprises a sequence that is at least complementary
to a sequence of the IRES of the HCV.
[0041] As used herein, "therapeutically effective amount" refers to
the amount of a small interfering RNA that will render a desired
therapeutic outcome (e.g., reduction or elimination of a viral
infection). A therapeutically effective amount may be administered
in one or more doses.
[0042] Generally, in methods for treating a viral infection in a
mammal, the small interfering RNA is administered with a
pharmaceutically acceptable carrier. As used herein,
"pharmaceutically acceptable carrier" (also interchangeably termed
"pharmaceutically acceptable excipient" herein) to a relatively
inert substance that facilitates administration of the small
interfering RNA. For example, a carrier can give form or
consistency to the composition or can act as a diluent. A
pharmaceutically acceptable carrier is biocompatible (i.e., not
toxic to the host) and suitable for a particular route of
administration for a pharmacologically effective substance.
Suitable pharmaceutically acceptable carriers include but are not
limited to stabilizing agents, wetting and emulsifying agents,
salts for varying osmolarity, encapsulating agents, buffers, and
skin penetration enhancers. In some embodiments, the
pharmaceutically acceptable carrier is water or saline. Examples of
pharmaceutically acceptable carriers are described in Remington's
Pharmaceutical Sciences (Alfonso R. Gennaro, ed., 18th edition,
1990).
[0043] In methods for treating a viral infection, small interfering
RNAs as described herein are generally administered parenterally,
e.g., subcutaneously, intravenously, intramuscularly.
Compositions
[0044] The invention provides compositions for inhibiting viral
gene expression and/or treating a viral infection in a mammal
comprising at least one small interfering RNA as described herein.
Compositions of the invention may comprises two or more small
interfering RNAs as described herein. In accordance with the
invention, a small interfering RNA, e.g., shRNA or siRNA, comprises
a sequence that is substantially complementary to a viral
polynucleotide sequence of about 19 to about 30 nucleotides,
wherein interaction of the substantially complementary sequence of
the small interfering RNA with the polynucleotide sequence of the
virus inhibits viral gene expression, for example, by cleavage of
viral polynucleotide sequences.
[0045] In some embodiments, the composition comprises a shRNA
comprising a sequence selected from the group consisting of SEQ ID
NOs: 12, 17, 18, 19, 20, 21, 22, 23, 24, and 25. In some
embodiments, the composition comprises a siRNA comprising a
sequence selected from SEQ ID NOs: 19, 20, 21, 22, 23, 24, and 25.
In some embodiments, the composition comprises a shRNA or siRNA
that binds to, i.e., comprises a sequence substantially
complementary to, a sequence of about 19 to about 30 nucleotides
within the IRES element of HCV, for example, HCV genotype 1a.
[0046] In some embodiments, the invention provides a pharmaceutical
composition comprising a small interfering RNA as described herein
and a pharmaceutically acceptable carrier. In some embodiments, the
pharmaceutical composition is formulated for parenteral
administration to a mammal, for example, a human.
Kits
[0047] The invention provides kits comprising a small interfering
RNA as described herein. In some embodiments, the kits also include
instructions for use in the methods for inhibiting viral gene
expression and/or methods for treatment of a viral infection in a
mammal described herein. Instructions may be provided in printed
form or in the form of an electronic medium such as a floppy disc,
CD, or DVD, or in the form of a website address where such
instructions may be obtained.
[0048] In some embodiments, the kits include a pharmaceutical
composition of the invention, for example including at least one
unit dose of at least one small interfering RNA such as a shRNA or
a siRNA, and instructions providing information to a health care
provider regarding usage for treating or preventing a viral
infection. The small interfering RNA is often included as a sterile
aqueous pharmaceutical composition or dry powder (e.g.,
lyophilized) composition.
[0049] Suitable packaging is provided. As used herein, "packaging"
refers to a solid matrix or material customarily used in a system
and capable of holding within fixed limits a composition of the
invention suitable for administration to an individual. Such
materials include glass and plastic (e.g., polyethylene,
polypropylene, and polycarbonate) bottles, vials, paper, plastic,
and plastic-foil laminated envelopes and the like. If e-beam
sterilization techniques are employed, the packaging should have
sufficiently low density to permit sterilization of the
contents.
[0050] Kits may also optionally include equipment for
administration of a pharmaceutical composition of the invention,
such as, for example, syringes or equipment for intravenous
administration, and/or a sterile solution, e.g., a diluent such as
water, saline, or a dextrose solution, for preparing a dry powder
(e.g., lyophilized) composition for administration.
TABLE-US-00001 TABLE 1 Listing of Targeting Sequences Disclosed in
the Application which may be Incorporated into shRNA or siRNA and
Examples of such shRNAs and sIRNAs Target Position on Examples of
Sequence ID # Antisense sequence (5'-3') HCV IRES shRNA or siRNA
SEQ ID NO:27 UCUUUGAGGUUUAGGAUUCGUGCUC 344-368 HCVa-wt shRNA SEQ ID
NO:28 UCUUUGAGGUUUAGGAUUGGUGCUC 344-368 HCVa-SNP1 shRNA SEQ ID
NO:29 UCUUUGAGCUUUAGGAUUCGUGGUC 344-368 HCVa-SNP2 shRNA SEQ ID
NO:30 UCUUUGAGCUUUAGGAUUCGUGCUC 344-368 HCVa-mut shRNA SEQ ID NO:31
CCUCCCGGGGCACUCGCAAGCACCC 299-323 HCVb-wt shRNA SEQ ID NO:32
UGGUGCACGGUCUACGAGACCUCCC 318-342 HCVc-wt shRNA SEQ ID NO:33
GGUUUUUCUUUGAGGUUUAGGAUUC 350-374 HCVd-wt shRNA SEQ ID NO:19
AGGUUUAGGAUUCGUGCUC 344-362 siRNA#1, shRNA#1 SEQ ID NO:20
GAGGUUUAGGAUUCGUGCU 345-363 siRNA#2, sbRNA#2 SEQ ID NO:21
UGAGGUUUAGGAUUCGUGC 346-364 siRNA#3, shRNA#3 SEQ ID NO:22
UUGAGGUUUAGGAUUCGUG 347-365 siRNA#4, shRNA#4 SEQ ID NO:23
UUUGAGGUUUAGGAUUCGU 348-366 siRNA#5, shRNA#5 SEQ ID NO:24
CUUUGAGGUUUAGGAUUCG 349-367 siRNA#6, shRNA#6 SEQ ID NO:25
UCUUUGAGGUUUAGGATUUC 350-368 siRNA#7, shRNA#7
[0051] The following examples are intended to illustrate, but not
to limit, the invention.
EXAMPLES
Example 1
Design and Construction of ShRNA Expression Cassettes, T7
Transcription Reactions, and Reporter Gene Assays
[0052] Chemically synthesized oligonucleotides were obtained from
IDT (Coralville, Iowa), resuspended in RNase- and pyrogen-free
water (Biowhittaker), and annealed as described below. The
following oligonucleotide pairs, for making shRNA, contain a T7
promoter element (doubly underlined), sense and antisense HCV IRES
sequence and a miR-23 microRNA loop structure (reported to
facilitate cytoplasmic localization [21, 22]).
TABLE-US-00002 T7-HCVa-wt fw:
5'-TAATACGACTCACTATAGGGAGCACGAATCCTAAACCTCA (SEQ ID NO:1)
AAGACTTCCTGTCATCTTTGAGGTTTAGGATTCGTGCTCTT-3'; T7-HCVa-wt rev:
5'-AAGAGCACGAATCCTAAACCTCAAAGATGACAGGAA (SEQ ID NO:2)
GTCTTTGAGGTTTAGGATTCGTGCTCCCTATAGTGAGTCGTATTA-3'
(T7 promoter sequence doubly underlined). T7 transcripts for
HCVa-mut shRNA were identical with the exception that nucleotide
changes (G.fwdarw.C and C.fwdarw.G) were incorporated into the
synthesized oligonucleotides at the singly underlined residues.
[0053] HCVa-wt shRNA (FIG. 1B) was designed to target the region
344-374 on the HCV IRES; HCVb-wt was designed to target the region
299-323 (FIG. 1C); HCVc-wt was designed to target the region
318-342 (FIG. 1C); and HCVd-wt was designed to target the region
350-374 (FIG. 1C).
[0054] ShRNAs #1-7 (targeting positions 344-362, 345-363, 346-364,
347-365, 348-366, 349-367, 350-368 on the HCV IRES; See FIG. 4A,
which depicts the 19 bp viral recognition sequences) were in vitro
transcribed using the MEGAscript kit (Ambion) and contained the
same loop sequences and 5',3'-overhangs as HCVa-wt shRNA. SiRNAs
#1-7 (see FIG. 4A, which depicts the 19 bp viral recognition
sequences) were chemically synthesized at Dharmacon (Lafayette,
Colo.) and contained 3'-UU overhangs on both sense and antisense
strands.
[0055] The oligonucleotide pair used to prepare the control shRNA
229 (which targets tumor necrosis factor alpha) is
229-5'-TAATACGACTCACTATAGGGGCG
GTGCCTATGTCTCAGCCTCTTCTCACTTCCTGTCATGAGAAGAGGCTGAGACA TAGGCACCGCC
TT-3' (SEQ ID NO:3)
and 229-3'-AAGGCG GTGCCTATGTC TCAGCC TCT TCTCA TGACAGGAAG TGAGA
AGAGGCTGA GACATAGGCACCCCTATAGTGAGTCGTATTA-5' (SEQ ID NO:4).
Pol III U6 ShRNA Expression Vector Construction--Design of Small
Hairpin ShRNA Expression Vectors
[0056] Oligonucleotide pairs were incubated together at 95.degree.
C. for 2 minutes in RNA polymerase buffer (e.g., 120 .mu.l of each
100 .mu.M oligonucleotide in 60 .mu.l 5.times. annealing buffer
(Promega; 1X=1 mM Tris-HCl (pH 7.5), 50 mM NaCl) and slowly cooled
(annealed) over 1 hour to less than 40.degree. C. The
oligonucleotides were designed to provide 4-base overhangs for
rapid cloning into Bbs1/BamH1-digested pCRII-U6 plasmid (Bbs1 and
BamH1 recognition sites or overhangs are underlined in the
oligonucleotide sequences). The pCRII-U6 pol III expression plasmid
was prepared by subcloning the PCR product obtained from human
HT-1080 genomic DNA using primers and huU6-5'
ATCGATCCCCAGTGGAAAGACGCGCAG (SEQ ID NO:5) and
huU6-3'-GGATCCGAATTCGAAGACCACGGTGTTTCGTCCTTTCCACAA-5' (SEQ ID NO:6)
[23] into the pCRII vector (Invitrogen) using the TA cloning kit
(Invitrogen). The cassette consisting of the annealed
oligonucleotides (encoding the HCV IRES shRNA) was ligated into the
Bbs1/BamH1-digested pCRII-U6 plasmid. The expressed shRNA contains
a miR-23 microRNA loop structure to facilitate cytoplasmic
localization [21, 22]. The final pCRII-U6 constructs were confirmed
by sequencing. The primers pairs used were: pHCVa-wt 5'-ACCG
GAGCACGAATCCTAAACCTCAAAGA CTTCCTGTCA TCTTTGAGGTTTAGGATTCGTGCTC
TTTTTTG-3' (SEQ ID NO:7) and 5'-GATCCAAAAAA
GAGCACGAATCCTAAACCTCAAAGA TGACAGGAAG TCTTTGAGGTTTAGGATTCGTGCTC-3'
(SEQ ID NO:8). Oligonucleotides containing the appropriate sequence
changes at the underlined residues (see above) were used to
generate the pCRII-U6/HCVa-mut (double mutation), HCVsnp1 (single
change at 5' side) and HCVsnp2 (single change at 3' end) as
depicted in FIG. 1B and described above. The control pCRII-U6/229
was prepared is similar fashion using the oligonucleotides
TABLE-US-00003 5'-ACCGGGCGGTGCCTATGTCTCAGCCTCTTCTCACTTCCTGTCATGAGA
(SEQ ID NO:9) AGAGGCTGAGACATAGGCACCGCCTTTTTT3' and
3'-GATCAAAAAAGGCGGTGCCTATGTCTCAGGCCTCTTCTCATGACAGGAAGTGAG (SEQ ID
NO:10) AAGAGGCTGAGACATAGGCACCGCC-5'.
T7 Transcription Reactions
[0057] Oligonucleotide pairs were incubated at 95.degree. C. for 2
minutes in RNA polymerase buffer (e.g., 120 .mu.l of each 100 .mu.M
Oligonucleotide in 60 .mu.l 5.times. transcription buffer
(Promega)) and slowly cooled (annealed) over 1 hour to less than
40.degree. C. ShRNA was transcribed at 42.degree. C. for 4 hours
from 5 .mu.M of the resulting annealed dsDNA template using the
AmpliScribe T7 Flash transcription kit (Epicentre Technologies)
followed by purification on a gel filtration spin column (Microspin
G-50, Amersham Biosciences) that had been thoroughly washed three
times with phosphate buffered saline (PBS) to remove
preservative.
SiRNAs
[0058] SiRNAs were prepared by annealing chemically synthesized
(Dharmacon) complementary strands of RNA, each containing the
appropriate recognition sequence plus an (overhanging) UU extension
on the 3'end.
Transfections and Reporter Gene Assays
[0059] Human 293FT (Invitrogen) and Huh7 cells (ATCC) were
maintained in DMEM (Biowhittaker) with 10% fetal bovine serum
(HyClone), supplemented with 2 mM L-glutamine and 1 mM sodium
pyruvate. The day prior to transfection, cells were seeded at
1.7.times.10.sup.5 cells/well in a 24-well plate, resulting in
.about.80% cell confluency at the time of transfection. Cells were
transfected with Lipofectamine 2000 (Invitrogen) following the
manufacturer's instructions. For the inhibition experiments, 293FT
or Huh7 cells were cotransfected (in triplicate) with 40 ng
pCDNA3/HCV IRES dual luciferase (renilla and firefly) reporter
construct, 50 ng pSEAP2-control plasmid (BD Biosciences Clontech,
as transfection controls) and the indicated amounts of T7-generated
shRNA (typical amount 1 pmole) or pCRII-U6 shRNA expression
construct (710 ng). Compensatory pUC18 plasmid was added to the
transfection mix to give a final concentration of 800 ng total
nucleic acid per transfection. 48 hours later, supernatant was
removed, heated at 65.degree. C. for 15-30 minutes, and 5-10 .mu.l
of the supernatant was added to 150 .mu.l p-nitrophenyl phosphate
liquid substrate system (pNPP, Sigma). After a 30-60 minute
incubation at room temperature, samples were read (405 nm) on a
Molecular Devices Thermomax microplate reader and quantitated using
SOFTmax software (Molecular Devices). The remaining cells were
lysed and luciferase activity measured using the Dual-Luciferase
Reporter assay system (Promega) and MicroLumat LB 96 P luminometer
(Berthold).
Mice
[0060] Six-week old female Balb/c mice were obtained from the
animal facility of Stanford University. Animals were treated
according to the NIH Guidelines for Animal Care and the Guidelines
of Stanford University.
Mouse Hydrodynamic Injections and In Vivo Imaging
[0061] Hydrodynamic tail vein injections were performed as
described by McCaffrey and colleagues with minor modifications
including omission of RNasin [24]. A total volume of 1.8 ml of
phosphate-buffered saline containing inhibitor (RNA or plasmid), 10
.mu.g of pHCV Dual Luc plasmid, and 2 .mu.g pSEAP2-control plasmid
(BD Biosciences Clontech, contains the SV40 early promoter), was
steadily injected into the mouse tail vein over .about.5 seconds
(N=4-6 animals per group). At the indicated times, 100 .mu.l of 30
mg/ml luciferin was injected intraperitoneally. Ten minutes
following the injection, live anesthetized mice were analyzed using
the IVIS7 imaging system (Xenogen Corp., Alameda, Calif.) and the
resulting light emission data quantitated using LivingImage
software (Xenogen). Raw values are reported as relative detected
light per minute and standard errors of the mean for each group
(N=4-5 animals) are shown.
Secreted Alkaline Phosphatase (SEAP) Assay
[0062] At day 5, mice were bled through the retro-orbital vein of
the eye. The serum was separated from blood cells by
microcentrifugation, heated at 65.degree. C. for 30 minutes to
inactivate endogenous alkaline phosphates, and 5-10 .mu.l of the
serum was added to 150 .mu.l pNPP liquid substrate system (see
above). After a 30-60 minute incubation at room temperature,
samples were read (405 nm) and quantitated as described above.
Example 2
ShRNA Inhibition of HCV IRES-Mediated Gene Expression in Human
Tissue Culture Cells
[0063] In this study, short interfering RNAs (shRNAs and siRNAs)
designed and constructed as in Example 1 to target a conserved
region of the hepatitis C IRES were tested for their ability to
inhibit HCV IRES-mediated reporter expression in human tissue
culture cells.
[0064] FIG. 1A shows the HCV IRES target site (panel A) as well as
the HCV shRNA resulting from T7 transcription of a template
prepared from hybridized oligonucleotides containing a T7 promoter
sequence and HCV IRES target (FIG. 1B). The underlined residues are
those that were changed to generate the mutant HCV shRNAs. The
shRNAs contain a mir-23 microRNA loop structure that was previously
suggested to facilitate cytoplasmic localization, [21, 22] and a 25
bp RNA stem with two nucleotides at the 5' (two guanines) and 3'
(two uridines) ends that may also hybridize though non Watson-Crick
G:U basepairings. For vector-delivered shRNAs, overlapping
oligonucleotides were subcloned into a poIII expression vector
(pCRII-U6, see Example 1).
[0065] We also designed three other shRNAs with the same stem
length and loop sequence that target nearby positions in Domain IV
of the HCV IRES (FIG. 1C). HCVb-wt shRNA targets a highly
structured region (used as negative control, to compare
efficiency), while HCVc-wt and HCVd-wt shRNA target regions that
are more `accessible` according to biochemical footprinting studies
(FIG. 1D; Brown et al., 1992). All RNAs were in vitro transcribed
from dsDNA templates containing a T7 promoter, similar to the
HCVa-wt shRNA.
[0066] To test the effectiveness of the HCV shRNAs to inhibit HCV
IRES-mediated gene expression, human 293FT or hepatocyte Huh7 cells
were co-transfected with pCDNA3/HCV IRES dual luciferase expression
plasmid, secreted alkaline phosphatase expression plasmid (pSEAP2,
to control for efficiency of transfection) as well as in vitro
synthesized shRNAs or alternatively, pol III expression vectors
containing the corresponding shRNA cassettes.
[0067] As seen in FIG. 1F, both HCVa-wt and HCVd-wt shRNAs, which
target the region of the IRES immediately downstream of the AUG
translation start site (positions 344-368 and 350-374,
respectively), strongly inhibit HCV IRES-mediated fLuc expression
in human 293FT cells. HCVc-wt (targeting 318-342) showed moderate
inhibition and HCVb-wt (299-323) displayed little if any activity,
as expected. Thus, preliminary screening revealed a potent shRNA,
HCVa-wt, that was chosen for further detailed studies.
[0068] HCVa-wt shRNA targeting the region of the IRES immediately
downstream of the AUG translation start site strongly inhibits HCV
IRES-mediated fLuc expression in both human 293FT (FIG. 2) and
hepatocyte Huh7 (FIG. 3B) cell lines. Little or no inhibition was
observed using either a mutant shRNA (HCVa-mut) containing two
changes in the pairing of the RNA hairpin (for mismatch location,
see FIG. 1B) or an unrelated TNF (229) shRNA. The 229 TNF shRNA is
highly effective at inhibiting TNF expression (Seyhan et al. 2005),
suggesting that this shRNA is utilized effectively by the RNAi
apparatus. Single nucleotide changes in the hairpin region, at
either the upstream or downstream position (SNP1 and SNP2
respectively; see FIG. 2C), had a partial effect. Little or no
inhibition was observed when the HCV shRNA was targeted to a
similar dual luciferase construct in which the HCV IRES was
replaced by the encephalomyocarditis virus (EMCV) IRES. (FIGS. 2B
and 3B).
[0069] To confirm that the shRNAs were acting by degrading their
target mRNA, a northern blot analysis was performed (FIG. 2F).
Equal amounts of total RNA, isolated from cells transfected with no
inhibitor or HCVa-wt, HCVmut1/2, or 229 shRNAs, were separated by
gel electrophoresis. The separated RNA was transferred to a
membrane and hybridized to radiolabeled cDNA probes specific for
fLuc, SEAP and elongation factor 1A (EF1A). HCVa-wt shRNA (lane 3)
specifically inhibited fLuc mRNA accumulation (63% inhibition
compared to 229 shRNA (lane 2) when corrected for SEAP and EF1A
mRNA levels; no inhibition was observed for HCVa-mut1/2) (compare
lanes 3 and 4) following quantitation by phosphorimager.
[0070] Dose response experiments showed that the HCVa-wt shRNA
effectively inhibited HCV IRES-dependent gene expression at 0.3 nM
in 293FT cells (96 percent inhibition, see FIG. 2D) and 0.1 nM in
Huh7 cells (75 percent inhibition, see FIG. 3A
[0071] To further investigate local sequence effects on potency,
seven in vitro-transcribed 19 bp shRNA and the corresponding
synthetic 19 bp siRNA, targeting all possible positions within the
31-bp site of HCVa (344-374; FIG. 4A), were assayed for inhibitory
activity. A 25-bp synthetic siRNA corresponding to HCVa-wt shRNA
was also tested. All of them exhibited a high level of activity
(FIG. 4B). The most potent were siRNA and shRNA versions of HCVa as
well as siRNA #3, which was effective at 1 nM (>90% inhibition,
FIG. 4B) and 0.1 nM (.about.90% inhibition, FIG. 4C). Thus, 19-25
bp shRNAs and siRNAs designed to target the region 344-374 on the
HCV IRES are potent, with some local differences.
Example 3
ShRNA Inhibition of HCV IRES-Mediated Gene Expression in a Mouse
Model System
[0072] The ability of the HCV shRNA and HCV shRNA expression
plasmid to inhibit target gene expression was extended to a mouse
model system using hydrodynamic injection to deliver the nucleic
acids to mouse liver. FIG. 5 shows the results of injecting a large
volume of PBS (1.8 ml) containing pHCV dual Luc, pSEAP2, and shRNAs
(10 fold excess over the target on a mass basis of either shRNA or
pol III expression vectors expressing the shRNAs) into the tail
veins of mice (n=4-5 mice). At the timepoints shown in FIG. 5B,
luciferin was injected intraperitoneally and the mice were imaged
with a high sensitivity, cooled CCD camera. (FIG. 5A shows
representative mice chosen from each set (4-5 mice per set) at the
84-hour timepoint.) At all timepoints tested, HCV shRNA robustly
inhibited luciferase expression ranging from 98 (84-hour timepoint)
to 94 (48-hour timepoint) percent inhibition compared to mice
injected with pUC18 in place of shRNA inhibitor. Mutant (mut) or
control (229) shRNAs had little or no effect. It should be noted
that luciferase activity decreases with time, possibly due to loss
of DNA or promoter silencing [8] and that the data are normalized
within each timepoint (see description of FIG. 5 above).
[0073] FIG. 6 shows a comparison of HCVa-wt shRNA inhibitory
activity with a phosphoramidite morpholino oligomer that was
previously shown to effectively target this same site [8]. Both the
HCVa-wt shRNA and morpholino oligomers effectively blocked
luciferase expression at all time-points tested. Data are shown for
the 48-hour time-point, where inhibition was 99.95 and 99.88
percent, respectively for the HCVa-wt shRNA and morpholino
inhibitors.
Example 4
Inhibition of Semliki Forest Virus (SFV) Using ShRNAs
[0074] SFV has been used as a model system for more virulent
positive-strand RNA viruses. To examine the inhibitory effect of
RNAi on SFV growth, we generated shRNAs targeting four SFV genes
(nsp-1, nsp-2 and nsp-4, and capsid) and one mismatched control for
the nsp-4 site, expressed them from a U6 promoter and tested their
ability to inhibit the proliferation of SFV-A7-EGFP, a version of
the replication-proficient SFV strain SFV-A7 that expresses a eGFP
reporter gene [49]. A modest reduction (.about.35%) of SFV-GFP
replication was seen with shRNAs targeting the nsp-1 (FIG. 7) but
not nsp-2, nsp-4 or capsid coding regions, nor with the mismatched
siRNA (not shown).
[0075] A site within the capsid coding region that was previously
shown to be effective on Sindbis virus [50] was not effective on
SFV. The Sindbis-SFV sequence homology at this site is only 77%.
SFV is a very rapidly growing virus, producing up to 200,000
cytoplasmic RNAs during its infectious cycle. To see if we could
better protect cells from a slower-growing virus, we also tested
the effects of these siRNAs on a replication-deficient strain of
SFV-GFP in two separate experiments. FIG. 8 shows that U6-expressed
shRNAs targeting this SFV strain can reduce viral expression by
.gtoreq.70% over a time period of up to five days. This effect was
seen with siRNAs targeting the nonstructural genes nsp-1, nsp-2,
and nsp-4 as well as an siRNA with one mismatch to nsp-4, but not
for the capsid gene (which is lacking in this crippled virus) or
other controls controls (FIG. 8). Note that the length of the
sequence targeted by the shRNAs is 29 nt and the single mismatch
used in the nsp-4 mismatch shRNA is apparently not disruptive for
the RNAi effect. The wide variation in effectiveness of the various
shRNAs underscores the importance of a library approach for finding
the best siRNAs and shRNAs when dealing with rapidly replicating
and highly mutagenic viruses such as SFV.
[0076] Although the foregoing invention has been described in some
detail by way of illustration and examples for purposes of clarity
of understanding, it will be apparent to those skilled in the art
that certain changes and modifications may be practiced without
departing from the spirit and scope of the invention. Therefore,
the description should not be construed as limiting the scope of
the invention, which is delineated by the appended claims.
[0077] All publications, patents and patent applications cited
herein are hereby incorporated by reference in their entireties for
all purposes to the same extent as if each individual publication,
patent or patent application were specifically indicated to be so
incorporated by reference.
REFERENCES
[0078] 1. Sookoian, S. C., New therapies on the horizon for
hepatitis C. Ann Hepatol, 2003. 2: 164-70. [0079] 2. Randall, G.
and C. M. Rice, Interfering with hepatitis C virus RNA replication.
Virus Res, 2004. 102: 19-25. [0080] 3. Radhakrishnan, S. K., T. J.
Layden, and A. L. Gartel, RNA interference as a new strategy
against viral hepatitis. Virology, 2004. 323: 173-81. [0081] 4.
Hugle, T. and A. Cerny, Current therapy and new molecular
approaches to antiviral treatment and prevention of hepatitis C.
Rev Med Virol, 2003. 13: 361-71. [0082] 5. Blight, K. J., A. A.
Kolykhalov, and C. M. Rice, Efficient initiation of HCV RNA
replication in cell culture. Science, 2000. 290: 1972-4. [0083] 6.
Pietschmann, T. and R. Bartenschlager, Tissue culture and animal
models for hepatitis C virus. Clin Liver Dis, 2003. 7: 23-43.
[0084] 7. Mercer, D. F., D. E. Schiller, J. F. Elliott, D. N.
Douglas, C. Hao, A. Rinfret, W. R. Addison, K. P. Fischer, T. A.
Churchill, J. R. Lakey, D. L. Tyrrell, and N. M. Kneteman,
Hepatitis C virus replication in mice with chimeric human livers.
Nat Med, 2001. 7: 927-33. [0085] 8. McCaffrey, A. P., L. Meuse, M.
Karimi, C. H. Contag, and M. A. Kay, A potent and specific
morpholino antisense inhibitor of hepatitis C translation in mice.
Hepatology, 2003. 38: 503-8. [0086] 9. Lieberman, J., E. Song, S.
K. Lee, and P. Shankar, Interfering with disease: opportunities and
roadblocks to harnessing RNA interference. Trends Mol Med, 2003. 9:
397-403. [0087] 10. Layzer, J. M., A. P. McCaffrey, A. K. Tanner,
Z. Huang, M. A. Kay, and B. A. Sullenger, In vivo activity of
nuclease-resistant siRNAs. Rna, 2004. 10: 766-71. [0088] 11. Rossi,
J. J. and G. J. Hannon, Unlocking the potential of the human genome
with RNA interference. Nature, 2004. 431: 35-43. [0089] 12.
McHutchison, J. G. and K. Patel, Future therapy of hepatitis C.
Hepatology, 2002. 36: S245-52. [0090] 13. Wilson, J. A., S.
Jayasena, A. Khvorova, S. Sabatinos, I. G. Rodrigue-Gervais, S.
Arya, F. Sarangi, M. Harris-Brandts, S. Beaulieu, and C. D.
Richardson, RNA interference blocks gene expression and RNA
synthesis from hepatitis C replicons propagated in human liver
cells. Proc Natl Acad Sci USA, 2003. 100: 2783-8. [0091] 14.
Randall, G., A. Grakoui, and C. M. Rice, Clearance of replicating
hepatitis C virus replicon RNAs in cell culture by small
interfering RNAs. Proc Natl Acad Sci USA, 2003. 100: 235-40. [0092]
15. Yokota, T., N. Sakamoto, N. Enomoto, Y. Tanabe, M. Miyagishi,
S. Maekawa, L. Yi, M. Kurosaki, K. Taira, M. Watanabe, and H.
Mizusawa, Inhibition of intracellular hepatitis C virus replication
by synthetic and vector-derived small interfering RNAs. EMBO Rep,
2003. 4: 602-8. [0093] 16. Kapadia, S. B., A. Brideau-Andersen, and
F. V. Chisari, Interference of hepatitis C virus RNA replication by
short interfering RNAs. Proc Natl Acad Sci USA, 2003. 100: 2014-8.
[0094] 17. Kronke, J., R. Kittler, F. Buchholz, M. P. Windisch, T.
Pietschmann, R. Bartenschlager, and M. Frese, Alternative
approaches for efficient inhibition of hepatitis C virus RNA
replication by small interfering RNAs. J Virol, 2004. 78: 3436-46.
[0095] 18. Sen, A., R. Steele, A. K. Ghosh, A. Basu, R. Ray, and R.
B. Ray, Inhibition of hepatitis C virus protein expression by RNA
interference. Virus Res, 2003. 96: 27-35. [0096] 19. Zhang, J., O.
Yamada, T. Sakamoto, H. Yoshida, T. Iwai, Y. Matsushita, H.
Shimamura, H. Araki, and K. Shimotohno, Down-regulation of viral
replication by adenoviral-mediated expression of siRNA against
cellular cofactors for hepatitis C virus. Virology, 2004. 320:
135-43. [0097] 20. McCaffrey, A. P., L. Meuse, T. T. Pham, D. S.
Conklin, G. J. Hannon, and M. A. Kay, RNA interference in adult
mice. Nature, 2002. 418: 38-9. [0098] 21. Kawasaki, H. and K.
Taira, Short hairpin type of dsRNAs that are controlled by
tRNA(Val) promoter significantly induce RNAi-mediated gene
silencing in the cytoplasm of human cells. Nucleic Acids Res, 2003.
31: 700-7. [0099] 22. Lagos-Quintana, M., R. Rauhut, W. Lendeckel,
and T. Tuschl, Identification of novel genes coding for small
expressed RNAs. Science, 2001. 294: 853-8. [0100] 23. Qin, X. F.,
D. S. An, I. S. Chen, and D. Baltimore, Inhibiting HIV-1 infection
in human T cells by lentiviral-mediated delivery of small
interfering RNA against CCR5. Proc Natl Acad Sci USA, 2003. 100:
183-8. [0101] 24. McCaffrey, A. P., K. Ohashi, L. Meuse, S. Shen,
A. M. Lancaster, P. J. Lukavsky, P. Sarnow, and M. A. Kay,
Determinants of hepatitis C translational initiation in vitro, in
cultured cells and mice. Mol Ther, 2002. 5: 676-84. [0102] 25. Seo,
M. Y., S. Abrignani, M. Houghton, and J. H. Han, Small interfering
RNA-mediated inhibition of hepatitis C virus replication in the
human hepatoma cell line Huh-7. J Virol, 2003. 77: 810-2. [0103]
26. Kim, D. H., M. Longo, Y. Han, P. Lundberg, E. Cantin, and J. J.
Rossi, Interferon induction by siRNAs and ssRNAs synthesized by
phage polymerase. Nat Biotechnol, 2004. 22: 321-5. [0104] 27.
Bridge, A. J., S. Pebernard, A. Ducraux, A. L. Nicoulaz, and R.
Iggo, Induction of an interferon response by RNAi vectors in
mammalian cells. Nat Genet, 2003. 34: 263-4. [0105] 28. Fish, R. J.
and E. K. Kruithof, Short-term cytotoxic effects and long-term
instability of RNAi delivered using lentiviral vectors. BMC Mol
Biol, 2004. 5: 9. [0106] 29. Han, J. H., V. Shyamala, K. H.
Richman, M. J. Brauer, B. Irvine, M. S. Urdea, P. Tekamp-Olson, G.
Kuo, Q. L. Choo, and M. Houghton, Characterization of the terminal
regions of hepatitis C viral RNA: identification of conserved
sequences in the 5' untranslated region and poly(A) tails at the 3'
end. Proc Natl Acad Sci USA, 1991. 88: 1711-5. [0107] 30. Choo, Q.
L., K. H. Richman, J. H. Han, K. Berger, C. Lee, C. Dong, C.
Gallegos, D. Coit, R. Medina-Selby, P. J. Barr, and et al., Genetic
organization and diversity of the hepatitis C virus. Proc Natl Acad
Sci USA, 1991. 88: 2451-5. [0108] 31. Okamoto, H., S. Okada, Y.
Sugiyama, K. Kurai, H. Iizuka, A. Machida, Y. Miyakawa, and M.
Mayumi, Nucleotide sequence of the genomic RNA of hepatitis C virus
isolated from a human carrier: comparison with reported isolates
for conserved and divergent regions. J Gen Virol, 1991. 72 (Pt 11):
2697-704. [0109] 32. Bukh, J., R. H. Purcell, and R. H. Miller,
Sequence analysis of the 5' noncoding region of hepatitis C virus.
Proc Natl Acad Sci USA, 1992. 89: 4942-6. [0110] 33. Rice, C. M.,
Virology: fresh assault on hepatitis C. Nature, 2003. 426: 129-31.
[0111] 34. Zhang, H., R. Hanecak, V. Brown-Driver, R. Azad, B.
Conklin, M. C. Fox, and K. P. Anderson, Antisense oligonucleotide
inhibition of hepatitis C virus (HCV) gene expression in livers of
mice infected with an HCV-vaccinia virus recombinant. Antimicrob
Agents Chemother, 1999. 43: 347-53. [0112] 35. Jubin, R., N. E.
Vantuno, J. S. Kieft, M. G. Murray, J. A. Doudna, J. Y. Lau, and B.
M. Baroudy, Hepatitis C virus internal ribosome entry site (IRES)
stem loop IIId contains a phylogenetically conserved GGG triplet
essential for translation and IRES folding. J Virol, 2000. 74:
10430-7. [0113] 36. Seyhan A A, Vlassov A V, Ilves H, Egry L,
Kaspar R L, Kazakov S A, Johnston B H. Complete, gene-specific
siRNA libraries: production and expression in mammalian cells. RNA.
2005. 11:837-46. [0114] 37. Wang Q, Contag C H, Ilves H, Johnston B
H, Kaspar R L. Small hairpin RNAs efficiently inhibit hepatitis C
IRES-mediated gene expression in human tissue culture cells and a
mouse model. Mol Ther. 2005. 12:562-8
Sequence CWU 1
1
33181DNAArtificial SequenceSynthetic construct 1taatacgact
cactataggg agcacgaatc ctaaacctca aagacttcct gtcatctttg 60aggtttagga
ttcgtgctct t 81281DNAArtificial SequenceSynthetic construct
2aagagcacga atcctaaacc tcaaagatga caggaagtct ttgaggttta ggattcgtgc
60tccctatagt gagtcgtatt a 81389DNAArtificial SequenceSynthetic
construct 3taatacgact cactataggg gcggtgccta tgtctcagcc tcttctcact
tcctgtcatg 60agaagaggct gagacatagg caccgcctt 89486DNAArtificial
SequenceSynthetic construct 4attatgctga gtgatatccc cacggataca
gagtcggaga agagtgaagg acagtactct 60tctccgactc tgtatccgtg gcggaa
86527DNAArtificial SequenceSynthetic construct 5atcgatcccc
agtggaaaga cgcgcag 27642DNAArtificial SequenceSynthetic construct
6aacacctttc ctgctttgtg gcaccagaag cttaagccta gg 42771DNAArtificial
SequenceSynthetic construct 7accggagcac gaatcctaaa cctcaaagac
ttcctgtcat ctttgaggtt taggattcgt 60gctctttttt g 71871DNAArtificial
SequenceSynthetic construct 8gatccaaaaa agagcacgaa tcctaaacct
caaagatgac aggaagtctt tgaggtttag 60gattcgtgct c 71978DNAArtificial
SequenceSynthetic construct 9accgggcggt gcctatgtct cagcctcttc
tcacttcctg tcatgagaag aggctgagac 60ataggcaccg cctttttt
781078DNAArtificial SequenceSynthetic construct 10ccgccacgga
tacagagtcg gagaagagtg aaggacagta ctcttctccg actctgtatc 60cgtggcggaa
aaaactag 7811393RNAArtificial SequenceSynthetic construct
11gccagccccc gauugggggc gacacuccac cauagaucac uccccuguga ggaacuacug
60ucuucacgca gaaagcgucu agccauggcg uuaguaugag ugucgugcag ccuccaggac
120ccccccuccc gggagagcca uaguggucug cggaaccggu gaguacaccg
gaauugccag 180gacgaccggg uccuuucuug gaucaacccg cucaaugccu
ggagauuugg gcgugccccc 240gcgagacugc uagccgagua guguuggguc
gcgaaaggcc uugugguacu gccugauagg 300gugcuugcga gugccccggg
aggucucgua gaccgugcac caugagcacg aauccuaaac 360cucaaagaaa
aaccaaacgu aacaccaacc gcc 3931264RNAArtificial SequenceSynthetic
construct 12gggagcacga auccuaaacc ucaaagacuu ccugucaucu uugagguuua
ggauucgugc 60ucuu 641364RNAArtificial SequenceSynthetic construct
13gggagcacca auccuaaacc ucaaagacuu ccugucaucu uugagguuua ggauuggugc
60ucuu 641464RNAArtificial SequenceSynthetic construct 14gggagcacga
auccuaaagc ucaaagacuu ccugucaucu uugagcuuua ggauucgugc 60ucuu
641564RNAArtificial SequenceSynthetic construct 15gggagcacca
auccuaaagc ucaaagacuu ccugucaucu uugagcuuua ggauuggugc 60ucuu
641660RNAArtificial SequenceSynthetic construct 16gggugcuugc
gagugccccg ggaggcuucc ugucaccucc cggggcacuc gcaagcaccc
601760RNAArtificial SequenceSynthetic construct 17gggaggucuc
guagaccgug caccacuucc ugucauggug cacggucuac gagaccuccc
601862RNAArtificial SequenceSynthetic construct 18gggaauccua
aaccucaaag aaaaacccuu ccugucaggu uuuucuuuga gguuuaggau 60uc
621919RNAArtificial SequenceSynthetic construct 19agguuuagga
uucgugcuc 192019RNAArtificial SequenceSynthetic construct
20gagguuuagg auucgugcu 192119RNAArtificial SequenceSynthetic
construct 21ugagguuuag gauucgugc 192219RNAArtificial
SequenceSynthetic construct 22uugagguuua ggauucgug
192319RNAArtificial SequenceSynthetic construct 23uuugagguuu
aggauucgu 192419RNAArtificial SequenceSynthetic construct
24cuuugagguu uaggauucg 192519RNAArtificial SequenceSynthetic
construct 25ucuuugaggu uuaggauuc 192631RNAArtificial
SequenceSynthetic construct 26gagcacgaau ccuaaaccuc aaagaaaaac c
312725RNAArtificial SequenceSynthetic construct 27ucuuugaggu
uuaggauucg ugcuc 252825RNAArtificial SequenceSynthetic construct
28ucuuugaggu uuaggauugg ugcuc 252925RNAArtificial SequenceSynthetic
construct 29ucuuugagcu uuaggauucg ugcuc 253025RNAArtificial
SequenceSynthetic construct 30ucuuugagcu uuaggauugg ugcuc
253125RNAArtificial SequenceSynthetic construct 31ccucccgggg
cacucgcaag caccc 253225RNAArtificial SequenceSynthetic construct
32uggugcacgg ucuacgagac cuccc 253325RNAArtificial SequenceSynthetic
construct 33gguuuuucuu ugagguuuag gauuc 25
* * * * *