U.S. patent application number 11/446527 was filed with the patent office on 2009-07-02 for artificial riboswitch for controlling pre-mrna splicing.
Invention is credited to Rajesh K. Gaur.
Application Number | 20090170793 11/446527 |
Document ID | / |
Family ID | 40799231 |
Filed Date | 2009-07-02 |
United States Patent
Application |
20090170793 |
Kind Code |
A1 |
Gaur; Rajesh K. |
July 2, 2009 |
ARTIFICIAL RIBOSWITCH FOR CONTROLLING PRE-MRNA SPLICING
Abstract
The present invention relates to riboswitches that have been
engineered to regulate pre-mRNA splicing. In particular, the
insertion of a high affinity theophylline binding aptamer into the
3' splice site region, 5' splice site region, or branchpoint
sequence (BPS) of a pre-mRNA modulates RNA splicing in the presence
of theophylline. Accordingly, the aspects of the present invention
include, but are not limited to, theophylline-dependent
riboswitches which modulate RNA splicing, methods of modulating RNA
splicing using theophylline and its corresponding riboswitches,
methods of improving/identifying theophylline-dependent
riboswitches, methods of treating diseases associated with or
caused by abnormal RNA splicing.
Inventors: |
Gaur; Rajesh K.; (Glendora,
CA) |
Correspondence
Address: |
PERKINS COIE LLP
POST OFFICE BOX 1208
SEATTLE
WA
98111-1208
US
|
Family ID: |
40799231 |
Appl. No.: |
11/446527 |
Filed: |
June 1, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60686838 |
Jun 1, 2005 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/320.1; 435/325; 436/501; 536/24.1; 536/25.4 |
Current CPC
Class: |
A61P 43/00 20180101;
C12N 2320/33 20130101; C12N 15/115 20130101; C12N 2310/16
20130101 |
Class at
Publication: |
514/44 ;
536/24.1; 435/320.1; 435/325; 536/25.4; 436/501 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; C07H 21/04 20060101 C07H021/04; C12N 15/74 20060101
C12N015/74; C12N 5/00 20060101 C12N005/00; C07H 21/00 20060101
C07H021/00; G01N 33/566 20060101 G01N033/566; A61P 43/00 20060101
A61P043/00 |
Goverment Interests
GOVERNMENT INTEREST
[0002] This invention was made with government support in part by
the Department of Defense, Grant Number BC023235. The government
may have certain rights in this invention.
Claims
1. An artificial riboswitch comprising a nucleic acid sequence set
forth as SEQ ID NO: 6.
2. A nucleic acid comprising the complementary sequence of the
nucleic acid sequence in claim 1.
3. A vector comprising the nucleic acid of claim 2.
4. A cell comprising the artificial riboswitch of claim 1 or the
nucleic acid of claim 1 or 2.
5. A method of modulating RNA splicing comprising the steps of: a)
providing a nucleic acid containing a ligand dependent riboswitch,
wherein the riboswitch comprises an aptamer having affinity to the
ligand; and b) contacting the ligand with the nucleic acid, wherein
the interaction of the ligand with the aptamer modulates the
splicing of the nucleic acid, wherein RNA splicing is
modulated.
6. The method of claim 5 wherein the ligand is theophylline.
7. The method of claim 5 wherein the aptamer is a theophylline
dependent aptamer.
8. (canceled)
9. (canceled)
10. A method of optimizing the BPS-to-3' spice distance comprising
the steps of: a) synthesizing a pre-mRNA containing a
theophylline-dependent riboswitch selected from SEQ ID NOs: 1, 2,
3, 7, 8, 9, 11, 12, 13, 14 and 15; b) contacting the pre-mRNA with
or without theophylline; and c) determining the level of pre-mRNA
splicing in the presence of theophylline relative to the absence
thereof, so as to optimize the BPS-to-3' splice distance.
11. A method of improving an aptamer affinity to theophylline
comprising the steps of: a) modifying the aptamer with a nucleic
acid sequence of SEQ ID NO: 10; b) contacting the aptamer with
theophylline; and c) measuring the binding affinity of theophylline
to the aptamer, wherein the aptamer affinity to theophylline is
improved.
12. The method of claim 11 wherein the aptamer is contacted with
theophylline at a physiological Mg.sup.2+ concentration.
13. A method of identifying an aptamer with affinity to
theophylline comprising the steps of: a) generating a test aptamer;
b) contacting the test aptamer with theophylline; and c) measuring
the binding affinity of the test aptamer to theophylline.
14. A method of identifying an agent that modulates pre-mRNA
splicing comprising the steps of: a) providing a pre-mRNA
containing a theophylline dependent riboswitch; b) contacting a
test agent with the pre-mRNA; and c) determining the level of
pre-mRNA splicing in the presence of the agent relative to the
absence of the agent.
15. A method of developing a theophylline-dependent bifunctional
molecule comprising the steps of: a) providing a test nucleic acid
molecule, wherein the molecule comprises a theophylline aptamer and
an antisense domain complementary to an exonic splicing enhancer
sequence of a pre-mRNA; b) contacting the test molecule with the
pre-mRNA; c) contacting the test molecule and the pre-mRNA with or
without theophylline; d) measuring the level of pre-mRNA splicing
in the presence or absence of theophylline; and e) determining if
the test molecule in absence of theophylline modulates the pre-mRNA
splicing and the addition of theophylline reduces the splicing
caused by the test molecule.
16. A method of modulating RNA splicing in a subject comprising the
steps of: a) introducing into a subject a pre-mRNA containing a
theophylline-dependent riboswitch; b) contacting the subject with
theophylline; and c) measuring the modulation of pre-mRNA splicing
in the presence of theophylline.
17. A ligand-dependent riboswitch comprising a ligand dependent
aptamer, wherein the aptamer is associated with the branchpoint
sequence-3' splice region in a pre-mRNA and the presence of the
ligand modulates pre-mRNA splicing.
18. The riboswitch of claim 17 wherein the ligand dependent aptamer
is a theophylline dependent aptamer.
19. The riboswitch of claim 18 wherein the theophylline aptamer has
a nucleic acid sequence of SEQ ID NO: 10.
20. A ligand-dependent riboswitch comprising a theophylline
dependent aptamer, wherein the theophylline dependent aptamer is
associated with the branchpoint sequence-3' splice region in a
pre-mRNA in a nucleic acid sequence set forth as SEQ ID NO: 6, and
the presence of theophylline modulates pre-mRNA splicing.
21. A ligand-dependent riboswitch comprising a ligand dependent
aptamer, wherein the aptamer is inserted into the 3' splice site in
a pre-mRNA and the presence of the ligand modulates pre-mRNA
splicing.
22. The riboswitch of claim 21 wherein the ligand dependent aptamer
is a theophylline dependent aptamer.
23. A ligand-dependent riboswitch comprising a ligand dependent
aptamer, wherein the aptamer is inserted into the 5' splice site in
a pre-mRNA and the presence of the ligand modulates pre-mRNA
splicing.
24. The riboswitch of claim 23 wherein the ligand dependent aptamer
is a theophylline dependent aptamer.
25. A ligand-dependent riboswitch comprising a ligand dependent
aptamer, wherein the aptamer is inserted into the branchpoint
sequence (BPS) in a pre-mRNA and the presence of the ligand
modulates pre-mRNA splicing.
26. The riboswitch of claim 25 wherein the ligand dependent aptamer
is a theophylline dependent aptamer.
Description
RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Provisional
Application No. 60/686,838, filed Jun. 1, 2005, the disclosure of
which is incorporated by reference herein in its entirety.
BACKGROUND
[0003] The vast majority of structural genes in higher eukaryotes
contain intervening sequences (introns) whose precise removal from
the mRNA precursors (pre-mRNAs) is essential for proper gene
expression. Excision of introns from nuclear pre-mRNAs is catalyzed
by the spliceosome, perhaps the most complex ribonucleoprotein
(RNP) assembly in the cell (Nilsen, 2003). A number of RNA-RNA and
RNA-protein interactions involving five small nuclear RNAs (U1, U2,
U4, U5 and U6) and many snRNP and non-snRNP proteins mediate the
removal of introns and joining of exons (Kramer, 1996; Moore et
al., 1993; Newman, 1994; Nilsen, 2003; Will and Luhrmann,
1997).
[0004] Pre-mRNAs are spliced in a two-step pathway involving two
sequential transesterification reactions. In the first step,
pre-mRNA is cleaved at the 5' splice site simultaneously generating
two splicing intermediates: a linear first exon RNA, and an
intron-second exon RNA in a lariat configuration. In the second
step, the 3'-hydroxyl group of the last nucleotide in the first
exon makes a nucleophilic attack at the phosphodiester bond
separating the intron and the second exon (3' splice site) enabling
the joining of two exons and the release of the intron as a lariat
(Kramer, 1996; Moore et al., 1993; Newman, 1994; Nilsen, 2003; Will
and Luhrmann, 1997).
[0005] In higher eukaryotes, three distinct sequences direct the
splicing reaction: the 5' splice site (/GURAGY), the branchpoint
sequence (BPS) (YNYURAC), and the 3' splice site (YAG/), where a
slash (/) denotes a splice site, N denotes any nucleotide, R
denotes purine, Y denotes pyrimidine, and underlining indicates the
conserved nucleotide. During the early stages of the spliceosome
assembly the 5' and the 3' end of the intron are recognized by
intermolecular base pairing between U1 snRNA and the 5' splice site
(Seraphin et al., 1988; Siliciano and Guthrie, 1988; Zhuang and
Weiner, 1986) and by the binding of U2AF to the poly(Y) tract/3' ss
AG (Merendino et al., 1999; Ruskin et al., 1988; Wu et al., 1999;
Zamore et al., 1992; Zorio and Blumenthal, 1999), respectively.
Later in the spliceosome assembly, U1 snRNA-5' splice site base
pairing is disrupted and the 5' splice site is bound by U6 snRNA
(Kandels-Lewis and Seraphin, 1993; Konforti et al., 1993; Lesser
and Guthrie, 1993; Sawa and Abelson, 1992; Sawa and Shimura, 1992;
Sontheimer and Steitz, 1993; Wassarman and Steitz, 1992). The
branchpoint adenosine is selected in part by intermolecular base
pairing between the BPS and U2 snRNA, and the RS domain of U2AF65
stabilizes this interaction (Gaur et al., 1995; Valcarcel et al.,
1996). Recently, a one-step assembly of the spliceosome has also
been reported (Malca et al., 2003; Stevens et al., 2002).
[0006] Pre-mRNAs can also undergo alternative splicing to generate
variant mRNAs with diverse and often antagonistic functions (Black,
2003; Clayerie, 2001; Graveley, 2001; Smith and Valcarcel, 2000).
Alternative splicing of pre-mRNA is now recognized as the most
important source of protein diversity in vertebrates (Maniatis and
Tasic, 2002; Mironov et al., 1999; Roberts and Smith, 2002;
Thanaraj et al., 2004). It has been estimated that 35-60% of human
genes generate transcripts that are alternatively spliced (Johnson
et al., 2003; Mironov et al., 1999), and 70-90% of alternative
splicing decisions result into the generation of proteins with
diverse functions ranging from sex determination to apoptosis
(Black, 2003; Kan et al., 2001; Modrek et al., 2001). Importantly,
the defective regulation of splice variant expression has been
identified as the cause of several genetic disorders (Dredge et
al., 2001; Faustino and Cooper, 2003; Garcia-Blanco et al., 2004;
Hull et al., 1993; Nissim-Rafinia and Kerem, 2002; Pagani and
Baralle, 2004; Phillips and Cooper, 2000), and certain forms of
cancer have been linked to unbalanced isoform expression from genes
involved in cell cycle regulation or angiogenesis (Krajewska et
al., 1996a; Krajewska et al., 1996b; Novak et al., 2001; Steinman
et al., 2004; Venables, 2004; Xerri et al., 1996). Therefore,
development of tools that could control pre-mRNA splicing may have
far-reaching effects in biotechnology and medicine.
[0007] Initial efforts aimed at controlling pre-mRNA splicing
exploited the intrinsic property of nucleic acids to bind specific
complementary pre-mRNA sequence and inhibit/modulate splicing
(Dominski and Kole, 1993). However, susceptibility of antisense
oligonucleotides to nuclease digestion, off-target effects, and
problems associated with the delivery and localization led to the
realization that better methods are needed (Heidenreich et al.,
1995). Bifunctional molecules that act like an antisense
oligonucleotide, but carry the binding site for a known splicing
factor have proved to be useful in reprogramming pre-mRNA splicing
(Cartegni and Krainer, 2003; Eperon and Muntoni, 2003; Skordis et
al., 2003; Villemaire et al., 2003). Although bifunctional
molecules have overcome some of the problems associated with
antisense-based approach, the need to include various chemical
modifications limit their utility.
[0008] Notably, all of the above mentioned approaches function in a
constitutive manner, i.e., an antisense oligonucleotide or a
bifunctional molecule directed to inhibit the splicing will
continue to do so as long as the oligonucleotide is available.
Given that splicing of many pre-mRNAs is regulated in a tissue or
development specific manner (Black, 2003; Lopez, 1998), to be able
to switch off/on the splicing would be of broad application in
gene-based therapy and functional genomics. Although a recently
reported small molecule-based approach, which could activate
splicing by simultaneously binding to a protein containing the
splicing activation domain and a second protein bound to the
pre-mRNA has the potential to act as a splicing switch, expression
of heterologous proteins and maintaining small molecule-protein
interplay makes this approach complicated (Graveley, 2005).
[0009] Accordingly, there is a need to develop novel approaches to
regulate RNA splicing or alternative RNA splicing in a
condition-specific manner.
SUMMARY
[0010] One aspect of the present invention relates to artificial
riboswitches that specifically regulate the splicing of their
cognate pre-mRNA in the presence of a condition that may affect or
bind to the riboswitches. For example, one embodiment of the
invention relates to artificial riboswitches that show affinity to,
or are regulated by, theophylline (Jenison et al., 1994), wherein
the theophylline-dependent or theophylline binding riboswitches
regulate RNA splicing in the presence of theophylline.
[0011] Another aspect of the present invention relates to methods
of regulating (e.g., inhibiting or inducing) the splicing of a
pre-mRNA (e.g., AdML-Theo29AG, SEQ ID NO: 6) in a
theophylline-dependent manner, wherein the 3' splice site AG is
embedded within the theophylline binding aptamer. In one
embodiment, the BPS-to-3' splice distance as well as the location
of the 3' splice site AG within the aptamer is designed such that
it confers theophylline-dependent control of RNA splicing. In a
preferred embodiment, the distance between BPS and 3' splice site
AG is between 21 to 39 nucleotides (e.g., 29) starting from the C
of the BPS and ending with the G of the 3' splice site. In another
preferred embodiment, the pre-mRNA splicing can be regulated in
vitro, in vivo, or ex vivo. It is noted that theophylline mediated
control of pre-mRNA splicing is specific. First, theophylline
specifically blocks the step II of the splicing. Second, a small
molecule ligand similar in shape and size of theophylline has no
effect on the splicing of pre-mRNAs modulated by theophylline.
Third, theophylline fails to exert any influence on the splicing of
a pre-mRNA that does not contain its binding site (aptamer).
Finally, theophylline-dependent modulation of pre-mRNA splicing is
functionally relevant.
[0012] Another aspect of the present invention relates to methods
of optimizing the BPS-to-3' splice distance so that theophylline
can effectively modulate the pre-mRNA splicing. The method
comprises the steps of generating riboswitches of various distance
between the BPS and the 3' splice (AG), measuring the effect of
theophylline on RNA splicing in a pre-mRNA containing the
riboswitches.
[0013] Another aspect of the present invention relates to methods
of modifying theophylline-dependent aptamers so that the aptamers'
affinity to theophylline can be modified (e.g., improved). The
method comprises the steps of modifying nucleotides in a
theophylline-dependent aptamer, designing pre-mRNA embedding the
modified aptamer, and determining the level of RNA splicing.
[0014] Another aspect of the present invention relates to methods
of identifying aptamers that bind to theophylline, preferably at
physiological Mg.sup.2+ concentration. The method comprises the
steps of designing an aptamer and testing the aptamer's affinity to
theophylline.
[0015] Another aspect of the present invention relates to methods
of developing theophylline-dependent bifunctional molecules which
can regulate pre-mRNA splicing. The method comprises the steps of
designing a bifunctional molecule, where the molecule comprises an
antisense domain to an exonic splicing enhancer and a theophylline
aptamer; wherein the binding of the antisense domain to the exonic
splicing enhance reduces RNA splicing and the introduction of
theophylline to a splicing reaction inhibits the binding of the
antisense domain to the exonic splicing enhancer. In one
embodiment, the stability of a bifunctional molecule may be
improved by using phosphorothioate or 2' modified nucleotides.
[0016] Another aspect of the present invention relates to
bimolecular allosteric hammerhead molecules, which are able to
regulate pre-mRNA splicing in a theophylline-dependent manner.
[0017] Another aspect of the present invention relates to methods
of identifying theophylline-like compounds or test agents. In one
embodiment, the method comprises the steps of providing a pre-mRNA
containing a theophylline-dependent aptamer wherein the splicing of
the pre-mRNA is regulated in the presence of theophylline;
contacting a test agent with the pre-mRNA; and determining the
level of pre-mRNA splicing in the presence of the agent relative to
the absence of the agent. In another embodiment, the method
comprises the steps of providing a cell or a subject containing a
pre-mRNA comprising a theophylline-dependent aptamer wherein the
splicing of the pre-mRNA is regulated in the presence of
theophylline, contacting the cell or the subject with a test agent,
and determining the level of pre-mRNA splicing in the presence of
the agent relative to the absence of the agent.
[0018] Another aspect of the present invention relates to methods
of modulating RNA splicing in a subject using theophylline and a
theophylline-dependent riboswitch. The method comprises the steps
of introducing into a subject a pre-mRNA containing a
theophylline-dependent riboswitch, contact the subject with
theophylline, examining the modulation of pre-mRNA splicing in the
presence of theophylline.
[0019] Another aspect of the present invention relates to methods
of placing or inserting a theophylline aptamer into the 5' splice
site and determining whether a theophylline-dependent riboswitch
would modulate the 5' splice site choice in the presence of
theophylline. Another aspect of the present invention relates to
methods of modulating RNA splicing comprising the steps of
inserting a theophylline aptamer into the 5' splice site and
modulating pre-mRNA splicing in the presence of theophylline.
[0020] Another aspect of the present invention relates to methods
of placing or inserting a theophylline aptamer into the BPS and
determining whether a theophylline-dependent riboswitch would
modulate pre-mRNA splicing in the presence of theophylline. Another
aspect of the present invention relates to methods of modulating
RNA splicing comprising the steps of inserting a theophylline
aptamer into the BPS and modulating pre-mRNA splicing in the
presence of theophylline.
[0021] Another aspect of the present invention relates to methods
of treating a disease associated with abnormal RNA splicing or a
fragment of mutated gene using a theophylline dependent aptamer. In
one embodiment, a vector containing the complementary sequence of a
theophylline dependent aptamer is introduced into a cell or a
subject. The vector may be transcribed to a pre-mRNA and the
splicing of the pre-mRNA is dependent on the presence of
theophylline. Theophylline or a theophylline-like agent is
contacted with or administered to the cell or subject and regulates
the splicing of the pre-mRNA. Consequently, abnormal RNA splicing
is corrected or inhibited in the presence of theophylline.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1. (A) Structure of theophylline. (B) Sequence and
secondary structure of the theophylline binding RNA (SEQ ID NO:
16). The original aptamer numbering is shown (Zimmermann et al.,
1997). The residues that are required for theophylline binding are
enclosed in the box.
[0023] FIG. 2. BPS-to-theophylline aptamer distance affects the
second step of the splicing. (A) and (B), diagrams of AdML Par (SEQ
ID NO: 17) and AdML-Theo39AG (SEQ ID NO: 18) pre-mRNAs,
respectively. Underlined A represents the branchpoint. The boxed
residues in theophylline aptamer represent exon 2. (C), Splicing
time course with the AdML Par and AdML-Theo39AG substrates.
.sup.32P-Labeled pre-mRNAs were incubated in HeLa nuclear extract
at 30.degree. C. for the times indicated above each lane (see
materials and methods section for experimental details). Total RNA
isolated from each sample was fractionated on a 13% polyacrylamide
denaturing gel. The bands corresponding to intermediates and
spliced products are indicated. M, Century.TM.-plus RNA size marker
(Ambion).
[0024] FIG. 3. Lowering of BPS-to-AG distance rescues step II of
the splicing and confers theophylline-dependent regulation of
splicing. (A) Schematic representation of AdML-Theo29AG pre-mRNA
(SEQ ID NO: 6). (B), Splicing time course with the AdML-Theo29AG
substrate. .sup.32P-Labeled AdML-Theo29AG pre-mRNA was subjected to
in vitro splicing in the absence (lanes 1-5) or with indicated
concentration of theophylline (lanes 6-17). The extracted RNA was
fractionated on a 13% polyacrylamide denaturing gel. The bands
corresponding to intermediates and spliced products are indicated
on left (C), Theophylline inhibits the splicing of AdML-Theo29AG
pre-mRNA by blocking the step II of the splicing. The amount of the
first (lariat-exon 2, triangles) and second step product (mRNA,
squares) is plotted as a function of theophylline concentration.
(D), Histogram depicting the effect of theophylline on the first
and the second step of AdML-Theo29AG splicing at 120 min time point
(from B). The first step splicing efficiency was calculated as the
ratio of the first step products (lariat-exon 2 and first exon) to
the total (pre-mRNA, lariat-exon 2, first exon and mRNA) and
normalized to the control (no theophylline). The step II efficiency
was calculated as the ratio of spliced mRNA to the total and
normalized to the control.
[0025] FIG. 4. BPS-to-AG distance as well as the location of AG
within the aptamer determines theophylline-dependent regulation of
splicing. (A) Schematic representation of AdML-Theo27AG pre-mRNA
(SEQ ID NO: 4). (B), Splicing time course with the AdML-Theo27AG
substrate. .sup.32P-Labeled AdML-Theo27AG pre-mRNA was subjected to
in vitro splicing in the absence (lanes 1-5) or with indicated
concentration of theophylline (lanes 6-17) as described in FIG. 2.
The extracted RNA was fractionated on a 13% denaturing
polyacrylamide gel. The position of the pre-mRNA, splicing
intermediates, and spliced products is indicated on left. (C),
Histogram representing the effect of theophylline on the splicing
efficiency of AdML-Theo27AG pre-mRNA at 120 min time point (from
B). The splicing efficiency was calculated as described in FIG.
3.
[0026] FIG. 5. Pre-mRNA in which 3' ss AG is outside the
theophylline core does not confer theophylline-mediated regulation
of splicing. (A) Schematic representation of AdML-Theo-Stem21AG
pre-mRNA (SEQ ID NO: 19). (B), Splicing time course with the
AdML-Theo-Stem21AG substrate. .sup.32P-Labeled AdML-Theo-Stem21AG
pre-mRNAs was subjected to in vitro splicing in the absence (lanes
1-4) or with indicated concentration of theophylline (lanes 5-16)
as described in FIG. 2. The extracted RNA was fractionated on a 13%
polyacrylamide denaturing gel. The position of the pre-mRNAs,
splicing intermediates, and spliced products is indicated on left.
(C), Histogram representing the effect of theophylline on the
splicing efficiency of AdML-Theo-Stem21AG pre-mRNA at 120 min time
point (from B) as described in FIG. 4.
[0027] FIG. 6. Theophylline-dependent inhibition of the second step
of the splicing is functionally relevant. (A) Schematic
representation of AdML-TheoExon 2 pre-mRNA (SEQ ID NO: 20). (B),
Splicing time course with the AdML-TheoExon 2 substrate.
.sup.32P-Labeled AdML-TheoExon2 pre-mRNA was subjected to in vitro
splicing in the absence (lanes 2-5) or with indicated concentration
of theophylline (lanes 6-14) as described in FIG. 2. The extracted
RNA was fractionated on a 13% polyacrylamide denaturing gel. The
position of the pre-mRNAs, splicing intermediates, and spliced
products is indicated on right. M, Century.TM.-plus RNA size marker
(Ambion). (C), Histogram representing the effect of theophylline on
the splicing efficiency of AdML-TheoExon 2 pre-mRNA at 120 min time
point (from B) as described in FIG. 4.
[0028] FIG. 7. Analysis of the effect of theophylline on
spliceosomal complexes. (A) AdML-Theo29AG pre-mRNA (SEQ ID NO: 6)
was incubated in HeLa nuclear extract under the conditions that
support pre-mRNA splicing for the times indicated above each lane
at 30.degree. C. in the absence (lanes 1-6) or presence (lanes
7-24) of theophylline. The complexes were separated on a 2% agarose
gel. The bands representing complex H, A, B and C are marked on the
left. (B), The relative intensity of the splicing complex C formed
in the absence or presence of theophylline as a function of time is
indicated.
[0029] FIG. 8. Theophylline-dependent regulation of pre-mRNA
splicing is highly specific. (A) Schematic representation of
AdML-21AG pre-mRNA (SEQ ID NO: 21). (B), Splicing time course with
the AdML-21AG pre-mRNA. .sup.32P-Labeled AdML-21AG pre-mRNA was
subjected to in vitro splicing in the absence (lanes 2-6) or with
increasing concentration of theophylline (lanes 7-18) as described
in FIG. 2. The extracted RNA was fractionated on a 13%
polyacrylamide denaturing gel. The position of the pre-mRNAs,
splicing intermediates, and spliced products is indicated on right.
An asterisk (*) indicates degraded lariat. (C), Histogram
representing the effect of theophylline on the splicing efficiency
of AdML-21AG pre-mRNA at 120 min time point (from B) as described
in FIG. 4.
[0030] FIG. 9. Splicing of AdML-Theo29AG pre-mRNA (SEQ ID NO: 6)
remained unaffected in the presence of Caffeine. (A) Structure of
caffeine. (B), Splicing time course with the AdML-Theo29AG
pre-mRNA. .sup.32P-Labeled AdML-Theo29AG pre-mRNA was subjected to
in vitro splicing in the absence (lanes 2-6) or with increasing
concentration of theophylline (lanes 7-18) as described in FIG. 2.
The extracted RNA was fractionated on a 13% polyacrylamide
denaturing gel. The position of the pre-mRNAs, splicing
intermediates, and spliced products is indicated on right. (C),
Histogram representing the effect of caffeine on the splicing
efficiency of AdML-29AG pre-mRNA at 120 min time point (from B) as
described in FIG. 4.
[0031] FIG. 10. Theophylline mediated regulation of alternative
pre-mRNA splicing. (A) Schematic representation of AdML-Theo 3'
Minx pre-mRNA. (B) In vitro splicing of AdML-Theo 3' Minx pre-mRNA.
(C) Graphical representation of the ratio of distal to proximal 3'
splice as a function of theophylline/caffeine.
[0032] FIG. 11. Theophylline-mediated regulation of pre-mRNA in
living cells.
[0033] FIG. 12. AdML-Theo19 (SEQ ID NO: 22), AdML-Theo21 (SEQ ID
NO: 23), and AdML-Theo23 (SEQ ID NO: 24) pre-mRNAs.
[0034] FIG. 13. Sequence and secondary structure of
theophylline-binding RNA (SEQ ID NO: 16). Right panel shows the
schematic representation of the base triples and stacking
interactions in the core of the RNA-theophylline complex. Dashes
lines: hydrogen bonds; ovals: stacking interactions. (See also
Zimmermann et al., Nat. Struct. Biol. 4, 644-649 (1999)).
[0035] FIG. 14. Structure of proposed modified nucleotides.
[0036] FIG. 15. Schematic representation of the steps in the in
vitro selection of anti-theophylline aptamer.
[0037] FIG. 16. Bifunctional theophylline aptamer can regulate
pre-mRNA splicing in the theophylline-dependent manner. (A) Model
explaining the hypothesis. (B) in vitro splicing of IgM pre-mRNA.
(C) Histogram qualifying the data in (B). NS control indicates
non-specific control. An asterisk (*) indicates that similar size
bands were also reported by Graveley et al., RNA 7, 806-18
(2001).
[0038] FIG. 17. Model describing bifunctional hammerhead ribozyme
based regulation of pre-mRNA splicing.
[0039] FIG. 18. Model for the regulation of tra pre-mRNA splicing
by Sex-lethal protein. Line: non-sex-specific intron; striped box:
female specific portion of tra intron; NSS: non-sex specific; FS:
female specific.
[0040] FIG. 19. Proposed scheme for the construction of M-Theo-tra
derivatives.
[0041] FIG. 20. Overlapping PCR for the construction of M-Theo-tra
templates.
[0042] FIG. 21. Drosophila Schneider cell viability assay.
[0043] FIG. 22. Theophylline-responsive riboswitch confers ligand
dependent control of splicing. (A), AdML pre-mRNA derivatives
(AdMLBPT12AG (SEQ ID NO: 25), AdMLBPT15AG (SEQ ID NO: 26), and
AdMLBPT18AG (SEQ ID NO: 27)) in which the branchpoint sequence is
inserted within the upper stem of theophylline binding sequences.
(B), .sup.32P-labeled pre-mRNAs were synthesized as run-off
transcripts from linearized plasmids (1 .mu.g) using T7 RNA
polymerase. Gel purified pre-mRNAs were subjected to in vitro
splicing in the absence or presence of theophylline by incubating
in HeLa nuclear extract. Addition of theophylline to the splicing
reaction significantly lowered the yield of the spliced product
(Compare lanes 6, 11 and 16 with lanes 2-5, 7-10 and 12-15,
respectively. (C), Quantification of the data in panel B. Percent
splicing was calculated by amount of mRNA product over the sum of
pre-mRNA and mRNA.
[0044] FIG. 23. Theophylline inhibits splicing in a dose dependent
manner. (A), .sup.32P-labeled AdML BPT15AG pre-mRNA was incubated
in HeLa nuclear extract (experimental details described in FIG. 2)
in the absence or with increasing concentrations of theophylline.
(B), Quantification of data indicate that while 250 .mu.M of
theophylline can affect splicing reaction, 0.5 mM theophylline is
sufficient to achieve .about.50% splicing inhibition.
[0045] FIG. 24. Theophylline inhibits splicing by blocking
spliceosome assembly. (A), .sup.32P-labeled AdML BPT15AG pre-mRNA
was incubated in HeLa extract for designated time at 30.degree. C.
without or with 2 mM theophylline. Aliquots were withdrawn at
various time points, followed by the separation of complexes on
native agarose gels according to the published protocol (Das and
Reed, 1999). The bands representing splicing complex H, A and B/C
are marked on the left. (B), Quantification of data from (A).
[0046] FIG. 25. Theophylline dependent inhibition of splicing is
specific. (A), Nucleotides that are necessary for theophylline
binding were mutated to generate BrkBpTheo pre-mRNA (SEQ ID NO:
28). (B), .sup.32P-labeled pre-mRNAs were subjected to in vitro
splicing in the absence or presence of theophylline by incubating
in HeLa nuclear extract. (C), Quantification of data from (B).
Splicing of BrkBpTheo remained virtually unaffected at 2 mM
theophylline.
[0047] FIG. 26. Thermodynamic stability of the RNA-theophylline
complex and splicing inhibition. (A), AdML-Theo15AG derivatives
were constructed in which the size of the lower theophylline
aptamer stem was varied from four to ten nucleotides. (B),
.sup.32P-labeled pre-mRNAs with stem lengths of four, six, eight,
and ten nucleotides were subjected to in vitro splicing in the
absence or presence of theophylline by incubating in HeLa nuclear
extract. (C), Quantification of data from (B). Inhibition of
splicing increased with stem size for the four, six, and eight
nucleotide stem pre-mRNAs.
[0048] FIG. 27. Location of BPS affects splicing. (A), An AdML
derivative was constructed in which the BPS was inserted in the
lower theophylline aptamer stem (AdML-lowerBPS, n is 9-15; SEQ ID
NO: 29). (B), .sup.32P-labeled pre-mRNAs with BPS in the lower or
upper stem were subjected to in vitro splicing in the absence or
presence of theophylline by incubating in HeLa nuclear extract.
(C), Quantification of data from (B). Relocation of BPS to the
lower stem resulted in an AdML derivative that was less responsive
to theophylline-mediated splice repression.
[0049] FIG. 28. Schematic representation of alternative splicing
substrate. A series of model splicing substrates were constructed
consisting of three exons interrupted by two introns. "Strong" and
"Weak" refer to the strength of 5' ss in exon 2.
[0050] FIG. 29. Theophylline-dependent control of alternative
splicing in vitro. (A), .sup.32P-labeled ABT0M, ABT2M, ABT4M,
ABT6M, and ABT8M pre-mRNAs were subjected to in vitro splicing in
the absence or presence of theophylline by incubating in HeLa
nuclear extract. (B), Quantification of exon 2 exclusion/inclusion
in the presence and absence of theophylline.
[0051] FIG. 30. Theophylline-dependent control of alternative
splicing in vitro. (A), HeLa cells were transfected with
pcDNA-ABT0-8M constructs in the presence or absence of
theophylline. Total RNA was extracted following a 24 hour
incubation. (B), Quantification of exon 2 exclusion/inclusion in
the presence and absence of theophylline.
[0052] FIG. 31. Controlling Bcl-x pre-mRNA splicing with
theophylline. (A), .sup.32P-labeled BclxSHTheo57 (7 nucleotide
stem), BclxSHTheo510 (10 nucleotide stem), and BclxSHTheo513 (13
nucleotide stem) pre-mRNAs were subjected to in vitro splicing in
the absence or presence of theophylline by incubating in HeLa
nuclear extract. (B), Quantification of the distal to proximal
product ratio in the presence and absence of theophylline.
[0053] FIG. 32. Theophylline inhibits pre-mRNA splicing of a
substrate whose 5' splice site (ss) is embedded within the
theophylline binding aptamer. (A), Construction of theophylline
responsive pre-mRNA substrates. The pre-mRNAs were generated by in
vitro run-off transcription using BamHI digested plasmids. (B),
.sup.32P-labeled AdMLTheo54Mut (4 nucleotide lower aptamer),
AdMLTheo57Mut (7 nucleotide lower aptamer), AdMLTheo510Mut (10
nucleotide lower aptamer), and AdMLTheo513Mut (13 nucleotide lower
aptamer) pre-mRNAs were subjected to in vitro splicing in the
absence or presence of theophylline by incubating in HeLa nuclear
extract. (C), Quantification of data from (B). Splicing efficiency
was calculated and normalized as the ratio of spliced mRNA to
pre-mRNA.
[0054] FIG. 33. Theophylline inhibits pre-mRNA splicing by blocking
spliceosome assembly. (A), .sup.32P-labeled AdMLTheo510Mut was
subjected to a spliceosome assembly assay in the absence or
presence of 2 mM theophylline. Bands representing splicing complex
H, A, and B/C are marked on the left. (B), Effect of theophylline
on the relative intensity of splicing complex A formation of
AdMLTheo510Mut.
[0055] FIG. 34. Theophylline-mediated sequestering of 5' ss can
promote alternative splicing. (A), .sup.32P-labeled AdML Theo 5' ss
was subjected to in vitro splicing in the absence or presence of 2
mM theophylline. (B), Effect of theophylline on activation of
distal 5' ss using AdMLTheo510 and AdML513 substrates at 120
minutes.
[0056] FIG. 35. Theophylline can induce alternative splicing in a
dose-dependent manner. (A), .sup.32P-labeled AdML Theo 5' ss with
10 nucleotide stem was subjected to in vitro splicing in the
presence of varying concentrations of theophylline. (B), Effect of
theophylline on the activation of distal 5' ss AdMLTheo510 splicing
at 120 minutes.
DETAILED DESCRIPTION
[0057] One aspect of the present invention relates to artificial
riboswitches that specifically regulate the splicing of its cognate
pre-mRNA in the presence of a condition (e.g., a ligand or a
molecule) that triggers the modulation of RNA splicing.
[0058] The term "riboswitch" used herein refers to a fragment of
nucleic acids inserted by or linked with an aptamer such that the
binding of an aptamer-specific ligand or molecule to the aptamer
would affect the activity of the fragment. One example of a
riboswitch contains a sequence 3' to the BPS, which comprises a
poly pyrimidine sequence, the 3' splice site, and an aptamer that
is inserted or linked to the 3' splice site region in a way that
the pre-mRNA splicing is affected or modulated in the presence of a
ligand or molecule specific to the aptamer. Another example of a
riboswitch contains a sequence 5' to the BPS, wherein the sequence
comprises an aptamer that is associated with (e.g., inserted or
linked to) to the 5' splice site in a way that the pre-mRNA
splicing is affected or modulated in the presence of a ligand or
molecule specific to the aptamer. Yet another example of a
riboswitch contains a modified BPS, wherein an aptamer is
associated with (e.g., inserted or linked to) the BPS in such a way
that pre-mRNA splicing is affected or modulated in the presence of
a ligand or molecule specific to the aptamer.
[0059] The "aptamer" used herein refers to a fragment (or a domain)
of nucleic acid sequence that selectively binds to a ligand or
molecule. The introduction of a ligand to a ligand-specific aptamer
causes conformational changes within the aptamer and influences
nucleic acids adjacent to the aptamer.
[0060] In one embodiment of the present invention, a riboswitch
contains a theophylline-dependent aptamer with a nucleic acid
sequence of AUACCAGCCGAAAGGCCCUUGGCAG (SEQ ID NO: 10) and a ligand
is theophylline (FIGS. 1(A) & (B)). For modulating mRNA
splicing, a ligand or molecule specific to an aptamer should meet
some or all of the following criteria. First, it should be able to
bind its ligand-binding aptamer with high affinity. Second,
ligand-aptamer interaction should not require the assistance of any
other factor. Third, the ligand-binding site (the aptamer) should
be unstructured and only upon the binding of ligand should the
aptamer undergo a conformational change or rearrangement. Fourth,
the ligand-aptamer binding must be preserved under the conditions
that support pre-mRNA splicing. Finally, the ligand should not
affect the splicing of a substrate that does not contain its
binding site.
[0061] A number of ligands such as tobramycin (Wang and Rando,
1995), neomycin (Wallis et al., 1995), ATP (Sassanfar and Szostak,
1993), FMN (Burgstaller and Famulok, 1994) and theophylline
(Jenison et al., 1994) have been shown to bind RNAs that were
evolved by in vitro selection (Joyce, 1994). All of these ligands
meet some of the above mentioned criteria (e.g., the first three
requirements). However, since both ATP and FMN are cellular
components, and ATP is required for in vitro splicing, a system
based on these two molecules might interfere with splicing
regulation. To assess the suitability of ligands, the splicing of
pre-mRNA not having ligand-dependent aptamer (e.g., AdML-21AG
pre-mRNA (Chua and Reed, 2001)) is examined in the presence of
these ligands. As a result, theophylline (FIG. 1) exerts no effect
on the splicing of AdML-21AG pre-mRNA (see FIG. 8). Accordingly, a
preferred ligand is theophylline (FIG. 1(A)) and a preferred
aptamer is a theophylline-dependent aptamer (FIG. 1(B)).
[0062] Accordingly, examples of riboswitches include but are not
limited to, for instance:
TABLE-US-00001 1) AC(Y).sub.nAUACCAGCCGAAAGGCCCUUGGCAG, n ranges
from 15 to 31; (SEQ ID NO: 1) 2)
AC(Y).sub.nAUACCAGCCGAAAGGCCCUUGGCAG, n = 21; (SEQ ID NO: 2) 3)
AC(Y).sub.nAUACCAGCCGAAAGGCCCUUGGCAG, n = 17; (SEQ ID NO: 3) 4)
ACUUUUUUUCUUUUUUUUUCCAUACCAGCCGAAAGGCCCUUGGCAGG; (SEQ ID NO: 4) 5)
ACUUUUUUUCUUUUUUUUUCCUCAUACCAGCCGAAAGGCCCUUGGCAG; (SEQ ID NO: 5) 6)
ACUUUUUUUCUUUUUUUUUCCUCAUACCAGCCGAAAGGCCCUUGGCAGGAGG; (SEQ ID NO:
6)
7)
AC(Y)nN.sub.1N.sub.2N.sub.3N.sub.4AUACCAGCCGAAAGGCCCUUGGCAGN'.sub.4N.s-
ub.3N'.sub.2N'.sub.1, n ranges from 11 to 27, N.sub.1-N.sub.4 each
denote any nucleotide, N'.sub.1-N'.sub.4 are complementary to
N.sub.1-N.sub.4, respectively (SEQ ID NOs: 7); 8)
AC(U).sub.nNNNNAUACCAGCCGAAAGGCCCUUGGCAGN'N'N'N', n ranges from 11
to 27, N is any nucleotide, N' is complementary to N (SEQ ID NOs:
8); 9) AC(Y).sub.nNNNNAUACCAGCCGAAAGGCCCUUGGCAGN'N'N'N', n ranges
from 19 to 23, N is any nucleotide, N' is complementary to N (SEQ
ID NOs: 9).
[0063] As shown below, theophylline mediated inhibition of
AdML-Theo29AG (SEQ ID NO: 6) splicing is highly specific: First,
theophylline inhibits the splicing of AdML-Theo29AG by blocking the
step II of the splicing. Second, a molecule similar in shape and
size to theophylline failed to elicit any effect on its splicing.
Third, the splicing of a pre-mRNA that does not contain
appropriately placed theophylline-binding aptamer remained
unaffected in the presence of theophylline. Finally, insertion of
theophylline aptamer 8 and 10 nucleotides downstream of the 3' or
5' splice site, respectively failed to elicit any effect on the
splicing.
[0064] However, the introduction or insertion of
theophylline-dependent aptamer at the 3' splice site does not
necessarily confer theophylline-dependent regulation of pre-mRNA
splicing. Distance as well as the location of 3' splice site AG
plays an important role in conferring theophylline-dependent
regulation of splicing. To investigate whether formation of
RNA-theophylline complex affects pre-mRNA splicing, a derivative of
AdML Par pre-mRNA (Gozani et al., 1994) designated AdML-Theo39AG,
that has a theophylline aptamer sequence 3' adjacent to the poly
(Y) tract was used (FIG. 2, whereas the 3' splice site G is 39
nucleotides away from C marked as 1). AdML-Theo39AG is isogeneic to
AdML Par (Gozani et al., 1994) except that AdML-Theo39AG contains a
long uninterrupted poly(Y) tract followed by theophylline binding
sequence, and the AG dinucleotide at the 3' terminus of AdML Par
has been deleted (compare AdML par and AdML-Theo39AG pre-mRNAs,
FIGS. 2A-B).
[0065] To analyze in vitro splicing, .sup.32P-labeled RNAs were
incubated in HeLa nuclear extract under standard conditions that
support splicing (Gaur et al., 1995). After incubation, the
splicing reaction was terminated and products were fractionated by
electrophoresis on a 13% denaturing polyacrylamide gel. The wild
type substrate, as expected, underwent both steps of the splicing
reaction with normal kinetics, as evidenced by the presence of
lariat containing RNAs and spliced mRNA (FIG. 2C; lanes 3-5).
Surprisingly, the splicing of AdML-Theo39AG substrate gave rise to
the accumulation of lariat-exon 2, suggesting that splicing was
strongly affected at the second step (FIG. 2C, compare lanes 3-5
with lanes 7-9).
[0066] To rule out the possibility that the observed step II
splicing inhibition in AdML-Theo39AG might be due to a higher order
structure formed by the presence of aptamer sequence, a derivative
of human .beta.-globin pre-mRNA (H.beta.-Theo41AG) in which the 3'
splice site AG is engineered to be the part of the theophylline
binding sequence was constructed. The in vitro splicing of
H.beta.-Theo41AG pre-mRNA also resulted in the inhibition of the
step II of the splicing.
[0067] It has been previously shown that pre-mRNA derivatives
bearing mutations of the splice sites (Aebi et al., 1986; Lamond et
al., 1987; Newman et al., 1985; Ruskin and Green, 1985; Seraphin
and Rosbash, 1990) or the branchpoint (Freyer et al., 1987; Gaur et
al., 1997; Hornig et al., 1986; Query et al., 1994) can undergo the
first step of the splicing, giving rise to a lariat-exon 2
intermediate that is blocked for the second step. To examine
whether mutation of the splice sites or branch point might be the
cause of step II splicing inhibition, AdML-Theo39AG substrate was
subjected to reverse transcription and PCR. The amplified DNA was
cloned into pCR2.1 vector using a TA cloning kit according to the
instructions provided by the manufacturer (Invitrogen). Sequencing
of 20 randomly selected clones revealed no mutations, suggesting
that a mutation of the splice sites or the branchpoint is not the
cause of step II splicing inhibition.
[0068] To further investigate why AdML-Theo39AG pre-mRNA failed to
undergo the second step of the splicing, we examined the 3' half of
the intron. As illustrated in FIG. 2, the sequence encompassing the
BPS-to-AG and poly(Y)-to-AG in AdML Par and AdML-Theo39AG indicate
striking differences. In AdML Par the 3' ss AG is located 23
nucleotides downstream of the BPS, whereas in AdML-Theo39AG this
distance is 39 nucleotides (compare FIGS. 2 A and B). In addition,
the poly(Y)-to-AG distance in AdML Par and AdML-Theo39AG is 4 and
11 nucleotides, respectively. Furthermore, in AdML-Theo39AG the
sequence between the poly(Y) tract and 3' ss AG contains several
purines. It has been previously proposed that a long BPS-to-AG
distance and the presence of purine residues preceding the 3' ss AG
not only affect not only the efficiency of the second step of the
splicing, but also the selection of the correct 3' splice site
(Chua and Reed, 2001; Luukkonen and Seraphin, 1997; Patterson and
Guthrie, 1991).
[0069] To determine whether the aforementioned reasons could be the
cause of step II splicing inhibition, an AdML derivative with
BPS-to-AG distance of 29 nucleotides and the sequence between the
poly(Y) tract and AG bearing the substitutions of cytidine for
guanosine was synthesized (FIG. 3A; AdML-Theo-29AG). The in vitro
splicing results of this pre-mRNA presented in FIG. 3B demonstrate
that lowering of the BPS-to-AG distance has indeed rescued the step
II splicing inhibition. Quantification of this data indicates that
unlike AdML-Theo-39AG where less than 10% of the pre-mRNA is
converted into the spliced product, .about.26% of AdML-Theo-29AG
pre-mRNA is converted into mRNA (compare lanes 7-9, FIG. 2C with
lanes 2-4, FIG. 3B). Remarkably, theophylline could efficiently
inhibit the step II of the splicing in a dose dependent manner, as
evidenced by the decrease in the amount of the second step
products, i.e., lariat and mRNA (FIG. 3B, compare lanes 2-5 with
lanes 6-17). This conclusion is further supported by the fact that
in the presence of theophylline, splicing of AdML-Theo-29AG
pre-mRNA resulted in the accumulation of the lariat-exon 2 (FIG.
3C). Quantification of the results presented in FIG. 3D indicate
that 0.5 mM theophylline was able to inhibit the splicing of
AdML-Theo-29AG by .about.50%, and at 2.0 mM theophylline,
.about.75% inhibition was achieved. To rule out the possibility
that the observed results are substrate specific, a derivative of
MINX pre-mRNA (Zillmann et al., 1988) (MINX-Theo28AG) carrying the
high affinity theophylline binding aptamer between the poly (Y)
tract and 3' splice site AG was synthesized. The in vitro splicing
of MINX-Theo28AG pre-mRNA indicates that theophylline-RNA
interaction could efficiently inhibit the step II of the splicing,
confirming the generality of this approach. Accordingly, the
BPS-to-AG distance plays a role in theophylline-dependent
modulation of RNA splicing.
[0070] Although lowering of BPS-to-AG distance from 39 to 29
nucleotides has relieved step II splicing inhibition in the absence
of theophylline, yet compared to the parent substrate the
efficiency of the second step of splicing of AdML-Theo-29AG remains
low (FIG. 2C, compare lanes 3-5 with FIG. 3B, lanes 2-5). To assess
whether further lowering of BPS-to-AG distance would improve the
step II splicing efficiency, two substrates, AdML-Theo-27AG and
AdML-Theo-Stem21AG, were constructed following standard PCR-based
cloning (see materials and methods). In AdML-Theo-27AG, the
BPS-to-AG distance is 27 nucleotides, and the lower stem of
theophylline aptamer contains only a single base-pair (FIG. 4A). On
the other hand, the BPS-to-AG distance in AdML-Theo-Stem21AG is 21
nucleotides, but the proximal AG is no longer located within the
theophylline binding pocket (FIG. 5A).
[0071] The in vitro splicing of AdML-Theo-27AG pre-mRNA
demonstrates that lowering of BPS-to-AG distance by 2 nucleotides
not only failed to improve the efficiency of the second step of
splicing any further (FIGS. 3B and 4B, compare lanes 2-5), but also
this pre-mRNA responded less efficiently to theophylline dependent
step II splicing inhibition (FIGS. 3D and 4C). In contrast,
lowering of BPS-to-AG distance to 21 nucleotides significantly
improved the splicing efficiency of AdML-Theo-Stem21AG (compare
FIGS. 3B and 4B, lanes 2-5 with FIG. 5B, lanes 1-4). However, like
AdML-Theo-27AG, AdML-Theo-Stem21 AG pre-mRNA responded poorly to
theophylline dependent splicing inhibition; while 0.5 mM
theophylline was able to inhibit the splicing of AdML-Theo-29AG by
more than 50%, a 4-fold higher concentration of theophylline could
only result in .about.40-50% inhibition of AdML-Theo-27AG and
AdML-Theo-Stem21AG splicing (FIGS. 3D, 4C-5C).
[0072] These results can be explained in terms of the location of
the 3' ss AG. In AdML-Theo-29AG, the AG proximal to the BPS is
"buried" inside the theophylline-RNA complex, which makes its
accessibility to the spliceosome as a 3' acceptor site difficult.
This interpretation is in general agreement with the NMR structure
of theophylline in complex with its aptamer, which revealed that
A28 (the adenine of 3' ss AG) participates in multiple interactions
involving G29 and G43 (FIG. 3A) (Zimmermann et al., 1997). These
interactions not only add to the stability of RNA-ligand complex,
but also likely interfere in the recognition and activation of AG
as a 3' ss signal. In the case of AdML-Theo-27AG, although the AG
is located inside the theophylline-binding pocket, the deletion of
three base pairs in the lower stem apparently compromises with the
stability of RNA-theophylline complex. On the other hand, in
AdML-Theo-Stem21AG the presence of proximal AG outside the
theophylline-binding pocket enables its recognition as the 3'
splice site relatively easier. Consequently, the BPS-to aptamer
distance as well as the location of AG within the aptamer plays a
critical role in conferring theophylline-dependent regulation of
pre-mRNA splicing.
[0073] The selection and activation of AG as a 3' splice site is a
complex phenomenon in which several step II splicing factors make
functionally important contacts near the 3' end of the intron
(Chiara et al., 1997; van Nues and Beggs, 2001 and references there
in). The results presented in the previous section strongly suggest
that sequestering of the AG within the theophylline-RNA complex
prevent such protein-RNA contact(s). If that is true, then
relocation of theophylline aptamer to a position that has no
apparent contribution in the selection and activation of AG will
have no effect on the splicing.
[0074] To test this hypothesis, we decided to synthesize an AdML
pre-mRNA derivative, termed AdML-TheoExon 2, in which the
theophylline-binding site was moved eight nucleotides downstream of
the 3' ss (FIG. 6). The in vitro splicing results presented in FIG.
6B demonstrate that AdML-TheoExon 2 pre-mRNA underwent both steps
of the splicing with normal kinetics, and unlike AdML-Theo29AG,
addition of theophylline had no effect on the outcome of either
step of the splicing (compare FIG. 3B, lanes 6-17 with FIG. 6B,
lane 6-14). The splicing of AdML-Theo+10*pre-mRNA in which
theophylline aptamer was inserted 10 nucleotides downstream of the
5' splice site also remained unaltered in the presence of
theophylline (data not shown). Thus, only the functionally
important elements of pre-mRNA could be the target of
theophylline-dependent control of pre-mRNA splicing.
[0075] It has been previously shown that in vitro, spliceosome
assembly on pre-mRNA can proceed through one-step assembly (Malca
et al., 2003; Stevens et al., 2002), or via a coordinated assembly
of complexes E.fwdarw.A.fwdarw.B.fwdarw.C with the catalytic steps
of splicing occurring in the complex C (Reed and Palandjian, 1997).
In addition, the efficiency of the spliceosome assembly and the
intermediate steps can be monitored by native gel electrophoresis
(Konarska and Sharp, 1986).
[0076] To investigate the effect of theophylline on spliceosome
assembly, .sup.32P-labeled AdML-Theo-29AG pre-mRNA was incubated
under splicing conditions in the absence or presence of
theophylline. Aliquots were removed at various time points,
followed by the separation of complexes on native agarose gels
according to the published protocol (Das and Reed, 1999). In the
absence of theophylline, complex A was detected as early as 5 min
and converted into B/C complex thereafter. Complex B/C appeared
after 5 min and peaked between 15-30 min, and after 30 min declined
steadily. In the presence of theophylline, the kinetics of
complexes A and B/C formation is not very different; complex A
appeared at 5 min and decreased thereafter. However, the amount of
complexes B/C steadily accumulated (FIG. 7A, compare lanes 4-6 with
lanes 9-12, 15-18 and 21-24). In addition, complex H, which almost
completely disappeared after 30 min in the absence of theophylline,
also accumulated even after 60-90 min of incubation (FIG. 7A,
compare lanes 5-6 with lanes 22-24). Quantitation of these results
presented in FIG. 7B indicate that theophylline-dependent
inhibition of the step II of splicing leads to the accumulation of
complex C, which is consistent with previously published reports in
which mutation of the 3' splice site (Gozani et al., 1994) or the
addition of boric acid, both of which specifically inhibit step II
of the splicing, led to the accumulation of complexes B/C (Shomron
and Ast, 2003; Shomron et al., 2002).
[0077] It is noted that the theophylline-mediated control of
pre-mRNA splicing is highly specific. The extraordinary ability
with which the splicing regulators discriminate between a specific
and a non-specific RNA target play a critical role in the precise
regulation of pre-mRNA splicing. For example, both U2AF65 (Zamore
et al., 1992) and Sxl (Sakamoto et al., 1992) are poly(Y) tract
binding proteins and yet, they utilize different mechanisms
(Banerjee et al., 2003; Singh et al., 2000; Singh et al., 1995) for
recognizing polypyrimidine tracts and perform different functions;
while U2AF65 is a splicing activator, Sxl is a repressor of
splicing (Valcarcel et al., 1993). Thus, before theophylline could
be employed as a splicing regulator its specificity must be
established. First, theophylline should not affect the splicing of
a substrate, which does not contain its binding site. Second,
molecules that are similar in size and shape to theophylline should
not inhibit the splicing of the pre-mRNA that contains
theophylline-binding sequence.
[0078] To address the first issue, we examine the splicing of
AdML-21AG (Chua and Reed, 2001), a pre-mRNA that does not contain
the binding site for theophylline, but otherwise is identical to
AdML-Theo-29AG (Compare FIGS. 3A and 8A). The results shown in
FIGS. 8B and C demonstrate that the splicing of AdML-21AG pre-mRNA
remained virtually unaffected even at the maximum tested dose of
theophylline.
[0079] The second issue was addressed by examining the splicing of
AdML-Theo-29AG in the presence of caffeine (FIG. 9). Caffeine
differs from theophylline only by a methyl group at the N-7
position in the imidazole ring, yet binds to theophylline aptamer
with 10,000-fold lower affinity (FIG. 9A) (Jenison et al., 1994).
Uniformly labeled AdML-Theo-29AG was incubated in HeLa nuclear
extract in the absence or with increasing concentrations of
caffeine, and the products of the splicing reaction were analyzed
by denaturing 13% PAGE. The splicing gel of FIG. 9B shows that even
at 2.0 mM concentration, caffeine failed to elicit any noticeable
effect on the splicing of AdML-Theo-29AG pre-mRNA. In contrast, a
similar concentration of theophylline was able to inhibit the
splicing of AdML-Theo-29 AG by more than 70% (compare FIGS. 3B,
lanes 6-17 and 9B, lanes 7-18). Collectively these results suggest
that theophylline-mediated inhibition of AdML-Theo29AG splicing is
highly specific.
[0080] Alternative splicing plays an important role in the
regulation of gene expression in higher eukaryotes. Alternative
splicing is normally regulated by the regulatory proteins, which
bind to the specific regions of pre-mRNA and enhance or repress the
ability of the spliceosome to recognize the splice sites flanking
the regulated exon (Black, 2003; Graveley, 2001). To demonstrate
that RNA-small molecule interaction could also regulate alternative
splicing, a model pre-mRNA in which two 3' splice sites competing
for a common 5' splice site was generated following standard
molecular biology techniques (FIG. 10, AdML-Theo-3'Minx). In
AdML-Theo-3'Minx pre-mRNA, the proximal 3' ss AG is embedded within
the theophylline-binding sequence, while the distal 3' splice site
is unmodified. It was contemplated that the binding of theophylline
to its target will repress the recognition of the proximal 3'
splice site thereby, redirecting the splicing machinery to activate
the distal 3' splice site. To test this, uniformly labeled
AdML-Theo-3'Minx pre-mRNA (-10 fmol) was incubated in HeLa nuclear
extract in the absence or presence of theophylline. In the control
splicing, theophylline was replaced by caffeine. As illustrated in
FIG. 10, in the absence of theophylline both proximal as well as
distal 3' splice sites were utilized to the same degree (FIG. 10,
lane 2). Importantly, the addition of theophylline, but not
caffeine, to the splicing reaction increased the ratio of distal to
proximal 3' splice site. Quantitation of the data revealed that 0.5
mM theophylline increased the ratio of distal to proximal 3' splice
site by .about.3-fold as compared to the control (FIG. 10C). These
results indicate that theophylline-RNA interaction can influence 3'
splice site switch.
[0081] Similar experiments were run using pre-mRNA substrates
wherein the 5' ss rather than the 3' ss was embedded within the
theophylline binding aptamer. Plasmids encoding three 5' ss
embedded AdML pre-mRNA derivatives (AdMLTheo54Mut, AdMLTheo57Mut,
AdMLTheo510Mut, and AdMLTheo513Mut) were constructed using a
standard PCR based approach (FIG. 32A). The length of the lower
aptamer stem in these substrates varied from 4 to 13 nucleotides.
To prevent the activation of a cryptic 5' ss, the GU's (potential
5' ss) upstream of the authentic 5' ss were mutated to GC. In a
splicing assay, theophylline was found to inhibit splicing of each
of these 5' ss embedded substrates (FIGS. 32B and C). The proximal
to distal product ratio decreased in the presence of theophylline
in the 10- and 13-nucleotide lower aptamer substrates (FIGS. 34A
and B). Theophylline induced alternative splicing in a
dose-dependent manner (FIGS. 35A and B). In a subsequent
spliceosome assembly assay, theophylline was found to inhibit
spliceosome assembly (FIGS. 33A and B).
[0082] Controlling gene expression in living cells through
theophylline-RNA interaction. In the in vitro splicing assay,
theophylline-RNA interaction has been shown to regulate pre-mRNA
splicing. To determine if such an approach could also regulate gene
expression in living cells, a splicing reporter was constructed in
which the cDNA of AdML-Theo29AG pre-mRNA was inserted into the 5'
UTR of green fluorescence protein (GFP) cDNA. It was contemplated
that theophylline mediated inhibition of AdML-Theo29AG splicing
will prevent the export of GFP mRNA which will be mirrored by the
lack of GFP expression. The reporter plasmid was constructed by
standard molecular cloning approach. In brief, a PCR amplified DNA
fragment containing the entire AdML-Theo29AG sequence was cloned
into the EcoRI/Sal I digested expression vector (pEGFP-N1,
Invitrogen). The resulting reporter plasmid, pAdML-Theo29AG-EGFP,
contains the cDNA of AdML-Theo29AG pre-mRNA fused 5' to the GFP
coding sequence.
[0083] To examine theophylline-mediated regulation of AdML-Theo29AG
splicing, HEK293 cells were transfected with pAdML-Theo29AG-EGFP
reporter using polyfectin following manufacturer's instructions
(Qiagen). Cells were grown and maintained in a humidified
atmosphere at 37.degree. C. under 5% CO2 in Dulbecco's Modified
Eagle Medium (Cellgro) supplemented with 10% fetal bovine serum and
antibiotics (100 .mu.g/ml streptomycin and 100 U/ml penicillin).
For transfection, cells (3.times.10.sup.4, per well) were seeded in
a 24 well plate and incubated for 24 h (50-80% confluency) at which
time pAdML-Theo29AG-EGFP or pEGFP-N1 was introduced. After 10 hours
of incubation, cells were treated with buffer or theophylline (0 to
1M) and incubation was continued up to 48 hours. The GFP expression
was visualized with a fluorescence microscope and cells were
photographed with color CCD camera (Olympus). We observed that the
cells, which were transfected with pAdML-Theo29AG-EGFP and treated
with theophylline showed a dose dependent decrease in GFP
expression (FIG. 11A). In contrast, theophylline treatment had
virtually no effect on levels of GFP expression of cells that were
transfected with the control plasmid, pEGFP-N1 (FIG. 11B).
[0084] An RT-PCR assay was performed to confirm that
theophylline-mediated reduction of GFP expression is due to the
inhibition of AdML-Theo29AG-EGFP splicing and not the result of
mRNA degradation. Total RNA was isolated (from 3.times.10.sup.4
cells) using trizol reagent. In a total volume of 20 .mu.l, 5 .mu.g
of total RNA was reverse transcribed (RT) using vector specific
reverse primer (GFPR, 5'-GTCGCCGTCCAGCTCGACCAGG-3') according to
manufacturer's instructions (Invitrogen Kit). Next, an aliquot (2
.mu.l) of RT product was subjected to PCR amplification in a 50
.mu.l reaction using 2.5 units of Taq polymerase, vector specific
forward (GFPF, 5'-GCGCTACCGGACTCAGATCTCG-3') and reverse primer
(GFPR, 5'-GTCGCCGTCCAGCTCGACCAGG-3'). The amplified product was
analyzed on a 2% agarose gel. As shown in FIG. 11C, theophylline
repressed the splicing of AdML-Theo29AG-EGFP pre-mRNA. Unlike the
untreated control, which generated .about.250 bp fragment,
theophylline treated cell yielded a PCR product corresponding to
the size of unspliced RNA (.about.350-bp). Significantly, there is
a direct correlation between the intron retention and the
concentration of theophylline (FIG. 11C, cf lanes 2-7). Notably,
the RT-PCR of RNA from the cells transfected with control vector
yielded a smaller DNA fragment (FIG. 11D, this vector did not
contain AdML-TheoAG29 pre-mRNA). These results indicate that
theophylline-RNA interaction can regulate the splicing of a target
gene both in vitro as well as in vivo.
[0085] As mentioned above, another aspect of the present invention
relates to the optimization of the BPS-to-3' splice (AG) distance.
It has been reported that the preferred distance for an AG to serve
as the site for second transesterification step has been proposed
to be 19 to 23 nucleotides downstream from the BPS (Chua and Reed,
2001). Thus, preferred pre-mRNA for theophylline-dependent splicing
includes the one in which BPS-to-AG distance is 19 to 23
nucleotides and AG is located within the theophylline binding
pocket. The sequences subject to the optimization include:
TABLE-US-00002 (SEQ ID NO: 11) 1)
ACUUUUUUUCCUCAUACCAGCCGAAAGGCCCUUGGCAG; (SEQ ID NO: 12) 2)
ACUUUUUUUUCCUCAUACCAGCCGAAAGGCCCUUGGCAG; (SEQ ID NO: 13) 3)
ACUUUUUUUUUCCUCAUACCAGCCGAAAGGCCCUUGGCAG; (SEQ ID NO: 14) 4)
ACUUUUUUUUUUCCUCAUACCAGCCGAAAGGCCCUUGGCAG; and (SEQ ID NO: 15) 5)
ACUUUUUUUUUUUCCUCAUACCAGCCGAAAGGCCCUUGGCAG.
[0086] To test this, a series of pre-mRNAs will be synthesized in
which the BPS-to-AG distance will be varied from 19 to 23 nt.
Plasmids encoding these pre-mRNAs (FIG. 12, AdML-Theo19, 21 and
23-AG) will be constructed by inserting oligonucleotides into the
Hind III and Sal I sites of pAdML-Theo29AG to replace the sequences
from the BPS to the entire theophylline-binding sequence.
Linearized plasmids will be used to transcribe pre-mRNAs. Next,
.sup.32P-labeled pre-mRNAs (.about.10 fmol) will be subjected to in
vitro splicing in the absence or presence of theophylline as
described in FIG. 3. The pre-mRNA, which in the absence of
theophylline completes both steps of the splicing with normal
kinetics, and whose splicing is specifically inhibited by the
addition of theophylline will be used in future experiments.
[0087] Another aspect of the present invention relates to the
modification of theophylline-dependent aptamers to improve their
affinity for theophylline, preferably in physiological relevant
concentration of divalent metal ions (e.g., Mg.sup.2+). As
described above, theophylline achieves partial modulation of RNA
splicing (FIG. 3). This could most likely be due to the
differential metal ion requirements for the binding of theophylline
to its cognate RNA and in vitro splicing reaction. While 5.0 mM
Mg.sup.2+ (Jenison et al., 1994; Zimmermann et al., 2000) has been
reported to be optimum for the high affinity RNA binding of
theophylline, .about.3.0 mM Mg.sup.2+ has been found to be optimum
for in vitro splicing (Krainer et al., 1984). Although the observed
.about.70% repression of splicing is sufficient to influence splice
site switch, in many cases a complete repression may be desirable.
Moreover, it would be even preferable, especially for in vivo
applications, if this could be achieved by using physiological
relevant concentrations of Mg.sup.2+ (e.g., .about.3.0 mM).
[0088] To achieve high affinity theophylline-aptamer binding at
physiological Mg.sup.2+ concentrations, the RNA affinity of
theophylline will be increased by introducing modifications in the
existing aptamer. A large body of evidence suggests that modified
nucleotides stabilize RNA structures by affecting thermodynamic and
kinetic parameters (Bevers et al., 1999; Proctor et al., 2004). As
a parallel approach, we will employ in vitro selection to screen
new aptamers that may bind to theophylline with high affinity and
specificity at .about.3.0 mM Mg.sup.2+.
[0089] The NMR structure of theophylline-aptamer complex indicates
that a number of stacking interactions make important contribution
towards stabilization of the RNA-theophylline complex (Zimmermann
et al., 1997). For example, a "base-zipper" which forms one side of
the binding pocket and consists of residues U6, C22, A7, and C21
plays an important role in the stabilization of theophylline-RNA
complex (FIG. 13). Likewise, on the other side of the core, G26
intercalates between the bases U24 and G25 (FIG. 13). Additional
interactions between A5 and U6, and A28 and G29 have been proposed
to stabilize this complex (FIG. 13). This model predicts that an
increase in the hydrophobicity of U6, U23 or U24 residues should
increase the stability of theophylline-RNA complex. Indeed,
replacement of U24 by an unnatural base,
5-phenylethynyl-3-(.beta.-D-ribofuranosyl)pyridin-2-one (Ph-y)
(FIG. 14) has been shown to significantly improve the stability of
theophylline aptamer (Endo et al., 2004). Likewise, an adenosine
analog, 2-(4-phenylbutyl)-adenosine (A-4cPh) in which a phenyl
group is linked to the adenine base has been shown to increase the
affinity of a mutant U1A protein for U1 snRNA (FIG. 14) (Zhao and
Baranger, 2003). Thus, it is conceivable that insertion of these
modifications into the theophylline aptamer may improve its
affinity for theophylline.
[0090] In addition, one embodiment of the invention relates to a
systematic analysis of the effect of these modified nucleotides on
the RNA affinity of theophylline. For example, a series of
theophylline aptamers bearing the substitution of Ph-y for U6, U23
or U24 will be synthesized by in vitro transcription following the
published protocol (Endo et al., 2004). Because Ph-y can be
incorporated into the RNA only if the template contains an
unnatural base (2-amino-6-(2-thienyl) purine) opposite the site of
Ph-y incorporation, T7 transcription templates containing
2-amino-6-(2-thienyl) purine at predetermined site will be
synthesized as described in the literature (Endo et al., 2004). The
aptamers with A-4cPh modification at position A5, A7, A10 or A28
will be synthesized following standard RNA synthesis protocol by
substituting A4cPh phosphoramidite for adenosine phosphoramidite
(Zhao and Baranger, 2003). Since the phenyl groups in Ph-y and
A4cPh do not occupy the positions, which have been proposed to be
involved in the base-triple interactions (Zimmermann et al., 1997),
these modifications may not interfere in the binding of
theophylline. Once the RNA aptamers with the desired modifications
are synthesized, our next goal will be to determine the binding
affinity of theophylline for modified aptamers. We will use
equilibrium filtration technique to estimate RNA affinity of
theophylline (Jenison et al., 1994). Among the sets of Ph-y and
A-4cPh modified aptamers that provide tight binding (better than
the wild type aptamer) will be subjected to double substitution to
determine if a further increase in the binding affinity can be
achieved. In other words, if determined that from the sets of Ph-y
and A4cPh modified aptamers U23 and A7 modifications, respectively
resulted into improved binding of theophylline, then an aptamer
bearing both U23 and A7 modifications will be synthesized and
tested for its ability to bind theophylline. The aptamer with
highest binding affinity will be used to construct AdML derivative
following Moore and Sharp approach (Moore and Sharp, 1992). First,
we will construct pre-mRNAs as shown in FIG. 12. However, if they
turn out to be less effective, then we will substitute the modified
aptamer for the aptamer in AdML-Theo29AG. Finally, the splicing of
the assembled pre-mRNAs will be examined in the absence or with
increasing concentrations of theophylline. If found that
theophylline can achieve a complete or improved inhibition of the
splicing, that would suggest that the preexisting RNA structural
information can be used to increase the binding affinity of
theophylline.
[0091] Another embodiment of present invention relates to methods
of designing/screening/isolating aptamers that bind to theophylline
at physiological Mg.sup.2+ concentration. It has been reported that
in vitro selection can be used to isolate RNA aptamers, which can
specifically bind to a trans-activation-responsive (TAR) RNA at
physiological magnesium condition (3.0 mM) (Duconge and Toulme,
1999). If an anti-TAR aptamer could bind to a polyanionic target
with high affinity (Kd .about.30 nM) and specificity, it is
conceivable that SELEX (Joyce, 1994) might also evolve an aptamer
that would bind to theophylline with high affinity at physiological
Mg.sup.2+ concentration. The isolation of aptamers will be carried
out according to the published protocol (Jenison et al., 1994)
except that selection will be performed in the buffer containing
3.0 mM Mg.sup.2+. Briefly, the RNA populations (pool of
.about.10.sup.12 molecules) will be generated by in vitro
transcription from a DNA template containing a random cassette of
30 nucleotides (FIG. 15). Because the coupling efficiency of dG and
dT monomers is higher than dA and dC, a pre-made mixture of
dA:dG:dC:dT, 1.5:1.15:1.25:1 will be used for the synthesis of
random pool. This will prevent the overrepresentation of dG and dT
in the random DNA library (Huang and Szostak, 2003; Marshall and
Ellington, 2000).
[0092] Prior to in vitro selection, 12-15 cycles of PCR will be
performed with .about.0.2-0.4 .mu.mol of gel purified DNA library
with forward (primer 1, SEQ ID NO: 37) and reverse (primer 2, SEQ
ID NO: 38) primers which will bind to the constant segments (FIG.
15). The initial DNA pool will be subjected to the second PCR
amplification with the forward primer containing the T7 promoter
sequence (primer 3, SEQ ID NO: 39) and the same reverse primer used
in the previous PCR. RNAs will be generated by in vitro
transcription using PCR amplified library and T7 RNA polymerase.
Before the actual selection, the starting pool will be heat
denatured to disrupt potentially higher order structures. Next, the
RNA pool will be allowed to pass through the underivatized
Sepharose column followed by the column containing
theophylline-linked Sepharose, which will be prepared following
published report (Jenison et al., 1994). The bound RNAs will be
eluted by theophylline and then converted to cDNAs for further
amplification by PCR. To increase the stringency of the selection
process, "counter SELEX" step will be included: after washing,
bound RNAs will first be eluted with 0.1 M caffeine. Unlike
previously reported protocol, where 0.1 M theophylline was used for
elution (Jenison et al., 1994), buffers with step-wise increase of
theophylline concentration will be used. Initially, we will start
with buffers containing 10-20 .mu.M theophylline. The rational for
using low concentrations of theophylline is to isolate only those
RNA molecules that bind to theophylline with extremely
high-affinity. If 10-20 .mu.M theophylline failed to elute
detectable amounts of RNAs, elution buffer containing increasing
concentrations of theophylline (a step-wise increase) will be used.
Each RNA population isolated from increasing concentrations of
theophylline will be subjected to reverse transcription and PCR
amplification separately. After 8-10 rounds of selection, the
double-strand complementary DNA populations derived from each set
will be cloned and sequenced. Finally the binding affinity of each
class of aptamers will be estimated (Jenison et al., 1994).
[0093] Once a class of high affinity theophylline aptamer is
identified, we will determine the minimal sequence that may be
sufficient for the binding of theophylline. To this end,
sequence/motif that is common among the candidate aptamers will be
identified, and mfold program will be used to generate the
secondary structure (Zuker, 1989). With this information in hand,
aptamers bearing the deletion of non-consensus sequences will be
synthesized and evaluated for their affinity for theophylline. The
aptamer(s) that bind to theophylline with high affinity (preferably
in low nM range) at physiological Mg.sup.2+ will be used to
generate AdML derivatives essentially as described above. The new
anti-theophylline aptamer will not only be of direct use in the
proposed studies, but also be of general interest for generating
theophylline dependent allosteric ribozymes and in the construction
of highly sensitive biosensor for monitoring theophylline in
biological samples.
[0094] Another aspect of the present invention relates to method of
developing theophylline-dependent bifunctional molecules which can
regulate pre-mRNA splicing. It has been demonstrated that a system
based on theophylline-RNA aptamer binding could be manipulated to
regulate pre-mRNA splicing. However, such an approach may not be
applicable for reprogramming the splicing of an endogenous gene.
With the aim of developing a versatile approach, which not only
modulates pre-mRNA splicing like an antisense RNA, but also has the
mechanism to switch on/off the binding of antisense RNA, it is
contemplated that if an antisense oligonucleotide directed to bind
an exonic splicing enhancer (ESE) were part of theophylline aptamer
then the resulting bifunctional molecule would be modular in
nature: The binding of antisense domain to the ESE will repress the
splicing of targeted pre-mRNA, whereas the addition of theophylline
to the splicing reaction will induce a conformational rearrangement
which will displace antisense RNA from its target. Thus, the
bifunctional molecule will function like an allosteric enzyme whose
activity can be controlled by an effector.
[0095] To test this, we designed a bifunctional theophylline
aptamer in which the non-conserved portion of the aptamer is
complementary to the ESE present in the alternative exon M2 of the
mouse IgM gene (FIG. 16). The IgM pre-mRNA is a well-characterized
substrate and its ESE is essential for the splicing of the
preceding intron between exon M1 and M2 (Tanaka et al., 1994;
Watakabe et al., 1993). To prevent non-specific binding,
.sup.32P-labeled IgM pre-mRNA and bifunctional aptamer were
denatured for 1 minute at 90.degree. C. followed by incubation for
10 min at 30.degree. C. Next, the splicing mixture with or without
theophylline was added, and reaction mixture incubated at
30.degree. C. for 2 hours. After which the products of the splicing
reaction were separated on a 13% denaturing polyacrylamide gel.
FIG. 16 shows that in contrast to a non-specific control (lane 1),
the addition of 10 pmole of enhancer specific bifunctional aptamer
was able to inhibit the splicing by .about.50%. However, addition
of theophylline and bifunctional aptamer together resulted in
restoration of splicing (FIG. 16, compare lanes 2 and 10, and
histogram in panel C), suggesting that a theophylline induced
conformation change has displaced the bifunctional aptamer from the
enhancer.
[0096] It is noted that the bifunctional aptamer did not elicit a
complete inhibition of splicing. Although increasing the
concentration of bifunctional aptamer did improve splicing
repression (FIG. 16, lane 2-5), but the efficiency of
theophylline-mediated restoration of splicing was also compromised,
suggesting that excess bifunctional aptamer likely titrated out
theophylline. The observed incomplete repression of splicing might
also be the result of nucleases-assisted degradation of
bifunctional aptamer. Incubation of .sup.32P-labeled bifunctional
aptamer in HeLa nuclear extract confirmed that significant portion
of the RNA is degraded (not shown). We also observed that
theophylline-mediated reversal of splicing repression is
impressive, but requires 1.0 mM theophylline. A possible
explanation to this observation could be that the free energy of
theophylline-aptamer binding may be insufficient to disrupt the
Watson-Crick base-paring interactions between the antisense domain
and ESE. High affinity binding of theophylline to its aptamer
requires 5.0 mM Mg.sup.2+ (Jenison et al., 1994), and under in
vitro splicing conditions at .about.3.0 mM Mg.sup.2+ apparently
weak interaction between theophylline and aptamer might have
resulted into incomplete reversal of splicing inhibition. This may
also be true for incomplete inhibition of AdML-Theo29AG splicing
(FIG. 3).
[0097] Another aspect of the present invention relates to methods
of improving the stability of bifunctional theophylline aptamer
against nucleases. The high affinity theophylline aptamer
identified will serve as the starting molecule to generate nuclease
resistant bifunctional aptamer. A number of chemical modifications
have been shown to increase the stability of both DNA and RNA
against nucleases (Kurreck, 2003). Modifications that have been
shown to improve the stability of antisense RNAs will be tested to
identify those that show maximum serum stability without
compromising with the affinity for theophylline.
[0098] For example, a bifunctional aptamer may be modified to
improve stability by using phosphorothioate. One of the most
important chemical modifications that have been widely used in
classical antisense approach is the replacement of the
phosphodiester backbone with phosphorothioate (PS) linkage
(Kurreck, 2003; Vortler and Eckstein, 2000). Excellent water
solubility, reduced cleavage by nuclease, relative ease of
synthesis, and improved bioavailability of P-S modified
oligonucleotides make them an attractive tool for antisense
research. The phosphorothioate substituted bifunctional aptamer
will be synthesized by standard in vitro transcription except that
NTPs will be replaced by NTPaS. The resulting bifunctional aptamer
will be tested for nuclease sensitivity by incubating in HeLa
nuclear extract. Splicing assay will be performed with IgM
pre-mRNA.
[0099] Another example of improving the stability of a bifunctional
aptamer is to use 2'-modified nucleotides. The presence of 2'
hydroxyl group in RNA makes it more susceptible to cleavage by
nucleases (Eder et al., 1991; Shaw et al., 1991; Tsuji et al.,
1992). Interestingly, modifications such as 2'-O-methyl (Monia et
al., 1993), 2'-deoxy-2'-fluoropyrimidines (Kawasaki et al., 1993)
and 2'-O-methoxyethyl (2'-OMOE) (Chen et al., 2002) have been shown
to increase the stability of RNA. Among them,
2'-deoxy-2'-fluoropyrimidine has gained considerable attention.
Compared to unmodified RNAs, 2'-fluoro, 2'-deoxy-substituted RNAs
are significantly more stable (10.sup.3-10.sup.5-fold), and
therefore more commonly used for the preparation of aptamers,
ribozymes and antisense molecules for therapeutic application
(Heidenreich et al., 1994; Kubik M F, 1997; Pieken et al., 1991).
In addition to having resistance to nucleases, 2'-deoxy,
2'-fluoronucleosides prefer to adopt C3'-endo conformation, as in
the case of ribonucleosides (Aurup et al., 1992; Guschlbauer,
1980). Furthermore, the commercial availability of 2'-deoxy,
2'-fluoronucleosides both as a 5' triphosphate and phosphoramidite,
allow the synthesis of 2'-fluoro substituted RNAs by chemical and
enzymatic methods.
[0100] Pardi and coworkers (Zimmermann et al., 2000) have shown
that all but one 2' hydroxyl group (U24) of theophylline binding
aptamer can be converted to the 2'-deoxy without having a
noticeable effect on its affinity for theophylline. Thus, it is
reasonable to assume that replacement of uridines (except U24) by
2'-deoxy, 2'-fluorouridine may not have any negative effect on RNA
affinity of theophylline. Bifunctional aptamer will be synthesized
in which the 2'-deoxy-2,-fluorouridine will be substituted for
uridine (except U24), and the four terminal phosphodiester linkages
will be replaced by P-S group; a report published by Eckstein and
coworkers suggests that such a combination significantly improves
the stability of hammerhead ribozymes (Heidenreich et al.,
1994).
[0101] Another aspect of the present invention relates to a novel
bimolecular allosteric hammerhead molecule, which should be able to
regulate pre-mRNA splicing in theophylline-dependent manner. In
other words, theophylline-dependent bimolecular hammerhead
ribozymes may be engineered to regulate pre-mRNA splicing. It has
been demonstrated that hammerhead ribozyme can be made to induce or
suppress RNA cleavage in theophylline-dependent fashion by
appending theophylline aptamer to a non-essential stem region
(Soukup and Breaker, 1999a; Soukup and Breaker, 1999b; Soukup et
al., 2000). It has also been shown that both hammerhead ribozyme
(Kuwabara et al., 1998; Kuznetsova et al., 2004) and theophylline
aptamer (Zimmermann et al., 1998; Zimmermann et al., 2000) could be
assembled into their native conformations by using two RNA
oligonucleotides. These properties of theophylline aptamer and
hammerhead ribozyme will be exploited to generate an effector
dependent hammerhead ribozyme, which will regulate the splicing of
a target pre-mRNA without cleaving the pre-mRNA.
[0102] The theophylline-dependent bimolecular hammerhead ribozyme
approach is outlined in FIG. 17. RNA A is the lower half of the
theophylline-dependent hammerhead ribozyme in which the 5' portion
of stem I is complementary to ESE. The IgM pre-mRNA and RNA A will
be incubated in nuclear extract under splicing conditions. This
will repress the splicing of IgM pre-mRNA. This assumption is
supported by the data presented in FIG. 16. The addition of both
RNA B and theophylline, but not individually, to the splicing
reaction will lead to the assembly of the active hammerhead
ribozyme, and restoration of splicing. Since the assembly of the
active ribozyme has been reported to be dependent on the presence
of theophylline (Soukup and Breaker, 1999a; Soukup et al., 2000),
the addition of either RNA B or theophylline to the splicing
reaction may not revert inhibition. The prerequisite for
theophylline-dependent assembly of hammerhead ribozyme is the
disruption of RNA A-ESE duplex, and an extended duplex might prove
to be problematic. Thus, initial experiments will be aimed at
optimization of the length of the antisense domain of RNA A. The
ideal antisense domain should be long enough to achieve repression,
but be displaced in the presence of theophylline and RNA B. We will
start with 8 nucleotides, which was originally employed to generate
theophylline dependent allosteric ribozyme (Soukup and Breaker,
1999a). If determined that 8 nucleotides failed to provide splicing
repression, we will increase the length to 10, 12 and 15
nucleotides.
[0103] To test the utility of the proposed approach, the splicing
of IgM pre-mRNA will be examined. .sup.32P-labeled pre-mRNA and RNA
A will be annealed. After 15-20 minutes, theophylline, RNA B, HeLa
nuclear extract and other components of the splicing mix will be
added followed by incubation at 30.degree. C. for 2 hours. Control
reactions without RNA B or theophylline will also be performed.
Although .about.200 .mu.M theophylline has been reported to be
optimum for the assembly of active ribozyme, for the proposed assay
the optimum concentration will be determined (0.1-1 mM will be
tested). The products of the splicing reaction will be analyzed. It
is expected that the splicing reaction performed in the presence of
RNA A will not yield the spliced RNA. In contrast, the reaction
carried out in the presence of RNA A, RNA B and theophylline will
result into mRNA.
[0104] Another aspect of the present invention relates to methods
of modulating RNA splicing in a subject using theophylline and
theophylline-dependent riboswitch. The experiments described in the
application demonstrate that the aptamer selected in vitro could
retain its target recognition property in a cell free system or
when expressed inside the living cells. If theophylline-RNA
interaction could control a 3' splice site switch in a model
pre-mRNA (FIG. 10), it is reasonable to expect that it might also
regulate the alternative splicing of a physiologically relevant
trans-gene in a subject (e.g., a model organism). However, before
undertaking experiments in transgenic animals, it will be prudent
to test theophylline modulation with cultured cells or extracts
prepared from such cells.
[0105] In one embodiment, Drosophila cells are used for the test.
Drosophila sexual differentiation involves a hierarchy of
alternative splicing events, which are the best-characterized
examples of alternative splicing regulation (Black, 2003; Cline and
Meyer, 1996; Lopez, 1998). The Drosophila protein sex-lethal (Sxl),
which is the master sex-switch in somatic cells and only expressed
in female flies, regulates the alternative splicing of transformer
(tra) pre-mRNA (Boggs et al., 1987; Granadino et al., 1997; Inoue
et al., 1990; Sosnowski et al., 1989; Valcarcel et al., 1993).
Experiments in transgenic flies and with nuclear extracts prepared
from HeLa as well as Drosophila cells have demonstrated that Sxl
protein blocks the binding of general splicing factor U2AF to NSS
3' ss and thereby diverting it to activate the lower affinity
female specific (FS) 3' splice site (Inoue et al., 1990; Sosnowski
et al., 1989; Valcarcel et al., 1993) (FIG. 18). In contrast, lack
of Sxl expression in male flies leaves U2AF to bind to the NSS Py
tract, enabling the synthesis of a truncated non-functional protein
(FIG. 18). Our hypothesis is that if the AG of NSS 3' splice site
were to be the part of a high-affinity theophylline-binding site,
then binding of theophylline to its cognate sequence would
sequester NSS 3' splice site thus, allowing the activation of
female specific 3' splice site.
[0106] To test theophylline-mediated modulation of tra splicing, a
series of M-tra derivatives carrying the high affinity
theophylline-binding site at various positions 5' to the NSS 3'
splice site junction will be constructed (FIG. 19 and see below).
M-tra is a derivative of tra, which was designed to overcome the
low in vitro splicing efficiency of tra, and has been shown to
faithfully recapitulate Drosophila gender specific splicing in HeLa
as well as in Drosophila nuclear extracts (Valcarcel et al., 1993).
In addition, M-tra lacks exon 3, which is included in both
sexes.
[0107] As outlined in FIG. 20, an overlapping PCR approach will be
used to generate M-Theo-tra derivatives containing
theophylline-binding site at positions 26, 28 and 30. In the first
PCR, the portion of M-Theo-tra encompassing the first exon and
non-sex-specific 3' splice site will be generated using forward
(Primer #1) and reverse primers (Primer #2). The forward primer
will be specific for the first exon and the reverse primer will be
designed to bind the NSS 3' splice site and carry the theophylline
aptamer sequence. The second PCR will be carried out with a forward
primer (Primer #3) whose 5' end will be overlapping to the 3' end
of the first PCR product, and the reverse primer will be designed
to bind 3' end of the second exon (Primer #4). In the third PCR,
the products of first two PCRs will be annealed and forward and
reverse primers from the first and second PCRs, respectively will
be used. The gel purified PCR product will be cloned downstream of
T7 promoter in KpnI/BamHI digested pBluescript SK (Stratagene) to
yield pM-Theo-tra37, pM-Theo-tra39 and pM-Theo-tra41. The plasmids
pM-mutTheo-tra37, pM-mutTheo-tra39 and pM-mutTheo-tra41, each one
carrying a mutation in the theophylline-binding site, and is
expected not to bind theophylline, will also be generated
(Zimmermann et al., 2000). The authenticity of these constructs
will be confirmed by sequencing.
[0108] To determine whether M-Theo-tra can recapitulate gender
specific splicing of tra, .sup.32P-labeled M-Theo-tra pre-mRNA will
be incubated in HeLa nuclear extract in the presence of
theophylline or caffeine as described in FIG. 3. The splicing of
M-mutTheo-tra will also be performed in an identical manner. The
M-theo-tra derivative in which the addition of theophylline
inhibits NSS 3' splice site with simultaneous activation of FS 3'
splice site would be the desired substrate and will be used in
future experiments. Additionally, in the absence of theophylline or
in the presence of caffeine, this substrate is expected to undergo
male specific default splicing. Finally, none of the M-mutTheo-tra
derivatives (negative control) are expected to undergo
theophylline-dependent 3' splice site switch.
[0109] It was further investigated whether theophylline could be
used to regulate splicing of tra in a more physiological and
biologically meaningful context, for example, in Drosophila
Schneider cells (SL-2). Drosophila Schneider cells (SL-2), which
are known to be male with respect to Sxl expression provides an
excellent model system for studying the underlying mechanisms that
control the sex determination pathway (Ryner and Baker, 1991).
Before theophylline could be employed as a regulatory molecule it
is important to determine whether theophylline has any adverse
effect on the growth of Schneider cells. To this end, Schneider's
cells (2.times.10.sup.6, per well) were seeded in a six well plate
in 3 ml Drosophila medium supplemented with 5% FCS and L-glutamine
(Invitrogen). The cells were grown at 27.degree. C. without CO2 in
the absence or presence of theophylline. After 72 h, cell were
harvested and resuspended in PBS containing trypan blue (0.05%).
The cells were counted using hemocytometer. Dead cells were
identified by uptake of the trypan blue; live cells by exclusion of
the trypan blue marker. In FIG. 21, the growth rate for Schneider's
cells in the presence of indicated concentrations of theophylline
(an average of three identical experiments were performed in
parallel) is shown. The data indicates that even at the highest
concentration of theophylline (2 mM) the growth profile of majority
of cells is not altered. Because 0.1-0.5 mM theophylline is
sufficient to inhibit pre-mRNA splicing (FIG. 11), Schneider's
cells can be safely used to study theophylline-dependent regulation
of tra splicing.
[0110] It is contemplated that the M-theo-tra derivative (FIG. 19),
which responds best to theophylline-dependent gender specific
splicing, will be used in here. M-theo-tra will be subcloned
downstream of metallothionein promoter in a Drosophila expression
vector pRmHa-3, a generous gift from Juan Valcarcel. The expression
plasmid pRmHa-3 is a pUC18 based vector and contains the promoter,
metal response element and transcription start site from the
metallothionein gene followed by the multiple cloning site, and the
polyadenylation signal (A+) from the Drosophila melanogaster
alcohol dehydrogenase (ADH) gene. The Drosophila expression vector
(pRM-mutTheo-tra) harboring an analog of M-Theo-tra, which contains
a mutation in theophylline-binding site, will also be constructed.
The construction of these plasmids will be carried out following
standard molecular cloning techniques. In brief, PCR amplified
fragments encoding M-Theo-tra or M-mutTheo-tra will subcloned into
EcoR I/Sal I digested pRmHa-3 to yield pRM-theo-tra. The
authenticity of the inserts will be confirmed by direct
sequencing.
[0111] Schneider cells will be transiently transfected with
pRM-theo-tra, pRM-mutTheo-tra or with empty vector (pRmHa-3). In
brief, Schneider cells (2-3.times.10.sup.6 cells/well) will be
seeded in a six well plate in 3 ml Drosophila medium (Gibco)
supplemented with 5% FCS, and 50 .mu.g/ml gentamycin. The following
day, cells will be washed with 2-3 ml of serum free medium, and
transfected with 0.5-3.0 .mu.g plasmid (the total amount of DNA
will be kept constant by using empty vector) using CellFectin
(Invitrogen) following manufacture's instructions. The amount of
DNA and the transfection time will be standardized and the
conditions that result in highest transfection efficiency will be
used. After 18-24 h, the DNA-containing medium will be replaced by
3 ml of Drosophila medium and cells will be allowed to grow for
another 24 h. At this stage theophylline or caffeine will be added
and the transcription will be induced by CuSO4 (0.7-1.0 .mu.g).
After an incubation of 24 and 48 h, cells will be collected, washed
with ice cold PBS, total RNA will be isolated with PARIS.TM. Kit
(Ambion), and analyzed by RT-PCR. Since the timing of theophylline
addition (after transfection), concentration of copper sulfate and
induction time could affect the outcome of an experiment; each of
these factors will separately optimized. Although every effort will
be made to maintain Schneider cells under optimal culture
conditions according to the published protocol (Bunch et al.,
1988), cultured cells are known to change their properties with
repeated passages. Therefore key findings obtained with Schneider
cells will also be studied in other cell line such as Drosophila Kc
cells.
[0112] It is contemplated that both pRM-Theo-tra and
pRM-mutTheo-tra transfected cells, untreated or treated with
caffeine, are expected to undergo male specific splicing, i.e., the
NSS 3' splice site will be activated, which would be confirmed by
.about.383-bp PCR product. Upon theophylline treatment,
pRM-theo-tra, but not pRM-mutTheo-tra transfected cells, is
expected to generate female specific splicing (.about.186-bp band
in RT-PCR) 3. Finally, pRmHa-3 (vector only) transfected cells will
be negative in terms of M-Theo-tra splicing.
[0113] Another aspect of the present invention relates to methods
of placing or inserting a theophylline aptamer into the 5' splice
site and determining whether a theophylline-dependent riboswitch
would modulate the 5' splice site choice in the presence of
theophylline. Another aspect of the present invention relates to
methods of modulating RNA splicing comprising the steps of
inserting a theophylline aptamer into the 5' spice site and
modulating pre-mRNA splicing in the presence of theophylline.
[0114] Another aspect of the present invention relates to methods
of placing or inserting a theophylline aptamer into the BPS and
determining whether a theophylline-dependent riboswitch would
modulate pre-mRNA splicing in the presence of theophylline. Another
aspect of the present invention relates to methods of modulating
RNA splicing comprising the steps of inserting a theophylline
aptamer into the BPS and modulating pre-mRNA splicing in the
presence of theophylline.
[0115] In recent years tremendous efforts have been made in the
development of tools that could manipulate gene expression at the
level of transcription. For example, sequence specific DNA binding
of pyrrole-imidazole polyamide oligomers has been exploited to
control transcription (Gottesfeld et al., 1997). Likewise,
principle of chemically induced proximity has been used for the
development of small molecule-based approach for the regulation of
transcription (Belshaw et al., 1996; Ho et al., 1996). Although
controlling gene expression at the level of transcription is
useful, to be able to control pre-mRNA splicing will have many
applications in biology and medicine. For instance, a
theophylline-dependent trans gene whose expression is turned on/off
at a specific time in the development can be used to study the
function of a developmentally regulated gene. Similarly, if a gene
of interest encodes a transcription factor, a trans gene could be
designed so that its alternative splicing modulated by theophylline
would generate mRNAs encoding transcription activator and repressor
molecules that bind to the same sequence of the promoter.
[0116] Another aspect of the present invention relates to
riboswitch and a small molecule-based approach for controlling gene
expression at the level of splicing. The approach is based on the
principle of riboswitch in which the binding of a small molecule
ligand to the specific RNA sequence leads to the formation of a
stem loop structure that either terminates transcription
prematurely or sequesters the Shine-Dalgarno sequence and inhibits
translation initiation (Nudler and Mironov, 2004). Since aptamers
can also bind small molecule ligands, it is interestingly found
that insertion of an aptamer within the 3' splice site region of a
pre-mRNA generates an artificial riboswitch that may enable ligand
specific control of pre-mRNA splicing.
[0117] A series of model pre-mRNAs in which the 3' splice site AG
was engineered to be the part of theophylline-binding aptamer were
constructed and tested for their ability to undergo pre-mRNA
splicing in the absence or presence of theophylline (FIGS. 2-5).
These substrates differ in terms of the BPS-to-AG distance and the
location of the 3' splice site AG within the theophylline binding
aptamer. In AdML-Theo39AG, step II of splicing was nearly abolished
in the absence of theophylline (FIG. 2C, lanes 6-9), and our
observation that lowering of the BPS-to-AG distance by 10 (FIG. 3,
AdML-Theo29AG) or 12 nucleotides (FIG. 4, AdML-Theo27AG) rescued
this inhibition is consistent with the previously published reports
which suggest that: 1. Although the normal BPS-to-AG distance in
vertebrates is 18-40 nucleotides, utilization of an AG farther than
30 nucleotides downstream of the BPS significantly reduces the
efficiency of the second step of the splicing (Chua and Reed,
2001), and 2. Insertion of pyrimidines upstream of such an AG
alleviates the poor step II splicing (Chiara et al., 1997;
Patterson and Guthrie, 1991).
[0118] Experimental data included herein indicate that
AdML-Theo29AG, AdML-Theo27AG and AdML-Theo-Stem21AG pre-mRNAs
conferred theophylline dependent control of splicing, albeit with
varying degree (FIGS. 3-5, also see below). While 0.5 mM
theophylline was able to inhibit the splicing of AdML-Theo29AG by
more than 50%, a 4-fold higher concentration of theophylline was
required to achieve the same level of inhibition in AdML-Theo27AG
(FIGS. 3D and 4C). Increasing the concentration of theophylline to
2.0 mM, however, reduced this difference to <2-fold (FIGS. 3D
and 4C). This difference, which corresponds to only .about.0.5
kcal/mol, can not account for the loss of three base pairing
interactions between AdML-Theo29AG and AdML-Theo27AG (a hydrogen
bond can contribute from 0.5 to 2.0 kcal/mol to the stability of a
base pair), suggesting that the unpaired region of theophylline
aptamer makes the major contribution towards the overall binding
energy. This may explain why none of the 15 residues (FIG. 1B,
nucleotides shown in the box) required for high affinity
theophylline binding resides in the lower stem (Jenison et al.,
1994; Zimmermann et al., 2000).
[0119] Unlike AdML-Theo29AG and AdML-Theo27AG substrates, the
normal step II of the splicing of AdML-Theo-Stem21AG in the absence
of theophylline (see accumulation of lariat-exon 2 in lanes 2-5,
FIGS. 3B and 4B versus no accumulation in lanes 1-4 FIG. 5B)
further confirmed the BPS-to-AG distance rule (Chiara et al., 1997;
Chua and Reed, 2001; Patterson and Guthrie, 1991). However, the
poor response of AdML-Theo-Stem21AG to theophylline-mediated step
II splicing inhibition is somewhat intriguing (compare FIGS. 3D,
4C-5C). Two explanations can be offered to this observation: First,
while present in the lower stem of the aptamer, the AG could still
serve as a 3' splice site. Given that the 3' splice site AG as well
as the nucleotides in its vicinity have been shown to interact with
the nucleotides at the 5' splice site (Collins and Guthrie, 1999;
Collins and Guthrie, 2001; Deirdre et al., 1995; Parker and
Siliciano, 1993) and with the conserved loop of U5 snRNA
(Sontheimer and Steitz, 1993), it is highly unlikely that while
sequestered in the double-stranded stem the AG could maintain these
interactions. An alternative explanation is that after the
completion of the first step or just prior to the step II of the
splicing, the spliceosome unwinds the lower stem of the aptamer and
select this AG as splice acceptor site. Support to this explanation
comes from the fact that the second step of the splicing is
preceded by a major conformational rearrangement aided in part by
putative RNA helicases, which likely unfold the lower stem (Staley
and Guthrie, 1998; Umen and Guthrie, 1995).
[0120] Data disclosed herein indicate that even at the highest
concentration of theophylline, 20-25% of the AdML-Theo29AG pre-mRNA
underwent step II of splicing (FIGS. 3B and 3D). This could most
likely be due to the differential metal ion requirements for the
binding of theophylline to its cognate RNA and in vitro splicing;
while high affinity theophylline-RNA aptamer binding requires 5.0
mM Mg.sup.2+ (Jenison et al., 1994; Zimmermann et al., 2000),
.about.3.0 mM Mg.sup.2+ has been found to be optimum for in vitro
splicing (Krainer et al., 1984). Since the in vitro splicing
experiments were performed in the presence of .about.3.0 mM
Mg.sup.2+, the observed incomplete splicing inhibition could be the
consequence of weak theophylline-aptamer binding. In addition, the
design of the pre-mRNA construct could also account for the
incomplete repression of splicing. For example, unavailability of a
competing 3' splice site likely forced the splicing machinery to
select a structured AG. This interpretation is in agreement to the
previously reported studies in which the repression of a targeted
splice site was significantly higher when an alternative splice
site was available (Goguel et al., 1993; Villemaire et al.,
2003).
[0121] Several lines of evidence argue strongly that the observed
theophylline dependent inhibition of step II of the splicing is
specific. First, theophylline mediated decrease in the yield of the
spliced product is directly proportional to the amount of the
lariat product, suggesting that the inhibition of AdML-Theo-29AG
splicing is not the result of mRNA degradation (see lariat and
spliced product in FIG. 3B, lanes 2-17). Second, the lower yield of
the mRNA is mirrored by the accumulation of lariat-exon 2,
confirming that the splicing was specifically blocked at the second
step (FIG. 3C). Third, even at the highest concentration,
theophylline does not affect the efficiency of the first step of
splicing, thus excluding the possibility that the lower efficiency
of the first step of splicing might be the cause of reduced level
of mRNA (FIG. 3D). Fourth, theophylline failed to affect the
splicing of pre-mRNAs in which the theophylline aptamer was
inserted to 8 or 10 nucleotides downstream of 3' or 5' ss,
respectively (FIG. 6 and data not shown). Fifth, even at the
highest tested dose, theophylline failed to elicit any effect on
the splicing of a pre-mRNA that does not contain its binding site
(FIG. 8). Finally, caffeine, which is similar in shape and size to
theophylline, had no effect on the splicing of AdML-Theo-29AG
pre-mRNA (FIG. 9).
[0122] The formation of RNA secondary structure has been known to
account for the regulation of splicing in a number of natural
pre-mRNAs (Buratti et al., 2004). In addition, the effects of
artificial stem-loop structures on the splicing of pre-mRNAs in
yeast (Goguel and Rosbash, 1993; Goguel et al., 1993), mammals
(Eperon et al., 1988; Liu et al., 1997; Solnick, 1985) and plants
(Goodall and Filipowicz, 1991; Liu et al., 1995) have also been
investigated. More recently, the analysis of human intronic
sequences has revealed a strong correlation between alternative
splicing and the prevalence of tandem nucleotide repeats that have
the potential of forming secondary structure in introns that flank
alternatively spliced exons (Lian and Garner, 2005). Given these
facts, it would be interesting to test whether or not the
RNA-theophylline system developed here could be used to influence a
3' splice site switch of a pre-mRNA in which a common 5' splice
site pairs with two alternative 3' splice site.
[0123] In conclusion, we have demonstrated that an artificial
riboswitch, which exploits the high affinity binding of
theophylline to an in vitro evolved aptamer, can regulate pre-mRNA
splicing. Theophylline-dependent control of pre-mRNA splicing may
have many advantages. First, theophylline is a well-known drug with
favorable pharmacokinetic and cellular uptake properties. Second,
theophylline is highly stable and possesses good water solubility.
Third, theophylline is commercially available and is inexpensive.
Finally, theophylline binds to its cognate sequence with high
affinity and specificity, and the BLAST search of the human genome
revealed no apparent match for theophylline aptamer sequence.
[0124] Since the choice of alternative splice sites is generally
made at early stages of spliceosome assembly, it was next examined
whether a theophylline riboswitch could be engineered to control
splicing prior to the first step. A series of pre-mRNA substrates
were constructed in which the branchpoint sequence (BPS) was
inserted within the theophylline aptamer. In AdML pre-mRNA
derivatives in which the branchpoint sequence is inserted within
the upper stem of theophylline binding sequences, normal splicing
was observed in the absence of theophylline, albeit with varying
efficiency (FIG. 22B, lanes 2-5, 7-10, and 12-15). However,
addition of theophylline to the splicing reaction significantly
lowered the yield of the spliced product (FIG. 22B, lanes 6, 11,
and 16; FIG. 22C). AdML BPT15AG, which showed the most significant
effects in the presence of theophylline, was chosen for further
experiments. To determine whether theophylline-mediated inhibition
was dose dependent and to identify the optimum concentration for
controlling splicing, the splicing experiment was repeated using
AdML BPT15AG in the presence of varying concentrations of
theophylline. Theophylline as found to inhibit splicing in a
dose-dependent manner (FIGS. 23A and B). While 250 .mu.M of
theophylline could affect the splicing reaction, 0.5 mM
theophylline was necessary to achieve 50% splicing inhibition (FIG.
23B).
[0125] To investigate whether theophylline inhibits pre-mRNA
splicing by blocking the step(s) in the assembly of the spliceosome
or simply interferes with the chemical step(s) of splicing,
splicing complex assembly was analyzed. Spliceosome assembly assays
were performed in the presence or absence of 2 mM theophylline.
Addition of theophylline significantly affected the kinetics of
spliceosome assembly (FIG. 24A, compare lanes 1-7 and lanes 8-14).
For example, in the absence of theophylline, splicing complex A was
detected at approximately five minutes and converted into complex
B/C at approximately 30 minutes. This process peaked between 45-60
minutes, and declined after 90 minutes of incubation. In contrast,
splicing complex A appeared as early as approximately five minutes
in the presence of theophylline, but its conversion to complex B/C
was significantly impaired. In addition, theophylline affected the
kinetics of complex H to A transformation. While the majority of
complex H disappeared after 30 minutes of incubation, in the
presence of theophylline it persisted even after 90 minutes. Thus,
theophylline inhibits pre-mRNA splicing by blocking assembly of the
spliceosome.
[0126] To determine whether theophylline-dependent splicing is
specific, nucleotides that are necessary for theophylline binding
(boxed residues in FIG. 1A) were mutated. The resultant pre-mRNA
(BrkBpTheo) was not expected to bind theophylline, and thus should
remain unaffected during in vitro splicing in the presence of
theophylline. This was indeed the case, as splicing of BrkBpTheo
remained virtually unaffected even at the maximum tested dose of
theophylline (FIG. 25).
[0127] Biochemical and structural studies showed that the lower
theophylline aptamer stem is not critical for ligand binding
(Zimmermann 1997), but apparently increases the stability of the
RNA-theophylline complex. If true, then an increase in the length
of the lower theophylline aptamer stem should further stabilize the
RNA-theophylline complex, which may bring stronger splicing
repression. To test this prediction, AdML-Theo15AG derivatives were
constructed in which the size of the lower theophylline aptamer
stem was varied from four to ten nucleotides (FIG. 26A). Results
showed that the longer the stem size, the stronger the inhibition
of splicing (FIGS. 26B and C). A slightly lower degree of
inhibition was observed in the case of the substrate with a ten
nucleotide stem, apparently due to overall low splicing efficiency
in the absence of theophylline.
[0128] The effect of BPS location on splicing repression was tested
next. An AdML derivative in which the BPS was inserted in the lower
theophylline aptamer stem was constructed (FIG. 27A). Splicing
assays showed that relocation of BPS to the lower stem rendered the
AdML derivative less responsive to theophylline-mediated splicing
repression (FIG. 27B, compare lane 4 and lane 8). These results are
consistent with experiments in which relocation of 3' ss AG from
the core to the lower stem resulted in a significantly weaker
response to theophylline-mediated splice repression.
[0129] Naturally-occurring RNA structure elements as well as
artificial stem-loop structures are known to influence alternative
splicing. To determine whether theophylline-induced secondary
structure can likewise influence alternative splicing, a series of
model splicing substrates were constructed consisting of three
exons interrupted by two introns (FIG. 28). While intron 1 BPS was
inserted within TBS, the BPS of intron 2 remained unchanged. The
strength of 5' ss in exon 2 increased in the following order:
ABT0M<ABT2M<ABT4M<ABT6M<ABT8M. It was hypothesized that
in the presence of theophylline, intron 1 branchpoint would be
sequestered within the RNA-theophylline complex, which in turn
should repress excision of intron 1 and enable intron 2 branchpoint
to choose between the 5' ss of exons 1 and 2 for the first step of
splicing. Thus, which of the two 5' ss is utilized will determine
the level of exon 2 inclusion/exclusion in the full-length mRNA. To
test this hypothesis, radioactively labeled ABT0M, ABT2M, ABT4M,
ABT6M, and ABT8M were incubated in HeLa nuclear extract under
standard conditions for in vitro splicing. Splicing of ABT0M
substrate gave rise to two spliced products, a slower migrating
band of approximately 150 nucleotides and a smaller band of
approximately 100 nucleotides (FIG. 29A). To determine the identity
of these mRNAs, representative bands were excised and subjected to
RT-PCR followed by DNA sequencing. The sequencing results suggested
that the slower migrating band represented full-length mRNA, while
the faster migrating band represented mRNA in which exon 2 was
missing due to alternative splicing. Significantly, theophylline
shifted ABT0M splicing in favor of the short isoform by decreasing
the amount of the long isoform (FIG. 29A, compare lanes 1 and 2).
Compared to the control, theophylline promoted exon 2 exclusion
(FIG. 29B). Results with other substrates suggested an inverse
correlation between the strength of exon 2 5' ss and the level of
exon 2 skipped mRNA. Thus, splicing of an alternative exon can be
fine-tuned in a theophylline-dependent manner.
[0130] To determine whether theophylline-induced sequestering of
branchpoint can control splicing in living cells, DNAs that encode
ABT0-8M pre-mRNAs was inserted into the mammalian expression vector
pcDNA3.1 to yield pcDNA-ABT0-8M. HeLa cells (70-90% confluence)
were transiently transfected with these constructs or with empty
vector, then treated with theophylline (1 mM) or buffer. After a 24
hour incubation, cells were harvested and total RNA was extracted
using an RNeasy mini-kit (Qiagen). RT-PCR assays showed that
theophylline can affect alternative splicing (FIG. 30A), which is
in agreement with the in vitro results (FIG. 29A). These results
suggest that artificial riboswitches can be engineered to regulate
alternative splicing both in vitro and in cultured cells.
[0131] Alternative splicing is a precisely regulated process by
which a single pre-mRNA can undergo differential joining of 5' and
3' splice sites to generate variant mRNAs with diverse, and often
antagonistic functions (Black, 2003; Clayerie, 2001; Graveley,
2001). The defective regulation of splice variant expression has
been identified as the cause of several genetic disorders (Dredge
et al., 2001; Faustino and Cooper, 2003; Garcia-Blanco et al.,
2004; Hull et al., 1993; Nissim-Rafinia and Kerem, 2002; Pagani and
Baralle, 2004; Phillips and Cooper, 2000). Moreover, certain forms
of cancer have been linked to unbalanced isoform expression from
genes involved in cell cycle regulation or angiogenesis (Krajewska
et al., 1996a; Krajewska et al., 1996b; Novak et al., 2001;
Steinman et al., 2004; Venables, 2004; Xerri et al., 1996). Thus, a
system based on a small drug like molecule (such as theophylline)
that can influence a splicing decision may emerges as novel
pharmacological tools with potential for therapeutic
intervention.
[0132] For example, the theophylline-dependent riboswitches can be
employed to target two genes that are linked to human diseases: the
Bcl-x gene and the SMN1 gene. Alternative splicing of Bcl-x gene
generates a long isoform, Bcl-xL and a short isoform, Bcl-xS. A
proper balance between these two isoforms is essential for the
normal cell function, such as maintaining breast epithelial cell
homeostasis and mammary gland involution. In addition,
overexpression of Bcl-xL has been associated with increased risk of
breast cancer metastasis and resistance to chemotherapeutic agents.
It has been suggested that Bcl-xL promotes cell survival by
counteracting signals that lead to the expression of Bcl-xS, a
pro-apoptotic protein. An ideal approach for breast cancer
treatment would be a conditional splicing switch that regulates
Bcl-x trans gene splicing in a dose-dependent manner according to
individual patient need.
[0133] To investigate whether theophylline can affect alternative
splicing of Bcl-x trans gene, a Bcl-x minigene (pBcl-x-Theo) was
constructed in which the proximal 5' ss is imbedded within TBS.
Because the entire TBS is present in the intron, it was expected
that the modified minigene would remain functional. Three
derivatives of the Bcl-x minigene were prepared by in vitro
transcription: BclxSHTheo57 (7 nucleotide stem), BclxSHTheo510 (10
nucleotide stem), and BclxSHTheo513 (13 nucleotide stem), and used
for in vitro splicing assays (FIG. 31A). The distal to proximal
product ratio increased in the presence of theophylline in the 10-
and 13-nucleotide stem substrates (FIG. 31B). Experiments will next
be performed in human breast cancer cells (MFC-7) transfected with
the Bcl-x minigene to verify in vivo functionality.
[0134] Spinal muscular atrophy (SMA) is a hereditary
neurodegenerative disorder, which is caused by mutation in the SMN1
gene (Cartegni et al., 2002; Garcia-Blanco et al., 2004; Khoo et
al., 2003). Although SMN2 gene can compensate partially for the
loss of SMN1, a translationally silent C-to-T substitution in exon
7 disrupts an SF2/ASF-dependent ESE, resulting into exclusion of
exon 7 and production of defective protein. Thus, blocking the 3'
splice site (using theophylline aptamer system) of exon 8 may force
the splicing machinery to include included exon 7 and therefore
produce the functional protein.
EXAMPLES
Example 1
Pre-mRNA Substrates
[0135] AdML Par and AdML21AG pre-mRNAs were generated by in vitro
transcription using BamHI digested plasmids pAdML Par (Gozani et
al., 1994) and pAdML21AG, respectively. AdML-Theo39AG pre-mRNA was
synthesized from a PCR derived template, which was amplified from
plasmid pAdML.DELTA.AG (Gozani et al., 1994) using T7 primer
(5'-TAATACGACTCACTATAG-3'; SEQ ID NO: 30) and oligonucleotide
#17179 (5'-TCAACGTCGAGACGCTGCCAAGGGCCTTTCGGCTG
GTATCGCCAGAGAGAGAGG-3'; SEQ ID NO: 31) as forward and reverse
primers, respectively. Plasmids encoding AdML-Theo29AG,
AdML-Theo27AG and AdML-Theo-Stem21AG pre-mRNAs are derivatives of
pAdML (Gozani et al., 1994) and were constructed by PCR using T7
primer as the forward primer and oligonucleotide #17396
(5'-TTGACGTCGACCTCCTGCCAAGGGCCTTTCGGCTGGTATGAGGAA
AAAAAAAGAAAAAAAGT-3'; SEQ ID NO: 32); oligonucleotide #17395
(5'-TTGACGTCGACCTGCCAAGGGCCTTTCGGCTGGTATGGAAAAAAAAAGAAAAA AAGT-3';
SEQ ID NO: 33); and oligonucleotide #22735 (5'-TTGACGTCGATCAGCT
GCCAAGGGCCTTTCGGCTGGTATCTGAAAAAAAAAAGAAAAAGT-3'; SEQ ID NO: 34),
respectively as reverse primer. AdML-TheoExon2 pre-mRNA was
synthesized from PstI digested plasmid pAdML-TheoExon2, which was
generated by PCR using oligonucleotides #30036
(5'-CCCTTGGCAGCGTCTGAGGACAAAC TCTTCGCGG-3'; SEQ ID NO: 35) and
#30037 (5'-CCTTTCGGCTGGTATCGCCAC GTCGACCTGAAAAAAAAAG-3'; SEQ ID NO:
36) and pAdML21AG as the template, underline represents
theophylline binding sequence. The PCR amplified DNA was
circularized using T4 DNA ligase to yield the desired
pAdML-TheoExon2.
Example 2
In Vitro Transcription Assay
[0136] Linearized plasmid (1 .nu.g) or PCR generated DNA
(.about.150-200 ng) was used as template for run-off transcription.
A typical (10 .mu.L) in vitro transcription reaction consisted of
40 mM Tris-HCl (pH 8.0), 2.0 mM spermidine, 10 mM DTT, 20 mM
MgCl.sub.2, NTP mixture (0.4 mM CTP and ATP, and 0.1 mM GTP and
UTP), 2.0 mM cap analog (NEB), .about.10 .mu.Ci
[.gamma.-.sup.32P]UTP, 10-20 units SP6 (NEB) or T7 polymerase
(Ambion). After incubation at 37.degree. C. for 2 hours, the
reaction was terminated by adding 12.5 .mu.L stop buffer and RNA
was purified on a 10% denaturing polyacrylamide gel.
Example 3
In Vitro Splicing Assay
[0137] Nuclear extracts were prepared from HeLa cells (obtained
from National Cell Culture), essentially as described by Dignam et
al., (Dignam et al., 1983). To ensure that theophylline binds to
its RNA target, a solution (5 .mu.l) consisting of .sup.32P-labeled
pre-mRNA (5-10 fmol, .about.10,000 cpm per reaction), indicated
concentration of theophylline, 0.5 .mu.l BC300 (20 mM HEPES, pH
8.0, 20% glycerol, 300 mM KCl, 0.2 mM EDTA) and 0.25 .mu.l 160 mM
MgCl.sub.2 were heated to 65.degree. C. for 5 minutes, followed by
20 minutes incubation at room temperature. Next, 0.5 mM ATP, 20 mM
creatine phosphate, 0.4 units of RNasin (Promega), 1.0 mM DTT, 6.25
.mu.l HeLa nuclear extract, and water up to 12.5 .mu.l (all
concentrations are final) was added and incubation continued at
30.degree. C. for the indicated time. Where indicated, theophylline
was substituted by caffeine or water. Splicing reaction was
terminated by the addition of 125 .mu.l stop buffer (100 mM
Tris-HCl, pH 7.5, 10 mM EDTA, 1% SDS, 150 mM NaCl, 300 mM sodium
acetate) followed by phenol-chloroform extraction and isolation of
the RNA by ethanol precipitation. The RNA pallet was washed with
70% aqueous ethanol, dried and dissolved in 10 .mu.l loading
buffer. Splicing intermediates and products were analyzed by
electrophoresis in 13% denaturing polyacrylamide gels. The
fractionated RNAs were visualized by PhosphorImager (Molecular
Dynamics) and RNA signals were quantified by ImageQuant version 4.2
software (Molecular Dynamics) or ImageJ version 1.36 software
(Rasband, W. S., ImageJ, U.S. National Institutes of Health,
Bethesda, Md., http://rsb.info.nih.gov/ij, 1997-2006).
Example 4
Spliceosome Assembly Assay
[0138] Spliceosome assembly and separation of individual complexes
were performed essentially as described earlier (Das and Reed,
1999). Briefly, pre-mRNA (.about.5 ng) was incubated in HeLa
nuclear extract in the absence or presence of theophylline (12.5
.mu.l total volume) under the conditions that support in vitro
splicing. After the incubation, 2.5 .mu.l of 4 .mu.g/.mu.l heparin
and 2.5 .mu.l of 5.times. loading dye containing 1.times.TBE (89 mM
Tris, 89 mM boric acid, 2.5 mM EDTA), 20% glycerol, 0.25%
bromophenol blue, 0.25% xylene cyanol) was added and the 3 .mu.l
aliquots of each reaction mixture were loaded on a 2% horizontal
low-melting agarose gels followed by the spliceosome complexes at
70 V for 3 h in Tris-glycine running buffer at room temperature
(Konarska and Sharp, 1986). Gels were fixed in 10% acetic acid, 10%
methanol for 30 min, and then dried under vacuum at 80.degree.
C.
[0139] As stated above, the foregoing is merely intended to
illustrate various embodiments of the present invention. The
specific modifications discussed above are not to be construed as
limitations on the scope of the invention. It will be apparent to
one skilled in the art that various equivalents, changes, and
modifications may be made without departing from the scope of the
invention, and it is understood that such equivalent embodiments
are to be included herein. All references cited herein are
expressly incorporated by reference herein in their entirety.
REFERENCES
[0140] 1. Aebi, M., Hornig, H., Padgett, R. A., Reiser, J. and
Weissmann, C. (1986) Sequence requirements for splicing of higher
eukaryotic nuclear pre-mRNA. Cell, 47, 555-565. [0141] 2. Aurup,
H., Williams, D. and Eckstein, F. (1992) 2'-Fluoro- and
2'-amino-2'-deoxynucleoside 5'-triphosphates as substrates for T7
RNA polymerase. Biochemistry, 31, 9636-9641. [0142] 3. Banerjee,
H., Rahn, A., Davis, W. and Singh, R. (2003) Sex lethal and U2
small nuclear ribonucleoprotein auxiliary factor (U2AF65) recognize
polypyrimidine tracts using multiple modes of binding. Rna, 9,
88-99. [0143] 4. Belshaw, P. J., Ho, S. N., Crabtree, G. R. and
Schreiber, S. L. (1996) Controlling protein association and
subcellular localization with a synthetic ligand that induces
heterodimerization of proteins. Proc Natl Acad Sci USA, 93,
4604-4607. [0144] 5. Bevers, S., Ha, S. B. and McLaughlin, L. W.
(1999) Critical nature of a specific uridine O2-carbonyl for
cleavage by the hammerhead ribozyme. Biochemistry, 38, 7710-7718.
[0145] 6. Black, D. L. (2003) Mechanisms of alternative
pre-messenger RNA splicing. Annu Rev Biochem, 72, 291-336. [0146]
7. Boggs, R. T., Gregor, P., Idriss, S., Belote, J. M. and McKeown,
M. (1987) Regulation of sexual differentiation in D. melanogaster
via alternative splicing of RNA from the transformer gene. Cell,
50, 739-747. [0147] 8. Bunch, T. A., Grinblat, Y. and Goldstein, L.
S. (1988) Characterization and use of the Drosophila
metallothionein promoter in cultured Drosophila melanogaster cells.
Nucleic Acids Res, 16, 1043-1061. [0148] 9. Buratti, E., Muro, A.
F., Giombi, M., Gherbassi, D., Iaconcig, A. and Baralle, F. E.
(2004) RNA folding affects the recruitment of SR proteins by mouse
and human polypurinic enhancer elements in the fibronectin EDA
exon. Mol Cell Biol, 24, 1387-1400. [0149] 10. Burgstaller, P. and
Famulok, M. (1994) Isolation of RNA aptamers for biological
cofactors by in vitro selection. Angew. Chem. Int. Ed. Engl., 33,
1084-1087. [0150] 11. Cartegni, L. and Krainer, A. R. (2003)
Correction of disease-associated exon skipping by synthetic
exon-specific activators. Nat Struct Biol, 10, 120-125. [0151] 12.
Chen, Z., Monia, B. P. and Corey, D. R. (2002) Telomerase
inhibition, telomere shortening, and decreased cell proliferation
by cell permeable 2'-O-methoxyethyl oligonucleotides. J Med Chem,
45, 5423-5425. [0152] 13. Chiara, M. D., Palandjian, L., Feld
Kramer, R. and Reed, R. (1997) Evidence that U5 snRNP recognizes
the 3' splice site for catalytic step II in mammals. Embo J, 16,
4746-4759. [0153] 14. Chua, K. and Reed, R. (2001) An upstream AG
determines whether a downstream AG is selected during catalytic
step II of splicing. Mol Cell Biol, 21, 1509-1514. [0154] 15.
Clayerie, J. M. (2001) Gene number. What if there are only 30,000
human genes? Science, 291, 1255-1257. [0155] 16. Cline, T. W. and
Meyer, B. J. (1996) Vive la difference: males vs females in flies
vs worms. Annu Rev Genet, 30, 637-702. [0156] 17. Collins, C. A.
and Guthrie, C. (1999) Allele-specific genetic interactions between
Prp8 and RNA active site residues suggest a function for Prp8 at
the catalytic core of the spliceosome. Genes Dev, 13, 1970-1982.
[0157] 18. Collins, C. A. and Guthrie, C. (2001) Genetic
interactions between the 5' and 3' splice site consensus sequences
and U6 snRNA during the second catalytic step of pre-mRNA splicing.
RNA, 7, 1845-1854. [0158] 19. Das, R. and Reed, R. (1999)
Resolution of the mammalian E complex and the ATP-dependent
spliceosomal complexes on native agarose mini-gels. Rna, 5,
1504-1508. [0159] 20. Deirdre, A., Scadden, J. and Smith, C. W.
(1995) Interactions between the terminal bases of mammalian introns
are retained in inosine-containing pre-mRNAs. Embo J, 14,
3236-3246. [0160] 21. Dignam, J. D., Lebovitz, R. M. and Roeder, R.
G. (1983) Accurate transcription initiation by RNA polymerase II in
a soluble extract from isolated mammalian nuclei. Nucleic Acids
Res., 11, 1475-1489. [0161] 22. Dominski, Z. and Kole, R. (1993)
Restoration of correct splicing in thalassemic pre-mRNA by
antisense oligonucleotides. Proc Natl Acad Sci USA, 90, 8673-8677.
[0162] 23. Dredge, B. K., Polydorides, A. D. and Darnell, R. B.
(2001) The splice of life: alternative splicing and neurological
disease. Nat Rev Neurosci, 2, 43-50. [0163] 24. Duconge, F. and
Toulme, J. J. (1999) In vitro selection identifies key determinants
for loop-loop interactions: RNA aptamers selective for the TAR RNA
element of HIV-1. Rna, 5, 1605-1614. [0164] 25. Eder, P. S.,
DeVine, R. J., Dagle, J. M. and Walder, J. A. (1991) Substrate
specificity and kinetics of degradation of antisense
oligonucleotides by a 3' exonuclease in plasma. Antisense Res Dev,
1, 141-151. [0165] 26. Endo, M., Mitsui, T., Okuni, T., Kimoto, M.,
Hirao, I. and Yokoyama, S. (2004) Unnatural base pairs mediate the
site-specific incorporation of an unnatural hydrophobic component
into RNA transcripts. Bioorg Med Chem Lett, 14, 2593-2596. [0166]
27. Eperon, I. C. and Muntoni, F. (2003) Can a `patch` in a skipped
exon make the pre-mRNA splicing machine run better? Trends Mol Med,
9, 233-234. [0167] 28. Eperon, L. P., Graham, I. R., Griffiths, A.
D. and Eperon, I. C. (1988) Effects of RNA secondary structure on
alternative splicing of pre-mRNA: is folding limited to a region
behind the transcribing RNA polymerase? Cell, 54, 393-401. [0168]
29. Faustino, N. A. and Cooper, T. A. (2003) Pre-mRNA splicing and
human disease. Genes Dev, 17, 419-437. [0169] 30. Freyer, G. A.,
Arenas, J., Perkins, K. K., Furneaux, H. M., Pick, L., Young, B.,
Roberts, R. J. and Hurwitz, J. (1987) In vitro formation of a
lariat structure containing a G2'-5'G linkage. J Biol Chem., 262,
4267-4273. [0170] 31. Garcia-Blanco, M. A., Baraniak, A. P. and
Lasda, E. L. (2004) Alternative splicing in disease and therapy.
Nat Biotechnol, 22, 535-546. [0171] 32. Gaur, R. K., McLaughlin, L.
W. and Green, M. R. (1997) Functional group substitutions of the
branchpoint adenosine in a nuclear pre-mRNA and a group II intron.
Rna, 3, 861-869. [0172] 33. Gaur, R. K., Valcarcel, J. and Green,
M. R. (1995) Sequential recognition of the pre-mRNA branch point by
U2AF65 and a novel spliceosome-associated 28-kDa protein. RNA, 1,
407-417. [0173] 34. Goguel, V. and Rosbash, M. (1993) Splice site
choice and splicing efficiency are positively influenced by
pre-mRNA intramolecular base pairing in yeast. Cell, 72, 893-901.
[0174] 35. Goguel, V., Wang, Y. and Rosbash, M. (1993) Short
artificial hairpins sequester splicing signals and inhibit yeast
pre-mRNA splicing. Mol. Cell. Biol., 13, 6841-6848. [0175] 36.
Goodall, G. J. and Filipowicz, W. (1991) Different effects of
intron nucleotide composition and secondary structure on pre-mRNA
splicing in monocot and dicot plants. Embo J, 10, 2635-2644. [0176]
37. Gottesfeld, J. M., Neely, L., Trauger, J. W., Baird, E. E. and
Dervan, P. B. (1997) Regulation of gene expression by small
molecules. Nature, 387, 202-205. [0177] 38. Gozani, O., Patton, J.
G. and Reed, R. (1994) A novel set of spliceosome-associated
proteins and the essential splicing factor PSF bind stably to
pre-mRNA prior to catalytic step II of the splicing reaction. Embo
J, 13, 3356-3367. [0178] 39. Granadino, B., Penalva, L. O., Green,
M. R., Valcarcel, J. and Sanchez, L. (1997) Distinct mechanisms of
splicing regulation in vivo by the Drosophila protein Sex-lethal.
Proc. Natl. Acad. Sci. USA, 94, 7343-7348. [0179] 40. Graveley, B.
R. (2001) Alternative splicing: increasing diversity in the
proteomic world. Trends Genet, 17, 100-107. [0180] 41. Graveley, B.
R. (2005) Small molecule control of pre-mRNA splicing. Rna, 11,
355-358. [0181] 42. Guschlbauer, W. (1980) Conformational analysis
of ribonucleosides from proton-proton coupling constants. Biochim
Biophys Acta, 610, 47-55. [0182] 43. Heidenreich, O., Benseler, F.,
Fahrenholz, A. and Eckstein, F. (1994) High activity and stability
of hammerhead ribozymes containing 2'-modified pyrimidine
nucleosides and phosphorothioates. J Biol Chem, 269, 2131-2138.
[0183] 44. Heidenreich, O., Kang, S. H., Xu, X. and Nerenberg, M.
(1995) Application of antisense technology to therapeutics. Mol Med
Today, 1, 128-133. [0184] 45. Ho, S. N., Biggar, S. R., Spencer, D.
M., Schreiber, S. L. and Crabtree, G. R. (1996) Dimeric ligands
define a role for transcriptional activation domains in
reinitiation. Nature, 382, 822-826. [0185] 46. Hornig, H., Aebi, M.
and Weissmann, C. (1986) Effect of mutations at the lariat branch
acceptor site on beta-globin pre-mRNA splicing in vitro. Nature,
324, 589-591. [0186] 47. Huang, Z. and Szostak, J. W. (2003)
Evolution of aptamers with a new specificity and new secondary
structures from an ATP aptamer. Rna, 9, 1456-1463. [0187] 48. Hull,
J., Shackleton, S. and Harris, A. (1993) Abnormal mRNA splicing
resulting from three different mutations in the CFTR gene. Hum Mol
Genet, 2, 689-692. [0188] 49. Inoue, K., Hoshijima, K., Sakamoto,
H. and Shimura, Y. (1990) Binding of the Drosophila sex-lethal gene
product to the alternative splice site of transformer primary
transcript. Nature, 344, 461-463. [0189] 50. Jenison, R. D., Gill,
S. C., Pardi, A. and Polisky, B. (1994) High-resolution molecular
discrimination by RNA. Science, 263, 1425-1429. [0190] 51. Johnson,
J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P. M.,
Armour, C. D., Santos, R., Schadt, E. E., Stoughton, R. and
Shoemaker, D. D. (2003) Genome-wide survey of human alternative
pre-mRNA splicing with exon junction microarrays. Science, 302,
2141-2144. [0191] 52. Joyce, G. F. (1994) In vitro evolution of
nucleic acids. Curr Opin Struct Biol, 4, 331-336. [0192] 53. Kan,
Z., Rouchka, E. C., Gish, W. R. and States, D. J. (2001) Gene
structure prediction and alternative splicing analysis using
genomically aligned ESTs. Genome Res, 11, 889-900. [0193] 54.
Kandels-Lewis, S, and Seraphin, B. (1993) Involvement of U6 snRNA
in 5' splice site selection. Science, 262, 2035-2039. [0194] 55.
Kawasaki, A. M., Casper, M. D., Freier, S. M., Lesnik, E. A.,
Zounes, M. C., Cummins, L. L., Gonzalez, C. and Cook, P. D. (1993)
Uniformly modified 2'-deoxy-2'-fluoro phosphorothioate
oligonucleotides as nuclease-resistant antisense compounds with
high affinity and specificity for RNA targets. J. Med. Chemistry,
36, 831-841. [0195] 56. Konarska, M. M. and Sharp, P. A. (1986)
Electrophoretic separation of complexes involved in the splicing of
precursors to mRNAs. Cell, 46, 845-855. [0196] 57. Konforti, B. B.,
Koziolkiewicz, M. J. and Konarska, M. M. (1993) Disruption of base
pairing between the 5' splice site and the 5' end of U1 snRNA is
required for spliceosome assembly. Cell, 75, 863-873. [0197] 58.
Krainer, A. R., Maniatis, T., Ruskin, B. and Green, M. R. (1984)
Normal and mutant human beta-globin pre-mRNAs are faithfully and
efficiently spliced in vitro. Cell, 36, 993-1005. [0198] 59.
Krajewska, M., Fenoglio-Preiser, C. M., Krajewski, S., Song, K.,
Macdonald, J. S., Stemmerman, G. and Reed, J. C. (1996a)
Immunohistochemical analysis of Bcl-2 family proteins in
adenocarcinomas of the stomach. Am J Pathol, 149, 1449-1457. [0199]
60. Krajewska, M., Krajewski, S., Epstein, J. I., Shabaik, A.,
Sauvageot, J., Song, K., Kitada, S, and Reed, J. C. (1996b)
Immunohistochemical analysis of bcl-2, bax, bcl-X, and mcl-1
expression in prostate cancers. Am J Pathol, 148, 1567-1576. [0200]
61. Kramer, A. (1996) The structure and function of proteins
involved in mammalian pre-mRNA splicing. Annu Rev Biochem, 65,
367-409. [0201] 62. Kubik M F, B. C., Fitzwater T, Watson S R,
Tasset D M. (1997) Isolation and characterization of 2'-fluoro-,
2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human
IFN-gamma that inhibit receptor binding. J Immunol, 159. [0202] 63.
Kurreck, J. (2003) Antisense technologies. Improvement through
novel chemical modifications. Eur J Biochem, 270, 1628-1644. [0203]
64. Kuwabara, T., Warashina, M., Tanabe, T., Tani, K., Asano, S,
and Taira, K. (1998) A novel allosterically trans-activated
ribozyme, the maxizyme, with exceptional specificity in vitro and
in vivo. Mol Cell, 2, 617-627. [0204] 65. Kuznetsova, M.,
Novopashina, D., Repkova, M., Venyaminova, A. and Vlassov, V.
(2004) Binary hammerhead ribozymes with high cleavage activity.
Nucleosides Nucleotides Nucleic Acids, 23, 1037-1042. [0205] 66.
Lamond, A. I., Konarska, M. M. and Sharp, P. A. (1987) A mutational
analysis of spliceosome assembly: evidence for splice site
collaboration during spliceosome formation. Genes Dev., 1, 532-543.
[0206] 67. Lesser, C. and Guthrie, C. (1993) Mutations in U6 snRNA
that alter splice site specificity: implications for the active
site. Science, 262, 1982-1988. [0207] 68. Lian, Y. and Garner, H.
R. (2005) Evidence for the regulation of alternative splicing via
complementary DNA sequence repeats. Bioinformatics, 21, 1358-1364.
[0208] 69. Liu, H.-K., Goodall, G. J., Kole, R. and Filipowicz, W.
(1995) Effects of secondary structure on pre-mRNA splicing:
hairpins sequestering the 5' but not the 3' splice site inhibit
intron processing in Nicotiana plumbaginifolia. EMBO J., 14,
377-388. [0209] 70. Liu, Z. R., Laggerbauer, B., Luhrmann, R. and
Smith, C. W. (1997) Crosslinking of the U5 snRNP-specific 116-kDa
protein to RNA hairpins that block step 2 of splicing. Rna, 3,
1207-1219. [0210] 71. Lopez, A. J. (1998) Alternative splicing of
pre-mRNA: developmental consequences and mechanisms of regulation.
Annu Rev Genet, 32, 279-305. [0211] 72. Luukkonen, B. G. and
Seraphin, B. (1997) The role of branchpoint-3' splice site spacing
and interaction between intron terminal nucleotides in 3' splice
site selection in Saccharomyces cerevisiae. Embo J, 16, 779-792.
[0212] 73. Malca, H., Shomron, N. and Ast, G. (2003) The U1 snRNP
base pairs with the 5' splice site within a penta-snRNP complex.
Mol Cell Biol, 23, 3442-3455. [0213] 74. Maniatis, T. and Tasic, B.
(2002) Alternative pre-mRNA splicing and proteome expansion in
metazoans. Nature, 418, 236-243. [0214] 75. Marshall, K. A. and
Ellington, A. D. (2000) In vitro selection of RNA aptamers. Methods
Enzymol, 318, 193-214. [0215] 76. Merendino, L., Guth, S., Bilbao,
D., Martinez, C. and Valcarcel, J. (1999) Inhibition of msl-2
splicing by Sex-lethal reveals interaction between U2AF35 and the
3' splice site AG. Nature, 402, 838-841. [0216] 77. Mironov, A. A.,
Fickett, J. W. and Gelfand, M. S. (1999) Frequent alternative
splicing of human genes. Genome Res, 9, 1288-1293. [0217] 78.
Modrek, B., Resch, A., Grasso, C. and Lee, C. (2001) Genome-wide
detection of alternative splicing in expressed sequences of human
genes. Nucleic Acids Res, 29, 2850-2859. [0218] 79. Monia, B. P.,
Lesnik, E. A., Gonzalez, C., Lima, W. F., McGee, D., Guinosso, C.
J., Kawasaki, A. M., Cook, P. D. and Freier, S. M. (1993)
Evaluation of 2'-modified oligonucleotides containing 2'-deoxy gaps
as antisense inhibitors of gene expression. J Biol Chem, 268,
14514-14522. [0219] 80. Moore, J. J., Query, C. C. and Sharp, P. A.
(1993) Splicing of precursors to mRNA by the spliceosome. In
Gesteland, R. F. and Atkins, J. R. (eds.), In The RNA world. Cold
Spring Harbor, N.Y.
[0220] 81. Moore, M. J. and Sharp, P. A. (1992) Site-specific
modification of pre-mRNA: the 2'-hydroxyl groups at the splice
sites. Science, 256, 992-997. [0221] 82. Newman, A. (1994) Activity
in the spliceosome. Curr. Biol., 4, 462-464. [0222] 83. Newman, A.
J., Lin, R. J., Cheng, S. C. and Abelson, J. (1985) Molecular
consequences of specific intron mutations on yeast mRNA splicing in
vivo and in vitro. Cell, 42, 335-344. [0223] 84. Nilsen, T. W.
(2003) The spliceosome: the most complex macromolecular machine in
the cell? Bioessays, 25, 1147-1149. [0224] 85. Nissim-Rafinia, M.
and Kerem, B. (2002) Splicing regulation as a potential genetic
modifier. Trends Genet, 18, 123-127. [0225] 86. Novak, U., Grob, T.
J., Baskaynak, G., Peters, U. R., Aebi, S., Zwahlen, D., Tschan, M.
P., Kreuzer, K. A., Leibundgut, E. O., Cajot, J. F., Tobler, A. and
Fey, M. F. (2001) Overexpression of the p73 gene is a novel finding
in high-risk B-cell chronic lymphocytic leukemia. Ann Oncol, 12,
981-986. [0226] 87. Nudler, E. and Mironov, A. S. (2004) The
riboswitch control of bacterial metabolism. Trends Biochem Sci, 29,
11-17. [0227] 88. Pagani, F. and Baralle, F. E. (2004) Genomic
variants in exons and introns: identifying the splicing spoilers.
Nat Rev Genet, 5, 389-396. [0228] 89. Parker, R. and Siliciano, P.
G. (1993) Evidence for an essential non-Watson-Crick interaction
between the first and last nucleotides of a nuclear pre-mRNA
intron. Nature, 361, 660-662. [0229] 90. Patterson, B. and Guthrie,
C. (1991) A U-rich tract enhances usage of an alternative 3' splice
site in yeast. Cell, 64, 181-187. [0230] 91. Phillips, A. and
Cooper, T. (2000) RNA processing and human disease. Cell Mol Life
Sci, 57, 235-249. [0231] 92. Pieken, W. A., Olsen, D. B., Benseler,
F., Aurup, H. and Eckstein, F. (1991) Kinetic characterization of
ribonuclease-resistant 2'-modified hammerhead ribozymes. Science,
253, 314-317. [0232] 93. Proctor, D. J., Ma, H., Kierzek, E.,
Kierzek, R., Gruebele, M. and Bevilacqua, P. C. (2004) Folding
thermodynamics and kinetics of YNMG RNA hairpins: specific
incorporation of 8-bromoguanosine leads to stabilization by
enhancement of the folding rate. Biochemistry, 43, 14004-14014.
[0233] 94. Query, C. C., Moore, M. J. and Sharp, P. A. (1994)
Branch nucleophile selection in pre-mRNA splicing: evidence for the
bulged duplex model. Genes & Dev., 8, 587-597. [0234] 95. Reed,
R. and Palandjian, L. (1997) Spliceosome assembly. In Krainer, A.
(ed.), Eukaryotic mRNA processing. IRL Press, Oxford, pp. 103-129.
[0235] 96. Roberts, G. C. and Smith, C. W. (2002) Alternative
splicing: combinatorial output from the genome. Curr Opin Chem
Biol, 6, 375-383. [0236] 97. Ruskin, B. and Green, M. R. (1985)
Role of the 3' splice site consensus sequence in mammalian pre-mRNA
splicing. Nature, 317, 732-734. [0237] 98. Ruskin, B., Zamore, P.
D. and Green, M. R. (1988) A factor, U2AF, is required for U2 snRNP
binding and splicing complex assembly. Cell, 52, 207-219. Ryner, L.
C. and Baker, B. S. (1991) Regulation of doublesex pre-mRNA
processing by 3' splice site activation. Genes Dev., 5, 2071-2085.
[0238] 99. Sakamoto, H., Inoue, K., Higuchi, I., Ono, Y. and
Shimura, Y. (1992) Control of Drosophila Sex-lethal pre-mRNA
splicing by its own female-specific product. Nucleic Acids Res, 20,
5533-5540. [0239] 100. Sambrook, J., and Russell, D. W. 2001.
Molecular cloning: a laboratory manual, 3rd ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. [0240] 101. Sassanfar,
M. and Szostak, J. W. (1993) An RNA motif that binds ATP. Nature,
364, 550-553. [0241] 102. Sawa, H. and Abelson, J. (1992) Evidence
for a base-pairing interaction between U6 small nuclear RNA and the
5' splice site during the splicing reaction in yeast. Proc. Natl.
Acad. Sci. USA, 89, 11269-11273. [0242] 103. Sawa, H. and Shimura,
Y. (1992) Association of U6 snRNA with the 5'-splice site region of
pre-mRNA in the spliceosome. Genes & Dev., 6, 244-254. [0243]
104. Seraphin, B., Kretzner, L. and Rosbash, M. (1988) A U1
snRNA:pre-mRNA base pairing interaction is required early in yeast
spliceosome assembly but does not uniquely define the 5' cleavage
site. EMBO J., 7, 2533-2538. [0244] 105. Seraphin, B. and Rosbash,
M. (1990) Exon mutations uncouple 5' splice site selection from U1
snRNA pairing. Cell, 63, 619-629. [0245] 106. Shaw, J. P., Kent,
K., Bird, J., Fishback, J. and Froehler, B. (1991) Modified
deoxyoligonucleotides stable to exonuclease degradation in serum.
Nucleic Acids Res, 19, 747-750. [0246] 107. Shomron, N. and Ast, G.
(2003) Boric acid reversibly inhibits the second step of pre-mRNA
splicing. FEBS Left, 552, 219-224. [0247] 108. Shomron, N., Malca,
H., Vig, I. and Ast, G. (2002) Reversible inhibition of the second
step of splicing suggests a possible role of zinc in the second
step of splicing. Nucleic Acids Res, 30, 4127-4137. [0248] 109.
Siliciano, P. G. and Guthrie, C. (1988) 5' splice site selection in
yeast: genetic alterations in base-pairing with U1 reveal
additional requirements. Genes Dev., 2, 1258-1267. [0249] 110.
Singh, R., Banerjee, H. and Green, M. R. (2000) Differential
recognition of the polypyrimidine-tract by the general splicing
factor U2AF65 and the splicing repressor sex-lethal. Rna, 6,
901-911. [0250] 111. Singh, R., Valcarcel, J. and Green, M. R.
(1995) Distinct binding specificities and functions of higher
eukaryotic polypyrimidine tract-binding proteins. Science, 268,
1173-1176. [0251] 112. Skordis, L. A., Dunckley, M. G., Yue, B.,
Eperon, I. C. and Muntoni, F. (2003) Bifunctional antisense
oligonucleotides provide a trans-acting splicing enhancer that
stimulates SMN2 gene expression in patient fibroblasts. Proc Natl
Acad Sci USA, 100, 4114-4119. [0252] 113. Smith, C. W. and
Valcarcel, J. (2000) Alternative pre-mRNA splicing: the logic of
combinatorial control. Trends Biochem Sci, 25, 381-388. [0253] 114.
Solnick, D. (1985) Alternative splicing caused by RNA secondary
structure. Cell, 43, 667-676. [0254] 115. Sontheimer, E. and
Steitz, J. A. (1993) The U5 and U6 small nuclear RNAs as active
site components of the spliceosome. Science, 262, 1989-1996. [0255]
116. Sosnowski, B. A., Belote, J. M. and McKeown, M. (1989)
Sex-specific alternative splicing of RNA from the transformer gene
results from sequence-dependent splice site blockage. Cell, 58,
449-459. [0256] 117. Soukup, G. A. and Breaker, R. R. (1999a)
Engineering precision RNA molecular switches. Proc Natl Acad Sci
USA, 96, 3584-3589. [0257] 118. Soukup, G. A. and Breaker, R. R.
(1999b) Nucleic acid molecular switches. Trends Biotechnol, 17,
469-476. [0258] 119. Soukup, G. A., Emilsson, G. A. and Breaker, R.
R. (2000) Altering molecular recognition of RNA aptamers by
allosteric selection. J Mol Biol, 298, 623-632. [0259] 120. Staley,
J. P. and Guthrie, C. (1998) Mechanical devices of the spliceosome:
motors, clocks, springs, and things. Cell, 92, 315-326. [0260] 121.
Steinman, H. A., Burstein, E., Lengner, C., Gosselin, J., Pihan,
G., Duckett, C. S. and Jones, S. N. (2004) An alternative splice
form of Mdm2 induces p53-independent cell growth and tumorigenesis.
J Biol Chem, 279, 4877-4886. [0261] 122. Stevens, S. W., Ryan, D.
E., Ge, H. Y., Moore, R. E., Young, M. K., Lee, T. D. and Abelson,
J. (2002) Composition and functional characterization of the yeast
spliceosomal penta-snRNP. Mol Cell, 9, 31-44. [0262] 123. Tanaka,
K., Watakabe, A. and Shimura, Y. (1994) Polypurine sequences within
a downstream exon function as a splicing factor. Mol. Cell. Biol.,
14, 1347-1354. [0263] 124. Thanaraj, T. A., Stamm, S., Clark, F.,
Riethoven, J. J., Le Texier, V. and Muilu, J. (2004) ASD: the
Alternative Splicing Database. Nucleic Acids Res, 32 Database
issue, D64-69. [0264] 125. Tsuji, H., Nomiyama, K., Murai, K.,
Akagi, K. and Fujishima, M. (1992) Comparison of the properties of
ribonucleases in human liver tissue and serum. Eur J Clin Chem Clin
Biochem, 30, 339-341. [0265] 126. Umen, J. G. and Guthrie, C.
(1995) The second catalytic step of pre-mRNA splicing. RNA, 1,
869-885. [0266] 127. Valcarcel, J., Gaur, R. K., Singh, R. and
Green, M. R. (1996) Interaction of U2AF65 RS region with pre-mRNA
branch point and promotion of base pairing with U2 snRNA. Science,
273, 1706-1709. [0267] 128. Valcarcel, J., Singh, R., Zamore, P. D.
and Green, M. R. (1993) The protein Sex-lethal antagonizes the
splicing factor U2AF to regulate alternative splicing of
transformer pre-mRNA. Nature, 362, 171-175. [0268] 129. van Nues,
R. W. and Beggs, J. D. (2001) Functional contacts with a range of
splicing proteins suggest a central role for Brr2p in the dynamic
control of the order of events in spliceosomes of Saccharomyces
cerevisiae. Genetics, 157, 1451-1467. [0269] 130. Venables, J. P.
(2004) Aberrant and alternative splicing in cancer. Cancer Res, 64,
7647-7654. [0270] 131. Villemaire, J., Dion, I., Elela, S. A. and
Chabot, B. (2003) Reprogramming alternative pre-messenger RNA
splicing through the use of protein-binding antisense
oligonucleotides. J Biol Chem, 278, 50031-50039. [0271] 132.
Vortler, L. C. and Eckstein, F. (2000) Phosphorothioate
modification of RNA for stereochemical and interference analyses.
Methods Enzymol, 317, 74-91. [0272] 133. Wallis, M. G., von Ahsen,
U., Schroeder, R. and Famulok, M. (1995) A novel RNA motif for
neomycin recognition. Chem Biol, 2, 543-552. [0273] 134. Wang, Y.
and Rando, R. R. (1995) Specific binding of aminoglycoside
antibiotics to RNA. Chem Biol, 2, 281-290. [0274] 135. Wassarman,
D. A. and Steitz, J. A. (1992) Interactions of small nuclear RNA's
with precursor messenger RNA during in vitro splicing. Science,
257, 1918-1925. [0275] 136. Watakabe, A., Tanaka, K. and Shimura,
Y. (1993) The role of exon sequences in splice site selection.
Genes Dev., 7, 407-418. [0276] 137. Will, C. L. and Luhrmann, R.
(1997) Protein functions in pre-mRNA splicing. Curr Opin Cell Biol,
9, 320-328. [0277] 138. Wu, S., Romfo, C. M., Nilsen, T. W. and
Green, M. R. (1999) Functional recognition of the 3' splice site AG
by the splicing factor U2AF35. Nature, 402, 832-835. [0278] 139.
Xerri, L., Parc, P., Brousset, P., Schlaifer, D., Hassoun, J.,
Reed, J. C., Krajewski, S, and Birnbaum, D. (1996) Predominant
expression of the long isoform of Bcl-x (Bcl-xL) in human
lymphomas. Br J Haematol, 92, 900-906. [0279] 140. Zamore, P. D.,
Patton, J. G. and Green, M. R. (1992) Cloning and domain structure
of the mammalian splicing factor U2AF. Nature, 355, 609-614. [0280]
141. Zhao, Y. and Baranger, A. M. (2003) Design of an adenosine
analogue that selectively improves the affinity of a mutant U1A
protein for RNA. J Am Chem Soc, 125, 2480-2488. [0281] 142. Zhuang,
Y. and Weiner, A. M. (1986) A compensatory base change in U1 snRNA
suppresses a 5' splice site mutation. Cell, 46, 827-835. [0282]
143. Zillmann, M., Zapp, M. L. and Berget, S. M. (1988) Gel
electrophoretic isolation of splicing complexes containing U1 small
nuclear ribonucleoprotein particles. Mol Cell Biol, 8, 814-821.
[0283] 144. Zimmermann, G. R., Jenison, R. D., Wick, C. L.,
Simorre, J. P. and Pardi, A. (1997) Interlocking structural motifs
mediate molecular discrimination by a theophylline-binding RNA. Nat
Struct Biol, 4, 644-649. [0284] 145. Zimmermann, G. R., Shields, T.
P., Jenison, R. D., Wick, C. L. and Pardi, A. (1998) A
semiconserved residue inhibits complex formation by stabilizing
interactions in the free state of a theophylline-binding RNA.
Biochemistry, 37, 9186-9192. [0285] 146. Zimmermann, G. R., Wick,
C. L., Shields, T. P., Jenison, R. D. and Pardi, A. (2000)
Molecular interactions and metal binding in the
theophylline-binding core of an RNA aptamer. Rna, 6, 659-667.
[0286] 147. Zorio, D. A. and Blumenthal, T. (1999) Both subunits of
U2AF recognize the 3' splice site in Caenorhabditis elegans.
Nature, 402, 835-838. [0287] 148. Zuker, M. (1989) Computer
prediction of RNA structure. Methods Enzymol, 180, 262-288.
Sequence CWU 1
1
91142RNAArtificialChemically synthesized riboswitch 1acyyyyyyyy
yyyyyyyaua ccagccgaaa ggcccuuggc ag 42248RNAArtificialChemically
synthesized riboswitch 2acyyyyyyyy yyyyyyyyyy yyyauaccag ccgaaaggcc
cuuggcag 48344RNAArtificialChemically synthesized riboswitch
3acyyyyyyyy yyyyyyyyya uaccagccga aaggcccuug gcag
44447RNAArtificialChemically synthesized riboswitch 4acuuuuuuuc
uuuuuuuuuc cauaccagcc gaaaggcccu uggcagg
47548RNAArtificialChemically synthesized riboswitch 5acuuuuuuuc
uuuuuuuuuc cucauaccag ccgaaaggcc cuuggcag
48652RNAArtificialChemically synthesized riboswitch 6acuuuuuuuc
uuuuuuuuuc cucauaccag ccgaaaggcc cuuggcagga gg
52746RNAArtificialChemically synthesized riboswitch 7acyyyyyyyy
yyynnnnaua ccagccgaaa ggcccuuggc agnnnn
46846RNAArtificialChemically synthesized riboswitch 8acuuuuuuuu
uuunnnnaua ccagccgaaa ggcccuuggc agnnnn
46954RNAArtificialChemically synthesized riboswitch 9acyyyyyyyy
yyyyyyyyyy ynnnnauacc agccgaaagg cccuuggcag nnnn
541025RNAArtificialChemically synthesized theophylline-dependent
aptamer 10auaccagccg aaaggcccuu ggcag 251138RNAArtificialChemically
synthesized riboswitch sequence subject to optimization
11acuuuuuuuc cucauaccag ccgaaaggcc cuuggcag
381239RNAArtificialChemically synthesized riboswitch sequence
subject to optimization 12acuuuuuuuu ccucauacca gccgaaaggc
ccuuggcag 391340RNAArtificialChemically synthesized riboswitch
sequence subject to optimization 13acuuuuuuuu uccucauacc agccgaaagg
cccuuggcag 401441RNAArtificialChemically synthesized riboswitch
sequence subject to optimization 14acuuuuuuuu uuccucauac cagccgaaag
gcccuuggca g 411542RNAArtificialChemically synthesized riboswitch
sequence subject to optimization 15acuuuuuuuu uuuccucaua ccagccgaaa
ggcccuuggc ag 421633RNAArtificialChemically synthesized
theophylline binding sequence 16ggcgauacca gccgaaaggc ccuuggcagc
guc 331724RNAArtificialChemically synthesized riboswitch
17acccuguccc uuuuuuuucc acag 241862RNAArtificialChemically
synthesized riboswitch 18acccuuuccc uuuuuuuucc ucucucucug
gcgauaccag ccgaaaggcc cuuggcagcg 60cc 621951RNAArtificialChemically
synthesized riboswitch 19acuuuuuuuc uuuuuuuuuc agauaccagc
cgaaaggccc uuggcagcug a 512055RNAArtificialChemically synthesized
riboswitch 20acuuuuuuuc uuuuuuuuuc agggcgauac cagccgaaag gcccuuggca
gcguc 552122RNAArtificialChemically synthesized riboswitch
21acuuuuuuuc uuuuuuuuuc ag 222242RNAArtificialChemically
synthesized riboswitch 22acuuuuuuuc cucauaccag ccgaaaggcc
cuuggcagga gg 422344RNAArtificialChemically synthesized riboswitch
23acuuuuuuuu uccucauacc agccgaaagg cccuuggcag gagg
442446RNAArtificialChemically synthesized riboswitch 24acuuuuuuuu
uuuccucaua ccagccgaaa ggcccuuggc aggagg
462552RNAArtificialChemically synthesized riboswitch 25ggugauacca
gucagcgucu ugcugacccu uggcagcacc uuuuuuuuuc ag
522655RNAArtificialChemically synthesized riboswitch 26ggugauacca
gucagcgucu ugcugacccu uggcagcacc uuuuuuuuuu uucag
552758RNAArtificialChemically synthesized riboswitch 27ggugauacca
gucagcgucu ugcugacccu uggcagcacc uuuuuuuuuu uuuuucag
582840RNAArtificialChemically synthesized riboswitch 28gguggauggu
gucagcgucu ugcugacccu uggcagcacc 402950RNAArtificialChemically
synthesized riboswitch 29gucagcagau accagcaucg ucuugaugcc
cuuggcagcu gcugacucag 503018DNAArtificialChemically synthesized PCR
primer 30taatacgact cactatag 183154DNAArtificialChemically
synthesized PCR primer 31tcaacgtcga gacgctgcca agggcctttc
ggctggtatc gccagagaga gagg 543262DNAArtificialChemically
synthesized PCR primer 32ttgacgtcga cctcctgcca agggcctttc
ggctggtatg aggaaaaaaa aagaaaaaaa 60gt 623357DNAArtificialChemically
synthesized PCR primer 33ttgacgtcga cctgccaagg gcctttcggc
tggtatggaa aaaaaaagaa aaaaagt 573461DNAArtificialChemically
synthesized PCR primer 34ttgacgtcga tcagctgcca agggcctttc
ggctggtatc tgaaaaaaaa agaaaaaaag 60t 613534DNAArtificialChemically
synthesized PCR primer 35cccttggcag cgtctgagga caaactcttc gcgg
343640DNAArtificialChemically synthesized PCR primer 36cctttcggct
ggtatcgcca cgtcgacctg aaaaaaaaag 403719DNAArtificialChemically
synthesized PCR primer 37ggttaccagc cttcactgc
193819DNAArtificialChemically synthesized PCR primer 38gtgtgaccga
ccgtggtgc 193919DNAArtificialChemically synthesized PCR primer
39tctaatacga ctcactata 194043RNAArtificialChemically synthesized
riboswitch 40acyyyyyyyy yyyyyyyyau accagccgaa aggcccuugg cag
434144RNAArtificialChemically synthesized riboswitch 41acyyyyyyyy
yyyyyyyyya uaccagccga aaggcccuug gcag 444245RNAArtificialChemically
synthesized riboswitch 42acyyyyyyyy yyyyyyyyyy auaccagccg
aaaggcccuu ggcag 454346RNAArtificialChemically synthesized
riboswitch 43acyyyyyyyy yyyyyyyyyy yauaccagcc gaaaggcccu uggcag
464447RNAArtificialChemically synthesized riboswitch 44acyyyyyyyy
yyyyyyyyyy yyauaccagc cgaaaggccc uuggcag
474548RNAArtificialChemically synthesized riboswitch 45acyyyyyyyy
yyyyyyyyyy yyyauaccag ccgaaaggcc cuuggcag
484649RNAArtificialChemically synthesized riboswitch 46acyyyyyyyy
yyyyyyyyyy yyyyauacca gccgaaaggc ccuuggcag
494750RNAArtificialChemically synthesized riboswitch 47acyyyyyyyy
yyyyyyyyyy yyyyyauacc agccgaaagg cccuuggcag
504851RNAArtificialChemically synthesized riboswitch 48acyyyyyyyy
yyyyyyyyyy yyyyyyauac cagccgaaag gcccuuggca g
514952RNAArtificialChemically synthesized riboswitch 49acyyyyyyyy
yyyyyyyyyy yyyyyyyaua ccagccgaaa ggcccuuggc ag
525053RNAArtificialChemically synthesized riboswitch 50acyyyyyyyy
yyyyyyyyyy yyyyyyyyau accagccgaa aggcccuugg cag
535154RNAArtificialChemically synthesized riboswitch 51acyyyyyyyy
yyyyyyyyyy yyyyyyyyya uaccagccga aaggcccuug gcag
545255RNAArtificialChemically synthesized riboswitch 52acyyyyyyyy
yyyyyyyyyy yyyyyyyyyy auaccagccg aaaggcccuu ggcag
555356RNAArtificialChemically synthesized riboswitch 53acyyyyyyyy
yyyyyyyyyy yyyyyyyyyy yauaccagcc gaaaggcccu uggcag
565457RNAArtificialChemically synthesized riboswitch 54acyyyyyyyy
yyyyyyyyyy yyyyyyyyyy yyauaccagc cgaaaggccc uuggcag
575558RNAArtificialChemically synthesized riboswitch 55acyyyyyyyy
yyyyyyyyyy yyyyyyyyyy yyyauaccag ccgaaaggcc cuuggcag
585647RNAArtificialChemically synthesized riboswitch 56acyyyyyyyy
yyyynnnnau accagccgaa aggcccuugg cagnnnn
475748RNAArtificialChemically synthesized riboswitch 57acyyyyyyyy
yyyyynnnna uaccagccga aaggcccuug gcagnnnn
485849RNAArtificialChemically synthesized riboswitch 58acyyyyyyyy
yyyyyynnnn auaccagccg aaaggcccuu ggcagnnnn
495950RNAArtificialChemically synthesized riboswitch 59acyyyyyyyy
yyyyyyynnn nauaccagcc gaaaggcccu uggcagnnnn
506051RNAArtificialChemically synthesized riboswitch 60acyyyyyyyy
yyyyyyyynn nnauaccagc cgaaaggccc uuggcagnnn n
516152RNAArtificialChemically synthesized riboswitch 61acyyyyyyyy
yyyyyyyyyn nnnauaccag ccgaaaggcc cuuggcagnn nn
526253RNAArtificialChemically synthesized riboswitch 62acyyyyyyyy
yyyyyyyyyy nnnnauacca gccgaaaggc ccuuggcagn nnn
536354RNAArtificialChemically synthesized riboswitch 63acyyyyyyyy
yyyyyyyyyy ynnnnauacc agccgaaagg cccuuggcag nnnn
546455RNAArtificialChemically synthesized riboswitch 64acyyyyyyyy
yyyyyyyyyy yynnnnauac cagccgaaag gcccuuggca gnnnn
556556RNAArtificialChemically synthesized riboswitch 65acyyyyyyyy
yyyyyyyyyy yyynnnnaua ccagccgaaa ggcccuuggc agnnnn
566657RNAArtificialChemically synthesized riboswitch 66acyyyyyyyy
yyyyyyyyyy yyyynnnnau accagccgaa aggcccuugg cagnnnn
576758RNAArtificialChemically synthesized riboswitch 67acyyyyyyyy
yyyyyyyyyy yyyyynnnna uaccagccga aaggcccuug gcagnnnn
586859RNAArtificialChemically synthesized riboswitch 68acyyyyyyyy
yyyyyyyyyy yyyyyynnnn auaccagccg aaaggcccuu ggcagnnnn
596960RNAArtificialChemically synthesized riboswitch 69acyyyyyyyy
yyyyyyyyyy yyyyyyynnn nauaccagcc gaaaggcccu uggcagnnnn
607061RNAArtificialChemically synthesized riboswitch 70acyyyyyyyy
yyyyyyyyyy yyyyyyyynn nnauaccagc cgaaaggccc uuggcagnnn 60n
617162RNAArtificialChemically synthesized riboswitch 71acyyyyyyyy
yyyyyyyyyy yyyyyyyyyn nnnauaccag ccgaaaggcc cuuggcagnn 60nn
627247RNAArtificialChemically synthesized riboswitch 72acuuuuuuuu
uuuunnnnau accagccgaa aggcccuugg cagnnnn
477348RNAArtificialChemically synthesized riboswitch 73acuuuuuuuu
uuuuunnnna uaccagccga aaggcccuug gcagnnnn
487449RNAArtificialChemically synthesized riboswitch 74acuuuuuuuu
uuuuuunnnn auaccagccg aaaggcccuu ggcagnnnn
497550RNAArtificialChemically synthesized riboswitch 75acuuuuuuuu
uuuuuuunnn nauaccagcc gaaaggcccu uggcagnnnn
507651RNAArtificialChemically synthesized riboswitch 76acuuuuuuuu
uuuuuuuunn nnauaccagc cgaaaggccc uuggcagnnn n
517752RNAArtificialChemically synthesized riboswitch 77acuuuuuuuu
uuuuuuuuun nnnauaccag ccgaaaggcc cuuggcagnn nn
527853RNAArtificialChemically synthesized riboswitch 78acuuuuuuuu
uuuuuuuuuu nnnnauacca gccgaaaggc ccuuggcagn nnn
537954RNAArtificialChemically synthesized riboswitch 79acuuuuuuuu
uuuuuuuuuu unnnnauacc agccgaaagg cccuuggcag nnnn
548055RNAArtificialChemically synthesized riboswitch 80acuuuuuuuu
uuuuuuuuuu uunnnnauac cagccgaaag gcccuuggca gnnnn
558156RNAArtificialChemically synthesized riboswitch 81acuuuuuuuu
uuuuuuuuuu uuunnnnaua ccagccgaaa ggcccuuggc agnnnn
568257RNAArtificialChemically synthesized riboswitch 82acuuuuuuuu
uuuuuuuuuu uuuunnnnau accagccgaa aggcccuugg cagnnnn
578358RNAArtificialChemically synthesized riboswitch 83acuuuuuuuu
uuuuuuuuuu uuuuunnnna uaccagccga aaggcccuug gcagnnnn
588459RNAArtificialChemically synthesized riboswitch 84acuuuuuuuu
uuuuuuuuuu uuuuuunnnn auaccagccg aaaggcccuu ggcagnnnn
598560RNAArtificialChemically synthesized riboswitch 85acuuuuuuuu
uuuuuuuuuu uuuuuuunnn nauaccagcc gaaaggcccu uggcagnnnn
608661RNAArtificialChemically synthesized riboswitch 86acuuuuuuuu
uuuuuuuuuu uuuuuuuunn nnauaccagc cgaaaggccc uuggcagnnn 60n
618762RNAArtificialChemically synthesized riboswitch 87acuuuuuuuu
uuuuuuuuuu uuuuuuuuun nnnauaccag ccgaaaggcc cuuggcagnn 60nn
628855RNAArtificialChemically synthesized riboswitch 88acyyyyyyyy
yyyyyyyyyy yynnnnauac cagccgaaag gcccuuggca gnnnn
558956RNAArtificialChemically synthesized riboswitch 89acyyyyyyyy
yyyyyyyyyy yyynnnnaua ccagccgaaa ggcccuuggc agnnnn
569057RNAArtificialChemically synthesized riboswitch 90acyyyyyyyy
yyyyyyyyyy yyyynnnnau accagccgaa aggcccuugg cagnnnn
579158RNAArtificialChemically synthesized riboswitch 91acyyyyyyyy
yyyyyyyyyy yyyyynnnna uaccagccga aaggcccuug gcagnnnn 58
* * * * *
References