U.S. patent application number 12/239276 was filed with the patent office on 2009-06-25 for polypeptide having an activity to support proliferation or survival of hematopoietic stem cell or hematopoietic progenitor cell, and dna coding for the same.
This patent application is currently assigned to Kirin Pharma Kabushiki Kaisha. Invention is credited to Mitsuo NISHIKAWA.
Application Number | 20090162932 12/239276 |
Document ID | / |
Family ID | 29270747 |
Filed Date | 2009-06-25 |
United States Patent
Application |
20090162932 |
Kind Code |
A1 |
NISHIKAWA; Mitsuo |
June 25, 2009 |
POLYPEPTIDE HAVING AN ACTIVITY TO SUPPORT PROLIFERATION OR SURVIVAL
OF HEMATOPOIETIC STEM CELL OR HEMATOPOIETIC PROGENITOR CELL, AND
DNA CODING FOR THE SAME
Abstract
A gene encoding a polypeptide having an activity to support
proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells is isolated by comparing expressed
genes between cells which support proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells and
cells which do not support the proliferation or survival.
Proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells is supported by using stromal cells
in which the isolated gene is expressed or a gene product of the
isolated gene.
Inventors: |
NISHIKAWA; Mitsuo; (Gunma,
JP) |
Correspondence
Address: |
FOLEY AND LARDNER LLP;SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
Kirin Pharma Kabushiki
Kaisha
|
Family ID: |
29270747 |
Appl. No.: |
12/239276 |
Filed: |
September 26, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10512109 |
Jul 21, 2005 |
7439332 |
|
|
PCT/JP2003/005383 |
Apr 25, 2003 |
|
|
|
12239276 |
|
|
|
|
60376001 |
Apr 26, 2002 |
|
|
|
Current U.S.
Class: |
435/366 ;
435/320.1; 435/373; 435/375; 530/387.9; 536/23.1 |
Current CPC
Class: |
A61P 7/00 20180101; C07K
14/47 20130101 |
Class at
Publication: |
435/366 ;
536/23.1; 435/320.1; 530/387.9; 435/373; 435/375 |
International
Class: |
C12N 5/08 20060101
C12N005/08; C12N 15/11 20060101 C12N015/11; C07K 16/18 20060101
C07K016/18; C12N 15/00 20060101 C12N015/00 |
Claims
1. A DNA coding a polypeptide wherein the polypeptide comprises:
(A) the amino acid sequence of SEQ ID NO: 48; or (B) an amino acid
sequence including deletion, substitution or insertion of one or
several amino acids in the amino acid sequence as defined in (A),
wherein the polypeptide has an activity to support hematopoietic
stem cell or hematopoietic progenitor cell proliferation or
survival.
2. The DNA according to claim 1, comprising: (A) the nucleotides 18
to 746 of SEQ ID NO: 47; or (B) a nucleotide sequence which
hybridizes under stringent conditions to nucleotides 18 to 744 of
SEQ ID NO: 47, wherein the DNA encodes a polypeptide having an
activity to support hematopoietic stem cell or hematopoietic
progenitor cell proliferation or survival.
3. The DNA according to claim 2, wherein the stringent condition is
6.times.SSC, 5.times.Denhardt, 0.5% SDS and 68.degree. C., or
6.times.SSC, 5.times.Denhardt, 0.5% SDS, 50% formamide and
42.degree. C.
4. An expression vector which comprises the DNA of any one of
claims 1 or 2 in such a manner that the DNA can be expressed.
5. An isolated cell into which the DNA of any one of claims 1 or 2
is introduced in such a manner that the DNA can be expressed.
6. A monoclonal antibody which binds to a polypeptide which is an
expression product of the nucleic acid of SEQ ID NO: 47.
7. A monoclonal antibody which binds to a polypeptide having the
amino acid sequence of SEQ ID NO: 48.
8. A method for supporting hematopoietic stem cell or hematopoietic
progenitor cell proliferation or survival, comprising the step of
co-culturing stromal cells comprising a DNA encoding a polypeptide
under conditions in which the polypeptide is expressed, with
hematopoietic stem cells or progenitor cells, wherein the
polypeptide comprises: (A) the amino acid sequence of SEQ ID NO:
48; or (B) an amino acid sequence including deletion, substitution
or insertion of one or several amino acids in the amino acid
sequence of SEQ ID NO: 48, wherein the polypeptide has an activity
to support hematopoietic stem cell or hematopoietic progenitor cell
proliferation or survival.
9. The method according to claim 8, wherein the DNA comprises: (A)
the nucleotide sequence of nucleotides 18 to 746 of SEQ ID NO: 47;
or (B) a nucleotide sequence that hybridizes under stringent
conditions to nucleotides 18-746 of SEQ ID NO: 47, wherein the
polynucleotide encodes a polypeptide having activity to support
hematopoietic stem cell or hematopoietic progenitor cell
proliferation or survival.
10. A method for supporting hematopoietic stem cell or
hematopoietic progenitor cell proliferation or survival comprising
culturing hematopoietic stem cells or progenitor cells in the
presence of a polypeptide, wherein said polypeptide has an activity
to support hematopoietic stem cell or hematopoietic progenitor cell
proliferation or survival when the hematopoietic stem cells or
hematopoietic progenitor cells are cultured in the presence of the
polypeptide, said polypeptide comprising: (A) the amino acid
sequence of SEQ ID NO: 48; or (B) an amino acid sequence including
deletion, substitution or insertion of one or several amino acids
in the amino acid sequence of SEQ ID NO: 48, wherein said
polypeptide has activity to support hematopoietic stem cell or
hematopoietic progenitor cell proliferation or survival.
Description
TECHNICAL FIELD
[0001] The present invention relates to a polypeptide having an
activity to support proliferation or survival of hematopoietic stem
cells or hematopoietic progenitor cells, a DNA coding the
polypeptide, and a pharmaceutical composition comprising the
polypeptide as active ingredient.
BACKGROUND ART
[0002] Fully differentiated mature hematopoietic cells have limited
short lives. Homeostasis of the blood is maintained due to supply
of the mature blood cells caused by continuous differentiation of
hematopoietic progenitor cells. The hematopoietic progenitor cells
are giving rise from more undifferentiated hematopoietic stem
cells. The hematopoietic stem cells have potential of
differentiating into all of the differentiation lineages
(totipotency) and have potential of self-renew with retaining the
totipotency so as to supply the hematopoietic cells through life.
That is, the hematopoietic stem cells are known to generate
totipotent stem cells by the self-renew and to differentiate in
parts to a variety of the mature blood cells through the
hematopoietic progenitor cells.
[0003] This differentiation of the blood cells is regulated by a
variety of cytokines. Erythropoietin is known to promote the
differentiation of the erythrocytic lineages. G-CSF and
thrombopoietin are also known to promote the differentiation of the
neutrophils, and the megakaryocytes and the platelet productive
cells, respectively. However, a factor required for the self-renew
of the hematopoietic stem cell with retaining the totipotency has
not been clear. Although SCF/MGF (Williams, D. E., Cell, 63:
167-174, 1990; Zsebo, K. M., Cell, 63: 213-224, 1990), SCGF
(WO98/08869), and the like are reported as growth factors for the
hematopoietic stem cells, none of them have potency to sufficiently
retain the totipotency of the hematopoietic stem cells. Although
attempts to culture the hematopoietic stem cells in the presence of
combinations of known cytokines, a system for efficient
amplification of the hematopoietic stem cells was not realized
(Miller, C. L., Proc. Natl. Acad. Sci. USA, 94: 13648-13653, 1997;
Yagi, M., Proc. Natl. Acad. Sci. USA, 96: 8126-8131, 1999; Shih, C.
C., Blood, 94: 5 1623-1636, 1999).
[0004] On the other hand, attempts to allow the hematopoietic stem
cells to survive or proliferate without differentiation by using
stromal cells which supply an environment suitable for survival or
proliferation of the hematopoietic stem cells were reported (Moore
K. A., Blood, 89: 12, 4337-4347, 1997).
[0005] In addition, WO99/03980 discloses a stromal cell line
capable of supporting proliferation or survival of hematopoietic
stem cells and hematopoietic progenitor cells, which are
established from an AGM (Aorta-Gonad-Mesonephros) region of a fetal
mouse.
[0006] It is postulated that there should be more peptides that
efficiently facilitate hematopoietic stem cell and progenitor cell
amplification by themselves or in combination with stromal cells or
stimulating factors such as cytokines, in addition to known factors
affecting hematopoietic cells.
DISCLOSURE OF INVENTION
[0007] Since the proliferation or survival of hematopoietic stem
cells or hematopoietic progenitor cells in vitro can be supported
by co-culture of stromal cells and hematopoietic stem cells and
hematopoietic progenitor cells, the stromal cells are expected to
produce factors supporting the proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells. An
object of the present invention is to provide a factor supporting
the proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells, which is derived from the stromal
cells.
[0008] The inventor of the present invention has assumed that the
mouse stromal cells produce factors supporting the proliferation or
survival of hematopoietic stem cells or hematopoietic progenitor
cells, as mentioned above. Attention is given that there are two
kinds of stromal cells. One has a ability to support the
proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells (hereafter sometimes referred to as
"activity to support hematopoietic stem cells"). The other does not
have the activity to support hematopoietic stem cells. The inventor
of the present invention has assumed that this difference in the
ability is due to the fact that expression of genes encoding the
factors is increased in the supporting stromal cells and that the
expression is low in non-supporting stromal cells. Thus the
inventor think it can be found the factors supporting the
proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells among the genes expressed higher in
the supporting cells compared to in the non-supporting cells. In
this context, the inventor has identified genes of which
expressions are high in AGM-s3-A9 cell line which has the activity
to support hematopoietic stem cells, and low or undetected in
AGM-s3-A7 cell line which does not have the activity to support
hematopoietic stem cells, and has determined the activities to
support hematopoietic stem cells, of cells in which these gene
groups are highly expressed. As a result, the present invention has
been completed.
[0009] That is, the present invention provides the followings.
[0010] (1) A DNA coding for a polypeptide of the following (A) or
(B):
[0011] (A) a polypeptide which comprises the amino acid sequence of
SEQ ID NO: 48; or
[0012] (B) a polypeptide which comprises an amino acid sequence
including deletion, substitution or insertion of one or several
amino acids in the amino acid sequence as defined in (A), and which
has an activity to support proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells.
[0013] (2) The DNA according to (1), which is a DNA of the
following (a) or (b):
[0014] (a) a DNA which comprises the nucleotide sequence of
nucleotides 18 to 746 of SEQ ID NO: 47; or
(b) a DNA which is hybridizable with a DNA comprising the
nucleotide sequence as defined in (a) or a prove prepared from said
DNA, under the stringent condition, and which has an activity to
support proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells.
[0015] (3) The DNA according to (2), the stringent condition is
6.times.SSC 5.times.Denhardt, 0.5% SDS and 68.degree. C. (SSC: 3 M
NaCl, 0.3 M sodium citrate; 50.times.Denhardt: 1% BSA, 1% polyvinyl
pyrrolidone, 1% Ficoll 400), or 6.times.SSC, 5.times.Denhardt, 0.5%
SDS, 50% formamide and 42.degree. C.
[0016] (4) A expression vector which comprises the DNA of any one
of (1) to (3) in such a manner that the DNA can be expressed.
[0017] (5) A cell into which the DNA of any one of (1) to (3) is
introduced in such a manner that the DNA can be expressed.
[0018] (6) A polypeptide which is an expression product of the DNA
of any one of (1) to (3), the polypeptide having an activity to
support proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells.
[0019] (7) The polypeptide according to (6), which comprises the
amino acid sequence of SEQ ID NO: 48, or an amino acid sequence
including deletion, substitution or insertion of one or several
amino acids in the amino acid sequence.
[0020] (8) The polypeptide according to (6) or (7), which is
modified with one or more modifying agents selected from the group
consisting of polyethylene glycol (PEG), dextran,
poly(N-vinyl-pyrrolidone), polypropylene glycol homopolymer,
copolymer of polypropylene oxide/ethylene oxide, polyoxyethylated
polyol and polyvinyl alcohol.
[0021] (9) An monoclonal antibody which binds to the polypeptide of
any one of (6) to (8).
[0022] (10) A method for supporting proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells,
comprising the step of co-culturing stromal cells in which a DNA
coding for a polypeptide of the following (A) or (B) is expressed,
with hematopoietic stem cells or progenitor cells,
[0023] (A) a polypeptide which comprises the amino acid sequence of
SEQ ID NO: 48; or
[0024] (B) a polypeptide which comprises an amino acid sequence
including deletion, substitution or insertion of one or several
amino acids in the amino acid sequence as defined in (A), and which
has an activity to support proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells.
[0025] (11) The method according to (10), wherein the DNA is a DNA
of the following (a) or (b):
[0026] (a) a DNA which comprises the nucleotide sequence of
nucleotides 18 to 746 of SEQ ID NO: 47; or
(b) a DNA which is hybridizable with a DNA comprising the
nucleotide sequence as defined in (a) or a prove prepared from said
DNA, under the stringent condition, and which has an activity to
support proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells.
[0027] (12) A method for supporting proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells,
comprising the step of culturing hematopoietic stem cells or
progenitor cells in the presence of a polypeptide of the following
(A) or (B), said polypeptide having an activity to support
proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells when the hematopoietic stem cells or
hematopoietic progenitor cells are cultured in the presence of the
polypeptide,
[0028] (A) a polypeptide which comprises the amino acid sequence of
SEQ ID NO: 48; or
[0029] (B) a polypeptide which comprises an amino acid sequence
including deletion, substitution or insertion of one or several
amino acids in the amino acid sequence as defined in (A), and which
has an activity to support proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells.
[0030] (13) A pharmaceutical composition having an effect to
support proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells, which comprises an effective amount
of a polypeptide of the following (A) or (B), said polypeptide
having an activity to support proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells when
hematopoietic stem cells or hematopoietic progenitor cells are
cultured in the presence of the polypeptide,
[0031] (A) a polypeptide which comprises the amino acid sequence of
SEQ ID NO: 48; or
[0032] (B) a polypeptide which comprises an amino acid sequence
including deletion, substitution or insertion of one or several
amino acids in the amino acid sequence as defined in (A), and which
has an activity to support proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells.
[0033] Terms used in this specification are defined as follows.
[0034] A hematopoietic stem cell is defined as a cell having
totipotency, that is, ability to differentiate into all the cell
lineages of the blood cells, and having a potency of self-renew
with retaining the totipotency. A hematopoietic progenitor cell is
defined as a cell which can differentiate a single cell lineage of
the blood cell or plural cell lineages but cannot differentiate
into all of the cell lineages. A stromal cell is defined as a cell
which can be co-cultured together with the hematopoietic stem cells
to construct a hematopoietic environment simulating in vivo
hematopoietic environment in vitro. Cells derived from any origin
can be used as long as the cells can be co-cultured with the
hematopoietic cells in vitro.
[0035] Erythrocyte progenitor cells hardly survive and proliferate
in in vitro culture environments and rapidly disappear. If the
survival and proliferation of the erythrocyte progenitor cells are
observed, continuous production of the erythrocyte progenitor cells
is predicted to occur due to the survival and proliferation of the
more immature hematopoietic stem cells or the hematopoietic
progenitor cells. Therefore, in an assessment system of human
hematopoietic stem cells, proliferation of hematopoietic stem cells
or immature hematopoietic progenitor cells can be determined by
using the survival and proliferation of the erythrocyte progenitor
cells (BFU-E, CFU-E, and CFU-E mix) as an index.
BRIEF DESCRIPTION OF DRAWINGS
[0036] FIG. 1 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-s3 subclone A9, A7, or D11 cells for two weeks.
[0037] FIG. 2 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-s3 subclone A9, A7, or OP9 cells for two weeks.
[0038] FIG. 3 shows time course of donor derived lymphoid lineage
cells or myeloid lineage cells reconstitution in irradiated
recipient mice that received the hematopoietic stem cells
co-cultured with stromal cells.
[0039] FIG. 4 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-S3-A9 cells in which a gene SCR-2 is highly expressed
(A9/SCR-2), AGM-S3-A9 cells into which a control vector is
introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.
[0040] FIG. 5 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-S3-A7 cells in which a gene SCR-2 is highly expressed
(A7/SCR-2), AGM-S3-A7 cells into which a control vector is
introduced (A7/pMXIG) or AGM-S3-A7 cells (A7) for two weeks.
[0041] FIG. 6 shows time course of donor derived lymphoid lineage
cells or myeloid lineage cells reconstitution in peripheral blood
of irradiated recipient mice that received the hematopoietic stem
cells co-cultured with AGM-S3-A7 cells in which a gene SCR-3 is
highly expressed (A7/SCR-3), AGM-S3-A7 cells into which a control
vector is introduced (A7/pMXIG) or AGM-S3-A7 cells.
[0042] FIG. 7 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-S3-A9 cells in which a gene SCR-4 is highly expressed
(A9/SCR-4), AGM-S3-A9 cells into which a control vector is
introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.
[0043] FIG. 8 shows time course of donor derived lymphoid lineage
cells or myeloid lineage cells reconstitution in peripheral blood
of irradiated recipient mice that received the hematopoietic stem
cells co-cultured with AGM-S3-A7 cells in which a gene SCR-5 is
highly expressed (A7/SCR-5), AGM-S3-A7 cells into which a control
vector is introduced (A7/pMXIG) or AGM-S3-A7 cells.
[0044] FIG. 9 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-S3-A9 cells in which a gene SCR-6 is highly expressed
(A9/SCR-6), AGM-S3-A9 cells into which a control vector is
introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.
[0045] FIG. 10 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-S3-A9 cells in which a gene SCR-7 is highly expressed
(A9/SCR-7), AGM-S3-A9 cells into which a control vector is
introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.
[0046] FIG. 11 shows proliferation statuses of hematopoietic stem
cells and hematopoietic progenitor cells determined by a clonogenic
assay after co-culture of CD34-positive hematopoietic stem cells
with AGM-S3-A9 cells in which a gene SCR-8 is highly expressed
(A9/SCR-8), AGM-S3-A9 cells into which a control vector is
introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.
BEST MODE FOR CARRYING OUT THE INVENTION
[0047] Hereafter, the present invention will be described in detail
below.
[0048] The following genes are those identified as genes of which
expressions are high in AGM-s3-A9 cell line which has the activity
to support hematopoietic stem cells, and low or undetected in
AGM-s3-A7 cell line which does not have the activity to support
hematopoietic stem cells, and determined to have the activities to
support hematopoietic stem cells, of cells in which these gene
groups are highly expressed.
[0049] Gene SCR-2
[0050] The gene is the same gene as a mouse gene, Mus musculus
glypican-1 (GPC-1) of a GenBank accession number AF185613.
[0051] The nucleotide sequence of the gene from mouse and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 8. Only the amino acid sequence is shown in SEQ ID NO:
9.
[0052] The human amino acid sequence of GPC-1 is recorded in
GenBank under an accession number P35052, and the human nucleotide
sequence of GPC-1 is recorded in GenBank database under an
accession number AX020122. It is predicted that the similar
activity is detected in the human gene.
[0053] The nucleotide sequence of the gene from human and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 10. Only the amino acid sequence is shown in SEQ ID NO:
11.
[0054] Glypican is a major hepran sulfate proteoglycan existing on
a cell surface, and have a characteristic structure such as
cysteine rich globular domain, short glycosaminoglycan binding
domain, glycosylphosphatidyl-inositol membrane binding domain. Six
family genes from glypican-1 to glypican-6 have been found (J Biol
Chem 1999 Sep. 17; 274(38):26968-77, Glypican-6, a new member of
the glypican family of cell surface heparan sulfate proteoglycans.
Veugelers M, De Cat B, Ceulemans H, Bruystens A M, Coomans C, Durr
J, Vermeesch J, Marynen P, David G).
[0055] With respect to biological activities of GPC-1, there are a
number of reports: To regulate growth stimulating activity of
heparin binding growth factors (fibroblast growth factor 2 (FGF2),
heparin-binding EGF-like growth factor (HB-EGF)) to promote
proliferation of cancer cells showing autocrine proliferation by
stimulation by the growth factors (J Clin Invest 1998 Nov. 1;
102(9):1662-73, The cell-surface heparan sulfate proteoglycan
glypican-1 regulates growth factor action in pancreatic carcinoma
cells and is overexpressed in human pancreatic cancer, Kleeff J,
Ishiwata T, Kumbasar A, Friess H, Buchler M W, Lander A D, Korc
M).
[0056] To bind HGF (hepatocyte growth factor) to promote reactivity
with cytokines, of antigen-specific B cells. To participate in
association of a cell with an adhesive molecule to involve in
invasion of the cell (J Biol Chem 1998 Aug. 28; 273(35):22825-32,
Heparan sulfate proteoglycans as adhesive and anti-invasive
molecules. Syndecans and glypican have distinct functions, Liu W,
Litwack E D, Stanley M J, Langford J K, Lander A D, Sanderson R D).
These findings show that GPC-1 involves in activity expression of
various cell-stimulating factors. Also, there is a report that
expression of the glypican family gene in bone marrow is confirmed
(Biochem J 1999 Nov. 1; 343 Pt 3:663-8, Expression of proteoglycan
core proteins in human bone marrow stroma, Schofield K P, Gallagher
J T, David G). However, in these reports, it is not described about
effects of GPC-1 on hematopoietic stem cells or hematopoietic
progenitor cells.
[0057] Gene SCR-3
[0058] The gene is the same gene as mouse genes, Mus musculus
chemokine MMRP2 mRNA of a GenBank accession number U15209, Mus
musculus C10-like chemokine mRNA of U19482 and mouse macrophage
inflammatory protein-1gamma mRNA of U49513.
[0059] The nucleotide sequence of the gene from mouse and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 12. Only the amino acid sequence is shown in SEQ ID NO:
13.
[0060] Gene SCR-4
[0061] The nucleotide sequence of the gene from mouse and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 14. Only the amino acid sequence is shown in SEQ ID NO:
15.
[0062] It has been found that the sequence has a high homology to
Homo sapiens clone 25077 mRNA of a GenBank accession number
AF131820, and that it is considered to be a mouse ortholog. This
sequence is described in WO 00/66784.
[0063] The nucleotide sequence of the gene from human and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 16. Only the amino acid sequence is shown in SEQ ID NO:
17.
[0064] Gene SCR-5
[0065] The nucleotide sequence of the gene from mouse and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 18. Only the amino acid sequence is shown in SEQ ID NO:
19.
[0066] It has been found that the sequence has a high homology with
Homo sapiens esophageal cancer related gene 4 portein (ECRG4) mRNA
of a GenBank accession number AF325503, and that it is considered
to be a mouse ortholog of AF325503.
[0067] The nucleotide sequence of the gene from human and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 20. Only the amino acid sequence is shown in SEQ ID NO:
21.
[0068] Gene SCR-6
[0069] The nucleotide sequence of the gene from mouse and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 22. Only the amino acid sequence is shown in SEQ ID NO:
23.
[0070] The nucleotide sequence of the gene from human and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 47. Only the amino acid sequence is shown in SEQ ID NO:
48.
[0071] Gene SCR-7
[0072] The nucleotide sequence of the gene from mouse and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 24. Only the amino acid sequence is shown in SEQ ID NO:
25.
[0073] Gene SCR-8
[0074] The gene is the same gene as Mus musculus mRNA for ADAM23 of
a GenBank accession number AB009673.
[0075] The nucleotide sequence of the gene from mouse and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 26. Only the amino acid sequence is shown in SEQ ID NO:
27.
[0076] The sequence has a high homology with a sequence described
by JP 11155574-A and the sequence described by JP 11155574-A is
considered to be a human ortholog.
[0077] The nucleotide sequence of the gene from human and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 28. Only the amino acid sequence is shown in SEQ ID NO:
29.
[0078] Polypeptides which are products of these genes have an
activity to support proliferation or survival of hematopoietic stem
cells or hematopoietic progenitor cells. The expression that a
polypeptide has an activity to support proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells means
that proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells is supported in the presence of the
polypeptide or in the presence of stroma cells expressing the
polypeptide.
[0079] Therefore, the present invention provides use of the
polypeptides and DNAs encoding the polypeptides and novel
polypeptides among the polypeptides and DNAs encoding the novel
polypeptides.
[0080] A stem cell proliferation-supporting factor which is a
polypeptide encoded by the DNA can be produced by introducing the
DNA into a suitable host to prepare a transformant cell, and
allowing the DNA to be expressed in the transformant cell.
[0081] The DNA may encode the above described factors which have
amino acid sequences including substitution, deletion or insertion
of one or several amino acids, as long as the activity of the stem
cell proliferation-supporting factor to be encoded is not lost.
DNAs encoding substantially equivalent polypeptides to this stem
cell proliferation-supporting factor can be obtained by modifying
the nucleotide sequences so as to include substitution, deletion,
insertion, addition, or inversion of amino acid residues in a
specific region using site-directed mutagenesis.
[0082] The DNAs including the above described mutation can be
expressed in appropriate cells and the activity to support
hematopoietic stem cells, of the expressed products can be
examined, so that the DNAs encoding the polypeptide having
functions which are substantially equivalent to this stem cell
proliferation-supporting factor are obtained. In addition, the DNAs
encoding substantially equivalently active protein as this stem
cell proliferation-supporting factor can be obtained by isolating
DNAs which hybridize with DNAs including, for example, the
nucleotide sequence (ORF portion) as described in SEQ ID NO: 8, 10,
12, 14, 16, 18, 20, 22, 24, 26, 28, or 47 from the cells having the
DNA, or probes prepared from these DNAs under the stringent
condition; and which encode proteins possessing the activity to
support hematopoietic stem cells. The length of the probe is
usually 30 to 1000 nucleotides. The stringent condition is, for
example, one in which DNAs having homology (determinable with
homology search in the compare function of DNASIS version 3.7
(Hitachi Software Engineering)) at not less than 70%, preferably at
not less than 80%, are hybridized each other and DNAs having less
homology than those are not hybridized each other. The above
described stringent condition may be 6.times.SSC, 5.times.Denhardt,
0.5% SDS, 68.degree. C. (SSC; 3 M NaCl, 0.3 M sodium citrate)
(50.times.Denhardt; 1% BSA, 1% polyvinyl pyrrolidone, 1% Ficoll
400) or 6.times.SSC, 5.times.Denhardt, 0.5% SDS, 50% Formamide,
42.degree. C., or the like.
[0083] Microorganisms such as Escherichia Coli and yeast, culture
cells derived from animals or plants, and the like are used for
host cells for expressing the DNA. Preferably, culture cells
derived from mammals are used as the host cells. In the case that
prokaryotic cells are used as the host cells, the expression is
preferably performed in a condition in which a signal peptide
region is replaced with a leader sequence suitable for the
prokaryotic cells such as .beta.-lactamase (bla), alkaline
phosphatase (phoA), and outer membrane protein A (ompA) and the
like, or in a form in which a methionine residue is added to the
N-terminal site of the mature protein.
[0084] The introduction of the DNA to the host cell can be carried
out by, for example, incorporating the DNA into a vector suitable
for the host in an expressible form, and introducing the resultant
recombinant vector to the host cell.
[0085] Examples of the culture cells derived from mammals include
CHO cell, 293 cell, COS7 cell, and the like. Gene expression
regulatory sequence such as a promoter to express the DNA may be
originated from the gene itself, or may be derived from other genes
such as cytomegalovirus promoter and elongation factor 1 promoter
and the like.
[0086] Examples of a vector for animal culture cells include
plasmid vectors, retrovirus vectors, adenovirus vectors (Neering,
S. J., Blood, 88: 1147, 1996), herpes virus vectors (Dilloo, D.,
Blood, 89: 119, 1997), HIV vectors, and the like.
[0087] In order to introduce the recombinant vector into culture
cells, the conventional methods which are usually employed for
transformation of culture cells such as calcium phosphate
transfection, the liposome method, the DEAE dextran method, the
electroporation method and the microinjection method are
employed.
[0088] The polypeptides of the present invention also comprise
polypeptides having amino acid sequences in which one or several
amino acids are substituted, deleted or inserted in the amino acid
sequence represented in SEQ ID NO: 9, 11, 13, 15, 17, 19, 21, 23,
25, 27 or 29, and having activity to support hematopoietic stem
cells in addition to the polypeptides having the amino acid
sequence represented in SEQ ID NO: 9, 11, 13, 15, 17, 19, 21, 23,
25, 27, 29, or 48. That is, even if mouse and human stem cell
proliferation-supporting factors are modified by substitution,
deletion, insertion or the like, polypeptides holding essential
functions as a stem cell proliferation-supporting factor can be
considered to be substantially equivalent to the stem cell
proliferation-supporting factor.
[0089] These modified stem cell proliferation-supporting factors
can be obtained by treating DNA encoding the stem cell
proliferation-supporting factor or host cells including the above
mentioned DNA with a mutagen, or by mutating the above mentioned
DNA so as to substitute, delete, or insert an amino acid at a
specific site using site-directed mutagenesis. The residual of the
activity to support the hematopoietic stem cells in the obtained
mutant polypeptide is confirmed by transferring hematopoietic stem
cells cultured in the presence of the mutant polypeptides into
irradiated mice, and monitoring peripheral hematological
cellularity over time, as in the examples described below.
[0090] As for the amino acid deletion, the polypeptide may be a
fragment which lacks an amino acid sequence at the N-terminal end
and/or the C-terminal end. The fragment lacking the amino acid
sequence at the N-terminal end and/or the C-terminal end can be
obtained by a usual method, and the hematopoietic stem
cell-supporting activity of the fragment can be determined by a
similar way to that described with respect to the mutated
polypeptide. In particular, if there is a portion predicted as a
signal sequence or a transmembrane region in the amino acid
sequence, a fragment having the hematopoietic stem cell-supporting
activity is predicted by using it as an index. For example, a
protein encoded by human SCR-8 is a transmembrane protein of type I
passing through the membrane once, and it is therefore predicted
that even if it made to be a soluble protein lacking the
transmembrane region, it has the activity to support to
proliferation or survival of hematopoietic stem cells or
hematopoietic progenitor cells. The transmembrane region can be
predicted with a known program based on the amino acid sequence.
For example, if it is predicted with a program called PSORT II
(available through the Internet, URL:
http://psort.nibb.ac.jp/index.html), the transmembrane region is
amino acids at positions 790 to 806 in SEQ ID NO: 29, and it is
predicted that even if a fragment up to position 789, the fragment
has activity to support proliferation or survival of hematopoietic
stem cells or hematopoietic progenitor cells.
[0091] Since the nucleotide sequences of the above described DNAs
have been clarified by the present invention, the DNAs can be also
obtained by isolating the corresponding DNAs from mouse or human
cDNA or chromosome DNA libraries using PCR in which the
oligonucleotides prepared based on these nucleotide sequences are
used as primers or using hybridization in which the
oligonucleotides prepared based on these nucleotide sequences are
used as probes.
[0092] In order to complete the present invention, the DNAs of the
present invention have been isolated from cDNA library of AGM-s3-A9
cells which are a mouse stromal cell line having the activity to
support the hematopoietic stem cells, using SBH (Sequencing By
Hybridization) method (Drmanac, S., Nat. Biotechnol., 16. 54, 1998;
Drmanac, R., Methods. Enzymol., 303, 165, 1999) as described below.
The mouse stromal cell lines having the activity to support the
hematopoietic stem cells can be obtained using the method disclosed
in WO99/03980 or from Cell Bank of Institute of Physical and
Chemical Research (RIKEN) or ATCC.
[0093] An outline of SBH method will be described below. Probes
having eight or nine nucleotides whose sequences are different from
each other are prepared. When the nucleotide sequences
corresponding to those of the probe exist in a targeted gene, the
probes can hybridize with the gene. The hybridization can be easily
detected with utilization of radio isotope- or
fluorescence-labelled probes. Each clone in the library is picked
up, and blotted on a membrane. Then, the repeated hybridizations
are performed with the each of above described probes, so that one
can identify the combination of probes that hybridize to each
clone. Since the combination of hybridized probes depends on genes,
the combination of probes which hybridize to an identical gene is
the same. That is, the same gene can be identified as one group
(cluster) according to the combination of the hybridized probes.
The number of clones of each gene in the cDNA library can be
determined by classifying each clone in the library based on
patterns of the hybridized probes and counting the classified
clones. Thus, frequency of expression of each gene in the library
can be determined.
[0094] cDNA libraries are prepared from cells having an activity to
support the hematopoietic stem cells and from cells not having the
activity. Clustering is performed for the cDNA libraries. Statuses
of expressed genes among cells are compared, so that the genes
highly expressed with specificity to the supporting cells are
selected. The expression statuses of these genes in each of above
described cells are further examined by Northern blot analysis, so
that genes which are highly expressed in the cells having the
activity to support the hematopoietic stem cells are obtained.
[0095] The above mentioned genes are the genes which are highly
expressed with specificity to the supporting cells and which are
obtained through the above described process. Full-length genes
have been cloned from the cDNA library derived from AGM-s3-A9
cell.
[0096] Further, in order to determine an ability of gene products
to support hematopoiesis, a gene fragment including gene ORF was
transferred into stromal cells using a retrovirus vector, and the
change in the activity to support the hematopoietic stem cells of
the stromal cells was determined. Specifically, after the stromal
cells into which the gene was not introduced or into which a
control vector was introduced and those into which the gene was
introduced were each co-cultured with the mouse hematopoietic stem
cells, the hematopoietic cells were transplanted into irradiated
mice. The engraftment of the co-cultured hematopoietic cells in
recipient mice were examined. As a result, the mice into which the
hematopoietic stem cells co-cultured with the gene-introduced cells
were transplanted, showed increased chimerism after the
transplantation compared with co-culture with the cells into which
the gene was not introduced. This result shows that in the
gene-expressed stromal cells, an activity to support the
proliferation or survival of the hematopoietic stem cells or the
hematopoietic progenitor cells is increased or imparted. As a
result, it has become evident that expression of the above
described genes has a function to increase the above described
activity in the stromal cells or impart the activity to the stromal
cells. Therefore, it is revealed that products of the genes affect
hematopoietic stem cells or hematopoietic progenitor cells to show
an activity to support the survival or the proliferation thereof,
or affect stromal cells to show an activity to increase an activity
to support the hematopoietic stem cells therein or impart the
activity thereto.
[0097] The polypeptides of the present invention can be used as a
medicine to proliferate or support human hematopoietic stem cells
or human hematopoietic progenitor cells when they affect
hematopoietic stem cells or hematopoietic progenitor cells to show
an activity to support survival or proliferation thereof, in other
words, the polypeptides have an activity to support survival or
proliferation of hematopoietic stem cells or hematopoietic
progenitor cells if the hematopoietic stem cells or the
hematopoietic progenitor cells are cultured in the presence of the
polypeptides. The pharmaceutical composition can be used for
supporting proliferation or survival of human hematopoietic stem
cells or human hematopoietic progenitor cells in vitro. For
hematopoietic stem cell transplantation therapies such as
peripheral blood stem cell transplantation and cord blood stem cell
transplantation, a sufficient amount of the hematopoietic stem
cells sometimes cannot be collected and the transplantation may not
be performed. Even if the enough amount of the stem cells can not
be collected, the enough amount of the hematopoietic stem cells can
be obtained and transplanted by amplification of the hematopoietic
stem cells in vitro using this polypeptides. That is, the
hematopoietic stem cells can be amplified without differentiation
by culturing the hematopoietic stem cells in culture medium
including these polypeptides. It may be considered the
hematopoietic stem cells are able to be amplified more efficiently
with addition of a variety of cytokines to the medium.
[0098] When the hematopoietic stem cells or the hematopoietic
progenitor cells are cultured in the medium including the
polypeptides of the present invention, the hematopoietic stem cells
or the hematopoietic progenitor cells used may be isolated one of
these cell types alone or may be both of the cell types. In
addition, the cells may include at least the hematopoietic stem
cells or the hematopoietic progenitor cells, and include other
hematopoietic cells. Further, it can be used a fraction containing
hematopoietic stem cells or progenitor cells fractionated from the
cell population that contain the hematopoietic stem cells or
progenitor cells.
[0099] Examples of sources of the hematopoietic stem cells and the
hematopoietic progenitor cells in the method of the present
invention include a fetal liver, bone marrow, fetal bone marrow,
peripheral blood, the peripheral blood from persons whose stem
cells are mobilized by administration of cytokines and/or antitumor
drugs, cord blood, and the like of mammals such as human and mouse
and the like. Any sources may be used as long as the tissue
includes the hematopoietic stem cells.
[0100] A culture method using petri dishes and flasks for culture
may be employed to culture the hematopoietic stem cells or the
hematopoietic progenitor cells. The cultivation of the
hematopoietic stem cells and/or progenitor cells may be improved by
mechanically controlling medium composition, pH, and the like, and
using a bioreactor capable of high density cultivation (Schwartz,
Proc. Natl. Acad. Sci. U.S.A., 88: 6760, 1991; Koller, M. R.,
Bio/Technology, 11: 358, 1993; Koller, M. R., Blood, 82: 378, 1993;
Palsson, B. O., Bio/Technology, 11: 368, 1993).
[0101] The stromal cells in which DNAs encoding the polypeptide of
the present invention can be obtained as described with respect to
the expression of the DNAs.
[0102] The co-culture of the stromal cells and the hematopoietic
cells can be performed simply after the collection of the bone
marrow cells without further separation. Furthermore, co-culture
can be performed by separating components such as stromal cells,
hematopoietic cells and other cell populations from collected bone
marrow and combining them with the hematopoietic cells and stromal
cells which are not from the individual from which the bone marrow
is collected. Furthermore, after stromal cells are cultured to grow
to the stromal cells, hematopoietic cells can be added to perform
co-culture with the hematopoietic stem cells. At this time, cell
stimulating factors can added to the culture system of stromal
cells to more effectively support proliferation and survival.
Concrete examples of the cell stimulating factor include a growth
factor which is typically a cytokine such as SCF (stem cell
factor), IL-3 (interleukin 3), GM-CSF (granulocyte/macrophage
colony-stimulating factor), IL-6 (interleukin 6), TPO
(thrombopoietin), G-CSF (granulocyte colony-stimulating factor),
TGF-b (transforming growth factor-b), MIP-1.alpha. (Davatelis, G.,
J. Exp. Med. 167: 1939, 1988); a differentiation and proliferation
control factor such as hematopoietic hormones such as EPO
(erythropoietin), chemokine, Wnt gene product, and notch ligand;
and a development control factor.
[0103] In addition, when the polypeptide of the present invention
affects hematopoietic stem cells or hematopoietic progenitor cells
to show an activity to support survival or proliferation thereof,
in other words, the polypeptide has an activity to support survival
or proliferation of hematopoietic stem cells or hematopoietic
progenitor cells if the hematopoietic stem cells or the
hematopoietic progenitor cells are cultured in the presence of the
polypeptide, the proliferation and the survival of the
hematopoietic stem cells or the hematopoietic progenitor cells can
be retained by allowing the recombinant polypeptide of the present
invention alone or in combination with the cell stimulating factors
to affect hematopoietic stem cells or hematopoietic progenitor
cells, without stromal cells. Examples of the cell stimulating
factors used in this case are above described cell stimulating
factors and the like.
[0104] Medium used for the culture is not specially restricted as
long as the proliferation or the survival of the hematopoietic stem
cells or the hematopoietic progenitor cells is not harmed.
Preferable media are, for example, MEM-.alpha. medium (GIBCO BRL),
SF-02 medium (Sanko Junyaku), Opti-MEM medium (GIBCO BRL), IMDM
medium (GIBCO BRL), and PRMI1640 medium (GIBCO BRL). A culture
temperature is usually ranging from 25 to 39.degree. C., and
preferably ranging from 33 to 39.degree. C. Examples of additives
to the medium are fetal bovine serum, human serum, horse serum,
insulin, transferrin, lactoferrin, ethanolamine, sodium selenite,
monothiolglycerol, 2-mercaptoethanol, bovine serum albumin, sodium
pyruvate, polyethylene glycol, a variety of vitamins, and a variety
of amino acids. A concentration of CO.sub.2 is usually ranging from
four to six percent, and preferably five percent.
[0105] Since the hematopoietic stem cells can differentiate into
all the hematopoietic cell lineages, the hematopoietic stem cells
can be amplified and differentiated into a specific cell type in
vitro, and then the specific cells can be transplanted. For
example, when erythrocytes are necessary, after the cultivation of
the patient's stem cells to amplify them, the hematopoietic cells
whose main component is the erythrocyte can be artificially
produced using an erythrocyte differentiation induction-promoting
factor such as EPO.
[0106] The hematopoietic stem cells or the hematopoietic progenitor
cells cultured using the polypeptides of the present invention can
be used as a graft for blood cell transplantation replacing the
conventional bone marrow transplantation or cord blood
transplantation. Transplantation of the hematopoietic stem cells is
superior to the conventional blood cell transplantation therapy,
since the engraftment can last semipermanently.
[0107] The transplantation of the hematopoietic stem cells can be
employed as therapy for a variety of diseases in addition to
combination therapy with total body X-ray irradiation therapy or
advanced chemotherapy for leukemia. For example, when therapy
accompanied with myelosuppression as an adverse reaction, such as
chemotherapy, radiation therapy, and the like is performed for the
patient with solid cancer, the patient can get benefit of early
recovery and stronger chemotherapy than the conventional one can be
performed to improve the therapeutic effect of the chemotherapy by
collecting the bone marrow before the therapy, allowing the
hematopoietic stem cells or the hematopoietic progenitor cells to
be amplified in vitro and returning the amplified cells to the
patient after the therapy. In addition, by allowing the
hematopoietic stem cells or the hematopoietic progenitor cells
obtained according to the present invention to be differentiated
into a variety of hematopoietic cells and transplanting these cells
into a patient with hypoplasia of a given hematopoietic cells, the
patient's deficient status can be improved. In addition, this
therapy can improve dyshemopoietic anemia to develop anemia such as
aplastic anemia caused by bone marrow hypoplasia. Furthermore,
examples of diseases in which the transplantation of the
hematopoietic stem cells according to the present invention is
effective include immunodeficiency syndrome such as chronic
granulomatous disease, duplicated immunodeficiency syndrome,
agammaglobulinemia, Wiskott-Aldrich syndrome, acquired
immunodeficiency syndrome (AIDS), and the like, thalassemia,
hemolytic anemia due to an enzyme defect, congenital anemia such as
sicklemia, Gaucher's disease, lysosomal storage disease such as
mucopolysaccharidosis, adrenoleukodegeneracy, a variety of cancers
and tumors, and the like.
[0108] Transplantation of the hematopoietic stem cells may be
performed in the same manner as the conventional bone marrow
transplantation or cord blood transplantation other than the
differences of the cells used.
[0109] The source of the hematopoietic stem cells which may be used
for the above described hematopoietic stem cell transplantation is
not restricted to the bone marrow, and the above described fetal
liver, the fetal bone marrow, the peripheral blood, the peripheral
blood with stem cells mobilized by administration of cytokines
and/or antitumor drugs, the cord blood, and the like may be
used.
[0110] The graft may be a composition including buffer solution and
the like in addition to the hematopoietic stem cells and the
hematopoietic progenitor cells produced by the method according to
the present invention.
[0111] The hematopoietic stem cells or the hematopoietic progenitor
cells produced according to the present invention may be used for
ex vivo gene therapy. Because of the low frequency of recombination
of target genes to the chromosome because the stem cells are in the
resting state, differentiation of the stem cells during the culture
period, and the like, the gene therapy to the hematopoietic stem
cells has been hard to be established. However, the present
invention can amplify the stem cells without differentiation, so
that efficacy of gene transfer is expected to be remarkably
improved. In this gene therapy, a foreign gene (a gene for therapy)
is transferred into the hematopoietic stem cells or the
hematopoietic progenitor cells, and then the obtained
gene-transferred cells are used. The foreign gene to be transferred
is appropriately selected according to disease. Examples of
diseases in which the target cells of the gene therapy are the
hematopoietic cells include immunodeficiency syndrome such as
chronic granulomatous disease, duplicated immunodeficiency
syndrome, agammaglobulinemia, Wiskott-Aldrich syndrome, acquired
immunodeficiency syndrome (AIDS), and the like, thalassemia,
hemolytic anemia due to an enzyme defect, congenital anemia such as
sicklemia, Gaucher's disease, lysosomal storage disease such as
mucopolysaccharidosis, adrenoleukodegeneracy, a variety of cancers
and tumors, and the like.
[0112] A usual method used for transfer of a gene into animal cells
is employed for the transfer of the gene for the therapy into the
hematopoietic stem cells or the hematopoietic progenitor cells.
Examples include a method using a vector for animal cells derived
from virus utilized for a gene therapy such as retrovirus vectors
such as Moloney mouse leukemia virus, adenovirus vectors,
adeno-associated virus (AAV) vectors, herpes simplex virus vectors,
and HIV vectors (with respect to a vector for gene therapy, see
Verma, I. M., Nature, 389: 239, 1997); calcium phosphate
transfection, DEAE-dextran transfection, electroporation, the
liposome method, the lipofection method, the microinjection method,
and the like. Among them, the method using the retrovirus vector,
the adeno-associated virus vector, or the HIV vector is preferable,
since permanent expression of a gene is expected due to insertion
into the chromosome DNA of a target cell.
[0113] For example, the adeno-associated virus (AAV) vector can be
prepared as follows. First, a vector plasmid in which a gene for
therapy is inserted into ITR (inverted terminal repeat) at both
ends of wild-type adeno-associated virus DNA and a helper plasmid
for supplementing virus proteins are transfected into 293 cell
line. Next, adenovirus as helper virus is infected, so that virus
particles including the AAV vector are produced. Alternatively,
instead of adenovirus, a plasmid which expresses adenovirus gene
having helper function may be transfected. The hematopoietic stem
cells or the hematopoietic progenitor cells are infected with the
obtained virus particles. Preferably, appropriate promoter,
enhancer, insulator and the like are inserted into the upstream
region of the target gene in the vector DNA, so that the expression
of the gene is regulated. When a marker gene such as a drug
resistant gene is used in addition to the gene for therapy, cells
into which the gene for therapy are transferred are easily
selected. The gene for therapy may be a sense gene or an antisense
gene.
[0114] A composition for gene therapy may include a buffer solution
and a novel active ingredient and the like in addition to the
hematopoietic stem cells or the hematopoietic progenitor cells by
the method according to the present invention.
[0115] A vector for gene therapy can be produced by incorporating
the DNA of the present invention in an expression vector using a
usual method. This vector for gene therapy is useful to treat
diseases which need survival and proliferation of the human
hematopoietic stem cells. That is, the vector for gene therapy is
transferred into the hematopoietic stem cells and the cells are
cultured in vitro, so that the hematopoietic stem cells or the
hematopoietic progenitor cells can proliferate dominatingly. The
proliferation of hematopoietic stem cells in vivo can be caused by
returning these hematopoietic stem cells thus treated. The
proliferation of hematopoietic stem cells in vivo can significantly
promoted by introducing this vector for gene therapy into the body.
Alternatively, the bone marrow cells derived from a patient are
cultured as it is and this vector for gene therapy is transferred
thereto, so that the hematopoietic stem cells or the hematopoietic
progenitor cells can be proliferated in a culture system.
Alternatively, this vector for gene therapy is transferred into the
stromal cells and mesenchaymal stem cells obtained by isolating and
culturing stromal cells from the bone marrow, so that the activity
to support the hematopoietic stem cells can be added or
increased.
[0116] As shown in Examples, since it is possible that by
introducing the DNA of the present invention into the stromal cells
without the activity to support the hematopoietic stem cells, this
activity can be imparted, stromal cells having the activity to
support the hematopoietic stem cells can be prepared by gene
transfer to stromal cells derived from human or mouse. The stromal
cells expressing the DNA of the present invention and the
hematopoietic stem cells or the hematopoietic progenitor cells are
co-cultured, so that the hematopoietic stem cells or the
hematopoietic progenitor cells can survive and proliferate so as to
be useful for a variety treatment.
[0117] Since the hematopoietic stem cells or the hematopoietic
progenitor cells can survive and proliferate by expression of the
DNA of the present invention in the stromal cell, an activity to
support the hematopoietic stem cells of the stromal cells can be
determined using the expression of the DNA of the present invention
as an index. The expression of the DNA of the present invention in
the stromal cells can be confirmed using an antibody against a
polypeptide encoded by the DNA of the present invention. Also, PCR
primers can be prepared based on nucleotide sequences, and RNA is
prepared from the stromal cells of interest, and RT-PCR is
performed, so that the expression of the DNA of the present
invention can be confirmed. The antibody will be described
below.
[0118] The pharmaceutical composition of the present invention can
be administered to human. The pharmaceutical composition having an
activity to proliferate or to support the human hematopoietic stem
cells or the hematopoietic progenitor cells can be produced by
mixing medically acceptable diluent, stabilizer, carrier, and/or
other additives with the polypeptides of the present invention. At
this time, in order to increase the stability of the protein in
vivo, the polypeptides of the present invention may be modified by
a modifying agent. Examples of the modifying agent include
polyethylene glycol (PEG), dextran, poly(N-vinyl-pyrrolidone),
polypropylene glycol homopolymer, polypropylene oxide/ethylene
oxide copolymer, polyoxyethylated polyol, polyvinyl alcohol, and
the like. The modification of the protein with PEG can be performed
by, for example, a method in which activated ester derivatives of
PEG is reacted with the protein, a method in which aldehyde
derivatives at the terminal portion of PEG is reacted with the
protein in the presence of a reducing agent, and the like. Japanese
Patent Application Laid-Open No. 10-510980 discloses such protein
modification in detail.
[0119] When the pharmaceutical composition of the present invention
is administered to human, recovery from hematological suppression
due to an adverse drug reaction of carcinostatics; early recovery
of hematopoietic cells at bone marrow transplantation, peripheral
blood stem cell transplantation, or cord blood transplantation; and
recovery of hematopoietic function at pancytopenia such as aplastic
anemia (AA) and myelodysplastic syndrome (MDS) are expected.
[0120] The antibodies of the present invention react specifically
to the above described polypeptides of the present invention. The
antibodies of the present invention may be monoclonal antibodies or
polyclonal antibodies as long as they react specifically to the
above described polypeptides.
[0121] The antibodies of the present invention can be prepared
according to usual methods. For example, the antibodies can be
prepared either in vivo method in which animals are additionally
immunized by an antigen together with adjuvant once or several
times at an interval of several weeks or in vitro method in which
immune cells are isolated and sensitized in an appropriate culture
system. Examples of immune cells which can produce the antibodies
of the present invention include splenic cells, tonsillar cells,
lymph gland cells, and the like.
[0122] The whole polypeptide according to the present invention is
not necessarily used as an antigen. A part of this polypeptide may
be used as an antigen. When the antigen is a short peptide,
particularly, a peptide made of about 20 amino acid residues, it
may be used by binding it to a carrier protein having high
antigenicity such as keyhole lympet hemocyanin or bovine serum
albumin using chemical modification and the like. Alternatively,
the antigen may be used by covalently binding it to peptide having
branching skeleton such as lysine core MAP peptide instead of the
carrier protein (Posnett et al., J. Biol. Chem., 263, 1719-1725,
1988; Lu et al., Mol. Immunol., 28, 623-630, 1991; Briand et al.,
J. Immunol. Methods, 156, 255-265, 1992).
[0123] Examples of adjuvant include Freund's complete adjuvant,
Freund's incomplete adjuvant, aluminum hydroxide gel, and the like.
Antigen-given animals are, for example, mouse, rat, rabbit, sheep,
goat, chicken, bovine, horse, guinea pig, hamster, and the like.
The blood is collected from these animals and the serum is
separated. Then, immunoglobulin is purified from the serum using an
ammonium sulfate precipitation method, anion exchange
chromatography, protein A chromatography, or protein G
chromatography to obtain polyclonal antibodies.
[0124] With respect to chicken, antibodies can be purified from an
egg. Monoclonal antibodies can be prepared by purification from
supernatant of culture of hybridoma cells which are made by fusion
of the immune cells sensitized in vitro, or immune cells from the
above described animals with parent cells capable of cultivation,
or ascites from animals which received intraperitoneal
administration of hybridoma cells. Examples of parent cells include
X63, NS-1, P3U1, X63.653, SP2%, Y3, SKO-007, GM1500, UC729-6,
HM2.0, NP4-1 cell lines, and the like. Preparation may be performed
by cultivating the immortalized antibody-forming cells obtained by
sensitization in vitro, or infection of a proper virus such as EB
virus to the immune cells of the above described animals.
[0125] In addition to these cell engineering methods, the
antibodies can be obtained using gene engineering methods. For
example, the antibody gene obtained from the in vitro sensitized
cells or immune cells derived from the above described animals is
amplified by PCR (polymerase chain reaction) and isolated, and the
amplified genes are transferred into microorganisms such as E. coli
to produce the antibodies. Alternatively, the antibodies may be
expressed on surfaces of phages as fused proteins.
[0126] By measuring polypeptides in vivo using the antibodies of
the present invention, the relationship between the polypeptides
and pathological status of a variety of diseases can be clarified.
Moreover, the antibodies can be used for diagnosis and treatment of
diseases, and efficient affinity purification of the
polypeptides.
[0127] The present invention provides polypeptides having an
activity to support survival or proliferation of hematopoietic stem
cells or hematopoietic progenitor cells by effecting thereon, or an
activity to impart an activity to support the hematopoietic stem
cells to stromal cells by effecting thereon, and also provides DNAs
encoding thereof. The polypeptides of the present invention can
efficiently maintain the proliferation or the survival of the
hematopoietic stem cells or the hematopoietic progenitor cells.
EXAMPLES
[0128] Hereafter, the present invention will be described in detail
by reference to examples.
Example 1
Preparation of Fragment of Gene which is Specifically Expressed in
Hematopoietic Stem Cell-Supporting Cells
[0129] (I) Preparation of Stromal Cell Line Derived from Mouse AGM
(1) Isolation of AGM Region from Fetal Mouse
[0130] C3H/HeNSLc mice of both genders (purchased from Japan SLC
INC.) were kept under a SPF (specific pathogen-free) environment.
One or two female mice and one male mouse were placed in the same
cage over a night. In the next morning, the female mice in which
the existence of a vaginal plug was observed were transferred to
other cages and kept. The day when the existence of the vaginal
plug was observed was defined to be the 0.5th day of pregnancy. On
the 10.5th day of the pregnancy, after mouse was sacrificed by
cervical dislocation, fetuses were extirpated. Isolation of AGM
regions was performed according to the method by Godin et al.
(Godin, I., Proc. Natl. Acad. Sci. U.S.A., 92: 773-777, 1995) and
the method by Medvinsky et al. (Medvinsky, A. L., Blood, 87:
557-565, 1996). The fetuses were placed in a culture dishes to
which PBS(-) (phosphate buffered saline) (produced by Nissui
Seiyaku) was added in a volume just sufficient to cover the
fetuses. After the AGM regions were carefully excised so as not to
include other regions under a stereoscopic microscope, they were
put in another 24-well culture dish (Nunc).
(2) Establishment of Cell Lines Derived from AGM
[0131] One drop of MEM medium (Sigma) containing 10% FCS (Hyclone)
was added to the AGM regions in the 24-well culture dish (Nunc),
and AGM regions were cultured in an incubator overnight. The
culture was performed in the MEM medium (Sigma) containing 10% FCS
(Hyclone) at 37.degree. C., in an atmosphere of 5% CO.sub.2, and at
a humidity of 100%. When the cells of the AGM regions adhered to
the culture dish due to overnight cultivation, two milliliters of
MEM medium containing 10% FCS was further added. Stromal cells
began to appear around the AGM region tissue fragment after the
continuous cultivation. After one-week cultivation, adhesive cells
were separated by trypsin treatment (0.05% trypsin in PBS
containing 0.53 mM EDTA (Gibco BRL) at 37.degree. C. for three to
five minutes). The stromal cells were then washed twice with the
medium, and seeded on 6-well culture dish (Nunc). On the next day,
the cells which did not adhere to the culture dish and the medium
were removed, and then, fresh medium was added. Two weeks after
transfer to the 6-well culture dish, cells were
.gamma.-ray-irradiated at 900 Rad to eliminate endogenous
hematopoietic cells. An attempt of the direct cell cloning by
limiting dilution from this culture system was made, but no cell
proliferation was observed and the cloning ended in failure. Then,
after the number of seeded cells in one well was increased and
cells were adapted so as to be able to proliferate from a small
number of cells, the cells were cloned by limiting dilution.
[0132] Specifically, the AGM was extirpated and cultured in the
same manner as described above. The culture system two weeks after
the .gamma.-ray radiation was trypsinized (0.05% trypsin in PBS
containing 0.53 mM EDTA at 37.degree. C. for three to five minutes)
to suspend the cells, and the cells were seeded in a 24-well
culture dish at 50 to 100 cells/well. After the culture was
continued for three weeks, the cells were seeded in a 96-well
culture dish (Nunc) by means of limiting dilution, at 0.3
cells/well. The cells which were grown from the well in which only
one cell was seeded were allowed to enlarge culture. As a result,
the cells were successfully cloned to obtain fibroblast-like cells
and cobble stone-like cells.
[0133] A CD34-positive cell fraction derived from the human cord
blood was co-cultured with the fibroblast-like cells for two weeks
to examine the presence of colony-forming cells during the culture.
Colony-forming cells could not be found in the co-culture system
with the fibroblast-like cells. Then, the similar examination was
performed for seven cell clones showing the cobble-stone-like form.
Three clones having an activity to support proliferation of human
hematopoietic stem cells were obtained and were named AGM-s1,
AGM-s2, and AGM-s3.
(II) Preparation of Hematopoietic Stem Cells from Mouse Bone
Marrow
[0134] Bone marrow was collected from a femur of C57BL/6-Ly5.1 pep
(eight- to ten-week age, and male) (the gift from Professor K.
Nakauchi, University of Tsukuba), and suspended in PBS. After the
mouse bone marrow mononuclear cells were concentrated by specific
gravity centrifugation according to the usual method (S. Kouzu,
Fundamental techniques for immunology, YODOSHA, 1995), the cells
were suspended in staining buffer (PBS containing 5% FCS and 0.05%
NaN.sub.3), and a hematopoietic stem cell fraction was obtained as
follows (Osawa, M. et al., Science 273: 242-245, 1996).
[0135] An FITC-conjugated anti-CD34 antibody, a
phycoerythrin-conjugated anti-Sca-1 antibody, an allophycocyanin
anti-c-Kit antibody (all purchased from Pharmingen) and six
biotylated anti-differentiation antigen antibodies (CD45R, CD4,
CD8, Gr-1, Ter119, and CD11c, all purchased from Pharmingen) as
molecular markers (Lin), were added to a suspension of the bone
marrow mononuclear cells and incubated for 20 min on ice to cause
reaction. After the cells were washed twice with staining buffer,
CD34-negative, Sca-1-positive, c-Kit-positive, and Lin-negative
cells were isolated on a cell sorter (FACS Vantage, Becton
Dickinson).
(III) Subcloning of Mouse Stromal Cell Line and Determination of
Activity to Support Hematopoietic Stem Cells of a Variety of Cell
Lines
(1) Subcloning of Mouse Stromal Cell Line
1) Isolation of AGM-s3 Subclone
[0136] Stromal cell line AGM-s3 derived from AGM, which was
subcultured in MEMA medium (GIBCO BRL) including inactivated 10%
FCS (bovine fetal serum, Hyclone), was suspended in PBS containing
5% FCS (PBS-FCS). Clone sorting was performed in a 96-well culture
dish (Falcon) at one cell/well using a cell sorter (FACS Vantage;
Becton Dickinson). Among cells in the 96 wells, cultures of the
cells which grew were expanded, so that thirteen kinds of AGM-s3
subclones were obtained. The activity to support the hematopoietic
cells of these AGM-s3 subclones were examined.
2) Isolation of Human Cord Blood CD34-Positive Stem Cell
[0137] The human cord blood was collected at normal delivery
according to the criteria approved by Ethics committee of Kirin
Beer Iyaku Tansaku Kenkyusho. The cord blood was collected using a
heparin-added syringe so as not to coagulate. The heparin treated
cord blood was overlaid on Lymphoprep (NYCOMED PHARMA), and
mononuclear cells were separated by specific gravity centrifugation
(at 400G, at room temperature, and for 30 minutes). Erythrocytes
contaminated in the mononuclear cell fraction were lyzed by
treatment with an ammonium chloride buffer solution (0.83%
NH.sub.4Cl-Tris HCl, 20 mM, pH 6.8) at room temperature for two
minutes. After the mononuclear cells were washed with PBS-FCS, ten
milligrams of human IgG was added thereto and the mixture was
allowed to stand on ice for ten minutes. Then, the cells were
further washed with PBS-FCS. Biotinylated antibodies against the
antigens specific to the human differentiated blood cells, that is,
the antibodies against CD2, CD11c (purified from ATCC hybridoma),
CD19 (Pharmingen), CD15, and CD41 (Leinco Technologies Inc.), and
Glycophorin A (Cosmo Bio) were added thereto, and the mixture was
allowed to stand on ice for 20 min. After washing with PBS-FCS, the
cells were suspended in one milliliter of PBS containing 5% FCS, 10
mM EDTA, and 0.05% NaN.sub.3 (PBS-FCS-EDTA-NaN.sub.3).
Streptavidin-bound magnetic beads (BioMag. Per Septive Diagnostics)
were added thereto, and the mixture was allowed to stand on ice for
40 min. The differentiated blood cells which expressed
differentiation antigens were removed using a magnetic separator
(Dynal MPC-1 Dynal). An FITC-labeled anti-CD34 antibody (Immunotech
S.A., Marseilles, France) was added to the remaining differentiated
blood cell antigen-negative cell fraction. After incubation on ice
for 20 min., a CD34-positive fraction was recovered using a cell
sorter. This cell population was defined as a hematopoietic stem
cell population derived from the human cord blood.
3) Co-Culture of the Human Hematopoietic Stem Cells and AGM-s3
Subclone
[0138] After 13 kinds of AGM-s3 subclones and stromal cell line
MS-5 derived from the mouse bone marrow were each seeded in a
24-well culture dish (Falcon) at 1.times.10.sup.4 cells/well, and
cells were cultured in one milliliter of MEM.alpha. medium
containing 10% FCS and allowed to grow until the cells covered all
over the bottom surfaces of the wells. CD34-positive hematopoietic
stem cells derived from the human cord blood were placed on the
above described stromal cells at 500 cells/well, and co-cultured in
one milliliter of MEM.alpha. medium containing 10% FCS. One week
after the start of the co-culture, one milliliter of the same
medium was further added. Two weeks after the start of the
co-culture, the stromal cells and the human blood cells were
trypsinized (0.05% trypsin in PBS containing 0.5 mM EDTA (GIBCO
BRL) at 37.degree. C.; standing for two to five min.) to
simultaneously separate them from the culture dish. An activity to
support the hematopoietic stem cells was determined with a
clonogenic assay.
4) Assessment of Proliferation Statuses of the Hematopoietic Stem
Cells and Hematopoietic Progenitor Cells by Clonogenic Assay
[0139] The cells which proliferated in the above described
co-culture system were appropriately diluted, and subjected to one
milliliter of methylcellulose culture system to be analyzed. The
analysis using the methylcellulose culture system was performed
using a 6-well culture dish (Falcon) in MethoCult H4230 (Stem Cell
Technologies Inc.) to which 10 ng/ml of human SCF, human IL-3,
human IL-6, human G-CSF, and human TPO, and 2 IU/ml of EPO were
added. All of a variety of the above described hematopoietic
factors were recombinants and pure. After two-week culture,
developed colonies were observed under a microscope to count
numbers of CFU-GM (granulocyte-macrophage colony-forming unit),
BFU-E (erythroid burst forming unit), and CFU-E mix (erythrocyte
mixed colony-forming unit).
[0140] FIG. 1 shows the result of two-week co-culture of the
CD34-positive hematopoietic stem cells and the AGM-s3 subclone A9,
A7, or D11. As a result of the co-culture, A9 and D11 subclones
among 13 kinds of AGM-s3 subclones supported proliferation of all
three series of CFU-GM, BFU-E, and CFU-E mix. Especially, although
BFU-E and CFU-E mix, that is, the progenitor cells of erythrocytes
were hardly to be supported in usual, their proliferations were
observed in the co-culture system with A9 or D11 cells. The results
showed that proliferation or maintenance of the hematopoietic stem
cells or the hematopoietic progenitor cells occurred in the
co-culture with A9 or D11 cells and the progenitor cells of the
erythrocyte were continuously supplied. In contrast, although
cellular morphology of A7 was similar to that of A9, A7 did not
support CFU-GM, BFU-E, and CFU-E mix.
5) Comparison of an Activity to Support The Human Hematopoietic
Stem Cells Between A9 and a Stromal Cell Line OP9 Derived from
Mouse Fetus
[0141] Comparison of an activity to support the CD34-positive
hematopoietic stem cells derived from the human cord blood between
AGM-s3 subclones A9 and A7, and a stromal cell line OP9 derived
from mouse fetus (RCB1124, the Cell Development Bank of RIKEN) were
performed with CFU-GM, BFU-E, CFU-E and CFU-E mix as indexes, using
the above described determination system. FIG. 2 shows the result
of the two-week co-culture. In the A7 cell culture system, CFU-GM,
BFU-E, and CFU-E were significantly decreased and CFU-E mix was
completely disappeared. In contrast, with OP9 cells, a variety of
blood cell progenitor cells including CFU-E mix were supported,
although the supporting ability was less than that of A9 cells.
Therefore, it has been found that OP9 cells possess the activity to
support the hematopoietic stem cells.
(2) Assessment of Activity to Support the Hematopoietic Stem Cells
in a Variety of Cell Lines
[0142] The above described stromal cell lines (AGM-s3-A9,
AGM-s3-A7, and AGM-s3-G1), 3T3Swiss (ATCC), OP9, and NIH3T3 (ATCC)
were seeded in a 24-well culture dish (Falcon) at 5.times.10.sup.4
cells/well. The cell lines were cultured in MEM.alpha. medium
(GIBCO BRL) containing inactivated 10% FCS (bovine fetal serum,
Hyclone) for one day and allowed to proliferate until the cells
covered all over the bottom surfaces of the wells. Then, the medium
was replaced to one milliliter of fresh medium, thirty cells of the
mouse hematopoietic stem cells (derived from C57BL/6-Ly5.1)
obtained in the above (II) were placed on this cell layer, and
co-culture was started.
[0143] On seventh day of the cultivation, the cells were
trypsinized (0.05% trypsin in PBS containing 0.5 mM EDTA (GIBCO
BRL) at 37.degree. C. for two to five minutes) to separate and
recover all the cells on the culture dish. The recovered whole
cells of each cell line and 200,000 cells of whole bone marrow
cells (derived from C57BL/6-Ly5.2 mouse, Charles River) were
transplanted into C57BL/6-Ly5.2 mice (eight weeks age and male,
Charles River) irradiated with X-ray at 8.5 Gy through the tail
vein. After the transplantation, peripheral blood was collected
from orbit at intervals, and the ratio in number of cells derived
from the C57BL/6-Ly5.1 prep mouse was determined with FACS. The
peripheral blood was analyzed according to the usual method (S.
Kouzu, Fundamental techniques for immunology, YODOSHA, 1995). Three
hundreds and fifty .mu.L of distilled water was added to 50 .mu.L
of the peripheral blood, and the mixture was allowed to stand for
30 seconds so as to lyze the erythrocytes. Then, PBS at twice
concentrations was added and the mixture was centrifuged to recover
white blood cells. After the cells were washed once using the
staining buffer (PBS containing 5% FCS and 0.05% NaN.sub.3),
anti-CD16 antibody, anti-Ly5.1 (CD45.1) antibody labeled with FITC,
anti-Gr-1 and anti-CD11c antibodies labeled with phycoerythrin, and
anti-CD45R (B220) and anti-CD90 (Thy1) antibodies labeled with
allophycocyanin (all of these were purchased from Pharmingen) were
added. After these cells were allowed to stand for reaction in the
ice bath for 30 minuets, they were washed with the staining buffer
and FACS analysis was performed.
[0144] Change in the number of cells capable of reconstitution
during the hematopoietic stem cell culture was determined by
calculating the proportions of Ly5.1-positive cells in the Gr-1- or
CD11c-positive cells (myeloid cells) and Ly5.1-positive cells in
the CD90- or CD45R-positive cells (lymphoid cells) in the
peripheral blood at intervals after transplantation.
[0145] FIG. 3 shows the results. When the cells were co-cultured
with AGM-s3-A9 cells, OP9 cells, or 3T3Swiss cells, high chimerism
of donor cells were maintained after the transplantation.
Therefore, these stromal cells were considered to have a high
activity to support the hematopoietic stem cells. In contrast, when
the cells were co-cultured with AGM-s3-A7 cells, AGM-s3-G1 cells,
or NIH3T3 cells, high chimerism derived from the transplanted cells
was not observed. Therefore, these stromal cells were low in an
activity to support the hematopoietic stem cells or the
hematopoietic progenitor cells.
(IV) Identification of Sequences of Genes which Specifically
Express in Hematopoietic Stem Cell-Supporting Cells
[0146] AGM-s3-A9 cells, AGM-s3-A7 cells and OP9 cells were each
dissolved in 20 mL of ISOGEN (Nippon gene, Japan) and total RNAs
were prepared according to the attachment. Messenger RNAs were
prepared from one milligram of the total RNAs according to the
protocol of the mRNA purification kit (Amersham Pharmacia, U.S.A.).
cDNAs were synthesized from the mRNAs and cDNA libraries
(hereinafter, also called as AGM-s3-A9 cDNA, AGM-s3-A7 cDNA and OP9
cDNA, respectively) were constructed using pSPORT1 (GIBCO Lifetech,
U.S.A.). A clone harboring a cDNA fragment which highly expresses
specifically to AGM-s3-A9 cells or OP9 cells compared with
AGM-s3-A7 cells was obtained from the libraries with SBH method
(Hyseq, U.S.A.). A nucleotide sequence of the obtained clone was
determined using ABI377 DNA sequencer (Perkin Elmer, U.S.A.).
[0147] As a result, it has been found that expression of genes
comprising nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2,
SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID
NO:7, or parts thereof in AGM-s3-A9 or OP9 cells is higher than
that in AGM-s3-A7 cells. These genes were named as SCR-2, SCR-3,
SCR-4, SCR-5, SCR-6, SCR-7 and SCR-8, respectively.
Example 2
Cloning of SCR-2 and Activity Determination
[0148] By searching GenBank database for the nucleotide sequence
shown in SEQ ID NO: 1 with BLAST, it has been found that SCR-2 is
the same gene as a mouse gene, Mus musculus glypican-1 (GPC-1) of
an accession number AF185613. The nucleotide sequence of ORF (Open
Reading Frame) of SCR-2 and the amino acid sequence deduced from
the nucleotide sequence are shown in SEQ ID NO: 8. Only the amino
acid sequence is shown in SEQ ID NO: 9.
[0149] The human nucleotide sequence of GPC-1 is recorded in
GenBank database under an accession number AX020122. The nucleotide
sequence of ORF of AX020122 and the amino acid sequence deduced
from the nucleotide sequence are shown in SEQ ID NO: 10. Only the
amino acid sequence is shown in SEQ ID NO: 11.
[0150] Determination of the activity to support the hematopoietic
stem cells or hematopoietic progenitor cells was performed as
follows.
(1) Construction of Retrovirus Vector for Expression of Mouse
SCR-2
[0151] Based on the nucleotide sequence of SCR-2 ORF, SCR-2Fsal1
and SCR-2Reco primers having the following nucleotide sequences
were prepared, and PCR was performed using OP9 cDNA as a
template.
SCR-2Fsal
CCGGTCGACCACCatggaactccggacccgaggctgg (SEQ ID NO: 30)
SCR-2Reco
CCGAATTCttaccgccacctgggcctggctgc (SEQ ID NO: 31)
[0152] An amplified fragment was digested with restriction enzymes
EcoRI and SalI. After electrophoresis, a DNA fragment was purified
using JETSORB (Genomed, Germany). The purified DNA fragment was
ligated with pMX-IRES-GFP vector digested with EcoRI and XhoI (gift
form Professor T. Kitamura, TOKYO UNIV. INST. OF MEDICAL SCIENCE,
Japan). The pMX-IRES-GFP vector is a plasmid obtained by inserting
sequences encoding IRES (Internal Ribosome Entry Site) and GFP
(Green Fluorescence Protein) into the retrovirus vector pMX. IRES
enables ribosome to access to the middle of the mRNA. Therefore,
two genes can be expressed from one mRNA by ligation of upward and
downward genes separated by IRES in one transcription unit during
the construction of an expression vector. With respect to the
above-described plasmid, SCR-2 cDNA was inserted in the upward site
and GFP (Green Fluorescence Protein) was inserted in the downward
site. Thus, the expression of SCR-2 could be monitored by detecting
the expression status of GFP using FACS.
[0153] The obtained recombinant vector was introduced into E. coli
DH5.alpha., and was seeded on LB agar medium containing 100
.mu.g/ml of ampicillin, so that independent colonies were formed.
After the isolated colony was cultured in 100 mL of LB medium
containing 100 .mu.g/ml of ampicillin, plasmid was purified using
QIAGENtip100 (QIAGEN, U.S.A.). The sequence of the inserted gene
was determined using a conventional method, so that the sequence
was confirmed to be identical to the nucleotide sequence of SCR-2
ORF.
(2) Preparation of Stromal Cells Highly Expressing SCR-2
[0154] BOSC23 cells were seeded on a collagen type I-coated 60-mm
dish (Asahi technoglass) at 2.times.10.sup.6 cells/dish, and
cultured in DMEM medium (GIBCO BRL) containing 10% FCS at
37.degree. C., under an atmosphere of 5% CO.sub.2, and at a
humidity of 100%. Twelve to 18 hours after the start of the
culture, the medium was replaced by two milliliters of OPTI MEM
medium (GIBCO BRL).
[0155] About 3 .mu.g of plasmid obtained by inserting SCR-2 into
the above described pMX-IRES-GFP was added to 18 .mu.l of
LIPOFECTAMINE Reagent (GIBCO BRL) diluted with 100 .mu.l of OPTI
MEM medium, and the mixture was allowed to stand at room
temperature for 30 min. The prepared DNA solution was added to the
prepared BOSC23 cell culture solution. After about five hours, two
milliliters of DMEM medium containing 20% FCS (GIBCO BRL) was
added.
[0156] After about 24 hours, the medium was replaced by 4 ml of
DMEM containing 10% FCS. Further, after about 48 hours, the culture
medium was harvested. After the culture medium was filtrated
through 0.45-.mu.m filter, the filtrate was centrifuged at 1,200 g
for 16 hours and the supernatant was removed to obtain the virus
precipitation.
[0157] AGM-s3-A7 or AGM-s3-A9 cells were cultured in one milliliter
of MEM.alpha. medium containing 10% FCS (GIBCO BRL) on a 24-well
culture dish (FALCON) at 1.times.10.sup.4 cells/well. After 12 to
18 hours, the virus precipitation was suspended in one milliliter
of MEM.alpha. medium containing 10% FCS, and the stromal cell
culture medium was replaced by the virus suspension. Next,
POLYBRENE (Sigma, SEQUA-BRENE) was added to be 10 .mu.g/ml. After
the culture dish was centrifuged at 700 g for 45 minutes, the cells
were cultured at 37.degree. C., under an atmosphere of 5% CO.sub.2,
and at a humidity of 100%. After 48 hours, the medium was replaced
by one milliliter of MEMA medium containing 10% FCS. After 24
hours, the cells were subcultured on a 6-well culture dish (FALCON)
and cultured in three milliliters of MEM.alpha. medium containing
10% FCS. Forty-eight hours after the subculturing, GFP expression
in the stromal cells was detected using a cell sorter (FACSVantage,
Becton Dickinson) to indirectly confirm that not less than 80% of
cells expressed SCR-2.
[0158] Also, the same procedures were repeated by using
pMX-IRES-GFP vector instead of the plasmid obtained by inserting
SCR-2 into pMX-IRES-GFP to prepare stromal cells into which a
control vector was introduced.
(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells
Highly Expressing SCR-2, and Determination of Proliferation
Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor
Cells by Clonogenic Assay
[0159] In the same manner as described in (III) (1) 3) to 4) of
Example 1, AGM-s3-A9 or AGM-s3-A7 cells in which SCR-2 was highly
expressed through retrovirus, AGM-s3-A9 or AGM-s3-A7 cells into
which a control vector was introduced, or AGM-s3-A9 or AGM-s3-A7
cells were co-cultured with CD34-positive hematopoietic stem cells
derived from human cord blood, and proliferation statuses of
hematopoietic stem cells and hematopoietic progenitor cells are
determined.
[0160] FIG. 4 shows results when the CD34-positive hematopoietic
stem cells were co-cultured with AGM-S3-A9 cells in which SCR-2 was
highly expressed (A9/SCR-2), AGM-S3-A9 cells into which a control
vector was introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two
weeks. Also, FIG. 5 shows results when the CD34-positive
hematopoietic stem cells were co-cultured with AGM-S3-A7 cells in
which SCR-2 was highly expressed, AGM-S3-A7 cells into which a
control vector was introduced or AGM-S3-A7 cells for two weeks. As
a result, by the co-culture with AGM-S3-A9 cells in which SCR-2 was
highly expressed or AGM-S3-A7 cells in which SCR-2 was highly
expressed, increases of BFU-E and CFU-C were observed. Therefore,
it has been revealed that the activity to support hematopoietic
stem cells or hematopoietic progenitor cells, of AGM-S3-A9 or
AGM-S3-A7 increases by allowing SCR-2 to be highly expressed. From
the results, it has been revealed that a gene product of SCR-2 has
an activity to support survival or proliferation of hematopoietic
stem cells or hematopoietic progenitor cells or an activity to
affect stromal cells to enhance a hematopoietic cell-supporting
activity of the stromal cells or impart the activity to the stromal
cells.
Example 3
Cloning of SCR-3 and Activity Determination
[0161] By searching GenBank database for the nucleotide sequence
shown in SEQ ID NO: 2 with BLAST, it has been found that SCR-3 is
the same gene as mouse genes, Mus musculus chemokine MMRP2 mRNA of
an accession number U15209, Mus musculus C10-like chemokine mRNA of
U19482 and mouse macrophage inflammatory protein-1gamma mRNA of
U49513. The nucleotide sequence of SCR-3 ORF and the amino acid
sequence deduced from the nucleotide sequence are shown in SEQ ID
NO: 12. Only the amino acid sequence is shown in SEQ ID NO: 13.
[0162] Determination of the activity of SCR-3 to support the
hematopoietic stem cells or hematopoietic progenitor cells was
performed as follows.
(1) Construction of Retrovirus Vector for Expression of Mouse
SCR-3
[0163] Based on the nucleotide sequence of SCR-3 ORF, SCR-3FxhoI
and SCR-3Reco primers having the following nucleotide sequences
were prepared, and PCR was performed using AGM-s3-A9 cDNA as a
template. An amplified fragment was inserted to the retrovirus
vector pMX-IRES-GFP in the same manner as described in (1) of
Example 2.
TABLE-US-00001 SCR-3FxhoI (SEQ ID NO: 32)
ccgCTCGAGccaccATGAAGCCTTTTCATACTGCC SCR-3Reco (SEQ ID NO: 33)
tccGAATTCttattgtttgtaggtccgtgg
(2) Preparation of Stromal Cells Highly Expressing SCR-3
[0164] AGM-s3-A7 cells in which SCR-3 was highly expressed were
prepared by using the above retrovirus vector in the same manner as
(2) of Example 2.
(3) Determination of Activity to Support Hematopoietic Stem Cells
of Stromal Cells in which SCR-3 is Highly Expressed
[0165] In the same manner as described in (III) (2) of Example 1,
determination of the activity to support hematopoietic stem cells
was performed except that AGM-S3-A7 cells, AGM-S3-A7 cells in which
SCR-3 was highly expressed through retrovirus, and AGM-S3-A7 cells
into which a control vector was introduced were seeded in a 24-well
culture dish (Falcon) at 1.times.10.sup.5 cells/well.
[0166] The results are shown in FIG. 6. Hematopoietic cells
co-cultured with AGM-s3-A7 cells in which SCR-3 was highly
expressed (A7/SCR-3) showed high chimerism in recipient individuals
after the transplantation compared with the parent cell lines or
hematopoietic cells co-cultured with the cells into which a control
vector was introduced. The high chimerism was observed in myeloid
and lymphoid cells two months after the transplantation. Therefore,
it is revealed that hematopoietic stem cells and hematopoietic
progenitor cells which can reconstitute the hematopoietic system in
bodies of irradiated mice have maintained and amplified superiorly
to the co-culture with cells into which SCR-3 is not introduced,
during the co-culture period. From the results, it is revealed that
an activity of stromal cells to support survival or proliferation
of hematopoietic stem cells or hematopoietic progenitor cells is
increased by high expression of SCR-3. Therefore, it is revealed
that a gene product of SCR-3 has an activity to affect
hematopoietic stem cells or hematopoietic progenitor cells to
support survival or proliferation thereof or an activity to affect
stromal cells to enhance a hematopoietic cell-supporting activity
of the stromal cells or impart the activity to the stromal
cells.
Example 4
Cloning of SCR-4 and Activity Determination
[0167] By searching GenBank database for the nucleotide sequence
shown in SEQ ID NO: 3 with BLAST, it has been found that SCR-4 has
a high homology to Homo sapiens clone 25077 mRNA of an accession
number AF131820, and that SCR-4 is a mouse ortholog. This sequence
is described in WO 00/66784.
[0168] The nucleotide sequence of ORF of AF131820 and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 16. Only the amino acid sequence is shown in SEQ ID NO:
17.
[0169] The nucleotide sequence of ORF of SCR-4 and the amino acid
sequence deduced from the nucleotide sequence are shown in SEQ ID
NO: 14. Only the amino acid sequence is shown in SEQ ID NO: 15.
[0170] Determination of the activity of SCR-4 to support the
hematopoietic stem cells or hematopoietic progenitor cells was
performed as follows.
(1) Construction of Retrovirus Vector for Expression of Human
SCR-4
[0171] From 3 .mu.g of mRNA derived from fetal liver (CLONETEC,
U.S.A.), cDNA was synthesized by using oligo-dT primer and reverse
transcriptase (SuperscriptII, GIBCO-BRL). Using the cDNA as a
template, the ORF region of human SCR-4 was amplified by PCR with
HSCR-4FxhoI and HSCR-4RecoRV primers having the following
nucleotide sequences. An amplified fragment was digested with XhoI
and inserted to the retrovirus vector PMX-IRES-GFP in the same
manner as described in (1) of Example 2. For the insertion, the
pMX-IRES-GFP was digested with a restriction enzyme EcoRI,
blunt-ended with KOD DNA synthase (TOYOBO, Japan) and digested with
a restriction enzyme XhoI.
TABLE-US-00002 HSCR-4FxhoI (SEQ ID NO: 34)
CCGCTCGAGCCACCatgttggctgcaaggctggtgt HSCR-4RecoRV (SEQ ID NO: 35)
CCGGATATCtcatttctttctgttgcctcca
(2) Preparation of Stromal Cells Highly Expressing Human SCR-4
[0172] AGM-s3-A9 cells in which human SCR-4 was highly expressed
were prepared by using the above retrovirus vector in the same
manner as (2) of Example 2.
(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells
Highly Expressing Human SCR-4, and Determination of Proliferation
Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor
Cells by Clonogenic Assay
[0173] In the same manner as described in (III) (1) 3) to 4) of
Example 1, AGM-s3-A9 cells in which SCR-4 was highly expressed
through retrovirus, AGM-s3-A9 cells into which a control vector was
introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive
hematopoietic stem cells derived from human cord blood, and
proliferation statuses of hematopoietic stem cells and
hematopoietic progenitor cells are determined.
[0174] FIG. 6 shows results when the CD34-positive hematopoietic
stem cells were co-cultured with AGM-S3-A9 cells in which human
SCR-4 was highly expressed, AGM-S3-A9 cells into which a control
vector was introduced or AGM-S3-A9 cells for two weeks. As a
result, the co-culture with AGM-S3-A9 cells in which human SCR-4
was highly expressed, increases of BFU-E and CFU-C were observed.
Therefore, it has been revealed that the activity to support
hematopoietic stem cells or hematopoietic progenitor cells, of
AGM-S3-A9 increases by allowing human SCR-4 to be highly expressed.
From the results, it has been revealed that human SCR-4 has an
activity to support survival or proliferation of hematopoietic stem
cells or hematopoietic progenitor cells or an activity to affect
stromal cells to impart a hematopoietic cell-supporting activity to
the stromal cells.
Example 5
Cloning of SCR-5 and Activity Determination
[0175] In the nucleotide sequence of SEQ ID NO: 4 obtained by the
SBH analysis, the presence of ORF was predicted. The nucleotide
sequence of ORF and the amino acid sequence deduced from the
nucleotide sequence are shown in SEQ ID NO: 18. Only the amino acid
sequence is shown in SEQ ID NO: 19.
[0176] By searching GenBank database for the nucleotide sequence of
SEQ ID NO: 18 with BLAST, it has been found that SCR-5 has a high
homology with Homo sapiens esophageal cancer related gene 4 portein
(ECRG4) mRNA of an accession number AF325503, and that SCR-5 is a
mouse ortholog of AF325503. The nucleotide sequence of ORF of
AF325503 and the amino acid sequence deduced from the nucleotide
sequence are shown in SEQ ID NO: 20. Only the amino acid sequence
is shown in SEQ ID NO: 21.
[0177] Determination of the activity of SCR-5 to support the
hematopoietic stem cells or hematopoietic progenitor cells was
performed as follows.
(1) Construction of Retrovirus Vector for Expression of Mouse
SCR-5
[0178] Based on the nucleotide sequence of SCR-5 ORF, SCR-5FxhoI
and SCR-5Rblunt primers having the following nucleotide sequences
were prepared for retrovirus cloning, and PCR was performed using
DNA having the nucleotide sequence shown in SEQ ID NO: 23 as a
template. An amplified fragment was digested with a restriction
enzyme XhoI and inserted to the retrovirus vector pMX-IRES-GFP in
the same manner as described in (1) of Example 2. For the
insertion, the pMX-IRES-GFP was digested with a restriction enzyme
EcoRI, blunt-ended with KOD DNA synthase (TOYOBO, Japan) and
digested with a restriction enzyme XhoI.
TABLE-US-00003 SCR-5FxhoI ccgCTCGAGccaccatgagcacctcgtctgcgcg (SEQ
ID NO: 36) SCR-5Rblunt tccGTTAACttaatagtcatcatagttca (SEQ ID NO:
37)
(2) Preparation of Stromal Cells Highly Expressing SCR-5
[0179] AGM-s3-A7 cells in which SCR-5 was highly expressed were
prepared by using the above retrovirus vector in the same manner as
(2) of Example 2.
(3) Determination of Activity to Support Hematopoietic Stem Cells
of Stromal Cells in which SCR-5 is Highly Expressed
[0180] In the same manner as described in (3) of Example 3,
determination of the activity to support hematopoietic stem cells
was performed.
[0181] The results are shown in FIG. 8. Hematopoietic cells
co-cultured with AGM-s3-A7 cells in which SCR-5 was highly
expressed (A7/SCR-5) showed high chimerism in recipient individuals
after the transplantation compared with the parent cell lines or
hematopoietic cells co-cultured with the cells into which a control
vector was introduced. The high chimerism was observed in myeloid
and lymphoid cells two months after the transplantation. Therefore,
it is revealed that hematopoietic stem cells and hematopoietic
progenitor cells which can reconstitute the hematopoietic system in
bodies of irradiated mice have maintained and amplified superiorly
to the co-culture with cells into which SCR-5 is not introduced,
during the co-culture period. From the results, it is revealed that
an activity of stromal cells to support survival or proliferation
of hematopoietic stem cells or hematopoietic progenitor cells is
increased by high expression of SCR-5. Therefore, it is revealed
that a gene product of SCR-5 has an activity to affect
hematopoietic stem cells or hematopoietic progenitor cells to
support survival or proliferation thereof or an activity to affect
stromal cells to enhance a hematopoietic cell-supporting activity
of the stromal cells or impart the activity to the stromal
cells.
Example 6
Cloning of SCR-6 and Activity Determination
[0182] Based on the nucleotide sequence of SEQ ID NO: 5, a probe
was prepared and AGM-s3-A9 cDNA was screened by hybridization to
obtain a gene containing ORF of mouse SCR-6.
[0183] AGM-s3-A9 cells (1.4.times.10.sup.8 cells) were dissolved in
20 mL of ISOGEN (Nippon gene, Japan) and total RNAs were prepared
according to the attachment. Messenger RNAs were prepared from one
milligram of the total RNAs according to the protocol of the mRNA
purification kit (Amersham Pharmacia, U.S.A.). By using SMART cDNA
library construction kit (CLONTECH, U.S.A.), cDNA libraries devided
to 15 fractions were prepared from the 2 .mu.g of the prepared
mRNAs according to the attachment. The libraries contained about
400,000 of independent clones in total. For each fraction, PCR was
performed under the following conditions to identify a fraction
containing SCR-6 cDNA.
[0184] Based on the sequence of a partial fragment of the mouse
SCR-6 gene, the following primers were prepared, and PCR was
performed with 35 cycles of 94.degree. C., 30 seconds, 55.degree.
C., 30 seconds and 72.degree. C., 1 minute, by using each fraction
of AGM-s3-A9 cDNA libraries as a template.
TABLE-US-00004 SCR-6F (SEQ ID NO: 38) AGCTCATTACTGTATATTTA (SEQ ID
NO: 22; 1971-1990) SCR-6R (SEQ ID NO: 39) GCTATATTTCATAAGTCATC (SEQ
ID NO: 22; 2330-2349)
[0185] The PCR product was subjected to 2% agarose gel
electrophoresis and a fraction from which the PCR product having
the expected size was obtained was identified. For each of two
fractions among the positive fractions, 50,000 plaques were seeded
on two 15-cm petri dishes and incubated 37.degree. C. for 10 hours.
Then, plaques of each petri dish were replicated to a sheet of
Biodyne nylon filter (Pall, U.S.A.). The replicated nylon filter
was subjected to DNA fixation treatment according to the
attachment, and screening with .sup.32P-labeled DNA probe was
performed.
[0186] The probe was prepared as follows. PCR was performed with 35
cycles of 94.degree. C., 30 seconds, 55.degree. C., 30 seconds and
72.degree. C., 1 minute, by using SCR-6F and SCR-6R and the plasmid
containing a partial fragment of the mouse SCR-6 gene as a
template. The PCR product was subjected to 2% agarose gel
electrophoresis and the amplified fragment was purified by JETSORB.
By using 25 ng of the obtained PCR fragment, .sup.32P-labeled DNA
probe was prepared with Megaprime labeling kit (Amersham Pharmacia,
U.S.A.).
[0187] Hybridization and washing were performed with
ExpressHybSolution (CLONETECH, U.S.A.) according to the attachment.
An X-ray film was exposed to the filter and developed with a Fuji
film auto developer to analyze the result. A plaque at a position
corresponding to the resultant strongly exposed portion was scraped
from the petri dish, and seeded again so that about 200 of plaques
should appear on 10-cm petri dish. Screening was again performed
according to the above-mentioned method to isolate a single plaque.
The obtained phage clone was transfected to E. coli strain BM25.8
according to the attachment of SMART cDNA library construction kit,
and allowed to be converted to plasmid in the cells to form colony
on LB agar medium containing 50 .mu.g/ml ampicilin. A single colony
of the transfected E. coli was inoculated to 3 ml of LB medium
containing 50 .mu.g/ml ampicilin and cultured at 30.degree. C.
overnight. Plasmid was extracted with RPM kit (BIO101, U.S.A.) to
obtain about 10 mg of plasmid.
[0188] Sequencing the both ends of the inserted fragment with an
ABI377 DNA sequencer by using .lamda.TriplEx5'LD-Insert Screening
Amplimer (CTCGGGAAGCGCGCCATTGTGTTGGT (SEQ ID NO: 40); CLONTECH,
U.S.A.) revealed that it included cDNA containing the nucleotide
sequence from nucleotide 1 of SEQ ID NO: 5. The full-length
nucleotide sequence was also determined with the ABI377 DNA
sequencer. The nucleotide sequence and the amino acid sequence
deduced from a nucleotide sequence predicted as ORF in the
nucleotide sequence are shown in SEQ ID NO: 22. Only the amino acid
sequence is shown in SEQ ID NO: 23.
[0189] By searching the cDNA database of KAZUSA DNA Institute for
mouse SCR-6 nucleotide sequence with BLAST, it has been found
homologous Homo sapiens clone HJ08186R. HJ08186R has a high
homology to the nucleotide sequence from guanine at nucleotide
position 319 to adenine at nucleotide position 917 of mouse SCR-6,
but is not predicted to have an entire ORF sequence.
[0190] KF305X primer; 5'-CCG CTC GAG CCG CCC AGA TGC AGT TTC GC-3'
(SEQ ID NO: 49) having Xho I site at 5'-end was prepared according
to the nucleotide sequence of HJ08186R, 5'-CCG CCC AGA TGC AGT TTC
GC-3' (nucleotide position: 10-29 in SEQ ID NO: 49), which is
homologous to predicted initial methionine coding region of mouse
SCR-6. 3'-RACE was performed with KOD-PLUS- (TOYOBO #KOD201) for
the DNA polymerase and the enzyme reaction system by following
protocol in the package insert. Primers used for amplification were
KF305X primer for 5'-end primer and AP1 primer in Marathon Ready
cDNA (CLONTECH) for 3'-end primer (0.2 .mu.M of each final
concentration). Marathon Ready cDNA Human Fetal Liver
(CLONTECH#7403-1) was used as a template. PCR was performed with
GeneAmp PCR System 9700 (Applied Biosystems). Amplification was
performed with 94.degree. C. for 5 minutes; 5 cycles of 94.degree.
C., 10 seconds, 72.degree. C., 4 minutes; 5 cycles of 94.degree.
C., 10 seconds, 70.degree. C., 4 minutes; 20 cycles of 94.degree.
C., 10 seconds, 68.degree. C., 4 minutes; 72.degree. C. for 7
minutes and thereafter 4.degree. C. By using 1/50 volume (1 .mu.l)
of the amplified product, 2.sup.nd amplification was further
performed with KF305X primer for 51-end primer and AP2 primer for
3'-end primer (0.2 .mu.M of each final concentration). The 2.sup.nd
amplification was performed with 94.degree. C. for 5 minutes; 5
cycles of 94.degree. C., 10 seconds, 72.degree. C., 4 minutes; 5
cycles of 94.degree. C., 10 seconds, 70.degree. C., 4 minutes; 35
cycles of 94.degree. C., 10 seconds, 68.degree. C., 4 minutes;
72.degree. C. for 7 minutes and thereafter 4.degree. C. As a
result, an amplified band of about 2 kilo base pairs was
obtained.
[0191] The 2.sup.nd amplified product was incubated with dNTPs (40
.mu.M of final concentration) and 5 units of Takara Taq (Takara
Shuzo#R001A) at 72.degree. C. for 7 minutes and subjected to
agarose gel electrophoresis. A DNA fragment about 2 kilo base pairs
in size was identified and purified by JETSORB Gel Extraction Kit
(Genomed#110150). The purified DNA fragment was inserted to the
pGEM-T Easy vector (Promega) by conventional method.
[0192] The nucleotide sequences of obtained clones were determined
with the ABI377 DNA sequencer (Applied Biosystems). The nucleotide
sequence and amino acid sequence deduced from a nucleotide sequence
predicted as ORF are shown in SEQ ID NO: 47. Only the amino acid
sequence is shown in SEQ ID NO: 48. The nucleotide sequence
contains a predicted ORF of 732 base pairs in size (nucleotide
position: 18-749 in SEQ ID NO: 47) and has homology with the mouse
SCR-6 coding region at 92.3% (nucleotide sequence) and 95.9% (amino
acid sequence). Thus, the sequence was identified as a counterpart
of mouse SCR-6 in human and defined as human SCR-6. The homology
was determined with homology search in the compare function of
DNASIS version 3.7 (Hitachi Software Engineering).
[0193] Determination of the activity of SCR-6 to support the
hematopoietic stem cells or hematopoietic progenitor cells was
performed as follows.
(1) Construction of Retrovirus Vector for Expression of Mouse
SCR-6
[0194] Based on the nucleotide sequence of SCR-6 ORF, SCR-6FxhoI
and SCR-6Reco primers having the following sequences were prepared
for retrovirus cloning, and PCR was performed by using DNA having
the nucleotide sequence shown in SEQ ID NO: 22 as a template. An
amplified fragment was inserted to the retrovirus vector
pMX-IRES-GFP in the same manner as described in (1) of Example
2.
TABLE-US-00005 SCR-6FxhoI ccgctcgagccaccATGCGTTTTTGCCTCTTCTC (SEQ
ID NO: 41) SCR-6Reco cggaattcTTATTGGTTCACTCTGTCTG (SEQ ID NO:
42)
(2) Preparation of Stromal Cells Highly Expressing SCR-6
[0195] AGM-s3-A9 cells in which SCR-6 was highly expressed were
prepared by using the above retrovirus vector in the same manner as
(2) of Example 2.
(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells
Highly Expressing SCR-6, and Determination of Proliferation
Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor
Cells by Clonogenic Assay
[0196] In the same manner as described in (III) (1) 3) to 4) of
Example 1, AGM-s3-A9 cells in which SCR-6 was highly expressed
through retrovirus, AGM-s3-A9 cells into which a control vector was
introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive
hematopoietic stem cells derived from human cord blood, and
proliferation statuses of hematopoietic stem cells and
hematopoietic progenitor cells are determined.
[0197] FIG. 9 shows results when the CD34-positive hematopoietic
stem cells were co-cultured with AGM-S3-A9 cells in which SCR-6 was
highly expressed (A9/SCR-9), AGM-S3-A9 cells into which a control
vector was introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two
weeks. As a result, the co-culture with AGM-S3-A9 cells in which
SCR-6 was highly expressed, increases of BFU-E and CFU-C were
observed. Therefore, it has been revealed that the activity to
support hematopoietic stem cells or hematopoietic progenitor cells,
of AGM-S3-A9 increases by allowing SCR-6 to be highly expressed.
From the results, it has been revealed that the gene product of
SCR-6 has an activity to support survival or proliferation of
hematopoietic stem cells or hematopoietic progenitor cells or an
activity to affect stromal cells to enhance a hematopoietic
cell-supporting activity of the stromal cells or impart the
activity to the stromal cells.
Example 7
Cloning of SCR-7 and Activity Determination
[0198] In the nucleotide sequence of SEQ ID NO: 6 obtained by the
SBH analysis, the presence of ORF was predicted. The nucleotide
sequence of ORF and the amino acid sequence deduced from the
nucleotide sequence are shown in SEQ ID NO: 24. Only the amino acid
sequence is shown in SEQ ID NO: 25.
[0199] Determination of the activity of SCR-7 to support the
hematopoietic stem cells or hematopoietic progenitor cells was
performed as follows.
(1) Construction of Retrovirus Vector for Expression of Mouse
SCR-7
[0200] Based on the nucleotide sequence of SCR-7 ORF, SCR-7FsalI
and SCR-7Reco primers having the following nucleotide sequences
were prepared for retrovirus cloning, and PCR was performed using
DNA having the nucleotide sequence shown in SEQ ID NO: 24 as a
template. An amplified fragment was inserted to the retrovirus
vector pMX-IRES-GFP in the same manner as described in (1) of
Example 2.
TABLE-US-00006 SCR-7FSalI acgcgtcgacccaccATGCCCCGCTACGAGTTG (SEQ ID
NO: 43) SCR-7Reco attGAATTCTCACTTCTTCCTCCTCTTTG (SEQ ID NO: 44)
(2) Preparation of Stromal Cells Highly Expressing SCR-7
[0201] AGM-s3-A9 cells in which SCR-7 was highly expressed were
prepared by using the above retrovirus vector in the same manner as
(2) of Example 2.
(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells
Highly Expressing SCR-7, and Determination of Proliferation
Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor
Cells by Clonogenic Assay
[0202] In the same manner as described in (III) (1) 3) to 4) of
Example 1, AGM-s3-A9 cells in which SCR-7 was highly expressed
through retrovirus, AGM-s3-A9 cells into which a control vector was
introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive
hematopoietic stem cells derived from human cord blood, and
proliferation statuses of hematopoietic stem cells and
hematopoietic progenitor cells are determined.
[0203] FIG. 10 shows results when the CD34-positive hematopoietic
stem cells were co-cultured with AGM-S3-A9 cells in which SCR-7 was
highly expressed (A9/SCR-7), AGM-S3-A9 cells into which a control
vector was introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two
weeks. As a result, the co-culture with AGM-S3-A9 cells in which
SCR-7 was highly expressed, increases of BFU-E and CFU-C were
observed. Therefore, it has been revealed that the activity to
support hematopoietic stem cells or hematopoietic progenitor cells,
of AGM-S3-A9 increases by allowing SCR-7 to be highly expressed.
From the results, it has been revealed that the gene product of
SCR-7 has an activity to support survival or proliferation of
hematopoietic stem cells or hematopoietic progenitor cells or an
activity to affect stromal cells to enhance a hematopoietic
cell-supporting activity of the stromal cells or impart the
activity to the stromal cells.
Example 8
Cloning of SCR-8 and Activity Determination
[0204] By searching GenBank database for the nucleotide sequence
shown in SEQ ID NO: 7 with BLAST, it has been found that SCR-8 is
the same gene as Mus musculus mRNA for ADAM23 of an accession
number AB009673. The nucleotide sequence of SCR-8 ORF and the amino
acid sequence deduced from the nucleotide sequence are shown in SEQ
ID NO: 26. Only the amino acid sequence is shown in SEQ ID NO:
27.
[0205] Also, the sequence encoding Human MDC3 protein [Homo
sapiens] described by JP 11155574-A has a homology of not less than
90% with SCR-8 and, therefore, is a human ortholog of SCR-8. The
nucleotide sequence of this ORF and the amino acid sequence deduced
from the nucleotide sequence are shown in SEQ ID NO: 28. Only the
amino acid sequence is shown in SEQ ID NO: 29.
[0206] Determination of the activity of SCR-8 to support the
hematopoietic stem cells or hematopoietic progenitor cells was
performed as follows.
(1) Construction of Retrovirus Vector for Expression of Mouse
SCR-8
[0207] Based on the nucleotide sequence of SCR-8 ORF, SCR-8FxhoI
and SCR-8Reco primers having the following nucleotide sequences
were prepared, and PCR was performed using AGM-s3-A9 cDNA as a
template. An amplified fragment was inserted to the retrovirus
vector pMX-IRES-GFP in the same manner as described in (1) of
Example 2.
TABLE-US-00007 SCR-8FxhoI (SEQ ID NO: 45)
ccgctcgagccaccATGAAGCCGCCCGGCAGCATC SCR-8Reco (SEQ ID NO: 46)
cggaattcTCAGATGGGGCCTTGCTGAGT
(2) Preparation of Stromal Cells Highly Expressing SCR-8
[0208] AGM-s3-A9 cells in which SCR-8 was highly expressed were
prepared by using the above retrovirus vector in the same manner as
(2) of Example 2.
(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells
Highly Expressing SCR-8, and Determination of Proliferation
Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor
Cells by Clonogenic Assay
[0209] In the same manner as described in (III) (1) 3) to 4) of
Example 1, AGM-s3-A9 cells in which SCR-8 was highly expressed
through retrovirus, AGM-s3-A9 cells into which a control vector was
introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive
hematopoietic stem cells derived from human cord blood, and
proliferation statuses of hematopoietic stem cells and
hematopoietic progenitor cells are determined.
[0210] FIG. 11 shows results when the CD34-positive hematopoietic
stem cells were co-cultured with AGM-S3-A9 cells in which SCR-8 was
highly expressed, AGM-S3-A9 cells into which a control vector was
introduced or AGM-S3-A9 cells for two weeks. As a result, the
co-culture with AGM-S3-A9 cells in which SCR-8 was highly
expressed, increases of BFU-E and CFU-C were observed. Therefore,
it has been revealed that the activity to support hematopoietic
stem cells or hematopoietic progenitor cells, of AGM-S3-A9
increases by allowing SCR-8 to be highly expressed. From the
results, it has been revealed that the gene product of SCR-8 has an
activity to support survival or proliferation of hematopoietic stem
cells or hematopoietic progenitor cells or an activity to affect
stromal cells to enhance a hematopoietic cell-supporting activity
of the stromal cells or impart the activity to the stromal
cells.
INDUSTRIAL APPLICABILITY
[0211] A factor supporting the proliferation or survival of
hematopoietic stem cells or hematopoietic progenitor cells, which
is derived from the stromal cells, is provided.
Sequence CWU 1
1
491343DNAMus musculus 1cctatggcgg caacgacgtg gacttccagg atgctagtga
tgacggcagt ggctccggca 60gcggtggcgg atgcccagat gacacctgtg gccggagggt
cagcaagaag agttccagct 120cccggacccc cttgacccat gccctccccg
gcctgtcaga acaggaggga cagaagacct 180cagctgccac ctgcccagag
ccccacagct tcttcctgct cttcctcgtc accttggtcc 240ttgcggcagc
caggcccagg tggcggtaac tgccccctat cccagacagt aactctgagt
300gctgcggcag ggtgcatgga ggggtccctc cctccttgag tcg 3432546DNAMus
musculus 2tgtaccccag ggacttcctg atcctcttac atgtataaat agcaagaccg
ggccaggaac 60agcaagcagt ctgaaggcca gctgggtctg cccactaaga agatgaagcc
ttttcatact 120gccctctcct tcctcattct tacaactgct cttggaatct
gggcccagat cacacatgca 180acagagacaa aagaagtcca gagcagtctg
aaggcacagc aagggcttga aattgaaatg 240tttcacatgg gctttcaaga
ctcttcagat tgctgcctgt cctataactc acggattcag 300tgttcaagat
ttataggtta ttttcccacc agtggtgggt gtaccaggcc gggcatcatc
360tttatcagca agagggggtt ccaggtctgt gccaacccca gtgatcggag
agttcagaga 420tgcattgaaa gattggagca aaactcacaa ccacggacct
acaaacaata acatttgctt 480gaagagaagg gtgtgaactg ccagctactt
tctttggtct tccccagtga ccacctaagt 540ggctct 54631223DNAMus musculus
3gtgacccgga agggagcccc gtggtagagg tgaccggagc tgagcatttc agatctgctt
60agtaaaccgg tgtatcgccc accatgttgg ctgcaaggct tgtgtgtctc cggacactac
120cttccagggt tttccagccc actttcatca ccaaggcctc tccacttgtg
aagaattcca 180tcacaaagaa ccaatggctc gtaacaccca gcagggaata
tgctaccaag acaagaatta 240ggactcaccg tgggaaaact ggacaagaac
tgaaagaggc agccttggaa ccatcaatgg 300aaaaaatctt taaaatcgat
caaatgggaa ggtggtttgt tgctggagga gcagctgttg 360gtcttggagc
gctctgctac tatggcttgg gaatgtctaa tgagattgga gctatcgaaa
420aggctgtaat ttggcctcag tatgtaaagg atagaattca ttctacttac
atgtacttag 480caggaaggta ttgtttaaca gctttgtctg ccttggcagt
agccagaaca cctgctctca 540tgaacttcat gatgacaggc tcttgggtga
caattggtgc gacctttgca gccatgattg 600gagctggaat gcttgtacac
tcaatatcat atgagcagag cccaggccca aagcatctgg 660cttggatgct
gcattctggt gtgatgggtg cagttgtggc tcctctgacg atcttagggg
720ggcctcttct cctgagagcc gcatggtaca ccgctggtat tgtgggaggc
ctctctactg 780tggccatgtg tgcgcctagt gagaagtttc tgaacatggg
agcacccctg ggagtgggcc 840tgggtcttgt ctttgcgtct tctctggggt
ctatgtttct tccccctacc tctgtggctg 900gtgccactct gtactcagtg
gcaatgtatg gtggattagt tcttttcagc atgttccttc 960tgtatgatac
tcagaaagta atcaaacgtg cagaaataac acccatgtat ggagctcaaa
1020agtatgatcc catcaattcg atgttgacaa tctacatgga tacattaaat
atatttatgc 1080gagttgcaac tatgctagca actggaagca acagaaagaa
atgaagtaac cgcttgtgat 1140gtctccgctc actgatgtct tgcttgttta
ataggagcag atagtcatta cagtttgcat 1200cagcagaatt cccgcgcggc cgc
12234839DNAMus musculus 4gctgtgcctg gcatcagtct tgccctctcc
cctttggcca cgcggccctt ctcagcgatt 60tgcagcagac ccgcagggca gtgtgcctcg
gtggcattga actgaagctt ggctctcggc 120ctggcctgct ggctagttgc
ccaccctgtg ggtcccgccc agagcaagga tactggagct 180ttcgcctgcc
tcactgagcc tgggtctcca ctccagtcat ccctccagct actttgcagc
240actctgtcgc catgagcacc tcgtctgcgc ggcctgcagt cctggccctt
gccgggctgg 300ctctgctcct tctgctgtgc ctgggtccag atggcataag
tggaaacaaa ctcaagaaga 360tgctccagaa acgagaagga cctgtcccgt
caaagactaa tgtagctgta gccgagaaca 420cagcaaagga attcctaggt
ggcctgaagc gtgccaaacg acagctgtgg gaccgtacgc 480ggcctgaggt
acagcagtgg taccagcagt tcctctacat gggctttgat gaggctaaat
540ttgaagatga tgtcaactat tggctaaaca gaaatcgaaa cggccatgac
tactatggtg 600actactacca gcgtcattat gatgaagatg cggccattgg
tccccacagc cgggaaagct 660tcaggcatgg agccagtgtg aactatgatg
actattaagc ttcctgaggt gcccacagag 720cttgtgcctg cttcagtagg
ccttctctac ctataccacg tgaccatcag gctaaaggaa 780agaatataag
tgctttttgc atttcatgca tgtgcttaac gatatgtctc acttaaaaa
83951420DNAMus musculus 5cctgtgccta ttttgatgga tggcaatgct
aagcaagcaa gcactgttca cttgtgactt 60tcatttctca cactgtgcac tgtcaaagac
aaatgtgcat ggaaaaatgt ttagtgtcac 120ctcatggcgt tctcagcatc
agtgaccttc aaacggtcct acaatgagac tgtgttctag 180ctaggggtat
gctgtggaaa ttcctgctac atttcatctt agtgctaaca tgtacagatt
240ctgctgcgct acattcaaag ctcattactg tatatttatg ctttctctgt
gtaacaagtt 300atacctgata agatgtcact ttgtttctag tgattcttaa
ccatggtctg gtacatggct 360attctagttt tggaaattaa caagtgtttt
gttgcctctt gttttctttt gttcctatca 420tttttggcgg gggttgggtg
ggcttgattc taaccgtaag tataggataa gctagttttg 480tatatagagt
caaatgactg atgtcagagg atcagtgctg atagaacttc cccagttcat
540gtcacgatac acacagagag aaagcagcat gaggcatctt gccatcagaa
gccaaatttc 600ttttgagtcc caaaattgat gacttatgaa atatagctga
aaacaagatt tgggtgtagt 660tacttgtatt tattatacaa tttccaatta
catttttttt caaactcaaa ataacccatg 720actttgagtg ataggtcact
tggcaatgtt cttgaattac tggggaagct gttgtcacta 780agataatgag
agagaaaata gaatggcttc gcccaagtga gagccacatc ttacatttct
840ctgttgaatc ggaatcaact atattagaac agaagcctga tagaagcttt
ctagttaaca 900cacacaaggc catggtttca aaaacatctt tgtcccctta
ggtcagtttg tccttagatt 960atgaattggc aggttctaat tgcattattt
ccctggctga tccaggaaaa agttagaaca 1020aaataagttg catagttttg
aggaaacatc caaagcaagg cgaagccttt ccttgccttg 1080cattggcaaa
actacctctt tagcatttat gttgattcag aaacatcttg ctgatatgtg
1140tagatgtttt aagcttcatt gtgaaaatat tgatgcaaga taagccatat
atgaatgttg 1200tattcaactt tagggcttga aattaatcct aaagtgttca
cctctctcca tgtctattta 1260cactctgttc ctatttacta agagggtagg
ggtctcctta atatcatact tcattgttaa 1320taagtcaatg cttgttatgt
ttcttggctg ttgtttttgt gcattaaaaa ctcaaaattg 1380gaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 14206763DNAMus musculus
6cccgccctcg cgaccccggc tctcctggac tcggcgccgc caacctgggc gatgccccgc
60tacgagttgg ctttgattct gaaagccatg cggcggccag agaccgctgc tgctttgaaa
120cgtacaatag aatccctgat ggaccgagga gccatagtga ggaacttgga
aagcctgggt 180gagcgtgcgc tcccctacag gatctcgagt cacagccagc
agcacagccg aggagggtat 240ttcctggtgg atttttatgc tccgacaagt
gctgtggaga acatactgga acacttggcg 300cgagacattg acgtggttag
accaaatatt gtgaaacacc ctctgaccca ggaagtaaaa 360gagtgtgacg
gcatagtccc agtcccactt gaagaaaaac tgtattcaac aaagaggagg
420aagaagtgag aagattcacc agattctggc cttatattta atcctaaggg
cactatgggt 480gctgctaggt tgttgtctag gatactttag cccatgacca
ttttgctgca ggaggtagaa 540actgctggcc gagacctgcc ctgatgtctc
tgctgagatt tcatcccact tgtggggttt 600gtcgggagtg ggggtgttca
cagtaccact gtagcgtttc caagagcaaa atgtttgtca 660ttcacacttg
gttgtcttgc aagcctatat ggaacactgg gagcagagta ataaacatga
720ctttatcaac actggaaaaa aaaaaaaaaa aaaaaaaaaa aaa 76371300DNAMus
musculus 7ggtatgcagt ctttcgcttg aatttgctgt ttgtttatat agtaataaca
gcgctatcta 60taaggcttac tggccttatt cctggttcca taagacacag gctgtacccc
tttactgaat 120ggcatgggct cagcttggag gaaagtcaga ggaaattcag
ataacttggt atctcttcct 180gtcgttgcaa tgtttcgggg tccacttcac
tatgagatac caagcagctg ccaacctcac 240catactcatt tcgttacaat
ttctgaggca ccgtggtgac ttgatccgac atacgaccac 300gtcagttaca
aaccagatct ttatggttaa cttttgaaca tttcacaaac aacattgtaa
360atgtgcgatg ttatgtttta aatcagacca cagtggtccc caaatattat
gtacatatga 420caaatgtcag tgtaactttt tgttacactg acagtttcat
aggtaaacaa acctacgctc 480caatgttaaa ttatgcttgt gtatgtaaaa
tacacaagca ttgggctatg tgtgtacgga 540catgagggta gtgcaatcgt
actgtacgaa atgggtcaga atcattttca gtggtgttag 600gttatgtagt
ttcagactcc atgctgcatt ttctcttgca catgccatcc atttgcttat
660tttggagtgt gagtattcct tcttattaat ttgaattcaa agcacaagcc
tcccattgtt 720caacattacc caacaagagt gtccagtgat gaccgagtta
tctcacctgc tatactttta 780ctgcaataat taatgacacc tggatgagga
ggcgtgcgct gacttcattg ttcacccggg 840atagtgcatg agcccactga
attagagctg cttctaccag caaaagtgag cagtacacat 900aggtgcatgt
ttgaaacatg aatcacatag agctatggag ttttgccaag tgatgtgttt
960tctttttctt ttttcttttt ttttcttttt cttctttttt ttccttttct
tcttcttctt 1020cttttttttt ttttttacta tgcaaagatg ggaaatgcac
aaacttccaa gacatgtctg 1080aagaacttta caatacttga attttttctt
taatcatccc atcacattta tggcattgat 1140gcttccattg tatttttctt
ttgtcccttc aacttcaatg gtttgtaatt tcaatgcaca 1200acctaacttt
tgtttgcagt aacttccaat cctattggct gcctggaacg gagattctgt
1260catcctacac gcatctttta gttgactgtg cataaaagtt 130081674DNAMus
musculusCDS(1)..(1671) 8atg gaa ctc cgg acc cga ggc tgg tgg ctg ctg
tgc gcg gcc gcc gcg 48Met Glu Leu Arg Thr Arg Gly Trp Trp Leu Leu
Cys Ala Ala Ala Ala1 5 10 15ctg gtc gtc tgc gcc cgc ggg gac ccc gcc
agc aag agc cgg agc tgc 96Leu Val Val Cys Ala Arg Gly Asp Pro Ala
Ser Lys Ser Arg Ser Cys20 25 30agc gaa gtc cgc cag atc tac ggg gct
aag ggc ttt agc ctg agc gat 144Ser Glu Val Arg Gln Ile Tyr Gly Ala
Lys Gly Phe Ser Leu Ser Asp35 40 45gtg ccc cag gca gag atc tcg ggt
gag cac ctg cgg atc tgc ccc cag 192Val Pro Gln Ala Glu Ile Ser Gly
Glu His Leu Arg Ile Cys Pro Gln50 55 60ggc tac act tgc tgt acc agt
gag atg gag gag aat ttg gcc aac cac 240Gly Tyr Thr Cys Cys Thr Ser
Glu Met Glu Glu Asn Leu Ala Asn His65 70 75 80agc cga atg gag ctg
gag agc gca ctc cat gac agc agc cgc gcc ctg 288Ser Arg Met Glu Leu
Glu Ser Ala Leu His Asp Ser Ser Arg Ala Leu85 90 95cag gcc aca ctg
gcc acc cag ctg cat ggc atc gat gac cac ttc cag 336Gln Ala Thr Leu
Ala Thr Gln Leu His Gly Ile Asp Asp His Phe Gln100 105 110cgc ctg
ctg aat gac tcg gag cgc aca ctg cag gag gct ttc cct ggg 384Arg Leu
Leu Asn Asp Ser Glu Arg Thr Leu Gln Glu Ala Phe Pro Gly115 120
125gcc ttt ggg gac ctg tat acg cag aac act cgt gcc ttc cgg gac cta
432Ala Phe Gly Asp Leu Tyr Thr Gln Asn Thr Arg Ala Phe Arg Asp
Leu130 135 140tat gtt gag ctg cgc ctc tac tac cgt ggg gcc aac ctg
cac ctt gag 480Tyr Val Glu Leu Arg Leu Tyr Tyr Arg Gly Ala Asn Leu
His Leu Glu145 150 155 160gag acg ctg gcc gag ttc tgg gca cgg ctg
ctg gag cgc ctc ttc aag 528Glu Thr Leu Ala Glu Phe Trp Ala Arg Leu
Leu Glu Arg Leu Phe Lys165 170 175cag ctg cac ccc cag ctg ctg cct
gat gac tac ctg gac tgc ctg ggc 576Gln Leu His Pro Gln Leu Leu Pro
Asp Asp Tyr Leu Asp Cys Leu Gly180 185 190aag cag gcg gag gca ctg
cgg ccg ttt gga gat gcc cct cga gaa ctg 624Lys Gln Ala Glu Ala Leu
Arg Pro Phe Gly Asp Ala Pro Arg Glu Leu195 200 205cgc ctg cgg gcc
acc cgt gcc ttt gtg gct gca cgt tcc ttt gtg cag 672Arg Leu Arg Ala
Thr Arg Ala Phe Val Ala Ala Arg Ser Phe Val Gln210 215 220ggc ctg
ggt gtg gcc agt gat gta gtc cgg aag gtg gcc cag gta cct 720Gly Leu
Gly Val Ala Ser Asp Val Val Arg Lys Val Ala Gln Val Pro225 230 235
240ctg gcc cca gaa tgt tct cgg gcc atc atg aag ttg gtc tac tgt gct
768Leu Ala Pro Glu Cys Ser Arg Ala Ile Met Lys Leu Val Tyr Cys
Ala245 250 255cat tgc cgg gga gtc ccg ggc gcc cgg ccc tgc ccc gac
tat tgc cga 816His Cys Arg Gly Val Pro Gly Ala Arg Pro Cys Pro Asp
Tyr Cys Arg260 265 270aat gtg ctc aaa ggc tgc ctt gcc aac cag gcc
gac ctg gat gcc gag 864Asn Val Leu Lys Gly Cys Leu Ala Asn Gln Ala
Asp Leu Asp Ala Glu275 280 285tgg agg aac ctc ctg gac tcc atg gtg
ctc atc act gac aag ttc tgg 912Trp Arg Asn Leu Leu Asp Ser Met Val
Leu Ile Thr Asp Lys Phe Trp290 295 300ggc ccg tcg ggt gcg gag agt
gtc att ggc ggt gtg cac gtg tgg ctg 960Gly Pro Ser Gly Ala Glu Ser
Val Ile Gly Gly Val His Val Trp Leu305 310 315 320gcg gag gcc atc
aac gcc ctc cag gac aac aag gac aca ctc aca gct 1008Ala Glu Ala Ile
Asn Ala Leu Gln Asp Asn Lys Asp Thr Leu Thr Ala325 330 335aag gtc
atc cag gcc tgt gga aac ccc aag gtc aat ccc cac ggc tct 1056Lys Val
Ile Gln Ala Cys Gly Asn Pro Lys Val Asn Pro His Gly Ser340 345
350ggg ccc gag gag aag cgt cgc cgt ggc aaa ttg gca ctg cag gag aag
1104Gly Pro Glu Glu Lys Arg Arg Arg Gly Lys Leu Ala Leu Gln Glu
Lys355 360 365ccc tcc aca ggt act ctg gaa aaa ctg gtc tct gag gcc
aag gcc cag 1152Pro Ser Thr Gly Thr Leu Glu Lys Leu Val Ser Glu Ala
Lys Ala Gln370 375 380ctc cga gac att cag gac ttc tgg atc agc ctc
cca ggg aca ctg tgc 1200Leu Arg Asp Ile Gln Asp Phe Trp Ile Ser Leu
Pro Gly Thr Leu Cys385 390 395 400agt gag aag atg gcc atg agt cct
gcc agt gat gac cgc tgc tgg aat 1248Ser Glu Lys Met Ala Met Ser Pro
Ala Ser Asp Asp Arg Cys Trp Asn405 410 415gga att tcc aag ggc cgg
tac cta cca gag gtg atg ggt gac ggg ctg 1296Gly Ile Ser Lys Gly Arg
Tyr Leu Pro Glu Val Met Gly Asp Gly Leu420 425 430gcc aac cag atc
aac aac cct gag gtg gaa gtg gac atc acc aag cca 1344Ala Asn Gln Ile
Asn Asn Pro Glu Val Glu Val Asp Ile Thr Lys Pro435 440 445gac atg
acc atc cgc cag cag att atg cag ctc aag atc atg acc aac 1392Asp Met
Thr Ile Arg Gln Gln Ile Met Gln Leu Lys Ile Met Thr Asn450 455
460cgt tta cgt ggc gcc tat ggc ggc aac gac gtg gac ttc cag gat gct
1440Arg Leu Arg Gly Ala Tyr Gly Gly Asn Asp Val Asp Phe Gln Asp
Ala465 470 475 480agt gat gac ggc agt ggc tcc ggc agc ggt ggc gga
tgc cca gat gac 1488Ser Asp Asp Gly Ser Gly Ser Gly Ser Gly Gly Gly
Cys Pro Asp Asp485 490 495acc tgt ggc cgg agg gtc agc aag aag agt
tcc agc tcc cgg acc ccc 1536Thr Cys Gly Arg Arg Val Ser Lys Lys Ser
Ser Ser Ser Arg Thr Pro500 505 510ttg acc cat gcc ctc ccc ggc ctg
tca gaa cag gag gga cag aag acc 1584Leu Thr His Ala Leu Pro Gly Leu
Ser Glu Gln Glu Gly Gln Lys Thr515 520 525tca gct gcc acc tgc cca
gag ccc cac agc ttc ttc ctg ctc ttc ctc 1632Ser Ala Ala Thr Cys Pro
Glu Pro His Ser Phe Phe Leu Leu Phe Leu530 535 540gtc acc ttg gtc
ctt gcg gca gcc agg ccc agg tgg cgg taa 1674Val Thr Leu Val Leu Ala
Ala Ala Arg Pro Arg Trp Arg545 550 5559557PRTMus musculus 9Met Glu
Leu Arg Thr Arg Gly Trp Trp Leu Leu Cys Ala Ala Ala Ala1 5 10 15Leu
Val Val Cys Ala Arg Gly Asp Pro Ala Ser Lys Ser Arg Ser Cys20 25
30Ser Glu Val Arg Gln Ile Tyr Gly Ala Lys Gly Phe Ser Leu Ser Asp35
40 45Val Pro Gln Ala Glu Ile Ser Gly Glu His Leu Arg Ile Cys Pro
Gln50 55 60Gly Tyr Thr Cys Cys Thr Ser Glu Met Glu Glu Asn Leu Ala
Asn His65 70 75 80Ser Arg Met Glu Leu Glu Ser Ala Leu His Asp Ser
Ser Arg Ala Leu85 90 95Gln Ala Thr Leu Ala Thr Gln Leu His Gly Ile
Asp Asp His Phe Gln100 105 110Arg Leu Leu Asn Asp Ser Glu Arg Thr
Leu Gln Glu Ala Phe Pro Gly115 120 125Ala Phe Gly Asp Leu Tyr Thr
Gln Asn Thr Arg Ala Phe Arg Asp Leu130 135 140Tyr Val Glu Leu Arg
Leu Tyr Tyr Arg Gly Ala Asn Leu His Leu Glu145 150 155 160Glu Thr
Leu Ala Glu Phe Trp Ala Arg Leu Leu Glu Arg Leu Phe Lys165 170
175Gln Leu His Pro Gln Leu Leu Pro Asp Asp Tyr Leu Asp Cys Leu
Gly180 185 190Lys Gln Ala Glu Ala Leu Arg Pro Phe Gly Asp Ala Pro
Arg Glu Leu195 200 205Arg Leu Arg Ala Thr Arg Ala Phe Val Ala Ala
Arg Ser Phe Val Gln210 215 220Gly Leu Gly Val Ala Ser Asp Val Val
Arg Lys Val Ala Gln Val Pro225 230 235 240Leu Ala Pro Glu Cys Ser
Arg Ala Ile Met Lys Leu Val Tyr Cys Ala245 250 255His Cys Arg Gly
Val Pro Gly Ala Arg Pro Cys Pro Asp Tyr Cys Arg260 265 270Asn Val
Leu Lys Gly Cys Leu Ala Asn Gln Ala Asp Leu Asp Ala Glu275 280
285Trp Arg Asn Leu Leu Asp Ser Met Val Leu Ile Thr Asp Lys Phe
Trp290 295 300Gly Pro Ser Gly Ala Glu Ser Val Ile Gly Gly Val His
Val Trp Leu305 310 315 320Ala Glu Ala Ile Asn Ala Leu Gln Asp Asn
Lys Asp Thr Leu Thr Ala325 330 335Lys Val Ile Gln Ala Cys Gly Asn
Pro Lys Val Asn Pro His Gly Ser340 345 350Gly Pro Glu Glu Lys Arg
Arg Arg Gly Lys Leu Ala Leu Gln Glu Lys355 360 365Pro Ser Thr Gly
Thr Leu Glu Lys Leu Val Ser Glu Ala Lys Ala Gln370 375 380Leu Arg
Asp Ile Gln Asp Phe Trp Ile Ser Leu Pro Gly Thr Leu Cys385 390 395
400Ser Glu Lys Met Ala Met Ser Pro Ala Ser Asp Asp Arg Cys Trp
Asn405 410 415Gly Ile Ser Lys Gly Arg Tyr Leu Pro Glu Val Met Gly
Asp Gly Leu420 425 430Ala Asn Gln Ile Asn Asn Pro Glu Val Glu Val
Asp Ile Thr Lys Pro435 440 445Asp Met Thr Ile Arg Gln Gln Ile Met
Gln Leu Lys Ile Met Thr Asn450 455 460Arg Leu Arg Gly Ala Tyr Gly
Gly Asn Asp Val Asp Phe Gln Asp Ala465 470 475 480Ser Asp Asp Gly
Ser Gly Ser Gly Ser Gly Gly Gly Cys Pro Asp Asp485 490 495Thr Cys
Gly Arg Arg Val Ser Lys Lys Ser Ser Ser Ser Arg Thr Pro500 505
510Leu Thr His Ala Leu Pro Gly Leu Ser Glu Gln Glu Gly Gln Lys
Thr515 520 525Ser Ala Ala Thr Cys Pro Glu Pro His Ser Phe Phe Leu
Leu Phe Leu530
535 540Val Thr Leu Val Leu Ala Ala Ala Arg Pro Arg Trp Arg545 550
555101677DNAHomo sapiensCDS(1)..(1674) 10atg gag ctc cgg gcc cga
ggc tgg tgg ctg cta tgt gcg gcc gca gcg 48Met Glu Leu Arg Ala Arg
Gly Trp Trp Leu Leu Cys Ala Ala Ala Ala1 5 10 15ctg gtc gcc tgc gcc
cgc ggg gac ccg gcc agc aag agc cgg agc tgc 96Leu Val Ala Cys Ala
Arg Gly Asp Pro Ala Ser Lys Ser Arg Ser Cys20 25 30ggc gag gtc cgc
cag atc tac gga gcc aag ggc ttc agc ctg agc gac 144Gly Glu Val Arg
Gln Ile Tyr Gly Ala Lys Gly Phe Ser Leu Ser Asp35 40 45gtg ccc cag
gcg gag atc tcg ggt gag cac ctg cgg atc tgt ccc cag 192Val Pro Gln
Ala Glu Ile Ser Gly Glu His Leu Arg Ile Cys Pro Gln50 55 60ggc tac
acc tgc tgc acc agc gag atg gag gag aac ctg gcc aac cgc 240Gly Tyr
Thr Cys Cys Thr Ser Glu Met Glu Glu Asn Leu Ala Asn Arg65 70 75
80agc cat gcc gag ctg gag acc gcg ctc cgg gac agc agc cgc gtc ctg
288Ser His Ala Glu Leu Glu Thr Ala Leu Arg Asp Ser Ser Arg Val
Leu85 90 95cag gcc atg ctt gcc acc cag ctg cgc agc ttc gat gac cac
ttc cag 336Gln Ala Met Leu Ala Thr Gln Leu Arg Ser Phe Asp Asp His
Phe Gln100 105 110cac ctg ctg aac gac tcg gag cgg acg ctg cag gcc
acc ttc ccc ggc 384His Leu Leu Asn Asp Ser Glu Arg Thr Leu Gln Ala
Thr Phe Pro Gly115 120 125gcc ttc gga gag ctg tac acg cag aac gcg
agg gcc ttc cgg gac ctg 432Ala Phe Gly Glu Leu Tyr Thr Gln Asn Ala
Arg Ala Phe Arg Asp Leu130 135 140tac tca gag ctg cgc ctg tac tac
cgc ggt gcc aac ctg cac ctg gag 480Tyr Ser Glu Leu Arg Leu Tyr Tyr
Arg Gly Ala Asn Leu His Leu Glu145 150 155 160gag acg ctg gcc gag
ttc tgg gcc cgc ctg ctc gag cgc ctc ttc aag 528Glu Thr Leu Ala Glu
Phe Trp Ala Arg Leu Leu Glu Arg Leu Phe Lys165 170 175cag ctg cac
ccc cag ctg ctg ctg cct gat gac tac ctg gac tgc ctg 576Gln Leu His
Pro Gln Leu Leu Leu Pro Asp Asp Tyr Leu Asp Cys Leu180 185 190ggc
aag cag gcc gag gcg ctg cgg ccc ttc ggg gag gcc ccg aga gag 624Gly
Lys Gln Ala Glu Ala Leu Arg Pro Phe Gly Glu Ala Pro Arg Glu195 200
205ctg cgc ctg cgg gcc acc cgt gcc ttc gtg gct gct cgc tcc ttt gtg
672Leu Arg Leu Arg Ala Thr Arg Ala Phe Val Ala Ala Arg Ser Phe
Val210 215 220cag ggc ctg ggc gtg gcc agc gac gtg gtc cgg aaa gtg
gct cag gtc 720Gln Gly Leu Gly Val Ala Ser Asp Val Val Arg Lys Val
Ala Gln Val225 230 235 240ccc ctg ggc ccg gag tgc tcg aga gct gtc
atg aag ctg gtc tac tgt 768Pro Leu Gly Pro Glu Cys Ser Arg Ala Val
Met Lys Leu Val Tyr Cys245 250 255gct cac tgc ctg gga gtc ccc ggc
gcc agg ccc tgc cct gac tat tgc 816Ala His Cys Leu Gly Val Pro Gly
Ala Arg Pro Cys Pro Asp Tyr Cys260 265 270cga aat gtg ctc aag ggc
tgc ctt gcc aac cag gcc gac ctg gac gcc 864Arg Asn Val Leu Lys Gly
Cys Leu Ala Asn Gln Ala Asp Leu Asp Ala275 280 285gag tgg agg aac
ctc ctg gac tcc atg gtg ctc atc acc gac aag ttc 912Glu Trp Arg Asn
Leu Leu Asp Ser Met Val Leu Ile Thr Asp Lys Phe290 295 300tgg ggt
aca tcg ggt gtg gag agt gtc atc ggc agc gtg cac acg tgg 960Trp Gly
Thr Ser Gly Val Glu Ser Val Ile Gly Ser Val His Thr Trp305 310 315
320ctg gcg gag gcc atc aac gcc ctc cag gac aac agg gac acg ctc acg
1008Leu Ala Glu Ala Ile Asn Ala Leu Gln Asp Asn Arg Asp Thr Leu
Thr325 330 335gcc aag gtc atc cag ggc tgc ggg aac ccc aag gtc aac
ccc cag ggc 1056Ala Lys Val Ile Gln Gly Cys Gly Asn Pro Lys Val Asn
Pro Gln Gly340 345 350cct ggg cct gag gag aag cgg cgc cgg ggc aag
ctg gcc ccg cgg gag 1104Pro Gly Pro Glu Glu Lys Arg Arg Arg Gly Lys
Leu Ala Pro Arg Glu355 360 365agg cca cct tca ggc acg ctg gag aag
ctg gtc tct gaa gcc aag gcc 1152Arg Pro Pro Ser Gly Thr Leu Glu Lys
Leu Val Ser Glu Ala Lys Ala370 375 380cag ctc cgc gac gtc cag gac
ttc tgg atc agc ctc cca ggg aca ctg 1200Gln Leu Arg Asp Val Gln Asp
Phe Trp Ile Ser Leu Pro Gly Thr Leu385 390 395 400tgc agt gag aag
atg gcc ctg agc act gcc agt gat gac cgc tgc tgg 1248Cys Ser Glu Lys
Met Ala Leu Ser Thr Ala Ser Asp Asp Arg Cys Trp405 410 415aac ggg
atg gcc aga ggc cgg tac ctc ccc gag gtc atg ggt gac ggc 1296Asn Gly
Met Ala Arg Gly Arg Tyr Leu Pro Glu Val Met Gly Asp Gly420 425
430ctg gcc aac cag atc aac aac ccc gag gtg gag gtg gac atc acc aag
1344Leu Ala Asn Gln Ile Asn Asn Pro Glu Val Glu Val Asp Ile Thr
Lys435 440 445ccg gac atg acc atc cgg cag cag atc atg cag ctg aag
atc atg acc 1392Pro Asp Met Thr Ile Arg Gln Gln Ile Met Gln Leu Lys
Ile Met Thr450 455 460aac cgg ctg cgc agc gcc tac aac ggc aac gac
gtg gac ttc cag gac 1440Asn Arg Leu Arg Ser Ala Tyr Asn Gly Asn Asp
Val Asp Phe Gln Asp465 470 475 480gcc agt gac gac ggc agc ggc tcg
ggc agc ggt gat ggc tgt ctg gat 1488Ala Ser Asp Asp Gly Ser Gly Ser
Gly Ser Gly Asp Gly Cys Leu Asp485 490 495gac ctc tgc ggc cgg aag
gtc agc agg aag agc tcc agc tcc cgg acg 1536Asp Leu Cys Gly Arg Lys
Val Ser Arg Lys Ser Ser Ser Ser Arg Thr500 505 510ccc ttg acc cat
gcc ctc cca ggc ctg tca gag cag gaa gga cag aag 1584Pro Leu Thr His
Ala Leu Pro Gly Leu Ser Glu Gln Glu Gly Gln Lys515 520 525acc tcg
gct gcc agc tgc ccc cag ccc ccg acc ttc ctc ctg ccc ctc 1632Thr Ser
Ala Ala Ser Cys Pro Gln Pro Pro Thr Phe Leu Leu Pro Leu530 535
540ctc ctc ttc ctg gcc ctt aca gta gcc agg ccc cgg tgg cgg taa
1677Leu Leu Phe Leu Ala Leu Thr Val Ala Arg Pro Arg Trp Arg545 550
55511558PRTHomo sapiens 11Met Glu Leu Arg Ala Arg Gly Trp Trp Leu
Leu Cys Ala Ala Ala Ala1 5 10 15Leu Val Ala Cys Ala Arg Gly Asp Pro
Ala Ser Lys Ser Arg Ser Cys20 25 30Gly Glu Val Arg Gln Ile Tyr Gly
Ala Lys Gly Phe Ser Leu Ser Asp35 40 45Val Pro Gln Ala Glu Ile Ser
Gly Glu His Leu Arg Ile Cys Pro Gln50 55 60Gly Tyr Thr Cys Cys Thr
Ser Glu Met Glu Glu Asn Leu Ala Asn Arg65 70 75 80Ser His Ala Glu
Leu Glu Thr Ala Leu Arg Asp Ser Ser Arg Val Leu85 90 95Gln Ala Met
Leu Ala Thr Gln Leu Arg Ser Phe Asp Asp His Phe Gln100 105 110His
Leu Leu Asn Asp Ser Glu Arg Thr Leu Gln Ala Thr Phe Pro Gly115 120
125Ala Phe Gly Glu Leu Tyr Thr Gln Asn Ala Arg Ala Phe Arg Asp
Leu130 135 140Tyr Ser Glu Leu Arg Leu Tyr Tyr Arg Gly Ala Asn Leu
His Leu Glu145 150 155 160Glu Thr Leu Ala Glu Phe Trp Ala Arg Leu
Leu Glu Arg Leu Phe Lys165 170 175Gln Leu His Pro Gln Leu Leu Leu
Pro Asp Asp Tyr Leu Asp Cys Leu180 185 190Gly Lys Gln Ala Glu Ala
Leu Arg Pro Phe Gly Glu Ala Pro Arg Glu195 200 205Leu Arg Leu Arg
Ala Thr Arg Ala Phe Val Ala Ala Arg Ser Phe Val210 215 220Gln Gly
Leu Gly Val Ala Ser Asp Val Val Arg Lys Val Ala Gln Val225 230 235
240Pro Leu Gly Pro Glu Cys Ser Arg Ala Val Met Lys Leu Val Tyr
Cys245 250 255Ala His Cys Leu Gly Val Pro Gly Ala Arg Pro Cys Pro
Asp Tyr Cys260 265 270Arg Asn Val Leu Lys Gly Cys Leu Ala Asn Gln
Ala Asp Leu Asp Ala275 280 285Glu Trp Arg Asn Leu Leu Asp Ser Met
Val Leu Ile Thr Asp Lys Phe290 295 300Trp Gly Thr Ser Gly Val Glu
Ser Val Ile Gly Ser Val His Thr Trp305 310 315 320Leu Ala Glu Ala
Ile Asn Ala Leu Gln Asp Asn Arg Asp Thr Leu Thr325 330 335Ala Lys
Val Ile Gln Gly Cys Gly Asn Pro Lys Val Asn Pro Gln Gly340 345
350Pro Gly Pro Glu Glu Lys Arg Arg Arg Gly Lys Leu Ala Pro Arg
Glu355 360 365Arg Pro Pro Ser Gly Thr Leu Glu Lys Leu Val Ser Glu
Ala Lys Ala370 375 380Gln Leu Arg Asp Val Gln Asp Phe Trp Ile Ser
Leu Pro Gly Thr Leu385 390 395 400Cys Ser Glu Lys Met Ala Leu Ser
Thr Ala Ser Asp Asp Arg Cys Trp405 410 415Asn Gly Met Ala Arg Gly
Arg Tyr Leu Pro Glu Val Met Gly Asp Gly420 425 430Leu Ala Asn Gln
Ile Asn Asn Pro Glu Val Glu Val Asp Ile Thr Lys435 440 445Pro Asp
Met Thr Ile Arg Gln Gln Ile Met Gln Leu Lys Ile Met Thr450 455
460Asn Arg Leu Arg Ser Ala Tyr Asn Gly Asn Asp Val Asp Phe Gln
Asp465 470 475 480Ala Ser Asp Asp Gly Ser Gly Ser Gly Ser Gly Asp
Gly Cys Leu Asp485 490 495Asp Leu Cys Gly Arg Lys Val Ser Arg Lys
Ser Ser Ser Ser Arg Thr500 505 510Pro Leu Thr His Ala Leu Pro Gly
Leu Ser Glu Gln Glu Gly Gln Lys515 520 525Thr Ser Ala Ala Ser Cys
Pro Gln Pro Pro Thr Phe Leu Leu Pro Leu530 535 540Leu Leu Phe Leu
Ala Leu Thr Val Ala Arg Pro Arg Trp Arg545 550 55512369DNAMus
musculusCDS(1)..(366) 12atg aag cct ttt cat act gcc ctc tcc ttc ctc
att ctt aca act gct 48Met Lys Pro Phe His Thr Ala Leu Ser Phe Leu
Ile Leu Thr Thr Ala1 5 10 15ctt gga atc tgg gcc cag atc aca cat gca
aca gag aca aaa gaa gtc 96Leu Gly Ile Trp Ala Gln Ile Thr His Ala
Thr Glu Thr Lys Glu Val20 25 30cag agc agt ctg aag gca cag caa ggg
ctt gaa att gaa atg ttt cac 144Gln Ser Ser Leu Lys Ala Gln Gln Gly
Leu Glu Ile Glu Met Phe His35 40 45atg ggc ttt caa gac tct tca gat
tgc tgc ctg tcc tat aac tca cgg 192Met Gly Phe Gln Asp Ser Ser Asp
Cys Cys Leu Ser Tyr Asn Ser Arg50 55 60att cag tgt tca aga ttt ata
ggt tat ttt ccc acc agt ggt ggg tgt 240Ile Gln Cys Ser Arg Phe Ile
Gly Tyr Phe Pro Thr Ser Gly Gly Cys65 70 75 80acc agg ccg ggc atc
atc ttt atc agc aag agg ggg ttc cag gtc tgt 288Thr Arg Pro Gly Ile
Ile Phe Ile Ser Lys Arg Gly Phe Gln Val Cys85 90 95gcc aac ccc agt
gat cgg aga gtt cag aga tgc att gaa aga ttg gag 336Ala Asn Pro Ser
Asp Arg Arg Val Gln Arg Cys Ile Glu Arg Leu Glu100 105 110caa aac
tca caa cca cgg acc tac aaa caa taa 369Gln Asn Ser Gln Pro Arg Thr
Tyr Lys Gln115 12013122PRTMus musculus 13Met Lys Pro Phe His Thr
Ala Leu Ser Phe Leu Ile Leu Thr Thr Ala1 5 10 15Leu Gly Ile Trp Ala
Gln Ile Thr His Ala Thr Glu Thr Lys Glu Val20 25 30Gln Ser Ser Leu
Lys Ala Gln Gln Gly Leu Glu Ile Glu Met Phe His35 40 45Met Gly Phe
Gln Asp Ser Ser Asp Cys Cys Leu Ser Tyr Asn Ser Arg50 55 60Ile Gln
Cys Ser Arg Phe Ile Gly Tyr Phe Pro Thr Ser Gly Gly Cys65 70 75
80Thr Arg Pro Gly Ile Ile Phe Ile Ser Lys Arg Gly Phe Gln Val Cys85
90 95Ala Asn Pro Ser Asp Arg Arg Val Gln Arg Cys Ile Glu Arg Leu
Glu100 105 110Gln Asn Ser Gln Pro Arg Thr Tyr Lys Gln115
120141223DNAMus musculusCDS(84)..(1121) 14gtgacccgga agggagcccc
gtggtagagg tgaccggagc tgagcatttc agatctgctt 60agtaaaccgg tgtatcgccc
acc atg ttg gct gca agg ctt gtg tgt ctc cgg 113Met Leu Ala Ala Arg
Leu Val Cys Leu Arg1 5 10aca cta cct tcc agg gtt ttc cag ccc act
ttc atc acc aag gcc tct 161Thr Leu Pro Ser Arg Val Phe Gln Pro Thr
Phe Ile Thr Lys Ala Ser15 20 25cca ctt gtg aag aat tcc atc aca aag
aac caa tgg ctc gta aca ccc 209Pro Leu Val Lys Asn Ser Ile Thr Lys
Asn Gln Trp Leu Val Thr Pro30 35 40agc agg gaa tat gct acc aag aca
aga att agg act cac cgt ggg aaa 257Ser Arg Glu Tyr Ala Thr Lys Thr
Arg Ile Arg Thr His Arg Gly Lys45 50 55act gga caa gaa ctg aaa gag
gca gcc ttg gaa cca tca atg gaa aaa 305Thr Gly Gln Glu Leu Lys Glu
Ala Ala Leu Glu Pro Ser Met Glu Lys60 65 70atc ttt aaa atc gat caa
atg gga agg tgg ttt gtt gct gga gga gca 353Ile Phe Lys Ile Asp Gln
Met Gly Arg Trp Phe Val Ala Gly Gly Ala75 80 85 90gct gtt ggt ctt
gga gcg ctc tgc tac tat ggc ttg gga atg tct aat 401Ala Val Gly Leu
Gly Ala Leu Cys Tyr Tyr Gly Leu Gly Met Ser Asn95 100 105gag att
gga gct atc gaa aag gct gta att tgg cct cag tat gta aag 449Glu Ile
Gly Ala Ile Glu Lys Ala Val Ile Trp Pro Gln Tyr Val Lys110 115
120gat aga att cat tct act tac atg tac tta gca gga agg tat tgt tta
497Asp Arg Ile His Ser Thr Tyr Met Tyr Leu Ala Gly Arg Tyr Cys
Leu125 130 135aca gct ttg tct gcc ttg gca gta gcc aga aca cct gct
ctc atg aac 545Thr Ala Leu Ser Ala Leu Ala Val Ala Arg Thr Pro Ala
Leu Met Asn140 145 150ttc atg atg aca ggc tct tgg gtg aca att ggt
gcg acc ttt gca gcc 593Phe Met Met Thr Gly Ser Trp Val Thr Ile Gly
Ala Thr Phe Ala Ala155 160 165 170atg att gga gct gga atg ctt gta
cac tca ata tca tat gag cag agc 641Met Ile Gly Ala Gly Met Leu Val
His Ser Ile Ser Tyr Glu Gln Ser175 180 185cca ggc cca aag cat ctg
gct tgg atg ctg cat tct ggt gtg atg ggt 689Pro Gly Pro Lys His Leu
Ala Trp Met Leu His Ser Gly Val Met Gly190 195 200gca gtt gtg gct
cct ctg acg atc tta ggg ggg cct ctt ctc ctg aga 737Ala Val Val Ala
Pro Leu Thr Ile Leu Gly Gly Pro Leu Leu Leu Arg205 210 215gcc gca
tgg tac acc gct ggt att gtg gga ggc ctc tct act gtg gcc 785Ala Ala
Trp Tyr Thr Ala Gly Ile Val Gly Gly Leu Ser Thr Val Ala220 225
230atg tgt gcg cct agt gag aag ttt ctg aac atg gga gca ccc ctg gga
833Met Cys Ala Pro Ser Glu Lys Phe Leu Asn Met Gly Ala Pro Leu
Gly235 240 245 250gtg ggc ctg ggt ctt gtc ttt gcg tct tct ctg ggg
tct atg ttt ctt 881Val Gly Leu Gly Leu Val Phe Ala Ser Ser Leu Gly
Ser Met Phe Leu255 260 265ccc cct acc tct gtg gct ggt gcc act ctg
tac tca gtg gca atg tat 929Pro Pro Thr Ser Val Ala Gly Ala Thr Leu
Tyr Ser Val Ala Met Tyr270 275 280ggt gga tta gtt ctt ttc agc atg
ttc ctt ctg tat gat act cag aaa 977Gly Gly Leu Val Leu Phe Ser Met
Phe Leu Leu Tyr Asp Thr Gln Lys285 290 295gta atc aaa cgt gca gaa
ata aca ccc atg tat gga gct caa aag tat 1025Val Ile Lys Arg Ala Glu
Ile Thr Pro Met Tyr Gly Ala Gln Lys Tyr300 305 310gat ccc atc aat
tcg atg ttg aca atc tac atg gat aca tta aat ata 1073Asp Pro Ile Asn
Ser Met Leu Thr Ile Tyr Met Asp Thr Leu Asn Ile315 320 325 330ttt
atg cga gtt gca act atg cta gca act gga agc aac aga aag aaa 1121Phe
Met Arg Val Ala Thr Met Leu Ala Thr Gly Ser Asn Arg Lys Lys335 340
345tgaagtaacc gcttgtgatg tctccgctca ctgatgtctt gcttgtttaa
taggagcaga 1181tagtcattac agtttgcatc agcagaattc ccgcgcggcc gc
122315346PRTMus musculus 15Met Leu Ala Ala Arg Leu Val Cys Leu Arg
Thr Leu Pro Ser Arg Val1 5 10 15Phe Gln Pro Thr Phe Ile Thr Lys Ala
Ser Pro Leu Val Lys Asn Ser20 25 30Ile Thr Lys Asn Gln Trp Leu Val
Thr Pro Ser Arg Glu Tyr Ala Thr35 40 45Lys Thr Arg Ile Arg Thr His
Arg Gly Lys Thr Gly Gln Glu Leu Lys50 55 60Glu Ala Ala Leu Glu Pro
Ser Met Glu Lys Ile Phe Lys Ile Asp Gln65 70 75 80Met Gly Arg Trp
Phe Val Ala Gly Gly Ala Ala Val Gly Leu Gly Ala85 90 95Leu Cys Tyr
Tyr Gly Leu Gly Met Ser Asn Glu Ile Gly Ala Ile Glu100 105 110Lys
Ala Val Ile Trp Pro Gln Tyr Val Lys Asp Arg Ile His Ser Thr115 120
125Tyr Met Tyr Leu Ala Gly Arg Tyr Cys Leu Thr Ala Leu Ser Ala
Leu130 135 140Ala Val Ala Arg Thr Pro Ala Leu Met Asn Phe Met Met
Thr Gly Ser145 150 155 160Trp Val Thr Ile Gly Ala Thr Phe Ala Ala
Met Ile Gly Ala Gly Met165 170 175Leu Val His Ser Ile Ser Tyr Glu
Gln Ser Pro Gly Pro Lys His Leu180
185 190Ala Trp Met Leu His Ser Gly Val Met Gly Ala Val Val Ala Pro
Leu195 200 205Thr Ile Leu Gly Gly Pro Leu Leu Leu Arg Ala Ala Trp
Tyr Thr Ala210 215 220Gly Ile Val Gly Gly Leu Ser Thr Val Ala Met
Cys Ala Pro Ser Glu225 230 235 240Lys Phe Leu Asn Met Gly Ala Pro
Leu Gly Val Gly Leu Gly Leu Val245 250 255Phe Ala Ser Ser Leu Gly
Ser Met Phe Leu Pro Pro Thr Ser Val Ala260 265 270Gly Ala Thr Leu
Tyr Ser Val Ala Met Tyr Gly Gly Leu Val Leu Phe275 280 285Ser Met
Phe Leu Leu Tyr Asp Thr Gln Lys Val Ile Lys Arg Ala Glu290 295
300Ile Thr Pro Met Tyr Gly Ala Gln Lys Tyr Asp Pro Ile Asn Ser
Met305 310 315 320Leu Thr Ile Tyr Met Asp Thr Leu Asn Ile Phe Met
Arg Val Ala Thr325 330 335Met Leu Ala Thr Gly Ser Asn Arg Lys
Lys340 345161038DNAHomo sapiensCDS(1)..(1035) 16atg ttg gct gca agg
ctg gtg tgt ctc cgg aca cta cct tct agg gtt 48Met Leu Ala Ala Arg
Leu Val Cys Leu Arg Thr Leu Pro Ser Arg Val1 5 10 15ttc cac cca gct
ttc acc aag gcc tcc cct gtt gtg aag aat tcc atc 96Phe His Pro Ala
Phe Thr Lys Ala Ser Pro Val Val Lys Asn Ser Ile20 25 30acg aag aat
caa tgg ctg tta aca cct agc agg gaa tat gcc acc aaa 144Thr Lys Asn
Gln Trp Leu Leu Thr Pro Ser Arg Glu Tyr Ala Thr Lys35 40 45aca aga
att ggg atc cgg cgt ggg aga act ggc caa gaa ctc aaa gag 192Thr Arg
Ile Gly Ile Arg Arg Gly Arg Thr Gly Gln Glu Leu Lys Glu50 55 60gca
gca ttg gaa cca tcg atg gaa aaa ata ttt aaa att gat cag atg 240Ala
Ala Leu Glu Pro Ser Met Glu Lys Ile Phe Lys Ile Asp Gln Met65 70 75
80gga aga tgg ttt gtt gct gga ggg gct gct gtt ggt ctt gga gca ttg
288Gly Arg Trp Phe Val Ala Gly Gly Ala Ala Val Gly Leu Gly Ala
Leu85 90 95tgc tac tat ggc ttg gga ctg tct aat gag att gga gct att
gaa aag 336Cys Tyr Tyr Gly Leu Gly Leu Ser Asn Glu Ile Gly Ala Ile
Glu Lys100 105 110gct gta att tgg cct cag tat gtc aag gat aga att
cat tcc acc tat 384Ala Val Ile Trp Pro Gln Tyr Val Lys Asp Arg Ile
His Ser Thr Tyr115 120 125atg tac tta gca ggg agt att ggt tta aca
gct ttg tct gcc ata gca 432Met Tyr Leu Ala Gly Ser Ile Gly Leu Thr
Ala Leu Ser Ala Ile Ala130 135 140atc agc aga acg cct gtt ctc atg
aac ttc atg atg aga ggc tct tgg 480Ile Ser Arg Thr Pro Val Leu Met
Asn Phe Met Met Arg Gly Ser Trp145 150 155 160gtg aca att ggt gtg
acc ttt gca gcc atg gtt gga gct gga atg ctg 528Val Thr Ile Gly Val
Thr Phe Ala Ala Met Val Gly Ala Gly Met Leu165 170 175gta cga tca
ata cca tat gac cag agc cca ggc cca aag cat ctt gct 576Val Arg Ser
Ile Pro Tyr Asp Gln Ser Pro Gly Pro Lys His Leu Ala180 185 190tgg
ttg cta cat tct ggt gtg atg ggt gca gtg gtg gct cct ctg aca 624Trp
Leu Leu His Ser Gly Val Met Gly Ala Val Val Ala Pro Leu Thr195 200
205ata tta ggg ggt cct ctt ctc atc aga gct gca tgg tac aca gct ggc
672Ile Leu Gly Gly Pro Leu Leu Ile Arg Ala Ala Trp Tyr Thr Ala
Gly210 215 220att gtg gga ggc ctc tcc act gtg gcc atg tgt gcg ccc
agt gaa aag 720Ile Val Gly Gly Leu Ser Thr Val Ala Met Cys Ala Pro
Ser Glu Lys225 230 235 240ttt ctg aac atg ggt gca ccc ctg gga gtg
ggc ctg ggt ctc gtc ttt 768Phe Leu Asn Met Gly Ala Pro Leu Gly Val
Gly Leu Gly Leu Val Phe245 250 255gtg tcc tca ttg gga tct atg ttt
ctt cca cct acc acc gtg gct ggt 816Val Ser Ser Leu Gly Ser Met Phe
Leu Pro Pro Thr Thr Val Ala Gly260 265 270gcc act ctt tac tca gtg
gca atg tac ggt gga tta gtt ctt ttc agc 864Ala Thr Leu Tyr Ser Val
Ala Met Tyr Gly Gly Leu Val Leu Phe Ser275 280 285atg ttc ctt ctg
tat gat acc cag aaa gta atc aag cgt gca gaa gta 912Met Phe Leu Leu
Tyr Asp Thr Gln Lys Val Ile Lys Arg Ala Glu Val290 295 300tca cca
atg tat gga gtt caa aaa tat gat ccc att aac tcg atg ctg 960Ser Pro
Met Tyr Gly Val Gln Lys Tyr Asp Pro Ile Asn Ser Met Leu305 310 315
320agt atc tac atg gat aca tta aat ata ttt atg cga gtt gca act atg
1008Ser Ile Tyr Met Asp Thr Leu Asn Ile Phe Met Arg Val Ala Thr
Met325 330 335ctg gca act gga ggc aac aga aag aaa tga 1038Leu Ala
Thr Gly Gly Asn Arg Lys Lys340 34517345PRTHomo sapiens 17Met Leu
Ala Ala Arg Leu Val Cys Leu Arg Thr Leu Pro Ser Arg Val1 5 10 15Phe
His Pro Ala Phe Thr Lys Ala Ser Pro Val Val Lys Asn Ser Ile20 25
30Thr Lys Asn Gln Trp Leu Leu Thr Pro Ser Arg Glu Tyr Ala Thr Lys35
40 45Thr Arg Ile Gly Ile Arg Arg Gly Arg Thr Gly Gln Glu Leu Lys
Glu50 55 60Ala Ala Leu Glu Pro Ser Met Glu Lys Ile Phe Lys Ile Asp
Gln Met65 70 75 80Gly Arg Trp Phe Val Ala Gly Gly Ala Ala Val Gly
Leu Gly Ala Leu85 90 95Cys Tyr Tyr Gly Leu Gly Leu Ser Asn Glu Ile
Gly Ala Ile Glu Lys100 105 110Ala Val Ile Trp Pro Gln Tyr Val Lys
Asp Arg Ile His Ser Thr Tyr115 120 125Met Tyr Leu Ala Gly Ser Ile
Gly Leu Thr Ala Leu Ser Ala Ile Ala130 135 140Ile Ser Arg Thr Pro
Val Leu Met Asn Phe Met Met Arg Gly Ser Trp145 150 155 160Val Thr
Ile Gly Val Thr Phe Ala Ala Met Val Gly Ala Gly Met Leu165 170
175Val Arg Ser Ile Pro Tyr Asp Gln Ser Pro Gly Pro Lys His Leu
Ala180 185 190Trp Leu Leu His Ser Gly Val Met Gly Ala Val Val Ala
Pro Leu Thr195 200 205Ile Leu Gly Gly Pro Leu Leu Ile Arg Ala Ala
Trp Tyr Thr Ala Gly210 215 220Ile Val Gly Gly Leu Ser Thr Val Ala
Met Cys Ala Pro Ser Glu Lys225 230 235 240Phe Leu Asn Met Gly Ala
Pro Leu Gly Val Gly Leu Gly Leu Val Phe245 250 255Val Ser Ser Leu
Gly Ser Met Phe Leu Pro Pro Thr Thr Val Ala Gly260 265 270Ala Thr
Leu Tyr Ser Val Ala Met Tyr Gly Gly Leu Val Leu Phe Ser275 280
285Met Phe Leu Leu Tyr Asp Thr Gln Lys Val Ile Lys Arg Ala Glu
Val290 295 300Ser Pro Met Tyr Gly Val Gln Lys Tyr Asp Pro Ile Asn
Ser Met Leu305 310 315 320Ser Ile Tyr Met Asp Thr Leu Asn Ile Phe
Met Arg Val Ala Thr Met325 330 335Leu Ala Thr Gly Gly Asn Arg Lys
Lys340 34518447DNAMus musculusCDS(1)..(444) 18atg agc acc tcg tct
gcg cgg cct gca gtc ctg gcc ctt gcc ggg ctg 48Met Ser Thr Ser Ser
Ala Arg Pro Ala Val Leu Ala Leu Ala Gly Leu1 5 10 15gct ctg ctc ctt
ctg ctg tgc ctg ggt cca gat ggc ata agt gga aac 96Ala Leu Leu Leu
Leu Leu Cys Leu Gly Pro Asp Gly Ile Ser Gly Asn20 25 30aaa ctc aag
aag atg ctc cag aaa cga gaa gga cct gtc ccg tca aag 144Lys Leu Lys
Lys Met Leu Gln Lys Arg Glu Gly Pro Val Pro Ser Lys35 40 45act aat
gta gct gta gcc gag aac aca gca aag gaa ttc cta ggt ggc 192Thr Asn
Val Ala Val Ala Glu Asn Thr Ala Lys Glu Phe Leu Gly Gly50 55 60ctg
aag cgt gcc aaa cga cag ctg tgg gac cgt acg cgg cct gag gta 240Leu
Lys Arg Ala Lys Arg Gln Leu Trp Asp Arg Thr Arg Pro Glu Val65 70 75
80cag cag tgg tac cag cag ttc ctc tac atg ggc ttt gat gag gct aaa
288Gln Gln Trp Tyr Gln Gln Phe Leu Tyr Met Gly Phe Asp Glu Ala
Lys85 90 95ttt gaa gat gat gtc aac tat tgg cta aac aga aat cga aac
ggc cat 336Phe Glu Asp Asp Val Asn Tyr Trp Leu Asn Arg Asn Arg Asn
Gly His100 105 110gac tac tat ggt gac tac tac cag cgt cat tat gat
gaa gat gcg gcc 384Asp Tyr Tyr Gly Asp Tyr Tyr Gln Arg His Tyr Asp
Glu Asp Ala Ala115 120 125att ggt ccc cac agc cgg gaa agc ttc agg
cat gga gcc agt gtg aac 432Ile Gly Pro His Ser Arg Glu Ser Phe Arg
His Gly Ala Ser Val Asn130 135 140tat gat gac tat taa 447Tyr Asp
Asp Tyr14519148PRTMus musculus 19Met Ser Thr Ser Ser Ala Arg Pro
Ala Val Leu Ala Leu Ala Gly Leu1 5 10 15Ala Leu Leu Leu Leu Leu Cys
Leu Gly Pro Asp Gly Ile Ser Gly Asn20 25 30Lys Leu Lys Lys Met Leu
Gln Lys Arg Glu Gly Pro Val Pro Ser Lys35 40 45Thr Asn Val Ala Val
Ala Glu Asn Thr Ala Lys Glu Phe Leu Gly Gly50 55 60Leu Lys Arg Ala
Lys Arg Gln Leu Trp Asp Arg Thr Arg Pro Glu Val65 70 75 80Gln Gln
Trp Tyr Gln Gln Phe Leu Tyr Met Gly Phe Asp Glu Ala Lys85 90 95Phe
Glu Asp Asp Val Asn Tyr Trp Leu Asn Arg Asn Arg Asn Gly His100 105
110Asp Tyr Tyr Gly Asp Tyr Tyr Gln Arg His Tyr Asp Glu Asp Ala
Ala115 120 125Ile Gly Pro His Ser Arg Glu Ser Phe Arg His Gly Ala
Ser Val Asn130 135 140Tyr Asp Asp Tyr14520447DNAHomo
sapiensCDS(1)..(444) 20atg gct gcc tcc ccc gcg cgg cct gct gtc ctg
gcc ctg acc ggg ctg 48Met Ala Ala Ser Pro Ala Arg Pro Ala Val Leu
Ala Leu Thr Gly Leu1 5 10 15gcg ctg ctc ctg ctc ctg tgc tgg ggc cca
ggt ggc ata agt gga aat 96Ala Leu Leu Leu Leu Leu Cys Trp Gly Pro
Gly Gly Ile Ser Gly Asn20 25 30aaa ctc aag ctg atg ctt caa aaa cga
gaa gca cct gtt cca act aag 144Lys Leu Lys Leu Met Leu Gln Lys Arg
Glu Ala Pro Val Pro Thr Lys35 40 45act aaa gtg gcc gtt gat gag aat
aaa gcc aaa gaa ttc ctt ggc agc 192Thr Lys Val Ala Val Asp Glu Asn
Lys Ala Lys Glu Phe Leu Gly Ser50 55 60ctg aag cgc cag aag cgg cag
ctg tgg gac cgg act cgg ccc gag gtg 240Leu Lys Arg Gln Lys Arg Gln
Leu Trp Asp Arg Thr Arg Pro Glu Val65 70 75 80cag cag tgg tac cag
cag ttt ctc tac atg ggc ttt gac gaa gcg aaa 288Gln Gln Trp Tyr Gln
Gln Phe Leu Tyr Met Gly Phe Asp Glu Ala Lys85 90 95ttt gaa gat gac
atc acc tat tgg ctt aac aga gat cga aat gga cat 336Phe Glu Asp Asp
Ile Thr Tyr Trp Leu Asn Arg Asp Arg Asn Gly His100 105 110gaa tac
tat ggc gat tac tac caa cgt cac tat gat gaa gac tct gca 384Glu Tyr
Tyr Gly Asp Tyr Tyr Gln Arg His Tyr Asp Glu Asp Ser Ala115 120
125att ggt ccc cgg agc ccc tac ggc ttt agg cat gga gcc agc gtc aac
432Ile Gly Pro Arg Ser Pro Tyr Gly Phe Arg His Gly Ala Ser Val
Asn130 135 140tac gat gac tac taa 447Tyr Asp Asp Tyr14521148PRTHomo
sapiens 21Met Ala Ala Ser Pro Ala Arg Pro Ala Val Leu Ala Leu Thr
Gly Leu1 5 10 15Ala Leu Leu Leu Leu Leu Cys Trp Gly Pro Gly Gly Ile
Ser Gly Asn20 25 30Lys Leu Lys Leu Met Leu Gln Lys Arg Glu Ala Pro
Val Pro Thr Lys35 40 45Thr Lys Val Ala Val Asp Glu Asn Lys Ala Lys
Glu Phe Leu Gly Ser50 55 60Leu Lys Arg Gln Lys Arg Gln Leu Trp Asp
Arg Thr Arg Pro Glu Val65 70 75 80Gln Gln Trp Tyr Gln Gln Phe Leu
Tyr Met Gly Phe Asp Glu Ala Lys85 90 95Phe Glu Asp Asp Ile Thr Tyr
Trp Leu Asn Arg Asp Arg Asn Gly His100 105 110Glu Tyr Tyr Gly Asp
Tyr Tyr Gln Arg His Tyr Asp Glu Asp Ser Ala115 120 125Ile Gly Pro
Arg Ser Pro Tyr Gly Phe Arg His Gly Ala Ser Val Asn130 135 140Tyr
Asp Asp Tyr145223132DNAMus musculusCDS(630)..(1358) 22gggggtctgc
atctccatcg gaaagtgcgc tggccacatc ccttcggcct ccgggcagtg 60ttctgtctcc
cttagctcag gcagcgagaa acttcagctg tgaagtggtg gtggagagag
120ccctgggagc agcgactgga cccggacacc aagaagagag tggacgcgcc
cctcgactag 180gaatcgctct cgcaggcgga gacccagcat ctcagcgcct
gcggtcgcgc ttgcccggcc 240gcgcgctttt gctaggcgcc gccagccccg
aaggaccctc ggggtccgcg gacccttctg 300cagccggcgg aatcctaaag
ctgccaagag ctcccggcgg gtgtcggcaa actttttccg 360agcccacgtg
ctgaccaaac agcccggctc gcttccagag cctggcatgg agcgccgcgc
420ctaggcacgc cgtgcagccc gagagacgcg agcgcacggt tcaccgtgga
gggagagatg 480ctcatcgagc caaattgatc attgcagccc cagggcagtg
acatctgtct ctgagtcctc 540cctaggagcg cgacccgcac tgtctccttc
caggagcccg tcatttcctc gacttttgag 600aggtgtctct ccccagcccg accgtccag
atg cgt ttt tgc ctc ttc tca ttt 653Met Arg Phe Cys Leu Phe Ser Phe1
5gcc ctc atc att ctg aac tgt atg gat tac agc cag tgc caa ggc aac
701Ala Leu Ile Ile Leu Asn Cys Met Asp Tyr Ser Gln Cys Gln Gly
Asn10 15 20cga tgg aga cgc aat aag cga gct agt tat gta tca aat ccc
att tgc 749Arg Trp Arg Arg Asn Lys Arg Ala Ser Tyr Val Ser Asn Pro
Ile Cys25 30 35 40aag ggt tgt ttg tct tgt tcg aag gac aat ggt tgc
agc cga tgt caa 797Lys Gly Cys Leu Ser Cys Ser Lys Asp Asn Gly Cys
Ser Arg Cys Gln45 50 55cag aag ttg ttc ttt ttc ctt cga aga gaa gga
atg cgt cag tat gga 845Gln Lys Leu Phe Phe Phe Leu Arg Arg Glu Gly
Met Arg Gln Tyr Gly60 65 70gag tgc ctg cat tcc tgc cca tca ggg tat
tat gga cac cga gcc cca 893Glu Cys Leu His Ser Cys Pro Ser Gly Tyr
Tyr Gly His Arg Ala Pro75 80 85gat atg aac aga tgt gca cga tgc aga
ata gaa aac tgt gat tct tgc 941Asp Met Asn Arg Cys Ala Arg Cys Arg
Ile Glu Asn Cys Asp Ser Cys90 95 100ttt agc aaa gac ttt tgt acg aag
tgc aaa gta ggc ttt tat ttg cat 989Phe Ser Lys Asp Phe Cys Thr Lys
Cys Lys Val Gly Phe Tyr Leu His105 110 115 120aga ggc cgc tgc ttt
gat gaa tgt cca gat ggt ttt gca ccg tta gat 1037Arg Gly Arg Cys Phe
Asp Glu Cys Pro Asp Gly Phe Ala Pro Leu Asp125 130 135gag act atg
gaa tgt gta gaa ggt tgt gaa gtt ggt cat tgg agc gaa 1085Glu Thr Met
Glu Cys Val Glu Gly Cys Glu Val Gly His Trp Ser Glu140 145 150tgg
gga acg tgt agc aga aac aac cgc acg tgt gga ttt aaa tgg ggt 1133Trp
Gly Thr Cys Ser Arg Asn Asn Arg Thr Cys Gly Phe Lys Trp Gly155 160
165ctg gaa acc aga aca cgg cag att gtt aaa aag cca gca aaa gac aca
1181Leu Glu Thr Arg Thr Arg Gln Ile Val Lys Lys Pro Ala Lys Asp
Thr170 175 180ata cca tgt ccg acc att gcg gag tcc agg aga tgc aag
atg gcc atg 1229Ile Pro Cys Pro Thr Ile Ala Glu Ser Arg Arg Cys Lys
Met Ala Met185 190 195 200agg cac tgt cca gga gga aag aga aca cca
aag gca aaa gag aag aga 1277Arg His Cys Pro Gly Gly Lys Arg Thr Pro
Lys Ala Lys Glu Lys Arg205 210 215aac aag aag aag agg cgg aag ctg
att gag aga gcc caa gag cag cac 1325Asn Lys Lys Lys Arg Arg Lys Leu
Ile Glu Arg Ala Gln Glu Gln His220 225 230agc gtc ttc ctc gct aca
gac aga gtg aac caa taaaatacaa gaaatagctg 1378Ser Val Phe Leu Ala
Thr Asp Arg Val Asn Gln235 240gggcattttg aggttttctg ttttgtttat
gttgttgttt tgcaaaagtg cacaaagcta 1438ctctccagtc cacactggtg
gacagcattc ctgatcctct gaccagtatc cattttcagt 1498aatgctgcag
agggaggtgc ccaagcatgg actcagcgtt atttatgctt tgattggaat
1558ctggggcctg tgatggcagg agcttgttga gctgagtcag cgggagctga
tgcatctgta 1618ctcttgtgat gagcacagtg tgtcataaga acctgtccct
ggcacggtgg acccacagga 1678ggcacaaggc tgtagatcac caccagagaa
tgcacctgtg cctattttga tggatggcaa 1738tgctaagcaa gcaagcactg
ttcacttgtg actttcattt ctcacactgt gcactgtcaa 1798agacaaatgt
gcatggaaaa atgtttagtg tcacctcatg gcgttctcag catcagtgac
1858cttcaaacgg tcctacaatg agactgtgtt ctagctaggg gtatgctgtg
gaaattcctg 1918ctacatttca tcttagtgct aacatgtaca gattctgctg
cgctacattc aaagctcatt 1978actgtatatt tatgctttct ctgtgtaaca
agttatacct gataagatgt cactttgttt 2038ctagtgattc ttaaccatgg
tctggtacat ggctattcta gttttggaaa ttaacaagtg 2098ttttgttgcc
tcttgttttc ttttgttcct atcatttttg gcgggggttg ggtgggcttg
2158attctaaccg taagtatagg ataagctagt tttgtatata gagtcaaatg
actgatgtca 2218gaggatcagt gctgatagaa cttccccagt tcatgtcacg
atacacacag agagaaagca 2278gcatgaggca tcttgccatc agaagccaaa
tttcttttga gtcccaaaat tgatgactta 2338tgaaatatag ctgaaaacaa
gatttgggtg tagttacttg tatttattat acaatttcca 2398attacatttt
ttttcaaact caaaataacc catgactttg agtgataggt cacttggcaa
2458tgttcttgaa ttactgggga agctgttgtc actaagataa tgagagagaa
aatagaatgg 2518cttcgcccaa gtgagagcca catcttacat ttctctgttg
aatcggaatc aactatatta 2578gaacagaagc ctgatagaag ctttctagtt
aacacacaca aggccatggt ttcaaaaaca 2638tctttgtccc cttaggtcag
tttgtcctta gattatgaat tggcaggttc taattgcatt 2698atttccctgg
ctgatccagg aaaaagttag aacaaaataa
gttgcatagt tttgaggaaa 2758catccaaagc aaggcgaagc ctttccttgc
cttgcattgg caaaactacc tctttagcat 2818ttatgttgat tcagaaacat
cttgctgata tgtgtagatg ttttaagctt cattgtgaaa 2878atattgatgc
aagataagcc atatatgaat gttgtattca actttagggc ttgaaattaa
2938tcctaaagtg ttcacctctc tccatgtcta tttacactct gttcctattt
actaagaggg 2998taggggtctc cttaatatca tacttcattg ttaataagtc
aatgcttgtt atgtttcttg 3058gctgttgttt ttgtgcatta aaaactcaaa
attggaaaaa aaaaaaaaaa aaaaaaaaaa 3118aaaaaaaaaa aaaa
313223243PRTMus musculus 23Met Arg Phe Cys Leu Phe Ser Phe Ala Leu
Ile Ile Leu Asn Cys Met1 5 10 15Asp Tyr Ser Gln Cys Gln Gly Asn Arg
Trp Arg Arg Asn Lys Arg Ala20 25 30Ser Tyr Val Ser Asn Pro Ile Cys
Lys Gly Cys Leu Ser Cys Ser Lys35 40 45Asp Asn Gly Cys Ser Arg Cys
Gln Gln Lys Leu Phe Phe Phe Leu Arg50 55 60Arg Glu Gly Met Arg Gln
Tyr Gly Glu Cys Leu His Ser Cys Pro Ser65 70 75 80Gly Tyr Tyr Gly
His Arg Ala Pro Asp Met Asn Arg Cys Ala Arg Cys85 90 95Arg Ile Glu
Asn Cys Asp Ser Cys Phe Ser Lys Asp Phe Cys Thr Lys100 105 110Cys
Lys Val Gly Phe Tyr Leu His Arg Gly Arg Cys Phe Asp Glu Cys115 120
125Pro Asp Gly Phe Ala Pro Leu Asp Glu Thr Met Glu Cys Val Glu
Gly130 135 140Cys Glu Val Gly His Trp Ser Glu Trp Gly Thr Cys Ser
Arg Asn Asn145 150 155 160Arg Thr Cys Gly Phe Lys Trp Gly Leu Glu
Thr Arg Thr Arg Gln Ile165 170 175Val Lys Lys Pro Ala Lys Asp Thr
Ile Pro Cys Pro Thr Ile Ala Glu180 185 190Ser Arg Arg Cys Lys Met
Ala Met Arg His Cys Pro Gly Gly Lys Arg195 200 205Thr Pro Lys Ala
Lys Glu Lys Arg Asn Lys Lys Lys Arg Arg Lys Leu210 215 220Ile Glu
Arg Ala Gln Glu Gln His Ser Val Phe Leu Ala Thr Asp Arg225 230 235
240Val Asn Gln24843DNAMus musculusCDS(132)..(506) 24ggccattatg
gccgggggct ttcgccgtcc gggagctgac cggccgtgtt cctctctcgt 60cttcctctgc
gccccgcgtc cccgccctcg cgaccccggc tctcctggac tcggcgccgc
120caacctgggc g atg ccc cgc tac gag ttg gct ttg att ctg aaa gcc atg
170Met Pro Arg Tyr Glu Leu Ala Leu Ile Leu Lys Ala Met1 5 10cgg cgg
cca gag acc gct gct gct ttg aaa cgt aca ata gaa tcc ctg 218Arg Arg
Pro Glu Thr Ala Ala Ala Leu Lys Arg Thr Ile Glu Ser Leu15 20 25atg
gac cga gga gcc ata gtg agg aac ttg gaa agc ctg ggt gag cgt 266Met
Asp Arg Gly Ala Ile Val Arg Asn Leu Glu Ser Leu Gly Glu Arg30 35 40
45gcg ctc ccc tac agg atc tcg agt cac agc cag cag cac agc cga gga
314Ala Leu Pro Tyr Arg Ile Ser Ser His Ser Gln Gln His Ser Arg
Gly50 55 60ggg tat ttc ctg gtg gat ttt tat gct ccg aca agt gct gtg
gag aac 362Gly Tyr Phe Leu Val Asp Phe Tyr Ala Pro Thr Ser Ala Val
Glu Asn65 70 75ata ctg gaa cac ttg gcg cga gac att gac gtg gtt aga
cca aat att 410Ile Leu Glu His Leu Ala Arg Asp Ile Asp Val Val Arg
Pro Asn Ile80 85 90gtg aaa cac cct ctg acc cag gaa gta aaa gag tgt
gac ggc ata gtc 458Val Lys His Pro Leu Thr Gln Glu Val Lys Glu Cys
Asp Gly Ile Val95 100 105cca gtc cca ctt gaa gaa aaa ctg tat tca
aca aag agg agg aag aag 506Pro Val Pro Leu Glu Glu Lys Leu Tyr Ser
Thr Lys Arg Arg Lys Lys110 115 120 125tgagaagatt caccagattc
tggccttata tttaatccta agggcactat gggtgctgct 566aggttgttgt
ctaggatact ttagcccatg accattttgc tgcaggaggt agaaactgct
626ggccgagacc tgccctgatg tctctgctga gatttcatcc cacttgtggg
gtttgtcggg 686agtgggggtg ttcacagtac cactgtagcg tttccaagag
caaaatgttt gtcattcaca 746cttggttgtc ttgcaagcct atatggaaca
ctgggagcag agtaataaac atgactttat 806caacactgga aaaaaaaaaa
aaaaaaaaaa aaaaaaa 84325125PRTMus musculus 25Met Pro Arg Tyr Glu
Leu Ala Leu Ile Leu Lys Ala Met Arg Arg Pro1 5 10 15Glu Thr Ala Ala
Ala Leu Lys Arg Thr Ile Glu Ser Leu Met Asp Arg20 25 30Gly Ala Ile
Val Arg Asn Leu Glu Ser Leu Gly Glu Arg Ala Leu Pro35 40 45Tyr Arg
Ile Ser Ser His Ser Gln Gln His Ser Arg Gly Gly Tyr Phe50 55 60Leu
Val Asp Phe Tyr Ala Pro Thr Ser Ala Val Glu Asn Ile Leu Glu65 70 75
80His Leu Ala Arg Asp Ile Asp Val Val Arg Pro Asn Ile Val Lys His85
90 95Pro Leu Thr Gln Glu Val Lys Glu Cys Asp Gly Ile Val Pro Val
Pro100 105 110Leu Glu Glu Lys Leu Tyr Ser Thr Lys Arg Arg Lys
Lys115 120 125262490DNAMus musculusCDS(1)..(2487) 26atg aag ccg ccc
ggc agc atc tcc cgg cgg ccg acc ctg acg ggt tgc 48Met Lys Pro Pro
Gly Ser Ile Ser Arg Arg Pro Thr Leu Thr Gly Cys1 5 10 15agc ctt ccc
ggc gcc tcc tgc ggc ccc ggc cgc tgc ccc gcc ggc ccg 96Ser Leu Pro
Gly Ala Ser Cys Gly Pro Gly Arg Cys Pro Ala Gly Pro20 25 30gtg ccg
gcc cgc gcg ccg ccc tgc cgc ctg ctc ctc gtc ctt ctc ctg 144Val Pro
Ala Arg Ala Pro Pro Cys Arg Leu Leu Leu Val Leu Leu Leu35 40 45cta
cct gcg ctc gcc acc tca tcc cgg ccc cgt gcc cgg ggg gcc gct 192Leu
Pro Ala Leu Ala Thr Ser Ser Arg Pro Arg Ala Arg Gly Ala Ala50 55
60gcg ccc agc gct ccg cac tgg aat gaa act gca gaa aaa acc ctg gga
240Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala Glu Lys Thr Leu
Gly65 70 75 80gtc ctg gca gat gaa gac aac aca ttg caa caa aat agc
agc agc aga 288Val Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln Asn Ser
Ser Ser Arg85 90 95aat acc agc tac agc agt gca gtg caa aaa gaa atc
aca ctg cct tca 336Asn Thr Ser Tyr Ser Ser Ala Val Gln Lys Glu Ile
Thr Leu Pro Ser100 105 110aga ctg gtg tat tac atc aac cag gac tca
gaa agc ccc tat cat gtt 384Arg Leu Val Tyr Tyr Ile Asn Gln Asp Ser
Glu Ser Pro Tyr His Val115 120 125ctt gac aca aag gcc aga cac caa
cag aaa cac aat aag gct gtg cat 432Leu Asp Thr Lys Ala Arg His Gln
Gln Lys His Asn Lys Ala Val His130 135 140ctg gcc cag gca agc ttc
cag atc gaa gct ttc ggc tcc aag ttc att 480Leu Ala Gln Ala Ser Phe
Gln Ile Glu Ala Phe Gly Ser Lys Phe Ile145 150 155 160ctt gac ctc
aca ctg aac aat ggt ttg cta tct tct gac tac gtg gag 528Leu Asp Leu
Thr Leu Asn Asn Gly Leu Leu Ser Ser Asp Tyr Val Glu165 170 175atc
cac tat gaa gac ggg aag cag atg tac tct aag ggt gga gag cac 576Ile
His Tyr Glu Asp Gly Lys Gln Met Tyr Ser Lys Gly Gly Glu His180 185
190tgt tac tac cac gga agc atc aga ggc gtc aag gat tcc agg gtg gct
624Cys Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp Ser Arg Val
Ala195 200 205cta tcg acc tgc aat gga ctc cat ggc atg ttt gag gat
gac acc ttt 672Leu Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp
Asp Thr Phe210 215 220gtg tat atg ata gag cct ctg gaa ctg act gat
gat gag aaa agc aca 720Val Tyr Met Ile Glu Pro Leu Glu Leu Thr Asp
Asp Glu Lys Ser Thr225 230 235 240ggc cga ccg cac ata atc cag aaa
acc ttg gca gga cag tat tct aag 768Gly Arg Pro His Ile Ile Gln Lys
Thr Leu Ala Gly Gln Tyr Ser Lys245 250 255cag atg aag aat ctc agc
aca gat ggc agt gac cag tgg cct ttg cta 816Gln Met Lys Asn Leu Ser
Thr Asp Gly Ser Asp Gln Trp Pro Leu Leu260 265 270cct gaa tta caa
tgg ctg aga aga agg aaa aga gcg gtc aat cca tct 864Pro Glu Leu Gln
Trp Leu Arg Arg Arg Lys Arg Ala Val Asn Pro Ser275 280 285cgt ggt
gtg ttt gaa gaa atg aag tat ttg gag ctt atg att gtt aat 912Arg Gly
Val Phe Glu Glu Met Lys Tyr Leu Glu Leu Met Ile Val Asn290 295
300gat cac aag acg tat aag aag cac cgc tct tct cac gcg cat acc aac
960Asp His Lys Thr Tyr Lys Lys His Arg Ser Ser His Ala His Thr
Asn305 310 315 320aac ttc gca aag tct gtg gtc aac ctt gta gat tct
att tac aag gaa 1008Asn Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser
Ile Tyr Lys Glu325 330 335cag ctc aac acc agg gtt gtc ctg gtg gct
gtc gag acc tgg acc gag 1056Gln Leu Asn Thr Arg Val Val Leu Val Ala
Val Glu Thr Trp Thr Glu340 345 350aag gat cac att gac atc acc atc
aac ccc gtg cag atg cta cat gac 1104Lys Asp His Ile Asp Ile Thr Ile
Asn Pro Val Gln Met Leu His Asp355 360 365ttc tcc aag tac cgg cag
cga atc aaa cag cac gct gac gcg gtc cac 1152Phe Ser Lys Tyr Arg Gln
Arg Ile Lys Gln His Ala Asp Ala Val His370 375 380ctc atc tcg cgc
gtg aca ttc cat tat aag aga agc agt ctg agt tac 1200Leu Ile Ser Arg
Val Thr Phe His Tyr Lys Arg Ser Ser Leu Ser Tyr385 390 395 400ttt
gga ggc gtg tgt tct cga ata aga ggg gtt ggt gtg aat gag tat 1248Phe
Gly Gly Val Cys Ser Arg Ile Arg Gly Val Gly Val Asn Glu Tyr405 410
415ggt ctt cca atg gcg gtg gca caa gta tta tca cag agc ctg gct caa
1296Gly Leu Pro Met Ala Val Ala Gln Val Leu Ser Gln Ser Leu Ala
Gln420 425 430aac ctt gga atc cag tgg gaa cct tcg agc agg aag cca
aaa tgt gaa 1344Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro
Lys Cys Glu435 440 445tgc ata gag tcc tgg ggc ggc tgc atc atg gaa
gaa aca ggg gtg tcc 1392Cys Ile Glu Ser Trp Gly Gly Cys Ile Met Glu
Glu Thr Gly Val Ser450 455 460cac tct cga aag ttc tca aag tgc agc
att ttg gag tac aga gac ttt 1440His Ser Arg Lys Phe Ser Lys Cys Ser
Ile Leu Glu Tyr Arg Asp Phe465 470 475 480tta cag aga ggt ggc gga
gca tgt ctt ttc aat agg cca act aag ctg 1488Leu Gln Arg Gly Gly Gly
Ala Cys Leu Phe Asn Arg Pro Thr Lys Leu485 490 495ttt gag ccc acg
gaa tgt gga aat gga tat gtg gag gcc ggg gag gaa 1536Phe Glu Pro Thr
Glu Cys Gly Asn Gly Tyr Val Glu Ala Gly Glu Glu500 505 510tgc gac
tgt ggt ttc cat gtg gaa tgc tat gga gtt tgc tgt aag aag 1584Cys Asp
Cys Gly Phe His Val Glu Cys Tyr Gly Val Cys Cys Lys Lys515 520
525tgt tcg ctc tcc aat ggg gcc cac tgc agt gac ggc ccc tgc tgt aac
1632Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly Pro Cys Cys
Asn530 535 540aac acc tca tgt ctt ttt cag tca cga ggg tat gaa tgt
cgg gat gcc 1680Asn Thr Ser Cys Leu Phe Gln Ser Arg Gly Tyr Glu Cys
Arg Asp Ala545 550 555 560gta aac agc tgt gat atc acc gag tac tgc
act gga gac tct ggc cag 1728Val Asn Ser Cys Asp Ile Thr Glu Tyr Cys
Thr Gly Asp Ser Gly Gln565 570 575tgc cca ccg aac ctc cat aaa caa
gat ggc tat agc tgc aat caa aat 1776Cys Pro Pro Asn Leu His Lys Gln
Asp Gly Tyr Ser Cys Asn Gln Asn580 585 590cag ggt cgc tgc tac aat
ggc gag tgc aag aca agg gac aat caa tgc 1824Gln Gly Arg Cys Tyr Asn
Gly Glu Cys Lys Thr Arg Asp Asn Gln Cys595 600 605cag tac atc tgg
ggg aca aag gct gcg ggg tca gac aag ttc tgc tat 1872Gln Tyr Ile Trp
Gly Thr Lys Ala Ala Gly Ser Asp Lys Phe Cys Tyr610 615 620gaa aag
ctg aac acg gaa ggc acc gag aag ggc aat tgt gga aag gat 1920Glu Lys
Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys Gly Lys Asp625 630 635
640gga gac cgg tgg atc ccg tgc agc aag cat gat gtg ttc tgt gga ttt
1968Gly Asp Arg Trp Ile Pro Cys Ser Lys His Asp Val Phe Cys Gly
Phe645 650 655ctg ctt tgc acc aat ctt acc cga gct cca cgt atc ggt
caa ctt caa 2016Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro Arg Ile Gly
Gln Leu Gln660 665 670gga gag atc atc ccg act tcc ttc tat cat caa
ggc cga gtg att gac 2064Gly Glu Ile Ile Pro Thr Ser Phe Tyr His Gln
Gly Arg Val Ile Asp675 680 685tgc agt ggt gct cat gta gtt tta gac
gat gat aca gac gtg ggt tac 2112Cys Ser Gly Ala His Val Val Leu Asp
Asp Asp Thr Asp Val Gly Tyr690 695 700gtt gaa gat ggg act ccg tgt
ggc ccc tcc atg atg tgc tta gat cgg 2160Val Glu Asp Gly Thr Pro Cys
Gly Pro Ser Met Met Cys Leu Asp Arg705 710 715 720aag tgc cta cag
att caa gcc ctg aat atg agc agc tgc cca ctt gac 2208Lys Cys Leu Gln
Ile Gln Ala Leu Asn Met Ser Ser Cys Pro Leu Asp725 730 735tca agg
ggt aaa gtc tgc tcc ggc cac ggg gtg tgt agc aac gaa gcc 2256Ser Arg
Gly Lys Val Cys Ser Gly His Gly Val Cys Ser Asn Glu Ala740 745
750acc tgc atc tgt gat ttc act tgg gca ggc aca gac tgc agc atc cgg
2304Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys Ser Ile
Arg755 760 765gat cca gtt cgg aac ccc aac ccc cct aag gat gaa ggc
cct aag ggt 2352Asp Pro Val Arg Asn Pro Asn Pro Pro Lys Asp Glu Gly
Pro Lys Gly770 775 780cct agc gcc acc aat ctc ata ata ggc tcc atc
gct ggt gcc atc ctg 2400Pro Ser Ala Thr Asn Leu Ile Ile Gly Ser Ile
Ala Gly Ala Ile Leu785 790 795 800gta gca gct att gtc ctt ggg ggc
aca ggc tgg gga ttt aaa aac gtc 2448Val Ala Ala Ile Val Leu Gly Gly
Thr Gly Trp Gly Phe Lys Asn Val805 810 815aag aag agg aga ttc gat
ccc act cag caa ggc ccc atc tga 2490Lys Lys Arg Arg Phe Asp Pro Thr
Gln Gln Gly Pro Ile820 82527829PRTMus musculus 27Met Lys Pro Pro
Gly Ser Ile Ser Arg Arg Pro Thr Leu Thr Gly Cys1 5 10 15Ser Leu Pro
Gly Ala Ser Cys Gly Pro Gly Arg Cys Pro Ala Gly Pro20 25 30Val Pro
Ala Arg Ala Pro Pro Cys Arg Leu Leu Leu Val Leu Leu Leu35 40 45Leu
Pro Ala Leu Ala Thr Ser Ser Arg Pro Arg Ala Arg Gly Ala Ala50 55
60Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala Glu Lys Thr Leu Gly65
70 75 80Val Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln Asn Ser Ser Ser
Arg85 90 95Asn Thr Ser Tyr Ser Ser Ala Val Gln Lys Glu Ile Thr Leu
Pro Ser100 105 110Arg Leu Val Tyr Tyr Ile Asn Gln Asp Ser Glu Ser
Pro Tyr His Val115 120 125Leu Asp Thr Lys Ala Arg His Gln Gln Lys
His Asn Lys Ala Val His130 135 140Leu Ala Gln Ala Ser Phe Gln Ile
Glu Ala Phe Gly Ser Lys Phe Ile145 150 155 160Leu Asp Leu Thr Leu
Asn Asn Gly Leu Leu Ser Ser Asp Tyr Val Glu165 170 175Ile His Tyr
Glu Asp Gly Lys Gln Met Tyr Ser Lys Gly Gly Glu His180 185 190Cys
Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp Ser Arg Val Ala195 200
205Leu Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp Asp Thr
Phe210 215 220Val Tyr Met Ile Glu Pro Leu Glu Leu Thr Asp Asp Glu
Lys Ser Thr225 230 235 240Gly Arg Pro His Ile Ile Gln Lys Thr Leu
Ala Gly Gln Tyr Ser Lys245 250 255Gln Met Lys Asn Leu Ser Thr Asp
Gly Ser Asp Gln Trp Pro Leu Leu260 265 270Pro Glu Leu Gln Trp Leu
Arg Arg Arg Lys Arg Ala Val Asn Pro Ser275 280 285Arg Gly Val Phe
Glu Glu Met Lys Tyr Leu Glu Leu Met Ile Val Asn290 295 300Asp His
Lys Thr Tyr Lys Lys His Arg Ser Ser His Ala His Thr Asn305 310 315
320Asn Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser Ile Tyr Lys
Glu325 330 335Gln Leu Asn Thr Arg Val Val Leu Val Ala Val Glu Thr
Trp Thr Glu340 345 350Lys Asp His Ile Asp Ile Thr Ile Asn Pro Val
Gln Met Leu His Asp355 360 365Phe Ser Lys Tyr Arg Gln Arg Ile Lys
Gln His Ala Asp Ala Val His370 375 380Leu Ile Ser Arg Val Thr Phe
His Tyr Lys Arg Ser Ser Leu Ser Tyr385 390 395 400Phe Gly Gly Val
Cys Ser Arg Ile Arg Gly Val Gly Val Asn Glu Tyr405 410 415Gly Leu
Pro Met Ala Val Ala Gln Val Leu Ser Gln Ser Leu Ala Gln420 425
430Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro Lys Cys
Glu435 440 445Cys Ile Glu Ser Trp Gly Gly Cys Ile Met Glu Glu Thr
Gly Val Ser450 455 460His Ser Arg Lys Phe Ser Lys Cys Ser Ile Leu
Glu Tyr Arg Asp Phe465 470 475 480Leu Gln Arg Gly Gly Gly Ala Cys
Leu Phe Asn Arg Pro Thr Lys Leu485 490 495Phe Glu Pro Thr Glu Cys
Gly Asn Gly Tyr Val Glu Ala Gly Glu Glu500 505 510Cys Asp Cys Gly
Phe His Val Glu Cys Tyr Gly Val Cys Cys Lys
Lys515 520 525Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly Pro
Cys Cys Asn530 535 540Asn Thr Ser Cys Leu Phe Gln Ser Arg Gly Tyr
Glu Cys Arg Asp Ala545 550 555 560Val Asn Ser Cys Asp Ile Thr Glu
Tyr Cys Thr Gly Asp Ser Gly Gln565 570 575Cys Pro Pro Asn Leu His
Lys Gln Asp Gly Tyr Ser Cys Asn Gln Asn580 585 590Gln Gly Arg Cys
Tyr Asn Gly Glu Cys Lys Thr Arg Asp Asn Gln Cys595 600 605Gln Tyr
Ile Trp Gly Thr Lys Ala Ala Gly Ser Asp Lys Phe Cys Tyr610 615
620Glu Lys Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys Gly Lys
Asp625 630 635 640Gly Asp Arg Trp Ile Pro Cys Ser Lys His Asp Val
Phe Cys Gly Phe645 650 655Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro
Arg Ile Gly Gln Leu Gln660 665 670Gly Glu Ile Ile Pro Thr Ser Phe
Tyr His Gln Gly Arg Val Ile Asp675 680 685Cys Ser Gly Ala His Val
Val Leu Asp Asp Asp Thr Asp Val Gly Tyr690 695 700Val Glu Asp Gly
Thr Pro Cys Gly Pro Ser Met Met Cys Leu Asp Arg705 710 715 720Lys
Cys Leu Gln Ile Gln Ala Leu Asn Met Ser Ser Cys Pro Leu Asp725 730
735Ser Arg Gly Lys Val Cys Ser Gly His Gly Val Cys Ser Asn Glu
Ala740 745 750Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys
Ser Ile Arg755 760 765Asp Pro Val Arg Asn Pro Asn Pro Pro Lys Asp
Glu Gly Pro Lys Gly770 775 780Pro Ser Ala Thr Asn Leu Ile Ile Gly
Ser Ile Ala Gly Ala Ile Leu785 790 795 800Val Ala Ala Ile Val Leu
Gly Gly Thr Gly Trp Gly Phe Lys Asn Val805 810 815Lys Lys Arg Arg
Phe Asp Pro Thr Gln Gln Gly Pro Ile820 825282499DNAHomo
sapiensCDS(1)..(2496) 28atg aag ccg ccc ggc agc agc tcg cgg cag ccg
ccc ctg gcg ggc tgc 48Met Lys Pro Pro Gly Ser Ser Ser Arg Gln Pro
Pro Leu Ala Gly Cys1 5 10 15agc ctt gcc ggc gct tcc tgc ggc ccc caa
cgc ggc ccc gcc ggc tcg 96Ser Leu Ala Gly Ala Ser Cys Gly Pro Gln
Arg Gly Pro Ala Gly Ser20 25 30gtg cct gcc agc gcc ccg gcc cgc acg
ccg ccc tgc cgc ctg ctt ctc 144Val Pro Ala Ser Ala Pro Ala Arg Thr
Pro Pro Cys Arg Leu Leu Leu35 40 45gtc ctt ctc ctg ctg cct ccg ctc
gcc gcc tcg tcc cgg ccc cgc gcc 192Val Leu Leu Leu Leu Pro Pro Leu
Ala Ala Ser Ser Arg Pro Arg Ala50 55 60tgg ggg gct gct gcg ccc agc
gct ccg cat tgg aat gaa act gca gaa 240Trp Gly Ala Ala Ala Pro Ser
Ala Pro His Trp Asn Glu Thr Ala Glu65 70 75 80aaa aat ttg gga gtc
ctg gca gat gaa gac aat aca ttg caa cag aat 288Lys Asn Leu Gly Val
Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln Asn85 90 95agc agc agt aat
atc agt tac agc aat gca atg cag aaa gaa atc aca 336Ser Ser Ser Asn
Ile Ser Tyr Ser Asn Ala Met Gln Lys Glu Ile Thr100 105 110ctg cct
tca aga ctc ata tat tac atc aac caa gac tcg gaa agc cct 384Leu Pro
Ser Arg Leu Ile Tyr Tyr Ile Asn Gln Asp Ser Glu Ser Pro115 120
125tat cac gtt ctt gac aca aag gca aga cac cag caa aaa cat aat aag
432Tyr His Val Leu Asp Thr Lys Ala Arg His Gln Gln Lys His Asn
Lys130 135 140gct gtc cat ctg gcc cag gca agc ttc cag att gaa gcc
ttc ggc tcc 480Ala Val His Leu Ala Gln Ala Ser Phe Gln Ile Glu Ala
Phe Gly Ser145 150 155 160aaa ttc att ctt gac ctc ata ctg aac aat
ggt ttg ttg tct tct gat 528Lys Phe Ile Leu Asp Leu Ile Leu Asn Asn
Gly Leu Leu Ser Ser Asp165 170 175tat gtg gag att cac tac gaa aat
ggg aaa cca cag tac tct aag ggt 576Tyr Val Glu Ile His Tyr Glu Asn
Gly Lys Pro Gln Tyr Ser Lys Gly180 185 190gga gag cac tgt tac tac
cat gga agc atc aga ggc gtc aaa gac tcc 624Gly Glu His Cys Tyr Tyr
His Gly Ser Ile Arg Gly Val Lys Asp Ser195 200 205aag gtg gct ctg
tca acc tgc aat gga ctt cat ggc atg ttt gaa gat 672Lys Val Ala Leu
Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp210 215 220gat acc
ttc gtg tat atg ata gag cca cta gag ctg gtt cat gat gag 720Asp Thr
Phe Val Tyr Met Ile Glu Pro Leu Glu Leu Val His Asp Glu225 230 235
240aaa agc aca ggt cga cca cat ata atc cag aaa acc ttg gca gga cag
768Lys Ser Thr Gly Arg Pro His Ile Ile Gln Lys Thr Leu Ala Gly
Gln245 250 255tat tct aag caa atg aag aat ctc act atg gaa aga ggt
gac cag tgg 816Tyr Ser Lys Gln Met Lys Asn Leu Thr Met Glu Arg Gly
Asp Gln Trp260 265 270ccc ttt ctc tct gaa tta cag tgg ttg aaa aga
agg aag aga gca gtg 864Pro Phe Leu Ser Glu Leu Gln Trp Leu Lys Arg
Arg Lys Arg Ala Val275 280 285aat cca tca cgt ggt ata ttt gaa gaa
atg aaa tat ttg gaa ctt atg 912Asn Pro Ser Arg Gly Ile Phe Glu Glu
Met Lys Tyr Leu Glu Leu Met290 295 300att gtt aat gat cac aaa acg
tat aag aag cat cgc tct tct cat gca 960Ile Val Asn Asp His Lys Thr
Tyr Lys Lys His Arg Ser Ser His Ala305 310 315 320cat acc aac aac
ttt gca aag tcc gtg gtc aac ctt gtg gat tct att 1008His Thr Asn Asn
Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser Ile325 330 335tac aag
gag cag ctc aac acc agg gtt gtc ctg gtg gct gta gag acc 1056Tyr Lys
Glu Gln Leu Asn Thr Arg Val Val Leu Val Ala Val Glu Thr340 345
350tgg act gag aag gat cag att gac atc acc acc aac cct gtg cag atg
1104Trp Thr Glu Lys Asp Gln Ile Asp Ile Thr Thr Asn Pro Val Gln
Met355 360 365ctc cat gag ttc tca aaa tac cgg cag cgc att aag cag
cat gct gat 1152Leu His Glu Phe Ser Lys Tyr Arg Gln Arg Ile Lys Gln
His Ala Asp370 375 380gct gtg cac ctc atc tcg cgg gtg aca ttt cac
tat aag aga agc agt 1200Ala Val His Leu Ile Ser Arg Val Thr Phe His
Tyr Lys Arg Ser Ser385 390 395 400ctg agt tac ttt gga ggt gtc tgt
tct cgc aca aga gga gtt ggt gtg 1248Leu Ser Tyr Phe Gly Gly Val Cys
Ser Arg Thr Arg Gly Val Gly Val405 410 415aat gag tat ggt ctt cca
atg gca gtg gca caa gta tta tcg cag agc 1296Asn Glu Tyr Gly Leu Pro
Met Ala Val Ala Gln Val Leu Ser Gln Ser420 425 430ctg gct caa aac
ctt gga atc caa tgg gaa cct tct agc aga aag cca 1344Leu Ala Gln Asn
Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro435 440 445aaa tgt
gac tgc aca gaa tcc tgg ggt ggc tgc atc atg gag gaa aca 1392Lys Cys
Asp Cys Thr Glu Ser Trp Gly Gly Cys Ile Met Glu Glu Thr450 455
460ggg gtg tcc cat tct cga aaa ttt tca aag tgc agc att ttg gag tat
1440Gly Val Ser His Ser Arg Lys Phe Ser Lys Cys Ser Ile Leu Glu
Tyr465 470 475 480aga gac ttt tta cag aga gga ggt gga gcc tgc ctt
ttc aac agg cca 1488Arg Asp Phe Leu Gln Arg Gly Gly Gly Ala Cys Leu
Phe Asn Arg Pro485 490 495aca aag cta ttt gag ccc acg gaa tgt gga
aat gga tac gtg gaa gct 1536Thr Lys Leu Phe Glu Pro Thr Glu Cys Gly
Asn Gly Tyr Val Glu Ala500 505 510ggg gag gag tgt gat tgt ggt ttt
cat gtg gaa tgc tat gga tta tgc 1584Gly Glu Glu Cys Asp Cys Gly Phe
His Val Glu Cys Tyr Gly Leu Cys515 520 525tgt aag aaa tgt tcc ctc
tcc aac ggg gct cac tgc agc gac ggg ccc 1632Cys Lys Lys Cys Ser Leu
Ser Asn Gly Ala His Cys Ser Asp Gly Pro530 535 540tgc tgt aac aat
acc tca tgt ctt ttt cag cca cga ggg tat gaa tgc 1680Cys Cys Asn Asn
Thr Ser Cys Leu Phe Gln Pro Arg Gly Tyr Glu Cys545 550 555 560cgg
gat gct gtg aac gag tgt gat att act gaa tat tgt act gga gac 1728Arg
Asp Ala Val Asn Glu Cys Asp Ile Thr Glu Tyr Cys Thr Gly Asp565 570
575tct ggt cag tgc cca cca aat ctt cat aag caa gac gga tat gca tgc
1776Ser Gly Gln Cys Pro Pro Asn Leu His Lys Gln Asp Gly Tyr Ala
Cys580 585 590aat caa aat cag ggc cgc tgc tac aat ggc gag tgc aag
acc aga gac 1824Asn Gln Asn Gln Gly Arg Cys Tyr Asn Gly Glu Cys Lys
Thr Arg Asp595 600 605aac cag tgt cag tac atc tgg gga aca aag gct
gca ggg tct gac aag 1872Asn Gln Cys Gln Tyr Ile Trp Gly Thr Lys Ala
Ala Gly Ser Asp Lys610 615 620ttc tgc tat gaa aag ctg aat aca gaa
ggc act gag aag gga aac tgc 1920Phe Cys Tyr Glu Lys Leu Asn Thr Glu
Gly Thr Glu Lys Gly Asn Cys625 630 635 640ggg aag gat gga gac cgg
tgg att cag tgc agc aaa cat gat gtg ttc 1968Gly Lys Asp Gly Asp Arg
Trp Ile Gln Cys Ser Lys His Asp Val Phe645 650 655tgt gga ttc tta
ctc tgt acc aat ctt act cga gct cca cgt att ggt 2016Cys Gly Phe Leu
Leu Cys Thr Asn Leu Thr Arg Ala Pro Arg Ile Gly660 665 670caa ctt
cag ggt gag atc att cca act tcc ttc tac cat caa ggc cgg 2064Gln Leu
Gln Gly Glu Ile Ile Pro Thr Ser Phe Tyr His Gln Gly Arg675 680
685gtg att gac tgc agt ggt gcc cat gta gtt tta gat gat gat acg gat
2112Val Ile Asp Cys Ser Gly Ala His Val Val Leu Asp Asp Asp Thr
Asp690 695 700gtg ggc tat gta gaa gat gga acg cca tgt ggc ccg tct
atg atg tgt 2160Val Gly Tyr Val Glu Asp Gly Thr Pro Cys Gly Pro Ser
Met Met Cys705 710 715 720tta gat cgg aag tgc cta caa att caa gcc
cta aat atg agc agc tgt 2208Leu Asp Arg Lys Cys Leu Gln Ile Gln Ala
Leu Asn Met Ser Ser Cys725 730 735cca ctc gat tcc aag ggt aaa gtc
tgt tcg ggc cat ggg gtg tgt agt 2256Pro Leu Asp Ser Lys Gly Lys Val
Cys Ser Gly His Gly Val Cys Ser740 745 750aat gaa gcc acc tgc att
tgt gat ttc acc tgg gca ggg aca gat tgc 2304Asn Glu Ala Thr Cys Ile
Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys755 760 765agt atc cgg gat
cca gtt agg aac ctt cac ccc ccc aag gat gaa gga 2352Ser Ile Arg Asp
Pro Val Arg Asn Leu His Pro Pro Lys Asp Glu Gly770 775 780ccc aag
ggt cct agt gcc acc aat ctc ata ata ggc tcc atc gct ggt 2400Pro Lys
Gly Pro Ser Ala Thr Asn Leu Ile Ile Gly Ser Ile Ala Gly785 790 795
800gcc atc ctg gta gca gct att gtc ctt ggg ggc aca ggc tgg gga ttt
2448Ala Ile Leu Val Ala Ala Ile Val Leu Gly Gly Thr Gly Trp Gly
Phe805 810 815aaa aat gtc aag aag aga agg ttc gat cct act cag caa
ggc ccc atc 2496Lys Asn Val Lys Lys Arg Arg Phe Asp Pro Thr Gln Gln
Gly Pro Ile820 825 830tga 249929832PRTHomo sapiens 29Met Lys Pro
Pro Gly Ser Ser Ser Arg Gln Pro Pro Leu Ala Gly Cys1 5 10 15Ser Leu
Ala Gly Ala Ser Cys Gly Pro Gln Arg Gly Pro Ala Gly Ser20 25 30Val
Pro Ala Ser Ala Pro Ala Arg Thr Pro Pro Cys Arg Leu Leu Leu35 40
45Val Leu Leu Leu Leu Pro Pro Leu Ala Ala Ser Ser Arg Pro Arg Ala50
55 60Trp Gly Ala Ala Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala
Glu65 70 75 80Lys Asn Leu Gly Val Leu Ala Asp Glu Asp Asn Thr Leu
Gln Gln Asn85 90 95Ser Ser Ser Asn Ile Ser Tyr Ser Asn Ala Met Gln
Lys Glu Ile Thr100 105 110Leu Pro Ser Arg Leu Ile Tyr Tyr Ile Asn
Gln Asp Ser Glu Ser Pro115 120 125Tyr His Val Leu Asp Thr Lys Ala
Arg His Gln Gln Lys His Asn Lys130 135 140Ala Val His Leu Ala Gln
Ala Ser Phe Gln Ile Glu Ala Phe Gly Ser145 150 155 160Lys Phe Ile
Leu Asp Leu Ile Leu Asn Asn Gly Leu Leu Ser Ser Asp165 170 175Tyr
Val Glu Ile His Tyr Glu Asn Gly Lys Pro Gln Tyr Ser Lys Gly180 185
190Gly Glu His Cys Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp
Ser195 200 205Lys Val Ala Leu Ser Thr Cys Asn Gly Leu His Gly Met
Phe Glu Asp210 215 220Asp Thr Phe Val Tyr Met Ile Glu Pro Leu Glu
Leu Val His Asp Glu225 230 235 240Lys Ser Thr Gly Arg Pro His Ile
Ile Gln Lys Thr Leu Ala Gly Gln245 250 255Tyr Ser Lys Gln Met Lys
Asn Leu Thr Met Glu Arg Gly Asp Gln Trp260 265 270Pro Phe Leu Ser
Glu Leu Gln Trp Leu Lys Arg Arg Lys Arg Ala Val275 280 285Asn Pro
Ser Arg Gly Ile Phe Glu Glu Met Lys Tyr Leu Glu Leu Met290 295
300Ile Val Asn Asp His Lys Thr Tyr Lys Lys His Arg Ser Ser His
Ala305 310 315 320His Thr Asn Asn Phe Ala Lys Ser Val Val Asn Leu
Val Asp Ser Ile325 330 335Tyr Lys Glu Gln Leu Asn Thr Arg Val Val
Leu Val Ala Val Glu Thr340 345 350Trp Thr Glu Lys Asp Gln Ile Asp
Ile Thr Thr Asn Pro Val Gln Met355 360 365Leu His Glu Phe Ser Lys
Tyr Arg Gln Arg Ile Lys Gln His Ala Asp370 375 380Ala Val His Leu
Ile Ser Arg Val Thr Phe His Tyr Lys Arg Ser Ser385 390 395 400Leu
Ser Tyr Phe Gly Gly Val Cys Ser Arg Thr Arg Gly Val Gly Val405 410
415Asn Glu Tyr Gly Leu Pro Met Ala Val Ala Gln Val Leu Ser Gln
Ser420 425 430Leu Ala Gln Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser
Arg Lys Pro435 440 445Lys Cys Asp Cys Thr Glu Ser Trp Gly Gly Cys
Ile Met Glu Glu Thr450 455 460Gly Val Ser His Ser Arg Lys Phe Ser
Lys Cys Ser Ile Leu Glu Tyr465 470 475 480Arg Asp Phe Leu Gln Arg
Gly Gly Gly Ala Cys Leu Phe Asn Arg Pro485 490 495Thr Lys Leu Phe
Glu Pro Thr Glu Cys Gly Asn Gly Tyr Val Glu Ala500 505 510Gly Glu
Glu Cys Asp Cys Gly Phe His Val Glu Cys Tyr Gly Leu Cys515 520
525Cys Lys Lys Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly
Pro530 535 540Cys Cys Asn Asn Thr Ser Cys Leu Phe Gln Pro Arg Gly
Tyr Glu Cys545 550 555 560Arg Asp Ala Val Asn Glu Cys Asp Ile Thr
Glu Tyr Cys Thr Gly Asp565 570 575Ser Gly Gln Cys Pro Pro Asn Leu
His Lys Gln Asp Gly Tyr Ala Cys580 585 590Asn Gln Asn Gln Gly Arg
Cys Tyr Asn Gly Glu Cys Lys Thr Arg Asp595 600 605Asn Gln Cys Gln
Tyr Ile Trp Gly Thr Lys Ala Ala Gly Ser Asp Lys610 615 620Phe Cys
Tyr Glu Lys Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys625 630 635
640Gly Lys Asp Gly Asp Arg Trp Ile Gln Cys Ser Lys His Asp Val
Phe645 650 655Cys Gly Phe Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro
Arg Ile Gly660 665 670Gln Leu Gln Gly Glu Ile Ile Pro Thr Ser Phe
Tyr His Gln Gly Arg675 680 685Val Ile Asp Cys Ser Gly Ala His Val
Val Leu Asp Asp Asp Thr Asp690 695 700Val Gly Tyr Val Glu Asp Gly
Thr Pro Cys Gly Pro Ser Met Met Cys705 710 715 720Leu Asp Arg Lys
Cys Leu Gln Ile Gln Ala Leu Asn Met Ser Ser Cys725 730 735Pro Leu
Asp Ser Lys Gly Lys Val Cys Ser Gly His Gly Val Cys Ser740 745
750Asn Glu Ala Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp
Cys755 760 765Ser Ile Arg Asp Pro Val Arg Asn Leu His Pro Pro Lys
Asp Glu Gly770 775 780Pro Lys Gly Pro Ser Ala Thr Asn Leu Ile Ile
Gly Ser Ile Ala Gly785 790 795 800Ala Ile Leu Val Ala Ala Ile Val
Leu Gly Gly Thr Gly Trp Gly Phe805 810 815Lys Asn Val Lys Lys Arg
Arg Phe Asp Pro Thr Gln Gln Gly Pro Ile820 825 8303037DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30ccggtcgacc accatggaac tccggacccg aggctgg 373132DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31ccgaattctt accgccacct gggcctggct gc 323235DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32ccgctcgagc caccatgaag ccttttcata ctgcc 353330DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33tccgaattct tattgtttgt aggtccgtgg 303436DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34ccgctcgagc caccatgttg gctgcaaggc tggtgt 363531DNAArtificial
SequenceDescription of
Artificial Sequence Synthetic primer 35ccggatatct catttctttc
tgttgcctcc a 313634DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 36ccgctcgagc caccatgagc acctcgtctg cgcg
343729DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 37tccgttaact taatagtcat catagttca
293820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 38agctcattac tgtatattta 203920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39gctatatttc ataagtcatc 204026DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 40ctcgggaagc gcgccattgt gttggt
264134DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 41ccgctcgagc caccatgcgt ttttgcctct tctc
344228DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 42cggaattctt attggttcac tctgtctg
284333DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 43acgcgtcgac ccaccatgcc ccgctacgag ttg
334429DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 44attgaattct cacttcttcc tcctctttg
294535DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 45ccgctcgagc caccatgaag ccgcccggca gcatc
354629DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 46cggaattctc agatggggcc ttgctgagt 29471254DNAHomo
sapiensCDS(18)..(746) 47ccgctcgagc cgcccag atg cag ttt cgc ctt ttc
tcc ttt gcc ctc atc 50Met Gln Phe Arg Leu Phe Ser Phe Ala Leu Ile1
5 10att ctg aac tgc atg gat tac agc cac tgc caa ggc aac cga tgg aga
98Ile Leu Asn Cys Met Asp Tyr Ser His Cys Gln Gly Asn Arg Trp Arg15
20 25cgc agt aag cga gct agt tat gta tca aat ccc att tgc aag ggt
tgt 146Arg Ser Lys Arg Ala Ser Tyr Val Ser Asn Pro Ile Cys Lys Gly
Cys30 35 40ttg tct tgt tca aag gac aat ggg tgt agc cga tgt caa cag
aag ttg 194Leu Ser Cys Ser Lys Asp Asn Gly Cys Ser Arg Cys Gln Gln
Lys Leu45 50 55ttc ttc ttc ctt cga aga gaa ggg atg cgc cag tat gga
gag tgc ctg 242Phe Phe Phe Leu Arg Arg Glu Gly Met Arg Gln Tyr Gly
Glu Cys Leu60 65 70 75cat tcc tgc cca tcc ggg tac tat gga cac cga
gcc cca gat atg aac 290His Ser Cys Pro Ser Gly Tyr Tyr Gly His Arg
Ala Pro Asp Met Asn80 85 90aga tgt gca aga tgc aga ata gaa aac tgt
gat tct tgc ttt agc aaa 338Arg Cys Ala Arg Cys Arg Ile Glu Asn Cys
Asp Ser Cys Phe Ser Lys95 100 105gac ttt tgt acc aag tgc aaa gta
ggc ttt tat ttg cat aga ggc cgt 386Asp Phe Cys Thr Lys Cys Lys Val
Gly Phe Tyr Leu His Arg Gly Arg110 115 120tgc ttt gat gaa tgt cca
gat ggt ttt gca cca tta gaa gaa acc atg 434Cys Phe Asp Glu Cys Pro
Asp Gly Phe Ala Pro Leu Glu Glu Thr Met125 130 135gaa tgt gtg gaa
gga tgt gaa gtt ggt cat tgg agc gaa tgg gga act 482Glu Cys Val Glu
Gly Cys Glu Val Gly His Trp Ser Glu Trp Gly Thr140 145 150 155tgt
agc aga aat aat cgc aca tgt gga ttt aaa tgg ggt ctg gaa acc 530Cys
Ser Arg Asn Asn Arg Thr Cys Gly Phe Lys Trp Gly Leu Glu Thr160 165
170aga aca cgg caa att gtt aaa aag cca gtg aaa gac aca ata ctg tgt
578Arg Thr Arg Gln Ile Val Lys Lys Pro Val Lys Asp Thr Ile Leu
Cys175 180 185cca acc att gct gaa tcc agg aga tgc aag atg aca atg
agg cat tgt 626Pro Thr Ile Ala Glu Ser Arg Arg Cys Lys Met Thr Met
Arg His Cys190 195 200cca gga ggg aag aga aca cca aag gcg aag gag
aag agg aac aag aaa 674Pro Gly Gly Lys Arg Thr Pro Lys Ala Lys Glu
Lys Arg Asn Lys Lys205 210 215aag aaa agg aag ctg ata gaa agg gcc
cag gag caa cac agc gtc ttc 722Lys Lys Arg Lys Leu Ile Glu Arg Ala
Gln Glu Gln His Ser Val Phe220 225 230 235cta gct aca gac aga gct
aac caa taaaacaaga gatccggtag atttttaggg 776Leu Ala Thr Asp Arg Ala
Asn Gln240gtttttgttt ttgcaaatgt gcacaaagct actctccact cctgcacact
ggtgtgcagc 836ctttgtgctg ctctgcccag tatctgttcc cagtaacatg
gtgaaaggaa gcaccaccag 896catggcccct gtgttattta tgctttgatt
tgaatctgga gactgtgaag gcaggagtaa 956gtgcacagcc cgtgacttgg
ctcagtgtgt gctgagagaa tccgtccccg gcaccatgga 1016catgctagag
gtgtgaggct gcagaacacc gctggaggac ggacttgtgc ctatttatgt
1076gaaagaagat gcttggcagg caatgcgcta ctcactcgtg acctttattt
ctcacattgt 1136gcattttcaa ggatatgttt gtgtggatat ctgcttagtg
ttaccacatg gtattctcag 1196catgttacct tcacactgtt gtgcgatgaa
actgctttta gctgaggata tgctctgg 125448243PRTHomo sapiens 48Met Gln
Phe Arg Leu Phe Ser Phe Ala Leu Ile Ile Leu Asn Cys Met1 5 10 15Asp
Tyr Ser His Cys Gln Gly Asn Arg Trp Arg Arg Ser Lys Arg Ala20 25
30Ser Tyr Val Ser Asn Pro Ile Cys Lys Gly Cys Leu Ser Cys Ser Lys35
40 45Asp Asn Gly Cys Ser Arg Cys Gln Gln Lys Leu Phe Phe Phe Leu
Arg50 55 60Arg Glu Gly Met Arg Gln Tyr Gly Glu Cys Leu His Ser Cys
Pro Ser65 70 75 80Gly Tyr Tyr Gly His Arg Ala Pro Asp Met Asn Arg
Cys Ala Arg Cys85 90 95Arg Ile Glu Asn Cys Asp Ser Cys Phe Ser Lys
Asp Phe Cys Thr Lys100 105 110Cys Lys Val Gly Phe Tyr Leu His Arg
Gly Arg Cys Phe Asp Glu Cys115 120 125Pro Asp Gly Phe Ala Pro Leu
Glu Glu Thr Met Glu Cys Val Glu Gly130 135 140Cys Glu Val Gly His
Trp Ser Glu Trp Gly Thr Cys Ser Arg Asn Asn145 150 155 160Arg Thr
Cys Gly Phe Lys Trp Gly Leu Glu Thr Arg Thr Arg Gln Ile165 170
175Val Lys Lys Pro Val Lys Asp Thr Ile Leu Cys Pro Thr Ile Ala
Glu180 185 190Ser Arg Arg Cys Lys Met Thr Met Arg His Cys Pro Gly
Gly Lys Arg195 200 205Thr Pro Lys Ala Lys Glu Lys Arg Asn Lys Lys
Lys Lys Arg Lys Leu210 215 220Ile Glu Arg Ala Gln Glu Gln His Ser
Val Phe Leu Ala Thr Asp Arg225 230 235 240Ala Asn
Gln4929DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 49ccgctcgagc cgcccagatg cagtttcgc 29
* * * * *
References