U.S. patent application number 11/819161 was filed with the patent office on 2009-06-25 for identification and characterization of racemases, definition of protein signatures, and a test for detecting d-amino acid and for screening molecules capable of inhibiting the activity of racemase, especially proline racemase.
This patent application is currently assigned to Institut Pasteur. Invention is credited to Armand Berneman, Nathalie Chamond, Wim M. Degrave, Paolo Minoprio.
Application Number | 20090162844 11/819161 |
Document ID | / |
Family ID | 32869472 |
Filed Date | 2009-06-25 |
United States Patent
Application |
20090162844 |
Kind Code |
A1 |
Minoprio; Paolo ; et
al. |
June 25, 2009 |
Identification and characterization of racemases, definition of
protein signatures, and a test for detecting D-amino acid and for
screening molecules capable of inhibiting the activity of racemase,
especially proline racemase
Abstract
This invention provides identification and characterization of
racemases and definition of protein signatures of these racemases.
This invention also provides identification of nucleic acid
molecules encoding a peptide consisting of a motif characteristic
of the protein signatures, and to the peptides consisting of these
motifs. Antibodies specific for the peptides and to immune
complexes of these antibodies with the peptides are also provided.
Further, the invention relates to methods and kits for detecting
racemases using the nucleic acid molecules of the invention, as
well as the peptides consisting of the motifs and antibodies to
these peptides.
Inventors: |
Minoprio; Paolo; (Villiers
sur Marne, FR) ; Chamond; Nathalie; (Paris, FR)
; Degrave; Wim M.; (Rio de Janeiro, BR) ;
Berneman; Armand; (Paris, FR) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER;LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
Institut Pasteur
|
Family ID: |
32869472 |
Appl. No.: |
11/819161 |
Filed: |
June 25, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11008570 |
Dec 10, 2004 |
7262015 |
|
|
11819161 |
|
|
|
|
10775339 |
Feb 11, 2004 |
|
|
|
11008570 |
|
|
|
|
60446263 |
Feb 11, 2003 |
|
|
|
Current U.S.
Class: |
435/6.17 ;
435/287.2; 435/320.1; 435/325; 435/69.6; 435/7.4; 530/326;
530/387.9; 536/23.1 |
Current CPC
Class: |
C12Q 1/26 20130101; C12Q
1/533 20130101; G01N 2500/02 20130101; G01N 33/6806 20130101; G01N
33/573 20130101; Y02A 90/10 20180101; C12N 9/90 20130101; Y02A
90/26 20180101; G01N 2333/99 20130101 |
Class at
Publication: |
435/6 ; 536/23.1;
435/320.1; 530/326; 530/387.9; 435/325; 435/69.6; 435/7.4;
435/287.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/00 20060101 C07H021/00; C12N 15/74 20060101
C12N015/74; C07K 7/08 20060101 C07K007/08; C07K 16/00 20060101
C07K016/00; C12N 5/10 20060101 C12N005/10; C12P 21/00 20060101
C12P021/00; G01N 33/573 20060101 G01N033/573; C12M 1/34 20060101
C12M001/34 |
Claims
1. A purified nucleic acid molecule encoding a peptide consisting
of a motif selected from SEQ ID NOS: 1, 2, 3, or 4.
2. A purified nucleic acid molecule that hybridizes to either
strand of a denatured, double-stranded DNA comprising the nucleic
acid molecule of claim 1 under conditions of moderate
stringency.
3. A recombinant vector that directs the expression of a nucleic
acid molecule selected from the group consisting of the purified
nucleic acid molecules of claims 1 or 2.
4. A purified polypeptide encoded by a nucleic acid molecule
selected form the group consisting of the purified nucleic acid
molecules of claims 1 or 2.
5. A purified polypeptide consisting of Motif I (SEQ ID NO:1).
6. A purified polypeptide consisting of Motif II (SEQ ID NO:2).
7. A purified polypeptide consisting of Motif III (SEQ ID
NO:3).
8. A purified polypeptide consisting of Motif III* (SEQ ID
NO:4).
9. Purified antibodies that bind to a polypeptide of claim 4.
10. Purified antibodies according to claim 9, wherein the
antibodies are monoclonal antibodies.
11. Purified antibodies that bind to a polypeptide of claim 5.
12. Purified antibodies according to claim 11, wherein the
antibodies are monoclonal antibodies.
13. Purified antibodies that bind to a polypeptide of claim 6.
14. Purified antibodies according to claim 13, wherein the
antibodies are monoclonal antibodies.
15. Purified antibodies that bind to a polypeptide of claim 7.
16. Purified antibodies according to claim 15, wherein the
antibodies are monoclonal antibodies.
17. Purified antibodies that bind to a polypeptide of claim 8.
18. Purified antibodies according to claim 17, wherein the
antibodies are monoclonal antibodies.
19. A host cell transfected or transduced with the recombinant
vector of claim 3.
20. A method for the production of a polypeptide consisting of SEQ
ID NOS: 1, 2, 3, or 4, comprising culturing a host cell of claim 17
under conditions promoting expression, and recovering the
polypeptide from the host cell or the culture medium.
21. The method of claim 20, wherein the host cell is selected from
the group consisting of bacterial cells, parasite cells, and
eukaryotic cells.
22. An immunological complex comprising a polypeptide of claim 4
and an antibody that specifically recognizes said polypeptide.
23. A method of detecting a racemase encoded by a nucleotide
sequence containing a subsequence encoding a peptide selected form
SEQ ID NO: 1, 2, 3, or 4, said method comprising: (a) contacting
the nucleotide sequence with a primer or a probe, which hybridizes
with the nucleic acid molecule of claim 1; (b) amplifying the
nucleotide sequence using said primer or said probe; and (c)
detecting a hybridized complex formed between said primer or probe
and the nucleotide sequence.
24. A method of detecting a racemase encoded by a nucleotide
sequence containing a subsequence encoding a peptide selected from
SEQ ID NO: 1, 2, 3, or 4, said method comprising: (a) contacting
the product encoded by a nucleotide sequence racemase with
antibodies according to any one of claims 9 to 18; and (b)
detecting the resulting immunocomplex.
25. A kit for detecting a racemase encoded by a nucleotide sequence
containing a subsequence encoding a peptide selected form SEQ ID
NO: 1, 2, 3, or 4, said kit comprising: (a) a polynucleotide primer
or probe, which hybridizes with the polynucleotide sequence of
claim 1; and (b) reagents to perform a nucleic acid hybridization
reaction.
26. A kit for detecting a racemase encoded by a nucleotide sequence
containing a subsequence encoding a peptide selected form SEQ ID
NO: 1, 2, 3, or 4, said kit comprising: (a) purified antibodies
according to any one of claims 9 or 10; (b) standard reagents in a
purified form; and (c) detection reagents.
27. An in vitro method of screening for an active molecule capable
of inhibiting a racemase encoded by a nucleotide sequence
containing a subsequence encoding a peptide selected form SEQ ID
NO: 1, 2, 3, OR 4, said method comprising: (a) contacting the
active molecule with said racemase; (b) testing the capacity of the
active molecule, at various concentrations, to inhibit the activity
of the racemase; and (c) choosing the active molecule that provides
an inhibitory effect of at least 80% on the activity of the
racemase.
28. An immunizing composition containing at least a purified
polypeptide according to claim 4, capable of inducing an immune
response in vivo, and a pharmaceutical carrier.
29. A method for detecting a D-amino acid, wherein the method
comprises: (A) providing a reaction medium containing the D-amino
acid; (B) reacting the D-amino acid with a D-amino oxidase with a
prosthetic group to form a reduced prosthetic group by oxidative
deamination of the D-amino acid with a primary amine or oxidation
of the D-amino acid with a secondary amine; (C) reacting the
reduced prosthetic group with oxygen to form hydrogen peroxide; and
(D) detecting the hydrogen peroxide thus formed.
30. The method as claimed in claim 29, wherein the prosthetic group
is flavin-adenin-dinucleotide (FAD) or flavin-mononucleotide
(FMN).
31. The method as claimed in claim 30, wherein the hydrogen
peroxide is detected by reaction with a catalase.
32. The method as claimed in claim 29, wherein the D-amino acid is
a D-Proline, D-Tyrosine, D-Valine, D-Threonine, D-Glutamic acid,
D-Lysine, or D-Tryptophane.
33. The method as claimed in claim 30, wherein the hydrogen
peroxide is detected by reaction with a peroxidase.
34. The method as claimed in any one of claims 29-33, comprising
quantifying the D-amino acid in the reaction medium after the
formation of the hydrogen peroxide.
35. The method as claimed in claim 29, wherein the reaction medium
comprises a biological sample from a subject afflicted with
Alzheimer's disease, Parkinson's disease, renal disease, or
schizophrenia.
36. The method as claimed in claim 34, wherein the biological
sample comprises a fluid or tissue sample from the subject.
37. The method as claimed in claim 34, wherein the biological
sample comprises cells from the subject.
38. A method for detecting racemase activity in a reaction medium,
wherein the method comprises: (A) providing a reaction medium
containing a D-amino acid specific to the racemase to be detected;
(B) reacting the D-amino acid with a D-amino oxidase with a
prosthetic group to form a reduced prosthetic group by oxidation of
the D-amino acid; (C) reacting the reduced prosthetic group with
oxygen to form hydrogen peroxide; and (D) detecting the hydrogen
peroxide thus formed; wherein the detection of hydrogen peroxide
indicates racemase activity tin the reaction medium.
39. The method as claimed in claim 38 wherein the hydrogen peroxide
is detected by reaction with catalase.
40. The method as claimed in claim 38, wherein the hydrogen
peroxide is detected with a chromogenic reagent.
41. The method as claimed in claim 39, wherein the chromogenic
reagent is orthophenylalaninediamine (OPD),
3,3',5,5'-tetrimethylbenzadine (TMB), or 5-aminosalicyclic acid
(ASA).
42. A kit for screening for inhibitors of TcPRAC, wherein the kit
comprises: (A) L-proline, D-proline, and a proline-racemase; (B) a
peroxidase and a substrate of a peroxidase, or a catalase and a
reagent sensitive to oxygen; (C) a D-amino acid oxidase; and (D)
optionally, one or more molecules to be screened for inhibitory
activity of TcPRAC.
43. A kit for detecting a D-amino acid in a sample, wherein the kit
comprises: (A) a D-amino acid; (B) a peroxidase and a substrate of
a peroxidase; (C) a D-amino acid oxidase; and (D) optionally, a
L-amino acid enantiomer as control.
44. A method for detecting a D-amino acid in a sample, wherein the
method comprises: (A) oxidatively deaminating a D-amino acid by
reaction with a D-amino acid oxidase in a prosthetic group; and (B)
detecting the hydrogen peroxide generated by the oxidative
deamination; wherein the presence of hydrogen peroxide is
indicative of the presence of a D-amino acid in the sample.
45. The method as claimed in claim 43, wherein the D-amino acid is
D-Proline, D-Tyrosine, D-Valine, D-Threonine, D-Glutamic acid,
D-Lysine, or D-Tryptophane.
46. A method for screening a molecule, which can modulate a
racemase activity, wherein the method comprises: (A) modulating a
racemase activity by means of a molecule being tested in the
presence of an equimolar mixture of a L- and D-amino acid an of a
racemase to be modulated; (B) oxidatively deaminating the D-amino
acid generated in step (A) by means of a D-amino oxidase in a
prosthetic group; and (C) detecting the hydrogen peroxide generated
by the oxidative deamination; wherein modulation of the hydrogen
peroxide is indicative of the capability of the tested molecule to
modulate racemase activity.
47. The method as claimed in claim 46, wherein said molecule
inhibits said racemase activity.
48. The method as claimed in claim 46, wherein said racemase is a
proline racemase.
49. The method as claimed in claim 47, wherein said proline
racemase is Tripanosoma cruzi proline racemase.
50. A molecule identified by a method as claimed in claims 45 to
48.
51. A technological platform and all reagents and devices necessary
to perform the method of claims 29 to 41 and 44 to 49.
52. The technological platform as claimed in claim 50, comprising
a) L-amino acid, D-amino acid, and a racemase; b) a peroxydase and
a substrate of a peroxydase, or a catalase and a reagent sensitive
to oxygen; c) a D-amino acid oxidase; and d) optionally, one or
more molecules to be screened for inhibitory activity of said
racemase.
53. The technological platform as claimed in claim 51, wherein said
racemase is a proline racemase and said L-amino acid and D-amino
acid are L-proline and D-proline, respectively.
54. A molecule inhibiting a proline racemase containing a
subsequence selected form the SEQ ID NO: 1, 2, 3, or 4.
55. A purified nucleic acid molecule encoding a polypeptide
consisting of an amino acid sequence that is substantially similar
to SEQ ID NO: 1, 2, 3, or 4.
56. The purified nucleic acid molecule of claim 55, wherein the
purified nucleic acid molecule hybridizes to either strand of a
denatured, double-stranded nucleic acid molecule encoding a
polypeptide consisting of the amino acid sequence SEQ ID NO: 1, 2,
3, or 4, wherein the hybridization conditions comprise incubating
the nucleic acids at 50.degree. C. in a solution containing
5.times.SSC and 1.times.Denhardt's solution and three washes for
twenty minutes each in 2.times.SSC at 60.degree. C.
57. A recombinant vector that directs the expression of the nucleic
acid molecule as claimed in claim 55.
58. An isolated host cell transfected or transduced with the
recombinant vector as claimed in claim 57.
59. A method for the production of a polypeptide consisting of an
amino acid sequence substantially similar to SEQ ID NO: 1, 2, 3, or
4, comprising culturing the host cell of claim 58 under conditions
promoting expression, and recovering the polypeptide from the host
cell or the culture medium.
60. The method of claim 59, wherein the host cell is selected from
the group consisting of bacterial cells, parasite cells, and
eukaryotic cells.
61. A purified nucleic acid molecule consisting of nucleotides
encoding a polypeptides consisting of an amino acid sequence that
is substantially similar to SEQ ID NO: 1, 2, 3, or 4.
62. A duplex nucleic acid molecule comprising a single strand of a
denatured, double-stranded DNA hybridized to either strand of a
denatured, double-stranded DNA comprising the nucleic acid molecule
of claim 55 or 61, wherein the hybridization conditions comprise
incubating the nucleic acids at 50.degree. C. in a solution
containing 5.times.SSC and 1.times.Denhardt's solution and three
washes for twenty minutes each in 2.times.SSC at 60.degree. C.
63. The purified nucleic acid molecule of claim 61, wherein the
purified nucleic acid molecule hybridizes to either strand of a
denatured, double-stranded nucleic acid molecule consisting of
nucleotides encoding a polypeptide consisting of the amino acid
sequence of SEQ ID NO: 1, 2, 3, or 4, wherein the hybridization
conditions comprise incubating the nucleic acids at 50.degree. C.
in a solution containing 5.times.SSC and 1.times.Denhardt's
solution and three washes for twenty minutes each in 2.times.SSC at
60.degree. C.
64. A recombinant vector that directs the expression of the nucleic
acid molecule as claimed in claim 61.
65. An isolated host cell transfected or transduced with the
recombinant vector of claim 64.
66. A method for the production of a polypeptide consisting of an
the amino acid sequence substantially similar to SEQ ID NO: 1, 2,
3, or 4, comprising culturing the host cell of claim 65 under
conditions promoting expression, and recovering the polypeptide
from the host cell or the culture medium.
67. The method of claim 66, wherein the host cell is selected from
the group consisting of bacterial cells, parasite cells, and
eukaryotic cells.
68. A kit for detecting a racemase encoded by a nucleotide sequence
having a subsequence encoding the peptide SEQ ID NO: 1, 2, 3, or 4,
said kit comprising: (a) a polynucleotide primer or probe
consisting of the polynucleotide sequence of claim 55 or 61; and
(b) reagents to perform a nucleic acid hybridization reaction.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is based on and claims the benefit of U.S.
Provisional Application Ser. No. 60/446,263, filed Feb. 11, 2003
(Attorney Docket No. 03495.6087). The entire disclosure of this
Provisional application is relied upon and incorporated by
reference herein
BACKGROUND OF THE INVENTION
[0002] This invention relates to the identification and
characterization of racemases and definition of protein signatures
of these racemases. More particularly, this invention relates to
the identification of nucleic acid molecules encoding a peptide
consisting of a motif characteristic of the protein signatures, and
to the peptides consisting of these motifs. This invention also
relates to antibodies specific for the peptides and to immune
complexes of these antibodies with the peptides. Further, the
invention relates to methods and kits for detecting racemases using
the nucleic acid molecules of the invention, as well as the
peptides consisting of the motifs and antibodies to these
peptides.
[0003] D-amino acids have long been described in the cell wall of
gram-positive and especially gram-negative bacteria, where they
constitute essential elements of the peptidoglycan and as
substitutes of cell wall techoic acids (1). Moreover, various types
of D-amino acids were discovered in a number of small peptides made
by a variety of microorganisms through non-ribosomal protein
synthesis (2), that function mainly as antibiotic agents. However,
these examples were considered exceptions to the rule of
homochirality and a dogma persisted that only L-amino acid
enantiomers were present in eukaryotes, apart from a very low level
of D-amino acids from spontaneous racemization due to aging
(3).
[0004] Recently, an increasing number of studies have reported the
presence of various D-amino acids (D-aa) either as protein bound
(4) or under free forms (5) in a wide variety of organisms,
including mammals. The origin of free D-aa, is less clear than that
of protein bound D-aa. For instance, in mammals, free D-aa may
originate from exogenous sources (as described in (6), but the
recent discovery of amino acid racemases in eukaryotes has also
uncovered an endogenous production of D-aa, questioning their
specific functions. Thus, the level of D-aspartate is
developmentally regulated in rat embryos (7); the binding of
D-serine to NMDA mouse brain receptors promotes neuromodulation
(8),(9), and D-aspartate appears to be involved in hormonal
regulation in endocrine tissues (10).
[0005] All amino acid racemases require pyridoxal phosphate as a
cofactor, except proline and hydroxyproline racemases, which are
cofactor-independent enzymes. For example, two reports have been
published addressing the biochemical and enzymatic characteristics
of the proline racemase from the gram-positive bacterium
Clostridium sticklandii (11,12). A reaction mechanism was proposed
whereby the active site Cys.sup.256 forms a half-reaction site with
the corresponding cysteine of the other monomer in the active,
homodimeric enzyme.
[0006] Although a variety of racemases and epimerases has been
demonstrated in bacteria and fungi, the first eukaryotic amino acid
(proline) racemase isolated from the infective metacyclic forms of
the parasitic protozoan Trypanosoma cruzi, the causative agent of
Chagas' disease in humans (13), was recently described. This
parasite-secreted proline racemase (TcPRAC) was shown to be a
potent mitogen for host B cells and to play an important role in T.
cruzi immune evasion and persistence through polyclonal lymphocyte
activation (13). This protein, previously annotated as TcPA45, with
monomer size of 45 kDa, is only expressed and released by infective
metacyclic forms of the parasite (13).
[0007] The genomic organization and transcription of TcPRAC proline
racemase gene indicated the presence of two homologous genes per
haploid genome (TcPRACA and TcPRACB). Furthermore, localization
studies using specific antibodies directed to 45 kDa-TcPRAC protein
revealed that an intracellular and/or membrane associated isoform,
with monomer size of 39 kDa is expressed in non-infective
epimastigote forms of the parasite.
[0008] Computer-assisted analysis of the TcPRACA gene sequence
suggested that it could give rise to both isoforms (45 kDa and 39
kDa) of parasite proline racemases through a mechanism of
alternative trans-splicing, one of which would contain a signal
peptide (13). In addition, preliminary analysis of putative TcPRACB
gene sequences had revealed several differences that include point
mutations as compared to TcPRACA, but that also suggest that
TcPRACB gene could only encode an intracellular isoform of the
enzyme as the gene lacks the export signal sequence. Any of these
molecular mechanisms per se would ensure the differential
expression of intracellular and extracellular isoforms of proline
racemases produced in different T. cruzi developmental stages.
[0009] The process of production of a D-amino acid by using a
L-amino acid source comprises the use of an amino acid racemase
specific for the amino acid of interest, the racemase being
produced from a recombinant expression system containing a vector
having a polynucleotide sequence encoding the enzyme. In
prokaryotic hosts, the racemases are known to be implicated in the
synthesis of D-amino acids and/or in the metabolism of L-amino
acids. For instance, the presence of free D-amino acids in tumors
and in progressive autoimmune and degenerative diseases suggests
the biological importance of eukaryotic amino acid racemases. It is
well known that proteins or peptides containing D-amino acids are
resistant to proteolysis by host enzymes. In addition, such
proteins containing D-amino acids, at least one D-amino acid
residue, can display antibiotic or immunogenic properties.
[0010] There is a growing interest in the biological role of
D-amino acids, either as free molecules or within polypeptide
chains in human brain, tumors, anti-microbial and neuropeptides,
suggesting widespread biological implications. Research on D-amino
acids in living organisms has been hampered by their difficult
detection. There exists a need in the art for the identification of
racemases and the identification of their enzymatic properties and
their specificity for other compounds.
[0011] Although much progress has been made concerning prophylaxis
of Chagas' disease, particularly vector eradication, additional
cases of infection and disease development still occur every day
throughout the world. Whilst infection was largely limited in the
past to vector transmission in endemic areas of Latin America, its
impact has increased in terms of congenital and blood transmission,
transplants and recrudescence following immunosuppressive states.
Prevalence of Chagas' disease in Latin America may reach 25% of the
population, as is the case of Bolivia, or yet 1%, as observed in
Mexico. From the 18-20 million people already infected with the
parasite Trypanosoma cruzi, more than 60% live in Brazil and WHO
estimates that 90 million individuals are at risk in South and
Central America.
[0012] Some figures obtained from a recent census in USA, for
instance, revealed that the net immigration from Mexico is about
1000 people/day, of those 5-10 individuals are infected by Chagas'
disease. The disease can lie dormant for 10-30 years and as an
example of many other progressive chronic pathologies it is
characterized by being "asymptomatic". Although at the 1990's,
blood banks increased their appeals to Hispanics (50% of Bolivian
blood is contaminated), panels of Food and Drug Administration
(FDA) have recommended that all donated blood be screened for
Chagas. Today, FDA has not yet approved an `accurate` blood test to
screen donor blood samples. This allegation seriously contrasts
with the more than 30 available tests used in endemic countries.
Additionally, recent reports on new insect vectors adapted to the
parasite and domestic animals infected in more developed countries
like USA, and the distributional predictions based on Genetic
Algorithm for Rule-set Prediction models indicate a potentially
broad distribution for these species and suggest additional areas
of risk beyond those previously reported emphasizing the continuing
worldwide public health issue.
[0013] To date, two drugs are particularly used to treat
Trypanosoma cruzi infections. Nifurtimox
(3-methyl-4-5'-nitrofurfurylidene-amino tetrahydro
4H-1,4-thiazine-1,1-dioxide), a nitrofurane from Bayer, known as
Lampit, was the first drug to be used since 1967. After 1973,
Benznidazol, a nitroimidazol derivative, known as Rochagan or
Radanyl (N-benzyl-2-nitro-1-imidazol acetamide) was produced by
Hoffman-La-Roche and is consensually the drug of choice. Both drugs
are trypanosomicides and act against intracellular or extracellular
forms of the parasite. Adverse side-effects include a localized or
generalized allergic dermopathy, peripheral sensitive
polyneuropathy, leucopenia, anorexia, digestive manifestations and
rare cases of convulsions which are reversible by interruption of
treatment. The most serious complications include agranulocytosis
and trombocytopenic purpura.
[0014] Unquestionably, the treatment is efficient and should be
applied in acute phases of infection, in children, and in cases
where reactivation of parasitaemia is observed following therapy
with immunosuppressive drugs or organ transplantation procedures.
Some experts recommend that patients in indeterminate and chronic
phases should also be treated. However, close to a hundred years
after the discovery of the infection and its consequent disease,
researchers still maintain divergent points of view concerning
therapy against the chronic phases of the disease. As one of the
criteria of cure is based on the absence of the parasite in the
blood, it is very difficult to evaluate the efficacy of the
treatment in indeterminate or chronic phases. Because the
indeterminate form is asymptomatic, it is impossible to clinically
evaluate the cure. Furthermore, a combination of serology and more
sensitive advanced molecular techniques will be required and still
may not be conclusive. The follow-up of patients for many years is
then inevitable to objectively ascertain the cure.
[0015] Chagas' disease was recently considered as a neglected
disease and DND-initiative (Drug for Neglected Diseases Initiative,
DNDi) wishes to support drug discovery projects focused on the
development of effective, safe and affordable new drugs against
trypanosomiasis. Since current therapies remain a matter of debate,
may be inadequate in some circumstances, are rather toxic and may
be of limited effectiveness, the characterization of new
formulations and the discovery of parasite molecules capable of
eliciting protective immunity are absolutely required and must be
considered as priorities.
SUMMARY OF THE INVENTION
[0016] This invention aids in fulfilling these needs in the art. It
has been discovered that the TcPRAC genes in T. cruzi encode
functional intracellular or secreted versions of the enzyme
exhibiting distinct kinetic properties that may be relevant for
their relative catalytic efficiency. While the K.sub.M of the
enzyme isoforms were of a similar order of magnitude (29-75 mM),
V.sub.max varied between 2.times.10.sup.-4 to 5.3.times.10.sup.-5
mol of L-proline/sec/0.125 .mu.M of homodimeric recombinant
protein. Studies with the enzyme specific inhibitor and abrogation
of enzymatic activity by site-directed mutagenesis of the active
site Cys.sup.330 residue, reinforced the potential of proline
racemase as a critical target for drug development against Chagas'
disease.
[0017] This invention provides a purified nucleic acid molecule
encoding a peptide consisting of a motif selected from SEQ ID NOS:
1, 2, 3, or 4.
[0018] This invention also provides a purified nucleic acid
molecule that hybridizes to either strand of a denatured,
double-stranded DNA comprising this nucleic acid molecule under
conditions of moderate stringency.
[0019] In addition, this invention provides a recombinant vector
that directs the expression of a nucleic acid molecule selected
from these purified nucleic acid molecules.
[0020] Further, this invention provides a purified polypeptide
encoded by a nucleic acid molecule selected from the group
consisting of a purified nucleic acid molecule coding for: [0021]
(a) a purified polypeptide consisting of Motif I (SEQ ID NO:1);
[0022] (b) a purified polypeptide consisting of Motif II (SEQ ID
NO:2); [0023] (c) a purified polypeptide consisting of Motif III
(SEQ ID NO:3); and [0024] (d) a purified polypeptide consisting of
Motif III* (SEQ ID NO:4).
[0025] Purified antibodies that bind to these polypeptides are
provided. The purified antibodies can be monoclonal antibodies. An
immunological complex comprises a polypeptide and an antibody that
specifically recognizes the polypeptide of the invention.
[0026] A host cell transfected or transduced with the recombinant
vector of the invention is provided.
[0027] A method for the production of a polypeptide consisting of
SEQ ID NOS: 1, 2, 3, or 4, comprises culturing a host cell of the
invention under conditions promoting expression, and recovering the
polypeptide from the host cell or the culture medium. The host cell
can be a bacterial cell, parasite cell, or eukaryotic cell.
[0028] A method of the invention for detecting a racemase encoded
by a nucleotide sequence containing a subsequence encoding a
peptide selected from SEQ ID NO: 1, 2, 3, or 4, comprises: [0029]
(a) contacting the nucleotide sequence with a primer or a probe,
which hybridizes with the nucleic acid molecule of the invention;
[0030] (b) amplifying the nucleotide sequence using the primer or
the probe; and [0031] (c) detecting a hybridized complex formed
between the primer or probe and the nucleotide sequence.
[0032] This invention provides a method of detecting a racemase
encoded by a nucleotide sequence containing a subsequence encoding
a peptide selected from SEQ ID NO: 1, 2, 3, or 4. The method
comprises: [0033] (a) contacting the racemase with antibodies of
the invention; and [0034] (b) detecting the resulting
immunocomplex.
[0035] A kit for detecting a racemase encoded by a nucleotide
sequence containing a subsequence encoding a peptide selected from
SEQ ID NO: 1, 2, 3, or 4, comprises: [0036] (a) a polynucleotide
probe or primer, which hybridizes with the polynucleotide of the
invention; and [0037] (b) reagents to perform a nucleic acid
hybridization reaction.
[0038] This invention also provides a kit for detecting a racemase
encoded by a nucleotide sequence containing a subsequence encoding
a peptide selected from SEQ ID NO: 1, 2, 3, or 4. The kit
comprises: [0039] (a) purified antibodies of the invention; [0040]
(b) standard reagents in a purified form; and [0041] (c) detection
reagents.
[0042] An in vitro method of screening for an active molecule
capable of inhibiting a racemase encoded by a nucleotide sequence
containing a subsequence encoding a peptide selected from SEQ ID
NO: 1, 2, 3, or 4, comprises: [0043] (a) contacting the active
molecule with the racemase; [0044] (b) testing the capacity of the
active molecule, at various concentrations, to inhibit the activity
of the racemase; and [0045] (c) choosing the active molecule that
provides an inhibitory effect of at least 80% on the activity of
any proline racemase.
[0046] In a preferred embodiment of the invention the racemase is a
proline racemase.
[0047] An immunizing composition of the invention contains at least
a purified polypeptide of the invention, capable of inducing an
immune response in vivo, and a pharmaceutical carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
[0048] This invention will be understood with reference to the
drawings in which:
[0049] FIG. 1: Comparative analysis of sequences of T. cruzi
TcPRACA and TcPRACB proline racemase isoforms. A. Alignment of
TcPRACA (Tc-A) and TcPRACB (Tc-B) nucleotide sequences: non coding
sequences are shown in italics; trans-splicing signals are
underlined and putative spliced leader acceptor sites are
double-underlined; the region encoding the computer-predicted
signal peptide is indicated by double-headed arrow; initiation of
translation for TcPRACA and TcPRACB are shown by single-headed
arrows; nucleotides shaded in light and dark grey, represent
respectively silent mutations or point mutations; box, proline
racemase active site; UUA triplets are underlined in bold and
precede polyadenylation sites that are double-underlined. B.
Schematic representation of amino acid sequence alignments of T.
cruzi TcPRACA (Tc-A), TcPRACB (Tc-B) proline racemases. The common
scale is in amino acid residue positions along the linear alignment
and represent the initiation codons for TcPRACA and TcPRACB
proteins, respectively; .gradient. represents an alternative
TcPRACA putative initiation codon; Amino acid differences are
indicated above and below the vertical lines and their positions in
the sequence are shown in parenthesis. SP: signal peptide; the
N-terminal domain of TcPRACA extends from positions 1 to 69; SPCGT:
conserved active sites of TcPRACA and TcPRACB proline racemases;
N-terminus and C-terminus are indicated for both proteins. C.
Hydrophobicity profile of TcPRACA: dotted line depicts the cleavage
site as predicted by Von Heijne's method (aa 31-32). D. Ethidium
bromide-stained gel of chromosomal bands of T. cruzi CL Brener
clone after separation by PFGE (lane 1) and Southern blot
hybridization with TcPRAC probe (lane 2). The sizes (Mb) of
chromosomal bands are indicated, as well as the region chromosome
numbers in roman numerals.
[0050] FIG. 2: Biochemical characterization of T. cruzi proline
racemase isoforms and substrate specificities. A. SDS-PAGE analysis
of purified rTcPRACA (lane 1) and rTcPRACB (lane 2) recombinant
proteins. A 8% polyacrylamide gel was stained with Coomassie blue.
Right margin, molecular weights. B. Percent of racemization of
L-proline, D-proline, L-hydroxy (OH) proline and D-hydroxy (OH)
proline substrates by rTcPRACB (open bar) as compared to rTcPRACA
(closed bar). Racemase activity was determined with 0.25 .mu.M of
each isoform of proline racemase and 40 mM substrate in sodium
acetate buffer pH 6.0. C. Percent of racemization as a function of
pH: Racemase assays were performed in buffer containing 0.2 M
Tris-HCl (squares), sodium acetate (triangles) and sodium phosphate
(circles), 40 mM L-proline and 0.25 .mu.M of purified rTcPRACA
(closed symbols) and rTcPRACB (open symbols). After 30 min at
37.degree. C., the reaction was stopped by heat inactivation and
freezing. D. 39 kDa intracellular isoform was isolated from soluble
(Ese) extracts of non-infective epimastigote forms of the parasite.
Western-blots of serial dilutions of the soluble suspension was
compared to known amounts of rTcPRACB protein and used for protein
quantitation using Quantity One.RTM. software. Racemase assays were
performed in sodium acetate buffer pH6, using 40 mM L-proline and
the equivalent depicted amounts of 39 kDa (ng) contained in Ese
extract.
[0051] FIG. 3: Kinetic parameters of L-proline racemization
catalyzed by rTcPRACA and rTcPRACB proline racemase isoforms. The
progress of racemization reaction was monitored polarimetrically,
as previously described (13). A. The determination of the linear
part of the curve was performed at 37.degree. C. in medium
containing 0.2 M sodium acetate, pH 6.0; 0.25 .mu.M purified enzyme
and 40 mM L-proline. rTcPRACA reactions are represented by black
squares and rTcPRACB reactions by white squares. B. Initial rate of
racemase activity was assayed at 37.degree. C. in medium containing
0.2 M sodium acetate, pH 6.0, 0.125 .mu.M of rTcPRACA (solid
squares) or rTcPRACB (open squares) purified enzymes and different
concentrations of L-proline. Lineweaver-Burk double reciprocal
plots were used to determine values for K.sub.M and V.sub.max where
1/V is plotted in function of 1/[S] and the slope of the curve
represents K.sub.M/V.sub.max. Values obtained were confirmed by
using the Kaleidagraph.RTM. program and Michaelis-Menten equation.
The values are representative of six experiments with different
enzyme preparations. C. Double reciprocal plot kinetics of 0.125
.mu.M rTcPRACA proline racemase isoform in the presence (open)
squares or absence (solid) squares of 6.7 .mu.M PAC competitive
inhibitor in function of L-proline concentration. For comparison:
K.sub.M reported for the proline racemase of C. sticklandii was 2.3
mM; kinetic assays using the native protein obtained from a soluble
epimastigote fraction revealed a K.sub.M of 10.7 mM and a K.sub.i
of 1.15 .mu.M.
[0052] FIG. 4: Size exclusion chromatography of rTcPRACA protein
using a Superdex 75 column. Fractions were eluted by HPLC at pH
6.0, B2 and B4 peaks correspond to rTcPRACA dimer and monomer
species respectively. B1 and B5 eluted fractions were reloaded into
the column (bold, see inserts) using the same conditions and
compared to previous elution profile (not bold).
[0053] FIG. 5: Site-directed mutagenesis of TcPRACA proline
racemase. Schematic representation of the active site mutagenesis
of proline racemase of TcPRACA gene.
[0054] FIG. 6: Sequence alignments of proteins (Clustal X) obtained
by screening SWISS-PROT and TrEMBL databases using motifs I, II and
III. Amino acids involved in MI, MII and III are shaded in dark
grey and light grey figures the 13-14 unspecific amino acids
involved in M II. SWISS-PROT accession numbers of the sequences are
in Table IV.
[0055] FIG. 7: Cladogram of protein sequences obtained by T-coffee
alignment radial tree. See Table IV for SWISS-PROT protein
accession numbers.
[0056] FIG. 8 shows the percent of racemisation inhibition of
different L-proline concentrations (ranging from 10-40 mM) using
the D-AAO (D-AAO/L-) microtest as compared to conventional
detection using a polarimeter (Pol/L-).
[0057] FIG. 9 shows the comparison of D-MO/HRP reaction using
D-Proline alone or an equimolar mixture of D- and L-Proline as
standard.
[0058] FIG. 10 shows optical density at 490 nm as a function of
D-proline concentration under the following conditions.
[0059] FIG. 11 is a Graph obtained with the serial dilutions of
D-proline, as positive reaction control Obs: OD of wells (-)
average of OD obtained from blank wells.
[0060] FIG. 12 shows the loss of the enzymatic activity of proline
racemase after mutagenesis of the residue Cys.sup.160 or the
residue Cys.sup.330.
DETAILED DESCRIPTION OF THE INVENTION
[0061] Proline racemase catalyses the interconversion of L- and
D-proline enantiomers and has to date been described in only two
species. Originally found in the bacterium Clostridium sticklandii,
it contains cysteine residues in the active site and does not
require co-factors or other known coenzymes. The first eukaryotic
amino acid (proline) racemase, after isolation and cloning of a
gene from the pathogenic human parasite Trypanosoma cruzi, has been
described. While this enzyme is intracellularly located in
replicative non-infective forms of T. cruzi, membrane-bound and
secreted forms of the enzyme are present upon differentiation of
the parasite into non-dividing infective forms. The secreted
isoform of proline racemase is a potent host B-cell mitogen
supporting parasite evasion of specific immune responses.
[0062] Primarily it was essential to elucidate whether TcPRACB gene
could encode a functional proline racemase. To answer this
question, TcPRACA and TcPRACB paralogue genes were expressed in
Escherichia coli and detailed studies were performed on biochemical
and enzymatic characteristics of the recombinant proteins. This
invention demonstrates that TcPRACB indeed encodes a functional
proline racemase that exhibits slightly different kinetic
parameters and biochemical characteristics when compared to TcPRACA
enzyme. Enzymatic activities of the respective recombinant proteins
showed that the 39 kDa intracellular isoform of proline racemase
produced by TcPRACB construct is more stable and has higher rate of
D/L-proline interconversion than the 45 kDa isoform produced by
TcPRACA. Additionally, the dissociation constant of the
enzyme-inhibitor complex (K.sub.i) obtained with
pyrrole-2-carboxylic acid, the specific inhibitor of proline
racemases, is lower for the recombinant TcPRACB enzyme.
[0063] Moreover, this invention demonstrates that Cys.sup.330 and
Cys.sup.160 are key amino acids of the proline racemase active site
since the activity of the enzyme is totally abolished by
site-direct mutagenesis of these residues.
Also, multiple alignment of proline racemase amino acid sequences
allowed the definition of protein signatures that can be used to
identify putative proline racemases in other microorganisms. The
significance of the presence of proline racemase in eukaryotes,
particularly in T. cruzi, is discussed, as well as the consequences
of this enzymatic activity in the biology and infectivity of the
parasite.
[0064] This invention provides amino acid motifs, which are useful
as signatures for proline racemaces. These amino acid motifs are as
follows:
TABLE-US-00001 MOTIF I [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XG [SEQ ID
NO:1] MOTIF II [NSM][VA][EP][AS][FY]X(13, 14) [SEQ ID NO:2]
[GK]X[IVL]XXD[IV][AS][YwF]GGX[FWY] MOTIF III DRSPXGXGXXAXXA [SEQ ID
NO:3] MOTIF III* DRSPCGXGXXAXXA [SEQ ID NO:4]
where X is an amino acid in each of these sequences.
[0065] This invention also provides polynucleotides encoding amino
acid motifs, which are also referred to herein as the
"polynucleotides of the invention" and the "polypeptides of the
invention."
[0066] Databases were screened using these polynucleotide or
polypeptide sequences of TcPRACA. Motifs I to III were searched. M
I corresponds to [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG, M II to of
[NSM][VA][EP][AS][FY]X(13,14)[GK]X[IVL]XXD[IV][AS][YWF] GGX[FWY] M
III to DRSPXGXGXXAXXA and M III* to DRSPCGXGXX AXXA. Sequences
presented in the annex, where the conserved regions of 2 Cysteine
residues of the active site are squared, are presented in Table V
in bold with corresponding Accession numbers. The two cysteine
residues are Cys.sup.330 and its homologue Cys.sup.160, where
residue Cys.sup.160 mutation by a serine by site directed
mutagenesis also induces a drastic loss of the enzymatic activity
as for residue Cys.sup.330.
[0067] Proline racemase, an enzyme previously only described in
protobacterium Clostridium sticklandii (11), was shown to be
encoded also by the eukaryote Trypanosoma cruzi, a highly
pathogenic protozoan parasite (13). The Trypanosoma cruzi proline
racemase (TcPRAC), formerly called TcPA45, is an efficient mitogen
for host B cells and is secreted by the metacyclic forms of the
parasite upon infection, contributing to its immune-evasion and
persistence through non-specific polyclonal lymphocyte activation
(13). Previous results suggested that TcPRAC is encoded by two
paralogous genes per haploid genome. Protein localization studies
have also indicated that T. cruzi can differentially express
intracellular and secreted versions of TcPRAC during cell cycle and
differentiation, as the protein is found in the cytoplasm of
non-infective replicative (epimastigote) forms of the parasite, and
bound to the membrane or secreted in the infective, non-replicative
(metacyclic trypomastigote) parasites (13).
[0068] This invention characterizes the two TcPRAC paralogues and
demonstrates that both TcPRACA and TcPRACB give rise to functional
isoforms of co-factor independent proline racemases, which display
different biochemical properties that may well have important
implications in the efficiency of the respective enzymatic
activities. As suggested before by biochemical and theoretical
studies for the bacterial proline racemase (11,17,18), TcPRAC
activities rely on two monomeric enzyme subunits that perform
interconversion of L- and/or D-proline enantiomers by a two base
mechanism reaction in which the enzyme removes an .alpha.-hydrogen
from the substrate and donates a proton to the opposite side of the
.alpha.-carbon. It has been predicted that each subunit of the
homodimer furnishes one of the sulphydryl groups (18).
[0069] The present invention demonstrates that TcPRAC enzymatic
activities are bona fide dependent on the Cys.sup.330 residue of
the active site, as site-specific .sup.330Cys>Ser mutation
totally abrogates L- and D-proline racemization, in agreement with
a previous demonstration that TcPRAC enzymatic activity is
abolished through alkylation with iodoacetate or iodoacetamide
(13), similarly to the Clostridium proline racemase, where
carboxymethylation was shown to occur specifically with the two
cysteines of the reactive site leading to enzyme inactivation (12).
The present invention demonstrates also that the residue
Cys.sup.160 is also a critical residue of the active site and that
TcPRAC possesses two active sites in its homodimer. These
observations make it possible to search for inhibitors by means of
assays based on the native and mutated sequences.
[0070] While gene sequence analysis predicted that, by a mechanism
of alternative splicing, TcPRACA could generate both intracellular
and secreted versions of parasite proline racemase, the present
invention demonstrates that TcPRACB gene sequence per se codes for
a protein lacking the amino acids involved in peptide signal
formation and an extra N-terminal domain present in TcPRACA
protein, resembling more closely the CsPR. Thus, TcPRACB can only
generate an intracellular version of TcPRAC proline racemase. This
discovery makes it possible to carry out a search of one putative
inhibitor of an intracellular enzyme should penetrate the cell.
[0071] Interestingly, the presence of two homologous copies of
TcPRAC genes in the T. cruzi genome, coding for two similar
polypeptides but with distinct specific biochemical properties,
could reflect an evolutionary mechanism of gene duplication and a
parasite strategy to ensure a better environmental flexibility.
This assumption is comforted by the potential of TcPRACA gene to
generate two related protein isoforms by alternative splicing, a
mechanism that is particularly adept for cells that must respond
rapidly to environmental stimuli. Primarily, trans-splicing appears
indeed to be an ancient process that may constitute a selective
advantage for split genes in higher organisms (19) and alternative
trans-splicing was only recently proven to occur in T. cruzi (20).
As an alternative for promoter selection, the regulated production
of intracellular and/or secreted isoforms of proline racemase in T.
cruzi by alternative trans-splicing of TcPRACA gene would allow the
stringent conservation of a constant protein domain and/or the
possibility of acquisition of an additional secretory region
domain. As a matter of fact, recent investigations using RT-PCR
based strategy and a common 3' probe to TcPRACA and TcPRACB
sequences combined to a 5' spliced leader oligonucleotide followed
by cloning and sequencing of the resulting fragments have indeed
proved that an intracellular version of TcPRAC may also originate
from the TcPRACA gene, corroborating this hypothesis.
[0072] Gene duplication is a relatively common event in T. cruzi
that adds complexity to parasite genomic studies. Moreover, TcPRAC
chromosomal mapping revealed two chromosomal bands that possess
more than 3 chromosomes each and that may indicate that proline
racemase genes are mapped in size-polymorphic homologous
chromosomes, an important finding for proline racemase gene family
characterization. Preliminary results have, for instance, revealed
that T. cruzi DM28c type I strain maps proline racemase genes to
the same chromoblot regions identified with T. cruzi CL type II
strain used in the present invention.
[0073] It is well known that proline constitutes an important
source of energy for several organisms, such as several
hemoflagellates (21),(22),(23), and for flight muscles in insects
(24). Furthermore, a proline oxidase system was suggested in
trypanosomes (25) and the studies reporting the abundance of
proline in triatominae guts (26) have implicated proline in
metabolic pathways of Trypanosoma cruzi parasites as well as in its
differentiation in the digestive tract of the insect vector (27).
Thus, it is well accepted that T. cruzi can use L-proline as a
principal source of carbon (25).
[0074] Moreover, preliminary results using parasites cultured in
defined media indicate that both epimastigotes, found in the
vector, and infective metacyclic trypomastigote forms can
efficiently metabolize L- or D-proline as the sole source of
carbon. While certain reports indicate that biosynthesis of proline
occurs in trypanosomes, i.e. via reduction of glutamate carbon
chains or transamination reactions, an additional and direct
physiological regulation of proline might exist in the parasite to
control amino acid oxidation and its subsequent degradation or yet
to allow proline utilization. In fact, a recent report showed two
active proline transporter systems in T. cruzi (28). T. cruzi
proline racemase may possibly play a consequential role in the
regulation of intracellular proline metabolic pathways, or else, it
could participate in mechanisms of post-translational addition of
D-amino acid to polypeptide chains.
[0075] On one hand, these hypotheses would allow for an energy gain
and, on the other hand, would permit the parasite to evade host
responses. In this respect, it was reported that a single D-amino
acid addition in the N-terminus of a protein is sufficient to
confer general resistance to lytic reactions involving host
proteolytic enzymes (29). The expression of proteins containing
D-amino acids in the parasite membrane would benefit the parasite
inside host cell lysosomes, in addition to the contribution to the
initiation of polyclonal activation, as already described for
polymers composed of D-enantiomers (30), (31). Although D-amino
acid inclusion in T. cruzi proteins would benefit the parasite,
this hypothesis remains to be proven and direct evidence is
technically difficult to obtain.
[0076] It is worth noting that metacyclogenesis of epimastigotes
into infective metacyclic forms involves parasite morphologic
changes that include the migration of the kinetoplast, a structure
that is physically linked to the parasite flagellum, and many other
significant metabolic alterations that combine to confer
infectivity/virulence to the parasite (13,32). Proline racemase was
shown to be preferentially localized in the flagellar pocket of
infective parasite forms after metacyclogenesis (13), as are many
other known proteins secreted and involved in early infection
(33).
[0077] It is also conceivable that parasite proline racemase may
function as an early mediator for T. cruzi differentiation through
intracellular modification of internalized environmental free
proline, as suggested above and already observed in some bacterial
systems. As an illustration, exogenous alanine has been described
as playing an important role in bacterial transcriptional
regulation by controlling an operon formed by genes coding for
alanine racemase and a smaller subunit of bacterial dehydrogenase
(34).
[0078] In bacteria, membrane alanine receptors are responsible for
alanine and proline entry into the bacterial cell (35). It can then
be hypothesized that the availability of proline in the insect gut
milieu associated to a mechanism of environmental sensing by
specific receptors in the parasite membrane would stand for
parasite proline uptake and its further intracellular racemization.
Proline racemase would then play a fundamental role in the
regulation of parasite growth and differentiation by its
participation in both metabolic energetic pathways and the
expression of proteins containing D-proline, as described above,
consequently conferring parasite infectivity and its ability to
escape host specific responses.
[0079] Thus far, and contrasting to the intracellular isoform of
TcPRAC found in epimastigote forms of T. cruzi, the ability of
metacyclic and bloodstream forms of the parasite to express and
secrete proline racemase may have further implications in
host/parasite interaction. In fact, the parasite-secreted isoform
of proline racemase participates actively in the induction of
non-specific polyclonal B-cell responses upon host infection (13)
and favors parasite evasion, thus ensuring its persistence in the
host.
[0080] As described for other mitogens and parasite antigens (36),
(37), (38), and in addition to its mitogenic property, TcPRAC could
also be involved in modifications of host cell targets enabling
better parasite attachment to host cell membranes in turn assuring
improved infectivity. Since several reports associate accumulation
of L-proline with muscular dysfunction (39) and inhibition of
muscle contraction (40), the release of proline racemase by
intracellular parasites could alternatively contribute to the
maintenance of infection through regulation of L-proline
concentration inside host cells, as proline was described as
essential for the integrity of muscular cell targets. Therefore, it
has recently been demonstrated that transgenic parasites
hyperexpressing TcPRACA or TcPRACB genes, but not functional knock
outs, are 5-10 times more infective to host target cells pointing
to a critical role of proline racemases in the ongoing of the
infectious process. Likewise, previous reports demonstrated that
genetic inactivation of Lysteria monocytogenes alanine racemase and
D-amino acid oxidase genes abolishes bacterial pathogenicity, since
the presence of D-alanine is required for the synthesis of the
mucopeptide component of the cell wall that protects virtually all
bacteria from the external milieu (41).
[0081] Present analysis using identified critical conserved
residues in TcPRAC and C. sticklandii proline racemase genes and
the screening of SWISS-PROT and TrEMBL databases led to the
discovery of a minimal signature for proline racemases,
DRSPXGX[GA]XXAXXA, and to confirm the presence of putative proteins
in at least 10 distinct organisms. Screening of unfinished genome
sequences showed highly homologous proline racemase candidate genes
in an additional 8 organisms, amongst which are the fungus
Aspergillus fumigatus and the bacteria Bacillus anthracis and
Clostridium botulinum. This is of particular interest, since
racemases, but not proline racemases, are widespread in bacteria
and only recently described in more complex organisms such as T.
cruzi, 42,43). These findings may possibly reflect cell adaptative
responses to extracellular stimuli and uncover more general
mechanisms for the regulation of gene expression by D-amino acids
in eukaryotes. The finding of similar genes in human and mouse
genome databases using less stringent signatures for proline
racemase is striking. However, the absence of the crucial amino
acid cysteine in the putative active site of those predicted
proteins suggests a different functionality than that of a proline
racemase.
[0082] This invention shows that TcPRAC isoforms are highly stable
and have the capacity to perform their activities across a large
spectrum of pH. In addition, the affinity of pyrrol-carboxylic
acid, a specific inhibitor of proline racemase, is higher for
TcPRAC enzymes than for CsPR.
[0083] The invention also provides amino acid or nucleic acid
sequences substantially similar to specific sequences disclosed
herein.
[0084] The term "substantially similar" when used to define either
amino acid or nucleic acid sequences means that a particular
subject sequence, for example, a mutant sequence, varies from a
reference sequence by one or more substitutions, deletions, or
additions, the net effect of which is to retain activity.
Alternatively, nucleic acid subunits and analogs are "substantially
similar" to the specific DNA sequences disclosed herein if: (a) the
DNA sequence is derived from a region of the invention; (b) the DNA
sequence is capable of hybridization to DNA sequences of (a) and/or
which encodes active molecules; or DNA sequences that are
degenerate as a result of the genetic code to the DNA sequences
defined in (a) or (b) and/or which encode active molecules.
[0085] In order to preserve the activity, deletions and
substitutions will preferably result in homologously or
conservatively substituted sequences, meaning that a given residue
is replaced by a biologically similar residue. Examples of
conservative substitutions include substitution of one aliphatic
residue for another, such as Ile, Val, Leu, or Ala for one another,
or substitution of one polar residue for another, such as between
Lys and Arg; Glu and Asp; or Gln and Asn. Other such conservative
substitutions, for example, substitutions of entire regions having
similar hydrophobicity characteristics, are well known. When said
activity is proline racemase activity, Cys.sup.330 and Cys.sup.160
must be present.
[0086] The polynucleotides of the invention can be used as probes
or to select nucleotide primers notably for an amplification
reaction. PCR is described in the U.S. Pat. No. 4,683,202 granted
to Cetus Corp. The amplified fragments can be identified by agarose
or polyacrylamide gel electrophoresis, or by a capillary
electrophoresis, or alternatively by a chromatography technique
(gel filtration, hydrophobic chromatography, or ion exchange
chromatography). The specificity of the amplification can be
ensured by a molecular hybridization using as nucleic acid probes
the polynucleotides of the invention, oligonucleotides that are
complementary to these polynucleotides, or their amplification
products themselves.
[0087] Amplified nucleotide fragments are useful as probes in
hybridization reactions in order to detect the presence of one
polynucleotide according to the present invention or in order to
detect the presence of a gene encoding racemase activity, such as
in a biological sample. This invention also provides the amplified
nucleic acid fragments ("amplicons") defined herein above. These
probes and amplicons can be radioactively or non-radioactively
labeled using, for example, enzymes or fluorescent compounds.
[0088] Other techniques related to nucleic acid amplification can
also be used alternatively to the PCR technique. The Strand
Displacement Amplification (SDA) technique (Walker et al., 1992) is
an isothermal amplification technique based on the ability of a
restriction enzyme to cleave one of the strands at a recognition
site (which is under a hemiphosphorothioate form), and on the
property of a DNA polymerase to initiate the synthesis of a new
strand from the 3' OH end generated by the restriction enzyme, and
on the property of this DNA polymerase to displace the previously
synthesized strand being localized downstream.
[0089] The SDA amplification technique is more easily performed
than PCR (a single thermostated water bath device is necessary),
and is faster than the other amplification methods. Thus, the
present invention also comprises using the nucleic acid fragments
according to the invention (primers) in a method of DNA or RNA
amplification, such as the SDA technique.
[0090] The polynucleotides of the invention, especially the primers
according to the invention, are useful as technical means for
performing different target nucleic acid amplification methods,
such as:
[0091] TAS (Transcription-based Amplification System), described by
Kwoh et al. in 1989;
[0092] SR (Self-Sustained Sequence Replication), described by
Guatelli et al. in 1990;
[0093] NASBA (Nucleic acid Sequence Based Amplification), described
by Kievitis et al. in 1991; and
[0094] TMA (Transcription Mediated Amplification).
[0095] The polynucleotides of the invention, especially the primers
according to the invention, are also useful as technical means for
performing methods for amplification or modification of a nucleic
acid used as a probe, such as:
[0096] LCR (Ligase Chain Reaction), described by Landegren et al.
in 1988 and improved by Barany et al. in 1991, who employ a
thermostable ligase;
[0097] RCR (Repair Chain Reaction), described by Segev et al. in
1992;
[0098] CPR (Cycling Probe Reaction), described by Duck et al. in
1990; and
[0099] Q-beta replicase reaction, described by Miele et al. in 1983
and improved by Chu et al. in 1986, Lizardi et al. in 1988, and by
Burg et al. and Stone et al. in 1996.
[0100] When the target polynucleotide to be detected is RNA, for
example mRNA, a reverse transcriptase enzyme can be used before the
amplification reaction in order to obtain a cDNA from the RNA
contained in the biological sample. The generated cDNA can be
subsequently used as the nucleic acid target for the primers or the
probes used in an amplification process or a detection process
according to the present invention.
[0101] The oligonucleotide probes according to the present
invention hybridize specifically with a DNA or RNA molecule
comprising all or part of the polynucleotide of the invention under
stringent conditions. As an illustrative embodiment, the stringent
hybridization conditions used in order to specifically detect a
polynucleotide according to the present invention are
advantageously the following:
[0102] Prehybridization and hybridization are performed as follows
in order to increase the probability for heterologous
hybridization: [0103] The prehybridization and hybridization are
done at 50.degree. C. in a solution containing 5.times.SSC and
1.times.Denhardt's solution.
[0104] The washings are performed as follows: [0105] 2.times.SSC at
60.degree. C. 3 times during 20 minutes each.
[0106] The non-labeled polynucleotides of the invention can be
directly used as probes. Nevertheless, the polynucleotides can
generally be labeled with a radioactive element (.sup.32P,
.sup.35S, .sup.3H, .sup.125I) or by a non-isotopic molecule (for
example, biotin, acetylaminofluorene, digoxigenin,
5-bromodesoxyuridin, fluorescein) in order to generate probes that
are useful for numerous applications. Examples of non-radioactive
labeling of nucleic acid fragments are described in the French
Patent No. FR 78 10975 or by Urdea et al. or Sanchez-Pescador et
al. 1988.
[0107] Other labeling techniques can also be used, such as those
described in the French patents 2 422 956 and 2 518 755. The
hybridization step can be performed in different ways. A general
method comprises immobilizing the nucleic acid that has been
extracted from the biological sample on a substrate
(nitrocellulose, nylon, polystyrene) and then incubating, in
defined conditions, the target nucleic acid with the probe.
Subsequent to the hybridization step, the excess amount of the
specific probe is discarded, and the hybrid molecules formed are
detected by an appropriate method (radioactivity, fluorescence, or
enzyme activity measurement).
[0108] Advantageously, the probes according to the present
invention can have structural characteristics such that they allow
signal amplification, such structural characteristics being, for
example, branched DNA probes as those described by Urdea et al. in
1991 or in the European Patent No. 0 225 807 (Chiron).
[0109] In another advantageous embodiment of the present invention,
the probes described herein can be used as "capture probes", and
are for this purpose immobilized on a substrate in order to capture
the target nucleic acid contained in a biological sample. The
captured target nucleic acid is subsequently detected with a second
probe, which recognizes a sequence of the target nucleic acid that
is different from the sequence recognized by the capture probe.
[0110] The oligonucleotide probes according to the present
invention can also be used in a detection device comprising a
matrix library of probes immobilized on a substrate, the sequence
of each probe of a given length being localized in a shift of one
or several bases, one from the other, each probe of the matrix
library thus being complementary to a distinct sequence of the
target nucleic acid. Optionally, the substrate of the matrix can be
a material able to act as an electron donor, the detection of the
matrix positions in which hybridization has occurred being
subsequently determined by an electronic device. Such matrix
libraries of probes and methods of specific detection of a target
nucleic acid are described in European patent application No. 0 713
016, or PCT Application No. WO 95 33846, or also PCT Application
No. WO 95 11995 (Affymax Technologies), PCT Application No. WO 97
02357 (Affymetrix Inc.), and also in U.S. Pat. No. 5,202,231
(Drmanac), said patents and patent applications being herein
incorporated by reference.
[0111] The present invention also pertains to recombinant plasmids
containing at least a nucleic acid according to the invention. A
suitable vector for the expression in bacteria, and in particular
in E. coli, is pET-28 (Novagen), which allows the production of a
recombinant protein containing a 6.times.His affinity tag. The
6.times.His tag is placed at the C-terminus or N-terminus of the
recombinant polypeptide.
[0112] The polypeptides according to the invention can also be
prepared by conventional methods of chemical synthesis, either in a
homogenous solution or in solid phase. As an illustrative
embodiment of such chemical polypeptide synthesis techniques, the
homogenous solution technique described by Houbenweyl in 1974 may
be cited.
[0113] The polypeptides of the invention are useful for the
preparation of polyclonal or monoclonal antibodies that recognize
the polypeptides (SEQ ID NOS: 1, 2, 3, and 4) or fragments thereof.
The monoclonal antibodies can be prepared from hybridomas according
to the technique described by Kohler and Milstein in 1975. The
polyclonal antibodies can be prepared by immunization of a mammal,
especially a mouse or a rabbit, with a polypeptide according to the
invention, which is combined with an adjuvant, and then by
purifying specific antibodies contained in the serum of the
immunized animal on a affinity chromatography column on which has
previously been immobilized the polypeptide that has been used as
the antigen.
[0114] A method of detecting a racemase encoded by a nucleotide
sequence containing a subsequence encoding a peptide selected from
SEQ ID NOS: 1, 2, 3, or 4.
[0115] Consequently, the invention is also directed to a method for
detecting specifically the presence of a polypeptide according to
the invention in a biological sample. The method comprises: [0116]
a) bringing into contact the biological sample with an antibody
according to the invention; and [0117] b) detecting
antigen-antibody complex formed.
[0118] Also part of the invention is a diagnostic kit for in vitro
detecting the presence of a polypeptide according to the present
invention in a biological sample. The kit comprises: [0119] a
polyclonal or monoclonal antibody as described above, optionally
labeled; and [0120] a reagent allowing the detection of the
antigen-antibody complexes formed, wherein the reagent carries
optionally a label, or being able to be recognized itself by a
labeled reagent, more particularly in the case when the
above-mentioned monoclonal or polyclonal antibody is not labeled by
itself.
[0121] The present invention is also directed to bioinformatic
searches in data banks using the whole sequences of the
polypeptides using the whole sequences of the polypeptides (SEQ ID
NOS: 1, 2, 3, or 4). In this case the method detects the presence
of at least a subsequence encoding a peptide selected from SEQ ID
NOS: 1, 2, 3, or 4 wherein the said at least subsequence is
indicative of a racemase.
[0122] The invention also pertains to:
[0123] A purified polypeptide or a peptide fragment having at least
10 amino acids, which is recognized by antibodies directed against
a polynucleotide or peptide sequence according to the
invention.
[0124] A monoclonal or polyclonal antibody directed against a
polypeptide or a peptide fragment encoded by the polynucleotide
sequences according to the invention.
[0125] A method of detecting a racemase in a biological sample
comprising: [0126] a) contacting DNA or RNA of the biological
sample with a primer or a probe from a polynucleotide according to
the invention, which hybridizes with a nucleotide sequence; [0127]
b) amplifying the nucleotide sequence using the primer or said
probe; and [0128] c) detecting the hybridized complex formed
between the primer or probe with the DNA or RNA.
[0129] A kit for detecting the presence of a racemase in a
biological sample, comprises: [0130] a) a polynucleotide primer or
probe according to the invention; and [0131] b) reagents necessary
to perform a nucleic acid hybridization reaction.
[0132] An in vitro method of screening for an active molecule
capable of inhibiting a racemase encoded by a nucleic acid
containing a polynucleotide according to the invention, wherein the
inhibiting activity of the molecule is tested on at least said
racemase, comprises: [0133] a) providing racemase containing a
polypeptide according to the invention; [0134] b) contacting the
active molecule with said racemase; [0135] c) testing the capacity
of the active molecule, at various concentrations, to inhibit the
activity of the racemase; and [0136] d) choosing the active
molecule that provides an inhibitory effect of at least 80% on the
activity of the racemase.
[0137] The term "recombinant" as used herein means that a protein
or polypeptide employed in the invention is derived from
recombinant (e.g., microbial or mammalian) expression systems.
"Microbial" refers to recombinant proteins or polypeptides made in
bacterial or fungal (e.g., yeast) expression systems. As a product,
"recombinant microbial" defines a protein or polypeptide produced
in a microbial expression system, which is essentially free of
native endogenous substances. Proteins or polypeptides expressed in
most bacterial cultures, e.g. E. coli, will be free of glycan.
Proteins or polypeptides expressed in yeast may have a
glycosylation pattern different from that expressed in mammalian
cells.
[0138] The polypeptide or polynucleotide of this invention can be
in isolated or purified form. The terms "isolated" or "purified",
as used in the context of this specification to define the purity
of protein or polypeptide compositions, means that the protein or
polypeptide composition is substantially free of other proteins of
natural or endogenous origin and contains less than about 1% by
mass of protein contaminants residual of production processes. Such
compositions, however, can contain other proteins added as
stabilizers, excipients, or co-therapeutics. These properties
similarly apply to polynucleotides of the invention.
[0139] The platform of the invention relates to reagents, systems
and devices for performing the process of screening of D-amino acid
tests.
[0140] Appropriate carriers, diluents, and adjuvants can be
combined with the polypeptides and polynucleotides described herein
in order to prepare the compositions of the invention. The
compositions of this invention contain the polypeptides or
polynucleotides together with a solid or liquid acceptable nontoxic
carrier. Such carriers can be sterile liquids, such as water an
oils, including those of petroleum, animal, vegetable, or synthetic
origin. Examples of suitable liquids are peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier.
Physiological solutions can also be employed as liquid
carriers.
[0141] This invention will now be described with reference to the
following Examples.
Example 1
Cloning and Automated Sequencing
[0142] Lambda phage and plasmid DNA were prepared using standard
techniques and direct sequencing was accomplished with the Big dye
Terminator Kit (Perkin Elmer, Montigny-le Bretonneux, France)
according to the manufacturer's instructions. Extension products
were run for 7 h in an ABI 377 automated sequencer. Briefly, to
obtain the full length of the TcPRAC gene, .sup.32P-labeled 239 bp
PCR product was used as a probe to screen a T. cruzi clone
CL-Brener lamba Fix II genomic library (see details in (13)). There
were isolated 4 independent positive phages. Restriction analysis
and Southern blot hybridization showed two types of genomic
fragments, each represented by 2 phages. Complete sequence and
flanking regions of representative phages for each pattern was
done. Complete characterization of TcPRACA gene, representing the
first phage type, was previously described in (13). Full sequence
of the putative TcPRACB gene, representing the second phage type
was then performed and primers internal to the sequence were used
for sequencing, as described before (13).
Example 2
Chromoblots
[0143] Epimastigote forms T. cruzi (clone CL Brener) are maintained
by weekly passage in LIT medium. Agarose (0.7%) blocks containing
1.times.10.sup.7 cultured parasites were lysed with 0.5 M EDTA/10
mM Tris/1% sarcosyl pH 8.0, digested by proteinase K and washed in
10 mM Tris/1 mM EDTA, pH 8.0. Pulsed-field-gel electrophoresis
(PFGE) was carried out at 18.degree. C. using the Gene Navigator
apparatus (Pharmacia, Upsala, Sweden) in 0.5.times.TBE.
Electrophoresis were performed, as described in (14). Gels were
then stained with ethidium bromide, photographed, exposed to UV
light (265 nm) for 5 min and further blotted under alkaline
conditions to a nylon filter (HybondN.sup.+, Amersham Life Science
Inc., Cleveland, USA). DNA probe, obtained by PCR amplification of
TcPRACA gene with Hi-45 (5' CTC TCC CAT GGG GCA GGA AAA GCT TCT G
3') [SEQ ID NO:5] and Bg-45 (5' CTG AGC TCG ACC AGA T(CA)T ACT GC
3') [SEQ ID NO:6] oligonucleotides (as described in (13)) was
labelled with .alpha.dATP.sup.32 using Megaprime DNA labelling
system (Amersham). The chromoblot was hybridized overnight in
2.times.Denhart's/5.times.SSPE/1.5% SDS at 55.degree. C. and washed
in 2.times.SSPE/0.1% SDS followed by 1.times.SSPE at 60.degree. C.
Autoradiography was obtained by overnight exposure of the
chromoblot using a Phosphorimager cassette (Molecular Dynamics,
UK).
Example 3
Plasmid Construction and Protein Purification
[0144] TcPRACA gene fragment starting at codon 30 was obtained by
PCR, using Hi- and Bg45 primers, and cloned in frame with a
C-terminal six-histidine tag into the pET28b(+) expression vector
(Novagen-Tebu, Le Perray en Yvelines, France). The fragment
encoding for the TcPRACB consisted of a HindIII digestion of
TcPRACB gene fragment obtained by similar PCR and cloned in frame
with a C-terminal six-histidine tag into the pET28b(+) expression
vector. Respective recombinant proteins TcPRACA and TcPRACB were
produced in E. coli BL21 (DE3) (Invitrogen, Cergy Pontoise, France)
and purified using Immobilized Metal Affinity Chromatography on
nickel columns (Novagen-Tebu, Le Parrayen Yvelines, France)
following the manufacturer's instructions.
Example 4
Size Exclusion Chromatography
[0145] rTcPRACA and rTcPRACB proteins were purified as described
here above and dialysed against PBS pH 7.4 or 0.2 M NaOAc pH 6.0
elution buffers in dialysis cassettes (Slide-A-lyzer 7K Pierce),
overnight at 4.degree. C. The final protein concentration was
adjusted to 2 mg/ml and 0.5 ml of the solution were loaded onto
Pharmacia Superdex 75 column (HR10.times.30), previously calibrated
with a medium range protein calibration kit (Pharmacia). Size
exclusion chromatography (SEC) was carried out using an FPLC system
(AKTA Purifier, Pharmacia). Elution was performed at a constant
flow rate of 0.5 ml/min, protein fractions of 0.5 ml were collected
and the absorbance was monitored at 280 nm. Each fraction was
assayed in racemization assays as described here below. Fractions
B1 and B5, were reloaded in the Superdex 75 column and submitted to
a further SEC to verify the purity of the fractions.
Example 5
Racemization Assays
[0146] The percent of racemization with different concentrations of
L-proline, D-proline, L-hydroxy (OH)-proline, D-hydroxy
(OH)-proline was calculated, as described in (13), by incubating a
500 .mu.l mixture of 0.25 .mu.M of dimeric protein and 40 mM
substrate in 0.2 M sodium acetate pH 6.0 for 30 min or 1 h at
37.degree. C. The reaction was stopped by incubating for 10 min at
80.degree. C. and freezing. Water (1 ml) was then added, and the
optical rotation was measured in a polarimeter 241 MC (Perkin
Elmer, Montigny le Bretonneux, France) at a wavelength of 365 nm,
in a cell with a path length of 10 cm, at a precision of 0.001
degree. The percent of racemization of 40 mM L-proline as a
function of pH was determined using 0.2 M sodium acetate, potassium
phosphate and Tris-HCl buffers; reactions were incubated 30 min at
37.degree. C., as described above. All reagents were purchased from
Sigma.
Example 6
Kinetic Assays
[0147] Concentrations of L- and D-proline were determined
polarimetrically from the optical rotation of the solution at 365
nm in a cell of 10 cm path length, thermostated at 37.degree. C.
Preliminary assays were done with 40 mM of L-proline in 0.2 M
sodium acetate pH 6 in a final volume of 1.5 ml. Optical rotation
was measured every 5 sec during 10 min and every 5 min to 1 hour.
After determination of the linear part of the curve, velocity in
5-160 mM substrate was measured every 30 sec during 10 min to
determine K.sub.M and V.sub.max. Calculations were done using the
Kaleidagraph program. Inhibition assays were done by incubating
0.125 .mu.M dimeric protein, 6.7 .mu.M-6 mM pyrrole-2-carboxylic
acid (PAC), 20 to 160 mM L-proline, as described above. Graphic
representation and linear curve regression allowed the
determination of K.sub.i as [PAC]/[(slope with PAC/slope without
PAC)-1]. All reagents were purchased from Sigma.
Example 7
Site-Directed Mutagenesis of .sup.C330STcPRACA
[0148] Site-directed mutagenesis was performed by PCR, adapting the
method of Higuchi et al. (15). Briefly, mutation of Cys.sup.330 of
the proline racemase active site was produced by two successive
polymerase chain reactions based on site-directed mutagenesis using
two overlapping mutagenic primers: (act-1) 5' GCG GAT CGC TCT CCA
AGC GGG ACA GGC ACC 3' [SEQ ID NO:7] and (act-2) 5' GGT GCC TGT CCC
GCT TGG AGA GCG ATC CGC 3', [SEQ ID NO:8] designed to introduce a
single codon mutation in the active site by replacement of the
cysteine (TGT) at the position 330 by a serin (AGC). A first step
standard PCR amplification was performed using the TcPRACA DNA as
template and a mixture of act-1 primer and the reverse C-terminus
primer (Bg-45) 5' CTG AGC TCG ACC AGA T(CA)T ACT GC 3' (codon 423),
or a mixture of act-2 primer and the forward N-terminus primer
(Hi-45) 5' CTC TCC CAT GGG GCA GGA AAA GCT TCT G 3' (codon-53) (see
FIG. 5). Resulting amplified fragments of, respectively, 316 bp and
918 bp were purified by Qiagen PCR extraction kit (Qiagen,
Courtaboeuf, France), as prescribed, and further ligated by T4
ligase to generate a template consisting of the full length of a
potentially mutated TcPRACA* coding sequence used for the second
step PCR. Amplification of this template was performed using
forward Hi-45 and reverse Bg-45 primers and the resulting TcPRACA*
fragment encoding for the mature proline racemase was purified and
cloned in pCR.RTM.2.1-TOPO.RTM. vector (Invitrogen). TOP10
competent E. coli were transformed with the
pCR.RTM.2.1-TOPO.RTM.-TcPRACA* construct and plasmid DNA isolated
from individual clones prepared for DNA sequencing. Positive
mutants were then sub-cloned in frame with a C-terminal
six-histidine tag into the Nco I/Sac I sites of the pET 28b(+)
expression vector (Novagen-Tebu, Le Parrayen Yvelines, France).
Sub-clones of pET28b(+)-TcPRACA* produced in E. coli (DH5.alpha.)
were sequenced again to confirm the presence of the mutation.
Soluble recombinant .sup.C330STcPRACA protein was produced in E.
coli BL21 (DE3) (Invitrogen) and purified using a nickel column
(Novagen-Tebu), according the manufacturer's instructions.
Example 8
Mutagenesis
[0149] To verify the implication of the residue Cys160 in the
reaction mechanism of the proline racemase, a site specific
mutagenesis was performed to replace the residue Cys160 by a
Serine, similarly to mutation described for Cys330 residue (see
Example 7). Briefly, the site specific mutagenesis was performed by
PCR using the following primers:
TABLE-US-00002 Ser160-Forward:
.sup.5'GGCTATTTAAATATGTCTGGACATAACTCAATTGCAGCG.sup.3'
Ser160-Reverse:
.sup.5'CGCTGCAATTGAGTTATGTCCAGACATATTTAAATAGC.sup.3'
[0150] The presence of the mutation Cystein-Serine was verified by
sequencing of the respective plasmids containing the PCR products,
as shown here below. The plasmid pET-C160S was used to transform E.
coli BL21 (DE3) and to produce the corresponding recombinant
mutated protein.
TABLE-US-00003 139 M D T C G Y L N M C G H N G I A A 145 PET-TcPRAC
499 ATCGATACCGCTGGCTATTTAAATATGTGTGGACATAACTCAATTGCAGCG 550
Ser160-F/R CGCTATTTAAATATGTCTGGACATAACTCAATTGCAGCG 550 pET-C160S
499 ATGGATACCGGTGGCTATTTAAATATGTCTGGACATAACTCAATTGCAGCG 550
pET-C330S 499 ATGGATACCGGTGGCTATTTAAATATGTGTCGACATAACTCAATTGCAGCG
550 139 M D T C G Y L N M S G H N G I A A 145 318 V I F C N R Q A D
R S P C G T C T 334 pET-TcPRAC 999
GTGATATTTCGCAATCGCCAGCCGGATCGCTCTCCATGTGGGACAGGCACC 1050 Ser330-F/R
GCGGATCGCTCTCCAACCGGGACAGGCACC 1050 pET-C160S 999
CTCATATTTCCCAATCGCCAGCCCCATCGCTCTCCATCTGGGACACCCACC 1050 pET-C330S
999 CTGATATTTCGCAATCCCCAGGCGGATCGCTCTCCAACCCCGACACGCACC 1050 318 V
I F G N R Q A D R S P S G T C T 334
[0151] Underlined are the primer sequences used for the site
specific mutageneses. The mutations Cys.fwdarw.Ser are represented
in bold and underlined for both Cys160 and Cys330 residues.
Example 9
Expression of a Functional Intracellular Isoform of Proline
Racemase
[0152] Previously characterized was a TcPRAC gene from T. cruzi,
and it was demonstrated in vivo and in vitro that it encodes a
proline racemase enzyme (13). Analysis of the genomic organization
and transcription of the TcPRAC gene indicated the presence of two
paralogue gene copies per haploid genome, named TcPRACA.sup.1 and
TcPRACB.sup.2. It was shown that TcPRACA encodes a functional
co-factor independent proline racemase, closely resembling the C.
sticklandii proline racemase (CsPR) (11). Now sequenced was the
full length of TcPRACB and, as can be observed in FIG. 1A, TcPRACA
and TcPRACB genes both possess the characteristic trypanosome
polypyrimidine-rich motifs in the intergenic region that are
crucial trans-splicing signals when located upstream of an
(AG)-dinucleotide used as acceptor site. As in other T. cruzi
genes, UUA triplets are found at the end of the 3' untranslated
region preceding the polyadenylation site. Comparison between the
two sequences revealed 14 point mutations (resulting in 96%
identity) giving rise to 7 amino acid differences. When expressed,
the TcPRACB is predicted to produce a shorter protein (39 kDa)
whose translation would start at the ATG codon at position 274
located downstream of the (AG)-spliced leader acceptor site (at
position 175). In comparison, TcPRACA has an open reading frame
that encodes a peptide with an apparent molecular mass of 45 kDa.
The schematic protein sequence alignment of the two proteins
TcPRACA and TcPRACB depicted in FIG. 18 reveals that TcPRACB
proline racemase lacks the amino acid sequence corresponding to the
signal peptide observed in the TcPRACA protein (hatched box in the
figure; see predicted cleavage site in FIG. 1C). Therefore the
TcPRACB would produce a 39 kDa, intracellular and non-secreted
isoform of the protein. As with CsPR (11) and TcPRACA (13 and FIG.
1B), the active site of proline racemase is conserved in TcPRACB
sequence. Furthermore, while differing by only 7 amino acids, both
the TcPRACA and TcPRACB sequences display around 50% homology to
the CsPR (13). In accordance with other protein-coding genes in T.
cruzi, TcPRAC genes are located on two different chromosomal bands
of which one contains three or more chromosomes of similar size,
see FIG. 1D. Thus, hybridization of blots containing T. cruzi CL
Brener chromosomal bands separated by pulsed field gel
electrophoresis revealed that sequences recognized by an homologous
probe to both TcPRACA and TcPRACB are mapped in neighboring
migrating bands of approximately 0.9 Mb and 0.8 Mb, corresponding
respectively to regions VII and V, according to Cano et al.
numbering system (14).
[0153] In order to verify if the TcPRACB gene could encode a
functional proline racemase, both T. cruzi paralogues were
expressed in E. coli to produce C-terminal His.sub.6-tagged
recombinant proteins. After purification by affinity chromatography
on nickel-nitrilotriacetic acid agarose column, recombinant
proteins were separated by SDS gel electrophoresis revealing single
bands with the expected sizes of 45.8 and 40.1 kDa, respectively,
for the rTcPRACA and rTcPRACB proteins (FIG. 2A). To determine
whether rTcPRACB displays proline racemase enzymatic activity,
biochemical assays were employed to measure the shift in optical
rotation of L- and D-proline substrates, as described (13). As can
be seen in FIG. 2B, rTcPRACB racemizes both L- and D-proline but
not L-hydroxy-proline, like rTcPRACA. In a similar manner, rTcPRACB
is a co-factor independent proline racemase as described for CsPR
(11) and rTcPRACA (13) proline racemases. The rate of conversion of
L- into D-proline was measured at various pH values using both
recombinant enzymes. As illustrated in FIG. 2C, rTcPRACA activity
clearly shows a pH dependency with an optimal activity from pH 5.5
to 7.0. In contrast, the optimum activity of rTcPRACB can be
observed in a large pH spectrum varying from pH 4.5 to 8.5. These
results revealed that translation of the open reading frame of both
TcPRAC genes copies result in functional proline racemase isoforms.
As previously described, Western blot analysis of non-infective
epimastigote parasite extracts using antibodies raised against the
45 kDa secreted proline racemase had previously revealed a 39 kDa
protein mostly in the soluble cellular fraction, only weakly in the
cellular insoluble fraction and absent from culture medium (13). To
demonstrate that the intracellular 39 kDa isoform of the protein
was equally functional in vivo, soluble cellular extracts were
obtained from 5.times.10.sup.8 epimastigotes, non-infective
parasites and the levels of 39 kDa soluble protein quantified by
Western blot comparatively to known amounts of rTcPRACB enzyme. As
can be observed in FIG. 2D, the intracellular isoform of the
protein is indeed functional in vivo, since proline racemase
enzymatic activity was displayed and levels of racemization were
dependent on protein concentration. This discovery is useful for
specific inhibitors reaching the intracellular compartment.
Example 10
Functional Analysis and Kinetic Properties of Recombinant T. cruzi
Proline Racemases
[0154] Since the TcPRAC gene copies encode for secreted and
non-secreted isoforms of proline racemase with distinct pH
requirements for activity, our investigation was made to determine
whether other biochemical properties differ between rTcPRACA and
rTcPRACB proteins. Such differences might reflect the cellular
localization of the protein during parasite differentiation and
survival in the host. Both rTcPRACA and rTcPRACB enzyme activities
are maximal at 37.degree. C. and can be abolished by heating for 5
min at 80.degree. C. However, the stability of the two recombinant
enzymes differs considerably, when analyzed under different storage
conditions. Thus, as shown in Table 1, purified rTcPRACB is highly
stable, since its activity is maintained for at least 10 days at
room temperature in 0.5 M imidazol buffer pH 8.0, as compared to
rTcPRACA that loses 84% of its activity under such conditions. In
contrast, most of the enzymatic activity of rTcPRACA is maintained
at 4.degree. C. (65%), compared to that of rTcPRACB (34%). Both
enzymes can be preserved in 50% glycerol at -20.degree. C., or
diluted in sodium acetate buffer at pH 6.0, but under these storage
conditions rTcPRACA activity is impaired. However, best
preservation of both recombinant proline racemases was undoubtedly
obtained when proteins were kept at -20.degree. C. as ammonium
sulfate precipitates. Preservation is important for a kit.
TABLE-US-00004 TABLE I Stability of recombinant TcPRACA and TcPRACB
proline racemases under different storage conditions % of
preservation of proline racemase activity NaOAc Column pH 6
(NH.sub.4).sub.2SO.sub.4 Protein CTRL RT +4.degree. C.
Gly/-20.degree. C. 4.degree. C. 4.degree. C. -20.degree. C.
rTcPRACA 100.0 16.0 66.5 62.9 31.0 53.9 100.0 rTcPRACB 100.0 100.0
34.0 93.6 77.6 98.4 100.0
[0155] After purification on nickel-nitrilotriacteic acid agarose
column, recombinant proteins were kept for 10 days in nickel column
buffer (20 mM Tris/500 mM NaCl/500 mM imidazol, pH 8.0) at room
temperature (RT) or at +4.degree. C., or either diluted in 50%
glycerol and maintained at -20.degree. C. (Gly/-20.degree. C.) or
in optimum pH buffer (NaOAc, pH 6.0) at 4.degree. C. Recombinant
enzymes were precipitated in (NH.sub.4).sub.2SO.sub.4 and kept in
solution at 4.degree. C. or pellet dried at -20.degree. C. Racemase
assays were performed for 30 min at 37.degree. C. Percent of
preservation was determined polarimetrically using 0.25 .mu.M of
either purified rTcPRACA or rTcPRACB enzymes and 40 mM of
L-proline, as compared to results obtained with freshly purified
proteins (CTRL). These results are representative of at least two
independent experiments.
[0156] Both recombinant enzymes exhibited Michaelis-Menten kinetics
(FIG. 3A) and rTcPRACB had a higher activity than rTcPRACA. Indeed,
as can be observed in FIG. 3B, analysis of L>D conversion of
serial dilutions of L-proline catalyzed by a constant amount of
each enzyme showed that rTcPRACB enzyme (K.sub.M of 75 mM and
V.sub.max of 2.times.10.sup.-4 molsec.sup.-) has a higher velocity
as compared to rTcPRACA (K.sub.M of 29 mM and V.sub.max of
5.3.times.10.sup.-5 molsec.sup.-1). In order to determine the
K.sub.i values for pyrrole-2-carboxylic acid (PAC), the specific
and competitive inhibitor of CsPR (16), assays were performed with
both recombinant proteins. These assays revealed that PAC is
comparably effective as inhibitor of rTcPRACA (FIG. 3C) and
rTcPRACB, and K.sub.i values obtained were, respectively, 5.7 .mu.M
and 3.6 .mu.M. The difference in K.sub.i values reflects almost
perfectly the difference in K.sub.M values reported for both
enzymes, which are similar to that of the native protein. These
K.sub.i values indicate that the affinity of PAC inhibitor is
higher for rTcPRACA and rTcPRACB than for CsPR (K.sub.i of 18
.mu.M). The K.sub.m and K.sub.i values are important for an
inhibitor.
Example 11
Requirement of a Dimeric Structure for Proline Racemase
Activity
[0157] When rTcPRACA was submitted to size exclusion chromatography
on a Superdex 75 column at pH 6.0, two peaks of protein were
eluted, respectively, around 80 kDa (B2 fraction) and 43 kDa (B4
fraction), presumably corresponding to dimeric and monomeric forms
of the enzyme (FIG. 4). Western blot analysis of whole T. cruzi
epimastigote extracts using non-denaturing PAGE had previously
indicated a molecular mass of 80 kDa for the native protein while a
45 kDa band was obtained by SDS-PAGE (13). In order to eliminate
cross-contamination, B1 and B5 fractions, eluted, respectively, at
the start and at the end of the predicted dimer (B2) or monomer
(B4) peaks, were reloaded on the column and the profiles obtained
(see FIG. 4 inserts) confirmed the purity of the fractions. Enzyme
activity resides in the 80 kDa peak, but not in the 43 kDa peak
(Table II). These results corroborated that two subunits of the
protein are necessary for racemase activity. At neutral pH (7.4 or
above), the rTcPRACA gives rise to high molecular weight aggregates
which are not observed with rTcPRACB, consistently with its broader
optimal pH spectrum. The enzyme should be in optimal pH conditions
for a kit buffer, for example.
TABLE-US-00005 TABLE II Racemase activity of recombinant TcPRACA
fractions after size exclusion chromatography Fractions A15 B1 B2
B3 B4 B5 B6 B7 % racemization 1.3 35.5 62.9 42.8 0.7 0 0 0
[0158] After elution from Superdex 75 column, 20 .mu.l of each peak
(A15 to B7, see FIG. 4) corresponding to 1 .mu.g of protein were
incubated 1 h at 37.degree. C. with 40 mM of L-proline in 0.2 M
NaOAc, pH 6.0. Optical rotation was measured and % of racemization
was determined as described in Example 5.
Example 11
Abrogation of Proline Racemase Activity by Mutation of Cys.sup.330
and Alternately Cys.sup.160 of the Catalytic Site
[0159] C. sticklandii proline racemase is described as a
homodimeric enzyme with subunits of 38 kDa and a single proline
binding site for every two subunits, where two cysteines at
position 256 might play a crucial role in catalysis by the transfer
of protons from and to the bound substrate (12). It has previously
been shown that mitogenic properties of the T. cruzi proline
racemase are dependent on the integrity of the enzyme active site,
as inhibition of B-cell proliferation is obtained by substrate
competition and specific use of analogues (PAC) resembling the
structure assumed by the substrate proline in its transition state
(16). To verify the potential role of the cysteine residues at the
active site of the T. cruzi proline racemase, Cys.sup.330 and
alternately Cys.sup.160 were replaced by a serine residue through
site specific mutation of TcPRACA. The choice of serine as the
substituting amino acid was made to avoid further major
disturbances on three dimensional structure of the protein (see
strategy in FIG. 5 above). After confirmation of the single codon
mutation through sequencing of the construct, the C.sup.330S or
C.sup.160S rTcPRACA mutant proline racemase was expressed in E.
coli and purified in the same manner as wild type rTcPRACA. Then
used were C.sup.330S or C.sup.160s rTcPRACA in racemization assays
to verify the effects of the mutation on the enzymatic activity of
the protein. As can be observed in Table III (and in FIG. 12) a
total loss of proline racemase activity is observed as compared to
the wild type enzyme, establishing that proton transfer during
proline racemization is specifically dependent on the presence of
the cysteine residue in the active site.
TABLE-US-00006 TABLE III Loss of racemase enzymatic activity in the
site direct .sup.C330SrTcPRACA Data set rTcPRACA .sup.C330SrTcPRACA
Time (min) 0 10 30 60 0 10 30 60 Optical rotation -0.385 -0.300
-0.162 -0.088 -0.385 -0.382 -0.391 -0.387 % racemization 0 22 58 77
0 0 0 0
[0160] After purification, 5 .mu.g of rTcPRACA or
.sup.C330SrTcPRACA were incubated at 37.degree. C. with 40 mM of
L-proline in NaOAc buffer, pH 6.0. Optical rotation was measured at
different times and % of racemization was determined as described
in Example 5.
Example 12
Proline Racemase Protein Signatures and Putative Proline Racemases
in Sequence Databases
[0161] The conservation of critical residues between parasite and
bacterial proline racemases prompted a search for similarities
between TcPRAC and other protein sequences in SWISS-PROT and TrEMBL
databases. Twenty one protein sequences yielded significant
homologies, from 11 organisms, such as several proteobacteria of
the alpha subdivision (Agrobacterium, Brucella, Rhizobium) and
gamma subdivision (Xanthomonas and Pseudomonas), as well as of the
fermicutes (Streptomyces and Clostridium). Within the eukaryota,
besides in T. cruzi, homologous genes were detected in the human
and mouse genomes, where predicted proteins show overall
similarities with proline racemase. Except for Clostridium
sticklandii and Xantomonas campestri, each other organism encodes 2
paralogues, and Agrobacterium tumefaciens contains 3 genes. The
multiple alignment also allowed for the definition of three
signatures of proline racemase, which are described here in PROSITE
format. As can be seen in Table IV, when using a minimal motif of
proline racemase protein (M I), [IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG,
located immediately after the start codon at position 79, the
inventors obtained 9 hits. A second motif (M II), consisting of
[NSM][VA][EP][AS][FY]X(13,14)[GK]X[IVL]XXD[IV][AS][YWF]GGX[FWY],
starting at position 218, gave 14 hits; however, the first or the
second half of this motif is not sufficiently stringent to be
restrictive for putative proline racemases, but gives hits for
different protein families. A third motif (M III), from positions
326 to 339, namely DRSPXGX[GA]XXAXXA, was considered as a minimal
pattern. Note that in position 330, the cysteine of the active site
was replaced by an X. As shown in Table IV, this minimal pattern
yields all 21 hits. Curiously, both genes in human as well as in
mouse encode threonine instead of cysteine at the X position in
motif III, while in Brucella, Rhizobium and Agrobacterium species
each encode one protein with C and one with T in this position. One
cannot hypothesize the implications of this substitution for the
functionality of these putative proteins. If the residue at
position 330 is maintained as a cysteine in motif III, a reduced
number of 12 hits from 9 organisms is thus obtained, which can
probably be considered as true proline racemases. The alignment of
the 21 protein sequences and derived cladogram are shown in FIG. 6
and FIG. 7, respectively, the three boxes depicted correspond to
motifs I, II and III described here above. This invention thus
shows that DRSPCGXGXXAXXA is the minimal signature for proline
racemases. Blast searches against unfinished genomes yielded, at
present, an additional 13 predicted protein sequences from 8
organisms, with high similarity to proline racemases, all
containing motif III. Organisms are Clostridium difficile, C.
botulinum, Bacillus anthracis, Brucella suis, Pseudomonas putida,
Rhodobacter sphaeroides, Burkholderia pseudomallei, B. mallei, and
the fungus Aspergillus fumigatus. These results indicate that
proline racemases might be quite widespread.
TABLE-US-00007 TABLE IV SWISS-PROT and TrEMBL databases screening
using PROSITE motifs Motif M M M Organism Seq Access. nb M I II III
III* Agrobacterium tumefaciens 1 Q8UIA0 + + + + Agrobacterium
tumefaciens 2 Q8U6X2 - - + - Agrobacterium tumefaciens 3 Q8U8Y5 - -
+ - Brucella melitensis 1 Q8YJ29 - + + + Brucella melitensis 2
Q8YFD6 + - + - Clostridium stickilandii Q9L4Q3 - + + + Homo sapiens
1 Q96EM0 + + + - Homo sapiens 2 Q96LJ5 + + + - Mus musculus 1
Q9CXA2 + + + - Mus musculus 2 Q99KB5 + + + - Pseudomonas aeruginosa
1 Q9I476 - + + + Pseudomonas aeruginosa 2 Q9I489 - - + + Rhizobium
loti 1 Q98F20 - + + + Rhizobium loti 2 Q988B5 + + + - Rhizobium
meliloti 1 Q92WR9 - - + - Rhizobium meliloti 2 Q92WS1 - + + +
Streptomyces coelicolor Q93RX9 + - + + Trypanosoma cruzi 1 Q9NCP4 +
+ + + Trypanosoma cruzi 2 + + + + Xanthomonas axonopodis 1 Q8PJI1 -
+ + + Xanthomonas axonopodis 2 Q8PKE4 - - + + Xanthomonas
campestris Q8P833 - + + + Bacillus anthracis (Ames) 1 Q81UH1 + - +
+ Bacillus anthracis (Ames) 2 Q81PH1 - - + + Bacillus cereus 1
Q81HB1 + - + + Bacillus cereus 2 Q81CD7 - - + + Brucella suis 1
Q8FYSO + + + + Brucella suis 2 Q8G213 + - + - Chromobacterium
violaceum Q7NU77 + + + + Photorhabdus luminescens Q7N4S6 + + + +
Pseudomonas putida Q88NF3 + + + + Rhodopirella baltica Q7UWF3 - - +
+ Streptomyces avermitilis Q82MDO + - + + Vibrio parahaemolyticus
Q87Q20 + + + + SWISS-PROT and TrEMBL databases were screened using
motifs I to III (M I, M II and M III). M I corresponds to
[IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG, M II to of [NSM][VA]
[EP][AS][FY]X(13, 14)[GK]X[IVL]XXD[IV][AS][YWF]GGX[FWY] M III to
DRSPXGXGXXAXXA and M III* to DRSPCGXGXXAXXA. Access. nb, SWISS-PROT
accession number of the sequence; seq, sequence number according to
FIG. 6; + and -, presence or absence respectively of hit using the
corresponding motif.
[0162] Finally, Table V summarizes the genes in which the proline
racemase signature has been identified and the sequences including
both crucial residues Cys.sup.330 and Cys.sup.160 of the catalytic
site are present.
TABLE-US-00008 TABLE V Results of screening using nucleotide or
peptide sequence of TcPRACA Motifs common M III* MCGH sequence
Organism Accession number Database M I M II M III Cys.sup.330
Cys.sup.160 EPRGH Aspergillus fumigatus Af0787f05.p1c TIGR + - + -
+ + TIGR 5085 TIGR + + + + ? + Bacillus anthracis str. Ames
AE017027 EMBL + + + + + + Bacillus anthracis str. Ames AE017033
EMBL + + + + + + (minus strand) TIGR 1392 TIGR + + + + + + Bacillus
cereus ATCC14579 AE017007 EMBL + + + + + + (minus strand) Brucella
suis 1330 (minus AE014469 EMBL + + + + + + strand) TIGR 29461 TIGR
+ + + + + + Burkholderia mallei contig: 33162: b_mallei TIGR + + +
+ + EPRGSD TIGR 13373 TIGR + ? + + + EPRGSD SANGER 28450 Sanger + ?
+ + + EPRGSD Cbot12g05.q1c Sanger ? + + + + + SANGER 36826 Sanger +
+ + + + + Clostridium difficile Clostridium difficile Sanger ? + +
+ + + 630 SANGER 1496 Sanger + + + + + + Clostridium sticklandii
CST130879 EMBL + + + + + + LM16BINcontig2054 Sanger ? + + + +
EPRGND LM16W5b02.q1c Sanger ? + ? ? + EPRGND Pseudomonas putida
KT2440 AE016778 EMBL + + + + + EPRGND KT2440 TIGRpputida TIGR + ? +
+ + EPRGND 13538 UTHSC 1063 UTHSC + ? - - + + TbKIX28b06.qlc Sanger
? + ? ? + + TbKIX28b06.plc Sanger ? + ? ? + + Tviv655d02 Sanger ? +
+ + ? ? Tviv380d6 Sanger + ? ? ? + + congo208e06 Sanger ? + + + ? ?
AP005077 EMBL + + + + + + Databases were screened using nucleotide
or peptide sequences of TcPRACA. Motifs I to III (M I, M II and M
III) were searched. M I corresponds to
[IVL][GD]XHXXG[ENM]XX[RD]X[VI]XXG, M II to of [NSM][VA]
[EP][AS][FY]X(13, 14)[GK]X[IVL]XXD[IV][AS][YWF]GGX[FWY] M III to
DRSPXGXGXXAXXA and M III* to DRSPCGXGXXAXXA. Access. nbs, TIGR,
EMBL or SANGER accession numbers of the sequence; + and -, presence
or absence respectively of the corresponding motif. Others,
extremely conserved regions outside the motifs, including NMCGH
which contains one of the active site cysteine. Sequences presented
in annexe pages where the conserved regions of 2 Cysteine residues
of the active site are squared, are presented in the table in bold
with corresponding Accession numbers.
[0163] A variety of free D-amino acids can be found in different
mammalian tissues in naturally occurring conditions. Some examples
include the presence of D-serine in mammalian brain, peripheral and
physiological fluids, or else D-asp that can be also detected in
endocrine glands, testis, adrenals and pituitary gland. D-pro and
D-leu levels are also very high in some brain regions, pineal and
pituitary glands. Some reports attribute to D-amino acids a crucial
role as neuromodulators (receptor-mediated neurotransmission), as
is the case of D-ser, or as regulators of hormonal secretion,
oncogeny and differentiation (i.e. D-asp). It is believed that the
most probable origin of naturally occurring D-amino acids in
mammalian tissues and fluids is the synthesis by direct
racemization of free L-enantiomers present in situ. However, a part
from the cloning of serine racemase genes from rat brain and human
no other amino acid racemases were identified until now in man.
Some others report that D-amino acids present in mammalian tissues
are derived from nutrition and bacteria.
[0164] The increasing number of reports associating the presence of
D-amino acids and pathological processes indicate that the
alteration of their level in biological samples would be of some
diagnostic value as, for instance, the identification of changes in
free levels of D-asp and D-Ala in brain regions of individuals
presenting Alzheimer. The amounts of D-asp seems to decrease in
brain regions bearing neuropathological changes and is paralleled
by an increase of D-ala. Overall, total amounts of D-amino acids
increase in the brain of individuals presenting memory deficits in
Alzheimer, as compared to normal brains, offering new insights
towards the development of new simple methods of D-amino acid
detection. In the same line, D-ser concentrations in the brain are
altered in Parkinson disease and schizophrenia but other findings
clearly associate significant higher concentrations of D-amino
acids in plasma of patients with renal diseases or else in plasma
of elderly people.
[0165] Previous results determined that the polyclonal B cell
activation by parasite mitogens contributes to the mechanisms
leading to parasite evasion and persistence in the mammalian host.
It has also been demonstrated that TcPRAC is a potent B cell
mitogen released by the infective forms of the parasite. The TcPRAC
inhibition by pyrrole carboxylic acid induces a total loss of
TcPRAC B cell mitogenic ability.
[0166] It has also been shown that the overexpression of TcPRACA
and TcPRACB genes by mutant parasites are able to confer to these
mutants a better invasion ability of host cells in vitro. This
contrasts to the inability of para sites to survive if these TcPRAC
genes are inactivated by genetic manipulation. In addition, the
immunization of mice with sub-mitogenic doses of TcPRAC, or with
appropriate TcPRAC-DNA vector vaccine preparations, was shown to
trigger high levels of specific antibody responses directed to
TcPRAC and high levels of immunoprotection against an infectious
challenge with live Trypanosoma cruzi.
[0167] Altogether, these data suggest that TcPRAC enzyme isoforms
are essential elements for parasite survival and fate and also
support that parasite proline racemase is a good target for both
vaccination and chemotherapy. In fact, the addition of pyrrole
carboxylic acid at TcPRAC neutralizing doses to non-infected monkey
cell cultures do not interfere with cellular growth. Besides, the
utilization of a proline racemase inhibitor in humans would be a
priori possible since the absence of the two critical active site
cysteine residues (Cys 330 and Cys 160) for the PRAC enzyme
activity has been observed in the single sequence that displays
some peptide homologies with TcPRAC that was identified by blasting
the Human Genome available data with the TcPRAC gene sequence.
[0168] As observed by data mining using TcPRAC gene sequences, it
has been possible to identify putative proline racemases in other
microorganisms of medical and agricultural interest. As can be seen
in FIG. 8, the presence of MI, MII and most particularly MIII
stringent motif (the signature for proline racemases) indicates the
potentiality of those proteins to be functional proline racemases.
On the one hand, it can be observed that critical residues
necessary for the enzyme activity are displayed in those sequences
and, on the other hand, that the open reading frames (ORF) are
highly homologous to the ORF of the parasite PRAC.
[0169] In order to search for putative molecules that could be used
as inhibitors of TcPRAC, or other proline racemases, it would be
necessary to develop a microtest able to specifically reveal the
inhibition of proline racemization performed by TcPRAC and
consequently the blockage of a given proline stereoisomer
generation. For instance, this could be done by analysing the
ability of any potential inhibitory molecule to hinder the
generation of D-proline in a reaction where L-proline is submitted
to TcPRAC enzymatic activity.
[0170] At present, the available analyses to detect D- (or L-)
amino acids are very challenging and methods to differentiate
L-stereoisomers from D-stereoisomers are time-consuming, i.e. gas
chromatography, thin layer chromatography using chiral plates,
high-performance capillary electrophoretic methods, HPLC, and some
enzymatic methods. Some of those techniques also require the use of
columns and/or heavy equipment, such as polarimeters or
fluorescence detectors.
[0171] With the aim of developing a simple test that is useful to
rapidly screen putative inhibitors of TcPRAC, TcPRAC constructs
allowing for the production of high amounts of the recombinant
active enzyme were used together with the knowledge of a specific
inhibitor of proline racemases (pyrrole carboxylic acid, PAC) to
develop a medium/high throughput microplate test that can be used
to easily screen a high number of inhibitor candidates (i.e.
100-1000). Such a test is based on colorimetric reactions that are
certainly a simpler alternative to polarimetry and other
time-consuming tests. Thus, the evaluation of light deviation of L-
or D-proline enantiomers by a polarimeter to quantify the
inhibition of proline racemization to test such an elevated number
of molecules is impracticable, offers a low sensibility, and would
require greater amounts of reagents as compared to a microplate
test that would additionally be of an affordable price.
[0172] Accordingly, this invention is based on the detection of
D-proline originated through racemization of L-proline by TcPRAC,
in the presence or in the absence of known concentrations of PAC
inhibitor as positive and negative controls of racemization,
respectively. For that purpose, this invention utilizes another
enzyme, D-amino acid oxidase (D-AAO), that has the ability to
specifically oxidize D-amino acids in the presence of a
donor/acceptor of electrons and yield hydrogen peroxide. The
advantage of this strategy is that hydrogen peroxide can be
classically quantified by peroxidase in a very sensitive reaction
involving ortho-phenylenediamine, for example, ultimately offering
a chromogenic reaction that is visualized by colorimetry at 490
nm.
[0173] Since D-amino acid oxidase reacts indiscriminately with any
"D-amino acid", and not with their L-stereoisomers, such a test is
not only helpful to identify proline racemase inhibitors, but also
applicable, if slightly modified, to detect any alterations in
levels of free D-aa in various fluids to make a diagnosis of some
pathogenic processes.
I--Basics for a D-Amino-Acid Quantitative Test
[0174] The following method of the invention allows detection and
quantitation of D-Amino acids. A first reaction involves a
D-amino-oxidase. This enzyme specifically catalyses an oxidative
deamination of D-amino-acids, together with a prosthetic group,
either Flavin-Adenin-Dinucleotide (FAD) or Flavin-Mononucleotide
(FMN), according to the origin of the Enzyme. (Obs. FAD if the
enzyme comes from porcine kidney).
[0175] The general reaction is as follows:
##STR00001##
In (1), the D-amino acid is deaminated and oxidized, releasing
ammonia and the reduced prosthetic group. If the amino group is not
a primary group, the amino group remains untouched and no ammonia
is released. In (2), the reduced prosthetic group reduces oxygen,
and generates hydrogen peroxide. Either a catalase or a peroxidase
can decompose hydrogen peroxide. A catalase activity is written
as:
##STR00002##
whereas a peroxidase activity is
##STR00003## [0176] wherein K is any carbon chain
[0177] Thus, detection of hydrogen peroxide can be done with the
use of catalase and a reagent sensitive to oxygen such as by
destaining reduced methylene blue for instance with oxygen or with
the use of peroxidase with a change in color of the reagent
indicated by:
##STR00004##
II--Application of Such a Test for Evaluating the T. cruzi Racemase
Activity and the Inhibition of this Racemase.
[0178] II-1--Test for Racemase Activity
[0179] The T. cruzi racemase activity converts reversibly L-Pro
into D-Pro. Since these two forms can induce polarized light
deviation, this conversion can be measured by optical polarized
light deviation. But the presence of the D-form allows also the use
of D-amino-acid oxidase in order to assess the amount of D-Proline
in racemase kinetics. In this test the following reactions are
involved:
1) Proline-Racemase Activity.
##STR00005##
[0180] 2) D-Amino-Acid Oxidase
##STR00006##
[0181] (Obs: There is no ammonia formed in the case of Proline,
because the nitrogen of Proline is involved in a secondary
amine.)
##STR00007##
3) Detection of Hydrogen Peroxide with Peroxidase
##STR00008##
[0182] The chromogenic reagent can be, for example,
orthophenylenediamine (OPD), or 3,3',5,5' tetramethyl benzidine
(TMB), or 5-aminosalicylic acid (ASA).
[0183] These reactions can be carried out using the following
exemplary, but preferred, materials and methods.
II-1-1--Materials
TABLE-US-00009 [0184] Materials Comments Proline-racemase (TcPRAC)
(1 mg/ml Stock) L-Proline, Sigma, Ref. P-0380 (1M Stock) An
equimolar of D- and L-Proline is made by D-Proline, Aldrich, ref.
85 891-9 (1M Stock) mixing equal volumes of 2M D-Proline with 2M L-
Proline Orthophenylenediamine (OPD) Sigma refP-8287 10 mg tablets.
Extemporaneously used as a lot 119H8200 20 mg/ml stock solution in
water. D-AAO from swine kidney (Sigma) ref. A-5222 lot Powder
dissolved into 1 ml Buffer* + 1 ml 100% 102K1287 glycerol. The
resulting activity is 50 U/ml. Stored at -20.degree. C. Horse
radish peroxidase (HRP) Sigma ref P8375 Powder dissolved into 2.5
ml Buffer* + 2.5 ml 100% lot 69F95002 glycerol. The resulting
activity is 5042 U/ml. Stored at -20.degree. C. Sodium acetate 0.2M
Ph 6.0 Flavine-adenine-dinucleotide (FAD) (Sigma) ref. Stock
solution of 10.sup.-1M in water. Stored at -20.degree. C. F-6625
Used as a 10.sup.-3M sub-stock solution. Sodium pyrophosphate (Pop)
0.235M Not soluble at a higher concentration. Must be stored at
4.degree. C. and gently heated before use in order to solubilize
crystals which may occur. Buffer* = 10 ml of 0.2M sodium acetate
The final pH is 8.3. buffer pH 6.0 + 680 .mu.l 0.235M Pop
Microplates (96 wells) With adhesive coverlid ELISA reader for
microplates With a wavelength filter at 490 nm for OPD
substrate.
II-1-2--Methods
II-1-2.1--Racemisation in Microplates:
[0185] (1) The volumes are indicated for a single well, but
duplicates are mandatory. Leave enough raws of the microplate empty
for standard and controls to be used in further steps. Distribute
the following volumes per well reactions
a) without inhibitor (Vol=QS 81 .mu.l)
TABLE-US-00010 TcPRAC 1 mg/ml 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l
L-Proline 0.1M 32 .mu.l 16 .mu.l 8 .mu.l 4 .mu.l Proline Final (40
mM) (20 mM) (10 mM) (5 mM) concentration Sodium acetate 47 .mu.l 63
.mu.l 71 .mu.l 75 .mu.l buffer 0.2M pH 6
b) with inhibitor (Vol=QS 81 .mu.l)
[0186] A range of concentrations between 5 mM and 1 mM can be
planned for the inhibitor. It should be diluted in sodium acetate
buffer 0.2 M pH 6.0. Hence, the volume of inhibitor is subtracted
from the volume of buffer added in order to reach a final volume of
81 .mu.l. For instance, 50% inhibition of racemisation of 10 mM
L-proline is obtained with 45 .mu.M Pyrrole carboxylic acid (PAC,
specific inhibitor of proline racemase), when 36.5 .mu.l PAC+44.5
.mu.l buffer are used (see results in FIG. 8).
[0187] Table VI is provided for 10 mM L-Proline as a substrate.
TABLE-US-00011 TABLE IV TcPrac 1 mg/ml 2 .mu.l 2 .mu.l 2 .mu.l 2
.mu.l 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l 2 .mu.l L-Proline
0.1M 8 .mu.l 8 .mu.l 8 .mu.l 8 .mu.l 8 .mu.l 8 .mu.l 8 .mu.l 8
.mu.l 8 .mu.l 8 .mu.l PAC 0 .mu.l 5.4 .mu.l 11 .mu.l 22 .mu.l 43
.mu.l 9 .mu.l** 17 .mu.l** 35 .mu.l** 69 .mu.l** 14 .mu.l*** 0.1
mM/1 mM**/ 10 mM*** Final concentration (.mu.M) 0 6.7 13.5 27 54
107 214 429 858 1715 Sodium acetate buffer 71 .mu.l 65.6 .mu.l 60
.mu.l 49 .mu.l 28 .mu.l 62 .mu.l 54 .mu.l 36 .mu.l 2 .mu.l 57 .mu.l
0.2 M pH6 QS 81 .mu.l
(2) Cover the microplate with an adhesive coverlid and leave for 30
nm at 37.degree. C. (3) At the end of racemisation, 5.5 .mu.l of
0.235M Pop are added in each reaction well of the microplate in
order to shift pH from pH6.0 to pH 8.3.
II-1-2.1-2--Quantitation of Formed D-Proline: Standards and
Controls.
[0188] (1) Prepare standard and controls:
[0189] Standard: An equimolar mixture of L- and D-Proline is used
as a standard in a range from 0.05 mM to 50 mM (final concentration
in the assay). It is used for assessing the amount of D-Proline
formed after racemization. The standard range is made in
microtubes, as follows:
[0190] In tube 1, mix Proline and buffer according to the described
proportions.
[0191] Then, add 500 .mu.l of the obtained mixture to 500 .mu.l of
buffer in next tube, and so on.
TABLE-US-00012 ##STR00009##
Negative control is prepared in an other microtube, as follows:
TABLE-US-00013 L-Proline (1M) 200 .mu.l Buffer* 800 .mu.l Final
concentration 40 ml Blank = Buffer*.
(2) Dispense in the empty wells of the microplate (see step
II-1-2.1):
TABLE-US-00014 Buffer* 67 .mu.l Standard dilutions 20 .mu.l or
negative control Obs: For the blank dispense 87 .mu.l of Buffer*
only
(3) Prepare a mixture containing the enzymes (D-AAO/HRP Mix), as
follows: The amounts are given for one well, provided that the
final volume will be 100 .mu.l with the racemase products or the
substrate:
TABLE-US-00015 For 13 .mu.l: Buffer* 6.5 .mu.l D-AAO 50 U/ml 1.7
.mu.l OPD (20 mg/ml) 2.5 .mu.l HRP 5000 U/ml 0.75 .mu.l FAD
10.sup.-3M (4.5 .mu.l 10.sup.-1M + 446 .mu.l buffer) 1.5 .mu.l
This mixture is kept in the ice until use. (4) The quantitation
reaction starts when 13 .mu.l of D-AAO/HRP mix is added to the
reaction well. (5) The microplate is covered with an adhesive
coverlid and it is left in the dark at 37.degree. C. between 30 nm
and 2 hours. The reaction can be monitored by eye whenever a color
gradient matches the D-amino acid concentration of the standard
dilutions. (6) The microplate is read with a microplate
spectrophotometer using a filter of at 490 nm.
Example 13
D-AOO Microplate Test is More Sensitive than D-Amino Acid Detection
by Detection in Polarimeter
[0192] In order to compare the D-Proline quantitation by
polarimeter and by D-amino-oxidase/HRP a comparison was performed
between the two tests using different concentrations of L-proline
and different concentrations of PAC, the specific inhibitor of
proline racemases. FIG. 8 shows the percent of racemisation
inhibition of different L-proline concentrations (ranging from
10-40 mM) using the D-AAO (D-AA0/L-) microtest as compared to
conventional detection using a polarimeter (Pol/L-).
[0193] With the polarimeter, there seems to be no difference of PAC
inhibition of TcPRAC with the three concentrations of L-Proline.
Therefore, 50% inhibition is obtained with 1 mM PAC, whether 10 mM
or 40 mM L-Proline is used. In contrast, when using D-MO/HRP test,
it can be seen that inhibition by PAC is somewhat higher with a low
concentration of L-Proline (10 mM for example) than with an
increased one (20 mM or 40 mM). Therefore, 50% inhibition is
obtained:
[0194] with 50 .mu.M PAC when 10 mM L-Proline is used,
[0195] with 170 .mu.M PAC when 20 mM L-Proline is used and
[0196] with 220 .mu.M PAC when 40 mM L-Proline is used.
[0197] In conclusion, D-AAO/HRP evaluation is more sensitive since
it can discriminate PAC inhibition at a lower concentration than
evaluation with the polarimeter. Furthermore, inhibition is
logically conversely proportional to L-Proline concentration, which
can be assessed with the D-AAO/HRP method, but not with the
polarimeter measurement. Such a test is useful for the screening of
new inhibitors of TcPRAC in a medium/high throughput test.
[0198] A preferred technological platform to perform the above test
and to select appropriate inhibitors contains at least the
following products:
[0199] L-Proline, D-Proline, a proline-racemase
[0200] A peroxidase, a substrate of a peroxidase
[0201] A D-amino-acid oxidase
[0202] And optionally a battery of potential inhibitory
molecules.
Example 14
L-Proline Inhibits D-Amino-Oxidase Activity
[0203] FIG. 9 shows the comparison of D-AAO/HRP reaction using
D-Proline alone or an equimolar mixture of D- and L-Proline as
standard. It can be seen that the amount of D-Proline required to
obtain a given optical density is higher when a mixture of L- and
D-Proline are used as compared to a standard using D-proline alone.
Since Proline-racemase activity ends when both L- and D-Proline are
in equal amounts, it was also adequate to use an equimolar mixture
of both enantiomers of Proline as standard for D-Proline
determination.
Example 15
PAC does not Interfere with DAAO/HRP Activity
[0204] FIG. 10 shows optical density at 490 nm as a function of
D-proline concentration under the following conditions.
[0205] Conditions in .mu.l wells,
TABLE-US-00016 [D-Proline]range between 0.1 mM and 40 mM [D-AAO]
0.89 U/ml [HRP} 37.5 U/ml [OPD] 0.5 U/ml [FAD] 1.5 .times.
10.sup.-5M Buffer*
[0206] The presence of PAC does not influence DAAO/HRP
reaction.
Example 16
A Medium/High Throughput Test Using the D-AAO Microplate Test
[0207] Table VII is an Example of a medium/high throughput test
using the D-AAO microplate test. [0208] Blue: D-proline standard
(column 1) [0209] Green: Positive control of racemization using
avec 10 mM substrate (column 2, line A and B) [0210] Orange:
control for inhibition of racemization reaction by PAC using 10 mM
substrate (column 2, line C and D) [0211] Blank 1: mix with
racemase (column 2, line E) [0212] Blank 2: mix without racemase
(column 2, line F) [0213] Yellow: Negative control for specificity
of (without racemase+40 mM L-proline) (column 2, line G and H)
[0214] Other wells: with Inhibitors (T1, T2, T3, . . . T40): in
duplicates
TABLE-US-00017 [0214] TABLE VII 1 D-Pro (mM) 2 3 4 5 6 7 8 9 10 11
12 A 10 L-Pro T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 L-Pro '' '' '' '' ''
'' '' '' Pro PAC T11 T12 T13 T14 T15 T16 T17 T18 T19 T20 Pro PAC ''
'' '' '' '' '' '' '' '' '' Blanc 1 T21 T22 T23 T24 T25 T26 T27 T28
T29 T30 Blanc 2 '' '' '' '' '' '' '' '' '' L-Pro T31 T32 T33 T34
T35 T36 T37 T38 T39 T40 H 0.07 L-Pro '' '' '' '' '' '' '' ''
Example 17
Application of Such a Test for General Detection of D-Amino Acids
in Samples
[0215] The use of a microplate test based on D-amino-acid oxidase
together with a peroxidase, such as horseradish peroxidase, can be
used to detect and quantitate any D-amino acid in any biological or
chemical sample. For example, since D-amino acids are described to
be involved in several pathological processes or neurological
diseases, such as Alzheimer disease, Parkinson, or renal diseases,
their detection can be an important marker or parameter for the
diagnosis and the follow-up of these pathologies. This technology
can be also extended to the detection and quantification of D-amino
acids in eukaryotic organisms, such as plants or fungi, and in
bacteria.
[0216] The D-MO/HRP test described here above can also be used for
this purpose with slight modifications. For that purpose, the
racemase reaction step should be skipped and the microplate test
should start straightforward at the II-1-2.1-2 step described above
with the following remarks:
[0217] 1) Standard: It should not be an equimolar mixture of D- and
L-amino acid, but rather a serial dilution of D-Amino acids. The
choice of amino acid is made according to the interest of the
D-amino acid under investigation. The final volume in wells should
be of 87 .mu.l.
[0218] 2) Negative control: It is made with the L-enantiomer of the
D-amino acid under investigation. The final volume should be 87
.mu.l.
[0219] 3) Blank: It is made with 87 .mu.l buffer*. (See paragraph
II.1.1 Materials.)
[0220] 4) Samples: The samples to be tested should be adjusted to
pH 8.3 with buffer* and their final volumes should be of 87 .mu.l
per well.
[0221] Obs: Standards, negative controls, samples to test and
blanks should be made in duplicates. They are dispensed into the
wells of the microplate.
[0222] 5) Then, the procedure follows steps 3) to 6), as above.
[0223] Several D-amino acids and their L-counterparts have been
tested using the microplate test described above. Tables VIII and
IX show that D-forms of Tyrosine, Valine, Threonine, Glutamic acid,
Lysine and Tryptophane are indeed substrates for the D-AA0/HRP and
are detected by the test, as described for D-Proline. The results
also show that no L-amino acid is detected by such a
methodology.
TABLE-US-00018 TABLE VIII A Blank 49.5 24.75 12.37 6.19 3.09 1.55
0.77 0.39 0.19 0.09 0.05 D-pro B Blank 49.5 24.75 12.37 6.19 3.09
1.55 0.77 0.39 0.19 0.09 0.05 mM C Blank L-Tyr L-Val L-Thr L-Glu
L-Lys L-Try D Blank 12.5 12.5 12.5 12.5 12.5 12.5 mM E Blank D-Tyr
D-Val D-Thr D-Glu D-Lys D-Try F Blank 6.25 6.25 6.25 6.25 6.25 6.25
mM
Optical densities at 490 nm obtained after D-AAO reaction. (raw OD
data).
TABLE-US-00019 TABLE IX A 0.105 1.961 1.757 1.814 1.983 1.716 1.234
0.809 0.496 0.308 0.213 0.173 D-pro B 0.118 2.004 1.885 1.976 1.949
1.879 1.221 0.824 0.504 0.32 0.215 0.159 mM C 0.123 0.193 0.135
0.124 0.131 0.125 0.131 L- D 0.125 0.141 0.129 0.128 0.141 0.131
0.138 L- E 0.120 1.317 1.683 0.215 0.147 0.243 0.615 D- F 0.105
0.991 1.612 0.157 0.116 0.157 0.662 D-
[0224] Template of microplate, where, a serial dilution of
D-Proline (mM) was made as positive control of the D-AAO reaction.
Blank wells containing buffer* are shown. Different L- and D-amino
acids were tested, namely Tyrosine (Tyr), Valine (Val), Threonine
(Thr), Glutamic acid (Glu), Lysine (Lys) and Tryptophan (Try). To
highlight the sensitivity of the D-AAO microtest, higher
concentrations of L-enantiomers (12.5 mM) were used in the
reactions as compared to the concentrations used for D-enantiomers
(6.25 mM):
[0225] FIG. 11 is a Graph obtained with the serial dilutions of
D-proline, as positive reaction control Obs: OD of wells (-)
average of OD obtained from blank wells.
[0226] A preferred platform to search and quantitate the presence
of a D-Amino acid in samples contains at least the following
products:
[0227] A D-amino acid,
[0228] A peroxidase and a substrate of a peroxidase
[0229] A D-amino-acid oxidase
[0230] And optionally, a L-amino acid enantiomer, as control.
[0231] Finally, this invention relates to a method for screening a
molecule, which can modulate a racemase activity, wherein the
method comprises: [0232] (A) modulating a racemase activity by
means of a molecule being tested in the presence of an equimolar
mixture of a L- and D-amino acid and of a racemase to be modulated;
[0233] (B) oxidatively deaminating the D-amino acid generated in
step (A) by means of a D-amino oxidase in a prosthetic group; and
[0234] (C) detecting the hydrogen peroxide generated by the
oxidative deamination; wherein modulation of the hydrogen peroxide
is indicative of the capability of the tested molecule to modulate
racemase activity. Preferably the molecule inhibits racemase
activity, and more preferably the racemase is a proline racemase,
for example, Tripanosoma cruzi proline racemase. A molecule
identified by a method is also part of this invention.
[0235] Further, this invention relates to technological platform
and all reagents and devices necessary to perform the methods of
the invention. The technological platform comprises: [0236] a)
L-amino acid, D-amino acid, and a racemase; [0237] b) a peroxydase
and a substrate of a peroxydase, or a catalase and a reagent
sensitive to oxygen; [0238] c) a D-amino acid oxidase; and [0239]
d) optionally, one or more molecules to be screened for inhibitory
activity of said racemase.
[0240] Preferably, the racemase is a proline racemase and the
L-amino acid and D-amino acid are L-proline and D-proline,
respectively.
[0241] A molecule inhibits a proline racemase containing a
subsequence selected from the SEQ ID NO: 1, 2, 3 or 4.
REFERENCES
[0242] The following references are incorporated by reference, in
their entirety, herein. [0243] 1. Lamzin, V. S., Dauter, Z., and
Wilson, K. S. (1995) Curr Opin Struct Biol 5, 830-836. [0244] 2.
Kleinkauf, H., and von Dohren, H. (1987) Annu. Rev. Microbiol. 41,
259-289 [0245] 3. Fisher, G. H. (1998) Exs 85, 109-118 [0246] 4.
Nagata, Y., Fujiwara, T., Kawaguchi-Nagata, K., Fukumori, Y., and
Yamanaka, T. (1998) Biochim Biophys Acta 1379, 76-82. [0247] 5.
Nagata, Y., Tanaka, K., Iida, T., Kera, Y., Yamada, R., Nakajima,
Y., Fujiwara, T., Fukumori, Y., Yamanaka, T., Koga, Y., Tsuji, S.,
and Kawaguchi-Nagata, K. (1999) Biochim Biophys Acta 1435, 160-166.
[0248] 6. Oguri, S., Kumazaki, M., Kitou, R., Nonoyama, H., and
Tooda, N. (1999) Biochim Biophys Acta 1472, 107-114. [0249] 7.
Neidle, A., and Dunlop, D. S. (1990) Life sci. 46, 1512-1522 [0250]
8. Schell, M. J., Molliver, M. E., and Snyder, S. H. (1995) Proc.
Nat. Acad. Sci. 92, 3948-3952 [0251] 9. Wolosker, H., Blackshaw,
S., and Snyder, S. H. (1999) Proc Natl Acad Sci USA 96,
13409-13414. [0252] 10. Nagata, Y., Homma, H., Matsumoto, M., and
Imai, K. (1999) FEBS 454, 317-320 [0253] 11. Cardinale, G. J., and
Abeles, R. H. (1968) Biochemistry 7, 3970-3978 [0254] 12. Rudnick,
G., and Abeles, R. H. (1975) Biochemistry 14, 4515-4522 [0255] 13.
Reina-San-Martin, B., Degrave, W., Rougeot, C., Cosson, A.,
Charmond, N., Cordeiro-da-Silva, A., Arala-Chaves, M., and
Minoprio, P. (2000) Nature Medicine 6, 890-897 [0256] 14. Cano, M.
I., Gruber, A., Vazquez, M., Cortes, A., Levin, M. J., Gonzalez,
A., Degrave, W., Rondinelli, E., Zingales, B., Ramirez, J. L.,
Alonso, C., Requena, J. M., and Silveira, J. F. d. (1995) Mol. Bio.
Par. 71, 273-278 [0257] 15. Higuchi, R., Krummel, B., and Saiki, K.
K. (1988) Nuc. Ac. Res. 16, 7351-7367 [0258] 16. Keenan, M. V., and
Alworth, W. L. (1974) Biochem Biophys Res Commun 57, 500-504.
[0259] 17. Fisher, L. M., Albery, W. J., and Knowles, J. R. (1986)
Biochemistry 25, 2529-2537. [0260] 18. Albery, W. J., and Knowled,
J. R. (1986) Biochemistry 25, 2572-2577. [0261] 19. Breitbart, R.
E., Andreadis, A., and Nadal-Ginard, B. (1987) Annu. Rev. Biochem.
56, 467-495 [0262] 20. Manning-Cela, R., Gonzalez, A., and Swindle,
J. (2002) Infect. Immun. 70, 4726-4728 [0263] 21. Krassner, S. M.,
and Flory, B. (1972) J. Protozool. 19, 917-920 [0264] 22. Bowman,
I. B. R., Srivastava, H. K., and Flynn, I. W. (1972) Adaptation in
oxidative metabolism during the transformation of Trypanosoma
rhodesiense from bloodstream into culture forms, Van den Bossche H.
Ed. Comparative Biochemistry of parasites, Academic Press, New York
[0265] 23. Evans, D. A., and Brown, R. C. (1972) J. Protozool. 19,
686-690 [0266] 24. Auerswald, L., Schneider, P., and Gade, G.
(1998) J. Exp. Biol. 201, 2333-2342 [0267] 25. Sylvester, D., and
Krassner, S. M. (1976) Comp. Biochem. Physiol. 55B, 443-447 [0268]
26. de Isola, E. L., Lammel, E. M., Katzin, V. J., and Gonzalez
Cappa, S. M. (1981) J. Parasitol. 67, 53-58 [0269] 27. Contreras,
V. T., Salles, J. M., Thomas, N., Morel, C. M., and Goldenberg, S.
(1985) Mol. Biochem. Parasitol. 16, 315-327 [0270] 28. Silber, A.
M., Tonelli, R. R., Martinelli, M., Colli, W., and Alves, M. J.
(2002) J. Eukaryot. Microbiol. 49, 441-446 [0271] 29. Janeway, C.
A., and Humphrey, J. H. (1970) Folia Biol. 16, 156-172 [0272] 30.
Mozes, E., Kohn, L. D., Hakim, F., and Singer, D. S. (1993) Science
261, 91-92 [0273] 31. Sela, M., and Zisman, E. (1997) FASEB J. 11,
449-456 [0274] 32. Contreras, V. T., Morel, C. M., and Goldenberg,
S. (1985) Mol Biochem Parasitol 14, 83-96 [0275] 33. Souto-Padron,
T., Reyes, M. B., Leguizamon, S., Campetella, O. E., Frash, A. C.,
and de Souza, W. (1989) Eur. J. Cell Biol. 50, 272-278 [0276] 34.
Janes, B. K., and Bender, R. A. (1998) J Bacteriol 180, 563-570.
[0277] 35. de Jong, M. H., van der Drift, C., and Vogels, G. D.
(1975) J. Bacteriol. 123, 824-827 [0278] 36. Shakibaei, M., and
Frevert, U. (1996) J. Exp. Med. 184, 1699-1711 [0279] 37. Burleigh,
B. A., and Andrews, N. W. (1998) Cur. Op. Microbiol. 1, 461-465
[0280] 38. Gao, W., Wortis, H. H., and Pereira, M. A. (2002)
Internat. Immunol. 14, 299-308 [0281] 39. Martin, D., Ault, B., and
Nadler, J. V. (1992) Eur. J. Pharmacol. 21 9, 59-66 [0282] 40. Van
Harreveld, A. (1980) J. Neurobiol. 11, 519-529 [0283] 41. Thompson,
R. J., Bouwer, H. G., Portnoy, D. A., and Frankel, F. R. (1998)
Infect Immun 66, 3552-3561. [0284] 42. Wolosker, H., Sheth, K. N.,
Takahashi, M., Mothet, J. P., Brady, R. O., Jr., Ferris, C. D., and
Snyder, S. H. (1999) Proc Natl Acad Sci USA 96, 721-725. [0285] 43.
Watanabe, T., Shibata, K., Kera, Y., and Yamada, R. (1998) Amino
Acids 14, 353-360 [0286] .sup.1 GenBank accession number AF195522
[0287] .sup.2 GenBank accession number AY140947 [0288] .sup.3 EMBL
accession number E10199. [0289] .sup.4The proline racemase/B-cell
mitogen of Trypanosoma cruzi is a virulence factor whose mRNA is
differentially regulated through development by alternative
splicing. N. Chamond, N. Coatnoan, J. C. Barale, A. Cosson, A.
Bernenian, W. Degrave and P. Minoprio. Manuscript in
preparation.
BIBLIOGRAPHY RELATED TO THE MICROTEST USING D-AMINO ACID OXIDASE
ACCORDING TO THE INVENTION
[0289] [0290] 1. Reina-San-Martin B., Degrave W., Rougeot C.,
Cosson A., Chamond N., Cordeiro-da-Silva A., Arala-Chaves M. &
Minoprio P. (2000) A B-cell mitogen from a pathogenic trypanosome
is a eukaryotic proline racemase. Nature Medicine, 6, 890. [0291]
2. Chamond N., Gregoire C., Coatnoan N., Rougeot C., Freitas-Junior
L. H., da Silveira J. F., Degrave W. M. & Minoprio P. (2003)
Biochemical characterization of proline racemases from the human
protozoan parasite Trypanosoma cruzi and definition of putative
protein signatures. J Biol Chem, 278, 15484. [0292] 3. Chamond N.,
Coatnoan N. & Minoprio P. (2002) Immunotherapy of Trypanosoma
cruzi infections. Current Drug Targets, 2, 247. [0293] 4. Rassi A.
& Luquetti A. O. (1992) Therapy of Chagas Disease In: Chagas
Disease (American Trypanosomiasis): its impact on transfusion and
clinical medicine (ed. S. Wendel, Z. Brener, M. E. Camargo & A.
Rassi), p. 237. ISBT Brazil '92--SBHH, Sao Paulo. [0294] 5. Cancado
J. R. (1999) Criteria of Chagas disease cure. Mem Inst Oswaldo
Cruz, 94 Suppl 1, 331. [0295] 6. Urbina J. A. (2001) Specific
treatment of Chagas disease: current status and new developments.
Curr Opin Infect Dis, 14, 733. [0296] 7. Urbina J. A. (2002)
Chemotherapy of Chagas disease. Curr Pharm Des, 8, 287. [0297] 8.
Donald, G.& McNeil Jr. (2003) Rare Infection Threatens to
Spread in Blood Supply, in New York Times, Nov. 18, 2003 [0298] 9.
Beard, C., Pye, G. Steurer, F. J., Rodriguez, R., Campman, R.,
Townsend Peterson, A., Ramsey, J., Wirtz, R. A. & Robinson, L.
E. Chagas Disease in a Domestic Transmission Cycle, Southern Texas,
USA. (2003) Emerging Infectious Diseases, 9, 103. [0299] 10. Hamase
K., Morikawa A. & Zaitsu K. (2002) D-amino acids in mammals and
their diagnostic value. J Chromatogr B Analyt Technol Biomed Life
Sci, 781, 73. [0300] 11. D'Aniello A., Lee J. M., Petrucelli L.
& Di Fiore M. M. (1998) Regional decreases of free D-aspartate
levels in Alzheimer's disease. Neurosci Lett, 250, 131. [0301] 12.
D'Aniello A., Di Fiore M. M., Fisher G. H., Milone A., Seleni A.,
D'Aniello S., Perna A. F. & Ingrosso D. (2000) Occurrence of
D-aspartic acid and N-methyl-D-aspartic acid in rat neuroendocrine
tissues and their role in the modulation of luteinizing hormone and
growth hormone release. FASEB J, 14, 699. [0302] 13. Fisher G. H.,
D'Aniello A., Vetere A., Padula L., Cusano G. P. & Man E. H.
(1991) Free D-aspartate and D-alanine in normal and Alzheimer
brain. Brain Res Bull, 26, 983. [0303] 14. Fisher G. H., Torres D.,
Bruna J., Cerwinski S., Martin T., Bergljung C., Gruneiro A., Chou
S. J., Man E. H. & Pappatheodorou S. (1995) Presence of
D-aspartate and D-glutamate in tumor proteins. Cancer Biochem
Biophys, 15, 79. [0304] 15. Fisher G., Lorenzo N., Abe H., Fujita
E., Frey W. H., Emory C., Di Fiore M. M. & A D. A. (1998) Free
D- and L-amino acids in ventricular cerebrospinal fluid from
Alzheimer and normal subjects. Amino Acids, 15, 263. [0305] 16.
Fisher G. H. (1998) Appearance of D-amino acids during aging:
D-amino acids in tumor proteins. Exs, 85, 109. [0306] 17. Nagata
Y., Akino T., Ohno K., Kataoka Y., Ueda T., Sakurai T., Shiroshita
K. & Yasuda T. (1987) Free D-amino acids in human plasma in
relation to senescence and renal diseases. Clin Sci (Colch), 73,
105. [0307] 18. Nagata Y., Masui R. & Akino T. (1992) The
presence of free D-serine, D-alanine and D-proline in human plasma.
Experientia, 48, 986. [0308] 19. Chouinard M. L., Gaitan D. &
Wood P. L. (1993) Presence of the N-methyl-D-aspartate-associated
glycine receptor agonist, D-serine, in human temporal cortex:
comparison of normal, Parkinson, and Alzheimer tissues. J
Neurochem, 61, 1561. [0309] 20. Kumashiro S., Hashimoto A. &
Nishikawa T. (1995) Free D-serine in post-mortem brains and spinal
cords of individuals with and without neuropsychiatric diseases.
Brain Res, 681, 117. [0310] 21. Wellner D. and L. A. Lichtenberg,
(1968), Assay of Amino acid oxidase, Methods in Enzymology XVII,
"metabolism of Amino acids", 593 [0311] 22. Scannone H., D. WelIner
and A. Novogrodsky, (1964), A study of amino acid oxidase
specificity, using a new sensitive assay, Biochemistry, 3, 1742.
[0312] 23. Kishimoto M. and Takahashi T., (2001), A
spectrophotometric microplate Assay for L-amino acid oxidase,
Analytical Biochemistry, 298, 136. [0313] 24. Wolosker H., Sheth K.
N., Takahashi M., Mothet J.-P., Brady R. O. Jr, Ferris, C.D. and
Snyder S. H., (1999), Purification of serine racemase: Biosynthesis
of the neuromodulator D-Serine, Proc. Nat. Acad. Sci. USA, 96, 721
Sequence CWU 1
1
129115PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide motif 1Xaa Xaa Xaa His Xaa Xaa Gly Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Gly 1 5 10 15232PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide motif 2Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Xaa Gly Gly Xaa Xaa 20 25
30314PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide motif 3Asp Arg Ser Pro Xaa Gly Xaa Gly Xaa Xaa
Ala Xaa Xaa Ala 1 5 10414PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide motif 4Asp Arg Ser Pro Cys
Gly Xaa Gly Xaa Xaa Ala Xaa Xaa Ala 1 5 10528DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5ctctcccatg gggcaggaaa agcttctg 28623DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6ctgagctcga ccagatmtac tgc 23730DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7gcggatcgct ctccaagcgg gacaggcacc
30830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8ggtgcctgtc ccgcttggag agcgatccgc
30939DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 9ggctatttaa atatgtctgg acataactca
attgcagcg 391038DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 10cgctgcaatt gagttatgtc
cagacatatt taaatagc 381151DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 11atg gat acc ggt ggc
tat tta aat atg tgt gga cat aac tca att gca 48Met Asp Thr Gly Gly
Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala 1 5 10 15gcg
51Ala1217PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 12Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His
Asn Ser Ile Ala 1 5 10 15Ala1339DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 13ggctatttaa
atatgtctgg acataactca attgcagcg 391451DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14atg gat acc ggt ggc tat tta aat atg tct gga cat
aac tca att gca 48Met Asp Thr Gly Gly Tyr Leu Asn Met Ser Gly His
Asn Ser Ile Ala 1 5 10 15gcg 51Ala1551DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 15atggataccg gtggctattt aaatatgtgt ggacataact
caattgcagc g 511617PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 16Met Asp Thr Gly Gly Tyr Leu Asn Met
Ser Gly His Asn Ser Ile Ala 1 5 10 15Ala1751DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 17gtg ata ttt ggc aat cgc cag gcg gat cgc tct cca
tgt ggg aca ggc 48Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro
Cys Gly Thr Gly 1 5 10 15acc 51Thr1817PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 18Val
Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly 1 5 10
15Thr1930DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 19gcggatcgct ctccaagcgg gacaggcacc
302051DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 20gtgatatttg gcaatcgcca ggcggatcgc
tctccatgtg ggacaggcac c 512151DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 21gtg ata ttt ggc aat
cgc cag gcg gat cgc tct cca agc ggg aca ggc 48Val Ile Phe Gly Asn
Arg Gln Ala Asp Arg Ser Pro Ser Gly Thr Gly 1 5 10 15acc
51Thr2217PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 22Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro
Ser Gly Thr Gly 1 5 10 15Thr2316PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide motif 23Xaa Xaa Xaa His
Xaa Xaa Gly Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly 1 5 10
152414PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide motif 24Asp Arg Ser Pro Xaa Gly Xaa Xaa Xaa Xaa
Ala Xaa Xaa Ala 1 5 10255PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 25Glu Pro Arg Gly His 1
5266PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 26Glu Pro Arg Gly Ser Asp 1 5276PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 27Glu
Pro Arg Gly Asn Asp 1 5281598DNATrypanosoma cruzi 28cctttttctt
tttaaaaaca aaaaaaattc cggggggaat atggaacagg gtatatgcgt 60aaaagtgtct
gtcccaaaca aaaatttttt ttttccgcct tcccattttt tttttttttt
120tgtgtgtttc ccttgatctc tcgaacaggg caggaaaagc ttctgtttga
ccaaaaatat 180aaaattatta agggcgagaa aaaagaaaag aaaaaaaatc
aacgagcaaa caggagagaa 240caccaacaaa aaagggaaat tatgcgattt
aagaaatcat tcacatgcat cgacatgcat 300acggaaggtg aagcagcacg
gattgtgacg agtggtttgc cacacattcc aggttcgaat 360atggcggaga
agaaagcata cctgcaggaa aacatggatt atttgaggcg tggcataatg
420ctggaaccac gtggtcatga tgatatgttt ggagcctttt tatttgaccc
tattgaagaa 480ggcgctgact tgggcatggt attcatggat accggtggct
atttaaatat gtgtggacat 540aactcaattg cagcggttac ggcggcagtt
gaaacgggaa ttgtgagcgt gccggcgaag 600gcaacaaatg ttccggttgt
cctggacaca cctgcggggt tggtgcgcgg tacggcacac 660cttcagagtg
gtactgagag tgaggtgtca aatgcgagta ttatcaatgt accctcattt
720ttgtatcagc aggatgtggt ggttgtgttg ccaaagccct atggtgaagt
acgggttgat 780attgcatttg gaggcaattt tttcgccatt gttcccgcgg
agcagttggg aattgatatc 840tccgttcaaa acctctccag gctgcaggag
gcaggagaac ttctgcgtac tgaaatcaat 900cgcagtgtga aggttcagca
ccctcagctg ccccatatta acactgtgga ctgtgttgag 960atatacggtc
cgccaacgaa cccggaggca aactacaaga acgttgtgat atttggcaat
1020cgccaggcgg atcgctctcc atgtgggaca ggcaccagcg ccaagatggc
aacactttat 1080gccaaaggcc agcttcgcat cggagagact tttgtgtacg
agagcatact cggctcactc 1140ttccagggca gggtacttgg ggaggagcga
ataccggggg tgaaggtgcc ggtgaccaaa 1200gatgccgagg aagggatgct
cgttgtaacg gcagaaatta ctggaaaggc ttttatcatg 1260ggtttcaaca
ccatgctgtt tgacccaacg gatccgttta agaacggatt cacattaaag
1320cagtagatct ggtagagcac agaaactatt ggggaacacg tgcgaacagg
tgctgctacg 1380tgaagggtat tgaatgaatc gttttttttt atttttattt
tttattttta ttagtgcatt 1440attattaaat tttttttttg ttttggggtt
tcaacggtac cgcgttggga gcagggaagc 1500gatagcggcc ggacaatttt
ttgcttttat tttcattttc atcttcctac ccaaccccct 1560tggttccacc
ggtcgcggcg gggtcttgtg ggtggagg 1598291582DNATrypanosoma cruzi
29gtgtgttcaa cagttttgtt tccttttttc tctttttctc tttccatcat acatacatac
60atacatacat atatatatct gcgtagatat gcacatgcgt atatgcgtga agagtgtctg
120tcccaacatt tttttttttt ttttgtgtgt tttcccttga ttcccgaacg
ggcaggaaaa 180gcttctgttt gaccaaaaat ataaaattat taagggcgag
aaaagaaaaa aaaaatcaac 240cgaggagaca acaccaacaa aaaagggaaa
ttatgcgatt taagaaatca ttgacatgca 300tcgacatgca tacggaaggt
gaagcagcac ggattgtgac gagtggtttg ccacacattc 360caggttcgaa
tatggcggag aagaaagcat acctgcagga aaacatggat tatttgaggc
420gtggcataat gctggagcca cgtggtcatg atgatatgtt tggagccttt
ttatttgacc 480ctattgaaga aggcgctgac ttgggcatcg tattcatgga
taccggtggc tatttaaata 540tgtgtggaca taactcaatt gcagcggtta
cggcggcagt ggaaacggga attttgagcg 600tgccggcgaa ggcaacaaat
gttccggttg tcctggacac acctgcgggg ttggtgcgcg 660gtacggcaca
ccttcagagt ggtactgaga gtgaggtgtc aaatgcgagt attatcaatg
720tgccctcatt tttgtatcag caggatgtgg tgattgtttt gccaaagccc
tatggtgagg 780tacgggttga tattgcattt ggaggcaatt ttttcgccat
tgttcccgcg gagcacttgg 840gaattgatat ctccgttcaa aacctctcca
ggctgcagga ggcaggagaa cttctgcgta 900ctgaaatcaa tcgcagtgtg
aaggttcagc accctcagct gccccatatt aacactgtgg 960actgtgttga
gatatacggt ccgccaacga acccggaggc aaaatacaag aacgttgtga
1020tatttggcaa tcgccaggcg gatcgctctc catgtgggac aggcaccagc
gccaagatgg 1080caacacttta tgccaaaggc cagcttcgca tcggagagac
ttttgtgtac gagagcatac 1140tcggctcact cttccagggc agggtacttg
gggaggagcg aataccgggg gtgaaggtgc 1200cggtgaccaa agatgccgag
gaagggatgc tcgttgtaac gacagaaatt actggaaagg 1260cttttatcat
gggtttcaac accatgctgt ttgacccaac ggatccgttc ttaaacggat
1320tcacactaaa gcggtagatc tggtagagca cagaaactat tggggaacac
gtgcgaacag 1380gtgctgctac gtaaagggta ttgaatgaat cgtttttttt
tttttttttt tattagtgca 1440ttattttttt ttttttttgt tttggggttt
caacggtacc acgttgggag cagggaaacg 1500atagcggccg gacaattttt
tacttttatt ttcattttca ccttcctacc caaccccctt 1560ggttccaccg
gtcgcggcgg gg 158230423PRTTrypanosoma cruzi 30Met Arg Lys Ser Val
Cys Pro Lys Gln Lys Phe Phe Phe Ser Ala Phe 1 5 10 15Pro Phe Phe
Phe Phe Phe Cys Val Phe Pro Leu Ile Ser Arg Thr Gly 20 25 30Gln Glu
Lys Leu Leu Phe Asp Gln Lys Tyr Lys Ile Ile Lys Gly Glu 35 40 45Lys
Lys Glu Lys Lys Lys Asn Gln Arg Ala Asn Arg Arg Glu His Gln 50 55
60Gln Lys Arg Glu Ile Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp
65 70 75 80Met His Thr Glu Gly Glu Ala Ala Arg Ile Val Thr Ser Gly
Leu Pro 85 90 95His Ile Pro Gly Ser Asn Met Ala Glu Lys Lys Ala Tyr
Leu Gln Glu 100 105 110Asn Met Asp Tyr Leu Arg Arg Gly Ile Met Leu
Glu Pro Arg Gly His 115 120 125Asp Asp Met Phe Gly Ala Phe Leu Phe
Asp Pro Ile Glu Glu Gly Ala 130 135 140Asp Leu Gly Met Val Phe Met
Asp Thr Gly Gly Tyr Leu Asn Met Cys145 150 155 160Gly His Asn Ser
Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile 165 170 175Val Ser
Val Pro Ala Lys Ala Thr Asn Val Pro Val Val Leu Asp Thr 180 185
190Pro Ala Gly Leu Val Arg Gly Thr Ala His Leu Gln Ser Gly Thr Glu
195 200 205Ser Glu Val Ser Asn Ala Ser Ile Ile Asn Val Pro Ser Phe
Leu Tyr 210 215 220Gln Gln Asp Val Val Val Val Leu Pro Lys Pro Tyr
Gly Glu Val Arg225 230 235 240Val Asp Ile Ala Phe Gly Gly Asn Phe
Phe Ala Ile Val Pro Ala Glu 245 250 255Gln Leu Gly Ile Asp Ile Ser
Val Gln Asn Leu Ser Arg Leu Gln Glu 260 265 270Ala Gly Glu Leu Leu
Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln 275 280 285His Pro Gln
Leu Pro His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr 290 295 300Gly
Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe305 310
315 320Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser
Ala 325 330 335Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile
Gly Glu Thr 340 345 350Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe
Gln Gly Arg Val Leu 355 360 365Gly Glu Glu Arg Ile Pro Gly Val Lys
Val Pro Val Thr Lys Asp Ala 370 375 380Glu Glu Gly Met Leu Val Val
Thr Ala Glu Ile Thr Gly Lys Ala Phe385 390 395 400Ile Met Gly Phe
Asn Thr Met Leu Phe Asp Pro Thr Asp Pro Phe Lys 405 410 415Asn Gly
Phe Thr Leu Lys Gln 42031354PRTTrypanosoma cruzi 31Met Arg Phe Lys
Lys Ser Leu Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala
Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn
Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40
45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly
50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile
Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His
Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Leu
Ser Val Pro Ala 100 105 110Lys Ala Thr Asn Val Pro Val Val Leu Asp
Thr Pro Ala Gly Leu Val 115 120 125Arg Gly Thr Ala His Leu Gln Ser
Gly Thr Glu Ser Glu Val Ser Asn 130 135 140Ala Ser Ile Ile Asn Val
Pro Ser Phe Leu Tyr Gln Gln Asp Val Val145 150 155 160Ile Val Leu
Pro Lys Pro Tyr Gly Glu Val Arg Val Asp Ile Ala Phe 165 170 175Gly
Gly Asn Phe Phe Ala Ile Val Pro Ala Glu His Leu Gly Ile Asp 180 185
190Ile Ser Val Gln Asn Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu
195 200 205Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln His Pro Gln
Leu Pro 210 215 220His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr Gly
Asn Ala Thr Asn225 230 235 240Pro Glu Ala Lys Tyr Lys Asn Val Val
Ile Phe Gly Asn Arg Gln Ala 245 250 255Asp Arg Ser Pro Cys Gly Thr
Gly Thr Ser Ala Lys Met Ala Thr Leu 260 265 270Tyr Ala Lys Gly Gln
Leu Arg Ile Gly Glu Thr Phe Val Tyr Glu Ser 275 280 285Ile Leu Gly
Ser Leu Phe Gln Gly Arg Val Leu Gly Glu Glu Arg Ile 290 295 300Pro
Gly Val Lys Val Pro Val Thr Lys Asp Ala Glu Glu Gly Met Leu305 310
315 320Val Val Thr Thr Glu Ile Thr Gly Lys Ala Phe Ile Met Gly Phe
Asn 325 330 335Thr Met Leu Phe Asp Pro Thr Asp Pro Phe Leu Asn Gly
Phe Thr Leu 340 345 350Lys Arg32335PRTClostridium sticklandii 32Met
Lys Phe Ser Lys Gly Ile His Ala Ile Asp Ser His Thr Met Gly 1 5 10
15Glu Pro Thr Arg Ile Val Val Gly Gly Ile Pro Gln Ile Asn Gly Glu
20 25 30Thr Met Ala Asp Lys Lys Lys Tyr Leu Glu Asp Asn Leu Asp Tyr
Val 35 40 45Arg Thr Ala Leu Met His Glu Pro Arg Gly His Asn Asp Met
Phe Gly 50 55 60Ser Ile Ile Thr Ser Ser Asn Asn Lys Glu Ala Asp Phe
Gly Ile Ile 65 70 75 80Phe Met Asp Gly Gly Gly Tyr Leu Asn Met Cys
Gly His Gly Ser Ile 85 90 95Gly Ala Ala Thr Val Ala Val Glu Thr Gly
Met Val Glu Met Val Glu 100 105 110Pro Val Thr Asn Ile Asn Met Glu
Ala Pro Ala Gly Leu Ile Lys Ala 115 120 125Lys Val Met Val Glu Asn
Glu Lys Val Lys Glu Val Ser Ile Thr Asn 130 135 140Val Pro Ser Phe
Leu Tyr Met Glu Asp Ala Lys Leu Glu Val Pro Ser145 150 155 160Leu
Asn Lys Thr Ile Thr Phe Asp Ile Ser Phe Gly Gly Ser Phe Phe 165 170
175Ala Ile Ile His Ala Lys Glu Leu Gly Val Lys Val Glu Thr Ser Gln
180 185 190Val Asp Val Leu Lys Lys Leu Gly Ile Glu Ile Arg Asp Leu
Ile Asn 195 200 205Glu Lys Ile Lys Val Gln His Pro Glu Leu Glu His
Ile Lys Thr Val 210 215 220Asp Leu Val Glu Ile Tyr Asp Glu Pro Ser
Asn Pro Glu Ala Thr Tyr225 230 235 240Lys Asn Val Val Ile Phe Gly
Gln Gly Gln Val Asp Arg Ser Pro Cys 245 250 255Gly Thr Gly Thr Ser
Ala Lys Leu Ala Thr Leu Tyr Lys Lys Gly His 260 265 270Leu Lys Ile
Asp Glu Lys Phe Val Tyr Glu Ser Ile Thr Gly Thr Met 275 280 285Phe
Lys Gly Arg Val Leu Glu Glu Thr Lys Val Gly Glu Phe Asp Ala 290 295
300Ile Ile Pro Glu Ile Thr Gly Gly Ala Tyr Ile Thr Gly Phe Asn
His305 310 315 320Phe Val Ile Asp Pro Glu Asp Pro Leu Lys Tyr Gly
Phe Thr Val 325 330 33533354PRTHomo sapiens 33Met Glu Ser Ala Leu
Ala Val Pro Trp Leu Pro Pro His Asp Pro Gly 1 5 10 15Thr Pro Val
Leu Ser Val Val Asp Met His Thr Gly Gly Glu
Pro Leu 20 25 30Arg Ile Val Leu Ala Gly Cys Pro Glu Val Ser Gly Pro
Thr Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp His
Val Arg Arg Arg 50 55 60Leu Met Phe Glu Pro Arg Gly His Arg Asp Met
Tyr Gly Ala Val Leu 65 70 75 80Val Pro Ser Glu Leu Pro Asp Ala His
Leu Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys
Gly His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe
Gly Leu Val Pro Ala Pro Pro Ala Gly Thr 115 120 125Arg Glu Ala Arg
Val Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val
Ala Cys Glu Asp Gly Arg Ser His Gly Pro Val Arg Phe His145 150 155
160Ser Val Pro Ala Phe Val Leu Ala Thr Asp Leu Met Val Asp Val Pro
165 170 175Gly His Gly Lys Val Met Val Asp Ile Ala Tyr Gly Gly Ala
Phe Tyr 180 185 190Ala Phe Val Thr Ala Glu Lys Leu Gly Leu Asp Ile
Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala
Val Thr Glu Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro
Asp Ser Glu Asp Leu Ala Phe Leu225 230 235 240Tyr Gly Thr Ile Leu
Thr Asp Gly Lys Asp Ala Tyr Thr Lys Glu Pro 245 250 255Thr Thr Asn
Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr
Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280
285Leu Leu Glu Leu Asn Gln Met Arg Ala Phe Lys Ser Ser Ala Thr Gly
290 295 300Ser Val Phe Thr Gly Lys Ala Val Arg Glu Ala Lys Cys Gly
Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ser Gly Gln Ala
His Tyr Thr Gly Thr 325 330 335Ala Ser Phe Ile Ile Glu Asp Asp Asp
Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys34354PRTHomo sapiens
34Met Glu Ser Ala Leu Ala Val Pro Arg Leu Pro Pro His Asp Pro Gly 1
5 10 15Thr Pro Val Leu Ser Val Val Asp Met His Thr Gly Gly Glu Pro
Leu 20 25 30Arg Ile Val Leu Ala Gly Cys Pro Glu Val Ser Gly Pro Thr
Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp His Val
Arg Arg Arg 50 55 60Leu Met Phe Glu Pro Arg Gly His Arg Asp Met Tyr
Gly Ala Val Leu 65 70 75 80Val Pro Ser Glu Leu Pro Asp Ala His Leu
Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys Gly
His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe Gly
Leu Val Pro Ala Pro Pro Ala Gly Thr 115 120 125Arg Glu Ala Arg Val
Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val Ala
Cys Glu Asp Gly Arg Ser His Gly Pro Val Arg Phe His145 150 155
160Ser Val Pro Ala Phe Val Leu Ala Thr Asp Leu Met Val Asp Val Pro
165 170 175Gly His Gly Lys Val Met Val Asp Ile Ala Tyr Gly Gly Ala
Phe Tyr 180 185 190Ala Phe Val Thr Ala Glu Lys Leu Gly Leu Asp Ile
Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala
Val Thr Glu Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro
Asp Ser Glu Asp Leu Ala Phe Leu225 230 235 240Tyr Gly Thr Ile Leu
Thr Asp Gly Lys Asp Ala Tyr Thr Lys Glu Pro 245 250 255Thr Thr Asn
Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr
Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280
285Leu Leu Glu Leu Asn Gln Met Arg Ala Phe Lys Ser Ser Ala Thr Gly
290 295 300Ser Val Phe Thr Gly Lys Ala Val Arg Glu Ala Lys Cys Gly
Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ser Gly Gln Ala
His Tyr Thr Gly Thr 325 330 335Ala Ser Phe Ile Ile Glu Asp Asp Asp
Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys35354PRTMus musculus
35Met Glu Ala Ala Leu Ala Val Thr Arg Leu Pro Pro Asn Asp Pro Arg 1
5 10 15Thr Pro Ala Leu Ser Val Val Asp Met His Thr Gly Gly Glu Pro
Leu 20 25 30Arg Ile Val His Ala Gly Cys Pro Glu Val Ala Gly Pro Thr
Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp Tyr Ile
Arg Arg Arg 50 55 60Leu Val Phe Glu Pro Arg Gly His Arg Asp Met Tyr
Gly Ala Ile Leu 65 70 75 80Val Pro Ser Glu Leu Pro Asp Ala His Leu
Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys Gly
His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe Gly
Leu Val Pro Ala Pro Pro Lys Gly Ala 115 120 125Arg Glu Ala Gln Val
Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val Glu
Cys Glu Gly Gly Arg Ser Cys Gly Pro Val Arg Phe His145 150 155
160Ser Val Pro Ala Phe Val Leu Ala Ser Asp Leu Thr Val Asp Val Pro
165 170 175Gly His Gly Lys Val Leu Val Asp Ile Ala Tyr Gly Gly Ala
Phe Tyr 180 185 190Ala Phe Val Ser Ala Glu Lys Leu Gly Leu Asp Val
Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala
Leu Thr Gly Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro
Glu Ser Glu Asp Leu Gly Phe Leu225 230 235 240Tyr Gly Ser Ile Leu
Thr Asp Gly Lys Asp Ala Tyr Ser Glu Glu Ala 245 250 255Thr Thr Asn
Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr
Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280
285Leu Leu Gln Leu Asn Gln Thr Arg Ala Phe Lys Ser Ser Ala Thr Gly
290 295 300Ser Val Phe Thr Gly Cys Ala Val Arg Glu Ala Lys Cys Gly
Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ala Gly Gln Ala
His Tyr Thr Gly Thr 325 330 335Ala Asn Leu Thr Val Glu Asp Gly Asp
Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys36354PRTMus musculus
36Met Glu Ala Ala Leu Ala Val Thr Arg Leu Pro Pro His Asp Ser Arg 1
5 10 15Thr Pro Ala Leu Ser Val Val Asp Met His Thr Gly Gly Glu Pro
Leu 20 25 30Arg Ile Val His Ala Gly Cys Pro Glu Val Ala Gly Pro Thr
Leu Leu 35 40 45Ala Lys Arg Arg Tyr Met Arg Gln His Leu Asp Tyr Ile
Arg Arg Arg 50 55 60Leu Val Phe Glu Pro Arg Gly His Arg Asp Met Tyr
Gly Ala Ile Leu 65 70 75 80Met Pro Ser Glu Leu Pro Asp Ala His Leu
Gly Val Leu Phe Leu His 85 90 95Asn Glu Gly Tyr Ser Ser Met Cys Gly
His Ala Val Leu Ala Leu Gly 100 105 110Arg Phe Ala Leu Asp Phe Gly
Leu Val Pro Ala Pro Pro Glu Gly Ala 115 120 125Arg Glu Ala Gln Val
Asn Ile His Cys Pro Cys Gly Leu Val Thr Ala 130 135 140Phe Val Glu
Cys Glu Gly Gly Arg Ser Cys Gly Pro Val Arg Phe His145 150 155
160Ser Val Pro Ala Phe Val Leu Ala Ser Asp Leu Thr Val Asp Val Pro
165 170 175Gly His Gly Lys Val Leu Val Asp Ile Ala Tyr Gly Gly Ala
Phe Tyr 180 185 190Ala Phe Val Ser Ala Glu Lys Leu Gly Leu Asp Val
Cys Ser Ala Lys 195 200 205Thr Arg Asp Leu Val Asp Ala Ala Ser Ala
Leu Thr Gly Ala Val Lys 210 215 220Ala Gln Phe Lys Ile Asn His Pro
Glu Ser Glu Asp Leu Gly Phe Leu225 230 235 240Tyr Gly Ser Ile Leu
Thr Asp Gly Lys Asp Ala Tyr Ser Glu Glu Ala 245 250 255Thr Thr Asn
Ile Cys Val Phe Ala Asp Glu Gln Val Asp Arg Ser Pro 260 265 270Thr
Gly Ser Gly Val Thr Ala Arg Ile Ala Leu Gln Tyr His Lys Gly 275 280
285Leu Leu Gln Leu Asn Gln Thr Arg Ala Phe Lys Ser Ser Ala Thr Gly
290 295 300Ser Val Phe Thr Gly Cys Ala Val Arg Glu Ala Lys Cys Gly
Asp Phe305 310 315 320Lys Ala Val Ile Val Glu Val Ala Gly Gln Ala
His Tyr Thr Gly Thr 325 330 335Ala Asn Leu Thr Val Glu Asp Gly Asp
Pro Leu Arg Asp Gly Phe Leu 340 345 350Leu Lys37333PRTRhizobium
loti 37Met Ala Lys Lys Ser Phe Phe Cys Ile Asp Gly His Thr Cys Gly
Asn 1 5 10 15Pro Val Arg Leu Val Ala Gly Gly Gly Pro Leu Leu Glu
Gly Ser Thr 20 25 30Met Met Glu Arg Arg Ala His Phe Leu Ala Glu Tyr
Asp Trp Ile Arg 35 40 45Thr Gly Leu Met Phe Glu Pro Arg Gly His Asp
Val Met Ser Gly Ser 50 55 60Ile Leu Tyr Pro Pro Thr Arg Glu Asp Cys
Asp Ile Ala Ile Leu Phe 65 70 75 80Ile Glu Thr Ser Gly Cys Leu Pro
Met Cys Gly His Gly Thr Ile Gly 85 90 95Thr Val Thr Met Ala Ile Glu
His Gly Leu Ile Lys Pro Lys Thr Pro 100 105 110Gly Val Leu Arg Leu
Asp Thr Pro Ala Gly Leu Val Ile Ala Glu Tyr 115 120 125Lys Gln Val
Gly Glu Tyr Val Glu Glu Val Arg Ile Thr Asn Val Pro 130 135 140Ser
Phe Leu His Ala Glu Gly Leu Thr Val Glu Cys Pro Gly Leu Gly145 150
155 160Glu Ile Thr Val Asp Val Ala Tyr Gly Gly Asn Phe Tyr Ala Ile
Val 165 170 175Glu Pro Gln Glu Asn Tyr Arg Asp Met Ala Asp His Ser
Ala Gly Asp 180 185 190Leu Ile Ala Trp Ser Pro Val Val Arg Gln Arg
Leu Asn Glu Lys Tyr 195 200 205Ser Phe Val His Pro Glu Asn Pro Gly
Ile Asn Arg Leu Ser His Met 210 215 220Leu Trp Thr Gly Lys Pro Thr
Val Glu Gly Ala Asp Ala Arg Asn Ala225 230 235 240Val Phe Tyr Gly
Asp Lys Ala Ile Asp Arg Ser Pro Cys Gly Thr Gly 245 250 255Thr Ser
Ala Arg Met Ala Gln Leu His Ala Lys Gly Lys Leu Lys Ala 260 265
270Gly Asp Ala Phe Val His Glu Ser Ile Ile Gly Ser Leu Phe Lys Gly
275 280 285Lys Val Glu Lys Glu Val Thr Val Ala Gly Lys Pro Ala Ile
Ile Pro 290 295 300Ser Ile Gly Gly Trp Ala Arg Leu Thr Gly Leu Asn
Thr Ile Phe Ile305 310 315 320Asp Asp Arg Asp Pro Phe Ala His Gly
Phe Val Val Thr 325 33038333PRTBrucella melitensis 38Met Ala Arg
His Ser Phe Phe Cys Val Asp Gly His Thr Cys Gly Asn 1 5 10 15Pro
Val Arg Leu Val Ala Gly Gly Gly Pro Asn Leu Asn Gly Ser Thr 20 25
30Met Met Glu Lys Cys Ala His Phe Leu Ala Glu Tyr Asp Trp Ile Arg
35 40 45Thr Gly Leu Met Phe Glu Pro Arg Gly His Asp Met Met Ser Gly
Ser 50 55 60Ile Leu Tyr Pro Pro Thr Arg Pro Asp Cys Asp Val Ala Val
Leu Phe 65 70 75 80Ile Glu Thr Ser Gly Cys Leu Pro Met Cys Gly His
Gly Thr Ile Gly 85 90 95Thr Val Thr Met Ala Ile Glu Gln Gly Leu Val
Thr Pro Lys Thr Pro 100 105 110Gly Lys Leu Asn Leu Asp Thr Pro Ala
Gly Leu Val Ala Ile Glu Tyr 115 120 125Glu Gln Asp Gly Gln Tyr Val
Glu Arg Val Arg Leu Thr Asn Val Pro 130 135 140Ala Phe Leu Tyr Ala
Glu Gly Leu Glu Val Glu Cys Pro Asp Leu Gly145 150 155 160Pro Ile
Lys Val Asp Val Ala Tyr Gly Gly Asn Phe Tyr Ala Ile Val 165 170
175Glu Pro Gln Glu Asn Tyr Thr Asp Met Asp Asp Tyr Ser Ala Leu Gln
180 185 190Leu Ile Ala Trp Ser Pro Val Leu Arg Gln Arg Leu Asn Glu
Lys Tyr 195 200 205Lys Phe Gln His Pro Glu Leu Pro Asp Ile Asn Arg
Leu Ser His Ile 210 215 220Leu Trp Thr Gly Lys Pro Lys His Pro Gln
Ala His Ala Arg Asn Ala225 230 235 240Val Phe Tyr Gly Asp Lys Ala
Ile Asp Arg Ser Pro Cys Gly Thr Gly 245 250 255Thr Ser Ala Arg Met
Ala Gln Leu Ala Ala Lys Gly Lys Leu Lys Pro 260 265 270Gly Asp Glu
Phe Ile His Glu Ser Ile Ile Gly Ser Leu Phe His Gly 275 280 285Arg
Val Glu Arg Ala Ala Glu Val Ala Gly Arg Pro Ala Ile Val Pro 290 295
300Ser Ile Ala Gly Trp Ala Arg Met Thr Gly Tyr Asn Thr Ile Phe
Ile305 310 315 320Asp Asp Arg Asp Pro Phe Ala His Gly Phe Ser Ala
Ala 325 33039333PRTRhizobium meliloti 39Met Ala Thr His Thr Phe Ser
Cys Ile Asp Gly His Thr Cys Gly Asn 1 5 10 15Pro Val Arg Leu Val
Ser Gly Gly Gly Pro Arg Leu Glu Gly Ala Asn 20 25 30Met Leu Glu Lys
Arg Ala His Phe Leu Lys Glu Phe Asp Trp Ile Arg 35 40 45Thr Gly Leu
Met Phe Glu Pro Arg Gly His Asp Met Met Ser Gly Ser 50 55 60Ile Leu
Tyr Pro Pro Thr Arg Pro Asp Cys Asp Val Ala Val Leu Phe 65 70 75
80Ile Glu Thr Ser Gly Cys Leu Pro Met Cys Gly His Gly Thr Ile Gly
85 90 95Thr Ile Thr Met Gly Ile Glu Asn Gly Leu Ile Thr Pro Arg Glu
Pro 100 105 110Gly Lys Leu Ser Ile Asp Ala Pro Ala Gly Lys Val Asp
Ile Thr Tyr 115 120 125Arg Gln Glu Gly Arg Phe Val Glu Glu Val Arg
Leu Thr Asn Val Pro 130 135 140Ser Phe Leu Tyr Ala Glu Gly Leu Ala
Ala Glu Val Glu Gly Leu Gly145 150 155 160Glu Ile Val Val Asp Val
Ala Tyr Gly Gly Asn Phe Tyr Ala Ile Val 165 170 175Glu Pro Gln Lys
Asn Phe Arg Asp Met Ala Asp His Thr Ala Gly Glu 180 185 190Leu Val
Gly Trp Ser Pro Lys Leu Arg Ala Ala Leu Asn Ala Lys Tyr 195 200
205Glu Phe Val His Pro Glu His Pro Glu Ile Arg Gly Leu Ser His Ile
210 215 220Gln Trp Thr Gly Lys Pro Thr Gln Pro Glu Ala His Ala Arg
Asn Ala225 230 235 240Val Phe Tyr Gly Glu Lys Ala Ile Asp Arg Ser
Pro Cys Gly Thr Gly 245 250 255Thr Ser Ala Arg Ile Ala Gln Leu Ala
Ala Lys Gly Lys Leu Lys Val 260 265 270Gly Asp Glu Phe Val His Glu
Ser Ile Ile Gly Ser Leu Phe Lys Gly 275 280 285Arg Val Glu Ala Ala
Ala Lys Val Ala Asp Arg Asp Ala Ile Ile Pro 290 295 300Ser Ile Ala
Gly Trp Ala Arg Met Thr Gly Ile Asn Thr Ile Phe Ile305 310 315
320Asp Asp Arg Asp Pro Phe Ala His Gly Phe Val Val Arg 325
33040332PRTAgrobacterium tumefaciens 40Met Arg His Ser Phe Phe Cys
Ile Asp Ser His Thr Cys Gly Asn Pro 1 5 10 15Val Arg Leu Val Ala
Gly Gly Gly Pro Leu Leu Pro His Leu Pro Ile 20 25 30Ser Glu Arg Arg
Asp Leu Phe Val Arg Asn His Asp Trp Val Arg Gln 35 40 45Ala Leu Met
Phe Glu Pro Arg Gly His Asp Ile Met Ser Gly Ala Val 50 55 60Ile Tyr
Pro Ala Tyr Arg Asp Asp Cys Asp Phe Ala Val Ile Phe
Ile 65 70 75 80Glu Val Ser Gly Cys Leu Pro Met Cys Gly Ala Gly Thr
Ile Gly Leu 85 90 95Val Thr Ala Ala Ile Glu Glu Gly Leu Val Thr Pro
Arg Ile Pro Gly 100 105 110Arg Leu Ser Ile Glu Thr Pro Ala Gly Lys
Val Asp Ile Gln Tyr Asp 115 120 125Lys Pro Gly Glu Phe Val Glu Ser
Val Arg Ile Phe Asn Val Ala Ser 130 135 140Tyr Leu His Ala Ala Asp
Val Glu Val Asn Val Pro Gly Leu Gly Lys145 150 155 160Leu Val Val
Asp Ile Ala Tyr Gly Gly Asn Tyr Tyr Ala Val Ile Glu 165 170 175Pro
Gln Val Gly Trp Pro Gly Leu Asp Gly Met Thr Ala Gly Asp Val 180 185
190Val Asp Leu Ser Gln Lys Leu Arg Asp Ala Leu Gly Thr Ile Cys Asp
195 200 205Pro Val His Pro Asp Asp Glu Arg Ile Arg Gly Val His His
Ala Ile 210 215 220Trp Cys Asp Arg Pro Val Ser Ala Glu Ala Asp Gly
Arg Gly Ala Val225 230 235 240Phe Tyr Gly Asp Lys Ala Ile Asp Arg
Ser Pro Gly Gly Thr Gly Thr 245 250 255Ser Ala Arg Met Ala Gln Leu
His Gly Lys Gly Arg Leu Lys Ala Gly 260 265 270Glu Thr Phe Arg Gln
Glu Ser Leu Ile Gly Thr Ile Phe Glu Gly Lys 275 280 285Val Glu Glu
Glu Thr Thr Val Gly Ser Phe Ser Gly Ile Arg Pro Ser 290 295 300Ile
Gly Gly Trp Ala Arg Ile Ile Gly His Asn Thr Ile Phe Val Asp305 310
315 320Asp Arg Asp Pro Leu Ala His Gly Phe Gln Val Arg 325
33041312PRTXanthomonas campestris 41Met His Thr Ile Asp Val Ile Asp
Ser His Thr Ala Gly Glu Pro Thr 1 5 10 15Arg Val Val Leu Ala Gly
Phe Pro Asp Leu Gly Asp Gly Asp Leu Ala 20 25 30Gln Cys Arg Glu Arg
Phe Arg Ser Asp Phe Asp His Trp Arg Ser Ala 35 40 45Ile Ala Cys Glu
Pro Arg Gly Ser Asp Thr Met Val Gly Ala Leu Leu 50 55 60Leu Pro Pro
Arg Asp Pro Ser Ala Cys Thr Gly Val Ile Phe Phe Asn 65 70 75 80Asn
Val Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly Val Val 85 90
95Arg Thr Leu Ala Glu Leu Gly Arg Ile Ala Pro Gly Gln His Arg Ile
100 105 110Glu Thr Pro Val Gly Thr Val Gly Val Ala Leu Ala Asp Asp
Gly Thr 115 120 125Val Ser Ile Asp Asn Val Glu Ser Tyr Arg His Ala
Ala Gly Val Glu 130 135 140Val Asp Val Pro Gly His Gly Arg Val Arg
Gly Asp Val Ala Trp Gly145 150 155 160Gly Asn Trp Phe Phe Ile Thr
Glu Gln Ala Pro Cys Ala Leu Gly Leu 165 170 175Ala Gln Gln Arg Glu
Leu Thr Ala Tyr Thr Glu Ala Ile Arg Leu Ala 180 185 190Leu Glu Ala
Ala Gly Ile Thr Gly Glu Ala Gly Gly Glu Ile Asp His 195 200 205Ile
Glu Ile Ser Gly Val Ala Pro Asp Gly Ser Gly Ala Ala Arg Asn 210 215
220Phe Val Leu Cys Pro Gly Leu Ala Tyr Asp Arg Ser Pro Cys Gly
Thr225 230 235 240Gly Thr Ser Ala Lys Leu Ala Cys Leu Ala Ala Asp
Gly Lys Leu Ala 245 250 255Glu Gly Glu Arg Trp Leu Gln Gln Gly Ile
Leu Gly Ser Ala Phe Glu 260 265 270Gly Ser Tyr Arg His Ser Gly Arg
Gly Ile Ala Pro Arg Ile Ser Gly 275 280 285His Ala Phe Ile Thr Ala
Arg Ser Gln Leu Leu Ile Asp Pro Ala Asp 290 295 300Pro Phe Ala Trp
Gly Ile Val Ala305 31042312PRTXanthomonas axonopodis 42Met His Thr
Ile Asp Val Ile Asp Ser His Thr Ala Gly Glu Pro Thr 1 5 10 15Arg
Val Val Leu Ser Gly Phe Pro Asp Leu Gly Asp Gly Asp Leu Ala 20 25
30Gln Cys Arg Glu Arg Phe Arg Ser Glu Phe Asp His Trp Arg Ser Ala
35 40 45Ile Ala Cys Glu Pro Arg Gly Ser Asp Thr Met Val Gly Ala Leu
Leu 50 55 60Leu Pro Pro Arg Asp Pro Ser Ala Cys Thr Gly Val Ile Phe
Phe Asn 65 70 75 80Asn Val Gly Tyr Leu Gly Met Cys Gly His Gly Thr
Ile Gly Val Val 85 90 95Arg Thr Leu Ala Glu Leu Gly Arg Ile Ala Pro
Gly Gln His Arg Ile 100 105 110Glu Thr Pro Val Gly Thr Val Gly Val
Glu Leu Ala Asp Asp Gly Thr 115 120 125Val Ser Val Asp Asn Val Glu
Ser Tyr Arg Phe Ala Ser Gly Val Glu 130 135 140Val Glu Val Pro Gly
His Gly Arg Val Cys Gly Asp Val Ala Trp Gly145 150 155 160Gly Asn
Trp Phe Phe Ile Thr Glu His Ala Pro Cys Ala Leu Asp Leu 165 170
175Ala His Gln Arg Glu Leu Thr Ala Tyr Thr Glu Ala Ile Arg Leu Ala
180 185 190Leu Glu Ala Ala Gly Ile Thr Gly Glu Ala Gly Gly Glu Ile
Asp His 195 200 205Ile Glu Val Asn Gly Ala Ala Pro Asp Gly Ser Gly
Val Ala Arg Asn 210 215 220Phe Val Leu Cys Pro Gly Leu Ala Tyr Asp
Arg Ser Pro Cys Gly Thr225 230 235 240Gly Thr Ser Ala Lys Leu Ala
Cys Leu Ala Ala Asp Gly Lys Leu Ala 245 250 255Glu Gly Glu Arg Trp
Val Gln Gln Gly Ile Leu Gly Ser Ala Phe Glu 260 265 270Gly Asn Tyr
Arg Leu Ser Gly Arg Gly Ile Ala Pro Arg Ile Ser Gly 275 280 285Arg
Ala Tyr Ile Thr Ala Arg Ala Gln Leu Val Ile Asp Pro Ala Asp 290 295
300Pro Phe Ala Trp Gly Ile Val Ala305 31043314PRTPseudomonas
aeruginosa 43Met Gln Arg Ile Arg Ile Ile Asp Ser His Thr Gly Gly
Glu Pro Thr 1 5 10 15Arg Leu Val Ile Gly Gly Phe Pro Asp Leu Gly
Gln Gly Asp Met Ala 20 25 30Glu Arg Arg Arg Leu Leu Gly Glu Arg His
Asp Ala Trp Arg Ala Ala 35 40 45Cys Ile Leu Glu Pro Arg Gly Ser Asp
Val Leu Val Gly Ala Leu Leu 50 55 60Cys Ala Pro Val Asp Pro Glu Ala
Cys Ala Gly Val Ile Phe Phe Asn 65 70 75 80Asn Ser Gly Tyr Leu Gly
Met Cys Gly His Gly Thr Ile Gly Leu Val 85 90 95Ala Ser Leu Ala His
Leu Gly Arg Ile Gly Pro Gly Val His Arg Ile 100 105 110Glu Thr Pro
Val Gly Glu Val Glu Ala Thr Leu His Glu Asp Gly Ser 115 120 125Val
Ser Val Arg Asn Val Pro Ala Tyr Arg Tyr Arg Arg Gln Val Ser 130 135
140Val Glu Val Pro Gly Ile Gly Arg Val Ser Gly Asp Ile Ala Trp
Gly145 150 155 160Gly Asn Trp Phe Phe Leu Val Ala Gly His Gly Gln
Arg Leu Ala Gly 165 170 175Asp Asn Leu Asp Ala Leu Thr Ala Tyr Thr
Val Ala Val Gln Gln Ala 180 185 190Leu Asp Asp Gln Asp Ile Arg Gly
Glu Asp Gly Gly Ala Ile Asp His 195 200 205Ile Glu Leu Phe Ala Asp
Asp Pro His Ala Asp Ser Arg Asn Phe Val 210 215 220Leu Cys Pro Gly
Lys Ala Tyr Asp Arg Ser Pro Cys Gly Thr Gly Thr225 230 235 240Ser
Ala Lys Leu Ala Cys Leu Ala Ala Asp Gly Lys Leu Leu Pro Gly 245 250
255Gln Pro Trp Arg Gln Ala Ser Val Ile Gly Ser Gln Phe Glu Gly Arg
260 265 270Tyr Glu Trp Leu Asp Gly Gln Pro Gly Gly Pro Ile Val Pro
Thr Ile 275 280 285Arg Gly Arg Ala His Val Ser Ala Glu Ala Thr Leu
Leu Leu Ala Asp 290 295 300Asp Asp Pro Phe Ala Trp Gly Ile Arg
Arg305 31044344PRTPseudomonas aeruginosa 44Met Arg Ser Gln Arg Ile
Val His Ile Val Ser Cys His Ala Glu Gly 1 5 10 15Glu Val Gly Asp
Val Ile Val Gly Gly Val Ala Ala Pro Pro Gly Ala 20 25 30Thr Leu Trp
Glu Gln Ser Arg Trp Ile Ala Arg Asp Gln Asp Leu Arg 35 40 45Asn Phe
Val Leu Asn Glu Pro Arg Gly Gly Val Phe Arg His Ala Asn 50 55 60Leu
Leu Val Pro Ala Lys Asp Pro Arg Ala Gln Met Gly Trp Ile Ile 65 70
75 80Met Glu Pro Ala Asp Thr Pro Pro Met Ser Gly Ser Asn Ser Leu
Cys 85 90 95Val Ala Thr Val Leu Leu Asp Ser Gly Ile Leu Pro Met Arg
Glu Pro 100 105 110Leu Thr Arg Leu Leu Leu Glu Ala Pro Gly Gly Leu
Ile Glu Ala Arg 115 120 125Ala Glu Cys Arg Asp Gly Lys Ala Glu Arg
Val Glu Ile Arg Asn Val 130 135 140Pro Ser Phe Ala Asp Arg Leu Asp
Ala Trp Ile Glu Val Glu Gly Leu145 150 155 160Gly Ser Leu Gln Val
Asp Thr Ala Tyr Gly Gly Asp Ser Phe Val Ile 165 170 175Ala Asp Ala
Arg Arg Leu Gly Phe Ala Leu Arg Ala Asp Glu Ala Ala 180 185 190Glu
Leu Val Ala Thr Gly Leu Lys Ile Thr His Ala Ala Asn Glu Gln 195 200
205Leu Gly Phe Arg His Pro Thr Asn Pro Asp Trp Asp His Leu Ser Phe
210 215 220Cys Gln Leu Ala Ala Pro Pro Glu Arg Arg Asp Gly Val Leu
Gly Ala225 230 235 240Asn Asn Ala Val Val Ile Arg Pro Gly Lys Ile
Asp Arg Ser Pro Cys 245 250 255Gly Thr Gly Cys Ser Ala Arg Met Ala
Val Leu Gln Ala Lys Gly Gln 260 265 270Leu Arg Val Gly Glu Arg Phe
Val Gly Arg Ser Ile Ile Gly Ser Glu 275 280 285Phe His Cys His Ile
Glu Ser Leu Thr Glu Leu Gly Gly Arg Pro Ala 290 295 300Ile Leu Pro
Cys Leu Ser Gly Arg Ala Trp Ile Thr Gly Ile His Gln305 310 315
320Tyr Leu Leu Asp Pro Asp Asp Pro Trp Pro Gln Gly Tyr Arg Leu Ser
325 330 335Asp Thr Trp Pro Gly Gly His Cys 34045342PRTBrucella
melitensis 45Met Arg Ser Thr Lys Val Ile His Ile Val Gly Cys His
Ala Glu Gly 1 5 10 15Glu Val Gly Asp Val Ile Val Gly Gly Val Ala
Pro Pro Pro Gly Glu 20 25 30Thr Val Trp Glu Gln Ser Arg Phe Ile Ala
Asn Asp Glu Thr Leu Arg 35 40 45Asn Phe Val Leu Asn Lys Pro Arg Gly
Gly Val Phe Arg His Val Asn 50 55 60Leu Leu Val Pro Pro Lys Asp Pro
Arg Ala Gln Met Gly Phe Ile Ile 65 70 75 80Met Glu Pro Ala Asp Thr
Pro Pro Met Ser Gly Ser Asn Ser Ile Cys 85 90 95Val Ser Thr Val Leu
Leu Asp Ser Gly Ile Ile Ala Met Gln Glu Pro 100 105 110Val Thr His
Met Val Leu Glu Ala Pro Gly Gly Ile Ile Glu Val Glu 115 120 125Ala
Glu Cys Arg Asn Gly Lys Ala Glu Arg Ile Ser Val Arg Asn Val 130 135
140Pro Ser Phe Ala Asp Arg Leu Asp Ala Pro Leu Asp Val Thr Gly
Leu145 150 155 160Gly Thr Ile Met Val Asp Thr Ala Tyr Gly Gly Asp
Ser Phe Val Ile 165 170 175Val Asp Ala Ala Gln Ile Gly Met Lys Ile
Glu Pro Gly Gln Ala Arg 180 185 190Glu Leu Ala Glu Ile Gly Val Lys
Ile Thr Lys Ala Ala Asn Glu Gln 195 200 205Leu Gly Phe Arg His Pro
Glu Arg Asp Trp Arg His Ile Ser Phe Cys 210 215 220Gln Ile Thr Glu
Pro Val Thr Arg Glu Gly Asp Val Leu Thr Gly Val225 230 235 240Asn
Thr Val Ala Ile Arg Pro Ala Lys Phe Asp Arg Ser Pro Thr Gly 245 250
255Thr Gly Cys Ser Ala Arg Met Ala Val Leu His Ala Lys Gly Gln Met
260 265 270Lys Ala Gly Glu Arg Phe Ile Gly Lys Ser Val Leu Gly Thr
Glu Phe 275 280 285His Cys Arg Leu Asp Lys Val Leu Glu Leu Gly Gly
Lys Pro Ala Ile 290 295 300Ser Pro Ile Ile Ser Gly Arg Ala Trp Val
Thr Gly Thr Ser Gln Leu305 310 315 320Met Leu Asp Pro Ser Asp Pro
Phe Pro His Gly Tyr Arg Leu Ser Asp 325 330 335Thr Trp Pro Arg Asp
Glu 34046342PRTAgrobacterium tumefaciens 46Met Arg Ser Ile Lys Thr
Val His Val Ile Ser Ala His Ala Glu Gly 1 5 10 15Glu Val Gly Asp
Val Ile Val Gly Gly Val Lys Pro Pro Pro Gly Glu 20 25 30Thr Ile Trp
Glu Gln Ser Arg Phe Ile Ala Arg Asp Glu Thr Leu Arg 35 40 45Asn Phe
Val Leu Asn Glu Pro Arg Gly Gly Val Phe Arg His Val Asn 50 55 60Leu
Leu Val Pro Pro Lys His Pro Asp Ala Asp Ala Ala Phe Ile Ile 65 70
75 80Met Glu Pro Glu Asp Thr Pro Pro Met Ser Gly Ser Asn Ser Ile
Cys 85 90 95Val Ser Thr Val Leu Leu Asp Gly Gly Ile Val Pro Met Gln
Glu Pro 100 105 110Glu Thr His Met Leu Leu Glu Ala Pro Gly Gly Leu
Val Lys Val Arg 115 120 125Ala Glu Cys Arg Asn Gly Lys Ala Glu Arg
Ile Phe Val Gln Asn Leu 130 135 140Pro Ser Phe Ala Ala Lys Leu Asp
Ala Glu Leu Glu Val Glu Gly Leu145 150 155 160Gly Lys Leu Lys Val
Asp Thr Ala Tyr Gly Gly Asp Ser Phe Val Ile 165 170 175Val Asp Ala
Glu Ala Met Gly Phe Ser Leu Lys Pro Glu Glu Ala His 180 185 190Glu
Ile Ala Arg Leu Gly Val Arg Ile Thr Asn Ala Ala Asn Lys Ala 195 200
205Leu Gly Phe Asp His Pro Glu Asn Pro Asp Trp Arg His Phe Ser Phe
210 215 220Cys Leu Phe Ala Gly Lys Val Glu Arg Thr Ala Glu Gly Leu
Arg Ala225 230 235 240Gly Ala Ala Val Ala Ile Gln Pro Gly Lys Val
Asp Arg Ser Pro Thr 245 250 255Gly Thr Ala Leu Ser Ala Arg Met Ala
Val Leu His Ala Arg Gly Glu 260 265 270Met Lys Glu Gly Glu Thr Leu
Thr Ala Val Ser Leu Ile Gly Ser Thr 275 280 285Phe Thr Gly Arg Ile
Leu Gly Thr Thr Thr Val Gly Asp Arg Pro Ala 290 295 300Ile Leu Pro
Glu Ile Ser Gly Arg Gly Trp Ile Thr Gly Ile His Gln305 310 315
320His Met Leu Asp Pro Ser Asp Pro Trp Pro Glu Gly Tyr Arg Leu Thr
325 330 335Asp Thr Trp Gly Ala Arg 34047342PRTRhizobium meliloti
47Met Arg Ser Thr Lys Thr Ile His Val Ile Ser Ala His Ala Glu Gly 1
5 10 15Glu Val Gly Asp Val Ile Val Gly Gly Val Ala Pro Pro Pro Gly
Asp 20 25 30Thr Ile Trp Glu Gln Ser Arg Trp Ile Ala Arg Glu Gln Thr
Leu Arg 35 40 45Asn Phe Val Leu Asn Glu Pro Arg Gly Gly Val Phe Arg
His Val Asn 50 55 60Leu Leu Val Pro Pro Lys His Pro Asp Ala Asp Ala
Ala Phe Ile Ile 65 70 75 80Met Glu Pro Glu Asp Thr Pro Pro Met Ser
Gly Ser Asn Ser Ile Cys 85 90 95Val Ser Thr Val Leu Leu Asp Ser Gly
Ile Leu Pro Met Lys Glu Pro 100 105 110Val Thr Glu Ile Thr Leu Glu
Ala Pro Gly Gly Leu Val Arg Val Arg 115 120 125Ala Glu Cys Arg Asp
Gly Lys Ala Glu Arg Ile Phe Val Glu Asn Leu 130 135 140Pro Ser Phe
Ala Glu Arg Leu Asp Ala Lys Leu Glu Val Glu Gly Leu145 150 155
160Gly Thr Leu Thr Val Asp Thr Ala Tyr Gly Gly Asp Ser Phe Val Ile
165 170 175Val Asp Ala Ala Ala Met Gly Phe Ala Leu Lys Pro Asp Glu
Ala His 180 185 190Asp Ile Ala Arg Leu Gly Val Arg Ile Thr Asn Ala
Ala Asn Ala Lys 195 200 205Leu Gly Phe His His Pro Glu Asn Pro Asp
Trp Arg His Phe Ser Phe 210 215 220Cys Leu Phe Ala Gly Pro Val Glu
Arg Thr Ala Glu
Gly Leu Arg Ala225 230 235 240Gly Ala Ala Val Ala Ile Gln Pro Gly
Lys Val Asp Arg Ser Pro Thr 245 250 255Gly Thr Ala Leu Ser Ala Arg
Met Ala Val Leu His Ala Arg Gly Gln 260 265 270Met Gly Leu Ser Asp
Arg Leu Thr Ala Val Ser Leu Ile Gly Ser Thr 275 280 285Phe Ser Gly
Arg Ile Leu Gly Thr Thr Glu Val Gly Gly Arg Pro Ala 290 295 300Val
Leu Pro Glu Ile Ser Gly Arg Ala Trp Ile Thr Gly Thr His Gln305 310
315 320His Met Leu Asp Pro Ser Asp Pro Trp Pro Glu Gly Tyr Arg Leu
Thr 325 330 335Asp Thr Trp Gly Ala Arg 34048346PRTRhizobium loti
48Met Arg Ser Lys Thr Ser Ile Arg Val Val Gly Cys His Ala Glu Gly 1
5 10 15Glu Val Gly Asp Val Ile Ile Gly Gly Val Leu Pro Pro Ala Gly
Arg 20 25 30Thr Met Met Asp Lys Met Ile Thr Met Glu Arg Asp His Asp
His Ile 35 40 45Arg Arg Met Leu Ile Cys Glu Pro Arg Gly Ser Val Ala
Arg His Val 50 55 60Asn Leu Leu Val Pro Ser Thr Arg Glu Asp Cys Ala
Ala Gly Ala Ile 65 70 75 80Ile Met Glu Pro Thr Glu Tyr Pro Pro Met
Ser Gly Ser Asn Thr Ile 85 90 95Cys Val Ala Thr Val Leu Leu Glu Thr
Gly Met Val Pro Met Gln Glu 100 105 110Pro Glu Thr Arg Phe Lys Leu
Asp Met Pro Gly Gly Val Ile Glu Val 115 120 125Arg Ala Gln Cys Arg
Asp Gly Lys Cys Val Ser Ile Thr Leu Arg Asn 130 135 140Ala Pro Ala
Phe Val Asp Arg Leu Asp Ala Ser Ile Glu Val Glu Gly145 150 155
160Leu Gly Thr Leu Thr Val Asp Ile Ala Tyr Gly Gly Met Phe Tyr Ala
165 170 175Ile Val Asp Ala Lys Ala Leu Gly Phe Ser Ile Ala Pro Asp
Glu Ala 180 185 190Arg Glu Leu Ala Val Ala Gly Glu Lys Ile Arg Arg
Ala Ala Arg Glu 195 200 205Gln Leu Asp Val Val His Pro Gln Phe Asp
His Val Arg Gly Val Ser 210 215 220Ile Val Gln Phe Ala Met Pro Phe
Gln Gly Pro Gly Asn Val Thr Arg225 230 235 240Asn Thr Cys Ile Val
Ser Pro Gly Arg Ser Asp Arg Ser Pro Thr Gly 245 250 255Thr Gly Thr
Ser Ala Arg Met Ala Val Leu Gln Ala Arg Gly Leu Met 260 265 270Gly
Val Gly Asp Val Leu Ile His Glu Ser Ile Ile Gly Ser Arg Phe 275 280
285Thr Gly Arg Ile Val Glu Leu Ala Glu Ile Ala Gly Arg Lys Ala Ile
290 295 300Val Pro Glu Ile Thr Gly Arg Ala Trp Ile Thr Gly Glu His
Ser Tyr305 310 315 320Tyr Leu Asp Pro Thr Asp Pro Tyr Pro Gln Gly
Tyr Val Leu Ser Asp 325 330 335Thr Trp Gly Thr Ser Thr Ser Val Lys
Gln 340 34549339PRTXanthomonas axonopodis 49Met Arg Trp Ser Lys Gln
Phe Ser Val Val Asp Cys His Ala Glu Gly 1 5 10 15Glu Val Gly Lys
Val Ile Val Gly Gly Val Gly Asn Ile Pro Gly Thr 20 25 30Thr Met Phe
Glu Lys Lys Leu Tyr Leu Glu Gln His Arg Asp Asp Ile 35 40 45Arg Lys
Leu Val Leu Gln Glu Pro Arg Gly Ala Thr Trp His Asn Ala 50 55 60Asn
Ile Ile Leu Pro Pro Ser His Pro Glu Ala Ser Met Gly Phe Val 65 70
75 80Ile Leu Glu Ala Thr Glu Tyr Pro Ala Met Ser Gly Ser Asn Thr
Ile 85 90 95Cys Val Ala Thr Val Leu Leu Glu Thr Gly Ile Leu Pro Met
Gln Glu 100 105 110Pro Ile Thr Asp Leu Val Leu Glu Ala Pro Ala Gly
Leu Ile Arg Val 115 120 125Arg Cys Asp Cys Lys Asp Gly Lys Val Thr
Arg Val Lys Leu Val Asn 130 135 140Gln Pro Ala Phe Val Tyr His Leu
Asp Ala Lys Val Glu Val Ala Gly145 150 155 160Ile Gly Thr Val Ser
Ala Asp Ile Ala Phe Gly Gly Met Thr Phe Ala 165 170 175Leu Val Asp
Ala Ser Ser Leu Gly Phe Glu Ile Val Pro Ala Glu Ala 180 185 190Arg
Glu Leu Cys Glu Tyr Gly Gln Lys Ile Lys Ala Ala Ala Ala Glu 195 200
205Gln Leu Asp Val Ala Phe Pro Gly Asn Pro Asp Met Pro Gly Ile Thr
210 215 220Met Thr Gln Phe Thr Gly Pro Leu Ser Arg Ala Asp Gly Lys
Phe Phe225 230 235 240Ser Arg Asn Thr Thr Ile Val Ser Pro Gly Arg
Cys Asp Arg Ser Pro 245 250 255Cys Gly Ala Gly Ser Ser Ala Arg Leu
Ala Ala Leu His Ala Lys Gly 260 265 270Val Leu Ala Lys Gly Asp Thr
Leu Val His Glu Ser Ile Ile Gly Ser 275 280 285Arg Phe Glu Cys Gly
Ile Glu Asp Met Ser Asn Val Gly Asp Tyr Pro 290 295 300Ala Val Val
Pro Ser Ile Ala Gly Gln Ala Trp Ile Ser Gly Leu Ser305 310 315
320Gln Leu Gly Leu Asp Pro Ser Asp Pro Tyr Ala Glu Gly Phe Thr Leu
325 330 335Ala Asp Arg50333PRTStreptomyces coelicolor 50Met Arg Ser
Thr Val Cys Tyr His Ala Val Asp Ser His Thr Glu Gly 1 5 10 15Met
Pro Thr Arg Val Ile Thr Gly Gly Val Gly Val Leu Pro Gly Ala 20 25
30Thr Met Phe Glu Arg Arg Gln Arg Phe Val Ala Glu Arg Asp His Leu
35 40 45Arg Thr Leu Leu Met Cys Glu Pro Arg Gly His Ala Ser Met Ser
Gly 50 55 60Ala Ile Leu Gln Pro Pro Thr Arg Pro Asp Ala Asp Tyr Gly
Val Leu 65 70 75 80Phe Ile Glu Val Ser Gly Cys Leu Pro Met Cys Gly
His Gly Thr Ile 85 90 95Gly Val Ala Thr Val Leu Val Glu Thr Gly Met
Val Glu Val Thr Glu 100 105 110Pro Glu Thr Thr Val Arg Leu Asp Thr
Pro Ala Gly Leu Val Thr Ala 115 120 125Arg Val Arg Val Arg Asp Gly
His Ala Glu Ser Val Thr Leu Glu Asn 130 135 140Val Ala Ser Tyr Ser
His Ala Leu Asp Gln Val Val Asp Val Pro Gly145 150 155 160His Gly
Glu Val Arg Tyr Asp Ile Ala Tyr Gly Gly Asn Phe Tyr Ala 165 170
175Phe Val Arg Thr Asp Asp Leu Gly Ile Pro Phe Glu Arg Ala His Lys
180 185 190Gln Pro Leu Leu Asp Ala Gly Leu Ala Val Met Asp Ala Ile
Asn Lys 195 200 205Gln Asn Pro Val Ser His Pro Glu Asn Pro Asp Ile
Asp Val Cys His 210 215 220His Val Tyr Leu Glu Ala Pro Gly Ser Thr
Ala Glu His Ser Arg His225 230 235 240Ala Met Ala Ile His Pro Gly
Trp Phe Asp Arg Ser Pro Cys Gly Thr 245 250 255Gly Thr Ser Ala Arg
Met Ala Gln Leu His Ala Arg Gly Leu Leu Pro 260 265 270Ala Gly Arg
Asp Phe Val Asn Glu Ser Phe Ile Gly Ser Arg Phe Val 275 280 285Gly
Arg Val Leu Gly Glu Thr Thr Val Gly Gly Arg Pro Ala Val Leu 290 295
300Pro Ser Val Thr Gly Arg Ala Trp Ile Thr Gly Thr Ala Gln Tyr
Leu305 310 315 320Leu Asp Pro Ser Asp Pro Tyr Pro Ala Gly Phe Thr
Leu 325 33051345PRTAgrobacterium tumefaciens 51Met Arg Trp Lys Arg
Thr Leu Gln Leu Leu Asp Val His Cys Glu Gly 1 5 10 15Glu Ile Gly
Arg Val Val Thr Gly Gly Ala Pro Lys Ile Pro Gly Asn 20 25 30Thr Val
Ala Glu Gln Leu His Trp Met Asn Thr Asp Pro Gln Gly Glu 35 40 45Ala
Leu Arg Arg Phe Leu Thr Leu Glu Pro Arg Gly Thr Pro Met Gly 50 55
60Ser Val Asp Leu Leu Leu Pro Pro Lys His Pro Asp Ala His Ala Ala
65 70 75 80Phe Val Ile Leu Gln Pro Asp Gln Ala His Ala Ser Ser Gly
Ser Asn 85 90 95Ser Ile Cys Ala Thr Thr Ala Leu Leu Glu Ser Gly Met
Val Glu Met 100 105 110Gln Glu Pro Glu Thr Val Ile Ile Leu Glu Thr
Ala Ala Gly Leu Val 115 120 125Lys Ala Thr Ala Thr Cys Arg Asp Gly
Arg Cys Glu Lys Val Lys Leu 130 135 140Thr Met Val Pro Ser Phe Val
His Glu Leu Asp Val Ser Ile Asp Thr145 150 155 160Pro Glu Trp Gly
Arg Val Thr Met Asp Ile Ser Tyr Gly Gly Ile Phe 165 170 175Tyr Ala
Leu Val Asp Val Arg Gln Ile Gly Leu Thr Ile Glu Lys Ala 180 185
190Asn Ala Ala Lys Leu Val Ala Ala Gly Met Thr Leu Lys Asp Leu Val
195 200 205Asn Arg Glu Met Thr Val Val His Pro Glu Ile Pro Ala Ile
Ser Gly 210 215 220Val Ala Tyr Val Met Phe Arg Asp Val Asp Ala Asp
Gly Ser Ile Arg225 230 235 240Thr Cys Thr Thr Met Trp Pro Gly Arg
Ala Asp Arg Ser Pro Cys Gly 245 250 255Thr Gly Asn Ser Ala Asn Leu
Ala Thr Leu Tyr Ala Arg Gly Lys Val 260 265 270Lys Val Gly Asp Glu
Tyr Lys Ser Arg Ser Ile Ile Gly Ser Glu Phe 275 280 285Asp Val Gly
Leu Ser Ala Val Thr Glu Val Ala Gly Arg Pro Ala Val 290 295 300Ile
Pro Thr Ile Ala Gly Arg Gly Phe Thr Phe Gly Leu His Gln Val305 310
315 320Gly Leu Asp Pro Phe Asp Pro Leu Gly Asp Gly Phe Ala Met Thr
Asp 325 330 335Val Trp Gly Pro Glu Ala Gly Asn Ile 340
34552354PRTTrypanosoma cruzi 52Met Arg Phe Lys Lys Ser Leu Thr Cys
Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile Val Thr
Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu Lys Lys
Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly Ile Met
Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe Leu Phe
Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val 65 70 75 80Phe Met
Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile 85 90 95Ala
Ala Val Thr Ala Ala Val Glu Thr Gly Ile Leu Ser Val Pro Ala 100 105
110Lys Ala Thr Asn Val Pro Val Val Leu Asp Thr Pro Ala Gly Leu Val
115 120 125Arg Gly Thr Ala His Leu Gln Ser Gly Thr Glu Ser Glu Val
Ser Asn 130 135 140Ala Ser Ile Ile Asn Val Pro Ser Phe Leu Tyr Gln
Gln Asp Val Val145 150 155 160Ile Val Leu Pro Lys Pro Tyr Gly Glu
Val Arg Val Asp Ile Ala Phe 165 170 175Gly Gly Asn Phe Phe Ala Ile
Val Pro Ala Glu His Leu Gly Ile Asp 180 185 190Ile Ser Val Gln Asn
Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu 195 200 205Arg Thr Glu
Ile Asn Arg Ser Val Lys Val Gln His Pro Gln Leu Pro 210 215 220His
Ile Asn Thr Val Asp Cys Val Glu Ile Tyr Gly Pro Pro Thr Asn225 230
235 240Pro Glu Ala Lys Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln
Ala 245 250 255Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met
Ala Thr Leu 260 265 270Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr
Phe Val Tyr Glu Ser 275 280 285Ile Leu Gly Ser Leu Phe Gln Gly Arg
Val Leu Gly Glu Glu Arg Ile 290 295 300Pro Gly Val Lys Val Pro Val
Thr Lys Asp Ala Glu Glu Gly Met Leu305 310 315 320Val Val Thr Thr
Glu Ile Thr Gly Lys Ala Phe Ile Met Gly Phe Asn 325 330 335Thr Met
Leu Phe Asp Pro Thr Asp Pro Phe Leu Asn Gly Phe Thr Leu 340 345
350Lys Arg5315DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 53tct cca tgt ggg aca 15Ser Pro
Cys Gly Thr 1 5545PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 54Ser Pro Cys Gly Thr 1
55515DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 55tct cca agc ggg aca 15Ser Pro Ser Gly
Thr 1 5565PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 56Ser Pro Ser Gly Thr 1 557146PRTTrypanosoma
cruzi 57Gly Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala
Ile 1 5 10 15Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln
Asn Leu Ser 20 25 30Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu
Ile Asn Arg Ser 35 40 45Val Lys Val Gln His Pro Gln Leu Pro His Ile
Asn Thr Val Asp Cys 50 55 60Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro
Glu Ala Asn Tyr Lys Asn 65 70 75 80Val Val Ile Phe Gly Asn Arg Gln
Ala Asp Arg Ser Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Lys Met Ala
Thr Leu Tyr Ala Lys Gly Gln Leu Arg 100 105 110Ile Gly Glu Thr Phe
Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln 115 120 125Gly Arg Val
Leu Gly Glu Glu Arg Ile Pro Gly Val Lys Val Pro Val 130 135 140Thr
Lys14558146PRTBacillus anthracis 58Gly Thr Val Glu Ala Asp Ile Ala
Tyr Gly Gly Asn Phe Tyr Ala Ile 1 5 10 15Ile Asp Ala Lys Ser Val
Gly Leu Glu Leu Val Pro Glu His Ala Ser 20 25 30Thr Ile Ile Asp Lys
Ala Ile His Ile Arg Asn Ile Ile Asn Glu Arg 35 40 45Phe Glu Ile Ile
His Pro Glu Tyr Ser Phe Ile Arg Gly Leu Thr His 50 55 60Val Glu Phe
Tyr Thr Asp Pro Thr His Glu Ser Ala His Val Lys Asn 65 70 75 80Thr
Val Val Val Pro Pro Gly Gly Ile Asp Arg Ser Pro Cys Gly Thr 85 90
95Gly Thr Ser Ala Lys Leu Ala Val Leu Tyr Ala Asn Gln Lys Ile Glu
100 105 110Met Asn Glu Glu Phe Val His Glu Ser Ile Val Gly Ser Leu
Phe Lys 115 120 125Gly Cys Val Ile Asn Thr Thr Asn Val Ala Asn Met
Glu Ala Val Val 130 135 140Thr Lys14559117PRTTrypanosoma cruzi
59Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly 1
5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly
Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp
Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp
Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp
Leu Gly Met Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met
Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr
Gly Ile Val Ser Val Pro Ala 100 105 110Lys Ala Thr Asn Val
11560117PRTBacillus anthracis 60Met Arg Thr Gln Lys Val Phe Thr Thr
Ile Asp Thr His Thr Gly Gly 1 5 10 15Asn Pro Thr Arg Thr Leu Ile
Ser Gly Leu Pro Lys Leu Leu Gly Glu 20 25 30Thr Met Ala Glu Lys Met
Leu His Met Lys Lys Glu Tyr Asp Trp Ile 35 40 45Arg Lys Leu Leu Met
Asn Glu Pro Arg Gly His Asp Val Met Ser Gly 50 55 60Ala Leu Leu Thr
Asp Pro Cys His Pro Asp Ala Asp Ile Gly Val Ile 65 70 75 80Tyr Ile
Glu Thr Gly Gly Tyr Leu Pro Met Cys Gly His Asp Thr Ile 85 90 95Gly
Val Cys Thr Ala Leu Ile Glu Ser Gly Leu Ile Pro Val Val Glu 100 105
110Pro
Ile Thr Ser Leu 11561145PRTTrypanosoma cruzi 61Glu Val Arg Val Asp
Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile Val 1 5 10 15Pro Ala Glu
Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser Arg 20 25 30Leu Gln
Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser Val 35 40 45Lys
Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys Val 50 55
60Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val
65 70 75 80Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly
Thr Gly 85 90 95Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly Gln
Leu Arg Ile 100 105 110Gly Glu Thr Phe Val Tyr Glu Ser Ile Leu Gly
Ser Leu Phe Gln Gly 115 120 125Arg Val Leu Gly Glu Glu Arg Ile Pro
Gly Val Lys Val Pro Val Thr 130 135 140Lys14562145PRTBacillus
anthracis 62Glu Phe Gln Val Asp Ile Ala Phe Gly Gly Ala Phe Tyr Ala
Val Val 1 5 10 15Asp Ser Lys Glu Phe Gly Leu Lys Val Asp Phe Lys
Asp Leu Ser Ala 20 25 30Ile Gln Gln Trp Gly Gly Lys Ile Lys His Tyr
Ile Glu Ser Lys Met 35 40 45Glu Val Lys His Pro Leu Glu Glu Gly Leu
Lys Gly Ile Tyr Gly Val 50 55 60Ile Phe Ser Asp Asp Pro Lys Gly Glu
Gly Ala Thr Leu Arg Asn Val 65 70 75 80Thr Ile Phe Ala Asp Gly Gln
Val Asp Arg Ser Pro Cys Gly Thr Gly 85 90 95Thr Ser Ala Arg Ile Ala
Thr Leu Phe Glu Lys Gly Ile Leu Gln Lys 100 105 110Gly Glu Ile Phe
Ile His Glu Cys Ile Thr Asp Gly Glu Phe Glu Gly 115 120 125Glu Val
Leu Ser Val Thr Ala Val His Thr Tyr Glu Ala Val Val Pro 130 135
140Lys14563113PRTTrypanosoma cruzi 63Met Arg Phe Lys Lys Ser Phe
Thr Cys Ile Asp Met His Thr Glu Gly 1 5 10 15Glu Ala Ala Arg Ile
Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser 20 25 30Asn Met Ala Glu
Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu 35 40 45Arg Arg Gly
Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly 50 55 60Ala Phe
Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val 65 70 75
80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile
85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro
Ala 100 105 110Lys64113PRTBacillus anthracis 64Met Lys Val Ser Lys
Val Tyr Thr Thr Ile Asp Ala His Val Ala Gly 1 5 10 15Glu Pro Leu
Arg Ile Ile Thr Gly Gly Val Pro Glu Ile Lys Gly Glu 20 25 30Thr Gln
Leu Glu Arg Arg Trp Tyr Cys Met Glu His Leu Asp Tyr Leu 35 40 45Arg
Glu Val Leu Met Tyr Glu Pro Arg Gly His His Gly Met Tyr Gly 50 55
60Cys Ile Ile Thr Pro Pro Ala Ser Ala His Ala Asp Phe Gly Val Leu
65 70 75 80Phe Met His Asn Glu Gly Trp Ser Thr Met Cys Gly His Gly
Ile Ile 85 90 95Ala Val Ile Thr Val Gly Ile Glu Thr Gly Met Phe Glu
Thr Lys Gln 100 105 110Lys65138PRTTrypanosoma cruzi 65Tyr Gly Glu
Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala 1 5 10 15Ile
Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu 20 25
30Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg
35 40 45Ser Val Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val
Asp 50 55 60Cys Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn
Tyr Lys 65 70 75 80Asn Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg
Ser Pro Cys Gly 85 90 95Thr Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr
Ala Lys Gly Gln Leu 100 105 110Arg Ile Gly Glu Thr Phe Val Tyr Glu
Ser Ile Leu Gly Ser Leu Phe 115 120 125Gln Gly Arg Val Leu Gly Glu
Glu Arg Ile 130 13566138PRTClostridium botulinum 66Tyr Gly Lys Leu
Thr Leu Asp Ile Ser Phe Gly Gly Ser Phe Phe Ala 1 5 10 15Met Val
Asp Ala Glu Lys Val Gly Ile Asp Ile Ser Pro Ala Asn Ser 20 25 30Gln
Lys Leu Asn Asp Leu Gly Met Lys Ile Val His Ala Val Asn Glu 35 40
45Gln Val Glu Ile Lys His Pro Val Leu Glu His Ile Lys Thr Val Asp
50 55 60Leu Cys Glu Phe Tyr Gly Pro Ala Lys Ser Glu Asp Ala Asp Val
Gln 65 70 75 80Asn Val Val Val Phe Gly Gln Gly Gln Val Asp Arg Ser
Pro Cys Gly 85 90 95Thr Gly Thr Ser Ala Lys Met Ala Leu Leu Tyr Ala
Gln Gly Lys Met 100 105 110Lys Val Gly Glu Glu Ile Val Asn Glu Ser
Ile Ile Cys Thr Lys Phe 115 120 125Lys Gly Lys Ile Leu Glu Glu Thr
Lys Val 130 13567118PRTTrypanosoma cruzi 67Ile Met Arg Phe Lys Lys
Ser Phe Thr Cys Ile Asp Met His Thr Glu 1 5 10 15Gly Glu Ala Ala
Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly 20 25 30Ser Asn Met
Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr 35 40 45Leu Arg
Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe 50 55 60Gly
Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met 65 70
75 80Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn
Ser 85 90 95Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser
Val Pro 100 105 110Ala Lys Ala Thr Asn Val 11568118PRTClostridium
botulinum 68Ile Met Arg Ala Ile Lys Thr Ile Gln Thr Ile Glu Ser His
Thr Met 1 5 10 15Gly Glu Pro Thr Arg Ile Val Ile Gly Gly Leu Pro
Lys Val Pro Gly 20 25 30Lys Thr Met Ala Glu Lys Met Glu Tyr Leu Glu
Glu Asn Asn Asp Ser 35 40 45Leu Arg Thr Met Leu Met Ser Glu Pro Arg
Gly His Asn Asp Met Phe 50 55 60Gly Ala Ile Tyr Thr Glu Pro Ala Asp
Glu Thr Ala Asp Leu Gly Ile 65 70 75 80Ile Phe Met Asp Gly Gly Gly
Tyr Leu Asn Met Cys Gly His Gly Ser 85 90 95Ile Gly Ala Ala Thr Cys
Ala Val Glu Met Gly Ile Val Lys Val Glu 100 105 110Glu Pro Tyr Thr
Asn Ile 11569224PRTTrypanosoma cruzi 69Ala Asp Leu Gly Ile Val Phe
Met Asp Thr Gly Gly Tyr Leu Asn Met 1 5 10 15Cys Gly His Asn Ser
Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly 20 25 30Ile Leu Ser Val
Pro Ala Lys Ala Thr Asn Val Pro Val Val Leu Asp 35 40 45Thr Pro Ala
Gly Leu Val Arg Gly Thr Ala His Leu Gln Ser Gly Thr 50 55 60Glu Ser
Glu Val Ser Asn Ala Ser Ile Ile Asn Val Pro Ser Phe Leu 65 70 75
80Tyr Gln Gln Asp Val Val Ile Val Leu Pro Lys Pro Tyr Gly Glu Val
85 90 95Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile Val Pro
Ala 100 105 110Glu His Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser
Arg Leu Gln 115 120 125Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn
Arg Ser Val Lys Val 130 135 140Gln His Pro Gln Leu Pro His Ile Asn
Thr Val Asp Cys Val Glu Ile145 150 155 160Tyr Gly Asn Ala Thr Asn
Pro Glu Ala Lys Tyr Lys Asn Val Val Ile 165 170 175Phe Gly Asn Arg
Gln Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser 180 185 190Ala Lys
Met Ala Thr Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu 195 200
205Thr Phe Val Tyr Glu Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val
210 215 22070218PRTClostridium botulinum 70Ala Asp Leu Gly Ile Ile
Phe Met Asp Gly Gly Gly Tyr Leu Asn Met 1 5 10 15Cys Gly His Gly
Ser Ile Gly Ala Ala Thr Cys Ala Val Glu Met Gly 20 25 30Ile Val Lys
Val Glu Glu Pro Tyr Thr Asn Ile Lys Leu Glu Ala Pro 35 40 45Ala Gly
Met Ile Asn Ala Arg Val Lys Val Glu Asp Gly Lys Ala Lys 50 55 60Glu
Thr Ser Ile Val Asn Val Pro Ala Phe Leu Tyr Lys Lys Asp Val 65 70
75 80Glu Ile Asp Val Pro Asp Tyr Gly Lys Leu Thr Leu Asp Ile Ser
Phe 85 90 95Gly Gly Ser Phe Phe Ala Met Val Asp Ala Glu Lys Val Gly
Ile Asp 100 105 110Ile Ser Pro Ala Asn Ser Gln Lys Leu Asn Asp Leu
Gly Met Lys Ile 115 120 125Val His Ala Val Asn Glu Gln Val Glu Ile
Lys His Pro Val Leu Glu 130 135 140His Ile Lys Thr Val Asp Leu Cys
Glu Phe Tyr Gly Pro Ala Lys Ser145 150 155 160Glu Asp Ala Asp Val
Gln Asn Val Val Val Phe Gly Gln Gly Gln Val 165 170 175Asp Arg Ser
Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Leu Leu 180 185 190Tyr
Ala Gln Gly Lys Met Lys Val Gly Glu Glu Ile Val Asn Glu Ser 195 200
205Ile Ile Cys Thr Lys Phe Lys Gly Lys Ile 210
2157172PRTTrypanosoma cruzi 71Pro Thr Asn Pro Glu Ala Asn Tyr Lys
Asn Val Val Ile Phe Gly Asn 1 5 10 15Arg Gln Ala Asp Arg Ser Pro
Cys Gly Thr Gly Thr Ser Ala Lys Met 20 25 30Ala Thr Leu Tyr Ala Lys
Gly Gln Leu Arg Ile Gly Glu Thr Phe Val 35 40 45Tyr Glu Ser Ile Leu
Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu 50 55 60Glu Arg Ile Pro
Gly Val Lys Val 65 707272PRTAspergillus fumigatus 72Pro Asp Asp Val
Gln Gly Ala Glu Thr Gly Leu Cys Tyr Phe Ala Glu 1 5 10 15Asn Gln
Ile Asp Arg Ser Pro Thr Gly Ser Cys Val Ile Ala Arg Met 20 25 30Ala
Leu Ala Tyr Ala Lys Gly Leu Arg Ser Leu Gly Gln Arg Trp Ala 35 40
45Tyr Asn Ser Leu Val Ser Asn Arg Phe Gly Thr Gly Ala Phe Ser Ala
50 55 60Glu Ile Val Glu Glu Val Thr Ile 65 707334PRTTrypanosoma
cruzi 73Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu
Arg 1 5 10 15Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp Met
Phe Gly Ala 20 25 30Phe Leu7434PRTAspergillus fumigatus 74Leu Leu
Glu Gln Arg Asp Gln Ala Lys Gln His His Asp His Ile Arg 1 5 10
15Lys Cys Leu Met Leu Glu Pro Arg Gly His Asn Gly Met Tyr Gly Ala
20 25 30Ile Ile7529PRTTrypanosoma cruzi 75Cys Ile Asp Met His Thr
Glu Gly Glu Ala Ala Arg Ile Val Thr Ser 1 5 10 15Gly Leu Pro His
Ile Pro Gly Ser Asn Met Ala Glu Lys 20 257629PRTAspergillus
fumigatus 76Cys Ile Asp Met His Thr Thr Gly Glu Pro Thr Arg Ile Ile
Tyr Ser 1 5 10 15Gly Phe Pro Pro Leu Ser Gly Thr Leu Leu Glu Gln
Arg 20 257727PRTTrypanosoma cruzi 77Val Asp Ile Ala Phe Gly Gly Asn
Phe Phe Ala Ile Val Pro Ala Glu 1 5 10 15Gln Leu Gly Ile Asp Ile
Ser Val Gln Asn Leu 20 257827PRTAspergillus fumigatus 78Leu Asp Ile
Ser Tyr Gly Gly Ala Phe Tyr Ala Ile Val Gln Ala Ser 1 5 10 15Glu
Leu Gly Phe Ser Gly Gly Leu Arg Asp Leu 20 257920PRTTrypanosoma
cruzi 79Ser Ser Ile Gly Ser Asn Lys Lys Ala Pro Asn Ile Ser Ser Pro
Arg 1 5 10 15Gly Ser Ser Ile 208020PRTAspergillus fumigatus 80Ser
Ser Val Ser Gly Arg Met Met Ala Pro Tyr Ile Pro Leu Pro Arg 1 5 10
15Gly Ser Ser Ile 2081146PRTTrypanosoma cruzi 81Gly Glu Val Arg Val
Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile 1 5 10 15Val Pro Ala
Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser 20 25 30Arg Leu
Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser 35 40 45Val
Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys 50 55
60Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn
65 70 75 80Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys
Gly Thr 85 90 95Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala Lys Gly
Gln Leu Arg 100 105 110Ile Gly Glu Thr Phe Val Tyr Glu Ser Ile Leu
Gly Ser Leu Phe Gln 115 120 125Gly Arg Val Leu Gly Glu Glu Arg Ile
Pro Gly Val Lys Val Pro Val 130 135 140Thr
Lys14582146PRTClostridium difficile 82Gly Thr Val Lys Phe Asp Ile
Ser Phe Gly Gly Ser Phe Phe Ala Ile 1 5 10 15Ile His Ala Ser Gln
Leu Gly Leu Lys Ile Glu Pro Gln Asn Ala Gly 20 25 30Lys Leu Thr Glu
Leu Ala Met Lys Leu Arg Asp Ile Ile Asn Glu Lys 35 40 45Ile Glu Ile
Gln His Pro Thr Leu Ala His Ile Lys Thr Val Asp Leu 50 55 60Val Glu
Ile Tyr Asp Glu Pro Thr His Pro Glu Ala Thr Tyr Lys Asn 65 70 75
80Val Val Ile Phe Gly Gln Gly Gln Val Asp Arg Ser Pro Cys Gly Thr
85 90 95Gly Thr Ser Ala Lys Leu Ala Thr Leu His Ala Lys Gly Glu Leu
Lys 100 105 110Val Gly Glu Lys Phe Val Tyr Glu Ser Ile Leu Gly Thr
Leu Phe Lys 115 120 125Gly Glu Ile Val Glu Glu Thr Lys Val Ala Asp
Phe Asn Ala Val Val 130 135 140Pro Lys14583117PRTTrypanosoma cruzi
83Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly 1
5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly
Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp
Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp
Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp
Leu Gly Met Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met
Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr
Gly Ile Val Ser Val Pro Ala 100 105 110Lys Ala Thr Asn Val
11584117PRTClostridium difficile 84Met Lys Phe Ser Arg Ser Ile Gln
Ala Ile Asp Ser His Thr Ala Gly 1 5 10 15Glu Ala Thr Arg Ile Val
Val Gly Gly Ile Pro Asn Ile Lys Gly Asn 20 25 30Ser Met Pro Glu Lys
Lys Glu Tyr Leu Glu Glu Asn Leu Asp Tyr Leu 35 40 45Arg Thr Ala Ile
Met Leu Glu Pro Arg Gly His Asn Asp Met Phe Gly 50 55 60Ser Val Met
Thr Gln Pro Cys Cys Pro Asp Ala Asp Phe Gly Ile Ile 65 70 75 80Phe
Met Asp Gly Gly Gly Tyr Leu Asn Met Cys Gly His Gly Thr Ile 85 90
95Gly Ala Met Thr Ala Ala Ile Glu Thr Gly Val Val Pro Ala Val Glu
100 105 110Pro Val Thr His Val 11585139PRTTrypanosoma cruzi 85Gly
Glu Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile 1 5 10
15Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser
20 25
30Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser
35 40 45Val Lys Val Gln His Pro Gln Leu Pro His Ile Asn Thr Val Asp
Cys 50 55 60Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr
Lys Asn 65 70 75 80Val Val Ile Phe Gly Asn Arg Gln Ala Asp Arg Ser
Pro Cys Gly Thr 85 90 95Gly Thr Ser Ala Lys Met Ala Thr Leu Tyr Ala
Lys Gly Gln Leu Arg 100 105 110Ile Gly Glu Thr Phe Val Tyr Glu Ser
Ile Leu Gly Ser Leu Phe Gln 115 120 125Gly Arg Val Leu Gly Glu Glu
Arg Ile Pro Gly 130 13586139PRTBrucella suis 86Gly Pro Ile Lys Val
Asp Val Ala Tyr Gly Gly Asn Phe Tyr Ala Ile 1 5 10 15Val Glu Pro
Gln Glu Asn Tyr Thr Asp Met Asp Asp Tyr Ser Ala Leu 20 25 30Gln Leu
Ile Ala Trp Ser Pro Val Leu Arg Gln Arg Leu Asn Glu Lys 35 40 45Tyr
Lys Phe Gln His Pro Glu Leu Pro Asp Ile Asn Arg Leu Ser His 50 55
60Ile Leu Trp Thr Gly Lys Pro Lys His Pro Gln Ala His Ala Arg Asn
65 70 75 80Ala Val Phe Tyr Gly Asp Lys Ala Ile Asp Arg Ser Pro Cys
Gly Thr 85 90 95Gly Thr Ser Ala Arg Met Ala Gln Leu Ala Ala Lys Gly
Lys Leu Lys 100 105 110Pro Gly Asp Glu Phe Ile His Glu Ser Ile Ile
Gly Ser Leu Phe His 115 120 125Gly Arg Val Glu Arg Ala Ala Glu Val
Ala Gly 130 13587106PRTTrypanosoma cruzi 87Lys Lys Ser Phe Thr Cys
Ile Asp Met His Thr Glu Gly Glu Ala Ala 1 5 10 15Arg Ile Val Thr
Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala 20 25 30Glu Lys Lys
Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly 35 40 45Ile Met
Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu 50 55 60Phe
Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val Phe Met Asp 65 70
75 80Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala
Val 85 90 95Thr Ala Ala Val Glu Thr Gly Ile Val Ser 100
10588106PRTBrucella suis 88Arg His Ser Phe Phe Cys Val Asp Gly His
Thr Cys Gly Asn Pro Val 1 5 10 15Arg Leu Val Ala Gly Gly Gly Pro
Asn Leu Asn Gly Ser Thr Met Met 20 25 30Glu Lys Arg Ala His Phe Leu
Ala Glu Tyr Asp Trp Ile Arg Thr Gly 35 40 45Leu Met Phe Glu Pro Arg
Gly His Asp Met Met Ser Gly Ser Ile Leu 50 55 60Tyr Pro Pro Thr Arg
Pro Asp Cys Asp Val Ala Val Leu Phe Ile Glu 65 70 75 80Thr Ser Gly
Cys Leu Pro Met Cys Gly His Gly Thr Ile Gly Thr Val 85 90 95Thr Met
Ala Ile Glu Gln Gly Leu Val Thr 100 10589109PRTTrypanosoma cruzi
89Met Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly 1
5 10 15Glu Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro Gly
Ser 20 25 30Asn Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp
Tyr Leu 35 40 45Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp
Met Phe Gly 50 55 60Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp
Leu Gly Met Val 65 70 75 80Phe Met Asp Thr Gly Gly Tyr Leu Asn Met
Cys Gly His Asn Ser Ile 85 90 95Ala Ala Val Thr Ala Ala Val Glu Thr
Gly Ile Val Ser 100 10590109PRTRhodobacter sphaeroides 90Met Arg
Val Gln Asp Val Tyr Asn Val Ile Tyr Thr His Thr Glu Gly 1 5 10
15Glu Pro Leu Cys Ile Ile Tyr Ser Gly Val Pro Tyr Pro Ala Gly Ser
20 25 30Thr Ile Leu Glu Lys Arg Ala Phe Leu Glu Glu Asn Tyr Asp Trp
Leu 35 40 45Arg Lys Ala Leu Met Arg Glu Pro Arg Gly His Ala Asp Met
Phe Gly 50 55 60Val Phe Leu Thr Pro Pro Ser Ser Arg Asp Tyr Asp Ala
Gly Leu Ile 65 70 75 80Tyr Ile Asp Gly Lys Glu Tyr Ser His Met Cys
Gly His Gly Thr Ile 85 90 95Ala Val Ala Met Ala Met Val Ala Asn Gly
Leu Val Ala 100 1059147PRTTrypanosoma cruzi 91Lys Val Gln His Pro
Gln Leu Pro His Ile Asn Thr Val Asp Cys Val 1 5 10 15Glu Ile Tyr
Gly Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val 20 25 30Val Ile
Phe Gly Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly Thr 35 40
459247PRTRhodobacter sphaeroides 92Lys Ser Ser Thr Pro Thr Glu Ala
His Ile Asn Asn Leu Asn Phe Val 1 5 10 15Thr Leu Trp His Lys Pro
Pro Ser Arg Gly Trp Leu Tyr Lys Asn Val 20 25 30His Cys Phe Leu Glu
Gly Gln Leu Asp Arg Leu Pro Gly Gly Thr 35 40 4593118PRTTrypanosoma
cruzi 93Arg Phe Lys Lys Ser Phe Thr Cys Ile Asp Met His Thr Glu Gly
Glu 1 5 10 15Ala Ala Arg Ile Val Thr Ser Gly Leu Pro His Ile Pro
Gly Ser Asn 20 25 30Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met
Asp Tyr Leu Arg 35 40 45Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp
Asp Met Phe Gly Ala 50 55 60Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala
Asp Leu Gly Met Val Phe 65 70 75 80Met Asp Thr Gly Gly Tyr Leu Asn
Met Cys Gly His Asn Ser Ile Ala 85 90 95Ala Val Thr Ala Ala Val Glu
Thr Gly Ile Val Ser Val Pro Ala Lys 100 105 110Ala Thr Asn Val Pro
Val 11594118PRTBurkholderia pseudomallei 94Arg Asp Met Lys His Ile
His Ile Ile Asp Ser His Thr Gly Gly Glu 1 5 10 15Pro Thr Arg Val
Val Val Ser Gly Phe Pro Ala Leu Gly Gly Gly Thr 20 25 30Met Ala Glu
Arg Leu Ala Val Leu Ala Arg Glu His Asp Arg Tyr Arg 35 40 45Ala Ala
Cys Ile Leu Glu Pro Arg Gly Ser Asp Val Leu Val Gly Ala 50 55 60Leu
Leu Cys Glu Pro Val Ser Ala Gly Ala Ala Ala Gly Val Ile Phe 65 70
75 80Phe Asn Asn Ala Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile
Gly 85 90 95Leu Val Arg Thr Leu His His Met Gly Arg Ile Gly Pro Gly
Val His 100 105 110Arg Ile Glu Thr Pro Val 1159563PRTTrypanosoma
cruzi 95Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg
Gln 1 5 10 15Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys
Met Ala Thr 20 25 30Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr
Phe Val Tyr Glu 35 40 45Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg Val
Leu Gly Glu Glu 50 55 609663PRTBurkholderia pseudomallei 96Asp Pro
Glu Tyr Asp Ser Arg Ser Phe Val Leu Cys Pro Gly His Ala 1 5 10
15Tyr Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Leu Ala Cys
20 25 30Leu Ala Ala Asp Gly Lys Leu Ala Ala Gly Val Thr Trp Arg Gln
Ala 35 40 45Ser Val Ile Gly Ser Val Phe Ser Ala Ser Tyr Ala Ala Ala
Glu 50 55 6097118PRTTrypanosoma cruzi 97Arg Phe Lys Lys Ser Phe Thr
Cys Ile Asp Met His Thr Glu Gly Glu 1 5 10 15Ala Ala Arg Ile Val
Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn 20 25 30Met Ala Glu Lys
Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg 35 40 45Arg Gly Ile
Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala 50 55 60Phe Leu
Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Met Val Phe 65 70 75
80Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala
85 90 95Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala
Lys 100 105 110Ala Thr Asn Val Pro Val 11598118PRTBurkholderia
mallei 98Arg Asp Met Lys His Ile His Ile Ile Asp Ser His Thr Gly
Gly Glu 1 5 10 15Pro Thr Arg Val Val Val Ser Gly Phe Pro Ala Leu
Gly Gly Gly Thr 20 25 30Met Ala Glu Arg Leu Ala Val Leu Ala Arg Glu
His Asp Arg Tyr Arg 35 40 45Ala Ala Cys Ile Leu Glu Pro Arg Gly Ser
Asp Val Leu Val Gly Ala 50 55 60Leu Leu Cys Glu Pro Val Ser Ala Gly
Ala Ala Ala Gly Val Ile Phe 65 70 75 80Phe Asn Asn Ala Gly Tyr Leu
Gly Met Cys Gly His Gly Thr Ile Gly 85 90 95Leu Val Arg Thr Leu His
His Met Gly Arg Ile Gly Pro Gly Val His 100 105 110Arg Ile Glu Thr
Pro Val 1159963PRTTrypanosoma cruzi 99Asn Pro Glu Ala Asn Tyr Lys
Asn Val Val Ile Phe Gly Asn Arg Gln 1 5 10 15Ala Asp Arg Ser Pro
Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr 20 25 30Leu Tyr Ala Lys
Gly Gln Leu Arg Ile Gly Glu Thr Phe Val Tyr Glu 35 40 45Ser Ile Leu
Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu Glu 50 55
6010063PRTBurkholderia mallei 100Asp Pro Glu Tyr Asp Ser Arg Ser
Phe Val Leu Cys Pro Gly His Ala 1 5 10 15Tyr Asp Arg Ser Pro Cys
Gly Thr Gly Thr Ser Ala Lys Leu Ala Cys 20 25 30Leu Ala Ala Asp Gly
Lys Leu Val Ala Gly Val Thr Trp Arg Gln Ala 35 40 45Ser Val Ile Gly
Ser Val Phe Ser Ala Ser Tyr Ala Ala Ala Glu 50 55
60101115PRTTrypanosoma cruzi 101Lys Ser Phe Thr Cys Ile Asp Met His
Thr Glu Gly Glu Ala Ala Arg 1 5 10 15Ile Val Thr Ser Gly Leu Pro
His Ile Pro Gly Ser Asn Met Ala Glu 20 25 30Lys Lys Ala Tyr Leu Gln
Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile 35 40 45Met Leu Glu Pro Arg
Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe 50 55 60Asp Pro Ile Glu
Glu Gly Ala Asp Leu Gly Met Val Phe Met Asp Thr 65 70 75 80Gly Gly
Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val Thr 85 90 95Ala
Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala Lys Ala Thr Asn 100 105
110Val Pro Val 115102115PRTPseudomonas putida 102Lys Gln Ile His
Val Ile Asp Ser His Thr Gly Gly Glu Pro Thr Arg 1 5 10 15Leu Val
Met Lys Gly Phe Pro Gln Leu Arg Gly Arg Ser Met Ala Glu 20 25 30Gln
Arg Asp Glu Leu Arg Glu Leu His Asp Arg Trp Arg Arg Ala Cys 35 40
45Leu Leu Glu Pro Arg Gly Asn Asp Val Leu Val Gly Ala Leu Tyr Cys
50 55 60Pro Pro Val Ser Ala Asp Ala Thr Cys Gly Val Ile Phe Phe Asn
Asn 65 70 75 80Ala Gly Tyr Leu Asn Met Cys Gly His Gly Thr Ile Gly
Leu Val Ala 85 90 95Ser Leu Gln His Met Gly Leu Ile Thr Pro Gly Val
His Lys Ile Asp 100 105 110Thr Pro Val 11510358PRTTrypanosoma cruzi
103Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln
1 5 10 15Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met
Ala Thr 20 25 30Leu Tyr Ala Lys Gly Gln Leu Arg Ile Gly Glu Thr Phe
Val Tyr Glu 35 40 45Ser Ile Leu Gly Ser Leu Phe Gln Gly Arg 50
5510458PRTPseudomonas putida 104Asp Pro Asn Ala Asp Ser Arg Asn Phe
Val Met Cys Pro Gly Lys Ala 1 5 10 15Tyr Asp Arg Ser Pro Cys Gly
Thr Gly Thr Ser Ala Lys Leu Ala Cys 20 25 30Leu Ala Ala Asp Gly Lys
Leu Ala Glu Gly Gln Thr Trp Val Gln Ala 35 40 45Ser Ile Thr Gly Ser
Gln Phe His Gly Arg 50 55105180PRTTrypanosoma cruzi 105Ser Gly Leu
Pro His Ile Pro Gly Ser Asn Met Ala Glu Lys Lys Ala 1 5 10 15Tyr
Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile Met Leu Glu 20 25
30Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe Asp Pro Ile
35 40 45Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met Asp Thr Gly Gly
Tyr 50 55 60Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala Val Thr Ala
Ala Val 65 70 75 80Glu Thr Gly Ile Val Ser Val Pro Ala Lys Ala Thr
Asn Val Pro Val 85 90 95Val Leu Asp Thr Pro Ala Gly Leu Val Arg Gly
Thr Ala His Leu Gln 100 105 110Ser Gly Thr Glu Ser Glu Val Ser Asn
Ala Ser Ile Ile Asn Val Pro 115 120 125Ser Phe Leu Tyr Gln Gln Asp
Val Val Val Val Leu Pro Lys Pro Tyr 130 135 140Gly Glu Val Arg Val
Asp Ile Ala Phe Gly Gly Asn Phe Phe Ala Ile145 150 155 160Val Pro
Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn Leu Ser 165 170
175Arg Leu Gln Glu 180106164PRTLeishmania major 106Thr Gly Phe Pro
Glu Leu Ala Gly Glu Thr Ile Ala Asp Lys Leu Asp 1 5 10 15Asn Leu
Arg Thr Gln His Asp Gln Trp Arg Arg Ala Cys Leu Leu Glu 20 25 30Pro
Arg Gly Asn Asp Val Leu Val Gly Ala Leu Tyr Cys Ala Pro Val 35 40
45Ser Ala Asp Ala Thr Cys Gly Val Ile Phe Phe Asn Asn Ala Gly Tyr
50 55 60Leu Gly Met Cys Gly His Gly Thr Ile Gly Leu Val Ala Ser Leu
His 65 70 75 80His Leu Gly Arg Ile Ala Pro Gly Val His Lys Ile Asp
Thr Pro Val 85 90 95Gly Pro Val Ser Ala Thr Leu His Ala Asp Gly Ala
Val Thr Leu Arg 100 105 110Asn Val Pro Ala Tyr Arg Tyr Arg Gln Gln
Val Pro Val Asp Val Pro 115 120 125Gly His Gly Arg Val Tyr Gly Asp
Ile Ala Trp Gly Gly Asn Trp Phe 130 135 140Phe Leu Val Ser Asp His
Gly Gln Ala Leu Gln Met Asp Asn Val Glu145 150 155 160Ala Leu Thr
Asp10768PRTTrypanosoma cruzi 107Pro Thr Asn Pro Glu Ala Asn Tyr Lys
Asn Val Val Ile Phe Gly Asn 1 5 10 15Arg Gln Ala Asp Arg Ser Pro
Cys Gly Thr Gly Thr Ser Ala Lys Met 20 25 30Ala Thr Leu Tyr Ala Lys
Gly Gln Leu Arg Ile Gly Glu Thr Phe Val 35 40 45Tyr Glu Ser Ile Leu
Gly Ser Leu Phe Gln Gly Arg Val Leu Gly Glu 50 55 60Glu Arg Ile Pro
6510868PRTLeishmania major 108Pro Thr Thr Pro Thr Pro Thr Ala Thr
Ser Ser Cys Ala Gln Gly Lys 1 5 10 15Ala Tyr Asp Arg Ser Pro Cys
Gly Thr Gly Thr Asn Ala Lys Leu Ala 20 25 30Cys Leu Ala Gly Asp Ser
Lys Leu Ala Ala Gly Glu Pro Trp Leu Gln 35 40 45Val Thr Ile Thr Cys
Arg Gln Phe Lys Arg Ser Tyr Gln Trp Glu Cys 50 55 60Lys Arg Val Pro
6510928PRTTrypanosoma cruzi 109Val Thr Ala Glu Ile Thr Gly Lys Ala
Phe Ile Met Gly Phe Asn Thr 1 5 10 15Met Leu Phe Asp Pro Thr Asp
Pro Phe Lys Asn Gly 20 2511027PRTLeishmania major 110Val Pro Pro
Ser Ile Thr Arg Arg Ala Tyr Met Thr Ala Asp Ser Thr 1 5 10 15Leu
Leu Ile Asp Gln Asp Pro Phe Ala Trp Gly 20 25111182PRTTrypanosoma
cruzi 111Val Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala
Glu Lys 1 5 10
15Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile Met
20 25 30Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe
Asp 35 40 45Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met Asp
Thr Gly 50 55 60Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala
Val Thr Ala 65 70 75 80Ala Val Glu Thr Gly Ile Val Ser Val Pro Ala
Lys Ala Thr Asn Val 85 90 95Pro Val Val Leu Asp Thr Pro Ala Gly Leu
Val Arg Gly Thr Ala His 100 105 110Leu Gln Ser Gly Thr Glu Ser Glu
Val Ser Asn Ala Ser Ile Ile Asn 115 120 125Val Pro Ser Phe Leu Tyr
Gln Gln Asp Val Val Val Val Leu Pro Lys 130 135 140Pro Tyr Gly Glu
Val Arg Val Asp Ile Ala Phe Gly Gly Asn Phe Phe145 150 155 160Ala
Ile Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser Val Gln Asn 165 170
175Leu Ser Arg Leu Gln Glu 180112166PRTLeishmania major 112Val Met
Thr Gly Phe Pro Glu Leu Ala Gly Glu Thr Ile Ala Asp Lys 1 5 10
15Leu Asp Asn Leu Arg Thr Gln His Asp Gln Trp Arg Arg Ala Cys Leu
20 25 30Leu Glu Pro Arg Gly Asn Asp Val Leu Val Gly Ala Leu Tyr Cys
Ala 35 40 45Pro Val Ser Ala Asp Ala Thr Cys Gly Val Ile Phe Phe Asn
Asn Ala 50 55 60Gly Tyr Leu Gly Met Cys Gly His Gly Thr Ile Gly Leu
Val Ala Ser 65 70 75 80Leu His His Leu Gly Arg Ile Ala Pro Gly Val
His Lys Ile Asp Thr 85 90 95Pro Val Gly Pro Val Ser Ala Thr Leu His
Ala Asp Gly Ala Val Thr 100 105 110Leu Arg Asn Val Pro Ala Tyr Arg
Tyr Arg Gln Gln Val Pro Val Asp 115 120 125Val Pro Gly His Gly Arg
Val Tyr Gly Asp Ile Ala Trp Gly Gly Asn 130 135 140Trp Phe Phe Leu
Val Ser Asp His Gly Gln Ala Leu Gln Met Asp Asn145 150 155 160Val
Glu Ala Leu Thr Asp 165113142PRTTrypanosoma cruzi 113Arg Ile Val
Thr Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala 1 5 10 15Glu
Lys Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly 20 25
30Ile Met Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu
35 40 45Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met
Asp 50 55 60Thr Gly Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala
Ala Val 65 70 75 80Thr Ala Ala Val Glu Thr Gly Ile Leu Ser Val Pro
Ala Lys Ala Thr 85 90 95Asn Val Pro Val Val Leu Asp Thr Pro Ala Gly
Leu Val Arg Gly Thr 100 105 110Ala His Leu Gln Ser Gly Thr Glu Ser
Glu Val Ser Asn Ala Ser Ile 115 120 125Ile Asn Val Pro Ser Phe Leu
Tyr Gln Gln Asp Val Val Ile 130 135 140114137PRTTrypanosoma brucei
114Arg Ile Ile Thr Gly Gly Val Pro Glu Ile Lys Gly Glu Thr Gln Leu
1 5 10 15Glu Arg Arg Ala Tyr Cys Met Glu His Leu Asp Tyr Leu Arg
Glu Ile 20 25 30Leu Met Tyr Glu Pro Arg Gly His His Gly Met Tyr Gly
Cys Ile Ile 35 40 45Thr Pro Pro Ala Ser Ala His Ala Asp Phe Gly Val
Leu Phe Met His 50 55 60Asn Glu Gly Trp Ser Thr Met Cys Gly His Gly
Ile Ile Ala Val Ile 65 70 75 80Thr Val Gly Ile Glu Thr Gly Met Phe
Glu Val Lys Gly Glu Lys Gln 85 90 95Asn Phe Ile Ile Asp Ser Pro Ala
Gly Glu Val Ile Ala Tyr Ala Lys 100 105 110Tyr Asn Gly Ser Glu Val
Glu Ser Val Ser Phe Glu Asn Val Pro Ser 115 120 125Phe Val Tyr Lys
Lys Asp Val Pro Ile 130 135115140PRTTrypanosoma cruzi 115Val Thr
Ser Gly Leu Pro His Ile Pro Gly Ser Asn Met Ala Glu Lys 1 5 10
15Lys Ala Tyr Leu Gln Glu Asn Met Asp Tyr Leu Arg Arg Gly Ile Met
20 25 30Leu Glu Pro Arg Gly His Asp Asp Met Phe Gly Ala Phe Leu Phe
Asp 35 40 45Pro Ile Glu Glu Gly Ala Asp Leu Gly Ile Val Phe Met Asp
Thr Gly 50 55 60Gly Tyr Leu Asn Met Cys Gly His Asn Ser Ile Ala Ala
Val Thr Ala 65 70 75 80Ala Val Glu Thr Gly Ile Leu Ser Val Pro Ala
Lys Ala Thr Asn Val 85 90 95Pro Val Val Leu Asp Thr Pro Ala Gly Leu
Val Arg Gly Thr Ala His 100 105 110Leu Gln Ser Gly Thr Glu Ser Glu
Val Ser Asn Ala Ser Ile Ile Asn 115 120 125Val Pro Ser Phe Leu Tyr
Gln Gln Asp Val Val Ile 130 135 140116135PRTTrypanosoma brucei
116Ile Thr Gly Gly Val Pro Glu Ile Lys Gly Glu Thr Gln Leu Glu Arg
1 5 10 15Arg Ala Tyr Cys Met Glu His Leu Asp Tyr Leu Arg Glu Ile
Leu Met 20 25 30Tyr Glu Pro Arg Gly His His Gly Met Tyr Gly Cys Ile
Ile Thr Pro 35 40 45Pro Ala Ser Ala His Ala Asp Phe Gly Val Leu Phe
Met His Asn Glu 50 55 60Gly Trp Ser Thr Met Cys Gly His Gly Ile Ile
Ala Val Ile Thr Val 65 70 75 80Gly Ile Glu Thr Gly Met Phe Glu Val
Lys Gly Glu Lys Gln Asn Phe 85 90 95Ile Ile Asp Ser Pro Ala Gly Glu
Val Ile Ala Tyr Ala Lys Tyr Asn 100 105 110Gly Ser Glu Val Glu Ser
Val Ser Phe Glu Asn Val Pro Ser Phe Val 115 120 125Tyr Lys Lys Asp
Val Pro Ile 130 135117103PRTTrypanosoma cruzi 117Phe Gly Gly Asn
Phe Phe Ala Ile Val Pro Ala Glu Gln Leu Gly Ile 1 5 10 15Asp Ile
Ser Val Gln Asn Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu 20 25 30Leu
Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln His Pro Gln Leu 35 40
45Pro His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr Gly Pro Pro Thr
50 55 60Asn Pro Glu Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg
Gln 65 70 75 80Ala Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys
Met Ala Thr 85 90 95Leu Tyr Ala Lys Gly Gln Leu
10011895PRTTrypanosoma congolense 118Trp Gly Gly Asn Trp Phe Phe
Leu Val Ser Asp His Gly His Glu Leu 1 5 10 15Gln Met Asp Asn Val
Glu Ala Leu Thr Asp Tyr Thr Trp Ala Met Leu 20 25 30Asn Ala Leu Glu
Ala Gln Gly Ile Arg Gly Ala Asp Gly Ala Leu Ile 35 40 45Asp His Ile
Glu Leu Phe Ala Asp Asp Ala His Ala Asp Ser Arg Asn 50 55 60Phe Val
Met Cys Pro Gly Lys Ala Tyr Asp Arg Ser Pro Cys Gly Thr 65 70 75
80Gly Thr Ser Ala Lys Leu Ala Cys Leu Ala Ala Asp Ala Lys Leu 85 90
9511955PRTTrypanosoma cruzi 119Asn Val Pro Ser Phe Leu Tyr Gln Gln
Asp Val Val Val Val Leu Pro 1 5 10 15Lys Pro Tyr Gly Glu Val Arg
Val Asp Ile Ala Phe Gly Gly Asn Phe 20 25 30Phe Ala Ile Val Pro Ala
Glu Gln Leu Gly Ile Asp Ile Ser Val Gln 35 40 45Asn Leu Ser Arg Leu
Gln Glu 50 5512052PRTTrypanosoma congolense 120His Val Pro Ala Tyr
Arg Tyr Arg Lys Gln Val Pro Val Glu Val Pro 1 5 10 15Gly His Gly
Val Val Leu Gly Asp Ile Ala Trp Gly Gly Asn Trp Phe 20 25 30Phe Leu
Val Ser Asp His Gly His Glu Leu Gln Met Asp Asn Val Glu 35 40 45Ala
Leu Thr Asp 50121117PRTTrypanosoma cruzi 121Leu Pro Lys Pro Tyr Gly
Glu Val Arg Val Asp Ile Ala Phe Gly Gly 1 5 10 15Asn Phe Phe Ala
Ile Val Pro Ala Glu Gln Leu Gly Ile Asp Ile Ser 20 25 30Val Gln Asn
Leu Ser Arg Leu Gln Glu Ala Gly Glu Leu Leu Arg Thr 35 40 45Glu Ile
Asn Arg Ser Val Lys Val Gln His Pro Gln Leu Pro His Ile 50 55 60Asn
Thr Val Asp Cys Val Glu Ile Tyr Gly Pro Pro Thr Asn Pro Glu 65 70
75 80Ala Asn Tyr Lys Asn Val Val Ile Phe Gly Asn Arg Gln Ala Asp
Arg 85 90 95Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala Thr Leu
Tyr Ala 100 105 110Lys Gly Gln Leu Arg 115122116PRTTrypanosoma
vivax 122Leu Pro His Pro Tyr Gly Lys Tyr Ala Val Ile Ser Phe Gly
Gly Ser 1 5 10 15Phe Phe Ala Leu Ile Asp Ala Ala Gln Leu Gln Leu
Thr Val Asp Lys 20 25 30Gly His Leu Ser Thr Leu Gln His Val Gly Gly
Leu Leu Arg Asp Thr 35 40 45Leu Asn Arg Asn Val Ser Val Gln His Pro
Gln Leu Pro His Ile Asn 50 55 60Arg Ile Asp Cys Val Glu Ile Tyr Asp
Pro Pro Thr Asn Pro Ala Ala 65 70 75 80Ser Cys Lys Asn Val Val Ile
Phe Gly Asn Ser Gln Val Asp Arg Ser 85 90 95Pro Cys Gly Thr Gly Thr
Cys Ala Lys Met Ala Leu Leu Tyr Ala Lys 100 105 110Gly Lys Leu Lys
115123106PRTTrypanosoma cruzi 123Arg Glu Ile Met Arg Phe Lys Lys
Ser Phe Thr Cys Ile Asp Met His 1 5 10 15Thr Glu Gly Glu Ala Ala
Arg Ile Val Thr Ser Gly Leu Pro His Ile 20 25 30Pro Gly Ser Asn Met
Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn Met 35 40 45Asp Tyr Leu Arg
Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp Asp 50 55 60Met Phe Gly
Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp Leu 65 70 75 80Gly
Met Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly His 85 90
95Asn Ser Ile Ala Ala Val Thr Ala Ala Val 100
105124106PRTTrypanosoma vivax 124Arg Val Val Met Gln Phe Thr Gly
Thr Met Thr Cys Ile Asp Met His 1 5 10 15Thr Ala Gly Glu Pro Ala
Arg Ile Val Thr Ser Gly Phe Pro Asn Ile 20 25 30Pro Gly Ala Ser Leu
Val Glu Lys Arg Asp His Leu Gln Arg His Met 35 40 45Asp His Ile Arg
Arg Arg Val Met Leu Glu Pro Arg Gly His Asp Asn 50 55 60Met Phe Gly
Ala Phe Leu Phe Tyr Pro Leu Thr Asp Gly Ala Asp Phe 65 70 75 80Ser
Val Ile Phe Met Asp Ala Gly Gly Tyr Leu Asn Met Cys Gly His 85 90
95Asn Ser Ile Ala Ile Ala Thr Ala Ala Val 100
105125357PRTTrypanosoma cruzi 125Lys Arg Glu Ile Met Arg Phe Lys
Lys Ser Phe Thr Cys Ile Asp Met 1 5 10 15His Thr Glu Gly Glu Ala
Ala Arg Ile Val Thr Ser Gly Leu Pro His 20 25 30Ile Pro Gly Ser Asn
Met Ala Glu Lys Lys Ala Tyr Leu Gln Glu Asn 35 40 45Met Asp Tyr Leu
Arg Arg Gly Ile Met Leu Glu Pro Arg Gly His Asp 50 55 60Asp Met Phe
Gly Ala Phe Leu Phe Asp Pro Ile Glu Glu Gly Ala Asp 65 70 75 80Leu
Gly Met Val Phe Met Asp Thr Gly Gly Tyr Leu Asn Met Cys Gly 85 90
95His Asn Ser Ile Ala Ala Val Thr Ala Ala Val Glu Thr Gly Ile Val
100 105 110Ser Val Pro Ala Lys Ala Thr Asn Val Pro Val Val Leu Asp
Thr Pro 115 120 125Ala Gly Leu Val Arg Gly Thr Ala His Leu Gln Ser
Gly Thr Glu Ser 130 135 140Glu Val Ser Asn Ala Ser Ile Ile Asn Val
Pro Ser Phe Leu Tyr Gln145 150 155 160Gln Asp Val Val Val Val Leu
Pro Lys Pro Tyr Gly Glu Val Arg Val 165 170 175Asp Ile Ala Phe Gly
Gly Asn Phe Phe Ala Ile Val Pro Ala Glu Gln 180 185 190Leu Gly Ile
Asp Ile Ser Val Gln Asn Leu Ser Arg Leu Gln Glu Ala 195 200 205Gly
Glu Leu Leu Arg Thr Glu Ile Asn Arg Ser Val Lys Val Gln His 210 215
220Pro Gln Leu Pro His Ile Asn Thr Val Asp Cys Val Glu Ile Tyr
Gly225 230 235 240Pro Pro Thr Asn Pro Glu Ala Asn Tyr Lys Asn Val
Val Ile Phe Gly 245 250 255Asn Arg Gln Ala Asp Arg Ser Pro Cys Gly
Thr Gly Thr Ser Ala Lys 260 265 270Met Ala Thr Leu Tyr Ala Lys Gly
Gln Leu Arg Ile Gly Glu Thr Phe 275 280 285Val Tyr Glu Ser Ile Leu
Gly Ser Leu Phe Gln Gly Arg Val Leu Gly 290 295 300Glu Glu Arg Ile
Pro Gly Val Lys Val Pro Val Thr Lys Asp Ala Glu305 310 315 320Glu
Gly Met Leu Val Val Thr Ala Glu Ile Thr Gly Lys Ala Phe Ile 325 330
335Met Gly Phe Asn Thr Met Leu Phe Asp Pro Thr Asp Pro Phe Lys Asn
340 345 350Gly Phe Thr Leu Lys 355126337PRTVibrio parahaemolyticus
126Lys Glu Arg Lys Met Arg Gln Gly Thr Phe Phe Cys Ile Asp Ala His
1 5 10 15Thr Cys Gly Asn Pro Val Arg Leu Val Ala Gly Gly Val Pro
Pro Leu 20 25 30Glu Gly Asn Thr Met Ser Glu Lys Arg Gln Tyr Phe Leu
Glu His Tyr 35 40 45Asp Trp Ile Arg Gln Ala Leu Met Phe Glu Pro Arg
Gly His Ser Met 50 55 60Met Ser Gly Ser Val Val Leu Pro Pro Cys Ser
Asp Asn Ala Asp Ala 65 70 75 80Ser Ile Leu Phe Ile Glu Thr Ser Gly
Cys Leu Pro Met Cys Gly His 85 90 95Gly Thr Ile Gly Thr Val Thr Thr
Ala Ile Glu Asn Arg Leu Ile Thr 100 105 110Pro Lys Glu Glu Gly Arg
Leu Ile Leu Asp Val Pro Ala Gly Gln Ile 115 120 125Glu Val His Tyr
Gln Thr Lys Gly Asp Lys Val Thr Ser Val Lys Ile 130 135 140Phe Asn
Val Pro Ala Tyr Leu Ala His Gln Asp Val Thr Val Glu Ile145 150 155
160Glu Gly Leu Gly Glu Ile Thr Val Asp Val Ala Tyr Gly Gly Asn Tyr
165 170 175Tyr Val Ile Val Asp Pro Gln Glu Asn Tyr Ala Gly Leu Glu
His Tyr 180 185 190Ser Pro Asp Glu Ile Leu Met Leu Ser Pro Lys Val
Arg Thr Ala Val 195 200 205Ser Lys Ala Val Glu Cys Ile His Pro Asn
Asp Pro Thr Val Cys Gly 210 215 220Val Ser His Val Leu Trp Thr Gly
Lys Pro Thr Gln Glu Gly Ala Thr225 230 235 240Ala Arg Asn Ala Val
Phe Tyr Gly Asp Lys Ala Leu Asp Arg Ser Pro 245 250 255Cys Gly Thr
Gly Thr Ser Ala Arg Met Ala Gln Trp His Ala Lys Gly 260 265 270Lys
Leu Lys Ser Gly Glu Asp Phe Val His Glu Ser Ile Ile Gly Ser 275 280
285Leu Phe Asn Gly Arg Ile Glu Gly Ile Thr Glu Val Asn Gly Gln Thr
290 295 300Ala Ile Leu Pro Ser Ile Glu Gly Trp Ala Gln Val Tyr Gly
His Asn305 310 315 320Thr Ile Trp Val Asp Asp Glu Asp Pro Tyr Ala
Tyr Gly Phe Glu Val 325 330 335Lys12714PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide motif
127Asp Arg Ser Pro Cys Gly Thr Gly Thr Ser Ala Lys Met Ala 1 5
101285PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide motif 128Asn Met Cys Gly His 1 51296PRTArtificial
SequenceDescription of Artificial Sequence Synthetic 6xHis tag
129His His His His His His 1 5
* * * * *