U.S. patent application number 11/529083 was filed with the patent office on 2009-06-25 for apo-2 ligand.
This patent application is currently assigned to Genentech, Inc.. Invention is credited to Avi J. Ashkenazi.
Application Number | 20090162364 11/529083 |
Document ID | / |
Family ID | 27039483 |
Filed Date | 2009-06-25 |
United States Patent
Application |
20090162364 |
Kind Code |
A1 |
Ashkenazi; Avi J. |
June 25, 2009 |
Apo-2 ligand
Abstract
A novel cytokine, designated Apo-2 ligand, which induces
mammalian cell apoptosis is provided. The Apo-2 ligand is believed
to be a member of the TNF cytokine family. Compositions including
Apo-2 ligand chimeras, nucleic acid encoding Apo-2 ligand, and
antibodies to Apo-2 ligand are also provided. Methods of using
Apo-2 ligand to induce apoptosis and to treat pathological
conditions such as cancer, are further provided.
Inventors: |
Ashkenazi; Avi J.; (San
Mateo, CA) |
Correspondence
Address: |
GENENTECH, INC.
1 DNA WAY
SOUTH SAN FRANCISCO
CA
94080
US
|
Assignee: |
Genentech, Inc.
South San Francisco
CA
|
Family ID: |
27039483 |
Appl. No.: |
11/529083 |
Filed: |
September 28, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11311550 |
Dec 19, 2005 |
|
|
|
11529083 |
|
|
|
|
09459808 |
Dec 13, 1999 |
6998116 |
|
|
11311550 |
|
|
|
|
08584031 |
Jan 9, 1996 |
6030945 |
|
|
09459808 |
|
|
|
|
Current U.S.
Class: |
424/139.1 ;
435/243; 435/320.1; 435/69.1; 530/350; 530/387.9; 536/23.1 |
Current CPC
Class: |
C07K 14/70575 20130101;
Y10S 930/14 20130101; C07K 2319/00 20130101; A61K 38/00 20130101;
A61P 35/00 20180101; A01K 2217/05 20130101 |
Class at
Publication: |
424/139.1 ;
530/350; 530/387.9; 435/320.1; 536/23.1; 435/243; 435/69.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 14/00 20060101 C07K014/00; C07K 16/00 20060101
C07K016/00; C12N 15/74 20060101 C12N015/74; C07H 21/02 20060101
C07H021/02; C12N 1/00 20060101 C12N001/00; C12P 21/02 20060101
C12P021/02; A61P 35/00 20060101 A61P035/00 |
Claims
1. Isolated biologically active human Apo-2 ligand comprising amino
acid residues 114-281 of FIG. 1A.
2. The Apo-2 ligand of claim 1 comprising amino acid residues
41-281 of FIG. 1A.
3. The Apo-2 ligand of claim 2 comprising amino acid residues
15-281 of FIG. 1A.
4. The Apo-2 ligand of claim 3 comprising amino acid residues 1-281
of FIG. 1A.
5. Isolated biologically active human Apo-2 ligand having amino
acid residues 1-281 of FIG. 1A.
6. Isolated biologically active Apo-2 ligand having at least about
80% sequence identity with either of: (a) the full-length native
human Apo-2 ligand comprising amino acid residues 1-281 of FIG. 1A;
(b) the extracellular region of native human Apo-2 ligand
comprising amino acid residues 41-281 of FIG. 1A; or (c) the
extracellular region of native human Apo-2 ligand comprising amino
acid residues 114-281 of FIG. 1A.
7. The Apo-2 ligand of claim 6 wherein said ligand has at least
about 90% sequence identity with either of (a), (b), or (c).
8. The Apo-2 ligand of claim 7 wherein said ligand has at least
about 95% sequence identity with either of (a), (b), or (c).
9. A chimeric polypeptide comprising the Apo-2 ligand of claim 1
fused to a heterologous polypeptide sequence.
10. The chimeric polypeptide of claim 9 wherein said heterologous
polypeptide sequence is a tag polypeptide sequence.
11. An antibody which binds to Apo-2 ligand.
12. The antibody of claim 11 wherein said antibody is a monoclonal
antibody.
13. Isolated nucleic acid encoding Apo-2 ligand.
14. The nucleic acid of claim 13 wherein said nucleic acid encodes
the Apo-2 ligand of claim 1.
15. The nucleic acid of claim 13 wherein said nucleic acid encodes
the Apo-2 ligand of claim 2.
16. The nucleic acid of claim 13 wherein said nucleic acid encodes
the Apo-2 ligand of claim 5.
17. A vector comprising the nucleic acid of claim 13.
18. A host cell comprising the vector of claim 17.
19. A method of producing Apo-2 ligand comprising culturing the
host cell of claim 18 and recovering the Apo-2 ligand from the host
cell culture.
20. A composition comprising Apo-2 ligand and a
pharmaceutically-acceptable carrier.
21. The composition of claim 20 wherein said Apo-2 ligand comprises
the Apo-2 ligand of claim 1.
22. A pharmaceutical composition useful for stimulating mammalian
cell apoptosis comprising an effective amount of Apo-2 ligand in a
pharmaceutically-acceptable carrier.
23. A method of inducing apoptosis in mammalian cells comprising
exposing mammalian cells to an effective amount of Apo-2
ligand.
24. A method of treating a mammal having cancer, comprising
administering to a mammal diagnosed as having cancer an effective
amount of Apo-2 ligand.
25. The method of claim 24 wherein the Apo-2 ligand is administered
to the mammal in combination with one or more other therapies.
26. The method of claim 25 wherein said one or more other therapies
are selected from the group consisting of radiation therapy,
chemotherapy, TNF-.alpha., TNF-.beta., CD30 ligand, 4-1BB ligand,
and Apo-1 ligand.
27. The method of claim 24 wherein said cancer is breast cancer,
prostate cancer or ovarian cancer.
28. An article of manufacture, comprising: a container; a label on
said container; and a composition contained within said container;
wherein the composition includes an active agent effective for
inducing apoptosis, the label on said container indicates that the
composition can be used to induce apoptosis, and the active agent
in said composition comprises Apo-2 ligand.
29. The article of manufacture of claim 28 further comprising
instructions for administering the Apo-2 ligand to a mammal.
Description
FIELD OF THE INVENTION
[0001] The present invention relates generally to the
identification, isolation, and recombinant production of a novel
cytokine, designated herein as "Apo-2 ligand", which induces
mammalian cell apoptosis, and to methods of using Apo-2 ligand.
BACKGROUND OF THE INVENTION
[0002] Control of cell numbers in mammals is believed to be
determined, in part, by a balance between cell proliferation and
cell death. One form of cell death, sometimes referred to as
necrotic cell death, is typically characterized as a pathologic
form of cell death resulting from some trauma or cellular injury.
In contrast, there is another, "physiologic" form of cell death
which usually proceeds in an orderly or controlled manner. This
orderly or controlled form of cell death is often referred to as
"apoptosis" [see, e.g., Barr et al., Bio/Technology, 12:487-493
(1994)]. Apoptotic cell death naturally occurs in many
physiological processes, including embryonic development and clonal
selection in the immune system [Itoh et al., Cell, 66:233-243
(1991)]. Decreased levels of apoptotic cell death, however, have
been associated with a variety of pathological conditions,
including cancer, lupus, and herpes virus infection [Thompson,
Science, 267:1456-1462 (1995)].
[0003] Apoptotic cell death is typically accompanied by one or more
characteristic morphological and biochemical changes in cells, such
as condensation of cytoplasm, loss of plasma membrane microvilli,
segmentation of the nucleus, degradation of chromosomal DNA or loss
of mitochondrial function. A variety of extrinsic and intrinsic
signals are believed to trigger or induce such morphological and
biochemical cellular changes [Raff, Nature, 356:397-400 (1992);
Steller, Science, 267:1445-1449 (1995); Sachs et al., Blood, 82:15
(1993)]. For instance, they can be triggered by hormonal stimuli,
such as glucocorticoid hormones for immature thymocytes, as well as
withdrawal of certain growth factors [Watanabe-Fukunaga et al.,
Nature, 356:314-317 (1992)]. Also, some identified oncogenes such
as myc, rel, and E1A, and tumor suppressors, like p53, have been
reported to have a role in inducing apoptosis. Certain chemotherapy
drugs and some forms of radiation have likewise been observed to
have apoptosis-inducing activity [Thompson, supra].
[0004] Various molecules; such as tumor necrosis factor-.alpha.
("TNF-.alpha."), tumor necrosis factor-.beta. ("TNF-.beta." or
"lymphotoxin"), CD30 ligand, CD27 ligand, CD40 ligand, OX-40
ligand, 4-1BB ligand, and Apo-1 ligand (also referred to as Fas
ligand or CD95 ligand) have been identified as members of the tumor
necrosis factor ("TNF") family of cytokines [See, e.g., Gruss and
Dower, Blood, 85:3378-3404 (1995)]. Among these molecules,
TNF-.alpha., TNF-.beta., CD30 ligand, 4-1BB ligand, and Apo-1
ligand have been reported to be involved in apoptotic cell death.
Both TNF-.alpha. and TNF-.beta. have been reported to induce
apoptotic death in susceptible tumor cells [Schmid et al., Proc.
Natl. Acad. Sci., 83:1881 (1986); Dealtry et al., Eur. J. Immunol.,
17:689 (1987)]. Zheng et al. have reported that TNF-.alpha. is
involved in post-stimulation apoptosis of CD8-positive T cells
[Zheng et al., Nature, 377:348-351 (1995)]. Other investigators
have reported that CD30 ligand may be involved in deletion of
self-reactive T cells in the thymus [Amakawa et al., Cold Spring
Harbor Laboratory Symposium on Programmed Cell Death, Abstr. No.
10, (1995)].
[0005] Mutations in the mouse Fas/Apo-1 receptor or ligand genes
(called lpr and gld, respectively) have been associated with some
autoimmune disorders, indicating that Apo-1 ligand may play a role
in regulating the clonal deletion of self-reactive lymphocytes in
the periphery [Krammer et al., Curr. Op. Immunol., 6:279-289
(1994); Nagata et al., Science, 267:1449-1456 (1995)]; Apo-1 ligand
is also reported to induce post-stimulation apoptosis in
CD4-positive T lymphocytes and in B lymphocytes, and may be
involved in the elimination of activated lymphocytes when their
function is no longer needed. [Krammer et al., supra; Nagata et
al., supra]. Agonist mouse monoclonal antibodies specifically
binding to the Apo-1 receptor have been reported to exhibit cell
killing activity that is comparable to or similar to that of
TNF-.alpha. [Yonehara et al., J. Exp. Med., 169:1747-1756
(1989)].
[0006] Induction of various cellular responses mediated by such TNF
family cytokines is believed to be initiated by their binding to
specific cell receptors. Two distinct TNF receptors of
approximately 55-kDa (TNF-R1) and 75-kDa (TNF-R2) have been
identified [Hohman et al., J. Biol. Chem., 264:14927-14934 (1989);
Brockhaus et al., Proc. Natl. Acad. Sci., 87:3127-3131 (1990); EP
417,563, published Mar. 20, 1991] and human and mouse cDNAs
corresponding to both receptor types have been isolated and
characterized [Loetscher et al., Cell, 61:351 (1990); Schall et
al., Cell, 61:361 (1990); Smith et al., Science, 248:1019-1023
(1990); Lewis et al., Proc. Natl. Acad. Sci., 88:2830-2834 (1991);
Goodwin et al., Mol. Cell. Biol., 11:3020-3026 (1991)].
[0007] Itoh et al. disclose that the Apo-1 receptor can signal an
apoptotic cell death similar to that signaled by the 55-kDa TNF-R1
[Itoh et al., supra]. Expression of the Apo-1 antigen has also been
reported to be down-regulated along with that of TNF-R1 when cells
are treated with either TNF-.alpha. or anti-Apo-1 mouse monoclonal
antibody [Krammer et al., supra; Nagata et al., supra].
Accordingly, some investigators have hypothesized that cell lines
that co-express both Apo-1 and TNF-R1 receptors may mediate cell
killing through common signaling pathways [Id.].
[0008] The TNF family ligands identified to date, with the
exception of lymphotoxin-.alpha., are type II transmembrane
proteins, whose C-terminus is extracellular. In contrast, the
receptors in the TNF receptor (TNFR) family identified to date are
type I transmembrane proteins. In both the TNF ligand and receptor
families, however, homology identified between family members has
been found mainly in the extracellular domain ("ECD"). Several of
the TNF family cytokines, including TNF-.alpha., Apo-1 ligand and
CD40 ligand, are cleaved proteolytically at the cell surface; the
resulting protein in each case typically forms a homotrimeric
molecule that functions as a soluble cytokine. TNF receptor family
proteins are also usually cleaved proteolytically to release
soluble receptor ECDs that can function as inhibitors of the
cognate cytokines. For a review of the TNF family of cytokines and
their receptors, see Gruss and Dower, supra.
SUMMARY OF THE INVENTION
[0009] Applicants have identified cDNA clones that encode a novel
cytokine, designated "Apo-2 ligand." It is presently believed that
Apo-2 ligand is a member of the TNF cytokine family; Apo-2 ligand
is related in amino acid sequence to some known TNF-related
proteins, including the Apo-1 ligand. Applicants found, however,
that the Apo-2 ligand is not inhibited appreciably by known soluble
Apo-1 or TNF receptors, such as the Fas/Apo-1, TNF-R1, or TNF-R2
receptors.
[0010] In one embodiment, the invention provides isolated
biologically active Apo-2 ligand. In particular, the invention
provides isolated biologically active human Apo-2 ligand, which in
one embodiment, includes an amino acid sequence comprising residues
114-281 of FIG. 1A. In another embodiment, the Apo-2 ligand
includes an amino acid sequence comprising residues 41-281 or
15-281 of FIG. 1A. In another embodiment, the isolated biologically
active human Apo-2 ligand includes an amino acid sequence shown as
residues 1-281 of FIG. 1A (SEQ ID NO:1).
[0011] In another embodiment, the invention provides chimeric
molecules comprising Apo-2 ligand fused to another, heterologous
polypeptide. An example of such a chimeric molecule comprises the
Apo-2 ligand fused to a tag polypeptide sequence.
[0012] In another embodiment, the invention provides an isolated
nucleic acid molecule encoding Apo-2 ligand. In one aspect, the
nucleic acid molecule is RNA or DNA that encodes a biologically
active Apo-2 ligand or is complementary to nucleic acid sequence
encoding such Apo-2 ligand, and remains stably bound to it under
stringent conditions. In one embodiment, the nucleic acid sequence
is selected from:
[0013] (a) the coding region of the nucleic acid sequence of FIG.
1A that codes for the full-length protein from residue 1 to residue
281 (i.e., nucleotides 91 through 933), inclusive, or nucleotides
211 through 933 that encodes for the extracellular protein from
residue 41 to 281, inclusive, or nucleotides 430 through 933 that
encodes for the extracellular protein from residue 114 to 281,
inclusive, of the nucleic acid sequence shown in FIG. 1A (SEQ ID
NO:2); or
[0014] (b) a sequence corresponding to the sequence of (a) within
the scope of degeneracy of the genetic code.
[0015] In a further embodiment, the invention provides a replicable
vector comprising the nucleic acid molecule encoding the Apo-2
ligand operably linked to control sequences recognized by a host
cell transfected or transformed with the vector. A host cell
comprising the vector or the nucleic acid molecule is also
provided. A method of producing Apo-2 ligand which comprises
culturing a host cell comprising the nucleic acid molecule and
recovering the protein from the host cell culture is further
provided.
[0016] In another embodiment, the invention provides an antibody
which binds to the Apo-2 ligand.
[0017] In another embodiment, the invention provides a composition
comprising biologically active Apo-2 ligand and a
pharmaceutically-acceptable carrier. The composition may be a
pharmaceutical composition useful for inducing or stimulating
apoptosis.
[0018] In another embodiment, the invention provides a method for
inducing apoptosis in mammalian cells, comprising exposing
mammalian cells, in vivo or ex vivo, to an amount of Apo-2 ligand
effective for inducing apoptosis.
[0019] In another embodiment, the invention provides methods of
treating a mammal having cancer. In the methods, an effective
amount of Apo-2 ligand is administered to a mammal diagnosed as
having cancer. The Apo-2 ligand may also be administered to the
mammal along with one or more other therapies, such as
chemotherapy, radiation therapy, or other agents capable of
inducing apoptosis.
[0020] A further embodiment of the invention provides articles of
manufacture and kits that include Apo-2 ligand or Apo-2 ligand
antibodies. The articles of manufacture and kits include a
container, a label on the container, and a composition contained
within the container. The label on the container indicates that the
composition can be used for certain therapeutic or non-therapeutic
applications. The composition contains an active agent, and the
active agent comprises Apo-2 ligand or Apo-2 ligand antibodies.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1A shows the nucleotide sequence of human Apo-2 ligand
cDNA and its derived amino acid sequence.
[0022] FIG. 1B shows an alignment of the C-terminal region of human
Apo-2 ligand with the corresponding region of known members of the
human TNF cytokine family, 4-1BBL, OX40L, CD27L, CD30L,
TNF-.alpha., LT-.beta., LT-.alpha., CD40L, and Apo-1L.
[0023] FIGS. 1C-1E show (C) the cellular topology of the
recombinant, full-length, C-terminal myc epitope-tagged Apo-2
ligand expressed in human 293 cells, as determined by FACS analysis
using anti-epitope antibody; (D) the size and subunit structure of
recombinant, His.sub.10 epitope-tagged soluble Apo-2 expressed in
recombinant baculovirus-infected insect cells and purified by
Ni.sup.2+-chelate affinity chromatography, as determined with
(lanes 2, 3) or without (lane 1) chemical crosslinking followed by
SDS-PAGE and silver staining; (E) the size and subunit structure of
recombinant, gD epitope-tagged, soluble Apo-2 ligand expressed in
metabolically labeled human 293 cells, as determined by
immunoprecipitation with anti-epitope antibody, followed by
SDS-PAGE and autoradiography.
[0024] FIGS. 2A-2E show the induction of apoptosis in B and T
lymphocyte cell lines by Apo-2 ligand. Apoptotic cells were
identified by characteristic morphological changes (A); by positive
fluorescence staining with propidium iodide (PI) and
FITC-conjugated annexin V, measured by flow cytometry (B-D); and by
analysis of internucleosomal DNA fragmentation (E).
[0025] FIGS. 3A-3C show the time course and the dose-dependence of
Apo-2 ligand-induced apoptosis and the lack of inhibition of Apo-2
ligand-induced apoptosis by soluble receptor-IgG-fusion proteins
based on the Fas/Apo-1 receptor, TNF-R1 receptor, or TNF-R2
receptor.
[0026] FIG. 4 shows the expression of Apo-2 ligand mRNA in human
fetal and human adult tissues, as measured by Northern blot
analysis.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
I. Definitions
[0027] The terms "Apo-2 ligand" and "Apo-2L" are used herein to
refer to a polypeptide sequence which includes amino acid residues
114-281, inclusive, residues 41-281, inclusive, residues 15-281,
inclusive, or residues 1-281, inclusive, of the amino acid sequence
shown in FIG. 1A, as well as biologically active deletional,
insertional, or substitutional variants of the above sequences. In
a preferred embodiment, the polypeptide sequence has at least
residues 114-281 of FIG. 1A. In another preferred embodiment, the
biologically active variants have at least about 80% sequence
identity, more preferably at least about 90% sequence identity, and
even more preferably, at least about 95% sequence identity with any
one of the above sequences. The definition encompasses Apo-2 ligand
isolated from an Apo-2 ligand source, such as from the human tissue
types described herein (see Example 8) or from another source, or
prepared by recombinant or synthetic methods. The present
definition of Apo-2 ligand excludes known EST sequences, such as
GenBank HHEA47M, T90422, R31020, H43566, H44565, H44567, H54628,
H44772, H54629, T82085, and T10524.
[0028] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising Apo-2 ligand, or a portion thereof,
fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope against which an antibody can be
made, yet is short enough such that it does not interfere with
activity of the Apo-2 ligand. The tag polypeptide preferably also
is fairly unique so that the antibody does not substantially
cross-react with other epitopes. Suitable tag polypeptides
generally have at least six amino acid residues and usually between
about 8 to about 50 amino acid residues (preferably, between about
10 to about 20 residues).
[0029] "Isolated," when used to describe the various proteins
disclosed herein, means protein that has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would typically interfere with diagnostic or
therapeutic uses for the protein, and may include enzymes,
hormones, and other proteinaceous or non-proteinaceous solutes. In
preferred embodiments, the protein will be purified (1) to a degree
sufficient to obtain at least 15 residues of N-terminal or internal
amino acid sequence by use of a spinning cup sequenator, or (2) to
homogeneity by SDS-PAGE under non-reducing or reducing conditions
using Coomassie blue or, preferably, silver stain. Isolated protein
includes protein in situ within recombinant cells, since at least
one component of the Apo-2 ligand natural environment will not be
present. Ordinarily, however, isolated protein will be prepared by
at least one purification step.
[0030] An "isolated" Apo-0.2 ligand nucleic acid molecule is a
nucleic acid molecule that is identified and separated from at
least one contaminant nucleic acid molecule with which it is
ordinarily associated in the natural source of the Apo-2 ligand
nucleic acid. An isolated Apo-2 ligand nucleic acid molecule is
other than in the form or setting in which it is found in nature.
Isolated Apo-2 ligand nucleic acid molecules therefore are
distinguished from the Apo-2 ligand nucleic acid molecule as it
exists in natural cells. However, an isolated Apo-2 ligand nucleic
acid molecule includes Apo-2 ligand nucleic acid molecules
contained in cells that ordinarily express Apo-2 ligand where, for
example, the nucleic acid molecule is in a chromosomal location
different from that of natural cells.
[0031] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0032] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0033] The term "antibody" is used in the broadest sense and
specifically covers single anti-Apo-2 ligand monoclonal antibodies
(including agonist and antagonist antibodies) and anti-Apo-2 ligand
antibody compositions with polyepitopic specificity.
[0034] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally-occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen.
[0035] The monoclonal antibodies herein include hybrid and
recombinant antibodies produced by splicing a variable (including
hypervariable) domain of an anti-Apo-2 ligand antibody with a
constant domain (e.g. "humanized" antibodies), or a light chain
with a heavy chain, or a chain from one species with a chain from
another species, or fusions with heterologous proteins, regardless
of species of origin or immunoglobulin class or subclass
designation, as well as antibody fragments (e.g., Fab,
F(ab').sub.2, and Fv), so long as they exhibit the desired
biological activity. See, e.g. U.S. Pat. No. 4,816,567 and Mage et
al., in Monoclonal Antibody Production Techniques and Applications,
pp. 79-97 (Marcel Dekker, Inc.: New York, 1987).
[0036] Thus, the modifier "monoclonal" indicates the character of
the antibody as being obtained from a substantially homogeneous
population of antibodies, and is not to be construed as requiring
production of the antibody by any particular method. For example,
the monoclonal antibodies to be used in accordance with the present
invention may be made by the hybridoma method first described by
Kohler and Milstein, Nature, 256:495 (1975), or may be made by
recombinant DNA methods such as described in U.S. Pat. No.
4,816,567. The "monoclonal antibodies" may also be isolated from
phage libraries generated using the techniques described in
McCafferty et al., Nature, 348:552-554 (1990), for example.
[0037] "Humanized" forms of non-human (e.g. murine) antibodies are
specific chimeric immunoglobulins, immunoglobulin chains, or
fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which residues from a complementary determining region (CDR) of
the recipient are replaced by residues from a CDR of a non-human
species (donor antibody) such as mouse, rat, or rabbit having the
desired specificity, affinity, and capacity. In some instances, Fv
framework region (FR)-residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore, the
humanized antibody may comprise residues which are found neither in
the recipient antibody nor in the imported CDR or framework
sequences. These modifications are made to further refine and
optimize antibody performance. In general, the humanized antibody
will comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin.
[0038] "Biologically active" for the purposes herein means having
the ability to induce or stimulate apoptosis in at least one type
of mammalian cell in vivo or ex vivo.
[0039] The terms "apoptosis" and "apoptotic activity" are used in a
broad sense and refer to the orderly or controlled form of cell
death in mammals that is typically accompanied by one or more
characteristic cell changes, including condensation of cytoplasm,
loss of plasma membrane microvilli, segmentation of the nucleus,
degradation of chromosomal DNA or loss of mitochondrial function.
This activity can be determined and measured, for instance, by cell
viability assays, FACS analysis or DNA electrophoresis.
[0040] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typically characterized
by unregulated cell growth. Examples of cancer include but are not
limited to, carcinoma, lymphoma, leukemia, blastoma, and sarcoma.
More particular examples of such cancers include squamous cell
carcinoma, small-cell lung cancer, non-small cell lung cancer,
pancreatic cancer, glioblastoma multiforme, cervical cancer,
stomach cancer, bladder cancer, hepatoma, breast cancer, colon
carcinoma, and head and neck cancer. In a preferred embodiment, the
cancer includes follicular lymphoma, carcinoma with p53 mutations,
or hormone-dependent cancer such as breast cancer, prostate cancer,
or ovarian cancer.
[0041] The terms "treating," "treatment," and "therapy" as used
herein refer to curative therapy, prophylactic therapy, and
preventative therapy.
[0042] The term "mammal" as used herein refers to any mammal
classified as a mammal, including humans, cows, horses, dogs and
cats. In a preferred embodiment of the invention, the mammal is a
human.
II. Compositions and Methods of the Invention
[0043] The present invention provides a novel cytokine related to
the TNF ligand family, the cytokine identified herein as "Apo-2
ligand." The predicted mature amino acid sequence of human Apo-2
ligand contains 281 amino acids, and has a calculated molecular
weight of approximately 32.5 kDa and an isoelectric point of
approximately 7.63. There is no apparent signal sequence at the
N-terminus, although hydropathy analysis indicates the presence of
a hydrophobic region between residues 15 and 40. The absence of a
signal sequence and the presence of an internal hydrophobic region
suggests that Apo-2 ligand is a type II transmembrane protein. A
potential N-linked glycosylation site is located at residue 109 in
the putative extracellular region. The putative cytoplasmic region
comprises amino acid residues 1-14, the transmembrane region
comprises amino acid residues 15-40 and the extracellular region
comprises amino acid residues 41-281, shown in FIG. 1A. An Apo-2
ligand polypeptide comprising amino acid residues 114-281 of the
extracellular region, shown in FIG. 1A, is also described in the
Examples below.
[0044] A. Preparation of Apo-2 Ligand
[0045] The description below relates primarily to production of
Apo-2 ligand by culturing cells transformed or transfected with a
vector containing Apo-2 ligand nucleic acid and recovering the
polypeptide from the cell culture. It is of course, contemplated
that alternative methods, which are well known in the art, may be
employed to prepare Apo-2 ligand.
[0046] 1. Isolation of DNA Encoding Apo-2 Ligand
[0047] The DNA encoding Apo-2 ligand may be obtained from any cDNA
library prepared from tissue believed to possess the Apo-2 ligand
mRNA and to express it at a detectable level. Accordingly, human
Apo-2 ligand DNA can be conveniently obtained from a cDNA library
prepared from human tissues, such as the bacteriophage library of
human placental cDNA described in Example 1. The Apo-2
ligand-encoding gene may also be obtained from a genomic library or
by oligonucleotide synthesis.
[0048] Libraries can be screened with probes (such as antibodies to
the Apo-2 ligand or oligonucleotides of at least about 20-80 bases)
designed to identify the gene of interest or the protein encoded by
it. Examples of oligonucleotide probes are provided in Example 1.
Screening the cDNA or genomic library with the selected probe may
be conducted using standard procedures, such as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual (New York:
Cold Spring Harbor. Laboratory Press, 1989). An alternative means
to isolate the gene encoding Apo-2 ligand is to use PCR methodology
[Sambrook et al., supra; Dieffenbach et al., PCR Primer: A
Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)].
[0049] A preferred method of screening employs selected
oligonucleotide sequences to screen cDNA libraries from various
human tissues. Example 1 below describes techniques for screening a
cDNA library with two different oligonucleotide probes. The
oligonucleotide sequences selected as probes should be of
sufficient length and sufficiently unambiguous that false positives
are minimized. The oligonucleotide is preferably labeled such that
it can be detected upon hybridization to DNA in the library being
screened. Methods of labeling are well known in the art, and
include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling.
[0050] Nucleic acid having all the protein coding sequence may be
obtained by screening selected cDNA or genomic libraries using the
deduced amino acid sequence disclosed herein for the first time,
and, if necessary, using conventional primer extension procedures
as described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0051] Amino acid sequence variants of Apo-2-ligand can be prepared
by introducing appropriate nucleotide changes into the Apo-2 ligand
DNA, or by synthesis of the desired Apo-2 ligand polypeptide. Such
variants represent insertions, substitutions, and/or deletions of
residues within or at one or both of the ends of the intracellular
region, the transmembrane region, or the extracellular region, or
of the amino acid sequence shown for the full-length Apo-2 ligand
in FIG. 1A. Any combination of insertion, substitution, and/or
deletion can be made to arrive at the final construct, provided
that the final construct possesses the desired apoptotic activity
as defined herein. In a preferred embodiment, the variants have at
least about 80% sequence identity, more preferably, at least about
90% sequence identity, and even more preferably, at least about 95%
sequence identity with the sequences identified herein for the
intracellular, transmembrane, or extracellular regions of Apo-2
ligand, or the full-length sequence for Apo-2 ligand. The amino
acid changes also may alter post-translational processes of the
Apo-2 ligand, such as changing the number or position of
glycosylation sites or altering the membrane anchoring
characteristics.
[0052] Variations in the native sequence as described above can be
made using any of the techniques and guidelines for conservative
and non-conservative mutations set forth in U.S. Pat. No.
5,364,934. These include oligonucleotide-mediated (site-directed)
mutagenesis, alanine scanning, and PCR mutagenesis.
[0053] 2. Insertion of Nucleic Acid into a Replicable Vector
[0054] The nucleic acid (e.g., cDNA or genomic DNA) encoding native
or variant Apo-2 ligand may be inserted into a replicable vector
for further cloning (amplification of the DNA) or for expression.
Various vectors are publicly available. The vector components
generally include, but are not limited to, one or more of the
following: a signal sequence, an origin of replication, one or more
marker genes, an enhancer element, a promoter, and a transcription
termination sequence, each of which is described below.
[0055] (i) Signal Sequence Component
[0056] The Apo-2 ligand may be produced recombinantly not only
directly, but also as a fusion polypeptide with a heterologous
polypeptide, which may be a signal sequence or other polypeptide
having a specific cleavage site at the N-terminus of the mature
protein or polypeptide. In general, the signal sequence may be a
component of the vector, or it may be a part of the Apo-2 ligand
DNA that is inserted into the vector. The heterologous signal
sequence selected preferably is one that is recognized and
processed (i.e., cleaved by a signal peptidase) by the host cell.
The signal sequence may be a prokaryotic signal sequence selected,
for example, from the group of the alkaline phosphatase,
penicillinase, lpp, or heat-stable enterotoxin II leaders. For
yeast secretion the signal sequence may be, e.g., the yeast
invertase leader, alpha factor leader (including Saccharomyces and
Kluyveromyces .alpha.-factor leaders, the latter described in U.S.
Pat. No. 5,010,182), or acid phosphatase leader, the C. albicans
glucoamylase leader (EP 362,179 published 4 Apr. 1990), or the
signal described in WO 90/13646 published 15 Nov. 1990. In
mammalian cell expression the native Apo-2 ligand presequence that
normally directs insertion of Apo-2 ligand in the cell membrane of
human cells in vivo is satisfactory, although other mammalian
signal sequences may be used to direct secretion of the protein,
such as signal sequences from secreted polypeptides of the same or
related species, as well as viral secretory leaders, for example,
the herpes simplex glycoprotein D signal.
[0057] The DNA for such precursor region is preferably ligated in
reading frame to DNA encoding Apo-2 ligand.
[0058] (ii) Origin of Replication Component
[0059] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Generally, in cloning vectors this sequence is
one that enables the vector to replicate independently of the host
chromosomal DNA, and includes origins of replication or
autonomously replicating sequences. Such sequences are well known
for a variety of bacteria, yeast, and viruses. The origin of
replication from the plasmid pBR322 is suitable for most
Gram-negative bacteria, the 2.mu. plasmid origin is suitable for
yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or
BPV) are useful for cloning vectors in mammalian cells. Generally,
the origin of replication component is not needed for mammalian
expression vectors (the SV40 origin may typically be used because
it contains the early promoter).
[0060] Most expression vectors are "shuttle" vectors, i.e., they
are capable of replication in at least one class of organisms but
can be transfected into another organism for expression. For
example, a vector is cloned in E. coli and then the same vector is
transfected into yeast or mammalian cells for expression even
though it is not capable of replicating independently of the host
cell chromosome.
[0061] DNA may also be amplified by insertion into the host genome.
This is readily accomplished using Bacillus species as hosts, for
example, by including in the vector a DNA sequence that is
complementary to a sequence found in Bacillus genomic DNA.
Transfection of Bacillus with this vector results in homologous
recombination with the genome and insertion of Apo-2 ligand DNA.
However, the recovery of genomic DNA encoding Apo-2 ligand is more
complex than that of an exogenously replicated vector because
restriction enzyme digestion is required to excise the Apo-2 ligand
DNA.
[0062] (iii) Selection Gene Component
[0063] Expression and cloning vectors typically contain a selection
gene, also termed a selectable marker. This gene encodes a protein
necessary for the survival or growth of transformed host cells
grown in a selective culture medium. Host cells not transformed
with the vector containing the selection gene will not survive in
the culture medium. Typical selection genes encode proteins that
(a) confer resistance to antibiotics or other toxins, e.g.,
ampicillin, neomycin, methotrexate, or tetracycline, (b) complement
auxotrophic deficiencies, or (c) supply critical nutrients not
available from complex media, e.g., the gene encoding D-alanine
racemase for Bacilli.
[0064] One example of a selection scheme utilizes a drug to arrest
growth of a host cell. Those cells that are successfully
transformed with a heterologous gene produce a protein conferring
drug resistance and thus survive the selection regimen. Examples of
such dominant selection use the drugs neomycin [Southern et al., J.
Molec. Appl. Genet., 1:327 (1982)], mycophenolic acid (Mulligan et
al., Science, 209:1422 (1980)] or hygromycin [Sugden et al., Mol.
Cell. Biol., 5:410-413 (1985)]. The three examples given above
employ bacterial genes under eukaryotic control to convey
resistance to the appropriate drug G418 or neomycin (geneticin),
xgpt (mycophenolic acid), or hygromycin, respectively.
[0065] Another example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the Apo-2 ligand nucleic acid, such as DHFR or thymidine
kinase. The mammalian cell transformants are placed under selection
pressure that only the transformants are uniquely adapted to
survive by virtue of having taken up the marker. Selection pressure
is imposed by culturing the transformants under conditions in which
the concentration of selection agent in the medium is successively
changed, thereby leading to amplification of both the selection
gene and the DNA that encodes Apo-2 ligand. Amplification is the
process by which genes in greater demand for the production of a
protein critical for growth are reiterated in tandem within the
chromosomes of successive generations of recombinant cells.
Increased quantities of Apo-2 ligand are synthesized from the
amplified DNA. Other examples of amplifiable genes include
metallothionein-I and -II, adenosine deaminase, and ornithine
decarboxylase.
[0066] Cells transformed with the DHFR selection gene may first be
identified by culturing all of the transformants in a culture
medium that contains methotrexate (Mtx), a competitive antagonist
of DHFR. An appropriate host cell when wild-type DHFR is employed
is the Chinese hamster ovary (CHO) cell line deficient in DHFR
activity, prepared and propagated as described by Urlaub et al.,
Proc. Natl. Acad. Sci. USA, 77:4216 (1980). The transformed cells
are then exposed to increased levels of methotrexate. This leads to
the synthesis of multiple copies of the DHFR gene, and,
concomitantly, multiple copies of other DNA comprising the
expression vectors, such as the DNA encoding Apo-2 ligand. This
amplification technique can be used with any otherwise suitable
host, e.g., ATCC No. CCL61 CHO-K1, notwithstanding the presence of
endogenous DHFR if, for example, a mutant DHFR gene that is highly
resistant to Mtx is employed (EP 117,060).
[0067] Alternatively, host cells (particularly wild-type hosts that
contain endogenous DHFR) transformed or co-transformed with DNA
sequences encoding Apo-2 ligand, wild-type DHFR protein, and
another selectable marker such as aminoglycoside
3'-phosphotransferase (APH) can be selected by cell growth in
medium containing a selection agent for the selectable marker such
as an aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or
G418. See U.S. Pat. No. 4,965,199.
[0068] A suitable selection gene for use in yeast is the trp1 gene
present in the yeast plasmid YRp7 [Stinchcomb et al., Nature,
282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et
al., Gene, 10:157 (1980)]. The trp1 gene provides a selection
marker for a mutant strain of yeast lacking the ability to grow in
tryptophan, for example, ATCC No. 44076 or PEP4-1 [(Jones,
Genetics, 85:12 (1977)]. The presence of the trp1 lesion in the
yeast host cell genome then provides an effective environment for
detecting transformation by growth in the absence of tryptophan.
Similarly, Leu2-deficient yeast strains (ATCC 20,622 or 38,626) are
complemented by known plasmids bearing the Leu2 gene.
[0069] In addition, vectors derived from the 1.6 .mu.m circular
plasmid pKD1 can be used for transformation of Kluyveromyces yeasts
[Bianchi et al., Curr. Genet., 12:185 (1987)]. More recently, an
expression system for large-scale production of recombinant calf
chymosin was reported for K. lactis [Van den Berg, Bio/Technology,
8:135 (1990)]. Stable multi-copy expression vectors for secretion
of mature recombinant human serum albumin by industrial strains of
Kluyveromyces have also been disclosed [Fleer et al.,
Bio/Technology, 9:968-975 (1991)].
[0070] (iv) Promoter Component
[0071] Expression and cloning vectors usually contain a promoter
that is recognized by the host organism and is operably linked to
the Apo-2 ligand nucleic acid sequence. Promoters are untranslated
sequences located upstream (5') to the start codon of a structural
gene (generally within about 100 to 1000 bp) that control the
transcription and translation of particular nucleic acid sequence,
such as the Apo-2 ligand nucleic acid sequence, to which they are
operably linked. Such promoters typically fall into two classes,
inducible and constitutive. Inducible promoters are promoters that
initiate increased levels of transcription from DNA under their
control in response to some change in culture conditions, e.g., the
presence or absence of a nutrient or a change in temperature. At
this time a large number of promoters recognized by a variety of
potential host cells are well known. These promoters are operably
linked to Apo-2 ligand encoding DNA by removing the promoter from
the source DNA by restriction enzyme digestion and inserting the
isolated promoter sequence into the vector. Both the native Apo-2
ligand promoter sequence and many heterologous promoters may be
used to direct amplification and/or expression of the Apo-2 ligand
DNA.
[0072] Promoters suitable for use with prokaryotic hosts include
the .beta.-lactamase and lactose promoter systems [Chang et al.,
Nature, 275:615 (1978); Goeddel et al., Nature, 281:544 (1979)],
alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel,
Nucleic Acids Res., 8:4057 (1980); EP 36,776], and hybrid promoters
such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci.
USA, 80:21-25 (1983)]. However, other known bacterial promoters are
suitable. Their nucleotide sequences have been published, thereby
enabling a skilled worker operably to ligate them to DNA encoding
Apo-2 ligand [Siebenlist et al., Cell, 20:269 (1980)] using linkers
or adaptors to supply any required restriction sites. Promoters for
use in bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA encoding Apo-2 ligand.
[0073] Promoter sequences are known for eukaryotes. Virtually all
eukaryotic genes have an AT-rich region located approximately 25 to
30 bases upstream from the site where transcription is initiated.
Another sequence found 70 to 80 bases upstream from the start of
transcription of many genes is a CXCAAT region where X may be any
nucleotide. At the 3' end of most eukaryotic genes is an AATAAA
sequence that may be the signal for addition of the poly A tail to
the 3' end of the coding sequence. All of these sequences are
suitably inserted into eukaryotic expression vectors.
[0074] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman
et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic
enzymes [Hess et al., J. Adv. Enzyme Req., 7:149 (1968); Holland,
Bibchemistry, 17:4900 (1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0075] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657. Yeast enhancers also are advantageously used with yeast
promoters.
[0076] Apo-2 ligand transcription from vectors in mammalian host
cells is controlled, for example, by promoters obtained from the
genomes of viruses such as polyoma virus, fowlpox virus (UK
2,211,504 published 5 Jul. 1989), adenovirus (such as Adenovirus
2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus and most preferably Simian Virus 40
(SV40), from heterologous mammalian promoters, e.g., the actin
promoter or an immunoglobulin promoter, from heat-shock promoters,
and from the promoter normally associated with the Apo-2 ligand
sequence, provided such promoters are compatible with the host cell
systems.
[0077] The early and late promoters of the SV40 virus are
conveniently obtained as an SV40 restriction fragment that also
contains the SV40 viral origin of replication [Fiers et al.,
Nature, 273:113 (1978); Mulligan and Berg, Science, 209:1422-1427
(1980); Pavlakis et al., Proc. Natl. Acad. Sci. USA, 78:7398-7402
(1981)]. The immediate early promoter of the human cytomegalovirus
is conveniently obtained as a HindIII E restriction fragment
[Greenaway et al., Gene, 18:355-360 (1982)]. A system for
expressing DNA in mammalian hosts using the bovine papilloma virus
as a vector is disclosed in U.S. Pat. No. 4,419,446. A modification
of this system is described in U.S. Pat. No. 4,601,978 [See also
Gray et al., Nature, 295:503-508 (1982) on expressing cDNA encoding
immune interferon in monkey cells; Reyes et al., Nature,
297:598-601 (1982) on expression of human .beta.-interferon cDNA in
mouse cells under the control of a thymidine kinase promoter from
herpes simplex virus; Canaani and Berg, Proc. Natl. Acad. Sci. USA
79:5166-5170 (1982) on expression of the human interferon .beta.1
gene in cultured mouse and rabbit cells; and Gorman et al., Proc.
Natl. Acad. Sci. USA, 79:6777-6781 (1982) on expression of
bacterial CAT sequences in CV-1 monkey kidney cells, chicken embryo
fibroblasts, Chinese hamster ovary cells, HeLa cells, and mouse
NIH-3T3 cells using the Rous sarcoma virus long terminal repeat as
a promoter].
[0078] (v) Enhancer Element Component
[0079] Transcription of a DNA encoding the Apo-2 ligand of this
invention by higher eukaryotes may be increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp, that act on a
promoter to increase its transcription. Enhancers are relatively
orientation and position independent, having been found 5' [Laimins
et al., Proc. Natl. Acad. Sci. USA, 78:993 (1981)] and 3' [Lusky et
al., Mol. Cell. Bio., 3:1108 (1983]) to the transcription unit,
within an intron [Banerji et al., Cell, 33:729 (1983)], as well as
within the coding sequence itself [Osborne et al., Mol. Cell. Bio.,
4:1293 (1984)]. Many enhancer sequences are now known from
mammalian genes (globin, elastase, albumin, .alpha.-fetoprotein,
and insulin). Typically, however, one will use an enhancer from a
eukaryotic cell virus. Examples include the SV40 enhancer on the
late side of the replication origin (bp 100-270), the
cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus enhancers.
See also Yaniv, Nature, 297:17-18 (1982) on enhancing elements for
activation of eukaryotic promoters. The enhancer may be spliced
into the vector at a position 5' or 3' to the Apo-2 ligand-encoding
sequence, but is preferably located at a site 5' from the
promoter.
[0080] (vi) Transcription Termination Component
[0081] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding Apo-2
ligand.
[0082] (vii) Construction and Analysis of Vectors
[0083] Construction of suitable vectors containing one or more of
the above-listed components employs standard ligation techniques.
Isolated plasmids or DNA fragments are cleaved, tailored, and
re-ligated in the form desired to generate the plasmids
required.
[0084] For analysis to confirm correct sequences in plasmids
constructed, the ligation mixtures can be used to transform E. coli
K12 strain 294 (ATCC 31,446) and successful transformants selected
by ampicillin or tetracycline resistance where appropriate.
Plasmids from the transformants are prepared, analyzed by
restriction endonuclease digestion, and/or sequenced by the method
of Messing et al., Nucleic Acids Res., 9:309 (1981) or by the
method of Maxam et al., Methods in Enzymology, 65:499 (1980).
[0085] (viii) Transient Expression Vectors
[0086] Expression vectors that provide for the transient expression
in mammalian cells of DNA encoding Apo-2 ligand may be employed. In
general, transient expression involves the use of an expression
vector that is able to replicate efficiently in a host cell, such
that the host cell accumulates many copies of the expression vector
and, in turn, synthesizes high levels of a desired polypeptide
encoded by the expression vector [Sambrook et al., supra].
Transient expression systems, comprising a suitable expression
vector and a host cell, allow for the convenient positive
identification of polypeptides encoded by cloned DNAs, as well as
for the rapid screening of such polypeptides for desired biological
or physiological properties. Thus, transient expression systems are
particularly useful in the invention for purposes of identifying
analogs and variants of Apo-2 ligand that are biologically active
Apo-2 ligand.
[0087] (ix) Suitable Exemplary Vertebrate Cell Vectors
[0088] Other methods, vectors, and host cells suitable for
adaptation to the synthesis of Apo-2 ligand in recombinant
vertebrate cell culture are described in Gething et al., Nature,
293:620-625 (198.1); Mantei et al., Nature, 281:40-46 (1979); EP
117,060; and EP 117,058. A particularly useful plasmid for
mammalian cell culture expression of Apo-2 ligand is pRK5 [EP
307,247; also described in Example 1] or pSVI6B [WO 91/08291
published 13 Jun. 1991].
[0089] 3. Selection and Transformation of Host Cells
[0090] Suitable host cells for cloning or expressing the DNA in the
vectors herein are the prokaryote, yeast, or higher eukaryote cells
described above. Suitable prokaryotes for this purpose include but
are not limited to eubacteria, such as Gram-negative or
Gram-positive organisms, for example, Enterobacteriaceae such as
Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella,
Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g.,
Serratia marcescans, and Shigella, as well as Bacilli such as B.
subtilis and B. licheniformis (e.g., B. licheniformis 41P disclosed
in DD 266,710 published 12 Apr. 1989), Pseudomonas such as P.
aeruginosa, and Streptomyces. Preferably, the host cell should
secrete minimal amounts of proteolytic enzymes.
[0091] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for Apo-2 ligand-encoding vectors. Saccharomyces cerevisiae, or
common baker's yeast, is the most commonly used among lower
eukaryotic host microorganisms. However, a number of other genera,
species, and strains are commonly available and useful herein.
[0092] Suitable host cells for the expression of glycosylated Apo-2
ligand are derived from multicellular organisms. Such host cells
are capable of complex processing and glycosylation activities. In
principle, any higher eukaryotic cell culture is workable, whether
from vertebrate or invertebrate culture. Examples of invertebrate
cells include plant and insect cells. Numerous baculoviral strains
and variants and corresponding permissive insect host cells from
hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti
(mosquito), Aedes albopictus (mosquito), Drosophila melanogaster
(fruitfly), and Bombyx mori have been identified [See, e.g., Luckow
et al., Bio/Technology, 6:47-55 (1988); Miller et al., in Genetic
Engineering, Setlow et al., eds., Vol. 8 (Plenum Publishing, 1986),
pp. 277-279; and Maeda et al., Nature, 315:592-594 (1985)]. A
variety of viral strains for transfection are publicly available,
e.g., the L-1 variant of Autographa californica NPV and the Bm-5
strain of Bombyx mori NPV, and such viruses may be used as the
virus herein according to the present invention, particularly for
transfection of Spodoptera frugiperda ("Sf9") cells, described in
Example 2.
[0093] Plant cell cultures of cotton, corn, potato, soybean,
petunia, tomato, and tobacco can be utilized as hosts. Typically,
plant cells are transfected by incubation with certain strains of
the bacterium Agrobacterium tumefaciens, which has been previously
manipulated to contain the Apo-2 ligand-encoding DNA. During
incubation of the plant cell culture with A. tumefaciens, the DNA
encoding the Apo-2 ligand is transferred to the plant cell host
such that it is transfected, and will, under appropriate
conditions, express the Apo-2 ligand-encoding DNA. In addition,
regulatory and signal sequences compatible with plant cells are
available, such as the nopaline synthase promoter and
polyadenylation signal sequences [Depicker et al., J. Mol. Appl.
Gen., 1:561 (1982)]. In addition, DNA segments isolated from the
upstream region of the T-DNA 780 gene are capable of activating or
increasing transcription levels of plant-expressible genes in
recombinant DNA-containing plant tissue [EP 321,196 published 21
Jun. 1989].
[0094] Propagation of vertebrate cells in culture (tissue culture)
is also well known in the art [See, e.g., Tissue Culture, Academic
Press, Kruse and Patterson, editors (1973)]. Examples of useful
mammalian host cell lines are monkey kidney CV1 line transformed by
SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or
293 cells subcloned for growth in suspension culture, Graham et
al., J. Gen Virol., 36:59 (1977)); baby hamster kidney cells (BHK,
ATCC CCL 10); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and
Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli
cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); monkey
kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells
(VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA,
ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat
liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC
CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor
(MMT 060562, ATCC CCL51); TR1 cells (Mather et al., Annals N.Y.
Acad. Sci., 383:44-68 (1982)); MRC 5 cells; and FS4 cells.
[0095] Host cells are transfected and preferably transformed with
the above-described expression or cloning vectors for Apo-2 ligand
production and cultured in conventional nutrient media modified as
appropriate for inducing promoters, selecting transformants, or
amplifying the genes encoding the desired sequences.
[0096] Transfection refers to the taking up of an expression vector
by a host cell whether or not any coding sequences are in fact
expressed. Numerous methods of transfection are known to the
ordinarily skilled artisan, for example, CaPO.sub.4 and
electroporation. Successful transfection is generally recognized
when any indication of the operation of this vector occurs within
the host cell.
[0097] Transformation means introducing DNA into an organism so
that the DNA is replicable, either as an extrachromosomal element
or by chromosomal integrant. Depending on the host cell used,
transformation is done using standard techniques appropriate to
such cells. The calcium treatment employing calcium chloride, as
described in Sambrook et al., supra, or electroporation is
generally used for prokaryotes or other cells that contain
substantial cell-wall barriers. Infection with Agrobacterium
tumefaciens is used for transformation of certain plant cells, as
described by Shaw et al., Gene, 23:315 (1983) and WO 89/05859
published 29 Jun. 1989. In addition, plants may be transfected
using ultrasound treatment as described in WO 91/00358 published 10
Jan. 1991.
[0098] For mammalian cells without such cell walls, the calcium
phosphate precipitation method of Graham and van der Eb, Virology,
52:456-457 (1978) is preferred. General aspects of mammalian cell
host system transformations have been described in U.S. Pat. No.
4,399,216. Transformations into yeast are typically carried out
according to the method of Van Solingen et al., J. Bact., 130:946
(1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA) 76:3829
(1979). However, other methods for introducing DNA into cells, such
as by nuclear microinjection, electroporation, bacterial protoplast
fusion with intact cells, or polycations, e.g., polybrene,
polyornithine, may also be used. For various techniques for
transforming mammalian cells, see Keown et al., Methods in
Enzymology, 185:527-537 (1990) and Mansour et al., Nature,
336:348-352 (1988).
[0099] 4. Culturing the Host Cells
[0100] Prokaryotic cells used to produce Apo-2 ligand may be
cultured in suitable media as described generally in Sambrook et
al., supra.
[0101] The mammalian host cells used to produce Apo-2 ligand may be
cultured in a variety of media. Examples of commercially available
media include Ham's F10 (Sigma), Minimal Essential Medium ("MEM",
Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium
("DMEM", Sigma). Any such media may be supplemented as necessary
with hormones and/or other growth factors (such as insulin,
transferrin, or epidermal growth factor), salts (such as sodium
chloride, calcium, magnesium, and phosphate), buffers (such as
HEPES), nucleosides (such as adenosine and thymidine), antibiotics
(such as Gentamycin.TM. drug), trace elements (defined as inorganic
compounds usually present at final concentrations in the micromolar
range), and glucose or an equivalent energy source. Any other
necessary supplements may also be included at appropriate
concentrations that would be known to those skilled in the art. The
culture conditions, such as temperature, pH, and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan.
[0102] In general, principles, protocols, and practical techniques
for maximizing the productivity of mammalian cell cultures can be
found in Mammalian Cell Biotechnology: a Practical Approach, M.
Butler, ed. (IRL Press, 1991).
[0103] The host cells referred to in this disclosure encompass
cells in culture as well as cells that are within a host
animal.
[0104] 5. Detecting Gene Amplification/Expression
[0105] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Various labels may
be employed, most commonly radioisotopes, and particularly
.sup.32P. However, other techniques may also be employed, such as
using biotin-modified nucleotides for introduction into a
polynucleotide. The biotin then serves as the site for binding to
avidin or antibodies, which may be labeled with a wide variety of
labels, such as radionucleotides, fluorescers or enzymes.
Alternatively, antibodies may be employed that can recognize
specific duplexes, including DNA duplexes, RNA duplexes, and
DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in
turn may be labeled and the assay may be carried out where the
duplex is bound to a surface, so that upon the formation of duplex
on the surface, the presence of antibody bound to the duplex can be
detected.
[0106] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. With
immunohistochemical staining techniques, a cell sample is prepared,
typically by dehydration and fixation, followed by reaction with
labeled antibodies specific for the gene product coupled, where the
labels are usually visually detectable, such as enzymatic labels,
fluorescent labels, luminescent labels, and the like.
[0107] Antibodies useful for immunohistochemical staining and/or
assay of sample fluids may be either monoclonal or polyclonal, and
may be prepared in any mammal. Conveniently, the antibodies may be
prepared against a native Apo-2 ligand polypeptide or against a
synthetic peptide based on the DNA sequences provided herein or
against exogenous sequence fused to Apo-2 ligand DNA and encoding a
specific antibody epitope.
[0108] 6. Purification of Apo-2 Ligand Polypeptide
[0109] Apo-2 ligand preferably is recovered from the culture medium
as a secreted polypeptide, although it also may be recovered from
host cell lysates when directly produced without a secretory
signal. If the Apo-2 ligand is membrane-bound, it can be released
from the membrane using a suitable detergent solution (e.g.
Triton-X 100) or its extracellular region may be released by
enzymatic cleavage.
[0110] When Apo-2 ligand is produced in a recombinant cell other
than one of human origin, the Apo-2 ligand is free of proteins or
polypeptides of human origin. However, it is usually necessary to
purify Apo-2 ligand from recombinant cell proteins or polypeptides
to obtain preparations that are substantially homogeneous as to
Apo-2 ligand. As a first step, the culture medium or lysate may be
centrifuged to remove particulate cell debris. Apo-2 ligand
thereafter is purified from contaminant soluble proteins and
polypeptides, with the following procedures being exemplary of
suitable purification procedures: by fractionation on an
ion-exchange column; ethanol precipitation; reverse phase HPLC;
chromatography on silica or on a cation-exchange resin such as
DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation;
gel filtration using, for example, Sephadex G-75; and protein A
Sepharose columns to remove contaminants such as IgG.
[0111] In a preferred embodiment, the Apo-2 ligand can be isolated
by affinity-chromatography, as described in Example 3.
[0112] Apo-2 ligand variants in which residues have been deleted,
inserted, or substituted are recovered in the same fashion as
native Apo-2 ligand, taking account of any substantial changes in
properties occasioned by the variation. For example, preparation of
an Apo-2 ligand fusion with another protein or polypeptide, e.g., a
bacterial or viral antigen, facilitates purification; an
immunoaffinity column containing antibody to the antigen can be
used to adsorb the fusion polypeptide. In a preferred embodiment,
an extracellular sequence of Apo-2 ligand is fused to a His.sub.10
peptide and purified by Ni.sup.2+-chelate affinity
chromatography.
[0113] A protease inhibitor such as phenyl methyl sulfonyl fluoride
(PMSF) also may be useful to inhibit proteolytic degradation during
purification, and antibiotics may be included to prevent the growth
of adventitious contaminants. One skilled in the art will
appreciate that purification methods suitable for native Apo-2
ligand may require modification to account for changes in the
character of Apo-2 ligand or its variants upon expression in
recombinant cell culture.
[0114] 7. Covalent Modifications of Apo-2 Ligand Polypeptides
[0115] Covalent modifications of Apo-2 ligand are included within
the scope of this invention. Both native Apo-2 ligand and amino
acid sequence variants of the Apo-2 ligand may be covalently
modified. One type of covalent modification of the Apo-2 ligand is
introduced into the molecule by reacting targeted amino acid
residues of the Apo-2 ligand with an organic derivatizing agent
that is capable of reacting with selected side chains or the N- or
C-terminal residues of the Apo-2 ligand.
[0116] Derivatization with bifunctional agents is useful for
crosslinking Apo-2 ligand to a water-insoluble support matrix or
surface for use in the method for purifying anti-Apo-2 ligand
antibodies, and vice-versa. Commonly used crosslinking agents
include, e.g., 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azido-salicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidyl-propionate), and bifunctional
maleimides such as bis-N-maleimido-1,8-octane. Derivatizing agents
such as methyl-3-[(p-azidophenyl)-dithio]propioimidate yield
photoactivatable intermediates that are capable of forming
crosslinks in the presence of light. Alternatively, reactive
water-insoluble matrices such as cyanogen bromide-activated
carbohydrates and the reactive substrates described in U.S. Pat.
Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and
4,330,440 are employed for protein immobilization.
[0117] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the .alpha.-amino groups of lysine, arginine, and
histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W.H. Freeman & Co., San. Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group. The modified forms of the
residues fall within the scope of the present invention.
[0118] Another type of covalent modification of the Apo-2 ligand
polypeptide included within the scope of this invention comprises
altering the native glycosylation pattern of the polypeptide.
"Altering the native glycosylation pattern" is intended for
purposes herein to mean deleting one or more carbohydrate moieties
found in native Apo-2 ligand, and/or adding one or more
glycosylation sites that are not present in the native Apo-2
ligand.
[0119] Glycosylation of polypeptides is typically either N-linked
or O-linked. N-linked refers to the attachment of the carbohydrate
moiety to the side chain of an asparagine residue. The tripeptide
sequences asparagine-X-serine and asparagine-X-threonine, where X
is any amino acid except proline, are the recognition sequences for
enzymatic attachment of the carbohydrate moiety to the asparagine
side chain. Thus, the presence of either of these tripeptide
sequences in a polypeptide creates a potential glycosylation site.
O-linked glycosylation refers to the attachment of one of the
sugars N-aceylgalactosamine, galactose, or xylose to a
hydroxylamino acid, most commonly serine or threonine, although
5-hydroxyproline or 5-hydroxylysine may also be used.
[0120] Addition of glycosylation sites to the Apo-2 ligand
polypeptide may be accomplished by altering the amino acid sequence
such that it contains one or more of the above-described tripeptide
sequences (for N-linked glycosylation sites). The alteration may
also be made by the addition of, or substitution by, one or more
serine or threonine residues to the native Apo-2 ligand sequence
(for O-linked glycosylation sites). The Apo-2 ligand amino acid
sequence may optionally be altered through changes at the DNA
level, particularly by mutating the DNA encoding the Apo-2 ligand
polypeptide at preselected bases such that codons are generated
that will translate into the desired amino acids. The DNA
mutation(s) may be made using methods described above and in U.S.
Pat. No. 5,364,934, supra.
[0121] Another means of increasing the number of carbohydrate
moieties on the Apo-2 ligand polypeptide is by chemical or
enzymatic coupling of glycosides to the polypeptide. Depending on
the coupling mode used, the sugar(s) may be attached to (a)
arginine and histidine, (b) free carboxyl groups, (c) free
sulfhydryl groups such as those of cysteine, (d) free hydroxyl
groups such as those of serine, threonine, or hydroxyproline, (e)
aromatic residues such as those of phenylalanine, tyrosine, or
tryptophan, or (f) the amide group of glutamine. These methods are
described in WO 87/05330 published 11 Sep. 1987, and in Aplin and
Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).
[0122] Removal of carbohydrate moieties present on the Apo-2 ligand
polypeptide may be accomplished chemically or enzymatically. For
instance, chemical deglycosylation by exposing the polypeptide to
the compound trifluoromethanesulfonic acid, or an equivalent
compound can result in the cleavage of most or all sugars except
the linking sugar (N-acetylglucosamine- or N-acetylgalactosamine),
while leaving the polypeptide intact. Chemical deglycosylation is
described by Hakimuddin, et al., Arch. Biochem. Biophys., 259:52
(1987) and by Edge et al., Anal. Biochem., 118:131 (1981).
Enzymatic cleavage of carbohydrate moieties on polypeptides can be
achieved by the use of a variety of endo- and exo-glycosidases as
described by Thotakura et al., Meth. Enzymol., 138:350 (1987).
[0123] Glycosylation at potential glycosylation sites may be
prevented by the use of the compound tunicamycin as described by
Duskin et al., J. Biol. Chem., 257:3105 (1982). Tunicamycin blocks
the formation of protein-N-glycoside linkages.
[0124] Another type of covalent modification of Apo-2 ligand
comprises linking the Apo-2 ligand polypeptide to one of a variety
of nonproteinaceous polymers, e.g., polyethylene glycol,
polypropylene glycol, or polyoxyalkylenes, in the manner set forth
in U.S. Pat. No. 4,640,835; 4,496,689; 4,301,144; 4,670,417;
4,791,192 or 4,179,337.
[0125] 8. Epitope-Tagged Apo-2 Ligand
[0126] The present invention also provides chimeric polypeptides
comprising Apo-2 ligand fused to another, heterologous polypeptide.
In one embodiment, the chimeric polypeptide comprises a fusion of
the Apo-2 ligand with a tag polypeptide which provides an epitope
to which an anti-tag antibody can selectively bind. The epitope tag
is generally placed at the amino- or carboxyl-terminus of the Apo-2
ligand. The presence of such epitope-tagged forms of the Apo-2
ligand can be detected using an antibody against the tag
polypeptide. Also, provision of the epitope tag enables the Apo-2
ligand to be readily purified by affinity purification using an
anti-tag antibody or another type of affinity matrix that binds to
the epitope tag.
[0127] Various tag polypeptides and their respective antibodies are
well known in the art. Examples include the flu HA tag polypeptide
and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165
(1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10
antibodies thereto [Evan et al., Molecular and Cellular Biology,
5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D
(gD) tag and its antibody [Paborsky et al., Protein Engineering,
3(6):547-553 (1990)]. Other tag polypeptides include the
Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; the
KT3 epitope peptide [Martin et al., Science, 255:192-194 (1992)];
an .alpha.-tubulin epitope peptide [Skinner et al., J. Biol. Chem.,
266:15163-15166 (1991)]; and the T7 gene 10 protein peptide tag
[Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397
(1990)]. Once the tag polypeptide has been selected, an antibody
thereto can be generated using the techniques disclosed herein.
[0128] Generally, epitope-tagged Apo-2 ligand may be constructed
and produced according to the methods described above for native
and variant Apo-2 ligand. Apo-2 ligand-tag polypeptide fusions are
preferably constructed by fusing the cDNA sequence encoding the
Apo-2 ligand portion in-frame to the tag polypeptide DNA sequence
and expressing the resultant DNA fusion construct in appropriate
host cells. Ordinarily, when preparing the Apo-2 ligand-tag
polypeptide chimeras of the present invention, nucleic acid
encoding the Apo-2 ligand will be fused at its 3' end to nucleic
acid encoding the N-terminus of the tag polypeptide, however 5'
fusions are also possible. Examples of epitope-tagged Apo-2 ligand
are described in further detail in Example 2 below.
[0129] Epitope-tagged Apo-2 ligand can be purified by affinity
chromatography using the anti-tag antibody. The matrix to which the
affinity antibody is attached may include, for instance, agarose,
controlled pore glass or poly(styrenedivinyl)benzene). The
epitope-tagged Apo-2 ligand can then be eluted from the affinity
column using techniques known in the art.
[0130] B. Therapeutic Uses for Apo-2 Ligand
[0131] Apo-2 ligand, as disclosed in the present specification, can
be employed therapeutically to induce apoptosis in mammalian cells.
Generally, the methods for inducing apoptosis in mammalian cells
comprise exposing the cells to an effective amount of Apo-2 ligand.
This can be accomplished in vivo or ex vivo in accordance, for
instance, with the methods described below and in the Examples. It
is contemplated that the methods for inducing apoptosis can be
employed in therapies for particular pathological conditions which
are characterized by decreased levels of apoptosis. Examples of
such pathological conditions include autoimmune disorders like
lupus and immune-mediated glomerular nephritis, and cancer.
Therapeutic application of Apo-2 ligand for the treatment of cancer
is described in detail below.
[0132] In the methods for treating cancer, Apo-2 ligand is
administered to a mammal diagnosed as having cancer. It is of
course contemplated that the Apo-2 ligand can be employed in
combination with still other therapeutic compositions and
techniques, including other apoptosis-inducing agents,
chemotherapy, radiation therapy, and surgery.
[0133] The Apo-2 ligand is preferably administered to the mammal in
a pharmaceutically-acceptable carrier. Suitable carriers and their
formulations are described in Remington's Pharmaceutical Sciences,
16th ed., 1980, Mack Publishing Co., edited by Oslo et al.
Typically, an appropriate amount of a pharmaceutically-acceptable
salt is used in the formulation to render the formulation isotonic.
Examples of the pharmaceutically-acceptable carrier include saline,
Ringer's solution and dextrose solution. The pH of the solution is
preferably from about 5 to about 8, and more preferably from about
7.4 to about 7.8. It will be apparent to those persons skilled in
the art that certain carriers may be more preferable depending
upon, for instance, the route of administration and concentration
of Apo-2 ligand being administered.
[0134] The Apo-2 ligand can be administered to the mammal by
injection (e.g., intravenous, intraperitoneal, subcutaneous,
intramuscular), or by other methods such as infusion that ensure
its delivery to the bloodstream in an effective form. It is also
contemplated that the Apo-2 ligand can be administered by in vivo
or ex vivo gene therapy.
[0135] Effective dosages and schedules for administering Apo-2
ligand may be determined empirically, and making such
determinations is within the skill in the art. It is presently
believed that an effective dosage or amount of Apo-2 ligand used
alone may range from about 1 .mu.g/kg to about 100 mg/kg of body
weight or more per day. Interspecies scaling of dosages can be
performed in a manner known in the art, e.g., as disclosed in
Mordenti et al., Pharmaceut. Res., 8:1351 (1991). Those skilled in
the art will understand that the dosage of Apo-2 ligand that must
be administered will vary depending on, for example, the mammal
which will receive the Apo-2 ligand, the route of administration,
and other drugs or therapies being administered to the mammal.
[0136] The one or more other therapies administered to the mammal
may include but are not limited to, chemotherapy and radiation
therapy, immunoadjuvants, cytokines, and antibody-based therapies.
Examples interleukins (e.g., IL-1, IL-2, IL-3, IL-6), leukemia
inhibitory factor, interferons, TGF-beta, erythropoietin,
thrombopoietin, and HER-2 antibody. Other agents known to induce
apoptosis in mammalian cells may also employed, and such agents
include TNF-.alpha., TNF-.beta. (lymphotoxin-.alpha.), CD30 ligand,
4-1BB ligand, and Apo-1 ligand.
[0137] Chemotherapies contemplated by the invention include
chemical substances or drugs which are known in the art and are
commercially available, such as Doxorubicin, 5-Fluorouracil,
Cytosine arabinoside ("Ara-C"), Cyclophosphamide, Thiotepa,
Busulfan, Cytoxin, Taxol, Methotrexate, Cisplatin, Melphalan,
Vinblastine and Carboplatin. Preparation and dosing schedules for
such chemotherapy may be used according to manufacturers,
instructions or as determined empirically by the skilled
practitioner. Preparation and dosing schedules for such
chemotherapy are also described in Chemotherapy Service Ed., M. C.
Perry, Williams & Wilkins, Baltimore, Md. (1992).
[0138] The chemotherapy is preferably administered in a
pharmaceutically-acceptable carrier, such as those described above
for Apo-2 ligand. The mode of administration of the chemotherapy
may be the same as employed for the Apo-2 ligand or it may be
administered to the mammal via a different mode. For example, the
Apo-2 ligand may be injected while the chemotherapy is administered
orally to the mammal.
[0139] Radiation therapy can be administered to the mammal
according to protocols commonly employed in the art and known to
the skilled artisan. Such therapy may include cesium, iridium,
iodine, or cobalt radiation. The radiation therapy may be whole
body irradiation, or may be directed locally to a specific site or
tissue in or on the body. Typically, radiation therapy is
administered in pulses over a period of time from about 1 to about
2 weeks. The radiation therapy may, however, be administered over
longer periods of time. Optionally, the radiation therapy may be
administered as a single dose or as multiple, sequential doses.
[0140] The Apo-2 ligand and one or more other therapies may be
administered to the mammal concurrently or sequentially.
[0141] Following administration of Apo-2 ligand and one or more
other therapies to the mammal, the mammal's cancer and
physiological condition can be monitored in various ways well known
to the skilled practitioner. For instance, tumor mass may be
observed physically, by biopsy or by standard x-ray imaging
techniques.
[0142] It is contemplated that Apo-2 ligand can be employed to
treat cancer cells ex vivo. Such ex vivo treatment may be useful in
bone marrow transplantation and particularly, autologous bone
marrow transplantation. For instance, treatment of cells or
tissue(s) containing cancer cells with Apo-2 ligand, and
optionally, with one or more other therapies, such as described
above, can be employed to induce apoptosis and substantially
deplete the cancer cells prior to transplantation in a recipient
mammal.
[0143] Cells or tissue(s) containing cancer cells are first
obtained from a donor mammal. The cells or tissue(s) may be
obtained surgically and preferably, are obtained aseptically. In
the method of treating bone marrow for transplantation, bone marrow
is obtained from the mammal by needle aspiration. The cells or
tissue(s) containing cancer cells are then treated with Apo-2
ligand, and optionally, with one or more other therapies, such as
described above. Bone marrow is preferably fractionated to obtain a
mononuclear cell fraction (such as by centrifugation over
ficoll-hypaque gradient) prior to treatment with Apo-2 ligand.
[0144] The treated cells or tissue(s) can then be infused or
transplanted into a recipient mammal. The recipient mammal may be
the same individual as the donor mammal or may be another,
heterologous mammal. For an autologous bone marrow transplant, the
mammal is treated prior to the transplant with an effective dose of
radiation or chemotherapy as known in the art and described for
example in Autologous Bone Marrow Transplantation: Proceedings of
the Third International Symposium, Dicke et al., eds., University
of Texas M.D. Anderson Hospital and Tumor Institute (1987).
[0145] C. Non-Therapeutic Uses for Apo-2 Ligand
[0146] The Apo-2 ligand of the invention also has utility in
non-therapeutic applications. Nucleic acid sequences encoding the
Apo-2 ligand may be used as a diagnostic for tissue-specific
typing. For example, procedures like in situ hybridization,
Northern and Southern blotting, and PCR analysis may be used to
determine whether DNA and/or RNA encoding Apo-2 ligand is present
in the cell type(s) being evaluated. Apo-2 ligand nucleic acid will
also be useful for the preparation of Apo-2 polypeptide by the
recombinant techniques described herein.
[0147] The isolated Apo-2 ligand may be used in quantitative
diagnostic assays as a control against which samples containing
unknown quantities of Apo-2 ligand may be prepared. Apo-2 ligand
preparations are also useful in generating antibodies, as standards
in assays for Apo-2 ligand (e.g., by labeling Apo-2 ligand for use
as a standard in a radioimmunoassay, radioreceptor assay, or
enzyme-linked immunoassay), in affinity purification techniques for
example, in identifying or in isolating a receptor that binds Apo-2
ligand, and in competitive-type receptor binding assays when
labeled with, for instance, radioiodine, enzymes, or
fluorophores.
[0148] D. Anti-Apo-2 Ligand Antibody Preparation
[0149] The present invention further provides anti-Apo-2
antibodies. Antibodies against Apo-2 ligand may be prepared as
follows. Exemplary antibodies include polyclonal, monoclonal,
humanized, bispecific, and heteroconjugate antibodies.
[0150] 1. Polyclonal Antibodies
[0151] The Apo-2 ligand antibodies may comprise polyclonal
antibodies. Methods of preparing polyclonal antibodies are known to
the skilled artisan. Polyclonal antibodies can be raised in a
mammal, for example, by one or more injections of an immunizing
agent and, if desired, an adjuvant. Typically, the immunizing agent
and/or adjuvant will be injected in the mammal by multiple
subcutaneous or intraperitoneal injections. The immunizing agent
may include the Apo-2 ligand polypeptide or a fusion protein
thereof. It may be useful to conjugate the immunizing agent to a
protein known to be immunogenic in the mammal being immunized.
Examples of such immunogenic proteins which may be employed include
but are not limited to keyhole limpet hemocyanin, serum albumin,
bovine thyroglobulin, and soybean trypsin inhibitor. An aggregating
agent such as alum may also be employed to enhance the mammal's
immune response. Examples of adjuvants which may be employed
include Freund's complete adjuvant and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The
immunization protocol may be selected by one skilled in the art
without undue experimentation. The mammal can then be bled, and the
serum assayed for antibody titer. If desired, the mammal can be
boosted until the antibody titer increases or plateaus.
[0152] 2. Monoclonal Antibodies
[0153] The Apo-2 ligand antibodies may, alternatively, be
monoclonal antibodies. Monoclonal antibodies may be prepared using
hybridoma methods, such as those described by Kohler and Milstein,
Nature, 256:495 (1975). In a hybridoma method, a mouse, hamster, or
other appropriate host animal, is typically immunized (such as
described above) with an immunizing agent to elicit lymphocytes
that produce or are capable of producing antibodies that will
specifically bind to the immunizing agent. Alternatively, the
lymphocytes may be immunized in vitro.
[0154] The immunizing agent will typically include the Apo-2 ligand
polypeptide or a fusion protein thereof. Cells expressing Apo-2
ligand at their surface may also be employed. Generally, either
peripheral blood lymphocytes ("PBLs") are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell [Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press,
(1986) pp. 59-103]. Immortalized cell lines are usually transformed
mammalian cells, particularly myeloma cells of rodent, bovine and
human origin. Usually, rat or mouse myeloma cell lines are
employed. The hybridoma cells may be cultured in a suitable culture
medium that preferably contains one or more substances that inhibit
the growth or survival of the unfused, immortalized cells. For
example, if the parental cells lack the enzyme hypoxanthine guanine
phosphoribosyl transferase (HGPRT or HPRT), the culture medium for
the hybridomas typically will include hypoxanthine, aminopterin,
and thymidine ("HAT medium"), which substances prevent the growth
of HGPRT-deficient cells.
[0155] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Rockville, Md. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies [Kozbor, J.
Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
[0156] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against Apo-2 ligand. Preferably, the binding specificity
of monoclonal antibodies produced by the hybridoma cells is
determined by immunoprecipitation or by an in vitro binding assay,
such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent
assay (ELISA). Such techniques and assays are known in the art, and
are described further in the Examples below. The binding affinity
of the monoclonal antibody can, for example, be determined by the
Scatchard analysis of Munson and Pollard, Anal. Biochem., 107:220
(1980).
[0157] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods [Goding, supra]. Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells may be
grown in vivo as ascites in a mammal.
[0158] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0159] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences [U.S.
Pat. No. 4,816,567; Morrison et al., supra] or by covalently
joining to the immunoglobulin coding, sequence all or part of the
coding sequence for a non-immunoglobulin polypeptide. Such a
non-immunoglobulin polypeptide can be substituted for the constant
domains of an antibody of the invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody
of the invention to create a chimeric bivalent antibody.
[0160] The antibodies may be monovalent antibodies. Methods for
preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy-chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain crosslinking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent crosslinking.
[0161] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art. For instance, digestion can be
performed using papain. Examples of papain digestion are described
in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566.
Papain digestion of antibodies typically produces two identical
antigen binding fragments, called Fab fragments, each with a single
antigen binding site, and a residual Fc fragment. Pepsin treatment
yields an F(ab').sub.2 fragment that has two antigen combining
sites and is still capable of cross-linking antigen.
[0162] The Fab fragments produced in the antibody digestion also
contain the constant domains of the light chain and the first
constant domain (CH.sub.1) of the heavy chain. Fab' fragments
differ from Fab fragments by the addition of a few residues at the
carboxy terminus of the heavy chain CH.sub.1 domain including one
or more cysteines from the antibody hinge region. Fab'-SH is the
designation herein for Fab' in which the cysteine residue(s) of the
constant domains bear a free thiol group. F(ab').sub.2 antibody
fragments originally were produced as pairs of Fab' fragments which
have hinge cysteines between them. Other chemical couplings of
antibody fragments are also know.
[0163] 3. Humanized Antibodies
[0164] The Apo-2 ligand antibodies of the invention may further
comprise humanized antibodies or human antibodies. Humanized forms
of non-human (e.g., murine) antibodies are chimeric
immunoglobulins, immunoglobulin chains or fragments thereof (such
as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding
subsequences of antibodies) which contain minimal sequence derived
from non-human immunoglobulin. Humanized antibodies include human
immunoglobulins (recipient antibody) in which residues from a
complementary determining region (CDR) of the recipient are
replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and capacity. In some instances, Fv framework
residues of the human immunoglobulin are replaced by corresponding
non-human residues. Humanized antibodies may also comprise residues
which are found neither in the recipient antibody nor in the
imported CDR or framework sequences. In general, the humanized
antibody will comprise substantially all of at least one, and
typically two, variable domains, in which all or substantially all
of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin consensus sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Reichmann
et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct.
Biol., 2:593-596 (1992)].
[0165] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers [Jones et al.,
Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327
(1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567),
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0166] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important in
order to reduce antigenicity. According to the "best-fit" method,
the sequence of the variable domain of a rodent antibody is
screened against the entire library of known human variable domain
sequences. The human sequence which is closest to that of the
rodent is then accepted as the human framework (FR) for the
humanized antibody [Sims et al., J. Immunol., 151:2296 (1993);
Chothia and Lesk, J. Mol. Biol., 196:901 (1987)] Another method
uses a particular framework derived from the consensus sequence of
all human antibodies of a particular subgroup of light or heavy
chains. The same framework may be used for several different
humanized antibodies [Carter et al., Proc. Natl. Acad. Sci. USA,
89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993)].
[0167] It is further important that antibodies be humanized with
retention of high affinity for the antigen and other favorable
biological properties. To achieve this goal, according to a
preferred method, humanized antibodies are prepared by a process of
analysis of the parental sequences and various conceptual humanized
products using three dimensional models of the parental and
humanized sequences. Three dimensional immunoglobulin models are
commonly available and are familiar to those skilled in the art.
Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence, i.e., the
analysis of residues that influence the ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can be
selected and combined from the consensus and import sequence so
that the desired antibody characteristic, such as increased
affinity for the target antigen(s), is achieved. In general, the
CDR residues are directly and most substantially involved in
influencing antigen binding [see, WO 94/04679 published 3 Mar.
1994].
[0168] Transgenic animals (e.g., mice) that are capable, upon
immunization, of producing a full repertoire of human antibodies in
the absence of endogenous immunoglobulin production can be
employed. For example, it has been described that the homozygous
deletion of the antibody heavy chain joining region (JH) gene in
chimeric and germ-line mutant mice results in complete inhibition
of endogenous antibody production. Transfer of the human germ-line
immunoglobulin gene array in such germ-line mutant mice will result
in the production of human antibodies upon antigen challenge [see,
e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551-255
(1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann
et al., Year in Immuno., 7:33 (1993)]. Human antibodies can also be
produced in phage display libraries [Hoogenboom and Winter, J. Mol.
Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581
(1991)]. The techniques of Cote et al. and Boerner et al. are also
available for the preparation of human monoclonal antibodies (Cote
et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p.
77 (1985) and Boerner et al., J. Immunol., 147(1):86-95
(1991)].
[0169] 4. Bispecific Antibodies
[0170] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for the Apo-2 ligand, the other one is for any
other antigen, and preferably for a cell-surface protein or
receptor or receptor subunit.
[0171] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities [Millstein and Cuello, Nature, 305:537-539
(1983)]. Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published 13 May
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0172] According to a different and more preferred approach,
antibody variable domains with the desired binding specificities
(antibody-antigen combining sites) are fused to immunoglobulin
constant domain sequences. The fusion preferably is with an
immunoglobulin heavy-chain constant domain, comprising at least
part of the hinge, CH2, and CH3 regions. It is preferred to have
the first heavy-chain constant region (CH1) containing the site
necessary for light-chain binding present in at least one of the
fusions. DNAs encoding the immunoglobulin heavy-chain fusions and,
if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. This provides for great flexibility in adjusting the
mutual proportions of the three polypeptide fragments in
embodiments when unequal ratios of the three polypeptide chains
used in the construction provide the optimum yields. It is,
however, possible to insert the coding sequences for two or all
three polypeptide chains in one expression vector when the
expression of at least two polypeptide chains in equal ratios
results in high yields or when the ratios are of no particular
significance. In a preferred embodiment of this approach, the
bispecific antibodies are composed of a hybrid immunoglobulin heavy
chain with a first binding specificity in one arm, and a hybrid
immunoglobulin heavy-chain/light-chain pair (providing a second
binding specificity) in the other arm. It was found that this
asymmetric structure facilitates the separation of the desired
bispecific compound from unwanted immunoglobulin chain
combinations, as the presence of an immunoglobulin light chain in
only one half of the bispecific molecule provides for a facile way
of separation. This approach is disclosed in WO 94/04690 published
3 Mar. 1994. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0173] 5. Heteroconjugate Antibodies
[0174] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells [U.S.
Pat. No. 4,676,980], and for treatment of HIV infection [WO
91/00360; WO 92/200373; EP 03089]. It is contemplated that the
antibodies may be prepared in vitro using known methods in
synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a
disulfide exchange reaction or by forming a thioether bond.
Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed, for example, in U.S. Pat. No. 4,676,980.
[0175] E. Uses of Apo-2 Ligand Antibodies
[0176] Apo-2 ligand antibodies may be used in diagnostic assays for
Apo-2 ligand, e.g., detecting its expression in specific cells,
tissues, or serum. Various diagnostic assay techniques known in the
art may be used, such as competitive binding assays, direct or
indirect sandwich assays and immunoprecipitation assays conducted
in either heterogeneous or homogeneous phases [Zola, Monoclonal
Antibodies: A Manual of Techniues, CRC Press, Inc. (1987) pp.
147-158]. The antibodies used in the diagnostic assays can be
labeled with a detectable moiety. The detectable moiety should be
capable of producing, either directly or indirectly, a detectable
signal. For example, the detectable moiety may be a radioisotope,
such as .sup.3H, .sup.14C, .sup.32P, .sup.35S, or .sup.125I, a
fluorescent or chemiluminescent compound, such as fluorescein
isothiocyanate, rhodamine, or luciferin, or an enzyme, such as
alkaline phosphatase, beta-galactosidase or horseradish peroxidase.
Any method known in the art for conjugating the antibody to the
detectable moiety may be employed, including those methods
described by Hunter et al., Nature, 144:945 (1962); David et al.,
Biochemistry, 13:1014 (1974); Pain et al., J. Immunol. Meth.,
40:219 (1981); and Nygren, J. Histochem. and Cytochem., 30:407
(1982).
[0177] Apo-2 ligand antibodies also are useful for the affinity
purification of Apo-2 ligand from recombinant cell culture or
natural sources. In this process, the antibodies against Apo-2
ligand are immobilized on a suitable support, such a Sephadex resin
or filter paper, using methods well known in the art. The
immobilized antibody then is contacted with a sample containing the
Apo-2 ligand to be purified, and thereafter the support is washed
with a suitable solvent that will remove substantially all the
material in the sample except the Apo-2 ligand, which is bound to
the immobilized antibody. Finally, the support is washed with
another suitable solvent that will release the Apo-2 ligand from
the antibody. Apo-2 ligand antibodies also are useful for the
affinity purification of a solubilized. Apo-2 receptor or for
expression cloning of an Apo-2 receptor.
[0178] F. Kits Containing Apo-2 Ligand or Apo-2-Ligand
Antibodies
[0179] In a further embodiment of the invention, there are provided
articles of manufacture and kits containing Apo-2 ligand or Apo-2
ligand antibodies which can be used, for instance, for the
therapeutic or non-therapeutic applications described above. The
article of manufacture comprises a container with a label. Suitable
containers include, for example, bottles, vials, and test tubes.
The containers may be formed from a variety of materials such as
glass or plastic. The container holds a composition which includes
an active agent that is effective for therapeutic or
non-therapeutic applications, such as described above. The active
agent in the composition is Apo-2 ligand or an Apo-2 ligand
antibody. The label on the container indicates that the composition
is used for a specific therapy or non-therapeutic application, and
may also indicate directions for either in vivo or in vitro use,
such as those described above.
[0180] The kit of the invention will typically comprise the
container described above and one or more other containers
comprising materials desirable from a commercial and user
standpoint, including buffers, diluents, filters, needles,
syringes, and package inserts with instructions for use.
[0181] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0182] All references cited in the present specification are hereby
incorporated by reference in their entirety.
EXAMPLES
[0183] All restriction enzymes referred to in the examples were
purchased from New England Biolabs and used according to
manufacturer's instructions. All other commercially available
reagents referred to in the examples were used according to
manufacturer's instructions unless otherwise indicated. The source
of those cells identified in the following examples, and throughout
the specification, by ATCC accession numbers is the American Type
Culture Collection, Rockville, Md.
Example 1
Isolation of cDNA Clones Encoding Human Apo-2 Ligand
[0184] To isolate a full-length cDNA for Apo-2 ligand, a lambda
gt11 bacteriophage library of human placental cDNA (about
1.times.10.sup.6 clones) (HL10756, commercially available from
Clontech) was screened by hybridization with synthetic
oligonucleotide probes based on an EST sequence (GenBank locus
HHEA47M), which showed some degree of homology to human Fas/Apo-1
ligand. The EST sequence of HHEA47M is 390 bp and when translated
in its +3 frame, shows 16 identities to a 34 amino acid region of
human Apo-1 ligand. The sequence of HHEA47M is as follows:
TABLE-US-00001 SEQ ID NO:3
GGGACCCCAATGACGAAGAGAGTATGAACAGCCCCTGCTGGCAAGTCAAG
TGGCAACTCCGTCAGCTCGTTAGAAAGATGATTTTGAGAACCTCTGAGGA
AACCATTTCTACAGTTCAAGAAAAGCAACAAAATATTTCTCCCCTAGTGA
GAGAAAGAGGTCCTCAGAGAGTAGCAGCTCACATAACTGGGACCAGAGGA
AGAAGCAACACATTGTCTTCTCCAAACTCCAAGAATGAAAAGGCTCTGGG
CCGCAAAATAAACTCCTGGGAATCATCAAGGAGTGGGCATTCATTCCTGA
GCAACTTGCACTTGAGGAATGGTGAACTGGTCATCCATGAAAAAGGGTTT
TACTACATCTATTCCCAAACATACTTTCGATTTCAGGAGG
A 60 bp oligonucleotide probe with the following sequence was
employed in the screening:
TABLE-US-00002
TGACGAAGAGAGTATGAACAGCCCCTGCTGGCAAGTCAAGTGGCAACTCCGTCAGCTCGT SEQ ID
NO:4
Hybridization was conducted overnight at room temperature in buffer
containing 20% formamide, 5.times.SSC, 10% dextran sulfate, 0.1%
NaPiPO.sub.4, 0.05M NaPO.sub.4, 0.05 mg salmon sperm DNA, and 0.1%
sodium dodecyl sulfate, followed by several washes at 42.degree. C.
in 5.times.SSC, and then in 2.times.SSC. Twelve positive clones
were identified in the cDNA library, and the positive clones were
rescreened by hybridization to a second 60 bp oligonucleotide probe
(not overlapping the first probe) having the following
sequence:
TABLE-US-00003
GGTGAACTGGTCATCCATGAAAAAGGGTTTTACTACATCTATTCCCAAACATACTTTCGA SEQ ID
NO:5
Hybridization was conducted as described above.
[0185] Four resulting positive clones were identified and amplified
by polymerase chain reaction (PCR) using a primer based on the
flanking 5' vector sequence and adding an external ClaI restriction
site and a primer based on the 3' flanking vector sequence and
adding an external HindIII restriction site. PCR products were gel
purified and subcloned into pGEM-T (commercially available from
Promega) by T-A ligation. Three independent clones from different
PCRs were then subjected to dideoxy DNA sequencing. DNA sequence
analysis of these clones demonstrated that they were essentially
identical, with some length variation at their 5' region.
[0186] The nucleotide sequence of the coding region of Apo-2 ligand
is shown in FIG. 1A. Sequencing of the downstream 3' end region of
one of the clones revealed a characteristic polyadenylation site
(data not shown). The cDNA contained one long open reading frame
with an initiation site assigned to the ATG codon at nucleotide
positions 91-93. The surrounding sequence at this site is in
reasonable agreement with the proposed consensus sequence for
initiation sites [Kozak, J. Cell. Biol., 115:887-903 (1991)]. The
open reading frame ends at the termination codon TAA at nucleotide
positions 934-936.
[0187] The predicted mature amino acid sequence of human Apo-2
ligand contains 281 amino acids, and has a calculated molecular
weight of approximately 32.5 kDa and an isoelectric point of
approximately 7.63. There is no apparent signal sequence at the
N-terminus, although hydropathy analysis (data not shown) indicated
the presence of a hydrophobic region between residues 15 and 40.
The absence of a signal sequence and the presence of an internal
hydrophobic region suggests that Apo-2 ligand is a type II
transmembrane protein. The putative cytoplasmic, transmembrane and
extracellular regions are 14, 26 and 241 amino acids long,
respectively. The putative transmembrane region is underlined in
FIG. 1A. A potential N-linked glycosylation site is located at
residue 109 in the putative extracellular domain.
[0188] An alignment (using the Align.TM. computer program) of the
amino acid sequence of the C-terminal region of Apo-2 ligand with
other known members of the TNF cytokine family showed that, within
the C-terminal region, Apo-2 ligand exhibits 23.2% identity to
Apo-1 ligand (FIG. 1B). The alignment analysis showed a lesser
degree of identity with other TNF family members: CD40L (20.8%),
LT-.alpha. (20.2%), LT-.beta. (19.6%), TNF-.alpha. (19.0%), CD30L
and CD27L (15.5%), OX-40L (14.3%), and 4-lBBL (13.7%). In the TNF
cytokine family, residues within regions which are predicted to
form .beta. strands, based on the crystal structures of TNF-.alpha.
and LT-.alpha. [Eck et al., J. Bio. Chem., 264:17595-17605 (1989);
Eck et al., J. Bio. Chem., 267:2119-2122 (1992)], tend to be more
highly conserved with other TNF family members than are residues in
the predicted connecting loops. It was found that Apo-2 ligand
exhibits greater homology to other TNF family members in its
putative .beta. strand regions, as compared to homology in the
predicted connecting loops. Also, the loop connecting putative
.beta. strands, B and B', is markedly longer in Apo-2 ligand.
Example 2
Expression of Human Apo-2 Ligand
[0189] A. Full-Length cDNA Fusion Construct
[0190] A full-length Apo-2 ligand-cDNA fused to a myc epitope tag
was constructed as follows. The Apo-2 ligand cDNA insert was
excised from the parental pGEM-T Apo-2 ligand plasmid (described in
Example 1) by digestion with ClaI and HindIII, and inserted into a
pRK5 mammalian expression plasmid [Schall et al., Cell, 61:361-370
(1990); Suva et al., Science, 237:893'-896 (1987)], which was
digested with the same restriction enzymes. A sequence encoding a
13 amino acid myc epitope tag
TABLE-US-00004 Ser Met Glu Gln Lys Leu Ile Ser Glu Glu SEQ ID NO:6
Asp Leu Asn
[Evan et al., Mol. Cell. Biol., 5:3610-3616 (1985)] was then
inserted between codon 281 and the stop codon (codon 282) at the 3'
end of the Apo-2 ligand coding sequence by oligonucleotide directed
mutagenesis [Zoller et al., Nucleic Acids Res., 10:6487-6496
(1982)] to give plasmid pRK5 Apo-2 ligand-myc.
[0191] The pRK5 Apo-2 ligand-myc plasmid was co-transfected into
human 293 cells (ATCC CRL 1573) with a pRK5 plasmid carrying a
neomycin resistance gene, by calcium phosphate precipitation.
Stable clones expressing Apo-2 ligand-myc were selected by ability
to grow in 50% HAM's F12/50% DMEM (GIBCO) media in the presence of
the antibiotic, G418 (0.5 mg/mL) (GIBCO).
[0192] To investigate the topology of Apo-2 ligand, a
G418-resistant clone was analyzed by FACS after staining with
anti-myc monoclonal antibody, (mAb) clone 9E10 [Evan et al., supra;
commercially available from Oncogene Science) followed by a
phycoerythrin (PE)-conjugated goat anti-mouse antibody
(commercially available from Jackson ImmunoResearch). The FACS
analysis revealed a specific positive staining shift in the Apo-2
ligand-myc-transfected clone as compared to mock transfected cells
(FIG. 1C), showing that Apo-2 ligand is expressed at the
cell-surface, with its carboxy terminus exposed. Accordingly, Apo-2
ligand is believed to be a type II transmembrane protein.
[0193] B. ECD Fusion Constructs
[0194] Two soluble Apo-2 ligand extracellular domain ("ECD") fusion
constructs were prepared, in which another sequence was fused
upstream of the C-terminal region of Apo-2 ligand.
[0195] In one construct, 27 amino acids of the herpes virus
glycoprotein D ("gD") signal peptide [described in Lasky et al.,
DNA, 3:23-29 (1984); Pennica et al., Proc. Natl. Acad. Sci.,
92:1142-1146 (1995); Paborsky et al. Protein Engineering, 3:547-553
(1990)] and epitope tag sequence
TABLE-US-00005 SEQ ID NO:7 Lys Tyr Ala Leu Ala Asp Ala Ser Leu Lys
Met Ala Asp Pro Asn Arg Phe Arg Gly Lys Asp Leu Pro Val Leu Asp
Gln
were fused upstream to codons 114-281 of Apo-2 ligand within a pRK5
mammalian expression plasmid. Briefly, the gD sequence was
amplified from a parent plasmid, PCHAD (Genentech, prepared
substantially as described in Lasky et al., Science, 233:209-212
(1986)), in a PCR in which the 3' primer was complementary to the
3' region of the gD sequence as well as to codons 114-121 of Apo-2
ligand. The product was used as a 5' primer along with a 3' primer
complementary to the 3' end of the Apo-2 ligand-coding region in a
subsequent PCR in which the pRK5 Apo-2 ligand plasmid was used as a
template. The product, encoding the gD-Apo-2 ligand ECD fusion was
then subcloned into a pRK5 plasmid to give the plasmid pRK5
gD-Apo-2 ligand ECD.
[0196] Human embryonic kidney 293 cells (ATCC CRL 1573) were
transiently transfected with the pRK5 gD-Apo-2 ligand ECD plasmid
or with pRK5, by calcium phosphate precipitation. Expression of
soluble gD-Apo-2 ligand protein was assessed by metabolic labeling
of the transfected cells with .sup.35S-Cys and .sup.35S-Met. Cell
supernatants were collected after 24 hours and cleared by
centrifugation. For immunoprecipitation, 5 ml of supernatant were
incubated with 5B6 anti-gD monoclonal antibody (Genentech) at 1
.mu.g/ml overnight at 4.degree. C. Then, 25 .mu.l Pansorbin (Sigma)
was added for another 1 hour at 4.degree. C. The tubes were spun,
the pellets were washed in PBS and boiled for 5 minutes in SDS
sample buffer. The boiled samples were spun again, and the
supernatants were subjected to SDS-PAGE and autoradiography.
[0197] Immunoprecipitation with anti-gD antibody revealed three
predominant protein bands in the supernatants of cells transfected
with the gD-Apo-2 ligand plasmid (FIG. 1E). These bands migrated
with relative molecular masses (Mr) of 23, 48 and 74 kDa. The
calculated molecular weight of the mature gD-Apo-2 polypeptide is
approximately 22.5 kDa; hence, the observed bands may represent
monomeric (23 kDa), dimeric (48 kDa) and trimeric (74 kDa) forms of
the fusion protein, and indicate that Apo-2 ligand can be expressed
as a secreted soluble gD fusion protein in mammalian cells.
[0198] In a second construct, a Met Gly His.sub.10 sequence
(derived from the plasmid pET19B, Novagen), followed by a 12 amino
acid enterokinase cleavage site
TABLE-US-00006 SEQ ID NO:8 Met Gly His His His His His His His His
His His Ser Ser Gly His Ile Asp Asp Asp Asp Lys His Met
was fused upstream to codons 114-281 of Apo-2 ligand within a
baculovirus expression plasmid (pVL1392, Pharmingen). Briefly, the
Apo-2 ligand codon 114-281 region was amplified by PCR from the
parent pRK5 Apo-2 ligand plasmid (described in Example 1) with
primers complementary to the 5' and 3' regions which incorporate
flanking NdeI and BamHI restriction sites respectively. The product
was subcloned into pGEM-T (Promega) by T-A ligation, and the DNA
sequence was confirmed. The insert was then excised by digestion
with NdeI and BamHI and subcloned into a modified baculovirus
expression vector pVL1392 (commercially available from Pharmingen)
containing an amino terminal Met Gly His.sub.10 tag and
enterokinase cleavage site.
[0199] Recombinant baculovirus was generated by co-transfecting the
His.sub.10-Apo-2 ECD plasmid and BaculoGold.TM. virus DNA
(Pharmingen) into Spodoptera frugiperda ("Sf9") cells (ATCC CRL
1711) using lipofectin (commercially available from GIBCO-BRL).
After 4-5 days of incubation at 28.degree. C., the released viruses
were harvested and used for further amplifications. Viral infection
and protein expression was performed as described by O'Reilley et
al., Baculovirus expression vectors: A laboratory Manual,
Oxford:Oxford University Press (1994). The protein was purified by
Ni.sup.2+-chelate affinity chromatography, as described in Example
3 below.
Example 3
Purification of Recombinant Human APo-2 Ligand
[0200] Extracts were prepared from recombinant virus-infected and
mock-infected Sf9 cells (see Example 2, section B above) as
described by Rupert et al., Nature, 362:175-179 (1993). Briefly,
Sf9 cells were washed, resuspended in sonication buffer (25 mL
Hepes, pH 7.9; 12.5 mM MgCl.sub.2; 0.1 mM EDTA; 10% Glycerol; 0.1%
NP-40; 0.4 M KCl), and sonicated twice for 20 seconds on ice. The
sonicates were cleared by centrifugation, and the supernatant was
diluted 50-fold in loading-buffer (50 mM phosphate, 300 mM NaCl,
10% Glycerol, pH 7.8) and filtered through a 0.45 .mu.m filter. A
Ni.sup.2+-NTA agarose column (commercially available from Qiagen)
was prepared with a bed volume of 5 mL, washed with 25 mL of water
and equilibrated with 25 mL of loading buffer. The filtered cell
extract was loaded onto the column at 0.5 mL per minute. The column
was washed to baseline A.sub.280 with loading buffer, at which
point fraction collection was started. Next, the column was washed
with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10%
Glycerol, pH 6.0), which eluted nonspecifically bound protein.
After reaching A.sub.280 baseline again, the column was developed
with a 0 to 500 mM Imidazole gradient in the secondary wash buffer.
One mL fractions were collected and analyzed by SDS-PAGE and silver
staining or western blot with Ni.sup.2+-NTA-conjugated to alkaline
phosphatase (Qiagen). Fractions containing the eluted
His.sub.10-Apo-2 ligand protein were pooled and dialyzed against
loading buffer.
[0201] An identical procedure was repeated with mock-infected Sf9
cells as the starting material, and the same fractions were pooled,
dialyzed, and used as control for the purified human Apo-2.
[0202] SDS-PAGE analysis of the purified protein revealed a
predominant band of Mr 24 kDa, corresponding with the calculated
molecular weight of 22.4 kDa for the His.sub.10-Apo-2 ligand
monomer (FIG. 1D, lane 3); protein sequence microanalysis (data not
shown) confirmed that the 24 kDa band represents the
His.sub.10-Apo-2 ligand polypeptide. Minor 48 kDa and 66 kDa bands
were also observed, and probably represent soluble Apo-2 ligand
homodimers and homotrimers. Chemical crosslinking of the purified
His.sub.10-Apo-2 ligand by incubation with sulfo-NHS (5 mM) (Pierce
Chemical) and EDC (Pierce Chemical) at 25 mM and 50 mM (FIG. 1D,
lanes 1 and 2, respectively), shifted the protein into the 66 kDa
band primarily. These results suggest that the predominant form of
Apo-2 ligand in solution is homotrimeric and that these trimers
dissociate into dimers and monomers in the presence of SDS.
Example 4
Apoptotic Activity of Apo-2 Ligand on Human Lymphoid Cell Lines
[0203] Apoptotic activity of purified, soluble Apo-2 ligand
(described in Example 3) was examined using several human lymphoid
cell lines. In a first study, the effect of Apo-2 ligand on 9D
cells (Genentech, Inc.), derived from Epstein-Barr virus
(EBV)-transformed human peripheral blood B cells, was examined. The
9D cells (5.times.10.sup.4 cells/well in RPMI 1640 medium plus 10%
fetal calf serum) were incubated for 24 hours with either a media
control, Apo-2 ligand (3 .mu.g/ml, prepared as described in Example
3 above), or anti-Apo-1 monoclonal antibody, CH11 (1 .mu.g/ml)
[described by Yonehara et al., J. Exp. Med., 169:1747-1756 (1989);
commercially available from Medical and Biological Laboratories
Co.]. The CH11 anti-Apo-1 antibody is an agonistic antibody which
mimics Fas/Apo-1 ligand activity.
[0204] After the incubation, the cells were collected onto cytospin
glass slides, and photographed under an inverted light microscope.
Both Apo-2 ligand and the anti-Apo-1 monoclonal antibody induced a
similar apoptotic effect, characterized by cytoplasmic condensation
and reduction in cell numbers. (see FIG. 2A).
[0205] The effects of the Apo-2 ligand on the 9D cells, as well as
on Raji cells (human Burkitt's lymphoma B cell line, ATCC CCL 86)
and Jurkat cells (human acute T cell leukemia cell line, ATCC TIB
152) were further analyzed by FACS. The FACS analysis was
conducted, using established criteria for apoptotic cell death,
namely, the relation of fluorescence staining of the cells with two
markers: (a) propidium iodide ("PI") dye, which stains apoptotic
but not live cells, and (b) a fluorescent derivative of the
protein, annexin V, which binds to the exposed phosphatidylserine
found on the surface of apoptotic cells, but not on live cells
[Darzynkiewicz et al., Methods in Cell Biol., 41:15-38 (1994);
Fadok et al., J. Immunol., 148:2207-2214 (1992); Koopman et al.,
Blood, 84:1415-1420 (1994)].
[0206] The 9D cells (FIG. 2B), Raji cells (FIG. 2C), and Jurkat
cells (FIG. 2D) were incubated (1.times.10.sup.6 cells/well) for 24
hours with a media control (left panels), Apo-2 ligand (3 .mu.g/ml,
prepared as described in Example 3) (center panels), or anti-Apo-1
ligand antibody, CH11 (1 .mu.g/ml) (right panels). The cells were
then washed, stained with PI and with fluorescein thiocyanate
(FITC)-conjugated annexin V (purchased from Brand Applications) and
analyzed by flow cytometry. Cells negative for both PI and annexin
V staining (quadrant 3) represent live cells; PI-negative, annexin
V-positive staining cells (quadrant 4) represent early apoptotic
cells; PI-positive, annexin V-positive staining cells (quadrant 2)
represent primarily cells in late stages of apoptosis.
[0207] The Apo-2 ligand treated 9D cells exhibited elevated
extracellular annexin V binding, as well as a marked increase in
uptake of PI (FIG. 2B), indicating that Apo-2 ligand induced
apoptosis in the cells. Comparable results were obtained with
anti-Apo-1 antibody, CH11 (FIG. 2B). The Apo-2 ligand induced a
similar response in the Raji and Jurkat cells, as did the
anti-Apo-1 antibody. (see FIGS. 2C and 2D). The induction of
apoptosis (measured as the % apoptotic cells) in these cell lines
by Apo-2 ligand, as compared to the control and to the anti-Apo-1
antibody, is also shown in Table 1 below.
[0208] The activation of internucleosomal DNA fragmentation by
Apo-2 ligand was also analyzed. Jurkat cells (left lanes) and 9D
cells (right lanes) were incubated (2.times.10.sup.6 cells/well)
for 6 hours with a media control or Apo-2 ligand (3 .mu.g/ml,
prepared as described in Example 3), The DNA was then extracted
from the cells and labeled with .sup.32P-ddATP using terminal
transferase. The labeled DNA samples were subjected to
electrophoresis on 2% agarose gels and later analyzed by
autoradiography [Moore et al., Cytotechnology, 17:1-11 (1995)]. The
Apo-2 ligand induced internucleosomal DNA fragmentation in both the
Jurkat cells and 9D cells (FIG. 2E). Such DNA fragmentation is
characteristic of apoptosis [Cohen, Advances in Immunol., 50:55-85
(1991)].
[0209] To examine the time-course of the Apo-2 ligand apoptotic
activity, 9D cells were incubated in microtiter dishes
(5.times.10.sup.4 cells/well) with a media control or Apo-2 ligand
(3 .mu.g/ml, prepared as described in Example 3) for a period of
time ranging from 0 hours to 50 hours. Following the incubation,
the numbers of dead and live cells were determined by microscopic
examination using a hemocytometer.
[0210] As shown in FIG. 3A, maximal levels of cell death were
induced in 9D cells within 24 hours.
[0211] To determine dose-dependency of Apo-2 ligand-induced cell
death, 9D cells were incubated (5.times.10.sup.4 cells/well) for 24
hours with serial dilutions of a media control or Apo-2 ligand
(prepared as described in Example 3). The numbers of dead and live
cells following the incubation were determined as described above.
The results are illustrated in FIG. 3B. Specific apoptosis was
determined by subtracting the % apoptosis in the control from %
apoptosis in Apo-2 ligand treated cells. Half-maximal activation of
apoptosis occurred at approximately 0.1 .mu.g/ml (approximately 1
nM), and maximal induction occurred at about 1 to about 3 .mu.g/ml
(approximately 10 to 30 nM).
Example 5
Apoptotic Activity of Apo-2 Ligand on Human Non-Lymphoid Tumor Cell
Lines
[0212] The effect of Apo-2 ligand on human non-lymphoid tumor cell
lines was examined using the following cell lines: HeLa (derived
from human cervical carcinoma, ATCC CCL 22); ME-180 (derived from
human cervical carcinoma, ATCC HTB 33); MCF7 (derived from human
breast carcinoma, ATCC HTB 22); U-937 (derived from human
hystiocytic lymphoma, ATCC CRL 1593); A549 (derived from human lung
carcinoma, ATCC CCL 185); and 293 (derived from an
adenovirus-transformed human embryonic kidney cells, ATCC CCL
1573).
[0213] In the assay, 1.times.10.sup.6 cells of each cell line were
incubated for 24 hours with a media control, Apo-2 ligand (3
.mu.g/ml, prepared as described in Example 3), or anti-Apo-1
monoclonal antibody, CH 11 (1 .mu.g/ml). Following the incubation,
apoptosis was measured by FACS analysis, as described in Example 4.
The results are shown below in Table 1.
TABLE-US-00007 TABLE 1 % apoptotic cells Cell line Control Apo-2L
Anti-Apo-1 Ab Lymphoid 9D 22.5 92.4 90.8 Raji 35.9 73.4 83.7 Jurkat
5.9 77.0 18.1 Non-lymphoid HeLa 5.3 18.6 17.9 MCF7 39.9 47.3 44.0
U-937 3.6 62.3 16.6 A549 16.5 74.6 25.1 ME-180 8.6 80.7 9.9 293
12.3 12.2 16.7
[0214] The HeLa cells and MCF7 cells were equally sensitive to
induction of apoptosis by Apo-2 ligand as compared to the CH11
anti-Apo-1 antibody. In contrast, the U-937 cells and A549 cells
were markedly more sensitive to induction of apoptosis by Apo-2
ligand. The ME-180 cells were quite sensitive to the Apo-2 ligand,
but were relatively resistant to the anti-apo-1 antibody. The 293
cells were resistant to the Apo-2 ligand and weakly responsive to
the anti-Apo-1 antibody.
[0215] Thus, Apo-2 ligand is capable of inducing apoptosis in cells
of non-lymphoid origin, as well as cells of lymphoid origin (see
Example 4). Also, although not fully understood and not wishing to
be bound by any particular theory, Applicants presently believe
that Apo-2 ligand acts via a receptor which is distinct from Apo-1.
This belief is supported by the data herein showing that the cell
lines described above exhibit differential patterns of sensitivity
to Apo-2 ligand and to anti-Apo-1 antibody. (see also, Example 7
below).
Example 6
Effect of Apo-2 Ligand on Human Peripheral Blood Monocytes
[0216] Peripheral blood mononuclear cells ("PBMC") were isolated
from the blood of human donors by Ficoll density gradient
centrifugation using Lymphocyte Separation Medium (LSM.RTM.,
Organon Teknika). An isolated population of T cells was prepared
from the PBMC by removal of B cells through surface Ig binding to
an anti-Ig column and removal of monocytes through Fc receptor
binding to an Ig column (R & D Systems). An isolated population
of B cells was prepared from the PBMC by complement-mediated
elimination of T cells reacted with the anti-CD3 antibody produced
by the OKT3 myeloma (ATCC, CRL 8001) and of monocytes reacted with
a monocyte-specific antibody produced by the 4F2C13 hybridoma
(ATCC, HB 22). Additional monocyte removal was accomplished by
adherence to plastic.
[0217] The freshly isolated peripheral blood B or T cells
(1.times.10.sup.6 cells/well) were cultured for 3 days in the
presence of a media control or Apo-2 ligand (3 .mu.g/ml, prepared
as described in Example 3). For activation, B cells were treated
simultaneously with lipopolysaccharide ("LPS", 1 .mu.g/ml), and T
cells were treated with phorbol myristate acetate ("PMA", 10 ng/ml)
plus ionomycin (1 .mu.g/ml) (Sigma). For interleukin-2 ("IL-2")
pretreatment, T cells were cultured for 3-5 days in the presence of
IL-2 (50 U/ml) (Genzyme) before exposure to Apo-2 ligand. Apoptosis
was determined using FACS analysis essentially as described above
in Example 4. However, B cells were gated by anti-CD19/CD20
antibodies (Jackson Immunoresearch), and T cells were gated by
anti-CD4/CD8 antibodies (Jackson Immunoresearch). The results are
shown in Table 2 below, representing means.+-.SE of independent
experiments [B lymphocytes--9 experiments; T lymphocytes--8
experiments; T lymphocytes plus IL-2--5 experiments], in which
50,000 cells were analyzed per data point. Statistical analysis was
performed using the student t-test. In Table 2, a=p<0.05 and
b=p<0.02 relative to the respective control.
TABLE-US-00008 TABLE 2 % apoptotic cells Treatment Control Apo-2L B
lymphocytes none 40.1 .+-. 4.1 53.2 .+-. 3.3.sup.a LPS 44.8 .+-.
2.8 55.9 .+-. 3.2.sup.a T lymphocytes none 6.3 .+-. 0.6 8.2 .+-.
0.8 PMA/ionomycin 40.3 .+-. 4.4 54.2 .+-. 3.3.sup.a IL-2 13.7 .+-.
1.2 34.5 .+-. 4.8.sup.b pretreatment
[0218] Apo-2 ligand induced significant apoptosis in unstimulated B
cells, in B cells activated by LPS and in T cells activated with
PMA and ionomycin. It was previously reported that peripheral T
cells can be predisposed to apoptosis by culturing the cells in the
presence of IL-2 [Lenardo et al., Nature, 353:858-861 (1991)]. The
present study showed that pretreatment with IL-2 did sensitize the
peripheral T cells to Apo-2 ligand-induced death.
Example 7
Inhibition Assay Using Fas/Apo-1 and TNF Receptors
[0219] An assay was conducted to determine if the Fas/Apo-1
receptor, as well as the type 1 and type 2 TNF receptors (TNF-R1
and TNF-R2), are involved in mediating the apoptotic activity of
Apo-2 ligand by testing if soluble forms of these receptors are
capable of inhibiting the apoptotic activity of purified, soluble
Apo-2 ligand (described in Example 3).
[0220] 9D cells were incubated (5.times.10.sup.4 cells/well) for 24
hours with a media control or Apo-2 ligand (0.3 .mu.g/ml, prepared
as described in Example 3) in the presence of buffer control,
CD4-IgG control (25 .mu.g/ml), soluble Apo-1-IgG (25 .mu.g/ml),
soluble. TNFR1-IgG (25 .mu.g/ml) or soluble TNFR2-IgG fusion
protein (25 g/ml). Soluble derivatives of the Fas/Apo-1, TNF-R1 and
TNF-R2 receptors were produced as IgG fusion proteins as described
in Ashkenazi et al., Methods, 8:104-115 (1995). CD4-IgG was
produced as an IgG fusion protein as described in Byrn et al.,
Nature, 344:667-670 (1990) and used as a control.
[0221] As shown in FIG. 3C, none of the receptor-fusion molecules
inhibited Apo-2 ligand apoptotic activity on the 9D cells. These
results indicate that Apo-2 ligand apoptotic activity is
independent of Fas/Apo-1 and of TNF-R1 and TNF-R2.
Example 8
Expression of Apo-2 Ligand mRNA in Mammalian Tissues
[0222] Expression of Apo-2 ligand mRNA in human tissues was
examined by Northern blot analysis (FIG. 4). Human RNA blots were
hybridized to a .sup.32P-labeled DNA probe based on the full-length
Apo-2 ligand cDNA, or to a .sup.32P-labeled RNA probe based on the
GenBank EST sequence, HHEA47M (see Example 1). Human fetal RNA blot
MTN (Clontech) and human adult RNA blot MTN-II (Clontech) were
incubated with the DNA probe, while human adult RNA blot MTN-I
(Clontech) was incubated with the RNA probe. Blots were incubated
with the probes in hybridization buffer (5.times.SSPE;
2.times.Denhardt's solution; 100 mg/mL denatured sheared salmon
sperm DNA; 50% formamide; 2% SDS) for 16 hours at 42.degree. C. The
blots were washed several times in 1.times.SSPE; 2% SDS for 1 hour
at 65.degree. C. and 50% freshly deionized formamide; 1.times.SSPE;
0.2% SDS for 30 minutes at 65.degree. C. The blots were developed
after overnight exposure, using a phosphorimager (Fuji).
[0223] The results are shown in FIG. 4. In fetal human tissues,
Apo-2 ligand mRNA expression was detected in lung, liver and
kidney, but not in brain tissue. In adult human tissues, Apo-2
ligand mRNA expression was detected in spleen, thymus, prostate,
ovary, small intestine, peripheral blood lymphocytes, heart,
placenta, lung, and kidney. Little or no expression was detected in
testis, brain, skeletal muscle, and pancreas. The expression
profile observed for Apo-2 ligand, as described above, is not
identical to that of Apo-1 ligand, which is expressed primarily in
T cells and testis [Nagata et al., supra].
Deposit of Material
[0224] The following cell line has been deposited with the American
Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., USA
(ATCC):
TABLE-US-00009 Cell line ATCC Dep. No. Deposit Date
2935-pRK5-hApo-2L- CRL-12014 Jan. 3, 1996 myc clone 2.1
[0225] This deposit was made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposit will be made available by ATCC under the terms
of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC .sctn.122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn.1.14
with particular reference to 886 OG 638).
[0226] The assignee of the present application has agreed that if a
culture of the cell line on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the cell line
will be promptly replaced on notification with another of the same
plasmid. Availability of the deposited cell line is not to be
construed as a license to practice the invention in contravention
of the rights granted under the authority of any government in
accordance with its patent laws.
[0227] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 1
1
171281PRTHomo sapiens 1Met Ala Met Met Glu Val Gln Gly Gly Pro Ser
Leu Gly Gln Thr Cys 1 5 10 15Val Leu Ile Val Ile Phe Thr Val Leu
Leu Gln Ser Leu Cys Val Ala 20 25 30Val Thr Tyr Val Tyr Phe Thr Asn
Glu Leu Lys Gln Met Gln Asp Lys 35 40 45Tyr Ser Lys Ser Gly Ile Ala
Cys Phe Leu Lys Glu Asp Asp Ser Tyr 50 55 60Trp Asp Pro Asn Asp Glu
Glu Ser Met Asn Ser Pro Cys Trp Gln Val 65 70 75 80Lys Trp Gln Leu
Arg Gln Leu Val Arg Lys Met Ile Leu Arg Thr Ser 85 90 95Glu Glu Thr
Ile Ser Thr Val Gln Glu Lys Gln Gln Asn Ile Ser Pro 100 105 110Leu
Val Arg Glu Arg Gly Pro Gln Arg Val Ala Ala His Ile Thr Gly 115 120
125Thr Arg Gly Arg Ser Asn Thr Leu Ser Ser Pro Asn Ser Lys Asn Glu
130 135 140Lys Ala Leu Gly Arg Lys Ile Asn Ser Trp Glu Ser Ser Arg
Ser Gly145 150 155 160His Ser Phe Leu Ser Asn Leu His Leu Arg Asn
Gly Glu Leu Val Ile 165 170 175His Glu Lys Gly Phe Tyr Tyr Ile Tyr
Ser Gln Thr Tyr Phe Arg Phe 180 185 190Gln Glu Glu Ile Lys Glu Asn
Thr Lys Asn Asp Lys Gln Met Val Gln 195 200 205Tyr Ile Tyr Lys Tyr
Thr Ser Tyr Pro Asp Pro Ile Leu Leu Met Lys 210 215 220Ser Ala Arg
Asn Ser Cys Trp Ser Lys Asp Ala Glu Tyr Gly Leu Tyr225 230 235
240Ser Ile Tyr Gln Gly Gly Ile Phe Glu Leu Lys Glu Asn Asp Arg Ile
245 250 255Phe Val Ser Val Thr Asn Glu His Leu Ile Asp Met Asp His
Glu Ala 260 265 270Ser Phe Phe Gly Ala Phe Leu Val Gly 275
28021042DNAHomo sapiens 2tttcctcact gactataaaa gaatagagaa
ggaagggctt cagtgaccgg ctgcctggct 60gacttacagc agtcagactc tgacaggatc
atggctatga tggaggtcca ggggggaccc 120agcctgggac agacctgcgt
gctgatcgtg atcttcacag tgctcctgca gtctctctgt 180gtggctgtaa
cttacgtgta ctttaccaac gagctgaagc agatgcagga caagtactcc
240aaaagtggca ttgcttgttt cttaaaagaa gatgacagtt attgggaccc
caatgacgaa 300gagagtatga acagcccctg ctggcaagtc aagtggcaac
tccgtcagct cgttagaaag 360atgattttga gaacctctga ggaaaccatt
tctacagttc aagaaaagca acaaaatatt 420tctcccctag tgagagaaag
aggtcctcag agagtagcag ctcacataac tgggaccaga 480ggaagaagca
acacattgtc ttctccaaac tccaagaatg aaaaggctct gggccgcaaa
540ataaactcct gggaatcatc aaggagtggg cattcattcc tgagcaactt
gcacttgagg 600aatggtgaac tggtcatcca tgaaaaaggg ttttactaca
tctattccca aacatacttt 660cgatttcagg aggaaataaa agaaaacaca
aagaacgaca aacaaatggt ccaatatatt 720tacaaataca caagttatcc
tgaccctata ttgttgatga aaagtgctag aaatagttgt 780tggtctaaag
atgcagaata tggactctat tccatctatc aagggggaat atttgagctt
840aaggaaaatg acagaatttt tgtttctgta acaaatgagc acttgataga
catggaccat 900gaagccagtt ttttcggggc ctttttagtt ggctaactga
cctggaaaga aaaagcaata 960acctcaaagt gactattcag ttttcaggat
gatacactat gaagatgttt caaaaaatct 1020gaccaaaaca aacaaacaga aa
10423390DNAHomo sapiens 3gggaccccaa tgacgaagag agtatgaaca
gcccctgctg gcaagtcaag tggcaactcc 60gtcagctcgt tagaaagatg attttgagaa
cctctgagga aaccatttct acagttcaag 120aaaagcaaca aaatatttct
cccctagtga gagaaagagg tcctcagaga gtagcagctc 180acataactgg
gaccagagga agaagcaaca cattgtcttc tccaaactcc aagaatgaaa
240aggctctggg ccgcaaaata aactcctggg aatcatcaag gagtgggcat
tcattcctga 300gcaacttgca cttgaggaat ggtgaactgg tcatccatga
aaaagggttt tactacatct 360attcccaaac atactttcga tttcaggagg
390460DNAArtificial Sequencemisc_feature(1)..(60)Sequence is
synthesized 4tgacgaagag agtatgaaca gcccctgctg gcaagtcaag tggcaactcc
gtcagctcgt 60560DNAArtificial Sequencemisc_feature(1)..(60)Sequence
is synthesized 5ggtgaactgg tcatccatga aaaagggttt tactacatct
attcccaaac atactttcga 60613PRTArtificial
SequenceUNSURE(1)..(13)Sequence is synthesized 6Ser Met Glu Gln Lys
Leu Ile Ser Glu Glu Asp Leu Asn 1 5 10727PRTArtificial
SequenceUNSURE(1)..(27)Sequence is synthesized 7Lys Tyr Ala Leu Ala
Asp Ala Ser Leu Lys Met Ala Asp Pro Asn Arg 1 5 10 15Phe Arg Gly
Lys Asp Leu Pro Val Leu Asp Gln 20 25824PRTArtificial
SequenceUNSURE(1)..(24)Sequence is synthesized 8Met Gly His His His
His His His His His His His Ser Ser Gly His 1 5 10 15Ile Asp Asp
Asp Asp Lys His Met 209175PRTHomo sapiens 9Asp Pro Ala Gly Leu Leu
Asp Leu Arg Gln Gly Met Phe Ala Gln Leu 1 5 10 15Val Ala Gln Asn
Val Leu Leu Ile Asp Gly Pro Leu Ser Trp Tyr Ser 20 25 30Asp Pro Gly
Leu Ala Gly Val Ser Leu Thr Gly Gly Leu Ser Tyr Lys 35 40 45Glu Asp
Thr Lys Glu Leu Val Val Ala Lys Ala Gly Val Tyr Tyr Val 50 55 60Phe
Phe Gln Leu Glu Leu Arg Arg Val Val Ala Gly Glu Gly Ser Gly 65 70
75 80Ser Val Ser Leu Ala Leu His Leu Gln Pro Leu Arg Ser Ala Ala
Gly 85 90 95Ala Ala Ala Leu Ala Leu Thr Val Asp Leu Pro Pro Ala Ser
Ser Glu 100 105 110Ala Arg Asn Ser Ala Phe Gly Phe Gln Gly Arg Leu
Leu His Leu Ser 115 120 125Ala Gly Gln Arg Leu Gly Val His Leu His
Thr Glu Ala Arg Ala Arg 130 135 140His Ala Trp Gln Leu Thr Gln Gly
Ala Thr Val Leu Gly Leu Phe Arg145 150 155 160Val Thr Pro Glu Ile
Pro Ala Gly Leu Pro Ser Pro Arg Ser Glu 165 170 17510132PRTHomo
sapiens 10Val Ser His Arg Tyr Pro Arg Ile Gln Ser Ile Lys Val Gln
Phe Thr 1 5 10 15Glu Tyr Lys Lys Glu Lys Gly Phe Ile Leu Thr Ser
Gln Lys Glu Asp 20 25 30Glu Ile Met Lys Val Gln Asn Asn Ser Val Ile
Ile Asn Cys Asp Gly 35 40 45Phe Tyr Leu Ile Ser Leu Lys Gly Tyr Phe
Ser Gln Glu Val Asn Ile 50 55 60Ser Leu His Tyr Gln Lys Asp Glu Glu
Pro Leu Phe Gln Leu Lys Lys 65 70 75 80Val Arg Ser Val Asn Ser Leu
Met Val Ala Ser Leu Thr Tyr Lys Asp 85 90 95Lys Val Tyr Leu Asn Val
Thr Thr Asp Asn Thr Ser Leu Asp Asp Phe 100 105 110His Val Asn Gly
Gly Glu Leu Ile Leu Ile His Gln Asn Pro Gly Glu 115 120 125Phe Cys
Val Leu 13011151PRTHomo sapiens 11Gln Gln Gln Leu Pro Leu Glu Ser
Leu Gly Trp Asp Val Ala Glu Leu 1 5 10 15Gln Leu Asn His Thr Gly
Pro Gln Gln Asp Pro Arg Leu Tyr Trp Gln 20 25 30Gly Gly Pro Ala Leu
Gly Arg Ser Phe Leu His Gly Pro Glu Leu Asp 35 40 45Lys Gly Gln Leu
Arg Ile His Arg Asp Gly Ile Tyr Met Val His Ile 50 55 60Gln Val Thr
Leu Ala Ile Cys Ser Ser Thr Thr Ala Ser Arg His His 65 70 75 80Pro
Thr Thr Leu Ala Val Gly Ile Cys Ser Pro Ala Ser Arg Ser Ile 85 90
95Ser Leu Leu Arg Leu Ser Phe His Phe His Gln Gly Cys Thr Ile Val
100 105 110Ser Gln Arg Leu Thr Pro Leu Ala Arg Gly Asp Thr Leu Cys
Thr Asn 115 120 125Leu Thr Gly Thr Leu Leu Pro Ser Arg Asn Thr Asp
Glu Thr Phe Phe 130 135 140Gly Val Gln Trp Val Arg Pro145
15012148PRTHomo sapiens 12Leu Cys Ile Leu Lys Arg Ala Pro Phe Lys
Lys Ser Trp Ala Tyr Leu 1 5 10 15Gln Val Ala Lys His Leu Asn Lys
Thr Lys Leu Ser Trp Asn Lys Asp 20 25 30Gly Ile Leu His Gly Val Arg
Tyr Gln Asp Gly Asn Leu Val Ile Gln 35 40 45Phe Pro Gly Leu Tyr Phe
Ile Ile Cys Gln Leu Gln Phe Leu Val Gln 50 55 60Cys Pro Asn Asn Ser
Val Asp Leu Lys Leu Glu Leu Leu Ile Asn Lys 65 70 75 80His Ile Lys
Lys Gln Ala Leu Val Thr Val Cys Glu Ser Gly Met Gln 85 90 95Thr Lys
His Val Tyr Gln Asn Leu Ser Gln Phe Leu Leu Asp Tyr Leu 100 105
110Gln Val Asn Thr Thr Ile Ser Val Asn Val Asp Thr Phe Gln Tyr Ile
115 120 125Asp Thr Ser Thr Phe Pro Leu Glu Asn Val Leu Ser Ile Phe
Leu Tyr 130 135 140Ser Asn Ser Asp14513157PRTHomo sapiens 13Val Arg
Ser Ser Ser Arg Thr Pro Ser Asp Lys Pro Val Ala His Val 1 5 10
15Val Ala Asn Pro Gln Ala Glu Gly Gln Leu Gln Trp Leu Asn Arg Arg
20 25 30Ala Asn Ala Leu Leu Ala Asn Gly Val Glu Leu Arg Asp Asn Gln
Leu 35 40 45Val Val Pro Ser Glu Gly Leu Tyr Leu Ile Tyr Ser Gln Val
Leu Phe 50 55 60Lys Gly Gln Gly Cys Pro Ser Thr His Val Leu Leu Thr
His Thr Ile 65 70 75 80Ser Arg Ile Ala Val Ser Tyr Gln Thr Lys Val
Asn Leu Leu Ser Ala 85 90 95Ile Lys Ser Pro Cys Gln Arg Glu Thr Pro
Glu Gly Ala Glu Ala Lys 100 105 110Pro Trp Tyr Glu Pro Ile Tyr Leu
Gly Gly Val Phe Gln Leu Glu Lys 115 120 125Gly Asp Arg Leu Ser Ala
Glu Ile Asn Arg Pro Asp Tyr Leu Asp Phe 130 135 140Ala Glu Ser Gly
Gln Val Tyr Phe Gly Ile Ile Ala Leu145 150 15514168PRTHomo sapiens
14Glu Glu Pro Glu Thr Asp Leu Ser Pro Gly Leu Pro Ala Ala His Leu 1
5 10 15Ile Gly Ala Pro Leu Lys Gly Gln Gly Leu Gly Trp Glu Thr Thr
Lys 20 25 30Glu Gln Ala Phe Leu Thr Ser Gly Thr Gln Phe Ser Asp Ala
Glu Gly 35 40 45Leu Ala Leu Pro Gln Asp Gly Leu Tyr Tyr Leu Tyr Cys
Leu Val Gly 50 55 60Tyr Arg Gly Arg Ala Pro Pro Gly Gly Gly Asp Pro
Gln Gly Arg Ser 65 70 75 80Val Thr Leu Arg Ser Ser Leu Tyr Arg Ala
Gly Gly Ala Tyr Gly Pro 85 90 95Gly Thr Pro Glu Leu Leu Leu Glu Gly
Ala Glu Thr Val Thr Pro Val 100 105 110Leu Asp Pro Ala Arg Arg Gln
Gly Tyr Gly Pro Leu Trp Tyr Thr Ser 115 120 125Val Gly Phe Gly Gly
Leu Val Gln Leu Arg Arg Gly Glu Arg Val Tyr 130 135 140Val Asn Ile
Ser His Pro Asp Met Tyr Asp Phe Ala Arg Gly Lys Thr145 150 155
160Phe Phe Gly Ala Val Met Val Gly 16515155PRTHomo sapiens 15Pro
Lys Met His Leu Ala His Ser Thr Leu Lys Pro Ala Ala His Leu 1 5 10
15Ile Gly Asp Pro Ser Lys Gln Asn Ser Leu Leu Trp Arg Ala Asn Thr
20 25 30Asp Arg Ala Phe Leu Gln Asp Gly Phe Ser Leu Ser Asn Asn Ser
Leu 35 40 45Leu Val Pro Thr Ser Gly Ile Tyr Phe Val Tyr Ser Gln Val
Val Phe 50 55 60Ser Gly Lys Ala Tyr Ser Pro Lys Ala Thr Ser Ser Pro
Leu Tyr Leu 65 70 75 80Ala His Glu Val Gln Leu Phe Ser Ser Gln Tyr
Pro Phe His Val Pro 85 90 95Leu Leu Ser Ser Gln Lys Met Val Tyr Pro
Gly Leu Gln Glu Pro Trp 100 105 110Leu His Ser Met Tyr His Gly Ala
Ala Phe Gln Leu Thr Gln Gly Asp 115 120 125Gln Leu Ser Thr His Thr
Asp Gly Ile Pro His Leu Val Leu Ser Pro 130 135 140Ser Thr Val Val
Phe Phe Gly Ala Phe Ala Leu145 150 15516149PRTHomo sapiens 16Met
Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val Ile Ser 1 5 10
15Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu Lys Gly
20 25 30Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly Lys
Gln 35 40 45Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln
Val Thr 50 55 60Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe
Ile Ala Ser 65 70 75 80Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg
Ile Leu Leu Arg Ala 85 90 95Ala Asn Thr His Ser Ser Ala Lys Pro Cys
Gly Gln Gln Ser Ile His 100 105 110Leu Gly Gly Val Phe Glu Leu Gln
Pro Gly Ala Ser Val Phe Val Asn 115 120 125Val Thr Asp Pro Ser Gln
Val Ser His Gly Thr Gly Phe Thr Ser Phe 130 135 140Gly Leu Leu Lys
Leu14517149PRTHomo sapiens 17Pro Ser Pro Pro Pro Glu Lys Lys Glu
Leu Arg Lys Val Ala His Leu 1 5 10 15Thr Gly Lys Ser Asn Ser Arg
Ser Met Pro Leu Glu Trp Glu Asp Thr 20 25 30Tyr Gly Ile Val Val Leu
Leu Ser Gly Val Lys Tyr Lys Lys Gly Gly 35 40 45Leu Val Ile Asn Glu
Thr Gly Leu Tyr Phe Val Tyr Ser Lys Val Tyr 50 55 60Phe Arg Gly Gln
Ser Cys Asn Asn Leu Pro Leu Ser His Lys Val Tyr 65 70 75 80Met Arg
Asn Ser Lys Tyr Pro Gln Asp Leu Val Met Met Glu Gly Lys 85 90 95Met
Met Ser Tyr Cys Thr Thr Gly Gln Met Trp Ala Arg Ser Ser Tyr 100 105
110Leu Gly Ala Val Phe Asn Leu Thr Ser Ala Asp His Leu Tyr Val Asn
115 120 125Val Ser Glu Leu Ser Leu Val Asn Phe Glu Glu Ser Gln Thr
Phe Phe 130 135 140Gly Leu Tyr Lys Leu145
* * * * *