U.S. patent application number 12/356579 was filed with the patent office on 2009-06-18 for use of mass labeled probes to detect target nucleic acids using mass spectrometry.
This patent application is currently assigned to TRILLION GENOMICS LIMITED. Invention is credited to Andrew Thompson.
Application Number | 20090156424 12/356579 |
Document ID | / |
Family ID | 34971509 |
Filed Date | 2009-06-18 |
United States Patent
Application |
20090156424 |
Kind Code |
A1 |
Thompson; Andrew |
June 18, 2009 |
USE OF MASS LABELED PROBES TO DETECT TARGET NUCLEIC ACIDS USING
MASS SPECTROMETRY
Abstract
The invention relates to the use of mass labeled probes to
characterise nucleic acids by mass spectrometry. Thus the invention
provides methods of detecting the presence of a target nucleic acid
in a sample, using a circularising probe in which a mass tag is
present in the probe. Further methods of detecting the presence of
a target nucleic acid are provided, which in contrast use a probe
detection sequence in the circularising probe, wherein the probe
detection sequence is detected with a probe attached to a mass tag.
Methods for determining a genetic profile from the genome of an
organism also form part of the invention.
Inventors: |
Thompson; Andrew;
(Cambridge, GB) |
Correspondence
Address: |
OPPENHEIMER WOLFF & DONNELLY LLP
45 SOUTH SEVENTH STREET, SUITE 3300
MINNEAPOLIS
MN
55402
US
|
Assignee: |
TRILLION GENOMICS LIMITED
CAMBRIDGE
GB
|
Family ID: |
34971509 |
Appl. No.: |
12/356579 |
Filed: |
January 21, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11597109 |
Nov 20, 2006 |
|
|
|
PCT/GB2005/001980 |
May 19, 2005 |
|
|
|
12356579 |
|
|
|
|
60572464 |
May 20, 2004 |
|
|
|
Current U.S.
Class: |
506/9 ; 435/6.1;
435/6.18; 436/94 |
Current CPC
Class: |
C12Q 1/6823 20130101;
C12Q 1/682 20130101; Y10T 436/143333 20150115; C12Q 1/6816
20130101; C12Q 1/6816 20130101; C12Q 2563/167 20130101; C12Q
2525/307 20130101; C12Q 2521/319 20130101; C12Q 1/682 20130101;
C12Q 2563/167 20130101; C12Q 2531/125 20130101; C12Q 2525/307
20130101; C12Q 1/6823 20130101; C12Q 2563/167 20130101; C12Q
2561/101 20130101; C12Q 2525/307 20130101 |
Class at
Publication: |
506/9 ; 436/94;
435/6 |
International
Class: |
C40B 30/04 20060101
C40B030/04; G01N 33/00 20060101 G01N033/00; C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of detecting the presence of a target nucleic acid in a
sample, which method comprises a) contacting the sample, under
hybridizing conditions, with a probe for said target nucleic acid,
wherein said probe comprises two terminal nucleic acid target
recognition sequences that are complementary to and capable of
hybridizing to two neighboring regions of the target sequence, and
wherein the probe is linked to a tag that is identifiable by mass
spectrometry; b) covalently connecting the ends of the hybridized
probe with each other to form a circularized-probe, which
interlocks with the target strand through catenation; c) cleaving
the mass tag from the circularized probe; and d) detecting the mass
tag by mass spectrometry.
2. The method according to claim 1, wherein the two neighboring
regions of the target sequence are immediately adjacent to each
other.
3. The method according to claim 1, wherein the two neighboring
regions of the target sequence are separated by a gap, and wherein
covalent connection of the sequences is performed by providing an
oligonucleotide capable of hybridizing to the sequence between the
neighboring regions of the target sequence, and ligating said
oligonucleotide to the terminal nucleic acid recognition
sequences.
4. The method according to claim 1, wherein the two neighboring
regions of the target sequence are separated by a gap, and wherein
covalent connection of the sequences is performed by providing a
gap-filling polymerase and one or more nucleotide triphosphates to
extend the 3' terminal nucleic acid target recognition sequence of
the probe to fill the gap, and ligating the terminal nucleic acid
recognition sequences.
5. The method according to claim 1, wherein the sample is contacted
with two or more different probes capable of binding different
alleles of the target sequence, under conditions which a probe
complementary for an allele present in the sample will form a
circularized probe and a probe not complementary for an allele
present in the sample will not form a circularized probe, wherein
each probe comprises a different mass tag, and wherein the method
includes the step of separating circularized probes from
non-circularized probes.
6. The method according to claim 5, wherein circularized probe is
separated from non-circularized probe by digesting non-circularized
probe with an exonuclease.
7. The method according to claim 5, wherein the probes are captured
onto a solid support and cleaved such that only circularized probes
retain the tagged portion on the solid support.
8. The method according to claim 1, wherein the sample is contacted
with two or more sets of probes, each probe set comprising one or
more probes for one or more alleles of a target sequence.
9. The method according to claim 8, wherein each probe in a set
comprises a tandem mass tag having a mass tag component and a mass
normalization component such that the sum of the masses of the two
components are the same for each member of the set.
10. The method according to claim 1, wherein the probe further
comprises a microarray address sequence.
11. A method for determining a genetic profile from the genome of
an organism, said method comprising: a) providing a microarray
which has an array of microarray address sequence complements at
discrete locations on said array; b) performing the method of claim
10 so as to detect the presence of one or more mass tags at one or
more locations of the microarray; and c) correlating the presence
of a mass tag at a location with the presence of a target sequence
in the organism.
12. A method of detecting the presence of a target nucleic acid in
a sample, which method comprises a) contacting the sample, under
hybridizing conditions, with a probe for said target nucleic acid,
wherein said probe comprises two terminal nucleic acid target
recognition sequences that are complementary to and capable of
hybridizing to two neighboring regions of the target sequence, and
wherein the probe comprises a probe identification sequence; b)
covalently connecting the ends of the hybridized probe with each
other to form a circularized-probe, which interlocks with the
target strand through catenation; c) hybridizing a probe detection
oligonucleotide to the probe identification sequence present in the
said probe, where the probe detection oligonucleotide is cleavably
linked to a mass tag; d) cleaving the mass tag from the probe
detection oligonucleotide; and e) detecting the mass tag by mass
spectrometry.
13. The method according to claim 12, wherein the two neighboring
regions of the target sequence are immediately adjacent to each
other.
14. The method according to claim 12, wherein the two neighboring
regions of the target sequence are separated by a gap, and wherein
covalent connection of the sequences is performed by providing an
oligonucleotide capable of hybridizing to the sequence between the
neighboring regions of the target sequence, and ligating said
oligonucleotide to the terminal nucleic acid recognition
sequences.
15. The method according to claim 12, wherein the two neighboring
regions of the target sequence are separated by a gap, and wherein
covalent connection of the sequences is performed by a providing a
gap-filling polymerase and one or more nucleotide triphosphates to
extend the 3' terminal nucleic acid target recognition sequence of
the probe to fill the gap, and ligating the terminal nucleic acid
recognition sequences.
16. The method according to claim 12, wherein the sample is
contacted with two or more different probes capable of binding
different alleles of the target sequence, under conditions which a
probe complementary for an allele present in the sample will form a
circularized probe and a probe not complementary for an allele
present in the sample will not form a circularized probe, wherein
each probe comprises a different probe identification sequence, and
wherein the method includes the step of separating circularized
probes from non-circularized probes.
17. The method according to claim 16, wherein circularized probe is
separated from non-circularized probe by digesting non-circularized
probe with an exonuclease.
18. The method according to claim 16, wherein the circularized
probes comprise a primer binding site, and said probes are
contacted with a rolling circle primer under conditions for rolling
circle replication to occur, to provide a linear extension
product.
19. The method according to claim 18, wherein said rolling circle
primer is attached to a solid support.
20. The method according to claim 18, wherein said rolling circle
primer is attached to an affinity ligand that allows the
replication product to be captured onto a solid support derivatized
with the corresponding ligand for the affinity ligand.
21. The method according to claim 18, wherein the probe detection
oligonucleotide is hybridized to the probe identification sequence
present in the linear extension product.
22. The method according claim 12, wherein the sample is contacted
with two or more sets of probes, each probe set comprising one or
more probes for one or more alleles of a target sequence.
23. The method according to claim 22, wherein each probe in a set
is detected with a probe detection oligonucleotide attached to a
tandem mass tag having a mass tag component and a mass
normalization component such that the sum of the masses of the two
components are the same for each member of the set.
24. The method according to claim 12, wherein the probe further
comprises a microarray address sequence.
25. A method for determining a genetic profile from the genome of
an organism, said method comprising: a) providing a microarray
which has an array of microarray address sequence complements at
discrete locations on said array; b) performing the method of claim
24 so as to detect the presence of one or more mass tags at one or
more locations of the microarray; and c) correlating the presence
of a mass tag at a location with the presence of a target sequence
in the organism.
26. A method of detecting the presence of a target nucleic acid in
a sample, which method comprises a) contacting the sample, under
hybridizing conditions, with a probe for said target nucleic acid,
wherein said probe comprises two terminal nucleic acid target
recognition sequences that are complementary to and capable of
hybridizing to two neighboring regions of the target sequence, and
wherein the probe further comprises a probe identification sequence
and a pair of primer binding sequences; b) covalently connecting
the ends of the hybridized probe with each other to form a
circularized-probe, which interlocks with the target strand through
catenation; c) contacting one primer binding sequence with a
complementary primer under conditions for rolling circle
replication to occur, to provide a linear extension product; d)
contacting the linear extension product with a primer having the
sequence of the second primer binding sequence, under conditions to
provide for hyper-branching rolling circle replication; e)
hybridizing a probe detection oligonucleotide to the probe
identification sequence present in the said probe, where the probe
detection oligonucleotide is cleavably linked to a mass tag; and f)
detecting the mass tag by mass spectrometry.
27. The method according to claim 26, wherein prior to detection of
the mass tag the probe is hybridized to a microarray at a location
having a nucleotide sequence complementary to the microarray
address sequence of the probe.
28. The method according to claim 26, wherein the probe further
comprises a microarray address sequence.
29. A method for determining a genetic profile from the genome of
an organism, said method comprising: a) providing a microarray
which has an array of microarray address sequence complements at
discrete locations on said array; b) performing the method of claim
28 so as to detect the presence of one or more mass tags at one or
more locations of the microarray; and c) correlating the presence
of a mass tag at a location with the presence of a target sequence
in the organism.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 11/597,109, filed Nov. 20, 2006, which is a National Stage
Application of PCT/GB2005/01980, filed May 19, 2004, which claims
priority from U.S. Provisional Application 60/572,464, filed May
20, 2004, the entireties of which are hereby incorporated by
reference.
REFERENCE TO SEQUENCE LISTING
[0002] In accordance with 37 CFR .sctn.1.824, Applicant attaches
herewith a copy of the Sequence Listing in computer readable form
(CRF) in an electronic file, file name Sequence Listing.txt,
created Nov. 20, 2006, file size 10.2 kilobytes, the contents
thereof being incorporated by reference herein. The content of the
sequence listing recorded in computer readable form is identical to
the written sequence listing and, includes no new matter.
FIELD OF THE INVENTION
[0003] This invention relates to useful probe molecules for
characterising biomolecules of interest, particularly nucleic
acids. Specifically this invention relates to oligonucleotide
probes that are cleavably linked to tags designed for detection by
mass spectrometry and tandem mass spectrometry. In addition, this
invention relates to associated methods for employing mass labeled
probes to detect target nucleic acids using mass spectrometry.
BACKGROUND OF THE INVENTION
[0004] Nucleic acids are typically detected by contacting them with
labelled probe molecules under controlled conditions and detecting
the labels to determine whether specific binding or hybridisation
has taken place. Various methods of labeling probes are known in
the art, including the use of radioactive atoms, fluorescent dyes,
luminescent reagents, electron capture reagents and light absorbing
dyes. Each of these labeling systems has features which make it
suitable for certain applications and not others. For reasons of
safety, interest in non-radioactive labeling systems lead to the
widespread commercial development of fluorescent labeling schemes
particularly for genetic analysis. Fluorescent labeling schemes
permit the labeling of a relatively small number of molecules
simultaneously, typically 4 labels can be used simultaneously and
possibly up to eight. However the costs of the detection apparatus
and the difficulties of analysing the resultant signals limit the
number of labels that can be used simultaneously in a fluorescence
detection scheme.
[0005] More recently there has been development in the area of mass
spectrometry as a method of detecting labels that are cleavably
attached to their associated probe molecules. Until recently, Mass
Spectrometry has been used to detect analyte ions or their fragment
ions directly, however for many applications such as nucleic acid
analysis, the structure of the analyte can be determined from
indirect labeling. This is advantageous particularly with respect
to the use of mass spectrometry because complex biomolecules such
as DNA have complex mass spectra and are detected with relatively
poor sensitivity. Indirect detection means that an associated label
molecule can be used to identify the original analyte, where the
label is designed for sensitive detection and a simple mass
spectrum. Simple mass spectra mean that multiple labels can be used
to analyse multiple analytes simultaneously. In fact, many more
labels than can currently be used simultaneously in fluorescence
based assays can be generated.
[0006] WO98/31830 describes arrays of nucleic acid probes
covalently attached to cleavable labels that are detectable by mass
spectrometry which identify the sequence of the covalently linked
nucleic acid probe. The labeled probes of this application have the
structure Nu-L-M where Nu is a nucleic acid covalently linked to L,
a cleavable linker, covalently linked to M, a mass label. Preferred
cleavable linkers in this application cleave within the ion source
of the mass spectrometer. Preferred mass labels are substituted
poly-aryl ethers. These application discloses a variety of
ionisation methods and analysis by quadrupole mass analysers, TOF
analysers and magnetic sector instruments as specific methods of
analysing mass labels by mass spectrometry.
[0007] WO 95/04160 disclose ligands, and specifically nucleic
acids, cleavably linked to mass tag molecules. Preferred cleavable
linkers are photo-cleavable. These application discloses Matrix
Assisted Laser Desorption Ionisation (MALDI) Time of Flight (TOF)
mass spectrometry as a specific method of analysing mass labels by
mass spectrometry.
[0008] WO 98/26095 discloses releasable non-volatile mass-label
molecules. In preferred embodiments these labels comprise polymers,
particularly biopolymers, and more particularly nucleic acids,
which are cleavably attached to a reactive group or ligand, i.e. a
probe. Preferred cleavable linkers appear to be chemically or
enzymatically cleavable. This application discloses MALDI TOF mass
spectrometry as a specific method of analysing mass labels by mass
spectrometry.
[0009] WO 97/27327, WO 97/27325, WO 97/27331 disclose ligands, and
specifically nucleic acids, cleavably linked to mass tag molecules.
Preferred cleavable linkers appear to be chemically or
photo-cleavable. These application discloses a variety of
ionisation methods and analysis by quadrupole mass analysers, TOF
analysers and magnetic sector instruments as specific methods of
analysing mass labels by mass spectrometry.
[0010] WO 01/68664 and WO 03/025576 disclose organic molecule mass
markers that are analysed by tandem mass spectrometry. These
applications disclose mass markers comprised of two components, a
mass tag component and a mass normalization component that are
connected to each other by a collision cleavable group. Sets of
tags can be synthesised where the sum of the masses of the two
components produce markers with the same overall mass. The mass
markers are typically analysed after cleavage from their analyte.
Analysis takes place in an instrument capable of tandem mass
spectrometric analysis. In the first stage of analysis, the MS/MS
instrument is set to select ions with the mass-to-charge ratio that
corresponds to the mass marker comprising both the mass tag and
mass normaliser, which may be referred to as the `parent ion`. This
selection process effected by the MS/MS instrument allows the
markers to be abstracted from the background. Collision of selected
the marker ions in the second stage of the analysis separates the
two components of the tag from each other. Only the mass tag
fragments of the parent ion, which may be referred to as the
`daughter ions` are detected in the third stage of analysis. This
allows confirmation that the ion selected in the first stage of
analysis is from a mass marker and not from a contaminating ion,
which happens to have the same mass-to-charge ratio as the parent
ion. The whole process greatly enhances the signal to noise ratio
of the analysis and improves sensitivity. This mass marker design
also compresses the mass range over which an array of mass markers
is spread as mass markers can have the same mass as long as they
give rise to mass tag fragments that are uniquely resolvable.
Moreover, with isotopes, this mass marker design allows the
synthesis of markers, which are chemically identical, have the same
mass but which are still resolvable by mass spectrometry. Use of
these markers to identify oligonucleotide probes is described.
[0011] Thus, the prior art provides oligonucleotide probes
cleavably linked to tags that are detectable by mass spectrometry.
The prior art also shows that these probes enable multiplexing of
nucleic acid probe binding assays. However, multiplexed assays
require more than just multiple tags. Many nucleic acid probe
binding assays do not function well when multiplexed because of
problems of cross-hybridisation. This is a particular problem for
polymerase chain reaction (PCR) based assays, for which it is very
costly and time-consuming to optimize reactions involving multiple
primer pairs. The problems are due to the high risk of cross
hybridization of primers to incorrect templates leading to
cross-amplification of templates and hence to incorrect
results.
[0012] However, some nucleic acid probe binding assay methods that
enable high-order multiplexing are known in the art. Most notably,
Oligonucleotide Ligation Assays (OLA) such as those described in
U.S. Pat. No. 4,988,617, which discloses an assay for determining
the sequence of a region of a target nucleic acid, which has a
known possible mutation in at least one nucleotide position in the
sequence. In this sort of assay, two oligonucleotide probes that
are complementary to immediately adjacent segments of a target DNA
or RNA molecule which, contains the possible mutation(s) near the
segment joint, are hybridised to the target DNA. A ligase is then
added to the juxtaposed hybridised probes. Assay conditions are
selected such that when the target nucleotide is correctly base
paired, the probes will be covalently joined by the ligase, and if
not correctly base paired due to a mismatching nucleotide(s) near
the segment joint, the probes are incapable of being covalently
joined by the ligase. The presence or absence of ligation is
detected as an indication of the sequence of the target
nucleotide.
[0013] Similar assays are disclosed in EP-A-185 494. In this
method, however, the formation of a ligation product depends on the
capability of two adjacent probes to hybridize under high
stringency conditions rather than on the requirement of correct
base-pairing in the joint region for the ligase to function
properly as in the above U.S. Pat. No. 4,988,617. Other references
relating to ligase-assisted detection are, e.g., EP-A-330 308,
EP-A-324 616, EP-A-473 155, EP-A-336 731, U.S. Pat. No. 4,883,750
and U.S. Pat. No. 5,242,794.
[0014] Ligation mediated assays have a number of advantages over
conventional hybridization based assays. The reaction is more
specific than hybridization as it requires several independent
events to take place to give rise to a signal. Ligation reactions
rely on the spatial juxtaposition of two separate probe sequences
on a target sequence, and this is unlikely to occur in the absence
of the appropriate target molecule even under non-stringent
reaction conditions. This means that standardised reaction
conditions can be used enabling automation. In addition, due to the
substrate requirements of ligases, incorrectly hybridised probes
with terminal mismatches at the ligation junction are ligated with
very poor efficiency. This means that allelic sequence variants can
be distinguished with suitably designed probes. The ligation event
creates a unique molecule, not previously present in the assay
which enables a variety of useful signal generation systems to be
employed to detect the event. This high specificity makes ligation
based assays easier to multiplex as disclosed in provisional U.S.
application 20030108913.
[0015] Further improvements in stringency and multiplexing can be
achieved using circularising probes. Circularising probes comprise
a single oligonucleotide probe, typically about 70 nucleotides in
length or greater, in which the two probe sequences that are to be
ligated to each other are located at either end of the probe
molecule. The probe sequences are designed so that when they bind
to their target sequence, the two probe sequences are brought into
juxtaposition. The probe sequences can then be ligated to form a
closed circular loop of DNA. Since both probe sequences are linked
to each other, when one probe sequence binds to its target, binding
of the second probe sequence takes place with rapid kinetics. This
ensures that intra-molecular ligation is much more likely than
inter-molecular ligation reducing cross-ligation of probes to very
low levels. In addition, cross-ligated probes are still linear and
it is highly unlikely that two or more probes will cross-ligate to
form a circular species. Similarly, mismatched probes, i.e. probes
that have bound to a target that does not exactly match the probe
sequence, are unable to ligate and therefore will not be
circularized. This all means that correctly reacted probes can be
distinguished from incorrectly reacted probes by the fact that
correctly reacted probes are circular. The ability to resolve
correctly matched probes means that large numbers of probes can be
used simultaneously in a single reaction. The key to using
circularizing probes lies in being able to obtain a signal from
circularised probes rather than from non-circularised probes and
various methods have been disclosed in the prior art to date.
[0016] The first disclosure of circularizing probes appears to have
been made by Aono Toshiya in JP 4262799 and JP 4304900. These
applications both disclose the use of ligation reactions with
circularising probes.
[0017] Circularisation is detected by the ability of circularized
probes to undergo linear Rolling Circle Amplification (RCA). The
methodology disclosed in the above Japanese applications comprises
contacting the sample in the presence of a ligase with a probe
oligonucleotide. Correctly hybridised probes will be circularized
by ligation and will act as a template in a RCA polymerization
reaction. A primer, which is at least partially complementary to
the circularised probe, together with a strand-displacing nucleic
acid polymerase and nucleotide triphosphates are added to the
circularized sequences and a single stranded nucleic acid is formed
which has a tandemly repeated sequence complementary to the
circularized probe and at least partially to the template. The
amplification product is then detected either via a labelled
nucleotide triphosphate incorporated in the amplification, or by an
added labelled nucleic acid probe capable of hybridizing to the
amplification product.
[0018] Other methods based on RCA of circularized probes have been
disclosed in U.S. Pat. No. 5,854,033 and related divisions of this
application published as U.S. Pat. No. 6,344,329, U.S. Pat. No.
6,210,884 and U.S. Pat. No. 6,183,960. The most notable difference
between the disclosure of these applications and the disclosure of
JP 4262799 and JP 4304900, is the use of hyper-branching RCA. In
this method, a second primer that is at least partially
complementary to the single-stranded product of linear RCA of a
circularized probe is added to the reaction. This results in a
further geometric amplification of the single stranded product.
[0019] Another method for resolving circularized probes from
non-circularised probes is disclosed in WO 95/22623. The methods
disclosed in this application exploit the fact that circularized
probes are not susceptible to degradation by exonucleases while
unreacted linear probes are susceptible to degradation. In
addition, cyclisation of a probe `locks`, the probe onto its
target, i.e. the probes are resistant to being separated from their
target. This allows circularized probes to be distinguished from
linear probes by subjecting the probes to non-hybridising
conditions. This approach to the use of circularizing probes is
sometimes referred to as Padlock Probe technology.
[0020] Despite the ability of mass tags to enable multiplexing of
nucleic acid assays, none of the prior art on mass tags provides
methods of analysing nucleic acids using circularising probes.
Similarly, none of the prior art on circularising probes provides
methods of detecting circularising probes suggests using mass
spectrometry. It is thus an object of this invention to provide
methods and reagents to exploit the abilities of both mass tags and
circularising probes to be used in highly multiplexed nucleic acid
detection assays.
BRIEF SUMMARY OF THE INVENTION
[0021] In a first aspect the invention provides a method of
detecting a target nucleic acid comprising
[0022] a) contacting the sample, under hybridizing conditions, with
a probe for said target nucleic acid, wherein said probe comprises
two terminal nucleic acid target recognition sequences that are
complementary to and capable of hybridizing to two neighbouring
regions of the target sequence, and wherein the probe is linked to
a tag that is identifiable by mass spectrometry;
[0023] b) covalently connecting the ends of the hybridized probe
with each other to form a circularized-probe, which interlocks with
the target strand through catenation;
[0024] c) cleaving the mass tag from the circularized probe;
and
[0025] d) detecting the mass tag by mass spectrometry.
[0026] In a second aspect, the invention comprises a method of
detecting the presence of a target nucleic acid in a sample, which
method comprises [0027] a) contacting the sample, under hybridizing
conditions, with a probe for said target nucleic acid, wherein said
probe comprises two terminal nucleic acid target recognition
sequences that are complementary to and capable of hybridizing to
two neighbouring regions of the target sequence, and wherein the
probe comprises a probe identification sequence; [0028] b)
covalently connecting the ends of the hybridized probe with each
other to form a circularized-probe, which interlocks with the
target strand through catenation; [0029] c) hybridizing a probe
detection oligonucleotide to the probe identification sequence
present in the said probe, where the probe detection
oligonucleotide is cleavably linked to a mass tag; [0030] d)
cleaving the mass tag from the probe detection oligonucleotide; and
[0031] e) detecting the mass tag by mass spectrometry.
[0032] In a third aspect, the invention provides a method of
detecting the presence of a target nucleic acid in a sample, which
method comprises [0033] a) contacting the sample, under hybridizing
conditions, with a probe for said target nucleic acid, wherein said
probe comprises two terminal nucleic acid target recognition
sequences that are complementary to and capable of hybridizing to
two neighbouring regions of the target sequence, and wherein the
probe further comprises a probe identification sequence and a pair
of primer binding sequences; [0034] b) covalently connecting the
ends of the hybridized probe with each other to form a
circularized-probe, which interlocks with the target strand through
catenation; [0035] c) cleaving the circularized probe such that the
opened probe has the primer binding sequences oriented to enable
polymerase chain reaction amplification of the probe identification
sequence; [0036] d) hybridizing a probe detection oligonucleotide
to the probe identification sequence present in the said probe,
where the probe detection oligonucleotide is cleavably linked to a
mass tag; [0037] e) performing a primer extension reaction by
providing a primer capable of hybridizing to the primer binding
sequence upstream of the probe identification sequence and
extending said primer with a polymerase having 5' exonuclease
activity, so as to cleave the mass tag from the probe detection
oligonucleotide; and [0038] f) detecting the mass tag by mass
spectrometry.
[0039] In a fourth aspect, the invention provides a method of
detecting the presence of a target nucleic acid in a sample, which
method comprises [0040] a) contacting the sample, under hybridizing
conditions, with a probe for said target nucleic acid, wherein said
probe comprises two terminal nucleic acid target recognition
sequences that are complementary to and capable of hybridizing to
two neighbouring regions of the target sequence, and wherein the
probe further comprises a probe identification sequence and a pair
of primer binding sequences; [0041] b) covalently connecting the
ends of the hybridized probe with each other to form a
circularized-probe, which interlocks with the target strand through
catenation; [0042] c) contacting one primer binding sequence with a
complementary primer under conditions for rolling circle
replication to occur, to provide a linear extension product; [0043]
d) contacting the linear extension product with a primer having the
sequence of the second primer binding sequence, under conditions to
provide for hyper-branching rolling circle replication; [0044] e)
hybridizing a probe detection oligonucleotide to the probe
identification sequence present in the said probe, where the probe
detection oligonucleotide is cleavably linked to a mass tag; and
[0045] f) detecting the mass tag by mass spectrometry.
[0046] The first aspect of the invention set out above relates to a
method for detection of a nucleic acid using a circularising probe
in which a mass tag is present in the probe. The other aspects of
the invention set out above in contrast use a probe detection
sequence in the circularising probe, wherein the probe detection
sequence is detected with a probe attached to a mass tag.
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] FIG. 1 illustrates a directly labelled Circularising Probe
according to the first aspect of this invention. The probe
comprises two Target Recognition Sequences (TRS1 and TRS2; marked
as the grey regions) at either end of the probe. The intermediate
sequence is shown in white. A mass tag is shown linked to the probe
sequence. In some embodiments, more than 1 mass tag may be linked
to a probe of the invention.
[0048] FIG. 2 illustrates hybridisation of a circularising probe to
its target nucleic acid. It can be seen that the TRS regions are
designed to hybridise in juxtaposition on the target, leaving a
small gap, which may be just a missing phosphodiester linkage or a
space of one or more nucleotides.
[0049] FIG. 3 illustrates a Circularising Probe according to the
second aspect of this invention. The probe comprises two Target
Recognition Sequences (TRS1 and TRS2; marked as the grey regions)
at either end of the probe. The intermediate sequence is shown in
white. A Probe Identification sequence (marked as the black region)
is present in the Intermediate region (marked as the white region).
The Probe Identification sequence is designed to uniquely identify
the probe. In some embodiments, more than 1 Probe Identification
sequence may be present in a probe of the invention.
[0050] FIGS. 4a and 4b schematically illustrate the use of a
directly labelled Circularising Probe in a method according to the
first aspect of this invention. The details of the method are
discussed in detail in the detailed description that follows.
[0051] FIGS. 5a and 5b schematically illustrate the use of
Circularising Probes that comprise Probe Identification Sequences
in a method according to the second aspect of this invention. The
details of the method are discussed in detail in the detailed
description that follows.
[0052] FIGS. 6a, 6b and 6c schematically illustrate the use of
Circularising Probes that comprise Probe Identification Sequences
and Primer Binding Sequences in a method according to the third
aspect of this invention. The details of the method are discussed
in detail in the detailed description that follows.
DETAILED DESCRIPTION OF THE INVENTION
[0053] This invention describes reagents, methods and kits that
exploit circularising probes to characterise nucleic acids by mass
spectrometry.
Definitions
[0054] The term `MS/MS` in the context of mass spectrometers refers
to mass spectrometers capable of selecting ions, subjecting
selected ions to Collision Induced Dissociation (CID) and
subjecting the fragment ions to further analysis.
[0055] The term `serial instrument` refers to mass spectrometers
capable of MS/MS in which mass analysers are organised in series
and each step of the MS/MS process is performed one after the other
in linked mass analysers. Typical serial instruments include triple
quadrupole mass spectrometers, tandem sector instruments and
quadrupole time of flight mass spectrometers.
[0056] A Linear Circularising Probe (LCP) is probe sequence where
the two termini of the probe comprise Target Recognition Sequences
(TRS) that are designed to hybridise in juxtaposition on a target
nucleic acid. The 3' terminus of the probe preferably comprises a
free hydroxyl group while the 5' hydroxyl group is preferably
phosphorylated. These probes are designed so that the TRS portions
can be covalently linked to each other after correct hybridization
to their target to form a circular molecule.
[0057] A Closed Circularizing Probe (CCP) is simply a name for an
LCP whose TRS regions have been covalently linked to form a
circular molecule.
[0058] A Probe Identification (PI) sequence is a sequence present
in an LCP that allows the LCP to be identified through
hybridisation with an appropriate Probe Detection Sequence that is
preferably labelled with a unique mass tag.
[0059] A Probe Detection Sequence (PDS) is a labelled probe
sequence that is at least partially complementary to a Probe
Identification sequence and through hybridisation with a PI
sequence it can be used to identify the presence of an LCP or CCP.
Generally, the PDS probes are applied in a way that ensures that
only CCPs are detected.
[0060] A Primer Binding Site (PBS) is a sequence that is present in
an LCP or CCP that allows for the binding of a primer
oligonucleotide so that the primer can facilitate replication of
the CCP. Primers for rolling circle replication and for PCR can be
used with this invention.
[0061] A primer for rolling circle replication is referred to as a
Rolling Circle Primer (RCP) while a primer for PCR is simply
referred to as a PCR primer.
Overview of the Invention
[0062] Circularising probes have a number of distinct advantages
when compared to other approaches for SNP analysis and Gene
Expression Profiling. The most widely used technologies at the
moment that enables analysis of both SNPs and Gene Expression are
microarrays and Real Time PCR. Both of these technologies have a
number of disadvantages. Both these technologies typically require
conversion of RNA into cDNA by reverse transcription prior to
analysis. For mRNA analysis on microarrays, this typically requires
the presence of a polyadenylation sequence at the 5' end of the
mRNA to allow a generic amplification reaction. This means that RNA
species that are not polyadenylated are difficult to analyse with
microarray techniques, such as bacterial or viral RNA. For PCR
based analysis of RNA, the lack of polyadenylation is not such a
problem but PCR requires a pair of primers to be designed for each
RNA species. Because each primer can potentially cross-hybridise
and thus cross-amplify incorrect RNA molecules, PCR primer pairs
must have a very high level of specificity. However, even with
careful optimisation it is very difficult to design reactions with
more than 20 pairs of specific PCR primers. Circularising probes
have the advantage that large numbers can be used simultaneously in
a single reaction (Hardenbol et al., Nature Biotechnology 21 (6)
pages 673-678, 2003) but can be designed for specific sequences,
rather than relying on polyadenylation making Circularising probes
ideal for analysis of bacterial and viral RNA. In addition, the
ability to analyse numerous species simultaneously will allow
analysis of viral RNA and bacterial simultaneously with human mRNA
for example allowing expression changes in both host and infectious
agent to be analysed simultaneously during studies of infection.
The use of mass tags to detect circularisation events, as disclosed
in this invention, has many advantages, since large arrays of
isotopic tags can be generated. The use of isotopic tags means that
accurate quantification is enabled as the relative abundances of
isotope tags are an accurate indicator of the levels of the
expression products.
[0063] In addition, the high specificity of circularising probes
and the ability to accurately measure expression changes with
isotopic mass tags allows both measurement of expression changes
and the presence of genetic variation to be performed
simultaneously. An example of an application of this ability would
be viral load monitoring, where it is desirable to detect not only
the total amount of virus, but the amount of each genetic variant.
This is of importance in management of HIV treatment where specific
genetic variations correspond to different forms of drug
resistance. To be able to monitor this in a single test would
enable much more effective management of this disease. Similar
considerations apply to the treatment of cancers which also
gradually evolve drug resistance.
[0064] Analysis of gene expression has a number of specific issues.
Expression analysis typically involves the analysis of RNA species.
RNA can be converted to cDNA by reverse transcription and numerous
methods are known in the art (Wang J. et al., Biotechniques
34(2):394-400, "RNA amplification strategies for cDNA microarray
experiments." 2003; Petalidis L. et al., Nucleic Acids Res. 31
(22): e142, "Global amplification of mRNA by template-switching
PCR: linearity and application to microarray analysis." 2003; Baugh
L. R. et al., Nucleic Acids Res. 29 (5):E29, "Quantitative analysis
of mRNA amplification by in vitro transcription." 2001). However,
it has been shown that target mediated ligation of LCPs can be
performed with RNA targets directly, thus avoiding the need for
conversion of RNA to cDNA (Nilsson M. et al., Nat Biotechnol.
18(7):791-793, "Enhanced detection and distinction of RNA by
enzymatic probe ligation." 2000). Thus in preferred embodiments of
this invention involving RNA targets, it is preferred that LCPs are
contacted directly with the target RNA molecules.
[0065] In preferred embodiments of the second aspect of the
invention, correctly ligated CCPs are resolved from unreacted or
incorrectly reacted LCPs by RCR. Target mediated ligation of LCPs
to form CCPs interlocks the CCP with its target. It has been shown
that RCR does still take place in this constrained environment but
at a slightly lower efficiency than free circles (Kuhn H. et al.,
Nucleic Acids Res. 30(2):574-580, "Rolling-circle amplification
under topological constraints." 2002) so where possible it is
desirable to separate the CCPs from their target prior to RCR. When
the target species is RNA it is possible to degrade the RNA
component of an RNA/DNA duplex using RNAse H. Thus in embodiments
of this invention where RCR is to be used, it may be preferred that
prior to RCR, the CCP/RNA duplexes are degraded by contacting them
with RNAse H.
[0066] Finally, in applications where many thousands of RNA species
are analysed it is preferable that a large library of LCPs is
applied in a single reaction and that a captured library of CCPs is
generated from the RCR reaction as described above so that the
library can be probed at leisure with multiple arrays of mass
tagged Probe Detection Sequences.
[0067] Linear Circularising Probes:
[0068] A Linear Circularising Probe (LCP) of all aspects of the
present invention comprise two Target Recognition Sequences (TRSs)
which hybridise to two neighbouring regions of a target sequence.
In the accompanying Figures, these are designated TRS1 and
TRS2.
[0069] The size of each of TRS1 and TRS2 may vary and be
independent of each other. Usually, one of the TRSs will be
designed to detect an allelic sequence, e.g. a target sequence
which may be one of two of more possibilities at a specific
nucleotide. This may be designated TRS1, though it will be
understood that this is an arbitrary designation and TRS1 may be at
the 5' end or the 3' end of the LCP. The present invention may be
used to determine which of two or more single nucleotide
polymorphisms (SNPs) is present in a target sequence, by using a
set comprising a mixture of two or more LCPs, each of which has a
TRS1 specific for one SNP and a TRS2 which will usually be
identical for each member of a set of LCPs.
[0070] The length of the TRS1 and position of the allelic
nucleotide will be selected to allow the TRS1 which is completely
homologous to its target to hybridise to that target sequence and
be ligated to TRS2 whilst a TRS1 of the same set which differs by
only a single residue does not hybridise sufficiently to undergo
ligation with TRS2 when the target is that for the former TRS1.
[0071] Typically, the TRSs may be between 15 and 25 nucleotides in
length each, though shorter lengths, e.g. of from 4 or more
nucleotides, are not excluded. The precise size and composition of
the TRSs may be selected by a person of skill in the art taking
into account the specific nature of the target.
[0072] After TRS1 and 2 have hybridized to the target molecule and
any missing nucleotides between the LCP ends have been filled, the
probe ends are connected to each other, typically by ligation with
a ligase, to form a covalently Closed Circularizing Probe (CCP)
molecule. Exemplary ligases are T4 DNA ligase, T7 DNA ligase, E.
coli DNA ligase, and Thermus thermophilus DNA ligase. Alternative
ways of effecting such covalent closure may, for example, be
achieved by use of a catalytic RNA molecule or by chemical
ligation.
[0073] By selecting the probe as well as the combined length of any
gap filling nucleotides or oligonucleotides properly, the circular
molecule formed will be wound around and will interlock with the
target molecule. Typically, the circularized sequence should be 70
bases or greater for a probe comprised entirely of nucleotide
linkages. Typically, for a nucleotide probe a size range of from 70
to 100 nucleotides may be used, e.g. a probe of about 80 or about
90 nucleotides in length.
[0074] A probe comprised of non-nucleotide linkages may have
different steric limitations and in this way it may be possible to
synthesise shorter oligonucleotide probes. It is sufficient, for
the purposes of some aspects of the present invention, that only
the actual TRS segments consist of nucleotides or optionally
functionally analogous structures that can undergo ligation. The
remainder of the LCP may have another chemical composition,
comprising, for example, residues selected from peptides or
proteins, carbohydrates or other natural or synthetic polymers.
Such an intermediate structure of non-nucleotide nature may even be
preferred with regard to stability and ease of introducing-labels
or tags, and also since a non-nucleotide intermediate structure
will not exhibit a secondary structure or cause
mishybridization.
[0075] If, however, the probe structure does comprise only nucleic
acid, the combined lengths of the component sequences of each LCP
should preferably be such that the strands will leave the double
helix on the same face 10 or a multiple of 10 bases apart, 10 bases
representing approximately one turn of the DNA double helix.
[0076] Leaving a gap of one or more nucleotides between TRS1 and
TRS 2 may be advantageous as the gap filling step can improve
specificity of the recognition reaction, but a gap is not critical
and the method of the invention may be performed without it just as
effectively, i.e. that TRS1 and 2 are designed to in immediate
juxtaposition on the target molecule, whereupon the two ends can be
directly ligated to circularize the LCP to form a CCP.
[0077] Typically oligonucleotides for use as LCPs will be linear
polymers of nucleotides and for many of the embodiments of this
invention, this is preferred. It is however possible to introduce
branched structures into nucleic acids, producing Y-shaped and
comb-shaped branched structures (see for example Reese C. B. &
Song Q., Nucleic Acids Res. 27(13):2672-2681, "A new approach to
the synthesis of branched and branched cyclic
oligoribonucleotides." 1999; Horn T. et al., Nucleic Acids Res.
25(23):4835-4841, "An improved divergent synthesis of comb-type
branched oligo-deoxyribonucleotides (bDNA) containing multiple
secondary sequences." 1997; Braich R. S. & Damha M. J.,
Bioconjug Chem. 8(3):370-377, "Regiospecific solid-phase synthesis
of branched oligonucleotides. Effect of vicinal 2',5'- (or 2',3'-)
and 3',5'-phosphodiester linkages on the formation of hairpin DNA."
1997; Horn T. & Urdea M S., Nucleic Acids Res.
17(17):6959-6967, "Forks and combs and DNA: the synthesis of
branched oligodeoxyribonucleotides." 1989).
[0078] Branched oligonucleotides are sometimes used to enable
signal amplification without resorting to nucleic acid
amplification, particularly comb-oligonucleotides in which a
primary sequence specific linear oligonucleotide is linked to a
series of secondary oligonucleotides (Horn T. et al., Nucleic Acids
Res. 25(23):4842-4849, "Chemical synthesis and characterization of
branched oligodeoxyribonucleotides (bDNA) for use as signal
amplifiers in nucleic acid quantification assays." 1997). Thus in
those aspects of the present invention in which the LCPs comprise a
probe detection sequence, the LCPs may have a primary sequence
which comprises the TRS sequences of the circularising probe and
secondary oligonucleotides branched off the primary sequence,
preferably all comprising an identical sequence, which act as the
probe identification sequence. After circularisation of the primary
sequence and removal of unreacted probes, the circularised sequence
can be probed with mass tagged Probe Detection Sequences. Since the
comb structure allows multiple Probe Identification sequences to be
incorporated into a probe of this invention, this enables signal
amplification without requiring amplification of the target
sequence or the probe sequence.
[0079] The quantity of covalently circularized probe may be
increased by repeating the cyclizing and dehybridizing steps one or
more times. Thereby, multiple allele-specific LCPs will find and be
ligated to form CCPs on target molecules. It is worth noting that
when these reaction steps are repeated, it is possible that under
appropriate conditions the same target sequence will mediate
closure of multiple LCPs to form CCPs as the CCPs can become
threaded on the target molecule. This is because the CCPs will
move, or wander, to some extent along the target molecule during
the dehybridizing step, making the target sequence available for a
renewed hybridization by a non-circularized probe. If
non-hybridising conditions are to be used to separate CCPs from
unreacted and incorrectly ligated LCPs, and if multiple probe
hybridization and closure cycles are to be used, it is, of course,
necessary that the target molecule is reasonably large and that the
target sequence is at a sufficient distance from the ends of the
target molecule that the CCPs remain linked to the target molecule.
For practical purposes, the target sequence should be at least
about 200 base pairs from the nearest end depending on whether and
how the target sequence is bound to a solid phase support. If the
target sequence is free in solution, a longer distance may be
required, especially in the case of long-lasting denaturing
washes.
[0080] There are a number of advantages to gained by employing LCPs
that can form covalently closed circular molecules upon correct
hybridization to their target nucleic acids rather than detecting
conventional labelled linear probes: First, each target requires
only a single, synthetic probe molecule. Second, the ligation
reaction provides high specificity of detection, since allelic
sequence variants can be distinguished by the ligase. Third, the
circularization of correctly hybridised probes provides a number of
ways by which correctly matched probes can be distinguished from
incorrectly matched probes: CCPs catenate with the target
sequences, thereby becoming substantially insensitive to
denaturants, the ends of the CCP become unavailable to exonuclease
digestion and CCPs can mediate Rolling Circle Replication.
[0081] Finally, the simultaneous presence of two terminal probe
sequences on one molecule confers kinetic advantages in the
hybridization step.
[0082] Illustrated in FIG. 1 is a Linear Circularising Probe (LCP)
according to the first aspect of this invention in which the probe
is directly conjugated to a mass tag. The two termini of the probe
comprise the Target Recognition Sequence (TRS) portion of the
probe. The 3' terminus of the probe preferably comprises a free
hydroxyl group while the 5' hydroxyl group is preferably
phosphorylated. FIG. 2 illustrates the same directly labeled probe
hybridized to a target nucleic acid sequence, such as a DNA strand,
via two TRS end segments of the probe, designated TRS 1 and TRS 2.
TRS1 and TRS 2 are complementary to two respective almost
contiguous sequences of the target molecule. A small gap is shown
between the TRS segments. This gap may simply be a missing
phosphodiester linkage or it may comprise a gap of 1 or more
nucleotides. If the gap comprises a space of one or more
nucleotides, it may be bridged by a second oligonucleotide probe or
it may be filled by polymerase activity in the presence of the
necessary nucleotide triphosphates.
[0083] If the target nucleic acid is sufficiently large, the CCP
molecule will remain linked to the target molecule even under
conditions that would release or degrade any hybridized
non-cyclized LCPs. This is one way in which a circularization
reaction produces a selectively detectable species, indicating the
presence of the target molecule in a sample. Conditions that will
denature or degrade a hybridized but non-cyclized probe include
heat, alkali, guanidine hydrochloride, urea and other chemical
denaturants or exonuclease activity, the latter degrading the free
ends of any unreacted LCPs.
[0084] Gap-Filling:
[0085] As described above the TRS portions of an LCP can be
designed to hybridize to a target sequence so that there is a small
gap between the two TRS termini. This gap may be filled by
extending the 3' TRS using a polymerase and 1 or more nucleotide
triphosphates or, if the gap is sufficiently large it may be filled
by one or more `Gap Oligonucleotides`. The principles and
procedures for gap-filling ligation are well known in the art as
they are used in the method of `gap LCR` (Wiedmann et al., "PCR
Methods and Applications" published by Cold Spring Harbor
Laboratory Press, Cold Spring Harbor Laboratory, NY, pages S51-S64,
1994; Abravaya et al., Nucleic Acids Res., 23(4):675-682, 1995;
European Patent Application EP0439182, 1991). In the "gap LCR"
processes described in these publications, the gap-filling methods
are applied to allow the ligation of two independent nucleic acid
probes but these gap-filling are equally applicable to LCPs.
[0086] Hybridisation of LCPs with gaps, followed by gap-filling
prior to ligation is advantageous as it provides higher stringency
as multiple independent steps have to take place for correct
closure of an LCP to form a CCP. Since these steps are unlikely to
occur by chance, gap-filling offers a means for enhancing
discrimination between closely related target sequences.
Gap-filling should be performed with a different DNA polymerase
from the polymerase used for rolling circle replication discussed
later, and this polymerase will be referred to herein as a
gap-filling DNA polymerase. Suitable gap-filling DNA polymerases
are discussed in more detail later but in short when they extend
the TRS from the 3' end of a hybridised LCP, they should not
displace the hybridised TRS from the 5' end of the LCP. However,
when the gap between the two TRS regions of an LCP is only a single
nucleotide, then only the correct expected nucleotide needs to be
added to allow extension of the 3' TRS to fill the gap. As long as
the next base is not the same as the missing nucleotide, then most
DNA polymerases can be used to fill the gap. This missing base is
sometimes referred to as a "stop base". The use of "stop bases" in
the gap-filling operation of LCR is described in European Patent
Application EP0439182, for example. The principles of the design of
gaps and the ends of flanking probes to be joined, as described in
EP0439182, are generally applicable to the design of the gap spaces
between the ends of the TRS portions of the LCPs of this
inventions.
[0087] In embodiments of this invention which use rolling circle
replication, it is possible for the gap-filling polymerase to
interfere with rolling circle replication. To avoid this, the
gap-filling DNA polymerase can be removed by extraction or
inactivated with a neutralizing antibody prior to performing
rolling circle replication. Such inactivation is analogous to the
use of antibodies for blocking Taq DNA polymerase prior to PCR
(Kellogg et al., Biotechniques 16(6): 1134-1137, 1994). More
preferably, as shown in FIGS. 5a and 5b, after hybridization,
gap-filling and ligation of LCPs to form CCPs, the CCPs (and any
unreacted and incorrectly reacted LCPs) can be captured onto a
solid phase support by a tethered oligonucleotide. The capture step
can also be performed with a biotinylated oligonucleotide, which
can be subsequently captured onto an avidinated solid support. The
gap-filling polymerase can then be removed by washing the solid
support and disposing of the liquid phase. Similarly, if the target
sequence is captured onto a solid support, ligation of LCPs to form
CCPs will leave the CCPs catenated with the target sequence and
thus locked onto the solid support. This means that after ligation,
both the gap-filling polymerase and unreacted LCPs can be washed
away.
[0088] Directly Labelled Circularising Probes:
[0089] FIGS. 1, 2, 4a and 4b, schematically show an embodiment of
this invention in which directly labelled probes are used. In FIGS.
4a and 4b a method for resolving correctly circularised probes from
unreacted probes is shown. In these figures, the method is shown
for two probes that recognise different alleles of a single target
sequence. Each probe, designated Linear Circularising Probe 1 and
Linear Circularising Probe 2, is covalently linked to and
identified by a unique mass marker. After contacting LCP 1 and LCP
2 with the target sequence, only LCP 1 is capable of hybridising
with the target to form a ligatable complex and so in the presence
of ligase only LCP 1 is ligated to from a Closed Circularized Probe
(CCP). The unreacted LCP 2 and any remaining LCP 1 can then be
degraded by exonuclease activity while CCP 1 is protected by virtue
of being circular. The gene 6 exonuclease of phage T7 provides a
useful tool for the elimination of excess LCPs and any unreacted
gap oligonucleotides. This exonuclease digests DNA starting from
the 5'-end of a double-stranded structure. It has been used
successfully for the generation of single-stranded DNA after PCR
amplification (Holloway et al., Nucleic Acids Res. 21:3905-3906
(1993); Nikiforov et al., PCR Methods and Applications 3:285-291
(1994)). If a `capture` sequence is incorporated into the LCP
design, the surviving CCP 1 can be captured onto a solid phase
support. The support can then be washed and in this way exonuclease
digested LCP 2 and unreacted LCP 1, which cannot hybridise to the
solid support, can be separated from the captured CCP 1. After
washing away LCP 2 and its corresponding tags, the tags on CCP 1
can be cleaved from the CCP molecule. If the tags are linked via a
trypsin cleavable linkage the tags can be easily cleaved by this
enzyme. The solution phase containing the tags can then be injected
into a mass spectrometer for detection of the tags.
[0090] Although only two tags have been shown in the schematic
diagram in FIGS. 4a and 4b, many thousands of different LCPs can be
used together as has been demonstrated previously (Hardenbol et
al., Nature Biotechnology 21 (6) pages 673-678, 2003).
[0091] In a further embodiment of this aspect of the invention,
shown schematically in FIGS. 7a and 7b. Mass Tagged LCPs may be
designed with a cleavable group in them. The cleavable group is
positioned between the tag and the portion of the LCP that will
allow it to be captured onto the solid support. In FIG. 7a, it can
be seen that a capture sequence is present allowing the LCP to be
captured by hybridisation to a tethered or biotinylated
oligonucleotide. It would also be possible to directly biotinylate
the LCPs. The presence of the cleavable group means that CCPs may
be cleaved after their formation from LCPs. The cleavage step may
take before or after the CCPs are capture onto a solid phase
support. In FIG. 7b the cleavage is shown taking place before the
capture step. The cleavage step ensures that the tagged portion of
any unreacted LCPs is not retained on the solid support, as the
tagged portion of the LCP is only linked to the capture sequence by
the cleavable group. The ligation of LCPs to form CCPs means that
the tag is linked through the ligated portion of the probe so that
after the cleavage step the mass tags remain linked to the capture
sequence (or biotinylated portion) of the probe. In this way, tags
will only be captured for correctly closed CCPs allowing the tags
from unreacted LCPs to be washed away as shown in FIG. 7b.
[0092] The cleavable group may be a type IIS restriction
endonuclease recognition sequence, in which case the capture
sequence may also serve as the cleavage site by providing the
restriction sequence. In this situation, the tethered or
biotinylated oligonucleotide is preferably hybridised with the LCPs
and CCPs prior to cleavage to form a double stranded substrate for
the restriction endonuclease. Alternatively, the cleavable group my
be chemically cleavable. Replacement of one of the phosphodiester
linkages in the backbone of an LCP with 3'-(N)-phosphoramidate or a
5'-(N)-phosphoramidate, results in a linkage that is more
susceptible to acid hydrolysis than the rest of the probe.
Alternatively, a uracil residue can be incorporated into the
phosphodiester backbone. This residue is a substrate for the enzyme
uracil deglycosylase, which depurinates this residue. The
depurinated residue is then much more susceptible to hydrolysis
than the rest of the probe molecule.
[0093] Indirect Detection of Circularising Probes:
[0094] In an alternative preferred embodiment of this invention,
each different LCP of this invention comprises a unique Probe
Identification (PI) sequence by which it can be identified through
hybridisation with an appropriate Probe Detection Sequence that is
labelled with a unique mass tag.
[0095] PI sequences are incorporated in the intermediate region of
an LCP. Each PI sequence should uniquely identify its LCP. The PI
Sequence is designed to allow detection by a corresponding mass
tagged Probe Detection Sequence (PDS). The PI sequences, when
amplified during Rolling Circle replication, result in tandemly
repeated sequences that are complementary to the sequence of the
mass tagged PDS probes. It may be desirable to have two or more PI
sequences on an LCP as these will increase the signal from
correctly hybridised mass-tagged PDS probes. There is no
theoretical limit to the number of PI sequences that can be present
in an LCP except the practicality of synthesizing and using very
large LCPs comprising large numbers of PI sequences. When there are
multiple PI sequences, they may have the same sequence or they may
have different sequences, with each different sequence
complementary to a different PDS probe. It is preferred that an LCP
contain PI sequences that have the same sequence such that they are
all complementary to a single PDS probe. The PI sequences can each
be any length that supports specific and stable hybridization
between the PI sequences and PDS probes. For practical purposes, a
length of 10 to 35 nucleotides is preferred, with a length of 15 to
25, for example 15 to 20, nucleotides long being most
preferred.
[0096] Similarly, the PDS sequences should have a length that is
similar to the PI sequences.
[0097] In one embodiment, the Probe Detection Sequence may also be
a branched oligonucleotide. For example, the PDS may comprise
multiple sequences complementary to its Probe Identification
sequence, in addition to comprising a mass tag. Such a PDS may be
in the form of a Y-shaped oligonucleotide of a structure described
by Suzuki Y. et al. (Nucleic Acids Symp Ser. 2000;(44):125-126,
"Synthesis and properties of a new type DNA dendrimer.") comprising
three copies of the PDS. A second Y-shaped branched oligonucleotide
comprising three copies of the Probe Identification sequence when
added to the tripartite PDS probe will assemble a dendrimer in
which very large numbers of copies of the PDS, and consequently its
associated mass tag will be present. If the tripartite PDS sequence
is present in excess, then the dendrimer will have free PDS
sequences available for hybridization to the Probe Identification
sequences present in correctly circularized CCPs. In this way a
very substantial signal amplification can be achieved without
amplifying the target nucleic acid or CCPs.
[0098] FIGS. 5a and 5b illustrate an embodiment of the invention in
which LCPs are identified after closure by the ability of CCPs to
be selectively amplified by Rolling Circle Replication. In FIG. 5a,
a schematic of a method of detecting DNA sequence variants is
illustrated in which a pair of LCPs that identify different alleles
of a DNA sequence are used. The LCPs in this assay are identifiable
by their unique Probe Identification sequences. In FIG. 5a, a
preferred embodiment of the invention is illustrated for a pair of
probes that detect different variants of a single target molecule.
In the first step, the pair of LCPs are contacted with their target
sequence. Only one of the LCPs matches the target sequence
correctly and hybridises to form a duplex, so that in the next step
ligation only occurs at this correctly hybridised duplex converting
the LCP into a CCP. This circular sequence is now a substrate for
Rolling Circle Replication.
[0099] In some embodiments of this aspect of the invention, the
unreacted LCPs can be degraded by exonuclease, but this is not
shown in FIGS. 5a and 5b. In the next step, hybridisation of a
captured primer with the CCP takes place to form a CCP/primer
duplex. In the next step, polymerase extends the primer generating
a tandem repeated sequence complementary to the CCP where the
tandemly repeated complement is captured on a solid phase support.
In alternative embodiments that primer sequence may be biotinylated
rather than linked directly to a bead. In this sort of embodiment,
the biotinylated product of the linear extension of the primer can
then be captured onto an avidinated solid phase support after the
extension reaction. The captured tandem repeat sequences also
contain the complement of the Probe Identification (PI) sequences
present in the LCP sequence. In the final steps of the assay shown
in FIG. 5b, these complements of the PI sequences are probed with
mass tagged Probe Detection Sequences. Since the targets of the PDS
probes are captured on a solid phase support, the correctly
hybridised PDS probes will be captured onto the support by the
hybridisation reaction allowing unhybridised PDS probes to be
washed away. After washing away unhybridised PDS probes, the mass
tags on the correctly hybridised PDS probes can be cleaved off for
subsequent detection by mass spectrometry.
[0100] Captured Libraries:
[0101] Although only two tags have been shown in the schematic
diagram in FIGS. 5a and 5b, many different LCPs, such as several
hundred or even more than a thousand can be used together as has
been demonstrated previously (Hardenbol et al., Nature
Biotechnology 21 (6) pages 673-678, 2003). If many thousands of
probes were used in the assay shown in FIGS. 5a and 5b, the result
of the Rolling Circle Replication step in which the circularised
probes sequences are copied onto beads will generate a `captured
library` of circularised probes that represents information in the
probed sample. Captured Libraries have a number of advantages.
After appropriate washing steps the library can be archived for
future analysis. In addition, the library can be probed multiple
times with the same mass tagged PDS probes to give signal
amplification. In some embodiments of this aspect of the invention
the captured library is probed in multiple sequential assays rather
than in a single step using multiple distinct libraries of mass
tagged PDS probes. In this way the same tags can be used to detect
different Probe Identification sequences in the Captured Library.
Thus, the use of Captured Libraries is an especially preferred
embodiment of this invention. For the purposes of archiving
Captured Libraries, it may be desirable to synthesise the captured
libraries with exonuclease resistant nucleotide analogues that are
compatible with polymerases such as boranophosphate nucleotides, or
alpha-thio deoxynucleotide triphosphates.
[0102] Similarly, for long term storage, it may be preferable to
generate captured libraries with covalently tethered
oligonucleotides rather than with biotinylated oligonucleotides
that are later captured onto avidinated beads to avoid the risk of
sample loss by dissociation of the non-covalent biotin/avidin
complex.
[0103] Rolling Circle Replication:
[0104] In preferred embodiments of the second aspect of the
invention, rolling circle replication is applied to CCPs generated
by target mediated ligation of LCPs. To effect Rolling Circle
Replication (RCR) the circular single-stranded CCP DNA molecules
are contacted with Rolling Circle Primers (RCPs) that hybridise to
Primer Binding Sites in the CCPs. Extension of the RCPs by a strand
displacing polymerase will result in tandem repeats of the
complement of the CCP sequence as shown in FIGS. 5a and 5b. It can
be seen from FIGS. 5a and 5b that in preferred embodiments the RCP
is immobilized on a solid phase support or it is capable of being
immobilized on a solid support after extension and Rolling Circle
Replication of hybridised CCPs, by using a biotinylated RCP for
example.
[0105] Specifically FIGS. 5a and 5b show a schematic of a method
comprising the following steps:
[0106] (a) mixing one or more Linear Circularising Probes (LCP)
with a target nucleic acid under conditions promoting
hybridization, resulting in LCP-target duplexes,
[0107] (b) contacting the LCP-target duplexes with a ligase,
resulting in a ligation mixture, and incubating the ligation
mixture under conditions promoting ligation of the LCPs to form
CCPs,
[0108] (c) contacting a rolling circle primer (RCP) under
conditions that promote hybridization with the ligation mixture,
resulting in a RCP-CCP duplex,
[0109] (d) contacting the RCP-CCP duplex with a DNA polymerase
under conditions promoting extension of the RCP to produce the
complement of the CCP sequence, such that continuous extension of
the RCP results in formation of tandem repeats of the complement of
the CCP sequence.
[0110] Although FIGS. 5a and 5b show a schematic of an embodiment
in which only 2 LCPs are present, thousands of LCPs may be present
in a single reaction. Those LCPs that are ligated to form CCPs will
be able to support RCA and thus will generate captured tandem
repeats of their complement on a solid support. The solid support
bound complement sequences for a number of different CCPs will be
referred to as a Captured CCP Library.
[0111] In different embodiments of the second aspect of this
invention, the Target Recognition Sequences may hybridize to the
target nucleic acid sequence, with or without a central gap to be
filled by one or more gap nucleotides or oligonucleotides.
[0112] For the purposes of Rolling Circle Replication (RCR) each
LCP should comprise a Primer Binding Sequence (PBS). The PBS is
complementary to the rolling circle primer (RCP). Each LCP should
have at least one PBS, although if the LCPs are small, i.e. less
than 100 nucleotides in length then preferably only a single PBS
should be present. This allows rolling circle replication to
initiate at a single site on CCPs. The primer complement portion
and the corresponding rolling circle primer can have any desired
sequence as long as they are complementary to each other. In
general, the sequence of the PBS and the RCP should be chosen so
that they are not significantly similar to any other portion of the
LCP or any LCP in the library, when multiple LCPs are used
together. The PBS can be any length that supports specific and
stable hybridization between the PBS and the RCP. For this purpose,
a length of 10 to 35 nucleotides is preferred, with a primer
complement portion 16 to 20 nucleotides long being most preferred.
The PBS can be located anywhere within the spacer region of an OCP.
It is preferred that the PBS is adjacent to the 5' TRS, with the
TRS and the PBS preferably separated by three to ten nucleotides,
and most preferably separated by six nucleotides.
[0113] This location prevents the generation of any other spacer
sequences, such as detection tags and secondary target sequences,
from unligated LCPs during DNA replication.
[0114] A rolling circle primer (RCP) is an oligonucleotide having
sequence complementary to the primer binding sequence of an LCP or
CCP. This sequence is referred to as the complementary portion of
the RCP. The complementary portion of a RCP and the cognate Primer
Binding Sequence can have any desired sequence so long as they are
complementary to each other. In general, the sequence of the RCP
can be chosen such that it is not significantly complementary to
any other portion of the LCP or CCP. The complementary portion of a
rolling circle replication primer can be any length that supports
specific and stable hybridization between the primer and the primer
complement portion. Generally this is 10 to 35 nucleotides long,
but is preferably 16 to 20 nucleotides long.
[0115] It is preferred that rolling circle replication primers also
contain additional sequence at the 5' end of the RCP that is not
complementary to any part of the LCP or CCP. This sequence is
referred to as the Displacement region of the RCP. The Displacement
region is located at the 5' end of the primer and serves to
facilitate strand displacement during Rolling Circle Replication.
The displacement region is typically a short sequence, preferably
from 4 to 8 nucleotides long, and simply provides an unhybridised
region of already displaced sequence that assists the strand
displacing polymerase to start displacing the extended RCP.
[0116] In some embodiments of the Rolling Circle aspects of this
invention, gene 6 exonuclease of phage T7 can be added after the
ligation reaction, together with the DNA polymerase to be used to
effect Rolling Circle Replication. To protect the Rolling Circle
Replication product from degradation, the rolling circle primer can
be composed of a few phosphorothioate linkages at the 5' end, to
make the Rolling Circle Primer and its extension products resistant
to the exonuclease (Nikiforov et al. (1994)). The exonuclease will
degrade excess LCP molecules as they can become associated with the
rolling circle DNA product and interfere with hybridization of PDS
probes. The use of exonuclease digestion is a preferred method of
eliminating unreacted LCPs and gap oligonucleotides.
[0117] Hyper-Branching Rolling Circle Replication:
[0118] Contacting a circular template with a single initiating
primer and an appropriate polymerase results in linear Rolling
Circle Replication and produces a linear tandemly repeated
complementary copy of the circular template. If a second primer is
present in the reaction, that is complementary to a site in the
linear tandemly repeated copy of the circular template, this will
bind to the tandemly repeated sequence at multiple locations and
will initiate further replication. Since the second primer will
bind at multiple locations, extension that initiates upstream of a
primer will displace the extension product of that primer providing
a linear single stranded template that allows further binding and
extension of the initiating primer. This sort of reaction,
therefore, gives rise to geometric amplification of the circular
template and is sometimes referred to as hyper-branching RCR and
will be referred to in this way in this application. This is a
homogenous geometric amplification reaction and may be advantageous
for use with this invention. For a fuller discussion on this sort
of technique, see Zhang D. Y. et al. (Gene. 274 (1-2):209-216,
"Detection of rare DNA targets by isothermal ramification
amplification." 2001) or Lizardi P. M. et al. (Nat Genet.
19(3):225-32. "Mutation detection and single-molecule counting
using isothermal rolling-circle amplification." 1998).
[0119] Accordingly, the use of a hyper-branching RCR reaction may
be used in the present invention in order to provide a means of
amplifying the probe identification sequence following ligation of
a LCP.
[0120] Microarrays:
[0121] In further preferred embodiments of this invention, the LCP
sequences comprise a Microarray Address Sequence in the
intermediate region of the probe. A Microarray address sequence
will have a sequence that is complementary to an oligonucleotide at
a specific discrete location on a planar array.
[0122] In embodiments of the invention in which directly labeled
LCPs are used, it is possible to hybridise CCPs that form as a
result of template mediated ligation to a microarray. The
Microarray Address Sequence will thus ensure that each CCP
hybridizes to a discrete location on the microarray. In this way a
combination of distinct Microarray Address Sequences and Mass tags
can encode a very large number of LCPs that will then be uniquely
identifiable by a unique combination of their Microarray Address
Sequence and their Mass Tag. For example 1000 discrete Microarray
Address Sequences, corresponding to 1000 discrete locations on a
microarray, combined with 400 distinguishable Mass Tags, will allow
400 000 different LCPs to be uniquely identified in a single assay
providing an unprecedented level of multiplexing in a single
assay.
[0123] In alternative embodiments, in which LCPs are detected
through a Probe Identification Sequence, which is distinct from the
Microarray Address Sequence, the Microarray Address Sequence can be
used to ensure that subsets of CCPs in a library of CCPs hybridise
to distinct locations on the array. After hybridization, the
correctly hybridised microarray probe sequence can be extended
using an appropriate polymerase to effect rolling circle
replication of the hybridised CCPs. Thus, the Microarray Address
Sequence is also acting as the binding site for a Rolling Circle
Primer, which happens to be immobilized at a discrete location on a
planar array surface. In this way, a spatially resolved Captured
Library of CCP sequences can be generated. The captured library can
then be probed by hybridization with PDS sequences that recognize
the Probe Identification sequence complements generated by the
Rolling Circle replication that takes place at each array
location.
[0124] After hybridization of directly labeled LCPs or after
Rolling Circle Replication and hybridization of PDS sequences to
the microarray, the microarray can then be treated with a MALDI
matrix material such as 3-hydroxypicolinic acid or
alpha-cyano-cinnamic acid. Having prepared the microarray in this
way it can be loaded into a MALDI based mass spectrometer and the
cleaved tags can be desorbed from discrete locations on the array
by application of laser light to the desired location on the
array.
[0125] In one aspect the invention thus provides a microarray
comprising from 96 to 1000 discrete locations, such as from 96 to
500 discrete locations, each location comprising a discrete
microarray address sequence complement. In another aspect, the
invention provides a kit comprising such a microarray together with
a set of circularising probes of the invention, wherein each member
of the set of circularising probes comprises a discrete microarray
address sequence which is capable of hybridizing to a microarray
address sequence complement in the microarray.
[0126] In these microarray embodiments of the invention,
appropriate methods for cleaving the tags from their associated
probes on the array must be used. In one preferred approach, the
tags are linked to their associated probes (linked either directly
to LCPs or linked to PDS probes) through a photocleavable linker.
This means that cleavage of the tags can take place at discrete
locations on the array by exposure to light of the appropriate
frequency. This light can be applied to the whole array prior to
analysis by exposing the array to an intense light source.
Alternatively, in a MALDI mass spectrometer, the laser used for
desorption can be used to cleave the tags.
[0127] In an alternative embodiment, an acid cleavable linker can
be used. Since most MALDI matrix materials are acidic, addition of
the matrix will effect cleavage of the mass tags. In a further
embodiment, the entire probe label complex can be desorbed, and
cleavage of the tags can take place by collision using Post Source
Decay in a Time-Of-Flight mass spectrometer or in the mass analyzer
of an ion trap instrument or in a collision cell in alternative
geometries that are used with MALDI, such as the Q-TOF
geometry.
[0128] Practically speaking a microarray could comprise an array of
wells on microtitre plates, for example, such that each well
contains a single immobilised oligonucleotide that is a member of
the array. In this situation a sample of the pooled reactions is
added to each well and allowed to hybridise to the immobilised
oligonucleotide present in the well. After a predetermined time the
unhybridised DNA is washed away. The hybridised DNA can then be
melted off the capture oligonucleotide. The released DNA can then
be loaded into a capillary electrophoresis mass spectrometer or it
can be injected into the ion source of a mass spectrometer.
[0129] Equally, and preferably, the array could be synthesised
combinatorially on a glass `chip` according to the methodology of
Southern or that of Affymetrix, Santa Clara, Calif. (see for
example: A. C. Pease et al. Proc. Natl. Acad. Sci. USA. 91,
5022-5026, 1994; U. Maskos and E. M. Southern, Nucleic Acids
Research 21, 2269-2270, 1993; E. M. Southern et al, Nucleic Acids
Research 22, 1368-1373, 1994) or using related ink-jet technologies
such that discrete locations on the glass chip are derivitised with
one member of the hybridisation array.
[0130] Polymerase Chain Reaction Amplification of CCPs:
[0131] In another preferred embodiment of this invention, correct
closure of LCPs to form CCPs is detected by Polymerase Chain
Reaction. In this embodiment the LCPs must comprise a pair of PCR
Primer Binding Sequences (PPBS). The PPBS sites are preferably
oriented so that the first primer must copy across the ligation
junction that is formed when the LCP state of the probe is
converted to the CCP by target mediated ligation. This means that
the second PBS site does not become accessible to its primer unless
the correct ligation event has taken place.
[0132] FIGS. 6a and 6b illustrate an embodiment of PCR based assay
for the detection probe circularization using mass tags. These
figures illustrate the assay for a pair of probes but in practice
many thousands of probes could be used simultaneously. In the first
stage of the assay the pair of LCPs are hybridised with their
target. Ligation leads to closure of only one correctly hybridised
probe. The probes are captured onto a solid phase support by an
oligonucleotide that also comprises a restriction site for a type
II restriction endonuclease. Cleavage of the captured probes by the
endonuclease results in the formation of a linear structure in
which parts of the LCP sequence have been rearranged. A similar
process, using uracil deglycosylase to cleave the circularized
probes, is described by Hardenbol et al. in Nature Biotechnology 21
(6) pages 673-678, 2003 and is referred to as `molecular
inversion`. This results in the PPBS sites being in the correct
orientation to enable exponential amplification of the CCPs only in
the rearranged probes that have been correctly ligated by target
mediated ligation. In FIG. 6b, the primer sequences are added along
with Mass tagged Probe Identification Complement sequences. PCR is
then effected with a thermostable polymerase with 5' to 3'
exonuclease activity, which will release mass tags from correctly
hybridised Probe Identification Complement sequences during the PCR
reaction as shown in FIG. 6c. After the PCR reaction the released
mass tags can be analysed by mass spectrometry.
[0133] Target Nucleic Acids:
[0134] Since the circularising probes, described in the present
invention provide high specificity, it should be possible to detect
the location of a unique sequence in total vertebrate DNA,
particularly Human DNA. Other nucleic acid targets include
bacterial DNA, viral DNA and/or RNA and expressed RNA from
prokaryotes and eukaryotes.
[0135] In addition, the target nucleic acid library to be
characterised by the methods and reagents of this invention may,
for example, be DNA cloned in an M13 vector, or in a plasmid or
phagemid vector that permits the excision of inserts as circular
plasmids.
[0136] The target nucleic acid molecule, which may be DNA or RNA
and which contains the specific sequence to be detected, should
have a sufficient length to ensure that it can form a double helix,
which is required for the circularized probe to interlock or
catenate with the target molecule.
[0137] The target molecule may be a free molecule, but in some
preferred embodiments of this invention, the target nucleic acids
may be immobilized on a solid phase support.
[0138] Circularising probes can also be used for `in situ`
hybridization to tissue slices. With this sort of target, ligation
of the LCPs to form CCPs will leave the probes firmly linked to
their target sequences, thus allowing extensive washing to be
performed. This washing will remove any circles that may have been
formed by non-target-directed ligation, while circles ligated
on-target are impossible to remove because they are topologically
trapped (Nilsson et al. (1994)).
[0139] Reagents:
[0140] The methods of this invention require a variety of reagents,
which are discussed in detail below.
[0141] Oligonucleotide Synthesis:
[0142] LCPs, gap oligonucleotides, rolling circle primers, PCR
primers, mass tagged Probe Detection Sequences and any other
oligonucleotides can be synthesized using standard oligonucleotide
synthesis methods known in the art. Preferred methods are purely
synthetic methods, for example, by the cyanoethyl phosphoramidite
method (Beaucage and Caruthers, Tetrahedron Lett. 22: 1859-1862
(1981); McBride and Caruthers, Tetrahedron Lett. 24: 245-248
(1983)). Synthetic methods useful for making oligonucleotides are
also described by Ikuta et al., Ann. Rev. Biochem. 53:323-356
(1984), (phosphotriester and phosphite-triester methods), and
Narang et al., Methods Enzymol., 65:610-620 (1980),
(phosphotriester method). PNA molecules can be made using known
methods such as those described by Nielsen et al., Bioconjug. Chem.
5:3-7 (1994).
[0143] Since the circularizing probes of this invention are
typically comprised of a series of distinct sequence components,
such as a pair of TRS sequences separated by and intermediate
sequence which is common to all probes, although it may comprise a
unique probe identification sequence, it may be desirable to
presynthesise these smaller subsequences and assemble them by
ligation (Borodina et al., Anal Biochem. 318(2):309-313,
"Ligation-based synthesis of oligonucleotides with block
structure." 2003)
[0144] Methods for immobilization of oligonucleotides to
solid-phase supports are well known in the art. For example,
suitable attachment methods are described by Pease et al., Proc.
Natl. Acad. Sci. USA 91(11):5022-5026, 1994 and Khrapko et al., Mol
Biol (Mosk) (USSR) 25:718-730, 1991. A method for immobilization of
3'-amine oligonucleotides on casein-coated slides is described by
Stimpson et al., Proc. Natl. Acad. Sci. USA 92:6379-6383
(1995).
[0145] Preferred methods of attaching oligonucleotides to
solid-state substrates are described by Maskos, U. and Southern, E.
M., Nucleic Acids Res 20(7): 1679-1684, "Oligonucleotide
hybridizations on glass supports: a novel linker for
oligonucleotide synthesis and hybridization properties of
oligonucleotides synthesised in situ", 1992 and Guo et al., Nucleic
Acids Res. 22:5456-5465 (1994).
[0146] For many applications of the oligonucleotides of this
invention it is useful to know how stable they are, or more
specifically at what temperature they will dissociate. The
stability of DNA duplexes can be calculated using known methods for
prediction of melting temperatures (Breslauer, K. J. et al.,
PNASUSA 83(11): 3746-3750, "Predicting DNA duplex stability from
the base sequence.", 1986; Lesnick and Freier, Biochemistry
34:10807-10815, 1995; McGraw et al., Biotechniques 8:674-678, 1990;
and Rychlik et al., Nucleic Acids Res. 18:6409-6412, 1990).
[0147] Mass Tagged Oligonucleotides:
[0148] A variety of mass tags can be applied with this invention
although preferred mass tags are disclosed in WO 97/27327, WO
97/27325, WO 97/27331, WO 01/68664 and WO 03/025576. These
applications all disclose tags that comprise polyamide compounds,
essentially peptides or peptide-like tags, which means that these
tags can be prepared using a number of peptide synthesis methods
that are well known in the art (see for example Jones J. H., "The
chemical synthesis of peptides", Oxford University Press (1991);
Fields G. B. & Noble R. L., Int J Pept Protein Res 35(3):
161-214, "Solid phase peptide synthesis utilizing
9-fluorenylmethoxycarbonyl amino acids." (1990); Albericio F.,
Biopolymers 55(2):123-139, "Orthogonal protecting groups for
N(alpha)-amino and C-terminal carboxyl functions in solid-phase
peptide synthesis." (2000)). In addition, the use of peptide and
peptide-like tags enables coupling of these tags to
oligonucleotides using a variety of peptide conjugation techniques
that are known in the art.
[0149] A preferred mass tag is a tandem mass tag, comprising a mass
marker moiety attached via a cleavable linker to a mass
normalisation moiety, the mass marker moiety being fragmentation
resistant. Such tandem mass tags are disclosed in WO01/68664 and WO
03/025576 (which refers to said tags as "mass labels"), the
contents of which are incorporated herein by reference.
[0150] Where the present invention is used in the detection of
multiple nucleotide sequences using multiple different mass tags,
the tandem mass tags used may each be a member of a set of related
mass tags. Overall, in such a set all of the mass tags in that set
will be distinguishable from each other by mass spectrometry. This
may be achieved by having the aggregate mass of each tag in the set
to be same, but each mass marker moiety having a mass different
from that of all other mass marker moieties in the set.
Alternatively the mass marker moiety can be the same for each
member of the set and the aggregate mass of each member is
different from all other tags in that set.
[0151] The set of tags need not be limited to the two embodiments
described above, and may for example comprise tags of both types,
provided that all tags are distinguishable by mass spectrometry, as
outlined above.
[0152] In one preferred aspect, each mass marker moiety in the set
has a common basic structure and each mass normalisation moiety in
the set has a common basic structure, and each mass tag in the set
comprises one or more mass adjuster moieties, the mass adjuster
moieties being attached to or situated within the basic structure
of the mass marker moiety and/or the basic structure of the mass
normalisation moiety. In this embodiment, every mass marker moiety
in the set comprises a different number of mass adjuster moieties
and every mass tag in the set has the same number of mass adjuster
moieties.
[0153] By "common basic structure", it is meant that two or more
moieties share a structure which has substantially the same
structural skeleton, backbone or core. This skeleton or backbone
may be for example comprise one or more amino acids. Preferably the
skeleton comprises a number of amino acids linked by amide bonds.
However, other units such as aryl ether units may also be present.
The skeleton or backbone may comprise substituents pendent from it,
or atomic or isotopic replacements within it, without changing the
common basic structure.
[0154] Typically, a set of mass tags of the preferred type referred
to above comprises mass tags which can be represented by the
statement:
M(A.sup.1)y-L-X(A.sup.2)z
[0155] wherein M is the mass normalisation moiety, X is the mass
marker moiety, A.sup.1 and A.sup.2 are mass adjuster moieties, L is
the cleavable linker comprising the amide bond, y and z are
integers of 0 or greater, and y+z is an integer of 1 or greater.
Preferably M is a fragmentation resistant group, L is a linker that
is susceptible to fragmentation on collision with another molecule
or atom and X is preferably a pre-ionised, fragmentation resistant
group. Preferably M and X have the same basic structure or core
structure, this structure being modified by the mass adjuster
moieties. The mass adjuster moieties ensure that the sum of the
masses of M and X is the same for all mass tags in a set, but that
each X has a distinct (unique) mass.
[0156] Mass adjuster moieties may be one or more isotopic
substituents situated within the basic structure of the mass marker
moiety and/or within the basic structure of the mass normalisation
moiety and/or one or more substituent atoms or groups attached to
the basic structure of the mass marker moiety and/or attached to
the basic structure of the mass normalisation moiety. In a
preferred aspect, the mass adjuster moieties A.sup.1 and A.sup.2
are independently selected from a halogen atom substituent, a
methyl group substituent, a .sup.2H isotopic substituent, a
.sup.13C isotopic substituent or a .sup.15N isotopic
substituent.
[0157] In preferred embodiments, the mass tags above are peptides
where the mass normalisation moiety (M) and the mass marker moiety
(X) are comprised of one or more amino acids, which may be natural
amino acids or modified natural amino acids. In such embodiments,
the mass adjuster moieties are isotopic substituents which are
present as one or more atoms of the amino acids.
[0158] Preferably the cleavable linker (L) is preferably an amide
bond between amino acids or may comprise one or more amino acids
that facilitate cleavage by collision, such as proline (pro),
aspartic acid (asp) or the dipeptide sequence asp-pro.
[0159] In a preferred embodiment, neutral amino acids are preferred
as a mass normalisation moiety. These may be selected from the
group consisting of alanine, glycine, leucine, phenylalanine,
serine, threonine, tryptophan and valine. For the mass marker
moiety charged amino acids may be used, since this facilitates
ionisation and increases sensitivity. These may be selected from
the group consisting of arginine, asparagine, aspartic acid,
glutamic acid, glutamine, histidine, lysine and tyrosine.
[0160] Preferably a neutral amino acid of the mass normalisation
moiety is used in combination with a charged amino acid of the mass
marker moiety.
[0161] The mass normalisation and/or mass marker moieties which are
amino acids may be varied in mass by the mass adjuster moieties as
defined above.
[0162] Since the preferred compounds for use as mass tags are
peptides, it is necessary to be able to produce
peptide/oligonucleotide conjugates to provide the necessary
reagents for this invention. Fortunately, numerous methods for the
preparation of such conjugates are known in the art. There are two
general approaches, complete synthesis of the conjugate for which a
number of methods are known (Haralambidis J. et al., Nucleic Acids
Res. 18(3):493-499, "The synthesis of polyamide-oligonucleotide
conjugate molecules." 1990; de Koning M. C. et al. Curr Opin Chem.
Biol. 7(6):734-740, "Synthetic developments towards PNA-peptide
conjugates." 2003) or coupling of independently synthesized peptide
or oligonucleotides to each other for which a variety of methods
are known.
[0163] Methods for coupling tags including peptides to
oligonucleotides via 5' amine functionalities are well known in the
art (Smith L. M. et al., Nucleic Acids Res. 13(7):2399-2412, "The
synthesis of oligonucleotides containing an aliphatic amino group
at the 5' terminus: synthesis of fluorescent DNA primers for use in
DNA sequence analysis." 1985; Sproat B. S. et al., Nucleic Acids
Res. 15(15):6181-6196, "The synthesis of protected
5'-amino-2',5'-dideoxyribonucleoside-3'-O-phosphoramidites;
applications of 5'-amino-oligodeoxyribonucleotides." 1987). In
addition, it is possible to incorporate multiple amino groups into
an oligonucleotide (Nelson P. S. et al, Nucleic Acids Res.
17(18):7179-7186, "A new and versatile reagent for incorporating
multiple primary aliphatic amines into synthetic oligonucleotides."
1989) to allow multiple tags to be linked to the oligonucleotide.
Methods for conjugating peptides to oligonucleotides via thiol
groups at the termini of the oligonucleotides are disclosed in Arar
et al., Bioconjug Chem. 6(5): 573-577, "Synthesis and antiviral
activity of peptide-oligonucleotide conjugates prepared by using N
alpha-(bromoacetyl)peptides.", 1995. Oligonucleotides can be
coupled to peptides with terminal cysteine residues as disclosed in
Wei et al., Bioconjug Chem. 5(5): 468-74, "Synthesis of
oligoarginine-oligonucleotide conjugates and oligoarginine-bridged
oligonucleotide pairs.", 1994.
[0164] To allow more than one tag to be incorporated per
oligonucleotide, mass tags can be incorporated into the
oligonucleotide through conjugation to thymidine analogues, for
example, as disclosed in Brown et al., Tetrahedron Lett., 42:
2587-2592, "Synthesis of a Modified Thymidine Monomer for
Site-Specific Incorporation of Reporter Groups into
Oligonucleotides", 2001. In this publication, a thymidine analogue
is described with a linker coupled to the purine ring of the
thymidine. This thymidine analogue has a hydroxyl group protected
with an FMOC group on the end of the linker that can be made
available after the nucleotide has been coupled into an
oligonucleotide during automated oligonucleotide synthesis to allow
a phosphoramidite modified tag to be incorporated into an
oligonucleotide. Since this analogue can be incorporated within the
chain, multiple linkers and hence tags can be coupled to the
oligonucleotide.
[0165] DNA Ligases
[0166] Conversion of LCPs to CCPs is preferably carried out by a
DNA ligase Preferred ligases are those that preferentially form
phosphodiester bonds at nicks in double-stranded DNA. That is,
ligases that are unable to ligate the free ends of single-stranded
DNA at a significant rate are preferred. Thermostable ligases are
especially preferred. Many suitable ligases are known, such as T4
DNA ligase (Davis et al., Advanced Bacterial Genetics--A Manual for
Genetic Engineering (Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., 1980)), E. coli DNA ligase (Panasnko et al., J. Biol.
Chem. 253:4590-4592 (1978)). In preferred embodiments involving DNA
targets, a thermostable DNA ligase is used to effect closure of
LCPs to form CCPs as this will minimize the frequency of
non-target-directed ligation events because ligation takes place at
high temperature (50 to 75 degrees celsius). Examples of
thermostable ligases include AMPLIGASE.TM.(Kalin et al., Mutat.
Res., 283(2):119-123 (1992); Winn-Deen et al., Mol Cell Probes
(England) 7(3):179-186 (1993)), the T. aquaticus DNA ligase
(Barany, Proc. Natl. Acad. Sci. USA 88: 189-193 (1991), Thermus
scotoductus DNA ligase, Rhodothermus marinus DNA ligase and Thermus
thermophilus DNA ligase (Thorbjarnardottir et al., Gene 151:177-180
(1995); Housby J. N. et al., Nucleic Acids Res. 28 (3): E10.
(2000)).
[0167] The use of a thermostable ligase, enables a wide range of
ligation temperatures to be used, allowing greater freedom in the
selection of target sequences. A thermostable ligase also makes it
easier to select ligation conditions that favor intramolecular
ligation. Conditions are easily found where target mediated
ligation of LCPs to form CCPs occurs much more frequently than
tandem linear ligation of two LCPs. For example, circular ligation
is favored when the temperature at which the ligation operation is
performed is near the melting temperature (T.sub.m) of the least
stable of the left target probe portion and the right target probe
portion when hybridized to the target sequence. When ligation is
carried out near the T.sub.m of the target probe portion with the
lowest T.sub.m, the target probe portion is at
association/dissociation equilibrium. At equilibrium, the
probability of association in cis (that is, with the other target
probe portion of the same LCP) is much higher than the probability
of association in trans (that is, with a different LCP). When
possible, it is preferred that the target probe portions be
designed with melting temperatures near suitable temperatures for
the ligation operation.
[0168] T4 DNA ligase is preferred for ligations involving RNA
target sequences due to its ability to ligate DNA ends involved in
DNA:RNA hybrids (Hsuih et al., Quantitative detection of HCV RNA
using novel ligation-dependent polymerase chain reaction, American
Association for the Study of Liver Diseases (Chicago, Ill., Nov.
3-7, 1995)).
[0169] DNA Polymerases
[0170] DNA polymerases useful in the rolling circle replication
step of RCR must perform rolling circle replication of primed
single-stranded circles. Such polymerases are referred to herein as
rolling circle DNA polymerases. For rolling circle replication, it
is preferred that a DNA polymerase be capable of displacing the
strand complementary to the template strand, termed strand
displacement, and lack a 5' to 3' exonuclease activity. Strand
displacement is necessary to result in synthesis of multiple tandem
copies of the ligated CCP. Any 5' to 3' exonuclease activity can
result in the destruction of the synthesized strand.
[0171] It is also preferred that DNA polymerases for use in the
disclosed method are highly processive. The suitability of a DNA
polymerase for use in the disclosed method can be readily
determined by assessing its ability to carry out rolling circle
replication. Preferred rolling circle DNA polymerases are
bacteriophage Phi29 DNA polymerase (U.S. Pat. Nos. 5,198,543 and
5,001,050 to Blanco et al.), phage M2 DNA polymerase (Matsumoto et
al., Gene 84:247 (1989)), phage PhiPRD1 DNA polymerase (Jung et
al., Proc. Natl. Acad. Sci. USA 84:8287 (1987)), VENT.TM. DNA
polymerase (Kong et al., J. Biol. Chem. 268:1965-1975 (1993)),
Klenow fragment of DNA polymerase I (Jacobsen et al., Eur. J.
Biochem. 45:623-627 (1974)), T5 DNA polymerase (Chatterjee et al.,
Gene 97:13-19 (1991)), PRD1 DNA polymerase (Zhu and Ito, Biochim.
Biophys. Acta. 1219:267-276 (1994)), and T4 DNA polymerase
holoenzyme (Kaboord and Benkovic, Curr. Biol. 5:149-157
(1995)).
[0172] A further preferred polymerase is the exonuclease(-) BST
thermostable DNA polymerase available from New England Biolabs
(Mass, USA). Bacillus Stearothermophilus is a thermophilic
bacterium whose polymerase is highly processive and can be used at
elevated temperature (65 degrees centigrade). A Klenow-like
fragment without exonuclease activity is available (Phang S. M. et
al., Gene. 163(1):65-68, "Cloning and complete sequence of the DNA
polymerase-encoding gene (Bstpoll) and characterisation of the
Klenow-like fragment from Bacillus stearothermophilus." 1995;
Aliotta J. M. et al., Genet Anal. 12 (5-6):185-195, "Thermostable
Bst DNA polymerase I lacks a 3'-->5' proofreading exonuclease
activity." 1996) and it has been shown that this polymerase is
highly effective for rolling circle replication (Zhang D. Y. et
al., Gene. 274 (1-2):209-216, "Detection of rare DNA targets by
isothermal ramification amplification." 2001).
[0173] Of these Phi29 DNA polymerase and exo(-) BST DNA polymerase
are most preferred.
[0174] Strand displacement can be facilitated through the use of a
strand displacement factor, such as a helicase. It is considered
that any DNA polymerase that can perform rolling circle replication
in the presence of a strand displacement factor is suitable for use
in the disclosed method, even if the DNA polymerase does not
perform rolling circle replication in the absence of such a factor.
Strand displacement factors useful in RCA include BMRF1 polymerase
accessory subunit (Tsurumi et al., J. Virology 67(12):7648-7653
(1993)), adenovirus DNA-binding protein (Zijderveld and van der
Vliet, J. Virology 68(2):1158-1164 (1994)), herpes simplex viral
protein ICP8 (Boehmer and Lehman, J. Virology 67(2):711-715 (1993);
Skaliter and Lehman, Proc. Natl. Acad. Sci. USA 91(22):10665-10669
(1994)), single-stranded DNA binding proteins (SSB; Rigler and
Romano, J. Biol. Chem. 270:8910-8919 (1995)), and calf thymus
helicase (Siegel et al., J. Biol. Chem. 267:13629-13635
(1992)).
[0175] The ability of a polymerase to carry out rolling circle
replication can be determined by using the polymerase in a rolling
circle replication assay such as those described in Fire and Xu,
Proc. Natl. Acad. Sci. USA 92:4641-4645 (1995).
[0176] Another type of DNA polymerase can be used if a gap-filling
synthesis step is used. When using a DNA polymerase to fill gaps,
strand displacement by the DNA polymerase is undesirable. Such DNA
polymerases are referred to herein as gap-filling DNA polymerases.
Unless otherwise indicated, a DNA polymerase referred to herein
without specifying it as a rolling circle DNA polymerase or a
gap-filling DNA polymerase, is understood to be a rolling circle
DNA polymerase and not a gap-filling DNA polymerase. Preferred
gap-filling DNA polymerases are T7 DNA polymerase (Studier et al.,
Methods Enzymol. 185:60-89 (1990)), DEEP VENT.TM. DNA polymerase
(New England Biolabs, Beverly, Mass.), and T4 DNA polymerase
(Kunkel et al., Methods Enzymol. 154:367-382 (1987)). An especially
preferred type of gap-filling DNA polymerase is the Thermus flavus
DNA polymerase (MBR, Milwaukee, Wis.). The most preferred
gap-filling DNA polymerase is the Stoffel fragment of Taq DNA
polymerase (Lawyer et al., PCR Methods Appl. 2(4):275-287 (1993),
King et al., J. Biol. Chem. 269(18):13061-13064 (1994)).
[0177] In embodiments of the third aspect of this invention, in
which 5' exonuclease activity of the DNA polymerase is used to
degrade mass tagged PDS probes during PCR amplification of CCPs, it
is necessary to use a polymerase with the relevant 5' exonuclease
activity. Taq polymerase is widely used for this purpose (Livak K.
J., Genet Anal., 14 (5-6): 143-9, "Allelic discrimination using
fluorogenic probes and the 5' nuclease assay." (1999)) although a
variety of polymerases have been assessed for this purpose and
would be applicable with these embodiments of the invention
(Kreuzer K. A. et al., Mol Cell Probes., 14(2): 57-60 (2000)).
[0178] RNA Polymerases
[0179] In some embodiments of this invention in which linear
Rolling Circle Replication is used an RNA polymerase can be used to
effect the replication reaction. An RNA polymerase which can carry
out transcription in vitro and for which promoter sequences have
been identified can be used in the disclosed rolling circle
replication method. In this sort of embodiment, the Promoter
sequences are used as the Primer Binding Sequences. A DNA primer is
required in this sort of embodiment. The primer must be extended by
a non-displacing polymerase, i.e. with the same characteristics as
a gap-filling polymerase to produce a double stranded circular
product with a nick. The nick may be ligated if desired. The RNA
polymerase is then added to the promoter site and will initiate
transcription if ribonucleotide triphosphates are present. Stable
RNA polymerases without complex requirements are preferred. Most
preferred are T7 RNA polymerase (Davanloo et al., Proc. Natl. Acad.
Sci. USA 81:2035-2039 (1984)) and SP6 RNA polymerase (Butler and
Chamberlin, J. Biol. Chem. 257:5772-5778 (1982)) which are highly
specific for particular promoter sequences (Schenborn and
Meirendorf, Nucleic Acids Research 13:6223-6236 (1985)). Other RNA
polymerases with this characteristic are also preferred. Because
promoter sequences are generally recognized by specific RNA
polymerases, the OCP or ATC should contain a promoter sequence
recognized by the RNA polymerase that is used. Numerous promoter
sequences are known and any suitable RNA polymerase having an
identified promoter sequence can be used. Promoter sequences for
RNA polymerases can be identified using established techniques.
[0180] Kits:
[0181] The LCPs, Gap nucleotides or oligonucleotides, microarrays,
Ligases, Polymerases, Primers and Mass Tagged Tag Complement
Oligonucleotides described above can be packaged together in any
suitable combination as a kit useful for performing the disclosed
methods.
[0182] Analysis of Mass Tags by Mass Spectrometry:
[0183] The essential features of a mass spectrometer are as
follows
[0184] Inlet System->Ion Source->Mass Analyser->Ion
Detector->Data Capture System
[0185] There are preferred inlet systems, ion sources and mass
analysers and mass analysis methods for the purposes of analysing
the mass tags and mass tagged probes of this invention and these
are discussed in more detail below. Inlet systems may comprise
separation systems that allow mass tags or mass tagged probes to be
separated prior to mass spectrometry.
[0186] Cleavage of Mass Tagged Oligonucleotides:
[0187] The methods of this invention require that mass tags are
cleaved from either directly labeled probes or from Probe Detection
Sequences. Numerous methods are known in the art for the cleavage
of probes from their corresponding tags. See for example the
disclosures of WO98/31830, WO 97/27327, WO 97/27325, WO 97/27331
and WO 98/26095. In preferred embodiments, enzymatic methods may be
used. As discussed above, peptide and peptide-like tags are
preferred tags for use with the methods of this invention. As such,
specific endoproteases like trypsin are useful for cleaving tags
which comprise specific amino acids, arginine or lysine in the case
of trypsin. Thus a peptide tag comprising an arginine residue can
be cleaved from its probe sequence by contacting the probe/tag
conjugate with trypsin. Advantageously, arginine also gives rise to
intense positive ions. Alternatively, chemical cleavage may be used
to release tags. With peptide based tags, incorporation of a
methionine residue between the tag peptide and the probe sequence
allows the probe to be cleaved with cyanogen bromide under acidic
conditions. As discussed above, in relation to microarrays,
photocleavage is also a preferred method of cleaving tags from
their associated probes, for which details can be obtained from the
disclosure of WO 95/04160, which describes methods of synthesising
probes and cleaving said probes. In another preferred embodiment of
this invention cleavage may take place within the mass spectrometer
by collision. The amino acid proline and aspartic acid undergo low
energy collisions. This means that incorporation of a proline or
aspartic acid residue or both together to form an asp-pro linkage
between the tag peptide and the probe sequence allows the probe to
be readily cleaved by low energy collision without substantial
dissociation of the tag peptide. Collision cleavage must obviously
take place after injection of the mass tagged probes or probe
detection sequences into the mass spectrometer.
[0188] Separation of Mass Tagged Oligonucleotides by Chromatography
or Electrophoresis:
[0189] In further embodiments of the second aspect of this
invention, libraries of PDS sequences can be generated in which the
PDS comprises additional electrophoretic or chromatographic
mobility modifying components. These mobility modifiers may
comprise additional nucleotides or may comprise specifically
designed mobility modifiers (Baron, H. et al., Nature Biotechnology
14: 1279-1282 (1996). The mobility modifiers ensure that PDS probes
that recognise different Probe Identification sequences but which
carry the same mass tag can be resolved by having different elution
times in an electrophoretic or chromatographic separation. In this
way a large array of PDS probes can be identified by a unique
combination of their associated mass tag and the size of their
mobility modifier. After hybridisation of these mobility modified
PDS sequences with their corresponding probes, the probes are
subjected to an electrophoretic or chromatographic separation prior
to analysis by mass spectrometry. This is preferably Capillary
Electrophoresis or High Performance Liquid Chromatography (HPLC),
both of which can be coupled directly to a mass spectrometer for
in-line analysis of the mass tagged oligonucleotides as they elute
from the separation column. A variety of separation techniques may
be performed by HPLC but reverse phase chromatography is the most
widely used method for the separation of oligonucleotides prior to
mass spectrometry.
[0190] In these embodiments of the invention, the cleavage of the
mass tags from their associated probes must take place within the
mass spectrometer. This cleavage is preferably effected by
collision as discussed above. Collision based cleavage can be
effected in the Electrospray Ion Source through manipulation of the
Cone Voltage as discussed in more detail below. Alternatively,
cleavage can take place in the mass analysis cell of an ion trap
mass spectrometer or in a collision cell in a tandem mass
spectrometer.
[0191] Inlet Systems:
[0192] In some embodiments of this invention a chromatographic or
electrophoretic separation is preferred to reduce the complexity of
the sample prior to analysis by mass spectrometry. A variety of
mass spectrometry techniques are compatible with separation
technologies particularly capillary zone electrophoresis and High
Performance Liquid Chromatography (HPLC). The choice of ionisation
source is limited to some extent if a separation is required as
ionisation techniques such as MALDI and FAB (discussed below) which
ablate material from a solid surface are less suited to
chromatographic separations. For most purposes, it has been very
costly to link a chromatographic separation in-line with mass
spectrometric analysis by one of these techniques. Dynamic FAB and
ionisation techniques based on spraying such as electrospray,
thermospray and APCI are all readily compatible with in-line
chromatographic separations and equipment to perform such liquid
chromatography mass spectrometry analysis is commercially
available.
[0193] Ionisation Techniques:
[0194] For many biological mass spectrometry applications so called
`soft` ionisation techniques are used. These allow large molecules
such as proteins and nucleic acids to be ionised essentially
intact. The liquid phase techniques allow large biomolecules to
enter the mass spectrometer in solutions with mild pH and at low
concentrations. A number of techniques are appropriate for use with
this invention including but not limited to Electrospray Ionisation
Mass Spectrometry (ESI-MS), Fast Atom Bombardment (FAB), Matrix
Assisted Laser Desorption Ionisation Mass Spectrometry (MALDI MS)
and Atmospheric Pressure Chemical Ionisation Mass Spectrometry
(APCI-MS).
[0195] Electrospray Ionisation:
[0196] Electrospray Ionisation (ESI) requires that the dilute
solution of the analyte molecule is `atomised` into the
spectrometer, i.e. injected as a fine spray. The solution is, for
example, sprayed from the tip of a charged needle in a stream of
dry nitrogen and an electrostatic field. The mechanism of
ionisation is not fully understood but is thought to work broadly
as follows. In a stream of nitrogen the solvent is evaporated. With
a small droplet, this results in concentration of the analyte
molecule. Given that most biomolecules have a net charge this
increases the electrostatic repulsion of the dissolved molecule. As
evaporation continues this repulsion ultimately becomes greater
than the surface tension of the droplet and the droplet
disintegrates into smaller droplets. This process is sometimes
referred to as a `Coulombic explosion`. The electrostatic field
helps to further overcome the surface tension of the droplets and
assists in the spraying process. The evaporation continues from the
smaller droplets which, in turn, explode iteratively until
essentially the biomolecules are in the vapour phase, as is all the
solvent. This technique is of particular importance in the use of
mass labels in that the technique imparts a relatively small amount
of energy to ions in the ionisation process and the energy
distribution within a population tends to fall in a narrower range
when compared with other techniques. The ions are accelerated out
of the ionisation chamber by the use of electric fields that are
set up by appropriately positioned electrodes. The polarity of the
fields may be altered to extract either negative or positive ions.
The potential difference between these electrodes determines
whether positive or negative ions pass into the mass analyser and
also the kinetic energy with which these ions enter the mass
spectrometer. This is of significance when considering
fragmentation of ions in the mass spectrometer. The more energy
imparted to a population of ions the more likely it is that
fragmentation will occur through collision of analyte molecules
with the bath gas present in the source. By adjusting the electric
field used to accelerate ions from the ionisation chamber it is
possible to control the fragmentation of ions. This is advantageous
when fragmentation of ions is to be used as a means of removing
tags from a labeled biomolecule. Electrospray ionisation is
particularly advantageous as it can be used in-line with liquid
chromatography and capillary electrophoresis, referred to as Liquid
Chromatography Mass Spectrometry (LC-MS) and Capillary
Electrophoresis Mass Spectrometry (CE-MS) respectively.
[0197] Atmospheric Pressure Chemical Ionisation:
[0198] Atmospheric Pressure Chemical Ionisation (APCI) is similar
to (ESI) in that a dilute solution of the analyte molecule can be
`atomised` or nebulised into the ion source at atmospheric
pressure, however ionisation takes place by chemical ionisation. In
APCI the ion source is filled with a bath gas that is subjected to
a coronal discharge source which essentially generates a plasma
ionising the bath gas, which in turn ionises the molecules that are
sprayed into the ion source. APCI can also be coupled to laser
desorption ionisation (Coon J. J. et al., Rapid Commun Mass
Spectrom., 16(7): 681-685, "Atmospheric pressure laser
desorption/chemical ionization mass spectrometry: a new ionization
method based on existing themes." (2002)), which may also be
advantageous in certain embodiments of this invention, particularly
the microarray embodiments. In general APCI is a relatively mild
technique appropriate for analysis of mass tags.
[0199] Matrix Assisted Laser Desorption Ionisation (MALDI):
[0200] MALDI requires that the biomolecule solution be embedded in
a large molar excess of a photo-excitable `matrix`. The application
of laser light of the appropriate frequency results in the
excitation of the matrix which in turn leads to rapid evaporation
of the matrix along with its entrapped biomolecule. Proton transfer
from the acidic matrix to the biomolecule gives rise to protonated
forms of the biomolecule which can be detected by positive ion mass
spectrometry, particularly by Time-Of-Flight (TOF) mass
spectrometry. Negative ion mass spectrometry is also possible by
MALDI TOF. This technique imparts a significant quantity of
translational energy to ions, but tends not to induce excessive
fragmentation despite this. Accelerating voltages can again be used
to control fragmentation in variations of this technique, such as
Post Source Decay. The use of laser desorption techniques is
particularly compatible with applications of this invention where
microarray are used to analyse CCPs with Microarray Address
Sequences.
[0201] Fast Atom Bombardment:
[0202] Fast Atom Bombardment (FAB) has come to describe a number of
techniques for vaporising and ionising relatively involatile
molecules. In these techniques a sample is desorbed from a surface
by collision of the sample with a high energy beam of xenon atoms
or caesium ions. The sample is coated onto a surface with a simple
matrix, typically a non volatile material, e.g. m-nitrobenzyl
alcohol (NBA) or glycerol. FAB techniques are also compatible with
liquid phase inlet systems--the liquid eluting from a capillary
electrophoresis inlet or a high pressure liquid chromatography
system pass through a frit, essentially coating the surface of the
frit with analyte solution which can be ionised from the frit
surface by atom bombardment.
[0203] Mass Analysers:
[0204] Fragmentation of peptides by collision induced dissociation
is used in this invention to identify tags on proteins. Various
mass analyser geometries may be used to fragment peptides and to
determine the mass of the fragments.
[0205] MS/MS and MS.sup.n analysis of peptide Tandem Mass Tags:
[0206] Tandem mass spectrometers allow ions with a pre-determined
mass-to-charge ratio to be selected and fragmented by collision
induced dissociation (CID). The fragments can then be detected
providing structural information about the selected ion. When
peptides are analysed by CID in a tandem mass spectrometer,
characteristic cleavage patterns are observed, which allow the
sequence of the peptide to be determined. Natural peptides
typically fragment randomly at the amide bonds of the peptide
backbone to give series of ions that are characteristic of the
peptide. CID fragment series are denoted a.sub.n, b.sub.n, c.sub.n,
etc. for cleavage at the n.sup.th peptide bond where the charge of
the ion is retained on the N-terminal fragment of the ion.
Similarly, fragment series are denoted x.sub.n, y.sub.n, z.sub.n,
etc. where the charge is retained on the C-terminal fragment of the
ion.
[0207] Trypsin and thrombin are favoured cleavage agents for tandem
mass spectrometry as they produce peptides with basic groups at
both ends of the molecule, i.e. the alpha-amino group at the
N-terminus and lysine or arginine side-chains at the C-terminus.
This favours the formation of doubly charged ions, in which the
charged centres are at opposite termini of the molecule. These
doubly charged ions produce both C-terminal and N-terminal ion
series after CID. This assists in determining the sequence of the
peptide. Generally speaking only one or two of the possible ion
series are observed in the CID spectra of a given peptide. In
low-energy collisions typical of quadrupole based instruments the
b-series of N-terminal fragments or the y-series of C-terminal
fragments predominate. If doubly charged ions are analysed then
both series are often detected. In general, the y-series ions
predominate over the b-series.
[0208] In general peptides fragment via a mechanism that involves
protonation of the amide backbone follow by intramolecular
nucleophilic attack leading to the formation of a 5-membered
oxazolone structure and cleavage of the amide linkage that was
protonated (Schlosser A. and Lehmann W. D. J. Mass Spectrom. 35:
1382-1390, "Five-membered ring formation in unimolecular reactions
of peptides: a key structural element controlling low-energy
collision induced dissociation", 2000). FIG. 16a shows one proposed
mechanism by which this sort of fragmentation takes place. This
mechanism requires a carbonyl group from an amide bond adjacent to
a protonated amide on the N-terminal side of the protonated amide
to carry out the nucleophilic attack. A charged oxazolonium ion
gives rise to b-series ions, while proton transfer from the
N-terminal fragment to the C-terminal fragment gives rise to
y-series ions as shown in FIG. 16a. This requirement for an
appropriately located carbonyl group does not account for cleavage
at amide bonds adjacent to the N-terminal amino acid, when the
N-terminus is not protected and, in general, b-series ions are not
seen for the amide between the N-terminal and second amino acid in
a peptide. However, peptides with acetylated N-termini do meet the
structural requirements of this mechanism and fragmentation can
take place at the amide bond immediately after the first amino acid
by this mechanism. Peptides with thioacetylated N-termini, will
cleave particularly easily by the oxazolone mechanism as the
sulphur atom is more nucleophilic than an oxygen atom in the same
position. Fragmentation of the amide backbone of a peptide can also
be modulated by methylation of the backbone. Methylation of an
amide nitrogen in a peptide can promote fragmentation of the next
amide bond C-terminal to the methylated amide and also favours the
formation of b-ions. The enhanced fragmentation may be partly due
to the electron donating effect of the methyl group increasing the
nucleophilicity of the carbonyl group of the methylated amide,
while the enhanced formation of b-ions may be a result of the
inability of the oxazolonium ion that forms to transfer protons to
the C-terminal fragment as shown in FIG. 16b. In the context of
this invention thioacetylation of the N-terminus of a tag peptide
can be used to enhance cleavage of the tag peptide at the next
amide bond. Similarly, methylation of the nitrogen atom of an
N-terminal acetyl or thioacetyl group will also enhance cleavage of
the adjacent amide bond.
[0209] The ease of fragmentation of the amide backbone of a
polypeptide or peptide is also significantly modulated by the side
chain functionalities of the peptide. Thus the sequence of a
peptide determines where it will fragment most easily. In general
it is difficult to predict which amide bonds will fragment easily
in a peptide sequence. This has important consequences for the
design of the peptide mass tags of this invention. However, certain
observations have been made that allow peptide mass tags that
fragment at the desired amide bond to be designed. Proline, for
example, is known to promote fragmentation at its N-terminal amide
bond (Schwartz B. L., Bursey M. M., Biol. Mass Spectrom. 21:92,
1997) as fragmentation at the C-terminal amide gives rise to an
energetically unfavourable strained bicyclic oxazolone structure.
Aspartic acid also promotes fragmentation at its N-terminal amide
bond. Asp-Pro linkages, however, are particularly labile in low
energy CID analysis (Wysocki V. H. et al., J Mass Spectrom 35(12):
1399-1406, "Mobile and localized protons: a framework for
understanding peptide dissociation." 2000) and in this situation
aspartic acid seems to promote the cleavage of the amide bond on
its C-terminal side. Thus proline, and asp-pro linkages can also be
used in the tag peptides of this invention to promote fragmentation
at specified locations within a peptide.
[0210] A typical tandem mass spectrometer geometry is a triple
quadrupole which comprises two quadrupole mass analysers separated
by a collision chamber, also a quadrupole. This collision
quadrupole acts as an ion guide between the two mass analyser
quadrupoles. A gas can be introduced into the collision quadrupole
to allow collision with the ion stream from the first mass
analyser. The first mass analyser selects ions on the basis of
their mass/charge ration which pass through the collision cell
where they fragment. The fragment ions are separated and detected
in the third quadrupole. Induced cleavage can be performed in
geometries other than tandem analysers. Ion trap mass spectrometers
can promote fragmentation through introduction of a gas into the
trap itself with which trapped ions will collide. Ion traps
generally contain a bath gas, such as helium but addition of neon
for example, promotes fragmentation. Similarly photon induced
fragmentation could be applied to trapped ions. Another favorable
geometry is a Quadrupole/Orthogonal Time of Flight tandem
instrument where the high scanning rate of a quadrupole is coupled
to the greater sensitivity of a reflectron TOF mass analyser to
identify the products of fragmentation.
[0211] Conventional `sector` instruments are another common
geometry used in tandem mass spectrometry. A sector mass analyser
comprises two separate `sectors`, an electric sector which focuses
an ion beam leaving a source into a stream of ions with the same
kinetic energy using electric fields. The magnetic sector separates
the ions on the basis of their mass to generate a spectrum at a
detector. For tandem mass spectrometry a two sector mass analyser
of this kind can be used where the electric sector provide the
first mass analyser stage, the magnetic sector provides the second
mass analyser, with a collision cell placed between the two
sectors. Two complete sector mass analysers separated by a
collision cell can also be used for analysis of mass tagged
peptides.
[0212] Ion Traps:
[0213] Ion Trap mass analysers are related to the quadrupole mass
analysers. The ion trap generally has a 3 electrode construction--a
cylindrical electrode with `cap` electrodes at each end forming a
cavity. A sinusoidal radio frequency potential is applied to the
cylindrical electrode while the cap electrodes are biased with DC
or AC potentials. Ions injected into the cavity are constrained to
a stable circular trajectory by the oscillating electric field of
the cylindrical electrode. However, for a given amplitude of the
oscillating potential, certain ions will have an unstable
trajectory and will be ejected from the trap. A sample of ions
injected into the trap can be sequentially ejected from the trap
according to their mass/charge ratio by altering the oscillating
radio frequency potential. The ejected ions can then be detected
allowing a mass spectrum to be produced.
[0214] Ion traps are generally operated with a small quantity of a
`bath gas`, such as helium, present in the ion trap cavity. This
increases both the resolution and the sensitivity of the device as
the ions entering the trap are essentially cooled to the ambient
temperature of the bath gas through collision with the bath gas.
Collisions both increase ionisation when a sample is introduced
into the trap and dampen the amplitude and velocity of ion
trajectories keeping them nearer the centre of the trap. This means
that when the oscillating potential is changed, ions whose
trajectories become unstable gain energy more rapidly, relative to
the damped circulating ions and exit the trap in a tighter bunch
giving a narrower larger peaks.
[0215] Ion traps can mimic tandem mass spectrometer geometries, in
fact they can mimic multiple mass spectrometer geometries allowing
complex analyses of trapped ions. A single mass species from a
sample can be retained in a trap, i.e. all other species can be
ejected and then the retained species can be carefully excited by
super-imposing a second oscillating frequency on the first. The
excited ions will then collide with the bath gas and will fragment
if sufficiently excited. The fragments can then be analysed
further. It is possible to retain a fragment ion for further
analysis by ejecting other ions and then exciting the fragment ion
to fragment. This process can be repeated for as long as sufficient
sample exists to permit further analysis. It should be noted that
these instruments generally retain a high proportion of fragment
ions after induced fragmentation. These instruments and FTICR mass
spectrometers (discussed below) represent a form of temporally
resolved tandem mass spectrometry rather than spatially resolved
tandem mass spectrometry which is found in linear mass
spectrometers.
[0216] Fourier Transform Ion Cyclotron Resonance Mass Spectrometry
(FTICR MS):
[0217] FTICR mass spectrometry has similar features to ion traps in
that a sample of ions is retained within a cavity but in FTICR MS
the ions are trapped in a high vacuum chamber by crossed electric
and magnetic fields. The electric field is generated by a pair of
plate electrodes that form two sides of a box. The box is contained
in the field of a superconducting magnet which in conjunction with
the two plates, the trapping plates, constrain injected ions to a
circular trajectory between the trapping plates, perpendicular to
the applied magnetic field. The ions are excited to larger orbits
by applying a radio-frequency pulse to two `transmitter plates`
which form two further opposing sides of the box. The cycloidal
motion of the ions generate corresponding electric fields in the
remaining two opposing sides of the box which comprise the
`receiver plates`. The excitation pulses excite ions to larger
orbits which decay as the coherent motions of the ions is lost
through collisions. The corresponding signals detected by the
receiver plates are converted to a mass spectrum by Fourier
Transform (FT) analysis.
[0218] For induced fragmentation experiments these instruments can
perform in a similar manner to an ion trap--all ions except a
single species of interest can be ejected from the trap. A
collision gas can be introduced into the trap and fragmentation can
be induced. The fragment ions can be subsequently analysed.
Generally fragmentation products and bath gas combine to give poor
resolution if analysed by FT analysis of signals detected by the
`receiver plates`, however the fragment ions can be ejected from
the cavity and analysed in a tandem configuration with a
quadrupole, for example.
[0219] Analysis of TMT Labelled oligonucleotide Probes by
MS/MS:
[0220] In preferred embodiments of this invention, the circularised
probes are identified by copying successfully circularised probes
onto a solid phase support using Linear Rolling Circle Replication.
The captured multimeric repeats of the circularised probe sequences
are then probed with oligonucleotides conjugated to Tandem Mass
Tags (TMTs).
[0221] After cleavage of the TMTs from their oligonucleotides, the
TMTs are isolated and injected into the ion source of an
appropriate MS/MS instrument. Typically Electrospray Ionisation
(ESI) or Atmospheric Pressure Chemical Ionisation (APCI) sources
will be used. The tags can then be detected by selected reaction
monitoring with a triple quadrupole for example. Briefly, the first
quadrupole of the triple quadrupole is set to let through ions
whose mass-to-charge ratio corresponds to that of the parent tag
mass of interest. The selected parent tag ions are then subjected
to collision induced dissociation (CID) in the second quadrupole.
Under the sort of conditions used in the analysis of peptides the
ions will fragment mostly at the amide bonds in the molecule the
tag fragment. Although the tags all have the same mass, the
terminal portion is different because of differences in the
substituents on either side of the amide bond. Thus the markers can
be distinguished from each other. The presence of the marker
fragment associated with a parent ion of a specific mass should
identify the tag ion and consequently its associated
oligonucleotide.
Illustration of the Invention
[0222] In order to demonstrate the invention further, the following
three illustrations show how the techniques described herein may be
used in the detection of target sequences.
[0223] Protocol 1--Detection of HIV Mutations.
[0224] There are about 16 approved drugs (Shafer R. W., Clin
Microbiol Rev. 15(2):247-277, "Genotypic testing for human
immunodeficiency virus type 1 drug resistance." 2002) in use for
treatment of human immunodeficiency virus type 1 (HIV-1). These
drugs belong to three mechanistic classes: protease inhibitors,
nucleoside and nucleotide reverse transcriptase (RT) inhibitors,
and non-nucleoside RT inhibitors. New drugs based on novel
mechanisms, such as cell entry inhibitors and integrase inhibitors
are under development (Gulick R. M., Clin Microbiol Infect.
9(3):186-193, "New antiretroviral drugs." 2003). The reason for
this proliferation of drugs is due to the ability of HIV-1 to
evolve resistance to these drugs. Resistance is caused by mutations
in the target proteins, which are the protease and RT enzymes for
the existing approved drugs. Drug resistance mutations arise most
often in treated individuals, as a result of selective drug
pressure in the presence of incompletely suppressed virus
replication.
[0225] HIV-1 isolates with drug resistance mutations, however, may
also be transmitted to newly infected individuals. This means that
it is extremely important to be able to detect mutations present in
the virus population in a patient. Although the mechanism of
mutation is not fully established, it is believed that there is a
high natural level of mutation in the HIV-1 virus and that
essentially all possible mutations are generated in the virus
population at some point. Drug therapies select for particular
resistant variant which gradually become predominant. It is this
process of change in the predominance of particular HIV-1 variant
that leads to resistance and failure of therapy. It is thus
essential, not only to be able to identify HIV-1 mutations but to
accurately quantify their presence.
[0226] HIV-1 mutations are, by convention, defined as amino acid
substitutions with reference to a specific sequence referred to as
the subtype B consensus sequence, which can be obtained from the
Human Immunodeficiency Virus Reverse Transcriptase and Protease
Sequence Database (Shafer R. W. et al., Nucleic Acids Res.
27(1):348-352, 1999) maintained by Stanford University.
[0227] There are currently, approximately 80 amino acids in the HIV
genome in which substitutions are known to result in drug
resistance. At some of these 80 amino acid positions, more than one
amino acid can be substituted into the sequence, meaning that more
than 100 amino acid substitutions need to be detected in an HIV-1
assay, requiring the ability to resolve 180 or more probes for each
amino acid. Since each amino acid can be produced by more than one
codon, this corresponds to the possibility of up to 4 distinct
codons for each amino acid probe at the nucleic acid level. Not all
of these codon changes occur at an appreciable level in vivo and
since it is the functional change, i.e. the amino acid change that
needs to be detected, probes for different codons for the same
amino acid could be labeled with the same mass tag or could use the
same Probe Identification sequence.
[0228] In principle, however, all possible changes could be tested
for. In addition, certain substitutions are functionally
equivalent, leucine and isoleucine are often interchangeable.
Similarly, valine is often interchangeable with leucine and
isoleucine. This means that LCPs to detect functionally equivalent
substitutions could use the same mass tag or the same Probe
Identification sequence too.
[0229] Bi-allelic LCPs
TABLE-US-00001 TABLE 1 Components of a two probe set for the
detection of the M184V mutation in the HIV-1 reverse transcrip-
tase gene using linear Rolling Circle Replication. Component Probe
1 (Met) Probe 2 (Val) 5'Target ATGTATTGATAGATA ACGTATTGATAGATA
Recognition Sequence Primer ATGTTAAGTGACCGG ATGTTAAGTGACCGG Binding
CAGCA CAGCA Sequence Probe GATTTGATTAGATTT AGTAATGTGATTTGA
Identification GGTAA TAAAG Sequence 3'Target ACATATAAATCATCC
ACATATAAATCATCA Recognition Sequence
[0230] To illustrate the design of probes for an HIV assay, probes
are shown in Table 1 that have been designed to detect the M184V
mutation in reverse transcriptase that gives rise to AZT resistance
(Shirasaka T. et al., Proc Natl Acad Sci USA. 90(2):562-566,
"Changes in drug sensitivity of human immunodeficiency virus type 1
during therapy with azidothymidine, dideoxycytidine, and
dideoxyinosine: an in vitro comparative study." 1993). These probes
are designed for amplification by linear Rolling Circle Replication
and comprise four components: a 5' Target Recognition Sequence, a
Primer Binding Sequence, a Probe Identification Sequence and 3'
Target Recognition Sequence. The complete 70 base sequences of
Linear Circularising Probes 1 and 2 are shown below and would be
phosphorylated at the 5' hydroxyl group:
TABLE-US-00002 LCP1: 5'-
Atgtattgatagataatgttaagtgaccggcagcagatttgattagatttggtaaacatataaatcatcc-3'
(TRS1 and TRS2 in bold, PBS in italics) LCP2: 5'-
Acgtattgatagataatgttaagtgaccggcagcaagtaatgtgatttgataaagacatataaatcatca-3'
[0231] The two Target Recognition Sequences in Table 1 are each 15
bases in length. It can also be seen from Table 1 that the same
Primer Binding Sequence (PBS) is used for both probes and that this
PBS will bind to a 20-mer primer with the following sequence, which
is preferably biotinylated:
TABLE-US-00003 Primer: 5'-TGCTGCCGGTCACTTAACAT-3'
[0232] Conversely, it can be seen from Table 1 that a different
20-mer Probe Identification Sequence is used to identify each
probe. The design of these sequences is based on the disclosure of
Brenner et al. in U.S. Pat. No. 5,846,719, which provides a
convenient method for designing sets of oligonucleotide tags which
will have a minimal ability to cross-hybridise with each other's
target sequences. The corresponding Probe Detection Sequences that
are used to detect the Probe Identification Sequences will have the
same sequence as the Probe Identification Sequence as they must
bind to the complement of the Probe Identification Sequence that
will be produced by linear RCR of CCPs formed from LCPs that
correctly bind their targets. Thus the Probe Identification
Sequence in LCP1 can be detected after linear RCR by the following
Probe Detection Sequence (PDS):
TABLE-US-00004 PDS1: 5'-gatttgattagatttggtaa-3'
[0233] Similarly, the Probe Identification Sequence in LCP2 can be
detected after linear RCR by this Probe Detection Sequence:
TABLE-US-00005 PDS2: 5'-agtaatgtgatttgataaag-3
[0234] The PDS sequences are linked to a mass tag, preferably by a
photocleavable linker as disclosed in WO 97/27327 or a collision
cleavable linker as disclosed in WO98/31830. However, it is
preferred that the mass tags comprise a short peptide mass tag as
disclosed in WO 03/025576.
[0235] Redundant LCPs:
[0236] Table 1 and probes LCP1 and LCP2 illustrate the basic design
of a Linear Circularising Probe to assay for an amino acid
substitution in the HIV-1 reverse transcriptase gene. However, a
number of different nucleic acid changes can give rise to the same
amino acid change. Thus multiple LCP sequences could be necessary
to detect all possible variants of a sequence. Since all these
sequences give rise to the same amino acid change they could all be
identified by the same mass tag or Probe Identification Sequence.
For the M184V mutation this would result in a set of probes as
shown in Table 2 corresponding to the probe sets LCP3 and LCP4
shown below.
TABLE-US-00006 TABLE 2 Components of a two probe set for the
detection of the M184V mutation in the HIV-1 reverse transcriptase
gene using linear Rolling Circle Replication where all possible
codons are detected. Component Probe 3 (Met) Probe 4 (Val) 5'
Target ATGTATTGATAGATA ACGTATTGATAGATA (1) Recognition
CCGTATTGATAGATA (2) Sequence TCGTATTGATAGATA (3) GCGTATTGATAGATA
(4) Primer ATGTTAAGTGACCGGCAGC ATGTTAAGTGACCGGCAGC Binding A A
Sequence Probe GATTTGATTAGATTTGGTA AGTAATGTGATTTGATAAA Identifi- A
G cation Sequence 3' Target ACATATAAATCATCC ACATATAAATCATCA (1)
Recognition ACATATAAATCATCA (2) Sequence ACATATAAATCATCA (3)
ACATATAAATCATCA (4)
[0237] It can be seen that only one probe is required for the
detection of an internal methionine residue as there is only one
codon in the human code for internal methionine residues. Valine,
however can be encoded by four different codons and so four
different probes are need for the detection of nucleic acid
mutations that cause valine to be substituted into a protein. Thus,
the complete 70 base sequences of Linear Circularising Probes 3 and
4 are shown below and would be phosphorylated at the 5' hydroxyl
group:
TABLE-US-00007 LCP3:
5'-Atgtattgatagataatgttaagtgaccggcagcagatttgattaga
tttggtaaacatataaatcatcc-3' LCP4:
5'-Acgtattgatagataatgttaagtgaccggcagcaagtaatgtgatt
tgataaagacatataaatcatca-3'
5'-Ccgtattgatagataatgttaagtgaccggcagcaagtaatgtgatt
tgataaagacatataaatcatca-3'
5'-Tcgtattgatagataatgttaagtgaccggcagcaagtaatgtgatt
tgataaagacatataaatcatca-3'
5'-Gcgtattgatagataatgttaagtgaccggcagcaagtaatgtgatt
tgataaagacatataaatcatca-3'
[0238] Since only one codon needs to be tested for methionine LCP3
is the same as LCP1 but LCP4 comprises four different probes to
detect all nucleic acid changes that encode for valine, all
identified by the same Probe Identification Sequence.
[0239] LCPs PCR and Hyper-Branching RCR:
[0240] The sequences for LCPs 1 to 4 are all designed for linear
Rolling Circle Replication and require only one primer sequence.
However, for PCR amplification or for hyper-branching RCR, two
primers are required and the corresponding Primer Binding Sequences
must be incorporated into the corresponding LCPs.
TABLE-US-00008 TABLE 3 Components of a two probe set for the
detection of the M184V mutation in the HIV-1 reverse transcriptase
gene for PCR amplification or Hyper-Branching Rolling Circle
Replication. Component Probe 5 (Met) Probe 6 (Val) 5' Target
ATGTATTGATAGATA ACGTATTGATAGATA Recognition Sequence Primer
TGCTTTCCAGACCGT TGCTTTCCAGACCGT Binding CCATCA CCATCA Sequence 1
Probe gatttgattagatttggtaa AGTAATGTGATTTGA Identifi- TAAAG cation
Sequence Primer ggtgcctgtgcattgcctgcc GGTGCCTGTGCATTG Binding
CCTGCC Sequence 2 3' Target ACATATAAATCATCC ACATATAAATCATCA
Recognition Sequence
[0241] It can be seen from Table 3 that for PCR or Hyper-branching
Rolling Circle Replication, two primers are needed and that the
same Primer Binding Sequences (PBS) are used for both probes.
Primer 1, is preferably biotinylated. Again, the PBS sites will
bind to 20-mer primers with the following sequences:
TABLE-US-00009 Primer 1: 5'-gatggacggtctggaaagcaa-3' Primer 2:
5'-ggtgcctgtgcattgcctgcc-3'
[0242] Note that Primer 2 has the same sequence as the PBS as it is
designed to bind to the complementary strand generated by Primer 1.
Thus, the complete 90 base sequences of the example Linear
Circularising Probes for detecting the M184V mutation in the HIV-1
reverse transcriptase gene are shown below and would be
phosphorylated at the 5' hydroxyl group:
TABLE-US-00010 LCP5:
5'-ATGTATTGATAGATATGCTTTCCAGACCGTCCATCAGATTTGATTAG
ATTTGGTAAGGTGCCTGTGCATTGCCTGCCACATATAAATCATCC-3' LCP6:
5'-AcgtattgatagataTGCTTTCCAGACCGTCCATCAagtaatgtgat
ttgataaagggtgcctgtgcattgcctgccacatataaatcatca-3'
[0243] Since PCR amplification and hyper-branching RCR generate
sense and antisense copies of any CCPs that form, the Probe
Detection Sequences can be designed to bind to either the sense or
antisense amplification products. Thus the Probe Identification
Sequence in LCP5 can be detected after amplification by PDS1 or by
the following Probe Detection Sequence (PDS):
TABLE-US-00011 PDS3: 5'-TTACCAAATCTAATCAAATC-3'
[0244] Similarly, the Probe Identification Sequence in LCP6 can be
detected after amplification by PDS2 or by this Probe Detection
Sequence:
TABLE-US-00012 PDS4: 5'-CTTTATCAAATCACATTACT-3'
[0245] The Assay:
[0246] The first step in a viral load or genotyping assay would be
the extraction of the RNA from the source biological sample, which
is typically blood plasma for an HIV assay. This can be done using
a QIAamp Viral RNA kit from QIAgen (Hilden, Germany) following the
manufacturer's instructions. For a comprehensive review of viral
RNA extraction methods see Verhofstede C. et al., J Virol Methods.
60(2):155-159, "Isolation of HIV-1 RNA from plasma: evaluation of
eight different extraction methods." 1996 and Fransen K. et al., J
Virol Methods. 76 (1-2):153-157, "Isolation of HIV-1 RNA from
plasma: evaluation of seven different methods for extraction (part
two)." 1998.
[0247] After RNA extraction the RNA is assayed with the Linear
Circularising Probes (LCP1 and LCP2) comprised of the components
shown in table 1. Alternatively, if all possible codons are to be
detected then LCPs comprising of the components shown in table 2
would be used (LCP3 and LCP4). If PCR or hyper-branching RCR is to
be used later in the assay then Linear Circularising Probes
comprised of the components shown in table 3 would be used (LCP5
and LCP6). Appropriate assay conditions for RNA mediated ligation
of LCPs with T4 RNA ligase are disclosed by Nilsson M. et al., Nat
Biotechnol. 18(7):791-793, "Enhanced detection and distinction of
RNA by enzymatic probe ligation." 2000 and Nilsson M. et al.,
Nucleic Acids Res. 29(2):578-581, "RNA-templated DNA ligation for
transcript analysis." 2001.
[0248] After ligation of LCPs to form CCPs the CCPs are amplified.
Amplification is generally inhibited if the CCPs remain associated
with their targets. Since HIV-1 is an RNA virus, the RNA can be
selectively degraded by addition of RNAse H under hybridizing
conditions. The free CCPs are then available for unrestricted
amplification.
[0249] Methods for amplification of circular oligonucleotide probes
are disclosed by Baner J. et al. (Nucleic Acids Res.
26(22):5073-5078, "Signal amplification of padlock probes by
rolling circle replication." 1998) for example, or Zhang D. Y. et
al. (Gene. 274 (1-2):209-216, "Detection of rare DNA targets by
isothermal ramification amplification." 2001) or Hardenbol et al.
(Nature Biotechnology 21 (6) pages 673-678, 2003). The protocol
disclosed by Zhang et al. uses a second primer sequence to effect a
form of hyper-branching RCR and would thus require LCPs with the
components shown in table 3 to be used. Similarly, the protocol
disclosed by Hardenbol et al. uses two primers to amplify CCPs by
PCR. In the Hardenbol protocol, prior to PCR the CCPs are
linearised. For the purposes of this example, the protocols
disclosed in these publications would be modified such that the
primer for initiating rolling circle replication would be
biotinylated. This would allow a further step in the process to be
carried out which is the capture of the linear tandem repeat RCR
product onto an avidinated support such as the BioMag Nuclease-Free
Streptavidin from Qiagen (Hilden, Germany), Avidinated Magnetic
Porous Glass (MPG) particles from CPG Inc (Lincoln Park, N.J., USA)
or Avidin Magnetic Particles from Spherotech, Inc (Libertyville,
Ill., USA). Magnetic particles are preferred for ease of handling
with automated instrumentation such as the Kingfisher magnetic
particle processor instruments (Thermo Electron Corporation,
Waltham, Mass., USA). The captured RCR product can then be washed
on the beads allowing unreacted probes and other unwanted reagents
to be washed away.
[0250] The captured RCR products are then probed with mass tagged
Probe Detection Sequences, PDS1 and PDS2. The probes are added in a
mass spectrometry compatible hybridization enhancing buffer such as
those disclosed in WO 97/14815 or WO 98/13527 which comprise
volatile salts. After allowing hybridization to proceed for a
suitable period of time, unhydridised PDS sequences are washed
away. The tags are then analysed. If a photocleavable linker has
been used to link the mass tags to the PDS oligonucleotides, then
cleavage and analysis of the tags can be effected according to the
disclosure of WO 97/27327. If a collision cleavable linker has been
used then the correctly hybridised oligonucleotides must be
denatured from the captured RCR products, by heating for example
and the released PDS oligonucleotides are injected into the ion
source of an electrospray mass spectrometer and the tags are
cleaved by increasing the cone voltage in the electrospray ion
source as disclosed in WO98/31830. If peptide tags of the kind
disclosed in WO 03/025576, then it will be necessary to carry out
the sort of MS/MS analysis disclosed in this patent
application.
[0251] In this example, probes for a single mutation have been
illustrated. The references cited all disclose the use of multiple
probes and the methods above are applicable to assays which
comprise numerous distinct LCPs. As long as these are uniquely
identifiable, and U.S. Pat. No. 5,846,719 discloses methods for
designing large arrays of oligonucleotide tags and tag complements
that can be used for LCP identification, it will be possible for
one of ordinary skill in the art to adapt the above example to more
highly multiplexed assays.
[0252] Protocol 2-Detection of BRCA1 Gene Mutation.
[0253] Breast cancer is the most common cancer to affect women and
it is believed that there is a strong genetic basis for the
disease. Research has shown up to 5% of breast and ovarian cancers
are caused by mutations in two genes alone, dubbed BRCA1 and BRCA2
(Ponder BA. Biochem Soc Symp. 63:223-230, "Inherited predisposition
to breast cancer." 1998). Recent research has uncovered more than
150 nucleotide substitutions in the BRCA1 gene alone (Stenson P. D.
et al., Hum Mutat. 21(6):577-581, "Human Gene Mutation Database
(HGMD): 2003 update." 2003). Comprehensive screening of all these
mutations in an affordable assay is highly desirable to allow
accurate determinations of the risk of developing the disease, and
in patients with the disease, to allow determination of the most
appropriate treatment.
TABLE-US-00013 TABLE 4 Components of a two probe set for the
detection of the G255A mutation in the BRCA1 gene nucleotide
sequence using linear Rolling Circle Replication. Component Probe 7
Probe 8 5' Target TTTGTGGAGACAGGT TTTGTGGAGACAGGT Recognition
Sequence Primer ATGTTAAGTGACCGG ATGTTAAGTGACCGG Binding CAGCA CAGCA
Sequence Probe GATTTGATTAGATTT AGTAATGTGATTTGA Identifi- GGTAA
TAAAG cation Sequence 3' Target AATATGTGGTCACAC AATATGTGGTCACAT
Recognition Sequence
[0254] To illustrate the design of probes for a BRCA1 assay, probe
components are shown in Table 4 that have been designed to detect a
single nucleotide substitution that is known to occur in the BRCA1
gene. This mutation is listed in dbSNP (Wheeler D. L. et al.,
Nucleic Acids Res. 32 Database issue:D35-40, "Database resources of
the National Center for Biotechnology Information: update." 2004)
under the accession rs1800062. Two variants of this mutation exist
in which a G is replaced with an A residue. The pair of probes for
this mutation comprise four components: a 5' Target Recognition
Sequence, a Primer Binding Sequence, a Probe Identification
Sequence and 3' Target Recognition Sequence. The complete 70 base
sequences of Linear Circularising Probes 7 and 8 are shown below
and would be phosphorylated at the 5' hydroxyl group:
TABLE-US-00014 LCP7:
5'-TTTGTGGAGACAGGTatgttaagtgaccggcagcagatttgattaga
tttggtaaAATATGTGGTCACAC-3' LCP8:
5'-TTTGTGGAGACAGGTatgttaagtgaccggcagcaagtaatgtgatt
tgataaagAATATGTGGTCACAT-3'
[0255] The other features of this probe are the same as those for
the probes shown in Table 1 for Example 1.
[0256] The Assay:
[0257] The first step in a genotyping assay of this kind would be
the extraction genomic DNA from the source biological sample, which
could be a cheek swab or a blood sample. This extraction can be
done using a QIAamp Blood kit from QIAgen (Hilden, Germany)
following the manufacturer's instructions.
[0258] After genomic DNA extraction the DNA is assayed with the
Linear Circularising Probes (LCP7 and LCP8) comprised of the
components shown in table 4. Appropriate assay conditions for DNA
mediated ligation of LCPs are disclosed by Baner J. et al. (Nucleic
Acids Res. 26(22):5073-5078, "Signal amplification of padlock
probes by rolling circle replication." 1998).
[0259] Methods for amplification of circular oligonucleotide probes
are also disclosed by Baner J. et al. PCR or hyper-branching RCR
can also be used with this sort of assay but would require an
additional Primer Binding Site added to the LCP7 and LCP8
sequences. For the purposes of this example, the protocol disclosed
by Baner J. et al. would be modified such that the primer for
initiating rolling circle replication would be biotinylated. This
would allow a further step in the process to be carried out which
is the capture of the linear tandem repeat RCR product onto an
avidinated support as discussed in Example 1. The captured RCR
product can then be washed on the beads allowing unreacted probes
and other unwanted reagents to be washed away.
[0260] The captured RCR products are then probed with mass tagged
Probe Detection Sequences, PDS1 and PDS2. The probes are added in a
mass spectrometry compatible hybridization enhancing buffer such as
those disclosed in WO 97/14815 or WO 98/13527, which comprise
volatile salts. After allowing hybridization to proceed for a
suitable period of time, unhydridised PDS sequences are washed
away. The tags are then analysed. If a photocleavable linker has
been used to link the mass tags to the PDS oligonucleotides, then
cleavage and analysis of the tags can be effected according to the
disclosure of WO 97/27327. If a collision cleavable linker has been
used then the correctly hybridised oligonucleotides must be
denatured from the captured RCR products, by heating for example
and the released PDS oligonucleotides are injected into the ion
source of an electrospray mass spectrometer and the tags are
cleaved by increasing the cone voltage in the electrospray ion
source as disclosed in WO98/31830. If peptide tags of the kind
disclosed in WO 03/025576, then it will be necessary to carry out
the sort of MS/MS analysis disclosed in this patent
application.
[0261] Protocol 3-Leukemia Diagnosis
[0262] Leukemia is a cancer of the immune system's T-cells that is
characterised by a number of genetic translocations that give rise
to abnormal protein expression. Profiling of T-cell mRNA expression
is emerging as a useful tool in classifying leukemia's according to
the translocations that are present (Schoch C. et al., Proc Natl
Acad Sci USA. 99(15):10008-13. Epub 2002 Jul. 8, "Acute myeloid
leukemias with reciprocal rearrangements can be distinguished by
specific gene expression profiles." 2002; Kohlmann A. et al., Genes
Chromosomes Cancer. 37(4):396-405, "Molecular characterization of
acute leukemias by use of microarray technology." 2003). The
ability to perform these sorts of classifications is extremely
useful in determining appropriate treatment regimes for patients to
ensure the best possible outcome from treatment (Roche-Lestienne C.
and Preudhomme C., Semin Hematol. 40 (2 Suppl 2):80-82, "Mutations
in the ABL kinase domain pre-exist the onset of imatinib
treatment." 2003).
TABLE-US-00015 TABLE 5 Components of a two probe set for the
detection of the t (9; 22) translocation resulting in the formation
of the b3a2 variant of the BCR-ABL fusion gene using linear Rolling
Circle Repli- cation and microarray based detection. LCP11
Component LCP9 (BCR) LCP10 (ABL) (BCR-ABL) 5' Target TTGAACTCTGCTT
CTTCCAGATAACA TTGAACTCTGCTT Recognition AA GC AA Sequence Primer
ATGTTAAGTGACC ATGTTAAGTGACC ATGTTAAGTGACC Binding GGCAGCA GGCAGCA
GGCAGCA Sequence Microarray GTAAAGTAGATTA TGATTTTGATGTG
TAGAGTAAATGAA Address TGTTAGA TAAGATT AAGTGAT Sequence Probe
GATTTGATTAGAT AGTAATGTGATTT TTTGTAGATTTGA Identifi- TTGGTAA GATAAAG
GTAAGTA cation Sequence 3' Target CAAACCAGTACTT GCCGCTGAAGGGC
GCCGCTGAAGGGC Recognition AC TT TT Sequence
[0263] To illustrate the design of Linear Circularising Probes for
a leukemia T-cell expression profiling assay, a set of probes is
shown in Table 5 that has been designed to detect the b3a2 variant
of the t(9;22) translocation (Melo J. V., Baillieres Clin Haematol.
10(2):203-222, "BCR-ABL gene variants." 1997) that is the classic
signature of Chronic Myeloid Leukemia (CML) and the corresponding
normal sequences that give rise to the gene fusion. The t(9;22)
translocation is the result of the fusion of two genes, ABL and
BCR, that normally reside on chromosomes 9 and 22 respectively.
Transcription and translation of this fusion gene produces an
abnormal protein dubbed BCR-ABL that can transform
non-proliferative cells into cancerous cells. These LCPs are
designed for amplification by linear Rolling Circle Replication
followed by detection on a microarray. The LCPs comprise five
components: a 5' Target Recognition Sequence, a Primer Binding
Sequence, a Microarray Address Sequence, a Probe Identification
Sequence and 3' Target Recognition Sequence. The complete 90 base
sequences of Linear Circularising Probes 9, 10 and 11 are shown
below and would be phosphorylated at the 5' hydroxyl group:
TABLE-US-00016 LCP9:
5'-TTGAACTCTGCTTAAatgttaagtgaccggcagcaGTAAAGTAGATT
ATGTTAGAgatttgattagatttggtaaCAAACCAGTACTTAC-3' LCP10:
5'-CTTCCAGATAACAGCatgttaagtgaccggcagcaTGATTTTGATGT
GTAAGATTagtaatgtgatttgataaagGCCGCTGAAGGGCTT-3' LCP11:
5'-TTGAACTCTGCTTAAatgttaagtgaccggcagcaTAGAGTAAATGA
AAAGTGATTTTGTAGATTTGAGTAAGTAGCCGCTGAAGGGCTT-3'
[0264] The two Target Recognition Sequences in Table 5 are each 15
bases in length. It can also be seen from Table 5 that the same
Primer Binding Sequence (PBS) is used for all three probes and that
this PBS will bind to a 20-mer primer with the following sequence,
which is preferably biotinylated:
TABLE-US-00017 Primer: 5'-TGCTGCCGGTCACTTAACAT-3'
[0265] Conversely, it can be seen from Table 5 that a different
20-mer Probe Identification Sequence is used to identify each probe
in the same way as the probes designed for linear RCR in Example 1.
Thus PDS1 and PDS2, from Example 1, will identify LCP9 and LCP10
respectively. LCP11 would bind to a third PDS sequence as
below:
TABLE-US-00018 PDS3: 5'-TTTGTAGATTTGAGTAAGTA-3'
[0266] These PDS sequences would be linked to a mass tag as
discussed in Examples 1 and 2. However, one difference between
Examples 1 and 2 and this example is that for a microarray based
detection it would not be useful to use an electrospray cleavable
linker and a photocleavable linker would be preferred.
[0267] The Assay:
[0268] The first step in a gene expression profiling assay would be
the extraction of the mRNA from the source biological sample. The
source biological sample comprises T-cells from blood for a
Leukemia test. The extraction of mRNA from T-cells can be done
using a QuickPrep Micro mRNA Purification Kit (Amersham Pharmacia
Biotech, Uppsala, Sweden) or using an RNeasy Kit (Qiagen, Hilden,
Germany) following the manufacturer's instructions.
[0269] After RNA extraction the RNA is assayed with the Linear
Circularising Probes (LCP9, LCP10 and LCP 11) comprised of the
components shown in table 5. Appropriate assay conditions for RNA
mediated ligation of LCPs with T4 RNA ligase are disclosed by
Nilsson M. et al., Nat Biotechnol. 18(7):791-793, "Enhanced
detection and distinction of RNA by enzymatic probe ligation." 2000
and Nilsson M. et al., Nucleic Acids Res. 29(2):578-581,
"RNA-templated DNA ligation for transcript analysis." 2001.
[0270] After ligation of LCPs to form CCPs the CCPs are amplified.
Amplification is generally inhibited if the CCPs remain associated
with their targets. As discussed in Example 1, the mRNA can be
selectively degraded by addition of RNAse H under hybridizing
conditions. The free CCPs are then available for unrestricted
amplification.
[0271] Methods for amplification of circular oligonucleotide probes
using linear RCR are disclosed by Baner J. et al. (Nucleic Acids
Res. 26(22):5073-5078, "Signal amplification of padlock probes by
rolling circle replication." 1998) which would require that the
CCPs are contacted with the Primer sequence complementary to the
Primer Binding Site in LCPs 9, 10 and 11. The linear RCR products
generated by the primer extension reaction would then by hybridised
to an array comprising oligonucleotides that have the same
sequences as the Microarray Address Sequences that were
incorporated into LCP9, LCP10 and LCP11, so that the microarray
sequences can bind to the complement of the Microarray Address
Sequences that would be generated in the RCR product. Methods for
hybridizing amplification products of CCPs to microarrays are
provided by Baner J. et al. (Nucleic Acids Res. 31 (17):e103,
"Parallel gene analysis with allele-specific padlock probes and tag
microarrays." 2003).
[0272] In an alternative approach linear RCR is performed on the
microarray surface itself using the sequence on the array that is
complementary to the Microarray Address Sequence as the RCR
initiating primer. Methods for initiating RCA from a tethered
oligonucleotide are provided by Lizardi P. M. et al. (Nat Genet.
19(3):225-32. "Mutation detection and single-molecule counting
using isothermal rolling-circle amplification." 1998). In this case
the microarray should be comprised of oligonucleotides whose
sequences are complementary to the Microarray Address Sequences
present in LCP9, LCP10 and LCP11. In this situation, the Primer
Binding Sequence could be omitted from the probes used in the
assay.
[0273] The captured RCR products on the microarray surface are then
probed with mass tagged Probe Detection Sequences, PDS1, PDS2 and
PDS3. The probes are added in a mass spectrometry compatible
hybridization enhancing buffer such as those disclosed in WO
97/14815 or WO 98/13527 which comprise volatile salts. After
allowing hybridization to proceed for a suitable period of time,
unhydridised PDS sequences are washed away. The tags are then
analysed. With a photocleavable linker connecting the mass tags to
the PDS oligonucleotides, cleavage and analysis of the tags can be
effected according to the disclosure of WO 97/27327. If peptide
tags of the kind disclosed in WO 03/025576, then it will be
necessary to carry out the sort of MS/MS analysis disclosed in this
patent application. For purposes of this example, an Atmospheric
Pressure MALDI ion source linked to an Ion Trap mass spectrometer
would be appropriate. Such equipment is available from Agilent
(Palo Alto, Calif., USA) or Thermo Finnigan (San Jose, Calif.,
USA). In a MALDI ion trap instrument, the tags would be
sequentially laser desorbed from each location on the array
[0274] In this example, probes for detection of a single mRNA
translocation have been illustrated. These probes are designed
around the translocation site. The probes do not represent a
complete assay for leukemia translocations. The probes above can
only indicate the presence or absence of the b3a2 variant of the
t(9;22) translocation. Further probes would be required to classify
all the possible t(9;22) translocation variants. In most of the
references cited, the use of multiple probes is discussed and the
methods above are applicable to assays which comprise numerous
distinct LCPs. As long as these are uniquely identifiable by a
unique combination of Probe Detection Sequences and Microarray
Address Sequences, it will be possible for one of ordinary skill in
the art to adapt the above example to more highly multiplexed
assays. As discussed above, U.S. Pat. No. 5,846,719 discloses
methods for designing large arrays of oligonucleotide tags and tag
complements that can be used for LCP identification as both Probe
Identification Sequences and as Microarray Address Sequences.
Sequence CWU 1
1
43115DNAArtificial sequence5prime Target Recognition Sequence
1atgtattgat agata 15220DNAArtificial sequencePrimer binding
sequence 2atgttaagtg accggcagca 20320DNAArtificial sequenceProbe
Identification Sequence 3gatttgatta gatttggtaa 20415DNAArtificial
sequence3prime Target Recognition Sequence 4acatataaat catcc
15515DNAArtificial sequence5prime Target Recognition Sequence
5acgtattgat agata 15620DNAArtificial sequenceProbe Identification
Sequence 6agtaatgtga tttgataaag 20715DNAArtificial sequence3prime
Target Recognition Sequence 7acatataaat catca 15870DNAArtificial
sequenceLinear Circularising Probe 1 (and Linear Circularising
Probe 3) 8atgtattgat agataatgtt aagtgaccgg cagcagattt gattagattt
ggtaaacata 60taaatcatcc 70970DNAArtificial sequenceLinear
Circularising Probe 2 9acgtattgat agataatgtt aagtgaccgg cagcaagtaa
tgtgatttga taaagacata 60taaatcatca 701020DNAArtificial
sequencePrimer 10tgctgccggt cacttaacat 201120DNAArtificial
sequenceProbe Detection Sequence 1 11gatttgatta gatttggtaa
201220DNAArtificial sequenceProbe Detection Sequence 2 12agtaatgtga
tttgataaag 201315DNAArtificial sequence5prime Target Recognition
Sequence 13ccgtattgat agata 151415DNAArtificial sequence5prime
Target Recognition Sequence 14tcgtattgat agata 151515DNAArtificial
sequence5prime Target Recognition Sequence 15gcgtattgat agata
151670DNAArtificial sequenceLinear Circularising Probe 4
16acgtattgat agataatgtt aagtgaccgg cagcaagtaa tgtgatttga taaagacata
60taaatcatca 701770DNAArtificial sequenceLinear Circularising Probe
4 17ccgtattgat agataatgtt aagtgaccgg cagcaagtaa tgtgatttga
taaagacata 60taaatcatca 701870DNAArtificial sequenceLinear
Circularising Probe 4 18tcgtattgat agataatgtt aagtgaccgg cagcaagtaa
tgtgatttga taaagacata 60taaatcatca 701970DNAArtificial
sequenceLinear Circularising Probe 4 19gcgtattgat agataatgtt
aagtgaccgg cagcaagtaa tgtgatttga taaagacata 60taaatcatca
702021DNAArtificial sequencePrimer binding sequence 1 20tgctttccag
accgtccatc a 212121DNAArtificial sequencePrimer binding sequence 2;
and Primer 2. 21ggtgcctgtg cattgcctgc c 212221DNAArtificial
sequencePrimer 1 22gatggacggt ctggaaagca a 212392DNAArtificial
sequenceLinear Circularising Probe 5 23atgtattgat agatatgctt
tccagaccgt ccatcagatt tgattagatt tggtaaggtg 60cctgtgcatt gcctgccaca
tataaatcat cc 922492DNAArtificial sequenceLinear Circularising
Probe 6 24acgtattgat agatatgctt tccagaccgt ccatcaagta atgtgatttg
ataaagggtg 60cctgtgcatt gcctgccaca tataaatcat ca
922520DNAArtificial sequenceProbe Detection Sequence 3 25ttaccaaatc
taatcaaatc 202620DNAArtificial sequenceProbe Detection Sequence 4
26ctttatcaaa tcacattact 202715DNAArtificial sequence5prime Target
Recognition Sequence 27tttgtggaga caggt 152815DNAArtificial
sequence3prime Target Recognition Sequence 28aatatgtggt cacac
152915DNAArtificial sequence3prime Target Recognition Sequence
29aatatgtggt cacat 153070DNAArtificial sequenceLinear Circularising
Probe 7 30tttgtggaga caggtatgtt aagtgaccgg cagcagattt gattagattt
ggtaaaatat 60gtggtcacac 703170DNAArtificial sequenceLinear
Circularising Probe 8 31tttgtggaga caggtatgtt aagtgaccgg cagcaagtaa
tgtgatttga taaagaatat 60gtggtcacat 703215DNAArtificial
sequence5prime Target Recognition Sequence 32ttgaactctg cttaa
153320DNAArtificial sequenceMicroarray Address Sequence
33gtaaagtaga ttatgttaga 203415DNAArtificial sequence3prime Target
Recognition Sequence 34caaaccagta cttac 153515DNAArtificial
sequence5prime Target Recognition Sequence 35cttccagata acagc
153620DNAArtificial sequenceMicroarray Address Sequence
36tgattttgat gtgtaagatt 203715DNAArtificial sequence3prime Target
Recognition Sequence 37gccgctgaag ggctt 153820DNAArtificial
sequenceMicroarray Address Sequence 38tagagtaaat gaaaagtgat
203920DNAArtificial sequenceProbe Identification Sequence
39tttgtagatt tgagtaagta 204090DNAArtificial sequenceLinear
Circularising Probe 9 40ttgaactctg cttaaatgtt aagtgaccgg cagcagtaaa
gtagattatg ttagagattt 60gattagattt ggtaacaaac cagtacttac
904190DNAArtificial sequenceLinear Circularising Probe 10
41cttccagata acagcatgtt aagtgaccgg cagcatgatt ttgatgtgta agattagtaa
60tgtgatttga taaaggccgc tgaagggctt 904290DNAArtificial
sequenceLinear Circularising Probe 11 42ttgaactctg cttaaatgtt
aagtgaccgg cagcatagag taaatgaaaa gtgattttgt 60agatttgagt aagtagccgc
tgaagggctt 904320DNAArtificial sequenceProbe Detection Sequence 3
43tttgtagatt tgagtaagta 20
* * * * *