U.S. patent application number 12/322370 was filed with the patent office on 2009-06-18 for method for detecting nanbv associated seroconversion.
Invention is credited to Genevieve Inchauspe, Marc S. Nasoff, Alfred M. Prince, Suzanne Zebedee.
Application Number | 20090155772 12/322370 |
Document ID | / |
Family ID | 46330215 |
Filed Date | 2009-06-18 |
United States Patent
Application |
20090155772 |
Kind Code |
A1 |
Zebedee; Suzanne ; et
al. |
June 18, 2009 |
Method for detecting nanbv associated seroconversion
Abstract
The present invention relates to recombinant expression vectors
which express segments of deoxyribonucleic acid that encode
recombinant HIV and HCV antigens. These recombinant expression
vectors are transformed into host cells and used in a method to
express large quantities of these antigens. The invention also
provides compositions containing certain of the isolated antigens,
diagnostic systems containing these antigens and methods of
assaying body fluids to detect the presence of antibodies against
the antigens of the invention.
Inventors: |
Zebedee; Suzanne; (Carlsbad,
CA) ; Inchauspe; Genevieve; (Lyon, FR) ;
Nasoff; Marc S.; (San Diego, CA) ; Prince; Alfred
M.; (Pound Ridge, NY) |
Correspondence
Address: |
Joseph E. Mueth, Esq.
Suite 300, 100 E. Corson Street
Pasadena
CA
91103-3842
US
|
Family ID: |
46330215 |
Appl. No.: |
12/322370 |
Filed: |
January 29, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12077046 |
Mar 14, 2008 |
|
|
|
12322370 |
|
|
|
|
10677956 |
Oct 1, 2003 |
|
|
|
12077046 |
|
|
|
|
08931855 |
Sep 16, 1997 |
6692751 |
|
|
10677956 |
|
|
|
|
08563733 |
Nov 28, 1995 |
|
|
|
08931855 |
|
|
|
|
08272271 |
Jul 8, 1994 |
|
|
|
08563733 |
|
|
|
|
07616369 |
Nov 21, 1990 |
|
|
|
08272271 |
|
|
|
|
07573643 |
Aug 27, 1990 |
|
|
|
07616369 |
|
|
|
|
Current U.S.
Class: |
435/5 |
Current CPC
Class: |
C12Q 1/703 20130101;
A61K 38/00 20130101; C12N 2740/16222 20130101; C07K 14/005
20130101; Y10S 436/82 20130101 |
Class at
Publication: |
435/5 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70 |
Claims
1. A method for detecting seroconversion associated with NANBV
infection at early times after infection comprising: (a) initiating
an immunoreaction by contacting a body fluid sample with a pure and
isolated NANBV capsid antigen and C-100-3 antigen; (b) maintaining
said immunoreaction for a time period sufficient for allowing
antibodies against the NANBV capsid and C-100-3 antigens present in
said body fluid sample to immunoreact with said NANBV capsid and
C-100-3 antigens to form immunoreaction products; (c) detecting the
presence of any of said immunoreaction products formed and thereby
detecting early seroconversion and reducing the risk of a body
fluid sample being erroneously characterized as non-reactive in the
testing for NANBV hepatitis antibody.
2. A method for detecting seroconversion associated with NANBV
infection at early times after infection comprising: (a) initiating
an immunoreaction by contacting a body fluid sample pure and
isolated with NANBV capsid antigen having the amino acid sequence
from residue 1 to 120 of SEQ ID NO: 73 and C-100-3 antigen; (b)
maintaining said immunoreaction for a time period sufficient for
allowing antibodies against said NANBV capsid and C-100-3 antigens
present in the body fluid sample to immunoreact with said NANBV
capsid and C-100-3 antigens to form immunoreaction products; and
(c) detecting the presence of any said immunoreaction products
formed and thereby detecting early seroconversion and reducing the
risk of a body fluid sample being erroneously characterized as
non-reactive in the testing for NANBV hepatitis antibody.
3. The method of claims 1 or 2 wherein said detecting in step (c)
comprises the steps of: (a) admixing said immunoreaction products
formed in step (b) with a labeled specific binding agent to form a
labeling admixture, said labeled specific binding agent comprising
a specific binding agent and a label; (b) maintaining said labeling
admixture for a period of time sufficient for any of said
immunoreaction products present to bind with said labeled product;
and (c) detecting the of any said labeled product formed, and
thereby the presence of said immunoreaction products.
4. The method of claim 3 wherein said specific binding agent is
selected from the group consisting of Protein A, anti-human IgG and
anti-human IgM.
5. The method of claim 3, wherein said label is selected from the
group consisting of lanthanide chelate, biotin, enzyme and
radioactive isotope.
6. The method of claim 3, wherein said antigens are affixed to a
solid matrix.
7. The method of claim 3, wherein said antigens are comprised of a
fusion product.
8. The method of claim 1, wherein said pure and isolated NANBV
capsid antigen is selected from the group consisting of: (a) a
NANBV capsid antigen having the amino acid sequence from the
residue 1 to 120 of SEQ ID NO: 73; (b) a NANBV capsid antigen
having the amino acid sequence from the residue 1 to 20 of SEQ ID
NO: 73; (c) a NANBV capsid antigen having the amino acid sequence
from the residue 21 to 40 of SEQ ID NO: 73; (d) a NANBV capsid
antigen having the amino acid sequence from the residue 1 to 74 of
SEQ ID NO: 73; (e) a NANBV capsid antigen having the amino acid
sequence from the residue 69 to 120 of SEQ ID NO: 73; and (f) a
NANBV capsid antigen having the amino acid sequence from the
residue 2 to 40 of SEQ ID NO: 73.
9. A method for detecting seroconversion associated with NANBV
infection at early times after infection and thereby reducing the
number of body fluid samples erroneously characterized as
non-reactive in the testing of human body fluid for NANBV hepatitis
antibody by employing for each body fluid sample, in a plurality of
said samples from different subjects, a method comprising: (a)
initiating an immunoreaction by contacting each said body fluid
sample with a pure and isolated NANBV capsid antigen and C-100-3
antigen; (b) maintaining said immunoreaction for a time period
sufficient for allowing antibodies against the NANBV capsid-C-100-3
antigens present in each body fluid sample to immunoreact with said
NANBV capsid and C-100-3 antigens to form an immunoreaction
product; and (c) detecting the presence of any of said
immunoreaction product formed and early seroconversion, thereby
reducing the number of body fluid samples in said plurality of
samples erroneously characterized as non-reactive.
Description
[0001] This is a continuation of pending application Ser. No.
12/077,046 filed Mar. 14, 2008 which is a continuation of pending
application on appeal Ser. No. 10/677,956 filed Oct. 1, 2003 which
is a divisional of application Ser. No. 08/931,855 filed Sep. 16,
1997, now U.S. Pat. No. 6,692,751 B1, which is a
continuation-in-part application of Ser. No. 08/563,733, filed Nov.
28, 1995, now abandoned, and of Ser. No. 08/272,271, filed Jul. 8,
1994, which is a continuation of Ser. No. 07/616,369, filed Nov.
21, 1990, abandoned, which is a continuation-in-part of Ser. No.
07/573,643, filed Aug. 27, 1990, abandoned; the disclosures of
which are incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to recombinant expression
vectors which have segments of deoxyribonucleic acid (DNA) that
encode recombinant HIV and HCV antigens operatively linked to the
sequence AGGAGGGTTTTTCAT (nucleotides 1 to 15 of SEQ ID NO:1) to
control expression of the antigens. These recombinant expression
vectors are transformed into host cells and used in a method to
express large quantities of these antigens. The invention also
provides compositions containing certain of the isolated antigens,
diagnostic systems containing these antigens and methods of
assaying body fluids to detect the presence of antibodies against
the antigens of the invention.
BACKGROUND OF THE INVENTION
[0003] The development of immunoassays for the detection of
antibodies has been limited by difficulties in producing sufficient
quantities of specific antigens that are essentially free of
immunoreactive contaminants. The presence of contaminants that
react with antibodies present in patient samples results in lower
assay specificity and sensitivity and an increase in false positive
results. The production of large amounts of antigen enables easier
purification of antigen having a higher degree of purity and thus
less immunoreactive contaminants.
[0004] The present invention overcomes the difficulties by
providing a simple and highly efficient expression system that
allows for the production of large quantities of antigens. The
invention relies on the efficient expression resulting from the
inclusion of the nucleotide sequence AGGAGGGTTTTTCAT (which
corresponds to nucleotides 1-15 of SEQ ID NO.:1) directly upstream
from the ATG codon which marks the start of translation.
[0005] The invention is particularly useful for the expression of
viral antigens of Human Immunodeficiency Virus (HIV) and Hepatitis
C Virus (HCV).
[0006] HIV is the causative agent of Acquired Immunodeficiency
Syndrome (AIDS). The nucleic acid sequence of the HIV proviral
genome has been deduced and the location of various protein coding
regions within the viral genome has been determined. Of particular
interest to the present invention are the portions of the HIV
genome known in the art as the gag and env regions. The gag region
encodes a precursor protein that is cleaved and processed into
three mature proteins, p17, p24 and p15. The HIV p24 protein has an
apparent relative molecular weight of about 24,000 daltons and is
known in the art as the HIV core antigen because it forms the viral
capsid. Also of interest is the env region which encodes the
envelope glycoproteins gp120 and gp41, which are required for viral
entry into the cell. The first step in infection is the formation
of a complex of gp120, gp41 and the cellular CD4 protein, binding
the virus particle to the cell. The formation of this complex
appears to alter the conformation of gp41, allowing its interaction
with a second cellular protein "fusin", an interaction required for
HIV entry into the cell.
[0007] The p24 antigen of HIV is of particular interest because
studies have indicated that the first evidence of anti-HIV antibody
formation (sero-conversion) in infected individuals is the
appearance of antibodies induced by the p24 antigen, i.e., anti-p24
antibodies. In addition, recent studies have reported that p24
protein can be detected in blood samples even before the detection
of anti p24 antibodies. Detecting the presence of either the p24
protein or anti-p24 antibodies therefore appears to be the best
approach to detecting HIV infection at the earliest point in time.
Furthermore, the p24 antigen reappears in the blood of infected
individuals concomitant with the decline of anti-p24 antibody in
patients showing the deterioration in their clinical condition that
accompanies transition into full-blown AIDS. Thus, the p24 antigen
can serve as an effective prognostic marker in patients undergoing
therapy.
[0008] Most cases of Non-A, non-B hepatitis (NANBH) are caused by
the transmissible virus now designated as hepatitis C virus (HCV).
Isolates of HCV nucleic acids have been obtained and completely
characterized at the sequence level. The HCV genome is comprised of
a plus strand RNA molecule that codes for a single polyprotein
which is cleaved to produce functionally distinct structural and
nonstructural HCV proteins. Structural proteins include the capsid
and envelope proteins which form the viral particle. Nonstructural
proteins, such as helicase and RNA-directed RNA polymerase are
required for viral function.
[0009] Some HCV gene products, or portions thereof have been
expressed as fusion products. The HCV antigen C-100-3, derived from
portions of the nonstructural genes designated NS3 and NS4, has
been expressed as a fusion protein and used to detect anti-C-100-3
antibodies in patients with various forms of NANB hepatitis. See,
for example, Kuo et al, Science, 244:362-364 (1989) and
International Application No. PCT/US88/04125. A diagnostic assay
based on C-100-3 antigen is commercially available from Ortho
Diagnostics, Inc. (Raritan, N.J.). However, the C-100-3
antigen-based immunoassay has been reported to preferentially
detect antibodies in sera from chronically infected patients.
C-100-3 seroconversion generally occurs from four to six months
after the onset of hepatitis, and in some cases C-100-3 fails to
detect any antibody where an NANBV infection is present. Alter et
al, New Eng. J. Med., 321:1538-39 (1989); Alter et al, New Eng. J.
Med., 321:1494-1500 (1989); and Weiner et al, Lancet, 335:1-3
(1990). McFarlane et al, Lancet, 335:754-757 (1990), described
false positive results when the C-100-3-based immunoassay was used
to measure antibodies in patients with autoimmune chronic active
hepatitis. In addition, Grey et al., Lancet, 335:609-610 (1990),
describe false positive results using C-100-3-based immunoassay on
sera from patients with liver disease caused-by a variety of
conditions other than HCV. Houghton et al., U.S. Pat. No.
5,350,671, have disclosed a series of fusion proteins which include
amino acids from parts of various structural and nonstructural HCV
gene products fused to superoxide dismutase (SOD), many of which
have no immunogenic activity when tested against HCV positive
antisera.
[0010] A NANBV immunoassay that could accurately detect
seroconversion at early times after infection, or that could
identify an acute NANBV infection, is not presently available.
[0011] The present invention provides compositions of recombinantly
produced HIV and HCV antigens, free of bacterial and other viral
components, thus enabling the detection of HIV and HCV antibodies
with improved accuracy and sensitivity. The present invention also
enables high yield expression of these antigens alone or as fusion
proteins.
SUMMARY OF THE INVENTION
[0012] The present invention is directed to recombinant expression
vectors which comprise a first nucleic acid having the sequence
AGGAGGGTTTTTCAT (which corresponds to nucleotides 1-15 of SEQ ID
NO.:1) operatively linked to a second nucleic acid having a
sequence encoding an HIV or HCV antigen.
[0013] The preferred vectors of the inventions are pGEX7
derivatives. The pGEX7 vector contains the first nucleic acid
sequence (AGGAGGGTTTTTCAT) which corresponds to nucleotides 1-15 of
SEQ ID NO: 1. Thus, the second nucleic acid encoding the HIV
antigen or HCV antigen is operatively linked to pGEX7-derived first
nucleic acid.
[0014] In addition to the recombinant expression vectors, the
present invention includes host cells comprising these vectors, the
recombinant HIV and HCV antigens produced by treating the host
cells of the invention for a time and under conditions to cause
expression of the antigen, the HIV and HCV antigens produced by
this method and compositions comprising a recombinantly-produced
HIV or HCV antigen of the invention. The compositions can be
essentially free of procaryotic antigens or other viral related
proteins of the respective antigens.
[0015] The HIV antigen of the invention comprises three domains
which are optionally joined by 1 to 5 linker amino acids. The first
domain has a nucleotide sequence which encodes amino acids 1-225 of
an HIV p24 antigen, the second domain has a nucleotide sequence
which encodes an HIV gp41 antigen (or antigenic fragment thereof),
and the third domain has a nucleotide sequence which encodes amino
acids 224-232 of an HIV p24 antigen. In preferred embodiments the
HIV antigen is encoded by amino acids 1-258 of SEQ ID NO:2, 4, or
6. These preferred HIV antigens are expressed from the vectors
pGEXp24gp41-ANT, pGEXp24gp41-MVP and pGEXp24gp41-X84328,
respectively.
[0016] The HCV antigens of the invention are the HCV capsid
antigen, the HCV non-structural 794 antigen and the HCV CAP-B
antigen. In preferred embodiments, the HCV capsid antigen is
encoded by amino acids 1-120 from an HCV strain, and more
preferably are encoded by amino acids 1-120 of SEQ ID NO:8, 10, 12
or 14. The preferred HCV capsid antigens are expressed from the
vectors pGEX-C120H-V68, pGEX-C120H, pGEX120H-IS02 and
pGEX-C120H-ISO3, respectively. In preferred embodiments the HCV
non-structural 794 antigen is encoded by the amino acids of SEQ ID
NO:16 or the corresponding sequence from another HCV strain. The
antigen of SEQ ID NO:16 is preferably expressed from pGEX-NS3-794.
The CAP-B antigen is encoded by the amino acids of SEQ ID NO:18 or
the corresponding sequence from another HCV strain. The antigen of
SEQ ID NO:18 is preferably expressed from pGEX-CAP-B.
[0017] Another aspect of the invention is directed to a diagnostic
kit comprising an amount of a HIV antigen or HCV antigen
composition of the invention sufficient to perform at least one
assay.
[0018] Yet another aspect of the invention provides a method of
assaying a body fluid sample for the presence of antibodies against
an HIV or HCV antigen which comprises: [0019] a) forming an
immunoreaction admixture by admixing the body fluid sample with a
composition of the invention; [0020] b) maintaining the
immunoreaction admixture for a time period sufficient for
antibodies present against the desired antigen to immunoreact with
the antigen and to form an immunoreaction product; and [0021] c)
detecting the presence of any immunoreaction product formed and
thereby the presence of the desired antibodies.
[0022] The method wherein said detecting step (c) can further
comprise the steps of: [0023] (i) admixing the immunoreaction
product with a labeled specific binding agent to form a labeling
admixture, wherein the labeled specific binding agent comprises a
specific binding agent and a label; [0024] (ii) maintaining the
labeling admixture for a time period sufficient for any
immunoreaction product present to bind with the labeled specific
binding agent to form a labeled product; and [0025] (iii) detecting
the presence of any labeled product formed, and thereby the
presence of the immunoreaction product.
[0026] In preferred embodiments, the specific binding agent can be
Protein A, anti-human IgG or anti-human IgM and the label can be
biotin, an enzyme, a lanthanide chelate or a radioactive
isotope.
[0027] Further still, another embodiment of the invention is
directed to a composition comprising the HCV capsid antigen of the
invention and the HCV nonstructural 794 antigen of the invention
which is essentially free of procaryotic antigens and other
HCV-related proteins. These compositions can be provided as
diagnostic kits and used in the methods of assaying a body fluid to
detect antibodies against an HCV capsid antigen or an HCV
non-structural antigen as described above.
[0028] The Hutchinson strain (Hutch) of non-A, non-B hepatitis
virus (NANBV) has been propagated through passage in animals and
portions of the virus have been cloned and sequenced. Sequence data
shows differences at both the nucleotide and amino acid level when
compared to any previously reported NANBV strains. See, for
comparison, Okamoto, et al., Japan J. Exp. Med., 60:163-177 (1990);
and International Application No. PCT/US88/04125.
[0029] The identified sequences have been shown herein to encode
structural proteins of NANBV. The NANBV structural proteins are
also shown herein to include antigenic epitopes useful for
diagnosis of antibodies immunoreactive with structural proteins of
NANBV, and for use in vaccines to include neutralizing antibodies
against NANBV.
[0030] The nucleotide sequence that codes for the amino terminal
polyprotein portion of the structural genes of the Hutch strain of
NANBV is contained in SEQ ID NO: 30. By comparison to putative
relatives of NANBV, namely to other NANBV isolates, to flavivirus,
and to pestivirus, the nucleotide sequence contained in SEQ ID NO:
30 is believed to encode structural proteins of NANBV, namely
capsid and portions of envelope.
[0031] The structural antigens described herein are present in the
putative capsid protein contained in SEQ ID NO: 73 from amino acid
residue positions 1-120, and are present in the amino terminal
portion of the putative envelope protein contained in SEQ ID NO: 73
from residue positions 121-326.
[0032] The present invention contemplates a DNA segment encoding a
NANBV structural protein that comprises a NANBV structural antigen,
preferably capsid antigen. A particularly preferred capsid antigen
includes an amino acid residue sequence represented by SEQ ID NO:
73 from residue 1 to residue 20, from residue 21 to residue 40,
from residue 2 to residue 40, or from residue 1 to residue 74, and
the DNA segment preferably includes the nucleotide base sequence
represented by SEQ ID NO: 30 from base position 1 to base position
60, from base position 61 to base position 120, from base position
4 to base position 120, or from base position 1 to base position
222, respectively.
[0033] Also contemplated is a recombinant DNA molecule comprising a
vector, preferably an expression vector, operatively linked to a
DNA segment of the present invention. A preferred recombinant DNA
molecule is pGEX-3X-690:691, pGEX-3X-690:694, pGEX-3X-693:691,
pGEX-3X-15:17, pGEX-3X-15:18, pGEX-2T-15:17, pGEX-2T-CAP-A,
pGEX-2T-CAP-B or pGEX-2T-CAP-A-B.
[0034] A NANBV structural protein is contemplated that comprises an
amino acid residue sequence that defines a NANBV structural
antigen, preferably a capsid antigen, and more preferably one that
includes the amino acid residue sequence contained in SEQ ID NO: 73
from residue 1 to residue 20, from residue 21 to residue 40, from
residue 2 to residue 40, or from residue 1 to residue 74. Fusion
proteins comprised of a NANBV structural protein of this invention
are also contemplated.
[0035] Further contemplated is a culture of cells transformed with
a recombinant DNA molecule of this invention and methods of
producing a NANBV structural protein of this invention using the
culture.
[0036] Also contemplated is a composition comprising NANBV
structural protein. The composition is preferably characterized as
being essentially free of (a) procaryotic antigens, and (b) other
NANBV-related proteins.
[0037] Still further contemplated is a diagnostic system in kit
form comprising, in an amount sufficient to perform at least one
assay, a NANBV structural protein composition of this invention, as
a separately packaged reagent.
[0038] In another embodiment, the present invention contemplates a
diagnostic system, in kit form, comprising a fusion protein of this
invention. Preferably, the diagnostic systems contains the fusion
protein affixed to a solid matrix.
[0039] Further contemplated is a method of assaying a body fluid
sample for the presence of antibodies against at least one of the
NANBV structural antigens described herein. The method comprises
forming an immunoreaction admixture by admixing (contacting) the
body fluid sample with a fusion protein of this invention. The
immunoreaction admixture is maintained for a time period sufficient
for any of the antibodies present to immunoreact with the fusion
protein to form an immunoreaction product, which product, when
detected, is indicative of the presence of anti-NANBV structural
protein antibodies. Preferably, the fusion protein is affixed to a
solid matrix when practicing the method.
[0040] In another embodiment, this invention contemplates a vaccine
comprising an immunologically effective amount of a NANBV
structural protein of this invention in a pharmaceutically
acceptable carrier. The vaccine is essentially free of (a)
procaryotic antigens, and (b) other NANBV-related proteins.
[0041] A prophylactic method for treating infection, which method
comprises administering a vaccine of the present invention, is also
contemplated.
BRIEF SUMMARY OF THE DRAWINGS
[0042] FIG. 1 illustrates the plasmid pGEXp24 for expressing
recombinant HIV p24 protein in E. coli. The recombinant DNAs
manipulated and produced by the construction process are indicated
in the figure by the circles. The construction proceeds by a series
of steps as indicated by the arrows connecting the circles in the
figure and as described in detail in Example 1. Landmark and
utilized restriction enzyme recognition sites are indicated on the
circles by labeled lines intersecting the circles. The relative
location of individual genes and their direction of transcription
are indicated by the labeled arrows inside the circles.
[0043] FIG. 2 illustrates the HIV p24-gp41 hybrid proteins obtained
after purification from induced bacterial cultures previously
transformed with pGEXp24gp41 of U.S. Pat. No. 5,470,720 or with
pGEXp24gp41-ANT, pGEXp24gp41-MVP or pGEXp24gp41-X84328 of the
present invention.
[0044] FIG. 3 illustrates the HCV 1-120 capsid antigen (strain
Hutch) with an amino acid substitution of valine for alanine at
residue 68 after purification from induced bacterial cultures
previously transformed with pGEX-C120H-V68 of the present
invention.
[0045] FIG. 4 illustrates the HCV NS3-794 antigen (strain Hutch)
after purification from induced bacterial cultures previously
transformed with pGEX7-NS3-794 of the present invention.
[0046] FIG. 5 illustrates ELISAs of serially diluted HIV positive
antiserum using polystyrene plates coated with (A) p24-gp41
recombinant protein of U.S. Pat. No. 5,470,720; (B) p24-gp41
Subtype O ANT recombinant protein; (C) p24-gp41 Subtype O MVP5180
recombinant protein; and (D) p24-gp41 Subtype O X84328 recombinant
protein.
[0047] FIG. 6 illustrates the immune reactivity in an ELISA of a
combination of the recombinant proteins of FIGS. 3 and 4 with the
well-characterized, commercially available Boston Biomedica PHV901
seroconverter serum from an individual who developed HCV
infection.
[0048] FIG. 7 illustrates the immune reactivity in an ELISA of a
combination of the recombinant proteins of FIGS. 3 and 4 with the
well-characterized, commercially available Boston Biomedica PHV902
seroconverter serum from an individual who developed HCV
infection.
[0049] FIG. 8 illustrates the immune reactivity in an ELISA of a
combination of the recombinant proteins of FIGS. 3 and 4 with the
well-characterized, commercially available Boston Biomedica PHV903
seroconverter serum from an individual who developed HCV
infection.
[0050] SEQ ID NO: 30 illustrates the nucleotide base sequence of a
preferred DNA segment of the present invention that encodes
portions of the structural proteins of the Hutch strain of NANBV.
The base sequences are shown conventionally from left to right and
in the direction of 5' terminus to 3' terminus using the single
letter nucleotide base code (A=adenine, T=thymine, C=cytosine and
G=guanine) with the position number of the first base residue in
each row indicated to the left of the row showing the nucleotide
base sequence.
[0051] The reading frame of the nucleotide sequence illustrated in
SEQ ID NO: 30 is indicated by placement of the deduced amino acid
residue sequence of the protein for which it codes below the
nucleotide sequence such that the triple letter code for each amino
acid residue (Table of Correspondence) is located directly below
the three bases (codon) coding for each residue. The residue
sequence is shown conventionally from left to right and in the
direction of amino terminus to carboxy terminus. The position
number for the last amino acid residue in each row is indicated to
the right of the row showing the amino acid residue sequence.
[0052] SEQ ID NO: 74 illustrates the structure of a preferred
fusion protein comprised of an amino-terminal polypeptide portion
corresponding to residues 1-221 of glutathione-S-transferase, an
intermediate polypeptide portion corresponding to residues 222-225
and defining a cleavage site for the protease Factor Xa, a linker
portion corresponding to residues 226-234, a carboxy-terminal
polypeptide portion corresponding to residues 235-308 defining a
NANBV capsid antigen that has the amino acid residue sequence 1 to
74 of SEQ ID NO: 73, and a carboxy-terminal linker portion
corresponding to residues 309-315. SEQ ID NO: 31 also illustrates
the nucleotide base sequence of a DNA segment that encodes the
fusion protein illustrated therein. The nomenclature and
presentation of sequence information is as described in SEQ ID NO:
30.
DETAILED DESCRIPTION OF THE INVENTION
A. Definitions
[0053] Amino acid: All amino acid residues identified herein are in
the natural L-configuration. All abbreviations for amino acid
residues are in keeping with the standard polypeptide nomenclature,
J. Biol. Chem. 243: 3557-3559 (1969). It should be noted that all
amino acid residue sequences, typically referred to herein as
"residue sequences" are represented herein by formulae whose left
to right orientation is in the conventional direction of amino
terminus to carboxy-terminus.
[0054] Nucleotide: a monomeric unit of DNA or RNA consisting of a
sugar moiety (pentose) a phosphate and a nitrogenous heterocyclic
base. The base is linked to the sugar moiety via the glycoside
carbon (1' carbon of the pentose) and that combination of base and
sugar is a nucleoside. When the nucleoside contains a phosphate
group bonded to the 3' or 5' position of the pentose, it is
referred to as a nucleotide. A sequence of operatively linked
nucleotides is typically referred to herein as a "base sequence"
and it is represented herein by the formula whose left to right
orientation is in the conventional direction of 5' terminus to 3'
terminus.
[0055] Base pair (bp): a partnership of adenine (A) with thymine
(T), or of cytosine (C) with guanine (G) in a double stranded DNA
molecule.
[0056] Antigen: a protein or polypeptide portion thereof which is
immunologically identifiable. By immunologically identifiable is
meant that the protein or polypeptide reacts specifically with
naturally occurring or synthetically derived antibodies to form a
complex of bound antibody and antigen.
[0057] Operatively linked: the juxtaposition of sequence elements,
regulatory elements, control sequences and the like with coding
sequences for a gene product, wherein the elements so described are
joined to one another in a relationship permitting them to function
in their intended manner, e.g. to control expression. A control
sequence operatively linked to a coding sequence is spatially
joined in such a way that expression of the coding sequence is
achieved under conditions compatible with the control sequences. A
second coding sequence may be operatively linked to an expressed
first coding sequence such that the regulatory elements and control
sequences of the first coding region govern expression of the
second coding sequence as well. In the present invention,
operatively linked coding sequences are juxtaposed such that a
single expression product is produced which comprises regions from
each of the coding sequences.
[0058] HIV antigen: As referred to in the current invention, HIV
antigen means an HIV p24gp41 hybrid protein which comprises an
amino sequence from gp41 flanked on its amino terminus by amino
acids 1-225 of a HIV p24 protein and on its carboxy terminus by
amino acids 224-232 of a HIV p24 protein. In some instances, the
sequences of each protein domain can be joined by 1-5 linker amino
acids. Exemplary antigens are expressed by plasmids
pGEXp24gp41-ANT, pGEXp24gp41-MVP or pGEXp24gp41-X84328 of the
present invention.
[0059] HCV antigen: As referred to herein, HCV antigen means an HCV
CAP-B antigen, an HCV 1-120 capsid antigen or an HCV nonstructural
794 antigen. A nonstructural antigen, in the context of HCV means
an antigen not derived from capsid or envelope proteins. An HCV
CAP-B antigen consists of amino acid residues 1-220 of
glutathione-S-transferase, an intermediate polypeptide portion
corresponding to residues 221-226 and defining a cleavage site for
the protease Thrombin, a polypeptide portion corresponding to
residues 227-246 and defining residues 21-40 of an HCV capsid
antigen (exemplified by GenBank accession no. M67463) and with or
without a carboxy-terminal tail corresponding to residues 247-252.
An HCV 1-120 capsid antigen consists of amino acid residues 1 to
120 of an HCV polyprotein. Herein exemplified are an HCV 1-120
capsid antigen derived from HCV strain Hutch and three homologues
with various amino acid substitutions. An HCV nonstructural 794
antigen consists of amino acid residues 1-10 having six histidine
residues at positions 4 to 9, a nonstructural NS3 antigen of HCV
strain Hutch from residue 11 to residue 115 and a six residue tail.
The nonstructural NS3 antigen disclose herein corresponds to amino
acid residues 1352 to 1456 of the amino acid sequence disclosed in
GenBank accession no. 130461. Examples of HCV antigens are encoded
by plasmids pGEX-C120H-V68, pGEX-C120H, pGEX-C120H-ISO2,
pGEX-C120H-ISO3, pGEX-NS3-794 and pGEX-CAP-B1 of the current
invention.
B. Recombinant DNA Molecules
[0060] In living organisms, the amino acid residue sequence of a
protein or polypeptide is directly related via the genetic code to
the DNA sequence of the structural gene that codes for the protein.
Thus, a structural gene can be defined in terms of the amino acid
residue sequence, i.e., protein or polypeptide for which it
codes.
[0061] An important and well known feature of the genetic code is
its redundancy. That is, for most of the amino acids used to make
proteins, more than one coding nucleotide triplet (codon) can code
for or designate a particular amino acid residue. Therefore, a
number of different nucleotide sequences may code for a particular
amino acid residue sequence. Occasionally, a methylated variant of
a purine or pyrimidine may be incorporated into a given nucleotide
sequence. However, such methylations do not affect the coding
relationship in any way.
[0062] DNA sequences have other functions as well. Expression of a
gene product, i.e. transcription of DNA sequences into ribonucleic
acid (RNA) sequences and translation of messenger RNA (mRNA) into
sequences of amino acids, depends on DNA nucleotide sequences in
addition to those which actually encode the amino acid sequence of
interest.
[0063] A DNA segment of the present invention comprises a first
nucleotide base sequence that defines a ribosome binding site and
has a sequence by the formula:
TABLE-US-00001 AGGAGGGTTTTTCAT (which corresponds to nucleotides
1-15 of SEQ ID NO.:1).
The first sequence is joined at its 3' terminus to the 5' terminus
of a second nucleotide base sequence that defines the structural
gene product of interest. Structural gene products may include
natural proteins, polypeptides, fusion proteins and proteins to
which additional sequences of amino acids with specific functions
have been added. Preferred DNA segments are illustrated in SEQ ID
NO: 1, 3, 5, 7, 9, 11, 13, 15 and 17 and further include the base
sequence TAA or similar sequences representing one or several stop
signals, operatively linked to the 3' terminus of the structural
gene. The base sequences are shown conventionally from left to
right and in the direction of 5' terminus to 3' terminus of the
coding sequence using the single letter nucleotide base code
(A=Adenine, T=Thymine, C=Cytosine and G=Guanine). Nucleotide bases
1-4 represent the Shine Delgarno sequence (Shine et al. Proc. Natl.
Acad. Sci. USA Natl. Acad. Sci. USA Natl Acad. Sci. USA 71:1342
(1974)). Bases 1-15 of the above listed sequences define the 15
bases AGGAGGGTTTTTCAT (corresponding to nucleotides 1-15 of SEQ ID
NO:1) immediately preceding the nucleotide sequence encoding the
antigen of interest, said 15 bases positioned immediately upstream
of the polylinker cloning site of the ATCC deposited vector pGEX7
referred to herein. The amino acid sequences of the products
expressed from the preferred DNA segments are given by SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16 and 18.
[0064] In one embodiment of this invention, a DNA segment has the
nucleotide sequence AGGAGGGTTTTTCAT (which corresponds to
nucleotides 1-15 of SEQ ID NO:1) joined to a nucleotide base
sequence that defines an HIV antigen such as an HIV p24-gp41 hybrid
protein. The phrase "HIV p24-gp41 hybrid protein" refers to a
protein having an amino-terminal HIV p24 polypeptide portion joined
by a peptide bond at its carboxy-terminus to an HIV gp41
polypeptide portion followed by another HIV p24 polypeptide
portion. In the expressed protein, the first HIV p24 polypeptide
portion has an amino acid residue sequence corresponding to residue
2 to residue 225 from one of the sequences shown in SEQ ID NO:2, 4
or 6. The second HIV p24 polypeptide portion has an amino acid
sequence corresponding to residues 224 to 232 of an HIV p24
protein, which correspond to residues 250 to 258 of SEQ ID NOS:2, 4
and 6 for the expressed HIV p24-gp41 hybrid protein.
[0065] The HIV gp41 polypeptide portion has an amino acid residue
sequence corresponding to a polypeptide capable of immunoreacting
with anti-HIV gp41 antibodies, i.e., a polypeptide displaying HIV
gp41 antigenicity (an HIV gp41-antigenic polypeptide). Polypeptides
displaying HIV gp41 antigenicity are well known in the art. See,
for example, the U.S. Pat. No. 4,629,783 to Cosand, U.S. Pat. No.
4,735,896 to Wang et al., and Kennedy et al., Science,
231:1556-1559 (1986).
[0066] In preferred embodiments, the HIV gp41 polypeptide portion
of the HIV p24-gp41 fusion protein of this invention contains at
least 10 amino acid residues, but no more than about 35 amino acid
residues, and preferably has a length of about 15 to about 30
residues. A preferred HIV gp41 polypeptide portion of a HIV
p24-gp41 hybrid protein has an amino acid residue sequence
represented by residue 227 to residue 249 shown in SEQ ID NO:2, by
residue 227 to residue 249 shown in SEQ ID NO:4 or by residue 227
to residue 249 shown in SEQ ID NO:6.
[0067] In preferred embodiments, that portion of a HIV p24-gp41
hybrid protein encoding DNA segment of this invention that codes
for the first HIV p24 polypeptide portion has a nucleotide base
sequence corresponding to a sequence that codes for an amino acid
residue sequence as shown in SEQ ID NOS:2, 4 and 6 from residue 1
to about residue 225, and more preferably has a nucleotide base
sequence corresponding to a base sequence as shown in SEQ ID NOS:1,
3 and 5 from base 16 to base 690.
[0068] In preferred embodiments, that portion of a HIV p24-gp41
hybrid protein encoding DNA segment of this invention that codes
for the HIV gp41 polypeptide portion has a nucleotide base sequence
corresponding to a sequence that codes for an amino acid residue
sequence as shown in SEQ ID NO:2 from residue 227 to residue 249,
in SEQ ID NO:4 from residue 227 to residue 249, or in SEQ ID NO:6
from residue 227 to residue 249. More preferably that portion of
the DNA segment coding for the HIV gp41 polypeptide portion has a
nucleotide base segment corresponding in base sequence to the
sequence shown in SEQ NO:1 from base 694 to base 762, in SEQ ID
NO:3 from base 694 to base 762, or in SEQ ID NO:5 from base 694 to
base 762.
[0069] In preferred embodiments, that portion of a HIV p24-gp41
hybrid protein encoding DNA segment of this invention that codes
for the second HIV p24 polypeptide portion has a nucleotide base
sequence corresponding to a sequence that codes for an amino acid
sequence as shown in SEQ ID NOS:2, 4 and 6 from residue 250 to 258,
and more preferably has a nucleotide base sequence corresponding to
a base sequence as shown in SEQ ID NOS1, 3 and 5 from base 763 to
base 789.
[0070] Several HIV Type I, subtype O conserved sequences are well
known. (see, e.g., Cohen et al. Lancet, 345 p. 856, 1995, or
GenBank Accession # X84328). In a particularly preferred
embodiment, recombinant HIV p24-gp41 fusion protein is identified
by SEQ ID NO:2 and contains an amino terminal p24 polypeptide
portion (residues 2-225) followed by a Lys residue as linker amino
acid to an intermediate, a type 0 (strain ANT) specific HIV
envelope portion (residues 227-247), and a carboxy terminal HIV p24
polypeptide portion (residues 250-258).
[0071] A second particularly preferred recombinant HIV p24-gp41
hybrid protein is identified by SEQ ID NO:4, wherein residues
227-249 correspond to a type 0 specific HIV envelope portion of
strain MVP. A third particularly preferred recombinant HIV p24-gp41
hybrid protein is identified by SEQ ID NO:6. In this hybrid
protein, the intermediate linker amino acid residue at position 226
is Gln and residues 227-249 correspond to a type 0 specific HIV
envelope portion of strain GenBank X84328.
[0072] Most preferably, a HIV p24-gp41 hybrid protein encoding DNA
segment of this invention has a nucleotide base sequence
corresponding to the sequence shown in SEQ ID NO:1 from base 1 to
base 795, in SEQ ID NO:3 from base 1 to base 795, or in SEQ ID NO:5
from base 1 to base 795.
[0073] In another embodiment of this invention, the nucleotide
sequence AGGAGGGTTTTTCAT (which corresponds to nucleotides 1-15 of
SEQ ID NO: 1) is joined to a nucleotide base sequence that defines
the HCV antigen which is an HCV CAP-B fusion protein. The phrase
"CAP-B" refers to a recombinant protein having a first
glutathione-S-transferase (GST) polypeptide portion joined by a
peptide bond at its carboxy terminus to a second intermediate
polypeptide portion defining a cleavage site for Thrombin, said
second portion joined by a peptide bond at its carboxy terminus to
a third polypeptide portion defining an HCV capsid antigen
consisting of amino acids 21-40 of an HCV capsid protein and a six
residue tail.
[0074] The GST portion of a recombinant CAP-B antigen has an amino
acid residue sequence corresponding to a sequence as shown in SEQ
ID NO:18 from residue 2 to about residue 220, the amino terminal
methionine being cleaved after translation. An intermediate
polypeptide portion defining a thrombin cleavage site has the amino
acid sequence shown in SEQ ID NO:18 from residue 221 to residue
226.
[0075] SEQ ID NO:18 illustrates the amino acid sequence of a
particularly preferred recombinant CAP-B fusion protein wherein
amino acids 1-220 are from GST, residues 221-226 are a cleavage
site for protease Thrombin, residues 227 to 246 are from the HCV
capsid antigen with the amino acid sequence of residues 21-40 from
GenBank accession no. M67463 (strain Hutch) and residues 247 to 252
are a carboxy terminal tail.
[0076] In preferred embodiments, that portion of a CAP-B protein
encoding DNA segment of this invention that codes for the GST
portion has a nucleotide base sequence corresponding to a sequence
that codes for an amino acid residue sequence as shown in SEQ ID
NO:18 from about residue 1 to about residue 220 and more preferably
has a nucleotide base sequence corresponding to a base sequence as
shown in SEQ ID NO:17 from base 16 to base 675.
[0077] In preferred embodiments, that portion of a CAP-B protein
encoding DNA segment of this invention that codes for the
intermediate polypeptide portion defining a thrombin cleavage site
has a nucleotide base sequence corresponding to a sequence that
codes for an amino acid residue sequence as shown in SEQ ID NO:18
from residue 221 to residue 226 and more preferably has a
nucleotide base sequence corresponding to a base sequence as shown
in SEQ ID NO:17 from base 676 to base 693.
[0078] In preferred embodiments, that portion of a CAP-B protein
encoding DNA segment of this invention that codes for the HCV 2140
capsid portion has a nucleotide base sequence corresponding to a
sequence that codes for an amino acid residue sequence as shown in
SEQ ID NO:18 from residue 227 to residue 246 and more preferably
has a nucleotide base sequence corresponding to a base sequence
shown in SEQ ID NO:17 from base 694 to base 753.
[0079] In a particularly preferred embodiment, the CAP-B protein
encoding DNA segment codes for an amino acid residue sequence as
shown in SEQ ID NO:18 from residue 1 to residue 252. Most
preferably, a CAP-B protein encoding DNA segment of this invention
has a nucleotide base sequence corresponding to the sequence
disclosed by SEQ ID NO:17 from base 1 to base 774, and consists of
a ribosome binding site, coding sequence and a stop codon for
expression of the HCV strain Hutch CAP-B antigen.
[0080] This invention is further embodied by a DNA segment with the
nucleotide sequence AGGAGGGTTTTTCAT (which corresponds to
nucleotides 1 to 15 of SEQ ID NO: 1) joined to a nucleotide base
sequence that defines the HCV antigen which is an HCV 1-120 capsid
antigen. The phrase "capsid antigen" refers to a recombinant
protein consisting of amino acids 1-120 of HCV. Preferably, the
capsid protein is immunologically related to the Hutch strain of
HCV (amino acid sequence 1-120 of GenBank accession no.
M67463).
[0081] A preferred recombinant HCV capsid antigen is illustrated by
SEQ ID NO:8 which represents the structural polypeptide of HCV
strain Hutch (amino acid residues 1-120) exhibiting a substitution
from Alanine to Valine at amino acid residue 68. Another preferred
recombinant HCV capsid antigen is illustrated by SEQ ID NO:10 which
represents the structural polypeptide of HCV strain Hutch. A third
recombinant HCV capsid antigen is illustrated by SEQ ID NO:12 which
represents the structural polypeptide of HCV having the amino acid
sequence of strain Hutch except wherein amino acid residues 68 to
81 have been substituted by amino acid residues 68 to 81 of the
capsid antigen of an HCV genotype 2 isolate. A fourth recombinant
HCV capsid antigen is illustrated by SEQ ID NO:14 which represents
the structural polypeptide of HCV having the amino acid sequence of
strain Hutch except wherein amino acid residues 68 to 81 have been
substituted by amino acid residues 68 to 81 of the capsid antigen
of an HCV genotype 3 isolate.
[0082] Most preferably, DNA segments of this invention which
express preferred HCV 1-120 capsid antigens as illustrated in SEQ
ID NOS: 8, 10, 12, and 14 have nucleotide sequences represented by
SEQ ID NOS:7, 9, 11, and 13 (nucleotides 1 to 378) respectively.
Represented in each DNA sequence are the ribosome binding site,
coding sequence and stop codon. Nucleotides 212 and 259 are the
start of 6 nucleotide recognition sites for the Styl restriction
endonuclease.
[0083] In a final exemplary embodiment, a DNA segment comprises a
nucleotide base sequence that defines an HCV antigen which is a
recombinant HCV nonstructural 794 antigen. As exemplified herein,
"794 antigen" refers to a recombinant protein with the amino acid
sequence set forth in SEQ ID NO:16, which consists of a first 10
amino acid polypeptide region containing a hexahistidine tag (six
histidine residues) from amino acid residue 4 to 9, joined by a
peptide bond at its carboxy terminus to an NS3 nonstructural
antigen (residues 11-115) and a 6 amino acid tail (residues 116 to
121). By NS3 is meant the mature helicase protein of HCV which in
strain Hutch corresponds to amino acid residues 1007 to 1615 of the
HCV polyprotein. A preferred HCV NS3 nonstructural antigen has the
amino acid residue sequence shown in SEQ ID NO:16 from residue 11
to residue 115, which is that of the Hutch strain of HCV (amino
acid sequence 1352-1456 of GenBank accession no. M67463).
[0084] The hexahistidine sequence present within the first 10 amino
acid sequences exemplifies a "Tag" polypeptide designed to
facilitate the purification of the composite synthesis product.
Following induction and breakage of cells containing vector
encoding a protein with a hexahistidine "Tag", the protein of
interest can be isolated by metal chelate affinity chromatography
in accordance with well established procedures (see, e.g. Porath et
al. Nature, 258 p. 598 (1975)).
[0085] In a preferred embodiment, that portion of a recombinant HCV
nonstructural 794 antigen encoding DNA segment of this invention
that codes for the HCV nonstructural portion has a nucleotide base
sequence corresponding to a sequence that codes for an amino acid
residue sequence as shown in SEQ ID NO:16 from residue 11 to
residue 115 and more preferably has a nucleotide base sequence
corresponding to a base sequence shown in SEQ ID NO:15 from base 46
to base 360.
[0086] In a more preferred embodiment, a recombinant HCV
nonstructural 794 antigen encoding DNA segment codes for an amino
acid residue sequence as shown in SEQ ID NO:16 from residue 1 to
residue 121. Most preferably, a recombinant HCV nonstructural 794
antigen encoding DNA segment of this invention has a nucleotide
base sequence corresponding to the sequence shown in SEQ ID NO:15
from base 1 to base 381.
[0087] In preferred embodiments, a DNA segment of the present
invention includes its complimentary DNA segment and is preferably
bound thereto, thereby forming a double stranded DNA segment. In
addition, it should be noted that a double stranded DNA segment of
this invention can have a single stranded cohesive tail at one or
both of its termini.
[0088] A DNA segment of the present invention can easily be
prepared from isolated viruses or other sources by the polymerase
chain reaction (PCR) or synthesized by chemical techniques, for
example, the phosphotriester method of Matteucci et al. J. Am.
Chem. Soc., 103:3185 (1981). (the disclosures of the art cited
herein are incorporated herein by reference). Of course, by
chemically synthesizing the DNA, any desired modification can be
made simply by substituting the appropriate bases for those
encoding the native amino acid sequence.
[0089] The present invention further contemplates a recombinant DNA
(rDNA) that includes a DNA segment of the present invention
operatively linked to a vector. A preferred rDNA of the present
invention is characterized as being capable of directly expressing,
in a compatible host, the gene product of interest. By "directly
expressing" it is meant that the mature polypeptide chain of the
protein is formed by translation alone as opposed to proteolytic
cleavage of two or more terminal amino acid residues from a larger
translated precursor protein. Preferred rDNAs of the present
invention are derivatives of the pGEX7 expression vector containing
the DNA segments of the invention.
[0090] As used herein, the term "vector" refers to a DNA molecule
capable of autonomous replication in a cell and to which another
DNA segment can be operatively linked so as to bring about
replication or expression of the attached segment. Typical vectors
are plasmids, bacteriophage and the like. Vectors capable of
directing the expression of a DNA segment of the invention are
referred to herein as "expression vectors". Thus, a recombinant DNA
molecule (rDNA) is a hybrid DNA molecule comprising at least two
nucleotide sequences not normally found together in nature. A
vector contemplated by the present invention is also least capable
of directing replication, and includes a procaryotic replicbn
(ori), i.e., a DNA sequence having the ability to direct autonomous
replication and maintenance of the recombinant DNA molecule
extrachromosomally in a procaryotic host cell, such as a bacterial
host cell, transformed therewith. Such replicons are well known in
the art. In addition, those embodiments that include a procaryotic
replicon also typically include a gene whose expression confers
drug resistance to a bacterial host transformed therewith. Typical
bacterial drug resistance genes for use in these vectors are those
that confer resistance to ampicillin or tetracycline. Preferred
vectors of the present invention also include a procaryotic
promoter capable of directing the expression (transcription and
translation) of the gene encoding the HIV or HCV antigen or fusion
protein in a bacterial host cell, such as E. coli, transformed
therewith. A promoter is an expression control element formed by a
DNA sequence that permits binding of RNA polymerase and
transcription to occur. Promoter sequences compatible with
bacterial hosts are typically provided in plasmid vectors
containing convenient restriction sites for insertion of a DNA
segment of the present invention. A typical vector is pPL-lambda
available from Pharmacia (Piscataway, N.J.).
[0091] Although the expression vector pGEX7 has been used as
exemplary in producing the proteins described herein, other
functionally equivalent expression vectors can be used.
Functionally equivalent vectors have the sequence AGGAGGGTTTTTCAT
(which corresponds to nucleotides 1 to 15 of SEQ ID NO: 1) to which
coding sequences of interest may be joined, and contain an
expression promoter that is inducible by any number of methods such
as by temperature shift or by addition of IPTG.
[0092] A variety of methods have been developed to operatively link
DNA segments to vectors via compatible termini. General recombinant
DNA technologies are comprehensively described in a plethora of
publications, and for experimental protocols, attention is drawn to
the treatise by Maniatis et al. (Molecular Cloning: A Laboratory
Manual 2nd edition, Cold Spring Harbor Press (1989)), which is
incorporated herein by reference.
[0093] Synthetic linkers containing one or more restriction sites
provide an alternative method of joining the DNA segments to
vectors. The DNA segment, generated by endonuclease digestion or,
by some alternate procedure such as primer-directed synthesis via
techniques such by PCR (see, e.g., supra or, more specialized
monographs such as M. J. McPherson, P. Quirke and G. R. Taylor
(Eds), "PCR. A Practical Approach", IRL Press at Oxford University
press, Oxford, UK, (1991)) is treated with bacteriophage T4 DNA
polymerase or E. coli DNA polymerase I, enzymes that remove
protruding 3' single stranded termini with the 3'-5' exonucleolytic
activities and fill in recessed 3' ends with their polymerizing
activities. The combination of these activities therefore generate
blunt-ended DNA segments. The blunted segments are then incubated
with a large molar excess of linker molecules in the presence of an
enzyme that is able to catalyze the ligation of blunt-ended DNA
segments, such as the bacteriophage T4 DNA ligase. Thus, the
products of the reaction are DNA segments carrying polymeric linker
sequences at their ends. These DNA segments are then cleaved with
the appropriate restriction enzyme and ligated to an expression
vector that has been cleaved with an enzyme that produces termini
compatible with those of the DNA segment. Synthetic linkers
containing a variety of restriction endonuclease sites, as well as
the restriction endonucleases themselves are commercially available
from a number of sources including New England Biolabs (Boston,
Mass.).
[0094] Also contemplated by the present invention are RNA
equivalents of the above described recombinant DNA molecules.
C. Transformed Cells and Cultures
[0095] The present invention also relates to a procaryotic host
cell transformed with a recombinant DNA molecule of the present
invention, preferably an rDNA capable of expressing a recombinant
HIV p24-gp41 fusion protein, a recombinant HCV 1-120 capsid
protein, a recombinant HCV CAP-B protein or a recombinant HCV
nonstructural antigen 794. Bacterial cells are preferred
procaryotic host cells and typically are a strain of E. coli, such
as, for example, the E. coli strain W3110 or the strain DH5
available from Bethesda Research Laboratories, Inc., Bethesda, Md.
Transformation of appropriate cell hosts with a recombinant DNA
molecule of the present invention is accomplished by well known
methods that typically depend on the type of vector used. With
regard to transformation of procaryotic host cells, see, for
example, Cohen et al., Proc. Natl. Acad. Sci. USA, 69:2110 (1972);
and Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982).
Successfully transformed cells, i.e., cells that contain a
recombinant DNA molecule of the present invention, can be
identified by well known techniques. For example, cells resulting
from the introduction of an rDNA of the present invention can be
cloned to produce monoclonal colonies. Cells from those colonies
can be harvested, lysed and their DNA content examined for the
presence of the rDNA using a method such as that described by
Southern, J. Mol. Biol., 98:503 (1975) or Berent et al., Biotech.,
3:208 (1985). In addition to directly assaying for the presence of
rDNA, successful transformation can be confirmed by well known
immunological methods when the rDNA is capable of directing the
expression of a protein from the inserted gene of interest. Samples
of cells suspected of being transformed are harvested and assayed
for the presence of the encoded HIV or HCV antigen using antibodies
specific for the particular antigen of interest. Such antibodies
are well known in the art. Thus, in addition to the transformed
host cells themselves, the present invention also contemplates a
culture of those cells. Nutrient media useful for culturing
transformed host cells are well known in the art and can be
obtained from several commercial sources.
D. Methods for Producing Recombinant Proteins and Compositions
Containing Same
[0096] Another aspect of the present invention pertains to a method
for producing the HIV and HCV antigens of this invention, more
preferably an HIV p24-gp41 fusion protein, an HCV CAP-B protein, an
HCV 1-120 capsid protein or an HCV nonstructural antigen 794. The
present method entails initiating a culture comprising a nutrient
medium containing host cells transformed with a recombinant DNA
molecule of the present invention. The culture is maintained for a
time period sufficient for the transformed cells to express the HIV
or HCV antigen. The expressed protein is then recovered from the
culture. However, as is well known in the art, the expressed
protein recovered may or may not contain the amino-terminal
methionine residue present on the initial translation product
depending on cellular processing mechanisms. Methods for recovering
an expressed protein from a culture are well known in the art and
include fractionation of the protein-containing portion of the
culture using well known biochemical techniques. For instance, the
methods of gel filtration, gel chromatography, ultrafiltration,
electrophoresis, ion exchange, affinity chromatography and the
like, such as are known for protein fractionation, can be used to
isolate the expressed proteins found in the culture. In addition,
immunochemical methods, such as immunoaffinity, immunoadsorption
and the like can be performed using well known methods.
E. Recombinant Protein Compositions
[0097] In another embodiment, the present invention contemplates a
composition containing an HIV or HCV antigen of the invention,
including e.g., an HIV p24-gp41 fusion protein, an HCV CAP-B
protein, an HCV 1-120 capsid protein or an HCV nonstructural 794
antigen encoded by the DNA segments of the invention or
combinations thereof that is essentially free of both procaryotic
antigens (i.e. host cell-specific antigens) and other HIV- or
HCV-related proteins. By "essentially free" is meant that the ratio
of desired HIV or HCV proteins, alone or in combination, to either
procaryotic antigen or other HIV- or HCV-related proteins is at
least 100:1, and preferably is 1,000:1.
[0098] The presence and amount of contaminating protein in a
recombinant protein preparation can be determined by well known
methods. For example, a sample of the composition is subjected to
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) to separate the recombinant protein from any protein
contaminants present. The ratio of the amounts of the proteins
present in the sample is then determined by densitometric soft
laser scanning, as is well known in the art. See Guilian et al.,
Anal. Biochem., 129:277-287 (1983).
[0099] In another embodiment of the invention, the HIV or HCV
antigen of the invention is in non-reduced form, i.e.,
substantially free of sulfhydryl groups because of Cys-Cys bonding
that can occur in those antigens having cysteine residues.
G. Diagnostic Systems
[0100] A diagnostic system in kit form of the present invention
includes, in an amount sufficient for at least one assay, a
composition comprising a HIV or HCV antigen of the current
invention as a separately packaged reagent. Instructions for use of
the packaged reagent are also typically included. "Instructions for
use" typically include a tangible expression describing the reagent
concentration or at least one assay method parameter such as the
relative amounts of reagent and sample to be admixed, maintenance
time periods for reagent/sample admixtures, temperature, buffer
conditions and the like.
[0101] In preferred embodiments, the diagnostic system of the
present invention further includes a label or indicating means
capable of signaling the formation of a complex containing a
recombinant antigen. As used herein, the terms "label" and
"indicating means" in their various grammatical forms refer to
single atoms and molecules that are either directly or indirectly
involved in the production of a detectable signal to indicate the
presence of a complex. Any label or indicating means can be linked
to or incorporated in an expressed protein or polypeptide, or used
separately, and those atoms or molecules can be used alone or in
conjunction with additional reagents. Such labels are themselves
well-known in clinical diagnostic chemistry and constitute a part
of this invention only insofar as they are utilized with otherwise
novel proteins methods and/or systems.
[0102] The linking of labels, i.e., labeling of, polypeptides and
proteins is well known in the art. For instance, antibody molecules
produced by a hybridoma can be labeled by metabolic incorporation
of radioisotope-containing amino acids provided as a component in
the culture medium. See, for example, Galfre et al., Meth.
Enzymol., 73:3-46 (1981). The techniques of protein conjugation or
coupling through activated functional groups are particularly
applicable. See, for example, Avrameas, et al., Scand. J. Immunol.,
Vol. 8 Suppl. 7:7-23 (1978), Rodwell et al., Biotech., 3:889-894
(1984), and U.S. Pat. No. 4,493,795.
[0103] The diagnostic systems can also include, preferably as a
separate package, a specific binding agent. A "specific binding
agent" is a molecular entity capable of selectively binding a
reagent species of the present invention but is not itself a
protein expression product of the present invention. Exemplary
specific binding agents are antibody molecules, complement proteins
or fragments thereof, protein A, immobilized metal ion chelates,
immobilized glutathione and the like. Preferably the specific
binding agent can bind the recombinant antigen when the antigen is
present as part of a complex.
[0104] In preferred embodiments the specific binding agent is
labeled. However, when the diagnostic system includes a specific
binding agent that is not labeled, the agent is typically used as
an amplifying means or reagent. In these embodiments, the labeled
specific binding agent is capable of specifically binding the
amplifying means when the amplifying means is bound to a reagent
species-containing complex.
[0105] The diagnostic kits of the present invention can be used in
an "ELISA" format to detect the presence or quantity of antibodies
in a body fluid sample such as serum, plasma or saliva that react
with any of the antigens of the present invention. "ELISA" refers
to an enzyme-linked immunosorbent assay that employs an antibody or
antigen bound to a solid phase and an enzyme-antigen or
enzyme-antibody conjugate to detect and quantify the amount of an
antigen or antibody present in a sample. A description of the ELISA
technique is found in Chapter 22 of the 4th Edition of Basic and
Clinical Immunology by D. P. Sites et al., published by Lange
Medical Publications of Los Altos, Calif. in 1982 and in U.S. Pat.
Nos. 3,654,090; 3,850,752; and 4,016,043, which are all
incorporated herein by reference.
[0106] In preferred embodiments, an HIV or HCV antigen of the
present invention can be affixed to or coated on a solid matrix to
form a solid support that is separately packaged in the subject
diagnostic systems. The antigen is typically affixed to the solid
matrix by adsorption from an aqueous medium although other modes of
affixation, well known to those skilled in the art can be used.
Useful solid matrices are well known in the art. Such materials
include the cross-linked dextran available under the trademark
SEPHADEX from Pharmacia Fine Chemicals (Piscataway, N.J.); agarose;
beads of polystyrene about 1 micron to about 5 millimeters in
diameter available from Abbott Laboratories of North Chicago, Ill.;
polyvinyl chloride, polystyrene, cross-linked polyacrylamide,
nitrocellulose- or nylon-based webs such as sheets, strips or
paddles; or tubes, plates or the wells of a microtiter plate such
as those made from polystyrene or polyvinylchloride.
[0107] The HIV or HCV antigen, labeled specific binding agent or
amplifying reagent of any diagnostic system described herein can be
provided in solution, as a liquid dispersion or as a substantially
dry format, e.g., in lyophilized form. Where the indicating means
is an enzyme, the enzyme's substrate can also be provided in a
separate package of a system. A solid support such as the
before-described microtiter plate and one or more buffers can also
be included as separately packaged elements in this diagnostic
assay system.
[0108] The packages discussed herein in relation to diagnostic
systems are those customarily utilized in diagnostic systems. Such
packages include glass and plastic (e.g., polyethylene,
polypropylene and polycarbonate) bottles, vials, plastic and
plastic-foil laminated envelopes and the like.
EXAMPLES
[0109] The examples illustrate the present invention but in no way
limit its scope.
Example 1
Isolation of the HIV p24 Gene and Construction of Expression
Vector
[0110] The gag region from the pHXB2CG plasmid clone of HTLV IIIB
(obtained from Dr. Robert Gallo, National Cancer Institute,
Bethesda, Md.) was isolated by EcoRV restriction enzyme digestion
of plasmid pHXB2CG and the resulting 2.86 kilobase fragment was
isolated and inserted by ligation into the EcoRV site of a modified
pUC8 vector (pUC8NR) to form plasmid PUCGAG (FIG. 1, Step 1).
[0111] The plasmid (PUCGAG) was mutagenized to generate an ATG
translational initiation codon and an NdeI restriction enzyme site
(CATATG) at the beginning of the p24 structural gene by the
following series of manipulations (FIG. 1, Step 2). After
transformation of pUCGAG into the methylation deficient dam-strain
of E. coli, New England Biolabs, a gap was created in the pUCGAG
DNA at the p24 amino terminus by cutting with the ClaI and PstI
restriction enzymes to form gapped pUCGAG that lacks the smaller
DNA segment from the p24 amino terminus. Ten micrograms of gapped
pUCGAG DNA and 10 micrograms of pUCGAG DNA cut with the restriction
enzyme EcoRI were both subjected to electrophoresis on a 1% agarose
gel, and the DNA fragments were each separately isolated from the
agarose gel by electroelution (Model 1750 sample concentrator;
ISCO, Lincoln, Nebr.), combined, extracted twice with a 50/50
mixture of phenol and chloroform, and precipitated with the
addition of sodium acetate (final concentration, 100 mM) and three
volumes of ethanol.
[0112] The precipitated DNAs were collected by centrifugation and
resuspended to a concentration of 25 micrograms per milliliter in
water. After addition of an equal volume of annealing buffer (80%
formamide, 100 mM Tris, pH 8.0, 25 mM EDTA) the resuspended DNAs
were denatured by boiling for 5 minutes and allowed to anneal at
37.degree. C. for 30 minutes. The annealed DNAs were diluted with
an equal volume of water and precipitated in ethanol as described
above to form precipitated annealed DNA.
[0113] The NdeI and ATG sequences were joined to the amino terminus
of the p24 gene using the following synthetic oligonucleotide:
TABLE-US-00002 5'-CCAAAATTACCATATGCCAATCGTGCAGAAC-3'(SEQ ID
NO:19)
The 10 nucleotides at the 5' end and 9 nucleotides at the 3' end of
this oligonucleotide are homologous to the HTLV IIIB DNA sequence
(University of Wisconsin genetic database). The intervening
nucleotides were chosen to minimize the formation of secondary
structures within the oligonucleotide and within the RNA expected
to be generated from this sequence during expression of these
sequences in E. coli.
[0114] Forty picomoles of the above oligonucleotide (synthesized on
a Pharmacia Gene Assembler) was phosphorylated (as described in
Molecular Cloning by T. Maniatis, E. F. Fritsch and J. Sambrook,
Cold Spring Harbor Laboratory, 1982, p. 125) and admixed with 2.5
micrograms of the precipitated annealed DNA described above. The
admixed DNAs were then annealed by heating the admixture to
65.degree. C. for 5 minutes and then cooling to room temperature
over the course of an hour in ligase buffer (op. cit., p. 474). The
resulting DNA molecule (i.e., a gapped template) containing the
precipitated annealed DNA described above and the gapped template
with the annealed oligonucleotide was then repaired in vitro in
ligase buffer by incubating for 3 hours at 15.degree. C. in the
presence of 25 .mu.M of each deoxynucleoside triphosphate, 50 .mu.M
adenosine triphosphate, 5 units of T4 DNA ligase and 1 unit of the
Klenow fragment of E. coli DNA polymerase.
[0115] After transformation into competent cells of the JM83 strain
of E. coli the bacterial colonies were screened by hybridization
with radiolabeled oligonucleotide on nitrocellulose (op. cit., pp.
250-251, 313-329). A single colony was isolated by this procedure
containing the plasmid pUCp40 (FIG. 1), with the DNA sequence for
the amino terminal sequence of the p24 gene as disclosed in U.S.
Pat. No. 5,470,720.
[0116] The DNA fragment from pUCp40 encoding a p24-p15 fusion
protein referred to as p40 below and located between the NdeI
restriction enzyme site created by the above mutagenesis and the
EcoRV site, was isolated by digesting plasmid pUCp40 with NdeI and
EcoRV followed by separation on an agarose gel, extraction and
precipitation of the separated fragment.
[0117] Plasmid pGEX7 DNA was linearized by digestion with NdeI and
EcoRV. Plasmid pGEX7 is a bacterial expression vector deposited as
plasmid PHAGE 38 with the American Type Culture Collection (ATCC)
on Jun. 9, 1988 and given the ATCC accession number 40464. It
contains a lambda bacteriophage promoter (P.sub.L), the gene for
its temperature sensitive repressor (cl857), the sequence
AGGAAGGGTTTTTCAT (SEQ ID NO:1) and an origin of replication
(ori).
[0118] The digestion of pGEX7 with NdeI and EcoRV results in the
production of two linear fragments, one of which contains the
amp.sup.r and cl857 genes and the origin of replication and has
NdeI and EcoRV cohesive termini. The above described p40
gene-containing NdeI/EcoRV restriction fragment of pUCp40 was then
ligated to the pGEX7 NdeI/EcoRV amp.sup.r gene-containing fragment
via their respective NdeI and EcoRV termini to form the plasmid
pGEXp40 (FIG. 1, Step 3).
[0119] The sequences of pGEXp40 encoding p15 were removed from
plasmid pGEXp40 by restriction digestion with the enzymes PpuMI and
BamHI. Thereafter the 3' end of the p24 gene was reconstructed as
indicated by FIG. 1, Step 4 by synthesizing two complementary
oligonucleotides (SEQ ID NO:20 and SEQ ID NO:21) which when
annealed form a duplex comprising translational stop codons and
overhanging ends corresponding to PpuMI and BamHI restriction
enzyme sites. The resulting rDNA plasmid, pGEXp24, expresses an HIV
p24 antigen.
Example 2
Formation of Composite DNAs Comprising the pGEXp24 Vector with an
Inserted Gene for a Conserved Envelope gp41 (Subtype 0) Antigen
[0120] The plasmid pGEXp24, was linearized by digestion with the
restriction enzyme PpuMI and purified by phenol-chloroform
extraction followed by precipitation with ethanol. Two
complementary oligonucleotides (sequences given by nucleotides 686
to 763 and the complement of nucleotides 689 to 766 of SEQ ID NO:1)
forming protruding cohesive termini when annealed, were
synthesized. The synthetic oligonucleotides were allowed to form a
duplex by mixing and heating to 90.degree. C. for a approximately 3
minutes, followed by annealing at room temperature for a period of
10 minutes. The hybrid molecule represents a hybrid gene sequence
encoding the p24 molecule interrupted after codon 225 by a linker
amino acid (lysine), envelope sequence (amino acids 227-249) for
the conserved region of HIV Subtype 0 gp41 polypeptide, strain ANT,
followed by a repetition of p24 residues 224 and 225 and then p24
residues 226-232.
[0121] A similar hybrid oligonucleotide representing the gp41
conserved region of HIV Subtype 0, strain MVP 5180, was formed by
synthesizing complementary oligonucleotides with the sequences
given by nucleotides 686 to 763 and the complement of nucleotides
689 to 766 of SEQ ID NO:3.
[0122] A third hybrid oligonucleotide representing the gp41
conserved region of HIV Subtype 0, strain GenBank X84328 was formed
by synthesizing complementary oligonucleotides with the sequences
given by nucleotides 686 to 763 and the complement of nucleotides
689 to 766 of SEQ ID NO:5.
[0123] All three duplexes were separately mixed with the linearized
pGEXp24 vector and 400 U of T4 ligase and incubated in ligase
buffer containing 1 mM ATP at 16.degree. C. overnight. Subsequent
transformation into competent E. coli and screening of
mini-preparations by Avall digestion allowed for the selection of
clones containing the insert as described in U.S. Pat. No.
5,470,720. Mini-inductions confirmed high level synthesis of the
gene product of interest, as evidenced by lysing induced cultures
in the presence of SDS and running the lysate on a 16% SDS PAGE.
The plasmid containing the hybrid gene formed by the first
oligonucleotide pair, designated pGEXp24gp41-ANT, comprises the
nucleotide sequence given by SEQ ID NO:1. The plasmid containing
the hybrid gene formed by the second oligonucleotide pair,
designated pGEXp24gp41-MVP, comprises the nucleotide sequence given
by SEQ ID NO:3. The plasmid containing the hybrid gene formed by
the third oligonucleotide pair, designated pGEXp24gp41-X84328,
comprises the nucleotide sequence given by SEQ ID NO:5.
Example 3
Purification of Recombinant p24-gp41 (subtype 0) Fusion
Proteins
[0124] Plasmids containing the lambda promoter (pL) are normally
carried in a strain of bacteria containing a lysogen of
bacteriophage lambda in order to minimize the expression of the
gene product of interest during the manipulation of DNAs. The
pGEX7-based plasmids described in Example 1 were all carried in a
lysogen of the MM294 strain of E. coli. Expression from the lambda
promoter of pGEX7 can be demonstrated by transfer of the plasmid
into an uninfected bacterial host (e.g., E. coli strain W3110,
accession no. #27325, ATCC, Rockville, Md.) and inactivation of the
cl repressor protein at 42.degree. C. Competent E. coli (strain
W3110, 100 .mu.l bacterial suspension) were transformed with 1
.mu.l of pGEXp24gp41-ANT, pGEXp24gp41-MVP or pGEXp24gp41-X84328.
After 60 minutes on ice, the bacteria were diluted to 1 ml with LB
medium and incubated for a further 60 minutes at 30.degree. C.
Aliquots of the culture were than plated on ampicillin containing
agar plates which were held at 30.degree. C. for at least 24 hours.
A colony was picked and inoculated into 5 ml of LB medium and
incubated for approximately 6 hours at 30.degree. C. 1 ml of the
growing culture, indicated by developing turbidity of the inoculum,
was then transferred to a 1 liter flask for further overnight
culture, using a temperature controlled shaker at 300 rpm. The main
culture was initiated the following morning by inoculating each of
6 flasks containing 0.9 liter of LB Medium and 50 mg
ampicillin/liter with 100 ml of the overnight culture. The flasks
were shaken at 350 rpm for 1.5 hours. The cultures were induced by
raising the temperature to 42.degree. C. and maintained at that
temperature for 4 hours. The cells were harvested by centrifugation
(Sorvall, GSA Rotor, 7,000 rpm, 10 minutes in the cold),
transferred to a storage container and typically stored frozen
until used for purification.
[0125] The cell paste from 6 liter cultures (approximately 30 g of
frozen bacteria) were thawed and suspended in an equal volume of
0.2 M phosphate buffer, pH 7.0, containing 10 mM EDTA and 10 mM
benzamidine. Lysozyme (1 mg/g cell paste) and PMSF (0.2 mg/g cell
paste) was added and the suspension stirred for approximately 30
minutes at room temperature. During this period, the material
became very viscous. The cells were then placed in an ice bath and
subjected to 3 minutes of sonication on ice with intervening
cooling periods of 1-2 minutes.
[0126] Soluble materials were removed by centrifugation (Sorvall,
SS-34 rotor, 20,000 rpm for 30 minutes) and the extraction
procedure was repeated using 0.2 M phosphate buffer containing 10
mM EDTA and 10 mM benzamidine. The combined supernatants were
discarded and the sediment suspended in 6 M urea containing 0.02 M
Tris-HCl buffer, pH 8.6. The suspension was subjected to a further
cycle of sonication on ice (60 seconds) and the centrifugation was
repeated. The supernatant was saved and the sediment re-extracted
once, using urea-tris buffer of the same composition. The combined
supernatants were treated with ammonium sulfate (0.3 g/ml of
solution), kept at 4.degree. C. for about 30 minutes and then
centrifuged as described above. A large precipitate had formed
which was dissolved in approximately 20 ml of 6 M Guanidine-HCl,
containing 0.1 M phosphate buffer, 5 mM EDTA, pH 7.0. The
solubilized material was clarified by renewed centrifugation and
then applied to a 5.times.105 cm column, containing Sepharose S-300
gel and equilibrated with 6 M Guanidine-HCl in 0.1 M phosphate-5 mM
EDTA buffer, pH 7.0. Fractions (10 ml) were eluted and, following
dialysis against 6 M urea of selected aliquots, analyzed by SDS gel
electrophoresis. Based on the gel pattern, appropriate fractions
containing gene products migrating to a position of the gel which
corresponded to that reference proteins, or, if such was
unavailable, similar to the band appearing as a consequence of the
induction of cultures carrying the expression vector, were pooled
and exhaustively dialyzed against 4 M urea containing 0.015 M
Tris-HCl buffer, pH 8.6.
[0127] The dialyzed; clear solution was applied to a column
(2.5.times.30 cm) of DEAE-Sepharose equilibrated with 4 M
urea-0.015 M Tris-HCl buffer, pH 8.6. Following application of the
sample and washing to remove non-bound constituents, the protein of
interest was eluted with a salt gradient (250.times.250 ml, 0-0.1 M
NaCl in the initial Tris-HCl buffer containing 4 M urea) and
monitored by analysis in 16% SDS PAGE. Fractions containing the
protein of interest were pooled and adjusted to pH 5.6 by addition
of glacial acetic acid. The pH-adjusted pooled material was then
applied to a column (2.5.times.20 cm) of CM Sepharose equilibrated
with 20 mM sodium acetate buffer, pH 5.6 containing 4 M urea. A
salt gradient (250.times.250 ml, 0-0.4M NaCl in the same
urea-containing acetate buffer) was applied and fractions were
collected. Fractions were again analyzed for the protein of
interest. These fractions containing purified protein were pooled
and stored at frozen at -20.degree. C. FIG. 2 shows an analytical
SDS gel of the three recombinant p24-gp41 hybrid proteins of
subtype 0 after being purified in accordance with the above
protocol.
[0128] To test for immune reactivity with HIV positive sera,
polystyrene wells (Nunc, Polysorp) were coated with mixtures of the
p24-gp41 hybrid proteins described above in concentrations of 1
.mu.g/ml for 16 hours at 4.degree. C. After blocking with 3% bovine
serum albumin overnight, the plates were dried under vacuum and
then used to analyze the immune reactivity against sequential
dilutions of a serum known to test positive for HIV antibody. FIG.
5 shows a titration curve using the three newly synthesized
antigens in comparison with the prototype gene product obtained
from pGEXp24-gp41 as disclosed in U.S. Pat. No. 5,470,720. The
three antigens produce strong immune reactivity with this serum,
comparable to that seen with the reference protein.
Example 4
Formation of a Recombinant HCV Capsid Protein Gene Joined to pGEX7
for Synthesis of Carrier-free Polypeptide
A. Isolation of HCV Clones and Sequence Analysis
[0129] (1) Isolation of HCV RNA and Preparation of cDNA
[0130] As a source for HCV virions, blood was collected from a
chimpanzee infected with the Hutchinson (Hutch) strain exhibiting
acute phase HCV. Plasma was clarified by centrifugation and
filtration. Virions were then isolated from the clarified plasma by
immunoaffinity chromatography on a column of HCV IgG (Hutch strain)
coupled to protein G sepharose. HCV RNA was eluted from the
sepharose beads by soaking in guanidinium thiocyanate and the
eluted RNA was then concentrated through a cesium chloride (CsCl)
cushion. Maniatis et al., Molecular Cloning: A Laboratory Manual,
Maniatis et al., eds. Cold Spring Harbor, N.Y. (1989).
[0131] The purified HCV RNA was used as a template in a primer
extension reaction admixture containing random and oligo dT
primers, dNTP's, and reverse transcriptase to form first strand
cDNAs. The resultant first strand cDNAs were used as templates for
synthesis of second strand cDNAs in a reaction admixture containing
DNA polymerase I and RNAse H to form double stranded (ds) cDNAs
(Maniatis et al., supra). The synthesized ds cDNAs were amplified
using an asymmetric synthetic primer-adaptor system wherein sense
and anti-sense primers were annealed to each other and ligated to
the ends of the double stranded HCV cDNAs with T4 ligase under
blunt-end conditions to form cDNA-adaptor molecules. Polymerase
chain reaction (PCR) amplification was performed by admixing the
cDNA-adaptor molecules with the same positive sense adaptor
primers, dNTP's and TAQ polymerase to prepare amplified HCV cDNAs.
The resultant amplified HCV cDNA sequences were then used as
templates for subsequent amplification in a PCR reaction with
specific HCV oligonucleotide primers.
[0132] (2) Synthesis of Oligonucleotides For Use in HCV Cloning
[0133] Oligonucleotides were selected to correspond to the 5'
sequence of Hepatitis C virus which encodes the HCV structural
capsid and envelope proteins (HCJ1 sequence: Okamoto et al., Jap.
J. Exp. Med., 60:167-177, 1990). The selected oligonucleotides were
synthesized on a Pharmacia Gene Assembler according to the
manufacturer's instruction, purified by polyacrylamide gel
electrophoresis.
[0134] (3) PCR Amplification of HCV cDNA
[0135] PCR amplification was performed by admixing the
primer-adapted amplified cDNA sequences prepared in Example 4.A.(1)
with the synthetic oligonucleotide primer pair 690:694. (690:
nucleotides 16-36 of SEQ ID NO:9; 694: complement of nucleotides
162-178 of SEQ ID NO:9). The resulting PCR reaction admixture
contained the primer-adapted amplified cDNA template,
oligonucleotides 690 and 694, dNTP's, salts (KCl and MgC1.sub.2)
and TAQ polymerase. PCR amplification of the cDNA was conducted by
maintaining the admixture at a 37.degree. C. annealing temperature
for 30 cycles. Aliquots of samples from the first round of
amplification were reamplified at a 55.degree. C. annealing
temperature for 30 cycles under similar conditions.
[0136] (4) Preparation of Vectors Containing PCR Amplified ds
DNA
[0137] Aliquots from the second round of PCR amplification were
subjected to electrophoresis on a 5% acrylamide gel. After
separation of the PCR reaction products, the region of the gel
containing DNA fragments corresponding to the expected 690:694
amplified product of approximately 224 bp was excised and purified
following standard electroelution techniques (Maniatis et al.,
supra). The purified fragments were kinased and cloned into the
pUC18 plasmid cloning vector at the SmaI polylinker site to form a
plasmid containing the DNA segment 690:694 joined to pUC18.
[0138] The resulting mixture containing pUC18 and a DNA segment
corresponding to the 690:694 sequence region was then transformed
into the E. coli strain JM83. Plasmids containing inserts were
identified as lac- (white) colonies on X-gal medium containing
ampicillin. pUC18 plasmids which contained the 690:694 DNA segment
were identified by restriction enzyme analysis and subsequent
electrophoresis on agarose gels, and were designated pUC18
690:694.
[0139] (5) Sequencing of HCV Clones that Encode the Putative Capsid
Protein
[0140] Two independent colonies believed to contain a pUC18 vector
having the HCV Hutch strain 690:694 DNA segment (pUC18-690:694)
that codes for the amino terminus of the capsid protein were
amplified and used to prepare plasmid DNA by CsCl density gradient
centrifugation by standard procedures (Maniatis et al., supra). The
plasmids were sequenced using .sup.35S dideoxy procedures with
pUC18 specific primers. The two plasmids were independently
sequenced on both DNA strands to assure the accuracy of the
sequence.
[0141] (6) Preparation of HCV Clones from the 5' End of the
Genome
[0142] To obtain a clone encoding the remainder of the of the HCV
Hutch capsid region (Okamoto et al., supra), the oligonucleotide
pair 693:691 (693: nucleotides 162-178 of SEQ ID NO:9; 691:
complement of nucleotides 355-375 of SEQ ID NO:9) were used in PCR
reactions. cDNA was prepared as described in Example 4.A.(1) from
viral HCV RNA (Hutch) and used in PCR amplification as described in
Example 4.A.(3) with the oligonucleotide pair 693:691. The
resultant PCR amplified ds DNA was then cloned into pUC18 cloning
vectors and screened for inserts as described in Example 4.A.(4) to
form pUC18-693:691. Clones were then sequenced with pUC18 specific
primers as described in Example 4.A.(5). Plasmid pUC18-693:691 was
found to contain a HCV DNA segment that is 157 bp in length and
corresponds to the HCV prototype HJC1 sequence (SEQ ID NO:9) from
nucleotides 218-375.
B. Production of Recombinant DNA (rDNA) Encoding Fusion
Proteins
[0143] (1) Introduction of the 690:694 Fragment into pGEX-3X for
Expression of GST Fusion Protein
[0144] The pUC18-690:694 DNA was subjected to restriction enzyme
digestion with EcoRI and BamHI to release a DNA segment containing
the HCV 690:694 fragment. The released DNA segment was subjected to
acrylamide electrophoresis and a DNA segment containing the 224 bp
HCV insert plus portions of the pUC18 polylinker was then excised
and eluted from the gel as described in Example 4.A.(4). The DNA
segment was extracted with a mixture of phenol and chloroform, and
precipitated.
[0145] The precipitated DNA segment was resuspended to a
concentration of 25 .mu.g/ml in water and treated with the Klenow
fragment of DNA polymerase to fill in the staggered ends created by
the restriction digestion. The resultant blunt-ended 690:694
containing segment was admixed with the bacterial expression vector
pGEX-3X, (Pharmacia Inc., Piscataway, N.J.) which was linearized
with the blunt end restriction enzyme SmaI. The admixed DNAs were
then ligated by maintaining the admixture overnight at 16.degree.
C. in the presence of ligase buffer and 5 units of T4 DNA ligase to
form a plasmid of 690:694 DNA segment joined to pGEX-3X.
[0146] (2) Selection and Verification of Correct Orientation of
Ligated Insert
[0147] The ligation mixture containing the pGEX-3X vector and the
690:694 DNA containing segment was transformed into host E. coli
strain W3110. Plasmids containing inserts were identified by
selection of host bacteria containing vector in Luria broth (LB)
media containing ampicillin. Bacterial cultures at stationary phase
were subjected to alkaline lysis protocols to form a crude DNA
preparation. To screen for a vector containing the 690:694 DNA
segment, plasmid DNA was digested with the restriction enzyme XhoI,
which cleaves within the 690:694 DNA segment, but not within the
pGEX-3X vector.
[0148] Several 690:694 DNA segment-containing vectors were
amplified and the resultant amplified vector DNA was purified by
CsCl density gradient centrifugation. The DNA was sequenced across
the inserted DNA segment ligation junctions by .sup.35S dideoxy
methods with a primer which hybridized to the pGEX-3X Vectors
containing 690:694 DNA segment having the correct coding sequence
for in-frame translation of an HCV structural protein were thus
identified and selected to form pGEX-3X-690:694.
[0149] (3) Structure of the Fusion Protein
[0150] The pGEX-3X vector is constructed to allow for inserts to be
placed at the C terminus of Sj26, a 26-kDa
glutathione-S-transferase (GST; EC 2.5.1.18) encoded by the
parasitic helminth Schistosoma japonicum. The insertion of the
690:694 HCV fragment in-frame behind Sj26 allows for the synthesis
of the Sj26-HCV fusion polypeptide. The HCV polypeptide can be
cleaved from the GST carrier by digestion with the site-specific
protease factor Xa (Smith et al., Gene, 67:31-40, 1988).
[0151] The resulting rDNA molecule, pGEX-3X-690:694, encodes an HCV
fusion protein having an amino terminal polypeptide portion
corresponding to residues 1 to 221 of GST, a four residue
intermediate portion defining a cleavage site for the protease
Factor Xa, a nine residue linker, a polypeptide portion
corresponding to amino acid residue sequence 1 to 74 of SEQ ID
NO:10 and a six residue tail.
[0152] (4) Introduction of the 690:694 Fragment into pGEX-3X
[0153] Plasmid pGEX-3X-693:691 was formed by first subjecting the
plasmid pUC18-693:691 prepared in Example 4.A.(6) to restriction
enzyme digestion with EcoRI and BamHI as in Example 4.B.(1). The
purified DNA segment was admixed with and ligated to the pGEX-3X
vector which was linearized by restriction enzyme digestion with
EcoRI and BamHI in the presence of T4 ligase at 16.degree. C. to
form the plasmid pGEX-3X-693:691.
[0154] A pGEX-3X plasmid containing a 693:691 DNA segment was
identified as in Example 4.B.(2) with the exception that crude DNA
preparations were digested with EcoRI and BamHI to release the
693:691 insert. A pGEX-3X vector containing a 693:691 DNA segment
having the correct coding sequence for in-frame translation of an
HCV structural protein was identified by sequence analysis as
performed in Example 4.B.(2) and selected to form
pGEX-3X-693:691.
[0155] The resulting vector encodes a fusion protein (GST:HCV
693:691) that is comprised of an amino-terminal polypeptide portion
corresponding to residues 1-221 of GST, an intermediate polypeptide
portion corresponding to residues 222-225 and defining a cleavage
site for the protease Factor Xa, a five residue linker portion, a
carboxy-terminal polypeptide portion corresponding to amino acid
residues 69 to 120 of the HCV capsid antigen, and a three residue
tail.
C. Plasmids Encoding Complete Capsid Proteins
[0156] (1) Construction of a Vector Expressing a Composite Gene
[0157] To generate a composite gene spanning the entire amino acid
region of 1-120 and to create an operative linkage of the gene to
the first DNA segment of this invention, (i.e., AGGAAGGGTTTTTCAT,
which corresponds to nucleotides 1 to 15 of SEQ ID NO: 1), the
following experiments were conducted. The above described plasmids
pGEX-3X-690:694 and pGEX-3X-691:693, containing base pairs 1-224
and 203-360, respectively, of an HCV capsid gene (U.S. Ser. No.
07/573,643) were used as target templates for each of two separate
PCR reactions encompassing the following primer pairs.
[0158] A first PCR reaction was performed using a primer pair with
sequences given by SEQ ID NO:22 and the complement of nucleotides
219-239 of SEQ ID NO:7 to amplify a 210 base pair fragment from
plasmid pGEX-3X-690:694. The amplified fragment contains a single
NdeI and EagI site at the 5' and 3' ends, respectively.
[0159] A second PCR reaction was performed using a primer pair
(sequences given by SEQ ID NO:23 and nucleotides 219 to 239 of SEQ
ID NO:7) to amplify a 150 bp fragment from plasmid pGEX-3X-691:693.
The second amplified fragment contains an EagI site at the 5' end
and an EcoRI site at the 3' of the amplimer.
[0160] The PCR products were cut with the NdeI and EagI (first PCR
reaction product) and with EagI and EcoRI (second PCR reaction
product). In a third digestion, the pGEX7 vector was digested with
NdeI and EcoRI. Following isolation by preparative electrophoresis
in 5% acrylamide of each DNA segment, a three-way ligation mixture
containing the isolated and restricted PCR reaction products and
isolated pGEX7 vector was formed, and allowed to incubate with T4
Ligase overnight at 16.degree. C. The mixture was then transformed
into competent cells, colonies were selected for plasmid
mini-preparations and subsequently analyzed by redigestion with
NdeI and EcoRI. The vector pGEX-C120H-V68 released an insert of the
proper length upon restriction digestion with NdeI and EcoRI and
had the nucleotide sequence shown in SEQ ID NO:7. Compared with the
consensus sequence for the HUTCH strain, pGEX-C120H-V68 has amino
acid substitutions at amino acid 4 (Ile instead of Asn) and amino
acid 68 (Val instead of ala) shown in SEQ ID NO:8.
[0161] (2) Vectors Expressing Modified Capsid Proteins
[0162] The codon at position 68 is included in a stretch of the DNA
molecule spanned by two Styl sites, (nucleotides 212 and 259 of SEQ
ID NO:7 are the first base in the Styl recognition sites). A
plasmid vector containing the HUTCH sequence in this Styl fragment
is made by ligating a DNA fragment formed by annealing
complementary synthetic oligonucleotides with sequences given by
nucleotides 213 to 259 and the complement of nucleotides 217 to 263
of SEQ ID NO:9 into the Styl-digested PGEX-C120H-V68 vector. The
proper orientation of the inserted DNA fragment is assured as the
two Styl cohesive ends are different. The sequence of the resulting
vector, pGEX-C120H, codes for alanine at amino acid 68 of the
capsid sequence (SEQ ID NO:10).
[0163] Alternative modifications of the capsid structure which
substitute specific sequences from other genotypes of HCV may be
accomplished by the similar use of other synthetic oligonucleotide
pairs with Styl/Styl cohesive ends. For example, an amino acid
sequence corresponding to the HCV capsid of genotype 2 may be
substituted by annealing a synthetic oligonucleotide pair with the
sequences given by nucleotides 213 to 259 and the complement of
nucleotides 217 to 263 of SEQ ID NO:11 and inserting the duplex
into the Styl/Styl region. The capsid encoded by the resulting
pGEX-C120H-ISO2 is given in SEQ ID NO:12. Plasmid pGEX-C120H-ISO3
encoding particular amino acids corresponding to an HCV capsid
protein of genotype 3 (SEQ ID NO:14) is similarly obtained with the
synthetic sequences given by nucleotides 213 to 259 and the
complement of nucleotides 217 to 263 of SEQ ID NO:13.
Example 5
Preparation of Purified HCV 1-120 Capsid Proteins
A. Transformation and Growth of Bacteria
[0164] Competent E. coli (strain W3110, 100 ul bacterial
suspension) were transformed with 1 ul of purified pGEX-C120H-V68
plasmid containing the insert shown in SEQ ID NO:7. After 60
minutes on ice, the bacteria were diluted to 1 ml with LB medium
and incubated for a further 60 minutes at 30.degree. C. Aliquots of
the culture were than plated on Amp-containing agar plates which
were incubated at 30.degree. C. for at least 24 hours. A colony was
picked and inoculated into 5 ml of LB medium. After approximately 6
hours at 30.degree. C., 1 ml of the growing culture, indicated by
developing turbidity of the inoculum, was then transferred to a 1
liter flask for further overnight sub-culturing, using a
temperature controlled shaker at 300 rpm. The main culture was
initiated the following morning by inoculating each of 6 flasks
containing 0.9 liter of LB and 50 mg ampicillin/liter with 100 ml
of the overnight culture. The flasks were shaken at 350 rpm for 2
hours and the cultures were then induced by raising the temperature
to 42.degree. C. for 4 hours. The cells were harvested by
centrifugation and typically stored frozen until used for
purification.
B. Isolation of HCV Capsid Protein from Induced Cultures.
[0165] The cell paste from 6 liter cultures (approximately 30 g of
frozen bacteria) was thawed and suspended in an equal volume of 0.2
M phosphate buffer, pH 7.0, containing 10 mM EDTA and 10 mM
benzamidine. Lysozyme (1 mg/g cell paste) and PMSF (0.2 mg/g cell
paste) were added and the suspension stirred for approximately 30
minutes at room temperature. During this period, the material
became very viscous. The cells were then placed in an ice bath and
subjected to 3 minutes of sonication on ice with intervening
cooling periods of 1-2 minutes. Soluble materials were removed by
centrifugation (Sorvall, SS-34 rotor, 20,000 rpm for 30 minutes)
and the extraction procedure was repeated using 0.2 M phosphate
buffer containing 10 mM EDTA and 10 mM benzamidine. The combined
supernatants were discarded and the sediment suspended in 0.02 M
Tris-HCl buffer, pH 8.6, containing 6 M urea. The suspension was
subjected to a further cycle of sonication on ice (60 seconds) and
the centrifugation was repeated. The supernatant was saved and the
sediment re-extracted once, using urea-tris buffer of the same
composition. The combined supernatants were treated with ammonium
sulfate (0.3 g/ml of solution), kept at 4.degree. C. for about 30
minutes and then centrifuged as described above. A large
precipitate had formed which was dissolved in approximately 20 ml
of 0.1 M phosphate buffer, pH 7.0, containing 5 mM EDTA and 6 M
guanidine-HCl. The solubilized material was clarified by renewed
centrifugation and then applied to a 5.times.105 cm column,
containing Sepharose S-300 gel and equilibrated with the same
buffer. Fractions (10 ml) were eluted and, following dialysis
against 6 M urea of selected aliquots, analyzed by SDS gel
electrophoresis. Based on the gel pattern, appropriate fractions
were pooled and exhaustively dialyzed against 4 M urea containing
0.1 M sodium acetate buffer, pH 5.4. The dialyzed, clear solution
was applied to a column (2.5.times.20 cm) of CM-Sepharose
equilibrated with 4 M urea-0.1 M acetate buffer, pH 5.4. Following
application of the sample and washing to remove non-bound
constituents, the protein of interest was eluted with a salt
gradient (250.times.250 ml, 0-0.4 M NaCl in the initial
urea-containing acetate buffer) and monitored by analysis of
selected fractions by 16% SDS PAGE. Fractions containing pure
protein were pooled and stored at frozen at -20.degree. C. FIG. 3
shows an analytical SDS gel of purified capsid protein after being
subjected to the procedure described.
Example 6
Formation of a Fusion Protein Comprising GST and Amino Acids 21-40
of the HCV Capsid Protein
A. Construction of Plasmids Encoding GST-Capsid Fusion Proteins
[0166] (1) Construction of a Hybrid Gene in pGEX-2T-CAP-B
[0167] Oligonucleotides 21-40(+) and 21-40(-) for constructing the
vector pGEX-2T-CAP-B for expressing the CAP-B fusion protein were
prepared as described in Example 4.A.(2) having nucleotide base
sequences corresponding to SEQ ID NO:24 and SEQ ID NO:25,
respectively.
[0168] Oligonucleotides 21-40 (+) and 21-40 (-) were admixed in
equal amounts with the pGEX-2T expression vector (Pharmacia) that
had been predigested with EcoRI and BamHI and maintained under
annealing conditions to allow hybridization of the complementary
oligonucleotides and to allow the cohesive termini of the resulting
double-stranded oligonucleotide product to hybridize with pGEX-2T
at the EcoRI and BamHI cohesive termini. After ligation the
resulting plasmid, designated pGEX-2T-CAP-B contains a single copy
of the double-stranded oligonucleotide product and contains a
structural gene coding for a fusion protein designated CAP-B,
having an amino acid residue sequence shown in SEQ ID NO:18 from
residue 1 to residue 252.
[0169] (2) Insertion of Hybrid Gene into pGEX7-CAP-B1 for High
Level Expression
[0170] A PCR reaction was performed using the primer pair with
nucleotide sequences given by SEQ ID NO:26 and SEQ ID NO:27 to
amplify a 759 base pair fragment from plasmid pGEX-2T-CAP-B. The
amplified fragment will contain a single NdeI and EcoRI site at the
5' and 3' ends, respectively.
[0171] The PCR product was cut with the NdeI and EcoRI. In a second
digestion, the pGEX7 vector is separately digested with NdeI and
EcoRI. Following isolation by preparative electrophoresis in 5%
acrylamide of each DNA segment, a ligation mixture containing the
isolated and restricted PCR reaction product and pGEX7 vector is
formed, and incubated with T4 Ligase overnight at 16.degree. C. The
mixture is then transformed into competent cells. Colonies are
selected for plasmid mini-preparations which were subsequently
analyzed by redigestion with NdeI and EcoRI. The resulting
nucleotide sequence is shown in SEQ ID NO:17.
B. Structure of the Expressed CAP-B1 Protein
[0172] The fusion protein expressed by pGEX7-CAP-B is comprised of
an amino-terminal polypeptide portion corresponding to residues
1-220 of glutathione-S-transferase, an intermediate polypeptide
portion corresponding to residues 221-226 and defining a cleavage
site for Thrombin, and a polypeptide portion corresponding to
residues 227-246 defining a portion of the HCV capsid antigen that
has the amino acid residue sequence 21-40 in SEQ ID NO:10. CAP-B1
is identical to CAP-B except that it lacks the 6 amino acid residue
tail following the residues that correspond to amino acids 21-40 of
the HCV capsid.
Example 7
Formation of Recombinant Carrier Free HCV Non-structural Antigen
794
[0173] A. Construction of Plasmid Comprising Gene for 794 Antigen
Joined to pGEX7
[0174] The gene for the nonstructural 794 antigen was prepared from
clone 20 (Table 9 p. 109), the latter disclosed in PCT application
PCT/US91/06037 and encompassing 105 amino acids codons of the NS3
region inserted into the SmaI site of the vector pUC18. The pUC18
vector containing the insert was redigested with SmaI and EcoRI and
subsequently inserted into a similarly digested pGST-2T vector
(GenBank Accession number XXU13850). This resulted in an expression
vector producing a fusion protein with a contiguous GST-HCV NS3
fusion sequence, GST translation beginning at nucleotide 258 of the
vector, the NS3 protein beginning at nucleotide 936. The NS3 gene
was re-isolated from this vector by digesting with SmaI and EcoRI,
which released a 330 base-pair fragment isolated by preparative
electrophoresis.
[0175] The pGEX7 vector was modified as follows. A pair of
complementary synthetic oligonucleotides with sequences given by
SEQ ID NO:28 and SEQ ID NO:29, when annealed, form a duplex with
protruding NdeI and BamHI cohesive ends. The duplex encodes 6
histidine residues as well as a SmaI and EcoRI restriction site,
the latter followed by stop codons in all three reading frames. To
insert the DNA segment into pGEX7, the vector was first digested
with NdeI and BamHI and the intervening polylinker removed by
electrophoresis. Ligation of the digested vector with the synthetic
oligonucleotide was followed by transformation and analysis of
several mini-preparations. The plasmids were screened for a SmaI
restriction site which is present in the insert but not the parent
vector. Of ten colonies screened, all showed the presence of the
SmaI restriction site. A colony was picked and used for preparing a
sufficient quantity of modified pGEX7 plasmid. The plasmid was then
linearized by digesting with SmaI and EcoRI the vector fragment was
separated from the small SmaI-EcoRI fragment. The digested modified
pGEX7 vector was used for ligation with the gene for the
nonstructural NS3 antigen.
[0176] Ligation of the digested modified pGEX7 vector and the
SmaI-EcoRI fragment encompassing the gene for the NS3 antigen was
carried out overnight in the presence of 400 U of T4 DNA ligase and
1 mM ATP. Transformation of the ligase mixture was followed by
screening of mini-preparations which identified several clones that
contained the inserted gene for the 794 antigen as indicated by
electrophoresis in a 5% acrylamide gel. Several of these clones
also expressed a protein of the expected molecular size in
mini-inductions. One of the clones was selected for a 6 liter
fermentation experiment. The fermentation/induction was carried as
described in Example 5A.
B. Purification of 794 Antigen from Fermentation Broths
[0177] Frozen cell paste from induced cultures was thawed,
suspended in buffer (0.2 M phosphate, 10 mM EDTA, 10 mM
Benzamidine) and treated with lysozyme (1 mg/g cell paste) and PMSF
(0.2 mg/g cell paste) followed by sonication as described in
Example 5B. Following centrifugation, it was discovered that the
protein of interest was directly soluble in the aqueous
supernatant. Therefore, the sediment was discarded and the
supernatant subjected to gel chromatography on a column
(2.5.times.110 cm) of Sepharose S-300 eluted with 0.02 M Tris-HCl,
pH 8.6, containing 0.2 M NaCl. Fractions were monitored with SDS
PAGE and those containing the protein of interest pooled. The
pooled material was subsequently applied in aliquots to a column
(1.times.5 cm) of iminodiacetic acid derivatized Sepharose which
had been previously charged with 50 mM nickel chloride and washed
with 0.02 M Tris-HCl, 0.2 M NaCl. After absorption of the
hexahistidine derivative of the NS3 794 antigen, it was eluted
using successive elution steps with 0.03M Imidazole and 0.3 M
Imidazole, respectively, in the above buffer. The protein emerged
as a sharp peak with 0.3 M imidazole and was subsequently stored
frozen at -20.degree. C. An SDS PAGE analysis of the purified
material is shown in FIG. 4.
Example 8
Immune Reactivity of HCV Recombinant Antigens Expressed in pGEX7
Vectors
[0178] Polystyrene wells (Nunc, Polysorp) were coated with mixtures
of the HCV capsid polypeptide (SEQ ID NO:8) in concentrations
ranging between 1 and 4 .mu.g/ml and the HCV 794 NS3 antigen (SEQ
ID NO:16) at 0.2-0.5 .mu.g/ml. After blocking with 3% bovine serum
albumin the plates were dried under vacuum and then used to analyze
the immune reactivity against sera from individuals undergoing
seroconversion and therefore known to develop antibody against HCV.
The results are shown in FIGS. 6-8, each of which provide the
signal to cut off values recorded for the assay using the source
materials of the present invention and compared with the data from
commercial immunoassays as supplied by the manufacturer of the
conversion panels. These assays detected antibody at least as
early, or earlier than the state-of-the art assays.
[0179] I. Diagnostic Systems and Methods
[0180] 1. Diagnostic Systems
[0181] A diagnostic system in kit form includes, in an amount
sufficient for at least one assay according to the methods
described herein, a NANBV structural protein or fusion protein of
the present invention, as a separately packaged reagent.
Instructions for use of the packaged reagent are also typically
included.
[0182] "Instructions for use" typically include a tangible
expression describing the reagent concentration or at least one
assay method parameter such as the relative amounts of reagent and
sample to be admixed, maintenance time periods for reagent/sample
admixtures, temperature, buffer conditions and the like.
[0183] In preferred embodiments, a diagnostic system of the present
invention further includes a label or indicating means capable of
signaling the formation of a complex containing a recombinant
protein.
[0184] As used herein, the terms "label" and "indicating means" in
their various grammatical forms refer to single atoms and molecules
that are either directly or indirectly involved in the production
of a detectable signal to indicate the presence of a complex. Any
label or indicating means can be linked to or incorporated in an
antibody or monoclonal antibody or used separately, and those atoms
or molecules can be used alone or in conjunction with additional
reagents. Such labels are themselves well-known in clinical
diagnostic chemistry and constitute a part of this invention only
insofar as they are utilized with otherwise novel proteins, methods
and/or systems.
[0185] The label can be a fluorescent labeling agent that
chemically binds to antibodies or antigens without denaturing them
to form a fluorochrome (dye) that is a useful immunofluorescent
tracer. Suitable fluorescent labeling agents are fluorochromes such
as fluorescein isocyanate (FIC), fluorescein isothiocyanite (FITC),
5-dimethylamine-1-naphthalenesulfonyl chloride (DANSC),
tetramethylrhodamine isothiocyanate (TRITC), lissamine, rhodamine
8200 sulphonyl chloride (RB 200 SC), a chelate-lanthanide bound
(e.g., Eu, Tb, Sm) and the like. A description of
immunofluorescence analysis techniques is found in DeLuca,
"Immunofluorescence Analysis", in Antibody As a Tool, Marchalonis,
et al., eds., John Wiley & Sons, Ltd., pp. 189-231 (1982),
which is incorporated herein by reference.
[0186] In preferred embodiments, the label is an enzyme, such as
horseradish peroxidase. (HRP), glucose oxidase, alkaline
phosphatase or the like. In such cases where the principal label is
an enzyme such as HRP or glucose oxidase, additional reagents are
required to visualize the fact that an antibody-antigen complex
(immunoreactant) has formed. Such additional reagents for HRP
include hydrogen peroxide and an oxidation dye precursor such as
diaminobenzidine. An additional reagent useful with HRP is
2,2'-azino-di-(3-ethyl-benzthiazoline-6-sulfonic acid) (ABTS).
[0187] Radioactive elements are also useful labeling agents and are
used illustratively herein. An exemplary radiolabeling agent is a
radioactive element that produces gamma ray emissions. Elements
which themselves emit gamma rays, such as .sup.124I, .sup.125I,
.sup.128I, .sup.131I and .sup.51Cr represent one class of gamma ray
emission-producing radioactive element indicating groups.
Particularly preferred is .sup.125I. Another group of useful
labeling means are those elements such as .sup.11C, .sup.18F,
.sup.15O and .sup.13N which themselves emit positrons. The
positrons so emitted produce gamma rays upon encounters with
electrons present in the animal's body. Also useful is a beta
emitter, such as .sup.111indium, .sup.3H, .sup.35S, .sup.14C, or
.sup.32P.
[0188] Additional labels have been described in the art and are
suitable for use in the diagnostic systems of this invention. For
example, the specific affinity found between pairs of molecules can
be used, one as a label affixed to the specific binding agent and
the other as a means to detect the presence of the label. Exemplary
pairs are biotin:avidin, where biotin is the label; and peroxidase:
anti-peroxidase (PAP), where peroxidase is the label.
[0189] The linking of labels, i.e., labeling of, polypeptides and
proteins is well known in the art. For instance, antibody molecules
produced by a hybridoma can be labeled by metabolic incorporation
of radioisotope-containing amino acids provided as a component in
the culture medium. See, for example, Galfre et al., Meth.
Enzumol., 73:3-46 (1981). The techniques of protein conjugation or
coupling through activated functional groups are particularly
applicable. See, for example, Aurameas et al., Scand. J. Immunol.,
Vol. 8 Suppl. 7:7-23 (1978), Rodwell et al., Biotech., 3:889-894
(1984), and U.S. Pat. No. 4,493,795.
[0190] The diagnostic system can also include, preferably as a
separate package, a specific binding agent. A "specific binding
agent" is a molecular entity capable of selectively binding a
reagent species, which in turn is capable of reacting with a
product of the present invention but is not itself a protein
expression product of the present invention. Exemplary specific
binding agents are antibody molecules such as anti-human IgG or
anti-human IgM, complement proteins or fragments thereof, protein
A, and the like. Preferably the specific binding agent can bind the
anti-NANBV antibody to be detected when the antibody is present as
part of an immunocomplex.
[0191] In preferred embodiments the specific binding agent is
labeled. However, when the diagnostic systems includes a specific
binding agent that is not labeled, the agent is typically used as
an amplifying means or reagent. In these embodiments, the labeled
specific binding agent is capable of specifically binding the
amplifying means when the amplifying means is bound to a reagent
species-containing complex.
[0192] The diagnostic kits of the present invention can be used in
an "ELISA" format to detect the presence or quantity of antibodies
in a body fluid sample such as serum, plasma or saliva. "ELISA"
refers to an enzyme-linked immunosorbent assay that employs an
antibody or antigen bound to a solid phase and an enzyme-antigen or
enzyme-antibody conjugate to detect and quantify the amount of an
antigen or antibody present in a sample. A description of the ELISA
technique is found in Chapter 22 of the 4th Edition of Basic and
Clinical Immunology by D. P. Sites et al., published by Lange
Medical Publications of Los Altos, Calif. in 1982 and in U.S. Pat.
No. 3,654,090; No. 3,850,752; and No. 4,016,043, which are all
incorporated herein by reference.
[0193] Thus, in preferred embodiments, the NANBV structural protein
or fusion protein of the present invention can be affixed to a
solid matrix to form a solid support that is separately packaged in
the subject diagnostic systems.
[0194] The reagent is typically affixed to the solid matrix by
adsorption from an aqueous medium although other modes of
affixation, well known to those skilled in the art, can be
used.
[0195] Useful solid matrices are well known in the art. Such
materials include the cross-linked dextran available under the
trademark SEPHADEX from Pharmacia Fine Chemicals (Piscataway,
N.J.); agarose; beads of polystyrene about 1 micron to about 5
millimeters in diameter available from Abbott Laboratories of North
Chicago, Ill.; polyvinyl chloride, polystyrene, cross-linked
polyacrylamide, nitrocellulose- or nylon-based webs such as sheets,
strips or paddles; or tubes, plates or the wells of a microtiter
plate such as those made from polystyrene or polyvinylchloride.
[0196] The NANBV structural protein, fusion protein, labeled
specific binding agent or amplifying reagent of any diagnostic
system described herein can be provided in solution, as a liquid
dispersion or as a substantially dry powder, e.g., in lyophilized
form. Where the indicating means is an enzyme, the enzyme's
substrate can also be provided in a separate package of a system. A
solid support such as the before-described microtiter plate and one
or more buffers can also be included as separately packaged
elements in this diagnostic assay system.
[0197] The packages discussed herein in relation to diagnostic
systems are those customarily utilized in diagnostic systems. Such
packages include glass and plastic (e.g., polyethylene,
polypropylene and polycarbonate) bottles, vials, plastic and
plastic-foil laminated envelopes and the like.
[0198] 2. Diagnostic Methods
[0199] The present invention contemplates any diagnostic method
that results in detecting anti-NANBV structural protein antibodies
or NANBV structural antigens in a body fluid sample using a NANBV
structural protein, fusion protein or anti-NANBV structural antigen
antibody of this invention as an immunochemical reagent to form an
immunoreaction product whose amount relates, either directly or
indirectly, to the amount of material to be detected in the sample.
Those skilled in the art will understand that there are numerous
well known clinical diagnostic chemistry procedures in which an
immunochemical reagent of this invention can be used to form an
immunoreaction product whose amount relates to the amount of
specified antibody or antigen present in a body sample.
[0200] Various heterogenous and homogenous protocols, either
competitive or noncompetitive, can be employed in performing an
assay method of this invention. Thus, while exemplary methods are
described herein, the invention is not so limited.
[0201] To detect the presence of anti-NANBV structural protein
antibodies in a patient, a bodily fluid sample such as blood,
plasma, serum, urine or saliva from the patient is contacted by
admixture under biological assay conditions with a NANBV structural
protein, and preferably with a fusion protein of the present
invention, to form an immunoreaction admixture. The admixture is
then maintained for a period of time sufficient to allow the
formation of a NANBV structural protein-antibody molecule
immunoreaction product (immunocomplex). The presence, and
preferably the amount, of complex can then be detected as described
herein. The presence of the complex is indicative of anti-NANBV
antibodies in the sample.
[0202] In preferred embodiments the presence of the immunoreaction
product formed between NANBV structural protein and a patient's
antibodies is detected by using a specific binding reagent as
discussed herein. For example, the immunoreaction product is first
admixed with a labeled specific binding agent to form a labeling
admixture. A labeled specific binding agent comprises a specific
binding agent and a label as described herein. The labeling
admixture is then maintained under conditions compatible with
specific binding and for a time period sufficient for any
immunoreaction product present to bind with the labeled specific
binding agent and form a labeled product. The presence, and
preferably amount, of labeled product formed is then detected to
indicate the presence or amount of immunoreaction product.
[0203] In preferred embodiments the diagnostic methods of the
present invention are practiced in a manner whereby the
immunocomplex is formed and detected in a solid phase, as disclosed
for the diagnostic systems herein.
[0204] Thus, in a preferred diagnostic method, the NANBV structural
protein is affixed to a solid matrix to form the solid phase. It is
further preferred that the specific binding agent is protein A, or
an anti-human Ig, such as IgC or IgM, that can complex with the
ant-NANBV structural protein antibodies immunocomplexed in the
solid phase with the NANBV structural protein. Most preferred is
the use of labeled specific binding agents where the label is a
radioactive isotope, an enzyme, biotin or a fluorescence marker
such as lanthanide as described for the diagnostic systems, or
detailed by references shown below.
[0205] In this solid phase embodiment, it is particularly preferred
to use a recombinant protein that contains the antigen defined by
the amino acid residue sequence shown in SEQ ID NO: 73 from residue
1 to residue 74, as embodied in the fusion protein as described in
Example 15.
[0206] In another preferred diagnostic method, the NANBV structural
protein of the invention is affixed to solid matrix as described
above, and dilutions of the biological sample are subjected to the
immunocomplexing step by contacting dilutions of sample with the
solid surface and removing non-bound materials. Due to the
multivalence of antibodies present in biological samples from
infected individuals (bivalent for IgC, pentavalent for IgM)
subsequent addition of labeled NANBV structural protein of the
invention to this admixture will become attached to the solid phase
by the sample antibody serving as a bridge between the solid phase
NANBV structural protein of the invention and the soluble, labeled
NANBV structural protein. The presence of label in the solid phase
indicates the presence and preferably the amount of specific
antibody in the sample. One skilled in the art can determine a
range of dilutions and determine therefrom a concentration of
labeled antigen in the solid phase. The biological sample and the
labeled NANBV structural protein of the invention can be admixed
prior to, or simultaneously with contacting the biological sample
with the solid phase allowing the trimolecular complex to form at
the solid phase by utilizing the bridging property of bivalent or
multivalent specific antibody. As a particularly useful label,
biotinylated NANBV structural protein of the invention can be the
labeled antigen, allowing the subsequent detection by addition of
an enzyme-streptavidin, or an enzyme-avidin complex, followed by
the appropriate substrate. Enzymes such as horse-radish peroxidase,
alkaline phosphatase, .beta.-galactosidase or urease are frequently
used and these, and other, along with several appropriate
substrates are commercially available. Preferred labels with a
marker which allows direct detection of the formed complex include
the use of a radioactive isotope, such as, e.g., iodine, or a
lanthanide chelate such as Europium.
[0207] In another embodiment designed to detect the presence of a
NANBV structural antigen in a body fluid sample from a patient, the
sample, (e.g. blood, plasma, serum, urine or saliva) is contacted
by admixture under biological assay conditions with an anti-NANBV
structural protein antibody of this invention, to form an
immunoreaction admixture. The admixture is then maintained for a
period of time sufficient to allow the formation of a
antigen-antibody immunoreaction product containing NANBV structural
antigens complexed with an antibody of this invention. The presence
and preferably amount, of complex can then be determined, thereby
indicating the presence of antigen in the body fluid sample.
[0208] In a preferred embodiment, the antibody is present in a
solid phase. Still further preferred, the amount of immunocomplex
formed is measured by a competition immunoassay format where the
antigen in a patient's body fluid sample competes with a labeled
recombinant antigen of this invention for binding to the solid
phase antibody. The method comprises admixing a body fluid sample
with (1) solid support having affixed thereto an antibody according
to this invention and (2) a labeled NANBV structural protein of
this invention to form a competition immunoreaction admixture that
has both a liquid phase and a solid phase. The admixture is then
maintained for a time period sufficient to form a labeled NANBV
structural protein-containing immunoreaction product in the solid
phase. Thereafter, the amount of label present in the solid phase
is determined, thereby indicating the amount of NANBV structural
antigen in the body fluid sample.
[0209] Enzyme immunoassay techniques, whether direct or competition
assays using homogenous or heterogenous assay formats, have been
extensively described in the art. Exemplary techniques can be found
in Maggio, Enzyme Immunoassay, CRC Press, Cleveland, Ohio (1981);
and Tijssen, "Practice and Theory of Enzyme Immunoassays",
Elsevier, Amsterdam (1988).
[0210] Biological assay conditions are those that maintain the
biological activity of the NANBV structural protein and the
anti-NANBV structural protein antibodies in the immunoreaction
admixture. Those conditions include a temperature range of about 4
C to about 45 C, preferably about 37 C, a pH value range of about 5
to about 9, preferably about 7, and an ionic strength varying from
that of distilled water to that of about one molar sodium chloride,
preferably about that of physiological saline. Methods for
optimizing such conditions are well known in the art.
[0211] Also contemplated are the immunological assays capable of
detecting the presence of immunoreaction product without the use of
a label. Such methods employ a "detection means", which means are
themselves well-known in clinical diagnostic chemistry and
constitute a part of this invention only insofar as they are
utilized with otherwise novel polypeptides, methods and systems.
Exemplary detection means include methods known as biosensors and
include biosensing methods based on detecting changes in the
reflectivity of a surface (surface plasmon resonance), changes in
the absorption of an evanescent wave by optical fibers or changes
in the propagation of surface acoustical waves.
[0212] Another embodiment contemplates detection of the
immunoreaction product employing time resolved fluorometry
(TR-FIA), where the label used is able to produce a signal
detectable by TR-FIA. Typical labels suitable for TR-FIA are
metal-complexing agents such as a lanthanide chelate formed by a
lanthanide and an aromatic beta-diketone, the lanthanide being
bound to the antigen or antibody via an EDTA-analog so that a
fluorescent lanthanide complex is formed.
[0213] The principle of time-resolved fluorescence is described by
Soini et al., Clin. Chem., 25:353-361 (1979), and has been
extensively applied to immunoassay. See for example, Halonen et
al., Current Topics in Microbiology and Immunology, 104:133-146
(1985); Suonpaa et al., Clinica Chimica Acta, 145:341-348 (1985);
Lovgren et al., Talanta, 31:909-916 (1984); U.S. Pat. Nos.
4,374,120 and 4,569,790; and published International Patent
Application Nos. EPO 139 675 and WO87/02708. A preferred lanthanide
for use in TR-FIA is Europium.
[0214] Regents and systems for practicing the TR-FIA technology are
available through commercial suppliers (Pharmacia Diagnostics,
Upsala, Sweden).
[0215] Particularly preferred are the solid phase immunoassays
described herein in Example 15, performed as a typical "Western
Blot".
[0216] The present diagnostic methods may be practiced in
combination with other separate methods for detecting the
appearance of anti-NANBV antibodies in specifies infected with
NANBV. For example, a composition of this invention may be used
together with commercially available C-100-3 antigen (Ortho
Diagnostics, Inc., Raritan, N.J.) in assays to determine the
presence of either or both antibody species immunoreactive with the
two antigens.
Example 9
Production of Recombinant DNA Molecules
[0217] A. Isolation of NANBV Clones and Sequence Analysis
[0218] (1) Isolation of NANBV RNA and Preparation of cDNA
[0219] As a source for NANB virions, blood was collected from a
chimpanzee infected with the Hutchinson (Hutch) strain exhibiting
acute phase NANBH. Plasma was clarified by centrifugation and
filtration. NANB virions were then isolated from the clarified
plasma by immunoaffinity chromatography on a column of NANBV IgC
(Hutch strain) coupled to protein G sepharose. NANBV RNA was eluted
from the sepharose beads by soaking in guanidinium thiocyanate and
the eluted RNA was then concentrated through a cesium chloride
(CsCl) cushion. Maniatis et al., Molecular Cloning: A Laboratory
Manual, Maniatis et al., eds. Cold Spring Harbor, N.Y. (1989).
[0220] The purified NANBV RNA was used as a template in a primer
extension reaction admixture containing random and oligo dT
primers, dNTP's, and reverse transcriptase to form first strand
cDNAs. The resultant first strand cDNAs were used as templates for
synthesis of second strand cDNAs in a reaction admixture containing
DNA polymerase I and RNAse H to form double stranded (ds) cDNAs
(Maniatis et al., Supra). The synthesized ds cDNAs were amplified
using an asymmetric synthetic primer-adaptor system wherein sense
and anti-sense primers were annealed to each other and ligated to
the ends of double stranded NANBV cDNAs with T4 ligase under
blunt-end conditions to form cDNA-adaptor molecules. Polymerase
chain reaction (PCR) amplification was performed by admixing the
cDNA-adaptor molecules with the same positive sense adaptor
primers, dNTP's and TAQ polymerase to prepare amplified NANBV
cDNAs. The resultant amplified NANBV cDNA sequences were then used
as templates for subsequent amplification in a PCR reaction with
specific NANBV oligonucleotide primers.
[0221] (2) Synthesis of Oligonucleotides For Use in NANBV
Cloning
[0222] Oligonucleotides were selected to correspond to the 5'
sequence of Hepatitis C which putatively encodes the NANBV
structural capsid and envelope proteins (HCJ1 sequence: Okamoto et
al., Jap. J. Exp. Med., 60:167-177, 1990). The selected
oligonucleotides were synthesized on a Pharmacia Gene Assembler
according to the manufacturer's instruction, purified by
polyacrylamide gel electrophoresis and have nucleotide base
sequences SEQ ID NOS. beginning with 32 and ending with 40 as shown
in Table 1.
TABLE-US-00003 TABLE 1 Synthetic Oligonucleotides Oligo- SEQ
nucleotide Putative NANBV Oligonucleotide ID Designation.sup.a
Region Sequence NO: 690 (+) Capsid 1-21 ATGAGCACGATTCCCAAACCT 32
693 (+) Capsid 146-162 GAGGAAGACTTCCGAGC 33 694 (-) Capsid 208-224
GTCCTGCCCTCGGGCCG 34 691 (-) Capsid 340-360 ACCCAAATTGCGCGACCTACG
35 14 (+) Envelope 356-374 TGGGTAAGGTCATCGATAC 36 15 (+) Envelope
361-377 AAGGTCATCGATACCCT 37 18 (-) Envelope 512-529
AGATAGAGAAAGAGCAAC 38 16 (-) Envelope 960-981
GGACCAGTTCATCATCATATAT 39 17 (-) Envelone 957-976
CAGTTCATCATCATATCCCA 40 .sup.aThe oligonucleotides are numerically
defined and their polarity is indicated as (+) and (-) for sense
and anti-sense, respectively.
[0223] (3) PCR Amplification of NANBV cDNA
[0224] PCR amplification was performed by admixing the
primer-adapted amplified cDNA sequences prepared in Example 9.A.(1)
with the synthetic oligonucleotides 690 and 694 as primer (primer
pairs 690:694). As noted above, 690 contains nucleotides 16-36 of
SEQ ID NO: 9 and 694 contains nucleotides 162-178 of SEQ ID NO: 9.
The resulting PCR reaction admixture contained the primer-adapted
amplified cDNA template, oligonucleotides 690 and 694, dNTP's,
salts (KCl and MgCl.sub.2) and TAQ polymerase. PCR amplification of
the cDNA was conducted by maintaining the admixture at a 37 C
annealing temperature for 30 cycles. Aliquots of samples from the
first round of amplification were reamplified at a 55 C annealing
temperature for 30 cycles under similar conditions.
[0225] (4) Preparation of Vectors Containing PCR Amplified ds
DNA
[0226] Aliquots from the second round of PCR amplification were
subjected to electrophoresis on a 5% acrylamide gel. After
separation of the PCR reaction products, the region of the gel
containing DNA fragments corresponding to the expected 690:694
amplified product of approximately 224 bp was excised and purified
following standard electroelution techniques (Maniatis et al.,
Supra). The purified fragments were kinased and cloned into the pUC
18 plasmid cloning vector at the Sma I polylinker site to form a
plasmid containing the DNA segment 690:694 operatively linked to
pUC 18.
[0227] The resulting mixture containing pUC 18 and a DNA segment
corresponding to the 690:694 sequence region was then transformed
into the E. coli strain JM83. Plasmids containing inserts were
identified as lac-(white) colonies on Xgal medium containing
ampicillin. pUC 18 plasmids which contained the 690:694 DNA segment
were identified by restriction enzyme analysis and subsequent
electrophoresis on agarose gels, and were designated pUC 18 690:694
rDNA molecules.
[0228] (5) Sequencing of Hepatitis Clones that Encode the Putative
Capsid Protein
[0229] Two independent colonies believed to contain a pUC 18 vector
having the NANBV Hutch strain 690:694 DNA segment (pUC 18 690:694)
that codes for the amino terminus of the putative capsid protein
were amplified and used to prepare plasmid DNA by CsCl density
gradient centrifugation by standard procedures (Maniatis et al.,
Supra). The plasmids were sequenced using .sup.35S dideoxy
procedures with pUC 18 specific primers. The two plasmids were
independently sequenced on both DNA strands to assure the accuracy
of the sequence. The resulting sequence information is presented as
nucleotides 1-224 of SEQ ID NO: 30.
[0230] Plasmid pUC 18 690:694 contains a NANBV DNA segment that is
224 bp in length and when compared to the HCJ1 prototype sequence
reveals two nucleotide substitutions and one amino acid residue
difference in the amino terminal region of the putative capsid
protein.
[0231] (6) Preparation of NANBV Clones from the 5' End of the
Genome
[0232] To obtain the sequence of the NANBV Hutch genome encoding
the remainder of the capsid region (Okamoto et al., Supra), the
oligonucleotides 693 and 691 SEQ ID NO: 33 and SEQ ID NO: 35
(described in Table 1) were used in PCR reactions. cDNA was
prepared as described in Example 9.A.(1) to viral NANBV RNA from
(Hutch) and used in PCR amplification as described in Example
9.A.(3) with the oligonucleotide pair 693:691. The resultant PCR
amplified ds DNA was then cloned into pUC 18 cloning vectors and
screened for inserts as described in Example 9.A.(4) to form pUC 18
693:691. Clones were then sequenced with pUC 18 specific primers as
described in Example 9.A.(5).
[0233] Plasmid pUC 18 693:691 contains a NANBV DNA segment that is
157 bp in length and spans nucleotides 203-360 (SEQ ID NO: 30). The
clone is not complete to the 693 primer used for generating the
fragment. The sequence of this fragment reveals three nucleotide
differences when compared to the known sequence of HCJ1 and does
not have any corresponding amino acid changes to the HCJ1
sequence.
[0234] To obtain the sequence of the NANBV Hutch genome encoding
the putative envelope region (Okamoto et al., Supra), the
oligonucleotide primers 14 (SEQ ID NO: 36) through 18 (SEQ ID NO:
38) (described in Table 1) were used in various combinations with
NANBV Hutch RNA samples. As a source of NANBV RNA, a liver biopsy
specimen from a chimpanzee inoculated with the Hutch strain at 4
weeks post-inoculation and exhibiting acute infection was used. The
biopsied sample was first frozen and then ground. The resultant
powder was then subjected to treatment with guanidine
isothiocyanate for the extraction of RNA. RNA was extracted from
the guanidium treated liver samples with phenol in the presence of
SDS at 65 C. The liver samples were extracted a second time, and
subjected to extraction with chloroform. The extracted RNA was
precipitated at -20 C with isopropanol and sodium acetate.
[0235] The purified liver-derived RNA was used as a template in
primer extension reactions with the oligonucleotides 18 (SEQ ID NO:
38) and 16 (SEQ ID NO: 39) to generate NANBV specific-cDNAs. To
prepare cDNA to the Hutch strain amino-terminal protein coding
sequences, anti-sense oligonucleotides, 18 (SEQ ID NO: 38) and 16
(SEQ ID NO: 39), were annealed to liver-derived Hutch RNA in the
presence of dNTPs and reverse transcriptase at 42 C to form primer
extension products. The first round of PCR amplification of the two
cDNAs was performed by admixing the primer extension reaction
products with separate pairs of oligonucleotides 14:16 (SEQ ID NO:
36:SEQ ID NO: 39) (16 primed DNA) and 14:18 (SEQ ID NO: 36:SEQ ID
NO: 38) (18 primed cDNA) for 30 cycles at 55 C annealing
temperature. The PCR reactions were performed on the above
admixture as in 9.A.(3). Aliquots from the 14:16 (SEQ ID NO: 36:SEQ
ID NO: 39) and 14:18 (SEQ ID NO: 36:SEQ ID NO: 38) amplifications
were used as templates for the second round of amplification in
which the oligonucleotide pairs 15:17 (SEQ ID NO: 37:SEQ ID NO: 40)
and 15:18 (SEQ ID NO: 37:SEQ ID NO: 38), respectively, were used as
primers.
[0236] PCR reaction products from each of the primer pair reactions
were analyzed by electrophoresis on low melt agarose gels.
Following separation, the regions of the gel containing DNA
fragments corresponding to the expected 15:17 (SEQ ID NO: 37:SEQ ID
NO: 40) and 15:18 (SEQ ID NO: 37:SEQ ID NO: 38) amplified products
of approximately 617 bp and 168 bp, respectively, were excised and
eluted from the gel slices at 65 C. The resultant eluted fragments
were purified by phenol and chloroform extractions. To clone the
15:17 (SEQ ID NO: 37:SEQ ID NO: 40) and 15:18 (SEQ ID NO: 37:SEQ ID
NO: 38) fragments, the purified fragments were separately treated
with the Klenow fragment of DNA polymerase and kinase for
subsequent subcloning into the Sma I site of the pBluescript
plasmid vector (Stratagene Cloning Systems, La Jolla, Calif.).
Transformed E. coli DH5 colonies were analyzed for plasmid insert
by restriction enzyme analysis as described in Example 9.A.(4).
[0237] pBluescript plasmid containing 15:17 (SEQ ID NO: 37:SEQ ID
NO: 40) or 15:18 (SEQ ID NO: 37:SEQ ID NO: 38) DNA segments were
purified using large scale CsCl plasmid preparation protocols. The
DNA segments present in the amplified and purified plasmids were
each sequenced as described in Example 9.A.(5).
[0238] The sequence of the 15:17 DNA (SEQ ID NO: 37:SEQ ID NO: 40)
segment is shown in SEQ ID NO: 30 from nucleotide 361 to 978. The
sequence of the 15:18 (SEQ ID NO: 37:SEQ ID NO: 38) DNA segment is
also presented in SEQ ID NO: 30 from nucleotide 361 to 529. These
two clones overlap by 168 bp of the 15:18 (SEQ ID NO: 37:SEQ ID NO:
38) DNA segment.
[0239] The sequence results indicate that the 15:17 (SEQ ID NO:
37:SEQ ID NO: 40) DNA segment differs by 30 nucleotides when
compared to the HCJ1 sequence (Okamoto et al., Supra) and also
differs by ten amino acid residues. The 15:18 (SEQ ID NO: 37:SEQ ID
NO: 38) DNA segment differs by seven nucleotides and by three amino
acid residues when compared to HCJ1. In the overlap region, the two
DNA segments differ at two nucleotide bases, namely, bases 510 and
511, where DNA segment 15:18 (SEQ ID NO: 37:SEQ ID NO: 38) contains
a T in place of a C and a G in place of an A, respectively, which
results in a change of a serine in place of a glycine amino acid
residue, at residue 171 of SEQ ID NO:73. The reason for these
differences is unknown and may be due to a PCR artifact.
[0240] B. Production of Recombinant DNA (rDNA) that Encodes a
Fusion Protein
[0241] (1) Isolation of the 690:694 Fragment from the pUC 18 Clone
and Introduction of the Fragment into the pGEX-3X Expression
Vector
[0242] The pUC 18 vector containing the 690:694 DNA segment was
subjected to restriction enzyme digestion with Eco RI and Bam HI to
release the DNA segment having a sequence shown in SEQ ID NO:30
from base 1 to base 224 from the pUC 18 vector. The released DNA
segment was subjected to acrylamide electrophoresis and a DNA
segment containing the 224 bp NANBV insert plus portions of the pUC
18 polylinker was then excised and eluted from the gel as described
in Example 9.A.(4). The DNA segment was extracted with a mixture of
phenol and chloroform, and precipitated.
[0243] The precipitated DNA segment was resuspended to a
concentration of 25 ug/ml in water and treated with the Klenow
fragment of DNA polymerase to fill in the staggered ends created by
the restriction digestion. The resultant blunt-ended 690:694
segment was admixed with the bacterial expression vector, pGEX-3X.
(Pharmacia Inc, Piscataway, N.J.) which was linearized with the
blunt end restriction enzyme Sma I. The admixed DNAs were then
ligated by maintaining the admixture overnight at 16 C in the
presence of ligase buffer and 5 units of T4 DNA ligase to form a
plasmid of 690:694 DNA segment operatively linked to PGEX-3X.
[0244] (2) Selection and Verification of Correct Orientation of
Ligated Insert
[0245] The ligation mixture containing the pGEX-3X and the 690:694
DNA segment was transformed into host E. coli strain W3110.
Plasmids containing inserts were identified by selection of host
bacteria containing vector in Luria broth (LB) media containing
ampicillin. Bacterial cultures at stationary phase were subjected
to alkaline lysis protocols to form a crude DNA preparation. The
DNA was digested with the restriction enzyme Xho I. The single Xho
I site, which cleaves within the 690:694 DNA segment between
nucleotide position 173-178 (SEQ ID NO:30), but not within the
pGEX-3X vector, was used to screen for vector containing the
690:694 DNA segment.
[0246] Several 690:694 DNA segment-containing vectors were
amplified and the resultant amplified vector DNA was purified by
CsCl density gradient centrifugation. The DNA was sequenced across
the inserted DNA segment ligation junctions by .sup.35S dideoxy
methods with a primer which hybridized to the pGEX-3X sequence at
nucleotide positions 614 to 633 shown in SEQ ID NO: 31. Vectors
containing 690:694 DNA segment having the correct coding sequence
for in-frame translation of a NANBV structural protein were thus
identified and selected to form pGEX-3X-690:694.
[0247] (3) Structure of the Fusion Protein
[0248] The pGEX-3X vector is constructed to allow for inserts to be
placed at the C terminus of Sj26, a 26-kDa glutathione
S-transferase (GST; EC 2.5.1.18) encoded by the parasitic helminth
Schistosoma japonicum. The insertion of the 690:694 NANBV fragment
in-frame behind Sj26 allows for the synthesis of the Sj26-NANBV
fusion polypeptide. The NANBV polypeptide can be cleaved from the
GST carrier by digestion with the site-specific protease factor Xa
(Smith et al., Gene, 67:31-40, 1988).
[0249] The nucleotide and predicted amino acid sequence of the
pGEX-3X-690:694 fusion transcript from the GST sequence through the
690:694 insert is presented in SEQ ID NO: 73 and SEQ ID NO: 74,
respectively. The resulting rDNA molecule, pGEX-3X-690:694, is
predicted to encode a NANBV fusion protein having the amino acid
residue sequence shown in SEQ ID NO: 74 from amino acid residue 1
to residue 315. The resulting protein product generated from the
expression of the plasmid is referred to as the NANBV capsid
protein amino terminus (CAP-N).
[0250] C. Production of Recombinant DNAs (rDNAs) that Encode NANBV
Capsid and Envelope Fusion Proteins
[0251] pGEX-3X-693:691: Plasmid pGEX-3X-693:691 was formed by first
subjecting the plasmid pUC 18 693:691 prepared in Example 9.A.(6)
to restriction enzyme digestion with Eco RI and Bam HI as performed
in Example 9.B.(1). The resultant released DNA segment having a
sequence shown in SEQ ID NO: 30 from base 205 to base 360 was
purified as performed in Example 9.B.(1). The purified DNA segment
was admixed with and ligated to the pGEX-3X vector which was
linearized by restriction enzyme digestion with Eco RI and Bam HI
in the presence of T.sub.4 ligase at 16 C to form the plasmid
pGEX-3X-693:691.
[0252] A pGEX-3X plasmid containing a 693:691 DNA segment was
identified by selection Example 9.B.(2) with the exception that
crude DNA preparations were digested with Eco RI and Bam HI to
release the 693:691 insert. A pGEX-3X vector containing a 693:691
DNA segment having the correct coding sequence for in-frame
translation of a NANBV structural protein was identified by
sequence analysis as performed in Example 9.B.(2) and selected to
form pGEX-3X-693:691.
[0253] The resulting vector encodes a fusion protein (GST:NANBV
693:691) that is comprised of an amino-terminal polypeptide portion
corresponding to residues 1-221 of GST as shown in SEQ ID NO: 74,
an intermediate polypeptide portion corresponding to residues
222-225 and defining a cleavage site for the protease Factor Xa, a
linker protein corresponding to residues 226-230 consisting of the
amino acid residue sequence (SEQ ID NO: 41):
TABLE-US-00004 Gly Ile Pro Asn Ser
encoded by the nucleotide base sequence (SEQ ID NO: 42):
TABLE-US-00005 GGG ATC CCC AAT TCA, respectively;
a carboxy-terminal polypeptide portion corresponding to residues
231-282 defining a NANBV capsid antigen as shown by the amino acid
residue sequence 69-120 in SEQ ID NO:73, and a carboxy-terminal
portion corresponding to residues 283-287 consisting of the amino
acid residue sequence (SEQ ID NO: 43):
TABLE-US-00006 Asn Ser Ser END.
encoded by the nucleotide base sequence (SEQ ID NO: 44):
TABLE-US-00007 AAT TCA TCG TGA, respectively.
[0254] pGEX-3X-15:18: Plasmid pGEX-3X-15:18 was formed by first
subjecting the plasmid Bluescript 15:18 prepared in Example 9.A.(6)
to restriction enzyme digestion with Eco RV and Bam HI and the Bam
HI cohesive termini were filled in as performed in Example 9.B.(1).
The resultant released DNA segment having a sequence shown in SEQ
ID NO: 30 from base 361 to base 528 was purified as performed in
Example 9.B.(1). The purified DNA segment was admixed with and
ligated to the pGEX-3X vector which was linearized by restriction
enzyme digestion with Sma I as performed in 9.B.(1) to form the
plasmid pGEX-3X-15:18.
[0255] A pGEX-3X plasmid containing a 15:18 DNA segment was
identified by selection as performed in Example 9.B.(2) and crude
DNA preparations were cut with Eco RI and Bam HI to release the
15:18 inserts. A pGEX-3X vector containing a 15:18 DNA segment
having the correct coding sequence for in-frame translation of a
NANBV structural protein was identified as performed in Example
9.B.(2) and selected to form pGEX-3X-15:18.
[0256] The resulting vector encodes a fusion protein (GST:NANBV
15:18) that is comprised of an amino-terminal polypeptide portion
corresponding to residues 1-221 of GST, an intermediate polypeptide
portion corresponding to residues 222-225 and defining a cleavage
site for the protease Factor Xa, a linker protein corresponding to
residues 226-234 consisting of the amino acid residue sequence (SEQ
ID NO: 45):
TABLE-US-00008 Gly Ile Pro Ile Glu Phe Leu Gln Pro,
encoded by the nucleotide base sequence (SEQ ID NO: 46):
TABLE-US-00009 GGG ATC CCC ATC GAA TTC CTG GAG CCC,
respectively; a carboxy-terminal polypeptide portion corresponding
to residues 235-290 defining a NANBV envelope antigen as shown by
the amino acid residue sequence 121-176 in SEQ ID NO: 73, and a
carboxy-terminal linker portion corresponding to residues 291-298
consisting of a amino acid residue sequence (SEQ ID NO: 47):
TABLE-US-00010 Trp Gly Ile Gly Asn Ser Ser END
encoded by the nucleotide base sequence (SEQ ID NO: 48):
TABLE-US-00011 TGG GGG ATC GGG AAT TCA TCG TGA,
respectively.
[0257] pGEX-3X-15:17: Plasmid pGEX-3X-15:17 was formed by first
subjecting the plasmid Bluescript 15:17 prepared in Example 9.A.(6)
to restriction enzyme digestion with Eco RI and Bam HI and the
cohesive termini were filled in as performed in Example 9.B.(1).
The resultant released DNA segment having a sequence shown in SEQ
ID NO: 30 from base 361 to base 978 was purified as performed in
Example 9.B.(1). The purified DNA segment was admixed with and
ligated to the pGEX-3X vector which was linearized by restriction
enzyme digestion with Sma I as performed in Example 9.B.(1) to form
the plasmid pGEX-3X-15:17.
[0258] A pGEX-3X plasmid containing a 15:17 DNA segment was
identified by selection as performed in Example 9.B.(2) and DNA
preparations were digested with Eco RI and Bam HI as indicated
above. pGEX-3X vector containing a 15:17 DNA segment having the
correct coding sequence for in-frame translation of a NANBV
structural protein was identified as performed in Example 9.B.(2)
and selected to form pGEX-3X-15:17.
[0259] The resulting vector encodes a fusion protein (GST:NANBV
15:17) that is comprised of an amino-terminal polypeptide portion
corresponding to residues 1-221 of GST, an intermediate polypeptide
portion corresponding to residues 222-225 and defining a cleavage
site for the protease Factor Xa, a linker protein corresponding to
residues 226-233 consisting of the amino acid residue sequence (SEQ
ID NO: 49):
TABLE-US-00012 Gly Ile Pro Asn Leu Arg Ser Pro
encoded by the nucleotide base sequence (SEQ ID NO: 50):
TABLE-US-00013 GGG ATC CCC AAT TCC TGC AGC CCT,
respectively; a carboxy-terminal polypeptide portion corresponding
to residues 234-439 defining a NANBV envelope antigen as shown by
the amino acid residue sequence 121-326 in SEQ ID NO: 73, and a
carboxy-terminal linker portion corresponding to residues 440-446
consisting of the amino acid residue sequence (SEQ ID NO: 51):
TABLE-US-00014 Gly Ile Gly Asn Ser Ser END
encoded by the nucleotide base sequence (SEQ ID NO: 52):
TABLE-US-00015 GGG ATC GGG AAT TCA TCG TGA, respectively.
[0260] pGEX-2T-15:17: Plasmid pGEX-2T-15:17 was formed by first
subjecting the plasmid Bluescript 15:17 prepared in Example 9.A.(6)
to restriction enzyme digestion with Eco RV and Bam HI and the Bam
HI cohesive termini were filled in as performed in Example 9.B.(1).
The resultant released DNA segment having a sequence shown in SEQ
ID NO: 30 from base 361 to base 978 was purified as performed in
Example 9.B.(1). The purified DNA segment was admixed with and
ligated to the pGEX-2T vector (Pharmacia, INC.) which was
linearized by restriction enzyme digestion with Sma I as performed
in Example 9.B.(1) to form the plasmid pGEX-2T-15:17.
[0261] A pGEX-2T plasmid containing a 15:17 DNA segment was
identified by selection as performed in Example 9.B.(2) and by
digestion of crude DNA preparations with Eco RI and Bam HI. A
pGEX-2T vector containing a 15:17 DNA segment having the correct
coding sequence for in-frame translation of a NANBV structural
protein was identified as performed in Example 9.B.(2) and selected
to form pGEX-2T-15:17.
[0262] The resulting vector encodes a fusion protein (GST:NANBV
15:17) that is comprised of an amino-terminal polypeptide portion
corresponding to residues 1-221 of GST, an intermediate polypeptide
portion corresponding to residues 222-226 and defining a cleavage
site for the protease Thrombin consisting of the amino acid residue
sequence (SEQ ID NO: 53):
TABLE-US-00016 Val Pro Arg Gly Ser
[0263] encoded by the nucleotide base sequence (SEQ ID NO: 54):
TABLE-US-00017 GTT CCG CGT GGA TCC, respectively;
a linker protein corresponding to residues 227-233 consisting of an
amino acid residue sequence (SEQ ID NO: 55):
TABLE-US-00018 Pro Ser Asn Leu Arg Ser Pro
encoded by a nucleotide base sequence (SEQ ID NO: 56):
TABLE-US-00019 CCA TCG AAT TCC TGC AGC CCT,
respectively; a carboxy-terminal polypeptide portion corresponding
to residues 234-439 defining a NANBV envelope antigen, and a
carboxy-terminal linker portion corresponding to residues 440-446
consisting of the amino acid residue sequence (SEQ ID NO: 57):
TABLE-US-00020 Gly Ile His Arg Asp END
encoded by the nucleotide base sequence (SEQ ID NO:58):
TABLE-US-00021 GGA ATT CAT CGT GAC TGA, respectively.
[0264] pGEX-3X-690:691: To obtain a DNA segment corresponding to
the NANBV Hutch sequence shown from SEQ ID NO: 30 from base 1 to
base 360, the oligonucleotides 690:691 are used in PCR reactions as
performed in Example 9.A.(6). The resultant PCR amplified ds DNA is
then cloned into pUC18 cloning vectors as described in Example
9A.(4) to form pUC 18 690:691. Clones are then sequenced with pUC
18 primers as described in Example 9.A.(5) to identify a plasmid
containing the complete sequence. The resulting identified plasmid
is selected, is designated pUC 18 690:691, and contains a NANBV DNA
segment that is 360 bp in length and spans nucleotides 1-360 (SEQ
ID NO: 30).
[0265] Plasmid pGEX-3X-690:691 is formed by first subjecting the
plasmid pUC 18 690:691 to restriction enzyme digestion with Eco RI
and Bam HI as performed in Example 9.B.(1). The resultant released
DNA segment having a sequence shown in SEQ ID NO: 30 from base 1 to
base 360 with pUC 18 polylinker sequence is purified as performed
in Example 9.B.(1). The purified DNA segment is admixed with and
ligated to the pGEX-3X vector which is linearized by restriction
enzyme digestion with Sma I as performed in Example 9.B.(1) to form
the plasmid pGEX-3X-690:691.
[0266] A pGEX-3X plasmid containing a 690:691 DNA segment is
identified by selection as performed in Example 9.B.(2). pGEX-3X
vector containing a 690:691 DNA segment having the correct coding
sequence for in-frame translation of a NANBV structural protein is
identified as performed in Example 9.B.(2) and selected to form
pGEX-3X-690:691.
[0267] The resulting vector encodes a fusion protein (GST:NANBV
690:691) that is comprised of an amin-terminal polypeptide portion
corresponding to residues 1-221 of GST, an intermediate polypeptide
portion corresponding to residues 222-225 and defining a cleavage
site for the protease Factor Xa, a linker protein corresponding to
residues 226-234 consisting of the amino acid residue sequence (SEQ
ID NO: 59):
TABLE-US-00022 Gly Ile Pro Asn Ser Ser Ser Val Pro
encoded by the nucleotide base sequence (SEQ ID NO: 60):
TABLE-US-00023 GGG ATC CCC AAT TCG AGC TCG GTA CCC
respectively; a carboxy-terminal polypeptide portion corresponding
to residues 235-355 defining a NANBV capsid antigen, and a
carboxy-terminal linker portion corresponding to residues 356-363
consisting of the amino acid residue sequence (SEQ ID NO: 61):
TABLE-US-00024 Thr Gly Ile Gly Asn Ser Ser END
encoded by the nucleotide base sequence (SEQ ID NO: 62):
TABLE-US-00025 ACG GGG ATC GGG AAT TCA TCG TGA,
respectively.
Example 10
Expression of the NANBV 690:694 Fusion Protein Using rDNA
[0268] The bacterial colonies which contain the pGEX-3X-690:694
plasmid in the correct orientation were selected examine the
properties of the fusion protein. Bacterial cultures of
pGEX-3X-690:694 were grown to a stationary phase in the presence of
ampicillin (50 ug/ml final concentration) at 37 C. This culture was
inoculated at a 1:50 dilution into fresh LB medium at 37 C in the
presence of ampillicin and maintained at 37 C. with agitation at
250 rpm until the bacteria reached an optical density of 0.5 when
measured using a spectrometer with a 550 nm wavelength light source
detector. Isopropylthio-beta-D-galactoside (IPTG) was then admixed
to the bacterial culture at a final concentration of 1 mM to
initiate (induce) the synthesis of the fusion proteins under the
control of the tac promoter in the pGEX-3X vector.
[0269] Beginning at zero time and at one hour intervals thereafter
for three hours following admixture with IPTG (i.e., the induction
phase), the bacterial culture was maintained as above to allow
expression of recombinant protein. During this maintenance phase,
the optical density of the bacterial culture was measured and 1 ml
aliquots were removed for centrifugation. Each resultant cell
pellet containing crude protein lysate was resuspended in Laemmli
dye mix containing 1% beta-mercaptoethanol at a final volume of 50
microliters (ul) for each 0.5 OD 550 unit. Samples were boiled for
15 minutes and 10 ul of each sample was electrophoresed on a 10%
SDS-PAGE Laemmli gel.
Example 11
Detection of Expressed Fusion Proteins
[0270] To visualize the IPTG-induced fusion proteins, the Laemmli
gels were stained with Coomassie Blue and destained in acetic acid
and methanol. Induced proteins from separate clones were examined
and compared on the basis of the increase of a protein band in the
predicted size range from time zero to time three hours post-IPTG
treatment. Expression of fusion protein was observed in clones that
exhibited an increase from zero time of the intensity of a protein
band corresponding to the fusion protein.
Example 12
Western Blot Analysis
[0271] Samples from IPTG inductions were separated by gel
electrophoresis and were transferred onto nitrocellulose for
subsequent immunoblotting analysis. The nitrocellulose filter was
admixed with antibody blocking buffer (20 mM sodium phosphate, pH
7.5, 0.5 M sodium chloride, 1% bovine serum albumin, and 0.05%
Tween 40) for 3 to 12 hours at room temperature. Sera from humans
or chimpanzees with NANB hepatitis believed to contain antibody
immunoreactive with NANBV structural protein was diluted 1:500 in
the antibody blocking buffer and admixed with the nitrocellulose
and maintained for 12 hours at room temperature to allow the
formation of an immunoreaction product on the solid phase. The
nitrocellulose was then washed three times in excess volumes of
antibody blocking buffer. The washes were followed by admixture of
the nitrocellulose with 50 ul of .sup.125I protein A (New England
Nuclear, Boston, Mass.) at a 1:500 dilution in antibody blocking
buffer for one hour at room temperature to allow the labeled
protein A to bind to any immunoreaction product present in the
solid phase on the nitrocellulose. The nitrocellulose was then
washed as described herein, dried and exposed to X-ray film for one
to three hours at -70 C in order to visualize the label and
therefore any immunoreaction product on nitrocellulose. Results of
the Western blot immunoassay are shown in Tables 2 through 6.
Samples prepared using pGEX-3X vector that produces control GST
were also prepared as above and tested using the Western blot
procedure as a control. No expressed protein (GST) was detectable
having immunoreactivity with the sera shown to immunoreact with a
fusion protein of this invention (GST:NANBV 690:694 fusion
protein).
Example 13
Purification of the Expressed GST:NANBV 690:694 Fusion Protein
[0272] Cultures of E. coli strain W3110 transformed with
recombinant pGEX-3.times.690:694 plasmids prepared in Example 10
were cultured for 3 hours following IPTG induction treatment. The
cells were then centrifuged to form a bacterial cell pellet, the
cells were resuspended in 1/200 culture volume in lysis buffer
(MTPBS: 150 mM NaCl, 16 mM Na.sub.2HPO.sub.4, 4 mM
NaH.sub.2PO.sub.4, pH 7.3), and the cell suspension was lysed with
a French pressure cell. Triton X-100 was admixed to the cell lysate
to produce a final concentration of 1%. The admixture was
centrifuged at 50,000.times.g for 30 minutes at 4 C. The resultant
supernatant was collected and admixed with 2 ml of 50% (w/v)
glutathione agarose beads (Sigma, St. Louis, Mo.) preswollen in
MTPBS. After maintaining the admixture for 5 minutes at 25 degrees
C. to allow specific affinity binding between GST and glutathione
in the solid phase, the beads were collected by centrifugation at
1000.times.g and washed in MTPBS three times.
[0273] The GST:NANBV 690:694 fusion protein was eluted from the
washed glutathione beads by admixture and incubation of the
glutathione beads with 2 ml of 50 mM Tris HCl, pH 8.0, containing 5
mM reduced glutathione for 2 minutes at 25 degrees C. to form
purified GST:NANBV 690:694 fusion protein.
[0274] The above affinity purification procedure produced greater
than 95% pure fusion protein as determined by SDS PAGE. That is,
the purified protein was essentially free of procaryotic antigen
and non-structural NANBV antigens as defined herein.
[0275] Alternatively, GST:NANBV 690:694 fusion protein was purified
by anion exchange chromatography. Cultures were prepared as
described above and cell pellets were resuspended in 8M guanidine
and maintained overnight at 4 C to solubulize the fusion protein.
The cell suspension was then applied to an S-300 sepharose
chromatography column and peak fractions containing the GST:NANBV
690:694 fusion protein were collected, pooled, dialyzed in 4 M urea
and subjected to anion exchange chromatography to form purified
fusion protein.
Example 14
Protease Cleavage of Purified GST:NANBV 690:694 Fusion Protein
[0276] Purified GST:NANBV 690:694 fusion protein prepared in
Example 13 is subjected to treatment with activated Factor (Xa)
(Sigma) to cleave the GST carrier from the NANBV 690:694 fusion
protein (Smith et al., Supra). Seven ug of Factor X are activated
prior to admixture with purified fusion proteins by admixture and
maintenance with 75 nanograms (ng) activation enzyme, 8 mM Tris Hcl
(pH 8.0), 70 mM NaCl and 8 mM CaCl2 at 37 C for 5 minutes. Fifty ug
of purified fusion protein are then admixed with 500 ng activated
human factor Xa in the elution buffer described in Example 13
containing 50 mM Tris Hcl, 5 mM reduced glutathione, 100 mM NaCl,
and 1 mM CaCl2, and maintained at 25 C for 30 minutes. The
resulting cleavage reaction products are then absorbed on
glutathione-agarose beads prepared in Example 13 to affinity bind
and separate free GST from any cleaved NANBV structural
antigen-containing protein. Thereafter the liquid phase is
collected to form a solution containing purified NANBV structural
protein having an amino acid residue sequence shown in SEQ ID NO:
74 from residue 226 to residue 315.
Example 15
Immunological Detection of Anti-NANBV Structural Protein
Antibodies
[0277] NANBV Hutch strain virus was injected in chimpanzees and
blood samples were collected at various intervals to analyze the
immunological response to NANBV by five different diagnostic
assays. Chimpanzees were categorized as either being in the acute
or chronic phase of infection. The assays utilized in the
evaluation of the immune response include: 1) Alanine
aminotransferase (ALT) enzyme detection (Alter et al., JAMA,
246:630-634, 1981; Aach et al., N. Engl. J. Med., 304:989-994,
1981); 2)
[0278] Histological evaluation for NANBV virions by electron
microscopy (EM); 3) Detection of anti-HCV antibodies using the
commercially available kit containing C-100-3 antigen (Ortho
Diagnostics, Inc.); 4) Detection of anti-CAP-N antibodies by
immunoblot analysis as described in Example 12; and 5) Detection of
virus by PCR amplification as described in Example 9.
[0279] In Table 2, results are presented from ALT, EM, anti-HCV,
anti-CAP-N, and PCR assays on sera from a chimpanzee with acute
NANB Hepatitis.
TABLE-US-00026 TABLE 2 CHIMP 59 -ACUTE NANB HEPATITIS WEEK POST
ANTI PCR INNOC ALT EM ANTI HCV CAP-N.sup.1 690-691 8 26 ++ - - - 10
26 + - + - 12 107 + - + - 14 115 + + + - 16 26 + + + + 18 17 ND + +
(+) 20 11 ND + + - .sup.1A plus (+) indicates immunoreaction was
observed between admixed serum and the fusion protein, designated
"CAP-N" because it corresponds to the amino terminal of the
putative NANBV capsid protein, using the Western blot immuonassay
described in Example 12.
[0280] The results in Table 2 show immunoreaction between fusion
protein and anti-NANBV structural protein antibodies in the sera
tested. Furthermore, seroconversion is detectable by the
immunoassay using fusion protein containing capsid antigen at times
earlier than when the same sera is assayed in the C-100-3-based
immunoassay.
[0281] In Table 3, results are presented from ALT, anti-HCV and
anti-CAP-N assays on sera collected from a human with definitive
NANB Hepatitis.
TABLE-US-00027 TABLE 3 NYU - 169 - DEFINITIVE NANB HEPATITIS Week
Post Anti Anti Infect ALT HCV CAP-N 2 34 - - 6 8 - - 10 150 - - 12
118 - - 14 183 - + 16 317 - + 19 213 - + 23 53 - +
[0282] The results in Table 3 show that in the human series 169
seroconversion sera samples, the CAP-N antigen present in the
fusion protein detects NANBV-specific antibodies as early as 14
weeks post inoculation, whereas the C-100-3 based immunoassy does
not detect any anti-NANBV antibody at the times studied.
[0283] In Table 4, results are presented from ALT, EM, anti-HCV,
and anti-CAP-N assays on sera from a chimpanzee with a self limited
infection presented.
TABLE-US-00028 TABLE 4 CHIMP 213 - SELF LIMITED INFECTION Week Post
Anti Innoc ALT EM Anti HCV CAP-N 4 24 + - + 6 34 + - + 8 38 + - +
13 28 ND - + 16 25 ND - + 18 23 ND + + 20 25 - + +
[0284] The results in Table 4 show that the CAP-N antigen detects
anti-NANBV antibodies earlier than the C-100-3 antigen when using
sera sampled during the course of a self-limiting NANBV
infection.
[0285] In Table 5, results are presented from ALT, anti-HCV and
anti-CAP-N assays on sera from a chimpanzee that converted from an
acute infection profile to a chronic one.
TABLE-US-00029 TABLE 5 CHIMP 10 - ACUTE/CHRONIC NANB HEPATITIS Week
Post Peak Anti Anti Symptoms Innoc ALT HCV CAP-N acute 2 223 - +
chronic 40 223 + + chronic 42 223 + + chronic 44 223 + + chronic 51
223 + -
[0286] The results in Table 5 indicate that the CAP-N antigen
preferentially detects anti-NANBV antibodies in acute stages of
NANBV infection.
[0287] In Table 6, results are presented from ALT, EM, anti-HCV and
anti-Cap-N assays on sera collected at various intervals from
several chimpanzees with acute or chronic NANB Hepatitis.
TABLE-US-00030 TABLE 6 Week Post Week Post Peak Anti Anti Innoc Alt
Elev ALT HCV CAP-N ADDITIONAL ACUTE SERA 2 +1 73 - + 14 +2 66 - + 6
+2 197 - + 11 +1 151 - - 8 +4 125 - + 15 +1 82 - + 12 -4 73 ND +
ADDITIONAL CHRONIC SERA 156 +131 110 + + 156 - 89 + + 160 - 89 +
+
[0288] The results in Table 6 indicate that the CAP-N antigen more
often detected anti-NANBV antibodies in sera from acutely infected
individuals than did the C-100-3 antigen.
[0289] The results of Tables 2-6 show that the NANBV structural
protein of the invention, in the form of a fusion protein
containing CAP-N antigen and produced by the vector
pGEX-3X-690:694, detects antibodies in defined seroconversion at
times in an infected patient or chimpanzee earlier than detectable
by present state of the art methods using the C-100-3 antigen. In
addition, the results show that CAP-N antigen is particularly
useful to detect acute NANBV infection early in the infection.
[0290] Taken together, the results indicate that patients infected
with NANBV contain circulating antibodies in their blood that are
immunospecific for NANBV antigen designated herein as structural
antigens, and particularly are shown to immunoreact with the
putative capsid antigen defined by CAP-N. These antibodies are
therefore referred to as anti-NANBV structural protein antibodies
and are to be distinguished from the class of antibodies previously
detected using the NANBV non-structural protein antigen
C-100-3.
[0291] pGEX-2T-CAP-A: Oligonucleotides 1-20 (+) and 1-20 (-) for
constructing the vector pGEX-2T-CAP-A for expressing the CAP-A
fusion protein were prepared as described in Example 9A(2) having
nucleotide base sequences corresponding to SEQ ID NO: 63 and SEQ ID
NO: 64, respectively.
[0292] Oligonucleotides 1-20 (+) and 1-20 (-) were admixed in equal
amounts with the expression vector pGEX-2T (Pharmacia) that had
been predigested with Eco RI and Bam HI and maintained under
annealing conditions to allow hybridization of the complementary
oligonucleotides and to allow the cohesive termini of the resulting
double-stranded (ds) oligonucleotide product to hybridize with
pGEX-2T at the Eco RI and Bam HI cohesive termini. After ligation
the resulting plasmid designated pGEX-2T-CAP-A contains a single
copy of the ds oligonucleotide product and a structural gene coding
for a fusion protein designated CAP-A having an amino acid residue
sequence (encoded by nucleotide sequence SEQ ID NO: 65) shown in
SEQ ID NO: 75 from residue 1 to residue 252.
[0293] The pGEX-2T vector is similar to the pGEX-3X vector
described above, except that the resulting fusion protein is
cleavable by digestion with the site specific protease
thrombin.
[0294] pGEX-2T-CAP-B: Oligonucleotides 21-40 (+) and 21-40 (-) for
constructing the vector pGEX-2T-CAP-B for expressing the CAP-B
fusion protein were prepared as described in Example 9A(2) having
nucleotide base sequences corresponding to SEQ ID NO: 66 and SEQ ID
NO: 67, respectively.
[0295] Oligonucleotides 21-40 (+) and 21-40 (-) were admixed in
equal amounts with the pGEX-2T expression vector that had been
predigested with Eco RI and Bam HI and maintained under annealing
conditions to allow hybridization of the complementary
oligonucleotides and to allow the cohesive termini of the resulting
double-stranded oligonucleotide product to hybridize with pGEX-2T
at the Eco RI and Bam HI cohesive termini. After ligation the
resulting plasmid designated as pGEX-2T-CAP-B contains a single
copy of the ds oligonucleotide product and contains a structural
gene coding for a fusion protein designated CAP-B having an amino
acid residue sequence (encoded by nucleotide sequence SEQ ID NO:
68) shown in SEQ ID NO: 76 from residue 1 to residue 252.
[0296] pGEX-2T-CAP-A-B: Oligonucleotides for constructing the
vector pGEX-2T-CAP-A-B for expressing the CAP-A-B fusion protein
were prepared as described in Example 9A(2) having nucleotide base
sequences corresponding to SEQ ID NO: 69 and SEQ ID NO: 70,
respectively.
[0297] Oligonucleotides according to SEQ ID NO: 69 and SEQ ID NO:
70 were admixed in equimolar amounts with the plasmid
pGEX-3X-690:694 described in Example 9B(2). The admixture was
combined with the reagents for a polymerase chain reaction (PCR)
and the two admixed oligonucleotides were used as primers on the
admixed pGEX-3X-690:694 as template in a PCR reaction to form a PCR
extension product consisting of a double-stranded nucleic acid
molecule that encodes the amino acid residue sequence contained in
SEQ ID NO: 73 from residue 2 to 40 and also includes PCR-added
restriction sites for Bam HI at the 5' terminus and Eco RI at the
3' terminus. The PCR extension product was then cleaved with the
restriction enzymes Bam HI and Eco RI to produce cohesive termini
on the PCR extension product. The resulting product with cohesive
termini was admixed in equal amounts with the pGEX-2T expression
vector that had been predigested with Eco RI and Bam HI and
maintained under annealing conditions to allow the cohesive termini
of the double-stranded PCR extension product to hybridize with
pGEX-2T at the Eco RI and Bam HI cohesive termini. After ligation
the resulting plasmid designated pGEX-2T-CAP-A-B contains a single
copy of the double-stranded PCR extension product and contains a
structural gene coding for a fusion protein designated CAP-A-B
having an amino acid residue sequence shown in SEQ ID NO: 72 from
residue 1 to residue 271.
[0298] In Table 7, comparative results are presented from anti-HCV
capsid fusion protein assays according to the basic immunoblot
assay described in Example 12 using various chimp and human sera on
the following HCV capsid fusion proteins: CAP-N, CAP-A, CAP-B and
CAP-C.
TABLE-US-00031 TABLE 7 SERA TYPE.sup.a CAP-N.sup.b CAP-A.sup.c
CAP-B.sup.d CAP-C.sup.e C18 Chimp 10 (A) +++ + + - C10 Chimp 194
(A) +++ +++ +++ - 59-16 Chimp 59 (A) +++ + +++ ND 59-12 Chimp 59
(A) .sup. ND.sup.f ++ +++ - C9 Chimp 181 (A) +++ - +++ - 213-18
Chimp 213 (A) ND + + - C2 Chimp 10 (C) ++ - - - C1 Chimp 10 (C) +++
- - - C19 Chimp 10 (C) +++ - - - C4 Chimp 68 (C) +++ +++ +++ ND
169-16 Human ND +++ +++ - 169-23 Human ND +++ +++ - 191-1 Human + +
+ ND 191-2 Human + + ++ ND 191-3 Human + + + ND 216-1 Human - +/-
+/- ND 216-2 Human + + + ND 216-3 Human + + + ND .sup.aThe type of
sera tested is indicated by the species (chimp or human), a chimp
identification number if the sample is from a chimp, and a
designation (in parenthesis) if the sera donor exhibits acute (A)
or chronic (C) HCV infection at the time the sera was sampled.
.sup.bCAP-N indicates the GST:NANBV 690:694 fusion protein produced
in Example 13 that includes HCV capsid protein residues 1-74.
.sup.cCAP-A indicates the GST:NANBV fusion protein produced in
Example 13 that includes HCV capsid protein residues 1-20.
.sup.dCAP-B indicates the GST:NANBV fusion protein produced in
Example 13 that includes HCV capsid protein residues 21-40.
.sup.eCAP-C indicates the GST:NANBV fusion protein produced in
Example 13 that includes HCV capsid protein residues 41-60.
.sup.f+, ++ and +++ indicate relative amounts of anti-HCV capsid
antibody immunization product detected by the western blot assay,
where + indicates a weak band after overnight exposure of the x-ray
film, ++ indicates a strong band after overnight exposure of the
x-ray film, +++ indicates a strong band after 1 to 2 hours exposure
of the x-ray film, and +/- or - indicates a faint or no band,
respectively, after overnight exposure of the x-ray film.
.sup.g"ND" indicates not tested.
[0299] The results shown in Table 7 indicate that fusion proteins
containing the CAP-A antigen or CAP-B antigen are immunoreactive
with antibodies present in sera from HCV-infected humans or chimps.
In addition, CAP-C antigen does not significantly immunoreact with
sera from HCV infected humans or chimps.
[0300] Other GST:NANBV fusion proteins described herein were also
expressed in cultures of E. coli Strain W3110 as described above
using the GST fusion protein vectors produced in Example 9 after
their introduction by transformation into the E. coli host. After
induction and lysis of the cultures, the GST fusion proteins were
purified as described above using glutathione agarose affinity
chromatography to yield greater than 95% pure fusion protein as
determined by SDS-PAGE. Thus, CAP-A, CAP-B and CAP-C fusion
proteins were all expressed and purified as above using the
pGEX-2T-CAP-A vector, the pGEX-2T-CAP-B vector, or the
pGEX-2T-CAP-C vector, respectively, and CAP-A-B fusion protein is
expressed and purified using the PGEX-2T-CAP-A-B vector.
Sequence CWU 1
1
761795DNAHuman immunodeficiency virusCDS(16)..(789) 1aggagggttt
ttcat atg cca atc gtg cag aac atc cag ggg caa atg gta 51Met Pro Ile
Val Gln Asn Ile Gln Gly Gln Met Val1 5 10cat cag gcc ata tca cct
aga act tta aat gca tgg gta aaa gta gta 99His Gln Ala Ile Ser Pro
Arg Thr Leu Asn Ala Trp Val Lys Val Val15 20 25gaa gag aag gct ttc
agc cca gaa gtg ata ccc atg ttt tca gca tta 147Glu Glu Lys Ala Phe
Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu30 35 40tca gaa gga gcc
acc cca caa gat tta aac acc atg cta aac aca gtg 195Ser Glu Gly Ala
Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val45 50 55 60ggg gga
cat caa gca gcc atg caa atg tta aaa gag acc atc aat gag 243Gly Gly
His Gln Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu65 70 75gaa
gct gca gaa tgg gat aga gtg cat cca gtg cat gca ggg cct att 291Glu
Ala Ala Glu Trp Asp Arg Val His Pro Val His Ala Gly Pro Ile80 85
90gca cca ggc cag atg aga gaa cca agg gga agt gac ata gca gga act
339Ala Pro Gly Gln Met Arg Glu Pro Arg Gly Ser Asp Ile Ala Gly
Thr95 100 105act agt acc ctt cag gaa caa ata gga tgg atg aca aat
aat cca cct 387Thr Ser Thr Leu Gln Glu Gln Ile Gly Trp Met Thr Asn
Asn Pro Pro110 115 120atc cca gta gga gaa att tat aaa aga tgg ata
atc ctg gga tta aat 435Ile Pro Val Gly Glu Ile Tyr Lys Arg Trp Ile
Ile Leu Gly Leu Asn125 130 135 140aaa ata gta aga atg tat agc cct
acc agc att ctg gac ata aga caa 483Lys Ile Val Arg Met Tyr Ser Pro
Thr Ser Ile Leu Asp Ile Arg Gln145 150 155gga cca aag gaa ccc ttt
aga gac tat gta gac cgg ttc tat aaa act 531Gly Pro Lys Glu Pro Phe
Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr160 165 170cta aga gcc gag
caa gct tca cag gag gta aaa aat tgg atg aca gaa 579Leu Arg Ala Glu
Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu175 180 185acc ttg
ttg gtc caa aat gcg aac cca gat tgt aag act att tta aaa 627Thr Leu
Leu Val Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu Lys190 195
200gca ttg gga cca gcg gct aca cta gaa gaa atg atg aca gca tgt cag
675Ala Leu Gly Pro Ala Ala Thr Leu Glu Glu Met Met Thr Ala Cys
Gln205 210 215 220gga gta gga gga ccc aaa aat caa caa tta tta tcc
tta tgg ggg tgt 723Gly Val Gly Gly Pro Lys Asn Gln Gln Leu Leu Ser
Leu Trp Gly Cys225 230 235aaa ggg aaa ctt gtt tgt tat act tcc gtt
aaa tgg aat gga ccc ggc 771Lys Gly Lys Leu Val Cys Tyr Thr Ser Val
Lys Trp Asn Gly Pro Gly240 245 250cat aag gca aga gtt ttg taataa
795His Lys Ala Arg Val Leu2552258PRTHuman immunodeficiency virus
2Met Pro Ile Val Gln Asn Ile Gln Gly Gln Met Val His Gln Ala Ile1 5
10 15Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Val Val Glu Glu Lys
Ala20 25 30Phe Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu Ser Glu
Gly Ala35 40 45Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val Gly
Gly His Gln50 55 60Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu
Glu Ala Ala Glu65 70 75 80Trp Asp Arg Val His Pro Val His Ala Gly
Pro Ile Ala Pro Gly Gln85 90 95Met Arg Glu Pro Arg Gly Ser Asp Ile
Ala Gly Thr Thr Ser Thr Leu100 105 110Gln Glu Gln Ile Gly Trp Met
Thr Asn Asn Pro Pro Ile Pro Val Gly115 120 125Glu Ile Tyr Lys Arg
Trp Ile Ile Leu Gly Leu Asn Lys Ile Val Arg130 135 140Met Tyr Ser
Pro Thr Ser Ile Leu Asp Ile Arg Gln Gly Pro Lys Glu145 150 155
160Pro Phe Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr Leu Arg Ala
Glu165 170 175Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu Thr
Leu Leu Val180 185 190Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu
Lys Ala Leu Gly Pro195 200 205Ala Ala Thr Leu Glu Glu Met Met Thr
Ala Cys Gln Gly Val Gly Gly210 215 220Pro Lys Asn Gln Gln Leu Leu
Ser Leu Trp Gly Cys Lys Gly Lys Leu225 230 235 240Val Cys Tyr Thr
Ser Val Lys Trp Asn Gly Pro Gly His Lys Ala Arg245 250 255Val
Leu3795DNAHuman immunodeficiency virusCDS(16)..(789) 3aggagggttt
ttcat atg cca atc gtg cag aac atc cag ggg caa atg gta 51Met Pro Ile
Val Gln Asn Ile Gln Gly Gln Met Val1 5 10cat cag gcc ata tca cct
aga act tta aat gca tgg gta aaa gta gta 99His Gln Ala Ile Ser Pro
Arg Thr Leu Asn Ala Trp Val Lys Val Val15 20 25gaa gag aag gct ttc
agc cca gaa gtg ata ccc atg ttt tca gca tta 147Glu Glu Lys Ala Phe
Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu30 35 40tca gaa gga gcc
acc cca caa gat tta aac acc atg cta aac aca gtg 195Ser Glu Gly Ala
Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val45 50 55 60ggg gga
cat caa gca gcc atg caa atg tta aaa gag acc atc aat gag 243Gly Gly
His Gln Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu65 70 75gaa
gct gca gaa tgg gat aga gtg cat cca gtg cat gca ggg cct att 291Glu
Ala Ala Glu Trp Asp Arg Val His Pro Val His Ala Gly Pro Ile80 85
90gca cca ggc cag atg aga gaa cca agg gga agt gac ata gca gga act
339Ala Pro Gly Gln Met Arg Glu Pro Arg Gly Ser Asp Ile Ala Gly
Thr95 100 105act agt acc ctt cag gaa caa ata gga tgg atg aca aat
aat cca cct 387Thr Ser Thr Leu Gln Glu Gln Ile Gly Trp Met Thr Asn
Asn Pro Pro110 115 120atc cca gta gga gaa att tat aaa aga tgg ata
atc ctg gga tta aat 435Ile Pro Val Gly Glu Ile Tyr Lys Arg Trp Ile
Ile Leu Gly Leu Asn125 130 135 140aaa ata gta aga atg tat agc cct
acc agc att ctg gac ata aga caa 483Lys Ile Val Arg Met Tyr Ser Pro
Thr Ser Ile Leu Asp Ile Arg Gln145 150 155gga cca aag gaa ccc ttt
aga gac tat gta gac cgg ttc tat aaa act 531Gly Pro Lys Glu Pro Phe
Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr160 165 170cta aga gcc gag
caa gct tca cag gag gta aaa aat tgg atg aca gaa 579Leu Arg Ala Glu
Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu175 180 185acc ttg
ttg gtc caa aat gcg aac cca gat tgt aag act att tta aaa 627Thr Leu
Leu Val Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu Lys190 195
200gca ttg gga cca gcg gct aca cta gaa gaa atg atg aca gca tgt cag
675Ala Leu Gly Pro Ala Ala Thr Leu Glu Glu Met Met Thr Ala Cys
Gln205 210 215 220gga gta gga gga ccc aaa aat caa caa aga tta aat
tta tgg ggg tgt 723Gly Val Gly Gly Pro Lys Asn Gln Gln Arg Leu Asn
Leu Trp Gly Cys225 230 235aaa ggg aaa ctt att tgt tat act tcc gtt
aaa tgg aat gga ccc ggc 771Lys Gly Lys Leu Ile Cys Tyr Thr Ser Val
Lys Trp Asn Gly Pro Gly240 245 250cat aag gca aga gtt ttg taataa
795His Lys Ala Arg Val Leu2554258PRTHuman immunodeficiency virus
4Met Pro Ile Val Gln Asn Ile Gln Gly Gln Met Val His Gln Ala Ile1 5
10 15Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Val Val Glu Glu Lys
Ala20 25 30Phe Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu Ser Glu
Gly Ala35 40 45Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val Gly
Gly His Gln50 55 60Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu
Glu Ala Ala Glu65 70 75 80Trp Asp Arg Val His Pro Val His Ala Gly
Pro Ile Ala Pro Gly Gln85 90 95Met Arg Glu Pro Arg Gly Ser Asp Ile
Ala Gly Thr Thr Ser Thr Leu100 105 110Gln Glu Gln Ile Gly Trp Met
Thr Asn Asn Pro Pro Ile Pro Val Gly115 120 125Glu Ile Tyr Lys Arg
Trp Ile Ile Leu Gly Leu Asn Lys Ile Val Arg130 135 140Met Tyr Ser
Pro Thr Ser Ile Leu Asp Ile Arg Gln Gly Pro Lys Glu145 150 155
160Pro Phe Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr Leu Arg Ala
Glu165 170 175Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu Thr
Leu Leu Val180 185 190Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu
Lys Ala Leu Gly Pro195 200 205Ala Ala Thr Leu Glu Glu Met Met Thr
Ala Cys Gln Gly Val Gly Gly210 215 220Pro Lys Asn Gln Gln Arg Leu
Asn Leu Trp Gly Cys Lys Gly Lys Leu225 230 235 240Ile Cys Tyr Thr
Ser Val Lys Trp Asn Gly Pro Gly His Lys Ala Arg245 250 255Val
Leu5795DNAHuman immunodeficiency virusCDS(16)..(789) 5aggagggttt
ttcat atg cca atc gtg cag aac atc cag ggg caa atg gta 51Met Pro Ile
Val Gln Asn Ile Gln Gly Gln Met Val1 5 10cat cag gcc ata tca cct
aga act tta aat gca tgg gta aaa gta gta 99His Gln Ala Ile Ser Pro
Arg Thr Leu Asn Ala Trp Val Lys Val Val15 20 25gaa gag aag gct ttc
agc cca gaa gtg ata ccc atg ttt tca gca tta 147Glu Glu Lys Ala Phe
Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu30 35 40tca gaa gga gcc
acc cca caa gat tta aac acc atg cta aac aca gtg 195Ser Glu Gly Ala
Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val45 50 55 60ggg gga
cat caa gca gcc atg caa atg tta aaa gag acc atc aat gag 243Gly Gly
His Gln Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu65 70 75gaa
gct gca gaa tgg gat aga gtg cat cca gtg cat gca ggg cct att 291Glu
Ala Ala Glu Trp Asp Arg Val His Pro Val His Ala Gly Pro Ile80 85
90gca cca ggc cag atg aga gaa cca agg gga agt gac ata gca gga act
339Ala Pro Gly Gln Met Arg Glu Pro Arg Gly Ser Asp Ile Ala Gly
Thr95 100 105act agt acc ctt cag gaa caa ata gga tgg atg aca aat
aat cca cct 387Thr Ser Thr Leu Gln Glu Gln Ile Gly Trp Met Thr Asn
Asn Pro Pro110 115 120atc cca gta gga gaa att tat aaa aga tgg ata
atc ctg gga tta aat 435Ile Pro Val Gly Glu Ile Tyr Lys Arg Trp Ile
Ile Leu Gly Leu Asn125 130 135 140aaa ata gta aga atg tat agc cct
acc agc att ctg gac ata aga caa 483Lys Ile Val Arg Met Tyr Ser Pro
Thr Ser Ile Leu Asp Ile Arg Gln145 150 155gga cca aag gaa ccc ttt
aga gac tat gta gac cgg ttc tat aaa act 531Gly Pro Lys Glu Pro Phe
Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr160 165 170cta aga gcc gag
caa gct tca cag gag gta aaa aat tgg atg aca gaa 579Leu Arg Ala Glu
Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu175 180 185acc ttg
ttg gtc caa aat gcg aac cca gat tgt aag act att tta aaa 627Thr Leu
Leu Val Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu Lys190 195
200gca ttg gga cca gcg gct aca cta gaa gaa atg atg aca gca tgt cag
675Ala Leu Gly Pro Ala Ala Thr Leu Glu Glu Met Met Thr Ala Cys
Gln205 210 215 220gga gta gga gga cca caa aat caa caa ctt tta aat
tta tgg ggg tgt 723Gly Val Gly Gly Pro Gln Asn Gln Gln Leu Leu Asn
Leu Trp Gly Cys225 230 235aga ggg aaa gct att tgt tat act tcc gtt
caa tgg aat gga ccc ggc 771Arg Gly Lys Ala Ile Cys Tyr Thr Ser Val
Gln Trp Asn Gly Pro Gly240 245 250cat aag gca aga gtt ttg taataa
795His Lys Ala Arg Val Leu2556258PRTHuman immunodeficiency virus
6Met Pro Ile Val Gln Asn Ile Gln Gly Gln Met Val His Gln Ala Ile1 5
10 15Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Val Val Glu Glu Lys
Ala20 25 30Phe Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu Ser Glu
Gly Ala35 40 45Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val Gly
Gly His Gln50 55 60Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu
Glu Ala Ala Glu65 70 75 80Trp Asp Arg Val His Pro Val His Ala Gly
Pro Ile Ala Pro Gly Gln85 90 95Met Arg Glu Pro Arg Gly Ser Asp Ile
Ala Gly Thr Thr Ser Thr Leu100 105 110Gln Glu Gln Ile Gly Trp Met
Thr Asn Asn Pro Pro Ile Pro Val Gly115 120 125Glu Ile Tyr Lys Arg
Trp Ile Ile Leu Gly Leu Asn Lys Ile Val Arg130 135 140Met Tyr Ser
Pro Thr Ser Ile Leu Asp Ile Arg Gln Gly Pro Lys Glu145 150 155
160Pro Phe Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr Leu Arg Ala
Glu165 170 175Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu Thr
Leu Leu Val180 185 190Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu
Lys Ala Leu Gly Pro195 200 205Ala Ala Thr Leu Glu Glu Met Met Thr
Ala Cys Gln Gly Val Gly Gly210 215 220Pro Gln Asn Gln Gln Leu Leu
Asn Leu Trp Gly Cys Arg Gly Lys Ala225 230 235 240Ile Cys Tyr Thr
Ser Val Gln Trp Asn Gly Pro Gly His Lys Ala Arg245 250 255Val
Leu7378DNAHepatitis C virusCDS(16)..(375) 7aggagggttt ttcat atg agc
acg aat cct aaa cct caa aga aaa acc aaa 51Met Ser Thr Asn Pro Lys
Pro Gln Arg Lys Thr Lys1 5 10cgt aac acc aac cgt cgc cca cag gac
gtc aag ttc ccg ggt ggc ggt 99Arg Asn Thr Asn Arg Arg Pro Gln Asp
Val Lys Phe Pro Gly Gly Gly15 20 25cag atc gtt ggt gga gtt tac ttg
ttg ccg cgc agg ggc cct aga ttg 147Gln Ile Val Gly Gly Val Tyr Leu
Leu Pro Arg Arg Gly Pro Arg Leu30 35 40ggt gtg cgc gcg acg agg aag
act tcc gag cgg tcg caa cct cga ggt 195Gly Val Arg Ala Thr Arg Lys
Thr Ser Glu Arg Ser Gln Pro Arg Gly45 50 55 60aga cgt cag cct atc
ccc aag gtg cgt cgg ccg gag ggc agg acc tgg 243Arg Arg Gln Pro Ile
Pro Lys Val Arg Arg Pro Glu Gly Arg Thr Trp65 70 75gct cag ccc ggg
tac cct tgg ccc ctc tat ggc aat gag ggt tgc ggg 291Ala Gln Pro Gly
Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly80 85 90tgg gcg gga
tgg ctc ctg tct ccc cgt ggc tct cgg cct agc tgg ggc 339Trp Ala Gly
Trp Leu Leu Ser Pro Arg Gly Ser Arg Pro Ser Trp Gly95 100 105ccc
aca gac ccc cgg cgt agg tcg cgc aat ttg ggt taa 378Pro Thr Asp Pro
Arg Arg Arg Ser Arg Asn Leu Gly110 115 1208120PRTHepatitis C virus
8Met Ser Thr Asn Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn1 5
10 15Arg Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val
Gly20 25 30Gly Val Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val
Arg Ala35 40 45Thr Arg Lys Thr Ser Glu Arg Ser Gln Pro Arg Gly Arg
Arg Gln Pro50 55 60Ile Pro Lys Val Arg Arg Pro Glu Gly Arg Thr Trp
Ala Gln Pro Gly65 70 75 80Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly
Cys Gly Trp Ala Gly Trp85 90 95Leu Leu Ser Pro Arg Gly Ser Arg Pro
Ser Trp Gly Pro Thr Asp Pro100 105 110Arg Arg Arg Ser Arg Asn Leu
Gly115 1209378DNAHepatitis C virusCDS(16)..(378) 9aggagggttt ttcat
atg agc acg aat cct aaa cct caa aga aaa acc aaa 51Met Ser Thr Asn
Pro Lys Pro Gln Arg Lys Thr Lys1 5 10cgt aac acc aac cgt cgc cca
cag gac gtc aag ttc ccg ggt ggc ggt 99Arg Asn Thr Asn Arg Arg Pro
Gln Asp Val Lys Phe Pro Gly Gly Gly15 20 25cag atc gtt ggt gga gtt
tac ttg ttg ccg cgc agg ggc cct aga ttg 147Gln Ile Val Gly Gly Val
Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu30 35 40ggt gtg cgc gcg acg
agg aag act tcc gag cgg tcg caa cct cga ggt 195Gly Val Arg Ala Thr
Arg Lys Thr Ser Glu Arg Ser Gln Pro Arg Gly45 50 55 60aga cgt cag
cct atc ccc aag gca cgt cgg ccc gag ggc agg acc tgg 243Arg Arg Gln
Pro Ile Pro Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp65 70 75gct cag
ccc ggg tac cct tgg ccc ctc tat ggc aat gag ggt tgc ggg 291Ala Gln
Pro Gly Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly80 85 90tgg
gcg gga tgg ctc ctg tct ccc cgt ggc tct cgg cct agc tgg ggc 339Trp
Ala Gly Trp Leu Leu Ser Pro Arg Gly Ser Arg Pro Ser Trp Gly95 100
105ccc aca gac ccc cgg cgt agg tcg cgc aat ttg ggt taa 378Pro Thr
Asp Pro Arg Arg Arg Ser Arg Asn Leu Gly110 115
12010120PRTHepatitis C virus 10Met Ser Thr Asn Pro Lys Pro Gln Arg
Lys Thr Lys Arg Asn Thr Asn1 5 10 15Arg Arg Pro Gln Asp Val Lys Phe
Pro Gly Gly Gly Gln Ile Val Gly20 25 30Gly Val Tyr Leu Leu Pro Arg
Arg Gly Pro Arg Leu Gly Val Arg Ala35 40 45Thr Arg Lys Thr Ser Glu
Arg Ser Gln Pro Arg Gly Arg Arg Gln Pro50 55 60Ile Pro Lys Ala Arg
Arg Pro Glu Gly Arg Thr Trp Ala Gln Pro Gly65 70 75 80Tyr Pro Trp
Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp85 90 95Leu Leu
Ser Pro Arg Gly Ser Arg Pro Ser Trp Gly Pro Thr Asp Pro100 105
110Arg Arg Arg Ser Arg Asn Leu Gly115 12011378DNAHepatitis C
virusCDS(16)..(375) 11aggagggttt ttcat atg agc acg aat cct aaa cct
caa aga aaa acc aaa 51Met Ser Thr Asn Pro Lys Pro Gln Arg Lys Thr
Lys1 5 10cgt aac acc aac cgt cgc cca cag gac gtc aag ttc ccg ggt
ggc ggt 99Arg Asn Thr Asn Arg Arg Pro Gln Asp Val Lys Phe Pro Gly
Gly Gly15 20 25cag atc gtt ggt gga gtt tac ttg ttg ccg cgc agg ggc
cct aga ttg 147Gln Ile Val Gly Gly Val Tyr Leu Leu Pro Arg Arg Gly
Pro Arg Leu30 35 40ggt gtg cgc gcg acg agg aag act tcc gag cgg tcg
caa cct cga ggt 195Gly Val Arg Ala Thr Arg Lys Thr Ser Glu Arg Ser
Gln Pro Arg Gly45 50 55 60aga cgt cag cct atc ccc aag gac cgt cgg
tcc acg ggc aag tcc tgg 243Arg Arg Gln Pro Ile Pro Lys Asp Arg Arg
Ser Thr Gly Lys Ser Trp65 70 75ggt aag ccc ggg tac cct tgg ccc ctc
tat ggc aat gag ggt tgc ggg 291Gly Lys Pro Gly Tyr Pro Trp Pro Leu
Tyr Gly Asn Glu Gly Cys Gly80 85 90tgg gcg gga tgg ctc ctg tct ccc
cgt ggc tct cgg cct agc tgg ggc 339Trp Ala Gly Trp Leu Leu Ser Pro
Arg Gly Ser Arg Pro Ser Trp Gly95 100 105ccc aca gac ccc cgg cgt
agg tcg cgc aat ttg ggt taa 378Pro Thr Asp Pro Arg Arg Arg Ser Arg
Asn Leu Gly110 115 12012120PRTHepatitis C virus 12Met Ser Thr Asn
Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn1 5 10 15Arg Arg Pro
Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly20 25 30Gly Val
Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala35 40 45Thr
Arg Lys Thr Ser Glu Arg Ser Gln Pro Arg Gly Arg Arg Gln Pro50 55
60Ile Pro Lys Asp Arg Arg Ser Thr Gly Lys Ser Trp Gly Lys Pro Gly65
70 75 80Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly
Trp85 90 95Leu Leu Ser Pro Arg Gly Ser Arg Pro Ser Trp Gly Pro Thr
Asp Pro100 105 110Arg Arg Arg Ser Arg Asn Leu Gly115
12013378DNAHepatitis C virusCDS(16)..(375) 13aggagggttt ttcat atg
agc acg aat cct aaa cct caa aga aaa acc aaa 51Met Ser Thr Asn Pro
Lys Pro Gln Arg Lys Thr Lys1 5 10cgt aac acc aac cgt cgc cca cag
gac gtc aag ttc ccg ggt ggc ggt 99Arg Asn Thr Asn Arg Arg Pro Gln
Asp Val Lys Phe Pro Gly Gly Gly15 20 25cag atc gtt ggt gga gtt tac
ttg ttg ccg cgc agg ggc cct aga ttg 147Gln Ile Val Gly Gly Val Tyr
Leu Leu Pro Arg Arg Gly Pro Arg Leu30 35 40ggt gtg cgc gcg acg agg
aag act tcc gag cgg tcg caa cct cga ggt 195Gly Val Arg Ala Thr Arg
Lys Thr Ser Glu Arg Ser Gln Pro Arg Gly45 50 55 60aga cgt cag cct
atc ccc aag gca cgt cgg tcc gag ggc agg tcc tgg 243Arg Arg Gln Pro
Ile Pro Lys Ala Arg Arg Ser Glu Gly Arg Ser Trp65 70 75gct cag ccc
ggg tac cct tgg ccc ctc tat ggc aat gag ggt tgc ggg 291Ala Gln Pro
Gly Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly80 85 90tgg gcg
gga tgg ctc ctg tct ccc cgt ggc tct cgg cct agc tgg ggc 339Trp Ala
Gly Trp Leu Leu Ser Pro Arg Gly Ser Arg Pro Ser Trp Gly95 100
105ccc aca gac ccc cgg cgt agg tcg cgc aat ttg ggt taa 378Pro Thr
Asp Pro Arg Arg Arg Ser Arg Asn Leu Gly110 115 12014120PRTHepatitis
C virus 14Met Ser Thr Asn Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn
Thr Asn1 5 10 15Arg Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln
Ile Val Gly20 25 30Gly Val Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu
Gly Val Arg Ala35 40 45Thr Arg Lys Thr Ser Glu Arg Ser Gln Pro Arg
Gly Arg Arg Gln Pro50 55 60Ile Pro Lys Ala Arg Arg Ser Glu Gly Arg
Ser Trp Ala Gln Pro Gly65 70 75 80Tyr Pro Trp Pro Leu Tyr Gly Asn
Glu Gly Cys Gly Trp Ala Gly Trp85 90 95Leu Leu Ser Pro Arg Gly Ser
Arg Pro Ser Trp Gly Pro Thr Asp Pro100 105 110Arg Arg Arg Ser Arg
Asn Leu Gly115 12015381DNAHepatitis C virusCDS(16)..(378)
15aggagggttt ttcat atg cct att cat cat cat cat cat cat ggc ccg ggc
51Met Pro Ile His His His His His His Gly Pro Gly1 5 10tcc gtc act
gtg tcc cat cct aac atc gag gag gtt gct ctg tcc acc 99Ser Val Thr
Val Ser His Pro Asn Ile Glu Glu Val Ala Leu Ser Thr15 20 25acc gga
gag atc ccc ttt tac ggc aag gct atc ccc ctc gag gtg atc 147Thr Gly
Glu Ile Pro Phe Tyr Gly Lys Ala Ile Pro Leu Glu Val Ile30 35 40aag
ggg gga aga cat ctc atc ttc tgc cac tca aag aag aag tgc gac 195Lys
Gly Gly Arg His Leu Ile Phe Cys His Ser Lys Lys Lys Cys Asp45 50 55
60gag ctc gcc gcg aag ctg gtc gca ttg ggc atc aat gcc gtg gcc tac
243Glu Leu Ala Ala Lys Leu Val Ala Leu Gly Ile Asn Ala Val Ala
Tyr65 70 75tac cgc ggt ctt gac gtg tct gtc atc ccg acc agc ggc gat
gtt gtc 291Tyr Arg Gly Leu Asp Val Ser Val Ile Pro Thr Ser Gly Asp
Val Val80 85 90gtc gtg tca acc gat gct ctc atg act ggc ttt acc ggc
gac ttc gac 339Val Val Ser Thr Asp Ala Leu Met Thr Gly Phe Thr Gly
Asp Phe Asp95 100 105tcg gtg ata gac tgc aat acg ggt acc gag ctc
gaa ttc taa 381Ser Val Ile Asp Cys Asn Thr Gly Thr Glu Leu Glu
Phe110 115 12016121PRTHepatitis C virus 16Met Pro Ile His His His
His His His Gly Pro Gly Ser Val Thr Val1 5 10 15Ser His Pro Asn Ile
Glu Glu Val Ala Leu Ser Thr Thr Gly Glu Ile20 25 30Pro Phe Tyr Gly
Lys Ala Ile Pro Leu Glu Val Ile Lys Gly Gly Arg35 40 45His Leu Ile
Phe Cys His Ser Lys Lys Lys Cys Asp Glu Leu Ala Ala50 55 60Lys Leu
Val Ala Leu Gly Ile Asn Ala Val Ala Tyr Tyr Arg Gly Leu65 70 75
80Asp Val Ser Val Ile Pro Thr Ser Gly Asp Val Val Val Val Ser Thr85
90 95Asp Ala Leu Met Thr Gly Phe Thr Gly Asp Phe Asp Ser Val Ile
Asp100 105 110Cys Asn Thr Gly Thr Glu Leu Glu Phe115
12017774DNAHepatitis C virusCDS(16)..(771) 17aggagggttt ttcat atg
tcc cct ata cta ggt tat tgg aaa att aag ggc 51Met Ser Pro Ile Leu
Gly Tyr Trp Lys Ile Lys Gly1 5 10ctt gtg caa ccc act cga ctt ctt
ttg gaa tat ctt gaa gaa aaa tat 99Leu Val Gln Pro Thr Arg Leu Leu
Leu Glu Tyr Leu Glu Glu Lys Tyr15 20 25gaa gag cat ttg tat gag cgc
gat gaa ggt gat aaa tgg cga aac aaa 147Glu Glu His Leu Tyr Glu Arg
Asp Glu Gly Asp Lys Trp Arg Asn Lys30 35 40aag ttt gaa ttg ggt ttg
gag ttt ccc aat ctt cct tat tat att gat 195Lys Phe Glu Leu Gly Leu
Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp45 50 55 60ggt gat gtt aaa
tta aca cag tct atg gcc atc ata cgt tat ata gct 243Gly Asp Val Lys
Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala65 70 75gac aag cac
aac atg ttg ggt ggt tgt cca aaa gag cgt gca gag att 291Asp Lys His
Asn Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile80 85 90tca atg
ctt gaa gga gcg gtt ttg gat att aga tac ggt gtt tcg aga 339Ser Met
Leu Glu Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg95 100
105att gca tat agt aaa gac ttt gaa act ctc aaa gtt gat ttt ctt agc
387Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu
Ser110 115 120aag cta cct gaa atg ctg aaa atg ttc gaa gat cgt tta
tgt cat aaa 435Lys Leu Pro Glu Met Leu Lys Met Phe Glu Asp Arg Leu
Cys His Lys125 130 135 140aca tat tta aat ggt gat cat gta acc cat
cct gac ttc atg ttg tat 483Thr Tyr Leu Asn Gly Asp His Val Thr His
Pro Asp Phe Met Leu Tyr145 150 155gac gct ctt gat gtt gtt tta tac
atg gac cca atg tgc ctg gat gcg 531Asp Ala Leu Asp Val Val Leu Tyr
Met Asp Pro Met Cys Leu Asp Ala160 165 170ttc cca aaa tta gtt tgt
ttt aaa aaa cgt att gaa gct atc cca caa 579Phe Pro Lys Leu Val Cys
Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln175 180 185att gat aag tac
ttg aaa tcc agc aag tat ata gca tgg cct ttg cag 627Ile Asp Lys Tyr
Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln190 195 200ggc tgg
caa gcc acg ttt ggt ggt ggc gac cat cct cca aaa tcg gat 675Gly Trp
Gln Ala Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp205 210 215
220ctg gtt ccg cgt gga tcc gac gtc aag ttc ccg ggt ggc ggt cag atc
723Leu Val Pro Arg Gly Ser Asp Val Lys Phe Pro Gly Gly Gly Gln
Ile225 230 235gtt ggt gga gtt tac ttg ttg ccg cgc agg gaa ttc atc
gtg act gac 771Val Gly Gly Val Tyr Leu Leu Pro Arg Arg Glu Phe Ile
Val Thr Asp240 245 250tga 77418252PRTHepatitis C virus 18Met Ser
Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1 5 10 15Thr
Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu20 25
30Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu35
40 45Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val
Lys50 55 60Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys
His Asn65 70 75 80Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile
Ser Met Leu Glu85 90 95Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser
Arg Ile Ala Tyr Ser100 105 110Lys Asp Phe Glu Thr Leu Lys Val Asp
Phe Leu Ser Lys Leu Pro Glu115 120 125Met Leu Lys Met Phe Glu Asp
Arg Leu Cys His Lys Thr Tyr Leu Asn130 135 140Gly Asp His Val Thr
His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155 160Val Val
Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu165 170
175Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys
Tyr180 185 190Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly
Trp Gln Ala195 200 205Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser
Asp Leu Val Pro Arg210 215 220Gly Ser Asp Val Lys Phe Pro Gly Gly
Gly Gln Ile Val Gly Gly Val225 230 235 240Tyr Leu Leu Pro Arg Arg
Glu Phe Ile Val Thr Asp245 2501931DNAArtificialsynthetic
oligonucleotide 19ccaaaattac catatgccaa tcgtgcagaa c
312033DNAArtificialsynthetic oligonucleotide 20gacccggcca
taaggcaaga gttttgtaat aag 332134DNAArtificialsynthetic
oligonucleotide 21gatccttatt acaaaactct tgccttatgg ccgg
342228DNAArtificialsynthetic oligonucleotide 22gctcgcatat
gagcacgatt cccaaacc 282332DNAArtificialsynthetic oligonucleotide
23gacgaattct taacccaaat tgcgcgacct ac 322466DNAArtificialsynthetic
oligonucleotide 24gatccgacgt caagttcccg ggtggcggtc agatcgttgg
tggagtttac ttgttgccgc 60gcaggg 662566DNAArtificialsynthetic
oligonucleotide 25aattccctgc gcggcaacaa gtaaactcca ccaacgatct
gaccgccacc cgggaacttg 60acgtcg 662628DNAArtificialsynthetic
oligonucleotide 26ggaattccat atgtccccta tactaggt
282726DNAArtificialsynthetic oligonucleotide 27cggaattctc
acctgcgcgg caacaa 262852DNAArtificialsynthetic oligonucleotide
28tatgcctatt catcatcatc atcatcatgg cccgggaatt ctaagtaagt ag
522954DNAArtificialsynthetic oligonucleotide 29gatcctactt
acttagaatt cccgggccat gatgatgatg atgatgaata ggca 5430978DNAnon-A,
non-B hepatitis virusCDS(1)..(978)non-A, non-B hepatitis virus
structural antigen 30atg agc acg att ccc aaa cgt caa aga aaa acc
aaa cgt aac acc aac 48Met Ser Thr Ile Pro Lys Arg Gln Arg Lys Thr
Lys Arg Asn Thr Asn1 5 10 15cgt cgc cca cag gac gtc aag ttc ccg ggt
ggc ggt cag atc gtt ggt 96Arg Arg Pro Gln Asp Val Lys Phe Pro Gly
Gly Gly Gln Ile Val Gly20 25 30gga gtt tac ttg ttg ccg cgc agg ggc
cct aga ttg ggt gtg cgc gcg 144Gly Val Tyr Leu Leu Pro Arg Arg Gly
Pro Arg Leu Gly Val Arg Ala35 40 45acg agg aag act tcc gag cgg tcg
caa cct cga ggt aga cgt cag cct 192Thr Arg Lys Thr Ser Glu Arg Ser
Gln Pro Arg Gly Arg Arg Gln Pro50 55 60atc ccc aag gca cgt cgg ccc
gag ggc agg acc tgg gct cag ccc ggg 240Ile Pro Lys Ala Arg Arg Pro
Glu Gly Arg Thr Trp Ala Gln Pro Gly65 70 75 80tac cct tgg ccc ctc
tat ggc aat gag ggt tgc ggg tgg gcg gga tgg 288Tyr Pro Trp Pro Leu
Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp85 90 95ctc ctg tct ccc
cgt ggc tct cgg cct agc tgg ggc ccc aca gac ccc 336Leu Leu Ser Pro
Arg Gly Ser Arg Pro Ser Trp Gly Pro Thr Asp Pro100 105 110cgg cgt
agg tcg cgc aat ttg ggt aag gtc atc gat acc ctt acg tgc 384Arg Arg
Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys115 120
125ggc ttc gcc gac ctc atg ggg tac ata ccg ctc gtc ggc gcc cct ctt
432Gly Phe Ala Asp Leu Met Gly Tyr Ile Pro Leu Val Gly Ala Pro
Leu130 135 140gga ggc gct gcc agg gcc ctg gcg cat ggc gtc cgg gtt
ctg gaa gac 480Gly Gly Ala Ala Arg Ala Leu Ala His Gly Val Arg Val
Leu Glu Asp145 150 155 160ggc gtg aac tat gca aca ggg aac ctt cct
ggt tgc tct ttc tct atc 528Gly Val Asn Tyr Ala Thr Gly Asn Leu Pro
Gly Cys Ser Phe Ser Ile165 170 175ttc ctt ctg gcc ctg ctc tct tgc
ctg act gtg ccc gct tca gcc tac 576Phe Leu Leu Ala Leu Leu Ser Cys
Leu Thr Val Pro Ala Ser Ala Tyr180 185 190caa gtg cgc aat tcc tcg
ggg ctt tac cat gtc acc aat gat tgc cct 624Gln Val Arg Asn Ser Ser
Gly Leu Tyr His Val Thr Asn Asp Cys Pro195 200 205aac tcg agt gtt
gtg tac gag gcg gcc gat gcc atc ctg cac act ccg 672Asn Ser Ser Val
Val Tyr Glu Ala Ala Asp Ala Ile Leu His Thr Pro210 215 220ggg tgt
gtc cct tgc gtt cgc gag ggt aac gcc tcg agg tgt tgg gtg 720Gly Cys
Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg Cys Trp Val225 230 235
240gcg gtg acc ccc acg gtg gcc acc agg gac ggc aaa ctt ccc aca acg
768Ala Val Thr Pro Thr Val Ala Thr Arg Asp Gly Lys Leu Pro Thr
Thr245 250 255cag ctt cga cgt cat atc gat ctg ctt gtc ggg agc gcc
acc ctc tgc 816Gln Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala
Thr Leu Cys260 265 270tcg gcc ctc tac gtg ggg gac ctg tgc ggg tct
gtc ttt ctc gtt ggt 864Ser Ala Leu Tyr Val Gly Asp Leu Cys Gly Ser
Val Phe Leu Val Gly275 280 285caa ctg ttt acc ttc tct ccc agg cgc
cac tgg acg acg caa gac tgc 912Gln Leu Phe Thr Phe Ser Pro Arg Arg
His Trp Thr Thr Gln Asp Cys290 295 300aat tgt tct atc tat ccc ggc
cat ata acg ggt cat cgc atg gca tgg 960Asn Cys Ser Ile Tyr Pro Gly
His Ile Thr Gly His Arg Met Ala Trp305 310 315 320gat atg atg atg
aac tgg 978Asp Met Met Met Asn Trp32531948DNAArtificialCodes for a
fusion protein that includes sequences from
glutathione-S-transferase, non-A, non-B hepatitis virus capsid
antigen, and a Factor X
cleavage site 31atg tcc cct ata cta ggt tat tgg aaa att aag ggc ctt
gtg caa ccc 48Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu
Val Gln Pro1 5 10 15act cga ctt ctt ttg gaa tat ctt gaa gaa aaa tat
gaa gag cat ttg 96Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr
Glu Glu His Leu20 25 30tat gag cgc gat gaa ggt gat aaa tgg cga aac
aaa aag ttt gaa ttg 144Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn
Lys Lys Phe Glu Leu35 40 45ggt ttg gag ttt ccc aat ctt cct tat tat
att gat ggt gat gtt aaa 192Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr
Ile Asp Gly Asp Val Lys50 55 60tta aca cag tct atg gcc atc ata cgt
tat ata gct gac aag cac aac 240Leu Thr Gln Ser Met Ala Ile Ile Arg
Tyr Ile Ala Asp Lys His Asn65 70 75 80atg ttg ggt ggt tgt cca aaa
gag cgt gca gag att tca atg ctt gaa 288Met Leu Gly Gly Cys Pro Lys
Glu Arg Ala Glu Ile Ser Met Leu Glu85 90 95gga gcg gtt ttg gat att
aga tac ggt gtt tcg aga att gca tat agt 336Gly Ala Val Leu Asp Ile
Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser100 105 110aaa gac ttt gaa
act ctc aaa gtt gat ttt ctt agc aag cta cct gaa 384Lys Asp Phe Glu
Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu115 120 125atg ctg
aaa atg ttc gaa gat cgt tta tgt cat aaa aca tat tta aat 432Met Leu
Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn130 135
140ggt gat cat gta acc cat cct gac ttc atg ttg tat gac gct ctt gat
480Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu
Asp145 150 155 160gtt gtt tta tac atg gac cca atg tgc ctg gat gcg
ttc cca aaa tta 528Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala
Phe Pro Lys Leu165 170 175gtt tgt ttt aaa aaa cgt att gaa gct atc
cca caa att gat aag tac 576Val Cys Phe Lys Lys Arg Ile Glu Ala Ile
Pro Gln Ile Asp Lys Tyr180 185 190ttg aaa tcc agc aag tat ata gca
tgg cct ttg cag ggc tgg caa gcc 624Leu Lys Ser Ser Lys Tyr Ile Ala
Trp Pro Leu Gln Gly Trp Gln Ala195 200 205acg ttt ggt ggt ggc gac
cat cct cca aaa tcg gat ctg atc gaa ggt 672Thr Phe Gly Gly Gly Asp
His Pro Pro Lys Ser Asp Leu Ile Glu Gly210 215 220cgt ggg atc ccc
aat tcg agc tcg gta ccc atg agc acg att ccc aaa 720Arg Gly Ile Pro
Asn Ser Ser Ser Val Pro Met Ser Thr Ile Pro Lys225 230 235 240cct
caa aga aaa acc aaa cgt aac acc aac cgt cgc cca cag gac gtc 768Pro
Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg Arg Pro Gln Asp Val245 250
255aag ttc ccg ggt ggc ggt cag atc gtt ggt gga gtt tac ttg ttg ccg
816Lys Phe Pro Gly Gly Gly Gln Ile Val Gly Gly Val Tyr Leu Leu
Pro260 265 270cgc agg ggc cct aga ttg ggt gtg cgc gcg acg agg aag
act tcc gag 864Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg Lys
Thr Ser Glu275 280 285cgg tcg caa cct cga ggt aga cgt cag cct atc
ccc aag gca cgt cgg 912Arg Ser Gln Pro Arg Gly Arg Arg Gln Pro Ile
Pro Lys Ala Arg Arg290 295 300ccc gag ggc agg acg ggg atc ggg aat
tca tcg tga 948Pro Glu Gly Arg Thr Gly Ile Gly Asn Ser Ser305 310
3153221DNAArtificialsynthetic oligonucleotide 32atgagcacga
ttcccaaacc t 213317DNAArtificialsynthetic oligonucleotide
33gaggaagact tccgagc 173417DNAArtificialsynthetic oligonucleotide
34gtcctgccct cgggccg 173521DNAArtificialsynthetic oligonucleotide
35acccaaattg cgcgacctac g 213619DNAArtificialsynthetic
oligonucleotide 36tgggtaaggt catcgatac 193717DNAArtificialsynthetic
oligonucleotide 37aaggtcatcg ataccct 173818DNAArtificialsynthetic
oligonucleotide 38agatagagaa agagcaac 183922DNAArtificialsynthetic
oligonucleotide 39ggaccagttc atcatcatat at
224020DNAArtificialsynthetic oligonucleotide 40cagttcatca
tcatatccca 20415PRTArtificialSynthetic Construct 41Gly Ile Pro Asn
Ser1 54215DNAArtificialCodes for linker protein in GST-NANBV
693-691 42ggg atc ccc aat tca 15Gly Ile Pro Asn Ser1
5433PRTArtificialCarboxy-terminal linker protein in GST-NANBV
693-691 43Asn Ser Ser14412DNAArtificialCodes for carboxy-terminal
linker protein in GST-NANBV 693-691 44aat tca tcg tga 12Asn Ser
Ser1459PRTArtificialLinker protein in GST-NANBV 15-18 45Gly Ile Pro
Ile Glu Phe Leu Gln Pro1 54627DNAArtificialCDS(1)..(27)Codes for
linker protein in GST-NANBV 15-18 46ggg atc ccc atc gaa ttc ctg cag
ccc 27Gly Ile Pro Ile Glu Phe Leu Gln Pro1
5477PRTArtificialCarboxy-terminal linker protein in GST-NANBV 15-18
47Trp Gly Ile Gly Asn Ser Ser1 54824DNAArtificialCodes for
carboxy-terminal linker protein in GST-NANBV 15-18 48tgg ggg atc
ggg aat tca tcg tga 24Trp Gly Ile Gly Asn Ser Ser1
5498PRTArtificialLinker protein in GST-NANBV 15-17 49Gly Ile Pro
Asn Ser Cys Ser Pro1 55024DNAArtificialCodes for linker protein in
GST-NANBV 15-17 50ggg atc ccc aat tcc tgc agc cct 24Gly Ile Pro Asn
Ser Cys Ser Pro1 5516PRTArtificialCarboxy-terminal linker protein
in GST-NANBV 15-17 51Gly Ile Gly Asn Ser Ser1
55221DNAArtificialCodes for carboxy-terminal linker protein in
GST-NANBV 15-17 52ggg atc ggg aat tca tcg tga 21Gly Ile Gly Asn Ser
Ser1 5535PRTArtificialThrombin cleavage site in GST-NANBV 15-17
53Val Pro Arg Gly Ser1 55415DNAArtificialCodes for thrombin
cleavage site in GST-NANBV 15-17 54gtt ccg cgt gga tcc 15Val Pro
Arg Gly Ser1 5557PRTArtificialLinker protein in GST-NANBV 15-17
55Pro Ser Asn Ser Cys Ser Pro1 55621DNAArtificialCodes for linker
protein in GST-NANBV 15-17 56cca tcg aat tcc tgc agc cct 21Pro Ser
Asn Ser Cys Ser Pro1 5575PRTArtificialCarboxy-terminal linker
protein in GST-NANBV 15-17 57Gly Ile His Arg Asp1
55818DNAArtificialCodes for carboxy-terminal linker protein in
GST-NANBV 15-17 58gga att cat cgt gac tga 18Gly Ile His Arg Asp1
5599PRTArtificialLinker protein in GST-NANBV 690-691 59Gly Ile Pro
Asn Ser Ser Ser Val Pro1 56027DNAArtificialCodes for linker protein
in GST-NANBV 690-691 60ggg atc ccc aat tcg agc tcg gta ccc 27Gly
Ile Pro Asn Ser Ser Ser Val Pro1 5617PRTArtificialCarboxy-terminal
linker protein in GST-NANBV 690-691 61Thr Gly Ile Gly Asn Ser Ser1
56224DNAArtificialCodes for carboxy-terminal linker protein in
GST-NANBV 690-691 62acg ggg atc ggg aat tca tcg tga 24Thr Gly Ile
Gly Asn Ser Ser1 56366DNAArtificialsynthetic oligonucleotide
63gatccatgag cacgattccc aaacctcaaa gaaaaaccaa acgtaacacc aaccgtcgcc
60cacagg 666466DNAArtificialsynthetic oligonucleotide 64aattcctgtg
ggggacggtt ggtgttacgt ttggtttttc tttgaggttt gggaatcgtg 60ctcatg
6665759DNAArtificialCodes for a fusion protein that includes
sequences from glutathione-S-transferase, non-A, non-B hepatitis
virus capsid antigen, and a thrombin cleavage site 65atg tcc cct
ata cta ggt tat tgg aaa att aag ggc ctt gtg caa ccc 48Met Ser Pro
Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1 5 10 15act cga
ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg 96Thr Arg
Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu20 25 30tat
gag cgc gat gaa ggt gat aaa tgg cga aac aaa aag ttt gaa ttg 144Tyr
Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu35 40
45ggt ttg gag ttt ccc aat ctt cct tat tat att gat ggt gat gtt aaa
192Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val
Lys50 55 60tta aca cag tct atg gcc atc ata cgt tat ata gct gac aag
cac aac 240Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys
His Asn65 70 75 80atg ttg ggt ggt tgt cca aaa gag cgt gca gag att
tca atg ctt gaa 288Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile
Ser Met Leu Glu85 90 95gga gcg gtt ttg gat att aga tac ggt gtt tcg
aga att gca tat agt 336Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser
Arg Ile Ala Tyr Ser100 105 110aaa gac ttt gaa act ctc aaa gtt gat
ttt ctt agc aag cta cct gaa 384Lys Asp Phe Glu Thr Leu Lys Val Asp
Phe Leu Ser Lys Leu Pro Glu115 120 125atg ctg aaa atg ttc gaa gat
cgt tta tgt cat aaa aca tat tta aat 432Met Leu Lys Met Phe Glu Asp
Arg Leu Cys His Lys Thr Tyr Leu Asn130 135 140ggt gat cat gta acc
cat cct gac ttc atg ttg tat gac gct ctt gat 480Gly Asp His Val Thr
His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155 160gtt gtt
tta tac atg gac cca atg tgc ctg gat gcg ttc cca aaa tta 528Val Val
Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu165 170
175gtt tgt ttt aaa aaa cgt att gaa gct atc cca caa att gat aag tac
576Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys
Tyr180 185 190ttg aaa tcc agc aag tat ata gca tgg cct ttg cag ggc
tgg caa gcc 624Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly
Trp Gln Ala195 200 205acg ttt ggt ggt ggc gac cat cct cca aaa tcg
gat ctg gtt ccg cgt 672Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser
Asp Leu Val Pro Arg210 215 220gga tcc atg agc acg att ccc aaa cct
caa aga aaa acc aaa cgt aac 720Gly Ser Met Ser Thr Ile Pro Lys Pro
Gln Arg Lys Thr Lys Arg Asn225 230 235 240acc aac cgt cgc cca cag
gaa ttc atc gtg act gac tga 759Thr Asn Arg Arg Pro Gln Glu Phe Ile
Val Thr Asp245 2506666DNAArtificialsynthetic oligonucleotide
66gatccgacgt caagttcgcg ggtggcggtc agatcgttgg tggagtttac ttgttgccgc
60gcaggg 666766DNAArtificialsynthetic oligonucleotide 67aattccctgc
gcggcaacaa gtaaactcca ccaacgatct gaccgccacc cgggaacttg 60acgtcg
6668759DNAArtificialCodes for a fusion protein that includes
sequences from glutathione-S-transferase, non-A, non-B hepatitis
virus capsid antigen, and a thrombin cleavage site 68atg tcc cct
ata cta ggt tat tgg aaa att aag ggc ctt gtg caa ccc 48Met Ser Pro
Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1 5 10 15act cga
ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg 96Thr Arg
Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu20 25 30tat
gag cgc gat gaa ggt gat aaa tgg cga aac aaa aag ttt gaa ttg 144Tyr
Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu35 40
45ggt ttg gag ttt ccc aat ctt cct tat tat att gat ggt gat gtt aaa
192Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val
Lys50 55 60tta aca cag tct atg gcc atc ata cgt tat ata gct gac aag
cac aac 240Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys
His Asn65 70 75 80atg ttg ggt ggt tgt cca aaa gag cgt gca gag att
tca atg ctt gaa 288Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile
Ser Met Leu Glu85 90 95gga gcg gtt ttg gat att aga tac ggt gtt tcg
aga att gca tat agt 336Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser
Arg Ile Ala Tyr Ser100 105 110aaa gac ttt gaa act ctc aaa gtt gat
ttt ctt agc aag cta cct gaa 384Lys Asp Phe Glu Thr Leu Lys Val Asp
Phe Leu Ser Lys Leu Pro Glu115 120 125atg ctg aaa atg ttc gaa gat
cgt tta tgt cat aaa aca tat tta aat 432Met Leu Lys Met Phe Glu Asp
Arg Leu Cys His Lys Thr Tyr Leu Asn130 135 140ggt gat cat gta acc
cat cct gac ttc atg ttg tat gac gct ctt gat 480Gly Asp His Val Thr
His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155 160gtt gtt
tta tac atg gac cca atg tgc ctg gat gcg ttc cca aaa tta 528Val Val
Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu165 170
175gtt tgt ttt aaa aaa cgt att gaa gct atc cca caa att gat aag tac
576Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys
Tyr180 185 190ttg aaa tcc agc aag tat ata gca tgg cct ttg cag ggc
tgg caa gcc 624Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly
Trp Gln Ala195 200 205acg ttt ggt ggt ggc gac cat cct cca aaa tcg
gat ctg gtt ccg cgt 672Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser
Asp Leu Val Pro Arg210 215 220gga tcc gac gtc aag ttc ccg ggt ggc
ggt cag atc gtt ggt gga gtt 720Gly Ser Asp Val Lys Phe Pro Gly Gly
Gly Gln Ile Val Gly Gly Val225 230 235 240tac ttg ttg ccg cgc agg
gaa ttc atc gtg act gac tga 759Tyr Leu Leu Pro Arg Arg Glu Phe Ile
Val Thr Asp245 2506932DNAArtificialsynthetic oligonucleotide
69gaattcttac ctgcgcggca acaagtaaac tc 327032DNAArtificialsynthetic
oligonucleotide 70gctggatcca gcacgattcc caaacctcaa ag
3271816DNAArtificialCodes for a fusion protein that includes
sequences from glutathione-S-transferase, non-A, non-B hepatitis
virus capsid antigen, and a thrombin cleavage site 71atg tcc cct
ata cta ggt tat tgg aaa att aag ggc ctt gtg caa ccc 48Met Ser Pro
Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1 5 10 15act cga
ctt ctt ttg gaa tat ctt gaa gaa aaa tat gaa gag cat ttg 96Thr Arg
Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu20 25 30tat
gag cgc gat gaa ggt gat aaa tgg cga aac aaa aag ttt gaa ttg 144Tyr
Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu35 40
45ggt ttg gag ttt ccc aat ctt cct tat tat att gat ggt gat gtt aaa
192Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val
Lys50 55 60tta aca cag tct atg gcc atc ata cgt tat ata gct gac aag
cac aac 240Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys
His Asn65 70 75 80atg ttg ggt ggt tgt cca aaa gag cgt gca gag att
tca atg ctt gaa 288Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile
Ser Met Leu Glu85 90 95gga gcg gtt ttg gat att aga tac ggt gtt tcg
aga att gca tat agt 336Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser
Arg Ile Ala Tyr Ser100 105 110aaa gac ttt gaa act ctc aaa gtt gat
ttt ctt agc aag cta cct gaa 384Lys Asp Phe Glu Thr Leu Lys Val Asp
Phe Leu Ser Lys Leu Pro Glu115 120 125atg ctg aaa atg ttc gaa gat
cgt tta tgt cat aaa aca tat tta aat 432Met Leu Lys Met Phe Glu Asp
Arg Leu Cys His Lys Thr Tyr Leu Asn130 135 140ggt gat cat gta acc
cat cct gac ttc atg ttg tat gac gct ctt gat 480Gly Asp His Val Thr
His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155 160gtt gtt
tta tac atg gac cca atg tgc ctg gat gcg ttc cca aaa tta 528Val Val
Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu165 170
175gtt tgt ttt aaa aaa cgt att gaa gct atc cca caa att gat aag tac
576Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys
Tyr180 185 190ttg aaa tcc agc aag tat ata gca tgg cct ttg cag ggc
tgg caa gcc 624Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly
Trp Gln Ala195 200 205acg ttt ggt ggt ggc gac cat cct cca aaa tcg
gat ctg gtt ccg cgt 672Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser
Asp Leu Val Pro Arg210 215 220gga tcc agc acg att ccc aaa cct caa
aga aaa acc aaa cgt aac acc 720Gly Ser Ser Thr Ile Pro Lys Pro Gln
Arg Lys Thr Lys Arg Asn Thr225 230 235
240aac cgt cgc cca cag gac gtc aag ttc ccg ggt ggc ggt cag atc gtt
768Asn Arg Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile
Val245 250 255ggt gga gtt tac ttg ttg ccg cgc agg gaa ttc atc gtg
act gac tga 816Gly Gly Val Tyr Leu Leu Pro Arg Arg Glu Phe Ile Val
Thr Asp260 265 27072271PRTArtificialSynthetic Construct 72Met Ser
Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1 5 10 15Thr
Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu20 25
30Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu35
40 45Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val
Lys50 55 60Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys
His Asn65 70 75 80Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile
Ser Met Leu Glu85 90 95Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser
Arg Ile Ala Tyr Ser100 105 110Lys Asp Phe Glu Thr Leu Lys Val Asp
Phe Leu Ser Lys Leu Pro Glu115 120 125Met Leu Lys Met Phe Glu Asp
Arg Leu Cys His Lys Thr Tyr Leu Asn130 135 140Gly Asp His Val Thr
His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155 160Val Val
Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu165 170
175Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys
Tyr180 185 190Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly
Trp Gln Ala195 200 205Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser
Asp Leu Val Pro Arg210 215 220Gly Ser Ser Thr Ile Pro Lys Pro Gln
Arg Lys Thr Lys Arg Asn Thr225 230 235 240Asn Arg Arg Pro Gln Asp
Val Lys Phe Pro Gly Gly Gly Gln Ile Val245 250 255Gly Gly Val Tyr
Leu Leu Pro Arg Arg Glu Phe Ile Val Thr Asp260 265
27073326PRTnon-A, non-B hepatitis virus 73Met Ser Thr Ile Pro Lys
Arg Gln Arg Lys Thr Lys Arg Asn Thr Asn1 5 10 15Arg Arg Pro Gln Asp
Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly20 25 30Gly Val Tyr Leu
Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala35 40 45Thr Arg Lys
Thr Ser Glu Arg Ser Gln Pro Arg Gly Arg Arg Gln Pro50 55 60Ile Pro
Lys Ala Arg Arg Pro Glu Gly Arg Thr Trp Ala Gln Pro Gly65 70 75
80Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly Cys Gly Trp Ala Gly Trp85
90 95Leu Leu Ser Pro Arg Gly Ser Arg Pro Ser Trp Gly Pro Thr Asp
Pro100 105 110Arg Arg Arg Ser Arg Asn Leu Gly Lys Val Ile Asp Thr
Leu Thr Cys115 120 125Gly Phe Ala Asp Leu Met Gly Tyr Ile Pro Leu
Val Gly Ala Pro Leu130 135 140Gly Gly Ala Ala Arg Ala Leu Ala His
Gly Val Arg Val Leu Glu Asp145 150 155 160Gly Val Asn Tyr Ala Thr
Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile165 170 175Phe Leu Leu Ala
Leu Leu Ser Cys Leu Thr Val Pro Ala Ser Ala Tyr180 185 190Gln Val
Arg Asn Ser Ser Gly Leu Tyr His Val Thr Asn Asp Cys Pro195 200
205Asn Ser Ser Val Val Tyr Glu Ala Ala Asp Ala Ile Leu His Thr
Pro210 215 220Gly Cys Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg
Cys Trp Val225 230 235 240Ala Val Thr Pro Thr Val Ala Thr Arg Asp
Gly Lys Leu Pro Thr Thr245 250 255Gln Leu Arg Arg His Ile Asp Leu
Leu Val Gly Ser Ala Thr Leu Cys260 265 270Ser Ala Leu Tyr Val Gly
Asp Leu Cys Gly Ser Val Phe Leu Val Gly275 280 285Gln Leu Phe Thr
Phe Ser Pro Arg Arg His Trp Thr Thr Gln Asp Cys290 295 300Asn Cys
Ser Ile Tyr Pro Gly His Ile Thr Gly His Arg Met Ala Trp305 310 315
320Asp Met Met Met Asn Trp32574315PRTArtificialSynthetic Construct
74Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1
5 10 15Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His
Leu20 25 30Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe
Glu Leu35 40 45Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly
Asp Val Lys50 55 60Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala
Asp Lys His Asn65 70 75 80Met Leu Gly Gly Cys Pro Lys Glu Arg Ala
Glu Ile Ser Met Leu Glu85 90 95Gly Ala Val Leu Asp Ile Arg Tyr Gly
Val Ser Arg Ile Ala Tyr Ser100 105 110Lys Asp Phe Glu Thr Leu Lys
Val Asp Phe Leu Ser Lys Leu Pro Glu115 120 125Met Leu Lys Met Phe
Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn130 135 140Gly Asp His
Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155
160Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys
Leu165 170 175Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile
Asp Lys Tyr180 185 190Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu
Gln Gly Trp Gln Ala195 200 205Thr Phe Gly Gly Gly Asp His Pro Pro
Lys Ser Asp Leu Ile Glu Gly210 215 220Arg Gly Ile Pro Asn Ser Ser
Ser Val Pro Met Ser Thr Ile Pro Lys225 230 235 240Pro Gln Arg Lys
Thr Lys Arg Asn Thr Asn Arg Arg Pro Gln Asp Val245 250 255Lys Phe
Pro Gly Gly Gly Gln Ile Val Gly Gly Val Tyr Leu Leu Pro260 265
270Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr Arg Lys Thr Ser
Glu275 280 285Arg Ser Gln Pro Arg Gly Arg Arg Gln Pro Ile Pro Lys
Ala Arg Arg290 295 300Pro Glu Gly Arg Thr Gly Ile Gly Asn Ser
Ser305 310 31575252PRTArtificialSynthetic Construct 75Met Ser Pro
Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1 5 10 15Thr Arg
Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu20 25 30Tyr
Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu35 40
45Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys50
55 60Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His
Asn65 70 75 80Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser
Met Leu Glu85 90 95Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg
Ile Ala Tyr Ser100 105 110Lys Asp Phe Glu Thr Leu Lys Val Asp Phe
Leu Ser Lys Leu Pro Glu115 120 125Met Leu Lys Met Phe Glu Asp Arg
Leu Cys His Lys Thr Tyr Leu Asn130 135 140Gly Asp His Val Thr His
Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155 160Val Val Leu
Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu165 170 175Val
Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr180 185
190Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln
Ala195 200 205Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu
Val Pro Arg210 215 220Gly Ser Met Ser Thr Ile Pro Lys Pro Gln Arg
Lys Thr Lys Arg Asn225 230 235 240Thr Asn Arg Arg Pro Gln Glu Phe
Ile Val Thr Asp245 25076252PRTArtificialSynthetic Construct 76Met
Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro1 5 10
15Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu20
25 30Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu
Leu35 40 45Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp
Val Lys50 55 60Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp
Lys His Asn65 70 75 80Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu
Ile Ser Met Leu Glu85 90 95Gly Ala Val Leu Asp Ile Arg Tyr Gly Val
Ser Arg Ile Ala Tyr Ser100 105 110Lys Asp Phe Glu Thr Leu Lys Val
Asp Phe Leu Ser Lys Leu Pro Glu115 120 125Met Leu Lys Met Phe Glu
Asp Arg Leu Cys His Lys Thr Tyr Leu Asn130 135 140Gly Asp His Val
Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp145 150 155 160Val
Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu165 170
175Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys
Tyr180 185 190Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly
Trp Gln Ala195 200 205Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser
Asp Leu Val Pro Arg210 215 220Gly Ser Asp Val Lys Phe Pro Gly Gly
Gly Gln Ile Val Gly Gly Val225 230 235 240Tyr Leu Leu Pro Arg Arg
Glu Phe Ile Val Thr Asp245 250
* * * * *