U.S. patent application number 12/288330 was filed with the patent office on 2009-06-18 for compositions and methods for treatment of diabetic retinopathy.
This patent application is currently assigned to SARcode Corporation. Invention is credited to John Burnier, Thomas Gadek, Charles Semba.
Application Number | 20090155176 12/288330 |
Document ID | / |
Family ID | 40579823 |
Filed Date | 2009-06-18 |
United States Patent
Application |
20090155176 |
Kind Code |
A1 |
Burnier; John ; et
al. |
June 18, 2009 |
Compositions and methods for treatment of diabetic retinopathy
Abstract
The present invention provides compounds and methods for the
treatment of diabetic retinopathy. In particular, LFA-1 antagonists
are described herein to be used in the treatment of diabetic
retinopathy. One aspect of the invention provides for diagnosis of
diabetic retinopathy and administration of a LFA-1 antagonist,
after the patient is diagnosed with diabetic retinopathy.
Inventors: |
Burnier; John; (Pacifica,
CA) ; Gadek; Thomas; (Oakland, CA) ; Semba;
Charles; (Palo Alto, CA) |
Correspondence
Address: |
WILSON SONSINI GOODRICH & ROSATI
650 PAGE MILL ROAD
PALO ALTO
CA
94304-1050
US
|
Assignee: |
SARcode Corporation
San Francisco
CA
|
Family ID: |
40579823 |
Appl. No.: |
12/288330 |
Filed: |
October 17, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60999571 |
Oct 19, 2007 |
|
|
|
Current U.S.
Class: |
424/9.1 ;
424/172.1; 424/429; 424/45; 424/450; 424/484; 435/29; 514/266.21;
514/307; 514/369; 514/373; 514/387 |
Current CPC
Class: |
A61K 9/08 20130101; A61K
31/502 20130101; A61K 31/66 20130101; A61K 2039/505 20130101; G01N
2333/70503 20130101; C07K 2317/92 20130101; A61K 31/496 20130101;
A61K 2039/507 20130101; A61P 27/02 20180101; G01N 2800/164
20130101; G01N 2800/042 20130101; A61K 39/39533 20130101; A61P
43/00 20180101; A61K 9/06 20130101; A61K 31/343 20130101; A61K
31/517 20130101; A61K 31/277 20130101; A61K 31/341 20130101; A61K
9/0048 20130101; A61K 31/4025 20130101; A61F 9/0017 20130101; A61K
9/0014 20130101; A61P 9/10 20180101; A61K 45/06 20130101; A61P
41/00 20180101; G01N 33/6893 20130101; A61K 31/472 20130101; A61P
3/10 20180101; A61K 31/381 20130101; C07K 16/2821 20130101; A61K
31/14 20130101; A61K 31/198 20130101; G01N 2333/70525 20130101;
A61K 49/00 20130101; A61K 31/4725 20130101 |
Class at
Publication: |
424/9.1 ;
424/172.1; 514/307; 514/266.21; 514/369; 514/373; 514/387; 424/45;
424/484; 424/450; 424/429; 435/29 |
International
Class: |
A61K 49/00 20060101
A61K049/00; A61K 39/395 20060101 A61K039/395; A61K 31/472 20060101
A61K031/472; A61K 31/517 20060101 A61K031/517; A61K 31/426 20060101
A61K031/426; A61K 31/429 20060101 A61K031/429; C12Q 1/02 20060101
C12Q001/02; A61P 27/02 20060101 A61P027/02; A61K 31/4188 20060101
A61K031/4188; A61K 9/12 20060101 A61K009/12; A61K 9/10 20060101
A61K009/10; A61K 9/127 20060101 A61K009/127; A61K 9/00 20060101
A61K009/00 |
Claims
1. A method of treating a subject suffering from diabetic
retinopathy comprising administering to said subject in need
thereof a therapeutically effective amount of a therapeutic agent
which inhibits the interaction of LFA-1 and an ICAM.
2. The method of claim 1 wherein damage resulting from diabetic
retinopathy is macular edema, retinal neovascularization,
fibrovascular growth over a retina, loss of vision, basement
membrane thickening, retinal edema, or retinal ischemia.
3. The method of claim 1 wherein said ICAM is ICAM-1, ICAM-2, or
ICAM-3.
4. The method of claim 3 wherein said ICAM is ICAM-1.
5. The method of claim 1 wherein said therapeutic agent is an LFA-1
antagonist.
6. The method of claim 5 wherein said LFA-1 antagonist binds to a
high affinity binding site in the .alpha.L subunit of LFA-1
overlapping the ICAM-1 binding site.
7. The method of claim 5 wherein said LFA-1 antagonist is directly
competitive with the binding of ICAM-1 at the .alpha.L subunit of
LFA-1.
8. The method of claim 5 wherein said LFA-1 antagonist is an
allosteric antagonist of the binding of ICAM-1 at the .alpha.L
subunit of LFA-1.
9. The method of claim 5 wherein said LFA-1 antagonist is an
antibody.
10. The method of claim 5 wherein said LFA-1 antagonist is a
compound of Formula I or its pharmaceutically acceptable salts or
esters, wherein ##STR00142## R.sup.1 and R.sup.2 are each
independently hydrogen, an amino acid side chain,
--(CH.sub.2).sub.mOH, --(CH2).sub.maryl, --(CH2).sub.mheteroaryl,
wherein m is 0-6, --CH(R.sup.1A)(OR.sup.1B),
--CH(R.sup.1A)(NHR.sup.1B), U-T-Q, or an aliphatic, alicyclic,
heteroaliphatic or heteroalicyclic moiety optionally substituted
with U-T-Q; wherein U is absent, --O--, --S(O).sub.0-2--,
--SO.sub.2N(R.sup.1A), --N(R.sup.1A)--, --N(R.sup.1A)C(.dbd.O)--,
--N(R.sup.1A)C(.dbd.O)--O--, --N(R.sup.1A)C(.dbd.O)--N(R.sup.1B)--,
--N(R.sup.1A)--SO.sub.2--, --C(.dbd.O)--, --C(.dbd.O)--O--,
--O--C(.dbd.O)--, aryl, heteroaryl, alkylaryl, alkylheteroaryl,
--C(.dbd.O)--N(R.sup.1A)--, --OC(.dbd.O)N(R.sup.1A)--,
--C(.dbd.N--R.sup.1E)--, --C(.dbd.N--R.sup.1E)--O--,
--C(.dbd.N--R.sup.1E)--N(R.sup.1A)--,
--O--C(.dbd.N--R.sup.1E)--N(R.sup.1A)--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E),
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--O--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--N(R.sup.1B)--,
--P(.dbd.O)(OR.sup.1A)--O--, or --P(.dbd.O)(R.sup.1A)--O--; T is
absent, an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl
or alkylheteroaryl moiety; and Q is hydrogen, halogen, cyano,
isocyanate, --OR.sup.1B; --SR.sup.1B; --N(R.sup.1B).sub.2,
--NHC(.dbd.O)OR.sup.1B, --NHC(.dbd.O)N(R.sup.1B).sub.2, --NHC
(.dbd.O)R.sup.1B, --NHSO.sub.2R.sup.1B,
NHSO.sub.2N(R.sup.1B).sub.2, --NHSO.sub.2NHC(.dbd.O)OR.sup.1B,
--NHC(.dbd.O)NHSO.sub.2R.sup.1B, --C(.dbd.O)NHC(.dbd.O)OR.sup.1B,
C(.dbd.O)NHC(.dbd.O)R.sup.1B,
--C(.dbd.O)NHC(.dbd.O)N(R.sup.1B).sub.2,
--C(.dbd.O)NHSO.sub.2R.sup.1B,
--C(.dbd.O)NHSO.sub.2N(R.sup.1B).sub.2, C(.dbd.S)N(R.sup.1B).sub.2,
--SO.sub.2R.sup.1B, --SO.sub.2OR.sup.1B, SO.sub.2N(R.sup.1B).sub.2,
--SO.sub.2--NHC(.dbd.O)OR.sup.1B, OC(.dbd.O)--N(R.sup.1B).sub.2,
--OC(.dbd.O)R.sup.1B, --OC(.dbd.O)NHC(.dbd.O)R.sup.1B,
--OC(.dbd.O)NHSO.sub.2R.sup.1B, --OSO.sub.2R.sup.1B, or an
aliphatic heteroaliphatic, aryl or heteroaryl moiety, or wherein
R.sup.1 and R.sup.2 taken together are an alicyclic or heterocyclic
moiety, or together are ##STR00143## wherein each occurrence of
R.sup.1A and R.sup.1B is independently hydrogen, an aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety, --C(.dbd.O)R.sup.1C, or
--C(.dbd.O)NR.sup.1CR.sup.1D; wherein each occurrence of R.sup.1C
and R.sup.1D is independently hydrogen, hydroxyl, or an aliphatic,
heteroaliphatic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety; and R.sup.1E is hydrogen, an aliphatic, alicyclic,
heteroaliphatic, heterocyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, --CN, --OR.sup.1C, --NR.sup.1CR.sup.1D or
--SO.sub.2R.sup.1C; R.sup.3 is C(.dbd.O)OR.sup.3A, --C(.dbd.O)H,
--CH.sub.2OR.sup.3A, --CH.sub.2C(.dbd.O)-alkyl,
--C(.dbd.O)NH(R.sup.3A).--CH.sub.2X.sup.0; wherein each occurrence
of R.sup.3A is independently hydrogen, a protecting group, an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl, alkylheteroaryl, heteroalkylaryl
heteroalkylheteroaryl moiety, or pharmaceutically acceptable salt
or ester, or R.sup.3A, taken together with R.sup.1 and R.sup.2,
forms a heterocyclic moiety; wherein X.sup.0 is a halogen selected
from F, Br or I; R.sup.4 for each occurrence, is independently
hydrogen, halogen, --CN, --NO.sub.2, an aliphatic, alicyclic,
heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, or is GR.sup.G1 wherein G is --O--, --S--,
NR.sup.G2--, --CO--, --SO--, --SO.sub.2--, C(.dbd.O)O--,
--C(.dbd.O)NR.sup.G2--, C(.dbd.O)--, --NR.sup.G2C(.dbd.O)-- or
--SO.sub.2NR.sup.G2--, and R.sup.G1 and R.sup.G2 are independently
hydrogen, an aliphatic, alicyclic, heteroaliphatic,
heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety; n is an integer from 0-4; AR.sup.1 is a monocyclic or
polycyclic aryl, heteroaryl, alkylaryl, alkylheteroaryl, alicyclic
or heterocyclic moiety; A, B, D and E are connected by either a
single or double bond, as valency permits; wherein each occurrence
of A, B D and E is independently C.dbd.O, CR.sup.iR.sup.ii,
NR.sup.i, CR.sup.i, N, O, S, --S(.dbd.O) or SO.sub.2; wherein each
occurrence of R.sup.i and R.sup.ii are independently hydrogen,
halogen, --CN, --NO2, an aliphatic, alicyclic, heteroaliphatic,
heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety, or is -GR.sup.G1 wherein G is --O--, --S--, --NR.sup.G2,
--CO--, --C(.dbd.O)O--, --C(.dbd.O)NR.sup.G2--, --OC(.dbd.O)--,
--NR.sup.G2C(.dbd.O)-- or --SO.sub.2NR.sup.G2--, and R.sup.G1 and
R.sup.G2 are independently hydrogen, an aliphatic, alicyclic,
heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, or any two adjacent occurrences of taken
together, represent an alicyclic, heteroalicyclic, aryl, or
heteroaryl moiety; p is an integer from 0-4; and, L is absent or is
V--W--X--Y-Z, wherein each occurrence of V, W, X, Y and Z is
independently absent, C.dbd.O, NR.sup.L1, --O--,
--C(R.sup.L1).dbd., .dbd.C(R.sup.L1), --C(R.sup.L1)(R.sup.L2),
C(.dbd.N--OR.sup.L1), C(.dbd.NR.sup.L1), --N.dbd., S(O).sub.0-2; a
substituted or unsubstituted C.sub.1-6 alkenylidene or C.sub.2-6
alkenylidine chain wherein up to two non-adjacent methylene units
are independently optionally replaced by --C(.dbd.O)--,
--CO.sub.2--, --C(.dbd.O)C(.dbd.O)--, --C(C.dbd.O)NR.sup.L3--,
--OC(.dbd.O)--, --OC(.dbd.O)NR.sup.L3, --NR.sup.L3NR.sup.L4--,
--NR.sup.L3NR.sup.L4C(.dbd.O)--, --NR.sup.L3C(.dbd.O)--, NR
CO.sub.2--, NR.sup.L3C(.dbd.O)NR.sup.L4--, --S(.dbd.O)--,
--SO.sub.2--, --N.sup.L3SO.sub.2--, --SO.sub.2NR.sup.L3,
--NR.sup.L3SO.sub.2NR.sup.L4, --O--, --S--, or --NR.sup.L3--;
wherein each occurrence of R.sup.L3 and R.sup.L4 is independently
hydrogen, alkyl, heteroalkyl, aryl, heteroaryl or acyl; or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety; and each
occurrence of R.sup.L1 and R.sup.L2 is independently hydrogen,
hydroxyl, protected hydroxyl, amino, protected amino, thio,
protected thio, halogen, cyano, isocyanate, carboxy, carboxyalkyl,
formyl, formyloxy, azido, nitro, ureido, thioureido, thiocyanato,
alkoxy, aryloxy, mercapto, sulfonamido, benzamido, tosyl, or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety, or wherein one or
more occurrences of R.sup.L1 and R.sup.L2, taken together, or taken
together with one of V, W, X, Y or Z form an alicyclic or
heterocyclic moiety or form an aryl or heteroaryl moiety.
11. The method of claim 10 wherein said compound of Formula I is a
compound of Formula II: ##STR00144## wherein R.sup.27 is:
##STR00145## R.sup.28 is: ##STR00146## and R.sup.29 is hydrogen, a
pharmaceutically acceptable salt, or ester.
12. The method of claim 11 wherein the compounds of Formula II
further comprise stereochemistry as in Formula II'.
##STR00147##
13. The method of claim 10 wherein said compound of Formula I is a
compound of Formulae IA, IIA or IIB: ##STR00148## where R.sup.17 is
hydrogen, pharmaceutically acceptable salts or esters, and R.sup.27
is ##STR00149##
14. The method of claim 5 wherein said LFA-1 antagonist comprises a
compound of Formula III ##STR00150## wherein Cy is an aromatic
carbocycle, aromatic heterocycle, or a non-aromatic heterocycle
optionally substituted with hydroxyl, mercapto, thioalkyl, halogen,
oxo, thio, amino, aminoalkyl, amidine, guanidine, nitro, alkyl,
alkoxy or acyl; X.sub.2 is --CH.sub.2--NR.sup.10-[divalent
hydrocarbon chain]- wherein said divalent hydrocarbon chain is
optionally substituted with hydroxyl, mercapto, halogen, amino,
aminoalkyl, nitro, oxo or thio; K is a heterocycle optionally
substituted with hydroxyl, mercapto, halogen, oxo, thio, thioalkyl,
amino, aminoalkyl, carbocycle or heterocycle ring, hydrocarbon, a
halo-substituted hydrocarbon, amino, amidine, guanidine, cyano,
nitro, alkoxy or acyl; L.sub.2 is -[divalent hydrocarbon
chain]-NR.sup.10--CH.sub.2-- wherein said divalent hydrocarbon
chain is optionally substituted with hydroxyl, halogen, oxo or thio
and R.sup.10 is H or alkyl; R.sup.5 is H, OH, amino, O-carbocycle
or alkoxy optionally substituted with amino, a carbocycle,
heterocycle, or is a pharmaceutically acceptable salt or ester;
R.sup.6-9 are independently H, hydroxyl, mercapto, halogen, cyano,
amino, amidine, guanidine, nitro or alkoxy; R.sup.10 is H or a
hydrocarbon chain optionally substituted with a carbocycle or a
heterocycle; and salts, solvates and hydrates thereof.
15. The method of claim 5 wherein said LFA-1 antagonist is a
compound of Formula IV ##STR00151## wherein R.sup.11 is a group of
the formula ##STR00152## wherein A is hydrogen, hydroxy, amino, or
halogen and B is amino, carboxy, hydrogen, hydroxy, cyano,
trifluoromethyl, halogen, lower alkyl, or lower alkoxy; R.sup.12 is
a group of the formula ##STR00153## where R.sup.13 is hydrogen,
carboxy, or lower alkyl; n is 0 or 1; U.sub.2, V.sub.2, and W.sub.2
are independently hydrogen, halogen, or lower alkyl provided
U.sub.2 and V.sub.2 are not both hydrogen; X.sub.3 is carbonyl,
phenyl-substituted lower alkylene, imino, substituted imino, or
sulfonyl; Y.sub.2 is lower alkylene which may be substituted by one
or more of amino, substituted amino, lower alkyl, or cyclo lower
alkyl, or Y.sub.2 is lower alkenylene or lower alkylenethio; k is 0
or 1; when k is 1, Z.sub.2 is hydrogen, lower alkylthio, --COOH,
--CONH.sub.2, amino; when k is 0 or 1, Z.sub.2 is 1-adamantyl,
diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl, hydroxy,
phenylmethoxy,
2-chloro-4-[[[(3-hydroxyphenyl)methyl]amino]carbonyl]phenyl,
[2,6-dichlorophenyl)methoxy]phenyl; when k is 0 or 1, Z.sub.2 is
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, or a fused ring system containing two or three
rings which rings are independently cycloalkyl or aryl containing 0
to 3 heteroatoms which may be the same or different, any of which
rings may be unsubstituted, or substituted with at least one of
halogen, cyano, amino, substituted amino, aminosulfonyl, nitro,
oxo, hydroxy, aryl, aryloxy, unsubstituted lower alkyl,
halogen-substituted lower alkyl, lower alkoxy-substituted lower
alkyl, lower alkoxy, lower alkanesulfonyl, lower alkylthio, acetyl,
aminocarbonyl, hydrazino, carboxy, alkoxycarbonyl, acetoxy, or also
in addition with amino lower alkyl; and R.sup.20 is hydrogen, a
pharmaceutically acceptable salt or ester.
16. The method of claim 15 wherein the compounds of Formula III
further comprise stereochemistry as in Formula III'.
##STR00154##
17. The method of claim 5 wherein said LFA-1 antagonist is a
compound of Formula V wherein: ##STR00155## R.sup.14 is a group of
the formula ##STR00156## R.sup.15 is hydrogen, carboxy, or lower
alkyl; U.sub.3, V.sub.3, and W.sub.3 are independently hydrogen,
halogen; U.sub.3, V.sub.3, and W.sub.3 are lower alkyl provided
that U.sub.3 and V.sub.3 are not both hydrogen; X.sub.4 is
carbonyl, phenyl-substituted lower alkylene, imino, substituted
imino, or sulfonyl; Y.sub.3 is lower alkenylene, lower
alkylenethio, or is lower alkylene which may be substituted by
amino, acetylamino, or cyclo-lower alkyl; k.sub.2 is 0 or 1; when
k.sub.2 is 1, Z is hydrogen, lower alkylthio, --COOH,
--CONH.sub.2--, or amino; when k.sub.2 is 0 or 1, Z.sub.3 is
1-adamantyl, diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl; when k.sub.2
is 0 or 1, Z is cycloalkyl or aryl containing 0 to 3 heteroatoms
which may be the same or different, or a fused ring system
containing two or three rings which rings are independently
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, any of which rings may be unsubstituted, or
substituted with at least one of halogen, cyano, amino, substituted
amino, aminosulfonyl, nitro, oxo, hydroxy, aryl, aryloxy,
unsubstituted lower alkyl, halogen-substituted lower alkyl, lower
alkoxy-substituted lower alkyl, lower alkoxy, carboxy,
alkoxycarbonyl, or acetoxy; and, R.sup.21 is hydrogen, a
pharmaceutically acceptable salt or ester.
18. The method of claim 5 wherein said LFA-1 antagonist is a
compound of Formula VI wherein: ##STR00157## where D.sub.4 is a
mono-, bi-, or tricyclic saturated, unsaturated, or aromatic ring,
each ring having 5-, 6- or 7 atoms in the ring where the atoms in
the ring are carbon or from one to four heteroatoms selected from
the group nitrogen, oxygen, and sulfur, where any carbon or sulfur
ring atom may optionally be oxidized, each ring substituted with
0-3 R.sup.31; L.sub.3 is a bivalent linking group selected from the
group -L.sup.3-L.sup.2-L.sup.1-, -L.sup.4-L.sup.3-L.sup.2-L,.sup.1-
and -L.sup.5-L.sup.4-L.sup.3-L.sup.2-L.sup.1-, where L.sup.1 is
selected from oxo (--O--), S(O).sub.s, C(.dbd.O), CR.sup.32,
R.sup.32, CR.sup.32 het, NR.sup.30 and N, L.sup.2 is selected from
oxo (--O--), S(O).sub.s, C(.dbd.O), C(.dbd.N--O--R.sup.33),
CR.sup.34R.sup.34', CR.sup.34, het NR.sup.30 and N, L.sup.3 is
selected from oxo (--O--), S(O).sub.s, C(.dbd.O),
C(.dbd.N--O--R.sup.33), CR.sup.35R.sup.35', CR.sup.35, het
NR.sup.30 and N, L.sup.4 is absent or is selected from oxo (--O--),
S(O).sub.s, C(.dbd.O), C(.dbd.N--O--R.sup.33), CR.sup.36R.sup.36',
CR.sup.36, NR.sup.30 and N, L.sup.5 is absent or selected from oxo
(--O--), S(O).sub.s, C(.dbd.O), CR.sup.37R.sup.37', CR.sup.37,
NR.sup.30 and N, provided that only one of L.sup.1-L.sup.3 may be
het and that when one of L.sup.1-L.sup.3 is het the other
L.sup.1-L.sup.5 may be absent, where R.sup.32, R.sup.32', R.sup.34,
R.sup.34', R.sup.35, R.sup.35', R.sup.36, R.sup.36', R.sup.37 and
R.sup.37' each are independently selected from R.sup.38, R.sup.39
and U-Q-V--W, optionally, R.sup.24 and R.sup.34' separately or
together may form a saturated, unsaturated or aromatic fused ring
with B.sub.3 through a substituent RP on B, the fused ring
containing 5, 6 or 7 atoms in the ring and optionally containing
1-3 heteroatoms selected from the group O, S and N, where any S or
N may optionally be oxidized; optionally, R.sup.35 and R.sup.35
separately or together and R.sup.36 and R.sup.36' separately or
together may form a saturated, unsaturated or aromatic fused ring
with D.sub.3 through a substituent R.sup.31 on D.sub.3, the fused
ring containing 5, 6 or 7 atoms in the ring and optionally
containing 1-3 heteroatoms selected from the group O, S and N,
where any S or N may optionally be oxidized; also optionally, each
R.sup.32-R.sup.37, NR.sup.30 or N in L.sup.1-L.sup.5 together with
any other R.sup.32-R.sup.37, NR.sup.30 or N in L.sup.1-L.sup.5 may
form a 5, 6 or 7 member homo- or heterocycle either saturated,
unsaturated or aromatic optionally containing 1-3 additional
heteroatoms selected from N, O and S, where any carbon or sulfur
ring atom may optionally be oxidized, each cycle substituted with
0-3 R.sup.31; and where s is 0-2; B is selected from the group
##STR00158## wherein ##STR00159## is a fused hetero- or homocyclic
ring containing 5, 6 or 7 atoms, the ring being unsaturated,
partially saturated or aromatic, the heteroatoms selected from 1-3
O, S and N, Y.sub.3 is selected from CH and NR.sup.30; n is 0-3:
G.sub.3 is selected from hydrogen and C.sub.1-C.sub.6alkyl,
optionally G taken together with T may form a
C.sub.3-C.sub.6cycloalkyl optionally substituted with --V--W;
T.sub.3 is selected from the group a naturally occurring
.alpha.-amino-acid side chain, and
U.sub.4-Q.sub.4-V.sub.4--W.sub.4; U.sub.4 is an optionally
substituted bivalent radical selected from the group
C.sub.1-C.sub.6alkyl, C.sub.0-C.sub.6alkyl-Q,
C.sub.2-C.sub.6alkenyl-Q, and C.sub.2-C.sub.6alkynyl-Q: where the
substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38;
Q.sub.4 is absent or is selected from the group --O--,
--S(O).sub.s--, --SO.sub.2--N(R.sup.30)--, --N(R.sup.30)--,
--N(R.sup.30)--C(.dbd.O)--,
--N(R.sup.30)--C(.dbd.O)--N(R.sup.30)--,
--N(R.sup.30)--C(.dbd.O)--O--, --N(R.sup.30)--SO.sub.2--,
--C(.dbd.O)--, --C(.dbd.O)--O--, -het-, --C(.dbd.O)--N(R.sup.30)--,
--O--C(.dbd.O)--N(R.sup.30)--, --PO(OR.sup.30)O-- and --P(O)O--;
where s is 0-2 and het is a mono- or bicyclic 5, 6, 7, 9 or 10
member heterocyclic ring, each ring containing 1-4 heteroatoms
selected from N, O and S, where the heterocyclic ring may be
saturated, partially saturated, or aromatic and any N or S being
optionally oxidized, the heterocyclic ring being substituted with
0-3 R.sup.41; V.sub.4 is absent or is an optionally substituted
bivalent group selected from C.sub.1-C.sub.6alkyl,
C.sub.3-C.sub.8cycloalkyl,
C.sub.0-C.sub.6alkyl-C.sub.6-C.sub.10aryl, and
C.sub.0-C.sub.6alkyl-het; where the substituents on any alkyl are
1-3 R.sup.38 and the substituents on any aryl or het are 1-3
R.sup.31; W.sub.4 is selected from the group hydrogen, OR.sup.33,
SR.sup.42, NR.sup.30R.sup.30, NH--C(.dbd.O)--O--R.sup.43,
NH--C(.dbd.O)--NR.sup.nR.sup.n, NH--C(.dbd.O)--R.sup.43,
NH--SO.sub.2--R.sup.37, NH--SO.sub.2--NR.sup.30R.sup.30,
NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--NR.sup.30R.sup.30',
C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.S)--NR.sup.30R.sup.30', SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO.sub.2--NR.sup.37R.sup.37',
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.O)--NR.sup.30R.sup.30',
SO.sub.2--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NR.sup.30R.sup.30', O--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--SO.sub.2R.sup.46 and O--SO.sub.2--R.sup.37;
R.sup.44 is selected from C(.dbd.O)--R.sup.45, C(.dbd.O)--H,
CH.sub.2(OH), and CH.sub.2O--C(.dbd.O)--C.sub.1-C.sub.6alkyl;
R.sup.38 is R.sup.38' or R.sup.38'' substituted with 1-3 R.sup.38';
where R.sup.38' is selected from the group hydrogen, halo(F, Cl,
Br, I), cyano, isocyanate, carboxy, carboxy-C.sub.1-C.sub.11alkyl,
amino, amino-C.sub.1-C.sub.8alkyl, aminocarbonyl, carboxamido,
carbamoyl, carbamoyloxy, formyl, formyloxy, azido, nitro,
imidazoyl, ureido, thioureido, thiocyanato, hydroxy,
C.sub.1-C.sub.6alkoxy, mercapto, sulfonamido, het, phenoxy, phenyl,
benzamido, tosyl, morpholino, morpholinyl, piperazinyl,
piperidinyl, pyrrolinyl, imidazolyl, and indolyl; R.sup.38'' is
selected from the group
C.sub.0-C.sub.10alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkynyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.11cycloalkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.10cycloalkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12 aryl-Q-C.sub.0-C.sub.6alkyl,
C.sub.6-C.sub.10 aryl-C.sub.1-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-het-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-het-C.sub.0-C.sub.6alkyl,
het-C.sub.0-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-C.sub.6-C.sub.12aryl, and
-Q-C.sub.1-C.sub.6alkyl; R.sup.43 is selected from hydrogen and
substituted or unsubstituted C.sub.1-C.sub.10alkyl,
C.sub.2-C.sub.10alkenyl, C.sub.2-C.sub.10alkynyl,
C.sub.3-C.sub.11cycloalkyl, C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.16alkyl,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.12aryl and het, where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38 and the substituents on any
aryl or het are 1-3 R.sup.31; R.sup.31 is selected from R.sup.40
and R.sup.41; R.sup.41 is selected from the group OH, OCF.sub.3,
OR.sup.43, SR.sup.42, halo(F, Cl. Br, I), CN, isocyanate, NO.sub.2,
CF.sub.3, C.sub.0-C.sub.6alkyl-NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)--NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)--R.sup.38, C.sub.1-C.sub.8alkyl,
C.sub.1-C.sub.8alkoxy, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.8alkynyl, C.sub.3-C.sub.6cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.1-C.sub.6alkyl-phenyl,
phenyl-C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkyloxycarbonyl,
phenyl-C.sub.0-C.sub.6alkyloxy, C.sub.1-C.sub.6alkyl-het,
het-C.sub.1-C.sub.6alkyl, SO.sub.2-het, --O--C.sub.6-C.sub.12aryl,
--SO.sub.2--C.sub.6-C.sub.12aryl, --SO.sub.2--C.sub.1-C.sub.6alkyl
and het, where any alkyl, alkenyl or alkynyl may optionally be
substituted with 1-3 groups selected from OH, halo(F, Cl, Br, I),
nitro, amino and aminocarbonyl and the substituents on any aryl or
het are 1-2 hydroxy, halo(F, Cl, Br, I), CF.sub.3,
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkoxy, nitro and amino;
R.sup.42 is selected from S--C.sub.1-C.sub.6alkyl,
C(.dbd.O)--C.sub.1-C.sub.6alkyl, C(.dbd.O)--NR.sup.30R.sup.30',
C.sub.1-C.sub.6alkyl, halo(F, Cl, Br, I)--C.sub.1-C.sub.6alkyl,
benzyl and phenyl; R.sup.30 is selected from the group R.sup.43,
NH--C(.dbd.O)--O--R.sup.43, NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NHR.sup.43, NH--SO.sub.2--R.sup.46,
NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37, C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--R.sup.43, C(.dbd.O)--NHR.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--SO.sub.2--R.sup.46,
C(.dbd.O)--NH--SO.sub.2--NHR.sup.37, SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO.sub.2--N(R.sup.43).sub.2,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43 and
SO.sub.2--NH--C(.dbd.O)--R.sup.43; R.sup.30' is selected from
hydrogen, hydroxy and substituted or unsubstituted
C.sub.1-C.sub.11alkyl, C.sub.1-C.sub.11alkoxy,
C.sub.2-C.sub.10alkenyl, C.sub.2-C.sub.10alkynyl,
C.sub.3-C.sub.11cycloalkyl, C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.10aryl-C.sub.0-C.sub.6alkyloxy,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6alkyl,
C.sub.6-C.sub.12aryl, het, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.1-C.sub.8alkoxycarbonyl, C.sub.3-C.sub.8cycloalkylcarbonyl,
C.sub.3-C.sub.8cycloalkoxycarbonyl,
C.sub.6-C.sub.11aryloxycarbonyl,
C.sub.7-C.sub.11arylalkoxycarbonyl, heteroarylalkoxycarbonyl,
heteroarylalkylcarbonyl, heteroarylcarbonyl,
heteroarylalkylsulfonyl, heteroarylsulfonyl,
C.sub.1-C.sub.6alkylsulfonyl, and C.sub.6-C.sub.10arylsulfonyl,
where the substituents on any alkyl, alkenyl or alkynyl are 1-3
R.sup.38 and the substituents on any aryl, het or heteroaryl are
1-3 R.sup.31; R.sup.30 and R.sup.30' taken together with the common
nitrogen to which they are attached may from an optionally
substituted heterocycle selected from morpholinyl, piperazinyl,
thiamorpholinyl, pyrrolidinyl, imidazolidinyl, indolinyl,
isoindolinyl, 1,2,3,4-tetrahydro-quinolinyl,
1,2,3,4-tetrahydro-isoquinolinyl, thiazolidinyl and
azabicyclononyl, where the substituents are 1-3 R.sup.38; R.sup.33
is selected from hydrogen and substituted or unsubstituted
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.2-C.sub.6alkenyl, C.sub.2-C.sub.6alkynyl,
C.sub.3-C.sub.8cycloalkyl and benzoyl, where the substituents on
any alkyl are 1-3 R.sup.38 and the substituents on any aryl are 1-3
R.sup.40; R.sup.40 is selected from the group OH, halo(F, Cl. Br,
I), CN, isocyanate, OR.sup.43, SR.sup.42, SOR.sup.43, NO.sub.2,
CF.sub.3, R.sup.43, NR.sup.30R.sup.30',
NR.sup.30C(.dbd.O)--O--R.sup.43, NRC(.dbd.O)--R.sup.43,
C.sub.0-C.sub.6alkyl-SO.sub.2--R.sup.43,
C.sub.0-C.sub.6alkyl-SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.O)--R.sup.43, O--C(.dbd.O)--R.sup.43,
C(.dbd.O)--O--R.sup.43, and C(.dbd.O)--NR.sup.30R.sup.30', where
the substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38
and the substituents on any aryl or het are 1-3 R.sup.31; R.sup.46
is a substituted or unsubstituted group selected from
C.sub.1-C.sub.8alkyl, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.8alkynyl, C.sub.3-C.sub.8cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.0-C.sub.6alkyl-phenyl,
phenyl-C.sub.0-C.sub.6alkyl, C.sub.0-C.sub.6alkyl-het and
het-C.sub.0-C.sub.6alkyl, where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38 and the substituents on any
aryl or het are 1-3 R.sup.31; R.sup.45 is a substituted or
unsubstituted group selected from hydroxy, C.sub.1-C.sub.11alkoxy,
C.sub.3-C.sub.12cycloalkoxy, C.sub.8-C.sub.12aralkoxy,
C.sub.8-C.sub.12arcycloalkoxy, C.sub.6-C.sub.10aryloxy,
C.sub.3-C.sub.10 alkylcarbonyloxyalkyloxy, C.sub.3-C.sub.10
alkoxycarbonyloxyalkyloxy, C.sub.3-C.sub.10alkoxycarbonylalkyloxy,
C.sub.5-C.sub.10 cycloalkylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10cycloalkoxycarbonyloxyalkyloxy,
C5-C.sub.10cycloalkoxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonyloxyalkyloxy,
C.sub.8-C.sub.12arylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10alkoxyalkylcarbonyloxyalkyloxy,
(R.sup.30)(R.sup.30)N(C.sub.1-C.sub.10alkoxy)-, ##STR00160## where
the substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38
and the substituents on any aryl or het are 1-3 R.sup.31 and
pharmaceutically acceptable salts thereof.
19. The method according to claim 5, wherein said LFA-1 antagonist
is one of the following compounds: ##STR00161## ##STR00162##
##STR00163## and their pharmaceutically acceptable salts and
esters.
20. The method according to claim 5, wherein said LFA-1 antagonist
is one of the following compounds: ##STR00164## ##STR00165##
##STR00166## ##STR00167## ##STR00168## ##STR00169## ##STR00170##
##STR00171## ##STR00172## ##STR00173## ##STR00174## ##STR00175##
##STR00176## ##STR00177## ##STR00178## ##STR00179## ##STR00180##
##STR00181## ##STR00182## ##STR00183## or their pharmaceutically
acceptable salts and esters.
21. The method of claim 5 wherein the LFA-1 antagonist is a
compound of Formula VII: ##STR00184## and
pharmaceutically-acceptable salts and prodrugs thereof: wherein
R.sub.1, R.sub.2, R.sub.3, R.sub.4, and R.sub.5 are each
independently hydrogen, alkyl, alkenyl, alkenoxy, alkynyl,
aldehyde, alkanoyl, alkoxy, amido, amino, aryl, aryloxy, carboxy,
cyano, cycloalkyl, ether, ester, halogen, heterocyclyl, hydroxy,
ketone, nitro, oxo, perfluoroalkyl, sulfonyl, sulfonate, thio, or
other carbonyl-containing groups, R.sub.6 is unsubstituted alkyls,
unsubstituted saturated cycloalkyls, unsubstituted carboxyalkyls,
or unsubstituted heterocyclylalkyls, wherein the unsubstituted
saturated cycloalkyls, unsubstituted carboxyalkyls, and
unsubstituted heterocyclylalkyls are bonded to the NH of formula
VII through the alkyl group, wherein the unsubstituted
carboxyalkyls comprise a branched alkyl chain, with the proviso
that at least one of R.sub.1 and R.sub.3 is selected from: A.
cinnamides selected from cis-cinnamide or trans-cinnamide defined
as ##STR00185## wherein R.sub.8 and R.sub.9 are each independently
hydrogen, aldehyde, alkyl, alkenyl, alkynyl, alkoxy, amido, amino,
aryl, carboxy, cyano, cycloalkyl, ester, ether, halogen, hydroxy,
ketone, nitro, sulfonate, sulfonyl, thio, or other
carbonyl-containing groups; B. substituents of formula VII-a:
##STR00186## wherein D, B, Y and Z are each independently
--CR.sup.31.dbd., --CR.sup.32R.sup.33--, --C(O)--, --O--,
--SO.sub.2--, --S--, --N.dbd., or --NR.sup.34--; n is an integer of
zero to three; and R.sup.31, R.sup.32, R.sup.33 and R.sup.34 are
each independently hydrogen, alkyl, carboxy, hydroxyalkyl,
monoalkylaminocarbonylalkyl, dialkylaminocarbonylalkyl or
carboxyalkyl; C. cyclopropyl derivatives selected from
cis-cyclopropanoic acid, trans-cyclopropanoic acid,
cis-cyclopropanamide and trans-cyclopropanamide defined as
##STR00187## wherein R.sub.35 and R.sub.36 are each independently
hydrogen, alkyl, carboxy, hydroxyalkyl, or carboxyalkyl, and
wherein R.sub.37 and R.sub.38 are each independently hydrogen,
alkyl, carboxyalkyl, monoalkylaminocarbonylalkyl, or
dialkylaminocarbonylalkyl; D. substituents of formula VII-b:
##STR00188## wherein R.sub.8 and R.sub.9 are as defined above; E.
cinnamic acids of formula VII-c: ##STR00189## wherein R.sub.8 and
R.sub.9 are as defined above; wherein: R.sub.10 and R.sub.11 are
each independently hydrogen, alkanoyl, alkyl, alkenyl, alkynyl,
alkoxy, amido, aryl, arylalkyl, carboxy, cyano, cycloalkyl, ester,
ether, heterocyclyl, hydroxy, ketone, nitro, sulfonyl thio, or
other carbonyl-containing groups, or R.sub.10 and R.sub.11 are
taken together with N to form a heterocyclyl group comprising least
one substituent which is independently hydrogen, alkyl, alkenyl,
alkenoxy, alkynyl, aldehyde, alkanoyl, alkoxy, amido, amino, aryl,
aryloxy, carboxy, cyano, cycloalkyl, ether, ester, halogen,
heterocyclyl, hydroxy, ketone, nitro, oxo, perfluoroalkyl,
sulfonyl, sulfonate, thio, or other carbonyl-containing group, or
R.sub.1 and R.sub.2, and/or R.sub.4 and R.sub.5 are joined together
to form a 5- to 7-membered cycloalkyl, aryl or heterocyclyl ring
when R.sub.3 is a cinnamide, substituent of formula VII-a,
substituent of formula VII-b, or cyclopropyl derivative as defined
above; or R.sub.2 and R.sub.3, and/or R.sub.3 and R.sub.4, and/or
R.sub.4 and R.sub.5 are joined to form a 5- to 7-membered
cycloalkyl, aryl or heterocyclyl ring when R.sub.1 is selected from
cinnamides, substituents of formula VII-a, substituents of formula
VII-b, and cyclopropyl derivatives as defined above; and wherein Ar
is substituted aryl or substituted heteroaryl having at least one
substituent which independently is hydrogen, alkyl, alkenyl,
alkenoxy, alkynyl, aldehyde, alkanoyl, alkoxy, amido, amino, aryl,
aryloxy, carboxy, cyano, cycloalkyl, ether, ester, halogen,
heterocyclyl, hydroxy, ketone, nitro, oxo, perfluoroalkyl,
sulfonyl, sulfonate, thio, or other carbonyl-containing groups.
22. The method of claim 5 wherein the LFA-1 antagonist is a
compound of Formula VIII: ##STR00190## wherein m is 0, 1 or 2; X is
H, cycloalkyl or phenyl, which is unsubstituted or substituted with
one or more substituents which are lower alkyl, hydroxy or halogen;
n is 0 or 1; and Y is phenyl, furanyl, indole or pyrrole, which all
may be substituted with one or more substituents which are
independently lower alkyl, lower alkoxy, halogen,
(3,5-dimethylphenoxy)propoxy, or phenyl, wherein phenyl may be
further substituted with one or more halogen atoms, nitro, amino or
carboxyl groups.
23. The method of claim 5 wherein the LFA-1 antagonist is a
compound of Formula IX: ##STR00191## wherein the dotted line is a
bond or is no bond, R.sub.1 is hydrogen, optionally substituted
alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, aryl, heterocyclyl,
hydroxy, SH, SR.sub.5, cyano, halogen or amino; or the dotted line
is no bond and R.sub.1 is attached to the ring system via a double
bond and is oxo; R.sub.2 is hydrogen, or R.sub.2 is optionally
substituted cycloalkyl, aryl, or heterocyclyl; R.sub.3 is hydrogen,
COOR.sub.6, or aminocarbonyl, or R.sub.3 is optionally substituted
alkyl, alkenyl, alkynyl, aralkyl, alkoxy, cycloalkyloxy, aryloxy,
or heterocyclyloxy; R.sub.4 is hydrogen, halogen, hydroxy, SH,
optionally substituted alkyl, alkenyl, alkynyl, alkoxy or
alkylthio, or R.sub.4 is trialkylsilyl or trialkylsilyloxy,
N.sub.3, or amino, or R.sub.4 is heterocyclyl comprising at least
one nitrogen atom as a heteroatom and being bound via that nitrogen
atom to the compound of formula IX, or R.sub.4 is oxo; and R.sub.5
and R.sub.6 are independently alkyl, alkenyl, alkynyl, cycloalkyl,
aryl or heterocyclyl.
24. The method of claim 5 wherein the LFA-1 antagonist is a
compound of Formula X: ##STR00192## wherein each of a---b and
.alpha.---.beta. independently, is either a single bond or a double
bond; R.sub.1 is ##STR00193## R.sub.a is H, C.sub.1-6 alkyl
optionally substituted by OH or C.sub.1-4 alkoxy, C.sub.2-6 alkenyl
or aryl-C.sub.1-4 alkyl; R.sub.2 is OH; --O--CO--R.sub.5; R.sub.4
is H or OR.sub.19 wherein R.sub.19 is C.sub.1-6 alkyl,
hydroxy-C.sub.1-6 alkyl, C.sub.1-4 alkoxy-C.sub.1-6 alkyl,
aryl-C.sub.1-4 alkyl or C.sub.1-4 alkoxycarbonyl-C.sub.1-4 alkyl;
R.sub.5 is C.sub.1-8 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7
cycloalkyl-C.sub.1-4 alkyl, aryl or aryl-C.sub.1-4 alkyl; or
R.sub.5 is --O--R.sub.6 wherein R.sub.6 is the residue of an
.alpha.-amino-acid attached to O through its carbonyl residue; or
--R.sub.5 is --CHR.sub.7--COR..sub.8 wherein R.sub.7 is H, CIA
alkyl, heteroC.sub.1-4 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7
cycloalkyl-C.sub.1-4 alkyl, aryl or aryl-C.sub.1-4 alkyl and
R.sub.8 is OH, C.sub.1-4 alkoxy or NR.sub.9R.sub.10; each of
R.sub.9 and R.sub.10 independently is H or C.sub.1-4 alkyl, or
R.sub.9 and R.sub.10 form together with the nitrogen to which they
are bound, a heteroaryl group; R.sub.3 is a lactam of formula X-a;
##STR00194## wherein R.sub.30, is C.sub.1-8 alkyl, C.sub.3-7
cycloalkyl, aryl, C.sub.3-7 cycloalkyl-C.sub.1-4 alkyl,
aryl-C.sub.1-4 alkyl, heteroaryl, or heteroaryl-C.sub.1-4; and,
R.sub.31, is OH, C.sub.1-4 alkoxy, C.sub.1-4 alkyl, C.sub.1-4
alkoxy-carbonyl-C.sub.1-4 alkyl, hydroxy-C.sub.1-5 alkoxy,
C.sub.1-4 alkoxy-C.sub.1-5 alkoxy, C.sub.1-4
alkoxy-carbonyl-C.sub.1-4 alkyl, amino-C.sub.1-4 alkoxy,
HOOC--C.sub.1-4 alkoxy, HOOC--C.sub.1-4 alkyl, --R.sub.9a R.sub.10a
N--C.sub.1-5 alkoxy wherein R.sub.9a and R.sub.10a are
independently R.sub.9 or R.sub.10.
25. The method of claim 5 wherein the LFA-1 antagonist is a
compound of Formula XI: ##STR00195## and its enantiomers,
pharmaceutically-acceptable salts, or solvates, thereof, wherein:
R.sub.16 is: ##STR00196## each R.sub.17 is independently
--OR.sub.18, --NR.sub.18R.sub.19, --C(.dbd.O)R.sub.18,
--CO.sub.2R.sub.18, --C(.dbd.O)NR.sub.18R.sub.19,
--NR.sub.18C(.dbd.O)R.sub.19, --NR.sub.18C(.dbd.O)OR.sub.19,
--S(O).sub.pR.sub.19, --NR.sub.18SO.sub.2R.sub.19, or
--SO.sub.2NR.sub.18R.sub.19; R.sub.18 and R.sub.19 are
independently hydrogen, alkyl, substituted alkyl, cycloalkyl, or
substituted cycloalkyl; q is 1, 2, or 3; and p is 1 or 2.
26. The method of claim 1 wherein said therapeutic agent is
administered topically, orally, periocularly, intraocularly, via
injection, nasally, via an aerosol, via an insert, via an implanted
device, or via a drop.
27. The method of claim 26 wherein said therapeutic agent is
administered in a carrier vehicle which is liquid drops, liquid
wash, nebulized liquid, gel, ointment, aerosol, spray, polymer
micro and nanoparticles, solution, suspension, solid, biodegradable
matrix, powder, crystals, foam, or liposomes.
28. The method of claim 26, wherein said therapeutic agent is
administered topically and said topical administration comprises
infusion of said compound to said eyes via a device selected from
the group consisting of a pump-catheter system, an insert, a
continuous or selective release device, a bioabsorbable implant, a
continuous or sustained release formulation, and a contact
lens.
29. The method of claim 1, wherein a therapeutically effective
amount of said therapeutic agent is delivered to an eye of said
subject via local or systemic delivery.
30. The method of claim 26, wherein said therapeutic agent is
administered via injection and said injection is performed
intraocularly, intravitreally, periocularly, subcutaneously,
subconjunctivally, retrobulbarly, or intracamerally.
31. The method of claim 1, wherein said administration is
accomplished by administering an intra-ocular instillation of a
gel, cream, powder, foam, crystals, liposomes, spray, polymer micro
or nanoparticles, or liquid suspension form of said compound.
32. The method according to claim 1, wherein said compound is
administered to said subject in an amount sufficient to achieve
intraocular or retinal concentrations of from about
1.times.10.sup.-8 to about 1.times.10.sup.-1 moles/liter.
33. The method of claim 1 wherein said compound is administered at
least once a year.
34. The method of claim 1 wherein said compound is administered at
least once a day.
35. The method of claim 1 wherein said compound is administered at
least once a week.
36. The method of claim 1 wherein said compound is administered at
least once a month.
37. The method of claim 1 further comprising the step of
determining that said subject is in need of treatment for diabetic
retinopathy.
38. The method of claim 1 further comprising administering a second
therapeutic agent prior to, in combination with, at the same time,
or after administration of said LFA-1 antagonist.
39. The method of claim 38 wherein the second therapeutic agent is
selected from the group consisting of antioxidants,
antiinflammatory agents, antimicrobials, steroids, protein kinase C
inhibitors, angiotensin converting enzyme inhibitors,
antiangiogenic agents, complement inhibitors, and anti-apoptotic
agents.
40. The method of claim 38 wherein the second therapeutic agent is
an anti-adhesion therapeutic agent with allosteric competitive
binding site on LFA-1.
41. The method of claim 38 wherein the second therapeutic agent is
an anti-adhesion therapeutic antibody or antibody fragment.
42. A method of treating a subject suffering from macular edema
comprising administering to said subject in need thereof a
therapeutically effective amount of a therapeutic agent which
inhibits the interaction of LFA-1 and an ICAM, thereby reducing
and/or preventing macular edema in an eye of said subject.
43. The method of claim 42 wherein said ICAM is ICAM-1, ICAM-2, or
ICAM-3.
44. The method of claim 43 wherein said ICAM is ICAM-1.
45. The method of claim 42 wherein said therapeutic agent is an
LFA-1 antagonist.
46. The method of claim 45 wherein said LFA-1 antagonist binds to a
high affinity binding site in the .alpha.L subunit of LFA-1
overlapping the ICAM-1 binding site.
47. The method of claim 46 wherein said LFA-1 antagonist is
directly competitive with the binding of ICAM-1 at the .alpha.L
subunit of LFA-1.
48. The method of claim 45 wherein said LFA-1 antagonist is an
antibody.
49. The method of claim 45 wherein said LFA-1 antagonist comprises
a compound of Formula I, III, IV, or VI and its pharmaceutically
acceptable salts or esters, having the following structures:
##STR00197## R.sup.1 and R.sup.2 are each independently hydrogen,
an amino acid side chain, --(CH.sub.2).sub.mOH, --(CH2).sub.maryl,
--(CH2).sub.mheteroaryl, wherein m is 0-6,
--CH(R.sup.1A)(OR.sup.1B), --CH(R.sup.1A)(NHR.sup.1B), U-T-Q, or an
aliphatic, alicyclic, heteroaliphatic or heteroalicyclic moiety
optionally substituted with U-T-Q; wherein U is absent, --O--,
--S(O).sub.0-2--, --SO.sub.2N(R.sup.1A), --N(R.sup.1A)--,
--N(R.sup.1A)C(.dbd.O)--, --N(R.sup.1A)C(.dbd.O)--O--,
--N(R.sup.1A)C(.dbd.O)--N(R.sup.1B)--, --N(R.sup.1A)--SO.sub.2--,
--C(.dbd.O)--, --C(.dbd.O)--O--, --O--C(.dbd.O)--, aryl,
heteroaryl, alkylaryl, alkylheteroaryl, --C(.dbd.O)--N(R.sup.1A)--,
--OC(.dbd.O)N(R.sup.1A)--, --C(.dbd.N--R.sup.1E),
--C(.dbd.NR.sup.1E)--O--, --C(.dbd.NR.sup.1E)--N(R.sup.1A),
--C(.dbd.N--R.sup.1E)--N(R.sup.1A)--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--O--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--N(R.sup.1B)--,
--P(.dbd.O)(OR.sup.1A)--O--, or --P(.dbd.O)(R.sup.1A)--O--; T is
absent, an aliphatic, heteroaliphatic, aryl, heteroaryl, alkylaryl
or alkylheteroaryl moiety; and Q is hydrogen, halogen, cyano,
isocyanate, --OR.sup.1B; --SR.sup.1B; --N(R.sup.1B).sub.2,
--NHC(.dbd.O)OR.sup.1B, --NRC(.dbd.O)N(R.sup.1B).sub.2, --NHC
(.dbd.O)R.sup.1B, --NHSO.sub.2R.sup.1B,
NHSO.sub.2N(R.sup.1B).sub.2, --NHSO.sub.2NHC(.dbd.O)OR.sup.1B,
--NHC(.dbd.O)NHSO.sub.2R.sup.1B, --C(.dbd.O)NHC(.dbd.O)OR.sup.1B,
C(.dbd.O)NHC(.dbd.O)R.sup.1B,
--C(.dbd.O)NHC(.dbd.O)N(R.sup.1B).sub.2,
--C(.dbd.O)NHSO.sub.2R.sup.1B,
--C(.dbd.O)NHSO.sub.2N(R.sup.1B).sub.2, C(.dbd.S)N(R.sup.1B).sub.2,
--SO.sub.2R.sup.1B, --SO.sub.2OR.sup.1B, --SO.sub.2N(R).sub.2,
--SO.sub.2--NHC(.dbd.O)OR.sup.1B, --OC(.dbd.O)--N(R.sup.1B).sub.2,
--OC(.dbd.O)R.sup.1B, --OC(.dbd.O)NHC(.dbd.O)R.sup.1B,
--OC(.dbd.O)NHSO.sub.2R.sup.1B, --OSO.sub.2R.sup.1B, or an
aliphatic heteroaliphatic, aryl or heteroaryl moiety, or wherein
R.sup.1 and R.sup.2 taken together are an alicyclic or heterocyclic
moiety, or together are ##STR00198## wherein each occurrence of
R.sup.1A and R.sup.1B is independently hydrogen, an aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety, --C(.dbd.O)R.sup.1C, or
--C(.dbd.O)NR.sup.1CR.sup.1D; wherein each occurrence of R.sup.1C
and R.sup.1D is independently hydrogen, hydroxyl, or an aliphatic,
heteroaliphatic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety; and R.sup.1E is hydrogen, an aliphatic, alicyclic,
heteroaliphatic, heterocyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, --CN, --OR.sup.1C, --NR.sup.1CR.sup.1D or
--SO.sub.2R.sup.1C; R.sup.3 is --C(.dbd.O)OR.sup.3A, --C(.dbd.O)H,
--CH.sub.2OR.sup.3A, --CH.sub.2OC(.dbd.O)-alkyl,
--C(.dbd.O)NH(R.sup.3A).--CH.sub.2X.sup.0; wherein each occurrence
of R.sup.3A is independently hydrogen, a protecting group, an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl, alkylheteroaryl, heteroalkylaryl
heteroalkylheteroaryl moiety, or pharmaceutically acceptable salt
or ester, or R.sup.3A, taken together with R.sup.1 and R.sup.2,
forms a heterocyclic moiety; wherein X.sup.0 is a halogen selected
from F, Br or I; R.sup.4 for each occurrence, is independently
hydrogen, halogen, --CN, --NO.sub.2, an aliphatic, alicyclic,
heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, or is GR.sup.G1 wherein G is --O--, --S--,
NR.sup.G2--, --CO--, --SO--, --SO.sub.2--, C(.dbd.O)O--,
--C(.dbd.O)NR.sup.G2--, C(.dbd.O)--, --NR.sup.G2C(.dbd.O)-- or
--SO.sub.2NR.sup.G2--, and R.sup.G1 and R.sup.G2 are independently
hydrogen, an aliphatic, alicyclic, heteroaliphatic,
heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety; n is an integer from 0-4; AR.sup.1 is a monocyclic or
polycyclic aryl, heteroaryl, alkylaryl, alkylheteroaryl, alicyclic
or heterocyclic moiety; A, B, D and E are connected by either a
single or double bond, as valency permits; wherein each occurrence
of A, B, D and E is independently C.dbd.O, CR.sup.iR.sup.ii,
NR.sup.i, CR.sup.ii, N, O, S, --S(.dbd.O) or SO.sub.2; wherein each
occurrence of R.sup.i and R.sup.ii is independently hydrogen,
halogen, --CN, --NO2, an aliphatic, alicyclic, heteroaliphatic,
heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety, or is -GR.sup.G1 wherein G is --O--, --S--, --NR.sup.G2,
--CO--, --SO--, --C(.dbd.O)O--, --C(.dbd.O)NR.sup.G2--,
--OC(.dbd.O)--, --NR.sup.G2C(.dbd.O)-- or --SO.sub.2NR.sup.G2--,
and R.sup.G1 and R.sup.G2 are independently hydrogen, an aliphatic,
alicyclic, heteroaliphatic, heteroalicyclic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety, or any two adjacent
occurrences of taken together, represent an alicyclic,
heteroalicyclic, aryl, or heteroaryl moiety; p is an integer from
0-4; and, L is absent or is V--W--X--Y-Z, wherein each occurrence
of V, W, X, Y and Z is independently absent, C.dbd.O, NR.sup.L1,
--O--, --C(R.sup.L1).dbd., .dbd.C(R.sup.L1)--,
--C(R.sup.L1)(R.sup.L2), C(.dbd.N--OR.sup.L1), C(.dbd.NR.sup.L1),
--N.dbd., S(O).sub.0-2; a substituted or unsubstituted C.sub.1-6
alkenylidene or C.sub.2-6 alkenylidine chain wherein up to two
non-adjacent methylene units are independently optionally replaced
by --C(.dbd.O)--, --CO.sub.2--, --C(.dbd.O)C(.dbd.O)--,
--C(C.dbd.O)NR.sup.L3--, --OC(.dbd.O)--, --OC(.dbd.O)NR.sup.L1,
--NR.sup.L3NR.sup.L1--, --NR.sup.L3NR.sup.L4C(.dbd.O)--,
--NR.sup.L3C(.dbd.O)--, NR.sup.L3CO.sub.2--,
NR.sup.L3C(.dbd.O)NR.sup.L4--, --S(.dbd.O)--, --SO.sub.2--,
--NR.sup.L3SO.sub.2--, --SO.sub.2NR.sup.L3,
--NR.sup.L3SO.sub.2NR.sup.L4, --O--, --S--, or --NR.sup.L3--;
wherein each occurrence of R.sup.L3 and R.sup.L4 is independently
hydrogen, alkyl, heteroalkyl, aryl, heteroaryl or acyl; or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety; and each
occurrence of R.sup.L1 and R.sup.L2 is independently hydrogen,
hydroxyl, protected hydroxyl, amino, protected amino, thio,
protected thio, halogen, cyano, isocyanate, carboxy, carboxyalkyl,
formyl, formyloxy, azido, nitro, ureido, thioureido, thiocyanato,
alkoxy, aryloxy, mercapto, sulfonamido, benzamido, tosyl, or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety, or wherein one or
more occurrences of R.sup.L1 and R.sup.L2, taken together, or taken
together with one of V, W, X, Y or Z form an alicyclic or
heterocyclic moiety or form an aryl or heteroaryl moiety; or
##STR00199## wherein Cy is an aromatic carbocycle, aromatic
heterocycle or non-aromatic heterocycle optionally substituted with
hydroxyl, mercapto, thioalkyl, halogen, oxo, thio, amino,
aminoalkyl, amidine, guanidine, nitro, alkyl, alkoxy or acyl;
X.sub.2 is --CH.sub.2--NR.sup.10-[divalent hydrocarbon chain]-
wherein said divalent hydrocarbon chain is optionally substituted
with hydroxyl, mercapto, halogen, amino, aminoalkyl, nitro, oxo or
thio; K is a heterocycle optionally substituted with hydroxyl,
mercapto, halogen, oxo, thio, thioalkyl, amino, aminoalkyl,
carbocycle or heterocycle ring, hydrocarbon, a halo-substituted
hydrocarbon, amino, amidine, guanidine, cyano, nitro, alkoxy or
acyl; L.sub.2 is -[divalent hydrocarbon
chain]-NR.sup.10--CH.sub.2-- wherein said divalent hydrocarbon
chain is optionally substituted with hydroxyl, halogen, oxo or thio
and R.sup.10 is H or alkyl; R.sup.5 is H, OH, amino, O-carbocycle
or alkoxy optionally substituted with amino, a carbocycle,
heterocycle, or is a pharmaceutically acceptable salt or ester;
R.sup.6-9 are independently H, hydroxyl, mercapto, halogen, cyano,
amino, amidine, guanidine, nitro or alkoxy; R.sup.10 is H or a
hydrocarbon chain optionally substituted with a carbocycle or a
heterocycle; and salts, solvates and hydrates thereof; or
##STR00200## wherein R.sup.11 is a group of the formula
##STR00201## wherein A is hydrogen, hydroxy, amino, or halogen and
B is amino, carboxy, hydrogen, hydroxy, cyano, trifluoromethyl,
halogen, lower alkyl, or lower alkoxy; R.sup.12 is a group of the
formula ##STR00202## where R.sup.13 is hydrogen, carboxy, or lower
alkyl; n is 0 or 1; U.sub.2, V.sub.2, and W.sub.2 are independently
hydrogen, halogen, or lower alkyl provided U.sub.2 and V.sub.2 are
not both hydrogen; X.sub.3 is carbonyl, phenyl-substituted lower
alkylene, imino, substituted imino, or sulfonyl; Y.sub.2 is lower
alkylene which may be substituted by one or more of amino,
substituted amino, lower alkyl, or cyclo lower alkyl, or Y.sub.2 is
lower alkenylene or lower alkylenethio; k is 0 or 1; when k is 1,
Z.sub.2 is hydrogen, lower alkylthio, --COOH, --CONH.sub.2, amino;
when k is 0 or 1, Z.sub.2 is 1-adamantyl, diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl, hydroxy,
phenylmethoxy,
2-chloro-4-[[[(3-hydroxyphenyl)methyl]amino]carbonyl]phenyl,
[2,6-dichlorophenyl)methoxy]phenyl; when k is 0 or 1, Z.sub.2 is
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, or a fused ring system containing two or three
rings which rings are independently cycloalkyl or aryl containing 0
to 3 heteroatoms which may be the same or different, any of which
rings may be unsubstituted, or substituted with at least one of
halogen, cyano, amino, substituted amino, aminosulfonyl, nitro,
oxo, hydroxy, aryl, aryloxy, unsubstituted lower alkyl,
halogen-substituted lower alkyl, lower alkoxy-substituted lower
alkyl, lower alkoxy, lower alkanesulfonyl, lower alkylthio, acetyl,
aminocarbonyl, hydrazino, carboxy, alkoxycarbonyl, acetoxy, or also
in addition with amino lower alkyl; and R.sup.20 is hydrogen, a
pharmaceutically acceptable salt or ester; or ##STR00203## R.sup.14
is a group of the formula ##STR00204## R.sup.15 is hydrogen,
carboxy, or lower alkyl; U.sub.3, V.sub.3, and W.sub.3 are
independently hydrogen, halogen; U.sub.3, V.sub.3, and W.sub.3 are
lower alkyl provided that U.sub.3 and V.sub.3 are not both
hydrogen; X.sub.4 is carbonyl, phenyl-substituted lower alkylene,
imino, substituted imino, or sulfonyl; Y.sub.3 is lower alkenylene,
lower alkylenethio, or is lower alkylene which may be substituted
by amino, acetylamino, or cyclo-lower alkyl; k.sub.2 is 0 or 1;
when k.sub.2 is 1, Z is hydrogen, lower alkylthio, --COOH,
--CONH.sub.2--, or amino; when k.sub.2 is 0 or 1, Z.sub.3 is
1-adamantyl, diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl; when k.sub.2
is 0 or 1, Z is cycloalkyl or aryl containing 0 to 3 heteroatoms
which may be the same or different, or a fused ring system
containing two or three rings which rings are independently
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, any of which rings may be unsubstituted, or
substituted with at least one of halogen, cyano, amino, substituted
amino, aminosulfonyl, nitro, oxo, hydroxy, aryl, aryloxy,
unsubstituted lower alkyl, halogen-substituted lower alkyl, lower
alkoxy-substituted lower alkyl, lower alkoxy, carboxy,
alkoxycarbonyl, or acetoxy; and, R.sup.21 is hydrogen, a
pharmaceutically acceptable salt or ester or ##STR00205## wherein
D.sub.4 is a mono-, bi-, or tricyclic saturated, unsaturated, or
aromatic ring, each ring having 5-, 6- or 7 atoms in the ring where
the atoms in the ring are carbon or from one to four heteroatoms
selected from the group nitrogen, oxygen, and sulfur, where any
carbon or sulfur ring atom may optionally be oxidized, each ring
substituted with 0-3 R.sup.31; L.sub.3 is a bivalent linking group
selected from the group -L.sup.3-L.sup.2-L.sup.1-,
-L.sup.4-L.sup.3-L.sup.2-L,.sup.1- and
-L.sup.5-L.sup.4-L.sup.3-L.sup.2-L.sup.1-, where L.sup.1 is
selected from oxo (--O--), S(O).sub.s, C(.dbd.O), CR.sup.32,
R.sup.32, CR.sup.32 het, NR.sup.30 and N, L.sup.2 is selected from
oxo (--O--), S(O).sub.s, C(.dbd.O), C(.dbd.N--O--R.sup.33),
CR.sup.34R.sup.34', CR.sup.34, bet NR.sup.30 and N, L.sup.3 is
selected from oxo (--O--), S(O).sub.s, C(.dbd.O),
C(.dbd.N--O--R.sup.33), CR.sup.35R.sup.35', CR.sup.35, bet
NR.sup.30 and N, L.sup.4 is absent or is selected from oxo (--O--),
S(O).sub.s, C(.dbd.O), C(.dbd.N--O--R.sup.33), CR.sup.36R.sup.36',
CR.sup.36, NR.sup.30 and N, L.sup.5 is absent or selected from oxo
(--O--), S(O).sub.s, C(.dbd.O), CR.sup.37R.sup.37', CR.sup.37,
NR.sup.30 and N, provided that only one of L.sup.1-L.sup.3 may be
het and that when one of L.sup.1-L.sup.3 is het the other
L.sup.1-L.sup.5 may be absent, where R.sup.32, R.sup.32', R.sup.34,
R.sup.34', R.sup.35, R.sup.35', R.sup.36, R.sup.36', R.sup.37 and
R.sup.37' each are independently selected from R.sup.38, R.sup.39
and U-Q-V--W, optionally, R.sup.24 and R.sup.34' separately or
together may form a saturated, unsaturated or aromatic fused ring
with B.sub.3 through a substituent RP on B, the fused ring
containing 5, 6 or 7 atoms in the ring and optionally containing
1-3 heteroatoms selected from the group O, S and N, where any S or
N may optionally be oxidized; optionally, R.sup.35 and R.sup.35
separately or together and R.sup.36 and R.sup.36' separately or
together may form a saturated, unsaturated or aromatic fused ring
with D.sub.3 through a substituent R.sup.31 on D.sub.3, the fused
ring containing 5, 6 or 7 atoms in the ring and optionally
containing 1-3 heteroatoms selected from the group O, S and N,
where any S or N may optionally be oxidized; also optionally, each
R.sup.32-R.sup.37, NR.sup.30 or N in L.sup.1-L.sup.5 together with
any other R.sup.32-R.sup.37, NR.sup.30 or N in L.sup.1-L.sup.5 may
form a 5, 6 or 7 member homo- or heterocycle either saturated,
unsaturated or aromatic optionally containing 1-3 additional
heteroatoms selected from N, O and S, where any carbon or sulfur
ring atom may optionally be oxidized, each cycle substituted with
0-3 R.sup.31; and where s is 0-2; B is selected from the group;
##STR00206## wherein ##STR00207## is a fused hetero- or homocyclic
ring containing 5, 6 or 7 atoms, the ring being unsaturated,
partially saturated or aromatic, the heteroatoms selected from 1-3
O, S and N, Y.sub.3 is selected from CH and NR.sup.30; n is 0-3:
G.sub.3 is selected from hydrogen and C.sub.1-C.sub.6alkyl,
optionally G taken together with T may form a
C.sub.3-C.sub.6cycloalkyl optionally substituted with --V--W;
T.sub.3 is selected from the group a naturally occurring
.alpha.-amino-acid side chain, and
U.sub.4-Q.sub.4-V.sub.4--W.sub.4; U.sub.4 is an optionally
substituted bivalent radical selected from the group
C.sub.1-C.sub.6alkyl, C.sub.0-C.sub.6alkyl-Q,
C.sub.2-C.sub.6alkenyl-Q, and C.sub.2-C.sub.6alkynyl-Q: where the
substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38;
Q.sub.4 is absent or is selected from the group --O--,
--S(O).sub.s--, --SO.sub.2--N(R.sup.30)--, --N(R.sup.30)--,
--N(R.sup.30)--C(.dbd.
O)--, --N(R.sup.30)--C(.dbd.O)--N(R.sup.30)--,
--N(R.sup.30)--C(.dbd.O)--O--, --N(R.sup.30)--SO.sub.2--,
--C(.dbd.O)--, --C(.dbd.O)--O--, -het-, --C(.dbd.O)--N(R.sup.30)--,
--O--C(.dbd.O)--N(R.sup.30)--, --PO(OR.sup.30)O-- and --P(O)O--;
where is 0-2 and het is a mono- or bicyclic 5, 6, 7, 9 or 10 member
heterocyclic ring, each ring containing 1-4 heteroatoms selected
from N, O and S, where the heterocyclic ring may be saturated,
partially saturated, or aromatic and any N or S being optionally
oxidized, the heterocyclic ring being substituted with 0-3
R.sup.41; V.sub.4 is absent or is an optionally substituted
bivalent group selected from C.sub.1-C.sub.6alkyl,
C.sub.3-C.sub.8cycloalkyl,
C.sub.0-C.sub.6alkyl-C.sub.6-C.sub.10aryl, and
C.sub.0-C.sub.6alkyl-het; where the substituents on any alkyl are
1-3 R.sup.38 and the substituents on any aryl or het are 1-3
R.sup.31; W.sub.4 is selected from the group hydrogen, OR.sup.33,
SR.sup.42, NR.sup.30R.sup.30, NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NR.sup.nR.sup.n, NH--C(.dbd.O)--R.sup.43,
NH--SO.sub.2--R.sup.37, NH--SO.sub.2--NR.sup.30R.sup.30,
NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--NR.sup.30R.sup.30',
C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.S)--NR.sup.30R.sup.30', SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO.sub.2--NR.sup.37R.sup.37',
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.OC)--NR.sup.30R.sup.30',
SO.sub.2--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NR.sup.30R.sup.30', O--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--SO.sub.2R.sup.46 and O--SO.sub.2--R.sup.37;
R.sup.44 is selected from C(.dbd.O)--R.sup.45, C(.dbd.O)--H,
CH.sub.2(OH), and CH.sub.2O--C(.dbd.O)--C.sub.1-C.sub.6alkyl;
R.sup.38 is R.sup.38' or R.sup.38'' substituted with 1-3 R.sup.38';
where R.sup.38' is selected from the group hydrogen, halo(F, Cl,
Br, I), cyano, isocyanate, carboxy, carboxy-C.sub.1-C.sub.11alkyl,
amino, amino-C.sub.1-C.sub.8alkyl, aminocarbonyl, carboxamido,
carbamoyl, carbamoyloxy, formyl, formyloxy, azido, nitro,
imidazoyl, ureido, thioureido, thiocyanato, hydroxy,
C.sub.1-C.sub.6alkoxy, mercapto, sulfonamido, het, phenoxy, phenyl,
benzamido, tosyl, morpholino, morpholinyl, piperazinyl,
piperidinyl, pyrrolinyl, imidazolyl, and indolyl; R.sup.38'' is
selected from the group
C.sub.0-C.sub.10alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkynyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.11cycloalkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.10cycloalkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12 aryl-Q-C.sub.0-C.sub.6alkyl,
C.sub.6-C.sub.10 aryl-C.sub.1-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-het-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-het-C.sub.0-C.sub.6alkyl,
het-C.sub.0-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-C.sub.6-C.sub.12aryl, and
-Q-C.sub.1-C.sub.6alkyl; R.sup.43 is selected from hydrogen and
substituted or unsubstituted C.sub.1-C.sub.10alkyl,
C.sub.2-C.sub.10alkenyl, C.sub.2-C.sub.10alkynyl,
C.sub.3-C.sub.11cycloalkyl, C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.16alkyl,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.12aryl and het, where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38 and the substituents on any
aryl or het are 1-3 R.sup.31; R.sup.31 is selected from R.sup.40
and R.sup.41; R.sup.41 is selected from the group OH, OCF.sub.3,
OR.sup.43, SR.sup.42, halo(F, Cl. Br, I), CN, isocyanate, NO.sub.2,
CF.sub.3, C.sub.0-C.sub.6alkyl-NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)--NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)--R.sup.38, C.sub.1-C.sub.8alkyl,
C.sub.1-C.sub.8alkoxy, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.8alkynyl, C.sub.3-C.sub.6cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.1-C.sub.6alkyl-phenyl,
phenyl-C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkyloxycarbonyl,
phenyl-C.sub.0-C.sub.6alkyloxy, C.sub.1-C.sub.6alkyl-het,
het-C.sub.1-C.sub.6alkyl, SO.sub.2-het, --O--C.sub.6-C.sub.12aryl,
--SO.sub.2--C.sub.6-C.sub.12aryl, --SO.sub.2--C.sub.1-C.sub.6alkyl
and het, where any alkyl, alkenyl or alkynyl may optionally be
substituted with 1-3 groups selected from OH, halo(F, Cl, Br, I),
nitro, amino and aminocarbonyl and the substituents on any aryl or
het are 1-2 hydroxy, halo(F, Cl, Br, I), CF.sub.3,
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkoxy, nitro and amino;
R.sup.m is selected from S--C.sub.1-C.sub.6alkyl,
C(.dbd.O)--C.sub.1-C.sub.6alkyl, C(.dbd.O)--NR.sup.30R.sup.30',
C.sub.1-C.sub.6alkyl, halo(F, Cl, Br, I)--C.sub.1-C.sub.6alkyl,
benzyl and phenyl; R.sup.30 is selected from the group R.sup.43,
NH--C(.dbd.O)--O--R.sup.43, NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NHR.sup.43, NH--SO.sub.2--R.sup.46,
NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37, C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--R.sup.43, C(.dbd.O)--NHR.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--SO.sub.2--R.sup.46,
C(.dbd.O)--NH--SO.sub.2--NHR.sup.37, SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO.sub.2--N(R.sup.43).sub.2,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43 and
SO.sub.2--NH--C(.dbd.O)--R.sup.43; R.sup.30' is selected from
hydrogen, hydroxy and substituted or unsubstituted
C.sub.1-C.sub.11alkyl, C.sub.1-C.sub.11 alkoxy,
C.sub.2-C.sub.10alkenyl, C.sub.2-C.sub.10alkynyl,
C.sub.3-C.sub.11cycloalkyl, C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.16 alkyl,
C.sub.6-C.sub.10aryl-C.sub.0-C.sub.6alkyloxy,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6alkyl,
C.sub.6-C.sub.12aryl, het, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.1-C.sub.8alkoxycarbonyl, C.sub.3-C.sub.8cycloalkylcarbonyl,
C.sub.3-C.sub.8cycloalkoxycarbonyl,
C.sub.6-C.sub.11aryloxycarbonyl,
C.sub.7-C.sub.11arylalkoxycarbonyl, heteroarylalkoxycarbonyl,
heteroarylalkylcarbonyl, heteroarylcarbonyl,
heteroarylalkylsulfonyl, heteroarylsulfonyl,
C.sub.1-C.sub.6alkylsulfonyl, and C.sub.6-C.sub.10arylsulfonyl,
where the substituents on any alkyl, alkenyl or alkynyl are 1-3
R.sup.38 and the substituents on any aryl, het or heteroaryl are
1-3 R.sup.31; R.sup.30 and R.sup.30' taken together with the common
nitrogen to which they are attached may from an optionally
substituted heterocycle selected from morpholinyl, piperazinyl,
thiamorpholinyl, pyrrolidinyl, imidazolidinyl, indolinyl,
isoindolinyl, 1,2,3,4-tetrahydro-quinolinyl,
1,2,3,4-tetrahydro-isoquinolinyl, thiazolidinyl and
azabicyclononyl, where the substituents are 1-3 R.sup.38; R.sup.33
is selected from hydrogen and substituted or unsubstituted
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.2-C.sub.6alkenyl, C.sub.2-C.sub.6alkynyl,
C.sub.3-C.sub.8cycloalkyl and benzoyl, where the substituents on
any alkyl are 1-3 R.sup.38 and the substituents on any aryl are 1-3
R.sup.40; R.sup.40 is selected from the group OH, halo(F, Cl. Br,
I), CN, isocyanate, OR.sup.43, SR.sup.42, SOR.sup.43, NO.sub.2,
CF.sub.3, R.sup.43, NR.sup.30R.sup.30',
NR.sup.30C(.dbd.O)--O--R.sup.43, NRC(.dbd.O)--R.sup.43,
C.sub.0-C.sub.6alkyl-SO.sub.2--R.sup.43,
C.sub.0-C.sub.6alkyl-SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.O)--R.sup.43, O--C(.dbd.O)--R.sup.43,
C(.dbd.O)--O--R.sup.43, and C(.dbd.O)--NR.sup.30R.sup.30', where
the substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38
and the substituents on any aryl or het are 1-3 R.sup.31; R.sup.46
is a substituted or unsubstituted group selected from
C.sub.1-C.sub.8alkyl, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.8alkynyl, C.sub.3-C.sub.8cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.0-C.sub.6alkyl-phenyl,
phenyl-C.sub.0-C.sub.6alkyl, C.sub.0-C.sub.6alkyl-het and
het-C.sub.0-C.sub.6alkyl, where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38 and the substituents on any
aryl or het are 1-3 R.sup.31; R.sup.45 is a substituted or
unsubstituted group selected from hydroxy, C.sub.1-C.sub.11alkoxy,
C.sub.3-C.sub.12cycloalkoxy, C.sub.8-C.sub.12aralkoxy,
C.sub.8-C.sub.12arcycloalkoxy, C.sub.6-C.sub.10aryloxy,
C.sub.3-C.sub.10 alkylcarbonyloxyalkyloxy, C.sub.3-C.sub.10
alkoxycarbonyloxyalkyloxy, C.sub.3-C.sub.10alkoxycarbonylalkyloxy,
C.sub.5-C.sub.10 cycloalkylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10cycloalkoxycarbonyloxyalkyloxy,
C.sub.5-C.sub.10cycloalkoxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonyloxyalkyloxy,
C.sub.8-C.sub.12arylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10alkoxyalkylcarbonyloxyalkyloxy,
(R.sup.30)(R.sup.30)N(C.sub.1-C.sub.10alkoxy)-, ##STR00208## where
the substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38
and the substituents on any aryl or het are 1-3 R.sup.31 and
pharmaceutically acceptable salts thereof.
50. The method of claim 42 wherein said LFA-1 antagonist is
administered in a therapeutically acceptable formulation via
instillation, via intraocular implantation, via periocular
implantation, via injection, orally, intranasally, topically, or
iontophoretically.
51. The method of claim 50 wherein said administration via
injection is performed intraocularly, intravitreally, periocularly,
subcutaneously, subconjunctivally, retrobulbarly, or
intracamerally.
52. The method of claim 42 wherein said pharmaceutically acceptable
formulation comprises a gel, cream, powder, foam, crystals,
liposomes, spray, polymer micro or nanoparticles, biodegradable
matrix, liquid suspension, solution, suspension, an ointment, a
pack, bioabsorbable implant, or an ocular insert.
53. A method of treating diabetic retinopathy in an subject
comprising performing a diabetic retinopathy diagnostic test on
said subject; determining whether said subject suffers from
diabetic retinopathy based on the results of said diagnostic test;
and upon diagnosis of said diabetic retinopathy, administering to
said subject an effective amount of a lymphocyte function
associated antigen-1 (LFA-1) antagonist in a pharmaceutically
acceptable formulation.
54. The method of claim 53 wherein said diagnostic test is
performed by imaging an eye of said subject or analysis of a
biological sample of an eye of said subject.
55. A method of reducing and/or preventing post-operative ocular
inflammation in a subject suffering from diabetes comprising
administering to said subject in need thereof a therapeutically
effective amount of a LFA-1 antagonist, thereby reducing and/or
preventing post-operative inflammation in an eye of said
subject.
56. The method of claim 55 wherein said post-operative inflammation
is the result of vitrectomy, laser photocoagulation therapy,
photodynamic therapy, or LASIK.
57. The method of claim 42, 53, or 55 wherein said LFA-1 antagonist
is selected from the group consisting of: ##STR00209## ##STR00210##
##STR00211## and their pharmaceutically acceptable salts and
esters.
58. The method of claim 42, 53, or 55 wherein said LFA-1 antagonist
is one of the following compounds: ##STR00212## ##STR00213##
##STR00214## ##STR00215## ##STR00216## ##STR00217## ##STR00218##
##STR00219## ##STR00220## ##STR00221## ##STR00222## ##STR00223##
##STR00224## ##STR00225## ##STR00226## ##STR00227## ##STR00228##
##STR00229## ##STR00230## ##STR00231## or their pharmaceutically
acceptable salts and esters.
59. A pharmaceutical composition formulated for ocular delivery
comprising the compound of claim 1 and a pharmaceutically
acceptable carrier.
60. The pharmaceutical composition of claim 59, wherein the
compound of claim 1 is a compound of Formula I, II, III, IV, V, VI,
VII, VIII, IX, X, or XI.
61. The pharmaceutical compositions of claim 59, wherein the
pharmaceutical composition is suitable for topical
administration.
62. The pharmaceutical composition of claim 59, wherein the
pharmaceutical composition is suitable for administration via
injection.
63. The pharmaceutical compositions of claim 59, wherein the
pharmaceutical composition is suitable for administration as an
implant.
Description
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional
Application Ser. No. 60/999,571, filed Oct. 19, 2007, the entire
disclosure of which is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] Worldwide, one of the most significant causes of blindness
is diabetic retinopathy (DR) which often includes an associated
disorder, diabetic macular edema (DME), which is one of the
complications of diabetes resulting in microvasculature insult,
injury and degeneration in the body, and in particular, the eye.
The loss of workplace and personal function subsequent to such loss
of visual function can have devastating impact upon the individual
and on the community surrounding that individual as a whole. Nearly
all individuals with diabetes demonstrate some degree of diabetic
retinopathy, and the numbers of diabetic patients are increasing,
therefore there is need for more effective treatments for vision
loss and the symptoms of DR and associated macular edema.
SUMMARY OF THE INVENTION
[0003] In one aspect, the present invention provides methods of
treating a subject suffering from diabetic retinopathy comprising
administering to said subject in need thereof a therapeutically
effective amount of a therapeutic agent which inhibits the
interaction of LFA-1 and an ICAM.
[0004] In a second aspect a method is provided of treating a
subject suffering from macular edema comprising administering to
said subject in need thereof a therapeutically effective amount of
a therapeutic agent which inhibits the interaction of LFA-1 and an
ICAM, thereby reducing and/or preventing macular edema in an eye of
said subject.
[0005] In an third aspect of the invention, a method is provided to
treat diabetic retinopathy in a subject comprising performing a
diabetic retinopathy diagnostic test on said subject; determining
whether said subject suffers from diabetic retinopathy based on the
results of said diagnostic test; and upon diagnosis of said
diabetic retinopathy, administering to said subject an effective
amount of a (LFA-1) antagonist in a pharmaceutically acceptable
formulation.
[0006] In a fourth aspect of the invention, a method is provided
for reducing and/or preventing post-operative ocular inflammation
in a subject suffering from diabetes comprising administering to
said subject in need thereof a therapeutically effective amount of
a LFA-1 antagonist, thereby reducing and/or preventing
post-operative inflammation in an eye of said subject.
[0007] In some embodiments, post-operative inflammation is the
result of vitrectomy, laser photocoagulation therapy, photodynamic
therapy, or LASIK. In other embodiments, the diagnostic step is
performed by imaging an eye of said subject or analysis of a
biological sample of an eye of said subject.
[0008] In some of the embodiments of the invention, the ICAM is
ICAM-1, ICAM-2, or ICAM-3. In some embodiments, the ICAM is ICAM-1.
In some embodiments of the invention, the therapeutic agent is an
LFA-1 antagonist. In some of the embodiments of the invention, the
LFA-1 antagonist binds to a high affinity binding site in the
.alpha.L subunit of LFA-1 overlapping the ICAM-1 binding site. In
other embodiments of the invention, the LFA-1 antagonist is
directly competitive with the binding of ICAM-1 at the .alpha.L
subunit of LFA-1. In some embodiments of the invention, the LFA-1
antagonist is a competitive inhibitor of the interaction between
LFA-1 and ICAM-1. In some embodiments of the invention, the LFA-1
antagonist is an allosteric antagonist of the binding of ICAM-1 at
the .alpha.L subunit of LFA-1.
[0009] In some of the embodiments of the invention, the diabetic
retinopathy is non-proliferative. In some of the inventions, the
diabetic retinopathy is proliferative. In some embodiments of the
invention, damage resulting from diabetic retinopathy is macular
edema, retinal neovascularization, fibrovascular growth over a
retina, loss of vision, basement membrane thickening, retinal
edema, or retinal ischemia.
[0010] In some of the embodiments of the invention, an LFA
antagonist is provided which is an antibody. In some of the
embodiments of the invention, an LFA antagonist is provided which
is a compound of Formula I, II, III, IV, V or VI.
##STR00001##
[0011] In some embodiments, the compound of Formula II is provided
which contains a stereochemistry as in Formula II'.
##STR00002##
[0012] In some of the embodiments of the invention, the compound of
Formula III is provided which contains a stereochemistry as in
Formula III'.
##STR00003##
[0013] In some of the embodiments of the invention, an LFA
antagonist is provided which is a compound of Formula IA, IIA or
IIB.
##STR00004##
[0014] In some of the embodiments of the invention, the LFA-1
antagonist is a compound with one of the following structures:
##STR00005## ##STR00006## ##STR00007## ##STR00008## ##STR00009##
##STR00010## ##STR00011## ##STR00012## ##STR00013## ##STR00014##
##STR00015## ##STR00016## ##STR00017##
and their pharmaceutically acceptable salts and esters.
[0015] In some of the embodiments of the invention, the LFA-1
antagonist is a compound of Formula VII, VIII, IX, X, or XI or
enantiomers, pharmaceutically-acceptable salts, or solvates,
thereof.
##STR00018##
[0016] In some of the embodiments of the invention, the therapeutic
agent is administered topically, orally, periocularly,
intraocularly, via injection, nasally, via an aerosol, via an
insert, via an implanted device, or via a drop. In other of the
embodiments of the invention, the therapeutic agent is administered
in a carrier vehicle which is liquid drops, liquid wash, nebulized
liquid, gel, ointment, aerosol, spray, polymer micro and
nanoparticles, solution, suspension, solid, biodegradable matrix,
powder, crystals, foam, or liposomes. In some of the embodiments of
the invention, a therapeutically effective amount of said
therapeutic agent is delivered to an eye of said subject via local
or systemic delivery. In some of the embodiments of the invention
an injectable administration is performed intraocularly or
periocularly. In some embodiments of the invention, administration
is accomplished by administering an intra-ocular instillation of a
gel, cream, powder, foam, crystals, liposomes, spray, polymer micro
or nanospheres, or liquid suspension form of said compound. In some
of the embodiments, polymer micro or nanospheres are used to
deliver the therapeutic agent via periocular or intraocular
injection or implantation.
[0017] In some of the embodiments, a therapeutically effective
amount of the therapeutic agent is delivered to an eye of the
subject via local or systemic delivery.
[0018] In some of the embodiments of the invention, the therapeutic
agent is administered in a carrier vehicle which is liquid drops,
liquid wash, nebulized liquid, gel, ointment, aerosol, spray,
polymer micro and nanoparticles, solution, suspension, solid,
biodegradable matrix, powder, crystals, foam, or liposomes. In some
of the embodiments of the invention, topical administration
comprises infusion of said compound to said eyes via a device
selected from the group consisting of a pump-catheter system, an
insert, a continuous or selective release device, a bioabsorbable
implant, a continuous or sustained release formulation, and a
contact lens. In some of the embodiments of the invention,
injectable administration is performed intraocularly,
intravitreally, periocularly, subcutaneously, subconjunctivally,
retrobulbarly, or intracamerally. Controlled release formulations
are also provided for in some embodiments of the invention. In some
embodiments of the invention, the compounds of the invention are
formulated as prodrugs. In some embodiments of the invention the
formulation of the therapeutic agent includes no preservative. In
some embodiments of the invention the formulation of the
therapeutic agent includes at least one preservative. In some
embodiments of the invention the formulation of the therapeutic
agent includes a thickening agent. In other embodiments of the
invention, the formulation of the therapeutic agent uses PLGA
micro- or nanoparticles.
[0019] In some embodiments of the invention, the compound is
administered to the subject in an amount sufficient to achieve
intraocular or retinal concentrations of from about
1.times.10.sup.-8 to about 1.times.10.sup.-1 moles/liter. In some
embodiments of the invention, the compound is administered at least
once a year. In other embodiments of the invention, the compound is
administered at least once a day. In other embodiments of the
invention, the compound is administered at least once a week. In
some embodiments of the invention, the compound is administered at
least once a month.
[0020] In some embodiments of the invention, a second therapeutic
agent is administered prior to, in combination with, at the same
time, or after administration of the LFA-1 antagonist. In some
embodiments, the second therapeutic agent is selected from the
group consisting of antioxidants, antiinflammatory agents,
antimicrobials, steroids, protein kinase C inhibitors, angiotensin
converting enzyme inhibitors, antiangiogenic agents, complement
inhibitors, and anti-apoptotic agents. In some embodiments of the
invention, the second therapeutic agent is an anti-adhesion
therapeutic agent that binds to an allosteric binding site on
LFA-1. In some embodiments of the invention, the second therapeutic
agent is an anti-adhesion therapeutic antibody or antibody
fragment.
[0021] In some embodiments of the invention a diagnostic test is
included in a method of treatment with an LFA-1 antagonist. In one
embodiment, a diagnostic test for diabetic retinopathy is performed
and after a diagnosis of the disease is made, the subject is
administered an LFA-1 antagonist as described herein. In some
embodiments of the invention, the diagnostic test is performed by
imaging an eye of the subject or analysis of a biological sample of
an eye of the subject.
[0022] In another aspect, the invention provides a pharmaceutical
composition formulated for ocular delivery comprising a therapeutic
agent which inhibits the interaction of LFA-1 and an ICAM and a
pharmaceutically acceptable carrier. In some embodiments, the
pharmaceutical composition comprises a therapeutic agent which
inhibits the interaction of LFA-1 and an ICAM, which is a compound
of Formula I, II, III, IV, V, VI, VII, VIII, IX, X, or XI. In some
embodiments, the pharmaceutical composition is suitable for topical
administration. In some embodiments, the pharmaceutical composition
is suitable for administration via injection. In some embodiments,
the pharmaceutical composition is suitable for administration
suitable for administration as an implant.
[0023] In another aspect, compounds are provided for use in the
methods of the invention. Compounds that are useful in the methods
of the invention include antibodies, fragments of antibodies,
polypeptides, peptides, polymers, and organic small molecules. In
another an embodiment of the method of the present invention, the
antibody Raptiva is used in an ocular formulation to treat diabetic
retinopathy.
INCORPORATION BY REFERENCE
[0024] All publications and patent applications mentioned in this
specification are herein incorporated in its entirety by reference
to the same extent as if each individual publication or patent
application was specifically and individually indicated to be
incorporated in its entirety by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
[0026] FIG. 1 depicts rolling, adhesion of leukocytes and
transendothelial migration resulting from LFA-1:ICAM-1
interaction.
[0027] FIG. 2 depicts antigen activation of the LFA-1:ICAM-1
interaction.
[0028] FIG. 3 depicts co-stimulatory function of the LFA-1:ICAM-1
interaction.
[0029] FIG. 4 depicts small molecule antagonists useful in the
methods of identification.
[0030] FIG. 5 depicts SDS-PAGE analysis of compound 5 crosslinked
LFA-1.
[0031] FIG. 6 depicts binding of compound 2B and ICAM-1-Ig to 293
cells expressing wild type LFA-1 or LFA-1 lacking the I domain.
[0032] FIG. 7 depicts antagonist competition by compounds 2A, 3,
A-286982 and sICAM-1 in the LFA-1/ICAM-1 and LFA-1/small molecule
ELISAs.
[0033] FIG. 8 depicts correlation of IC50 values from antagonist
competition in the LFA-1/ICAM-1 and LFA-1/small molecule
ELISAs.
[0034] FIG. 9 depicts the effect of antagonists on ligand binding
in the LFA-1/ICAM-1 and LFA-1/small molecule ELISAs.
[0035] FIG. 10 depicts Schild regressions of sICAM-1 and compound 3
antagonism.
[0036] FIG. 11 is a graphical representation of the effect of a
directly competitive LFA-1 antagonist of the invention upon the
release of inflammatory cytokines, in human mononucleocytes (PBMC)
stimulated with staphylococcal enterotoxin B (SEB) as compared to
the effect of cyclosporine-A (CsA).
[0037] FIG. 12 is a graphical representation of the distribution
into the eye via topical application of a .sup.14C labeled directly
competitive LFA-1 antagonist of the invention at a 30 minute
timepoint and a 4 hour timepoint after administration, as measured
by detection of the radiolabel.
DETAILED DESCRIPTION OF THE INVENTION
I. Biology and Disease
Diabetic Retinopathy (DR) and the Use of LFA-1 Antagonists in
Treatments for DR
[0038] Diabetes is often described as a global disease leading to
deleterious effects observed throughout the body of an individual
suffering from this disease, which may increase significantly as
the individual ages. Ocular complications of diabetes is a leading
cause of visual loss and blindness worldwide.
[0039] One overall effect is the development of alterations in the
retinal microvasculature that leads to loss of microcapillary
autoregulation, a condition known as diabetic retinopathy (DR).
[0040] Diabetic retinopathy is often divided into two categories
for clinical disease management: non-proliferative (or background
stage) and a later, proliferative stage.
[0041] Non-proliferative diabetic retinopathy (NPDR) demonstrates,
at its outset, abnormalities of the normal microvascular
architecture characterized by degeneration of retinal capillaries,
formation of saccular capillary microaneurysms, pericyte deficient
capillaries, and capillary occlusion and obliteration. Mechanisms
of action include diabetes-induced vascular inflammation leading to
occlusion of the vascular lumen by leukocytes and platelets
followed by the eventual death of both pericytes and endothelial
cells. Attraction and adhesion of leukocytes to the vascular wall
by the inflammatory process cause leukocytes to adhere temporarily
to the endothelium (leukostasis), release cytotoxic factors, and
injure or kill the endothelial cell. The damaged endothelial
surface initiates platelet adherence, aggregation, microthrombi
formation, vascular occlusion and ischemia. Another consequence of
endothelial injury is alteration in the Blood-Retinal Barrier (BRB)
causing increased vascular permeability. This can be evidenced by
fluorescein leakage during fluorescein angiography or retinal
thickening assessed by optical coherence tomography (OCT).
Consequences of this leakage can be clinically significant macular
edema and deposition of lipoproteins in the retina (hard exudates)
contributing to retinal thickening. As the process continues,
retinal ganglion cells are lost leading towards visual loss or
blindness. The disrupted autoregulation and decreased retinal blood
flow resulting from the changes in vasculature in endothelial
cells, pericyte death, and capillary obliteration are markers for
progression of DR, and leads to development of retinal ischemia,
which enables development of the more severe, proliferative stage
of DR.
[0042] Proliferative DR involves neovascularization or
angiogenesis, induced by retinal ischemia of the disc or other
locations of the retina. This new vasculature can cause hemorrhage
of the vitreous humour and retinal detachments from accompanying
contractile fibrous tissue.
[0043] At any point during this progression of diabetic
retinopathy, macular edema or diabetic macular edema (DME) can
develop, with severe impact on vision function. Progression of this
associated disorder is predicted by retinal vascular leakage and
leads to photocoagulation treatment in order to reduce the risk of
vision loss. Since a large proportion of patients with diabetic
retinopathy suffer from this disorder as well, it is a relevant
clinical intervention target. All of these injuries or degenerative
insults may lead to impairment or even complete loss of visual
acuity and offer targets for therapeutic intervention. No efficient
therapeutic options currently are available. Laser photocoagulation
involves administering laser burns to various areas of the eye and
is used in the treatment of many neovascularization-linked
disorders. Neovascularization, in particular, is commonly treated
with scatter or panretinal photocoagulation. However, laser
treatment may cause permanent blind spots corresponding to the
treated areas. Laser treatment may also cause persistent or
recurrent hemorrhage, increase the risk of retinal detachment, or
induce neovascularization or fibrosis. Other treatment options for
ocular-related disorders include thermotherapy, vitrectomy,
photodynamic therapy, radiation therapy, surgery, e.g., removal of
excess ocular tissue, and the like. However, in most cases, all
available treatment options have limited therapeutic effect,
require repeated, costly procedures, and/or are associated with
dangerous side-effects.
[0044] Hyperglycemic control has not proved to be sufficient to end
this progression. A number of processes have been identified as
contributing to retinal capillary occlusion and capillary
obliteration in DR, including microthrombosis, apoptosis, and
proinflammatory changes, which may be useful intervention points to
prevent progression of DR and/or reverse damage already incurred.
Further, an early event in initiation of the breakdown of the BRB
and capillary nonperfusion, appears to be leukocyte adhesion to the
diabetic retinal vasculature.
[0045] Adherent leukocytes are temporally and spatially associated
with retinal endothelial cell injury and death within one week of
streptozotocin-induced experimental diabetes in rats. Antibody
based neutralization of ICAM-1 and CD18 has been shown to prevent
both leukocyte adhesion and retinal endothelial cell injury and
death. (A. M. Joussen, T. Murata, A. Tsujikawa, B. Kirchof, S-E.
Bursell, A. P. Adamis "Leukocyte-Mediated Endothelial Cell Injury
and Death in the Diabetic Retina" (2001) A, J. Pathol. 158(1):
147-162.)
[0046] Inhibiting adhesion events, disrupting proinflammatory
response cycles, and preventing formation of acellular capillaries
in ischemic tissues, all of which arise in this disease state, may
be advantageous strategies for therapy. Lymphocyte
function-associated antigen-1 (LFA-1)/Intracellular adhesion
molecule-1 (ICAM-1) interactions mediate each of these molecular
events. Hence, the LFA-1 antagonists of the invention may be useful
in therapies against one or more of the pathological symptoms
observed in this disease.
[0047] Not intending to limit the mechanism of action, the methods
of the present invention involve the inhibition of initiation and
progression of diabetic retinopathy (DR) by inhibiting the
interaction between LFA-1 and ICAM-1. LFA-1 and ICAM-1 are
molecules with extracellular receptor domains which are involved in
the process of lymphocyte/leukocyte adhesion, migration and
proliferation, leading to a cascade of inflammatory responses. In
preferred embodiments, such methods provide anti-inflammatory
effects in-vitro and in-vivo, e.g., as described in more detail
below, and are useful in the treatment of DR.
[0048] Human blood contains white blood cells (leukocytes) which
are further classified as neutrophils, lymphocytes (with B- and
T-subtypes), monocytes, eosinophils, and basophils. Several of
these classes of leukocytes, neutrophils, eosinophils, basophils
and lymphocytes, are involved in inflammatory disorders. LFA-1 is
one of a group of leucointegrins which are expressed on most
leucocytes, and is considered to be the lymphoid integrin which
interacts with a number of ICAMs as ligands. Disrupting these
interactions, and thus the immune/inflammatory response provides
for reduction of inflammation, in particular, inflammation of the
eye.
[0049] For example, ICAM-1 (CD54) is a member of the ICAM family of
adhesion receptors (ICAM-1, ICAM-2, ICAM-3, ICAM-4) in the
immunoglobulin protein super family, and is expressed on activated
leucocytes, dermal fibroblasts, and endothelial cells. It is
normally expressed on the endothelial cells lining the vasculature,
and is upregulated upon exposure to cytokines such as IL-1, LPS and
TNF during immune/inflammatory initiation.
[0050] Research conducted over the last decade has helped elucidate
the molecular events involved in the movement and activation of
cells in the immune system, focusing on cell-to-cell triggering
interactions within the cascade. The interaction of Intercellular
Adhesion Molecules (ICAMs) with leukointegrins plays a role in the
functioning of the immune system. Immune processes such as antigen
presentation, leukocyte mediated cytotoxicity, T-cell mediated
cytotoxicity and leukocyte transendothelial migration (diapedesis)
may require cellular adhesion mediated by ICAMs interacting with
leukointegrins.
[0051] The interaction of ICAM-1 and LFA-1 (LFA-1 is also referred
to as .alpha..sub.L.beta..sub.2 and CD11a/CD18) has been shown to
be involved in the processes of adhesion, leukocyte
transendothelial migration, migration to sites of injury, and
proliferation of lymphocytes at the activated target site, as shown
in FIG. 1. For example, it is presently believed that prior to
leukocyte adhesion and transendothelial migration, components of
the inflammatory response, the presence of cytokines/chemokines
activate integrins constitutively expressed on leukocytes. Blood
vessel endothelial cells also upregulate ICAM-1 in response to the
presence of the same cytokines/chemokines. As rolling leukocytes
approach activated endothelial cells, their progress is first
slowed by these upregulated ICAM-1 receptors. This is followed by a
ligand/receptor interaction between LFA-1 and ICAM-1, expressed on
blood vessel endothelial cell surfaces, which arrests the
lymphocyte from rolling further. The lymphocyte then flattens, and
transmigration takes place. This process is of importance both in
lymphocyte transmigration through vascular endothelium as well as
lymphocyte trafficking from peripheral blood to lymph nodes.
However, in Diabetic Retinopathy (DR), as discussed above,
leukostasis is the initial trigger for cytotoxic factor release
which damages and/or kills endothelial cells in the local area.
This damage leads to vessel leakiness and inflammation, which
continues and/or amplifies the injurious response.
[0052] LFA-1 plays a role in creating and maintaining the
immunological synapse, which may be defined as the physical
structure of the interacting surfaces of T cells and Antigen
Presenting Cells (APCs), as shown in FIG. 2. LFA-1 stabilizes
T-cell engagement with the APC, and thus leads to activation of T
cells. The interaction of LFA-1 and ICAM-1 also appears to provide
co-stimulatory signals to resting T cells, as shown in FIG. 3. CD4+
T-cell proliferation and cytokine synthesis are mediated by this
interaction as part of the inflammatory response.
[0053] Given the role that the interaction of ICAM-1 and LFA-1
plays in immune/inflammatory response, it is desirable to modulate
these interactions to achieve a desired therapeutic result (e.g.,
inhibition of the interaction in the event of an overactive
inflammatory response). Also, since LFA-1 has several ligand
partners within the ICAM family (ICAM-1, ICAM-2 and ICAM-3),
involving a number of signaling pathways, in some embodiments of
the invention, it is desirable to modulate these interactions
selectively. In some embodiments of the invention, therapeutic
agents are provided that will interfere with the association of
LFA-1 with ICAM-1, ICAM-2, and/or ICAM-3 to thus modulate the
respective signaling pathways for each pair of interactions.
[0054] The methods and compositions described herein can modulate
one or more components of the pathways described herein. In
addition to inhibiting interaction between LFA-1 and ICAM-1, the
methods and compositions of the present invention may also
intervene in either earlier or later portions of the inflammatory
process as well. For example, upregulation of ICAM-1 or LFA-1
(activation) on endothelial cells or leukocytes, prior to tethering
and transendothelial migration, may be modulated by the methods and
compositions described herein. The present invention may be useful
in modulating the expression of cytokines or chemokines that
activate ICAM-1 and LFA-1 in the course of leukocyte trafficking,
in modulating the transport of the cytokines or chemokines, in
preventing transmigration of the arrested leukocyte, in modulating
signaling via other mechanisms that are involved in leukocyte
proliferation at the site of injury or inflammation, and the
like.
[0055] The invention provides therapeutic agents that interfere
with the association of LFA-1 with ICAM-1, which can block the
adhesion, migration, proliferation, and release of inflammatory
signals to surrounding tissue by immune system cells. In some
embodiments, the invention provides methods of administering a
therapeutic agent which inhibits the interaction between LFA-1 and
an ICAM, In one example, the therapeutic agent binds to either
LFA-1 or binds to an ICAM. More specifically, the invention
provides therapeutic agents that bind to LFA-1 to inhibit the
association of LFA-1 with ICAM-1, ICAM-2, and/or ICAM-3 thus acting
as LFA-1 antagonists. In some embodiments, the therapeutic agent
provided by the invention binds at the high affinity binding site
in the .alpha.L subunit overlapping the ICAM-1 binding site, which
is a directly competitive antagonist of LFA-1. In some embodiments,
the therapeutic agent provided by the invention inhibits the
interaction between LFA-1 and ICAM-1 but does not completely block
the high affinity binding site in the .alpha.L subunit overlapping
the ICAM-1 binding site, and is a competitive but not a directly
competitive antagonist of LFA-1. In some embodiments, the
therapeutic agent provided by the invention binds at a site outside
the high affinity binding site in the .alpha.L subunit overlapping
the ICAM-1 binding site, and is an allosteric antagonist. In some
of the embodiments, the therapeutic agent provided by the invention
is an allosteric antagonist and is a competitive but not directly
competitive antagonist of LFA-1. In some embodiments of the
invention, the therapeutic agents are useful in treating diabetic
retinopathy and disorders associated with that condition.
II. Compounds Useful in the Method
[0056] The term "aliphatic", as used herein, includes both
saturated and unsaturated, straight chain (unbranched) or branched
aliphatic hydrocarbons, which are optionally substituted with one
or more functional groups. As will be appreciated by one of
ordinary skill in the art, "aliphatic" is intended herein to
include, but is not limited to, alkyl, alkenyl, alkynyl moieties.
Thus, as used herein, the term "alkyl" includes straight and
branched alkyl groups. An analogous convention applies to other
generic terms such as "alkenyl", "alkynyl" and the like.
[0057] Furthermore, as used herein, the terms "alkyl", "alkenyl",
"alkynyl", and the like encompass both substituted and
unsubstituted groups. In certain embodiments, as used herein,
"lower alkyl" is used to indicate those alkyl groups (substituted,
unsubstituted, branched or unbranched) having about 1-6 carbon
atoms.
[0058] In certain embodiments, the alkyl, alkenyl and alkynyl
groups employed in the invention contain about 1-20 aliphatic
carbon atoms. In certain other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the invention contain about 1-10
aliphatic carbon atoms. In yet other embodiments, the alkyl,
alkenyl, and alkynyl groups employed in the invention contain about
1-8 aliphatic carbon atoms. In still other embodiments, the alkyl,
alkenyl, and alkynyl groups employed in the invention contain about
1-6 aliphatic carbon atoms. In yet other embodiments, the alkyl,
alkenyl, and alkynyl groups employed in the invention contain about
1-4 carbon atoms. Illustrative aliphatic groups thus include, but
are not limited to, for example, methyl, ethyl, n-propyl,
isopropyl, allyl, n-butyl, sec-butyl, isobutyl, tert-butyl,
n-pentyl, sec-pentyl, isopentyl, tert-pentyl, n-hexyl, sec-hexyl,
moieties and the like, which again, may bear one or more
substituents.
[0059] Alkenyl groups include, but are not limited to, for example,
ethenyl, propenyl, butenyl, and the like. Representative alkynyl
groups include, but are not limited to, ethynyl, 2-propynyl and the
like.
[0060] The term "lower alkylene" as used herein refers to a
hydrocarbon chain which links together two other groups, i.e. is
bonded to another group at either end, for example methylene,
ethylene, butylene and the like. Such a substituent is preferably
from 1 to 10 carbons and more preferably from 1 to 5 carbons. Such
groups may be substituted, preferably with an amino, acetylamino (a
lower alkylcarbonyl group bonded via a nitrogen atom), or cyclo
lower alkyl group. By the latter is meant a saturated hydrocarbon
ring, preferably with a total of 3 to 10 methylenes (inclusive of
the attachment carbons), more preferably 3 to 6.
[0061] The term "alicyclic", as used herein, refers to compounds
which combine the properties of aliphatic and cyclic compounds and
include but are not limited to monocyclic, or polycyclic aliphatic
hydrocarbons and bridged cycloalkyl compounds, which are optionally
substituted with one or more functional groups.
[0062] As will be appreciated by one of ordinary skill in the art,
"alicyclic" is intended herein to include, but is not limited to,
cycloalkyl, cycloalkenyl, and cycloalkynyl moieties, which are
optionally substituted with one or more functional groups.
[0063] Illustrative alicyclic groups thus include, but are not
limited to, for example, cyclopropyl, --CH.sub.2-cyclopropyl,
cyclobutyl, --CH.sub.2-cyclobutyl, cyclopentyl, --CH.sub.2--
cyclopentyl, cyclohexyl, --CH.sub.2-cyclohexyl, cyclohexenylethyl,
cyclohexanylethyl, norbornyl moieties and the like, which again,
may bear one or more substituents.
[0064] The term "alkoxy" or "alkyloxy", as used herein refers to a
saturated or unsaturated parent molecular moiety through an oxygen
atom. In certain embodiments, the alkyl group contains about 1-20
aliphatic carbon atoms. In certain other embodiments, the alkyl
group contains about 1-10 aliphatic carbon atoms. In yet other
embodiments, the alkyl group employed in the invention contains
about 1-8 aliphatic carbon atoms. In still other embodiments, the
alkyl group contains about 1-6 aliphatic carbon atoms. In yet other
embodiments, the alkyl group contains about 1-4 aliphatic carbon
atoms. Examples of alkoxy, include but are not limited to, methoxy,
ethoxy, isopropoxy, n-butoxy, i-butoxy, sec-butoxy, tert-butoxy,
neopentoxy, n-hexyloxy and the like.
[0065] The term "lower alkoxy" as used herein refers to a lower
alkyl as defined above which may be branched or unbranched as also
defined above and which is bonded by an oxygen to another group
(i.e. alkyl ethers).
[0066] The term "thioalkyl" as used herein refers to a saturated or
unsaturated (i.e., S-alkenyl and S-alkynyl) group attached to the
parent molecular moiety through a sulfur atom. In certain
embodiments, the alkyl group contains about 1-20 aliphatic carbon
atoms. In certain other embodiments, the alkyl group contains about
1-10 aliphatic carbon atoms. In yet other embodiments, the alkyl
group employed in the invention contains about 1-8 aliphatic carbon
atoms. In still other embodiments, the alkyl group contains about
1-6 aliphatic carbon atoms. In yet other embodiments, the alkyl
group contains about 1-4 aliphatic carbon atoms. Examples of
thioalkyl include, but are not limited to, methylthio, ethylthio,
propylthio, isopropylthio, n-butylthio, and the like.
[0067] The term "lower alkylthio" as used herein refers to a lower
alkyl group bonded through a divalent sulfur atom, for example, a
methylmercapto or an isopropylmercapto group. By lower alkylenethio
is meant such a group which is bonded at each end.
[0068] The term "alkylamino" refers to a group having the structure
--NHR' wherein R' is alkyl, as defined herein. The term
"aminoalkyl" refers to a group having the structure NH.sub.2R'--,
wherein as defined herein. In certain embodiments, the alkyl group
contains about 1-20 aliphatic carbon atoms. In certain other
embodiments, the alkyl group contains about 1-10 aliphatic carbon
atoms. In yet other embodiments, the alkyl group employed in the
invention contains about aliphatic carbon atoms. In still other
embodiments, the alkyl group contains about 1-6 aliphatic carbon
atoms. In yet other embodiments, the alkyl group contains about 1-4
aliphatic carbon atoms. Examples of alkylamino include, but are not
limited to, methylamino, and the like.
[0069] Some examples of substituents of the above-described
aliphatic (and other) moieties of compounds of the invention
include, but are not limited to aliphatic; alicyclic;
heteroaliphatic; heterocyclic; aromatic; heteroaromatic; aryl
heteroaryl; alkylaryl; heteroalkylaryl; alkylheteroaryl;
heteroalkylheteroaryl; alkoxy; aryloxy; heteroalkoxy;
heteroaryloxy; alkylthio; arylthio; heteroalkylthio; R.sub.x
independently includes, but is not limited to, aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aryl or heteroaryl substituents described
above and herein may be substituted or unsubstituted. Additional
examples of generally applicable substituents are illustrated by
the specific embodiments shown in the Examples that are described
herein.
[0070] In general, the term "aromatic moiety", as used herein,
refers to a stable mono- or polycyclic, unsaturated moiety having
preferably 3-14 carbon atoms, each of which may be substituted or
unsubstituted. In certain embodiments, the term "aromatic moiety"
refers to a planar ring having p-orbitals perpendicular to the
plane of the ring at each ring atom and satisfying the Huckel rule
where the number of pi electrons in the ring is (4n+2) wherein n is
an integer. A mono- or polycyclic, unsaturated moiety that does not
satisfy one or all of these criteria for aromaticity is defined
herein as "non-aromatic", and is encompassed by the term
"alicyclic".
[0071] In general, the term "heteroaromatic moiety", as used
herein, refers to a stable mono- or polycyclic, unsaturated moiety
having preferably 3-14 carbon atoms, each of which may be
substituted or unsubstituted; and comprising at least one
heteroatom selected from O, S, and N within the ring in place of a
ring carbon atom). In certain embodiments, the term "heteroaromatic
moiety" refers to a planar ring comprising at least one heteroatom,
having p-orbitals perpendicular to the plane of the ring at each
ring atom, and satisfying the Huckel rule where the number of pi
electrons in the ring is (4n+2) wherein n is an integer.
[0072] It will also be appreciated that aromatic and heteroaromatic
moieties, as defined herein may be attached via an alkyl or
heteroalkyl moiety and thus also include -(alkyl) aromatic,
-(heteroalkyl) aromatic, -(heteroalkyl) heteroaromatic, and
-(heteroalkyl) heteroaromatic moieties. Thus, as used herein, the
phrases "aromatic or heteroaromatic moieties" and "aromatic,
(heteroalkyl) aromatic, -(heteroalkyl) heteroaromatic, and
(heteroalkyl) heteroaromatic" are interchangeable. Substituents
include, but are not limited to, any of the previously mentioned
substituents, e., the substituents recited for aliphatic moieties,
or for other moieties as disclosed herein, resulting in the
formation of a stable compound.
[0073] The term "aryl", as used herein, does not differ
significantly from the common meaning of the term in the art, and
refers to an unsaturated cyclic moiety comprising at least one
aromatic ring. In certain embodiments, "aryl" refers to a mono- or
bicyclic carbocyclic ring system having one or two aromatic rings
including, but not limited to, phenyl, naphthyl,
tetrahydronaphthyl, indanyl, indenyl and the like.
[0074] The term "heteroaryl" as used herein, does not differ
significantly from the common meaning of the term in the art, and
refers to a cyclic aromatic radical having from five to ten ring
atoms of which one ring atom is selected from S, and N; zero, one
or two ring atoms are additional heteroatoms independently selected
from S, and N; and the remaining ring atoms are carbon, the radical
being joined to the rest of the molecule via any of the ring atoms,
such as, for example, pyridyl, pyrazinyl, pyrimidinyl, pyrrolyl,
pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl,
thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl,
isoquinolinyl, and the like.
[0075] It will be appreciated that aryl and heteroaryl groups
(including bicyclic aryl groups) can be unsubstituted or
substituted, wherein substitution includes replacement of one or
more of the hydrogen atoms thereon independently with any one or
more of the following moieties including, but not limited to:
aliphatic; alicyclic; heteroaliphatic; heterocyclic; aromatic;
heteroaromatic; aryl; heteroaryl; alkylaryl; heteroalkylaryl;
alkylheteroaryl; heteroalkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroalkylthio;
heteroarylthio; F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2; --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x
wherein each occurrence of R.sub.x, independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl, heteroaryl,
-(alkyl) aryl or -(alkyl) heteroaryl substituents described above
and herein may be substituted or unsubstituted. Additionally, it
will be appreciated, that any two adjacent groups taken together
may represent a 4, 5, 6, or 7-membered substituted or unsubstituted
alicyclic or heterocyclic moiety. Additional examples of generally
applicable substituents are illustrated by the specific embodiments
shown in the Examples that are described herein.
[0076] The term "cycloalkyl", as used herein, refers specifically
to groups having three to seven, preferably three to ten carbon
atoms. Suitable cycloalkyls include, but are not limited to
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and
the like, which, as in the case of aliphatic, alicyclic,
heteroaliphatic or heterocyclic moieties, may optionally be
substituted with substituents including, but not limited to
aliphatic; alicyclic; heteroaliphatic; heterocyclic; aromatic;
heteroaromatic; aryl; heteroaryl; alkylaryl; heteroalkylaryl;
alkylheteroaryl; heteroalkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; heteroarylthio; F; Cl; Br;
I; --OH; --NO.sub.2; --CN; --CF.sub.3; --CH.sub.2CF.sub.3;
--CHCl.sub.2; --CH.sub.2OH; --CH.sub.2CH.sub.2OH;
--CH.sub.2NH.sub.2; --CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2; --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl or heteroaryl
substituents described above and herein may be substituted or
unsubstituted. Additional examples of generally applicable
substituents are illustrated by the specific embodiments shown in
the Examples that are described herein.
[0077] The term "heteroaliphatic", as used herein, refers to
aliphatic moieties in which one or more carbon atoms in the main
chain have been substituted with a heteroatom. Thus, a
heteroaliphatic group refers to an aliphatic chain which contains
one or more oxygen, sulfur, nitrogen, phosphorus or silicon atoms,
e. place of carbon atoms. Heteroaliphatic moieties may be linear or
branched, and saturated or unsaturated. In certain embodiments,
heteroaliphatic moieties are substituted by independent replacement
of one or more of the hydrogen atoms thereon with one or more
moieties including, but not limited to aliphatic; alicyclic;
heteroaliphatic; heterocyclic; aromatic; heteroaromatic; aryl;
heteroaryl; alkylaryl; alkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroarylthio;
F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2; --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl or heteroaryl
substituents described above and herein may be substituted or
unsubstituted. Additional examples of generally applicable
substituents are illustrated by the specific embodiments shown in
the Examples that are described herein.
[0078] The term "heterocycloalkyl", "heterocycle" or
"heterocyclic", as used herein, refers to compounds which combine
the properties of heteroaliphatic and cyclic compounds and include,
but are not limited to, saturated and unsaturated mono- or
polycyclic cyclic ring systems having 5-16 atoms wherein at least
one ring atom is a heteroatom selected from S and N (wherein the
nitrogen and sulfur heteroatoms may be optionally be oxidized),
wherein the ring systems are optionally substituted with one or
more functional groups, as defined herein. In certain embodiments,
the term "heterocycloalkyl", "heterocycle" or "heterocyclic" refers
to a non-aromatic 5-, 6- or 7-membered ring or a polycyclic group
wherein at least one ring atom heteroatom selected from S and N
(wherein the nitrogen and sulfur heteroatoms may be optionally be
oxidized), including, but not limited to, a bi- or tri-cyclic
group, comprising fused six-membered rings having between one and
three heteroatoms independently selected from oxygen, sulfur and
nitrogen, wherein (i) each 5-membered ring has 0 to 2 double bonds,
each 6-membered ring has 0 to 2 double bonds and each 7-membered
ring has 0 to 3 double bonds, (ii) the nitrogen and sulfur
heteroatoms may be optionally be oxidized, (iii) the nitrogen
heteroatom may optionally be quaternized, and (iv) any of the above
heterocyclic rings may be fused to an aryl or heteroaryl ring.
Representative heterocycles include, but are not limited to,
heterocycles such as furanyl, pyranyl, pyrrolyl, thienyl,
pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl,
imidazolidinyl, piperidinyl, piperazinyl, oxazolyl, oxazolidinyl,
isooxazolyl, isoxazolidinyl, dioxazolyl, thiadiazolyl, oxadiazolyl,
tetrazolyl, triazolyl, thiatriazolyl, thiadiazolyl, oxadiazolyl,
morpholinyl, thiazolyl, thiazolidinyl, isothiazolyl,
isothiazolidinyl, dithiazolyl, dithiazolidinyl, tetrahydrofuryl,
and benzofused derivatives thereof. In certain embodiments, a
"substituted heterocycle, or heterocycloalkyl or heterocyclic"
group is utilized and as used herein, refers to a heterocycle, or
heterocycloalkyl or heterocyclic group, as defined above,
substituted by the independent replacement of one, two or three of
the hydrogen atoms thereon with but are not limited to aliphatic;
alicyclic; heteroaliphatic; heterocyclic; aromatic; heteroaromatic;
aryl; heteroaryl; alkylaryl; heteroalkylaryl; alkylheteroaryl;
heteroalkylheteroaryl; alkoxy; aryloxy; heteroalkoxy;
heteroaryloxy; alkylthio; arylthio; heteroalkylthio;
heteroarylthio; F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2; --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl or heteroaryl
described above and herein may be substituted or unsubstituted.
Additionally, it will be appreciated that any of the alicyclic or
heterocyclic moieties described above and herein may comprise an
aryl or heteroaryl moiety fused thereto.
[0079] The terms "halo" and "halogen" used herein refer to an atom
selected from fluorine, chlorine, bromine and iodine.
[0080] The term "haloalkyl" denotes an alkyl group, as defined
above, having one, two, or three halogen atoms attached thereto and
is exemplified by such groups as chloromethyl, bromoethyl,
trifluoromethyl, and the like.
[0081] The term "amino" as used herein, refers to a primary
(--NH.sub.2), secondary (--NHR.sub.x), tertiary
(--NR.sub.xR.sub.y), or quaternary amine
(--N.sup.+R.sub.xR.sub.yR.sub.z), where R.sub.y and R.sub.z are
independently an aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic or heteroaromatic moiety, as defined herein.
Examples of amino groups include, but are not limited to,
methylamino, dimethylamino, ethylamino, diethylamino,
diethylaminocarbonyl, iso-propylamino, piperidino, trimethylamino,
and propylamino.
[0082] The term "acyl", as used herein, refers to a group having
the general formula --C(.dbd.O)R, where R is an aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aromatic or
heteroaromatic moiety, as defined herein.
[0083] The term "sulfonamido" as used herein, refers to a group of
the general formula --SO2NRxRy where Rx and Ry are independently
hydrogen, or an aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic or acyl moiety, as defined
herein.
[0084] The term "benzamido", as used herein, refers to a group of
the general formula PhNRx, where Rx is hydrogen, or an aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aromatic, heteroaromatic
or acyl moiety, as defined herein.
[0085] The term "C.sub.1-6 alkylidene" as used herein, refers to a
substituted or unsubstituted, linear or branched saturated divalent
radical consisting solely of carbon and hydrogen atoms, having from
one to six carbon atoms, having a free valence "-" at both ends of
the radical.
[0086] The term "C.sub.2-6 alkylidene" as used herein, refers to a
substituted or unsubstituted, linear or branched unsaturated
divalent radical consisting solely of carbon and hydrogen atoms,
having from two to six carbon atoms, having a free valence "-" at
both ends of the radical, and wherein the unsaturation is present
only as double bonds and wherein a double bond can exist between
the first carbon of the chain and the rest of the molecule.
[0087] As used herein, the terms "aliphatic", "heteroaliphatic",
"alkyl", "alkenyl", "alkynyl", "heteroalkyl", "heteroalkenyl",
"heteroalkynyl", and the like encompass substituted and
unsubstituted, saturated and unsaturated, and linear and branched
groups. Similarly, the terms, "alicyclic", "heterocyclic",
heterocycloalkyl", "heterocycle" and the like, encompass
substituted and unsubstituted, and saturated and unsaturated
groups. Additionally, the terms "cycloalkyl", cycloalkenyl",
cycloalkynyl", "heterocycloalkyl" "heterocycloalkenyl",
"heterocycloalkynyl", "aromatic", "heteroaromatic", "aryl",
"heteroaryl" and the like encompass both substituted and
unsubstituted groups.
[0088] The term "natural amino acid" as used herein refers to any
one of the common, naturally occurring L-amino acids found in
naturally occurring proteins: glycine (Gly), alanine (Ala), valine
(Val), leucine (Leu), isoleucine (Ile), lysine (Lys), arginine
(Arg), histidine (His), proline (Pro), serine (Ser), threonine
(Thr), phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp),
aspartic acid (Asp), glutamic acid (Glu), asparagine (Asn),
glutamine (Gln), cysteine (Cys) and methionine (Met).
[0089] The term "unnatural amino acid" as used herein refers to all
amino acids which are not natural amino acids. This includes, for
example, .alpha.-, .beta.-, D-, L-amino acid residues, and
compounds of the general formula:
##STR00019##
wherein the side chain R is other than the amino acid side chains
occurring in nature.
[0090] More generally, the term "amino acid", as used herein,
encompasses natural amino acids and unnatural amino acids.
[0091] The term "bioisosteres", as used herein, generally refers to
two or more compounds or moieties that possess similar molecular
shapes and/or volumes. In certain embodiments, bioisosteres have
approximately the same distribution of electrons. In certain other
embodiments, bioisosteres exhibit similar biological properties. In
preferred embodiments, bioisosteres possess similar molecular
shapes and volumes; have approximately the same distribution of
electrons; and exhibit similar biological properties.
[0092] The term "pharmaceutically acceptable derivative", as used
herein, denotes any pharmaceutically acceptable salt, ester, or
salt of such ester, of such compound, or any other adduct or
derivative which, upon administration to a subject, is capable of
providing (directly or indirectly) a compound as otherwise
described herein, or a metabolite or residue thereof.
Pharmaceutically acceptable derivatives thus include among others
pro-drugs. A pro-drug is a derivative of a compound, usually with
significantly reduced pharmacological activity, which contains an
additional moiety, which is susceptible to removal in vivo yielding
the parent molecule as the pharmacologically active species. An
example of a pro-drug is an ester, which is cleaved in vivo to
yield a compound of interest. Pro-drugs of a variety of compounds,
and materials and methods for derivatizing the parent compounds to
create the pro-drugs, are known and may be adapted to the present
invention. Certain exemplary pharmaceutical compositions and
pharmaceutically acceptable derivatives will be discussed in more
detail herein below.
[0093] As used herein, the term pharmaceutically acceptable salt"
refers to those salts which are suitable for pharmaceutical use,
preferably for use in the tissues of humans and lower animals
without undue irritation, allergic response and the like.
Pharmaceutically acceptable salts of amines, carboxylic acids, and
other types of compounds, are well known in the art. For example,
S. M. Berge, et al. describe pharmaceutically acceptable salts in
detail in J Pharmaceutical Sciences, 66: 1-19 (1977), incorporated
herein by reference. The salts can be prepared in situ during the
final isolation and purification of the compounds of the invention,
or separately by reacting a free base or free acid function with a
suitable reagent, as described generally below. For example, a free
base function can be reacted with a suitable acid. Furthermore,
where the compounds of the invention carry an acidic moiety,
suitable pharmaceutically acceptable salts thereof may, include
metal salts such as alkali metal salts, e.g. sodium or potassium
salts; and alkaline earth metal salts, e.g. calcium or magnesium
salts. Examples of pharmaceutically acceptable, nontoxic acid
addition salts are salts of an amino group formed with inorganic
acids such as hydrochloric acid, hydrobromic acid, phosphoric acid,
sulfuric acid and perchloric acid or with organic acids such as
acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid,
succinic acid or malonic acid or by using other methods used in the
art such as ion exchange. Other pharmaceutically acceptable salts
include adipate, alginate, ascorbate, aspartate, benzoate,
bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate, formate,
fumarate, glucoheptonate, glycerophosphate, gluconate,
hernisulfate, heptanoate, hexanoate, hydroiodide,
2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl
sulfate, malate, maleate, malonate, methanesulfonate, nicotinate,
nitrate, oleate, oxalate, palmitate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like. Further
pharmaceutically acceptable salts include, when appropriate,
nontoxic ammonium, quaternary ammonium, and amine cations formed
using counterions such as halide, hydroxide, carboxylate, sulfate,
phosphate, nitrate, sulfonate and aryl sulfonate.
[0094] As used herein, the term "pharmaceutically acceptable ester"
refers to esters that hydrolyze in vivo and include those that
break down readily in the human body to leave the parent compound
or a salt thereof. Suitable ester groups include, for example,
those derived from pharmaceutically acceptable aliphatic alcohol
compounds, particularly alkanes, alkenes, ethylene glycol,
cycloalkanes, and the like in which each alkyl or alkenyl moiety
advantageously has not more than 6 carbon atoms. These are
exemplary only and in no way limit the possibilities of esters
known in the art.
[0095] As used herein, the term "pharmaceutically acceptable
prodrugs" refers to those prodrugs of the compounds of the present
invention which are suitable for pharmaceutical use, preferably for
use with the tissues of humans and lower animals with undue
toxicity, irritation, allergic response, and the like, and
effective for their intended use, as well as the zwitterionic
forms, where possible, of the compounds of the invention. The term
"prodrug" refers to compounds that are rapidly transformed in vivo
to yield the parent compound of the above formula, for example by
hydrolysis in blood. A thorough discussion is provided in T.
Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14
of the A. C. S. Symposium Series, and in Edward B. Roche, ed.,
Bioreversible Carriers in Drug Design, American Pharmaceutical
Association and Pergamon Press, 1987, both of which are
incorporated herein by reference.
C. Compounds Useful in the Invention which are Directly Competitive
Antagonists or Allosteric Antagonists of LFA-1 Interaction with
ICAM-1.
[0096] Antagonists which are directly competitive antagonists of
the LFA-1 interaction with ICAM-1, at a high affinity binding site
in the .alpha.L subunit of LFA-1 overlapping the ICAM-1 binding
site can be identified, for example, by performing competitive
binding experiments as described in S. M. Keating, K. R. Clark, L.
D. Stepanich, F. Arellano, C. P. Edwards, S. C. Bodary, S. A.
Spencer, T. R. Gadek, J. C, Marsters Jr., M. H. Beresini,
"Competition between intercellular adhesion molecule-1 and a small
molecule antagonist for a common binding site on the .alpha.1
subunit of lymphocyte function-associated antigen-1." (2006)
Protein Science, 15:290-303. This high affinity site on LFA-1 that
overlaps with the ICAM-1 binding site has been shown to include the
MIDAS motif of the I domain in the .alpha.L subunit of LFA-1.
Allosteric antagonism, which may be competitive but not directly
competitive, can also be identified using this experimental
design.
1. Identification of the Binding Site of Directly Competitive
Antagonists of the LFA-1:ICAM Interaction.
[0097] a. Crosslinking of Compound 5 to the .alpha.L Subunit of
LFA-1.
[0098] The binding site of small molecule antagonists of this class
was identified by binding compound 5, a tritium-labeled,
photoactivatable analogue of compound 3 to LFA-1 and then
photocrosslinking (FIG. 4). To maximize specific, high affinity
crosslinking, it was necessary to gel filter the samples to remove
unbound or weakly bound compound 5 prior to irradiation (FIG. 5,
lanes e vs. f and g vs. h). In the absence of gel filtration, there
was significant crosslinking of compound 5 to LFA-1.alpha. subunit,
.beta. subunit, and heterodimer (the band at approximately
200,000), whereas nonspecific crosslinking was not observed in the
gel filtered samples (data not shown). Under gel filtration
conditions, compound 5 specifically crosslinked only to the
.alpha.L subunit (FIG. 5, lanes c and g). Moreover, the presence of
compound 3 during the incubation substantially reduced the
incorporation of tritium into the .alpha.L subunit (FIG. 5, lane e
vs. g). Similarly, in the presence of compound 3, there was a
slight reduction of tritium incorporation into the .alpha.L
subunit, .beta.2 subunit and heterodimer in the absence of gel
filtration (FIG. 5, lane f vs. h). No crosslinking of compound 5
occurred when gel filtered samples of the isolated, structurally
intact .alpha.L or .beta.2 subunits were used (data not shown).
Thus, the high affinity binding site necessary to crosslink after
gel filtration is provided by the intact LFA-1 heterodimer.
[0099] The site of crosslinking was further defined by fragmenting
the affinity-labeled .alpha.L subunit with hydroxylamine,
electrophoretically separating the fragments, and then performing
N-terminal sequencing on the radiolabeled fragments to determine
their locations within the protein sequence. Two sequences were
identified, the first starting with residue 1 (sequence found:
YNLDVRGARSFS (SEQ ID NO 1)) and the second with residue 30
(sequence found: GVIVGAPGEGNST (SEQ ID NO 2)). Both peptides were
approximately 500 amino acids long as judged by their sizes on
SDS-PAGE (50-60 kDa); this fragment size is consistent with the
next two predicted cleavage sites (N-G) for hydroxylamine, N507 and
N530. No label was incorporated into the C-terminal half of the
subunit.
b. Lack of Binding of Compound 2B to LFA-1 Lacking the I
Domain.
[0100] The role of the I domain in the binding of compound 2B and
related analogs to LFA-1 was demonstrated by preparing a construct
of the .alpha.L subunit lacking the I domain. The 132 construct
alone (mock) or together with the construct lacking the I domain or
wild type .alpha.L was transfected into 293 cells, and the binding
of compound 2B to the transfected cells was examined (FIG. 6).
Compound 2B showed substantial binding to the wild type .alpha.L
transfected cells but demonstrated no significant binding to the
cells transfected with .alpha.L lacking the I domain relative to
binding to mock (.beta.2) transfected cells. Transfectants were
also tested for their ability to adhere to ICAM-1-Ig, and as
expected, the LFA-1 transfected cells lacking the I domain and mock
transfectants showed indistinguishable background levels of
binding, while the wild type .alpha.L transfected cells showed
robust adhesion (FIG. 6B). Evaluation of the binding of a panel of
LFA-1 antibodies to the transfected cells indicated that, apart
from loss of binding by antibodies that mapped to the I domain, the
LFA-1 heterodimer appeared to be intact in the transfected cells
lacking the .alpha.L I domain (data not shown).
[0101] The data support the conclusion that compound 3 and related
molecules bind to a high affinity site on LFA-1 that overlaps with
the ICAM-1 binding site which has previously been shown to include
the MIDAS motif of the I domain in the .alpha.L subunit of
LFA-1.
[0102] Corroborating evidence for the close proximity of the ICAM-1
and small molecule antagonist binding sites on LFA-1 can be seen in
the common effect of the deletion of the I domain on the binding of
both ICAM-1-Ig and compound 2B. Both compound 2B and ICAM-1 were
unable to bind to LFA-1 lacking the I domain, the domain in which
the ICAM-1 binding site is located. Moreover, the ability of
A-286982 to allosterically modify the binding of both ICAM-1-Ig and
compound 2B is consistent with a close proximity of their binding
sites to the A-286982 binding site in the IDAS motif in the I
domain of the LFA-1 .alpha. subunit. The selective photochemical
crosslinking of compound 5 to the .alpha. chain of LFA-1 localizes
its binding site to within residues 30-507 of this subunit. All of
the findings noted above are consistent with a single high affinity
small molecule binding site located in the I domain of the .alpha.
chain of LFA-1.
[0103] Close examination of the photochemical crosslinking study
performed with a relatively high concentration of compound 5 (4.1
.mu.M, FIG. 5) affords direct evidence for an additional low
affinity small molecule binding site on LFA-1. Dramatically
different protein and crosslinking patterns are observed in the
presence and absence of gel filtration. When samples are gel
filtered to remove unbound and weakly bound molecules prior to
irradiation, only high affinity labeling of the .alpha. subunit is
observed. However, in the absence of the gel filtration step,
irradiation of the complex of compound 5 with LFA-1 results in high
intensity crosslinking to the .alpha. subunit and lower intensity
crosslinking to a low affinity binding site in the .beta. subunit
whose complex with compound 5 is too weak to survive gel
filtration. Under both conditions, the observed crosslinking is
partially inhibited by a large excess (290 .mu.M) of compound 3
(FIG. 5, lanes e and g, f and h), demonstrating the specific nature
of the binding to both sites. Attempts to crosslink compound 5 to
either of the isolated .alpha. or .beta. subunits failed to afford
high affinity complexes capable of surviving the gel filtration
process. Consequently, it appears that the high affinity
competitive binding of the class of compounds represented by
compound 3 requires the presence of an intact full length LFA-1
heterodimer. Attempts to capture this binding site in constructs of
either of the LFA-1 subunits or the isolated I domain results in
diminished affinity of LFA-1 for ICAM-1 and small molecule analogs
of compound 3 (e.g. XVA143). It is particularly interesting to note
the presence of a minor LFA-1 heterodimer band that appears in the
absence of gel filtration (FIG. 5, band at >200,000 daltons.)
The intensity of the LFA-1 band as judged by both Coomassie blue
staining and autoradiography is consistent with low affinity
binding to a second site on the p chain that stabilizes the
heterodimer.
[0104] The binding site responsible for the stabilization of LFA-1
to SDS-PAGE may reside in the I-like domain of the .beta. subunit.
As shown above, this .beta. subunit binding site is not related to
the high affinity binding site in the .alpha. subunit which is
responsible for the direct competitive inhibition of ICAM-1
binding. However, the .beta. subunit binding site responsible for
LFA-1 stabilization by compound 3 may be the same as the low
affinity .beta. subunit crosslinking site.
[0105] There are two distinct binding sites for the class of LFA-1
small molecule antagonist probes used herein. The first is a high
affinity binding site in the .alpha.L subunit of LFA-1 through
which the small molecule and LFA-1 form a complex which is stable
enough (e.g. K.sub.d<25 nM) to survive the gel filtration
process. It is this small molecule binding site that has been
characterized in the binding experiments reported here as
overlapping the ICAM-1 binding site and that correlates with: the
potent inhibition of LFA-1/ICAM-1 binding by compounds 3 and 4
(compound 4 IC.sub.50=1.4 nM); their potent inhibition of LFA-1
induced lymphocyte proliferation (compound 4 IC.sub.50=3 nM) in
vitro; and their inhibition of the immune system's response in
vivo. The second site is a lower affinity binding site (e.g.
K.sub.d>1 M) in the .beta. subunit which is involved with
stabilization of the LFA-1 heterodimer under SDS-PAGE. This site is
more dynamic by nature (i.e. faster off rate) and does not survive
the gel filtration/photolysis process. The characteristics of this
second low affinity site are consistent with those of an
.alpha./.beta. I-like allosteric antagonist binding site in the
I-like domain of the .beta. subunit. The low affinity binding of
the ICAM-1 mimetics described herein to the .beta. subunit of
LFA-1, presumably to the I-like domain, is likely due to the
sequence homology between the I and I-like domains, particularly
with regard to similarities in MIDAS motifs and their affinities
for the carboxylic acid moiety common to this class of antagonists.
Given that the .beta.2 family of integrins, including MAC-1, share
this subunit, the affinity of compounds for the I-like domain in
the .beta.2 subunit must be attenuated in order to select
antagonists which are specific to LFA-1.
[0106] The experiments described above substantiate the high
affinity binding of compounds 3 and 4 to LFA-1 in a manner that is
similar to that of ICAM-1, at a site overlapping the ICAM-1 binding
site involving the MIDAS motif within the I domain of the LFA-1
.alpha. subunit. This is consistent with their proposed mimicry of
the ICAM-1 epitope, and inconsistent with any conclusion that they
function as .alpha./.beta. I-like allosteric antagonists of
LFA-1/ICAM-1. The binding of these ICAM-1 mimetics to the .beta.2
integrin subunit, albeit with lower affinity, raises the question
of whether ICAM-1 itself binds to a second site in the I-like
domain as part of a feedback mechanism.
[0107] It has been shown, supra, that small molecules can bind with
high affinity to the .alpha.-L subunit, which is unique to LFA-1.
Consequently these compounds can be selective for LFA-1
(.alpha.L.beta.2) over Mac-1 (.alpha.M.beta.2). One preferred
embodiment of the invention is to utilize selective inhibitors of
LFA-1, which may confer advantages in therapeutic safety.
2. Competitive Binding Experiments.
[0108] a. Antagonist Competition in the LFA-1/ICAM-1 and
LFA-1/Small Molecule ELISA.
[0109] Compounds 2A and 3, A-286982, and sICAM-1 were used to
illustrate competitive inhibition of binding of ICAM-1-Ig to LFA-1,
by titration into the LFA-1/ICAM-1 ELISA. The format and results
from this form of the LFA-1/ICAM-1 assay are more robust due to
antibody capture of the LFA-1 rather than direct coating onto the
ELISA plate. The experiment was performed by the addition of 1/5
serial dilutions of compound 3 (- -), compound 2A
(-.tangle-solidup.-), A-286982 (-.diamond-solid.-) and sICAM-1 (--)
followed by incubation with either ICAM-1-Ig (A) or compound 2B (B)
on plates containing captured LFA-1. The data shown are the average
of two plates from a single experiment and are representative of
several independent measurements. The solid lines are the fits of
the data. The IC.sub.50 values (nM) are provided in the
legends.
[0110] Typical competition curves for these inhibitors in the ELISA
are shown in FIG. 7A. Compound 3 potently inhibited the binding of
ICAM-1-Ig to LFA-1 with a 2 nM IC.sub.50. Compound 2A, an analogue
of compound 3, inhibited binding but with an approximately 10-fold
higher IC.sub.50 value. A-286982 and sICAM-1 inhibited ICAM-1-Ig
binding to LFA-1 but with IC.sub.50 values that were more than
100-fold that of compound 3.
[0111] The ability of these same compounds to inhibit the binding
of a FITC labeled small molecule antagonist, compound 2B, to LFA-1
was also demonstrated (FIG. 7B). The potencies of compounds 2A and
3 and soluble ICAM-1 as inhibitors of compound 2B binding
paralleled their potencies as inhibitors of ICAM-1-Ig binding.
Compound 3, compound 2A and sICAM-1 inhibited the binding of
compound 2B to LFA-1 with IC.sub.50 values of 3, 56, and 1200 nM,
respectively. A-286982 did not inhibit but rather enhanced the
binding of compound 2B to LFA-1 as indicated by the transient
increase in the absorbance values, reaching a maximal effect at
approximately 4 .mu.M before decreasing.
[0112] The evaluation of IC.sub.50 values in the LFA-1/small
molecule and LFA-1/ICAM-1 ELISAs was extended to a larger set of
compounds including a group of kistrin-derived peptides and small
molecules representing the evolution of this class of LFA-1 small
molecule antagonists. As shown in FIG. 8 (Correlation of IC50
values from antagonist competition in the LFA-1:ICAM-1 and
LFA-1:small molecules ELISAs. The IC.sub.50 values of a diverse
group of compounds (4 peptides, 5 small molecules and sICAM-1) in
competition with compound 2B are plotted against the IC.sub.50
values determined in competition with ICAM-1-Ig for binding to
LFA-1. The slope of the plot is 0.964, y-intercept, 0.237 and
R=0.940. Each data point is the average of IC.sub.50 values from
two plates), there is a good correlation (R=0.94) between the
IC.sub.50 values for competition in each of the two ligand binding
assays for this diverse set of compounds, including sICAM-1,
compounds 2A and 3, across five log units of potency. The common
trend in potencies between the two antagonist competition ELISAs
with ICAM-1-Ig and compound 2B as ligands reveals that each
compound disrupts the binding of both ICAM-1 and small molecule
ligands in a mechanistically similar fashion. This parallel in
potency of inhibition demonstrates that ICAM-1-Ig and compound 2B
are binding to the same site on LFA-1. Hence, the compounds of the
invention are competitive antagonists of LFA-1.
b. Antagonist Modulation of Ligand Binding in LFA-1/ICAM-1 and
LFA-1/Small Molecule ELISAs.
[0113] An antagonist, which inhibits through direct competition
with the ligand of interest, exhibits a non-saturable rightward
shift of the ligand binding curves to higher apparent EC.sub.50
values with increasing antagonist concentration and no reduction in
the maximal binding of the ligand. Inhibition will be surmountable
but will require increasing amounts of ligand in the presence of
increasing concentrations of a direct competitive inhibitor. The
effects of directly competitive compound 3, an allosteric
antagonist A-286982 and sICAM-1 on the binding curves of ICAM-1-Ig
and compound 2B to LFA-1 are shown in FIG. 9 as examples of
antagonists displaying direct competition. Titration of ICAM-1-Ig
(A, C, E) or compound 2B (B, D, F) in the absence (-.diamond.-) or
presence of antagonist in the LFA-1/ICAM-1 and LFA-1/small molecule
ELISAs. The antagonists were added in two-fold dilutions starting
at 2.4 (A) and 2.7 (B) .mu.M sICAM-1, 0.040 (C) and 0.10 (D) .mu.M
compound 3 and 20 (E) and 50 (F) .mu.M A-286982. The order of
antagonist concentrations was, (lowest added antagonist
concentration), -.DELTA.-, -.largecircle.-, -.diamond-solid.-,
-.box-solid.-, -.tangle-solidup.- to - - (highest antagonist
concentration). The fits of the data are shown as the solid lines.
The data shown are from one plate and are representative of a
minimum of two experiments. (Note that A-286982 (F) resulted in
increased binding of compound 2B to LFA-1.) In contrast, an
allosteric inhibitor may alter the ligand binding curves by causing
a reduction in maximal binding or saturation in the rightward
shifts of the curves. As shown in FIG. 9A, the presence of
increasing concentrations of sICAM-1 clearly shifted the ICAM-1-Ig
binding curves rightward to higher EC.sub.50 values. Additionally,
the same maximal extent of binding of ICAM-1-Ig to LFA-1 was
observed in the presence and absence of sICAM-1 as expected when
two molecular forms of the same natural ligand are competing
directly for binding to one site on a receptor. Similarly,
increasing concentrations of compound 3 also shifted the binding of
ICAM-1-Ig to higher EC.sub.50 values with minimal variation in
maximal ICAM-1-Ig binding (FIG. 9C). Although the rightward shifts
in the ligand binding curves in the presence of a competitive
antagonist are typically parallel, this is not always the case. The
nonparallel slopes for the LFA-1/ICAM-1-Ig binding curves in the
presence and absence of compound 3 may be due to an inability to
attain complete equilibrium under the heterogeneous ligand binding
ELISA conditions with this compound. In the LFA-1/compound 2B
format of the ligand binding ELISA, increasing concentrations of
compound 3 also clearly shifted the compound 2B binding curves to
higher EC.sub.50 values with no reduction in maximal binding (FIG.
9D). Increasing concentrations of sICAM-1 also showed a similar
effect (FIG. 9B), although the extent of the shift in the curves
was limited by the maximum achievable concentration of sICAM-1 at
2.7 .mu.M. Thus, the effects of both sICAM-1 and compound 3 on
ICAM-1-Ig and compound 2B binding to LFA-1 are characteristic of
direct competition as described above.
[0114] The effect of A-286982 on ICAM-1-Ig and compound 2B binding
to the receptor was clearly different (FIGS. 9E and 9F). In the
LFA-1/ICAM-1 ELISA, the ICAM-1-Ig curves were shifted rightward to
higher EC.sub.50 values; however, the maximum binding of ICAM-1-Ig
to LFA-1 decreased considerably with increasing concentrations of
A-286982. The reduction in maximal binding and rightward shift of
the ligand binding curves with increasing A-286982 concentration
are reflective of allosteric inhibition as described above.
A-286982 causes reductions in both ligand affinity and binding
capacity; this demonstrates that A-286982 is an insurmountable
antagonist of ICAM-1-Ig binding. In contrast, in the LFA/small
molecule ELISA, the presence of A-286982 at micromolar
concentrations shifted the compound 2B binding curves to lower
EC.sub.50 values and appeared to enhance the binding of compound 2B
to LFA-1 (FIG. 9F). The contrasting effects of A-286982 on compound
2B and ICAM-1-Ig binding may be due to the known allosteric effect
of the compound binding to the IDAS site on LFA-1. The A-286982
binding data serve as an illustration for allosteric inhibition for
small molecule and protein ligand binding to LFA-1 in the binding
experiments demonstrated in this method.
[0115] Schild analysis can be also used to investigate whether a
compound inhibits ligand binding through direct competition for a
single binding site. This model is based upon the assumptions that
equiactive responses in an assay are the result of equivalent
occupancy of receptor by ligand and that maximal binding is
unchanged by the presence of antagonist. In a Schild analysis, the
dose ratio is the ratio of the EC.sub.50 values in the presence and
absence of antagonist and is a measure of the ligand concentrations
leading to equiactive responses. This dose ratio was determined for
each concentration of antagonist and the Schild regressions were
plotted as shown in FIG. 10. A linear response with a slope of 1 in
a Schild regression indicates that inhibition by an antagonist is
directly competitive and reversible. The Schild analysis would
yield a nonlinear relationship and/or a slope that deviates
significantly from 1 in the case of an allosteric inhibitor that
does not result in a reduction of maximal binding. The Schild
regressions for both sICAM-1 and compound 3 are shown in FIG. 10
with comparable slopes of 1.26 and 1.24, respectively. Schild
regressions of s-ICAM-1 (-.tangle-solidup.-) and compound 3 (- -)
antagonism in the LFA-1/ICAM-1 ligand binding ELISA are plotted
from the data in FIGS. 5 (A) and (C), respectively. The slope of
the plot for compound 3 is 1.24 with a y-intercept of 10.9 and
R=0.99832. The slope of the sICAM-1 plot is 1.26, y-intercept, 8.51
and R=0.99131. Although the Schild analysis requires a linear
regression with a slope close to 1 to demonstrate direct
competitive inhibition, there is no guidance in the extensive
literature as to what range of Schild values are acceptable. Slopes
of 1.24 and 1.26 fall within the bounds of many published Schild
values used to support competitive binding conclusions, and
therefore, these slope values are not considered significantly
different than 1. The linearity of the regression plots and the
similarity in slopes of the relationships are consistent with
binding of ligand (ICAM-1-Ig) and both antagonists (sICAM-1 and
compound 3) to the same site in a similar manner.
A. Antibodies
[0116] Several suitable antibodies are known in the art. Blocking
of the ICAMs, such as for example ICAM-1, or the leukointegrins,
such as for example, LFA-1, by antibodies directed against either
or both of these molecules can inhibit inflammatory response.
Previous studies have investigated the effects of anti-CD 11a MAbs
on many T-cell-dependent immune functions in vitro and a number of
immune responses in vivo. In vitro, anti-CD11a MAbs inhibit T-cell
activation (See Kuypers T. W., Roos D. 1989 "Leukocyte membrane
adhesion proteins LFA-1, CR3 and p150,95: a review of functional
and regulatory aspects" Res. Immunol., 140:461-465; Fischer A,
Durandy A, Sterkers G, Griscelli C. 1986 "Role of the LFA-1
molecule in cellular interactions required for antibody production
in humans" J. Immunol., 136, 3198; target cell lysis by cytotoxic
T-lymphocytes (Krensky et al., supra), formation of immune
conjugates (Sanders V M, Snyder J M, Uhr J W, Vitetta E S.,
"Characterization of the physical interaction between
antigen-specific B and T cells". J. Immunol., 137:2395 (1986);
Mentzer S J, Gromkowski S H, Krensky A M, Burakoff S J, Martz E.
1985 "LFA-1 membrane molecule in the regulation of homotypic
adhesions of human B lymphocytesn" J. Immunol., 135:9), and the
adhesion of T-cells to vascular endothelium (Lo S K, Van Seventer G
A, Levin S M, Wright S D., Two leukocyte receptors (CD11a/CD18 and
CD11b/CD18) mediate transient adhesion to endothelium by binding to
different ligands., J. Immunol., 143:3325 (1989)). Two anti-CD11a
MAbs, HI 111, and G43-25B are available from Pharmingen/BD
Biosciences. Additionally, a study including F8.8, CBR LFA 1/9,
BL5, May.035, TS1/11, TS1/12, TS1/22, TS2/14, 25-3-1, MHM2 and
efalizumab evaluated the range of binding sites on LFA-1 these
antibodies occupied. See Lu, C; Shimaoka, M.; Salas, A.; Springer,
T. A. 2004, "The Binding Sites for Competitive Antagonistic,
Allosteric Antagonistic, and Agonistic Antibodies to the I Domain
of Integrin LFA-1" J. Immun. 173: 3972-3978 and references therein.
It was shown that efalizumab, amongst other antibodies directed
against LFA-1, is a directly competitive antagonist of LFA-1.
[0117] Thus, a number of antibodies which are directed against
LFA-1, may be used to treat diabetic retinopathy, including
efalizumab (Raptiva).
B. Small Molecules.
1. Peptides.
[0118] Peptides have been investigated for use in reducing the
interaction of LFA-1 with ICAM-1. Polypeptides that do not contain
an Fc region of an IgG are described in U.S. Pat. No. 5,747,035,
which can be used to treat LFA-1 mediated disorders, in particular
diabetic retinopathy. Use of dual peptides, the first a modulator
of ICAM-1 and the second a blocking peptide with a sequence
obtained from LFA-1 is described in U.S. Pat. No. 5,843,885 to
reduce the interactions between LFA-1 and ICAM-1. Cyclic peptides
have been described in U.S. Pat. No. 6,630,447 as inhibitors of the
LFA-1:ICAM-1 interaction.
2. Small Organic Molecules.
[0119] a. Exemplary Compounds which are Directly Competitive
Antagonists of LFA-1.
[0120] "Small organic molecule" generally is used to refer to
organic molecules of a size comparable to those organic molecules
generally used in pharmaceuticals. The term typically excludes
organic biopolymers (e.g., proteins, nucleic acids, etc.). Small
organic molecules most often range in size up to about 5000 Da, in
some embodiments, up to about 2000 Da, or in other embodiments, up
to about 1000 Da.
[0121] i. In one embodiment, compounds useful in the methods of the
present invention include compounds of Formula I:
##STR00020##
where R.sup.1 and R.sup.2 are each independently hydrogen, an amino
acid side chain, --(CH.sub.2).sub.mOH, --(CH2).sub.maryl,
--(CH2).sub.mheteroaryl, wherein m is 0-6,
--CH(R.sup.1A)(OR.sup.1B), --CH(R.sup.1A)(NHR.sup.1B), U-T-Q, or an
aliphatic, alicyclic, heteroaliphatic or heteroalicyclic moiety
optionally substituted with U-T-Q; wherein U may be absent or one
of the following: --O--, --S(O).sub.0-2--, --SO.sub.2N(R.sup.1A),
--N(R.sup.1A)--, --N(R.sup.1A)C(.dbd.O)--,
--N(R.sup.1A)C(.dbd.O)--O--, --N(R.sup.1A)C(.dbd.O)--N(R.sup.1B)--,
--N(R.sup.1A)--SO.sub.2--, --C(.dbd.O)--, --C(.dbd.O)--O--,
--O--C(.dbd.O)--, aryl, heteroaryl, alkylaryl, alkylheteroaryl,
--C(.dbd.O)--N(R.sup.1A)--, --OC(.dbd.O)N(R.sup.1A)--,
C(.dbd.N--R.sup.1E)--, --C(.dbd.N--R.sup.1E)--O--,
--C(.dbd.N--R.sup.1E)--N(R.sup.1A)--,
--O--C(.dbd.N--R.sup.1E)--N(R.sup.1A)--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--O--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--N(R.sup.1B)--,
--P(.dbd.O)(OR.sup.1A)--O--, or --P(.dbd.O)(R.sup.1A)--O--; wherein
T is absent or, an aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety; and Q is hydrogen, halogen,
cyano, isocyanate, --OR.sup.1B; --SR.sup.1B; --N(R.sup.1B).sub.2,
--NHC(.dbd.O)OR.sup.1B, --NHC(.dbd.O)N(R.sup.1B).sub.2,
--NHC(.dbd.O)R.sup.1B, --NHSO.sub.2R.sup.1B,
NHSO.sub.2N(R.sup.1B).sub.2, --NHSO.sub.2NHC(.dbd.O)OR.sup.1B,
--NHC(.dbd.O)NHSO.sub.2R.sup.1B, --C(.dbd.O)NHC(.dbd.O)OR.sup.1B,
C(.dbd.O)NHC(.dbd.O)R.sup.1B,
--C(.dbd.O)NHC(.dbd.O)N(R.sup.1B).sub.2,
--C(.dbd.O)NHSO.sub.2R.sup.1B,
--C(.dbd.O)NHSO.sub.2N(R.sup.1B).sub.2, C(.dbd.S)N(R.sup.1B).sub.2,
--SO.sub.2R.sup.1B, SO.sub.2OR.sup.1B, --SO.sub.2N(R.sup.1B).sub.2,
--SO.sub.2--NHC(.dbd.O)OR.sup.1B, --OC(.dbd.O)--N(R.sup.1B)2,
--OC(.dbd.O)R.sup.1B, --OC(.dbd.O)NHC(.dbd.O)R.sup.1B,
--OC(.dbd.O)NHSO.sub.2R.sup.1B, --OSO.sub.2R.sup.1B, or an
aliphatic heteroaliphatic, aryl or heteroaryl moiety, or wherein
R.sup.1 and R.sup.2 taken together are an alicyclic or heterocyclic
moiety, or together are
##STR00021##
wherein each occurrence of R.sup.1A and R.sup.1B is independently
hydrogen, an aliphatic, alicyclic, heteroaliphatic, heterocyclic,
aryl, heteroaryl, alkylaryl or alkylheteroaryl moiety,
--C(.dbd.O)R.sup.1C, or --C(.dbd.O)NR.sup.1CR.sup.1D; wherein each
occurrence of R.sup.1C and R.sup.1D is independently hydrogen,
hydroxyl, or an aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety; and R.sup.1E is hydrogen, an
aliphatic, alicyclic, heteroaliphatic, heterocyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety, --CN, --OR.sup.1C,
--NR.sup.1CR.sup.1D or --SO2R.sup.1C; where R.sup.3 is
--C(.dbd.O)OR.sup.3A, --C(.dbd.O)H, --CH.sub.2OR.sup.3A,
--CH.sub.2C(.dbd.O)-alkyl,
--C(.dbd.O)NH(R.sup.3A).--CH.sub.2X.sup.0; wherein each occurrence
of R.sup.3A is independently hydrogen, a protecting group, an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl, alkylheteroaryl, heteroalkylaryl,
heteroalkylheteroaryl moiety, or a pharmaceutically acceptable salt
or ester, or R.sup.3A, taken together with R.sup.1 and R.sup.2,
forms a heterocyclic moiety; wherein X.sup.0 is a halogen selected
from F, Br or I; R.sup.4 for each occurrence, is independently
hydrogen, halogen, --CN, --NO.sub.2, an aliphatic, alicyclic,
heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, or is GR.sup.G1 wherein G is --O--, --S--,
NR.sup.G2--, --CO--, --SO--, --SO.sub.2--, C(.dbd.O)O--,
--C(.dbd.O)NR.sup.G2--, C(.dbd.O)--, or --NR.sup.G2C(.dbd.O)-- or
--SO.sub.2NR.sup.G2--, and R.sup.G1 and R.sup.G2 are independently
hydrogen, an aliphatic, alicyclic, heteroaliphatic,
heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety; n is an integer from 0-4; AR.sup.1 is a monocyclic or
polycyclic aryl, heteroaryl, alkylaryl, alkylheteroaryl, alicyclic
or heterocyclic moiety; A, B, D and E are connected by either a
single or double bond, as valency permits; wherein each occurrence
of A, B, D and E is independently C.dbd.O, CR.sup.iR.sup.ii,
NR.sup.i, CR.sup.i, N, O, S, --S(.dbd.O) or SO.sub.2; wherein each
occurrence of R.sup.i and R.sup.ii are independently hydrogen,
halogen, --CN, --NO2, an aliphatic, alicyclic, heteroaliphatic,
heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety, or is -GR.sup.G1 wherein G is --O--, --S--, --NR.sup.G2,
--CO--, --SO--, --C(.dbd.O)O--, --C(.dbd.O)NR.sup.G2--,
--OC(.dbd.O)--, --NR.sup.G2C(.dbd.O)-- or --SO.sub.2NR.sup.G2--,
and R.sup.G1 and R.sup.G2 are independently hydrogen, an aliphatic,
alicyclic, heteroaliphatic, heteroalicyclic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety, or any two adjacent
occurrences of taken together, represent an alicyclic,
heteroalicyclic, aryl, or heteroaryl moiety; p is an integer from
0-4; and, L is absent or is V--W--X--Y-Z, wherein each occurrence
of V, W, X, Y and Z is independently absent, C.dbd.O, NR.sup.L1,
--O--, --C(R.sup.L1).dbd., .dbd.C(R.sup.L1)--,
--C(R.sup.L1)(R.sup.L2), C(.dbd.N--OR.sup.L1), C(.dbd.NR.sup.L1),
--N.dbd., S(O).sub.0-2; a substituted or unsubstituted C.sub.1-6
alkenylidene or C.sub.2-6 alkenylidine chain wherein up to two
non-adjacent methylene units are independently optionally replaced
by --C(.dbd.O)--, --CO.sub.2--, --C(.dbd.O)C(.dbd.O)--,
--C(C.dbd.O)NR.sup.L3--, --OC(.dbd.O)--, --OC(.dbd.O)NR.sup.L3,
--NR.sup.L3NR.sup.L4--, --NR.sup.L3NR.sup.L4C(.dbd.O)--,
--NR.sup.L3C(.dbd.O)--, NR.sup.L3CO.sub.2--,
NR.sup.L3C(.dbd.O)NR.sup.L4--, --S(.dbd.O)--, --SO.sub.2--,
--NR.sup.L3SO.sub.2--, --SO.sub.2NR.sup.L3,
--NR.sup.L3SO.sub.2NR.sup.L4, --O--, --S--, or --NR.sup.L3--;
wherein each occurrence of R.sup.L3 and R.sup.L4 is independently
hydrogen, alkyl, heteroalkyl, aryl, heteroaryl or acyl; or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety; and each
occurrence of R.sup.L1 and R.sup.L2 is independently hydrogen,
hydroxyl, protected hydroxyl, amino, protected amino, thio,
protected thio, halogen, cyano, isocyanate, carboxy, carboxyalkyl,
formyl, formyloxy, azido, nitro, ureido, thioureido, thiocyanato,
alkoxy, aryloxy, mercapto, sulfonamido, benzamido, tosyl, or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety, or wherein one or
more occurrences of R.sup.L1 and R.sup.L2, taken together, or taken
together with one of V, W, X, Y or Z form an alicyclic or
heterocyclic moiety or form an aryl or heteroaryl moiety.
[0122] Some preferred embodiments of the method of the present
invention are of Formula II:
##STR00022##
where R.sup.28 is one of the following groups:
##STR00023##
and R.sup.27 is one of the following groups:
##STR00024##
and R.sup.29 is hydrogen, a pharmaceutically acceptable salt or
ester.
[0123] Some preferred embodiments of the invention are compounds of
the Formula II'
##STR00025##
where the substitution is as in Formula II.
[0124] Some particularly preferred embodiments of compounds of the
method of the present invention are compounds of Formulae IA, IIA
and IIB:
##STR00026##
where R.sup.17 is hydrogen, pharmaceutically acceptable salts or
esters, and R.sup.27 is as in Formula II. Compounds of this class
are disclosed in U.S. Pat. No. 7,314,938.
[0125] ii. Another set of preferred embodiments of compounds of the
method of the invention are compounds of the Formula III:
##STR00027##
where Cy is an aromatic carbocycle, aromatic heterocycle or a
non-aromatic carbocycle or heterocycle optionally substituted with
hydroxyl (--OH), mercapto (--SH), thioalkyl, halogen (e.g. F, Cl,
Br, I), oxo (.dbd.O), thio (.dbd.S), amino, aminoalkyl, amidine
(--C(NH)--NH.sub.2), guanidine (--NH.sub.2--C(NH)--NH.sub.2),
nitro, alkyl or alkoxy. In a particular embodiment, Cy is a 3-5
member ring. In a preferred embodiment, Cy is a 5- or 6-member
non-aromatic heterocycle optionally substituted with hydroxyl,
mercapto, halogen (preferably F or Cl), oxo (.dbd.O), thio
(.dbd.S), amino, amidine, guanidine, nitro, alkyl or alkoxy. In a
more preferred embodiment, Cy is a 5-member non-aromatic
heterocycle optionally substituted with hydroxyl, oxo, thio, Cl,
C.sub.1-4 alkyl (preferably methyl), or C.sub.1-4 alkanoyl
(preferably acetyl, propanoyl or butanoyl). More preferably the
non-aromatic heterocycle comprises one or heteroatoms (N, O or S)
and is optionally substituted with hydroxyl, oxo, mercapto, thio,
methyl, acetyl, propanoyl or butyl. In particular embodiments the
non-aromatic heterocycle comprises at least one nitrogen atom that
is optionally substituted with methyl or acetyl. In a particularly
preferred embodiment, the non-aromatic heterocycle is selected from
the group consisting of piperidine, piperazine, morpholine,
tetrahydrofuran, tetrahydrothiophene, oxazolidine, thiazolidine
optionally substituted with hydroxy, oxo, mercapto, thio, alkyl or
alkanoyl. In a most preferred embodiment Cy is a non-aromatic
heterocycle selected from the group consisting of
tetrahydrofuran-2-yl, thiazolidin-5-yl, thiazolidin-2-one-5-yl, and
thiazolidin-2-thione-5-yl and pyrrolidine. In a preferred
embodiment, Cy is a 5- or 6-member aromatic carbocycle or
heterocycle optionally substituted with hydroxyl, mercapto, halogen
(preferably F or Cl), oxo (.dbd.O), thio (.dbd.S), amino, amidine,
guanidine, nitro, alkyl or alkoxy. In a more preferred embodiment,
Cy is a 5-member aromatic carbocycle or heterocycle optionally
substituted with hydroxyl, oxo, thio, Cl, C.sub.1-4 alkyl
(preferably methyl), or C.sub.1-4 alkanoyl (preferably acetyl,
propanoyl or butanoyl). More preferably the aromatic or heterocycle
comprises one or heteroatoms (N, O or S) and is optionally
substituted with hydroxyl, oxo, mercapto, thio, methyl, acetyl,
propanoyl or butyl.
[0126] In another preferred embodiment Cy is a 3-6 member
carbocycle optionally substituted with hydroxyl, mercapto, halogen,
oxo, thio, amino, amidine, guanidine, alkyl, alkoxy or acyl. In a
particular embodiment the carbocycle is saturated or partially
unsaturated. In particular embodiments Cy is a carbocycle selected
from the group consisting of cyclopropyl, cyclopropenyl,
cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl or
cyclohexenyl.
[0127] X.sub.2 is a C.sub.1-5 divalent hydrocarbon linker
optionally having one or more carbon atoms replaced with N, O, S,
SO or SO.sub.2 and optionally being substituted with hydroxyl,
mercapto, halogen, amino, aminoalkyl, nitro, oxo or thio. In a
preferred embodiment X.sub.2 will have at least one carbon atom.
Replacements and substitutions may form an amide moiety
(--NRC(.dbd.O)-- or --C(.dbd.O)NR--) within the hydrocarbon chain
or at either or both ends. X is also sulfonamide (--NRSO.sub.2-- or
--SO.sub.2NR), acyl, ether, thioether or amine. In a particularly
preferred embodiment X.sub.2 is the group
--CH.sub.2--NR.sup.10--C(O)-- wherein the carbonyl --C(O)-- portion
thereof is adjacent (i.e. covalently bound) to Cy and R.sup.10 is
alkyl i.e. methyl or more preferably H.
[0128] K is a carbocycle or heterocycle optionally substituted with
hydroxyl, mercapto, halogen, oxo, thio, a hydrocarbon, a
halo-substituted hydrocarbon, amino, amidine, guanidine, cyano,
nitro, alkoxy or acyl. In particular embodiment, K is aryl or
heteroaryl optionally substituted with halogen or hydroxyl. In a
particularly preferred embodiment, K is phenyl, furan-2-yl,
thiophene-2-yl, phenyl substituted with a halogen (preferably Cl)
or hydroxyl, preferably at the meta position.
[0129] L.sub.2 is a divalent hydrocarbon optionally having one or
more carbon atoms replaced with N, O, S, SO or SO.sub.2 and
optionally being substituted with hydroxyl, halogen oxo, or thio;
or three carbon atoms of the hydrocarbon are replaced with an amino
acid residue. Preferably L.sub.2 is less than 10 atoms in length
and more preferably 5 or less and most preferably 5 or 3 atoms in
length. In particular embodiments, L.sub.2 is
--CH.dbd.CH--C(O)--NR.sup.10--CH.sub.2--,
--CH.sub.2--NR.sup.10--C(O)--, --C(O)--NR.sup.10--CH.sub.2--,
--CH(OH)--(CH.sub.2).sub.2--, --(CH.sub.2).sub.2--CH(OH)--,
--(CH.sub.2).sub.3--,
--C(O)--NR.sup.10--CH(R.sub.7)--C(O)--NR.sup.10--,
--NR.sup.10--C(O)--CH(R.sup.16)--NR.sup.10--C(O)--,
--CH(OH)--CH.sub.2--O-- or --CH(OH)--CF.sub.2--CH.sub.2-- wherein
each R.sup.10 is independently H or alkyl and R.sup.16 is an amino
acid side chain. Preferred amino acid side chains include
non-naturally occurring side chains such as phenyl or naturally
occurring side chains. Preferred side chains are those from Phe,
Tyr, Ala, Gln and Asn. In a preferred embodiments L.sub.2 is
--CH.dbd.CH--C(O)--NR.sup.10--CH.sub.2-- wherein the --CH.dbd.CH--
moiety thereof is adjacent (i.e. covalently bound) to K. In another
preferred embodiment, L.sub.2 is --CH.sub.2--NR.sup.10--C(O)--
wherein the methylene moiety (--CH.sub.2--) thereof is adjacent to
K. R.sup.5 is H, OH, amino, O-carbocycle or alkoxy optionally
substituted with amino, a carbocycle, a heterocycle, or a
pharmaceutically acceptable salt or ester. In a preferred
embodiment, R.sup.5 is H, phenyl or C.sub.1-4 alkoxy optionally
substituted with a carbocycle such as phenyl. In a particular
embodiment R.sup.5 is H. In another particular embodiment R.sup.5
is methoxy, ethoxy, propyloxy, butyloxy, isobutyloxy, s-butyloxy,
t-butyloxy, phenoxy or benzyloxy. In yet another particular
embodiment R.sup.5 is NH.sub.2. In a particularly preferred
embodiment R.sup.5 is ethoxy. In another particularly preferred
embodiment R.sup.5 is isobutyloxy. In another particularly
preferred embodiment R.sup.5 is alkoxy substituted with amino, for
example 2-aminoethoxy, N-morpholinoethoxy, N,N-dialkyaminoethoxy,
quaternary ammonium hydroxy alkoxy (e.g.
trimethylammoniumhydroxyethoxy).
[0130] R.sup.6-9 are independently H, hydroxyl, mercapto, halogen,
cyano, amino, amidine, guanidine, nitro or alkoxy; or R.sup.7 and
R.sup.5 together form a fused carbocycle or heterocycle optionally
substituted with hydroxyl, halogen, oxo, thio, amino, amidine,
guanidine or alkoxy. In a particular embodiment R.sup.6 and R.sup.7
are independently H, F, Cl, Br or I. In another particular
embodiment, R.sup.8 and R.sup.9 are both H. In another particular
embodiment, one of R.sup.6 and R.sup.7 is a halogen while the other
is hydrogen or a halogen. In a particularly preferred embodiment,
R.sup.7 is Cl while R.sup.6, R.sup.8 and R.sup.9 are each H. In
another particularly preferred embodiment, R.sup.6 and R.sup.7 are
both Cl while R.sup.8 and R.sup.9 are both H.
[0131] R.sup.10 is H or a hydrocarbon chain optionally substituted
with a carbocycle or a heterocycle. In a preferred embodiment,
R.sup.10 is H or alkyl i.e. methyl, ethyl, propyl, butyl, i-butyl,
s-butyl or t-butyl. In a particular embodiment R.sup.10 is H.
[0132] Compounds of the class of Formula III are disclosed in U.S.
Pat. Nos. 6,667,318, 6,872,735, and 6,803,384.
[0133] iii. Further preferred embodiments of the method of the
present invention are compounds of the Formula IV:
##STR00028##
[0134] where R.sup.11 is a group of the formula
##STR00029##
[0135] where A is hydrogen, hydroxy, amino, or halogen and B is
amino, carboxy, hydrogen, hydroxy, cyano, trifluoromethyl, halogen,
lower alkyl, or lower alkoxy;
[0136] R.sup.12 is a group of the formula:
##STR00030##
[0137] where R.sup.13 is hydrogen, carboxy, or lower alkyl; n is 0
or 1; U.sub.2, V.sub.2, and W.sub.2 are independently hydrogen,
halogen, or lower alkyl provided U.sub.2 and V.sub.2 are not both
hydrogen; X.sub.3 is carbonyl, phenyl-substituted lower alkylene,
imino, substituted imino, or sulfonyl; Y.sub.2 is lower alkylene
which may be substituted by one or more of amino, substituted
amino, lower alkyl, or cyclo lower alkyl, or Y.sub.2 is lower
alkenylene or lower alkylenethio;
k is 0 or 1; when k is 1, Z.sub.2 is hydrogen, lower alkylthio,
--COOH, --CONH.sub.2, amino; and when k is 0 or 1, Z.sub.2 is
1-adamantyl, diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl, hydroxy,
phenylmethoxy,
2-chloro-4-[[[(3-hydroxyphenyl)methyl]amino]carbonyl] phenyl,
[2,6-dichlorophenyl)methoxy]phenyl; further when k is 0 or 1,
Z.sub.2 may be cycloalkyl or aryl containing 0 to 3 heteroatoms
which may be the same or different, or a fused ring system
containing two or three rings which rings are independently
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, any of which rings may be unsubstituted, or
substituted with at least one of halogen, cyano, amino, substituted
amino, aminosulfonyl, nitro, oxo, hydroxy, aryl, aryloxy,
unsubstituted lower alkyl, halogen-substituted lower alkyl, lower
alkoxy-substituted lower alkyl, lower alkoxy, lower alkanesulfonyl,
lower alkylthio, acetyl, aminocarbonyl, hydrazino, carboxy,
alkoxycarbonyl, acetoxy, or also in addition with amino lower
alkyl; and R.sup.20 is hydrogen, a pharmaceutically acceptable salt
or ester.
[0138] One embodiment of compounds of Formula IV has
stereochemistry as indicated in Formula IV:
##STR00031##
[0139] iv. Another set of preferred embodiments of the compounds of
the method of the present invention are compounds of Formula V:
##STR00032##
[0140] where R.sup.14 is a group of the formula:
##STR00033##
[0141] where R.sup.15 is hydrogen, carboxy, or lower alkyl;
U.sub.3, V.sub.3, and W.sub.3 are independently hydrogen, halogen;
or U.sub.3, V.sub.3, and W.sub.3 are lower alkyl provided that
U.sub.3 and V.sub.3 are not both hydrogen; X.sub.4 is carbonyl,
phenyl-substituted lower alkylene, imino, substituted imino which
includes cyano, or sulfonyl; Y.sub.3 is lower alkenylene, lower
alkylenethio, or is lower alkylene which may be substituted by
amino, acetylamino, or cyclo-lower alkyl;
[0142] k.sub.2 is 0 or 1; when k.sub.2 is 1, Z is hydrogen, lower
alkylthio, --COOH, --CONH.sub.2--, or amino; when k.sub.2 is 0 or
1, Z.sub.3 is 1-adamantyl, diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl; and when
k.sub.2 is 0 or 1, Z may be cycloalkyl or aryl containing 0 to 3
heteroatoms which may be the same or different, or a fused ring
system containing two or three rings which rings are independently
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, any of which rings may be unsubstituted, or
substituted with at least one of halogen, cyano, amino, substituted
amino, aminosulfonyl, nitro, oxo, hydroxy, aryl, aryloxy,
unsubstituted lower alkyl, halogen-substituted lower alkyl, lower
alkoxy-substituted lower alkyl, lower alkoxy, carboxy,
alkoxycarbonyl, or acetoxy; and, R.sup.21 is hydrogen,
pharmaceutically acceptable salts or esters thereof.
[0143] A preferred embodiment of compounds of Formula V has the
stereochemistry as indicated in Formula V':
##STR00034##
[0144] Other compounds of the class of Formula IV and V are
disclosed in U.S. Pat. Nos. 7,217,728, 6,331,640, 6,515,124, and
6,803,384.
[0145] v. Another class of preferred compounds of the method are
represented by Formula VI
##STR00035##
[0146] where D.sub.4 is a mono-, bi-, or tricyclic saturated,
unsaturated, or aromatic ring, each ring having 5-, 6- or 7 atoms
in the ring where the atoms in the ring are carbon or from one to
four heteroatoms selected from the group nitrogen, oxygen, and
sulfur, where any carbon or sulfur ring atom may optionally be
oxidized, each ring substituted with 0-3 R.sup.31;
[0147] L.sub.3 is a bivalent linking group having one of the
following structures;
[0148] -L.sup.3-L.sup.2-L.sup.1-,
[0149] -L.sup.4-L.sup.3-L.sup.2-L,.sup.1- or
[0150] -L.sup.5-L.sup.4-L.sup.3-L.sup.2-L.sup.1-,
[0151] where L.sup.1 is oxo (--O--), S(O).sub.s, C(.dbd.O),
CR.sup.32, R.sup.32, CR.sup.32 het, NR.sup.30 or N,
[0152] L.sup.2 is oxo (--O--), S(O).sub.s, C(.dbd.O),
C(.dbd.N--O--R.sup.33), CR.sup.34R.sup.34', CR.sup.34, het
NR.sup.30 or N,
[0153] L.sup.3 is oxo (--O--), S(O).sub.s, C(.dbd.O),
C(.dbd.N--O--R.sup.33), CR.sup.35R.sup.35', CR.sup.35, het
NR.sup.30 or N,
[0154] L.sup.4 is absent, is oxo (--O--), S(O).sub.s, C(.dbd.O),
C(.dbd.N--O--R.sup.33), CR.sup.36R.sup.36', CR.sup.36, NR.sup.30 or
N,
[0155] L.sup.5 is absent, oxo (--O--), S(O).sub.s, C(.dbd.O),
CR.sup.37R.sup.37', CR.sup.37, NR.sup.30 or N, provided that only
one of L.sup.1-L.sup.3 may be het and that when one of
L.sup.1-L.sup.3 is het the other L.sup.1-L.sup.5 may be absent,
where
[0156] R.sup.32, R.sup.32', R.sup.34, R.sup.34', R.sup.35,
R.sup.35', R.sup.36, R.sup.36', R.sup.37 and R.sup.37' each are
independently R.sup.38, R.sup.39 or U-Q-V--W,
optionally, R.sup.24 and R.sup.34' separately or together may form
a saturated, unsaturated or aromatic fused ring with B.sub.3
through a substituent RP on B, the fused ring containing 5, 6 or 7
atoms in the ring and optionally containing 1-3 heteroatoms
selected from the group O, S and N, where any S or N may optionally
be oxidized; optionally, R.sup.35 and R.sup.35 separately or
together and R.sup.36 and R.sup.36' separately or together may form
a saturated, unsaturated or aromatic fused ring with D.sub.3
through a substituent R.sup.31 on D.sub.3, the fused ring
containing 5, 6 or 7 atoms in the ring and optionally containing
1-3 heteroatoms selected from the group O, S and N, where any S or
N may optionally be oxidized;
[0157] also optionally, each R.sup.32-R.sup.37, NR.sup.30 or N in
L.sup.1-L.sup.5 together with any other R.sup.32-R.sup.37,
NR.sup.30 or N in L.sup.1-L.sup.1 may form a 5, 6 or 7 member homo-
or heterocycle either saturated, unsaturated or aromatic optionally
containing 1-3 additional heteroatoms selected from N, O and S,
where any carbon or sulfur ring atom may optionally be oxidized,
each cycle substituted with 0-3 R.sup.31; and where s is 0-2; B is
selected from the group:
##STR00036##
[0158] wherein
##STR00037##
is a fused hetero- or homocyclic ring containing 5, 6 or 7 atoms,
the ring being unsaturated, partially saturated or aromatic, the
heteroatoms selected from 1-3 O, S and N,
[0159] Y.sub.3 is CH or NR.sup.30; n is 0, 1, 3, or 3:
[0160] G.sub.3 is hydrogen or C.sub.1-C.sub.6alkyl, optionally G
taken together with T may form a C.sub.3-C.sub.6cycloalkyl
optionally substituted with --V--W;
[0161] T.sub.3 is one of the following
[0162] a naturally occurring .alpha.-amino-acid side chain,
[0163] and U.sub.4-Q.sub.4-V.sub.4--W.sub.4;
[0164] U.sub.4 is an optionally substituted bivalent radical having
one of the following structures:
[0165] C.sub.1-C.sub.6alkyl, C.sub.0-C.sub.6alkyl-Q,
C.sub.2-C.sub.6alkenyl-Q, and C.sub.2-C.sub.6alkynyl-Q, where the
substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38;
[0166] Q.sub.4 is absent or is --O--, --S(O).sub.s--,
--SO.sub.2--N(R.sup.30)--, --N(R.sup.30)--,
--N(R.sup.30)--C(.dbd.O)--,
--N(R.sup.30)--C(.dbd.O)--N(R.sup.30)--,
[0167] --N(R.sup.30)--C(.dbd.O)--O--, --N(R.sup.30)--SO.sub.2--,
--C(.dbd.O)--, --C(.dbd.O)--O--, -het-,
--C(.dbd.O)--N(R.sup.30)--,
[0168] --O--C(.dbd.O)--N(R30)-, --PO(OR30)O-- or --P(O)O--;
[0169] where
[0170] s is 0-2 and
[0171] het is a mono- or bicyclic 5, 6, 7, 9 or 10 member
heterocyclic ring, each ring containing 1-4 heteroatoms selected
from N, O and S, where the heterocyclic ring may be saturated,
partially saturated, or aromatic and any N or S being optionally
oxidized, the heterocyclic ring being substituted with 0-3
R.sup.41;
V.sub.4 is absent or is an optionally substituted bivalent group
with one of the following structures C.sub.1-C.sub.6alkyl,
C.sub.3-C.sub.8cycloalkyl,
C.sub.0-C.sub.6alkyl-C.sub.6-C.sub.10aryl, and
C.sub.0-C.sub.6alkyl-het;
[0172] where the substituents on any alkyl are 1-3 R.sup.38 and the
substituents on any aryl or het are 1-3 R.sup.31;
[0173] W.sub.4 is hydrogen, OR.sup.33, SR.sup.42,
NR.sup.30R.sup.30, NH--C(.dbd.O)--O--R.sup.43,
NH--C(.dbd.O)--NR.sup.nR.sup.n, NH--C(.dbd.O)--R.sup.43,
NH--SO.sub.2--R.sup.37, NH--SO.sub.2--NR.sup.30R.sup.30,
NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--NR.sup.30R.sup.30',
C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.S)--NR.sup.30R.sup.30', SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO.sub.2--NR.sup.37R.sup.37',
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.O)--NR.sup.30R.sup.30',
SO.sub.2--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NR.sup.30R.sup.30', O--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--SO.sub.2R.sup.46 r O--SO.sub.2--R.sup.37;
[0174] R.sup.44 is C(.dbd.O)--R.sup.45, C(.dbd.O)--H, CH.sub.2(OH),
or CH.sub.2O--C(.dbd.O)--C.sub.1-C.sub.6alkyl;
[0175] R.sup.38 is R.sup.38' or R.sup.38'' substituted with 1-3
R.sup.38'; where
[0176] R.sup.38' is hydrogen, halo (F, Cl, Br, I), cyano,
isocyanate, carboxy, carboxy-C.sub.1-C.sub.11alkyl, amino,
amino-C.sub.1-C.sub.8alkyl, aminocarbonyl, carboxamido, carbamoyl,
carbamoyloxy, formyl, formyloxy, azido, nitro, imidazoyl, ureido,
thioureido, thiocyanato, hydroxy, C.sub.1-C.sub.6alkoxy, mercapto,
sulfonamido, het, phenoxy, phenyl, benzamido, tosyl, morpholino,
morpholinyl, piperazinyl, piperidinyl, pyrrolinyl, imidazolyl, or
indolyl;
[0177] R.sup.38'' is C.sub.0-C.sub.10alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkynyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.11cycloalkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.10cycloalkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12 aryl-Q-C.sub.0-C.sub.6alkyl,
C.sub.6-C.sub.10 aryl-C.sub.1-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-het-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-het-C.sub.0-C.sub.6alkyl,
het-C.sub.0-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-C.sub.6-C.sub.12aryl, or
-Q-C.sub.1-C.sub.6alkyl;
[0178] R.sup.43 is hydrogen and substituted or unsubstituted
C.sub.1-C.sub.10alkyl, C.sub.2-C.sub.10alkenyl,
C.sub.2-C.sub.10alkynyl, C.sub.3-C.sub.11cycloalkyl,
C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.6alkyl,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.12aryl or het, where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38 and the substituents on any
aryl or het are 1-3 R.sup.31; R.sup.31 is R.sup.40 or R.sup.41;
[0179] R.sup.41 is OH, OCF.sub.3, OR.sup.43, SR.sup.42, halo(F, Cl.
Br, I), CN, isocyanate, NO.sub.2, CF.sub.3,
C.sub.0-C.sub.6alkyl-NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)--NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)--R.sup.38, C.sub.1-C.sub.8alkyl,
C.sub.1-C.sub.8alkoxy, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.8alkynyl, C.sub.3-C.sub.6cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.1-C.sub.6alkyl-phenyl,
phenyl-C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkyloxycarbonyl,
phenyl-C.sub.0-C.sub.6alkyloxy, C.sub.1-C.sub.6alkyl-het,
het-C.sub.1-C.sub.6alkyl, SO.sub.2-het, --O--C.sub.6-C.sub.12aryl,
--SO.sub.2--C.sub.6-C.sub.12aryl, --SO.sub.2--C.sub.1-C.sub.6alkyl
or het, where any alkyl, alkenyl or alkynyl may optionally be
substituted with 1-3 groups selected from OH, halo(F, Cl, Br, I),
nitro, amino and aminocarbonyl and the substituents on any aryl or
het are 1-2 hydroxy, halo(F, Cl, Br, I), CF.sub.3,
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkoxy, nitro and amino;
[0180] R.sup.42 is S--C.sub.1-C.sub.6alkyl,
C(.dbd.O)--C.sub.1-C.sub.6alkyl, C(.dbd.O)--NR.sup.30R.sup.30',
C.sub.1-C.sub.6alkyl, halo(F, Cl, Br, I)--C.sub.1-C.sub.6alkyl,
benzyl or phenyl;
[0181] R.sup.30 is R.sup.43, NH--C(.dbd.O)--O--R.sup.43,
NH--C(.dbd.O)--R.sup.43, NH--C(.dbd.O)--NHR.sup.43,
NH--SO.sub.2--R.sup.46, NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37, C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--R.sup.43, C(.dbd.O)--NHR.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--SO.sub.2--R.sup.46,
C(.dbd.O)--NH--SO.sub.2--NHR.sup.37, SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO--N(R.sup.43).sub.2,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43 or
SO.sub.2--NH--C(.dbd.O)--R.sup.43;
[0182] R.sup.30' is hydrogen, hydroxy and substituted or
unsubstituted C.sub.1-C.sub.11alkyl, C.sub.1-C.sub.11 alkoxy,
C.sub.2-C.sub.10alkenyl, C.sub.2-C.sub.10alkynyl,
C.sub.3-C.sub.11cycloalkyl, C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.10aryl-C.sub.0-C.sub.6alkyloxy,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6alkyl,
C.sub.6-C.sub.12aryl, het, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.1-C.sub.8alkoxycarbonyl, C.sub.3-C.sub.8cycloalkylcarbonyl,
C.sub.3-C.sub.8cycloalkoxycarbonyl,
C.sub.6-C.sub.11aryloxycarbonyl,
C.sub.7-C.sub.11arylalkoxycarbonyl, heteroarylalkoxycarbonyl,
heteroarylalkylcarbonyl, heteroarylcarbonyl,
heteroarylalkylsulfonyl, heteroarylsulfonyl,
C.sub.1-C.sub.6alkylsulfonyl, or C.sub.6-C.sub.10arylsulfonyl,
where the substituents on any alkyl, alkenyl or alkynyl are 1-3
R.sup.38 and the substituents on any aryl, het or heteroaryl are
1-3 R.sup.31;
[0183] R.sup.30 and R.sup.30' taken together with the common
nitrogen to which they are attached may from an optionally
substituted heterocycle having one of the following structures
morpholinyl, piperazinyl, thiamorpholinyl, pyrrolidinyl,
imidazolidinyl, indolinyl, isoindolinyl,
1,2,3,4-tetrahydro-quinolinyl, 1,2,3,4-tetrahydro-isoquinolinyl,
thiazolidinyl or azabicyclononyl, where the substituents are 1-3
R.sup.38;
[0184] R.sup.33 is hydrogen and substituted or unsubstituted
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.2-C.sub.6alkenyl, C.sub.2-C.sub.6alkynyl,
C.sub.3-C.sub.8cycloalkyl or benzoyl, where the substituents on any
alkyl are 1-3 R.sup.38 and the substituents on any aryl are 1-3
R.sup.40; R.sup.40 is OH, halo(F, Cl. Br, I), CN, isocyanate,
OR.sup.43, SR.sup.42, SOR.sup.43, NO.sub.2, CF.sub.3, R.sup.43,
NR.sup.30R.sup.30', NR.sup.30C(.dbd.O)--O--R.sup.43,
NRC(.dbd.O)--R.sup.43, C.sub.0-C.sub.6alkyl-SO.sub.2--R.sup.43,
C.sub.0-C.sub.6alkyl-SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.O)--R.sup.43, O--C(.dbd.O)--R.sup.43,
C(.dbd.O)--O--R.sup.43, or C(.dbd.O)--NR.sup.30R.sup.30', where the
substituents on any alkyl, alkenyl or alkynyl are 1-3 R.sup.38 and
the substituents on any aryl or het are 1-3 R.sup.31;
[0185] R.sup.46 is a substituted or unsubstituted
C.sub.1-C.sub.8alkyl, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.8alkynyl, C.sub.3-C.sub.8cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.0-C.sub.6alkyl-phenyl,
phenyl-C.sub.0-C.sub.6alkyl, C.sub.0-C.sub.6alkyl-het or
het-C.sub.0-C.sub.6alkyl,
[0186] where the substituents on any alkyl, alkenyl or alkynyl are
1-3 R.sup.38 and the substituents on any aryl or het are 1-3
R.sup.31;
[0187] R.sup.45 is a substituted or unsubstituted hydroxy,
C.sub.1-C.sub.11alkoxy, C.sub.3-C.sub.12cycloalkoxy,
C.sub.8-C.sub.12aralkoxy, C.sub.8-C.sub.12arcycloalkoxy,
C.sub.6-C.sub.10aryloxy, C.sub.3-C.sub.10 alkylcarbonyloxyalkyloxy,
C.sub.3-C.sub.10 alkoxycarbonyloxyalkyloxy,
C.sub.3-C.sub.10alkoxycarbonylalkyloxy,
C.sub.5-C.sub.10cycloalkylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10cycloalkoxycarbonyloxyalkyloxy,
C.sub.5-C.sub.10cycloalkoxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonyloxyalkyloxy,
C.sub.8-C.sub.12arylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10alkoxyalkylcarbonyloxyalkyloxy,
(R.sup.30)(R.sup.30)N(C.sub.1-C.sub.10alkoxy)-,
##STR00038##
[0188] where the substituents on any alkyl, alkenyl or alkynyl are
1-3 R.sup.38 and the substituents on any aryl or het are 1-3
R.sup.31 and
[0189] pharmaceutically acceptable salts thereof.
[0190] Compounds of Formulas I-VI also include pharmaceutically
acceptable salts, and esters including pro-drug compounds of
Formula I-VI, where R.sup.3A, R.sup.5, R.sup.10, R.sup.17,
R.sup.18, R.sup.19, R.sup.20, R.sup.21, R.sup.29, and a carboxylic
ester at R.sup.44 may be lower alkyl or
--CH.sub.2CH.sub.2--R.sup.22 where R.sup.22 is one of the
following:
##STR00039##
[0191] where R.sup.23 is hydrogen or methyl and R.sup.24 is lower
alkyl or lower cycloalkyl.
[0192] A preferred embodiment of compounds of Formula VI has the
stereochemistry indicated in Formula VI'.
##STR00040##
[0193] Compounds of the class of Formula VI are disclosed in U.S.
Patent Application Publication No. 20050203135.
[0194] Some of the compounds described herein may comprise one or
more asymmetric centers, and thus may comprise individual
stereoisomers, individual diastereomers and any mixtures therein.
Further, compounds of the invention may contain geometric isomers
of double bonds, comprising Z and E isomers, and may be present as
pure geometric isomers or mixtures thereof.
[0195] In some preferred embodiments, the methods of the present
invention are performed with the following compounds:
##STR00041## ##STR00042## ##STR00043##
and their pharmaceutically acceptable salts and esters.
[0196] Compounds of the present invention include the following
compounds:
##STR00044## ##STR00045## ##STR00046## ##STR00047## ##STR00048##
##STR00049## ##STR00050## ##STR00051## ##STR00052## ##STR00053##
##STR00054## ##STR00055## ##STR00056## ##STR00057## ##STR00058##
##STR00059## ##STR00060## ##STR00061## ##STR00062## ##STR00063##
##STR00064## ##STR00065## ##STR00066## ##STR00067## ##STR00068##
##STR00069## ##STR00070## ##STR00071##
and their pharmaceutically acceptable salts and esters. b.
Exemplary Compounds which are Allosteric Antagonists of LFA-1.
[0197] i. A family of novel p-arylthio cinnamides can act as
allosteric antagonists of LFA-1. See Liu, G.; Link, J. T.; Pei, Z.;
Reilly, E. B.; Nguyen, B.; Marsh, K. C.; Okasinski, G. F.; von
Geldern, T. W.; Ormes, M.; Fowler, K.; Gallatin, M. 2000 "Discovery
of novel p-arylthio cinnamides as antagonists of leukocyte
function-associated antigen-1/intracellular adhesion molecule-1
interaction. 1. Identification of an additional binding pocket
based on an anilino diaryl sulfide lead." J. Med. Chem. 43,
4015-4030.
[0198] Compounds of Formula VII are provided in the present
invention which are useful in the methods of the invention, as
disclosed in US Patent Application Publication No. 20080234271,
wherein:
##STR00072##
[0199] and pharmaceutically-acceptable salts and prodrugs
thereof,
[0200] wherein R.sub.1, R.sub.2, R.sub.3, R.sub.4, and R.sub.5 are
each independently hydrogen, alkyl, alkenyl, alkenoxy, alkynyl,
aldehyde, alkanoyl, alkoxy, amido, amino, aryl, aryloxy, carboxy,
cyano, cycloalkyl, ether, ester, halogen, heterocyclyl, hydroxy,
ketone, nitro, oxo, perfluoroalkyl, sulfonyl, sulfonate, thio, or
other carbonyl-containing groups, R.sub.6 is unsubstituted alkyls,
unsubstituted saturated cycloalkyls, unsubstituted carboxyalkyls,
or unsubstituted heterocyclylalkyls, wherein the unsubstituted
saturated cycloalkyls, unsubstituted carboxyalkyls, and
unsubstituted heterocyclylalkyls are bonded to the NH of formula
VII through the alkyl group, wherein the unsubstituted
carboxyalkyls comprise a branched alkyl chain,
[0201] with the proviso that at least one of R.sub.1 and R.sub.3 is
selected from:
[0202] A. cinnamides selected from cis-cinnamide or trans-cinnamide
defined as
##STR00073##
[0203] wherein R.sub.8 and R.sub.9 are each independently hydrogen,
aldehyde, alkyl, alkenyl, alkynyl, alkoxy, amido, amino, aryl,
carboxy, cyano, cycloalkyl, ester, ether, halogen, hydroxy, ketone,
nitro, sulfonate, sulfonyl, thio, or other carbonyl-containing
groups;
[0204] B. substituents of formula VII-a:
##STR00074##
[0205] wherein D, B, Y and Z are each independently
--CR.sup.31.dbd., --CR.sup.32R.sup.33--, --C(O)--, --O--,
--SO.sub.2--, --S--, --N.dbd., or --NR.sup.34--;
[0206] n is an integer of zero to three; and R.sup.31, R.sup.32,
R.sup.33 and R.sup.34 are each independently hydrogen, alkyl,
carboxy, hydroxyalkyl, monoalkylaminocarbonylalkyl,
dialkylaminocarbonylalkyl or carboxyalkyl;
[0207] C. cyclopropyl derivatives selected from cis-cyclopropanoic
acid, trans-cyclopropanoic acid, cis-cyclopropanamide and
trans-cyclopropanamide defined as
##STR00075##
[0208] wherein R.sub.35 and R.sub.36 are each independently
hydrogen, alkyl, carboxy, hydroxyalkyl, or carboxyalkyl, and
[0209] wherein R.sub.37 and R.sub.38 are each independently
hydrogen, alkyl, carboxyalkyl, monoalkylaminocarbonylalkyl, or
dialkylaminocarbonylalkyl;
[0210] D. substituents of formula VII-b:
##STR00076##
[0211] wherein R.sub.5 and R.sub.9 are as defined above;
[0212] E. cinnamic acids of formula VII-c:
##STR00077##
[0213] wherein R.sub.8 and R.sub.9 are as defined above;
[0214] wherein:
[0215] R.sub.10 and R.sub.11 are each independently hydrogen,
alkanoyl, alkyl, alkenyl, alkynyl, alkoxy, amido, aryl, arylalkyl,
carboxy, cyano, cycloalkyl, ester, ether, heterocyclyl, hydroxy,
ketone, nitro, sulfonyl thio, or other carbonyl-containing groups,
or
[0216] R.sub.10 and R.sub.11 are taken together with N to form a
heterocyclyl group comprising at least one substituent which is
independently hydrogen, alkyl, alkenyl, alkenoxy, alkynyl,
aldehyde, alkanoyl, alkoxy, amido, amino, aryl, aryloxy, carboxy,
cyano, cycloalkyl, ether, ester, halogen, heterocyclyl, hydroxy,
ketone, nitro, oxo, perfluoroalkyl, sulfonyl, sulfonate, thio, or
other carbonyl-containing group, or
[0217] R.sub.1 and R.sub.2, and/or R.sub.4 and R.sub.5 are joined
together to form a 5- to 7-membered cycloalkyl, aryl or
heterocyclyl ring when R.sub.3 is a cinnamide, substituent of
formula VII-a, substituent of formula VII-b, or cyclopropyl
derivative as defined above; or R.sub.2 and R.sub.3, and/or R.sub.3
and R.sub.4, and/or R.sub.4 and R.sub.5 are joined to form a 5- to
7-membered cycloalkyl, aryl or heterocyclyl ring when R.sub.1 is
selected from cinnamides, substituents of formula VII-a,
substituents of formula VII-b, and cyclopropyl derivatives as
defined above; and
[0218] wherein Ar is substituted aryl or substituted heteroaryl
having at least one substituent which independently is hydrogen,
alkyl, alkenyl, alkenoxy, alkynyl, aldehyde, alkanoyl, alkoxy,
amido, amino, aryl, aryloxy, carboxy, cyano, cycloalkyl, ether,
ester, halogen, heterocyclyl, hydroxy, ketone, nitro, oxo,
perfluoroalkyl, sulfonyl, sulfonate, thio, or other
carbonyl-containing groups.
[0219] In some embodiments of the compounds of Formula VII, R6 is
not an unsubstituted heterocyclylalkyl of the following
structures:
##STR00078##
[0220] Some exemplary compounds of Formula VII include:
##STR00079##
which includes its stereoisomers, for example
##STR00080##
Other compounds of this general class are disclosed in U.S. Patent
Application Publication Nos. 20040116518, 20050014746, 20020156314,
20020132807, 2008 0249157, and 20070066585.
[0221] ii. Another family of small molecule allosteric antagonists
of LFA-1 is disclosed in US Patent Application Publication No
20080108677. The present invention provides compounds of Formula
VIII, and their pharmaceutically acceptable salts, which are useful
in the methods of the invention described herein.
##STR00081##
[0222] The compound of Formula VIII, wherein m is 0, 1 or 2; X is
H, cycloalkyl or phenyl, which is unsubstituted or substituted with
one or more substituents which are lower alkyl, hydroxy or halogen;
n is 0 or 1; and Y is phenyl, furanyl, indole or pyrrole, which all
may be substituted with one or more substituents which are
independently lower alkyl, lower alkoxy, halogen,
(3,5-dimethylphenoxy)propoxy, or phenyl, wherein phenyl may be
further substituted with one or more halogen atoms, nitro, amino or
carboxyl groups.
[0223] One exemplary compound of Formula VIII is
##STR00082##
[0224] iii. A further family of small molecule allosteric
antagonists of LFA-1 is disclosed in US Patent Application
Publication No 2008/0242710. In another aspect the present
invention provides a 3a,4,5,6-tetrahydro-pyrrolo1,2-b]-isothiazole,
and its pharmaceutically acceptable salts, wherein the sulphur is
in the form of a dioxide which is a compound of Formula IX, which
is useful in the methods of the present invention.
##STR00083##
[0225] such as a compound of Formula IX-a:
##STR00084##
[0226] wherein the dotted line is a bond or is no bond, R.sub.1 is
hydrogen, optionally substituted alkyl, alkenyl, alkynyl,
cycloalkyl, alkoxy, aryl, heterocyclyl, hydroxy, SH, SR.sub.5,
cyano, halogen or amino, or
[0227] the dotted line is no bond and R.sub.1 is attached to the
ring system via a double bond and is oxo,
[0228] R.sub.2 is hydrogen, or optionally substituted cycloalkyl,
aryl, or heterocyclyl,
[0229] R.sub.3 is hydrogen, COOR.sub.6, or aminocarbonyl, or
optionally substituted alkyl, alkenyl, alkynyl, aralkyl, alkoxy,
cycloalkyloxy, aryloxy, or heterocyclyloxy,
[0230] R.sub.4 is hydrogen, halogen, hydroxy, SH, optionally
substituted alkyl, alkenyl, alkynyl, alkoxy or alkylthio, or
R.sub.4 is a silyl group such as trialkylsilyl or trialkylsilyloxy,
e.g. tri(C.sub.1-6)alkylsilyl(oxy), N.sub.3, amino, or
[0231] R.sub.4 is heterocyclyl comprising at least one nitrogen
atom as a heteroatom and being bound via that nitrogen atom to the
compound of formula IX, or
[0232] R.sub.4 is attached to the ring system by a double bond and
is oxo; and
[0233] R.sub.5 and R.sub.6 independently of each other are alkyl,
alkenyl, alkynyl, cycloalkyl, aryl or heterocyclyl,
[0234] In some embodiments, the compound of Formula IX is:
##STR00085##
[0235] iv. Allosteric small molecule antagonists include statins
which bind to the CD11a domain of LFA-1. See Kallen, J.,
Welzenbach, K., Ramage, P. Geyl, D. Kriwacki, R., Legge, G.,
Cottens, S., Weitz-Schmidt, G., and Hommel, U. 1999. "Structural
basis for LFA-1 inhibition upon lovastatin binding to the CD11a
1-domain", J. Mol. Biol., 292: 1-9; and Weitz-Schmidt, G.,
Welzenbach, K., Brinkmann, V., Kamata, T., Kallen, J., Bruns, C.,
Cottens, S., Takada, Y., and Hommel, U. 2001. Statins selectively
inhibit leukocyte function antigen-1 by binding to a novel
regulatory integrin site, Nature Med., 7: 687-692; and Frenette, P.
S. 2001. "Locking a leukocyte integrin with statins", N. Engl. J.
Med., 345: 1419-1421. Molecules derived from the
mevinolin/compactin motif also show activity against LFA-1. See
Welzenbach, K., Hommel, U., and Weitz-Schmidt, G. 2002. "Small
molecule inhibitors induce conformational changes in the I domain
and the I-like domain of Lymphocyte Function-Associated Antigen-1",
J. Biol. Chem., 277: 10590-10598, and U.S. Pat. No. 6,630,492.
[0236] A family of allosteric LFA-1 antagonists of Formula X are
disclosed which are useful in the methods of the present invention.
See U.S. Pat. No. 6,818,638.
[0237] A compound of Formula X is provided for use in the methods
of the invention wherein,
##STR00086##
[0238] each of a---b and .alpha.---.beta. independently, is either
a single bond or a double bond; R.sub.1 is
##STR00087##
[0239] R.sub.a is H, C.sub.1-6 alkyl optionally substituted by OH
or C.sub.1-4 alkoxy, C.sub.2-6 alkenyl or aryl-C.sub.1-4 alkyl;
[0240] R.sub.2 is OH; --O--CO--R.sub.5;
[0241] R.sub.4 is H or OR.sub.19 wherein R.sub.19 is C.sub.1-6
alkyl, hydroxy-C.sub.1-6 alkyl, C.sub.1-4 alkoxy-C.sub.1-6 alkyl,
aryl-C.sub.1-4 alkyl or C.sub.1-4 alkoxycarbonyl-C.sub.1-4
alkyl;
[0242] R.sub.5 is C.sub.1-8 alkyl, C.sub.3-7 cycloalkyl, C.sub.3-7
cycloalkyl-C.sub.1-4 alkyl, aryl or aryl-C.sub.1-4 alkyl; or
R.sub.5 is --O--R.sub.6 wherein R.sub.6 is the residue of an
.alpha.-amino-acid attached to O through its carbonyl residue; or
--R.sub.5 is --CHR.sub.7--COR..sub.8 wherein R.sub.7 is H,
C.sub.1-4 alkyl, heteroC.sub.1-4 alkyl, C.sub.3-7 cycloalkyl,
C.sub.3-7 cycloalkyl-C.sub.1-4 alkyl, aryl or aryl-C.sub.1-4 alkyl
and R.sub.8 is OH, C.sub.1-4 alkoxy or NR.sub.9R.sub.10;
[0243] each of R.sub.9 and R.sub.10 independently is H or C.sub.1-4
alkyl, or R.sub.9 and R.sub.10 form together with the nitrogen to
which they are bound, a heteroaryl group;
[0244] R.sub.3 is a lactam of formula X-a:
##STR00088##
[0245] wherein R.sub.30, is C.sub.1-8 alkyl, C.sub.3-7 cycloalkyl,
aryl, C.sub.3-7 cycloalkyl-C.sub.1-4 alkyl, aryl-C.sub.1-4 alkyl,
heteroaryl, or heteroaryl-Cl.sub.4; and
[0246] R.sub.31, is OH, C.sub.1-4 alkoxy, C.sub.1-4 alkyl,
C.sub.1-4 alkoxy-carbonyl-C.sub.1-4 alkyl, hydroxy-C.sub.1-5
alkoxy, C.sub.1-4 alkoxy-C.sub.1-5 alkoxy, C.sub.1-4
alkoxy-carbonyl-C.sub.1-4 alkyl, amino-C.sub.1-4 alkoxy,
HOOC--C.sub.1-4 alkoxy, HOOC--C.sub.1-4 alkyl,
R.sub.9aR.sub.10aN--C.sub.1-5 alkoxy wherein R.sub.9a and R.sub.10a
are independently R.sub.9 or R.sub.10.
[0247] In some embodiments, wherever "aryl" or "aryl-C.sub.1-4
alkyl" appears in the above definition, it is "phenyl" or
"naphthyl" optionally substituted by halogen, OH, NR.sub.11,
R.sub.12, COOH, CF.sub.3, C.sub.1-4 alkoxy, C.sub.1-4 alkyl,
hydroxy-C.sub.1-4 alkyl, hydroxy-C.sub.1 alkoxy, C.sub.1-4
alkoxy-carbonyl, cyano or CONR.sub.11R.sub.12, each of R.sub.11 and
R.sub.12 independently being H, C.sub.1-4 alkyl, phenyl, naphthyl,
phenyl-C.sub.1-4 alkyl or naphthyl-C.sub.1-4 alkyl or R.sub.11 and
R.sub.12 together with the nitrogen to which they are bound forming
heteroaryl; and wherever "heteroaryl" appears, it is a 5- or
6-membered heteroaryl optionally fused to a benzene ring; in free
form or in salt form.
[0248] In some embodiments, the compound of Formula X is one of the
following compounds:
##STR00089##
[0249] v. A family of hydantoin-based inhibitors can also be used
as antagonists. See Kelly, T. A., Jeanfavre, D. D., McNeil, D. W.,
Woska, J. R. Jr., Reilly, P. L., Mainolfi, E. A., Kishimoto, K. M.,
Nabozny, G. H., Zinter, R., Bormann, B.-J., and Rothlein, R. 1999.
"Cutting edge: a small molecule antagonist of LFA-1-mediated cell
adhesion", J. Immunol., 163: 5173-5177. These compounds are
believed to be allosteric inhibitors of LFA-1.
[0250] A family of such hydantoin-based inhibitors of Formula XI is
disclosed in U.S. Patent Application Publication No. 2006/0148836
and are useful in the methods of the present invention.
[0251] A compound according to formula XI, is provided for use in
the methods of the invention,
##STR00090##
[0252] and its enantiomers, pharmaceutically-acceptable salts, or
solvates, thereof, wherein:
##STR00091##
[0253] each R.sub.17 is independently --OR.sub.18,
--NR.sub.18R.sub.19, --C(.dbd.O)R.sub.18, --CO.sub.2R.sub.18,
--C(.dbd.O)NR.sub.18R.sub.19, --NR.sub.18C(.dbd.O)R.sub.19,
--NR.sub.18C(.dbd.O)OR.sub.19, --S(O).sub.pR.sub.19,
--NR.sub.18SO.sub.2R.sub.19, or --SO.sub.2NR.sub.18R.sub.19;
[0254] R.sub.18 and R.sub.19 are independently hydrogen, alkyl,
substituted alkyl, cycloalkyl, or substituted cycloalkyl; q is 1,
2, or 3; and p is 1 or 2.
[0255] In one embodiment, the compound of Formula XI is:
##STR00092##
[0256] Other compounds of the general class of spiro-hydantoin
compounds which may be useful as allosteric antagonists of LFA-1 in
the methods of the invention are U.S. Application Publication Nos.
20060142319, 20060074099, 20060052434, 20050119279, 20050004153,
20040259897, 20040248920, 20040009998, and 20020143035.
c. Other Small Molecule Antagonists.
[0257] Other families of small molecule inhibitors are disclosed in
publications (See Gadek, T. R., Burdick, D. J., McDowell, R. S.,
Stanley, M. S., Marsters, J. C. Jr., Paris, K. J., Oare, D. A.,
Reynolds, M. E., Ladner, C., Zioncheck, K. A., Lee, W. P.,
Gribling, P., Dennis, M. S., Skelton, N. J., Tumas, D. B., Clark,
K. R., Keating, S. M., Beresini, M. H., Tilley, J. W., Presta, L.
G., and Bodary, S. C. 2002. "Generation of an LFA-1 antagonist by
the transfer of the ICAM-1 immunoregulatory epitope to a small
molecule" Science, 295: 1086-1089 and online supplementary
material.) and in patents, including U.S. Pat. No. 6,872,735, U.S.
Pat. No. 6,667,318, U.S. Pat. No. 6,803,384, U.S. Pat. No.
6,515,124, U.S. Pat. No. 6,331,640, and patent applications,
including: U.S. 20020119994. U.S. 20040058968, U.S. 20050080119,
WO99/49856, WO00/21920, WO01/58853, WO02/59114, WO05/044817, and
others. The contents of all the cited references are incorporated
in their entirety by reference.
[0258] The compounds of the invention may be prepared by methods
well known to those skilled in the art, or disclosed in the
references incorporated herein and may be purified in a number of
ways, including by crystallization or precipitation under varied
conditions to yield one or more polymorphs. Thus, the present
invention encompasses the above described inventive compounds,
their polymorphs, their pharmaceutically acceptable salts, their
pharmaceutically acceptable solvates, and pharmaceutically
acceptable compositions containing them.
[0259] The above examples of preferred embodiments are meant to
illustrate some of the potential therapeutic agents, and are not
meant to limit the invention in any way. The method of the
invention can be practiced with antibodies, fragments of
antibodies, peptides and other synthetic molecules that is a
selective, potent and directly competitive inhibitor of the
interaction between LFA-1 and ICAM-1, in order to treat the
symptoms of diabetic retinopathy.
II. Methods of Treatment
[0260] The term "subject" as used herein includes animals, in
particular humans as well as other mammals.
[0261] The term "treating" and its grammatical equivalents as used
herein includes achieving a therapeutic benefit and/or a
prophylactic benefit. By therapeutic benefit is meant eradication
or amelioration of the underlying disorder being treated. Also, a
therapeutic benefit is achieved with the eradication or
amelioration of one or more of the physiological symptoms
associated with the underlying disorder such that an improvement is
observed in the subject, notwithstanding that the subject may still
be afflicted with the underlying disorder. For prophylactic
benefit, the compositions may be administered to a subject at risk
of developing a particular disease, or to a subject reporting one
or more of the physiological symptoms of a disease, even though a
diagnosis of this disease may not have been made. The compositions
may be administered to a subject to prevent progression of
physiological symptoms or of the underlying disorder.
[0262] In some embodiments of the invention, methods are provided
to administer a therapeutic agent to a subject to treat diabetic
retinopathy. In some embodiments of the invention, the therapeutic
agent is a LFA-1 antagonist. In some embodiments, the LFA-1
antagonist is a directly competitive antagonist of LFA-1. In some
embodiments, the LFA-1 antagonist is a competitive antagonist of
LFA-1. In some embodiments, the LFA-1 antagonist is an allosteric
antagonist of LFA-1. In some embodiments of the invention, the
LFA-1 antagonist can modulate inflammation mediated by leukocytes.
Another embodiment of the invention treats a subject by
administering a therapeutically effective amount of an antagonist
of LFA-1 to modulate inflammation associated with ocular
inflammation. An embodiment of the invention treats a subject with
symptoms of diabetic retinopathy by administering a therapeutically
effective amount of a LFA-1 antagonist. In some embodiments of the
invention methods are provided to treat a subject with symptoms of
Type II diabetes by administering a therapeutically effective
amount of a LFA-1 antagonist. In some embodiments of the invention
methods are provided to treat a subject with symptoms of Type I
diabetes by administering a therapeutically effective amount of a
LFA-1 antagonist. In some embodiments of the invention, methods are
provided to treat a subject by administering a therapeutically
effective amount of a LFA-1 antagonist to decrease retinal edema in
an eye of the subject. In other embodiments of the invention,
methods are provided to treat a subject by administering a
therapeutically effect amount of a LFA-1 antagonist to decrease
macular edema. In other embodiments, methods are provided to treat
a subject by administering a therapeutically effective amount of a
LFA-1 antagonist to decrease basement membrane thickening in an eye
of the subject. In yet other embodiments of the invention, methods
are provided to treat a subject by administering a therapeutically
effective amount of a LFA-1 antagonist to decrease retinal
neovascularization in an eye of the subject. In some embodiments of
the invention, methods are provided to treat a subject by
administering a therapeutically effective amount of a LFA-1
antagonist to retard the loss of vision due to diabetic
retinopathy. In some embodiments, methods are provided to treat a
subject by administering a therapeutically effective amount of a
LFA-1 antagonist to decrease retinal ischemia in an eye of the
subject. In other embodiments, methods are provided to decrease
fibrovascular growth over a retina in an eye of a subject suffering
from diabetic retinopathy, by administering a therapeutically
effective amount of a LFA-1 antagonist. In some embodiments,
methods are provided to reduce retinal injury or degeneration due
to diabetic retinopathy in an eye of a subject suffering from
diabetic retinopathy, by administering a therapeutically effective
amount of a LFA-1 antagonist. In other embodiments, methods are
provided to limit non-proliferative damage to a retina in an eye of
a subject suffering from diabetic retinopathy, by administering a
therapeutically effective amount of a LFA-1 antagonist. In other
embodiments, methods are provided to slow proliferative damage to a
retina in an eye of a subject suffering from diabetic retinopathy,
by administering a therapeutically effective amount of a LFA-1
antagonist. In other embodiments, methods are provided to reduce or
prevent adhesion of leukocytes to capillary epithelial cells in an
eye of a subject in need thereof, by administering a
therapeutically effective amount of a LFA-1 antagonist. In some
other embodiments, methods are provided to reduce or prevent damage
from ischemic reperfusion in an eye of a subject in need thereof,
by administering a therapeutically effective amount of a LFA-1
antagonist. In some embodiments of the invention, methods are
provided wherein the LFA-1 antagonist which is administered to the
subject suffering from diabetic retinopathy, binds to a high
affinity binding site in the .alpha.L subunit of LFA-1 overlapping
the ICAM-1 binding site. Some embodiments of the invention utilize
compounds that are directly competitive inhibitors of the
LFA-1/ICAM-1 interaction. Some of the embodiments of the invention
utilize compounds which directly compete for a common high affinity
binding site for ICAM-1 on LFA-1. In some embodiments, methods are
provided which administer to a subject in need of treatment a
therapeutically effective amount of a LFA-1 antagonist which is a
compound of Formulas I, II, II', III, III', IV, IV', V, or VI. In
some embodiments, methods are provided which administer to a
subject in need of treatment a therapeutically effective amount of
a LFA-1 antagonist which is a compound of Formulas VII, VIII, IX, X
or XI.
[0263] In other therapeutic interventions which can be associated
with diabetic complications in the eye, vitrectomy procedures may
be utilized. Dexamethansone, a glucocorticoid steroid, has been
shown to be useful in reducing post-operative inflammation which
can be enhanced in diabetic subjects relative to non-diabetic
subjects. Thus, it may be desirable to use an LFA-1 antagonist of
the invention to reduce inflammation. In some embodiments of the
invention, methods are provided to reduce postoperative
inflammation in diabetic subjects undergoing vitrectomy procedures
by administering an LFA-1 antagonist to the subject in need
thereof. Further, in some embodiments, an LFA-1 antagonist of the
invention may be administered to a subject prior to a vitrectomy
procedure to prophylactically reduce post-operative
inflammation.
[0264] In other therapeutic interventions which can be associated
with diabetic complications in the eye, photodynamic therapy may be
utilized to correct occlusion or leakiness, and may cause excessive
inflammation in a diabetic subject. Thus, it may be desirable to
use an LFA-1 antagonist of the invention to reduce inflammation. In
some embodiments of the invention, methods are provided to reduce
postoperative inflammation in diabetic subjects undergoing
photodynamic therapeutic (PDT) procedures by administering an LFA-1
antagonist to the subject in need thereof. Further, in some
embodiments, an LFA-1 antagonist of the invention may be
administered to a subject prior to a PDT procedure to
prophylactically reduce post-operative inflammation.
[0265] In other therapeutic interventions which can be associated
with diabetic complications in the eye, laser photocoagulation
therapy may be utilized to correct occlusion or leakiness, and may
cause excessive inflammation in a diabetic subject. Thus, it may be
desirable to use an LFA-1 antagonist of the invention to reduce
inflammation. In some embodiments of the invention, methods are
provided to reduce postoperative inflammation in diabetic subjects
undergoing laser photocoagulation therapeutic procedures by
administering an LFA-1 antagonist to the subject in need thereof.
Further, in some embodiments, an LFA-1 antagonist of the invention
may be administered to a subject prior to a laser photocoagulation
therapy procedure to prophylactically reduce post-operative
inflammation.
[0266] In LASIK treatment of vision defects, diabetic patients are
at increased risk of post-operative complications from corneal
epithelial inflammation and defects than non-diabetic patients, and
anti-inflammatory treatment may be indicated. In some embodiments
of the invention, methods are provided to reduce inflammation due
to diabetic complications of LASIK treatment in an eye of a subject
thereof, by administering a LFA-1 antagonist and thereby reduce
such inflammation. Administration is made post-operatively or
pre-operatively to prophylactically prevent or reduce such
inflammation.
[0267] Individuals with DME have higher risk of cataract
development which is a frequent cause of vision loss. Diabetic
patients have a higher risk of both anterior and posterior segment
complications following cataract surgery. One of the most
significant of these is neovascularization of the iris as it can
progress to neovascular glaucoma. Other anterior chamber
complications include pigment dispersion with precipitates on the
surface of the newly implanted intraocular lens (IOL), fibrinous
exudates or membrane formation (from inflammation) in the anterior
chamber. In some embodiments of the invention, methods are provided
to reduce anterior or posterior segment complications following
cataract surgery in an eye of a subject with DME, by administering
a LFA-1 antagonist to a subject in need thereof. In some
embodiments, methods are provided to prophylactically administer a
LFA-1 antagonist to a subject with DME who is at higher risk of
developing cataracts compared to a healthy subject, thereby
reducing or preventing developing cataracts.
[0268] The methods generally involve the administration of one or
more drugs for the treatment of diabetic retinopathy where the drug
is delivered to or is distributed subsequent to delivery to the
retina or intraocular region of the eye. Combinations of agents can
be used to treat diabetic retinopathy or to modulate the
side-effects of one or more agents in the combination. Since the
pathological events in this disease state are marked by a
combination of impaired autoregulation, apoptosis, ischemia,
reperfused tissue, neovascularization, and inflammatory stimuli, it
may be desirable to administer the LFA-1 antagonists of the
invention in combination with other therapeutic agents to
additionally or synergistically intervene. In some embodiments, the
second therapeutic agent is an antioxidant, antiinflammatory agent,
antimicrobial, antiangiogenic agent, and/or anti-apoptotic agent.
In some embodiments of the invention, in addition to administering
a compound which directly competes for binding to LFA-1, an
additional therapeutic agent may be administered which is an
allosteric, but not a directly competitive, antagonist of LFA-1 as
discussed above, potentially resulting in synergistic efficacy. An
example of such allosteric antagonist is the class of hydantoin
inhibitors of LFA-1. Other examples of allosteric antagonists
include compounds of Formula VII, VIII, IX, X, or XI.
[0269] Another class of therapeutic agents which my be useful to
administer in combination with, prior to, after or concomitantly
with the LFA-1 antagonists of the invention is an anti-adhesion
therapeutic antibody or antibody fragment.
[0270] Another class of therapeutic agents which may be useful to
administer in combination, prior to, after, or concomitantly with
the LFA-1 antagonists of the invention is the group of drugs which
inhibit Vascular Endothelial Growth Factor and thus may target
another route of initiation of neovascularization. Any VEGF
inhibitor may be of use in the compositions of the invention, which
include, but are not limited to 1) neutralizing monoclonal
antibodies against VEGF or its receptor, 2) small molecule tyrosine
kinase inhibitors of VEGF receptors, 3) soluble VEGF receptors
which act as decoy receptors for VEGF, 4) ribozymes which
specifically target VEGF, and 5) siRNA which specifically targets
VEGF signalling proteins. Some examples of antibodies which are
active against VEGF are, for example, e.g., Lucentis (ranibizumab),
and Avastin (bevacizumab). An example of an oligonucleotide drug
is, e.g., Macugen (pegaptanib sodium injection). Small molecule
tyrosine kinase inhibitors include, for example, pazopanib,
sorafenib, sutent, and the like.
[0271] Inflammation is induced by the vascular permeability caused
by DR and by the process of leukocyte adhesion and
neovascularization. Therefore, other ant-inflammatory agents may be
administered in combination, prior to, after, or concomitantly with
the LFA-1 antagonists of the invention. The anti-inflammatory
agents can be chosen from corticosteroid related drugs including
but not limited to dexamethasone, fluoromethalone, medrysone,
betamethasone, triamcinolone, triamcinolone acetonide, prednisone,
prednisolone, hydrocortisone, rimexolone, and pharmaceutically
acceptable salts thereof, prednicarbate, deflazacort,
halomethasone, tixocortol, prednylidene, prednival, paramethasone,
methylprednisolone, meprednisone, mazipredone, isoflupredone,
halopredone acetate, halcinonide, formocortal, flurandrenolide,
fluprednisolone, flurprednidine acetate, fluperolone acetate,
fluocortolone, fluocortin butyl, fluocinonide, fluocinolone
acetonide, flunisolide, flumethasone, fludrocortisone,
fluclorinide, enoxolone, difluprednate, diflucortolone, diflorasone
diacetate, desoximetasone (desoxymethasone), desonide, descinolone,
cortivazol, corticosterone, cortisone, cloprednol, clocortolone,
clobetasone, clobetasol, chloroprednisone, cafestol, budesonide,
beclomethasone, amcinonide, allopregnane acetonide, alclometasone,
21-acetoxypregnenolone, tralonide, diflorasone acetate,
deacylcortivazol, RU-26988, budesonide, deacylcortivazol, and the
like. Alternatively, the antiinflammatory agents can be chosen from
the group of NSAIDs including but not limited to acetaminophen,
acemetacin, aceclofenac, alminoprofen, amfenac, bendazac,
benoxaprofen, bromfenac, bucloxic acid, butibufen, carprofen,
celecoxib, cinmetacin, clopirac, diclofenac, etodolac, etoricoxib,
felbinac, fenclozic acid, fenbufen, fenoprofen, fentiazac,
flunoxaprofen, flurbiprofen, ibufenac, ibuprofen, indomethacin,
isofezolac, isoxicam, isoxepac, indoprofen, ketoprofen, lonazolac,
loxoprofen, mefenamic acid, meclofenamic acid, meloxicam,
metiazinic acid, mofezolac, miroprofen, naproxen, niflumic,
oxaprozin, pirozolac, pirprofen, pranoprofen, protizinic acid,
rofecoxib, salicylic acid and its derivatives (i.e. for example,
asprin), sulindac, suprofen, suxibuzone, triaprofenic acid,
tolmetin, valdecoxib, xenbucin, ximoprofen, zaltoprofen, zomepirac,
aspirin, acemetcin, bumadizon, carprofenac, clidanac, diflunisal,
enfenamic acid, fendosal, flufenamic acid, flunixin, gentisic acid,
ketorolac, mesalamine, prodrugs thereof, and the like.
[0272] Another group of therapeutic agents which may be useful to
administer in combination, prior to, after, or concomitantly with
the LFA-1 antagonists of the invention is the group of drugs which
are known to inhibit retinopathy by inhibiting NFK.beta.. Some of
these classes of therapeutics include PARP inhibitors, benfotiamine
or other agents which intervene in blockade of AGEs (advanced
glycation endproducts), aldose reductase inhibitors; iNOS
inhibitors, FasL inhibitors, or angiopoeitin-1.
[0273] Oxidative stress may be induced in cells with impaired
autoregulatory and ischemic processes induced by DR. Therefore,
anti-oxidants may be useful to administer in combination, prior to,
after, or concomitantly with the LFA-1 antagonists of the
invention. Examples of suitable anti-oxidants useful in the methods
of the invention include, but are not limited to, ascorbic acid,
tocopherols, tocotrienols, carobinoids, glutathione, alpha-lipoic
acid, ubiquinols, bioflavonoids, carnitine, and superoxide
dismutase mimetics, such as, for example,
2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO), DOXYL, PROXYL
nitroxide compounds; 4-hydroxy-2,2,6,6-tetramethyl-1-piperidinyloxy
(Tempol), M-40401, M-40403, M-40407, M-40419, M-40484, M-40587,
M-40588, and the like.
[0274] In some stages of diabetic retinopathy, retinal ischemia is
a result, causing further cell death. In some embodiments of the
invention, methods are provided wherein anti-apoptotic therapeutic
agents may be administered in combination, prior to, after, or
concomitantly with the LFA-1 antagonists of the invention. Examples
of suitable anti-apoptotic agents are, for example, inhibitors of
caspases, cathepsins, and TNF-.alpha..
[0275] Another class of therapeutic agents which may be useful to
administer in combination, prior to, after, or concomitantly with
the LFA-1 antagonists of the invention are complement inhibitors.
The LFA-1/ICAM binding event is downstream of complement activation
of ICAM upregulation in tissue and on vascular/capillary epithelial
cells. Administration of both a complement inhibitor and LFA-1
antagonist may permit more complete modulation of LFA-1 expressing
leukocytes. One example of a complement inhibitor is Eculizumab.
Other complement inhibitors include, but are not limited to U.S.
Pat. Nos. 7,166,568, 6,319,897, 5,843,884, 5,135,916, and
5624837.
[0276] Another class of therapeutic agents which may be useful to
administer in combination, prior to, after, or concomitantly with
the LFA-1 antagonists of the invention are medications used in the
management of glaucoma in patients with background DM, which
includes primary, open angle, angle-closure as well as neovascular
glaucoma. Some of the therapeutic agents used for glaucoma include
but are not limited to prostaglandin analogs such as, for example,
latanoprost, bimatoprost, and travaprost; topical beta-adrenergic
receptor antagonists such as, for example, timolol, levobunolol,
and betaxolol; alpha 2-adrenergic agonist such as, for example,
brimonidine; sympathomimetics such as for example, epinephrine or
dipivifrin; miotic agents, such as, for example, pilocarpine;
carbonic anhydrase inhibitors, such as, for example, dorzolamide,
brinzolamide, and acetozolamide; or physostigmine.
[0277] Another class of therapeutic agents which may be useful to
administer in combination, prior to, after, or concomitantly with
the LFA-1 antagonists of the invention are antimicrobial agents.
Suitable antimicrobial compounds, include, but are not limited to,
penicillins, such as, for example, amoxicillin, ampicillin,
azlocillin, carbenicillin, cloxacillin, dicloxacillin,
flucloxacillin, meziocillin, nafcillin, penicillin, piperacillin,
ticarcillin, and the like; beta-lactamase inhibitors; carbapenems,
such as, for example, ertapenem, imipenem, meropenem, and the like;
cephalosporins, such as, for example, cefaclor, cefamandole,
cefoxitin, cefprozil, cefuroxime, cefixime, cefdinir, cefditoren,
cefoperazone, cefotaxime, cefpodoxime, cefadroxil, ceftazidime,
ceftibuten, ceftizoxime, ceffiriaxone, cefazolin, cefixime,
cephalexin, cefepime, and the like; quinolones, such as, for
example, ciprofloxacin, enoxacin, gatifloxacin, levofloxacin,
lomefloxacin, morifloxacin, norfloxacin, ofloxacin, trovafloxacin,
and the like; macrolides, such as, for example, azithromycin,
clarithromycin, dirithromycin, erythromycin, milbemycin,
troleandomycin, and the like; monbactams, such as, for example,
aztreonam, and the like; tetracyclins, such as, for example,
demeclocyclin, doxycycline, minocycline, oxytetracyclin,
tetracycline, and the like; aminoglycosides, such as, for example,
amikacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin,
streptomycin, tobramycin, and the like; carbacephem, such as, for
example, loracarbef, and the like; streptogramins; sulfonamides,
such as, for example, mefanide, prontosil, sulfacetamide,
sulfamethizole, sulfanilamide, sulfasalazine, sulfisoxazole,
trimethoprim, trimethoprim-1-sultamethoxazole, and the like; and
the combination drugs such as for example, sulfamethoxazole and
trimethoprim, and the like; and polypeptides, such as, for example,
bacitracin, colistin, polymyxin B, and the like.
[0278] Examples of other therapeutic agents which may be useful to
administer in combination, prior to, after, or concomitantly with
the LFA-1 antagonists of the invention are, include, but are not
limited to: (a) anti-diabetic agents such as insulin and insulin
mimetics, sulfonylureas (e.g., glyburide, meglinatide), biguanides,
e.g., metformin (Glucophage.TM.), .alpha.-glucosidase inhibitors
(acarbose), insulin sensitizers, e.g., thiazolidinone compounds,
rosiglitazone (Avandia.TM.), troglitazone (Rezulin.TM.),
ciglitazone, pioglitazone (Actos.TM.) and englitazone; (b)
cholesterol lowering agents such as HMG-CoA reductase inhibitors
(e.g., lovastatin, simvastatin, pravastatin, fluvastatin,
atorvastatin and other statins), bile acid sequestrants (e.g.,
cholestyramine and colestipol), vitamin B.sub.3 (also known as
nicotinic acid, or niacin), vitamin B.sub.6 (pyridoxine), vitamin
B.sub.12 (cyanocobalamin), fibric acid derivatives (e.g.,
gemfibrozil, clofibrate, fenofibrate and benzafibrate), probucol,
nitroglycerin, and inhibitors of cholesterol absorption (e.g.,
beta-sitosterol and acylCoA-cholesterol acyltransferase (ACAT)
inhibitors such as melinamide), HMG-CoA synthase inhibitors,
squalene epoxidase inhibitors and squalene synthetase inhibitors;
and (c) antithrombotic agents, such as thrombolytic agents (e.g.,
streptokinase, alteplase, anistreplase and reteplase), heparin,
hirudin and warfarin derivatives, beta-blockers (e.g., atenolol),
beta-adrenergic agonists (e.g., isoproterenol), ACE inhibitors and
vasodilators (e.g., sodium nitroprusside, nicardipine
hydrochloride, nitroglycerin and enaloprilat).
[0279] In some embodiments, the LFA-1 antagonist is present in an
amount sufficient to exert a therapeutic effect to reduce symptoms
of diabetic retinopathy by an average of at least about 5, 10, 15,
20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially
eliminate symptoms of diabetic retinopathy.
[0280] In other embodiments, the LFA-1 antagonist is present in an
amount sufficient to reduce retinal degeneration in a subject by an
average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70,
80, 90, more than 90%, or substantially eliminate retinal
degeneration.
[0281] In some embodiments, the LFA-1 antagonist is present in an
amount sufficient to decrease retinal edema in a treated eye of a
subject by an average of at least about 5, 10, 15, 20, 25, 30, 40,
50, 60, 70, 80, 90, more than 90%, or substantially eliminate
retinal edema.
[0282] In yet other embodiments, the LFA-1 antagonist is present in
an amount sufficient to decrease basement membrane thickening in a
treated eye of a subject by an average of at least about 5, 10, 15,
20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially
eliminate basement membrane thickening.
[0283] In some embodiments, the LFA-1 antagonist is present in an
amount sufficient to decrease retinal neovascularization in a
treated eye of a subject by an average of at least about 5, 10, 15,
20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially
eliminate retinal neovascularization.
[0284] In some embodiments, the LFA-1 antagonist is present in an
amount sufficient to decrease fibrovascular growth over a retina in
a treated eye of a subject by an average of at least about 5, 10,
15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or
substantially eliminate fibrovascular growth over the retina.
[0285] In some embodiments, the LFA-1 antagonist is present in an
amount sufficient to retard loss of vision in a treated eye of a
subject by an average of at least about 5, 10, 15, 20, 25, 30, 40,
50, 60, 70, 80, 90, more than 90%, or substantially eliminate
further loss of vision.
[0286] In some embodiments, the LFA-1 antagonist is present in an
amount sufficient to limit non-proliferative damage to a retina of
a subject by an average of at least about 5, 10, 15, 20, 25, 30,
40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate
the non-proliferative damage to the retina.
[0287] In some embodiments, the LFA-1 antagonist is present in an
amount sufficient to slow proliferative damage to a retina of a
subject by an average of at least about 5, 10, 15, 20, 25, 30, 40,
50, 60, 70, 80, 90, more than 90%, or substantially eliminate
further proliferative damage to the retina.
[0288] In some embodiments, an effective amount of the LFA-1
antagonist is a daily dose of about 1.times.10-.sup.11,
1.times.10-.sup.10, 1.times.10-.sup.9, 1.times.10.sup.-8,
1.times.10.sup.-7, 1.times.10.sup.-6, 1.times.10.sup.-5,
1.times.10.sup.-4, 1.times.10.sup.-3, 1.times.10.sup.-2,
1.times.10.sup.-1, 1.times.10.sup.1, 1.times.10.sup.2 grams.
[0289] Administration of the therapeutic agent may be by any
suitable means. In some embodiments, the therapeutic agent is
administered by oral administration. In some embodiments, the
therapeutic agent is administered by transdermal administration. In
some embodiments, the therapeutic agent is administered by
instillation. In some embodiments, the therapeutic agent is
administered by injection. In some embodiments, the therapeutic
agent is administered by slow release intravitreal injection. In
some embodiments, the therapeutic agent is administered by slow
release intraocular implantation. In some embodiments, the
therapeutic agent is administered by periocular implantation. In
some embodiments, the therapeutic agent is administered topically.
In some embodiments, the therapeutic agent is administered
topically, via an eye drop. If combinations of agents are
administered as separate compositions, they may be administered by
the same route or by different routes. If combinations of agents
are administered in a single composition, they may be administered
by any suitable route. In some embodiments, combinations of agents
are administered as a single composition by oral administration. In
some embodiments, combinations of agents are administered as a
single composition by transdermal administration. In some
embodiments, the combinations of agent are administered as a single
composition by injection. In some embodiments, the combinations of
agent are administered as a single composition topically.
[0290] In some embodiments of the invention, diagnostic procedures
will be employed to identify a subject in need of treatment by the
method of the invention. An exemplary list of procedures that may
be used to diagnose symptoms of diabetic retinopathy, includes,
e.g., for example, complete ophthalmic examination (which may
include Amsler grid examination and slit lamp examination), fundus
photography, fluorescein angiography, optical coherence tomography,
non-myriadic photography, and beta scan ultrasound, conventional
ocular exam, optical coherence tomography, beta scan ultrasound
alone, complete ophthalmic examination with fundus photography and
fluorescein angiography.
[0291] The antagonist of the method of the invention may be an
antibody, fragment of an antibody, peptide or small molecule. In
some embodiments, the LFA-1 antagonist used is a peptide which is
not an antibody. In other embodiments the, LFA-1 antagonist used is
a small molecule.
[0292] In some embodiments of the invention, treating or preventing
the symptoms of diabetic retinopathy by using LFA-1 antagonists
requires chronic therapy; therefore, small molecule inhibitors of
the LFA-1/ICAM-1 interaction may be utilized as they have the
potential for local administration as ocular drops with a lowered
cost of goods. Similarly oral administration offers advantages in
lowered cost of goods. Implantable devices, which may be
biodegradable or bioabsorbable or biodegradable slow release or
sustained release formulations implanted or injected into the eye
or near the eye in periocular tissue are used for chronic
therapy.
[0293] Another embodiment is a method of treating the symptoms of
diabetic retinopathy using therapeutic agents which are suitable
for formulation and administration as ocular therapeutics.
[0294] A cream formulation of the compounds of the invention may be
useful in the local delivery of a LFA-1 antagonist to the skin.
Compounds useful in this regard include LFA-1 antagonists and their
pro-drugs which are transformed into the active drug once within
the skin. A skin cream applied to the outer surface of the eyelids
thus delivering a LFA-1 antagonist across the eyelid to the inner
lining of the eyelid and the intervening conjunctival tissue and
accessory lacrimal glands and appear in tear and thus be absorbed
into the eye. This form of delivery may be desirable in treating
LFA-1 mediated inflammation of the eye, particularly in the
treatment of diabetic retinopathy.
III. Administration
[0295] The method of the present invention may draw upon many
suitable modes of administration to deliver the LFA-1 antagonist of
the methods described herein. Such delivery to affected regions of
the body may be achieved either via local or systemic
administration. Suitable formulations and additional carriers are
described in Remington "The Science and Practice of Pharmacy"
(20.sup.th Ed., Lippincott Williams & Wilkins, Baltimore Md.),
the teachings of which are incorporated by reference in their
entirety herein.
[0296] In some embodiments, the invention provides a pharmaceutical
composition for administration to a subject containing: (i) an
effective amount of a therapeutic agent; and (ii) a pharmaceutical
excipient suitable for oral administration. In some embodiments,
the composition further contains: (iii) an effective amount of a
second therapeutic agent. A pharmaceutical composition of the
invention can comprise any of the molecules disclosed herein.
[0297] In order to reduce inflammation in eye disorders, the
pharmaceutical composition of the invention is preferably delivered
to the retina, intraocular space, ocular surface, interconnecting
innervation, conjunctiva, lacrimal glands, or meibomian glands. It
is envisioned that effective treatment can encompass administering
therapeutic agents of the present invention via oral
administration, topical administration, via injection,
intranasally, rectally, transdermally, via an impregnated or coated
device such as an ocular insert or implant, or iontophoretically,
amongst other routes of administration.
[0298] For administration via injection, the pharmaceutical
composition can be injected intraocularly, periocularly,
intramuscularly, intra-arterially, subcutaneously, or
intravenously. A pump mechanism may be employed to administer the
pharmaceutical composition over a preselected period. For some
embodiments of the invention it is desirable to deliver drug
locally, thus injections may be made periocularly, intraocularly,
intravitreally, subconjunctively, retrobulbarly, into the sclera,
or intercamerally. For some embodiments of the invention, systemic
delivery is preferred.
[0299] For systemic administration, the compounds of the invention
can be formulated for and administered orally. For administration
that may result in either regional or systemic distribution of the
therapeutic agents, the composition of the invention may be
administered intranasally, transdermally, or via some forms of oral
administration, e.g. with use of a mouthwash or lozenge
incorporating a compound of the invention that is poorly absorbed
from the G.I. For administration that may result in regional or
local delivery of the composition of the invention, iontophoretic
or topical administration may be used.
[0300] Additionally, the pharmaceutical compositions of the present
invention may be administered to the ocular surface via a
pump-catheter system, or released from within a continuous or
selective release device such as, e.g., membranes such as, but not
limited to, those employed in the Ocusert.TM. System (Alza Corp,
Palo Alto, Calif.). The pharmaceutical compositions can be
incorporated within, carried by or attached to contact lenses which
are then worn by the subject. The pharmaceutical compositions can
be sprayed onto ocular surface.
[0301] Alternatively, the pharmaceutical compositions of the
present invention may be administered intraocularly or periocularly
via a pump-catheter system, or released from within a continuous or
selective release device. The pharmaceutical compositions may also
comprise biodegradable sustained, slow and/or delayed release
formulations such as, for example, PLGA microspheres,
microparticles or nanoparticles which may be delivered via a device
as described above or injected intraocularly or periocularly.
[0302] In some embodiments, the LFA-1 antagonist is administered in
a single dose. A single dose of a LFA-1 antagonist may also be used
when it is co-administered with another substance (e.g., an
analgesic) for treatment of an acute condition.
[0303] In some embodiments, the LFA-1 antagonist (by itself or in
combination with other drugs) is administered in multiple doses.
Dosing may be about once, twice, three times, four times, five
times, six times, seven times, eight times, nine times, ten times
or more than ten times per day. Dosing may be about once a year,
twice a year, every six months, every 4 months, every 3 months,
every 60 days, once a month, once every two weeks, once a week, or
once every other day. In one embodiment the drug is an analgesic.
In another embodiment the LFA-1 antagonist and another therapeutic
substance are administered together about once per day to about 10
times per day. In another embodiment the administration of the
LFA-1 antagonist and another therapeutic substance continues for
less than about 7 days. In yet another embodiment the
co-administration continues for more than about 6, 10, 14, 28 days,
two months, six months, or one year. In some cases, co-administered
dosing is maintained as long as necessary, e.g., dosing for chronic
inflammation.
[0304] Administration of the compositions of the invention may
continue as long as necessary. In some embodiments, a composition
of the invention is administered for more than 1, 2, 3, 4, 5, 6, 7,
14, or 28 days. In some embodiments, a composition of the invention
is administered for less than 28, 14, 7, 6, 5, 4, 3, 2, or 1 day.
In some embodiments, a composition of the invention is administered
chronically on an ongoing basis, e.g., for the treatment of chronic
pain.
[0305] Dosing for the LFA-1 antagonist in the method of the
invention may be found by routine experimentation. The daily dose
can range from about 1.times.10.sup.-8 g to 5000 mg. Daily dose
range may depend on the form of LFA-1 antagonist e.g., the esters
or salts used, and/or route of administration, as described herein.
For example, for systemic administration, typical daily dose ranges
are, e.g. about 1-5000 mg, or about 1-3000 mg, or about 1-2000 mg,
or about 1-1000 mg, or about 1-500 mg, or about 1-100 mg, or about
10-5000 mg, or about 10-3000 mg, or about 10-2000 mg, or about
10-1000 mg, or about 10-500 mg, or about 10-200 mg, or about 10-100
mg, or about 20-2000 mg or about 20-1500 mg or about 20-1000 mg or
about 20-500 mg, or about 20-100 mg, or about 50-5000 mg, or about
50-4000 mg, or about 50-3000 mg, or about 50-2000 mg, or about
50-1000 mg, or about 50-500 mg, or about 50-100 mg, about 100-5000
mg, or about 100-4000 mg, or about 100-3000 mg, or about 100-2000
mg, or about 100-1000 mg, or about 100-500 mg. In some embodiments,
the daily dose of LFA-1 antagonist is about 100, 200, 300, 400,
500, 600, 700, 800, 900, or 1000 mg. In some embodiments, the daily
dose of the LFA-1 antagonist is 10 mg. In some embodiments, the
daily dose of the LFA-1 antagonist is 100 mg. In some embodiments,
the daily dose of LFA-1 antagonist is 500 mg. In some embodiments,
the daily dose of LFA-1 antagonist is 1000 mg.
[0306] For topical delivery to the ocular surface, the typical
daily dose ranges are, e.g. about 1.times.10.sup.-8 g to 5.0 g, or
about 1.times.10.sup.-8 g to 2.5 g, or about 1.times.10.sup.-8 g to
1.00 g, or about 1.times.10.sup.-8 g to 0.5 g, or about
1.times.10.sup.-8 g to 0.25 g, or about 1.times.10.sup.-8 g to 0.1
g, or about 1.times.10.sup.-8 g to 0.05 g, or about
1.times.10.sup.-8 g to 0.025 g, or about 1.times.10.sup.-8 g to
1.times.10.sup.-2 g, or about 1.times.10.sup.-8 g to
5.times.10.sup.-3 g, or about 1.times.10.sup.-8 g to
2.5.times.10.sup.-3 g, or about 1.times.10.sup.-8 g to
1.times.10.sup.-3 g, or about 1.times.10.sup.-8 g to
5.times.10.sup.-4 g, or about 1.times.10.sup.-7 g to 5.0 g, or
about 1.times.10.sup.-7 g to 2.5 g, or about 1.times.10.sup.-7 g to
1.00 g, or about 1.times.10.sup.-7 g to 0.5 g, or about
1.times.10.sup.-7 g to 0.25 g, or about 1.times.10.sup.-7 g to 0.1
g, or about 1.times.10.sup.-7 g to 0.05 g, or about
1.times.10.sup.-7 g to 0.025 g, or about 1.times.10.sup.-7 g to
1.times.10.sup.-2 g, or about 1.times.10.sup.-7 g to
5.times.10.sup.-3 g, or about 1.times.10.sup.-7 g to
2.5.times.10.sup.-3 g, or about 1.times.10.sup.-7 g to
1.times.10.sup.-3 g, or about 1.times.10.sup.-7 g to
5.times.10.sup.-4 g, or about 1.times.10.sup.-6 g to 5.0 g, or
about 1.times.10.sup.-6 g to 2.5 g, or about 1.times.10.sup.-6 g to
1 g, or about 1.times.10.sup.-6 g to 0.5 g, or about
1.times.10.sup.-6 g to 0.25 g, or about 1.times.10.sup.-6 g to 0.1
g, or about 1.times.10.sup.-6 g to 5.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 5.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 2.5.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 1.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 5.times.10.sup.-3 g, or about
1.times.10.sup.-6 g to 2.5.times.10.sup.-3 g, or about
1.times.10.sup.-6 g to 1.times.10.sup.-3 g, or about
1.times.10.sup.-6 g to 5.times.10.sup.-4 g, or about
1.times.10.sup.-5 g to 5 g, or about 1.times.10.sup.-5 g to 2.5 g,
or about 1.times.10.sup.-5 g to 1 g, or about 1.times.10.sup.-5 g
to 0.5 g, or about 1.times.10.sup.-5 g to 0.25 g, or about
1.times.10.sup.-5 g to 0.1 g, or about 1.times.10.sup.-5 g to 0.05
g, or about 1.times.10.sup.-5 g to 2.5.times.10.sup.-2 g, or about
1.times.10.sup.-5 g to 1.times.10.sup.-2 g, or about
1.times.10.sup.-5 g to 5.times.10.sup.-3 g, or about
1.times.10.sup.-5 g to 2.5.times.10.sup.-3 g, or about
1.times.10.sup.-5 g to 1.times.10.sup.-3 g, or about
1.times.10.sup.-5 g to 5.times.10.sup.-4 g. In some embodiments,
the daily dose of LFA-1 antagonist is about 1.times.10.sup.-7,
1.times.10.sup.-6, 1.times.10.sup.-5, 1.times.10.sup.-4,
1.times.10.sup.-3 g, 1.times.10.sup.-2 g, 1.times.10.sup.1 g, or 1
g. In some embodiments, the daily dose of the LFA-1 antagonist is
1.times.10.sup.-7 g. In some embodiments, the daily dose of the
LFA-1 antagonist is 1.times.10.sup.-5 g. In some embodiments, the
daily dose of LFA-1 antagonist is 1.times.10.sup.-3 g. In some
embodiments, the daily dose of LFA-1 antagonist is
1.times.10.sup.-2 g. In some embodiments the subject dose ranges
from about 1.times.10.sup.-8 g to 5.0 g, or about 1.times.10.sup.-8
g to 2.5 g, or about 1.times.10.sup.-8 g to 1.00 g, or about
1.times.10.sup.-8 g to 0.5 g, or about 1.times.10.sup.-8 g to 0.25
g, or about 1.times.10.sup.-8 g to 0.1 g, or about
1.times.10.sup.-8 g to 0.05 g, or about 1.times.10.sup.-8 to 0.025
g, or about 1.times.10.sup.-8 g to 1.times.10.sup.-2 g, or about
1.times.10.sup.-8 g to 5.times.10.sup.-3 g, or about
1.times.10.sup.-8 g to 2.5.times.10.sup.-3 g, or about
1.times.10.sup.-8 g to 1.times.10.sup.-3 g, or about
1.times.10.sup.-8 g to 5.times.10.sup.-4 g, or about
1.times.10.sup.-7 g to 5.0 g, or about 1.times.10.sup.-7 g to 2.5
g, or about 1.times.10.sup.-7 g to 1.00 g, or about
1.times.10.sup.-7 g to 0.5 g, or about 1.times.10.sup.-7 g to 0.25
g, or about 1.times.10.sup.-7 g to 0.1 g, or about
1.times.10.sup.-7 g to 0.05 g, or about 1.times.10.sup.-7 g to
0.025 g, or about 1.times.10.sup.-7 g to 1.times.10.sup.-2 g, or
about 1.times.10.sup.-7 g to 5.times.10.sup.-3 g, or about
1.times.10.sup.-7 g to 2.5.times.10.sup.-3 g, or about
1.times.10.sup.-7 g to 1.times.10.sup.-3 g, or about
1.times.10.sup.-7 g to 5.times.10.sup.-4 g, or about
1.times.10.sup.-6 g to 5.0 g, or about 1.times.10.sup.-6 g to 2.5
g, or about 1.times.10.sup.-6 g to 1 g, or about 1.times.10.sup.-6
g to 0.5 g, or about 1.times.10.sup.-6 g to 0.25 g, or about
1.times.10.sup.-6 g to 0.1 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
2.5.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
1.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-3 g, or about 1.times.10.sup.-6 g to
2.5.times.10.sup.-3 g, or about 1.times.10.sup.-6 g to
1.times.10.sup.-3 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-4 g, or about 1.times.10.sup.-5 g to 5 g, or about
1.times.10.sup.-5 g to 2.5 g, or about 1.times.10.sup.-5 g to 1 g,
or about 1.times.10.sup.-5 g to 0.5 g, or about 1.times.10.sup.-5 g
to 0.25 g, or about 1.times.10.sup.-5 g to 0.1 g, or about
1.times.10.sup.-5 g to 0.05 g, or about 1.times.10.sup.-5 g to
2.5.times.10.sup.-2 g, or about 1.times.10.sup.-5 g to
1.times.10.sup.-2 g, or about 1.times.10.sup.-5 g to
5.times.10.sup.-3 g, or about 1.times.10.sup.-5 g to
2.5.times.10.sup.-3 g, or about 1.times.10.sup.-5 g to
1.times.10.sup.-3 g, or about 1.times.10.sup.-5 g to
5.times.10.sup.-4 g. In some embodiments, the individual dose as
described above, is repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times
per day.
[0307] In some embodiments of the invention, the eye drop, cream,
lotion or other topical formulations of the invention release
sufficient therapeutic agent intraocularly or periocularly to
sustain a level of LFA-1 antagonist of at least about 10 nM, about
50 nM, about 100 nM, about 150 nM, about 200 nM, about 250 nM,
about 300 nM, about 350 nM, about 500 nM, about 600 nM, about 700
nM, about 800 nM, about 900 nM, about 1 mM, about 2 mM, about 3 mM,
about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about
10 mM, about 15 mM, about 20 mM or about 25 mM from dose to
dose.
[0308] In some embodiments of the invention, an eye drop
formulation of the invention release sufficient therapeutic agent
intraocularly or periocularly to achieve a level of LFA-1
antagonist in the retina of at least about 10 nM, about 50 nM,
about 100 nM, about 150 nM, about 200 nM, about 250 nM, about 300
nM, about 350 nM, about 500 nM, about 600 nM, about 700 nM, about
800 nM, about 900 nM, about 1 mM, about 2 mM, about 3 mM, about 5
mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM,
about 155 mM, about 20 mM or about 25 mM from dose to dose.
[0309] For other forms of administration, the daily dosages may
range about the range described for systemic administration or may
range about the range described for topical administration.
[0310] For slow or sustained release intraocular or periocular
devices and formulations, in some embodiments, a typical dose range
is about 0.1 mg to about 100 mg of LFA-1 antagonist released over
the dosing period. In other embodiments, about 1 mg to about 50 mg,
about 1 to about 25 mg, about 5 mg to about 100 mg, about 5 to
about 50 mg, about 5 to about 25 mg, about 10 mg to about 100 mg,
about 10 mg to about 50 mg, about 10 mg to about 25 mg, or about 15
mg to about 50 mg is released over the dosing period. The dosing
period for slow release intraocular or periocular devices and
formulations, typically range from about 10 days to about 1 year,
about 30 days to about 1 year, about 60 days to about 1 year, about
3 months to about 1 year, about 4 months to about 1 year, about 5
months to about 1 year, or about 6 months to about 1 year. In some
embodiments, the slow release intraocular or periocular devices and
formulations release therapeutic agent over the period of about 1
month to about 9 months, about 1 month to about 8 months, about 1
month to about 7 months, about 1 month, to about 6 months, about 1
month to about 5 months, about 1 month to about 4 months, or about
1 month to about 3 months. In other embodiments the slow release
formulations and devices release therapeutic agent for up to 1
month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months,
8 months, 9 months, 10 months, 12 months, 18 months, 2 years, 30
months, or 3 years.
[0311] In some embodiments of the invention, the sustained release
formulation and/or implantations release sufficient therapeutic
agent intraocularly or periocularly to sustain a level of LFA-1
antagonist of at least about 10 nM, about 50 nM, about 100 nM,
about 150 nM, about 200 nM, about 250 nM, about 300 nM, about 350
nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about
900 nM, about 1 mM, about 2 mM, about 3 mM, about 5 mM, about 6 mM,
about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 15 mM, about
20 mM or about 25 mM across 1 year. In some embodiments of the
invention, the sustained release formulation and/or implantations
release sufficient therapeutic agent intraocularly or periocularly
to sustain a level of LFA-1 antagonist of at least about 10 nM,
about 50 nM, about 100 nM, about 150 nM, about 200 nM, about 250
nM, about 300 nM, about 350 nM, about 500 nM, about 600 nM, about
700 nM, about 800 nM, about 900 nM, about 1 mM, about 2 mM, about 3
mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM,
about 10 mM, about 15 mM, about 20 mM or about 25 mM across 6
months.
IV. Formulations
[0312] The compounds of the invention may be formulated as a
sterile solution or suspension, in suitable vehicles, well known in
the art. Suitable formulations and additional carriers are
described in Remington "The Science and Practice of Pharmacy"
(20.sup.th Ed., Lippincott Williams & Wilkins, Baltimore Md.),
the teachings of which are incorporated by reference in their
entirety herein.
[0313] For injectable formulations, the vehicle may be chosen from
those known in art to be suitable, including aqueous solutions or
oil suspensions, or emulsions, with sesame oil, corn oil,
cottonseed oil, or peanut oil, as well as elixirs, mannitol,
dextrose, or a sterile aqueous solution, and similar pharmaceutical
vehicles. The formulation may also comprise polymer compositions
which are biocompatible, biodegradable, such as
poly(lactic-co-glycolic)acid. These materials may be made into
micro or nanoparticles, loaded with drug and further coated or
derivatized to provide superior sustained release performance.
Vehicles suitable for periocular or intraocular injection include,
for example, suspensions of therapeutic agent in injection grade
water, liposomes and vehicles suitable for lipophilic substances.
Other vehicles for periocular or intraocular injection are well
known in the art.
[0314] The concentration of drug may be adjusted, the pH of the
solution buffered and the isotonicity adjusted to be compatible
with intravenous injection, as is well known in the art.
[0315] Any of the forms of LFA-1 may also be milled to provide more
suitable properties for formulation. Milling may provide smaller
particle size with greater surface area exposure, which can provide
faster solubilization in-vivo or during formulation. Alternatively,
milling to a smaller particle size may provide the capacity to pass
through biological barriers, such as the skin or gut wall,
directly, without initial solubilization, permitting use as a solid
in the formulation, which may provide additional benefits of
temperature stability, shelf life, ease of transport, and ease of
use by the subject.
[0316] Oral formulations can be tablets, capsules, troches, pills,
wafers, chewing gums, lozenges, aqueous solutions or suspensions,
oily suspensions, syrups, elixirs, or dispersible powders or
granules, and the like and may be made in any way known in the art.
Oral formulations may also contain sweetening, flavoring, coloring
and preservative agents. Pharmaceutically acceptable excipients for
tablet forms may comprise nontoxic ingredients such as inert
diluents, such as calcium carbonate, sodium carbonate, lactose,
calcium phosphate, or sodium phosphate, and the like.
[0317] In the case of tablets for oral use, carriers which are
commonly used include lactose and corn starch, and lubricating
agents such as magnesium stearate are commonly added. For oral
administration in capsule form, useful carriers include lactose and
corn starch. Further nonlimiting examples of carriers and
excipients include milk, sugar, certain types of clay, gelatin,
stearic acid or salts thereof, calcium stearate, talc, vegetable
fats or oils, gums and glycols.
[0318] Surfactant which can be used to form pharmaceutical
compositions and dosage forms of the invention include, but are not
limited to, hydrophilic surfactants, lipophilic surfactants, and
mixtures thereof. That is, a mixture of hydrophilic surfactants may
be employed, a mixture of lipophilic surfactants may be employed,
or a mixture of at least one hydrophilic surfactant and at least
one lipophilic surfactant may be employed.
[0319] A suitable hydrophilic surfactant may generally have an HLB
value of at least 10, while suitable lipophilic surfactants may
generally have an HLB value of or less than about 10. An empirical
parameter used to characterize the relative hydrophilicity and
hydrophobicity of non-ionic amphiphilic compounds is the
hydrophilic-lipophilic balance ("HLB" value). Surfactants with
lower HLB values are more lipophilic or hydrophobic, and have
greater solubility in oils, while surfactants with higher HLB
values are more hydrophilic, and have greater solubility in aqueous
solutions. Hydrophilic surfactants are generally considered to be
those compounds having an HLB value greater than about 10, as well
as anionic, cationic, or zwitterionic compounds for which the HLB
scale is not generally applicable. Similarly, lipophilic (i.e.,
hydrophobic) surfactants are compounds having an HLB value equal to
or less than about 10. However, HLB value of a surfactant is merely
a rough guide generally used to enable formulation of industrial,
pharmaceutical and cosmetic emulsions.
[0320] Hydrophilic surfactants may be either ionic or non-ionic.
Suitable ionic surfactants include, but are not limited to,
alkylammonium salts; fusidic acid salts; fatty acid derivatives of
amino acids, oligopeptides, and polypeptides; glyceride derivatives
of amino acids, oligopeptides, and polypeptides; lecithins and
hydrogenated lecithins; lysolecithins and hydrogenated
lysolecithins; phospholipids and derivatives thereof,
lysophospholipids and derivatives thereof; carnitine fatty acid
ester salts; salts of alkylsulfates; fatty acid salts; sodium
docusate; acyl lactylates; mono- and di-acetylated tartaric acid
esters of mono- and di-glycerides; succinylated mono- and
di-glycerides; citric acid esters of mono- and di-glycerides; and
mixtures thereof.
[0321] Within the aforementioned group, preferred ionic surfactants
include, by way of example: lecithins, lysolecithin, phospholipids,
lysophospholipids and derivatives thereof; carnitine fatty acid
ester salts; salts of alkylsulfates; fatty acid salts; sodium
docusate; acyl lactylates; mono- and di-acetylated tartaric acid
esters of mono- and di-glycerides; succinylated mono- and
di-glycerides; citric acid esters of mono- and di-glycerides; and
mixtures thereof.
[0322] Ionic surfactants may be the ionized forms of lecithin,
lysolecithin, phosphatidylcholine, phosphatidylethanolamine,
phosphatidylglycerol, phosphatidic acid, phosphatidylserine,
lysophosphatidylcholine, lysophosphatidylethanolamine,
lysophosphatidylglycerol, lysophosphatidic acid,
lysophosphatidylserine, PEG-phosphatidylethanolamine,
PVP-phosphatidylethanolamine, lactylic esters of fatty acids,
stearoyl-2-lactylate, stearoyl lactylate, succinylated
monoglycerides, mono/diacetylated tartaric acid esters of
mono/diglycerides, citric acid esters of mono/diglycerides,
cholylsarcosine, caproate, caprylate, caprate, laurate, myristate,
palmitate, oleate, ricinoleate, linoleate, linolenate, stearate,
lauryl sulfate, teracecyl sulfate, docusate, lauroyl carnitines,
palmitoyl carnitines, myristoyl carnitines, and salts and mixtures
thereof.
[0323] Hydrophilic non-ionic surfactants may include, but not
limited to, alkylglucosides; alkylmaltosides; alkylthioglucosides;
lauryl macrogolglycerides; polyoxyalkylene alkyl ethers such as
polyethylene glycol alkyl ethers; polyoxyalkylene alkylphenols such
as polyethylene glycol alkyl phenols; polyoxyalkylene alkyl phenol
fatty acid esters such as polyethylene glycol fatty acids
monoesters and polyethylene glycol fatty acids diesters;
polyethylene glycol glycerol fatty acid esters; polyglycerol fatty
acid esters; polyoxyalkylene sorbitan fatty acid esters such as
polyethylene glycol sorbitan fatty acid esters; hydrophilic
transesterification products of a polyol with at least one member
of the group consisting of glycerides, vegetable oils, hydrogenated
vegetable oils, fatty acids, and sterols; polyoxyethylene sterols,
derivatives, and analogues thereof; polyoxyethylated vitamins and
derivatives thereof; polyoxyethylene-polyoxypropylene block
copolymers; and mixtures thereof, polyethylene glycol sorbitan
fatty acid esters and hydrophilic transesterification products of a
polyol with at least one member of the group consisting of
triglycerides, vegetable oils, and hydrogenated vegetable oils. The
polyol may be glycerol, ethylene glycol, polyethylene glycol,
sorbitol, propylene glycol, pentaerythritol, or a saccharide.
[0324] Other hydrophilic-non-ionic surfactants include, without
limitation, PEG-10 laurate, PEG-12 laurate, PEG-20 laurate, PEG-32
laurate, PEG-32 dilaurate, PEG-12 oleate, PEG-15 oleate, PEG-20
oleate, PEG-20 dioleate, PEG-32 oleate, PEG-200 oleate, PEG-400
oleate, PEG-15 stearate, PEG-32 distearate, PEG-40 stearate,
PEG-100 stearate, PEG-20 dilaurate, PEG-25 glyceryl trioleate,
PEG-32 dioleate, PEG-20 glyceryl laurate, PEG-30 glyceryl laurate,
PEG-20 glyceryl stearate, PEG-20 glyceryl oleate, PEG-30 glyceryl
oleate, PEG-30 glyceryl laurate, PEG-40 glyceryl laurate, PEG-40
palm kernel oil, PEG-50 hydrogenated castor oil, PEG-40 castor oil,
PEG-35 castor oil, PEG-60 castor oil, PEG-40 hydrogenated castor
oil, PEG-60 hydrogenated castor oil, PEG-60 corn oil, PEG-6
caprate/caprylate glycerides, PEG-8 caprate/caprylate glycerides,
polyglyceryl-10 laurate, PEG-30 cholesterol, PEG-25 phyto sterol,
PEG-30 soya sterol, PEG-20 trioleate, PEG-40 sorbitan oleate,
PEG-80 sorbitan laurate, polysorbate 20, polysorbate 80, POE-9
lauryl ether, POE-23 lauryl ether, POE-10 oleyl ether, POE-20 oleyl
ether, POE-20 stearyl ether, tocopheryl PEG-100 succinate, PEG-24
cholesterol, polyglyceryl-10oleate, Tween 40, Tween 60, sucrose
monostearate, sucrose monolaurate, sucrose monopalmitate, PEG
10-100 nonyl phenol series, PEG 15-100 octyl phenol series, and
poloxamers.
[0325] Suitable lipophilic surfactants include, by way of example
only: fatty alcohols; glycerol fatty acid esters; acetylated
glycerol fatty acid esters; lower alcohol fatty acids esters;
propylene glycol fatty acid esters; sorbitan fatty acid esters;
polyethylene glycol sorbitan fatty acid esters; sterols and sterol
derivatives; polyoxyethylated sterols and sterol derivatives;
polyethylene glycol alkyl ethers; sugar esters; sugar ethers;
lactic acid derivatives of mono- and di-glycerides; hydrophobic
transesterification products of a polyol with at least one member
of the group consisting of glycerides, vegetable oils, hydrogenated
vegetable oils, fatty acids and sterols; oil-soluble
vitamins/vitamin derivatives; and mixtures thereof. Within this
group, preferred lipophilic surfactants include glycerol fatty acid
esters, propylene glycol fatty acid esters, and mixtures thereof,
or are hydrophobic transesterification products of a polyol with at
least one member of the group consisting of vegetable oils,
hydrogenated vegetable oils, and triglycerides.
[0326] Surfactants may be used in any formulation of the invention
where its use is not otherwise contradicted. In some embodiments of
the invention, the use of no surfactants or limited classes of
surfactants are preferred.
[0327] Other suitable aqueous vehicles include, but are not limited
to, Ringer's solution and isotonic sodium chloride. Aqueous
suspensions may include suspending agents such as cellulose
derivatives, sodium alginate, polyvinyl-pyrrolidone and gum
tragacanth, and a wetting agent such as lecithin. Suitable
preservatives for aqueous suspensions include methyl and n-propyl
p-hydroxybenzoate.
[0328] Chelating agents which can be used to form pharmaceutical
compositions and dosage forms of the invention include, but are not
limited to, ethylene diaminetetraacetic acid (EDTA), EDTA disodium,
calcium disodium edetate, EDTA trisodium, albumin, transferrin,
desferoxamine, desferal, desferoxamine mesylate, EDTA tetrasodium
and EDTA dipotassium, sodium metasilicate or combinations of any of
these.
[0329] Preservatives which can be used to form pharmaceutical
compositions and dosage forms of the invention include, but are not
limited to, purite, peroxides, perborates, imidazolidinyl urea,
diazolidinyl urea, phenoxyethanol, alkonium chlorides including
benzalkonium chlorides, methylparaben, ethylparaben and
propylparaben.
[0330] Thickening agents which can be used to form pharmaceutical
compositions land dosage forms of the invention include, but are
not limited to, isopropyl myristate, isopropyl palmitate, isodecyl
neopentanoate, squalene, mineral oil, C.sub.12-C.sub.15 benzoate
and hydrogenated polyisobutene. Particularly preferred are those
agents which would not disrupt other compounds of the final
product, such as non-ionic thickening agents. The selection of
additional thickening agents is well within the skill of one in the
art.
[0331] Anti-oxidants which can be used to form pharmaceutical
compositions and dosage forms of the invention include, but are not
limited to, propyl, octyl and dodecyl esters of gallic acid,
butylated hydroxyanisole (BHA, usually purchased as a mixture of
ortho and meta isomers), green tea extract, uric acid, cysteine,
pyruvate, nordihydroguairetic acid, ascorbic acid, salts of
ascorbic acid such as ascorbyl palmitate and sodium ascorbate,
ascorbyl glucosamine, vitamin E (i.e., tocopherols such as
a-tocopherol), derivatives of vitamin E (e.g., tocopheryl acetate),
retinoids such as retinoic acid, retinol, trans-retinol,
cis-retinol, mixtures of trans-retinol and cis-retinol,
3-dehydroretinol and derivatives of vitamin A (e.g., retinyl
acetate, retinal and retinyl palmitate, also known as tetinyl
palmitate), sodium citrate, sodium, sulfite, lycopene,
anthocyanids, bioflavinoids (e.g., hesperitin, naringen, rutin and
quercetin), superoxide dismutase, glutathione peroxidase, butylated
hydroxytoluene (BHT), indole-3-carbinol, pycnogenol, melatonin,
sulforaphane, pregnenolone, lipoic acid and
4-hydroxy-5-methyl-3[2H]-furanone.
[0332] When formulating compounds of the invention for oral
administration, it may be desirable to utilize gastroretentive
formulations to enhance absorption from the gastrointestinal (G1)
tract. A formulation which is retained in the stomach for several
hours may release compounds of the invention slowly and provide a
sustained release that may be preferred in some embodiments of the
invention. Disclosure of such gastro-retentive formulations are
found in Klausner, E. A.; Lavy, E.; Barta, M.; Cserepes, E.;
Friedman, M.; Hoffman, A. 2003 "Novel gastroretentive dosage forms:
evaluation of gastroretentivity and its effect on levodopa in
humans." Pharm. Res. 20, 1466-73, Hoffman, A.; Stepensky, D.; Lavy,
E.; Eyal, S. Klausner, E.; Friedman, M. 2004 "Pharmacokinetic and
pharmacodynamic aspects of gastroretentive dosage forms" Int. J.
Pharm. 11, 141-53, Streubel, A.; Siepmann, J.; Bodmeier, R.; 2006
"Gastroretentive drug delivery systems" Expert Opin. Drug Deliver.
3, 217-3, and Chavanpatil, M. D.; Jain, P.; Chaudhari, S.; Shear,
R.; Vavia, P. R. "Novel sustained release, swellable and
bioadhesive gastroretentive drug delivery system for olfoxacin"
Int. J. Pharm. 2006 epub March 24. Expandable, floating and
bioadhesive techniques may be utilized to maximize absorption of
the compounds of the invention.
[0333] Intranasal administration may utilize an aerosol suspension
of respirable particles comprised of the compounds of the
invention, which the subject inhales. The compound of the invention
are absorbed into the bloodstream via pulmonary absorption or
contact the lacrimal tissues via nasolacrimal ducts, and
subsequently be delivered to the retinal tissues in a
pharmaceutically effective amount. The respirable particles may be
solid or liquid, with suitably sized particles, as is known in the
art to be effective for absorption. Compositions for inhalation or
insufflation include solutions and suspensions in pharmaceutically
acceptable, aqueous or organic solvents, or mixtures thereof, and
powders. The liquid or solid compositions may contain suitable
pharmaceutically acceptable excipients as described supra.
Preferably the compositions are administered by the oral or nasal
respiratory route for local or systemic effect. Compositions in
preferably pharmaceutically acceptable solvents may be nebulized by
use of inert gases. Nebulized solutions may be inhaled directly
from the nebulizing device or the nebulizing device may be attached
to a face mask tent, or intermittent positive pressure breathing
machine. Solution, suspension, or powder compositions may be
administered, preferably orally or nasally, from devices that
deliver the formulation in an appropriate manner.
[0334] For transdermal administration, any suitable formulation
known in the art may be utilized, either as a solution, drop,
suspension, gel, powder, cream, oil, solids, dimethylsulfoxide
(DMSO)-based solutions or liposomal formulation for use in a patch
or other delivery system known in the art. The pharmaceutical
compositions also may comprise suitable solid or gel phase carriers
or excipients, which are compounds that allow increased penetration
of, or assist in the delivery of, therapeutic molecules across the
stratum corneum permeability barrier of the skin. There are many of
these penetration-enhancing molecules known to those trained in the
art of topical formulation. Examples of such carriers and
excipients include, but are not limited to, humectants (e.g.,
urea), glycols (e.g., propylene glycol), alcohols (e.g., ethanol),
fatty acids (e.g., oleic acid), surfactants (e.g., isopropyl
myristate and sodium lauryl sulfate), pyrrolidones, glycerol
monolaurate, sulfoxides, terpenes (e.g., menthol), amines, amides,
alkanes, alkanols, water, calcium carbonate, calcium phosphate,
various sugars, starches, cellulose derivatives, gelatin, and
polymers such as polyethylene glycols. The construction and use of
transdermal patches for the delivery of pharmaceutical agents is
well known in the art. See, e.g., U.S. Pat. Nos. 5,023,252,
4,992,445 and 5,001,139. Such patches may be constructed for
continuous, pulsatile, or on demand delivery of pharmaceutical
agents.
[0335] For topical administration, all the formulations for topical
ocular administration used in the field of ophthalmology (e.g., eye
drops, inserts, eye packs, impregnated contact lenses, pump
delivery systems, dimethylsulfoxide (DMSO)-based solutions
suspensions, liposomes, and eye ointment) and all the formulations
for external use in the fields of dermatology and otolaryngology
(e.g., ointment, cream, gel, powder, salve, lotion, crystalline
forms, foam, and spray) may be utilized as is known in the art. In
some embodiments, the extraordinary solubility of some of the LFA-1
antagonists of the invention permit concentrated solution
formulations which can then deliver therapeutically relevant doses
to regions of the eye. Additionally all suitable formulations for
topical administration to skin and mucus membranes of the nasal
passages may be utilized to deliver the compounds of the invention.
The pharmaceutical compositions of the present invention may be a
liposomal formulation for topical or oral administration, any of
which are known in the art to be suitable for the purpose of this
invention.
[0336] Lubricants which can be used to form pharmaceutical
compositions and dosage forms of the invention include, but are not
limited to, calcium stearate, magnesium stearate, mineral oil,
light mineral oil, glycerin, sorbitol, mannitol, polyethylene
glycol, other glycols, stearic acid, sodium lauryl sulfate, talc,
hydrogenated vegetable oil (e.g., peanut oil, cottonseed oil,
sunflower oil, sesame oil, olive oil, corn oil, and soybean oil),
zinc stearate, ethyl oleate, ethyl laureate, agar, or mixtures
thereof. Additional lubricants include, for example, a syloid
silica gel, a coagulated aerosol of synthetic silica, or mixtures
thereof. A lubricant can optionally be added, in an amount of less
than about 1 weight percent of the pharmaceutical composition.
[0337] Skin protecting agents are agents that protect the skin
against-chemical irritants and/or physical irritants, e.g., UV
light, including sunscreens, anti-acne additives, anti-wrinkle and
anti-skin atrophy agents. Suitable sunscreens as skin protecting
agents include 2-ethylhexyl p-methoxycinnamate, 2-ethylhexyl
N,N-dimethyl-p-aminobenzoate, p-aminobenzoic acid,
2-phenylbenzimidazole-5-sulfonic acid, octocrylene, oxybenzone,
homomethyl salicylate, octyl salicylate,
4,4'-methoxy-t-butyldibenzoylmethane, 4-isopropy dibenzoylmethane,
3-benzylidene camphor, 3-(4-methylbenzylidene) camphor,
anthanilates, ultrafine titanium dioxide, zinc oxide, iron oxide,
silica, 4-N,N-(2-ethylhexyl)methylaminobenzoic acid ester of
2,4-dihydroxybenzophenone, 4-N,N-(2-ethylhexyl)-methylaminobenzoic
acid ester with 4-hydroxydibenzoylmethane,
4-N,N-(2-ethylhexyl)-methylaminobenzoic acid ester of
2-hydroxy-4-(2-hydroxyethoxy)benzophenone and
4-N,N(2-ethylhexyl)-methylaminobenzoic acid ester of
4-(2-hydroxyethoxy)dibenzoylmethane. Suitable anti-acne agents
include salicylic acid; 5-octanoyl salicylic acid; resorcinol;
retinoids such as retinoic acid and its derivatives;
sulfur-containing D and L amino acids other than cysteine; lipoic
acid; antibiotics and antimicrobials such as benzoyl peroxide,
octopirox, tetracycline, 2,4,4'-trichloro-2'-hydroxydiphenyl ether,
3,4,4'-trichlorobanilide, azelaic acid, phenoxyethanol,
phenoxypropanol, phenoxisopropanol, ethyl acetate, clindamycin and
melclocycline; flavonoids; and bile salts such as scymnol sulfate,
deoxycholate and cholate. Examples of anti-wrinkle and anti-skin
atrophy agents are retinoic acid and its derivatives, retinol,
retinyl esters, salicylic acid and its derivatives,
sulfur-containing D and L amino acids except cysteine,
alpha-hydroxy acids (e.g., glycolic acid and lactic acid), phytic
acid, lipoic acid and lysophosphatidic acid.
[0338] The formulations may also contain irritation-mitigating
additives to minimize or eliminate the possibility of skin
irritation or skin damage resulting from the other components of
the composition. Suitable irritation-mitigating additives include,
for example: -tocopherol; monoamine oxidase inhibitors,
particularly phenyl alcohols such as 2-phenyl-1-ethanol; glycerin;
salicylic acids and salicylates; ascorbic acids and ascorbates;
ionophores such as monensin; amphiphilic amines; ammonium chloride;
N-acetylcysteine; cis-urocanic acid; capsaicin; and chloroquine.
The irritant-mitigating additive, if present, may be incorporated
into the present formulations at a concentration effective to
mitigate irritation or skin damage, typically representing not more
than about 20 wt. %, more typically not more than about 5 wt. %, of
the composition.
[0339] A dry-feel modifier is an agent which when added to an
emulsion, imparts a "dry feel" to the skin when the emulsion dries.
Dry feel modifiers can include talc, kaolin, chalk, zinc oxide,
silicone fluids, inorganic salts such as barium sulfate, surface
treated silica, precipitated silica, fumed silica such as an
Aerosil available from Degussa Inc. of New York, N.Y. U.S.A.
Another dry feel modifier is an epichlorohydrin cross-linked
glyceryl starch of the type that is disclosed in U.S. Pat. No.
6,488,916.
[0340] Other agents may also be added, such as antimicrobial
agents, to prevent spoilage upon storage, i.e., to inhibit growth
of microbes such as yeasts and molds. Suitable antimicrobial agents
are typically selected from the group consisting of the methyl and
propyl esters of p-hydroxybenzoic acid (i.e., methyl and propyl
paraben), sodium benzoate, sorbic acid, imidurea, purite,
peroxides, perborates and combinations thereof.
[0341] The formulation may also contain an aesthetic agent.
Examples of aesthetic agents include fragrances, pigments,
colorants, essential oils, skin sensates and astringents. Suitable
aesthetic agents include clove oil, menthol, camphor, eucalyptus
oil, eugenol, methyl lactate, bisabolol, witch hazel distillate
(preferred) and green tea extract (preferred).
[0342] Fragrances are aromatic substances which can impart an
aesthetically pleasing aroma to the sunscreen composition. Typical
fragrances include aromatic materials extracted from botanical
sources (i.e., rose petals, gardenia blossoms, jasmine flowers,
etc.) which can be used alone or in any combination to create
essential oils. Alternatively, alcoholic extracts may be prepared
for compounding fragrances. However, due to the relatively high
costs of obtaining fragrances from natural substances, the modern
trend is to use synthetically prepared fragrances, particularly in
high-volume products. One or more fragrances can optionally be
included in the sunscreen composition in an amount ranging from
about 0.001 to about 5 weight percent, preferably about 0.01 to
about 0.5 percent by weight. Additional preservatives may also be
used if desired and include well known preservative compositions
such as benzyl alcohol, phenyl ethyl alcohol and benzoic acid,
diazolydinyl, urea, chlorphenesin, iodopropynyl and butyl
carbamate, among others.
[0343] It is envisioned additionally, that the compounds of the
invention may be attached releasably to biocompatible polymers for
use in sustained release formulations on, in or attached to inserts
for topical, intraocular, periocular, or systemic administration.
The controlled release from a biocompatible polymer may be utilized
with a water soluble polymer to form a instillable formulation, as
well. The controlled release from a biocompatible polymer, such as
for example, PLGA microspheres, microparticles or nanoparticles,
may be utilized in a formulation suitable for intra ocular
implantation or injection for sustained release administration, as
well Any suitable biodegradable and biocompatible polymer or matrix
may be used.
[0344] Eye drops may be prepared by dissolving the active
ingredient in a sterile aqueous solution such as physiological
saline, buffering solution, etc., or by combining powder
compositions to be dissolved before use. Other vehicles may be
chosen, as is known in the art, including but not limited to:
balance salt solution, saline solution, water soluble polyethers
such as polyethyene glycol, polyvinyls, such as polyvinyl alcohol
and povidone, cellulose derivatives such as methylcellulose and
hydroxypropyl methylcellulose, petroleum derivatives such as
mineral oil and white petrolatum, animal fats such as lanolin,
polymers of acrylic acid such as carboxypolymethylene gel,
vegetable fats such as peanut oil and polysaccharides such as
dextrans, and glycosaminoglycans such as sodium hyaluronate. If
desired, additives ordinarily used in the eye drops can be added.
Such additives include isotonizing agents (e.g., sodium chloride,
etc.), buffer agent (e.g., boric acid, sodium monohydrogen
phosphate, sodium dihydrogen phosphate, etc.), preservatives (e.g.,
benzalkonium chloride, benzethonium chloride, chlorobutanol, etc.),
thickeners (e.g., saccharide such as lactose, mannitol, maltose,
etc.; e.g., hyaluronic acid or its salt such as sodium hyaluronate,
potassium hyaluronate, etc.; e.g., mucopolysaccharide such as
chondroitin sulfate, etc.; e.g., sodium polyacrylate, carboxyvinyl
polymer, crosslinked polyacrylate, polyvinyl alcohol, polyvinyl
pyrrolidone, methyl cellulose, hydroxy propyl methylcellulose,
hydroxyethyl cellulose, carboxymethyl cellulose, hydroxy propyl
cellulose or other agents known to those skilled in the art).
[0345] The solubility of the components of the present compositions
may be enhanced by a surfactant or other appropriate co-solvent in
the composition. Such cosolvents include polysorbate 20, 60, and
80, Pluronic F68, F-84 and P-103, cyclodextrin, or other agents
known to those skilled in the art. Such co-solvents may be employed
at a level of from about 0.01% to 2% by weight.
[0346] The composition of the invention can be formulated as a
sterile unit dose type containing no preservatives.
[0347] The compositions of the invention may be packaged in
multidose form. Preservatives may be preferred to prevent microbial
contamination during use. Suitable preservatives include:
benzalkonium chloride, thimerosal, chlorobutanol, methyl paraben,
propyl paraben, phenylethyl alcohol, edetate disodium, sorbic acid,
sodium perborate, Onamer M, or other agents known to those skilled
in the art. In the prior art ophthalmic products, such
preservatives may be employed at a level of from 0.004% to 0.02%.
In the compositions of the present application the preservative,
preferably benzalkonium chloride, may be employed at a level of
from 0.001% to less than 0.01%, e.g. from 0.001% to 0.008%,
preferably about 0.005% by weight. It has been found that a
concentration of benzalkonium chloride of 0.005% may be sufficient
to preserve the compositions of the present invention from
microbial attack.
[0348] The amount of administration and the number of
administrations of the active ingredient used in the present
invention vary according to sex, age and body weight of subject,
symptoms to be treated, desirable therapeutic effects,
administration routes and period of treatment. For eye drops for an
adult, the formulations containing the compounds of the invention
may range in concentration from about 0.0001 to 10.0 W/v %, about
0.005 to 10.0 W/v %, about 0.01 to 10.0 W/v %, about 0.05 to 10.0
W/v %, about 0.1 to 10.0 W/v %, about 0.5 to 10.0 W/v %, about 1.0
to 10.0 W/v %, about 20 to 10.0 W/V %, about 3.0 to 10.0 W/V %,
about 4.0 to 10.0 W/V %, or about 5.0 to 10.0 W/V %. One embodiment
of the invention has a formulation of about 1.0 to 10.0 W/V % of
the compounds of the invention. One embodiment of the invention has
a formulation of about 0.01 to 10.0 W/V % of the compounds of the
invention. One embodiment of the invention has a formulation of
about 5.0 to 10.0 W/V % of the compounds of the invention. The
administration may be administered several times a day per eye,
preferably one to ten times, more preferably one to four times,
most preferably once a day. The size of the drop administered may
be in the range of about 10-100 .mu.l, about 10-90 .mu.l, about
10-80 .mu.l, about 10-70 .mu.l, about 10-60 .mu.l, about 10-50
.mu.l, about 10-40 .mu.l, about 10-30 .mu.l, about 20-100 .mu.l,
about 20-90 .mu.l, about 20-80 .mu.l, about 20-70 .mu.l, about
20-60 .mu.l, about 20-50 .mu.l, about 20-40 .mu.l, or about 20-30
.mu.l. One embodiment of the invention administers a drop in the
range of about 10 to about 30 .mu.l. One embodiment of the
invention administers a drop in the range of about 10 to about 100
.mu.l. One embodiment of the invention administers a drop in the
range of about 20 to about 50 .mu.l. One embodiment of the
invention administers a drop in the range of about 20 to about 40
.mu.l. One embodiment of the invention administers a drop in the
range of about 10 to about 60 .mu.l.
[0349] The formulations of the invention may be administered
several drops per time, one to four drops, preferably one to three
drops, more preferably one to two drops, and most preferably one
drop per day. In one embodiment, the formulations of the invention
are administered about one drop per time and one time per day.
[0350] In formulations for ointment, cream, lotion or spray, the
concentration of the compounds of the invention in the formulations
may range about 0.0001 10.0 W/V %, about 0.005 to 10.0 W/V %, about
0.01 to 10.0 W/V %, about 0.05 to 10.0 W/V %, about 0.1 to 10.0 W/V
%, about 0.5 to 10.0 W/V %, about 1.0 to 10.0 W/V %, about 20 to
10.0 W/V %, about 3.0 to 10.0 W/V %, about 4.0 to 10.0 W/V %, or
about 5.0 to 10.0 W/V %. One embodiment of the invention has a
formulation of about 1.0 to 10.0 W/V % of the compounds of the
invention. One embodiment of the invention has a formulation of
about 0.01 to 10.0 W/V % of the compounds of the invention. One
embodiment of the invention has a formulation of about 5.0 to 10.0
W/V % of the compounds of the invention. These formulations may be
applied or sprayed several times a day, preferably one to six
times, more preferably one to four times, and most preferably once
a day. The compounding ratio of each ingredient may be suitably
increased or decreased based on the degree of inflammations or
infections.
[0351] The formulations of the invention can further include other
pharmacological active ingredients as far as they do not contradict
the purpose of the present invention. In a combination of plural
active ingredients, their respective contents may be suitably
increased or decreased in consideration of their effects and
safety.
V. Kits
[0352] The invention also provides kits. The kits include a
compound of the invention in suitable packaging, and written
material that can include instructions for use, discussion of
clinical studies, listing of side effects, and the like. The kit
may further contain another therapeutic agent that is
co-administered with the LFA-1 antagonist of the invention. In some
embodiments, the therapeutic agent and the LFA-1 antagonist of the
invention are provided as separate compositions in separate
containers within the kit. In some embodiments, the therapeutic
agent and the LFA-1 antagonist of the invention are provided as a
single composition within a container in the kit. Suitable
packaging and additional articles for use (e.g., measuring cup for
liquid preparations, foil wrapping to minimize exposure to air,
dispensers, and the like) are known in the art and may be included
in the kit.
VI. Examples
Example 1
Affinity Measurements
[0353] The affinities of the small molecules for LFA-1 were
measured using fluorescence polarization (FP) in a competitive
format with a small molecule antagonist, compound 1 (FIG. 2), as
previously described. All measurements were performed in buffer
containing 50 mM Hepes, pH 7.2, 150 mM NaCl, 0.05% n-octyglucoside
and 0.05% bovine gamma globulins (BGG) and either 1 mM MnCl.sub.2,
or 1 mM CaCl.sub.2 and 1 mM MgCl.sub.2. The affinity of compound 1
for LFA-1 was first measured by addition of 2 nM compound 1 to
serial dilutions of LFA-1 starting from 1 .mu.M in buffer
containing either MnCl.sub.2 or CaCl.sub.2 and MgCl.sub.2.
Competition experiments were performed by addition of serial
dilutions of antagonists to 2 nM compound 1 (using either 3 nM
LFA-1 (in MnCl.sub.2) or 40 nM LFA-1 (in CaCl.sub.2 and
MgCl.sub.2)). In the ICAM-1-Ig competition experiments, the LFA-1
concentrations were reduced to 2 and 20 nM LFA-1 in the two
divalent cation buffer conditions to maximize inhibition by
ICAM-1-Ig. The different LFA-1 concentrations used in the
experiments were taken into account in the affinity calculations
(see below). The solutions were incubated in 96-well black HE96
plates (Molecular Devices, Sunnyvale, Calif.) for 2 hours at
37.degree. C. Fluorescence Polarization (FP) measurements were
performed on an Analyst platereader (Molecular Devices, Sunnyvale,
Calif.) using 485 nm excitation, 530 nm emission and 505 nm
dichroic filters. All raw intensity data were corrected for
background emissions by subtraction of the intensities measured
from the appropriate samples without compound 1. The LFA-1 binding
and antagonist competition data were analyzed using a non linear
least squares fit of a four-parameter equation with KaleidaGraph
software (Synergy Software, Reading, Pa.) to obtain the EC.sub.50
values for the LFA-1 titration and the IC.sub.50 values of the
antagonists. The equation used to fit the data is Y=((A-D)/(1+(X/C)
B))+D, where Y is the assay response, A is Y--value at the upper
asymptote, B is the slope factor, C is the IC.sub.50 or EC.sub.50
and D is Y--the value at the lower asymptote. In general, the data
measured in both the homogeneous FP and heterogeneous ELISA formats
described below, contain relatively large signal to background
ratios and the error estimates in the fits are typically less than
10% of the final value of the fitted parameter. The equilibrium
dissociation constants (K.sub.d) of LFA-1 for compound 1 with and
without A-286982 were calculated using Klotz and Hill analyses. The
affinities (K.sub.i) of the antagonists for LFA-1 were calculated
using the IC.sub.50 values, the K.sub.d of compound 1/LFA-1, and
the concentrations of compound 1 and LFA-1 in the competition
experiments.
Example 2
LFA-1/ICAM-1 and LFA-1/Small Molecule Enzyme-Linked Immunosorbent
Assays (ELISAs)
[0354] (A) Antagonist Competition: Small molecules and sICAM-1 were
assayed for the ability to disrupt binding of ICAM-1-Ig or a
fluorescein-labeled small molecule antagonist, compound 2B, to
LFA-1 in a competitive format. Compound 2B is similar to compound
1, but with a longer linker between the small molecule and
fluorescein to maximize the binding of the anti-fluorescein
detection antibody. 96-well plates were coated with 5 .mu.g/ml
(33.3 nM) mouse anti-human .beta.2 integrin (a non-function
blocking antibody) in phosphate-buffered saline (PBS) overnight at
4.degree. C. The plates were blocked with assay buffer (20 mM
Hepes, pH 7.2, 140 mM NaCl, 1 mM MnCl.sub.2, 0.5% bovine serum
albumin (BSA) and 0.05% Tween-20) for 1 hour at room temperature.
After washing in buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM
MnCl.sub.2, and 0.05% Tween-20), 8 nM LFA-1 (LFA-1/ICAM-1 ELISA) or
2 nM LFA-1 (LFA-1/small molecule ELISA) were added, followed by
incubation for 1 h at 37.degree. C. The plates were washed, and for
the LFA-1/ICAM-1 ELISA, serial dilutions of the small molecule
antagonists or sICAM-1 were added to the plates for 30 minutes,
followed by addition of 0.89 nM ICAM-1-Ig (final concentration) for
2 hour at 37.degree. C. After an additional wash, goat anti-huIgG
(Fc specific)-HRP was added and incubated for one hour at
37.degree. C. In the LFA-1/small molecule ELISA, the diluted
antagonists and 25 nM compound 2B were added concurrently to the
plates, followed by a 2-hour incubation at 37.degree. C. Sheep
anti-fluorescein-HRP was added after a wash and incubated for one
hour at 37.degree. C. For both assays, after washing, the bound
HRP-conjugated antibodies were detected by addition of
tetramethylbenzidine (TMB) followed by measurement of the
absorbance of the product at 450 nm after the addition of 1 M
H.sub.3PO.sub.4 to stop the reaction. The IC.sub.50 values for each
curve were determined by fitting to the four-parameter equation
described above using KaleidaGraph software.
[0355] (B) Ligand Binding: The LFA-1/ICAM-1 and LFA-1/small
molecule ELISAs were performed as described above except that
serial dilutions of either ICAM-1-Ig or compound 2B were added to
plates either in the presence or absence of antagonist. In all
cases the ligand was added concurrently with the antagonist. The
plates were incubated for 6 h at 37.degree. C. to approach
equilibrium conditions after antagonist and ligand addition, before
wash and addition of the detection antibody. The EC.sub.50 values
for each curve were determined by fitting with a four parameter
model as described above. The EC.sub.50 values generated in the
presence and absence of antagonist were analyzed by Schild
regression. The Schild plots of Log (Conc. ratio-1) vs. antagonist
concentration are calculated from, (Conc. ratio-1)=((ligand
EC.sub.50 with antagonist)/(ligand EC.sub.50 without
antagonist))-1. The slopes of the plots of the Log (Conc. ratio-1)
vs. Antagonist concentration are calculated by fitting the line to
the linear equation, Y=A+BX.
Example 3
Crosslinking of a Radiolabeled, Photoactivatable Analogue of
Compound 3 to LFA-1
[0356] Full length human membrane-associated LFA-1 or BSA (0.35
mg/mL [1.4 and 5.3 .mu.M, respectively] in 20 mM Hepes, 150 mM
NaCl, 5 mM CaCl.sub.2, 5 mM MgCl.sub.2, 1 mM MnCl.sub.2, and 1%
n-octylglucoside, pH 7.2) was incubated overnight at 37.degree. C.
with 4.1 .mu.M compound 5, a tritium-labeled photoactivatable
analogue of compound 3, in either the presence or absence of 290
.mu.M compound 3. The molar ratio of compound 5 to LFA-1 was 3:1. A
96-well plate precoated with 1% BSA was used for the incubation.
Just prior to crosslinking, excess compound 5 was rapidly removed
by gel filtration with a G-25 microspin column in a 96-well format
equilibrated with the same buffer. The LFA-1/compound 5 complex was
crosslinked by exposure to a high-pressure mercury-vapor lamp (450
watts, Ace glass, Vineland, N.J.). During irradiation, samples were
cooled on ice and protected by a 5-mm thick plate of borosilicate
glass to minimize protein degradation. Residual unlinked compound 5
was removed by gel filtration (G-25) as above. The crosslinked
complex was then denatured in 8 M guanidine hydrochloride (GuHCl)
and reduced and alkylated. The treated proteins were subjected to
SDS-PAGE followed by Coomassie blue staining. Radiolabeled proteins
were visualized by audioradiography.
[0357] To identify compound 5 binding sites, the treated .alpha.L
and .beta.2 subunits were separated by size exclusion
chromatography in the presence of 6 M GuHCl, 20 mM Hepes, 10 mM
EDTA, pH 6.8 and then chemically cleaved with 2.6 M hydroxylamine
in 10% acetic acid with 7 M GuHCl for 4 h at 75.degree. C. The
radiolabeled protein fragments were separated by SDS-PAGE and
either visualized by autoradiography or transferred onto a
polyvinylidene fluoride membrane, stained with Coomassie blue, and
then identified by N-terminal protein sequencing.
Example 4
Generation of the .alpha.L Construct Lacking the I Domain
[0358] The construct used, pLFA.huID..DELTA.p, contains the
sequence of the .alpha.L gene from the Nar1 restriction site 5' of
the I domain to the second PflM1 restriction site 3' of the I
domain in which the first PflM1 restriction site 3' of the I domain
was abolished (Edwards et al. 1995). In order to generate the
mutant lacking the I domain, the following primers were made: the
forward primer
CACTGTGGCGCCCTGGTTTTCAGGAAGGTAGTGGATCAGGCACAAGCAAACAGGACCTGACTTC
(SEQ ID NO 3), containing the sequence from the Nar1 site to the
start of the I domain, a sequence of DNA encoding GSGSG (SEQ ID NO
3) and the 23 bp of the .alpha.L sequence after the end of the I
domain, and the reverse primer TCTGAGCCATGTGCTGGTATCGAGGGGC (SEQ ID
NO 5), which primes at the second PflM1 restriction site after the
I domain. PCR was performed using these primers and the
pLFA.huID..DELTA.p linearized with Bgl II, which cut at a site
within the I domain. A DNA fragment was amplified that contained
the sequence from the Nar 1 site to the second PflM1 site and in
which the entire I domain, from C125 through G311, was replaced
with a DNA sequence encoding GSGSG. This piece of DNA was purified,
digested with Nar1 and PflM1 and inserted into the human .alpha.L
plasmid (pRKLFA.alpha.m) at the corresponding Nar1 and PflM1 sites.
Correct insertion of the DNA sequence encoding GSGSG was confirmed
by sequence analysis.
Example 5
Binding of LFA-1 Lacking the I Domain to ICAM-1 or Compound 2B
[0359] 293 cells were transfected with the P2 construct alone
(mock) or with either the wild-type .alpha.L construct (wt) or the
.alpha.L construct lacking the I domain (I-less) and allowed to
recover for 3 days. The cells were detached and resuspended in
adhesion buffer (0.02 M HEPES, pH 7.2, 0.14 M NaCl, 0.2% glucose).
Binding to plate bound ICAM-1-Ig was performed as described
(Edwards et al. 1998). For binding of compound 2B, 2.times.10.sup.5
cells were added per well in a round bottom 96-well plate in
adhesion buffer containing 0.5% BGG, 0.1 mM MnCl.sub.2,
1.quadrature.g/ml anti-.beta.2 activating antibody MEM-48 and 1
.mu.M compound 2B. The cells were incubated for 1 hour at
37.degree. C., washed with cold PBS and fixed with 1%
formaldehyde/PBS. The cells were then incubated with a 1:500
dilution of sheep anti-fluorescein-HRP for 1 hour at room
temperature, washed with PBS and incubated with TMB for 15 minutes.
The reaction was stopped with 1 M H.sub.3PO.sub.4 and read at 450
nm. In parallel, the transfectants were tested for the structural
integrity of the surface-expressed .alpha.L/.beta.2 complexes and
for the presence or absence of the I domain by FACS analysis using
a panel of antibodies with known binding epitopes.
Example 6
Streptozotocin-Induced Rat Diabetic Retinopathy Model
[0360] 15 adult laboratory rats (Sprague-Dawley) are injected
intraperitoneally on day 1 with strepozocin (SZT), 65 mg/kg, to
render them hyperglycemic and to induce diabetes. 5 additional rats
are treated with a similar volume of saline, to create a
non-diabetic control group. Daily thereafter for a total of 6 days,
8 of the diabetic rats receive an instillation of an LFA-1
antagonist in a suitable carrier vehicle in each eye. 7 of the
diabetic animals receive similar instillations of the same volume
of carrier vehicle alone, according to the same dosage schedule.
Animals of the non-diabetic control group receive instillations of
carrier vehicle alone, and remain normogylcemic.
[0361] On day 14, the eyes of all animals are examined by
fluorescein angiography all animals from the three groups are then
sacrificed, and their eyes surgically removed and retinal tissue is
isolated from them. The retinal tissue is examined by
micropictograph. The extent to which microvasculature abnormalities
develops in the corneal tissue of the diabetic control, their
inhibition by administration of LFA-1 antagonist in the diabetic
treatment group, and comparison to the normoglyemic control group
are quantified by standardized morphometric analysis of the
photomicrographs.
Example 7
Human T-Cell Adhesion Assay
[0362] The T-cell adhesion assay was performed using the human
T-lymphoid cell line HuT 78 (ATCC TIB-161). Goat anti-HuIgG(Fc) was
diluted to 2 .mu.g/ml in PBS and 96-well plates were coated with 50
.mu.l/well at 37.degree. C. for 1 h. Plates were washed with PBS
and blocked for 1 h at room temperature with 1% BSA in PBS. 5
domain ICAM-Ig was diluted to 100 ng/ml in PBS and 50 .mu.l/well
was added to the plates O/N at 4.degree. C. HuT 78 cells were
centrifuged at 100 g and the cell pellet was treated with 5 mM EDTA
for .about.5' at 37.degree. C. in a 5% CO.sub.2 incubator. Cells
were washed in 0.14 M NaCl, 0.02 M Hepes, 0.2% glucose and 0.1 mM
MnCl.sub.2 (assay buffer) and centrifuged. The cells were
resuspended in assay buffer to 3.0.times.10.sup.6 c/ml. Inhibitors
were diluted in assay buffer to a 2.times. final concentration and
pre-incubated with HuT78 cells for 30' at room temperature. 100
.mu.l/well of cells and inhibitors were added to the plates and
incubated at room temperature for 1 h. 100 .mu.l/well PBS was added
and the plates were sealed and centrifuged inverted at 100 g for
5'. Unattached cells were flicked out of the plate and excess PBS
was blotted on a paper towel. 60 .mu.l/well p-nitrophenyl
n-acetyl-.beta.-D-glucosaminide (0.257 g to 100 ml citrate buffer)
was added to the plate and incubated for 1.5 h at 37.degree. C. The
enzyme reaction was stopped with 90 .mu.l/well 50 mM glycine/5 mM
EDTA and read on a platereader at 405 nM. HUT 78 cell adhesion to
5dICAM-Ig was measured using the p-nitrophenyl
n-acetyl-.beta.-D-glucosaminide method of Landegren, U. (1984). J.
Immunol. Methods 57, 379-388. The results are shown in Table 1.
TABLE-US-00001 TABLE 1 Adhesion assays results and solubility
results for selected directly competitive LFA-1 antagonists of the
invention. Compound Hut78 # Structure (EC.sub.50) Solubility 1
##STR00093## ** 2 ##STR00094## **** +++ 3 ##STR00095## **** 4
##STR00096## *** 5 ##STR00097## **** 6 ##STR00098## **** +++ 7
##STR00099## **** 8 ##STR00100## *** 9 ##STR00101## **** ++ 10
##STR00102## +++ 11 ##STR00103## * 12 ##STR00104## **** +++ 13
##STR00105## **** 14 ##STR00106## **** 15 ##STR00107## **** +++ 16
##STR00108## **** +++ 17 ##STR00109## **** 18 ##STR00110## **** 19
##STR00111## **** ++ 20 ##STR00112## **** +++ 21 ##STR00113## ****
+++ 22 ##STR00114## **** 23 ##STR00115## **** 24 ##STR00116## ***
25 ##STR00117## **** +++ 26 ##STR00118## **** 27 ##STR00119## ****
+++ 28 ##STR00120## **** 29 ##STR00121## * +++ 30 ##STR00122## ****
31 ##STR00123## **** ++ 32 ##STR00124## **** ++ 33 ##STR00125##
**** 34 ##STR00126## **** 35 ##STR00127## **** +++ 36 ##STR00128##
**** ++ 37 ##STR00129## *** 38 ##STR00130## **** 39 ##STR00131##
**** 40 ##STR00132## ** 41 ##STR00133## **** +++ 42 ##STR00134## *
+++ 43 ##STR00135## **** 44 ##STR00136## **** +++ 45 ##STR00137##
**** +++ 46 ##STR00138## *** +++ 47 ##STR00139## **** 48
##STR00140## **** 49 ##STR00141## *** The scale in the table
represents EC.sub.50 values as follows: *represents 3 .mu.M or
less, **represents 300 nM or less, ***represents 100 nM or less,
and ****represents 50 nM or less. The scale in the table represents
Solubility values as follows: +represents greater than 10 mg/mL,
++represents greater than 50 mg/mL, and +++represents greater than
100 mg/mL.
Example 8
In-Vitro Inhibition of Antigen Stimulated Release of Cytokines From
Human Peripheral Blood Monocytes (PBMC)
[0363] A directly competitive LFA-1 antagonist of the invention was
evaluated for its ability to inhibit release of inflammatory
cytokines, in human mononucleocytes (PBMC) stimulated with
staphylococcal enterotoxin B (SEB). Stock solutions of antagonist,
Rebamipide (a mucosal protective agent), and Cyclosporin A (CsA)
were prepared in culture media and dilutions were prepared by
addition of culture media to achieve the desired concentration.
Negative controls were prepared without SEB stimulation. SEB
stimulation with vehicle (0.25% DMSO/media) was used as the
positive control.
[0364] Human PBMC, frozen in cryopreservation media were thawed,
washed with RPMI culture media containing 10% FBS in growth media
and seeded onto a 96 well plate at 20,000 cells/well containing 180
.mu.l culture media. Cells were incubated in the presence of
antagonist, Rebamipide or CsA at 37 C for 1 hour prior to
stimulation with SEB. SEB was added at 1 ng/ml and cell
supernatants were harvested at 6, 16, and 48 hours. Cytokine levels
in the assay supernatants were determined using a Luminex multiplex
assay.
[0365] The antagonist demonstrated potent inhibition of the release
of inflammatory cytokines, particularly the T-cell regulating
cytokines, IL-2 and IL-4, with increasing dose. The results are
shown in Tables 2, 3, and 4 and graphically represented in FIG. 11.
The pattern of cytokine release inhibited by more than 50% with the
directly competitive LFA-1 antagonist is similar to that seen in
comparison with CsA. The exceptions to this similarity, IL-3, Il-6,
and IL-12p40, have not been shown to be important to T-cell
mediated inflammation.
TABLE-US-00002 TABLE 2 EC50 Concentrations for Inhibition of IL-2,
IFN.gamma., MIP-1.alpha., and TNF-.alpha.. EC50 .mu.M Cytokine
Release IL-2 IFN.gamma. MIP-1.alpha. TNF-.alpha. LFA-antagonist
0.0018 0.0016 0.020 0.076 Rebamipide >1000 >1000 >1000
>1000 Cyclosporine A 0.00094 0.00050 0.0011 0.00049
TABLE-US-00003 TABLE 3 EC50 Concentrations for Inhibition of IL-4,
IL-10, IP-10, GM-CSF and MCP-1. EC50 .mu.M Cytokine Release IL-4
IL-10 IP-10 GM-CSF MCP-1 LFA-1 antagonist 0.143 0.147 1.158 0.545
0.0050 Rebamipide >1000 >1000 >1000 >1000 >1000
Cyclosporine A 0.0063 0.0292 0.167 0.0202 0.0926
TABLE-US-00004 TABLE 4 EC50 Concentrations for Inhibition of
IL-1.alpha., IL-1.beta., IL-3, IL-5, IL-6, IL-12p40, and IL-13.
EC50 .mu.M Cytokine Release IL-1.alpha. IL-1.beta. IL-3 IL-5 IL-6
IL-12p40 IL-13 LFA-1 antagonist 0.24 0.36 52.23 0.11 43.51 >1000
0.36 Rebamipide >1000 >1000 >1000 >1000 >1000
>1000 >1000 Cyclosporine A 0.002 0.003 0.002 0.073 0.001
0.002 0.074
Example 9
Formulations of an LFA-1 Antagonist
[0366] A directly competitive LFA-1 antagonist of the invention was
formulated in several compositions for administration as gels,
lotions, ointments, and solutions, for administration by varying
routes, including but not limited to topical, via instillation,
aerosol, transdermal patch, via insert, or oral administration.
TABLE-US-00005 TABLE 5 Gel Formulations 1 and 2 of LFA-1
Antagonist. Formulation 1 (% w/w) Formulation 2 (% w/w) LFA-1
antagonist LFA-1 antagonist 15% Dimethyl Isosorbide 15% Dimethyl
Isosorbide 25% Transcutol 25% Transcutol 12% Hexylene glycol 12%
Hexylene glycol 5% Propylene Glycol 5% Propylene Glycol 0.15%
Methylparaben 0.15% Methylparaben 0.05% Propylparaben 0.05%
Propylparaben 0.01% EDTA 0.01% EDTA 0.5% Penmulen TR-1 1%
Hydroxyethyl Cellulose q.s. pH 6.0 25% Trolamine q.s. pH 4.5 25%
Trolamine q.s. 100 Water q.s. 100 Water
TABLE-US-00006 TABLE 6 Lotion Formulations 3 and 4 of LFA-1
Antagonist. Formulation 3 (% w/w) Formulation 4 (% w/w) 1% LFA-1
Antagonist 1% LFA-1 Antagonist 13% Dimethyl Isosorbide 13% Dimethyl
Isosorbide 20% Transcutol 20% Transcutol 10% Hexylene glycol 10%
Hexylene glycol 4% Propylene Glycol 4% Propylene Glycol 0.15%
Methylparaben 0.15% Methylparaben 0.05% Propylparaben 0.05%
Propylparaben 0.01% EDTA 0.01% EDTA 0.5% Carbopol Ultrez 10 0.3%
Carbopol Ultrez 10 0.2% Penmulen TR-1 0.2% Penmulen TR-1 3%
Isopropyl Myristate 2% Cetyl Alcohol 5% Olelyl Alcohol 5.5% Light
Mineral Oil 5% White Petrolatum 5% Oleic Acid 0.02% Butylated
Hydroxytoluene 0.02% Butylated Hydroxytoluene q.s. pH 6.0 25%
Trolamine q.s. pH 6.0 25% Trolamine q.s. 100 Water q.s. 100
Water
TABLE-US-00007 TABLE 7 Ointment Formulations 5 and 6 of LFA-1
Antagonist. Formulation 5 (% w/w) Formulation 6 (% w/w) 1% LFA-1
Antagonist 1% LFA-1 Antagonist 15% PEG 400 10% Dimethyl Isosorbide
0.02% Butylated Hydroxytoluene 0.02% Butylated Hydroxytoluene 2%
Span 80 2% Span 80 10% White Wax 10% White Wax 71.98% White
Petrolatum 76.98% White Petrolatum
TABLE-US-00008 TABLE 8 Solution Formulations 7, 8, and 9 of LFA-1
Antagonist. Formulation 9 Formulation 7 (% w/w) Formulation 8 (%
w/w) (% w/w) 1% LFA-1 Antagonist 1% LFA-1 Antagonist 1% LFA-1
Antagonist 15% Dimethyl Isosorbide 15% Dimethyl Isosorbide 99%
Dimethyl Sulfoxide 25% Transcutol 25% Transcutol 12% Hexylene
glycol 12% Hexylene glycol 5% Propylene Glycol 5% Propylene Glycol
q.s. pH 4.5 25% Trolamine q.s. pH 6.0 25% Trolamine q.s. 100 Water
q.s. 100 Water
TABLE-US-00009 TABLE 9 Solution Formulations 10, 11, 12, 13 and 14
of LFA-1 Antagonist. W/W % Formulation Formulation Formulation
Formulation Formulation 10 11 12 13 14 LFA-1 Antagonist 0.1% 0.3%
1% 3% 5% Sodium Bicarbonate 0.015% 0.046% 0.15% 0.46% 0.77% 0.1%
EDTA 0.12% Sodium Phosphate, Monobasic 0.4% Methylparaben 0.02%
Propylparaben q.s. Osmolality 270, Sodium Chloride q.s. pH 7.0 1%
Sodium Hydroxide q.s. pH 7.0 1% HCl q.s. Water
TABLE-US-00010 TABLE 10 Solution Formulation 15 of LFA-1
Antagonist. Formulation 15 1 ml of a solution of LFA-1 Antagonist
10% W/W in water, plus 0.158 mmol sodium bicarbonate Dilute with 9
ml PBS
Example 10
In-Vitro pPercutaneous Absorption of a Directly Competitive
Antagonist of LFA-1 of the Invention Following Topical
Application
[0367] Bioavailability following topical application in-vivo was
assessed using in-vito percutaneous absorption test methods, using
procedures adapted from Skelly et al., Pharmaceutical Research 1987
4(3): 265-276, "FDA and AAPS Report of the Workshop on Principles
and Practices of In-Vitro Percutaneous Penetration Studies:
Relevance to Bioavailability and Bioequivalence".
[0368] Formulations 1-9 were applied to dermatomed human skin
tissue excised from a single donor in a single clinically relevant
dose of 5 mg/cm.sup.2, which is equivalent to a 30-35 .mu.g dose.
The thickness of the tissue ranges form 0.023 to 0.039 inches
(0.584 to 0.991 mm) with a mean+/-standard deviation in thickness
of 0.030+/-0.004 inches (0.773+/-0.111 mm) and a coefficient of
variation of 14.4%. The tissue samples were mounted in Bronaugh
flow-through diffusion cells. The cells were maintained at a
constant temperature of 32.degree. C. using recirculating water
baths. The cells have a nominal diffusion area of 0.64 cm.sup.2.
PBS, at pH 7.4, with 0.1% sodium azide and 4% Bovine Serum Albumin
was used as the receptor phase below the mounted tissue. Fresh
receptor phase was continuously pumped under the tissue at a flow
rate of nominally 1.0 ml/hr and collected in 6 hour intervals. The
receptor phases were collected for analysis.
[0369] The tissue samples were exposed to Formulations 1-9 for 24
hours. The excess formulation residing on the strateum corneum at
that timepoint was removed by tape-stripping with CuDerm D-Squame
stripping discs. The tape strips were discarded. The epidermis and
dermis were separated by blunt dissection. Epidermis, dermis and
receptor phase were analyzed for content of LFA-1 Antagonist. The
results are represented in Table 11.
[0370] Tissue permeation levels (the receptor phase) of LFA-1
Antagonist for all formulations except for Formulation 9, which
contained 99% DMSO, were below the limits of quantitation, which
was 0.54 ng/ml (which is equivalent to 0.013% of the applied dose).
Formulation 9, in contrast, provided 1.4% of the applied dose,
permeating through all the layers of the skin tissue over the
exposure period of 24 hours.
[0371] Epidermal deposition of LFA-1 Antagonist over the 24 hour
exposure period was very high and consistent with a large
percentage of the applied dose being retained in the upper layers
of the epidermis. The levels reported in Table 10 were obtained
from small volume samples, which could not be re-assayed, and thus
are considered underestimates of the amount of drug present in the
epidermis.
[0372] Analytical data for the dermis fell within the linearity
range established for LFA-1 Antagonist, and are quantitative.
Dermal deposition of LFA-1 Antagonist following a 24 hour exposure
ranged from 0.66% (Formulation 6, 0.258 .mu.g/cm.sup.2) to 4.4%
(Formulation 7, 34.3 .mu.g/cm.sup.2) of the applied dose. The
concentration of LFA-1 Antagonist in the dermis is calculated as
6.7 .mu.M (Formulation 6) or greater (i.e., Formulation 7 provides
a concentration in the dermis of 54.1 .mu.M) for Formulations 1 to
9 in the dermis. These concentrations are well above the in-vitro
EC50 concentration for half maximal effect in inhibiting release of
inflammatory cytokines by the class of LFA-1 antagonists shown in
Example 7 and corresponding Table 1. These results are therefore
predictive for the ability of a variety of formulations, which
incorporate 1% W/W LFA-1 Antagonist, to provide therapeutically
effective levels of in-vivo inhibition of cytokine release.
TABLE-US-00011 TABLE 11 Cumulative Receptor Phase and Tissue Levels
of LFA-1 Antagonist After 24 Hours of Topical Exposure. Receptor
Phase Content at 24 hours Epidermis Dermis % Dose % Dose % Dose
Formulation # .mu.g/cm.sup.2 Applied .mu.g/cm.sup.2 Applied
.mu.g/cm.sup.2 .mu.g/ml Applied 1 Mean <Limit of Quantitation
3.93 7.48 1.14 18.8 2.15 SD.sup.1 2.92 5.50 0.91 14.9 1.73 %
CV.sup.2 74 74 80 80 80 2 Mean <Limit of Quantitation 6.03 11.9
0.750 12.3 1.49 SD 2.56 5.1 0.304 5.0 0.63 % CV 43 42 40 40 42 3
Mean <Limit of Quantitation 6.03 12.1 1.40 23.0 2.74 SD 2.97 6.4
0.27 4.4 0.47 % CV 49 53 19 19 17 4 Mean <Limit of Quantitation
7.92 17.0 0.975 16.0 2.10 SD 3.41 7.2 0.350 5.8 0.75 % CV 43 42 36
36 36 5 Mean <Limit of Quantitation 5.71 14.6 0.670 11.0 1.71 SD
1.73 4.2 0.351 5.8 0.87 % CV 30 29 52 52 51 6 Mean <Limit of
Quantitation 6.47 16.8 0.258 4.25 0.657 SD 1.07 2.7 0.158 2.6 0.394
% CV 17 16 61 61 60 7 Mean <Limit of Quantitation 7.22 15.0 2.08
34.3 4.35 SD 2.15 4.5 0.84 13.7 1.83 % CV 30 30 40 40 42 8 Mean
<Limit of Quantitation 8.58 18.0 1.48 24.3 3.09 SD 3.53 7.7 0.99
16.2 2.07 % CV 41 43 67 67 67 9 Mean 0.660 1.43 5.78 13.2 1.19 19.6
2.63 SD 0.253 0.49 3.18 8.3 0.49 8.1 1.15 % CV 38 34 55 63 41 41 44
.sup.1Standard Deviation. .sup.2Percent Coefficient of
Variation.
Example 11
T-Cell Proliferation Assay
[0373] This assay is an in vitro model of lymphocyte proliferation
resulting from activation, induced by engagement of the T-cell
receptor and LFA-1, upon interaction with antigen presenting cells
(Springer, Nature 346: 425 (1990)).
[0374] Microtiter plates (Nunc 96 well ELISA certified) are
pre-coated overnight at 4.degree. C. with 50 .mu.l of 2 .mu.g/ml of
goat anti-human Fc (Caltag H 10700) and 50 .mu.l of 0.07 .mu.g/ml
monoclonal antibody to CD3 (Immunotech 0178) in sterile PBS. The
next day coat solutions are aspirated. Plates are then washed twice
with PBS and 100 .mu.l of 17 ng/ml 5d-ICAM-1-IgG is added for 4
hours at 37.degree. C. Plates are washed twice with PBS prior to
addition of CD4+ T cells. Lymphocytes from peripheral blood are
separated from heparinized whole blood drawn from healthy donors.
An alternative method is to obtain whole blood from healthy donors
through leukophoresis. Blood is diluted 1:1 with saline, layered
and centrifuged at 2500.times.g for 30 minutes on LSM (6.2 g Ficoll
and 9.4 g sodium diztrizoate per 100 ml) (Organon Technica, N.J.).
Monocytes are depleted using a myeloid cell depletion reagent
method (Myeloclear, Cedarlane Labs, Hornby, Ontario, Canada). PBLs
are resuspended in 90% heat-inactivated Fetal Bovine serum and 10%
DMSO, aliquoted, and stored in liquid nitrogen. After thawing,
cells are resuspended in RPMI 1640 medium (Gibco, Grand Island,
N.Y.) supplemented with 10% heat-inactivated Fetal Bovine serum
(Intergen, Purchase, N.Y.), 1 mM sodium pyruvate, 3 mM L-glutamine,
1 mM nonessential amino acids, 500 .mu.g/ml penicillin, 50 .mu.g/ml
streptomycin, 50 .mu.g/ml gentamycin (Gibco).
[0375] Purification of CD4+ T cells are obtained by negative
selection method (Human CD4 Cell Recovery Column Kit # CL110-5
Accurate). 100,000 purified CD4+ T cells (90% purity) per
microtiter plate well are cultured for 72 hours at 37.degree. C. in
5% CO.sub.2 in 100 ml of culture medium (RPMI 1640 (Gibco)
supplemented with 10% heat inactivated FBS (Intergen), 0.1 mM
non-essential amino acids, 1 nM Sodium Pyruvate, 100 units/ml
Penicillin, 100 .mu.g/ml Streptomycin, 50 .mu.g/ml Gentamicin, 10
mM Hepes and 2 mM Glutamine). Inhibitors are added to the plate at
the initiation of culture. Proliferative responses in these
cultures are measured by addition of 1 .mu.Ci/well titrated
thymidine during the last 6 hours before harvesting of cells.
Incorporation of radioactive label is measured by liquid
scintillation counting (Packard 96 well harvester and counter).
Results are expressed in counts per minute (cpm).
Example 12
In Vitro Mixed Lymphocyte Culture Model
[0376] The mixed lymphocyte culture model, which is an in vitro
model of transplantation (A. J. Cunningham, "Understanding
Immunology, Transplantation Immunology" pages 157-159 (1978)
examines the effects of various LFA-1 antagonists in both the
proliferative and effector arms of the human mixed lymphocyte
response.
[0377] Isolation of Cells: Mononuclear cells from peripheral blood
(PBMC) are separated from heparanized whole blood drawn from
healthy donors. Blood is diluted 1:1 with saline, layered, and
centrifuged at 2500.times.g for 30 minutes on LSM (6.2 g Ficoll and
9.4 g sodium diztrizoate per 100 ml) (Organon Technica, N.J.). An
alternative method is to obtain whole blood from healthy donors
through leukophoresis. PBMCs are separated as above, resuspended in
90% heat inactivated Fetal Bovine serum and 10% DMSO, aliquoted and
stored in liquid nitrogen. After thawing, cells are resuspended in
RPMI 1640 medium (Gibco, Grand Island, N.Y.) supplemented with 10%
heat-inactivated Fetal Bovine serum (Intergen, Purchase, N.Y.), 1
mM sodium pyruvate, 3 mM L-glutamine, 1 mM nonessential amino
acids, 500 .mu.g/ml penicillin, 50 .mu.g/ml streptomycin, 50
.mu.g/ml gentamycin (Gibco).
[0378] Mixed Lymphocyte Response (MLR): One way human mixed
lymphocyte cultures are established are in 96-well flat-bottomed
microtiter plates. 1.5.times.10.sup.5 responder PBMCs are
co-cultured with an equal number of allogeneic irradiated (3000
rads for 3 minutes, 52 seconds stimulator PBMSc in 200 .mu.l of
complete medium. LFA-1 antagonists are added at the initiation of
cultures. Cultures are incubated at 37.degree. C. in 5% CO.sub.2
for 6 days, then pulsed with 1 .mu.Ci/well of 3H-thymidine (6.7
Ci/mmol, NEN, Boston, Mass.) for 6 hours. Cultures are harvested on
a Packard cell harvester (Packard, Canberra, Canada). [.sup.3H] TdR
incorporation is measured by liquid scintillation counting. Results
are expressed as counts per minute (cpm).
Example 13
T-Cell Adhesion Assay Using Jurkat Cells
[0379] The purpose of this study is to evaluate the anti-adhesive
properties of LFA-1 Antagonists on the attachment of Jurkat cells
to ICAM-1 following in vitro exposure.
[0380] Stock solutions of LFA-1 Antagonist and positive control are
prepared in DMSO/water (1:1) and diluted into assay media and
subsequent dilutions are prepared by addition of assay media to
achieve the desired concentration. A reported LFA-1 antagonist is
used as the positive control.
[0381] Jurkat cells are labeled with an 8 .mu.M solution of
BCECF-AM (2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein)
in growth media at room temperature for 15 minutes. Labeled cells
are incubated in 70 mL of assay media in each well of a 96 well
plate at 500,000 cells per well with 70 .mu.L of LFA-1 Antagonist
or positive control in assay media at 37.degree. C. for 30 minutes.
A 100 .mu.L aliquot of this fluorescently labeled Jurkat cell
suspension is allowed to settle in the presence of LFA-1 antagonist
or the positive control in wells of a 96 well plate coated with
recombinant human ICAM-1 expressed as an Fc chimera at 37.degree.
C. for 1 hour. Non-adherent cells are removed by washing and
centrifugation at 100 g for 1 minute. Adherent cells are determined
as adherent fluorescent units on a fluorescent plate reader.
Example 14
Dermal Delivery of a Directly Competitive LFA-1 Antagonist of the
Invention Via Topical Application to the Bloodstream
[0382] A study is performed to determine delivery of a directly
competitive LFA-1 antagonist of the invention via topical
application on the skin, to the bloodstream. Gel (formulated as in
Formulation# 1, Table 5), lotion (formulated as in Formulation #3,
Table 6), ointment (formulated as in Formulation #5, Table 6) and
1% DMSO solution (Control) formulations are evaluated in male
Sprague Dawley rats, as shown in Table 12.
[0383] Dose Administration. Animals are not fasted for this study.
All single and multiple doses are given on a fixed basis (200 .mu.L
formulation/animal/dose). Loaded and empty dose apparatus weights
are recorded for determination of actual formulation weights
administered.
[0384] Dermal. For dermal administration in Groups 1 through 4
(Group 1 (Gel); Group 2 (Ointment); Group 3 (Lotion); Group 4
(DMSO) single day study, data not shown), each animal receives a
single topical application to the dorsal skin on Day 1. For dermal
administration in Groups 6 through 9 (Group 6 (Gel); Group 7
(Ointment); Group 8 (Lotion); Group 9 (DMSO, Dermal)), each animal
receives 3 topical applications given daily (approximately 4 hours
apart) to the dorsal skin for 7 consecutive days.
[0385] Intradermal. For each animal in Group 5 (DMSO, Intradermal),
the single 200-.mu.L intradermal dose is administered on Day 1 as
two, 100-.mu.L injections given sequentially via a syringe and
needle in a shaved area of the subscapular region.
[0386] Sample Collection: Blood (All Groups). For the final dose
administration as applicable based on study group, blood is
collected from each animal predose and at 0.25, 0.5, 1, 2, and 4
hours postdose.
[0387] Sample Collection: Application Sites (Dermal Groups Only).
Following sacrifice for the terminal blood sample, the section of
skin exposed to the test article formulation is excised. The
stratum corneum and any unabsorbed test article formulation
remaining on the surface of the skin is removed by tape stripping.
The strips were combined into one sample vial for each animal, and
the remaining skin section was placed into a second sample vial.
Sample weights were recorded.
TABLE-US-00012 TABLE 12 Doses Administered to Male Sprague Dawley
Rats give Dermal or Intradermal Doses of a Directly Competitive
LFA-1 Antagonist of the Invention in Various Formulations (Groups 5
through 9). Dose Target Nominal Animal Antagonist Dose
Concentration Dose Level Dose Administered Number Formulation Route
(mg/g) (mg/animal) (g/animal).sup.a (mg/animal) (mg/kg) B11704 Gel
1% Dermal 10 2 0.2088 2.09 6.76 B11705 Gel 1% Dermal 10 2 0.2080
2.08 6.69 B11706 Gel 1% Dermal 10 2 0.2079 2.08 6.79 B11707
Ointment 1% Dermal 10 2 0.1669 1.67 5.06 B11708 Ointment 1% Dermal
10 2 0.1722 1.72 5.63 B11709 Ointment 1% Dermal 10 2 0.1744 1.74
5.64 B11710 Lotion 1% Dermal 10 2 0.2075 2.08 6.69 B11711 Lotion 1%
Dermal 10 2 0.2003 2.00 6.34 B11712 Lotion 1% Dermal 10 2 0.2063
2.06 6.92 B11713 DMSO 1% Dermal 10 2 0.2195 2.20 7.13 B11714 DMSO
1% Dermal 10 2 0.2180 2.18 6.96 B11715 DMSO 1% Dermal 10 2 0.2201
2.20 6.94 B11716 DMSO 1% Intradermal 10 2 0.2209 2.21 6.97 B11717
DMSO 1% Intradermal 10 2 0.2201 2.20 7.01 B11718 DMSO 1%
Intradermal 10 2 0.2248 2.25 7.54 .sup.aFormulation weight
administered.
[0388] Results: Data in Table 13 demonstrates that appreciable drug
penetrated the skin in the test formulations and was detected
circulating in plasma after absorption from capillaries in the
dermis and epidermis.
TABLE-US-00013 TABLE 13 Concentration of a Directly Competitive
LFA-1 Antagonist in Blood via Delivery in Various Formulations
after 7 Days (Dermal) or 1 Day (Intradermal). Conc. Animal #
Timepoint Group Dose Route (ng/mL) B11704 Predose Gel 1% Dermal
<0.500 B11704 4 Hr Gel 1% Dermal <0.500 B11705 Predose Gel 1%
Dermal <2.00~ B11705 4 Hr Gel 1% Dermal <0.500 B11706 Predose
Gel 1% Dermal NR B11706 4 Hr Gel 1% Dermal <0.500 B11707 Predose
Ointment 1% Dermal <0.500 B11707 4 Hr Ointment 1% Dermal
<0.500 B11708 Predose Ointment 1% Dermal <0.500 B11708 4 Hr
Ointment 1% Dermal <0.500 B11709 Predose Ointment 1% Dermal
<0.500 B11709 4 Hr Ointment 1% Dermal <0.500 B11710 Predose
Lotion 1% Dermal <2.00~ B11710 4 Hr Lotion 1% Dermal <0.500
B11711 Predose Lotion 1% Dermal <2.00~ B11711 4 Hr Lotion 1%
Dermal <0.500 B11712 Predose Lotion 1% Dermal <2.00~ B11712 4
Hr Lotion 1% Dermal <0.500 B11713 Predose DMSO 1% Dermal
<2.00~ B11713 4 Hr DMSO 1% Dermal 2.08 B11714 Predose DMSO 1%
Dermal <0.500 B11714 4 Hr DMSO 1% Dermal 2.81 B11715 Predose
DMSO 1% Dermal <2.00~ B11715 4 Hr DMSO 1% Dermal 2.22 B11716
Predose DMSO 1% Intra-Dermal <2.00~ B11716 4 Hr DMSO 1%
Intra-Dermal 93.9 B11717 Predose DMSO 1% Intra-Dermal <2.00~
B11717 4 Hr DMSO 1% Intra-Dermal 214 B11718 Predose DMSO 1%
Intra-Dermal <0.500 B11718 4 Hr DMSO 1% Intra-Dermal 136
<0.500 = Below the Limit of Quantitation (BLQ). <2.00 = Below
the Limit of Quantitation (BLQ) due to a 4.00-fold dilution. NR =
Low internal standard response. Insufficient sample volume for
reanalysis.
Example 15
Rat Ocular Pharmacokinetics
[0389] A rat model is used to measure distribution of a directly
competitive LFA-1 antagonist to tissues in the eye, particularly to
retina. (See S. P. Ayalasomayajula, and U. B. Kompella, European
Journal of Pharmacology, (2003) "Celecoxib, a selective
cyclooxygenase-2 inhibitor, inhibits retinal vascular endothelial
growth factor expression and vascular leakage in a
streptozotocin-induced diabetic rat model", 458: 283-289.) A single
drop of a 1% solution formulation of a .sup.14C radiolabeled LFA-1
antagonist of the invention (Formulation 12, Table 9 or Formulation
15, Table 10) is administered to the eye of rats, and radioactivity
followed over time. Data for t=30 min. and t=4 hours, is
graphically represented in FIG. 12. In FIG. 12, the concentration
of radiolabeled antagonist measured in each anatomical region is
indicated by the increasing grayscale of the box corresponding to
the anatomical region as labeled. Numerical values for this data
are shown in Table 14 and is given in nanogram equivalents of
.radiolabelled--LFA-1 antagonist per gram tissue.
TABLE-US-00014 TABLE 14 LFA-1 Antagonist Concentration, ng
Equivalents [.sup.14C]-LFA-1 Antagonist/g tissue. 0.5 hour after
4.0 hours after Physical region administration administration
Aqueous humor 1770 116 Conjunctiva (bulbar) 31500 4480 Conjunctiva
(palpebral) 26300 21830 Cornea 17150 1346 Iris-ciliary body 17550
500 Lens 38.8 9.69 Optic Nerve 796 0 Retina and Choroid (with RPE)
510 46.7 Sclera 2750 387 Vitreous Humor 1330 183
[0390] The results show that therapeutic levels of LFA-1 antagonist
are achieved in the retina, extending to the four hour timepoint
after administration, where a 50 ng/g concentration of drug is seen
in the retina. This is well above the expected threshold of 10 nM
required for inhibition of leukocyte adhesion and function in
Diabetic Macular Edema/Diabetic Retinopathy, for an antagonist with
an IC.sub.50 in the HuT78 cell adhesion assay of about 2 to 6
nM.
Example 16
Phase 1 Human Study
[0391] Healthy subjects are enrolled. A randomized, controlled,
dose escalation trial of both single and multiple administrations
of LFA-1 antagonist is conducted. Cohorts of 7 subjects each (5
treatment, 2 placebo) are treated at each of 6-8 dose levels of
LFA-1 antagonists formulated as sterile, neutral, isotonic,
buffered aqueous solutions. Subjects receive a single instillation
on Day 1. Samples are obtained for pharmacokinetic and
pharmacodynamic assessments over the subsequent week. Starting Day
8, subjects receive the same dose of LFA-1 antagonist daily for a
total of 14 days. PK/PD assessments, safety laboratory studies,
ophthalmic exams, corneal staining and fluorescein angiographies
are assessed.
Example 17
Phase II Human Study
[0392] Adult subjects with diabetic retinopathy in two groups
segregated into those with and those without diabetic macular edema
as defined by key inclusion/exclusion criteria are enrolled. A
randomized, controlled dose finding trial of LFA-1 antagonists is
conducted. Three groups of subjects receive instillations of either
carrier vehicle alone, or, one of two dose levels of LFA-1
antagonist, formulated as a neutral, buffered, isotonic aqueous
solution, daily for twelve weeks. Subjects are followed for safety
and for evidence of improvement in fluorescein angiography, fundus
photography, and overall visual acuity examinations for a follow up
period of three months.
[0393] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
Sequence CWU 1
1
9112PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Tyr Asn Leu Asp Val Arg Gly Ala Arg Ser Phe Ser1
5 10213PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 2Gly Val Ile Val Gly Ala Pro Gly Glu Gly Asn Ser
Thr1 5 1037PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 3Cys Gly Phe Asp Met Pro Cys1 547PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 4Cys
Gly Tyr Asp Met Pro Cys1 5513PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 5Cys Arg Ile Pro Arg Gly Asp
Met Pro Asp Asp Arg Cys1 5 1064PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 6Cys Asn Pro
Cys1764DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7cactgtggcg ccctggtttt caggaaggta gtggatcagg
cacaagcaaa caggacctga 60cttc 6485PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 8Gly Ser Gly Ser Gly1
5928DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9tctgagccat gtgctggtat cgaggggc 28
* * * * *