U.S. patent application number 12/328580 was filed with the patent office on 2009-06-11 for lentiviral vector-mediated gene transfer and uses thereof.
This patent application is currently assigned to Research Development Foundation. Invention is credited to Binoy Appukuttan, J. Timothy Stout.
Application Number | 20090148936 12/328580 |
Document ID | / |
Family ID | 32028926 |
Filed Date | 2009-06-11 |
United States Patent
Application |
20090148936 |
Kind Code |
A1 |
Stout; J. Timothy ; et
al. |
June 11, 2009 |
LENTIVIRAL VECTOR-MEDIATED GENE TRANSFER AND USES THEREOF
Abstract
The present invention provides lentiviral vectors that are
useful in human gene therapy for inherited or acquired
proliferative ocular disease. It furnishes methods to exploit the
ability of lentiviral vectors to transduce both mitotically active
and inactive cells so that eye diseases may be treated.
Inventors: |
Stout; J. Timothy;
(Portland, OR) ; Appukuttan; Binoy; (Portland,
OR) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE., SUITE 2400
AUSTIN
TX
78701
US
|
Assignee: |
Research Development
Foundation
Carson City
NV
|
Family ID: |
32028926 |
Appl. No.: |
12/328580 |
Filed: |
December 4, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11227319 |
Sep 15, 2005 |
|
|
|
12328580 |
|
|
|
|
10245050 |
Sep 17, 2002 |
7122181 |
|
|
11227319 |
|
|
|
|
10025264 |
Dec 19, 2001 |
|
|
|
10245050 |
|
|
|
|
60256701 |
Dec 19, 2000 |
|
|
|
Current U.S.
Class: |
435/320.1 |
Current CPC
Class: |
C12N 2740/15043
20130101; C12N 2740/16045 20130101; C07K 14/522 20130101; A61K
48/00 20130101; A61P 27/06 20180101; A61P 27/02 20180101; A61K
48/0075 20130101; C12N 15/86 20130101; C07K 14/47 20130101; C12N
2830/42 20130101; C12N 2840/203 20130101; C12N 2740/16043
20130101 |
Class at
Publication: |
435/320.1 |
International
Class: |
C12N 15/63 20060101
C12N015/63 |
Claims
1-24. (canceled)
25. A recombinant lentiviral vector comprising a first therapeutic
gene that encodes a first amino acid sequence that inhibits
angiogenesis and a second therapeutic gene that encodes a second
amino acid sequence that inhibits angiogenesis, wherein said first
therapeutic gene is different from said second therapeutic
gene.
26. The recombinant lentiviral vector of claim 25, wherein said
first amino acid sequence and said second amino acid sequence are
each selected from the group consisting of angiostatin, endostatin
XVIII, endostatin XV, kringle 1-5, PEX, the C-terminal hemopexin
domain of matrix metalloproteinase-2, the kringle 5 domain of human
plasminogen, the monokine-induced by interferon-gamma (Mig), the
interferon-alpha inducible protein 10 (IP10), soluble FLT-1
(fins-like tyrosine kinase 1 receptor), and kinase insert domain
receptor (KDR).
27. The recombinant lentiviral vector of claim 25, wherein one of
said therapeutic genes encodes an endostatin.
28. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes endostatin XV.
29. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes endostatin XVIII.
30. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes angiostatin.
31. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes kringle 1-5.
32. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes PEX.
33. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes the C-terminal hemopexin domain of
matrix metalloproteinase-2.
34. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes the kringle 5 domain of human
plasminogen.
35. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes Mig.
36. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes IP10.
37. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes soluble FLT-1.
38. The recombinant lentiviral vector of claim 26, wherein one of
said therapeutic genes encodes KDR.
39. The recombinant lentiviral vector of claim 26, wherein the
first therapeutic gene encodes endostatin XVIII and the second
therapeutic gene encodes angiostatin.
40. The recombinant lentiviral vector of claim 26, wherein the
first therapeutic gene encodes Mig and the second therapeutic gene
encodes IP10.
41. The recombinant lentiviral vector of claim 25, wherein the
lentiviral vector comprises an IRES (internal ribosome entry site)
element between said first therapeutic gene and said second
therapeutic gene so that said first amino acid sequence and said
second amino acid sequence are produced from a single
transcript.
42. The recombinant lentiviral vector of claim 25, wherein said
lentiviral vector encodes a fusion protein comprising the first
amino acid sequence and the second amino acid sequence.
43. The recombinant lentiviral vector of claim 42, further
comprising a linker between the first amino acid sequence and the
second amino acid sequence.
44. The recombinant lentiviral vector of claim 43, wherein the
linker is an elastin peptide linker.
45. The recombinant lentiviral vector of claim 42, wherein the
lentiviral vector encodes a fusion protein of endostatin XVIII and
angiostatin.
46. The recombinant lentiviral vector of claim 42, wherein the
lentiviral vector encodes a fusion protein of endostatin XVIII and
the kringle 5 domain of human plasminogen.
47. The recombinant lentiviral vector of claim 42, wherein the
lentiviral vector encodes a fusion protein of Mig and IP10.
48. The recombinant lentiviral vector of claim 25, wherein said
first therapeutic gene and said second therapeutic gene are under
the control of two separate promoters known to be active in human
retinal cells, human corneal epithelial cells, or human retinal
pigment epithelial cells.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This is a continuation-in-part application of U.S. Ser. No.
10/025,264, filed Dec. 19, 2001, which claims benefit of
provisional patent application U.S. Ser. No. 60/256,701, filed Dec.
19, 2000, now abandoned.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the fields of
gene delivery vectors and gene therapy. More specifically, the
present invention relates to lentiviral vectors useful in human
gene therapy for inherited and proliferative ocular disease.
[0004] 2. Description of the Related Art
[0005] One of the most common causes of human blindness is
abnormal, intraocular cellular proliferation that often results in
a loss of clarity of the visual axis or in a separation of the
retina from the retinal pigment epithelium due to tractional forces
applied directly to the retinal surface. Proliferative retinal
detachment, whether it is related to proliferative diabetic
disease, retinopathy of prematurity, proliferative
vitreoretinopathy, or neovascular age-related muscular
degeneration, ultimately will result in permanent loss of vision if
left untreated.
[0006] The abnormal proliferation of new blood vessels within the
eye, ocular neovascularization, is the most common cause of
permanent blindness in developed countries. Three diseases are
associated with the vast majority of all cases of intraocular
neovascularization, namely diabetes, retinopathy of prematurity and
age-related muscular degeneration. While these three clinical
entities are distinct and affect different groups of patients, they
share a final common pathway that involves uncontrolled division of
endothelial cells leading to formation of new blood vessels that
ultimately compromise retinal function. Ocular proliferative
diseases affect 7% of the U.S. population and leads to annually
25,000 new cases of blindness in the United States. For people over
65 years old in the United States, 30% are affected by the
diseases.
[0007] Proliferation of vascular endothelial cells within the
retina initiates the process of proliferative diabetic retinopathy
(PDR). If untreated, these endothelial cells continue to divide and
eventually form fibrovascular membranes that extend along the inner
surface of the retina or into the vitreous cavity. Contraction of
the posterior vitreous surface results in traction at the sites of
vitreo-fibrovascular adhesions and ultimately detaches the retina.
Approximately 50% of Type 1 diabetics will develop PDR within 20
years of the diagnosis of diabetes, whereas 10% of patients with
Type 2 disease will evidence PDR within a similar timeframe.
[0008] Blood vessels usually develop by one of two processes:
vasculogenesis or angiogenesis. During vasculogenesis, a primitive
network of capillaries is established during embryogenesis by the
maturation of multipotential mesenchymal progenitors. In contrast,
angiogenesis refers to a remodeling process involving pre-existing
vessels. In angiogenesis new vascular buds emanate from older,
established vessels and invade the surrounding tissue. In the
retina, once the normal vascular network is established, the
remodeling of this network is largely under the influence of tissue
oxygen concentration. Hypoxia (oxygen paucity) stimulates
angiogenesis. It is this process which results in blindness in
millions of diabetics, premature infants or the aged in our
society.
[0009] Current treatments for intraocular neovascular diseases are
invasive and destructive. The treatments frequently require
intraocular surgery that is associated with the death of some
tissues. Thus there is a need for new approaches to treat these
diseases, and it is of interest to determine whether genes that
modulate angiogenesis can be introduced into the eye to control the
proliferative diseases. Currently it is difficult to perform gene
transduction in mammalian cells with great degree of effectiveness.
Results seen with traditional vectors such as adenoviral vectors,
liposomes and dendrimer-based reagents are quite transient. It is
also problematic to introduce these vectors into the eye without
induction of a strong inflammatory response.
[0010] In order to mediate gene transfer to cells and tissues of
the eye, the ideal gene delivery vector should have broad tropism
and be able to transduce quiescent cells. The vector also needs to
maintain sustained and robust transgene expression for the
treatment of chronic diseases. Presently, there is a lack of means
of transducing terminally differentiated or proliferating human
cells within or derived from the eye. The present invention
fulfills this long-standing need and desire in the art.
SUMMARY OF THE INVENTION
[0011] It is an object of the present invention to develop
lentiviral vectors and methods of using these vectors in human gene
therapy for inherited and proliferative ocular diseases. The
usefulness of lentiviral vectors is described for the transduction
of human retinal, corneal, vascular endothelial, proliferative
vitreoretinopathic and retinal pigment epithelial cells.
[0012] The potential of suppressing intraocular cell division by a
lentiviral-delivered constitutively active (mutant or variant)
retinoblastoma (CA-rb) gene was demonstrated. Human ocular cells
were tested in vitro and two models of intraocular proliferative
disease (proliferative vitreoretinopathy and post-lens extraction
posterior capsular opacification) were tested in vivo. Significant
and long-lived inhibition of cell division in vitro was observed in
many different cell types. Reduction in the severity of
proliferative vitreoretinopathy and post-lens extraction posterior
capsular opacification were observed in vivo.
[0013] It is further demonstrated that lentivirus-mediated transfer
of genes known to be important in the development and inhibition of
new blood vessel growth (angiogenesis) or pre-programmed cell death
(apoptosis) could be useful in the treatment of pathologic ocular
angiogenesis (e.g. diabetic retinopathy or "wet" age related
macular degeneration) or pathologic cell death (e.g. "dry" age
related macular degeneration). These genes were placed under the
control of one of each of two separate strong promoters known to be
active in human retinal, corneal and retinal pigment epithelial
cells. Inhibition of corneal neovascularization was demonstrated in
rabbit model. This inhibition of corneal neovascularization was
shown to be associated with a prevention of graft failure in a
model of corneal transplantation.
[0014] In addition, the lentiviral vectors of the present invention
are useful in delivering genes known to be deficient in human
patients with inherited eye disease. The transfer of these genes by
the vectors disclosed herein forms the basis for useful therapies
for patients with eye diseases.
[0015] The present invention is drawn to a method of inhibiting
intraocular cellular proliferation in an individual having an
ocular disease, comprising the step of: administering to said
individual a pharmacologically effective dose of a lentiviral
vector comprising a therapeutic gene that inhibits intraocular
cellular proliferation.
[0016] The present invention is also drawn to a method of
inhibiting intraocular neovascularization in an individual having
an ocular disease, comprising the step of: administering to said
individual a pharmacologically effective dose of a lentiviral
vector comprising a therapeutic gene that inhibits intraocular
neovascularization.
[0017] The present invention also provides a method of preventing
neovascularization and corneal transplant failure by transducing
corneal tissue ex vivo with a lentiviral vector comprising a
therapeutic gene that inhibits neovascularization.
[0018] Other and further aspects, features, and advantages of the
present invention will be apparent from the following description
of the presently preferred embodiments of the invention. These
embodiments are given for the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] So that the matter in which the above-recited features,
advantages and objects of the invention, as well as others which
will become clear, are attained and can be understood in detail,
more particular descriptions of the invention briefly summarized
above may be had by reference to certain embodiments thereof which
are illustrated in the appended drawings. These drawings form a
part of the specification. It is to be noted, however, that the
appended drawings illustrate preferred embodiments of the invention
and therefore are not to be considered limiting in their scope.
[0020] FIG. 1 depicts the vector provided by Dr. Inder Verma (Salk
Institute, San Diego, Calif.). HIV: human immunodeficiency virus,
LTR: long terminal repeat, GAG: HIV GAG gene, POL: HIV reverse
transcriptase, ENV: HIV envelope gene, rre: rev-responsive element,
CMV: cytomegalovirus, VSV: vesicular stomatitis virus, Poly A:
polyadenylation signal, Specific promoter: any
transcription-enhancing promoter can be place here so as to
modulate spatial, temporal or quantitative aspects of therapeutic
gene expression, Therapeutic gene: any gene with therapeutic
potential can be placed here--examples include, but are not limited
to, CA-rb, or genes whose deficiency results in disease.
[0021] FIG. 2 shows in vitro transduction of the following human
cell lines: human retinal pigment epithelial cells (RPE), human
umbilical vein endothelial cells (HUVEC), Choroidal fibroblasts
(CF), human retinoblastoma (retinal-derived) cells (Weri-Rb-1 and
Y79). These cell lines were transduced with lentiviral particles
containing a marker gene (the enhanced green fluorescent protein
gene) and the fraction of cells expressing the marker gene were
determined by fluorescent-activated cell sorting. A dose-response
is noted as more cells are transduced with greater numbers of
lentiviral particles (multiplicity of infection--MOI)
[0022] FIG. 3A demonstrates lentiviral transduction of cultured
retinal pigment epithelial cells. Marker gene (eGFP) expression
results in green, fluorescent cells. FIG. 3B shows
fluorescent-activated cell sorting analysis of transduction
efficiency. Data outside of R2 gate in first panel reflects
pre-transduction lack of fluorescence. Second panel demonstrates a
post-transduction shift to >95% fluorescence.
[0023] FIG. 4 illustrates mitotic activity and transduction
efficiency in human retinal pigment epithelial cells. Human retinal
pigment epithelial cells were transduced by lentiviral or murine
leukemia viral (MLV) vectors. Cells were mitotically inactive
(confluent) or mitotically active (growing) at the time of exposure
to vector. These results demonstrate the superior ability of
lentiviral vectors over other retroviral vectors to transduce
non-dividing cells.
[0024] FIG. 5 depicts expression stability in human retinal pigment
epithelial cells. Cells were exposed to eGFP-containing lentiviral
vectors and were subsequently maintained for at least 120 days in
continuous culture. FIG. 5A depicts the stability of eGFP
expression in these cells as well as a lack of selection for, or
against, lentivirally transduced cells (the fraction of transduced
cells remains constant over time). FIG. 5B is the result of
Southern analysis on 5 clonal populations of cells. Lane 1 contains
genomic DNA from the non-transduce parental line. Lanes 2 and 3
contain DNA from cells which were exposed to vector but were not
green (non-transduces). Lanes 4 and 5 contain DNA from transduced,
green cells. Cells remain e-GFP positive as the result of genomic
integration.
[0025] FIG. 6 illustrates human fetal cell transgene expression.
This graph depicts the highly efficient mode of transduction
achieved with lentiviral vectors when compared with a
non-lentiviral retroviral vector (MND-eGFP) or no viral vector
(control) in human fetal cells.
[0026] FIG. 7 demonstrates corneal transduction. FIG. 7A is a
schematic representation of the human cornea. FIG. 7B demonstrates
human corneal endothelial transduction by an e-GFP-containing
lentiviral vectors. Human corneal buttons, removed at the time of
corneal transplant, were exposed to lentiviral particles.
Descemet's membrane, was subsequently removed and photographed in
room light (left) and under conditions amenable to fluorescence
detection (right). FIG. 7C demonstrates lentiviral-mediated eGFP
gene transfer to human corneal epithelial cells. Subpanel A is a
light micrograph of a human cornea with an artifactually detached
epithelial layer. Fluorescent microscopy (subpanel B) reveals
epithelial fluorescence.
[0027] FIG. 8 provides an example of lentiviral gene transfer of a
gene whose deficiency results in human disease. Normal human
retinal or retinal pigment epithelial (RPE) tissue, surgically
excised at the time of enucleation for retinoblastoma, was exposed
to lentiviral vectors which either lacked a therapeutic gene (Mock)
or contained the human peripherin gene. This gene, when genetically
deficient in humans is known to result in a wide variety of
disabling phenotypes. Results of reverse transcriptase-assisted
polymerase chain reaction (rt-PCR) employing primers designed to
recognize only the transferred peripherin gene were shown. The
expression of human peripherin in human retinal and RPE was clearly
demonstrated.
[0028] FIG. 9 demonstrates lentiviral-mediated expression of CA-rb
mRNA. This shows the results of a reverse transcriptase-assisted
polymerase chain reaction (rt-PCR) employing primers designed to
recognize only the constitutively active form of the retinoblastoma
gene. Lane 1 marker, Lane 2: reaction results with RNA isolated
from lentiviral-eGFP transduced cells, Lane 3: reaction results
with RNA isolated from lentiviral-CA-rb transduced cells. The
reaction product was of the expected size.
[0029] FIG. 10 shows the inhibitory effect of lentiviral CA-rb on
human retinal and choroidal cell division. Cells were exposed to
decreasing dilutions of a single lentiviral stock (1:400 dilution
to 1:50 dilution) and growth was compared with cells exposed to
lentiviral vectors which did not contain the CA-rb gene. An
inhibitory effect on cell division was clearly seen over time and
this effect was dose-dependant.
[0030] FIG. 11 shows the inhibitory effect of lentiviral CA-rb on
human lens epithelial cell division. Cells removed from human eyes
at the time of cataract extraction were exposed to decreasing
dilutions of a single lentiviral stock (1:400 dilution to 1:50
dilution) and growth was compared with cells exposed to lentiviral
vectors which did not contain the CA-rb gene. An inhibitory effect
on cell division was clearly seen over time and this effect was
dose-dependant.
[0031] FIG. 12 shows the in vivo inhibitory effects of lentiviral
CA-rb on blinding intraocular cellular proliferation. Proliferative
vitreoretinopathy was induced in three sets of rabbits. One set was
not treated, one set was treated with lantiviral vectors lacking
the CA-rb gene and the last set was treated with
intravitreally-delivered lentiviral CA-rb. Proliferative
vitreoretinopathy and retinal detachment was noted in the first two
sets at high frequency (>90%). The fraction of animals that went
on to retinal detachment was significantly lower in the set treated
with CA-rb (26%). Shown here are two retinal photographs. The eye
on the left had a completely attached retina and was treated with
CA-rb. The eye on the right had a completely detached retina, the
consequence of intraocular vitreoretinopathic cellular
proliferation, and was treated with lentiviral vectors lacking the
CA-rb gene.
[0032] FIG. 13 shows the in vivo inhibitory effect of lentiviral
CA-rb on the process of post-lens extraction posterior capsular
opacification. Three sets of rabbits underwent standard
phacoemulsfication to remove the native crystalline lens. The first
set (group 1) was subsequently treated with nothing and the second
two sets were treated with either empty lentiviral constructs (no
therapeutic gene, group 2) or with lentiviral CA-rb (group 3)
delivered into the intact lens capsular bag at the time of closure
of the cataract wound. Animals were serially examined for the
presence of posterior capsular opacification. The presence of
opacification was graded on a 1 to 5 scale where 1 represented no
opacification and 5 represented opacification severe enough to
preclude visualization of the retina with indirect binocular
opthalmoscopy. There were no statistically different results
obtained between groups 1 and 2 (no treatment and empty vector).
The graph here shows a striking inhibitory effect of lentiviral
CA-rb on the development of posterior capsule opacification. By day
28, control animals had an average opacification score of 4.4 while
animals treated with lentiviral CA-rb had an average opacification
score of 2.1.
[0033] FIG. 14 shows a map for a endostatin-18/angiostatin fusion
gene delivered by lentiviral vector.
[0034] FIG. 15 shows a map for the lentiviral vector
pHR-CMV-Endo/Ang-ires-eGFP carrying an endostatin/angiostatin
fusion gene.
[0035] FIG. 16 shows a map for the lentiviral vector
pHR-CMV-BIK-ires-eGFP carrying a BIK gene.
[0036] FIG. 17 shows a map for the lentiviral vector
pHR-CMV-Endo/Kringle-ires-eGFP carrying an endostatin/kringle
fusion gene.
[0037] FIG. 18 shows a map for the lentiviral vector
pHR-CMV-KDR-ires-eGFP carrying a KDR gene.
[0038] FIG. 19 shows a map for the lentiviral vector
pHR-CMV-P16-ires-eGFP carrying a p16 gene.
[0039] FIG. 20 shows a map for the lentiviral vector
pHR-CMV-P21-ires-eGFP carrying a p21 gene.
[0040] FIG. 21 shows a map for the lentiviral vector
pHR-CMV-Timp1-ires-eGFP carrying a Timp1 gene.
[0041] FIG. 22 shows a map for the lentiviral vector
pHR-EF1/HTLV-Ang-ires-eGFP carrying an angiostatin gene.
[0042] FIG. 23 shows a map for the lentiviral vector
pHR-EF1/HTLV-Endo XV-ires-eGFP carrying an endostatin XV gene.
[0043] FIG. 24 shows a map for the lentiviral vector
pHR-EF1/HTLV-EndoAng-ires-eGFP carrying an endostatin/angiostatin
fusion gene.
[0044] FIG. 25 shows a map for the lentiviral vector
pHR-EF1/HTLV-EndoKringle-ires-eGFP carrying an endostatin/kringle
fusion gene.
[0045] FIG. 26 shows a map for the lentiviral vector
pHR-EF1/HTLV-Kringle 1-5-ires-eGFP carrying a Kringle gene.
[0046] FIG. 27 shows a map for the lentiviral vector
pHR-EF1/HTLV-MigIP10-ires-eGFP carrying a Mig/IP10 fusion gene.
[0047] FIG. 28 shows a map for the lentiviral vector
pHR-EF1/HTLV-Timp1-ires-eGFP carrying a Timp1 gene.
[0048] FIG. 29 shows a map for the lentiviral vector
pHR-EF1/HTLV-Timp4-ires-eGFP carrying a Timp4 gene.
[0049] FIG. 30 shows a map for the lentiviral vector
pHR-EF1/HTLV-P21-ires-eGFP carrying a p21 gene.
[0050] FIG. 31 shows a map for the lentiviral vector
pHR-EF1/HTLV-Endo XVIII-ires-eGFP carrying an endostatin XVIII
gene.
[0051] FIG. 32 shows RT-PCR of mRNA isolated from human dermal
microvascular endothelial (hDMVE) cells transduced with the
endostatin-18/angiostatin fusion gene. Lane 1: 1000/100 bp ladder
mix; lane 2-5: RT-PCR from mRNA isolated from hDMVE cells
transduced with 1 .mu.l, 5 .mu.l, 10 .mu.l and 20 .mu.l of
pHR'-eF1.alpha./HTLV-Endo::Ang-IRES-eGFP virus supernatant from a
single well of a 12 well plate; lane 6: RT-PCR from mRNA isolated
from hDMVE cells incubated with 20 .mu.l of PBS; lane 7: negative
control (H2O as template for RT-PCR); lane 8: 100 bp ladder.
[0052] FIG. 33 shows a standardized method of evaluation for
corneal neovascularization after alkali burn. The formula for the
area of neovascularization is derived by calculating the area of
the larger sector bounded by radius RT and subtracting the smaller
sector bounded by radius R2. The area of the larger sector bounded
by radius RT is the number of clock hours divided by 12 and
multiplied by .pi.RT.sup.2. The area of the smaller sector bounded
by radius R2 is the number of clock hours divided by 12 and
multiplied by .pi.(R2).sup.2. The resulting area derived from the
subtraction of the two sectors would be the area of
neovascularization.
[0053] FIG. 34 shows the presence of eGFP in the corneal
micropocket in treated animals. FIG. 34A shows a fluorescent
photomicrograph demonstrating the presence of eGFP expression in a
micropocket. FIG. 34B shows a non-fluorescent photomicrograph of
the same tissue as shown in A. FIG. 34C shows a fluorescent
photomicrograph of a similarly processed tissue from an untreated
animal.
[0054] FIG. 35 shows inhibition of neovascularization in animals
treated with a lentiviral Endo/K5 vector. The graph depicts average
area of neovascularization in animals treated with PBS (n=3),
lentiviral vector carrying the marker eGFP gene (n=3) or lentiviral
vector carrying the Endo/K5 fusion gene (n=10).
[0055] FIG. 36 shows inhibition of neovascularization in animals
treated with a lentiviral K1-5 vector. The graph depicts average
area of neovascularization in animals treated with PBS (n=3),
lentiviral vector carrying the marker eGFP gene (n=5) or lentiviral
vector carrying the K1-5 gene (n=9).
[0056] FIG. 37 shows an inhibitory effect on neovascularization in
animals treated with a Mig/IP10 lentiviral vector. FIG. 37A shows a
photograph of normal (nontreated, nonstimulated) cornea. FIG. 37B
shows a photograph of an alkali challenged cornea of an animal
treated with a Mig/IP10 lentiviral vector. Note the lack of blood
vessels into the cornea. FIG. 37C shows a photograph of an alkali
challenged cornea of an animal treated with a control lentiviral
vector without a therapeutic anti-angiogenic gene. Note the
invasion of blood vessels into the cornea. FIG. 37D shows a
photograph of an alkali challenged cornea of an untreated animal.
Note the invasion of blood vessels into the cornea.
[0057] FIG. 38 shows inhibition of neovascularization in animals
treated with a Mig/IP10 lentiviral vector. The graph depicts
average area of neovascularization in animals treated with PBS,
lentiviral vector carrying the marker eGFP gene or lentiviral
vector carrying the K1-5 gene.
[0058] FIG. 39 shows inhibition of neovascularization in animals
treated with a lentiviral KDR vector. The graph depicts average
area of neovascularization in animals treated with PBS (n=3),
lentiviral vector carrying the marker eGFP gene (n=6) or lentiviral
vector carrying the KDR gene (n=9).
DETAILED DESCRIPTION OF THE INVENTION
[0059] Lentiviruses are slow viruses whose natural pathogenicity
occurs over a period of months to years. This viral genus includes
such retroviruses as HIV. These viruses are known to infect and
transduce a wide variety of terminally differentiated, mitotically
active or inactive human cell types. Their transduction efficiency
is very high, even cell lines traditionally very refractory to gene
transfer such as human retinal, corneal, trabecular, lenticular,
retinal pigment epithelial, proliferative vitreoretinopathic and
vascular endothelial cells can be transduced using this vector.
[0060] Upon infection with lentivirus, the viral genetic material
integrates itself within the host genome. Thus, the viral genes
become a permanent part of the host cell's genetic material and
gene expression is constant for the life of the cell. Each cell
transduced by a lentivirus will transmit the genetic information to
its progeny. Under natural conditions of infection, lentivirus is
an intraocular pathogen that does not induce inflammatory
responses. Therefore, lentiviruses are good candidates as vectors
in gene therapy for intraocular diseases. Previous work with this
virus has demonstrated its successful use in transduction of both
neural and retinal cells (Naldini et al., 1996; Miyoshi et al.,
1997).
[0061] The present invention provides new lentiviral vectors that
incorporated an IRES (internal ribosome entry site) element between
two cloning sites. The IRES element allows mRNA-ribosome binding
and protein synthesis. This backbone can accommodate two different
expressible genes. A single message is produced in transduced
cells; however, this message is functionally bi-cistronic and can
drive the synthesis of two different proteins because of the IRES
element. These two genes can be placed under the control of strong
promoters such as CMV or HTLV promoters. Alternatively, one of
skill in the art would readily employ other promoters known to be
active in human retinal, corneal or retinal pigment epithelial
cells. In this fashion each of the potentially therapeutic genes
discussed below can be linked to a marker gene (e.g. the enhanced
green fluorescent gene, the eGFP gene) so that transduced cells can
simultaneously be marked and express the therapeutic gene of
interest. Marked cells can easily be isolated in vitro and observed
in vivo.
[0062] It would be apparent to one of skill in the art that other
marker genes besides the enhanced green fluorescent protein gene
could be incorporated into the lentiviral vector. A person having
ordinary skill in this art would also readily be able to construct
lentiviral vectors containing other therapeutic genes of interest
in addition to those disclosed herein. Moreover, the lentiviral
vector system disclosed herein can transfer genes known to be
deficient in human patients with inherited eye disease or other
diseases. The transfer of these genes to human ocular cells or
other tissues by this system forms the basis for useful therapies
for patients with various diseases.
[0063] The basic discovery detailed herein demonstrates that
lentiviral vectors can transfer a variety of genes to modify
abnormal intraocular proliferation and, hence, decrease the
incidence of neovascular disease, retinal detachment or
post-cataract extraction posterior capsular opacification. A number
of therapeutic genes may be useful in clinical circumstances for in
vivo inhibition of intraocular cell division. These genes include a
variety of recently identified modulators for the process of new
blood vessel growth (angiogenesis) or apoptosis. It is believe that
genetic control of the expression of these modulators via
lentivirus-mediated gene transfer would prove useful in the
treatment of intraocular neovascular diseases such as age-related
macular degeneration (AMD), retinopathy of prematurity (ROP) and
proliferative diabetic retinopathy (PDR).
[0064] Vascular endothelial cells play a central role in both
vasculogenesis and angiogenesis. These cells respond mitogenically
(become active with regards to cell division or migration) to a
variety of protein cytokines. For example, vascular endothelial
growth factor (VEGF), angiogenin, angiopoietin-1 (Ang1) and
angiotropin are cytokines that stimulate endothelial cell division,
migration or cell-cell adhesion, and thus favor the process of
angiogenesis. Endostatin, soluble (decoy) VEGF receptors (sflt),
and thrombospondin are endogenous protein cytokines that appear to
inhibit angiogenesis. The present invention demonstrates that many
of these inhibitory proteins delivered by lentiviral vectors are
useful in the treatment of intraocular neovascularization. Examples
of genes that can be incorporated into the lentiviral vectors of
the present invention include, but are not limited to, the
following genes:
Tissue Inhibitors of Metalloproteinases
[0065] The tissue inhibitors of metalloproteinases (TIMPs)
represent a family of ubiquitous proteins that are natural
inhibitors of the matrix metalloproteinases (MMPs). Matrix
metalloproteinases are a group of zinc-binding endopeptidases
involved in connective tissue matrix remodeling and degradation of
the extracellular matrix (ECM), an essential step in tumor
invasion, angiogenesis, and metastasis. The matrix
metalloproteinases each have different substrate specificities
within the extracellular matrix and are important in its
degradation. The analysis of matrix metalloproteinases in human
mammary pathology showed that several matrix metalloproteinases
were involved in degradation of the extracellular matrix:
collagenase (MMP1) degrades fibrillar interstitial collagens;
gelatinase (MMP2) mainly degrades type IV collagen; and stromelysin
(MMP3) has a wider range of action.
[0066] There are four members of the TIMP family. TIMP-1 and TIMP-2
are capable of inhibiting tumor growth, invasion, and metastasis
that has been related to matrix metalloproteinase inhibitory
activity. Furthermore, both TIMP-1 and TIMP-2 are involved in the
inhibition of angiogenesis. Unlike other members of the TIMP
family, TIMP-3 is found only in the ECM and may function as a
marker for terminal differentiation. Finally, TIMP-4 is thought to
function in a tissue-specific fashion in extracellular matrix
hemostasis (Gomez et al., 1997).
TIMP-1
[0067] Tissue inhibitor of metalloproteinase-1 (TIMP-1) is a 23 kD
protein that is also known as metalloproteinase inhibitor 1,
fibroblast collagenase inhibitor, collagenase inhibitor and
erythroid potentiating activity (EPA). The gene encoding TIMP-1 has
been described by Docherty et al. (1985). TIMP-1 complexes with
metalloproteinases (such as collagenases) and causes irreversible
inactivation. The effects of TIMP-1 have been investigated in
transgenic mouse models: one that overexpressed TIMP-1 in the
liver, and another that expressed the viral oncogene Simian Virus
40/T antigen (TAg) leading to heritable development of
hepatocellular carcinomas. In double transgenic experiments in
which the TIMP-1 lines were crossed with the TAg transgenic line,
overexpression of hepatic TIMP-1 was reported to block the
development of TAg-induced hepatocellular carcinomas by inhibiting
growth and angiogenesis (Martin et al., 1996).
TIMP-2
[0068] Tissue inhibitor of metalloproteinase-2 (TIMP-2) is a 24 kD
protein that is also known as metalloproteinase inhibitor 2. The
gene encoding TIMP-2 has been described by Stetler-Stevenson et al.
(1990). Metalloproteinase (MMP2) which plays a critical role in
tumor invasion is complexed and inhibited by TIMP-2. Thus, TIMP-2
could be useful to inhibit cancer metastasis (Musso et al.; 1997).
When B16F10 murine melanoma cells, a highly invasive and metastatic
cell line, were transfected with a plasmid coding for human TIMP-2
and injected subcutaneously in mice, TIMP-2 over-expression limited
tumor growth and neoangiogenesis in vivo (Valente et al.,
1998).
TIMP-3
[0069] Tissue inhibitor of metalloproteinase-3 (TIMP-3) is also
known as metalloproteinase inhibitor 3. When breast carcinoma and
malignant melanoma cell lines were transfected with TIMP-3 plasmids
and injected subcutaneously into nude mice, suppression of tumor
growth was observed (Anand-Apte et al., 1996). However, TIMP-3
over-expression had no effect on the growth of the two tumor cell
lines in vitro. Thus, it was suggested that the TIMP-3 released to
the adjacent extracellular matrix by tumor cells inhibited tumor
growth by suppressing the release of growth factors sequestered in
extracellular matrix, or by inhibiting angiogenesis (Anand-Apte et
al. 1996).
TIMP-4
[0070] Tissue inhibitor of metalloproteinase-4 (TIMP-4) is also
known as metalloproteinase inhibitor 4. The TIMP-4 gene and tissue
localization have been described by Greene et al. (1996).
Biochemical studies have shown that TIMP-4 binds human gelatinase A
similar to that of TIMP-2 (Bigg et al., 1997). The effect of TIMP-4
modulation on the growth of human breast cancers in vivo was
investigated by Wang et al. (1997). Overexpression of TIMP-4 was
found to inhibit cell invasiveness in vitro, and tumor growth was
significantly reduced following injection of nude mice with TIMP-4
tumor cell transfectants in vivo (Wang et al., 1997).
Endostatin, Angiostatin, PEX, Kringle-5 and Fusion Genes
[0071] J. Folkman and his colleagues (Boehm et al., 1997) showed
that treatment of mice with Lewis lung carcinomas with the
combination of endostatin+angiostatin proteins induced complete
regression of the tumors, and that mice remained healthy for the
rest of their life. This effect was obtained only after one cycle
(25 days) of endostatin+angiostatin treatment, whereas endostatin
alone required 6 cycles to induce tumor dormancy.
[0072] D. Hanahan and colleagues (Bergers et al., 1999)
demonstrated a superior antitumoral effect of the combination of
endostatin+angiostatin proteins in a mouse model for pancreatic
islet carcinoma. Endostatin+angiostatin combination resulted in a
significant regression of the tumors, whereas endostatin or
angiostatin alone had no effect.
Endostatin XVIII
[0073] Endostatin, an angiogenesis inhibitor produced by
hemangioendothelioma, was first identified by O'Reilly et al.
(1997). Endostatin is a 20 kD C-terminal fragment of collagen XVIII
that specifically inhibits endothelial proliferation, and potently
inhibits angiogenesis and tumor growth. In fact, primary tumors
have been shown to regress to dormant microscopic lesions following
the administration of recombinant endostatin (O'Reilly et al.,
1997). Endostatin is reported to inhibit angiogenesis by binding to
the heparin sulfate proteoglycans involved in growth factor
signaling (Zetter, 1998).
Endostatin XV
[0074] Recently, a C-terminal fragment of collagen XV (Endostatin
XV) has been shown to inhibit angiogenesis like Endostatin XVIII,
but with several functional differences (Sasaki et al., 2000).
Angiostatin
[0075] Angiostatin, an internal fragment of plasminogen comprising
the first four kringle structures, is one of the most potent
endogenous angiogenesis inhibitors described to date. It has been
shown that systemic administration of angiostatin efficiently
suppresses malignant glioma growth in vivo (Kirsch et al., 1998).
Angiostatin has also been combined with conventional radiotherapy
resulting in increased tumor eradication without increasing toxic
effects in vivo (Mauceri et al., 1998). Other studies have
demonstrated that retroviral and adenoviral mediated gene transfer
of angiostatin cDNA resulted in inhibition of endothelial cell
growth in vitro and angiogenesis in vivo. The inhibition of
tumor-induced angiogenesis produced an increase in tumor cell death
(Tanaka et al., 1998). Gene transfer of a cDNA coding for mouse
angiostatin into murine T241 fibrosarcoma cells has been shown to
suppress primary and metastatic tumor growth in vivo (Cao et al.,
1998).
PEX
[0076] PEX is the C-terminal hemopexin domain of MMP-2 that
inhibits the binding of MMP-2 to integrin (.alpha.v.beta.3 and
blocks cell surface collagenolytic activity required for
angiogenesis and tumor growth. It was cloned and described by
Brooks et al. (1998).
Kringle-5
[0077] The kringle-5 domain of human plasminogen, which shares high
sequence homology with the four kringles of angiostatin, has been
shown to be a specific inhibitor for endothelial cell
proliferation. Kringle-5 appears to be more potent than angiostatin
on inhibition of basic fibroblast growth factor-stimulated
capillary endothelial cell proliferation (Cao et al., 1997). In
addition to its antiproliferative properties, kringle-5 also
displays an anti-migratory activity similar to that of angiostatin
that selectively affects endothelial cells (Ji et al., 1998).
Angiostatic Fusion Genes
[0078] Novel angiostatic fusion genes can be cloned using an
elastin peptide motif (Val-Pro-Gly-Val-Gly) as a linker. These
fusions combine two potent angiostatic genes to increase the
suppression of tumor angiogenesis. Since these molecules operate
through different mechanisms, their combination may result in
synergistic effects. Examples of angiostatic fusion proteins
include, but are not limited to, the fusion of endostatin 18 and
angiostatin (endo/ang), endostatin 18 and the kringle 5 motif of
plasminogen (endo/K5), as well as the monokine-induced by
interferon-gamma and the interferon-alpha inducible protein 10
(MIG/IP10).
Chemokines
[0079] Chemokines are low-molecular weight pro-inflammatory
cytokines capable of eliciting leukocyte chemotaxis. Depending on
the chemokine considered, the chemoattraction is specific for
certain leukocyte cell types. Expressing chemokine genes into
tumors may lead to more efficient recruiting of leukocytes capable
of antitumoral activity. Moreover, in addition to their chemotactic
activity, some chemokines possess an anti-angiogenic activity, i.e.
they inhibit the formation of blood vessels feeding the tumor. For
this reason, these chemokines are useful in cancer treatment.
Monokine-Induced by Interferon-Gamma (MIG)
[0080] MIG, the monokine-induced by interferon-gamma, is a CXC
chemokine related to IP-10 and produced by monocytes. MIG is a
chemoattractant for activated T cells, and also possesses strong
angiostatic properties. Intratumoral injections of MIG induced
tumor necrosis (Sgadari et al., 1997).
Interferon-Alpha Inducible Protein 10 (IP-10)
[0081] IP-10, the interferon-alpha inducible protein 10, is a
member of the CXC chemokine family. IP-10 is produced mainly by
monocytes, but also by T cells, fibroblasts and endothelial cells.
IP-10 exerts a chemotactic activity on lymphoid cells such as T
cells, monocytes and NK cells. IP-10 is also a potent inhibitor of
angiogenesis. It inhibits neovascularization by suppressing
endothelial cell differentiation. Because of its chemotactic
activity toward immune cells, IP-10 was considered as a good
candidate to enhance antitumour immune responses. Gene transfer of
IP-10 into tumor cells reduced their tumorigenicity and elicited a
long-term protective immune response (Luster and Leder, 1.993). The
angiostatic activity of IP-10 was also shown to mediate tumor
regression. Tumor cells expressing IP-10 became necrotic in vivo
(Sgadari et al., 1996). IP-10 was also shown to mediate the
angiostatic effects of IL-12 that lead to tumor regression
(Tannenbaum et al., 1998).
Soluble VEGF Receptors
[0082] FLT-1 (fms-like tyrosine kinase 1 receptor) is a
membrane-bound receptor of VEGF (VEGF Receptor 1). It has been
shown that a soluble fragment of FLT-1 (sFLT-1) has angiostatic
properties by way of its antagonist activity against VEGF. Soluble
FLT-1 acts by binding to VEGF but also because it binds and blocks
the external domain of the membrane-bound FLT-1. One example of
sFLT-1 is a human sFLT-1 spanning the 7 immunoglobulin-like domains
of the external part of FLT-1.
sFLK-1/KDR
[0083] FLK-1 or KDR (kinase insert domain receptor) is a
membrane-bound receptor of VFGF (VEGF Receptor 2). It has been
shown that a soluble fragment of KDR (sKDR) has angiostatic
properties by way of its antagonist activity against VEGF. The sKDR
also binds and blocks the external domain of the membrane-bound
KDR. One example of sKDR is a human sKDR spanning the 7
immunoglobulin-like domains of the external part of KDR.
Vascular Endothelial Growth Factor (VEGF) and Basic Fibroblast
Growth Factor (bFGF)
[0084] VEGF is a growth factor active in angiogenesis and
endothelial cell growth. It induces endothelial proliferation and
vascular permeability. bFGF is an angiogenic agent with many
potential gene therapy uses such as atherosclerosis therapy. VEGF
and bFGF are ideal candidates for novel gene transfer protocols
designed to promote new blood vessel growth. Stimulating
angiogenesis by gene transfer approaches offers the hope of
treating tissue ischemia which is untreatable currently.
Apoptosis
[0085] Apoptosis is the term used to describe the process of
programmed cell death or cell suicide. This process is a normal
component of the development and health of multicellular organisms.
The abnormal regulation of apoptosis has been implicated in a
variety of pathological disorders from cancer to autoimmune
diseases.
Bcl-2 Interacting Killer (BIK)
[0086] Bik is a 18 kD (160 amino acids) potent pro-apoptotic
protein, also known as apoptosis inducer NBK, BP4, and BIP1. Bik is
encoded by the gene bik (or nbk). The function of Bik is to
accelerate programmed cell death by complexing with various
apoptosis repressors such as Bcl-XL, BHRF1, Bcl-2, or its
adenovirus homologue EIB protein. In transient transfection
studies, Bik promoted cell death in a manner similar to the
pro-apoptotic members of the Bcl-2 family, Bax and Bak.
BAK
[0087] Bak, a Bcl-2 homologue, is a pro-apoptotic protein that
promotes apoptosis by binding anti-apoptotic family members
including Bcl-2 and Bcl-XL and inhibits their activity as
previously described for Bik (Chittenden et al., 1995).
BAX
[0088] Bax is a 21 kD protein that functions as an apoptosis
regulator. Bax accelerates programmed cell death by dimerizing with
and antagonizing the apoptosis repressor Bcl-2. The ratio of these
protein dimers is thought to relate to the initiation of apoptosis.
The effect of recombinant Bax expression in K562 erythroleukemia
cells has been investigated by Kobayashi et al. (1998).
Transfection with the Bax vector into K562 cells resulted in the
induction of apoptosis. Furthermore, cells stably transfected with
Bax were found to be more sensitive to the chemotherapeutic agents
ara-X, doxorubicin, and SN-38 (Kobayashi et al., 1998).
BAD
[0089] The Bad protein (Bcl-2 binding component 6, bad gene or bbc6
or bc1218) is a small protein (168 amino acids, 18 kDa) which
promotes cell death. It successfully competes for the binding to
Bcl-XL and Bcl-2, thereby affecting the level of heterodimerization
of both these proteins with Bax. It can reverse the death repressor
activity of Bcl-XL, but not that of Bcl-2.
BCL-2
[0090] B cell leukemia/lymphoma-2 (Bcl-2) is the prototype member
of a family of cell death regulatory proteins. Bcl-2 is found
mainly in the mitochondria and blocks apoptosis by interfering with
the activation of caspases. Gene transfer of Bcl-2 into tumor cells
has been shown to enhance their metastatic potential (Miyake et
al., 1999). Bcl-2 gene transfer may be applied to bone marrow
transplant since Bcl-2 enhances the survival of hematopoietic stem
cells after reconstitution of irradiated recipient (Innes et al.,
1999). Also, Bcl-2 gene transfer could be useful against
neurodegenerating diseases since expression of Bcl-2 in neurons
protects them from apoptosis (Saille et al., 1999).
BCL-XS
[0091] Bcl-XS (short isoform) is a dominant negative repressor of
Bcl-2 and Bcl-XL. It has been used in gene therapy experiments to
initiate apoptosis in tumors that express Bcl-2 and Bcl-XL.
Expression of Bcl-XS reduces tumor size (Ealovega et al., 1996) and
sensitizes tumor cells to chemotherapeutic agents (Sumatran et al.,
1995), suggesting a role for Bcl-XS in initiating cell death in
tumors that express Bcl-2 or Bcl-XL (Dole et al., 1996).
GAX
[0092] Gax is an homeobox gene coding for a transcription factor
that inhibits cell proliferation in a p21-dependent manner. Gax is
down-regulated when cells are stimulated to proliferate. Gax
over-expression leads to Bcl-2 down-regulation and Bax
up-regulation in mitogen-activated cells (Perlman et al., 1998).
Thus, Gax may be useful to inhibit the growth of certain tumor
cells. Moreover, Gax over-expression in vascular smooth muscle
cells inhibits their proliferation (Perlman et al., 1999). Hence,
Gax gene transfer could limit vascular stenosis following vascular
injuries.
Tumor Suppressor Genes
[0093] Various mutations of tumor suppressor genes have been
associated with different types of cancers. In these cases, somatic
gene therapy with wild-type versions of tumor suppressor genes have
been contemplated as anti-cancer therapeutic approaches p16, p21,
p27 & p53 inhibit the cell cycle by acting on the
cyclin-dependent kinases.
P16
[0094] P16, a 15 kD protein (148 amino acids), is also known as
CDK4I, P16-INK4, P16-INK4A, or multiple tumor suppressor 1 (MTS1).
P16 is encoded by the gene cdkn2a or cdkn2. P16 forms a heterodimer
with cyclin-dependent kinase 4 and 6, thereby preventing their
interaction with cyclin D both in vitro and in vivo. Thus, P16 acts
as a negative regulator of the proliferation of normal cells.
[0095] P16 (cdkn2) mutations are involved in tumor formation in a
wide range of tissues. cdkn2a is homozygously deleted, mutated, or
otherwise inactivated in a large proportion of tumor cell lines and
some primary tumors including melanomas and tumors of the biliary
tract, pancreas and stomach. Loss of p16IKN4a gene expression is
commonly observed in mesothelioma tumors and other cells lines. It
has been shown that p16INK4A transduction with an expressing
adenovirus in mesothelioma cells resulted in decreased cell growth
and the death of the transduced cells (Frizelle et al., 1998).
Furthermore, adenoviral mediated gene transfer of wildtype p16 into
three human glioma cell lines (U251 MG, U-87 MG and D54 MG) that
were not expressing an endogenous p16/CDKN2 gene resulted in the
arrest of cell growth in the GO and G1 phases (Fueyo et al., 1996).
In addition, adenoviral mediated gene transfer of wild-type
p16-INK4A into lung cancer cell lines that do not express p16-INK4A
inhibited tumor proliferation both in vitro and in vivo (Jin et
al., 1995). Thus, the restoration of the wild-type P16 protein in
tumor cells could have cancer therapeutic utility.
P21
[0096] p21 is an 18 kD protein (164 amino acids) also known as
Cyclin-Dependent Kinase Inhibitor 1 (CDKN1), melanoma
differentiation associated protein 6 (MDA-6), and CDK-interacting
protein 1. p21 is encoded by the gene CDKN1, also known as CIP1 and
WAF1. p21 may be the important intermediate by which p53 mediates
its role as an inhibitor of cellular proliferation in response to
DNA damage. p21 may bind to and inhibit cyclin-dependent kinase
activity, preventing the phosphorylation of critical
cyclin-dependent kinase substrates and blocking cell cycle
progression and proliferation. p21 is expressed in all adult human
tissues. p21 gene transfer into tumor cells could be useful to
inhibit tumor growth.
[0097] Recombinant adenovirus mediated p21 gene transfer in two
human non-small cell lung cancer (NSCLC) cell lines resulted in a
dose-dependent p21 induction and concomitant cell growth inhibition
due to GO/G1 cell cycle arrest. Moreover, injection of an
adenovirus carrying p21 into NSCLC pre-established tumors in mice
reduced tumor growth and increased survival of the animals (Joshi
et al., 1998). These results support the use of p21 for cancer gene
therapy.
[0098] In accordance with the present invention, there may be
employed conventional molecular biology, microbiology, and
recombinant DNA techniques within the skill of the art. Such
techniques are explained fully in the literature. See, e.g.,
Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory
Manual (1982); "DNA Cloning: A Practical Approach," Volumes I and
II (D. N. Glover ed. 1985); "Oligonucleotide Synthesis" (M. J. Gait
ed. 1984); "Nucleic Acid Hybridization" (B. D. Hames & S. J.
Higgins eds. (1985)); "Transcription and Translation" (B. D. Hames
& S. J. Higgins eds. (1984)); "Animal Cell Culture" [R. I.
Freshney, ed. (1986)); "Immobilized Cells And Enzymes" (IRL Press,
(1986)); B. Perbal, "A Practical Guide To Molecular Cloning"
(1984).
[0099] A "vector" is a replicon, such as plasmid, phage or cosmid,
to which another DNA segment may be attached so as to bring about
the replication of the attached segment.
[0100] A "promoter sequence" is a DNA regulatory region capable of
binding RNA polymerase in a cell and initiating transcription of a
downstream (3' direction) coding sequence. For purposes of defining
the present invention, the promoter sequence is bounded at its 3'
terminus by the transcription initiation site and extends upstream
(5' direction) to include the minimum number of bases or elements
necessary to initiate transcription at levels detectable above
background. Within the promoter sequence will be found a
transcription initiation site (conveniently defined by mapping with
nuclease S1), as well as protein binding domains (consensus
sequences) responsible for the binding of RNA polymerase.
Eukaryotic promoters will often, but not always, contain "TATA"
boxes and "CAT" boxes. Various promoters may be used to drive
vectors.
[0101] A cell has been "transduced" by exogenous or heterologous
DNA when such DNA has been introduced inside the cell, usually by a
viral vector. The transducing DNA may (as in the case of lentiviral
vectors) or may not be integrated (covalently linked) into the
genome of the cell. In prokaryotes, yeast, and mammalian cells for
example, DNA may be maintained on an episomal element such as a
plasmid. With respect to eukaryotic cells, a stably transformed
cell is one in which the transforming DNA has become integrated
into a chromosome so that it is inherited by daughter cells through
chromosome replication. This stability is demonstrated by the
ability of the eukaryotic cell to establish cell lines or clones
comprised of a population of daughter cells containing the
transforming DNA. A "clone" is a population of cells derived from a
single cell or common ancestor by mitosis. A "cell line" is a clone
of a primary cell that is capable of stable growth in vitro for
many generations.
[0102] A "therapeutic gene" refers to a gene that confers a desired
phenotype. For example, a constitutively active retinoblastoma
(CA-rb) gene is used to prevent intraocular proliferation or a
genetic deficit is restored by the transfer of peripherin gene.
Other desirable phenotypes include inhibition of tumor growth,
inhibition or regulation of angiogenesis and regulation of
apoptosis.
[0103] As used herein, the term "marker gene" refers to a coding
sequence attached to heterologous promoter or enhancer elements and
whose product is easily and quantifiably assayed when the construct
is introduced into tissues or cells. Markers commonly employed
include radioactive elements, enzymes, proteins (such as the
enhanced green fluorescence protein) or chemicals which fluoresce
when exposed to ultraviolet light, and others.
[0104] The present invention is directed to a novel means of
treating inherited or proliferative blinding diseases by means of
lentiviral gene transfer. There is provided a method of inhibiting
intraocular cellular proliferation in an individual having an
ocular disease, comprising the step of administering to said
individual a pharmacologically effective dose of a lentiviral
vector comprising a therapeutic gene that inhibits intraocular
cellular proliferation. Representative examples of ocular diseases
which may be treated using this method of the present invention
include age-related macular degeneration, proliferative diabetic
retinopathy, retinopathy of prematurity, glaucoma, and
proliferative vitreoretinopathy. The therapeutic gene can be a
constitutively active form of the retinoblastoma gene, a p16 gene
or a p21 gene. Preferably, the lentiviral vector is administered in
a dosage of from about 10.sup.6 to 10.sup.9 transducing units into
the capsular, vitreal or sub-retinal space.
[0105] The present invention is also drawn to a method of
inhibiting intraocular neovascularization in an individual having
an ocular disease, comprising the step of administering to said
individual a pharmacologically effective dose of a lentiviral
vector comprising a therapeutic gene that inhibits intraocular
neovascularization. Representative examples of ocular diseases
which may be treated using this method of the present invention
include age-related macular degeneration, proliferative diabetic
retinopathy, retinopathy of prematurity, glaucoma, and
proliferative vitreoretinopathy. The therapeutic gene can be a gene
that regulates angiogenesis or apoptosis. In general, genes that
regulate angiogenesis include genes that encode tissue inhibitor of
metalloproteinase (TIMP)-1, TIMP-2, TIMP-3, TIMP-4, endostatin,
angiostatin, endostatin XVIII, endostatin XV, the C-terminal
hemopexin domain of matrix metalloproteinase-2, the kringle 5
domain of human plasminogen, a fusion protein of endostatin and
angiostatin, a fusion protein of endostatin and the kringle 5
domain of human plasminogen, the monokine-induced by
interferon-gamma (Mig), the interferon-alpha inducible protein 10
(IP10), a fusion protein of Mig and IP10, soluble FLT-1 (fms-like
tyrosine kinase 1 receptor), and kinase insert domain receptor
(KDR), whereas genes that regulate apoptosis include genes that
encode Bcl-2, Bad, Bak, Bax, Bik, Bcl-X short isoform and Gax.
Preferably, the lentiviral vector is administered in a dosage of
from about 10.sup.6 to 10.sup.9 transducing units into the
capsular, vitreal or sub-retinal space.
[0106] The present invention also provides a method of preventing
neovascularization and corneal transplant failure. Corneal buttons
are transduced ex vivo prior to transplantation with a lentiviral
vector comprising a therapeutic gene that inhibits
neovascularization. The therapeutic gene is a gene that regulates
angiogenesis, and representative examples of such genes have been
listed above.
[0107] In another aspect of the present invention, there are
provided lentiviral vectors capable of mediating gene transfer to a
number of cell types. The recombinant lentiviral vectors comprise
(i) an IRES (internal ribosome entry site) element between two
cloning sites so that two different proteins are produced from a
single transcript; (ii) a marker gene such as the enhanced green
fluorescent protein gene; and (iii) a therapeutic gene. In general,
the therapeutic gene can regulate tumor growth, angiogenesis or
apoptosis. In one embodiment, therapeutic genes that regulate tumor
growth include p16, p21, p27, p53 and PTEN, and representative
lentiviral vectors are pHR-CMV-P16-ires-eGFP (FIG. 19),
pHR-CMV-P21-ires-eGFP (FIG. 20) and pHR-EF1/HTLV-P21-ires-eGFP
(FIG. 30).
[0108] In another embodiment, therapeutic genes that regulate
apoptosis include Bik, Bad, Bak, Bax, Bcl-2, Bcl-XL and Gax, and
representative lentiviral vector is pHR-CMV-BIK-ires-eGFP (FIG.
16).
[0109] In yet another embodiment, therapeutic genes that regulate
angiogenesis include genes that encode tissue inhibitor of
metalloproteinase (TIMP)-1, TIMP-2, TIMP-3, TIMP-4, endostatin,
angiostatin, endostatin XVIII, endostatin XV, the C-terminal
hemopexin domain of matrix metalloproteinase-2, the kringle 5
domain of human plasminogen, FLT-1 (fms-like tyrosine kinase 1
receptor), KDR (kinase insert domain receptor), IP-10 (the
interferon-alpha inducible protein 10) and MIG (the
monokine-induced by interferon-gamma). Representative lentiviral
vectors are pHR-CMV-KDR-ires-eGFP (FIG. 18),
pHR-CMV-Timp1-ires-eGFP (FIG. 21), pHR-EF1/HTLV-Ang-ires-eGFP (FIG.
22), pHR-EF1/HTLV-Endo XV-ires-eGFP (FIG. 23), pHR-EF1/HTLV-Kringle
1-5-ires-eGFP (FIG. 26), pHR-EF1/HTLV-Timp1-ires-eGFP (FIG. 28),
pHR-EF1/HTLV-Timp4-ires-eGFP (FIG. 29) and pHR-EF1/HTLV-Endo
XVIII-ires-eGFP (FIG. 31).
[0110] In yet another embodiment, therapeutic genes that regulate
angiogenesis encode angiostatic fusion protein such as a fusion
protein of endostatin and angiostatin, endostatin and the kringle 5
domain of human plasminogen, and Mig (monokine-induced by
interferon-gamma) and IP10 (interferon-alpha inducible protein 10).
Representative lentiviral vectors are pHR-CMV-Endo/Ang-ires-eGFP
(FIG. 15), pHR-CMV-Endo/Kringle-ires-eGFP (FIG. 17),
pHR-EF1/HTLV-EndoAng-ires-eGFP (FIG. 24),
pHR-EF1/HTLV-EndoKringle-ires-eGFP (FIG. 25) and
pHR-EF1/HTLV-MigIP10-ires-eGFP (FIG. 27).
[0111] The following examples are given for the purpose of
illustrating various embodiments of the invention and are not meant
to limit the present invention in any fashion:
EXAMPLE 1
Cells and Tissue
[0112] Primary explants of human choroidal fibroblasts (HCF), human
umbilical vein endothelial cells (HUVEC) and human fetal retinal
pigment epithelial cells (HRPE) were established and were plated in
conditions which either did or did not promote mitotic activity.
Stable photoreceptor-derived cells (Y-79 and Weri-Rb-1) were also
cultured.
[0113] Human retina and RPE, obtained at the time of enucleation
for retinoblastoma were used to demonstrate the ability of
lentiviral vectors to transduce these mitotically inactive cells
and induce the expression of an exogenous human peripherin
transgene. Human corneas obtained at the time of corneal transplant
surgery were used to demonstrate the ability of lentiviral vectors
to transduce these mitotically inactive cells with the marker gene
enhanced green fluorescence protein gene.
EXAMPLE 2
Lentivirus Vector
[0114] A three plasmid-based lentiviral vectoring system
pseudotyped with the vesicular stomatitis virus (VSV) envelope and
which contained the green fluorescent protein (GFP) gene as a
marker was used (FIG. 1). Recombinant lentiviruses were produced as
described by Naldini et al. The cytomegalovirus (CMV)
immediate-early gene promoter directed expression of eGFP in the
plasmid pHR'-CMV-eGFP. Stocks of virus were generated as follows.
Human kidney 293T cells (5.times.10.sup.6) were plated on 10 cm
plates, and were cotransfected the following day with 10 ug of
pCMV.DELTA.R8.91 (packaging function plasmid), 10 ug of
pHR'-CMV-eGFP (marker gene plasmid), and 2 ug of pMD.G (the VSV-G
envelope containing plasmid) by calcium phosphate precipitation in
D10 growth medium (high glucose DMEM with 10% fetal bovine serum)
and antibiotics. After 12-16 h at 37.degree. C., the medium was
removed and fresh D10 growth medium was added. Cells were cultured
for an additional 10 hours. Fresh D10 medium containing 10 mM
sodium butyrate and 20 mM Hepes buffer was added to the cells and
the cells were cultured for another 12 hours. This medium was
replaced with new D10 medium containing 20 mM Hepes buffer, and
after 12 h the virus-containing medium was collected. Fresh medium
was added and the supernatant was collected every 24 h for the
following 4 days. The viral supernatant was stored at -80.degree.
C. immediately after collection.
[0115] Viral stock were concentrated by ultracentrifugation of the
supernatant (19,000 rpm, Beckman SW28 rotor) for 140 min at room
temperature and the resulting viral pellets were resuspended in 1-3
ml of phosphate-buffered saline. Aliquoted viral stocks were
titered with 293 cells and the remaining samples were stored at
-80.degree. C.
[0116] All lentiviral vector supernatants were assayed for the
presence of replication competent retrovirus (RCR) by infection of
phytohemagglutinin-stimulated human peripheral blood mononuclear
cells, with subsequent analysis of the culture medium for p24 gag
by ELISA. RCR was not detected in any of the viral supernatants
produced.
EXAMPLE 3
Lentivirus Vector Transduction
[0117] Supernatants containing 2.times.10.sup.6
replication-deficient lentiviral particles/ml were generated by the
transfection of 293T cells with the lentivirus vector described
above, Cells were cultured with the viral particles for 24 hours
and then recovered in normal media for four days prior to the
determination of GFP expression by fluorescent-activated cell
sorting (FIGS. 2-3).
[0118] Transduction efficiency was measured as a function of
multiplicity of infection with MOIs ranging from 1 to 1000. Results
of in vitro transduction of a number of human cell lines
demonstrate a positive correlation between MOI and transduction
efficiency as more cells were transduced with increasing number of
lentiviral particles (FIG. 2).
[0119] The ability of the lentiviral vector to transduce
non-dividing cells was examined. Human retinal pigment epithelial
cells were transduced by lentiviral or murine leukemia viral
vectors. Cells were mitotically inactive (confluent) or mitotically
active (growing) at the time of exposure to vector. Results shown
in FIG. 4 demonstrate a superior ability of lentiviral vectors over
other retroviral vectors to transduce non-dividing cells. The
lentiviral vector was also highly efficient in transducing human
fetal cells as compared with non-lentiviral retroviral vector (FIG.
6).
[0120] To determine the duration of eGFP transgene expression,
cells transduced by the lentiviral vector were tested over a period
of 120 days. Results of Southern Blot analysis on clonal
populations of transduced cells indicate that the lentiviral-eGFP
vector was integrated into the host genome (FIG. 5B). Expression of
the integrated eGFP transgene was stable over 120 days and confer
no selective advantage for or against the transduced cells (FIG.
5A).
EXAMPLE 4
Corneal Transduction In Situ
[0121] Human corneal buttons obtained at the time of corneal
transplant surgery were used to demonstrate the ability of
lentiviral vectors to transduce these mitotically inactive cells
with the marker gene enhanced green fluorescence protein gene (FIG.
7). Endothelial cells attached to Descemet's membrane were peeled
away from the transduced corneal tissue, and examined by light and
fluorescent microscopy. The corneal endothelium was positive for
eGFP, indicating that efficient gene transfer and expression were
attained (FIG. 7B). Efficient in situ transduction and eGFP
expression in the epithelial layer was also observed (FIG. 7C).
[0122] In conclusion, these results indicate that a
replication-defective lentiviral vector is able to transfer
efficiently transgene to human corneal endothelial and epithelial
cells in situ, and achieve long-term transgene expression. This
vector could be useful in the treatment of corneal endothelial or
epithelial disorders and can be applied to modify the genetic
makeup of a donor cornea tissue ex vivo before transplantation in
such a way as to modulate permanently the process of allograft
rejection.
EXAMPLE 5
Growth Suppressor Therapy for Ocular Proliferative Disease
[0123] Human peripherin gene was used as one example of therapeutic
gene. Genetic deficiency of peripherin gene in humans is known to
result in a wide variety of disabling phenotypes. Normal human
retinal or retinal pigment epithelial (RPE) tissue surgically
excised at the time of enucleation for retinoblastoma was exposed
to lentiviral vectors which either lacked a therapeutic gene or
contained the human peripherin gene. Results in FIG. 8 demonstrate
that the peripherin gene was efficiently transferred to human
retinal tissue by the lentiviral vector.
[0124] As an another example of therapeutic gene transfer, the
constitutively active form of the retinoblastoma gene (CA-rb) was
used. The lentiviral vector disclosed herein mediated efficient
transfer of the constitutively active form of the retinoblastoma
gene (FIG. 9). The transferred CA-rb gene exhibited dose-dependent
inhibitory effects on the proliferation of human retinal and
choroidal cells (FIG. 10) and human lens epithelial cells (FIG.
11).
[0125] The constitutively active form of the retinoblastoma gene
transferred by the lentiviral vector also inhibited intraocular
cellular proliferation in vivo. Two models of intraocular
proliferative disease (proliferative vitreoretinopathy and
post-lens extraction posterior capsular opacification) were tested
in vivo. Proliferative vitreoretinopathy was induced in three sets
of rabbits (FIG. 12). One set was not treated, one set was treated
with lentiviral vectors lacking the CA-rb gene and the last set was
treated with intravitreally-delivered lentiviral CA-rb.
Proliferative vitreoretinopathy and retinal detachment was noted in
the first two sets at high frequency (>90%), whereas the
fraction of animals that went on to retinal detachment was
significantly lower in the set treated with CA-rb (26%).
[0126] Results shown in FIG. 13 demonstrate in vivo inhibitory
effect of lentiviral CA-rb on the process of post-lens extraction
posterior capsular opacification. Three sets of rabbits underwent
standard phacoemulsfication to remove the native crystalline lens.
The first set (group 1) was subsequently treated with nothing and
the second two sets were treated with either empty lentiviral
constructs (no therapeutic gene, group 2) or with lentiviral CA-rb
(group 3) delivered into the intact lens capsular bag at the time
of closure of the cataract wound. Animals were serially examined
for the presence of posterior capsular opacification. The presence
of opacification was graded on a 1 to 5 scale where 1 represented
no opacification and 5 represented opacification severe enough to
preclude visualization of the retina with indirect binocular
opthalmoscopy. There were no statistically different results
obtained between groups 1 and 2 (no treatment and empty vector),
whereas a striking inhibitory effect of lentiviral CA-rb on the
development of posterior capsule opacification was observed. By day
28, control animals had an average opacification score of 4.4 while
animals treated with lentiviral CA-rb had an average opacification
score of 2.1.
EXAMPLE 6
"Two Gene" Lentiviral Vector
[0127] A new lentiviral vector that incorporated an IRES (internal
ribosome entry site) element between two cloning sites was
constructed. The IRES element allows mRNA-ribosome binding and
protein synthesis. This backbone can accommodate two different
expressible genes. A single message is produced in transduced
cells; however, because of the IRES element, this message is
functionally bi-cistronic and can drive the synthesis of two
different proteins. In this fashion a number of potentially
therapeutic genes (Table 1) can be linked to a marker gene (e.g.
the enhanced green fluorescent gene--eGFP gene) so that transduced
cells will simultaneously be marked and able to express the
therapeutic gene of interest. Marked cells can then easily be
isolated in vitro and observed in vivo.
[0128] The lentiviral vector can also carries fusion genes that
combine the functional motifs of different angiostatic proteins via
an elastin peptide linker. These fusion proteins combine two potent
angiostatic genes to increase the suppression of tumor
angiogenesis. Since these molecules operate through different
mechanisms, their combination may result in additive or synergistic
effects. Examples of angiostatic fusion proteins include, but are
not limited to, the fusion of endostatin 18 and angiostatin
(endo/ang, FIG. 14), endostatin 18 and the kringle 5 motif of
plasminogen (endo/k5), fusion of endostatin 18 and PEX, as well as
the fusion of monokine-induced by interferon-gamma and the
interferon-alpha inducible protein 10 (MIG/IP10). Genetic maps for
a number of lentiviral vectors carrying various therapeutic genes
are shown in FIGS. 15-31.
[0129] Naive cells known to not express the therapeutic gene were
exposed to a lentiviral vector carrying one of the aforementioned
fusion genes for 24 hours. Two days following this exposure, RNA
was isolated from these cells and was tested for transgene
expression by reverse-transcriptase assisted polymerase chain
reaction (RT-PCR). FIG. 32 shows a positive RT-PCR product for the
endostatin-18/angiostatin fusion gene from mRNA isolated from human
dermal microvascular endothelial cells, thereby demonstrating
lentiviral-mediated gene transfer in vitro.
TABLE-US-00001 TABLE 1 Candidate Therapeutic Genes ANGIOGENESIS
INHIBITORS MMP inhibitors hTIMP1 hTIMP2 hTIMP3 hTIMP4 hPEX
Endostatin hEndo XV hEndo XVIII Angiostatin hK1-5 Anti-VEGF hFLTs
hFLK-1 (KDR) Chemokines Mig IP-10 TUMOR SUPPRESSORS hp16 hp21 hp27
hp53 hPTEN APOPTOSIS hBad hBak hBax-a hBc12-a hBc1XL hBik hGAX
EXAMPLE 7
Animal Model of Neovascularization
[0130] Following the demonstration of in vitro lentiviral-mediated
gene transfer as shown above, the ability to inhibit
neovascularization in vivo was then examined. Neovascularization
was induced in rabbit corneal tissues in the following fashion:
Creation of a Corneal Intrastromal Micropocket and Insertion of
Nylon Mesh Impregnated with Lentivirus
[0131] Rabbits underwent general anesthesia with Isoflourane (4
L/Min) and Oxygen (2 L/Min) by masking. One drop of Proparacaine
was placed in the fornix for topical anesthesia. The Isoflourane
was reduced to 2.5 L/Min. Betadine was placed in the fornix for 30
sec. and rinsed out with BSS (balanced saline solution, Alcon Inc).
A lid speculum was placed in the eye. A 2.8 mm microkeratome was
used to enter the corneal stroma at 12 o'clock. This intrastromal
incision was developed into a 5.times.5 mm intrastromal pocket with
a McPherson forceps and Iris Sweep instrument by sweeping
back-and-forth. The 12 o'clock incision was opened up on either
side so that the opening was 4.5 mm with Vannas scissors. A
4.times.4 mm Amersham hybridization nylon mesh (Amersham
Bioscientist RPN 2519) impregnated with 10 .mu.L of lentivirus was
inserted into the pre-formed pocket. A drop of tobramycin was
placed on the cornea. Isoflourane was discontinued and nasal oxygen
was increased to 4 L/Min. In this fashion, rabbits were
successfully brought out of general anesthesia after 20 minutes and
returned to their cages with normal vital functions.
[0132] Rabbits received 0.2 cc of buprenex (0.3 mg/cc) SQ bid for
two days for analgesia. Rabbits also received one drop of atropine
and one drop of tobramycin for two days for post-op cycloplegia and
antibiotic care. On the first post-operative day each rabbit
received a drop of topical proparacaine for anesthesia and the
nylon mesh was removed from the corneal intrastromal pocket with a
0.12 forceps. Post surgical pain control and care was monitored
daily for two weeks.
Alkali Induced Neovascularization
[0133] Two weeks after initial surgery, corneas were exposed to 6
mm Whatman #3 filter disks saturated with 20 .mu.l of 1.0M NaOH for
1 minute. All corneas were then copiously washed with BSS. Rabbits
received one drop of atropine and one drop of tobramycin for two
days for post-op cycloplegia and antibiotic care. Digital
photo-documentation was carried out to record the neovascular
response. The neovascular response was measured by slit-lamp
examination noting the clock hours and the length of vessels on
post-trauma day 1, 3, 5, 7, and 10. Neovascularization was
quantified by calculating the area of vessel growth as described in
FIG. 33. Confocal microscopy was performed to document the
expression of enhanced green fluorescent protein, the marker gene
included in the lentiviral bicistronic message. FIG. 34 shows
photomicrographs demonstrating the presence of eGFP within the
corneal micropocket in animals treated with the lentiviral
vector.
EXAMPLE 8
Inhibition of Neovascularization by the Endo/K5 Fusion Gene
[0134] The present example examines whether lentiviral mediated
expression of an Endostatin:Kringle-5 fusion gene has an inhibitory
effect on neovascularization and failure of corneal
transplants.
[0135] More than 30,000 corneal transplants are performed each year
in the United States. This is more than all heart, kidney, and
liver transplants combined. Corneal transplantation is one of the
most successful transplants in humans, with success rate exceeding
90%. Still there are a significant number of corneal transplants
that undergo rejection and graft failure every year. The need for
regrafting a failed transplant is one of the top two indications
for corneal transplantation in many centers in the US, competing
with pseudophakic bullous keratopathy in frequency. The major risk
factors for rejection are prior to corneal transplantation,
glaucoma, and preoperative corneal vascularization. Prevention of
corneal neovascularization would be a pivotal step towards
inhibiting graft failure and rejection, and the development of a
biological agent to combat pro-angiogenic stimulation would be a
useful tool.
[0136] Endostatin, a 20 kDa C-terminal fragment of Collagen XVIII,
has been shown to be an endogenous inhibitor of angiogenesis and
tumor growth in a hemangioendothelioma model in rats. Endostatin
impedes proliferation and migration by down regulating the
expression of genes involved in cell growth, anti-apoptosis and
angiogenesis specifically within endothelial cells. Angiostatin, a
protein derived from proteolytic cleavage of an internal fragment
of plasminogen, contains up to 4 kringle domains and inhibits
angiogenesis-dependent tumor growth. Kringle-5 of plasminogen
shares 46%-57% amino acid identity to each of the four kringle
domains of angiostatin and is a more potent inhibitor of basic
fibroblast growth factor-stimulated angiogenesis than angiostatin
alone. Kringle-5 acts specifically on endothelial cells by
inhibiting cell migration. The angiostatic fusion protein
consisting of mouse Endostatin and mouse Angiostatin has been shown
to have a more potent biological effect than either gene product
alone in an in vitro cancer model. In this example, the
biologically active domains of human endostatin 18 and human
kringle-5 were linked to make the fusion protein Endo::K-5 for the
purpose of producing a protein able to inhibit both endothelial
cell proliferation and migration.
Lentiviral Production
[0137] An Endostatin-Kringle-5 (Endo-Kr5) fusion cDNA was amplified
by PCR from the EK-5 pBlast vector (Invivogen) using the forward
primer (5'CTGAGGGATCCGGCGAAGGAG3', SEQ ID NO. 1) containing a BamH1
site and the reverse primer (5' CAATGTATCGGATCCRGTCGAGCTAGC3', SEQ
ID NO. 2) containing a BamH1 site. This fusion gene encodes 20
amino acids from the human Interleukin-2 secretion signal, amino
acids Ala 1333-Lys 1516 from the human Collagen XVIII gene
(endostatin), an 8 amino acid elastin linker motif VPGVGTAS (SEQ ID
NO. 3) and amino acids Pro 466-Asp 566 from the human plasminogen
gene. The PCR fragment was digested with BamH1 and ligated into a
lentiviral vector under the transcriptional control of the
cytomegalovirus (CMV) promoter (FIG. 17). Construction of the
Endo::K-5 fusion gene was confirmed by direct sequencing of the
transgene insert.
Viral Assay
[0138] The presence of viral particles was confirmed with a p24 GAG
antigen ELISA kit (Zeptometrix) as per manufacturer's instructions.
To ensure the infectivity of the lentiviral reagent, 10, 50, and
100 .mu.l of virus was placed into a six-well plate of human dermal
microvascular endothelial cells (HDMEC) for 20 min at 37.degree. C.
Media 131 (Cascade Biologicals; Oregon) was then added and cells
were incubated at 37.degree. C., 5% CO.sub.2 for 5 days, with media
changes every other day. On day 5, RNA was isolated using Trizol
(Gibco-BRL) and analyzed by standard RT-PCR. The forward primer
(5'TCTGAGGGTCCGCTGAAGCCCGGGG3', SEQ ID NO.4) and reverse primer
(5'CAAATGAAGGGGCCGCAC3', SEQ ID NO. 5) flanked the elastin linker
region and thus would only amplify the fusion transcript.
Corneal Transplantation in Rabbits
[0139] Sixteen 7 mm trephined donor corneas were obtained from
eight New Zealand White Rabbits. Each button was incubated for 18
hours at 37.degree. C. in 2 ml of optisol (CHIRON) containing 50
.mu.l Endo::K-5 lentivirus, 50 .mu.l eGFP lentivirus, or 50 .mu.l
PBS.
[0140] General anesthesia was induced by mask-administration of
isoflorane. Paracentesis was created and heparin and viscoelastic
were instilled into the anterior chamber (AC). A Hessburg-Barron 7
mm trephine was used to remove the host corneal button. Host
buttons were placed in optisol media containing viral or control
supplements for transplantation the following day. A 7 mm-trephined
corneal button treated with Enod::K-5, eGFP, or PBS was sewn in
with 16 interrupted 7-0 nylon sutures. 0.1 cc subconjuntival
injections of Baytril (23 mg/cc) and Kenolog (40 mg/cc) were given.
Postoperatively, all animals received a single dose of topical
atropine (1%) and a single dose of carprofen at 2.5 mg/kg SQ, as
well as tobramycin 1 drop twice a day for 5 days and Buprenex at
0.1 mg/kg SQ as necessary. No topical steroid drops were given
post-operatively.
Measurement of Neovascularization and Evaluation of Graft
Rejection
[0141] Neovascularization was followed by slit lamp examinations on
post-operative days 5, 9, 12, 14, 16, 24, 28, and 36. Measurements
of neovascularization were made with a portable slit lamp by a
single masked observer/ophthalmologist. Vessel growth onto the
clear cornea was noted in mm and number of clock hours.
Neovascularization was quantified by calculating the wedge shaped
area of vessel growth with the formula: Area=(clock hours/12)
.pi.r.sup.2 (FIG. 33). In most cases, vessel growth did not span
the entire wedge section. To correct for this, the area of the
section void of vessel growth was subtracted from the total area
(FIG. 33). Graft rejection was evaluated by portable slit-lamp.
Graft failure was judged by the presence of persistent corneal
graft edema with opacification of 100% of the graft. Serial
photographs of the cornea were taken. Animals were sacrificed on
postoperative days 9, 21, 30, & 40. Fresh corneal tissue was
placed in either Trizol (Gibco-BRL) for RT-PCR or formalin for
histopathologic study.
Results
[0142] Sixteen New Zealand white rabbits underwent sequential
allogeneic penetrating keratoplasty in one eye. Ten rabbits
received grafts soaked overnight in Optisol plus lentiviral vector
carrying the endostatin/kringle 5 fusion gene. Three rabbits
received grafts soaked with Optisol plus lentiviral vector carrying
the eGFP marker gene. Three rabbits received grafts soaked with
Optisol plus PBS.
[0143] Postoperative corneal neovascularization was significantly
lower in lentiviral Endo::K-5 transplanted eyes than either
lentiviral eGFP or PBS control eyes on postoperative days 5, 9, 12,
14, 16, 18, 24, 28 and 36 (FIG. 35). All PBS and all lentiviral
eGFP treated corneas exhibited neovascular arborization into the
graft bed. None of the ten Endo::K-5 treated corneas had new
vessels into the graft. Three of three PBS and two of three eGFP
treated corneas exhibited corneal opacification and graft failure,
while none of the ten Endo::K-5 grafts completely opacified or
failed by postoperative day 39.
[0144] All of the five grafts tested by RT-PCR for the presence of
fusion gene transcripts were positive on postoperative days 30 and
40. All control and non-operative eyes were negative by fusion gene
RT-PCR. Histopathology of the grafts revealed thicker, more
edematous corneas in the control eyes when compared to the
Endo::K-5 treated eyes. Analysis of serial sections revealed more
neovascularization and basophilic inflammatory infiltrates in
control eyes than in Endo::K-5 treated or non-operated eyes.
Histopathologic study of a site of retained suture, often the
location of an inflammatory infiltrate, was void of inflammatory
cells in the examined Endo::K-5 cornea.
[0145] The success of corneal transplantation has expanded the
indications for this surgery and has increased the number of
keratoplasties performed annually. Despite the relative success of
this surgery, graft rejection for a number of reasons remains a
major problem. A major risk factor for graft rejection is
neovascularization of the recipient corneal bed, the graft/host
interface or, subsequently, of the graft itself. The development of
new blood vessels into the graft is associated with high levels of
inflammatory cells, plasma proteins, and cytokines within the graft
and is often a presage to rejection and failure. Believing that
neovascularization promotes rejection, investigators have long
sought medical or surgical approaches to abort the process of
corneal neovascularization.
[0146] The present example describes a successful approach to
inhibit the development of post-penetrating keratoplasty
neovascularization in a rabbit model. This approach is based upon
the ability of lentiviral vectors to transduce corneal tissues ex
vivo with genes known to be anti-angiogenic in animal models of
tumor angiogenesis. A fusion gene that combines the human
endostatin gene and the fifth kringle element of the human
plasminogen gene as an inhibitor of new blood vessel growth was
tested herein.
[0147] Treatment of corneal buttons with lentiviral Endo::K-5 was
able to prevent new vessel growth onto the donor graft in all
treated corneas. Histologic study revealed a marked decrease in
inflammation in Endo::K-5 treated corneas. This included the areas
around retained sutures, a commonly inflamed area. Furthermore,
there was no evidence of graft failure as measured by persistent
corneal edema and corneal opacification in Endo::K-5 treated
corneas, whereas five of six control corneas exhibited evidence of
opacification and failure. These results indicate that ex vivo
lentiviral transduction of donor corneal tissue with a fusion
anti-angiogenic gene prior to penetrating keratoplasty may increase
the likelihood of long-term graft survival and can be a useful
surgical adjunct.
EXAMPLE 9
Inhibition of Neovascularization by Kringle 1-5 Gene
[0148] Angiostatin K1-5, encoding a 55 kD protein composed of all
five kringle domains of plasminogen, is created by protease action
of plasmin on plasminogen. It is a potent anti-angiogenic factor in
multiple models.
[0149] Corneal pocket assay was performed on New Zealand white
rabbits to determine the effects of the Kringle 1-5 gene on
neovascularization in the eye. Nylon mesh were inserted as spacers
into the intrastromal corneal pockets, followed by injection of
either a lentiviral vector carrying a Kringle 1-5 gene and a marker
gene eGFP (FIG. 26), a lentiviral vector carrying the marker gene
eGFP only, or injected with PBS alone. The mesh was removed from
the eyes 24 hours later, and sutures were applied to the eyes 7
days later to stimulate neovascularization. The extent of
neovascularization was measured at days 3, 5, 7 and 10 after
sutures application. Corneas were also harvested for
histopathological and transgene expression analysis. As shown in
FIG. 36, there was significant inhibition of neovascularization in
animals treated with lentiviral vector carrying the Kringle 1-5
gene.
EXAMPLE 10
Inhibition of Neovascularization by the Mig/IP10 Fusion Gene
[0150] Mig is the monokine induced by interferon gamma, whereas
IP10 is the interferon-alpha inducible protein 10. They have
similar structure and function, and they both are chemokines
belonging to the CXC family. In human these two protein are 37%
identical, and their genes are located adjacent to each other on
chromosome 4q21.21. Mig and IP10 bind to CXCR3, a G-protein coupled
receptor expressed predominantly on memory and activated T cells.
CXCR3 is also found on B cells, NK cells and monocytes. Recently, a
second receptor for Mig and IP10 was found on endothelial cells.
Functionally, both Mig and IP10 are chemotatic for activated T
cells and are thought to effect blood vessel formation by
inhibiting endothelial cell chemotaxis as well as growth factor
induced angiogenesis. The effects of a Mig/IP10 fusion gene on
neovascularization in the eye was examined as described below.
[0151] Corneal intrastromal micropockets were created as described
in Example 7, and nylon mesh impregnated with lentivirus carrying
the Mig/IP10 fusion gene (FIG. 27), lentiviral vector carrying the
marker gene eGFP only, or nylon mesh impregnated with PBS alone
were inserted into the micropockets. The mesh was removed after 24
hours. To induce neovascularization, the corneas were exposed to 6
mm Whatman #3 filter disks saturated with 20 .mu.l of 1.0M NaOH.
Neovascularization was then measured over a 10 day time course. As
shown in FIGS. 37-38, there was significant inhibition of
neovascularization in animals treated with lentiviral vector
carrying the Mig/IP10 fusion gene.
EXAMPLE 11
Inhibition of Neovascularization by KDR Gene
[0152] KDR (kinase insert domain receptor) is a membrane-bound
receptor of VEGF (VEGF Receptor 2). VEGF is a potent mitogen for
vascular endothelial cells and induces proliferation, migration and
protease production. It has been shown that a soluble fragment of
KDR (sKDR) has angiostatic properties by way of its antagonist
activity against VEGF. The sKDR also binds and blocks the external
domain of the membrane-bound KDR. The effects of a sKDR gene
delivered by lentiviral vector (FIG. 18) on neovascularization in
the eyes were examined in animal model as described above. Results
in FIG. 39 show that there was significant inhibition of
neovascularization in animals treated with lentiviral vector
carrying the sKDR gene.
[0153] The following references were cited herein: [0154]
Anand-Apte et al., (1996) Biochem. Cell. Biol. 74: 853-862. [0155]
Bergers et al., (1999) Science 284: 808-812. [0156] Bigg et al.,
(1997) J. Biol. Chem. 272: 15496-15500. [0157] Boehm et al., (1997)
Nature 390: 404-407. [0158] Brooks et al., (1998) Cell 92: 391-400.
[0159] Cao et al., (1997) J. Biol. Chem. 272: 22924-22928. [0160]
Chittenden et al., (1995) Nature 374: 733-736. [0161] Docherty et
al., (1985) Nature 318: 666-669. [0162] Dole et al., (1996) Cancer
Res. 56: 5734-5740. [0163] Ealovega et al., (1996) Cancer Res. 56:
1965-1969. [0164] Gomez et al., (1997) Eur. J. Cell. Biol. 74:
111-122. [0165] Greene et al., (1996) J. Biol. Chem. 271:
30375-30380. [0166] Innes et al., (1999) Exp. Hematol. 27: 75-87.
[0167] Ji et al., (1998) Biochem. Biophys. Res. Commun. 247:
414-419. [0168] Kirsch et al., (1998) Cancer Res. 58: 4654-4659.
[0169] Kobayashi et al., (1998) Oncogene 16: 1587-1591. [0170]
Luster and Leder, (1996) J. Exp. Med. 178: 1057-1065. [0171] Martin
et al., (1996) Oncogene 13: 569-576. [0172] Mauceri et al., (1998)
Nature 394: 287-291. [0173] Miyake et al., (1999) Br. J. Cancer 79:
1651-1656. [0174] Miyoshi et al., (1997) Proc. Natl. Acad. Sci. USA
94: 10319-10323. [0175] Musso et al., (1997) J. Hepatol. 26:
593-605. [0176] Naldini et al., (1996) Science 272: 263-267. [0177]
O'Reilly et al., (1997) Cell 88: 277-85. [0178] Perlman et al.,
(1999) Gene Ther. 6: 758-763. [0179] Perlman et al., (1998) EMBO
17: 3576-3586. [0180] Saille et al., (1999) Neuroscience 92:
1455-1463. [0181] Sasaki et al., (2000) J Mol Biol. 301(5):1179-90.
[0182] Sgadari et al., (1997) Blood 89:2635-2643. [0183] Sgadari et
al., (1996) Proc. Natl. Acad. Sci. USA 93: 13791-13796. [0184]
Stetler-Stevenson et al., (1990) J. Biol. Chem. 265: 13933-13938.
[0185] Tannenbaum et al., (1998) J. Immunol. 161: 927-932. [0186]
Valente et al., (1998) Int. J. Cancer 75: 246-253. [0187] Wang et
al., (1997) Oncogene 14: 2767-2774. [0188] Zetter (1998) EMBO. J.
17: 1656-1664.
[0189] Any patents or publications mentioned in this specification
are indicative of the levels of those skilled in the art to which
the invention pertains. Further, these patents and publications are
incorporated by reference herein to the same extent as if each
individual publication was specifically and individually indicated
to be incorporated by reference.
[0190] One skilled in the art will appreciate readily that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those objects,
ends and advantages inherent herein. The present examples, along
with the methods, procedures, treatments and specific compounds
described herein are representative of preferred embodiments and
are not intended as limitations on the scope of the invention.
Changes therein will occur to those skilled in the art which are
encompassed within the spirit of the invention as defined by the
scope of the claims.
Sequence CWU 1
1
5121DNAArtificial SequenceSynthetic primer 1ctgagggatc cggcgaagga g
21227DNAArtificial SequenceSynthetic primer 2caatgtatcg gatcctgtcg
agctagc 2738PRTArtificial SequenceSynthetic peptide 3Val Pro Gly
Val Gly Thr Ala Ser1 5425DNAArtificial SequenceSynthetic primer
4tctgagggtc cgctgaagcc cgggg 25518DNAArtificial SequenceSynthetic
primer 5caaatgaagg ggccgcac 18
* * * * *