U.S. patent application number 12/213368 was filed with the patent office on 2009-06-11 for single chain class i major histocompatibility complexes.
This patent application is currently assigned to Technion Research & Development Foundation Ltd.. Invention is credited to Yoram Reiter.
Application Number | 20090148925 12/213368 |
Document ID | / |
Family ID | 24132253 |
Filed Date | 2009-06-11 |
United States Patent
Application |
20090148925 |
Kind Code |
A1 |
Reiter; Yoram |
June 11, 2009 |
Single chain class I major histocompatibility complexes
Abstract
A recombinant polypeptide and nucleic acid constructs capable of
expressing the recombinant polypeptide are provided. The
recombinant polypeptide comprises a chimeric polypeptide including
an antigenic peptide being capable of binding a human MHC class I,
a functional human .beta.-2 microglobulin and a functional human
MHC class I heavy chain.
Inventors: |
Reiter; Yoram; (Haifa,
IL) |
Correspondence
Address: |
Martin D. Moynihan;PRTSI, Inc.
P.O. Box 16446
Arlington
VA
22215
US
|
Assignee: |
Technion Research & Development
Foundation Ltd.
Haifa
IL
|
Family ID: |
24132253 |
Appl. No.: |
12/213368 |
Filed: |
June 18, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10073300 |
Feb 13, 2002 |
7399838 |
|
|
12213368 |
|
|
|
|
09534966 |
Mar 27, 2000 |
|
|
|
10073300 |
|
|
|
|
Current U.S.
Class: |
435/252.3 ;
536/23.5 |
Current CPC
Class: |
C07K 14/70539
20130101 |
Class at
Publication: |
435/252.3 ;
536/23.5 |
International
Class: |
C12N 1/21 20060101
C12N001/21; C12N 15/11 20060101 C12N015/11 |
Claims
1-11. (canceled)
12. A nucleic acid construct comprising a first nucleic acid
sequence encoding an antigenic peptide capable of binding a
mammalian MHC class I, and a second nucleic acid sequence encoding
a mammalian beta-2 microglobulin translationally fused upstream of
a functional mammalian MHC class I heavy chain.
13. The nucleic acid construct of claim 12, wherein said first
nucleic acid sequence and said second nucleic acid sequence are
translationally fused.
14. The nucleic acid construct of claim 13, wherein said first
nucleic acid sequence is translationally fused upstream of said
second nucleic acid sequence.
15. A bacterial cell transformed with a nucleic acid construct
which comprises a first nucleic acid sequence encoding an antigenic
peptide capable of binding a mammalian MHC class I, and a second
nucleic acid sequence encoding a mammalian beta-2 microglobulin
translationally fused upstream of a functional mammalian MHC class
I heavy chain.
16. The bacterial cell of claim 15, wherein said first nucleic acid
sequence and said second nucleic acid sequence are translationally
fused.
17. The bacterial cell of claim 15, wherein said first nucleic acid
sequence is translationally fused upstream of said second nucleic
acid sequence.
Description
[0001] This is a Continuation-In-Part of U.S. patent application
Ser. No. 09/534,966, filed Mar. 27, 2000.
FIELD AND BACKGROUND OF THE INVENTION
[0002] The present invention relates to methods of generating a
functional mammalian single chain MHC class I complex in
prokaryotic expression systems and a functional human single chain
MHC class I complex in eukaryotic or prokaryotic expression
systems, which complexes are capable of presenting specific
antigenic peptides restricted to class I MHC and recognizable by
specific CTL clones or CD+8 T-cells. The present invention further
relates to a method of generating a functional mammalian single
chain MHC class I-peptide complex in eukaryotic, or preferably
prokaryotic expression systems, to nucleic acid constructs encoding
said single chain MHC class I complexes and to a novel human single
chain MHC class I polypeptide.
[0003] The major histocompatibility complex (MHC) is a complex of
antigens encoded by a group of linked loci, which are collectively
termed H-2 in the mouse and HLA in humans. The two principal
classes of the MHC antigens, class I and class II, each comprise a
set of cell surface glycoproteins which play a role in determining
tissue type and transplant compatibility. In transplantation
reactions, cytotoxic T-cells (CTLs) respond mainly against foreign
class I glycoproteins, while helper T-cells respond mainly against
foreign class II glycoproteins.
[0004] Major histocompatibility complex (MHC) class I molecules are
expressed on the surface of nearly all cells. These molecules
function in presenting peptides which are mainly derived from
endogenously synthesized proteins to CD8+ T cells via an
interaction with the .alpha..beta. T-cell receptor [1-4]. The class
I MUC molecule is a heterodimer composed of a 46-kDa heavy chain
which is non-covalently associated with the 12-kDa light chain
.beta.-2 microglobulin. Class I MHC-restricted peptides, which are
typically 8-10-amino acid-long, bind to the heavy chain
.alpha.1-.alpha.2 groove via two or three anchor residues that
interact with corresponding binding pockets in the MHC molecule.
The .beta.-2 microglobulin chain plays an important role in MHC
class I intracellular transport, peptide binding, and
conformational stability [5]. For most class I molecules, the
formation of a heterodimer consisting of the MHC class I heavy
chain, peptide (self or antigenic) and .beta.-2 microglobulin is
required for biosynthetic maturation and cell-surface expression
[5].
[0005] Research studies performed on peptide binding to class I MHC
molecules enable to define specific MHC motifs functional in
displaying peptides derived from viral or tumor antigens that are
potentially immunogenic and might elicit specific response from
cytotoxic T lymphocytes (CTLs) [6,7].
[0006] The realization that CTLs have an important role in the
control of many diseases, including chronic viral diseases, such as
AIDS, and cancer have lead to an increased need to produce
sufficient amounts of stable class I MHC complexes for functional
and structural studies.
[0007] Soluble MHC molecules bound to various peptides are a
valuable tool for the study of disease-related immune responses,
for characterizing MHC-T-cell receptor (TCR) interactions [6], for
structural studies [4], and more recently for direct visualization
of antigen-specific T cells [8]. These molecules can be also used
to activate specific CTLs in vitro as well as to study their
phenotypic characteristics.
[0008] In recent years, various approaches have been used in
attempts to develop an in vitro protocol for the induction of
cytotoxic T cell responses against viral and tumor antigens [9-10].
To effectively activate T-cells, a high density of MHC-peptide
complexes on the surface of the antigen presenting cells must be
utilized [7-10]. Thus, a desirable approach for in-vitro T-cell
activation would be to use soluble MHC-peptide complexes.
[0009] To overcome the low affinity binding of TCRs to soluble MHC
molecules and as such to provide efficient T-cell activation,
multimerization of the MHC-peptide complexes must be effected.
[0010] Soluble MHC multimers posses a higher avidity for T-cells
since they provide multi-point binding of TCRs with their
MHC-peptide ligands. As such, multimeric forms (tetramers) of
MHC-peptide complexes have been the center of much interest
recently, because they can be used for direct phenotypic
characterization of T cell responses in normal as well as
pathological conditions, thus, providing insight into the
pathopysiology and mechanisms of various diseases.
[0011] However, such studies require a reproducible method for
producing large amounts of soluble and functional multimeric
MHC-peptide complexes. Thus, attempts were made to produce
recombinant MHC class I and class II complexes [11-23] which are
soluble and which can be produced in large quantities.
[0012] Early studies utilizing recombinant techniques, separately
expressed the heavy chain and .beta.-2 microglobulin components of
the MHC complex in E. Coli and subsequently refolded them in-vitro
in the presence of an antigenic peptide [11].
[0013] More recently, recombinant MHC complexes were expressed in
eukaryotic expression systems and secreted therefrom in the form of
a single polypeptide which included the heavy chain covalently
linked to the .beta.-2 microglobulin chain thus forming a stable
and functional MHC complex which can be subsequently bound to a
peptide of interest [12-15,19,21-23]. The expression of functional
MHC complexes in eukaryotic cells suffers from several inherent
limitations. Since the expressed polypeptides form a functional MHC
complex they bind peptides endogenously derived from the cells
utilized for expression and as such the purified MHC complex must
be subjected to a peptide exchange step following purification
[13]. In addition, the production yields of these single-chain
MHC-peptide complexes was limited, typically reaching levels of
several hundred micrograms per liter of culture supernatant.
[0014] The present invention provides a novel approach for the
production of unprecedented large amounts of soluble, stable and
functional MHC-peptide complex by utilizing high level bacterial
expression of a single-chain MHC class I polypeptide or
co-expression of the single chain MHC class I polypeptide and an
MHC class I restricted antigenic peptide followed by in-vitro
reconstitution of the scMHC class I-peptide complex via
redox-shuffling and refolding in the presence of the antigenic
peptide.
[0015] The present invention further provides a novel human single
chain MHC class I polypeptide which is functional and which can
therefore be utilized in either the monomeric or preferably the
multimeric form to present MHC class I restricted antigenic
peptides to CTL clones or to CD8+ T-cells from various sources.
SUMMARY OF THE INVENTION
[0016] According to one aspect of the present invention there is
provided a nucleic acid construct comprising a first nucleic acid
sequence including a first polynucleotide encoding a functional
human .beta.-microglobulin, being translationally fused upstream of
a second polynucleotide encoding a functional human MHC class I
heavy chain.
[0017] According to further features in preferred embodiments of
the invention described below, the nucleic acid construct further
comprising a second nucleic acid sequence encoding an antigenic
peptide, the antigenic peptide being capable of binding a human MHC
class I complex.
[0018] According to still further features in the described
preferred embodiments the second polynucleotide encodes .alpha. 1-3
domains of the human MHC class I heavy chain.
[0019] According to another aspect of the present invention there
is provided a nucleic acid construct comprising (a) a first nucleic
acid sequence including (i) a first polynucleotide encoding a
functional mammalian .beta.-2 microglobulin; and (ii) a second
polynucleotide encoding a functional mammalian MHC class I heavy
chain, the second polynucleotide being translationally fused
downstream of the first polynucleotide; and (b) a cis acting
regulatory sequence being selected capable for directing expression
of the first nucleic acid sequence in bacteria.
[0020] According to still further features in the described
preferred embodiments the cis acting regulatory sequence is
selected from the group consisting of a bacterial derived cis
acting regulatory sequence and a phage derived cis acting
regulatory sequence.
[0021] According to still another aspect of the present invention
there is provided a transformed cell comprising any of the nucleic
acid constructs described herein. The cell can be a eukaryotic
cell, such as, for example, a mammalian cell, an insect cell, a
plant cell, a yeast cell and a protozoa cell, or alternatively, the
cell can be a bacterial cell.
[0022] According to still another aspect of the present invention
there is provided a host cell being co-transformed with (a) a first
expression construct including a first polynucleotide encoding a
functional mammalian .beta.-2 microglobulin, being translationally
fused upstream of a second polynucleotide encoding a functional MHC
class I heavy chain; and (b) a second expression construct
including a third polynucleotide encoding an antigenic peptide,
wherein when the first, second and third polynucleotides are
co-expressed in the host cell, an MHC class I-antigenic peptide
complex is formed.
[0023] According to still further features in the described
preferred embodiments the first nucleic acid sequence further
includes an in-frame linker polynucleotide encoding a linker
peptide interposed between the first and the second
polynucleotides.
[0024] According to still further features in the described
preferred embodiments the first nucleic acid sequence further
includes an in-frame tag sequence encoding a peptide capable of
being enzymatically modified to include a binding entity.
[0025] According to still further features in the described
preferred embodiments the linker peptide is as set forth in SEQ ID
NO:10.
[0026] According to still further features in the described
preferred embodiments the nucleic acid construct further comprising
a first cis acting regulatory sequence for regulating expression of
the first nucleic acid sequence.
[0027] According to still further features in the described
preferred embodiments the nucleic acid construct further comprising
a second cis acting regulatory sequence for regulating expression
of the second nucleic acid sequence.
[0028] According to still further features in the described
preferred embodiments the cis acting regulatory sequence is
functional in a bacterial host.
[0029] According to still another aspect of the present invention
there is provided a recombinant polypeptide comprising an amino
acid sequence including a functional human .beta.-2 microglobulin
directly or indirectly covalently linked to a functional human MHC
class I heavy chain.
[0030] According to still further features in the described
preferred embodiments the recombinant polypeptide further
comprising a linker peptide being interposed between the functional
human .beta.-2 microglobulin and the functional human MHC class I
heavy chain. Preferably, the recombinant polypeptide comprising an
amino acid sequence as set forth in SEQ ID NO:5
[0031] According to yet another aspect of the present invention
there is provided a preparation of bacterial derived inclusion
bodies comprising over 30 percent by weight of a recombinant
polypeptide including an amino acid sequence including a functional
mammalian .beta.-2 microglobulin directly or indirectly covalently
linked to a functional mammalian MHC class I heavy chain.
[0032] According to an additional aspect of the present invention
there is provided a method of producing a functional MHC class I
molecule comprising the steps of (a) expressing, in bacteria, a
single chain MHC class I polypeptide including a functional
mammalian .beta.-2 microglobulin amino acid sequence directly or
indirectly covalently linked to a functional mammalian MHC class I
heavy chain amino acid sequence; and (b) isolating the single chain
MHC class I polypeptide.
[0033] According to still further features in the described
preferred embodiments the method further comprising the step of (c)
refolding the single chain MHC class I polypeptide in presence of
an antigenic peptide capable of binding the single chain MHC class
I polypeptide, to thereby generate an MHC class I-antigenic peptide
complex.
[0034] According to still further features in the described
preferred embodiments the method further comprising the step of (d)
isolating the MHC class I-antigenic peptide complex via size
exclusion chromatography.
[0035] According to still further features in the described
preferred embodiments the antigenic peptide is co-expressed along
with the single chain MHC class I polypeptide in the bacteria.
[0036] According to still further features in the described
preferred embodiments step (a) is effected such that the single
chain MHC class I polypeptide forms inclusion bodies in the
bacteria.
[0037] According to still further features in the described
preferred embodiments the antigenic peptide and the single chain
MHC class I polypeptide form inclusion bodies in the bacteria.
[0038] According to still further features in the described
preferred embodiments the step of isolating the polypeptide further
includes the steps of (i) denaturing the inclusion bodies so as to
release protein molecules therefrom; and (ii) renaturing the
protein molecules.
[0039] According to still further features in the described
preferred embodiments the step of renaturing the protein molecules
is effected in the presence of an antigenic peptide capable of
binding the single chain MHC class I polypeptide.
[0040] According to still further features in the described
preferred embodiments the antigenic peptide is co-expressed along
with the single chain MHC class I polypeptide in the bacteria.
[0041] According to still further features in the described
preferred embodiments the mammalian .beta.-2 microglobulin amino
acid sequence is a human .beta.-2 microglobulin amino acid sequence
and further wherein the mammalian MHC class I heavy chain amino
acid sequence is a human MHC class I heavy chain amino acid
sequence.
[0042] According to still another aspect of the present invention,
there is provided a multimeric MHC class I complex comprising a
plurality of recombinant polypeptide monomers each including a
functional human .beta.-2 microglobulin directly or indirectly
covalently linked to a functional human MHC class I heavy
chain.
[0043] According to still further features in the described
preferred embodiments the plurality of recombinant polypeptide
monomers are linked to a common substrate.
[0044] According to yet another aspect of the present invention
there is provided a chimeric polypeptide comprising an antigenic
peptide being capable of binding a human MHC class I, a functional
human .beta.-2 microglobulin and a functional human MHC class I
heavy chain.
[0045] According to still further features in the described
preferred embodiments the chimeric polypeptide further comprising a
linker peptide being interposed between the functional human
.beta.-2 microglobulin and the functional human MHC class I heavy
chain.
[0046] According to still further features in the described
preferred embodiments the chimeric polypeptide further comprising a
linker peptide being interposed between the antigenic peptide and
the functional human .beta.-2 microglobulin.
[0047] According to still another aspect of the present invention
there is provided a nucleic acid construct comprising a nucleic
acid sequence encoding a chimeric polypeptide including an
antigenic peptide being capable of binding a human MHC class I, a
functional human .beta.-2 microglobulin and a functional human MHC
class I heavy chain.
[0048] According to still further features in the described
preferred embodiments the chimeric polypeptide further includes a
linker peptide interposed between the antigenic peptide and the
functional human .beta.-2 microglobulin.
[0049] According to still further features in the described
preferred embodiments the chimeric polypeptide further includes a
linker peptide interposed between the functional human .beta.-2
microglobulin and the functional human MHC class I heavy chain.
[0050] According to still further features in the described
preferred embodiments the linker peptide is as set forth in SEQ ID
NO:10.
[0051] According to still further features in the described
preferred embodiments the chimeric polypeptide further includes a
peptide capable of being enzymatically modified to include a
binding entity.
[0052] According to still further features in the described
preferred embodiments the nucleic acid construct further comprising
a cis acting regulatory sequence for regulating expression of the
nucleic acid sequence.
[0053] According to still further features in the described
preferred embodiments the cis acting regulatory sequence is
functional in a bacterial host.
[0054] According to still further features in the described
preferred embodiments there is provided a transformed cell
comprising the nucleic acid construct described above.
[0055] The present invention successfully addresses the
shortcomings of the presently known configurations by providing a
method of generating large quantities of pure single chain MHC
class I polypeptides which can be utilized in monomeric or
multimeric form to present antigenic peptides to CTL clones. The
present invention further addresses the shortcomings of the
presently known configurations by providing, for the first time, a
human single chain MHC class I polypeptide functional in both
monomeric and multimeric form in presenting antigenic peptides to
CTL clones.
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] The invention is herein described, by way of example only,
with reference to the accompanying drawings. With specific
reference now to the drawings in detail, it is stressed that the
particulars shown are by way of example and for purposes of
illustrative discussion of the preferred embodiments of the present
invention only, and are presented in the cause of providing what is
believed to be the most useful and readily understood description
of the principles and conceptual aspects of the invention. In this
regard, no attempt is made to show structural details of the
invention in more detail than is necessary for a fundamental
understanding of the invention, the description taken with the
drawings making apparent to those skilled in the art how the
several forms of the invention may be embodied in practice.
[0057] In the drawings:
[0058] FIG. 1 illustrates the various expression cassettes of the
present invention which were cloned into a bacterial expression
vector. .beta.2-M-human .beta.-2 microglobulin, HLA-A2--human MHC
class I heavy chain, BirA--a sequence encoding a peptide including
a biotin protein ligase-Bir A enzyme recognition sequence.
[0059] FIGS. 2a-b are SDS page gels depicting the analysis of the
expression products of the various constructs of FIG. 1. The
.beta.-2 microglobulin, HLA-A2, and the scMHC polypeptides were
expressed in E. Coli BL21 cells and the polypeptides accumulated as
insoluble inclusion bodies. Inclusion bodies were purified and
analyzed by reduced SDS-PAGE electrophoresis on 10% gels.
.beta.-2--human .beta.-2 microglobulin, HLA-A2--human MHC class I
heavy, S.C. .beta.2-A2--human scMHC class I and S.C.
.beta.2-A2-BirA human scMHC-BirA. Arrows indicate molecular size
markers. In all cases, the recombinant polypeptide expressed
comprised >90% of total inclusion body protein.
[0060] FIGS. 3a-c are SDS-PAGE gels depicting the analysis of
refolded purified single-chain MHC-peptide complexes. scMHC-peptide
complexes were generated by refolding of purified solubilized
inclusion bodies in the presence of antigenic peptides as described
in the Examples section. The refolded complexes were further
purified by size-exclusion chromatography and fractions were
analyzed by non-reduced SDS-PAGE on 10% gels. depicted are
representative fractions of the scMHC complexed with the G9-209-2M
(FIG. 3a) and G9-280-9V (FIG. 3b) gp100-derived peptides and the
scMHC-BirA-complexed with the G9-280-9V peptide (FIG. 3c).
[0061] FIG. 4 is a CD spectra analysis of a refolded single-chain
MHC-peptide complex collected and analyzed as described in the
Examples section below.
[0062] FIGS. 5a-b are graphs depicting antibody analysis of
single-chain MHC-peptide complexes. Binding of
conformation-specific antibodies to refolded and purified
scMHC-peptide complexes was performed by a capture double sandwich
ELISA assay as further described in the Examples section.
Anti-HLA-A2 specific mAb BB7.2 antibody was used to capture the
soluble scMHC-peptide complex and the biotinylated mAb W6/32
specific for fully assembled, peptide-containing HLA-A2 was used
for detection (FIG. 5a). The reaction was developed using
streptavidin-peroxidase conjugate. Specific recognition of the
single-chain MHC-BirA-peptide complex by the W6/32 antibody was
also determined for biotinylated or unbiotinylated complexes that
were immobilized to streptavidin-coated magnetic beads (FIG.
5b).
[0063] FIGS. 6a-c depict mass spectroscopy analysis of single-chain
MHC-peptide complexes. The scMHC-209 complex was resolved by HPLC
on a C-8 hydrophobic column, and eluted with a linear gradient of
acetonitrile in TFA, The sample was microsprayed directly from the
HPLC column into an electrospray ion trap (ESI) mass spectrometer
(LCQ) and analyzed in the positive ion mode. FIG. 6a depicts mass
spectrometry analysis of eluted peptides, wherein FIGS. 6b-c depict
mass estimation of the proteins.
[0064] FIGS. 7a-c are graphs depicting the biological activity of
single-chain MHC-peptide complexes as determined by measuring the
release of IFNg from specific CTL clones. FIG. 7a depicts the
ability of various scMHC-peptide complexes coated onto microtiter
plates to activate the G9-209-2M specific CTL clone R6C12.
Spontaneous release (Spont) was determined by incubation of CTLs in
wells that were not coated with the various complexes. FIG. 7b
depicts the role of peptide specificity in CTL activation. scMHC
tetramers complexed with the G9-209-2M peptide were generated as
described in the Examples section. The soluble tetramers were
incubated with the 209-specific CTL clone R6C12 or with the
Mart-1-specific clone JB2F4 as indicated. Spontaneous IFNg release
was determined by incubating the CTL clones with the unbiotinylated
scMHC-peptide complex (which does not support tetramer formation).
FIG. 7c depicts the dependency of CTLs activation on tetramer
formation. The 209-specific CTL clone R6C12 was incubated with
various biotinylated or unbiotinylated scMHC-BirA-peptide complexes
and streptavidin. Spontaneous release was determined by incubating
CTLs with the scMHC-209 complex which does not contain the BirA
tag.
[0065] FIGS. 8a-e are microscopic images of microtiter plate wells
containing the G9-209-2M--specific CTL clone R6C12 incubated with
biotinylated and thus tetramer forming scMHC-BirA-209 complexes or
unbiotinylated scMHC-BirA-209 complexes which are incapable of
forming tetramers and which served as controls. Cell agglutination
was peptide specific and dependent on the concentration of the
scMHC-BirA-209 tetramer (FIG. 8b). As the concentration of
tetramers increased, increased cell agglutination (rosette
formation) was observed (FIG. 8c-e). CTLs incubated with
unbiotinylated scMHC-BirA-209 complexes and streptavidin did not
exhibit any morphological appearance indicating of cell
agglutination (FIG. 8a).
[0066] FIGS. 9a-b are FACS analysis images of CTL clones specific
for the MART-1 peptide 27-35 incubated with either
scMHC-BirA/MART-1 PE-labeled tetramers (FIG. 9a) or with
scMHC-BirA/TAX PE-labeled tetramers (FIG. 9b) and co-stained with
FITC-labeled anti CD8 antibody. Specific staining of high avidity
CTLs was observed only when using the specific and functional
MART-1 peptide-containing scMHC tetramer.
[0067] FIGS. 10a-b are FACS analysis images of a heterogeneous
population of T-cells from an HLA-A2 transgenic mice immunized with
the TAX peptide. FIG. 10a is the FACS image of T-cells from
non-immunized mice stained with scMHC-BirA/TAX tetramer and FIG.
10b is the FACS image of T-cells from TAX-immunized mice stained
with the tetramers. Both preparations were also double stained with
anti-CD8.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0068] The present invention is of methods of generating a
functional mammalian single chain MHC class I complex in
prokaryotic expression systems and a functional human single chain
MHC class I complex in eukaryotic or prokaryotic expression
systems, which complexes are capable of presenting specific
antigenic peptides restricted to specific CTL clones. The present
invention is further of a method of generating a functional
mammalian single chain MHC class I-peptide complex in eukaryotic,
or preferably prokaryotic expression systems. The present invention
is also of nucleic acid constructs encoding said single chain MIC
class I complexes and of a novel human single chain MHC class I
polypeptide.
[0069] The principles and operation of the present invention may be
better understood with reference to the accompanying
descriptions.
[0070] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not limited
in its application to the details of construction and the
arrangement of the components set forth in the following
description or illustrated in the drawings described in the
Examples section. The invention is capable of other embodiments or
of being practiced or carried out in various ways. Also, it is to
be understood that the phraseology and terminology employed herein
is for the purpose of description and should not be regarded as
limiting.
[0071] Soluble class I MHC-peptide complexes are invaluable
reagents for characterizing immune responses involving CTLs, for
measuring the affinity of MHC-TCR interactions, and for
visualization of antigen-specific T cells.
[0072] One of the limitations in generating and using recombinant
MHC-peptide complexes is a relatively low production efficiency.
Most of the present studies utilize production methods that are
based on transfection of cells with MHC constructs which express
and secrete either scMHC or complexed MHC to the cell culture
medium [12-23]. These complexes contain peptides from
endogenously-expressed proteins which have to be subsequently
exchanged with the desired peptide to be displayed in the complex
[13].
[0073] Alternative methods for efficiently producing recombinant
MHC-peptide complexes is by expression of the heavy chain and
.beta.-2 microglobulin separately in E. Coli. followed by
co-refolding in vitro in the presence of antigenic peptide [8, 11].
Although such methods present some advantages as compared to the
eukaryotic methods described above, the quantity and purity of the
MHC complex produced thereby still fall well below of that required
for various studies.
[0074] While reducing the present invention to practice, it was
uncovered that recombinant single chain (sc) MHC-peptide complexes
produced in E. Coli constitute an efficient new way for the
generation of unprecedented large amounts (e.g., grams) of highly
purified and functional MHC-peptide complexes, as well as
MHC-peptide tetramers.
[0075] As is further described in the Examples section that follows
human scMHC-peptide complexes generated from E. Coli inclusion
bodies by in vitro refolding in the presence of antigenic peptides
are highly pure and functional.
[0076] Thus, according to one aspect of the present invention there
is provided a nucleic acid construct which includes a first nucleic
acid sequence including a first polynucleotide encoding a
functional human .beta.-2 microglobulin translationally fused
upstream of a second polynucleotide encoding a functional human MHC
class I heavy chain.
[0077] As used herein the term "functional" when used in reference
to the .beta.-2 microglobulin and heavy chain polypeptides regions
of a single chain MHC class I complex refers to any portion of each
which is capable of contributing to the assembly of a functional
single chain MHC class I complex (i.e., capable of binding and
presenting to CTLs specific antigenic peptides when complexed).
[0078] Preferably, the first polynucleotide encodes the entire
.beta.-2 microglobulin polypeptide while the second polynucleotide
encodes the .alpha.1-3 domains of the heavy chain.
[0079] The phrases "translationally fused" and "in frame" are
interchangeably used herein to refer to polynucleotides which are
covalently linked to form a single continuous open reading frame
spanning the length of the coding sequences of the linked
polynucleotides. Such polynucleotides can be covalently linked
directly or preferably indirectly through a spacer or linker
region.
[0080] Thus, according to a preferred embodiment of the present
invention, the nucleic acid sequence further includes an in-frame
linker polynucleotide. This linker polynucleotide encodes a linker
peptide and is interposed between the first and said second
polynucleotides.
[0081] The linker peptide is selected of an amino acid sequence
which is inherently flexible, such that the polypeptides encoded by
the first and said second polynucleotides independently and
natively fold following expression thereof, thus facilitating the
formation of a functional single chain (sc) human MHC class I
complex.
[0082] According to another preferred embodiment of the present
invention the linker peptide is as set forth in SEQ ID NO:10.
[0083] Thus, the first nucleic acid sequence of this aspect of the
present invention, encodes a functional human single chain MHC
class I polypeptide. Preferably, the first nucleic acid sequence is
as set forth in SEQ ID NO: 4.
[0084] According to another preferred embodiment of the present
invention, the first nucleic acid sequence further includes an
in-frame tag sequence (such as that set forth in SEQ ID NO:20)
which encodes a peptide capable of being enzymatically modified to
include a binding entity. As is further described in the Examples
section that follows, the binding entity, which can be, for
example, biotin, can be utilized by the present invention to
assemble a plurality of scMHC class I polypeptides into multimers,
by providing a ligand, such as avidin or streptavidin which serves
as a common attachment entity for the scMHC class I polypeptides.
MHC class I multimers are particularly advantageous for peptide
mediated CTL activation as is further described in the Examples
section which follows.
[0085] According to another preferred embodiment of the present
invention the nucleic acid construct further includes a first cis
acting regulatory sequence. The cis acting regulatory sequence can
include a promoter sequence and additional transcriptional or a
translational enhancer sequences all of which serve for
facilitating the expression of the nucleic acid sequence when
introduced into a host cell. Specific examples of promoters are
described hereinbelow in context of various eukaryotic and
prokaryotic expression systems and in the Examples section which
follows.
[0086] Thus, the nucleic acid construct of this aspect of the
present invention is capable of expressing in a host cell, a
recombinant human single chain MHC class I polypeptide which
includes the functional human .beta.-2 microglobulin and the
functional human MHC class I heavy chain and a linker peptide
interposed therebetween. Preferably, the expressible recombinant
polypeptide is as set forth in SEQ ID NO:5
[0087] According to another preferred embodiment of the present
invention, the nucleic acid construct also includes a second
nucleic acid sequence encoding an antigenic peptide. The antigenic
peptide is selected such that it is capable of binding a human MHC
class I complex. As is further described in the Examples section
which follows, various CTL specific antigenic peptides can be
encoded by the second nucleic acid sequence, including but not
limited to cancer cell derived antigenic peptides, virally derived
antigenic peptides and the like.
[0088] Preferably the second nucleic acid sequence is
translationally fused upstream of the first nucleic acid sequence,
such that the nucleic acid construct according to this aspect of
the present invention encodes a single chimeric amino acid sequence
(chimeric polypeptide) which includes the antigenic peptide fused
upstream of the functional human .beta.-2 microglobulin which is in
turn fused upstream of the functional human MHC class I heavy
chain. The antigenic peptide can be fused directly to the
functional human .beta.-2 microglobulin or it can be fused thereto
through a linker peptide in a manner similar to that described
hereinabove with respect to the .beta.-2 microglobulin-MHC class I
heavy chain fusion.
[0089] It will be appreciated that the above described
configuration of the nucleic acid construct of this aspect of the
present invention is particularly advantageous since, a single
construct enables the expression of a single chimeric polypeptide
which includes all three components necessary for presenting
specific antigenic peptides restricted to specific CTL clones, thus
substantially simplifying the expression/purification and folding
process.
[0090] In addition, the nucleic acid construct described above
ensures that the expression product always includes a correct ratio
of components of the chimeric polypeptide (1:1:1), thus traversing
limitations resultant from separately expressing each
component.
[0091] Alternatively, the nucleic acid construct includes a second
cis acting regulatory sequence which serves for expressing the
second nucleic acid sequence when introduced into a host cell.
[0092] It will be appreciated that a single cis acting regulatory
sequence can be utilized by the nucleic acid construct to direct
transcription of a single transcript which includes the first and
second nucleic acid sequence. In such a case, an internal ribosome
entry site (IRES) can be utilized so as to allow translation of the
internally positioned nucleic acid sequence.
[0093] Although co-expression of the scMHC class I polypeptide and
the antigenic peptide from a single nucleic acid construct is
advantageous when transforming a host cell, the two nucleic acid
sequences can alternatively be included in two separate nucleic
acid construct which can be utilized to co-transform a single
cell.
[0094] In any case, it will be appreciated that the nucleic acid
construct or constructs must be configured such that the levels of
expression of both the scMHC class I polypeptide and the binding
peptide thereof are stoichiometrically correct (a 1:1 peptide to
scMHC class I polypeptide ratio is preferred) so as to allow
efficient assembly of the scMHC class I-peptide complex.
[0095] Preferably the promoter utilized by the nucleic acid
construct(s) of the present invention is a strong constitutive
promoter such that high levels of expression are attained for the
first and second nucleic acid sequences following host cell
transformation.
[0096] It will be appreciated that high levels of expression can
also be effected by transforming the host cell with a high copy
number of the nucleic acid construct, or by utilizing cis acting
sequences which stabilize the resultant transcript and as such
decrease the degradation or "turn-over" of such a transcript.
[0097] According to another aspect of the present invention there
is provided a transformed host cell including the nucleic acid
construct or constructs described above.
[0098] As used herein, the phrase "transformed cell" describes a
cell into which an exogenous nucleic acid sequence is introduced to
thereby stabily or transiently genetically alter the host cell. It
may occur under natural or artificial conditions using various
methods well known in the art some of which are described in detail
hereinbelow in context with specific examples of host cells.
[0099] The transformed host cell can be a eukaryotic cell, such as,
for example, a mammalian cell, an insect cell, a plant cell, a
yeast cell and a protozoa cell, or alternatively, the cell can be a
bacterial cell.
[0100] When utilized for eukaryotic host cell expression, the
nucleic acid construct(s) according to the present invention can be
a shuttle vector, which can propagate both in E. coli (wherein the
construct comprises an appropriate selectable marker and origin of
replication) and be compatible for expression in eukaryotic host
cells. The nucleic acid construct(s) according to the present
invention can be, for example, a plasmid, a bacmid, a phagemid, a
cosmid, a phage, a virus or an artificial chromosome.
[0101] According to another preferred embodiment of the present
invention the host cell is a mammalian cell of, for example, a
mammalian cell culture. Suitable mammalian expression systems
include, but are not limited to, pcDNA3, pcDNA3.1(+/-),
pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto,
pCR3.1, which are available from Invitrogen, pCI which is available
from Promega, pBK-RSV and pBK-CMV which are available from
Stratagene, pTRES which is available from Clontech, and their
derivatives.
[0102] Insect cell cultures can also be utilized to express the
nucleic acid sequences of the present invention. Suitable insect
expression systems include, but are not limited to the baculovirus
expression system and its derivatives which are commercially
available from numerous suppliers such as Invitrogen (maxBac.TM.),
Clontech (BacPak.TM.), or Gibco (Bac-to-BaC.TM.).
[0103] Expression of the nucleic acid sequences of the present
invention can also be effected in plants cells. As used herein, the
phrase "plant cell" can refer to plant protoplasts, cells of a
plant tissue culture, cells of plant derived tissues or cells of
whole plants.
[0104] There are various methods of introducing nucleic acid
constructs into plant cells. Such methods rely on either stable
integration of the nucleic acid construct or a portion thereof into
the genome of the plant cell, or on transient expression of the
nucleic acid construct in which case these sequences are not
stabily integrated into the genome of the plant cell.
[0105] There are two principle methods of effecting stable genomic
integration of exogenous nucleic acid sequences such as those
included within the nucleic acid construct of the present invention
into plant cell genomes:
[0106] (i) Agrobacterium-mediated gene transfer: Klee et al. (1987)
Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell
Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular
Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K.,
Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in
Plant Biotechnology, eds. Kung, S, and Arntzen, C. J., Butterworth
Publishers, Boston, Mass. (1989) p. 93-112.
[0107] (ii) direct DNA uptake: Paszkowski et al., in Cell Culture
and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of
Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic
Publishers, San Diego, Calif. (1989) p. 52-68; including methods
for direct uptake of DNA into protoplasts, Toriyama, K. et al.
(1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief
electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988)
7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection
into plant cells or tissues by particle bombardment, Klein et al.
Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology
(1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by
the use of micropipette systems: Neuhaus et al., Theor. Appl.
Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant.
(1990) 79:213-217; or by the direct incubation of DNA with
germinating pollen, DeWet et al. in Experimental Manipulation of
Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels,
W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad.
Sci. USA (1986) 83:715-719.
[0108] The Agrobacterium system includes the use of plasmid vectors
that contain defined DNA segments that integrate into the plant
genomic DNA. Methods of inoculation of the plant tissue vary
depending upon the plant species and the Agrobacterium delivery
system. A widely used approach is the leaf disc procedure, see for
example, Horsch et al. in Plant Molecular Biology Manual A5, Kluwer
Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary
approach employs the Agrobacterium delivery system in combination
with vacuum infiltration. The Agrobacterium system is especially
viable in the creation of stabily transformed dicotyledenous
plants.
[0109] There are various methods of direct DNA transfer into plant
cells. In electroporation, protoplasts are briefly exposed to a
strong electric field. In microinjection, the DNA is mechanically
injected directly into the cells using very small micropipettes. In
microparticle bombardment, the DNA is adsorbed on microprojectiles
such as magnesium sulfate crystals, tungsten particles or gold
particles, and the microprojectiles are physically accelerated into
cells or plant tissues. Direct DNA transfer can also be utilized to
transiently transform plant cells.
[0110] In any case suitable plant promoters which can be utilized
for plant cell expression of the first and second nucleic acid
sequences, include, but are not limited to CaMV 35S promoter,
ubiquitin promoter, and other strong promoters which can express
the nucleic acid sequences in a constitutive or tissue specific
manner.
[0111] Plant viruses can also be used as transformation vectors.
Viruses that have been shown to be useful for the transformation of
plant cell hosts include CaV, TMV and BV. Transformation of plants
using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV),
EP-A 67,553 (TMV), Japanese Published Application No. 63-14693
(TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al.,
Communications in Molecular Biology: Viral Vectors, Cold Spring
Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus
particles for use in expressing foreign DNA in many hosts,
including plants, is described in WO 87/06261.
[0112] Construction of plant RNA viruses for the introduction and
expression of non-viral exogenous nucleic acid sequences in plants
is demonstrated by the above references as well as by Dawson, W. O.
et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J.
(1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and
Takamatsu et al. FEBS Letters (1990) 269:73-76.
[0113] When the virus is a DNA virus, the constructions can be made
to the virus itself. Alternatively, the virus can first be cloned
into a bacterial plasmid for ease of constructing the desired viral
vector with the nucleic acid sequences described above. The virus
can then be excised from the plasmid. If the virus is a DNA virus,
a bacterial origin of replication can be attached to the viral DNA,
which is then replicated by the bacteria. Transcription and
translation of this DNA will produce the coat protein which will
encapsidate the viral DNA. If the virus is an RNA virus, the virus
is generally cloned as a cDNA and inserted into a plasmid. The
plasmid is then used to make all of the constructions. The RNA
virus is then produced by transcribing the viral sequence of the
plasmid and translation of the viral genes to produce the coat
protein(s) which encapsidate the viral RNA.
[0114] Construction of plant RNA viruses for the introduction and
expression in plants of non-viral exogenous nucleic acid sequences
such as those included in the construct of the present invention is
demonstrated by the above references as well as in U.S. Pat. No.
5,316,931.
[0115] Yeast cells can also be utilized as host cells by the
present invention. Numerous examples of yeast expression vectors
suitable for expression of the nucleic acid sequences of the
present invention in yeast are known in the art. Such vectors are
usually introduced in a yeast host cell via chemical or
electroporation transformation methods well known in the art.
Commercially available systems include, for example, the pYES.TM.
(Invitrogen) or the YEX.TM. (Clontech) expression systems.
[0116] It will be appreciated that when expressed in eukaryotic
expression systems such as those described above, the nucleic acid
construct preferably includes a signal peptide encoding sequence
such that the polypeptides produced from the first and second
nucleic acid sequences are directed via the attached signal peptide
into secretion pathways. For example, in mammalian, insect and
yeast host cells, the expressed polypeptides can be secreted to the
growth medium, while in plant expression systems the polypeptides
can be secreted into the apoplast, or directed into a subcellular
organelle.
[0117] According to a presently preferred embodiment of the present
invention, the host cell is a bacterial cell, such as for example,
E. coli. A bacterial host can be transformed with the nucleic acid
sequence via transformation methods well known in the art,
including for example, chemical transformation (e.g., CaCl.sub.2)
or electroporation.
[0118] Numerous examples of bacterial expression systems which can
be utilized to express the nucleic acid sequences of the present
invention are known in the art. Commercially available bacterial
expression systems include, but are not limited to, the pET.TM.
expression system (Novagen), pSE.TM. expression system (Invitrogen)
or the pGEX.TM. expression system (Amersham).
[0119] As is further described in the Examples section which
follows, bacterial expression is particularly advantageous since
the expressed polypeptides form substantially pure inclusion bodies
readily amenable to recovery and purification of the expressed
polypeptide.
[0120] Thus, according to yet another aspect of the present
invention there is provided a preparation of bacterial derived
inclusion bodies which are composed of over 30 percent, preferably
over 50%, more preferably over 75%, most preferably over 90% by
weight of the recombinant human scMHC class I polypeptide of the
present invention. The isolation of such inclusion bodies and the
purification of the scMHC class I polypeptide therefrom are
described in detail in the Examples section which follows.
[0121] As demonstrated in the Examples section, bacterial
expression of an scMHC class I polypeptide can provide high
quantities of pure and functional scMHC class I polypeptides. As
such, the method of the present invention can also be applied to
bacterially express mammalian scMHC class I polypeptides which to
date have been expressed, with limited success, only in eukaryotic
expression system.
[0122] Thus, according to another aspect of the present invention
there is provided a nucleic acid construct which includes a nucleic
acid sequence including a first polynucleotide encoding a
functional mammalian .beta.-2 microglobulin. The nucleic acid
construct further includes a second polynucleotide encoding a
functional mammalian MHC class I heavy chain which is
translationally fused downstream of the first polynucleotide. The
nucleic acid construct according to this aspect of the present
invention further includes a cis acting regulatory sequence which
is capable of directing expression of the nucleic acid sequence in
bacteria. Suitable promoters and bacterial expression systems which
can be utilized to express the nucleic acid sequence of this aspect
of the present invention are described hereinabove.
[0123] The nucleic acid sequence according to this aspect of the
present invention can be derived from, or synthesized according to,
the MHC class I encoding sequences of a mammal such as, but not
limited to, a mouse, a rat, a pig, and a rabbit.
[0124] It will be appreciated that the various embodiments
described hereinabove for the human scMHC class I construct, which
embodiments apply and are useful for the bacterial expression of
the mammalian scMHC class I nucleic acid construct of this aspect
of the present invention are also incorporated herein.
[0125] Thus, the present invention provides various expression
constructs which can be utilized to express scMHC class I
polypeptides preferably along with binding peptides thereof in
eukaryotic or preferably bacterial expression systems.
[0126] According to an additional aspect of the present invention
there is provided a method of producing a functional MHC class I
molecule. the method according to this aspect of the present
invention utilizes any of the nucleic acid constructs described for
expressing, in bacteria, a single chain MHC class I polypeptide
including a functional mammalian .beta.-2 microglobulin amino acid
sequence directly or indirectly covalently linked to a functional
mammalian MHC class I heavy chain amino acid sequence.
[0127] Following expression, the single chain MHC class I
polypeptide is isolated and purified as described below.
[0128] As is further described in the Examples section which
follows, the expressed polypeptide forms substantially pure
inclusion bodies which are readily isolated via fractionation
techniques well known in the art and purified via for example
denaturing-renaturing steps.
[0129] Preferably, the single chain MHC class I polypeptide is
renatured and refolded in the presence of an antigenic peptide
capable of binding the single chain MHC class I polypeptide. As is
further described in the Examples section this enables to generate
a substantially pure MHC class I-antigenic peptide complex which
can further be purified via size exclusion chromatography.
[0130] It will be appreciated that the antigenic peptide used for
refolding can be co-expressed along with the single chain MHC class
I polypeptide in the bacteria. In such a case the expressed
polypeptide and peptide co-form inclusion bodies which can be
isolated and utilized for MHC class I-antigenic peptide complex
formation.
[0131] Additional objects, advantages, and novel features of the
present invention will become apparent to one ordinarily skilled in
the art upon examination of the following examples, which are not
intended to be limiting. Additionally, each of the various
embodiments and aspects of the present invention as delineated
hereinabove and as claimed in the claims section below finds
experimental support in the following examples.
EXAMPLES
[0132] Reference is now made to the following examples, which
together with the above descriptions, illustrate the invention in a
non limiting fashion.
[0133] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan
J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical
Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn.
(1994); Mishell and Shiigi (eds), "Selected Methods in Cellular
Immunology", W. H. Freeman and Co., New York (1980); available
immunoassays are extensively described in the patent and scientific
literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654;
3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219;
5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J.,
ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins
S. J., eds. (1985); "Transcription and Translation" Hames, B. D.,
and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R.
I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986);
"A Practical Guide to Molecular Cloning" Perbal, B., (1984) and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego,
Calif. (1990); Marshak et al., "Strategies for Protein Purification
and Characterization--A Laboratory Course Manual" CSHL Press
(1996); all of which are incorporated by reference as if fully set
forth herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
Example 1
Materials and Methods
[0134] Peptides:
[0135] Cancer cell associated peptides G9-209-2M (IMDQVPFSV SEQ ID
NO:1) and G9-280-9V (YLEPGPVTV SEQ ID NO:2), both derived from the
melanoma antigen gp100 [24-26] were used for MHC binding. These
peptides are modified at the MHC anchor positions 2 (in G9-209-2M)
and 9 (in G9-280-9V) to improve the binding affinity to HLA-A2
[26]. The TAX 11-19 HTLV-1 peptide (LLFGYPVYV, SEQ ID NO:3) was
used as a control [53].
[0136] Peptides were synthesized by standard
fluorenylmethoxycarbonyl chemistry and purified to >95% by
reverse phase HPLC. Following purification these peptides were used
in the refolding of the single-chain MHC (scMHC)-peptide complexes
and formation of scMHC-peptide tetramers further described
hereinunder.
[0137] Plasmid Constructs:
[0138] A cDNA construct (SEQ ID NO:4) encoding a single-chain (sc)
MHC polypeptide (SEQ ID NO:5) which includes the first three
extracellular domains of HLA-A2 (HLA-A*0201, amino acids 1-275 SEQ
ID NO:6) and the human .beta.2-microglobulin polypeptide (SEQ ID
NO:7) was assembled from .alpha.1-3 and .beta.-2 microglobulin
cDNAs derived from the human T-B cell hybrid T2 cell line [27]. The
human .beta.-2 microglobulin was PCR amplified using
b2M-5,5'-AGGAGATATACATATGATCCAGCGTACTCCAAAGAT-3' (SEQ ID NO:8) and
b2M-3,5'-CGGGCTTTGTTAGCAGCCGAATTCATTACA TGTCTCGATCCCACTTAAC-3' (SEQ
ID NO:9) and linked via a 15 residue flexible linker
(Gly-Ser4).sub.3 (SEQ ID NO:10) to the N-terminus of the HLA-A2
heavy chain which was PCR amplified using
A2-5,5'-GGAGATATACATATGGGCTCTCACTCCATGAGGTA-3' (SEQ ID NO:11) and
A2-3,5'-CGGGCTTTGTTAGCAGCCGAATTCATTAGGT GAGGGGCTTGGGCAA-3' (SEQ ID
NO:12) primers. The cDNAs of both chains were used in a two-step
PCR overlap extension reaction in which the 3''-end of the .beta.-2
microglobulin was connected to the 5'-end of the HLA-A2 gene.
[0139] To perform the two-step PCR overlap extension reaction, two
thirds of the linker sequence were introduced into the .beta.-2
microglobulin sequence using PCR primers b2M-L5,5'-GGAAGGCG
TTGGCGCATATGATCCAGCGTACTCCAAAGATT-3' (SEQ ID NO:13) and
b2M-L3,5'-GGAAGCGGCGGTGGAGGCT CTGGTGGAGGTGGCAGCGGCTCTCACTCCATGA-3'
(SEQ ID NO:14) while PCR primers A2-L5,5'-GGAAGCGGCGGTGGAGG
CTCTGGTGGAGGTGGCAGCGGCTCTCACTCCATGA-3' (SEQ ID NO:15) and
A2-L3,5'-GGGAGAATTCTTACTCCCATCTCA GGGTGAGGGGCTTGGGCAA-3' (SEQ ID
NO:16) were utilized for HLA-A2.
[0140] Following amplification, the .beta.-2 microglobulin and
HLA-A2 PCR products were combined in a 1:1 ratio and the reaction
was PCR amplified using the b2M-L5 and A2-L3 primers. the PCR
product was purified and subcloned into the pET-based expression
vector.
[0141] The HLA-A2 and .beta.-2 microglobulin coding sequences
described above were also separately cloned in pET21 for
independent expression.
[0142] The scMHC-BirA coding sequence included a peptide sequence
for site specific biotinylation (LGGIFEA LRD, SEQ ID NO:17), the
lysine residue biotinylated underlined) linked to HLA-A2 N-terminus
via a short linker (QSTRGGASGGG, SEQ ID NO:18).
[0143] The scMHC-BirA coding sequence was PCR amplified using
B2M-BirA-3,5'-CAGTAAAAGCTTTTTATCAGCCTCCGAACTGTG
GATGCCTCCACGCCGAACCTCCACCAGAACCACCTCCGGACCC
GCCACCTCCCTCCCATCTCAGGGT-3' (SEQ ID NO:19) and the b2M-L5 primer
described above. The resultant PCR product which included the BirA
recognition sequence (SEQ ID NO:20) was purified digested and
subcloned into a bacterial expression vector as shown in FIG.
1.
[0144] Expression, Refolding and Purification of scMHC-Peptide
Complexes:
[0145] The HLA-A2, .beta.-2 microglobulin, and the scMHC constructs
subcloned into pET21 were expressed under IPTG induction, forming
intracellular inclusion bodies in BL-21 DE3 cells. Inclusion bodies
were isolated and purified from the induced BL21 cells and
solubilized in 6M Guanidine HCl pH 7.4. Following reduction with 65
mM DTE, inclusion bodies were refolded in a redox-shuffling buffer
system (0.1M Tris, 0.5M Arginine, 0.09 mM oxidized glutathione, pH
8.0) in the presence of a 5 to 10 molar excess of the antigenic
peptides derived from gp 100 or the HTLV-1 viral peptide described
above [26,52]. Following refolding, the protein was dialyzed and
concentrated by a Minisette system (Filtron, Northborough, Mass.)
using a 10K cutoff cassette. Soluble scMHC-peptide complexes were
purified by size-exclusion chromatography on TSK3000 column
(TOSOHAAS, Montgomeryville, Pa.) using PBS as an elution
buffer.
[0146] Biotinylation of Recombinant scMHC-Peptide Complexes and
Tetrameric scMHC-Peptide Complexes:
[0147] The s.c-b2-A2-BirA (scMHC-BirA) construct also expressed as
described above was refolded in the presence of peptides 209 or 280
and purified by size exclusion chromatography on TSK3000 column
(elution buffer 10 mM Tris-HCl pH 8). The scMHC-peptide-BirA
complexes were concentrated to 20-30 mM (1-1.5 mg/ml) by Centricon
30 (Amicon) and were then subjected to enzymatic biotinylation for
16 hr at 25.degree. C. using a biotin protein ligase--Bir A enzyme
(AVIDITY). Buffer exchange and removal of excess biotin from the
biotinylated complexes was performed using Centricon 30
ultrafiltration. Tetrameric arrays of biotinylated scMHC-peptide
complexes were formed by the addition of streptavidin (Sigma, St.
Louis, Mo.) at a molar ration of 4:1 scMHC-peptide
complex:streptavidin, respectively.
[0148] ELISA Assays:
[0149] Maxisorb immunoplates (Nalge Nunc, Naperville, Ill.) were
coated overnight at 4.degree. C. with 1 mg/ml anti-HLA monoclonal
antibody BB7.2 (ATCC HB82) and blocked using PBS including 3% BSA.
Biotinylated anti-HLA W6/32 monoclonal antibody (ATCC HB95) was
used for detection of the HLA complex via a streptavidin-peroxidase
conjugate.
[0150] In addition, biotinylated or unbiotinylated
scMHC-BirA-peptide complexes were incubated for 30 minutes at room
temperature with washed MagnaBind.TM. streptavidin beads (PIERCE).
An external magnetic field was used to separate biotinylated
complexes bound to the beads from unbound material. The supernatant
was pooled away from bound sample and the beads were blocked with
2% MPBS (PBS+2% semi-skimmed milk powder) for 30 minutes at room
temperature. The biotinylated complexes were subsequently assayed
with the conformational dependent antibody W6/32 and detected using
anti-mouse IgG-peroxidase.
[0151] Circular Dichroism Spectra:
[0152] The circular dichroism spectra of the scMHC-peptide
complexes was measured at room temperature via a spectropolarimeter
(JASCO 500) adjusted to a sensitivity of 0.5 mdeg/cm and a scan
speed of 10 nm/minute. Scans were performed between 195 and 275 nm
at a protein concentration of 0.27 mg/ml. Secondary structure
calculations were measured using published programs [29].
[0153] Mass Spectrometry Analysis of scMHC-Peptide Complexes:
[0154] The scMHC-peptide complex was resolved by HPLC on a
2.1.times.30 mm C-8 column (AQUAPORE RP-300, Applied Biosystems),
and eluted with a linear gradient of 15-65% Acetonitrile (ACN) in
0.05 TFA, at 1.25%/min and a flow rate of 150 ml/min. The sample
was microsprayed directly from the HPLC column into an electrospray
(ESI) ion trap mass spectrometer (LCQ, Finnigan) and analyzed in
the positive ion mode. The mass estimation of the proteins was done
using the deconvolution algorithm, which transforms an ESI mass
spectral plot of relative abundance versus mass-to-charge ratios
into a plot of relative abundance versus mass. Each sequence of
multiply charged ion peaks in the acquired mass spectrum
corresponding to one sample component, is converted into a single
peak positioned at the molecular mass M in the deconvoluted
spectrum.
[0155] CTL Clones and CTL Stimulation Assays:
[0156] CTL clones specific for melanoma peptides were provided by
Drs. Steven Rosenberg and Mark Dudley (Surgery Branch, National
Cancer Institute, NIH). These CTL clones were generated by cloning
from bulk cultures of PBMCs acquired from patients receiving
peptide immunizations [24]. The CTLs were subsequently expanded
using irradiated PBMCs and the OKT3 antibody (30 ng/ml) in the
presence of 50 CU/ml IL-2.
[0157] The CTL clones (1.times.10.sup.5/well) were washed in tissue
culture medium and incubated in duplicates or triplicates with
various concentrations of scMHC-peptide tetramers in tissue culture
medium for 24 hrs at 37.degree. C. Alternatively scMHC-peptide
complexes were immobilized onto Maxisorb immunoplates over night at
4.degree. C. and CTL clones in culture medium were subsequently
added to the wells and incubated for 24 hrs at 37.degree. C.
Following incubation supernatants were collected via centrifugation
and IL-2 and IFNg present in the culture supernatants were assayed
using a double sandwich antibody-capture enzyme immunoassay
(Flexia, BIOSOURCE, Camarillo, Calif.). Concentrations of IL-2 and
INF.gamma. in the culture supernatants was determined against a
calibration curve of recombinant human IL-2 and INF.gamma..
Experimental Results
[0158] Expression, Refolding, and Purification of Recombinant
Single-Chain MHC-Peptide Complexes:
[0159] To produce soluble single-chain MHC-peptide complexes we
subcloned the genes encoding the single-chain MHC into a pET system
expression vector in which expression is driven by the phage T7
promoter.
[0160] The plasmid constructs used in this study are described in
FIG. 1. Expression of the scMHC gene in E. Coli BL21 cells was very
efficient and recombinant protein accumulated as insoluble
intracellular inclusion bodies. The single-chain MHC could be
detected as the major band on SDS-PAGE of solubilized whole cells
(not shown) as well as isolated purified inclusion bodies (FIG.
2a). The expression of the scMHC protein was comparable to that of
the separate components, i.e., the transmembrane HLA-A2 heavy chain
and .beta.-2 microglobulin (FIG. 2a). Very efficient expression was
also obtained for the scMHC-BirA protein (FIG. 2b). Purified
inclusion bodies contained 80-90% recombinant scMHC. Inclusion
bodies were purified, solubilized in 6M guanidine HCl, and refolded
by in vitro redox-shuffling buffer system in the presence of the
antigenic peptide. Three different peptides were used for the
refolding of the scMHC molecules. Two peptides (G9-209-2M and
G9-280-2V) are tumor associated antigens derived from the melanoma
common antigen gp100 [26] and one is a viral peptide derived from
HTLV-1 (TAX) [53]. These peptides were previously shown to be
HLA-A2 restricted [26, 53].
[0161] Refolded complexes were dialyzed and concentrated following
by purification using size-exclusion chromatography on TSK3000
column. SDS-PAGE analysis, under non-reducing conditions, of
refolded purified scMHC-peptide complexes revealed a homogenous
monomeric population of molecules that migrated as a uniform single
band corresponding to the scMHC molecule with an apparent molecular
weight of 45 kDa as calculated according to the relative migration
against a set of molecular weight markers (FIGS. 3a-b). As shown in
FIGS. 3a-b, purified homogenous scMHC-peptide complexes were
obtained with all three peptides tested. When the scMHC was
refolded in the absence of a peptide, a highly aggregated protein
was observed which was composed of a heterogeneous population of
molecules as analyzed by size-exclusion chromatography and
SDS-PAGE; this indicates the existence of an unstable population of
molecules that are improperly folded (data not shown). Thus, a
uniform population of monomers could only be found in the
peptide-induced refolding preparations. The refolded scMHC-peptide
complexes could be stored at -70.degree. C. and re-used upon
thawing. The yield of the refolded purified single-chain MHC
complexes was 20-25%, i.e. 20-25 mg of a purified soluble complex
was obtained from 100 mg of refolded inclusion body protein.
[0162] Similar results were obtained with the scMHC-BirA-peptide
complexes, which contain a sequence tag at the C-terminus of the
HLA-A2 for site specific biotinylation (FIG. 3c). The apparent
molecular weight of 48 kDa was observed for this molecule
reflecting the increase in the size of the scMHC molecule predicted
by the addition of the BirA peptide tag and the linker connecting
it to HLA-A2.
[0163] Thus, these results indicate that scMHC-peptide complexes
can be produced in vitro by refolding of E. Coli inclusion bodies
in the presence of antigenic peptides. The refolding process is
efficient and a homogenous population of complexes can be obtained
with high yields and purity.
[0164] Biochemical and Biophysical Characterization of Single-Chain
MHC-Peptide Complexes:
[0165] As shown in FIGS. 3a-c, the scMHC peptide complexes were
pure and homogenous as judged by SDS-PAGE. Size exclusion
chromatography on TSK3000 column revealed that the purified
scMHC-peptide complexes were eluted as monomers with a molecular
mass of 45 kDa (not shown). When purified complex was concentrated
by ultrafiltration to 0.15 mM (.about.6 mg/ml) and analyzed for its
molecular form on a size-exclusion TSK3000 column in PBS, no
indication of dimerization or aggregation, was observed.
[0166] To evaluate the secondary structure of the single-chain
MHC-peptide complex, protein purified through size-exclusion
chromatography was examined by circular dichroism (CD) spectroscopy
(FIG. 4). Spectra of the complex showed a characteristic minima at
218 nm consistent with a largely .beta.-sheet structure. When
analyzed for secondary structural calculations the spectra was
indicative of a specific pattern of secondary structure which
included 62% .beta.-sheet, 5% .beta.-turn, 8% .alpha.-helix and 18%
aromatic side chain contribution. When denatured at 80.degree. C.,
the spectra profile indicated that most of the characteristic
.beta.-sheet structure was lost and the CD signal increased,
indicating random coils were generated as the result of
denaturation. The melting curve showed that the complex containing
peptide G9-209-2M was thermally stable with a melting temperature
of approximately 60.degree. C. (data not shown). These results are
similar to the thermal denaturation curves for HLA-A2 complexed
with influenza virus peptides as was monitored by the change in the
CD signal at 218 nm [31]. Thus it is concluded that these secondary
structure features are characteristic of correct folded MHC-peptide
complexes [31].
[0167] The refolded scMHC-peptide complexes were also assayed using
conformation-specific antibodies, which recognize MHC-peptide
complexes only when correctly folded. As shown in FIG. 5a, the
anti-HLA-A2 specific mAb fragment BB7.2 and the mAb fragment W6/32
specific for a fully assembled, peptide-containing HLA-A2 detected
soluble scMHC-peptide complex. The W6/32 antibody specifically
recognized, in a concentration dependent manner, the refolded and
purified scMHC complexes containing any of the two gp100-derived
peptides indicating that the complexes are correctly folded,
include the peptide, and are structurally functional.
[0168] The specific recognition of the scMHC-BirA-peptide complex
by the W6/32 antibody was also effected when tested on biotinylated
complexes that were immobilized to streptavidin-coated magnetic
beads (FIG. 5b). The ELISA signal from beads coated with
biotinylated scMHC-BirA-peptide complexes was 5-6 fold higher than
scMHC-BirA-peptide complex that was not subjected to biotinylation
by the BirA enzyme (FIG. 5b).
[0169] Mass spectrometry analysis was performed in order to clearly
demonstrate that the scMHC complex is folded correctly and includes
the peptide. The refolded and purified complex was concentrated to
6 mg/ml and a sample was subjected to analysis by electron spray
mass spectrometry. The complex sample was first resolved by HPLC on
a C-8 column and was subsequently eluted with a linear gradient of
Acetonitrile in TFA, leading to separate sequential elution of the
peptide and the scMHC protein from the column. The eluted samples
were microsprayed directly from the HPLC column into an
electrospray ion trap (ESI) mass spectrometer and analyzed in the
positive ion mode. As shown in FIG. 6a, the eluted peptide has an
expected mass of 1035 dalton which corresponds to the mass of the
G9-209-2M peptide used for refolding the scMHC-peptide complex.
This was the only peptide detected indicating that the refolded
complex is a homogenous population of molecules containing a single
specific peptide. A minor peak with a mass of 1057 daltons was also
observed, which peak corresponds to the G9-209-2M peptide including
a sodium ion which probably originated from the PBS buffer in which
the complex was purified and concentrated prior to analysis.
[0170] The mass estimation of the scMHC complex was done using a
deconvolution algorithm, which transforms an ESI mass spectral plot
of relative abundance versus mass-to-charge ratios into a plot of
relative abundance versus mass (FIGS. 6b-c). Each sequence of
multiply charged ion peaks in the acquired mass spectrum (FIG. 6b)
which corresponds to one sample component, is converted into a
single peak positioned at the molecular mass (M) in the
deconvoluted spectrum (FIG. 6c). As shown in FIG. 6c, the
deconvoluted spectrum revealed a single peak with a mass of 44.6
kDa corresponding to the expected molecular weight of the scMHC
protein. As shown above for the peptide, this was the only
identified protein peak in the analyzed spectrum indicating that
the protein consists of a very homogenous population of folded
complexes. Stoichiometric estimation of the eluted peptide
performed according to the mass spectrometry data, revealed that
all refolded and purified scMHC molecules are complexed with the
peptide.
[0171] Biological Activity of Single-Chain MHC-Peptide Complex:
[0172] A CTL stimulation assay using cloned CTLs specific for the
G9-209-2M peptide was utilized to test the biological activity of
the scMHC-peptide complex.
[0173] The recombinant purified scMHC complexes that were produced
with the 3 different peptides (G9-209-2M, G9-280-9V, and TAX) were
immobilized on a microtiter plate and tested for the ability to
induce CTL activation. As shown in FIG. 7a, the single-chain MHC
molecule bound to the g9-209-2M peptide induced specific activation
of the g209-specific CTL clone R6C12 as determined by interferon-g
levels. On the other hand, the complexes bound to the g280 and TAX
peptides did not induce specific activation.
[0174] The ability of soluble scMHC-peptide complexes to induce T
cell activation in solution was also tested by generating
scMHC-peptide tetramers composed of the scMHC-peptide molecule
containing the sequence tag for site-specific biotinylation.
Refolded and purified peptide containing scMHC-BirA complexes were
biotinylated using the BirA enzyme. Following purification of the
scMHC-BirA complexes tetramers were formed by incubation with
streptavidin. The biological activity of the scMHC-BirA-peptide
tetramers was tested by their ability to activate the corresponding
CTL clone. As shown in FIG. 7b, the tetramers containing the
G9-209-2M peptide activated the 209-specific CTL clone R6C12 but
not the Mart-1 specific CTL clone JB2F4, indicating that the
refolded scMHC-peptide complexes are functional and specific. As
shown in FIG. 7c, the ability of the single-chain MHC-BirA-peptide
complex to activate the 209-specific CTL clone was tested with or
without biotinylation of the scMHC protein and subsequent
incubation with streptavidin. As is evident from this Figure, only
the biotinylated MHC-BirA-peptide which can form tetrameric
complexes activates the 209-specific CTL clone in solution thus T
cell activation in solution requires the multimerization of MHC
complexes in the form of tetramers which increase the avidity of
MHC-TCR interactions.
[0175] The tetramer-induced activation of the specific G9-209-2M
CTL clone was more efficient compared to the activation induced by
high density coating of microtiter plates since tetramers were
still able to induce specific CTL activation at ng/ml
concentrations (FIGS. 7a and 7c).
[0176] Microscopic observation of the activated CTL clone incubated
with the 209-containing MHC tetramers revealed that the cells were
agglutinated (FIG. 8b). This is due to the significant increase in
TCR-MHC avidity and enhanced cell to cell contacts effected by
multipoint binding and cross-linking which is caused by the high
concentration of MHC tetramers. These morphological effects were
peptide specific and dependent on the concentration of the
scMHC-BirA-peptide tetramer (FIG. 8b). As the concentration of
tetramers increased, increased cell agglutination (rosette
formation) was observed (FIG. 8c-e).
[0177] CTLs incubated with unbiotinylated scMHC-BirA-209 complexes
and streptavidin which served as a control did not exhibit any
morphological appearance indicating of cell agglutination (FIG.
8a).
[0178] In addition, no agglutinations were observed when the Mart-1
specific CTL clone was incubated with the same concentrations of
the g209-specific scMHC tetramer (data not shown).
[0179] The scMHC tetramers also specifically stained CTL clones
which recognize the MART-1 specific peptide 27-35. As shown in FIG.
9a, the scMHC/Mart tetramers specifically recognized a specific CTL
clone which was not recognized by the scMHC/TAX tetramers (FIG.
9b).
[0180] ScMHC tetramers were also used to stain a heterogeneous
population of T cells from the spleen of transgenic mice
(expressing HLA-A2) which were immunized with the TAX peptide. As
shown in FIGS. 10a-b the number of specific high avidity CD8+ T
cells increased by 2-fold when non-immunized and immunized mice
were compared. Thus, as clearly demonstrated above, the scMHC
tetramers generated according to the teachings of the present
invention can be utilized to detect and isolate antigen-specific
subpopulations of T cells.
[0181] The results presented herein suggest that the recombinant
scMHC-peptide complexes generated according to the teachings of the
present invention are functional, in both the monomeric and the
complexed tetrameric forms.
[0182] Recombinant MHC-peptide tetramers are a very important tool
for the molecular characterization of immune responses.
[0183] Fluorogenic tetramers have been widely used for the
characterization of CTL responses and have afforded many advantages
over previous techniques, particularly the ability to directly
quantify and phenotype Ag-specific CTLs ex-vivo [32-35,38-53].
[0184] It has also been suggested that the enhanced avidity
afforded by multimerization of peptide-MHC may allow binding to
TCRs with affinities too low to ever generate ligand-induced
physiological responses. MHC-peptide tetramers can be utilized in
the field of viral infections for direct visualization of
antigen-specific CD8+ cells in HIV and EBV infection
[33,40,41,45,52], animal models of viral infection [41-43] and
direct analysis of viral-specific CD8+ cells in patients with human
T cell lymphotropic virus-associated myelopathy [53].
[0185] MHC-peptide tetramers might also revolutionize the field of
anti cancer immunity and immunotherapy since they can be used to
identify low frequency anti-tumor CD8+ immune responses. This has
already been demonstrated for melanoma where there is now
considerable evidence that human tumors often express antigens that
make them susceptible to lysis by CTLs [32,36,37,48,50]. Recently
the use of tetrameric soluble class I MHC-peptide complexes for
characterizing melanoma-specific CTL ex vivo has been reported
[36]. An important advance in the field of immunotherapy will be
the ability to use this technology for adoptive immunotherapy. The
use of MHC-peptide tetramers will allow the isolation of CTLs
specific for one melanoma epitope from a mixed CTL population using
tetramer-driven cell sorting [36]. Polyclonal CTL lines can be
utilized to efficiently lyse autologous tumor cells by generating
monoclonal CTL lines against different melanoma epitopes using
direct tetramer-driven CTL cloning [24,36].
[0186] The ability to efficiently generate recombinant MHC-peptide
complexes, with a large variety of antigenic peptides, all related
to one disease (for example, melanoma) may lead to improved modes
of immunotherapy. Thus, it will enable the simultaneous isolation
and cloning of tumor-specific CTL clones specific for the various
peptides ex-vivo, accompanied with specific PCR typing of tumor
associated peptides expressed by individual patients. The specific
clones an then be expanded for adoptive transfer according to the
tumor associated antigen (peptide) expression profile of the
patient.
[0187] The availability of recombinant MHC-peptide complexes is of
interest not only for the generation of MHC tetramers but also for
rapid, sensitive, and reliable MHC-peptide binding assay to
identify high affinity MHC binding T cell epitopes. These complexes
can be used also in in-vitro primary CTL induction studies to
define, among the various MHC binders, those peptides that are
immunogenic.
[0188] They may be used for CTL in vitro induction as well as for
the generation of MHC-peptide tetramers and analysis of specific
immune responses or direct selection of CTLs from heterogeneous
lymphocyte populations by tetramer-driven cell sorting and
analysis.
[0189] Recombinant scMHC-peptide complexes can also be used to
generate specific antibodies by phage display technology [54]. Such
antibodies with TCR-like specificity can be a valuable tool for
studying antigen presentation by tumor cells as well as to develop
novel targeting agents for immunotherapy.
[0190] To date, studies utilizing MHC complexes, some of which are
described above, are limited by MHC purification methods which are
incapable of producing the required amounts of soluble and
functional monomeric or multimeric MHC-peptide complexes.
[0191] Thus, the expression method of the present invention
provides an invaluable tool for advancing studies with MHC
complexes by providing an easy and rapid method for producing large
amounts of highly pure and functional monomeric or multimeric
scMHC-peptide complexes without the need for arduous and time
consuming purification steps such as peptide exchange employed by
prior art methods. In addition, the present invention provides a
novel human single chain MHC class I polypeptide which is
functional in activating CTL clones when utilized as either a
monomer or a multimer.
Example 2
Co-Expression of the scMHC Complex and Peptide
[0192] It will be appreciated that the various scMHC constructs
described above and any mammalian scMHC class polypeptides can also
be co-expressed in E. coli or any other prokaryotic or eukaryotic
expression systems along with the respective binding peptides
thereof, thus negating the need for separately providing the
binding peptide. Thus according to this method of the present
invention, a single construct can be configured so as to express
both the scMHC class I polypeptide and respective binding peptide
coding sequences in the same cell by utilizing for example two
separate promoters or an internal ribosome entry site.
Alternatively the cells of the prokaryotic or eukaryotic expression
system be co-transformed with two expression constructs each
expressing a single coding sequence and each having a specific
selection marker.
[0193] Suitable eukaryotic expression systems include, but are not
limited to mammalian or insect cell cultures, plant protoplasts,
plant cell cultures, whole plants, yeast cells or protozoan cells.
It will be appreciated that when expressed in eukaryotic expression
systems the produced scMHC class I polypeptide preferably includes
a transit peptide (signal sequence) such that the expressed
polypeptide is secreted outside the cell (into the apoplast in
plant cell cultures or whole plants) so as to avoid interaction
with endogenous peptides.
[0194] It will be appreciated that the construct or constructs must
be configured such that the levels of expression of both the scMHC
class I polypeptide and the binding peptide thereof are
stoichiometrically correct.
[0195] Thus, a cell which expresses both coding sequences can
produce a fully functional scMHC-peptide complex which can be
purified via suitable isolation protocols well known in the art. It
will be appreciated that a bacterial expression system is
especially advantageous in this case since the scMHC-peptide
complex expressed thereby can form substantially pure inclusion
bodies when suitable expression conditions are employed. Thus, even
if the scMHC-peptide complex disassembles under denaturing
conditions utilized for solubilizing the inclusion bodies, suitable
renaturation conditions can be used so as to reform a functional
scMHC-peptide complex.
[0196] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims. All
publications cited herein are incorporated by reference in their
entirety. Citation or identification of any reference in this
application shall not be construed as an admission that such
reference is available as prior art to the present invention.
LIST OF REFERENCES
Additional References are Cited in the Text
[0197] 1. Rammensee, H. G., Falk, K., and Rotzschke, O. 1993.
Peptides naturally presented by MHC class I molecules. Ann. Rev.
Immunol 11: 213-244. [0198] 2. Germain, R., and Margulies, D.,
1993. The biochemistry and cell biology of antigen processing and
presentation. Ann. Rev. Immunol 11: 403-450. [0199] 3. Matsumura,
M., Fremont, D. H., Peterson, P. A., and Wilson, I. A. 1992.
Emerging principals for the recognition of peptide antigens by MHC
class I molecules. Science 257: 927-34. [0200] 4. Davis M M,
Boniface J J, Reich Z, Lyons D, Hampl J, Arden B, and Chien Y.
1998. Ligand recognition by alpha beta T cell receptors. Annu Rev
Immunol 16:523-44 [0201] 5. Hansen, T. H., and Lee, D. R. 1997.
Mechanism of class I assembly with beta 2 microglobulin and loading
with peptide. Adv Immunol. [0202] 6. Lanzavecchia, A., G. Lezzi,
and A. Viola. 1999. From TCR engagement to T cell activation: a
kinetic view of T cell behaviour. Cell 96:1 [0203] 7. A. van der
Merwe. 1999. TCR binding to peptide-MHC stabilizes a flexible
recognition interface. Immunity 10:357. [0204] 8. Altman, J. D., P.
A. H. Moss, P. J. R. Goulder, D. H. Barouch, M. G.
McHeyzer-Williams, J. I. Bell, A. J. McMichael, and M. M. Davis.
1996. Phenotypic analysis of antigen-specific T lymphocytes.
Science 274:94. [0205] 9. Kersh, G. J., E. N. Kersh, D. H. Fremont,
and P. M. Allen. 1998. High- and low-potency ligands with similar
affinities for the TCR: the importance of kinetics in TCR
signaling. Immunity 9:817. [0206] 10. Valitutti, S., S. Muller, M.
Cella, E. Padovan, and A. Lanzavecchia. 1995. Serial triggering of
many T-cell receptors by a few peptide-MHC complexes. Nature
375:148. [0207] 11. Garboczi, D. N., D. T. Hung, and D. C. Wiley.
1992. HLA-A2-peptide complexes: refolding and crystallization of
molecules expressed in Escherichia coli and complexed with single
antigenic peptides. Proc. Natl. Acad. Sci. USA 89:3429. [0208] 12.
Mottez, E., P. Langlade-Demoyen, H. Goumier, F. Martinon, J.
Maryanski, P. Kourilsky, and J. P. Abastado. 1995. Cells expressing
a major histocompatibility complex class I molecule with a single
covalently bound peptide are highly immunogenic. J. Exp. Med.
181:493. [0209] 13. Lone, Y-C., Motta, I., Mottez, E., Guilloux,
Y., Lim, A., Demay, F., Levraud, J., Kourilsky, P., and Abastado,
J., 1998. In virto induction of specific cytotoxic T lymphocyes
using recombinant single-chain class I/peptide complexes. J.
Immunother. 21:283. [0210] 14. Mage M G, Lee L, Ribaudo R K, Corr
M, Kozlowski S, McHugh L, and Margulies D H 1992. A recombinant,
soluble, single-chain class I major histocompatibility complex
molecule with biological activity. Proc Natl Acad Sci USA 89:10658.
[0211] 15. Lee L, McHugh L, Ribaudo R K, Kozlowski S, Margulies D
H, and Mage M G. 1994. Functional cell surface expression by a
recombinant single-chain class I major histocompatibility complex
molecule with a cis-active beta 2-microglobulin domain. Eur. J.
Immunol. 24: 2633. [0212] 16. Matsumura, M., Y. Saito, M. R.
Jackson, E. S. Song, and P. A. Peterson. 1992. In vitro peptide
binding to soluble empty class I major histocompatibility complex
molecules isolated from transfected Drosophila melanogaster cells.
J. Biol. Chem. 267:23589. [0213] 17. Stern, L. J., and D. C. Wiley.
1992. The human class II MHC protein HLA-DR1 assembles as empty
heterodimers in the absence of antigenic peptide. Cell 68:465.
[0214] 18. Altman, J. D., P. A. Reay, and M. M. Davis. 1993.
Formation of functional Peptide complexes of class II major
histocompatibility complex proteins from subunits produced in
Escherichia coli. Proc. Natl. Acad. Sci. USA 90:10330. [0215] 19.
Kozono, H., J. White, J. Clements, P. Marrack, and J. Kappler.
1994. Production of soluble MHC class II proteins with covalently
bound single peptides. Nature 369:151. [0216] 20. White, J.,
Crawford, F., Fremont, D., Marrack, P., and Kappler, J. 1999.
Soluble class I MHC with b-2 microglobulin covalently linked
peptides: specific binding to a T-cell hybridoma. J. Immunol. 162:
[0217] 21. Ignatowicz, L., G. Winslow, J. Bill, J. Kappler, and P.
Marrack. 1995. Cell Surface expression of class II MHC proteins
bound by a single peptide. J. Immunol. 154:3852. [0218] 22.
Ignatowicz, L., J. Kappler, and P. Marrack. 1996. The repertoire of
T cells shaped by a single MHC/peptide ligand. Cell 84:521. [0219]
23. Uger, R. A., and B. H. Barber. 1998. Creating CTL targets with
epitope-linked 2-microglobulin constructs. J. Immunol. 160:1598.
[0220] 24. Rosenberg, S. A. 1997 Cancer vaccines based on the
identification of genes encoding cancer regression antigens.
Immunol. Today 18:175. [0221] 25. Van den Eynde, B. and O. Van der
Bruggen. 1997. T-cell-defined tumor antigens. Curr. Opin. Immunol.
9: 684. [0222] 26. Parkhurst M R, Salgaller M L, Southwood S,
Robbins P F, Sette A, Rosenberg S A, and Kawakami, Y. 1996.
Improved induction of melanoma-reactive CTL with peptides from the
melanoma antigen gp100 modified at HLA-A*0201-binding residues. J
Immunol 157:2539. [0223] 27. Salter, R. D., Howell, D., and
Cresswell, P. 1985. Genes regulating HLA class I antigen expression
in T-B lymphoblast hybrids. Immunogenetics 21:235. [0224] 28.
Schatz, P. J. 1993. Use of peptide libraries to map the substrate
specificity of a peptide-modifying enzyme: a 13 residue consensus
peptide specifies biotinylation in Escherichia coli. Biotechnology
11:1138. [0225] 29. Brumfeld, V., and Werber, M. 1993. Studies of
fibronectin and its domains. II Secondary structure and spatial
configuration of fibronectin and its domains. Arch. Biochem.
Biophy. 302:134. [0226] 30. Reiter, Y., and Pastan, I. 1998.
Recombinant Fv immunotoxins and Fv fragments as novel agents for
cancer therapy and diagnosis. Trends in Biotech. 16: 513. [0227]
31. Bouvier, M., and Wiley, D. C. 1994. Importance of peptide amino
and carboxyl termini to the stability of MHC class I molecules.
Science 265:398. [0228] 32. Lee P P, Yee C, Savage P A, Fong L,
Brockstedt D, Weber J S, Johnson D, Swetter S, Thompson J,
Greenberg P D, Roederer M, and Davis M M,. 1999. Characterization
of circulating T cells specific for tumor-associated antigens in
melanoma patients. Nat Med 5:677. [0229] 33. Ogg, G. S., X. Jin, S.
Bonhoeffer, P. R. Dunbar, M. A. Nowak, S. Monard, J. P. Segal, Y.
Cao, S. L. Rowland-Jones, and V. Cerundolo, et al. 1998.
Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma
load of viral RNA. Science 279:2103. [0230] 34. Ogg, G. S., P. R.
Dunbar, P. Romero, J. L. Chen, and V. Cerundolo. 1998. High
frequency of skin-homing melanocyte-specific cytotoxic T
lymphocytes in autoimmune vitiligo. J. Exp. Med. 188:1203. [0231]
35. Ogg, G. S., and A. J. McMichael. 1998. HLA-peptide tetrameric
complexes. Curr. Opin. Immunol. 10:393. [0232] 36. Dunbar, P. R.,
J.-L. Chen, D. Chao, N. Rust, H. Teisserenc, G. S. Ogg, P. Romero,
P. Weynants, and V. Cerundolo. 1999. Cutting edge: rapid cloning of
tumor-specific CTL suitable for adoptive immunotherapy of melanoma.
J. Immunol. 162:6959. [0233] 37. Dunbar, P. R., G. S. Ogg, J. Chen,
N. Rust, P. van der Bruggen, and V. Cerundolo. 1998. Direct
isolation, phenotyping, and cloning of low-frequency
antigen-specific cytotoxic T lymphocytes from peripheral blood.
Curr. Biol. 8:413. [0234] 38. Bowness, P., R. L. Allen, D. N.
Barclay, E. Y. Jones, and A. J. McMichael. 1998. Importance of a
conserved TCR J-encoded tyrosine for T cell recognition of an HLA
B27/peptide complex. Eur. J. Immunol. 28:2704. [0235] 39. Schwartz,
R. S. 1998. Direct visualization of antigen-specific cytotoxic T
cellsDa new insight into immune defenses. N. Engl. J. Med.
339:1076. [0236] 40. Callan, M. F., L. Tan, N. Annels, G. S. Ogg,
J. D. Wilson, C. A. O'Callaghan, N. Steven, A. J. McMichael, and A.
B. Rickinson. 1998. Direct visualization of antigen-specific CD8+ T
cells during the primary immune response to Epstein-Barr virus in
vivo. J. Exp. Med. 187:1395. [0237] 41. Gallimore, A., A. Glithero,
A. Godkin, A. C. Tissot, A. Pluckthun, T. Elliott, H. Hengartner,
and R. Zinkernagel. 1998. Induction and exhaustion of lymphocytic
choriomeningitis virus-specific cytotoxic T lymphocytes visualized
using soluble tetrameric major histocompatibility complex class
I-peptide complexes. J. Exp. Med. 187:1383. [0238] 42. Kuroda, M.
J., J. E. Schmitz, D. H. Barouch, A. Craiu, T. M. Allen, A. Sette,
D. I. Watkins, M. A. Forman, and N. L. Letvin. 1998. Analysis of
Gag-specific Cytotoxic T lymphocytes in simian immunodeficiency
virus-infected rhesus monkeys by cell staining with a tetrameric
major histocompatibility complex class I-peptide complex. J. Exp.
Med. 187:1373. [0239] 43. Seth, A., I. Ourmanov, M. J. Kuroda, J.
E. Schmitz, M. W. Carroll, L. S. Wyatt, B. Moss, M. A. Forman, V.
M. Hirsch, and N. L. Letvin. 1998. Recombinant Modified vaccinia
virus Ankara-simian immunodeficiency virus gag pol elicits
cytotoxic T lymphocytes in rhesus monkeys detected by a major
histocompatibility complex class I/peptide tetramer. Proc. Natl.
Acad. Sci. USA 95:10112. [0240] 44. Wilson, J. D., G. S. Ogg, R. L.
Allen, P. J. Goulder, A. Kelleher, A. K. Sewell, C. A. O'Callaghan,
S. L. Rowland Jones, M. F. Callan, and A. J. McMichael. 1998.
Oligoclonal expansions of CD8+ T cells in chronic HIV infection are
antigen specific. J. Exp. Med. 188:785. [0241] 45. Sourdive, D. J.,
K. Murali-Krishna, J. D. Altman, A. J. Zajac, J. K. Whitmire, C.
Pannetier, P. Kourilsky, B. Evavold, A. Sette, and R. Ahmed. 1998.
Conserved T cell receptor repertoire in primary and memory CD8 T
cell responses to an acute viral infection. J. Exp. Med. 188:71.
[0242] 46. Bousso, P., A. Casrouge, J. D. Altman, M. Haury, J.
Kanellopoulos, J. P. Abastado, and P. Kourilsky. 1998. Individual
variations in the murine T cell response to a specific peptide
reflect variability in naive repertoires. Immunity 9:169. [0243]
47. Murali-Krishna, K., J. D. Altman, M. Suresh, D. J. Sourdive, A.
J. Zajac, J. D. Miller, J. Slansky, and R. Ahmed. 1998. Counting
antigen-specific CD8 T cells: a reevaluation of bystander
activation during viral infection. Immunity 8:177. [0244] 48.
Romero, P., P. R. Dunbar, D. Valmori, M. Pittet, G. S. Ogg, D.
Rimoldi, J.-L. Chen, D. Lienard, J.-C. Cerottini, and V. Cerundolo.
1998. Ex vivo staining of metastatic lymph nodes by class I major
histocompatibility complex tetramers reveals high numbers of
antigen-experienced tumor-specific cytotoxic T lymphocytes. J. Exp.
Med. 188:1641. [0245] 49. Flynn, K. J., G. T. Belz, J. D. Altman,
R. Ahmed, D. L. Woodland, and P. C. Doherty. 1998. Virus-specific
CD8+ T cells in primary and secondary influenza pneumonia. Immunity
8:683. [0246] 50. Yee, C., P. A. Savage, P. P. Lee, M. M. Davis,
and P. D. Greenberg. 1999. [0247] 51. Isolation of high avidity
melanoma-reactive CTL from heterogeneous populations using
peptide-MHC tetramers. J. Immunol. 162:2227. [0248] 52. He, X S,
Rehermann, B., Lopez-Labrador F X, Boisvert, J., Cheung, R., Mumm,
J., Wedemeyer, H., Berenguer, M., Wtright, T L., Davis, M M and
Greenberg H B. 1999 Quantitative analsysis of hepatitis C
virus-specific CD8(+) T cells in peripheral blood and liver using
peptide-MHC tetramers. Proc. Natl. Acad. Sci. USA 96: 5692 [0249]
53. Gray, M. V. Lawrence, J., Schapiro, J. M., Altman, J. M.,
Winters, M. A., Crompton, M., Smriti, M.,. Kundu, M., Davis, M. M.,
And Merigan. T. C. 1999. Frequency of Class I HLA-Restricted
Anti-HIV CD8+ T Cells in Individuals Receiving Highly Active
Antiretroviral Therapy (HAART). J. Immunol 162: 1780. [0250] 54.
Bieganowska, K., Hullsberg, p., Buckle, j. b., Lim, D., Greten, T.
F., Schneck, J., Altman, J. D., Jacobson, S., Ledis, S. L.,
Hanchard, B., Chin, J., Morgan, O., Roth, P. A., and Hafler D. A.
Direct Analysis of Viral-Specific CD8+ T Cells with Soluble
HLA-A2/Tax11-19 Tetramer Complexes in Patients with Human T Cell
Lymphotropic Virus-Associated Myelopathy J. Immunol 162:1765-1771
[0251] 55. De Haard, H., Henderikx, P., and Hoogenboom, H. R.,
1998. Creating and Engineering human antibodies for immunotherapy.
Adv. Drug. Delv. Rev. 31: 5. [0252] 56. Andersen, P. S., Stryhn,
A., Hansen, B. E., Fugger, L. & Engberg, J. (1996) A
recombinant antibody with the antigen specific, major
histocompetibibity complex-restricted specificity of T cells. Proc.
Natl. Acad. Sci. (USA) 93:1820. [0253] 57. Reiter, Y., DiCarlo, A.,
Engberg, J., and Pastan, I. (1997) Peptide-specific killing of
antigen-presenting cells by a recombinant antibody-toxin fusion
protein targeted to MHC/peptide class I complexes with T-cell
receptor-like specificity. Proc. Natl. Acad. Sci. USA 94: 4631.
Sequence CWU 1
1
2019PRTArtificial sequenceSynthetic peptide 1Ile Met Asp Gln Val
Pro Phe Ser Val1 529PRTArtificial sequenceSynthetic peptide 2Tyr
Leu Glu Pro Gly Pro Val Thr Val1 539PRTArtificial sequenceSynthetic
peptide 3Leu Leu Phe Gly Tyr Pro Val Tyr Val1 541048DNAHomo sapiens
4atgatccagc gtactccaaa gattcaggtt tactcacgtc atccagcaga gaatggaaag
60tcaaatttcc tgaattgcta tgtgtctggg tttcatccat ccgacattga agttgactta
120ctgaagaatg gagagagaat tgaaaaagtg gagcattcag acttgtcttt
cagcaaggac 180tggtctttct atctcttgta ttatactgag ttcaccccca
ctgaaaaaga tgagtatgcc 240tgccgtgtga accacgtgac tttgtcacag
cccaagatag ttaagtggga tcgagacatg 300ggtggcggtg gaagcggcgg
tggaggctct ggtggaggtg gcagcggctc tcactccatg 360aggtatttct
tcacatccgt gtcccggccc ggccgcgggg agccccgctt catcgcagtg
420ggctacgtgg acgacacgca gttcgtgcgg ttcgacagcg acgccgcgag
ccagaggatg 480gagccgcggg cgccgtggat agagcaggag ggtccggagt
attgggacgg ggagacacgg 540aaagtgaagg cccactcaca gactcaccga
gtggacctgg ggaccctgcg cggctactac 600aaccagagcg aggccggttc
tcacaccgtc cagaggatgt atggctgcga cgtggggtcg 660gactggcgct
tcctccgcgg gtaccaccag tacgcctacg acggcaagga ttacatcgcc
720ctgaaagagg acctgcgctc ttggaccgcg gcggacatgg cagctcagac
caccaagcac 780aagtgggagg cggcccatgt ggcggagcag ttgagagcct
acctggaggg cacgtgcgtg 840gagtggctcc gcagatacct ggagaacggg
aaggagacgc tgcagcgcac ggacgccccc 900aaaacgcaca tgactcacca
cgctgtctct gaccatgaag ccaccctgag gtgctgggcc 960ctgagcttct
accctgcgga gatcacactg acctggcagc ggacttggag gaatctttga
1020ggcaatgaag atggagctgc gggactga 10485415PRTArtificial
sequenceHuman beta2 microglobulin linked to MHC class I heavy chain
5Met Ile Gln Arg Thr Pro Lys Ile Gln Val Tyr Ser Arg His Pro Ala1 5
10 15Glu Asn Gly Lys Ser Asn Phe Leu Asn Cys Tyr Val Ser Gly Phe
His20 25 30Pro Ser Asp Ile Glu Val Asp Leu Leu Lys Asn Gly Glu Arg
Ile Glu35 40 45Lys Val Glu His Ser Asp Leu Ser Phe Ser Lys Asp Trp
Ser Phe Tyr50 55 60Leu Leu Tyr Tyr Thr Glu Phe Thr Pro Thr Glu Lys
Asp Glu Tyr Ala65 70 75 80Cys Arg Val Asn His Val Thr Leu Ser Gln
Pro Lys Ile Val Lys Trp85 90 95Asp Arg Asp Met Gly Gly Gly Gly Ser
Gly Gly Gly Gly Ser Gly Gly100 105 110Gly Gly Ser Gly Ser His Ser
Met Arg Tyr Phe Phe Thr Ser Val Ser115 120 125Arg Pro Gly Arg Gly
Glu Pro Arg Phe Ile Ala Val Gly Tyr Val Asp130 135 140Asp Thr Gln
Phe Val Arg Phe Asp Ser Asp Ala Ala Ser Gln Arg Met145 150 155
160Glu Pro Arg Ala Pro Trp Ile Glu Gln Glu Gly Pro Glu Tyr Trp
Asp165 170 175Gly Glu Thr Arg Lys Val Lys Ala His Ser Gln Thr His
Arg Val Asp180 185 190Leu Gly Thr Leu Arg Gly Tyr Tyr Asn Gln Ser
Glu Ala Gly Ser His195 200 205Thr Val Gln Arg Met Tyr Gly Cys Asp
Val Gly Ser Asp Trp Arg Phe210 215 220Leu Arg Gly Tyr His Gln Tyr
Ala Tyr Asp Gly Lys Asp Tyr Ile Ala225 230 235 240Leu Lys Glu Asp
Leu Arg Ser Trp Thr Ala Ala Asp Met Ala Ala Gln245 250 255Thr Thr
Lys His Lys Trp Glu Ala Ala His Val Ala Glu Gln Leu Arg260 265
270Ala Tyr Leu Glu Gly Thr Cys Val Glu Trp Leu Arg Arg Tyr Leu
Glu275 280 285Asn Gly Lys Glu Thr Leu Gln Arg Thr Asp Ala Pro Lys
Thr His Met290 295 300Thr His His Ala Val Ser Asp His Glu Ala Thr
Leu Arg Cys Trp Ala305 310 315 320Leu Ser Phe Tyr Pro Ala Glu Ile
Thr Leu Thr Trp Gln Arg Asp Gly325 330 335Glu Asp Gln Thr Gln Asp
Thr Glu Leu Val Glu Thr Arg Pro Ala Gly340 345 350Asp Gly Thr Phe
Gln Lys Trp Ala Ala Val Val Val Pro Ser Gly Gln355 360 365Glu Gln
Arg Tyr Thr Cys His Val Gln His Glu Gly Leu Pro Lys Pro370 375
380Leu Thr Leu Arg Trp Glu Gln Ser Thr Arg Gly Gly Ala Ser Gly
Gly385 390 395 400Gly Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu
Leu Arg Asp405 410 4156280PRTHomo sapiens 6Gly Ser His Ser Met Arg
Tyr Phe Phe Thr Ser Val Ser Arg Pro Gly1 5 10 15Arg Gly Glu Pro Arg
Phe Ile Ala Val Gly Tyr Val Asp Asp Thr Gln20 25 30Phe Val Arg Phe
Asp Ser Asp Ala Ala Ser Gln Arg Met Glu Pro Arg35 40 45Ala Pro Trp
Ile Glu Gln Glu Gly Pro Glu Tyr Trp Asp Gly Glu Thr50 55 60Arg Lys
Val Lys Ala His Ser Gln Thr His Arg Val Asp Leu Gly Thr65 70 75
80Leu Arg Gly Tyr Tyr Asn Gln Ser Glu Ala Gly Ser His Thr Val Gln85
90 95Arg Met Tyr Gly Cys Asp Val Gly Ser Asp Trp Arg Phe Leu Arg
Gly100 105 110Tyr His Gln Tyr Ala Tyr Asp Gly Lys Asp Tyr Ile Ala
Leu Lys Glu115 120 125Asp Leu Arg Ser Trp Thr Ala Ala Asp Met Ala
Ala Gln Thr Thr Lys130 135 140His Lys Trp Glu Ala Ala His Val Ala
Glu Gln Leu Arg Ala Tyr Leu145 150 155 160Glu Gly Thr Cys Val Glu
Trp Leu Arg Arg Tyr Leu Glu Asn Gly Lys165 170 175Glu Thr Leu Gln
Arg Thr Asp Ala Pro Lys Thr His Met Thr His His180 185 190Ala Val
Ser Asp His Glu Ala Thr Leu Arg Cys Trp Ala Leu Ser Phe195 200
205Tyr Pro Ala Glu Ile Thr Leu Thr Trp Gln Arg Asp Gly Glu Asp
Gln210 215 220Thr Gln Asp Thr Glu Leu Val Glu Thr Arg Pro Ala Gly
Asp Gly Thr225 230 235 240Phe Gln Lys Trp Ala Ala Val Val Val Pro
Ser Gly Gln Glu Gln Arg245 250 255Tyr Thr Cys His Val Gln His Glu
Gly Leu Pro Lys Pro Leu Thr Leu260 265 270Arg Trp Glu Gln Ser Thr
Arg Gly275 2807100PRTHomo sapiens 7Met Ile Gln Arg Thr Pro Lys Ile
Gln Val Tyr Ser Arg His Pro Ala1 5 10 15Glu Asn Gly Lys Ser Asn Phe
Leu Asn Cys Tyr Val Ser Gly Phe His20 25 30Pro Ser Asp Ile Glu Val
Asp Leu Leu Lys Asn Gly Glu Arg Ile Glu35 40 45Lys Val Glu His Ser
Asp Leu Ser Phe Ser Lys Asp Trp Ser Phe Tyr50 55 60Leu Leu Tyr Tyr
Thr Glu Phe Thr Pro Thr Glu Lys Asp Glu Tyr Ala65 70 75 80Cys Arg
Val Asn His Val Thr Leu Ser Gln Pro Lys Ile Val Lys Trp85 90 95Asp
Arg Asp Met100836DNAArtificial sequenceSingle strand DNA
oligonucleotide 8aggagatata catatgggct ctcactccat gaggta
36943DNAArtificial sequencesynthetic oligonucleotide 9cgggctttgt
tagcaccgat tcataggtga ggggcttggg caa 431015PRTArtificial
sequenceLinker polypeptide 10Gly Gly Gly Gly Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser1 5 10 151135DNAArtificial sequenceSingle
strand DNA oligonucleotide 11ggagatatac atatgatcca gcgtactcca aagat
351249DNAArtificial sequenceSingle strand DNA oligonucleotide
12cgggctttgt tagcagccga attcattaca tgtctcgatc ccacttaac
491341DNAArtificial sequenceSingle strand DNA oligonucleotide
13ggaaggcgtt ggcgcatatg atccagcgta ctccaaagat t 411450DNAArtificial
sequenceSingle strand DNA oligonucleotide 14ggaagcggcg gtggaggctc
tggtggaggt ggcagcggct ctcactccat 501550DNAArtificial sequenceSingle
strand DNA oligonucleotide 15ggaagcggcg gtggaggctc tggtggaggt
ggcagcggct ctcactccat 501643DNAArtificial sequenceSingle strand DNA
oligonucleotide 16gggagaattc ttactcccat ctcagggtga ggggcttggg caa
431714PRTArtificial sequenceSpecific biotinylation peptide sequence
17Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg Asp1 5
101811PRTArtificial sequenceLinker polypeptide 18Gln Ser Thr Arg
Gly Gly Ala Ser Gly Gly Gly1 5 1019100DNAArtificial sequenceSingle
strand DNA oligonucleotide 19cagtaaaagc tttttatcag cctccgaact
gtggatgcct ccacgccgaa cctccaccag 60aaccacctcc ggacccgcca cctccctccc
atctcagggt 1002039DNAArtificial sequenceBirA recognition tag
sequence 20ggaatctttg aggcaatgaa gatggagctg cgggactga 39
* * * * *