U.S. patent application number 12/203779 was filed with the patent office on 2009-06-11 for rapid magnetic flow assays.
This patent application is currently assigned to MICRONICS, INC.. Invention is credited to C. Frederick Battrell, Wayne L. Breidford, John Gerdes, Mark Kokoris, Stephen Mordue, Melud Nabavi.
Application Number | 20090148847 12/203779 |
Document ID | / |
Family ID | 38445613 |
Filed Date | 2009-06-11 |
United States Patent
Application |
20090148847 |
Kind Code |
A1 |
Kokoris; Mark ; et
al. |
June 11, 2009 |
RAPID MAGNETIC FLOW ASSAYS
Abstract
Disclosed is an improvement in methods for nucleic acid and
immunological bioassays. The methods comprise a step for "sweeping"
paramagnetic bead: target molecule complexes so as to capture them
with an affinity capture agent on a test pad by moving a magnetic
force field from outside to inside the test pad area so as to bring
into contact the paramagnetic complexes with the capture agent,
while sweeping any unbound paramagnetic material off the test pad
by moving the magnetic field from inside to outside the test pad
area. Surprisingly, the paramagnetic complexes are rapidly
affinity-extracted from the moving magnetic field.
Inventors: |
Kokoris; Mark; (Bothell,
WA) ; Nabavi; Melud; (Seattle, WA) ;
Breidford; Wayne L.; (Seattle, WA) ; Gerdes;
John; (Columbine Valley, CO) ; Mordue; Stephen;
(Kirkland, WA) ; Battrell; C. Frederick; (Redmond,
WA) |
Correspondence
Address: |
SEED INTELLECTUAL PROPERTY LAW GROUP PLLC
701 FIFTH AVE, SUITE 5400
SEATTLE
WA
98104
US
|
Assignee: |
MICRONICS, INC.
Redmond
WA
|
Family ID: |
38445613 |
Appl. No.: |
12/203779 |
Filed: |
September 3, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2007/006585 |
Mar 15, 2007 |
|
|
|
12203779 |
|
|
|
|
60782649 |
Mar 15, 2006 |
|
|
|
60844811 |
Sep 14, 2006 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
422/186.01; 536/24.33 |
Current CPC
Class: |
B01L 3/5027 20130101;
C12Q 1/686 20130101; B01L 3/502738 20130101; B01L 2300/0663
20130101; B01L 2400/0655 20130101; B01L 3/50273 20130101; B01L
2300/0887 20130101; C12Q 1/6834 20130101; B01L 2300/0816 20130101;
B01F 11/0071 20130101; B01F 13/0059 20130101; B01L 2300/087
20130101; B01L 2200/10 20130101; B01L 2200/16 20130101; B01L
2400/0481 20130101; B01L 3/502723 20130101; B01L 2400/0638
20130101; B01L 7/52 20130101; B01L 3/502746 20130101; B01L
2300/0867 20130101; B01L 2200/082 20130101; C12Q 1/686 20130101;
C12Q 2563/131 20130101; C12Q 1/6834 20130101; C12Q 2525/197
20130101; C12Q 2563/143 20130101; C12Q 2565/629 20130101 |
Class at
Publication: |
435/6 ;
536/24.33; 422/186.01 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04; B01J 19/00 20060101
B01J019/00 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under
Contract No. UO1 AI061187, awarded by the National Institutes of
Health. The government has certain rights in this invention.
Claims
1-4. (canceled)
5. A method for multiplex target nucleic acid detection by
heterogeneous binding assay, comprising: a) preparing an
amplification reagent comprising an amplification primer set having
a first primer tagged with a peptidyl hapten tag and a second
primer tagged with a ligand tag, wherein said first primer and said
second primer are complementary to flanking sequences of a nucleic
acid target sequence to be assayed; b) preparing a paramagnetic
bead reagent comprising a paramagnetic microbead with a binding
agent, wherein said binding agent has a binding affinity for said
ligand tag of said second primer; c) preparing a test pad area with
immobilized capture antibody, wherein said capture antibody has a
binding affinity for said peptidyl hapten tag of said first primer;
d) processing a biological sample to release a nucleic acid
fraction; e) contacting said nucleic acid fraction with said
amplification reagent; f) performing an amplification to yield
amplification products; and g) assaying said amplification products
for a two-tailed amplicon labeled with said peptidyl hapten tag of
said first primer on a first end of said two-tailed amplicon and
said ligand tag of said second primer on a second end of said
two-tailed amplicon by: i) contacting said amplification products
with said paramagnetic bead reagent, thereby binding said ligand
tag of said second end of said two-tailed amplicon to said binding
agent of said paramagnetic bead reagent to yield a two-tailed
amplicon paramagnetic bead complex; ii) sweeping said two-tailed
amplicon paramagnetic bead complex into close contact with said
test pad area by moving a magnetic force field from outside to
inside said test pad area, thereby binding said peptidyl hapten tag
of said first end of said two-tailed amplicon of said two-tailed
amplicon paramagnetic bead complex to said capture antibody of said
test pad area to yield an immunoimmobilized paramagnetic reporter
complex; iii) sweeping from said test pad area any unbound
two-tailed amplicon paramagnetic bead complex by moving said
magnetic force field from inside to outside said test pad area; and
iv) detecting the presence of said immunoimmobilized paramagnetic
reporter complex on said test pad area.
6. The method of claim 5 wherein said ligand tag of said
amplification reagent is biotin and said binding agent of said
paramagnetic bead reagent is an avidin.
7. The method of claim 5 wherein said peptidyl hapten tag is a
peptide with 2 to 100 amino acid residues.
8. The method of claim 5 wherein said immunoimmobilized
paramagnetic complex on said test pad is detected visually.
9. The method of claim 5 wherein said amplification step comprises
a thermocycling protocol or isothermal protocol.
10. The method of claim 5 wherein said amplification step further
comprises reverse transcription.
11. The method of claim 5 wherein said amplification step comprises
nested amplification.
12. The method of claim 5 further comprising a multiplex target
detection protocol.
13. A kit for performing the method of claim 5, said kit comprising
said amplification reagent and said test pad area.
14-33. (canceled)
34. A molecular detection complex comprising a two-tailed amplicon
having a first end and a second end, said first end comprising a
first primer covalently conjugated with a peptidyl hapten tag, and
said second end comprising a second primer covalently conjugated
with a ligand tag, wherein said first end further comprises a
peptidyl hapten-bound anti-peptidyl hapten antibody immobilized on
a solid phase, and wherein said second end further comprises a
ligand-bound ligand binding agent-coated reporter group.
35. The molecular detection complex of claim 34, wherein said
ligand-bound ligand binding agent-coated reporter group is a
magnetic microbead coated with said ligand binding agent, and
wherein said solid phase is a test pad area.
36. An apparatus for forming and purifying the molecular detection
complex of claim 35, comprising: a) a microfluidic cartridge
comprising a substrate and a microchannel in said substrate, said
microchannel comprising a fluid path with axis of flow and with
upper and lower aspects; b) a test pad in said microchannel, said
test pad comprising an affinity capture agent comprising an
anti-peptidyl hapten antibody immobilized on a solid phase; c) a
means for introducing a fluid comprising (i) a paramagnetic
microbead comprising said reporter group and (ii) a two-tailed
amplicon into said microchannel; and d) a means for moving a
magnetic force field along a plane parallel to said axis of flow of
said microfluidic channel to (i) sweep said paramagnetic microbead
in said fluid into close contact with said affinity capture agent,
thereby binding said paramagnetic microbead to said affinity
capture agent and binding said two-tailed amplicon to said
paramagnetic microbead to yield said molecular detection complex,
and (ii) sweep from said test pad any unbound paramagnetic
microbead and any unbound two-tailed amplicon.
37-43. (canceled)
44. A method for rapid bioassay comprising: a) preparing an
amplification primer set comprising a first primer comprising a
peptidyl hapten tag and a second primer comprising a ligand tag; b)
forming a two-tailed amplicon product comprising said peptidyl
hapten tag of said first primer on a first end and said ligand tag
of said second primer on a second end by amplifying a nucleic acid
target with said amplification primer set; c) complexing said
two-tailed amplicon product to a reporter group having a binding
affinity for said ligand tag to yield a two-tailed amplicon
reporter group complex; d) capturing said two-tailed amplicon
reporter group complex on a solid phase having an immobilized
capture antibody, wherein said capture antibody has a binding
affinity for said peptidyl hapten tag, to yield an immobilized
reporter group complex; and, e) detecting said immobilized reporter
group complex.
45. The method of claim 44 wherein said reporter group is a
magnetic microbead and said solid phase is a test pad.
46. The method of claim 44 wherein said reporter group is a
fluorophore and said solid phase is a barcoded latex bead.
47. The method of claim 44, wherein said steps a) through c) are
performed for a plurality of first primers conjugated with
different peptidyl hapten tags and a plurality of two-tailed
amplicon products are captured and detected on a plurality of solid
phases, each with an antibody specific for one of said different
peptidyl hapten tags.
48. The method of claim 45, wherein said steps a) through c) are
performed for a plurality of first primers conjugated with
different peptidyl hapten tags and a plurality of two-tailed
amplicon products are magnetically captured and detected on a
plurality of solid test pads, each with an antibody specific for
one of said different peptidyl hapten tags.
49. The method for multiplex target nucleic acid detection by
heterogeneous binding assay of claim 12, wherein said amplification
reagent comprises a plurality of first primers, each tagged with a
different peptidyl hapten tag, and wherein said test pad area
comprises a plurality of test pads, each with an immobilized
monoclonal capture antibody having a binding affinity for one of
the peptidyl hapten tags of the plurality of first primers.
50. The method for multiplex target nucleic acid detection by
heterogeneous binding assay of claim 12, wherein said test pad area
comprises a plurality of test pads, each with an immobilized
monoclonal capture antibody having a binding affinity for a
different peptidyl hapten tagged amplicon.
51. A method for multiplex target nucleic acid detection by
heterogeneous binding assay, comprising: a) preparing a plurality
of amplification reagents, each comprising an amplification primer
set having a first primer tagged with a peptidyl hapten tag and a
second primer tagged with an affinity tag, wherein each pair of
said first primers and said second primers are complementary to
flanking sequences of a plurality of nucleic acid target sequences
to be assayed; b) preparing a plurality of paramagnetic bead
reagents, each comprising a paramagnetic microbead with a binding
agent, wherein each of said binding agents has a binding affinity
for one of said affinity tags of said second primers; c) preparing
a plurality of test pads in a test pad area, each test pad having a
different immobilized capture antibody having a binding affinity
for one of said peptidyl hapten tags of said first primers; d)
processing a biological sample to release a nucleic acid fraction;
e) contacting said nucleic acid fraction with said amplification
reagents; f) performing an amplification to yield amplification
products; and g) assaying said amplification products for
two-tailed amplicons labeled with one of said peptidyl hapten tags
of said first primers on a first end and one of said affinity tags
of said second primers on a second end by: i) contacting said
amplification products with said paramagnetic bead reagents,
thereby binding said affinity tags of said second ends of said
two-tailed amplicons to said binding agents of said paramagnetic
bead reagents to yield two-tailed amplicon paramagnetic bead
complexes; ii) sweeping said two-tailed amplicon paramagnetic bead
complexes into close contact with said plurality of test pads by
moving a magnetic force field from outside to inside said test pad
area, thereby binding said peptidyl hapten tags of said first ends
of said two-tailed amplicon of said two-tailed amplicon
paramagnetic bead complex to said capture antibodies of said test
pads to yield immobilized paramagnetic reporter complexes; iii)
sweeping from said test pad area any unbound two-tailed amplicon
paramagnetic bead complexes by moving said magnetic force field
from inside to outside said test pad area; and iv) detecting the
presence of said immunoimmobilized paramagnetic reporter complexes
on each of said test pads.
52. The method for multiplex target nucleic acid detection by
heterogeneous binding assay of claim 51, wherein each of said
affinity tags is a peptidyl hapten tag and each of said binding
agents is an anti-peptidyl hapten antibody.
53. A molecular detection complex comprising a two-tailed amplicon
having a first end and a second end, said first end comprising a
first primer covalently conjugated with a first peptidyl hapten
tag, and said second end comprising a second primer covalently
conjugated with a second peptidyl hapten tag, wherein said first
end further comprises a first peptidyl hapten-bound anti-first
peptidyl hapten antibody immobilized on a solid phase, and wherein
said second end further comprises a second peptidyl hapten-bound
anti-second peptidyl hapten antibody-coated reporter group.
54. A method for rapid bioassay comprising: a) preparing an
amplification primer set comprising a first primer comprising a
first peptidyl hapten tag and a second primer comprising a second
peptidyl hapten tag; b) forming a two-tailed amplicon product
comprising said first peptidyl hapten tag of said first primer on a
first end and said second peptidyl hapten tag of said second primer
on a second end by amplifying a nucleic acid target with said
amplification primer set; c) complexing said two-tailed amplicon
product to a reporter group having a binding affinity for said
second peptidyl hapten tag of said second primer to yield a
two-tailed amplicon reporter group complex; d) capturing said
two-tailed amplicon reporter group complex on a solid phase having
an immobilized capture antibody, wherein said capture antibody has
a binding affinity for said first peptidyl hapten tag, to yield an
immobilized reporter group complex; and e) detecting said
immobilized reporter group complex.
55. A kit for performing a multiplex nucleic acid bioassay with
multiplex detection of two-tailed amplicons, said kit comprising: a
first assay reagent having a peptidyl-hapten conjugated first
amplification primer; a plurality of test pads, each of said test
pad comprising a dehydrated first affinity binding agent with
affinity for said peptidyl-hapten of said first primer; and a
second assay reagent comprising a bead reagent as a reporter group,
wherein said bead reagent is coated with a second affinity binding
agent.
56. The kit of claim 55 for performing a panel assay for multiplex
detection of multiple nucleic acid targets.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of International PCT
Patent Application No. PCT/US2007/006585, filed Mar. 15, 2007, now
pending, which claims the benefit under 35 U.S.C. 119(e) of U.S.
Provisional Patent Application No. 60/782,649, filed Mar. 15, 2006,
and U.S. Provisional Patent Application No. 60/844,811, filed Sep.
14, 2006. These applications are incorporated herein by reference
in their entireties.
STATEMENT REGARDING SEQUENCE LISTING
[0003] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is
660115.sub.--455C1_SEQUENCE_LISTING.txt. The text file is 6 KB, was
created on Sep. 3, 2008, and is being submitted electronically via
EFS-Web.
BACKGROUND OF THE INVENTION
[0004] 1. Field of the Invention
[0005] The present invention relates to the general fields of
molecular biology and medical science, and more particularly to
improved methods for nucleic acid and immunological bioassays.
[0006] 2. Description of the Related Art
[0007] There has been a dramatic transition in clinical laboratory
diagnostic assays from the macroscale to the microscale, with
specimen volume requirements decreasing from milliliters to
microliters, and continuing reduction of assay times from hours to
minutes.
[0008] These improvements are due in part to advances in materials
and fabrication, to the rapidity of mass and heat transfer at the
microscale, and to increases in detection sensitivity, but also
represent a continuing effort at innovation.
[0009] Numerous heterogeneous binding assay systems are known in
the prior art and need not be reviewed here. Particles, beads and
microspheres, impregnated with color or having a higher diffraction
index, are widely used to speed target isolation. The sensitivity
of these assays can be improved with ELISA, with fluorescent dyes,
by fluorescence quenching, with QDots as tags, for example, thereby
achieving higher sensitivity, smaller test pads and larger arrays.
Increasingly, nucleic acid assay targets have replaced serological
testing. Conventional means for nucleic acid amplification have had
a dramatic effect on assay sensitivity and robustness.
[0010] However, more can be accomplished to improve sensitivity and
accelerate detection of the assay endpoint. Typically the problem
is one of diffusion kinetics and mass transfer.
[0011] The zeta-potential at the shear boundary layer around
particles in solution can slow the close approach needed for
binding and immobilization of an assay target. In U.S. Pat. No.
6,720,411, particle colloids such as gold colloids coated with
oligomers are aggregated in such a way that the color changes with
the state of aggregation. As illustrated in Example 2B of U.S. Pat.
No. 6,720,411, the color changes noted are reported to occur over
several hours. The endpoint is temperature and salt sensitive and
thus represents Brownian motion as path length, the counterion
layer as a diffusion barrier, and reduction of interfacial tension
as a driving potential. Antibodies can be detected by similar
methods, as illustrated in U.S. Pat. No. 6,974,669. However, these
detection methods are inherently slow.
[0012] Target migration and complexation rates in a solid
chromatographic matrix also limit the sensitivity and velocity of
endpoint detection in lateral flow assays. Immunochromatographic
tests, commonly referred to as Lateral Flow Assays, have been
widely used for qualitative and semi-quantitative assays relying on
visual detection. One advantage is the wide variety of analytes
that can be detected using this type of test. Consequently, a large
industry exists for commercialization of this methodology. See,
e.g., U.S. Pat. No. 5,120,643, U.S. Pat. No. 4,943,522, U.S. Pat.
No. 5,770,460, U.S. Pat. No. 5,798,273, U.S. Pat. No. 5,504,013,
U.S. Pat. No. 6,399,398, U.S. Pat. No. 5,275,785, U.S. Pat. No.
5,504,013, U.S. Pat. No. 5,602,040, U.S. Pat. No. 5,622,871, U.S.
Pat. No. 5,656,503, U.S. Pat. No. 4,855,240, U.S. Pat. No.
5,591,645, U.S. Pat. No. 4,956,302, U.S. Pat. No. 5,075,078, and
U.S. Pat. No. 6,368,876 and U.S. Pat. No. 648,982. Techniques for
lateral flow assays are discussed in TechNotes #303 "Lateral Flow
Tests" by Bang's Laboratories, Inc. (Fishers, Ind.), which is
incorporated herein in full by reference.
[0013] As another example, in U.S. Pat. No. 5,989,813, amplicons
are prepared by amplification of target nucleic acid sequences in
the presence of forward and reverse primers conjugated with biotin
and digoxigenin, respectively, for use in lateral flow assays. The
amplicons are bound to particles with streptavidin and agglutinate
in the presence of antibody to digoxigenin. By lateral flow in a
sorbent, bifunctional amplicon complexes are detected as trapped
aggregates excluded from the fibrous matrix. Other solids are
interferences in the assay. In a second variant of the lateral flow
format, the avidin conjugates are wicked into a membrane and
migrate until encountering a detection strip coated with a capture
agent. Accumulation of dyed particles at the detection strip is
detected. The assays are generally dependent on flow rate in the
materials, particle size and pore dimensions as well as laminar
barriers to diffusion.
[0014] In Lateral Flow Assays, it is well known that capillary flow
rate and adequate contact between the analyte and its corresponding
capture antibody immobilized within the membrane are critical to
the assay sensitivity. This demands careful membrane selection to
optimize dwell time and flow rates. Contact between capture
antibody and target analyte again involves convective and
diffusional barriers to endpoint detection. These and other
limitations of lateral flow assays are discussed in co-assigned US
Patent Application 2007/0042427, "Microfluidic Laminar Flow
Detection Strip", herein incorporated in full by reference.
[0015] It is not uncommon that magnetic beads are used to
concentrate bioanalytes before or during assay (see for example US
2003/0032028). Beads have several advantages over arrays because
beads have a higher specific surface area, move through the liquid
sample matrix, and hence have more encounters per unit time with an
assay target than the corresponding array. Conceptually, use of
magnetic microspheres is generally regarded as a concentration
step, substituting for centrifugation or filtration.
[0016] Magnetic microbeads are also commonly used to position and
contact analytes with reagents or solid substrates, as for example
described in U.S. Pat. No. 5,660,990, U.S. Pat. No. 5,707,807, U.S.
Pat. No. 6,815,160, 2002/0086443, 2002/0192676, 2003/0215825,
2004/0018611, 2004/01211364, 2005/0142582, and cumulative related
citations representative of the prior art, all of which are
incorporated here in full by reference. These examples show the
breadth of the applications for microbeads. In US 2006/0292588,
where magnetic control circuitry for bead washing is provided in an
assay apparatus, time to assay endpoint is again the critical
factor (FIG. 1 of US 2006/0292588, showing 5 hr to endpoint).
[0017] Magnetic beads have proven remarkably amenable to surface
chemistry, and are routinely derivatized as assay reagents. Such
chemistries include functional groups selected from carboxylate,
amine, amide, hydrazide, anhydride, hydroxyl, sulfhydryl,
chloromethyl, aldehyde, glycidyl (epoxy), and others. A broad range
of applications exists.
[0018] In adapting microbeads to a microfluidics assay format, the
problem of laminar convective and diffusional boundaries again must
be overcome to optimize sensitivity and time to endpoint.
[0019] Accordingly, there remains a need for a generally applicable
improvement in the sensitivity and speed of endpoint detection in
nucleic acid and immunological bioassays.
[0020] Co-assigned patents and patent applications relevant to the
development methods for nucleic acid and antibody bioassays in a
microfluidic assay format include U.S. Pat. No. 6,743,399
("Pumpless Microfluidics"), U.S. Pat. No. 6,488,896 ("Microfluidic
Analysis Cartridge"), US Patent Applications 2005/0106066
("Microfluidic Devices for Fluid Manipulation and Analysis"),
2002/0160518 ("Microfluidic Sedimentation"), 2003/0124619
("Microscale Diffusion Immunoassay"), 2003/0175990 ("Microfluidic
Channel Network Device"), 2005/0013732 ("Method and system for
Microfluidic Manipulation, Amplification and Analysis of Fluids,
For example, Bacteria Assays and Antiglobulin Testing"), US Patent
Application 2007/0042427, "Microfluidic Laminar Flow Detection
Strip", and unpublished documents "Microfluidic Cell Capture and
Mixing Circuit", "Polymer Compositions and Hydrogels",
"Microfluidic Mixing and Analytical Apparatus," "System and method
for diagnosis of infectious diseases", and "Microscale Diffusion
Immunoassay Utilizing Multivalent Reactants", all of which are
hereby incorporated in full by reference.
BRIEF SUMMARY OF THE INVENTION
[0021] Surprisingly, ligand-tagged paramagnetic microbeads are
readily extracted from a moving magnetic field by formation of
molecular tethers with solid phase substrates coated with affinity
ligand-binding molecules.
[0022] At odds with this finding, the prior art has taught that
such molecular tethers are easily broken and that stationary
magnetic fields are needed to keep paramagnetic beads immobilized
during washing and separation of bound and unbound beads. Relevant
to affinity capture, US 2004/0226348, hereby incorporated in full
by reference, states for example, with respect to paramagnetic
microbeads, "A major concern with the bead assay is the amount of
force that a few covalent bonds has to hold a bead to the detection
surface" (para 0007), indicating that the strength of a covalent
bond is relatively weak. The disclosure continues, "Electromagnets
can be controlled to exert a precise amount of force. This is
critical in the stage of washing in an assay, where beads attached
to a bottom testing surface are separated from beads that are
unattached. During this stage, the precision in the amount of force
applied to the beads is critical because the difference in force
between moving an unattached bead and one that is tethered (i.e.,
attached) with a few covalent bonds (or biotin/avidin or DNA
hybridization) may be extremely slight. Care must be taken to
ensure that unattached beads are the only ones moved and the
tethered beads remain attached to an intended surface" (para 0033).
It was taught that, "The use of electromagnets eliminates the need
to design precise flow mechanisms to keep beads in place" (para
0009). Similar teachings are reported in US 2004/0005718, where is
stated, "Since magnetic beads to which probe DNA is attached are
fixed to the substrate by being attracted by a magnetic force, the
magnetic beads can be fixed to the substrate by a stronger force
than the conventional bonding of probe DNA with the substrate"
(para 0037), again teaching that a magnetic force is stronger than
a molecular binding force.
[0023] It was thus unexpected that tagged paramagnetic beads can be
affinity extracted from a moving magnetic field, not simply
directed to or retained on a test pad by a stationary magnetic
field. We found that a detectable endpoint for a bioassay can thus
be achieved in one simple step wherein first a population of
ligand-tagged paramagnetic microbeads is captured on an
affinity-binding test pad as a magnetic field moves the bead
complexes across the test pad, and second, as the magnetic field
moves away, affinity tagged paramagnetic beads remain bound, but
unbound paramagnetic beads are separated and pulled away to
waste.
[0024] In the preferred method, the magnetic force field has both a
perpendicular force vector and a lateral force vector. The
paramagnetic beads are attracted to a surface or substrate by a
magnetic force field emanating from the opposite side of the
surface, and as the magnetic field moves laterally, the
paramagnetic beads are dragged across the test pad while following
the magnetic flux laterally. Tagged magnetic beads so readily
adhere to the test pad in this way that visual detection endpoints
may be used. Although a visual endpoint is preferable for its
simplicity, the invention is not to be construed as limited to
such.
[0025] We also show how this improvement in rapidity of the
detection step can be integrated into various classes of assays for
nucleic acids, direct and indirect assays for immunoactive targets,
and other bioassays. Current detection time from sample
introduction to detection is about 5 min, including filtration,
extraction, and amplification.
While microfluidic devices are used in the embodiments of the
examples reduced to practice herein, the invention again should not
be construed as limited to such.
[0026] The method comprises the steps of:
[0027] a) Immobilizing an affinity capture agent within an area on
a substrate within a fluid path, said fluid path with axis of flow,
thereby forming a test pad area;
[0028] b) Binding a bioassay target molecule to a paramagnetic
microbead reagent in a fluid and contacting the fluid with the
substrate within said fluid path;
[0029] c) Sweeping the paramagnetic microbead reagent in the fluid
into close contact with the affinity capture agent by moving a
magnetic force field on a plane parallel to the axis of flow from
outside to inside the test pad area, and thereby affinity capturing
any bioassay target molecule bound to the paramagnetic bead reagent
from said magnetic force field in the form of a molecular detection
complex; and upon forming said molecular detection complex, then
sweeping from the test pad area any paramagnetic microbead reagent
in the fluid not formed as molecular detection complex by moving
the magnetic force field on a plane parallel to the axis of flow
from inside to outside the test pad area; and,
[0030] d) Detecting said molecular detection complex in the test
pad area.
[0031] In another aspect of the invention, we also show that
peptidyl-conjugates to the 5' tail of amplification primer sets are
generally applicable in polymerase-dependent amplification
protocols and are further robust, surprisingly retaining full
antigenicity and binding integrity following amplification. We show
that an immobilized antibody, for example a monoclonal antibody,
specific to a peptide-conjugated amplication primer will capture
the products of amplification tagged with the primer. By using a
second primer tagged with a second affinity ligand, rapid methods
for forming target specific detection complexes are readily
designed. Peptidyl-conjugated oligonucleotides have not previously
been used as primers in PCR amplification, or in other
amplification protocols, or used as means for tagging and
discriminating mixed PCR products in multiplex target detection
protocols. These detection complexes thus serve essentially as
means for interrogating a peptidyl-primer amplicon library.
Unexpectedly, this method has more breadth than prior art methods
of tagging primers, which are limited to a few species of binding
pairs, permitting simultaneous separation and detection of an
essentially infinite number of amplicons by the step of tagging
each amplicon with a unique peptide hapten (herein "peptidyl
hapten") and employing the corresponding antibody to capture and
immobilize it. The magnetic bead assay methods illustrated here are
one embodiment of this discovery.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0032] FIGS. 1-4 depict affinity-immobilized paramagnetic target
molecule binding complexes as detection complexes. Shown are four
"sandwich" detection complexes involving a paramagnetic target
molecule binding complex and a test pad.
[0033] FIG. 5 is a pictograph describing (in panel 5A) the use of a
vectored moving magnetic field to sweep paramagnetic two-tailed
amplicon complexes across and over two test pads while magnetically
contacting them with two species of capture antibodies immobilized
on the test pads, and (in panel 5B) the resultant
immuno-immobilized complexes on the test pad bearing an antibody
specific to the paramagnetic target molecule complexes.
[0034] FIG. 6 is a pictograph describing (in panel 6A) the use of a
vectored moving magnetic field to sweep paramagnetic
antigen:antibody complexes across and over a test pad while
magnetically contacting them with capture antigen immobilized on
the test pad, and (in panel 6B) the resultant immuno-immobilized
complexes on the test pad.
[0035] FIG. 7 is a pictograph describing (in panel 7A) the use of a
vectored moving magnetic field to sweep paramagnetic target
antibody:antigen complexes across and over a test pad while
magnetically contacting them with capture anti-antibodies
immobilized on the test pad, and (in panel 7B) the resultant
immuno-immobilized complexes on the test pad.
[0036] FIG. 8 is a pictograph describing (in panel 8A) the use of a
vectored moving magnetic field to sweep paramagnetic target
antibody:target antigen complexes across and over a test pad while
magnetically contacting them with capture antibodies immobilized on
the test pad, and (in panel 8B) the resultant immuno-immobilized
complexes on the test pad.
[0037] FIG. 9 is a sketch showing the use of the method in a
microfluidic detection chamber for a multiplex assay. The magnetic
field can be used to sweep the paramagnetic target molecule
complexes across and over multiple test pads, or to scrub the test
pads back and forth with the complexes in order to form
affinity-immobilized complexes.
[0038] FIG. 10 is a conceptual schematic of test pads and test pad
arrays as may be useful in the method.
[0039] FIG. 11 is a flow chart depicting steps of a method for
detection of affinity-immobilized amplicons.
[0040] FIG. 12 is a flow chart depicting steps of a method for
detection of affinity-immobilized target antibody:antibody
complexes with antigen.
[0041] FIG. 13 is a flow chart depicting steps of a method for
detection of affinity-immobilized target antibody:antigen complexes
with anti-antibody.
[0042] FIG. 14 is a flow chart depicting steps of a method for
detection of affinity-immobilized target antigen:antibody complexes
with complementary antibody.
[0043] FIG. 15 is a reproduction of a photograph of parallel
detection chambers in a microfluidic card treated by the inventive
method.
[0044] FIG. 16 pictographically depicts an affinity-immobilized
molecular detection complex with complex paramagnetic microbead
tethered to a solid phase by a two-tailed amplicon complex.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The following definitions are provided as an aid in
interpreting the claims and specification herein. Where works are
cited by reference, and definitions contained therein are
inconsistent in part or in whole with those supplied here, the
definition used therein may supplement but shall not supersede or
amend the definition provided herein.
1. DEFINITIONS
[0046] Test samples: Representative biosamples include, for
example: blood, serum, plasma, buffy coat, saliva, wound exudates,
pus, lung and other respiratory aspirates, nasal aspirates and
washes, sinus drainage, bronchial lavage fluids, sputum, medial and
inner ear aspirates, cyst aspirates, cerebral spinal fluid, stool,
diarrhoeal fluid, urine, tears, mammary secretions, ovarian
contents, ascites fluid, mucous, gastric fluid, gastrointestinal
contents, urethral discharge, synovial fluid, peritoneal fluid,
meconium, vaginal fluid or discharge, amniotic fluid, semen, penile
discharge, or the like may be tested. Assay from swabs or lavages
representative of mucosal secretions and epithelia are acceptable,
for example mucosal swabs of the throat, tonsils, gingival, nasal
passages, vagina, urethra, rectum, lower colon, and eyes, as are
homogenates, lysates and digests of tissue specimens of all sorts.
Mammalian cells are acceptable samples. Besides physiological
fluids, samples of water, industrial discharges, food products,
milk, air filtrates, and so forth are also test specimens. In some
embodiments, test samples are placed directly in the device; in
other embodiments, pre-analytical processing is contemplated.
[0047] Bioassay Target Molecule: or "analyte of interest", or
"target molecule", may include a nucleic acid, a protein, an
antigen, an antibody, a carbohydrate, a cell component, a lipid, a
receptor ligand, a small molecule such as a drug, and so forth.
Target nucleic acids include genes, portions of genes, regulatory
sequences of genes, mRNAs, rRNAs, tRNAs, siRNAs, cDNA and may be
single stranded, double stranded or triple stranded. Some nucleic
acid targets have polymorphisms, deletions and alternate splice
sequences. Multiple target domains may exist in a single molecule,
for example an immunogen may include multiple antigenic
determinants. An antibody includes variable regions, constant
regions, and the Fc region, which is of value in immobilizing
antibodies.
[0048] Pathogen: an organism associated with an infection or
infectious disease.
[0049] Pathogenic condition: a condition of a mammalian host
characterized by the absence of health, i.e., a disease, infirmity,
morbidity, or a genetic trait associated with potential
morbidity.
[0050] "Target nucleic acid sequence" or "template": As used
herein, the term "target" refers to a nucleic acid sequence in a
biosample that is to be amplified in the assay by a polymerase and
detected. The "target" molecule can be present as a "spike" or as
an uncharacterized analyte in a sample, and may consist of DNA,
cDNA, gDNA, RNA, mRNA, rRNA, or miRNA, either synthetic or native
to an organism. The "organism" is not limited to a mammal. The
target nucleic acid sequence is a template for synthesis of a
complementary sequence during amplification. Genomic target
sequences are denoted by a listing of the order of the bases,
listed by convention from 5' end to 3' end.
[0051] Reporter, "Label" or "Tag" refers to a biomolecule or
modification of a biomolecule that can be detected by physical,
chemical, electromagnetic and other related analytical techniques.
Examples of detectable reporters include, but are not limited to,
radioisotopes, fluorophores, chromophores, mass labels, electron
dense particles, magnetic particles, dyed particles, spin labels,
molecules that emit chemiluminescence, electrochemically active
molecules, enzymes, cofactors, enzymes linked to nucleic acid
probes, and enzyme substrates. Reporters are used in bioassays as
reagents, and are often covalently attached to another molecule,
adsorbed on a solid phase, or bound by specific affinity
binding.
[0052] Ligand: any molecule for which there exists another molecule
(i.e., an "antiligand" or ligand binding molecule) that binds with
specific affinity to the ligand with stereochemical recognition or
"fit" of some portion of the ligand by the ligand binding molecule.
Forces between ligand and binding molecule are typically Van der
Waals, hydrogen bond, hydrophobic bond, and electrostatic bond.
Ligand binding is not typically covalent and is thus distinguished
from "crosslinked" and "derivatized". As used herein, the term
"ligand" is reserved for binding moieties that are not "Peptidyl
haptens".
[0053] Peptidyl hapten: Refers to a subclass of haptens that is a
peptide fragment. As used herein, peptidyl haptens, or "peptide
haptens" are used with their complementary antibody to the peptide
fragment as a means for capturing two-tailed amplicons on a solid
phase.
[0054] Haptens are "molecular keys" in the Kekulean sense, that
when bound to an immunogenic carrier and introduced into a
vertebrate, will elicit formation of antibodies specific for the
hapten or epitope. These molecular keys have stereochemical
specificity, are generally exposed on the surface of the carrier,
and are of lower molecular weight than the carrier. Illustrative
examples include small-molecule derivatives of native proteins, RNA
loop-stem structures, a drug or steroid such as digoxigenin, the
carbohydrate side-chains that decorate a mucopeptide, and short
chain peptides or helices of non-native proteins such as diphtheria
toxin or toxoid. Even a dipeptide or a lipid, when conjugated on a
suitable immunogenic carrier, can produce an antibody response, and
affinity-captured antibody specific to the dipeptide or lipid
itself, not the immunogen, can be produced by absorbing out the
non-specific antibodies in an antiserum or by preparing a
monoclonal antibody by lymphocyte selection. Although a hapten is
not immunogenic of itself, it has very finely directed
immunospecificity and is recognized by a very limited set of
complementary antibodies.
[0055] As used herein, short chain peptides are a preferred hapten
for tagging amplicons as used to create peptidyl-amplicon libraries
because of their robust chemistry, compatibility with enzymes as
primer labels, and essentially infinite immunospecificity.
[0056] Capture agent: or "affinity capture agent" is a generic term
for a complementary partner in an affinity binding pair and is
generally used to capture a ligand or hapten by binding it to a
solid phase. Affinity binding pairs include streptavidin:biotin,
antibody:antigen, hapten:antibody, peptidyl hapten:antibody, and
antigen:antibody, for example, and either member of the affinity
binding pair may be the capture agent.
[0057] Test pad area--or test strip, or test field, or simply "test
pad", as used herein, is an area or zone occupied by an affinity
capture agent. The area is 3-dimensional at a nanomolecular level
and is generally formed on the surface of a substrate in a liquid
flow path. The test pad is generally the site in the assay where
the assay endpoint is observed or measured, and as such may be
housed in a detection chamber with optical window.
[0058] Heterogeneous capture or immobilization: refers use of
affinity binding pairs to concentrate an analyte or detection
complex on a solid phase surface, particle, or porous adsorbent
material, generally so that the analyte can be detected,
concentrated or purified. Heterogeneous or solid phase capture may
be achieved with capture agents such as immobilized antigen,
antibody, avidin, nickel-NTA, lectin, or other ligand/receptor
systems. As referred to herein, the molecular complex formed by
heterogeneous capture is the "immobilized reporter complex" and may
be the detection complex of a heterogeneous binding assay. Such
complexes are stabilized by non-covalent and cooperative
binding.
[0059] Amplification: As used here, the term "amplification" refers
to a "template-dependent process" that results in an increase in
the concentration of a nucleic acid sequence relative to its
initial concentration. A "template-dependent process" is a process
that involves "template-dependent extension" of a "primer"
molecule. A "primer" molecule refers to a sequence of a nucleic
acid that is complementary to a known portion of the target
sequence. A "template dependent extension" refers to nucleic acid
synthesis of RNA or DNA wherein the sequence of the newly
synthesized strand of nucleic acid is dictated by the rules of
complementary base pairing of the target nucleic acid and the
primers.
[0060] Amplicon refers to a double stranded DNA product of a prior
art amplification means, and includes double stranded DNA products
formed from DNA and RNA templates.
[0061] Two-tailed Amplicon refers to a double stranded DNA product
of a prior art amplification means in which tagged primer pairs are
covalently incorporated, a first primer conjugated with one
affinity tag, a second primer conjugated with a second affinity
tag, the two tags being different. As used herein, the two-tailed
amplicon functions as a "hetero-bifunctional" tether, and links a
magnetic bead to a solid substrate.
[0062] Primer: as used herein, is a single-stranded polynucleotide
or polynucleotide conjugate capable of acting as a point of
initiation for template-directed DNA synthesis in the presence of a
suitable polymerase and cofactors. Primers are generally at least 7
nucleotides long and, more typically range from 10 to 30
nucleotides in length, or longer. The term "primer pair" refers to
a set of primers including a 5' "forward" or "upstream" primer that
hybridizes with the complement of the 5' end of the DNA template to
be amplified and a 3' "reverse" or "downstream" primer that
hybridizes with the 3' end of the sequence to be amplified. Note
that both primers have 5' and 3' ends and that primer extension
always occurs in the direction of 5' to 3'. Therefore, chemical
conjugation at or near the 5' end does not block primer extension
by a suitable polymerase. Primers may be referred to as "first
primer" and "second primer", indicating a primer pair in which the
identity of the "forward" and "reverse" primers is interchangeable.
Additional primers may be used in nested amplification.
[0063] In the preferred embodiment, the first primer is a
monospecific or class-specific oligonucleotide conjugated to a
peptide hapten or epitope recognized by a specific antibody. And
the second "primer" is an oligonucleotide conjugated to a hapten,
to a biotin, a digoxin, a steroid, a polysaccharide, an antigen or
fragment thereof, a folic acid, a phycoerythrin dye, a fluorophore,
to an Fc fragment of an antibody, to a nickel chelator such as NTA,
or to a lectin, 2,4-dinitrophenyl, and so forth, at or near the 5'
terminus.
[0064] Complementary (with respect to nucleic acids) refers to two
single-stranded nucleic acid sequences that can hybridize to form a
double helix. The matching of base pairs in the double helix of two
complementary strands is not necessarily absolute. Selectivity of
hybridization is a function of temperature of annealing, salt
concentration, and solvent, and will generally occur under low
stringency when there is as little as 55% identity over a stretch
of at least 14-25 nucleotides. Stringency can be increased by
methods well known in the art. See M. Kanehisa, Nucleic Acids Res.
12:203 (1984). Regarding hybridization of primers, a primer that is
"perfectly complementary" has a sequence fully complementary across
the entire length of the primer and has no mismatches. A "mismatch"
refers to a site at which the base in the primer and the base in
the target nucleic acid with which it is aligned are not
complementary.
[0065] Complementary (with respect to immunobinding) refers to
antibody:immunogen or antibody:hapten binding that is
immunospecific.
[0066] Magnetic Microbead: refers to a "nanoparticle", "bead", or
"microsphere", or by other terms as known in the art, having at
least one dimension, such as apparent diameter or circumference, in
the micron or nanometer range. An upper range of such dimensions is
600 um, but typically apparent diameter is under 200 nm, and may be
1-50 um or 5-20 nm, while not limited to such. Such particles may
be composed of, contain cores of, or contain granular domains of, a
paramagnetic or superparamagnetic material, such as the
Fe.sub.2O.sub.3 and Fe.sub.3O.sub.4 (.alpha.-Fe crystal
type),.alpha.'-FeCo, .epsilon.-Cobalt, CoPt, CrPt.sub.3,
SmCo.sub.5, Nickel and nickel alloys, Cu.sub.2MnAl, .alpha.-FeZr,
Nd.sub.2Fe.sub.14B, NoTi, for example. Preferred are the Ferrites,
defined as ferrimagnetic or ceramic compound materials consisting
of various mixtures of iron oxides such as Hematite
(Fe.sub.2O.sub.3) or Magnetite (Fe.sub.3O.sub.4) and iron oxides in
alloys with other metals. These materials as used generally are
particles having dimensions smaller than a magnetic domain, and may
be formed into particles, beads or microspheres with binders such
as latex polymers (generically), silica, as is generally well known
and inclusive of such materials as are commercially available.
[0067] Particularly preferred are nanoparticles of Fe.sub.3O.sub.4
with diameters in the 50 nm-100 um range as are commercially
available for magnetic bioseparations. These particles are
"superparamagnetic", meaning that they are attracted to a magnetic
field but retain no residual magnetism after the field is removed.
Therefore, suspended superparamagnetic particles tagged to the
biomaterial of interest can be removed from a matrix using a
magnetic field, but they do not agglomerate (i.e., they stay
suspended) after removal of the field. Also of interest are nickel
and cobalt microbeads. These beads may be reactive with peptides
containing histidine.
[0068] Paramagnetic beads have the property that they align
themselves along magnetic flux lines and are attracted from areas
of lower magnetic flux density to areas of higher magnetic flux
density.
[0069] It should be recognized that magnetic microbeads may be
composite materials. Such beads may further contain other micro- or
nanoparticles agglomerated with a binder. Composites with RF-tags,
QDots, up-converting fluorophores, colloid sols and clays, and the
like are contemplated for use in the present invention. A magnetic
bead need not be formed entirely of a magnetic material, but may
instead comprise both magnetic and non-magnetic materials.
[0070] Microbeads may themselves be colloidal and have chromogenic
properties, or may be combined with other colloidal metal particles
with chromogenic properties. Mixed suspensions of differently
modified microbeads may be used.
[0071] Microbeads are by no means simply commodities. They may be
modified with surface active agents such as detergents to control
their rheological properties, as in ferrofluids. The surface of
microbeads may be modified by adsorption or covalent attachment of
bioactive molecules, including immunoaffinity agents, antibodies,
enzymes, dyes, fluorescent dyes, fluorescent quenchers, oligomers,
peptide nucleomers, and the like, and more specifically by coating
with streptavidin or single stranded DNA oligomers, for example.
These and other cumulative prior art skills are incorporated herein
in full without full recitation of their scope, as a full
recitation is unnecessary to understand the principles of the
current invention except insofar as to recognize that the
microbeads of interest herein are comprised of at least one
paramagnetic element therein, as would be readily recognized by
those skilled in the prior arts.
[0072] Suitable matrices for microbeads include polystyrene,
divinylbenzene, polyvinyltoluene, polyester, polyurethane, with
optional functional groups selected from SO3, COOH, NH2, Glycidyl
(COC), OH, Cl, Tosyl, aldehyde, and sulfhydryl. Particles often
range from 0.3 to 5 um or larger. Latex particles of 100 nm, and 1,
5, 20, 50 or 100 um are commercially available in bulk. Silica may
be used as a matrix or as a capsule. Derivatized silane includes
OH, NH2, COOH and more. Particles often range from 0.5 to 3 um.
Dextran may also be used as a matrix. Particles often range from
20-50 nm. Polysaccharide may also be used with silane as silica
fortified microbeads of particle size around 250 nm. Agarose and
cellulose matrices include particles in the range of 1-10 um, and
may be activated for introduction of functional groups. Protein
particles, such as of gelatin and albumin, have long been used for
magnetic microspheres. These are readily activated for amine,
carboxyl, hydroxyl and sulfhydryl linkages with ligands or tags.
Liposomes are somewhat more refractory to chemical derivatization,
but have been used to make magnetic particles. Naked iron oxide,
and other paramagnetic metal particles are also known, and may be
derivatized by adding sulfhydryl groups or chelators. These
particles often have sizes of 5 to 300 nm. Certain types of
particle populations are known to be uniform in size; in others the
heterogeneity may be controlled or selected.
[0073] Such microbeads may be readily prepared. For example,
carboxyl-modified microbeads containing .about.20-60% magnetite are
made by dispersing a (magnetite)/styrene/divinylbenzene ferrofluid
mixture in water, and emulsion-polymerizing the monomers to trap
the magnetite in a polymer matrix of microbeads of .about.1 .mu.m
diameter. The magnetite is thus dispersed throughout the solid
beads. Other prior art means for synthesizing and modifying
microbeads are commonly known.
[0074] Suitable microbeads for practicing the present invention may
also be purchased from vendors such as Bang's Laboratories, Inc.
(Fishers Ind.) and Polysciences, Inc (Warrington Pa.), as well as
numerous suppliers of specialty modified microbeads such as
Bioscience Beads (West Warwick R.I.). Tradenames of such beads,
again not as a comprehensive recitation, include Estapor.RTM.
SuperParaMagnetic Microspheres, COMPEL.TM. Uniform Magnetic
Microspheres, Dynabeads.RTM. V MyOne.TM. Microspheres, and the
like. Cobalt paramagnetic microbeads are sold as Dynabead's MyOne
TALON. BioMag Plus microbeads from Polysciences have an irregular
shape, and thus more surface area for affinity chemistry.
[0075] Populations--of microbeads are generally used to assay
populations of assay targets. A population as used herein refers to
a set of members sharing some common element or property. For
example, a population of beads may be similar in that the beads
share a common tag, such as an avidin coat, or a barcode. A
population of nucleic acids comprising an assay target may simply
share a target nucleic acid sequence, or may contain a common tag.
A population of antibodies may share a common specificity. And so
forth.
[0076] Paramagnetic and Superparamagnetic are taken as functionally
synonymous for the present purposes. These materials when
fabricated as microbeads, have the property of responding to an
external magnetic field when present, but dissipating any residual
magnetism immediately upon release of the external magnetic field,
and are thus easily resuspended and remain monodisperse, but when
placed in proximity to a magnetic field, clump tightly, the process
being fully reversible by simply removing the magnetic field.
[0077] Magnetic Force Field: is the volume defined by the magnetic
flux lines between two poles of a magnet or two faces of a coil.
Electromagnets and driving circuitry can be used to generate
magnetic fields and localized magnetic fields. Permanent magnets
may also be used. Preferred permanent magnetic materials include
NdFeB (Neodymium-Iron-Boron Nd.sub.2Fe.sub.14B), Ferrite (Strontium
or Barium Ferrite), AlNiCo (Aluminum-Nickel-Cobalt), and SmCo
(Samarium Cobalt). The magnetic forces within a magnetic force
field follow the lines of magnetic flux. Magnetic forces are
strongest where magnetic flux is most dense. Magnetic force fields
penetrate most solids and liquids. A moving magnetic force field
has two vectors: one in the direction of travel of the field and
the other in the direction of the lines of magnetic flux.
[0078] Localized Magnetic Field: As used herein, a localized
magnetic field is a magnetic field that substantially exists in the
volume between the poles of two magnets, and may be attractive or
repulsive.
[0079] Robustness: refers to the relative tolerance of an assay
format to variability in execution, to materials substitutions, and
to interferences, over a range of assay conditions. Robustness
generally increases with the strength of the detection signal
generated by a positive result. Robustness negatively correlates
with the difficulty and complexity of the assay.
[0080] Specificity: Refers to the ability of an assay to reliably
differentiate a true positive signal of the target biomarker from
any background, erroneous or interfering signals.
[0081] Sensitivity: Refers to the lower limit of detection of an
assay where a negative can no longer be reliably distinguished from
a positive.
[0082] Assay endpoint: "Endpoint" or "datapoint" is used here as
shorthand for a "result" from either qualitative or quantitative
assays, and may refer to both stable endpoints where a constant
plateau or level of reactant is attained, and to rate reactions,
where the rate of appearance or disappearance of a reactant or
product as a function of time (i.e., the slope) is the datapoint.
Detection of a "molecular detection complex", also termed an
"immobilized reporter complex", may constitute an assay
endpoint.
[0083] Microfluidic cartridge: a "device", "card", or "chip" with
fluidic structures and internal channels having microfluidic
dimensions. These fluidic structures may include chambers, valves,
vents, vias, pumps, inlets, nipples, and detection means, for
example. Generally, microfluidic channels are fluid passages having
at least one internal cross-sectional dimension that is less than
about 500 .mu.m and typically between about 0.1 .mu.m and about 500
.mu.m, but we extend the upper limit of the range to 600 um because
the macroscopic character of the bead suspensions used here have a
dramatic effect on the microfluidic flow regime, particularly as it
relates to restrictions in the fluid path. Therefore, as defined
herein, microfluidic channels are fluid passages having at least
one internal cross-sectional dimension that is less than 600 um.
The microfluidic flow regime is characterized by Poiseuille or
"laminar" flow. The particle volume fraction (.phi.) and ratio of
channel diameter to particle diameter (D/d) has a measurable effect
on flow characteristics. (See for example, Staben M E et al. 2005.
Particle transport in Poiseuille flow in narrow channels. Intl J
Multiphase Flow 31:529-47, and references cited therein.)
[0084] Microfluidic cartridges may be fabricated from various
materials using techniques such as laser stenciling, embossing,
stamping, injection molding, masking, etching, and
three-dimensional soft lithography. Laminated microfluidic
cartridges are further fabricated with adhesive interlayers or by
thermal adhesiveless bonding techniques, such by pressure treatment
of oriented polypropylene. The microarchitecture of laminated and
molded microfluidic cartridges can differ.
[0085] Lateral flow Assay: refers to a class of conventional assays
wherein particle aggregation, agglutination or binding is detected
by applying a particle-containing fluid to a fibrous layer such as
a permeable membrane and observing the chromatographic properties
as the particles and particle aggregates move into and through the
material. Penetration of clumps of particles is impeded, whereas
free particles penetrate between the fibers. Similarly, free
particles may accumulate as clumps in zones of the fibrous layer
treated with affinity binding agents. The devices and methods
described here are not lateral flow assays.
[0086] "Conventional" is a term designating that which is known in
the prior art to which this invention relates.
[0087] "About" and "generally" are broadening expressions of
inexactitude, describing a condition of being "more or less",
"approximately", or "almost" in the sense of "just about", where
variation would be insignificant, obvious, or of equivalent utility
or function, and further indicating the existence of obvious minor
exceptions to a norm, rule or limit.
[0088] Herein, where a "means for a function" is described, it
should be understood that the scope of the invention is not limited
to the mode or modes illustrated in the drawings alone, but also
encompasses all means for performing the function that are
described in this specification, and all other means commonly known
in the art at the time of filing. A "prior art means" encompasses
all means for performing the function as are known to one skilled
in the art at the time of filing, including the cumulative
knowledge in the art cited herein by reference to a few
examples.
[0089] Means for extracting: refers to various cited elements of a
device, such as a solid substrate, filter, filter plug, bead bed,
frit, or column, for capturing target nucleic acids from a
biological sample, and includes the cumulative knowledge in the art
cited herein by reference to a few examples.
[0090] A means for polymerizing, for example, may refer to various
species of molecular machinery described as polymerases and their
cofactors and substrates, for example reverse transcriptases and
TAQ polymerase, and includes the cumulative knowledge of enzymology
cited herein by reference to a few examples.
[0091] Means for Amplifying: Include thermocycling and isothermal
means. The first thermocycling technique was the polymerase chain
reaction (referred to as PCR) which is described in detail in U.S.
Pat. Nos. 4,683,195, 4,683,202 and 4,800,159, Ausubel et al.
Current Protocols in Molecular Biology, John Wiley and Sons,
Baltimore, Md. (1989), and in Innis et al., ("PCR Protocols",
Academic Press, Inc., San Diego Calif., 1990). Polymerase chain
reaction methodologies are well known in the art. Briefly, in PCR,
two primer sequences are prepared that are complementary to regions
on opposite complementary strands of a target sequence. An excess
of deoxynucleoside triphosphates are added to a reaction mixture
along with a DNA polymerase, e.g., Taq polymerase. If the target
sequence is present in a sample, the primers will bind to the
target and the polymerase will cause the primers to be extended
along the marker sequence by adding on nucleotides. By raising and
lowering the temperature of the reaction mixture, the extended
primers will dissociate from the template to form reaction
products, excess primers will bind to the template and to the
reaction products and the process is repeated. By adding
fluorescent intercalating agents, PCR products can be detected in
real time.
[0092] One isothermal technique is LAMP (loop-mediated isothermal
amplification of DNA) and is described in Notomi, T. et al. Nucl
Acid Res 2000 28:e63.
[0093] Strand Displacement Amplification (SDA) is another method of
carrying out isothermal amplification of nucleic acids which
involves multiple rounds of strand displacement and synthesis,
i.e., nick translation (Walker et al. Nucleic Acids Research,
1992:1691-1696). A similar method, called Repair Chain Reaction
(RCR), involves annealing several probes throughout a region
targeted for amplification, followed by a repair reaction in which
only two of the four bases are present. The other two bases can be
added as biotinylated derivatives for easy detection. A similar
approach is used in SDA. Target specific sequences can also be
detected using a cyclic probe reaction (CPR). In CPR, a probe
having 3' and 5' sequences of non-specific DNA and a middle
sequence of specific RNA is hybridised to DNA that is present in a
sample. Upon hybridisation, the reaction is treated with RNase H,
and the products of the probe identified as distinctive products
that are released after digestion. The original template is
annealed to another cycling probe and the reaction is repeated.
[0094] Another nucleic acid amplification technique is reverse
transcription polymerase chain reaction (RT-PCR). First,
complementary DNA (cDNA) is made from an RNA template, using a
reverse transcriptase enzyme, and then PCR is performed on the
resultant cDNA.
[0095] Another method for amplification is the ligase chain
reaction ("LCR"), disclosed in EPO No. 320 308. In LCR, two
complementary probe pairs are prepared, and in the presence of the
target sequence, each pair will bind to opposite complementary
strands of the target such that they abut. In the presence of a
ligase, the two probe pairs will link to form a single unit. By
temperature cycling, as in PCR, bound ligated units dissociate from
the target and then serve as "target sequences" for ligation of
excess probe pairs. U.S. Pat. No. 4,883,750 describes a method
similar to LCR for binding probe pairs to a target sequence.
[0096] Q.beta. Replicase, may also be used as still another
amplification method in the present invention. In this method, a
replicative sequence of RNA that has a region complementary to that
of a target is added to a sample in the presence of an RNA
polymerase. The polymerase will copy the replicative sequence that
can then be detected.
[0097] Still further amplification methods, described in GB
Application No. 2 202 328, and in PCT Application No.
PCT/US89/01025, may be used in accordance with the present
invention. In the former application, "modified" primers are used
in a PCR-like, template- and enzyme-dependent synthesis. The
primers may be modified by labelling with a capture moiety (e.g.,
biotin) and/or a detector moiety (e.g., enzyme). In the latter
application, an excess of labelled probes are added to a sample. In
the presence of the target sequence, the probe binds and is cleaved
catalytically. After cleavage, the target sequence is released
intact to be bound by excess probe. Cleavage of the labelled probe
signals the presence of the target sequence.
[0098] Other nucleic acid amplification procedures include
transcription-based amplification systems (TAS), including nucleic
acid sequence based amplification (NASBA) and 3SR (Kwoh et al.,
1989, Proc. Natl. Acad. Sci. U.S.A., 86: 1173; Gingeras et al., PCT
Application WO 88/10315). In NASBA, the nucleic acids can be
prepared for amplification by standard phenol/chloroform
extraction, heat denaturation of a clinical sample, treatment with
lysis buffer and minispin columns for isolation of DNA and RNA or
guanidinium chloride extraction of RNA. These amplification
techniques involve annealing a primer which has target specific
sequences. Following polymerisation, DNA/RNA hybrids are digested
with RNase H while double stranded DNA molecules are heat denatured
again. In either case the single stranded DNA is made fully double
stranded by addition of second target specific primer, followed by
polymerisation. The double-stranded DNA molecules are then multiply
transcribed by an RNA polymerase such as T7 or SP6. In an
isothermal cyclic reaction, the RNAs are reverse transcribed into
single stranded DNA, which is then converted to double stranded
DNA, and then transcribed once again with an RNA polymerase such as
T7 or SP6. The resulting products, whether truncated or complete,
indicate target specific sequences.
[0099] Davey et al., EPO No. 329 822 disclose a nucleic acid
amplification process involving cyclically synthesising
single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA
(dsDNA), which may be used in accordance with the present
invention. The ssRNA is a template for a first primer
oligonucleotide, which is elongated by reverse transcriptase
(RNA-dependent DNA polymerase). The RNA is then removed from the
resulting DNA:RNA duplex by the action of ribonuclease H(RNase H,
an RNase specific for RNA in duplex with either DNA or RNA). The
resultant ssDNA is a template for a second primer, which also
includes the sequences of an RNA polymerase promoter (exemplified
by T7 RNA polymerase) 5' to its homology to the template. This
primer is then extended by DNA polymerase (exemplified by the large
"Klenow" fragment of E. coli DNA polymerase D, resulting in a
double-stranded DNA ("dsDNA") molecule, having a sequence identical
to that of the original RNA between the primers and having
additionally, at one end, a promoter sequence. This promoter
sequence can be used by the appropriate RNA polymerase to make many
RNA copies of the DNA. These copies can then re-enter the cycle
leading to very swift amplification. With proper choice of enzymes,
this amplification can be done isothermally without addition of
enzymes at each cycle. Because of the cyclical nature of this
process, the starting sequence can be chosen to be in the form of
either DNA or RNA.
[0100] Miller et al. in PCT Application WO 89/06700 disclose a
nucleic acid sequence amplification scheme based on the
hybridisation of a promoter/primer sequence to a target
single-stranded DNA ("ssDNA") followed by transcription of many RNA
copies of the sequence. This scheme is not cyclic, i.e., new
templates are not produced from the resultant RNA transcripts.
Other amplification methods include "RACE" and "one-sided PCR"
(Frohman, M. A., In: "PCR Protocols: A Guide to Methods and
Applications", Academic Press, N.Y., 1990; Ohara et al., 1989,
Proc. Natl. Acad. Sci. U.S.A., 86: 5673-567).
[0101] Methods based on ligation of two (or more) oligonucleotides
in the presence of nucleic acid having the sequence of the
resulting "di-oligonucleotide", thereby amplifying the
di-oligonucleotide, may also be used in the amplification step of
the present invention. Wu et al., (1989, Genomics 4: 560).
[0102] Means for detecting: as used herein, refers to an apparatus
for displaying an endpoint, i.e., the result of an assay, and may
include a detection channel and test pads, and a means for
evaluation of a detection endpoint. Detection endpoints are
evaluated by an observer visually in a test field, or by a machine
equipped with a spectrophotometer, fluorometer, luminometer,
photomultiplier tube, photodiode, nephlometer, photon counter,
voltmeter, ammeter, pH meter, capacitative sensor, radio-frequency
transmitter, magnetoresistometer, or Hall-effect device. Magnetic
particles, beads and microspheres having impregnated color or
having a higher diffraction index may be used to facilitate visual
or machine-enhanced detection of an assay endpoint. Magnifying
lenses in the cover plate, optical filters, colored fluids and
labeling may be used to improve detection and interpretation of
assay results. Means for detection of magnetic particles, beads and
microspheres may also include embedded or coated "labels" or "tags"
such as, but not limited to, dyes such as chromophores and
fluorophores, for example Texas Red; radio frequency tags, plasmon
resonance, spintronic, radiolabel, Raman scattering,
chemoluminescence, or inductive moment as are known in the prior
art. Colloidal particles with unique chromogenic signatures
depending on their self-association are also anticipated to provide
detectable endpoints. QDots, such as CdSe coated with ZnS,
decorated on magnetic beads, or amalgamations of QDots and
paramagnetic Fe.sub.3O.sub.4 microparticles, optionally in a sol
gel microparticulate matrix or prepared in a reverse emulsion, are
a convenient method of improving the sensitivity of an assay of the
present invention, thereby permitting smaller test pads and larger
arrays. Fluorescence quenching detection endpoints are also
anticipated. A variety of substrate and product chromophores
associated with enzyme-linked immunoassays are also well known in
the art and provide a means for amplifying a detection signal so as
to improve the sensitivity of the assay. Detection systems are
optionally qualitative, quantitative or semi-quantitative. Visual
detection is preferred for its simplicity, however detection means
can involve visual detection, machine detection, manual detection
or automated detection.
[0103] Unless the context requires otherwise, throughout the
specification and claims which follow, the word "comprise" and
variations thereof, such as, "comprises" and "comprising" are to be
construed in an open, inclusive sense, that is as "including, but
not limited to".
[0104] Reference throughout this specification to "one embodiment"
or "an embodiment" means that a particular feature, structure or
characteristic described in connection with the embodiment is
included in at least one embodiment of the present invention. Thus,
the appearances of the phrases "in one embodiment" or "in an
embodiment" in various places throughout this specification are not
necessarily all referring to the same embodiment. Furthermore, the
particular features, structures, or characteristics may be combined
in any suitable manner in one or more embodiments.
2. DETAILED DESCRIPTION
[0105] Turning now to the figures, we will begin with the products
of the process--detection complexes--and then describe their method
of production. FIGS. 1 through 4 illustrate examples of amplicon
capture on immobilized antibody, target antibody capture on
immobilized antigen, target antibody capture on immobilized capture
agent, and target antigen capture on immobilized antibody,
respectively.
[0106] The detection complex of FIG. 1 depicts a paramagnetic bead
1 immobilized on test pad 2. The tether between bead and antibody 3
is formed by a two-tailed amplicon 4, in this case with first
primer 5 tagged with peptidyl hapten 6 and second primer 7 tagged
with biotin 8, for illustration. The paramagnetic beads are coated
with bound avidin 9.
[0107] As shown, the immobilized antibody on the test pad 1 has
captured a "two-tailed amplicon" (4), i.e., an amplicon with
peptidyl-oligomer-tagged primer at a first end and biotin-tagged
primer at the opposite end. These two-tailed amplicons are
synthesized during an amplification step by providing reagent
primer sets in which biotin has been used to tag a second primer
and peptide hapten the first primer by conventional chemistries. In
this example, the biotin tagged amplicon is captured by the
avidin-coated microbead, and the reporter bead complex in turn is
then immobilized on the test pad. The two-tailed amplicon thus
serves as a heterobifunctional tether. A sufficient number of
immobilized beads, as present in a few microliters of reagent,
result in a distinct visual coloration of the test pad. Biotin is
only one such ligand useful in constructing these unique molecular
detection complexes with magnetic beads.
[0108] Methods for preparation of affinity-modified microbeads are
also commonly known. As would be obvious to one skilled in the art,
composite magnetic beads can be prepared with materials such as
QDots, fluorophores, dyes, enzymes, RFIDs, and so forth, so as to
be readily detectable by alternative detection means when
immobilized on the respective test pads. Detection can involve
visual detection, machine detection, manual detection or automated
detection. Methods for preparation of hapten-tagged primers are
also readily extracted from the prior art.
[0109] Thus a "positive detection complex" results when an amplicon
becomes tethered to a test pad as shown in FIG. 1. Necessarily,
only those amplicons bearing both tags are immobilized on any one
test pad. Those test pads to which magnetic beads are tethered
indicate a positive result for one specific two-tailed species of
hapten-tagged amplicon. Those test pads to which no magnetic beads
are tethered indicate a negative result for the respective
hapten-tagged amplicon. Because the species of hapten are known and
are assigned to a particular forward or reverse primer conjugate,
the detection event can be interpreted as positive detection of the
particular nucleic acid sequence corresponding to the target
nucleic acid sequence under investigation.
[0110] In a preferred method, by using peptidyl-haptens (peptide
epitopes) attached to the primer nucleotide sequence as a tag,
large libraries of peptidyl-hapten-tagged amplicons can be prepared
by amplification, and interrogated by the magnetic bead methods
described here. Methods using the much more limited prior art
toolbox of non-peptide ligands as haptens or binding agents are not
so robust.
[0111] Clearly, the biotin:avidin affinity binding pair is one of
many ligand binding pairs that might be chosen for affinity
binding. Others include nickel:nickel binding complexes, as may be
suitable to nickel-bearing microbeads. Or digoxin and digoxigenin
and complementary antibodies, or the antibody Fc fragment and
Protein A or Protein G. Antibody-coated microbeads may also be used
to capture peptidyl hapten-tagged second primers (i.e., a unique
peptidyl hapten on both primers), and so forth.
[0112] In FIG. 2, we see a second detection complex, again taking
advantage of a bifunctional tether. Paramagnetic bead 20 is
immobilized on test pad 21 coated with antigen. The tether between
bead and antigen 22 is formed by an antibody 23. The paramagnetic
beads are coated with bound anti-antibody 24. Species specific
anti-antibodies are useful for this method, as are also Protein A
and Protein G.
[0113] In FIG. 3, the roles are reversed. Paramagnetic bead 30 is
immobilized on test pad 31 coated with an anti-antibody 32. The
tether between bead 30 and antibody 32 is again an antibody 33, but
the beads are now coated with antigen 34. Species specific
anti-antibodies are useful for this method.
[0114] In FIG. 4, antigen is the target molecule of the assay.
Paramagnetic bead 40 is coupled to test pad 41 coated with antibody
42 specific for the antigen. The tether between bead 40 and
antibody 42 is now an antigen 43. The beads are coated with an
antibody 44 specific for the antigen. The antibodies are not
necessarily identical, one antibody may be a hybridoma antibody,
the other a polyvalent antibody, and the antibodies may bind to
different recognition sites on a macromolecular antigen, or share a
common binding site where multiple binding sites are present, for
example when the antigen is a viral particle.
[0115] We now turn to the step in the method whereby the
immobilized paramagnetic complex is produced. Examples of
bead:amplicon capture on immobilized antibody, bead:target antibody
capture on immobilized antigen, bead:target antibody capture on
immobilized antibody capture agent, and bead:target antigen capture
on immobilized antibody, respectively, will again be discussed.
[0116] In FIG. 5, a key is used to describe the elements of the
step. In the first panel, FIG. 5A, paramagnetic bead:amplicon
binding complexes on the left are in the process of being "swept"
or "dragged" onto, through and across two patches of immobilized
antibody illustrating the test pads. It can be appreciated that at
a molecular level the test pads are not two-dimensional layers, but
are in fact 3-dimensional surfaces coated with a layer of bound and
unstirred water. The cone of the magnetic force field (long arrow)
is moving parallel to the plane of the test pad, but the magnetic
flux lines are experienced by paramagnetic particles as being
directed downwardly (short arrow). The magnetic force is thus seen
to have two vectors, one directed "downwardly" and the other
"laterally" (relative to the plane of the test pad). Paramagnetic
particles are attracted to the magnet from which the magnetic force
field emanates, and the magnet is positioned under the plane of the
test pad and is moving from left to right. The "J-hook" at the base
of the amplicons (for illustration) represents a peptidyl hapten
that is recognized by one of the test pads, which are coated with
different antibodies (left vs. right test pad).
[0117] In the second panel, FIG. 5B, the magnetic force field has
moved past the test pads, "sweeping" or "dragging" with it unbound
paramagnetic particles while--surprisingly--paramagnetic bead
complexes bearing the amplicon have been captured and extracted
from the magnetic field, and are seen in the panel to be
immunoimmobilized on the test pad coated with capture antibody
specific for the J-hook of the peptidyl hapten. This occurs much in
the same way that a cable captures the tailhook of a landing
airplane on an aircraft carrier. The bead complexes are dragged
through the mat of antibody and liquid crystalline water bound to
the test pad. The magnetic force pulls the complexes down into
close approach and full contact with the antibody mat, contacting
antibody and hapten. The magnetic force (which is a weak force) is
not strong enough to rip the hapten from the primer, or even to rip
the antibody from the test pad, but instead releases the bead
complex, which remains immobilized on the test pad.
[0118] Note that the process of removing unbound paramagnetic
material from the test pads after immunocapture could also be
accomplished by repositioning the source of the magnetic field
above the test pad. Paramagnetic beads will always move from a
field of less dense magnetic flux lines to a field of more dense
magnetic flux lines. Thus we can say that capture is accomplished
by sweeping the beads from outside to inside the test pad area, and
removal of unbound material is accomplished by sweeping the beads
from inside to outside the test pad area, without reference to
particular geometries. The magnetic field may also serve to remove
the unbound material to waste.
[0119] Immobilization is specific. In this illustration, the
peptide hapten is recognized only by the complementary antibody of
the right test pad, not the left, and the bead complexes are
therefore immobilized only on the right test pad. Detection of the
immunoimmobilized bead complexes is thus a positive detection event
and indicates here the presence of the target amplicon. Detection
of the immobilized complexes can be as simple as a visual estimate
of the color of the test pad before and after binding, or a
comparison with positive and negative control test pads.
Paramagnetic beads typically have a distinct color or can be
suitably dyed. More complex detection means may also be used.
[0120] In FIG. 6, a key is again used to describe the elements of
the step. In the first panel, FIG. 6A, paramagnetic bead:antibody
binding complexes on the left are in the process of being "swept"
or "dragged" onto, through and across a patch of immobilized
antibody on the test pad. The bead antibody complexes consist of a
mixture of target antibody (black body) and nonspecific antibodies
(black tips), all of which have been bound to the beads by an
anti-antibody, for example in the case of an assay for
antigen-specific IgG immunoglobins in human serum, a mouse or
hybridoma anti-human IgG antibody. The test pad is coated with
adsorbed antigen specific for the antibody targeted in the
assay.
[0121] It can again be seen that the magnetic force field (long
arrow) is moving parallel to the plane of the test pad, but is
experienced by paramagnetic particles as being directed downwardly
(short arrow). There are thus two vectors to the magnetic force,
the lateral vector corresponding to movement of the magnetic field
from left to right and the perpendicular vector corresponding to
the magnetic flux lines which are not shown. Paramagnetic particles
are attracted to the magnet from which the magnetic flux lines
emanate, and the magnet is positioned beneath the plane of the test
pad and is moving from left to right. The paramagnetic particles
will follow the motion of the magnetic force field, and are pulled
against the test pad while being dragged from left to right.
[0122] In the second panel, FIG. 6B, the magnetic force field has
moved past the test pads, "sweeping" or "dragging" with it
nonspecific antibody and unbound paramagnetic particles
while--surprisingly--paramagnetic bead complexes bearing target
antibody specific for the antigen have been captured and extracted
from the magnetic field, and are seen in the panel to be
immunoimmobilized on the test pad.
[0123] In FIG. 7A, paramagnetic bead:antibody binding complexes on
the left are in the process of being "swept" or "dragged" onto,
through and across immobilized antibody on the test pad. The
microbeads are coated with antigen complementary or specific for
the target antibody of the assay. The test pad is coated with an
anti-antibody, for example in the case of an assay for
antigen-specific IgG immunoglobins in human serum, a mouse or
hybridoma anti-human IgG antibody.
[0124] It can again be seen that the magnetic force field (long
arrow) is moving parallel to the plane of the test pad, but is
experienced by paramagnetic particles as having a downward vector
(short arrow). Paramagnetic microbeads are attracted to the magnet
from which the magnetic force field emanates, and the magnet is
positioned beneath the plane of the test pad and is moving from
left to right. The paramagnetic beads are thus pulled down on the
test pad, in close contact with the capture agent, while
simultaneously transversing the test pad from left to right.
[0125] In the second panel, FIG. 7B, the magnetic force field has
moved past the test pads, "sweeping" or "dragging" with it unbound
paramagnetic particles while--surprisingly--paramagnetic bead
complexes bearing target antibody have been captured and
immunoextracted from the magnetic field.
[0126] In FIG. 8A, paramagnetic bead:antigen complexes on the left
are in the process of being "swept" or "dragged" onto, through and
across immobilized antibody on the test pad. The beads are coated
with antibody complementary for the target antigen of the assay.
The test pad is coated with an anti-antigen antibody.
[0127] It can again be seen that the magnetic force field (long
arrow) is moving parallel to the plane of the test pad, but is
experienced by paramagnetic particles as being directed with a
downward vector component (short arrow). Paramagnetic particles are
attracted to the magnet from which the magnetic force field
emanates, and the magnet is positioned beneath the plane of the
test pad and is moving from left to right. The paramagnetic
particles will follow the motion of the magnetic force field, and
are pulled up against the test pad while being dragged from left to
right.
[0128] In the second panel, FIG. 8B, the magnetic force field has
moved past the test pads, "sweeping" or "dragging" with it unbound
paramagnetic particles while--surprisingly--paramagnetic bead
complexes bearing target antigen have been captured and
immunoextracted from the magnetic field.
[0129] Surprisingly, in the bound layer of water molecules on the
test pad, the intermolecular forces of affinity binding are
stronger than the magnetic forces on the particles. While not
limited by theory, the invention is a way of solving a critical
problem of bioassays, that of facilitating the close approach of
target and target capture agent by dislodging the boundary or
unstirred layer of water at the surface of the capture layer. At
the nanoscale of microfluidics, this barrier is a critical barrier
in affinity binding. Typically this problem has been overcome by
extending incubation time or by convective close approach (for
example as in the wicking effect of lateral flow) followed by
diffusion and capture. Here we show that unbound paramagnetic
complexes are first brought into contact with a capture surface or
substrate under the direction of a magnetic force field and are
then extracted from the magnetic field, while unbound paramagnetic
substrates are dragged away from the capture surface or substrate
by the continued lateral motion of the magnetic field.
[0130] The magnetic force field thus has two vectors, one directed
"downwardly" (relative to the plane of the capture surface or test
pad) and the other "laterally" (again relative to the plane of the
capture surface or test pad). The downward vector penetrates the
unstirred water layer around the capture molecule, and draws the
target molecule into the required close approach or "close
encounter" where affinity binding can occur. The lateral vector is
through the unstirred water layer, and again draws the target
molecules into the required close approach to capture molecules,
but further serves to differentiate bound and unbound material.
Unbound paramagnetic molecular complexes remain with the moving
magnetic field and continue their lateral path. Bound paramagnetic
materials are immobilized at the site of capture and are not
dislodged by the continuing lateral vector of the magnetic force
field.
[0131] The magnetic force field is manipulated by moving its source
(a permanent magnet or electromagnet) laterally across or through
the plane of the test pad, and may be disengaged by withdrawing the
magnet or turning off current to the electromagnet).
[0132] In FIG. 9, illustrated is a simple device for conducting the
method. It can be seen that the lateral motion of the magnetic
force field is optionally bidirectional, here shown with a net
motion in a fluid path of detection chamber 60 from upstream 61
(Paramagnetic Complexes In) to downstream (Waste Out). The source
of the magnetic field is again "underneath" (or "behind") the test
pad. This draws the target into close approach with the binding
sites, and facilitates the detection step. In the capture step, the
path of the magnetic field must necessarily contactingly traverse
one or more test pads 62 coated with affinity capture agent 63. In
the detection step, a viewing window 64 permits detection of the
bound complexes after the moving magnetic field has passed, thus
simplifying detection. The magnetic field is further useful in
directing unbound paramagnetic materials to waste. A multiplex
detection device is shown, having a plurality of test pads.
[0133] Note that this approach to assays eliminates the "hook
effect" characteristic of some lateral flow assays. The
affinity-modified paramagnetic beads are reacted with the target
molecule before seeing the capture agent, and when in excess, do
not compete with the target molecule for binding on the test
pad.
[0134] To assemble devices of the kind illustrated in FIG. 9, the
test pads are treated to immobilize a capture agent prior to
assembly of the device, for example, on polystyrene, by plasma
treatment of plastic areas delimited by a mask, followed by
application of the capture agent and drying. Spotting of capture
agent, for example with a laserjet printer, can eliminate the need
for masking test pads. If necessary, test pads are "blocked" with
blocking agents to prevent non-specific adsorption of target
molecules prior to sealing the detection chamber or channel.
[0135] In FIG. 10 we show examples of possible test pad geometries.
Test pads are a feature of the detection step of the method
described herein. Test pads 70 and 71 constitute for example a
negative and positive detection field for an assay and may be used
as a pair. Test pad array 72 is a vertical stack of banded or
striped test pads in the form of an array, not unlike that shown in
FIG. 9. Test pad array 73 is a rectangular array of individual test
squares, each treated with a unique capture agent. Test pad 74 is
circular and is adapted to inkjet printing. Test pad 75 is treated
with a gradient of a capture agent so as to display a readily
interpretable semi-quantitative endpoint.
[0136] Test pads have in common a test field bounded by an edge
inside of which a bioactive capture agent is immobilized. While not
a comprehensive list, the capture agent may be a protein such as an
antibody, an anti-antibody, an anti peptidyl hapten antibody,
Protein A, Protein G, or antigen, or a non-protein such as an
aptimer, a carbohydrate antigen, a mucopolysaccharide, a binding
protein such as folic acid binding protein or an avidin, or a
nucleotide oligomer. Capture agents may also include denatured
viral antigens and microbial antigens in general and cellular
components or whole cells in general.
[0137] Note that test pads are not necessarily impermeable
substrates, and may be porous or fibrous in character. The
microbead fluid path in the magnetic field may be across or through
the test pad area, as in from side-to-side or from front-to-back.
The test pad architecture, at a molecular level, is inherently
three-dimensional, although it may be represented as a
two-dimensional plane.
[0138] Solid substrates for test pads include olefin or other
thermoplastic materials such as polystyrene, polycarbonate,
polypropylene, polyethylene terephthalate, polyether sulfone,
polyvinyl chloride, polyvinyl acetate, copolymers of vinyl acetate
and vinyl chloride, and polyamides and also inorganic materials
such as glass. Certain fibrous or porous supports such as
nitrocellulose, nylon, hydrogel, and polyethylene may also be
applied as test pads, and may be pretreated with capture agent for
ease of assembly. To enhance binding of capture agents, crosslinked
proteins are sometimes employed. Drying also promotes irreversible
binding of the capture agent.
[0139] A preferred method for pretreating plastic prior to
adsorbing the capture agent is low pressure gas plasma treatment.
Exposure of the surface to pure oxygen or nitrogen produces an
activated hydroxylated and carboxylated substrate layer or an
activated aminated and nitroxidated layer, respectively. Argon may
also be used. In one embodiment, polystyrene plastic is used as the
substrate for immobilizing capture agent. Masking, followed by gas
plasma treatment is used to activate designated areas as test pads.
The capture agent is applied, dried in place, and the mask is
removed. When antibody is used as the capture agent, application by
hand or with an automated printer is followed by drying and
blocking. Other capture agents may require modified protocols as
are known in the art.
[0140] Techniques for surface activation are reviewed in Chan et
al. (1996) Surface Science Reports 24:1-54 and in Garbassi et al.
(1998) Polymer Surfaces-From Physics to Technology (John Wiley pp
238-241), and in U.S. Pat. No. 6,955,738, which describes
hydrophilization and functionalization of polymer surfaces and is
incorporated herein in its entirety by reference.
[0141] We now disclose integrated assay methods relying on a step
for laterally moving magnetic fields to contactingly capture and
extract target analytes from biological samples.
[0142] Turning to FIG. 11, an assay for a target nucleic acid
sequence becomes the steps of first preparing the sample for
amplification of the target sequence, amplifying the target by a
PCR or related isothermal protocol whereby tagged primers are
incorporated into the product amplicon, then binding those tagged
"two-tailed" amplicons on paramagnetic beads coated with an
affinity binding agent, and magnetically sweeping or dragging the
beads into close contact with a test pad area with immobilized
capture antibody so as to form immunoimmobilized paramagnetic
complexes of test pad:capture antibody:amplicon with hapten tag of
first primer and ligand tag of second primer:binding agent and
paramagnetic bead (i.e., the detection complex), before sweeping
from the test pad any un-immobilized paramagnetic material. And
finally a step for detecting any molecular detection complexes on
the test pad.
[0143] Preparation of a sample may involve lysing cells to release
the target nucleic acids, removing interferences such as hemoglobin
from a blood lysate by selective adsorption and elution of the
nucleic acids from a glass solid phase, and dissolution of the
nucleic acids with a suitable buffer for a polymerase. Also
required in some applications are preliminary steps for reverse
transcription, as when mRNA contains the target sequences and must
be converted to duplex DNA before amplification.
[0144] In the step for amplification, multiplex or nested primer
sets may be used. The method uses a second primer with tag suitable
for complexation with an affinity binding agent on the paramagnetic
beads, and often this a biotin tag as illustrated in FIG. 1. The
method uses a first primer with tag suitable for immunoaffinity
immobilization of the formed amplicon:bead complex on the surface
of the test pad.
[0145] So two levels of affinity capture are involved, the first
being the binding of a ligand-tagged amplicon on the paramagnetic
bead, and the second the immobilization or capture of an
amplicon:bead binding complexes on the test pad (forming the
detection complex or immobilized reporter complex). Various
affinity binding agents may be used in each phase of formation of
the detection complex. However, the advantage of using capture
antibodies for second phase immobilization is the specificity of
antibody:peptidyl hapten binding, which permits design of protocols
for simultaneous assay of multiple target nucleic acid sequences.
Immuno-immobilization of target analyte with antibody capture agent
is a preferred embodiment, but the invention is not limited to
such.
[0146] Having formed the paramagnetic bead:amplicon binding
complexes in free solution, the next step is to use a magnetic
field to localize and contact the analyte complexes with the test
pad so that the immunoimmobilized detection complexes can be
formed. The magnetic field is moved and optionally modulated to
perform this. Lateral motion of the magnetic field sweeps or drags
the bead complexes onto the test pad, through the unstirred layer
and the 3-dimensional network of bound capture antibody, and
finally across the test pad, where unbound paramagnetic material is
carried off the test pad and away with the lateral motion of the
magnetic force. This step promotes binding interactions without the
need for multi-minute incubations.
[0147] In the detection step, the double-stranded, two-tailed
amplicon, bound by avidin:biotin on one end (for example) and
antibody:peptidyl hapten on the other (for example), is
sufficiently strong to selectively tether the paramagnetic bead to
the test pad and resist delocalization by the moving magnetic force
field. It can be said that the capture antibody "extracts" the
amplicon:bead complexes from the moving magnetic field. Sufficient
numbers of bound bead complexes are readily identified and form a
positive result by visual endpoint. A visual detection step is
illustrated.
[0148] It should be noted that the primer set is essentially a
first assay reagent, and may be prepared and placed in an assay
device or kit, optionally in dried form, at any time prior to
performing the assay. Similarly, the beads are essentially a second
assay reagent, and may be sensitized with the desired binding
agent, and optionally dried in place prior to the assay. Test pads
are prepared in advance of the assay itself and may be rehydrated
prior to use or rehydrated by the test sample in performance of the
assay. Drying promotes irreversible binding of the capture agent to
the test pad substrate. Reagents for sample preparation and
amplification may also be prepared separately.
[0149] In FIG. 12 we see the same principles illustrated in a
target antibody assay. The sample is first processed to prepare a
liquid fraction, which might be serum or plasma, a paracellular
fluid, saliva, or other biological sample. Generally any solid
fraction of the sample is separated from the aqueous liquid
fraction.
[0150] Optionally, interferences are then adsorbed and any
antibody:target antigen complexes in the biological sample are
disrupted so as to release the analytical target.
[0151] The target antibody in free solution is then bound by
paramagnetic beads coated with an anti-antibody. This method is of
use, for example, when a particular class of target antibody is of
interest, as in distinguishing acute, convalescent, and chronic
stages of infection, or when all antibody in the sample is to be
interrogated for specificity to a plurality of antigens.
[0152] In the detection step, the bead:antibody:antibody:antigen
tether, is sufficiently strong to selectively anchor the
paramagnetic bead to the test pad and resist disruption by the
magnetic field. Sufficient numbers of bound bead complexes are
readily identified and form a visually positive detection endpoint.
The detection complex is formed of test pad:antigen:target
antibody:affinity bound paramagnetic bead. Alternatively, the
detection complex may contain an enzyme, for example, and may be
further developed for detection by enzymatic assay.
[0153] The common step in all these assays is to simultaneously use
a magnetic field a) to localize and contact the analyte:bead
complexes with the test pad so that the immobilized detection
complex can be formed and further b) to separate bound and unbound
paramagnetic bead complexes. This speeds the analytical process.
The magnetic field is moved and optionally modulated to perform
this. Lateral motion of the magnetic field sweeps or drags the bead
complexes onto the test pad, through the unstirred layer and the
3-dimensional network of bound capture antigen, and finally across
the test pad, where unbound paramagnetic material is carried off
the test pad and away with the lateral motion of the magnetic
force. Paramagnetic bead complexes bearing target antibody remain
behind, immuno-immobilized on complementary, irreversibly adsorbed
antigen on the test pad.
[0154] Clearly the bifunctional or "two-tailed" tether confers
assay specificity. Using FIG. 12 for illustration, which is
copacetic with FIGS. 2 and 6, nonspecific antibody may be bound to
the paramagnetic beads, but would not be captured by the antigen on
the test pads, so no false-positive detection complex will form.
Anti-antibodies directed at the Fc fragment of the target antibody
are preferable for this assay so that the variable regions of the
target antibody arms are free to recognize and bind to the bound
antigen.
[0155] It should be noted that the beads are essentially a first
assay reagent, and may be sensitized with the desired binding
agent, and optionally dried in place prior to the assay. Test pads
are prepared in advance of the assay itself and may be rehydrated
prior to use or rehydrated by the test sample in performance of the
assay. Reagents for sample preparation may also be prepared
separately.
[0156] In FIG. 13, the method differs from that of FIG. 12
essentially by the polarity of the tether. In the sample
preparation step, generally, the solid fraction of the sample is
separated from the aqueous liquid fraction. If needed,
interferences are then adsorbed and any antibody:target antigen
complexes in the biological sample are disrupted so as to release
the analytical target.
[0157] The target antibody in free solution is then bound by
paramagnetic beads coated with complementary antigen, forming
immunospecific antibody:antigen complexes on the bead (also termed
a "reporter:analyte complex".
[0158] The next step is common to all these assays and involves the
simultaneous use a magnetic field to a) localize and contact the
analyte:bead complexes with the test pad so that the immobilized
detection complex can be formed and b) to separate bound and
unbound paramagnetic bead complexes. Lateral motion of the magnetic
field sweeps or drags the bead complexes onto the test pad, through
the unstirred layer with a downward vector on the paramagnetic
beads, penetrating the 3-dimensional network of bound capture
anti-antibody on the test pad, and finally across the test pad,
whereupon unbound paramagnetic material is carried away with the
lateral motion of the magnetic force. Paramagnetic bead complexes
bearing target antibody remain trapped by immunoimmobilization on
adsorbed anti-antibody on the test pad.
[0159] In the detection step, the bead:antigen:antibody:antibody
tether, is sufficiently strong to selectively anchor the
paramagnetic bead to the test pad and resist disruption by the
magnetic field. Sufficient numbers of bound bead complexes are
readily identified and form a positive visual detection endpoint.
The detection complex is formed of test pad:antibody:target
antibody:affinity bound paramagnetic bead. The detection endpoint
may be further developed to amplify the detection sensitivity, for
example by excitation of a fluorophore.
[0160] Clearly the bifunctional tether confers assay specificity.
Using FIG. 13 for illustration, which corresponds to FIGS. 3 and 7,
the capture anti-antibody on the test pad in panel 13B will likely
capture a broad spectrum of antibodies in the sample, but only
those immunocomplexed by paramagnetic beads will result in a
positive assay. Thus the bifunctional specificity of the tether
ensures assay specificity. Note that, however, the paramagnetic
bead reagent is a mixture of beads coated with either a first
antigen and beads coated with a second antigen, an
immunoimmobilized positive assay endpoint will form if antibodies
to either antigen are present in the sample. The identity of
individual antibodies to particular antigens is, however, obtained
with the method of FIG. 12, even in a multiplexed bead format.
[0161] It should be noted that the beads are essentially a first
assay reagent, and may be sensitized with the desired binding
agent, and optionally dried in place prior to the assay. Test pads
are prepared in advance of the assay itself and may be rehydrated
prior to use or rehydrated by the test sample in performance of the
assay. Reagents for sample preparation may also be prepared
separately.
[0162] Similarly, individual antigens in a biological test sample
may be identified by the method of FIG. 14. In FIG. 14 we see the
same principles illustrated to assay for a target antigen. The
sample is first processed to prepare a liquid fraction containing a
solution or suspension of the target antigen.
[0163] Optionally, interferences are adsorbed and any
antibody:target antigen complexes in the biological sample are
disrupted so as to release the analytical target.
[0164] The target antigen in free solution is then bound by
paramagnetic beads coated with an antibody complementary for the
antigen. Multiple antigens may be targeted simultaneously. This
method is of use, for example, when a sample is suspected of
carrying an enteric pathogen, a virus, or a marker released from
malignant cells.
[0165] The common step in all these assays is use a magnetic field
to a) localize and contact the analyte:bead complexes with the test
pad so that the immobilized detection complex can be formed and to
b) separate bound and unbound paramagnetic bead complexes.
Essentially this is done simultaneously, thus speeding the assay
and eliminating multi-minute incubations for the binding
interaction.
[0166] The step for magnetic sweeping is comprised of applying a
magnetic force to said paramagnetic bead reagent, wherein said
magnetic force comprises generally lateral and generally
perpendicular force vectors generated by a moving magnetic force
field comprising flux lines extending from less dense to more
dense. Because paramagnetic beads move from areas of less dense
magnetic flux to areas of more dense magnetic flux, the magnetic
force pulls the beads onto and into the arms of the capture agent.
Because the magnetic field is moving laterally, the magnetic force
sweeps or pulls the beads laterally over and across the test pad,
separating bound and unbound materials as it goes. Rates of motion
(linear velocity) for the magnetic sweep have been in the range of
25 to 100 mm/min (up to about 0.2 cm/sec). This step can be
performed manually, or can be performed with an automated or
semi-automated apparatus.
[0167] FIG. 15 illustrates a result of the assay. Seven vertically
elongate detection chambers are placed side by side on a
microfluidic cartridge under an optical window. Within each
detection chamber are seven test pads stacked vertically. Each test
pad is about 0.5.times.2 mm in size. Paramagnetic microbead
reporter complexes are added to the detection chamber via a sample
port and the beads are drawn up the detection chamber by a magnetic
field originating from a magnet behind the cartridge. This magnetic
field serves to a) draw the reporter complexes to the site of
immobilization and b) remove unbound material. The result is a
striking rust colored band where reporter complexes are bound to
the corresponding antibody on a test pad. Seven amplicons were used
in preparation of this test cartridge, and seven corresponding
antibody test pads were prepared in each detection chamber. The
result thus appears as a "stairstep" from left to right.
[0168] We can thus, in general, characterize the method as a rapid
bioassay protocol comprising a step of moving a magnetic force
field from outside to inside a test pad area so as to sweep a
paramagnetic bead reagent in a fluid into close contact with an
affinity capture agent in said test pad area, and thereby affinity
capturing or extracting any bioassay target molecule bound to the
paramagnetic bead reagent from the magnetic force field in the form
of an immobilized paramagnetic microbead complex; and upon forming
the immobilized paramagnetic bead complex (i.e., the detection
complex), then moving the magnetic force field from inside to
outside the test pad area so as to sweep from the test pad area any
paramagnetic bead reagent not formed as immobilized paramagnetic
complex, before detecting the detection complex, although it should
be clear that, simplicity of description aside, the sweeping step
in fact simultaneously integrates multiple simultaneous acts of
formation of immobilized bead complexes and parallel acts of
separation of not immobilized materials.
[0169] Surprisingly, the tether is sufficiently strong to
selectively anchor the paramagnetic bead to the test pad while
resisting the separating force of the magnetic field. In the
detection step, sufficient numbers of bound bead complexes are
readily identified and form a visual detection endpoint. The
detection complex comprises bead:antibody:antigen:antibody:test
pad, and may be further developed to increase assay sensitivity,
for example by exciting an RFID tag or a fluorophore embedded in
the bead matrix. The bead thus acts as a reporter group itself, or
as a complex with accessory reporter groups.
[0170] Clearly the bifunctional or "two-tailed" tether confers
assay specificity. Using FIG. 14 for illustration, which is
copacetic with FIGS. 4 and 8, specific antibody binds the target
antigen, such as a drug or other small molecule, to the bead, and
the target antigen:bead binding complex is bound to the test pad
again by another antibody specific to the target analyte.
Specificity and robustness is also demonstrated in FIG. 15.
[0171] It should be noted that the beads are essentially a first
assay reagent, and may be sensitized with the desired binding
agent, and optionally dried in place prior to the assay. Test pads
are prepared in advance of the assay itself, are advantageously
dried in place, and may be rehydrated prior to use or rehydrated by
the test sample in performance of the assay. Reagents for sample
preparation may also be prepared separately before use.
[0172] In the various applications noted above, we have developed a
preference for monosized bead reagents with high density relative
to typical aqueous solutions. Metallic microbeads settle quickly in
micron-sized flow paths and the beads are not readily resuspended
during washing. Interestingly, in certain microfluidic
applications, a magnet is no longer used for routine washing and
rinsing of magnetic beads. These preferred beads are also readily
detected visually. Labelled test pads appear as brightly rust
colored spots or bands on a white or clear background.
[0173] The size of magnetic beads preferred in the assay are about
0.01 to 50 microns, more preferably 0.5 to 10 microns, and most
preferentially 0.8 to 2.8 microns, mean diameter. Homogeneously
sized beads are preferred. Suitable beads may be obtained from
Dynal Invitrogen (Carlsbad Calif.), Agencourt Bioscience Corp
(Beverly Mass.), Bang's Laboratories, Inc. (Fishers Ind.),
Polysciences, Inc (Warrington Pa.), Bioscience Beads (West Warwick
R.I.), Bruker Daltonics (Nashville Tenn.) and AGOWA (Berlin Del.),
for example.
[0174] The magnetic beads may be in the form of a ferrofluid, taken
broadly. In operation, in traversing the test pad, the method
serves as a sort of magnetic fluidized bed reactor for extraction
of affinity captured beads and separation out of nonspecifically
labeled beads, reagents and assay materials.
[0175] To effect motion of the magnetic force field relative to the
test pad, several alternative embodiments are possible: a) The
magnet itself can be moved. Movement can be manual or powered with
a stepper motor, servo motor, voice coil or with a spring-loaded
mechanism and an x-z or y-z carriage can be constructed and
automated. Alternatively, b) the test pad may be moved relative to
the magnetic field by similar means. And if electromagnets are used
in place of permanent magnets, c) an array of electromagnets can be
actuated in sequence to redirect the magnetic field. It is possible
to build a solid state system where a series of electromagnets are
used to move the beads in a chamber. However, the methods of the
inventions should not be construed as being limited to a
microfluidic device. Adaption to laminar flow, lateral flow,
capillary, dipstick, multiwell plate, and test tube formats is also
contemplated.
[0176] In a preferred apparatus, as built, a stepper motor is used
to move a rare earth magnet (neodymium) in an undercarriage mounted
in close proximity to the detection chamber of a microfluidic
device. Simple software commands are used to move the undercarriage
along y-axis of the detection chamber (see FIG. 9). The speed of
translation is adjustable and the carriage may be lowered in the
z-axis to weaken the magnetic field in the chamber. Because
paramagnetic beads line up on magnetic flux lines and are attracted
to areas of higher magnetic flux, they cannot be repelled by the
magnet and the orientation of the poles of the magnet is
reversible.
[0177] The preferred apparatus accepts a microfluidic cartridge
with detection chamber or "microchannel" configured in the body,
the microchannel comprising a fluid path with axis of flow and with
upper and lower aspects.
[0178] Within the microchannel is a test pad or solid phase
element, which comprises an affinity capture agent for the analyte
or for an analyte binding complex. A means is provided for
introducing a population of paramagnetic microbeads in a fluid into
the microchannel, generally by assembling the cartridge with
dehydrated beads inside and then rehydrating the beads in test
sample fluid so that the beads complex target analyte. Also
provided is a means for moving a magnetic force field along a plane
parallel to the axis of flow of said fluid path, so as to sweep the
population of paramagnetic microbeads in said fluid into close
contact with said affinity capture agent, thereby affinity
capturing any bioassay target molecule bound to said population of
paramagnetic beads from the magnetic force field in the form of an
molecular detection complex, and sweeping from the solid phase
element any paramagnetic bead reagent not formed as molecular
detection complex.
[0179] The means for moving a magnetic force field comprises a
subassembly external to said microfluidic cartridge, said
subassembly with moveable carriage with track upon which said
carriage is mounted, said track mounted in a plane parallel to said
axis of flow, said carriage further comprising a first magnet, the
subassembly further configured to move the magnet along said track,
first bringing the magnetic force field into proximity to said test
pad and then distancing the magnetic force field from said test pad
element.
[0180] Neodynium (NdFeB) magnets obtained from K&J Magnetics
(Jamison Pa.) were found to be suitable. Magnets designated D38,
D40, and D44 were used. These magnets are cylindrical with poles on
the long axis and have a Curie temperature of about 300.degree. C.
(maximum operating temperature of 80.degree. C.). The magnets are
Grade N52 neodynium and have a surface field strength of 4600 to
5000 Gauss. It should be recalled that magnetic field force is
inversely proportionate to the 4.sup.th power of the distance.
Proximity to the test pad is in the range of 0.2 to 1.2 mm for
these particular magnets. The diameter of the magnets range from to
about 5 to 10 mm at the poles. For reference, the test pads
themselves are about 0.5 mm.times.2 mm, with the long axis
perpendicular to the traverse of the magnet.
[0181] Magnets with a triangular cross-section (prism magnets) and
poles on two facets may also be used. These magnets have a sharply
focused flux density above the apex of the facets.
[0182] Another aspect of the invention is use of peptidyl primer
tagged amplicons in assays for nucleic acids. A number of methods
are now available for manufacture of specific peptide epitopes
attached to oligonucleotide probes or primers (see C.-H. Tung and
S. Stein, Bioconjugate Chem., 2000, 11, 605-618; E. Vives and B.
Lebleu, Tetrahedron Lett., 1997, 38, 1183-1186; R. Eritja, A. Pons,
M. Escarcellar, E. Giralt, and F. Albericio, Tetrahedron Lett.,
1991, 47, 4113-4120; J. P. Bongartz, A. M. Aubertin, P. G. Milhaud,
and B. Lebleu, Nucleic. Acids Res., 1994, 22, 4681-4688; C.-H.
Tung, M. J. Rudolph, and S. Stein, Bioconjugate Chem., 1991, 2,
461-465; J. G. Harrison and S. Balasubramanian, Nucleic. Acids
Res., 1998, 26, 3136-3145; S. Soukchareun, J. Haralambidis, and G.
Tregear, Bioconjugate Chem., 1998, 9, 466-475; K. Arar, A.-M.
Aubertin, A.-C. Roche, M. Monsigny, and M. Mayer, Bioconjugate
Chem., 1995, 6, 573-577; and, for an example of the use of the
native ligation technique see: D. A. Stetsenko and M. J. Gait, J
Organic Chem., 2000, 65, 4900-4908). See also US 20006/0263816,
incorporated herein in full by reference.
[0183] The peptidyl hapten conjugated primers of this method are
satisfactorily synthesized by the above chemistries and others. We
disclose here that primers of this class are compatible with PCR
methods and with molecular biological nucleic acid amplifications
in general. For use in assays, the amplification product with
peptide-tagged primer-labelled amplicons is first captured by an
affinity capture agent specific for a ligand on the second primer
of the amplification primer set and bound to a magnetic microbead.
The amplicon-bead complex is then interacted with peptidyl
hapten-specific antibodies on the testpad and only those bead
complexes with the peptide :amplicon molecular complex are captured
by the testpad. This method permits screening of peptidyl-amplicon
libraries by heterogeneous binding assays using magnetic bead
technology.
[0184] The method results in an inventive composition as a product:
a molecular detection complex comprising a two-tailed amplicon with
first end and second end, said first end comprising a first primer
covalently conjugated with a peptidyl hapten, and said second end
comprising a second primer covalently conjugated with a ligand,
said first end further comprising a ligand-bound ligand binding
agent-coated reporter group, and said second end further comprising
a peptidyl hapten bound anti-peptidyl hapten antibody immobilized
on a solid phase.
[0185] This aspect of the invention is illustrated in FIG. 16,
which shows a molecular detection complex with two-tailed amplicon
as tether, as in FIG. 1, but here not involving biotin, and
utilizing a more complex magnetic microbead than that described in
FIG. 1.
[0186] In FIG. 16, the magnetic microbead 161 contains inclusion
bodies or patches 162 of QDot, Texas Red, phycoerythrin, or other
fluor, covalently attached or immobilized in the magnetic microbead
matrix, here a latex binder with embedded particles of a
ferrofluid. The microbead further comprises adsorbed antibody 169.
This is the reporter group. The tether consists of amplicon 164
with first primer 165 and peptidyl hapten tag 166. Primer
conjugates are incorporated into the amplicon during amplification.
Anti-peptidyl hapten antibody 166 immobilizes the tether to solid
substrate 163, which may be another bead or a fiber or a test pad.
The second primer 167 is conjugated with digoxigenin (for example).
And the antibody in the reporter group is specific for digoxigenin.
The reporter group is thus immobilized in a complex comprising at
least 5 non-covalent bonds--bead:antibody; antibody:ligand;
DNA:DNA; peptide:antibody; and antibody:solid phase. Yet the assay
method described here permits the tether and reporter group to be
extracted with high specificity and robustness from a moving
magnetic field in which the paramagnetic beads are carried.
[0187] It should be noted that soluble reporter groups and
fluorophore dyed latex beads may be used with the two-tailed
amplicons of the present invention. By barcoding the fluorophore
beads and coating uniformly labeled bead populations with peptidyl
hapten specific antibodies, bead libraries can be synthesized for
analysis of mixed populations of two-tailed amplicons or of
two-tailed amplicon libraries, and the resulting affinity binding
complexes with pairs of beads tethered by the two-tailed amplicons
can then be sorted or assayed using dual excitation fluorometry, a
sort of liquid microarray. These assays may be performed, for
example, in a microfluidic cartridge configured as a fluorescent
particle sorter, or in a flow luminometer. In a preferred assay
method, the reporter group is a fluorophore of one emission
frequency and the barcoded latex bead is selected from those of the
prior art.
[0188] Assays of the method described herein are generally amenable
to the preparation of devices, apparatuses, and kits for their
performance.
EXAMPLE 1
A) Preparation of Primer Sets
[0189] Reverse primers were first prepared and HPLC purified.
Peptides were derivatized with n-terminal hydrazine before use.
Oligonucleotides were treated with succinimidyl 4-formylbenzoate in
formamide and then reacted with the hydrazine derivatized peptides
to form hapten-tagged primers.
[0190] The following peptidyl hapten-tagged primers were used.
TABLE-US-00001 5'-Peptidyl Oligomers Pri- mer Primer Sequence*
Peptide Sequence** A CGCCAGTACGATATTCAG (HNA) EQKLISEEDL (SEQ ID
NO:1) (NH2) (SEQ ID NO:8) B ACCTGGACATCACGGCTTTCAAC (HNA) YPYDVPDYA
(SEQ ID NO:2) (NH2) (SEQ ID NO:9) C CCTATTGCAGAGCGAATGAC (HNA)
YTDIEMNRLGK (SEQ ID NO:3) (NH2) (SEQ ID NO:10) D
TGAACTCCATTAACGCCAGA (HNA) CEEEEYMPME (SEQ ID NO:4) (NH2) (SEQ ID
NO:11) E CGACCTGACCAAATGCCAG (HNA) TDFYLK (NH2) (SEQ ID NO:5) (SEQ
ID NO:12) F CCTATAACAGCACCCACTATACGG (HNA) DTYRYI (NH2) (SEQ ID
NO:6) (SEQ ID NO:13) G CTCTGCGAGCATGGTCTGG (HNA) QPELAPEDPED (SEQ
ID NO:7) (NH2) (SEQ ID NO:14)
[0191] These peptide epitopes were selected based on the
availability of complementary antibodies. Alternate peptide
conjugation chemistries may also be used. Forward primers were all
conjugated with biotin.
B) Preparation of Paramagnetic Microbeads
[0192] Monodisperse streptavidin-coated magnetic beads (MyOne
Streptavidin Cl Dynabeads) were purchased from Dynal, Carlsbad
Calif. and washed and resuspended in 0.9.times.PBS, 30 mg/mL BSA
and 1% TritonX100 with 5% (v/v) of a solution of 80 mM MgCl.sub.2,
0.24% TritonX100, 1% BSA, in 0.5M TRIS pH 8 before use.
C) Preparation of Test Pads
[0193] A microfluidic device was built from stencil-cut laminates
and contained multiple detection chambers of the form illustrated
in FIG. 9. Each detection chamber was formed with an inlet port and
an outlet port fluidically connected to the detection chamber by
microfluidic channels. Sufficient detection chambers were built for
the experiment.
[0194] Before final assembly, test pads in the detection chamber
were masked and plasma treated with oxygen gas. Peptidyl
hapten-specific antibodies (Research Diagnostics, Flanders N.J.)
and negative control solution were spotted on the test pads, 1 uL
per pad, and dried in place under vacuum. Each detection chamber
contained one test pad corresponding to each primer set and a
negative control. The fully assembled device was treated with
blocking/wash solution consisting of 0.9.times.PBS, 30 mg/mL BSA
and 1% TritonX100 to passivate untreated plastic surfaces. The
blocking solution was removed before use and the chambers were
dried.
D) Assay Protocol
[0195] Using known DNA samples from enteric pathogens, PCR was
performed with the prepared primer sets (above) for 35 cycles.
Platinum Quantitative RT-PCR Thermoscript One-Step System reagents
were used for the amplification. Successful amplification was
confirmed by 5% agarose gel electrophoresis. Amplicon 10 uL was
then resuspended with 5 uL of beads (above) in about 20 uL of
buffer containing 10 mM MgCl.sub.2, 0.5% BSA, 0.1% TritonX100 and 5
mM TRIS Buffer pH 8 and the bulk of this solution was loaded into a
detection chamber. Each amplicon product corresponded to a single
primer set and was loaded into a separate detection chamber.
[0196] The beads were first captured with a magnet positioned on
the bottom of the detection chamber and the excess solution was
removed. The magnet was then used to smear the bead paste onto,
through and across the test pads, and the mixture was then allowed
to incubate 1 min. With the magnet positioned on the bottom of the
well, the well was gradually filled with blocking solution. The
magnet was moved along the flow of the buffer, creating a bead
front on the bottom layer of the detection chamber. The magnet was
then shifted to the top of the detection chamber, lifting unbound
beads out of the test pad areas. The unbound material could be
resuspended in flowing buffer and rinsed to waste. The test pads
were then rinsed with 1 volume of fresh buffer. Bright orange test
pad "stripes" were immediately visible and were determined to
correctly reflect specificity of binding of the hapten-tagged
amplicon to the test pad containing the complementary antibody.
Because the detection chambers were aligned in parallel when
constructed, a stairstep pattern was evident after all the amplicon
bead mixtures were processed because each tagged amplicon was bound
by only one test pad in each detection chamber.
[0197] Upon clearing, positive tests were immediately visible as
bright orange bands corresponding to the location of particular
test strips. Negative test strips and negative controls remained
translucent and uncolored. The results could be easily decoded by
matching the location of the stained test pad with a key of the
antibodies used in spotting.
EXAMPLE 2
[0198] PCR amplification was performed in a microfluidic device as
follows:
[0199] A microfluidic device was built from stencil-cut laminates.
Before final assembly, biotin- and hapten-tagged primer pairs,
dATP, dCTP, dGTP and dTTP, TAQ polymerase, and a matrix consisting
of TritonX100, BSA, PEG and Trehalose plus magnesium chloride were
deposited in the amplification channel or chamber and dried in
place under vacuum. Streptavidin-coated magnetic beads (Dynal MyOne
Streptavidin Cl, Carlsbad Calif.) were spotted and dried in a
chamber adjoining the amplification channels or chambers. Test pad
areas in the detection chamber were stenciled (see FIG. 21 for
general approach) and gas plasma treated, before antibody solutions
were applied and dried in place. Antibody spots were blocked with
StabilCoat (SurModics, Eden Prairie Minn.). The device was then
treated with a TritonX100:BSA buffer to passivate untreated plastic
surfaces.
The following reagents were also prepared:
Lysis Buffer
[0200] 4.5M Guanidinium thiocyanate
[0201] 5% TritonX100
[0202] 1% Sarcosine
[0203] 50 mM MES, pH 5.5
[0204] 20 mM EDTA
Wash Reagent
[0205] Anhydrous ethanol
Elution Buffer E11
[0206] 1% TritonX100
[0207] 0.1 mM EDTA
[0208] 20 mM TRIS pH8.0
[0209] 50 U RNAsin (Promega)
Rehydration Buffer
[0210] 1% TritonX100
[0211] 0.5% NaCl
[0212] 10 mg/mL Bovine Serum Albumin
[0213] 50 mM TRIS pH 8.0
[0214] Lysis Buffer, Wash Reagent, Elution Buffer, and Rehydration
Buffer were aliquoted into sealed blister packs in designated
chambers of the device. The device was then fully assembled and
placed in a pneumatic controller with variable temperature TEC
heating blocks positioned under the PCR fluidics and thermal
interface assembly.
[0215] Clinical swab samples from diarrhoeal patients known to
contain pathogenic microorganisms were handled with gloves in a
biosafety cabinet. Each rectal swab was mixed vigorously with 400
uL of TE to solubilize the contents. Using filter-plugged pipet
tips, about 400 uL of homogenate was then transferred to the sample
port of the microfluidic device and the sample port was closed. All
other steps were performed in the single-entry device, with no
other operator exposure.
[0216] The remaining assay steps were automated.
[0217] An on-board sanitary bellows pump was used to pull sample
through a pre-filter consisting of a depth filter element, made of
polypropylene for example, supported on a laser-cut plastic ribs. A
valve was then used to close the sample port. The crude filtrate
was then mixed with lysis buffer and drawn through a glass fiber
filter to trap nucleic acids, and the filter retentate was rinsed
thoroughly with ethanol. All rinses were sequestered in an onboard
waste receptacle which vents through a 0.45 micron hydrophobic
membrane filter. The nucleic acids on the glass fiber membrane were
then eluted with elution buffer and ported into the reaction
channel containing primers, dNTPs, polymerase, magnesium, buffer
and surface active agents in dehydrated form. The reaction mixture,
in a volume of about 50 uL, was then heated to 95.degree. C. in the
PCR fluidics and thermal interface assembly for about 10 sec to
effect denaturation of double stranded sequences and secondary
structure in the sample. Heating and cooling was supplied by
external Peltier chips mounted on suitable heat sinks and PID
controlled within a 1.degree. C. range from setpoint. Immediately
thereafter, the temperature was returned to about 60.degree. C. for
a first round of annealing and extension, which was continued for
about 20 sec. Thermocycling was repeated for 40 cycles over an 18
min period.
[0218] Following extraction and amplification, the amplicon
products were moved to a mag mix chamber for mixing
streptavidin-labelled magnetic beads (Dynal, MyOne Streptavidin C1)
which had been rehydrated in Rehydration Buffer. This mixture was
incubated with gentle mixing and then transferred to a MagnaFlow
chamber. Optionally the reaction mix can be rinsed to remove
unreacted hapten-conjugated primer while holding the magnetic beads
in place. Using permanent magnets mounted on an X-Y stage, the
coated beads with putative target amplicon were brought into
contact with the capture antibody test pads or array in the
detection chamber, and unbound beads were moved away from the test
pads with a moving magnetic field and sent to waste. Primers and
non-specific amplicons were rinsed from the chamber with an excess
of rehydration buffer, which again was discarded into on-board
waste.
[0219] Upon clearing, positive tests were readily visible as orange
bands corresponding to the location of particular test strips.
Negative test strips remained translucent and uncolored. Time
following transfer of amplification mixture to detection event was
about 4 min. Knowing the identity of each immobilized antibody, the
results could be easily decoded. In best practice to this date, the
time from amplification to data presentation is less than 4
minutes.
[0220] In a test run with clinical samples, pathogens in 46 out of
47 stools were scored correctly in screening with the Magnaflow
device. One sample previously identified as containing Salmonella
by culture was identified as also containing enterotoxigenic E.
Coli O157H1 by Magnaflow, (i.e., a double infection). For this
example, the following primer pairs were obtained by custom
synthesis and chemically conjugated by methods known in the
art.
TABLE-US-00002 5'-Peptidyl Oligomers 3' Target Gene Primer Target
Sequence Hapten conjugate InvA CAATGTAGAACGACCCCATAAACA EQKLISEEDL'
(SEQ ID NO:15) (SEQ ID NO:8) Gyrase A GCCATTCTAACCAAAGCATCATA
DTYRYI' (SEQ ID NO:16) (SEQ ID NO:13) ipaH ACTCCCGACACGCCATAGAA
QPELAPEDPED' (SEQ ID NO:17) (SEQ ID NO:14) Eae
CTATCCAACAAGTTCAATTCATCC TDFYLK' (SEQ ID NO:18) (SEQ ID NO:12)
Stx1A AGACGTATGTAGATTCGCTGAA YTDIEMNRLGK' (SEQ ID NO:19) (SEQ ID
NO:10) Stx2A CTGGATGCATCTCTGGTCAT CEEEEYMPME' (SEQ ID NO:20) (SEQ
ID NO:11) Ma1B GGCGAATACCCAGCGACAT YPYDVPDYA' (SEQ ID NO:21) (SEQ
ID NO:9) 5'-Biotinylated Oligomers 5'-Target Gene Primer Target
Sequence Primer Conjugate InvA TATCTGGTTGATTTCCTGATCGC Biotin (SEQ
ID NO:22) Gyrase A AAATGATGAGGCAAAAAGTAGAACA Biotin (SEQ ID NO:23)
ipaH GGACATTGCCCGGGATAAA Biotin (SEQ ID NO:24) Eae
TTACCCGACGCCTCAAAC Biotin (SEQ ID NO:25) Stx1A
AGACGTATGTAGATTCGCTGAA Biotin (SEQ ID NO:26) Stx2A
GGAATGCAAATCAGTCGTCA Biotin (SEQ ID NO:27) MalB GCCGATGCCAAATCGTCAG
Biotin (SEQ ID NO:28)
[0221] Forward primers for this example were conjugated with
biotin. Reverse primers were conjugated with peptide haptens for
which antibodies were available (Research Diagnostics, Flanders
N.J.). Covalent attachment of the haptens was at the 5' terminus of
the oligomer. Peptides were activated at the amino terminus for
coupling.
EXAMPLE 3
[0222] A result of an assay in which the targets of Example 2 were
extracted, amplified and detected is shown in FIG. 6.
EXAMPLE 4
[0223] A respiratory panel containing biotinylated and peptidyl
hapten-tagged primer pairs is designed. The primers are synthesized
and then deposited in separate amplification channels or chambers
of a device. Following the procedure of Example 2, throat swab
washings are analyzed. A mini-bead impact mill is used to prepare
the sample prior to analysis. A result is displayed in the
detection chamber. The product is packaged as a kit.
EXAMPLE 5
[0224] A sexually transmitted disease panel containing biotinylated
and peptidyl hapten-tagged primer pairs is designed and the primers
are synthesized. The primers are then deposited in separate
amplification channels or chambers of a device. Following the
procedure of Example 2, vaginal swab washings are analyzed. A
detection endpoint is displayed in the detection chamber. The
product is packaged as a kit.
EXAMPLE 6
[0225] An oncogene panel containing biotinylated and peptidyl
hapten-tagged primer pairs is designed and the primers are
synthesized. The primers are then deposited in a common
amplification channel or chamber. Following PCR amplification, the
amplification products are detected in a detection station. The
product is packaged as a kit.
[0226] While the above description contains specificities, these
specificities should not be construed as limitations on the scope
of the invention, but rather as exemplifications of embodiments of
the invention. That is to say, the foregoing description of the
invention is exemplary for purposes of illustration and
explanation. Without departing from the spirit and scope of this
invention, one skilled in the art can make various changes and
modifications to the invention to adapt it to various usages and
conditions without inventive step. As such, these changes and
modifications are properly, equitably, and intended to be within
the full range of equivalence of the following claims. Thus the
scope of the invention should be determined by the appended claims
and their legal equivalents, rather than by the examples given.
Sequence CWU 1
1
28118DNAArtificial SequencePrimer 1cgccagtacg atattcag
18223DNAArtificial SequencePrimer 2acctggacat cacggctttc aac
23320DNAArtificial SequencePrimer 3cctattgcag agcgaatgac
20420DNAArtificial SequencePrimer 4tgaactccat taacgccaga
20519DNAArtificial SequencePrimer 5cgacctgacc aaatgccag
19624DNAArtificial SequencePrimer 6cctataacag cacccactat acgg
24719DNAArtificial SequencePrimer 7ctctgcgagc atggtctgg
19810PRTArtificial SequencePeptide epitope selected on availability
of complementary antibodies 8Glu Gln Lys Leu Ile Ser Glu Glu Asp
Leu1 5 1099PRTArtificial SequencePeptide epitope selected on
availability of complementary antibodies 9Tyr Pro Tyr Asp Val Pro
Asp Tyr Ala1 51011PRTArtificial SequencePeptide epitope selected on
availability of complementary antibodies 10Tyr Thr Asp Ile Glu Met
Asn Arg Leu Gly Lys1 5 101110PRTArtificial SequencePeptide epitope
selected on availability of complementary antibodies 11Cys Glu Glu
Glu Glu Tyr Met Pro Met Glu1 5 10126PRTArtificial SequencePeptide
epitope selected on availability of complementary antibodies 12Thr
Asp Phe Tyr Leu Lys1 5136PRTArtificial SequencePeptide epitope
selected on availability of complementary antibodies 13Asp Thr Tyr
Arg Tyr Ile1 51411PRTArtificial SequencePeptide epitope selected on
availability of complementary antibodies 14Gln Pro Glu Leu Ala Pro
Glu Asp Pro Glu Asp1 5 101524DNAArtificial Sequence3' Primer -
Peptidyl Oligomer 15caatgtagaa cgaccccata aaca 241623DNAArtificial
Sequence3' Primer - Peptidyl Oligomer 16gccattctaa ccaaagcatc ata
231720DNAArtificial Sequence3' Primer - Peptidyl Oligomer
17actcccgaca cgccatagaa 201824DNAArtificial Sequence3' Primer -
Peptidyl Oligomer 18ctatccaaca agttcaattc atcc 241922DNAArtificial
Sequence3' Primer - Peptidyl Oligomer 19agacgtatgt agattcgctg aa
222020DNAArtificial Sequence3' Primer - Peptidyl Oligomer
20ctggatgcat ctctggtcat 202119DNAArtificial Sequence3' Primer -
Peptidyl Oligomer 21ggcgaatacc cagcgacat 192223DNAArtificial
Sequence5' Primer - Biotinylated Oligomer 22tatctggttg atttcctgat
cgc 232325DNAArtificial Sequence5' Primer - Biotinylated Oligomer
23aaatgatgag gcaaaaagta gaaca 252419DNAArtificial Sequence5' Primer
- Biotinylated Oligomer 24ggacattgcc cgggataaa 192518DNAArtificial
Sequence5' Primer - Biotinylated Oligomer 25ttacccgacg cctcaaac
182622DNAArtificial Sequence5' Primer - Biotinylated Oligomer
26agacgtatgt agattcgctg aa 222720DNAArtificial Sequence5' Primer -
Biotinylated Oligomer 27ggaatgcaaa tcagtcgtca 202819DNAArtificial
Sequence5' Primer - Biotinylated Oligomer 28gccgatgcca aatcgtcag
19
* * * * *