U.S. patent application number 12/218840 was filed with the patent office on 2009-06-11 for methods, compositions, and kits relating to chitinases and chitinase-like molecules and inflammatory disease.
This patent application is currently assigned to Yale University. Invention is credited to Jack A. Elias, Zhou Zhu.
Application Number | 20090148539 12/218840 |
Document ID | / |
Family ID | 23189747 |
Filed Date | 2009-06-11 |
United States Patent
Application |
20090148539 |
Kind Code |
A1 |
Elias; Jack A. ; et
al. |
June 11, 2009 |
Methods, compositions, and kits relating to chitinases and
chitinase-like molecules and inflammatory disease
Abstract
The present invention includes compositions and methods for the
treatment of inflammatory disease (e.g. asthma, COPD, inflammatory
bowel disease, atopic dermatitis, atopy, allergy, allergic
rhinitis, scleroderma, and the like), relating to inhibiting a
chitinase-like molecule. The invention further includes methods to
identify new compounds for the treatment of inflammatory disease,
including, but not limited to, asthma, COPD and the like. This is
because the present invention demonstrates, for the first time,
that expression of IL-13, and of a chitinase-like molecule,
mediates and/or is associated with inflammatory disease and that
inhibiting the chitinase-like molecule treats and even prevents,
the disease. Thus, the invention relates to the novel discovery
that inhibiting a chitinase-like molecule treats and prevents an
inflammatory disease.
Inventors: |
Elias; Jack A.; (Woodbridge,
CT) ; Zhu; Zhou; (Woodbridge, CT) |
Correspondence
Address: |
ROPES & GRAY LLP
PATENT DOCKETING 39/41, ONE INTERNATIONAL PLACE
BOSTON
MA
02110-2624
US
|
Assignee: |
Yale University
New Haven
CT
|
Family ID: |
23189747 |
Appl. No.: |
12/218840 |
Filed: |
July 18, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10980354 |
Nov 3, 2004 |
|
|
|
12218840 |
|
|
|
|
10202436 |
Jul 23, 2002 |
7214373 |
|
|
10980354 |
|
|
|
|
60307432 |
Jul 24, 2001 |
|
|
|
Current U.S.
Class: |
424/630 ;
424/641; 424/644; 514/1.1; 514/251; 514/27; 514/279; 514/3.3 |
Current CPC
Class: |
A61P 1/00 20180101; A61P
11/08 20180101; Y10S 530/868 20130101; A61K 38/12 20130101; A61P
29/00 20180101; C07K 16/18 20130101; C07K 16/40 20130101; C12Y
302/01014 20130101; C12N 9/2442 20130101; A61P 11/06 20180101; A61K
39/395 20130101; A61P 37/08 20180101; A61K 31/00 20130101; Y10S
424/81 20130101; A61K 31/70 20130101; A61P 9/00 20180101; A61P
11/00 20180101; C07K 2317/77 20130101 |
Class at
Publication: |
424/630 ; 514/27;
514/279; 514/9; 514/251; 424/641; 424/644 |
International
Class: |
A61K 33/34 20060101
A61K033/34; A61K 31/7042 20060101 A61K031/7042; A61K 31/4353
20060101 A61K031/4353; A61K 33/30 20060101 A61K033/30; A61P 29/00
20060101 A61P029/00; A61K 33/28 20060101 A61K033/28; A61K 38/12
20060101 A61K038/12; A61K 31/525 20060101 A61K031/525 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was supported in part by funds obtained from
the U.S. Government (National Institutes of Health Grant Numbers
R01-HL-64242, R01-HL66571, and P01-HL-56389) and the U.S.
Government may therefore have certain rights in the invention.
Claims
1-41. (canceled)
42. A method of treating an inflammatory disease in a mammal,
wherein said disease is associated with an increased level of a
chitinase-like molecule, comprising administering an effective
amount of a chemical compound inhibitor of the chitinase-like
molecule to said mammal, thereby treating said inflammatory
disease.
43. The method of claim 42, wherein said mammal is a human.
44. The method of claim 42, wherein said chitinase-like molecule is
selected from the group consisting of a YM-1, a YM-2, an acidic
mammalian chitinase (AMCase), an oviductal glycoprotein 1, a
cartilage glycoprotein 1, a chitotriosidase, a mucin 9, a cartilage
glycoprotein-39, YKL-40, chitinase 3-like-1 and a chondrocyte
protein 39.
45. The method of claim 42, wherein said chemical compound is
selected from the group consisting of allosamidin, glucoallosamidin
A, glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, stylogaunidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
46. The method of claim 42, wherein said inflammatory disease is
selected from the group consisting of asthma, chronic obstructive
pulmonary disease, interstitial lung disease, chronic obstructive
lung disease, chronic bronchitis, eosinophilic bronchitis,
eosinophilic pneumonia, pneumonia, inflammatory bowel disease,
atopic dermatitis, atopy, allergy, allergic rhinitis, idiopathic
pulmonary fibrosis, scleroderma, and emphysema.
47. A method of preventing an inflammatory disease in a mammal,
wherein said disease is associated with an increased level of a
chitinase-like molecule, comprising administering an effective
amount of a chemical compound inhibitor of the chitinase-like
molecule to said mammal, thereby preventing said inflammatory
disease.
48. The method of claim 47, wherein said mammal is a human.
49. The method of claim 47, wherein said chitinase-like molecule is
selected from the group consisting of a YM-1, a YM-2, an AMCase, an
oviductal glycoprotein 1, a cartilage glycoprotein 1, a
chitotriosidase, a mucin 9, a cartilage glycoprotein-39, YKL-40,
chitinase 3-like-1 and a chondrocyte protein 39.
50. The method of claim 47, wherein said inflammatory disease is
selected from the group consisting of asthma, chronic obstructive
pulmonary disease, interstitial lung disease, chronic obstructive
lung disease, chronic bronchitis, eosinophilic bronchitis,
eosinophilic pneumonia, pneumonia, inflammatory bowel disease,
atopic dermatitis, atopy, allergy, allergic rhinitis, idiopathic
pulmonary fibrosis, scleroderma, and emphysema.
51. The method of claim 47, wherein said chemical compound is
selected from the group consisting of allosamidin, glucoallosamidin
A, glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, styloguanidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
52. A method of treating an inflammatory disease in a mammal,
wherein said disease is associated with an increased level of
chitinase, comprising administering an effective amount of a
chemical compound inhibitor of chitinase to said mammal, thereby
treating said inflammatory disease.
53. The method of claim 52, wherein said mammal is a human.
54. The method of claim 52, wherein said chitinase is AMCase or
chitotriosidase.
55. The method of claim 52, wherein said chemical compound is
selected from the group consisting of allosamidin, glucoallosamidin
A, glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, styloguanidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
56. The method of claim 52, wherein said inflammatory disease is
selected from the group consisting of asthma, chronic obstructive
pulmonary disease, interstitial lung disease, chronic obstructive
lung disease, chronic bronchitis, eosinophilic bronchitis,
eosinophilic pneumonia, pneumonia, inflammatory bowel disease,
atopic dermatitis, atopy, allergy, allergic rhinitis, idiopathic
pulmonary fibrosis, scleroderma, and emphysema.
57. A method for treating an inflammatory disease in a mammal,
wherein said disease is associated with an increased level of
interleukin-13, comprising administering an effective amount of
chemical compound inhibitor of a chitinase-like molecule to said
mammal, thereby treating said inflammatory disease.
58. The method of claim 57, wherein said mammal is a human.
59. The method of claim 57, wherein said chitinase-like molecule is
selected from the group consisting of a YM-1, a YM-2, an AMCase, an
oviductal glycoprotein 1, a cartilage glycoprotein 1, a
chitotriosidase, a mucin 9, a cartilage glycoprotein-39, YKL-40,
chitinase 3-like-1 and a chondrocyte protein 39.
60. The method of claim 57, wherein said inflammatory disease is
selected from the group consisting of asthma and chronic
obstructive pulmonary disease.
61. The method of claim 57, wherein said chemical compound is
selected from the group consisting of allosamidin, glucoallosamidin
A, glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, styloguanidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
62. A method for treating an inflammatory disease in a mammal,
wherein said disease is associated with a Th2 inflammatory
response, comprising administering an effective amount of a
chemical compound inhibitor of a chitinase-like molecule to said
mammal, thereby treating said inflammatory disease.
63. The method of claim 62, wherein said mammal is a human.
64. The method of claim 62, wherein said chitinase-like molecule is
selected from the group consisting of a YM-1, a YM-2, an AMCase, an
oviductal glycoprotein 1, a cartilage glycoprotein 1, a
chitotriosidase, a mucin 9, a cartilage glycoprotein-39, YKL-40,
chitinase 3-like-I and a chondrocyte protein 39.
65. The method of claim 62, wherein inflammatory said disease is
selected from the group consisting of asthma, chronic obstructive
pulmonary disease, interstitial lung disease, chronic obstructive
lung disease, chronic bronchitis, eosinophilic bronchitis,
eosinophilic pneumonia, pneumonia, inflammatory bowel disease,
atopic dermatitis, atopy, allergy, allergic rhinitis, idiopathic
pulmonary fibrosis, scleroderma, and emphysema.
66. The method of claim 62, wherein said chemical compound is
selected from the group consisting of allosamidin, glucoallosamidin
A, glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, styloguanidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
67. A method of inhibiting an activity of a chitinase-like molecule
in a mammal, comprising administering an effective amount of a
chemical compound inhibitor of the chitinase-like molecule to said
mammal.
68. The method of claim 67, wherein said mammal is suffering from
an inflammatory disease associated with an increased level of a
chitinase-like molecule.
69. The method of claim 68, wherein said inflammatory disease is
selected from the group consisting of asthma, chronic obstructive
pulmonary disease, interstitial lung disease, chronic obstructive
lung disease, chronic bronchitis, eosinophilic bronchitis,
eosinophilic pneumonia, pneumonia, inflammatory bowel disease,
atopic dermatitis, atopy, allergy, allergic rhinitis, idiopathic
pulmonary fibrosis, scleroderma, and emphysema.
70. The method of claim 67, wherein said mammal is a human.
71. The method of claim 67, wherein said chitinase-like molecule is
selected from the group consisting of a YM-1, a YM-2, an acidic
mammalian chitinase (AMCase), an oviductal glycoprotein 1, a
cartilage glycoprotein 1, a chitotriosidase, a mucin 9, a cartilage
glycoprotein-39, YKL-40, chitinase 3-like-1 and a chondrocyte
protein 39.
72. The method of claim 67, wherein said chemical compound is
selected from the group consisting of allosamidin, glucoallosamidin
A, glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, styloguanidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 10/980,354, filed Nov. 3, 2004, which is a continuation of
U.S. patent application Ser. No. 10/202,436, filed Jul. 23, 2002
(now U.S. Pat. No. 7,214,373), which claims the benefit of U.S.
Provisional Application No. 60/307,432, filed Jul. 24, 2001, all of
which applications are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] The prevalence of asthma has been steadily increasing for
the past two decades, with an estimated 17 million cases in the
United States alone. Once believed to be primarily a dysfunction in
the contractile mechanisms of airway smooth muscles, recent studies
have indicated the role of the immune system and inflammation in
asthma and other pulmonary diseases.
[0004] Asthma is now characterized as a complex inflammatory
disease attributed to the inappropriate stimulation of the immune
system. In some cases, the inflammation is triggered by airborne
antigens. In others, exogenous triggers cannot be defined
(intrinsic asthma). The immune cells and mediators implicated in
asthmatic inflammation include IgE, mast cells, eosinophils, T
cells, interleukin-4 (IL-4), IL-5, IL-9, IL-13 and other cytokines
(Bradding et al., 1994, Am. J. Respir. Cell Mol. Biol. 10:471-480;
Bradding et al., 1997, Airway Wall Remodeling in Asthma, CRC Press,
Boca Raton, Fla.; Nicolaides et al., 1997, Proc. Natl. Acad. Sci.
USA 94:13175-13180; Wills-Karp, 1998, Science 282:2258-2260; Hamid
et al., 1991, J. Clin. Invest. 87:1541-1546; Kotsimbos et al.,
1996, Proc. Assoc. Am. Physicians 108:368-373). Of these immune
cells and mediators, the role of T-helper type 2 (Th2) cells and
cytokines is proving to be increasingly important, as they are
believed to be responsible for initiation and maintenance of airway
inflammation, as well as vital to B cell regulation, eosinophil
function, mucus responses, and stimulation of airway remodeling
(Elias et al., 1999, J. Clin. Invest. 104:1001-1006; Ray et al.,
1999, J. Clin Invest. 104:985-993).
[0005] Immune-mediated inflammation is thought to lead to airway
remodeling, or structural modifications, in the asthmatic airway.
The end result of remodeling is believed to contribute to both the
symptoms and physiological dysregulation of asthma. Remodeling is
often characterized by airway thickening, mucus metaplasia,
epithelial hypertrophy and airway fibrosis. Extensive fibrosis is
widely considered to increase disease severity, airway
hyperresponsiveness (AHR) and contribute to the generation of
incompletely reversible airway obstruction (Elias et al., 1999, J.
Clin. Invest. 104:1001-1006). Therefore, the successful design of
therapeutics for the treatment of asthma requires an understanding
of both the mechanisms of inflammation and the processes of injury
and wound healing in the respiratory system.
[0006] Two prominent cytokines, IL-4 and IL-13, are believed to
play an important role in the inflammation and airway remodeling of
asthma and other pulmonary diseases. IL-4 and IL-13 are similar in
that they are both produced by the same subset of Th2 helper T
cells, have overlapping effector profiles, and share a receptor
component and signaling pathways. However, the critical role of
IL-13 over IL-4 in AHR, eosinophil recruitment, mucus
overproduction, and other symptoms of asthma has been conclusively
demonstrated (Wills-Karp, 1998, Science 282:2258-2260, Grunig et
al. 1998, Science 282:2261-2263). Overexpression of IL-13 in the
murine lung results in eosinophil, lymphocyte, and macrophage rich
inflammation, mucus metaplasia, airway fibrosis, and AHR after
methacholine challenge (Zheng et al., 1999 J. Clin. Invest.
103:779-788). Further, polymorphisms in both the IL-13 promoter and
the coding region have been associated with the asthmatic phenotype
(Heinzmann et al., 2000, Hum. Mol. Genet. 9:549-559). These results
suggest that abnormal IL-13 production is a critical component of
asthmatic inflammation and airway remodeling.
[0007] The role of IL-13 in inflammatory pulmonary diseases is not
limited to asthma. Chronic obstructive pulmonary disease (COPD,
clinically defined as chronic bronchitis, emphysema, and chronic
obstructive lung disease) has long been thought of as a distinct
disease from asthma. However, the similarities between the two
diseases have been noted and have resulted in the formulation of
the "Dutch Hypothesis", that was first proposed in 1961. The most
recent revision of the Dutch Hypothesis proposes that asthma and
COPD, in some individuals, are not distinct processes, and that
common pathogenic mechanism underlie these disorders. The
hypothesis further states that a genetic predisposition to develop
atopy, asthma, AHR and/or increased levels of IgE predispose
cigarette smokers to develop COPD (Vestbo and Prescott, 1997,
Lancet 350:1431-1434). Further, overexpression of IL-13 in the
murine lung causes emphysema and COPD-like mucus metaplasia, IL-13
is overexpressed in biopsy and autopsy lung tissue from patients
with COPD, and polymorphisms of IL-13 have been described that
correlate with the presence of COPD. When these results are viewed
in light of the Dutch Hypothesis, not only are asthma and COPD more
closely related than previously thought, but the central role of
IL-13 dysregulation in these pulmonary inflammatory disorders
becomes more prominent.
[0008] The progress in illuminating the underlying mechanisms and
causes of asthma, COPD and related pulmonary inflammatory disorders
is striking considering the fact that what was once thought of as a
malfunction of bronchial muscle contraction can now be linked to
specific cytokines and cell types. Despite this progress, asthma
remains, along with tuberculosis and AIDS, the only chronic disease
with an increasing death rate. In addition, by 2020, COPD is
expected to be the fourth leading cause of death in the world.
[0009] To counter the increasing morbidity and mortality due to
asthma, the arsenal of medications for the treatment of asthma is
ever increasing.
[0010] Asthma medications fall into two general categories,
controllers and relievers. Controllers are for the prevention of
asthma attacks before symptoms arise, and relievers are taken
during the midst of an asthma attack. Controllers include
corticosteroids, widely considered the most potent and effective
anti-inflammatory drugs available, cromolyn sodium and nedocromil,
milder anti-inflammatories often used in children, and long-acting
beta-2 agonists, which are bronchodilators. Relievers include short
acting beta-2 agonists and anticholinergenics, which are often used
a supplements or alternatives to beta-2 agonists.
[0011] While corticosteroids and other therapeutics target the
inflammatory-mediated symptoms of asthma, they often have
broad-ranging immunosuppressive properties, as well as other
deleterious side effects. As the physiological and biological
mechanisms of asthma are elucidated, development of specific and
effective drugs should closely follow, and the symptoms, morbidity,
and mortality of asthma should drop, instead of its current rise.
However, despite increased understanding of the underlying disease
mechanism and despite the increasing incidence of asthma, and
morbidity and death therefrom, there are currently a limited number
of effective and safe treatments for asthma, COPD and other
inflammatory diseases. In addition, there are no pharmacologic
drugs that alter the progression of COPD.
[0012] Thus, there is a long felt and acute need for specific,
effective treatments for asthma, COPD, and other inflammatory
diseases. The present invention meets this need.
BRIEF SUMMARY OF THE INVENTION
[0013] A method of treating an inflammatory disease in a mammal
wherein the disease is associated with an increased level of a
chitinase-like molecule. The method comprises administering an
effective amount of a chitinase-like molecule inhibitor to the
mammal, thereby treating the inflammatory disease in the
mammal.
[0014] In one aspect, the mammal is a human.
[0015] In another aspect, the chitinase-like molecule is selected
from the group consisting of a YM-1, a YM-2, an acidic mammalian
chitinase (AMCase), an oviductal glycoprotein 1, a cartilage
glycoprotein 1, a chitotriosidase, a mucin 9, a cartilage
glycoprotein-39, and a chondrocyte protein 39.
[0016] In another aspect, the chitinase-like molecule inhibitor is
selected from the group consisting of a chemical compound, an
antibody, a ribozyme, a nucleic acid, and an antisense nucleic acid
molecule.
[0017] In yet another aspect, the chemical compound is selected
from the group consisting of allosamidin, glucoallosamidin A,
glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, stylogaunidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
[0018] In a further aspect, the antibody specifically binds with a
chitinase-like molecule selected from the group consisting of a
YM-1, a YM-2, an acidic mammalian chitinase (AMCase), an oviductal
glycoprotein 1, a cartilage glycoprotein 1, a chitotriosidase, a
mucin 9, a cartilage glycoprotein-39, and a chondrocyte protein
39.
[0019] In another aspect, the antisense nucleic acid molecule is an
isolated nucleic acid complementary to an isolated nucleic acid
encoding the chitinase-like molecule, or a fragment thereof.
[0020] In yet another aspect, the ribozyme is an isolated enzymatic
nucleic acid, which specifically cleaves mRNA transcribed from a
nucleic acid encoding the chitinase-like molecule.
[0021] In a further aspect, the inflammatory disease is selected
from the group consisting of asthma, chronic obstructive pulmonary
disease, interstitial lung disease, chronic obstructive lung
disease, chronic bronchitis, eosinophilic bronchitis, eosinophilic
pneumonia, pneumonia, inflammatory bowel disease, atopic
dermatitis, atopy, allergy, allergic rhinitis, idiopathic pulmonary
fibrosis, scleroderma, and emphysema.
[0022] The invention includes a method of preventing an
inflammatory disease in a mammal wherein the disease is associated
with an increased level of a chitinase-like molecule. The method
comprises administering an effective amount of a chitinase-like
molecule inhibitor to the mammal, thereby preventing the
inflammatory disease in the mammal.
[0023] In one aspect, the mammal is a human.
[0024] In another aspect, the chitinase-like molecule is selected
from the group consisting of a YM-1, a YM-2, an acidic mammalian
chitinase (AMCase), an oviductal glycoprotein 1, a cartilage
glycoprotein 1, a chitotriosidase, a mucin 9, a cartilage
glycoprotein-39, and a chondrocyte protein 39.
[0025] In another aspect, the chitinase-like molecule inhibitor is
selected from the group consisting of a chemical compound, an
antibody, a ribozyme, a nucleic acid, and an antisense nucleic acid
molecule.
[0026] In a further aspect, the inflammatory disease is selected
from the group consisting of asthma, chronic obstructive pulmonary
disease, interstitial lung disease, chronic obstructive lung
disease, chronic bronchitis, eosinophilic bronchitis, eosinophilic
pneumonia, pneumonia, inflammatory bowel disease, atopic
dermatitis, atopy, allergy, allergic rhinitis, idiopathic pulmonary
fibrosis, scleroderma, and emphysema.
[0027] In yet another aspect, the chitinase-like molecule is a YM
protein and further wherein the chitinase-like molecule inhibitor
is selected from the group consisting of allosamidin,
glucoallosamidin A, glucoallosamidin B,
methyl-N-demethylallosamidin, demethylallosamidin,
didemthylallosamidin, styloguanidine, a styloguanidine derivative,
dipeptide cyclo-(L-Arg-D-Pro), dipeptide cyclo-(L-Arg-L-Pro),
dipeptide cyclo-(D-Arg-D-Pro), dipeptide cyclo-(D-Arg-L-Pro),
riboflavin, a flavin derivative, copper, zinc, and mercury.
[0028] In another aspect, the chitinase-like molecule is
AMCase.
[0029] The invention includes a method of treating an inflammatory
disease in a mammal wherein the disease is associated with an
increased level of chitinase. The method comprising administering
an effective amount of a chitinase inhibitor to the mammal, thereby
treating the inflammatory disease in the mammal.
[0030] In one aspect, the mammal is a human.
[0031] In another aspect, the chitinase is acidic mammalian
chitinase (AMCase) and the chitinase inhibitor is selected from the
group consisting of a chemical compound, an antibody, a ribozyme, a
nucleic acid, a nucleic acid, and an antisense nucleic acid
molecule.
[0032] In yet another aspect, the chemical compound is selected
from the group consisting of allosamidin, glucoallosamidin A,
glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, stylogaunidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
[0033] In one aspect, the antibody specifically binds with
AMCase.
[0034] In another aspect, the antisense nucleic acid molecule is an
isolated nucleic acid complementary to an isolated nucleic acid
encoding an AMCase, or a fragment thereof.
[0035] In yet another aspect, the inflammatory disease is selected
from the group consisting of asthma, chronic obstructive pulmonary
disease, interstitial lung disease, chronic obstructive lung
disease, chronic bronchitis, eosinophilic bronchitis, eosinophilic
pneumonia, pneumonia, inflammatory bowel disease, atopic
dermatitis, atopy, allergy, allergic rhinitis, idiopathic pulmonary
fibrosis, scleroderma, and emphysema.
[0036] The invention includes a method for treating an inflammatory
disease in a mammal wherein the disease is associated with an
increased level of interleukin-13. The method comprises
administering an effective amount of a chitinase-like molecule
inhibitor to the mammal, thereby treating the inflammatory disease
in a mammal.
[0037] In one aspect, the mammal is a human.
[0038] In another aspect, the chitinase-like molecule inhibitor is
selected from the group consisting of a chemical compound, an
antibody, a ribozyme, a nucleic acid, and an antisense nucleic acid
molecule.
[0039] The invention also includes a method for treating an
inflammatory disease in a mammal wherein the disease is associated
with a Th2 inflammatory response. The method comprises
administering an effective amount of a chitinase-like molecule
inhibitor to the mammal, thereby treating the inflammatory disease
in a mammal.
[0040] The invention includes a method of identifying a compound
useful for treating an inflammatory disease in a mammal. The method
comprises administering a compound to a mammal afflicted with an
inflammatory disease and comparing the level of a chitinase-like
molecule in the mammal with the level of the chitinase-like
molecule in the mammal prior to administration of the compound,
wherein a lower level of the chitinase-like molecule in the mammal
after administration of the compound compared with the level of the
chitinase-like molecule in the mammal prior to administration of
the compound is an indication that the compound is useful for
treating an inflammatory disease in the mammal, thereby identifying
a compound useful for treating an inflammatory disease. In one
aspect, the invention includes a compound identified using this
method.
[0041] In one aspect, the level of a chitinase-like molecule is
selected from the group consisting of the level of chitinase-like
molecule nucleic acid expression and the level of chitinase-like
molecule enzymatic activity.
[0042] In another aspect, the chitinase-like molecule is selected
from the group consisting of a YM-1, a YM-2, an acidic mammalian
chitinase (AMCase), an oviductal glycoprotein 1, a cartilage
glycoprotein 1, a chitotriosidase, a mucin 9, a cartilage
glycoprotein-39, and a chondrocyte protein 39.
[0043] In yet another aspect, the mammal is a mouse.
[0044] In a further aspect, the mouse is selected from the group
consisting of a transgenic mouse constitutively expressing
interleukin 13 and a transgenic mouse inducibly expressing
interleukin 13.
[0045] In another aspect, the chitinase-like molecule is AMCase. In
yet another aspect, the invention includes a compound identified
using this method.
[0046] The invention includes a method of identifying a compound
useful for treating an inflammatory disease. The method comprises
contacting a cell with a compound and comparing the level of a
chitinase-like molecule in the cell with the level of the
chitinase-like molecule in an otherwise identical cell not
contacted with the compound, wherein a lower level of the
chitinase-like molecule in the cell contacted with the compound
compared with the level of the chitinase-like molecule in the cell
not contacted with the compound is an indication that the compound
is useful for treating an inflammatory disease, thereby identifying
a compound useful for treating an inflammatory disease.
[0047] The invention includes a kit for treating an inflammatory
disease in a mammal wherein the disease is associated with an
increased level of a chitinase-like molecule. The kit comprises an
effective amount of a chitinase-like molecule inhibitor, and
further comprises an applicator and an instructional material for
the use thereof.
[0048] In one aspect, the chitinase-like molecule inhibitor is
selected from the group consisting of a chemical compound, an
antibody, a ribozyme, an antisense molecule, and a nucleic
acid.
[0049] In another aspect, the chemical compound is selected from
the group consisting of allosamidin, glucoallosamidin A,
glucoallosamidin B, methyl-N-demethylallosamidin,
demethylallosamidin, didemthylallosamidin, stylogaunidine, a
styloguanidine derivative, dipeptide cyclo-(L-Arg-D-Pro), dipeptide
cyclo-(L-Arg-L-Pro), dipeptide cyclo-(D-Arg-D-Pro), dipeptide
cyclo-(D-Arg-L-Pro), riboflavin, a flavin derivative, copper, zinc,
and mercury.
[0050] In yet another aspect, the chitinase-like molecule is
AMCase.
[0051] The invention includes a kit for preventing an inflammatory
disease in a mammal wherein the disease is associated with an
increased level of a chitinase-like molecule. The kit comprises an
effective amount of an chitinase-like molecule inhibitor, and
further comprises an applicator and an instructional material for
the use thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] For the purpose of illustrating the invention, there are
depicted in the drawings certain embodiments of the invention.
However, the invention is not limited to the precise arrangements
and instrumentalities of the embodiments depicted in the
drawings.
[0053] FIG. 1 depicts the levels of IL-13 mRNA from autopsy lung
tissues from smokers who died of COPD (S/C) and non-smokers without
COPD (N), as determined by RT-PCR. The arrow indicates IL-13
transcripts.
[0054] FIG. 2, comprising FIG. 2A through FIG. 2D, is an image
depicting hematoxylin and eosin (H&E) stained lung tissues from
control normal and CC10-IL13 (constitutively expressing IL-13)
mice. FIG. 2A (transgene (-), 100.times.) and FIG. 2B (transgene
(+), 100.times.) illustrate histologic tissue from the control and
CC10-I1-13 mice respectively. FIG. 2B demonstrates the eosinophil,
lymphocyte, and macrophage rich inflammation in the parenchyma of
the IL-13 overexpressing mice. FIG. 2C (transgene (-), 250.times.)
and FIG. 2D (transgene (+), 250.times.) compare the airway
epithelial cells of control normal mice and CC10-IL-13 transgenic
mice respectively. FIG. 2D illustrates the epithelial hypertrophy
in the airways of mice overexpressing IL-13.
[0055] FIG. 3, comprising FIG. 3A and FIG. 3B, is an image
depicting periodic acid-Schiff with diastase (D-PAS) staining of
airways from control and CC10-IL-13 mice. FIG. 3A depicts airways
from transgene (-) mice, and FIG. 3B depicts mucus metaplasia and
goblet cell hyperplasia in transgene (+) mice. Magnification is
100.times..
[0056] FIG. 4, comprising FIG. 4A and FIG. 4B, depicts trichrome
staining of airways in CC10-IL-13 mice. FIG. 4A depicts collagen
deposition in transgene (-) mice. FIG. 4B depicts enhanced collagen
deposition in transgene (+) mice.
[0057] FIG. 5 is a schematic representation of the doxycycline
(dox) inducible constructs used to generate the inducible
CC10-rtTA-IL-13 transgenic mice.
[0058] FIG. 6, comprising FIG. 6A through 6E, depicts histologic
and morphometric analysis of lungs from CC10-rtTA-IL-13 inducible
mice. Lungs were removed, fixed to pressure, and processed for
microscopy to show alveolar enlargement upon transgene induction
after dox administration. FIG. 6A depicts inducible transgene (+)
mice before dox administration. FIG. 6B depicts inducible transgene
(+) mice one day after dox administration. FIG. 6C depicts
inducible transgene (+) mice alveoli 1 week after dox
administration, and FIG. 6D shows considerable alveolar enlargement
in inducible transgene (+) mice 1 month after dox administration.
FIG. 6E is a graph depicting the morphometric analysis of inducible
transgene (+) mice. Four week old transgene (-) and (+) mice were
randomized to normal or dox water and maintained on these
treatments for one month. Lungs were removed, fixed to pressure,
and chord length measurements were taken. Chord lengths were
significantly larger in transgene (+) mice given dox than in
transgene (-) mice given dox or transgene (+) mice given normal
water.
[0059] FIG. 7 depicts crystal deposition in transgenic mice
constitutively expressing IL-13. Crystals were multi-faceted and
often needle-shaped.
[0060] FIG. 8 depicts a Coomassie blue stained SDS-PAGE gel
comprising partially purified crystals from bronchioalveolar lavage
(BAL) fluid of CC10-IL-13 transgenic mice. The single protein bands
had a molecular weight of approximately 45 kDa.
[0061] FIG. 9 depicts YM mRNA levels in the lungs of two month old
transgene (+) and (-) CC10-IL-13 mice as determined by reverse
transcriptase polymerase chain reaction (RT-PCR).
[0062] FIG. 10, comprising FIGS. 10A and 10B, depicts YM mRNA
levels in transgene (-) and (+) CC10-rtTA-IL-13 mice that were
randomized to normal or dox water starting at one month of age. In
FIG. 10A, lungs were removed, after one month of randomization,
total lung RNA was isolated, and YM gene expression was determined
using RT-PCR. FIG. 10B depicts YM mRNA after dox or normal water
administration for the indicated time intervals (w=week, m=month).
mRNA levels were normalized using .beta.-actin as a control.
[0063] FIG. 11, comprising FIG. 11A through FIG. 11H, depicts in
situ hybridization of lung tissue from CC10-IL-13 and control mice
to detect expression of YM in the tissues. FIG. 11A and FIG. 11B
depict lung tissue from transgene (+) mice probed with antisense
and sense probes, respectively. FIG. 11C and FIG. 11D depict lung
tissue from transgene (-) mice with antisense and sense probes,
respectively. FIG. 11E and FIG. 11F depict lung tissue from four
week old transgene (+) mice probed using antisense and sense
probes, respectively. FIG. 11G and FIG. 11H depict lung tissue from
10 week old transgene (+) mice probed with antisense and sense
probes, respectively.
[0064] FIG. 12 is a graph depicting chitinase activity in BAL
fluids obtained from 2 month old transgene (-) and transgene (+)
CC10-IL-13 animals. (p<0.05 versus transgene (-))
[0065] FIG. 13, comprising FIG. 13A and FIG. 13B, depicts acidic
mammalian chitinase (AMCase) expression and chitinase activity in
CC10-rtTA-IL-13 mice, respectively. FIG. 13A depicts the levels of
mRNA encoding AMCases in lungs from transgene (-) and (+) mouse
lungs that were placed on dox or normal water at one month of age
and kept on this regimen for the noted intervals. AMCase and
.beta.-actin expression were evaluated by RT-PCR. FIG. 13B is a
graph depicting chitinase activity in inducible transgene (+) and
(-) animals randomized to normal or dox water at one month of age.
BAL fluid chitinase activity was assessed at the noted intervals
after dox or normal water administration.
[0066] FIG. 14, comprising FIG. 14A through 14D, depicts
localization of AMCase expression in CC10-IL-13 mice using in situ
hybridization. FIG. 14A and FIG. 14B depicts transgene (+) mouse
lung tissue using antisense and sense probes, respectively. FIG.
14C and FIG. 14D depict transgene (-) mouse lung tissue using
antisense and sense probes, respectively.
[0067] FIG. 15, comprising FIG. 15A through FIG. 15C, depicts YM
and AMCase mRNA expression and chitinase activity in ovalbumin
(OVA) sensitized and challenged wild-type mice, as determined using
RT-PCR and chitinase activity assays, respectively. FIG. 15A
depicts YM mRNA expression at the noted intervals after OVA aerosol
challenge (d=days, h=hours). FIG. 15B depicts AMCase mRNA
expression at the noted intervals after OVA aerosol challenge. FIG.
15C depicts the significantly (*p<0.01) higher chitinase
activity detected in bronchoalveolar lavage fluids (BAL) from wild
type mice twenty-four hours and later after OVA aerosol
challenge.
[0068] FIG. 16, comprising FIG. 16A through 16G, depict the effects
of allosamidin (allos) on OVA sensitized and subsequently
challenged wild type animals. FIG. 16A is a graph depicting the
effect of daily allosamidin administration (1 mg/kg) on total BAL
cell recovery. Asterisks indicate significant (p<0.01) reduction
in total BAL cell recovery after allosamidin administration. FIG.
16B is a graph depicting the effect of daily allosamidin
administration (1 mg/kg) on the percentage of eosinophils recovered
in BAL fluid. Asterisks indicate significant (p<0.01) reduction
in the percentage of eosinophils recovered after allosamidin
administration. FIG. 16C is a graph depicting the effect of daily
allosamidin administration (1 mg/kg) on the total number of
eosinophils recovered in BAL fluid. Asterisks indicate significant
(p<0.01) reduction in total eosinophil recovery after
allosamidin administration. FIG. 16D is a graph depicting the
effect of daily allosamidin administration (1 mg/kg) on the number
of lymphocytes recovered in BAL fluid. Asterisks indicate
significant (p<0.01) reduction in total lymphocyte recovery
after allosamidin administration. FIG. 16E is a graph depicting the
dose dependent effect of allosamidin on total BAL cell recovery.
Daily allosamidin doses were given starting on Day one, and animals
were evaluated for total BAL cell recovery on Days two and seven
following OVA aerosol challenge. Asterisks indicate significant
(p<0.01) reduction in total BAL cell recovery after allosamidin
administration. FIG. 16F is a graph depicting the dose-dependent
effect of allosamidin on the percentage eosinophil recovery in BAL.
Asterisks indicate significant (p<0.01) reduction in percentage
of eosinophils in BAL cell recovery after allosamidin
administration. FIG. 16G is a graph depicting the dose-dependent
effect of allosamidin on the total eosinophil recovery in BAL.
Asterisks indicate significant (p<0.01) reduction in total
eosinophil BAL cell recovery after allosamidin administration.
[0069] FIG. 17 depicts the effects of allosamidin administration
(randomized to 1 mg/kg allosamidin or vehicle control, daily doses
intraperitoneally (i.p.) for 14 days) on lung size in five week old
CC10-IL-13 transgene (+) and (-) mice. Lungs were removed, fixed to
pressure, and assessed using volume displacement methodology as
described elsewhere herein.
[0070] FIG. 18, comprising FIGS. 18A and 18B, depicts the effects
of anti-AMCase antibodies on ovalbumin-induced BAL cell counts.
FIG. 18A is a graph depicting the effect of anti-AMCase antibodies
on total ovalbumin-induced BAL cell counts. Comparisons between
unchallenged (unchall) and mice that were sensitized to ovalbumin
and challenged on three successive days with ovalbumin were made at
a seven day time point. The mice were treated with 0.5 ml of
anti-AMCase antibodies or control serum (serum) intraperitoneally
every other day starting the day before the first aerosol exposure.
FIG. 18B is a graph depicting the effect of anti-AMCase antibodies
on the percentage of eosinophils in BAL fluids from our sensitized
and challenged mice. Comparisons between unchallenged (unchall) and
mice that were sensitized to ovalbumin and challenged on three
successive days with ovalbumin were made at a seven day time point.
The mice were treated with 0.5 ml of anti-AMCase antibodies or
control serum (serum) intraperitoneally every other day starting
the day before the first aerosol exposure.
[0071] FIG. 19 comprises FIGS. 19A through 19F. FIG. 19A through
19D are images depicting detectable AMCase mRNA using in situ
hybridization in autopsy lung samples from a patient with asthma
using an AMCase antisense probe (FIG. 19A). AMCase mRNA was not
detected in histologically normal control lung tissue obtained at
autopsy from patients without lung disease using the antisense
probe (FIG. 19B). In situ hybridization using a sense probe did not
detect AMCase in either fatal asthma tissue (FIG. 19C) or control
tissue (FIG. 19D). Epithelial cell (thick arrow) and macrophage
(thin arrow) staining in fatal asthma was detected (FIG. 19A).
FIGS. 19E and 19F are images depicting detectable AMCase mRNA using
in situ hybridization in alveolar macrophages present in autopsy
lung samples from patients with asthma using an AMCase antisense
probe (FIG. 19E). AMCase mRNA was not detected using a sense probe
(FIG. 19F). Further, AMCase mRNA was not detected in control lung
tissue obtained from patients without lung disease using the
antisense or sense probes.
DETAILED DESCRIPTION OF THE INVENTION
[0072] The invention includes a method of treating an inflammatory
disease in a mammal where the disease is associated with, or
mediated by, expression of a chitinase-like molecule. The method
comprises administering a chitinase-like molecule inhibitor to the
mammal. As the data disclosed elsewhere herein demonstrate,
increased level of a chitinase-like molecule, is associated with,
and/or mediates an inflammatory disease including, but not limited
to, asthma, chronic obstructive pulmonary disease, interstitial
lung disease, chronic obstructive lung disease, chronic bronchitis,
eosinophilic bronchitis, eosinophilic pneumonia, pneumonia,
inflammatory bowel disease, atopic dermatitis, atopy, allergy,
allergic rhinitis, idiopathic pulmonary fibrosis, scleroderma,
emphysema, and the like.
[0073] The data disclosed herein demonstrate that increased
expression, presence and/or activity of a chitinase-like molecule
is associated with and/or mediates various inflammatory
disease-associated etiologies including, but not limited to, tissue
inflammation, increased lung volume, increased eosinophils in
bronchoalveolar lavage (BAL) fluid, increased lymphocytes in BAL
fluid and tissues, increased total cells in BAL fluid, increased
alveolus size, increased airway resistance, increased mucus
metaplasia, increased mucin expression, increased parenchymal
fibrosis, increased airway remodeling, increased subepithelial
fibrosis, increased collagen deposition in airway tissue,
epithelial hypertrophy in the lung tissue, focal organization of
crystalline material into Masson body-like fibrotic foci, and the
like.
[0074] The data disclosed herein demonstrate, surprisingly, that
even though some chitinase-like molecules, for example, YM, do not
have detectable classical chitinase activity, administering a
chitinase-like molecule inhibitor, such as, but not limited to,
allosamidin, provides a therapeutic benefit and treats the disease.
Further, the data disclosed herein demonstrate, for the first time,
that administration an inhibitor of a chitinase-like molecule, e.g.
an antibody to AMCase, provides a therapeutic effect and treats the
disease. Indeed, the data demonstrate that administration of a
chitinase-like molecule inhibitor before onset of the disease state
serves to prevent the disease. Accordingly, the present invention
provides a novel method whereby administration of a chitinase-like
molecule inhibitor in a mammal afflicted with an inflammatory
disease treats and/or prevents the disease when the disease is
mediated by, or associated with, a chitinase-like molecule, even
though the chitinase-like molecule may or may not have detectable
chitinase activity.
DEFINITIONS
[0075] As used herein, each of the following terms has the meaning
associated with it in this section.
[0076] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e. to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0077] By the term "applicator" as the term is used herein, is
meant any device including, but not limited to, a hypodermic
syringe, a pipette, an intravenous infusion, topical cream and the
like, for administering the chitinase-like molecule inhibitor
chemical compound, an antibody, nucleic acid, protein, and/or
composition of the invention to a mammal.
[0078] "Chitinase," as used herein, refers to a family of
polypeptides comprising microbial and mammalian chitinases. A
chitinase of the present invention demonstrates detectable
chitinase activity, in that it specifically cleaves chitin in an
endochitinase manner.
[0079] "Chitinase-like molecule," as the term is used herein,
encompasses a family of polypeptides comprising proteins that are
defined by a certain degree of homology to known chitinases, but
may not demonstrate detectable chitinase activity. Chitinase-like
molecules include, but are not limited to acidic mammalian
chitinase (also referred to as eosinophil chemotactic cytokine and
exemplified by GenBank Acc. No. AF290003 and No. AF29004), YM1
(also known as chitinase 3-like 3, ECF-L precursor, as exemplified
by GenBank Acc. No. M94584), YM2 as exemplified by GenBank Acc. No.
AF461142, oviductal glycoprotein 1 as exemplified by GenBank Acc.
No. XM.sub.--131100, cartilage glycoprotein 1 (also referred to as
BRP-39, chitinase 3-like 1, GP-1-39, YKL-40 and exemplified by
GenBank Acc. No. X93035), chitotriosidase as exemplified by GenBank
Acc. No. NM.sub.--003465, oviductal glycoprotein 1 (also referred
to as mucin 9, oviductin and as exemplified by GenBank Acc. No.
NM.sub.--002557), cartilage glycoprotein-39 (also known as
chitinase 3-like 1, GP-39, YKL-40, as exemplified by GenBank Acc.
No. NM.sub.--001276), and chondrocyte protein 39 (also known as
chitinase 3-like 2, YKL-39, as exemplified by GenBank Acc. No.
NM.sub.--004000). Thus, the skilled artisan would appreciate, once
armed with the teachings provided herein, that the present
invention encompasses chitinase-like molecules that possess
detectable chitinase activity as well as those similar to the
afore-mentioned molecules in that the potential chitinase-like
molecules shares substantial sequence homology to the family of
proteins. The invention is not limited to these particular
chitinase-like molecules; rather, the invention includes other
chitinase-like molecules that share substantial homology with them
and/or which possess detectable chitinase activity, and encompasses
such molecules known in the art as well as those discovered in the
future.
[0080] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a
defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if
transcription and translation of mRNA corresponding to that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the
non-coding strand, used as the template for transcription of a gene
or cDNA, can be referred to as encoding the protein or other
product of that gene or cDNA.
[0081] As used herein, the term "fragment" as applied to a nucleic
acid, may ordinarily be at least about 20 nucleotides in length,
typically, at least about 50 nucleotides, more typically, from
about 50 to about 200 nucleotides, preferably, at least about 200
to about 300 nucleotides, even more preferably, at least about 300
nucleotides to about 400 nucleotides, yet even more preferably, at
least about 400 to about 500, even more preferably, at least about
500 nucleotides to about 600 nucleotides, yet even more preferably,
at least about 600 to about 700, even more preferably, at least
about 700 nucleotides to about 800 nucleotides, yet even more
preferably, at least about 800 to about 900, even more preferably,
at least about 900 nucleotides to about 1000 nucleotides, yet even
more preferably, at least about 1000 to about 1100, even more
preferably, at least about 1100 nucleotides to about 1200
nucleotides, yet even more preferably, at least about 1200 to about
1300, even more preferably, at least about 1300 nucleotides to
about 1400 nucleotides, yet even more preferably, at least about
1400 to about 1500, at least about 1500 to about 1550, even more
preferably, at least about 1550 nucleotides to about 1600
nucleotides, yet even more preferably, at least about 1600 to about
1620 and most preferably, the nucleic acid fragment will be greater
than about 1625 nucleotides in length.
[0082] "Homologous" as used herein, refers to the subunit sequence
similarity between two polymeric molecules, e.g. between two
nucleic acid molecules, e.g., two DNA molecules or two RNA
molecules, or between two polypeptide molecules. When a subunit
position in both of the two molecules is occupied by the same
monomeric subunit, e.g., if a position in each of two DNA molecules
is occupied by adenine, then they are homologous at that position.
The homology between two sequences is a direct function of the
number of matching or homologous positions, e.g. if half (e.g.,
five positions in a polymer ten subunits in length) of the
positions in two compound sequences are homologous then the two
sequences are 50% homologous, if 90% of the positions, e.g. 9 of
10, are matched or homologous, the two sequences share 90%
homology. By way of example, the DNA sequences 3'-ATTGCC-5' and
3'-TATGGC-5' share 75% homology.
[0083] By "chitinase-like molecule inhibitor" is meant a compound
that detectably inhibits the level of a chitinase-like molecule in
a cell or tissue when compared to the level of the chitinase-like
molecule in an otherwise identical cell or tissue in the absence of
the compound. The level of the chitinase-like molecule includes,
but is not limited to, the level of expression of a nucleic acid
encoding the molecule, the level of chitinase-like molecule
detectable, and/or the level of chitinase activity. Chitinase-like
molecule inhibitors include, but are not limited to, a chemical
compound (e.g., allosamidin, glucoallosamidin A, glucoallosamidin
B, methyl-N-demethylallosamidin, demethylallosamidin,
didemthylallosamidin, stylogaunidine, a styloguanidine derivative,
dipeptide cyclo-(L-Arg-D-Pro), dipeptide cyclo-(L-Arg-L-Pro),
dipeptide cyclo-(D-Arg-D-Pro), dipeptide cyclo-(D-Arg-L-Pro),
riboflavin, a flavin derivative), copper, zinc, mercury, an
antibody, a ribozyme, an antisense molecule, and a nucleic
acid.
[0084] An "AMCase inhibitor," as the term is used herein, includes
a chitinase-like molecule inhibitor, as defined previously, that
inhibits AMCase. Such inhibitor includes, but it not limited to, a
chemical compound, as well as a ribozyme, antisense molecule, an
antibody, and the like, that inhibits the level of AMCase
expression and/or activity in a cell or tissue compared with the
level of AMCase expression and/or activity in the cell or tissue in
the absence of the inhibitor, or in an otherwise identical cell or
tissue, in the absence of the inhibitor. The inhibitor includes,
but is not limited to, a chemical compound, a ribozyme, an
antisense nucleic acid molecule, an antibody, and the like.
[0085] As used herein, the terms "gene" and "recombinant gene"
refer to nucleic acid molecules comprising an open reading frame
encoding a polypeptide of the invention. Such natural allelic
variations can typically result in 1-5% variance in the nucleotide
sequence of a given gene. Alternative alleles can be identified by
sequencing the gene of interest in a number of different
individuals. This can be readily carried out by using hybridization
probes to identify the same genetic locus in a variety of
individuals. Any and all such nucleotide variations and resulting
amino acid polymorphisms or variations that are the result of
natural allelic variation and that do not alter the functional
activity are intended to be within the scope of the invention.
[0086] As used herein, an "instructional material" includes a
publication, a recording, a diagram, or any other medium of
expression, which can be used to communicate the usefulness of the
nucleic acid, peptide, and/or composition of the invention in the
kit for effecting alleviation of the various diseases or disorders
recited herein. Optionally, or alternately, the instructional
material may describe one or more methods of alleviation the
diseases or disorders in a cell or a tissue of a mammal. The
instructional material of the kit of the invention may, for
example, be affixed to a container, which contains the nucleic
acid, peptide, chemical compound and/or composition of the
invention or be shipped together with a container, which contains
the nucleic acid, peptide, chemical composition, and/or
composition. Alternatively, the instructional material may be
shipped separately from the container with the intention that the
instructional material and the compound be used cooperatively by
the recipient.
[0087] An "inflammatory disease" is used herein to refer to a state
in which there is a response to tissue damage, cell injury, an
antigen, and/or an infectious disease. In some cases, causation
will not be able to be established. The symptoms of inflammation
may include, but are not limited to cell infiltration and tissue
swelling. Disease states contemplated under the definition of
inflammatory disease include asthma, chronic obstructive pulmonary
disease, interstitial lung disease, chronic obstructive lung
disease, chronic bronchitis, eosinophilic bronchitis, eosinophilic
pneumonia, pneumonia, inflammatory bowel disease, atopy dermatitis,
atopy, allergy, allergic rhinitis, idiopathic pulmonary fibrosis,
scleroderma, and emphysema.
[0088] An "isolated nucleic acid" refers to a nucleic acid segment
or fragment which has been separated from sequences which flank it
in a naturally occurring state, e.g. a DNA fragment which has been
removed from the sequences which are normally adjacent to the
fragment, e.g. the sequences adjacent to the fragment in a genome
in which it naturally occurs. The term also applies to nucleic
acids, which have been substantially purified from other
components, which naturally accompany the nucleic acid, e.g., RNA
or DNA or proteins, which naturally accompany it in the cell. The
term therefore includes, for example, a recombinant DNA which is
incorporated into a vector, into an autonomously replicating
plasmid or virus, or into the genomic DNA of a prokaryote or
eukaryote, or which exists as a separate molecule (e.g., as a cDNA
or a genomic or cDNA fragment produced by PCR or restriction enzyme
digestion) independent of other sequences. It also includes a
recombinant DNA, which is part of a hybrid gene encoding additional
polypeptide sequence.
[0089] By describing two polynucleotides as "operably linked" is
meant that a single-stranded or double-stranded nucleic acid moiety
comprises the two polynucleotides arranged within the nucleic acid
moiety in such a manner that at least one of the two
polynucleotides is able to exert a physiological effect by which it
is characterized, upon the other. By way of example, a promoter
operably linked to the coding region of a gene is able to promote
transcription of the coding region.
[0090] Preferably, when the nucleic acid encoding the desired
protein further comprises a promoter/regulatory sequence, the
promoter/regulatory sequence is positioned at the 5' end of the
desired protein coding sequence such that it drives expression of
the desired protein in a cell. Together, the nucleic acid encoding
the desired protein and its promoter/regulatory sequence comprise a
"transgene."
[0091] "Constitutive" expression is a state in which a gene product
is produced in a living cell under most or all physiological
conditions of the cell.
[0092] "Inducible" expression is a state in which a gene product is
produced in a living cell in response to the presence of a signal
in the cell.
[0093] A "recombinant polypeptide" is one, which is produced upon
expression of a recombinant polynucleotide.
[0094] "Polypeptide" refers to a polymer composed of amino acid
residues, related naturally occurring structural variants, and
synthetic non-naturally occurring analogs thereof linked via
peptide bonds, related naturally occurring structural variants, and
synthetic non-naturally occurring analogs thereof. Synthetic
polypeptides can be synthesized, for example, using an automated
polypeptide synthesizer.
[0095] The term "protein" typically refers to large
polypeptides.
[0096] The term "peptide" typically refers to short
polypeptides.
[0097] As used herein, the term "transgenic mammal" means a mammal,
the germ cells of which, comprise an exogenous nucleic acid.
[0098] As used herein, to "treat" means reducing the frequency with
which symptoms of the inflammatory disease, are experienced by a
patient, or altering the natural history and/or progression of the
disease in a patient.
[0099] As used herein, the term "antisense oligonucleotide" means a
nucleic acid polymer, at least a portion of which is complementary
to a nucleic acid which is present in a normal cell or in an
affected cell. Most preferably, the antisense oligonucleotides
comprise between about fifteen and about fifty nucleotides. The
antisense oligonucleotides of the invention include, but are not
limited to, phosphorothioate oligonucleotides and other
modifications of oligonucleotides.
[0100] The term "antibody," as used herein, refers to an
immunoglobulin molecule which is able to specifically bind to a
specific epitope on an antigen. Antibodies can be intact
immunoglobulins derived from natural sources or from recombinant
sources and can be immunoreactive portions of intact
immunoglobulins. Antibodies are typically tetramers of
immunoglobulin molecules. The antibodies in the present invention
may exist in a variety of forms including, for example, polyclonal
antibodies, monoclonal antibodies, Fv, Fab and F(ab).sub.2, as well
as single chain antibodies and humanized antibodies (Harlow et al.,
1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory
Manual, Cold Spring Harbor, N.Y.; Houston et al., 1988, Proc. Natl.
Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science
242:423-426).
[0101] By the term "synthetic antibody" as used herein, is meant an
antibody which is generated using recombinant DNA technology, such
as, for example, an antibody expressed by a bacteriophage as
described herein. The term should also be construed to mean an
antibody which has been generated by the synthesis of a DNA
molecule encoding the antibody and which DNA molecule expresses an
antibody protein, or an amino acid sequence specifying the
antibody, wherein the DNA or amino acid sequence has been obtained
using synthetic DNA or amino acid sequence technology which is
available and well known in the art.
[0102] A "portion" of a polynucleotide means at least at least
about fifteen to about fifty sequential nucleotide residues of the
polynucleotide. It is understood that a portion of a polynucleotide
may include every nucleotide residue of the polynucleotide.
[0103] By the term "specifically binds," as used herein, is meant
an antibody which recognizes and binds a chitinase-like molecule,
but does not substantially recognize or bind other molecules in a
sample.
[0104] A "prophylactic" treatment is a treatment administered to a
subject who does not exhibit signs of a disease or exhibits only
early signs of the disease for the purpose of decreasing the risk
of developing pathology associated with the disease.
[0105] "Preventing" a disease, as the term is used herein, means
that the onset of the disease is delayed, and/or that the symptoms
of the disease will be decreased in intensity and/or frequency,
when a chitinase-like molecule is administered compared with the
onset and/or symptoms in the absence of the inhibitor.
[0106] A "therapeutic" treatment is a treatment administered to a
subject who exhibits signs of pathology for the purpose of
diminishing or eliminating those signs.
I. Methods
[0107] A. Methods of Treating an Inflammatory Disease
[0108] The present invention includes a method of treating an
inflammatory disease wherein the disease is associated with an
increased level of a chitinase-like molecule. Contemplated in the
present invention are methods of treating an inflammatory disease
in a mammal, preferably a human, using a chitinase-like molecule
inhibitor. This is because, as would be appreciated by one skilled
in the art when provided with the disclosure herein, inhibiting the
expression and/or activity of a chitinase-like molecule serves as a
treatment for inflammatory diseases, including diseases mediated by
IL-13. That is, the data disclosed herein demonstrate that
administration of a chitinase-like molecule inhibitor in a model of
inflammatory disease associated with, or mediated by, expression of
IL-13, treats the disease after it has become established. Further,
the present invention relates to the discovery that chitinase-like
molecules and chitinase-like molecule mRNA are present in increased
levels in inflammatory disease tissue compared with the level of a
chitinase-like molecule in normal tissue. Thus, the present
invention relates to treating of such diseases using a
chitinase-like molecule inhibitors, including, but not limited to,
a chitinase-like molecule inhibitor (e.g. allosamidin).
[0109] Surprisingly, a chitinase-like molecule inhibitor can be
administered to treat the disease even when there is no detectable
chitinase activity. Thus, the skilled artisan would appreciate,
based upon the disclosure provided herein, that the present
invention is not limited to treatment of a disease where detectable
chitinase activity is present; instead, the present invention
encompasses treatment of a disease associated with or mediated by
expression of a chitinase-like molecule even when there is no
detectable chitinase activity.
[0110] It would be understood by one skilled in the art, based upon
the disclosure provided herein, that inhibition of a chitinase-like
molecule encompasses inhibition of a chitinase-like molecule
expression, such as that mediated by, among other things, a
ribozyme and/or antisense molecule that inhibits expression of a
nucleic acid encoding a chitinase-like molecule. Additionally, the
skilled artisan would appreciate, once armed with the teachings of
the present invention, that inhibition of a chitinase-like molecule
includes inhibition of a chitinase-like molecule activity in a
cell. Such inhibition of a chitinase-like molecule activity can be
effected using inhibitors of chitinase enzymatic activity,
including, inter alia, allosamidin, 1,10-phenanthroline,
glucoallosamidin A, glucoallosamidin B,
methyl-N-demethylallosamidin, demethylallosamidin,
didemthylallosamidin, stylogaunidine, a styloguanidine derivative,
dipeptide cyclo-(L-Arg-D-Pro), dipeptide cyclo-(L-Arg-L-Pro),
dipeptide cyclo-(D-Arg-D-Pro), dipeptide cyclo-(D-Arg-L-Pro),
riboflavin, a flavin derivative, copper, zinc, mercury and the
like. Further, inhibitors of chitinase-like molecule activity
include an antibody that specifically binds with a chitinase-like
molecule thereby preventing the enzyme from functioning. Thus, a
chitinase-like molecule inhibitor includes, but is not limited to,
inhibiting transcription, translation, or both, of a nucleic acid
encoding a chitinase-like molecule; and it also includes inhibiting
any activity of the peptide as well, including, but not limited to,
the ability to cleave chitin.
[0111] The present invention includes a method of treating or
preventing an inflammatory disease in a mammal. The method
comprises administering a chitinase-like molecule inhibitor to a
mammal in need of such treatment. This is because, as would be
appreciated by one skilled in the art armed with the teachings of
the present invention, inhibiting a chitinase-like molecule is
useful for treating or preventing an inflammatory disease.
Inhibition of a chitinase-like molecule prevents, in turn, the
pathology associated with an inflammatory disease, as amply
demonstrated by the data disclosed herein.
[0112] More specifically, the invention relates to inhibiting a
chitinase-like molecule using various inhibitors. That is, one
skilled in the art would understand, based upon the disclosure
provided herein, that compounds that inhibit the expression,
activity, and/or function of a chitinase-like molecule encompass,
but are not limited to, an antibody, an antisense nucleic acid, a
ribozyme, a small molecule, a peptidomimetic and a chemical
compound, either known or to be developed, which inhibits a
chitinase-like molecule, and thereby an inflammatory disease.
[0113] The invention encompasses inhibition of a chitinase-like
molecule where the molecule does or does not demonstrate detectable
chitinase activity in vitro or in vivo. That is, without wishing to
be bound by any particular theory, whether the chitinase-like
molecule demonstrates detectable chitinase activity, either in a
cell or tissue or in a cell-free system, is not relevant. More
specifically, as demonstrated by the data disclosed herein, a
chitinase-like molecule, such as Ym, which does not demonstrate
detectable chitinase activity in vitro or in vivo, is expressed at
an increased level in disease cells and tissues compared to a cell
or tissue that does not demonstrate inflammatory disease pathology,
and inhibiting Ym using, inter alia, allosamidin, treats and/or
prevents the disease. Additionally, the data disclosed herein
further demonstrate that increased level of a chitinase, AMCase, in
a cell or tissue is associated with, or mediates, an inflammatory
disease. Moreover, inhibition of AMCase treats the disease. Such
therapeutic effect may be related to inhibition of undetectable
chitinase activity, or it may be that the therapeutic effect does
not relate to any chitinase or chitinase-like activity of the
chitinase-like molecule, and the skilled artisan, based upon the
disclosure provided herein, would appreciate that the therapeutic
effect can be, but need not be, correlated with any chitinase
activity by the molecule.
[0114] One skilled in the art would appreciate, based on the
disclosure provided herein, that an inhibitor of the invention
includes molecules and compounds that prevent or inhibit the
expression, activity or function of a chitinase-like molecule in a
mammal. That is, the invention contemplates that an antisense
and/or antisense molecule that inhibits, decreases, and/or
abolishes expression of a chitinase-like molecule such that the
chitinase-like molecule is not detectable in the cell or tissue is
an inhibitor of the invention. For instance, a compound that
degrades a chitinase-like molecule can decrease its function, and
can be an inhibitor as contemplated in the present invention.
[0115] Inhibition of a chitinase-like molecule can be assessed
using a wide variety of methods, including those disclosed herein,
as well as methods well-known in the art or to be developed in the
future. That is, the routineer would appreciate, based upon the
disclosure provided herein, that inhibition of chitinase-like
molecule expression can be readily assessed using methods that
assess the level of a nucleic acid encoding a chitinase-like
molecule (e.g., mRNA) and/or the level of a chitinase-like molecule
present in a cell or fluid. Moreover, the routineer would
understand that inhibition of a chitinase-like molecule can be
assessed by determining the inhibition of chitinase enzymatic
activity in a cell or bodily fluid as exemplified elsewhere herein
and/or using methods well-known in the art or to be developed in
the future.
[0116] One skilled in the art, based upon the disclosure provided
herein, would understand that the invention encompasses treatment
of a variety of inflammatory diseases, including, but not limited
to, asthma, chronic obstructive pulmonary disease, interstitial
lung disease, chronic obstructive lung disease, chronic bronchitis,
eosinophilic bronchitis, eosinophilic pneumonia, pneumonia,
inflammatory bowel disease, atopic dermatitis, atopy, allergy,
allergic rhinitis, idiopathic pulmonary fibrosis, scleroderma, and
emphysema, and the like. As disclosed herein, these diseases
involve and/or are mediated by, increased chitinase-like molecules
in tissues where increased chitinase-like molecules includes, and
is not limited to, increased chitinase-like molecule expression,
increased chitinase-like molecule activity, or both.
[0117] Further, the skilled artisan would further appreciate, based
upon the teachings provided herein, that the diseases encompass any
disease comprising increased chitinase-like molecule in a tissue
including, among others, a disease mediated by increased IL-13
and/or increased IL-4 production. This is because, as more fully
set forth elsewhere herein, the data disclosed herein demonstrate
that increased IL-13 and/or increased IL-4 mediates an increase in
chitinase-like molecules which, in turns, mediates and/or is
associated with a variety of changes associated with inflammatory
disease including, but not limited to, tissue inflammation,
increased lung volume, increased eosinophils in bronchioalveolar
lavage (BAL) fluid, increased lymphocytes in BAL fluid, increased
total cells in BAL fluid, increased alveolus size, increased
deposition of crystals comprising chitinase-like molecules in lung
tissue, increased airway resistance, increased mucus metaplasia,
increased mucin expression, increased parenchymal fibrosis,
increased airway remodeling, increased subepithelial fibrosis,
increased collagen deposition in airway tissue, epithelial
hypertrophy in the lung tissue, focal organization of crystalline
material into Masson body-like fibrotic foci, and the like.
[0118] Therefore, the data disclosed herein demonstrate that
inhibition of a chitinase-like molecule in a mammal afflicted with
an inflammatory disease, wherein the disease is mediated or
associated with increased expression of IL-13 and/or IL-4, will
treat the disease by mediating a decrease in the level of a
chitinase-like molecule which, in turn, treats the disease. For
instance, such data include, but are not limited to, the inhibition
of various tissue pathology by administering a chitinase-like
molecule inhibitor (e.g., allosamidin) to a mammal where increased
expression of IL-13 mediates increased chitinase-like molecule
activity and increased chitinase-like molecule expression.
[0119] The present invention further comprises a method for
treating an inflammatory disease mediated by and/or associated with
a Th2 inflammatory response in a mammal. The skilled artisan, when
armed with the present disclosure and the teachings provided
herein, would understand that an inflammatory disease mediated by
and/or associated with a Th2 inflammatory response encompasses a
variety of inflammatory diseases, including, but not limited to,
asthma, chronic obstructive pulmonary disease, interstitial lung
disease, chronic obstructive lung disease, chronic bronchitis,
eosinophilic bronchitis, eosinophilic pneumonia, pneumonia,
inflammatory bowel disease, atopic dermatitis, atopy, allergy,
allergic rhinitis, idiopathic pulmonary fibrosis, scleroderma, and
emphysema, and the like. As disclosed herein, these diseases are
mediated by a Th2 inflammatory response in an mammal, and result
in, among other things, increased IL-13 production and/or
expression, increased chitinase-like molecule activity and/or
expression, and the like. Increased chitinase-like molecules
include, but is not limited to, increased chitinase-like molecule
expression, increased chitinase-like molecule activity, or
both.
[0120] Further, the skilled artisan would appreciate, based upon
the teachings provided herein, that the diseases encompass any
disease comprising increased chitinase-like molecule in a tissue
including, among others, a disease mediated by increased Th2
inflammatory response. This is because, as more fully set forth
elsewhere herein, the data disclosed herein demonstrate that
increased Th2 inflammatory responses result in, inter alia,
increased IL-13 and/or increased IL-4 activity and/or expression,
an increase in chitinase-like molecules which, in turns, mediates
and/or is associated with a variety of changes associated with
inflammatory disease including, but not limited to, increased total
cells in BAL fluid, increased alveolus size, increased deposition
of crystals comprising chitinase-like molecules in lung tissue,
increased airway resistance, increased mucus metaplasia, increased
mucin expression, increased parenchymal fibrosis, increased airway
remodeling, increased subepithelial fibrosis, increased eosinophils
in bronchioalveolar lavage (BAL) fluid, increased lymphocytes in
BAL fluid, and the like.
[0121] Therefore, the data disclosed herein demonstrate that
inhibition of a chitinase-like molecule in a mammal afflicted with
an inflammatory disease, wherein the disease is mediated by and/or
associated with an increased Th2 inflammatory response, will treat
the disease by mediating a decrease in the level of a
chitinase-like molecule which, in turn, treats the disease. For
instance, such data include, but are not limited to, the inhibition
of various tissue pathology by administering a chitinase-like
molecule inhibitor (e.g., allosamidin) to a mammal where a Th2
inflammatory response mediates increased chitinase-like molecule
activity and increased chitinase-like molecule expression.
[0122] The skilled artisan will further appreciate that a
chitinase-like molecule is a molecule that exhibits a substantial
degree of homology to known chitinases, such that it has been or
can be classified as a chitinase family molecule based upon, inter
alia, its amino acid sequence. Further, the skilled artisan would
understand, based upon the disclosure provided herein, that while a
chitinase-like molecule can exhibit homology to a known chitinase,
a chitinase-molecule need not demonstrate detectable chitinase
activity, in that they may not detectably cleave chitin an in assay
known in the art. Such chitinase like molecules include, but are
not limited to, acidic mammalian chitinase (eosinophil chemotactic
cytokine), YM1 (chitinase 3-like 3, ECF-L precursor), YM2,
oviductal glycoprotein 1, cartilage glycoprotein 1 (BRP-39,
chitinase 3-like 1, GP-39, YKL-40), chitotriosidase, oviductal
glycoprotein 1 (mucin 9, oviductin), cartilage glycoprotein-39
(chitinase 3-like 1, GP-39, YICL-40), and chondrocyte protein 39
(chitinase 3-like 2, YKL-39).
[0123] A chitinase-like molecule inhibitor can include, but should
not be construed as being limited to a chemical compound, a
protein, a peptidomemetic, an antibody, a ribozyme, and an
antisense nucleic acid molecule.
[0124] One of skill in the art would readily appreciate, based on
the disclosure provided herein, that a chitinase-like molecule
inhibitor encompasses a chemical compound that inhibits the
activity of a chitinase-like molecule. Chitinase-like molecule
inhibitors are well known in the art, and some of the key critical
elements of one class of chitinase-like molecule inhibitors have
been defined (Spindler and Spindler-Barth, 1999, Chitin and
Chitinases, Birkhauser Verlag Basel, Switzerland). Additionally, a
chitinase-like molecule inhibitor encompasses a chemically modified
compound, and derivatives, as is well known to one of skill in the
chemical arts.
[0125] The skilled artisan would appreciate that a chitinase-like
molecule inhibitor encompasses an already known chitinase-like
molecule inhibitor such as, but not limited to, allosamidin
(Allosamidine, Carbohydrate Chemistry Industrial Research Limited,
Lower Hutt, New Zealand, and Eli Lilly and Co., Greenfield, Ind.)
and its derivatives (see, e.g., U.S. Pat. No. 5,413,991),
glucoallosamidin A, glucoallosamidin B,
methyl-N-demethylallosamidin (Nishimoto et al., 1991, J.
Antibiotics 44:716-722) demethylallosamidin (U.S. Pat. No.
5,070,191), and didemthylallosamidin (Zhou et al., 1993, J.
Antibiotics 46:1582-1588). Further contemplated chitinase-like
molecule inhibitors include stylogaunidine and its derivatives
(Kato et al., 1995, Tetrahedron. Lett. 36:2133-2136), dipeptide
cyclo-(L-Arg-D-Pro) (Izumida et al., 1996, J. Antibiotics
49:76-80), divalent cations (e.g. Cu.sup.2+, Zn.sup.2+, and
Hg.sup.2+) (Izumida et al., 1995, J. Mar. Biotechnol. 2:163-166;
Funke and Spindler, 1989, Comp. Biochem Physiol. 94B:691-695), and
riboflavin and flavin derivatives (International Publication No. WO
02/23991).
[0126] Further, one of skill in the art would, when equipped with
this disclosure and the methods exemplified herein, appreciate that
a chitinase-like molecule inhibitor includes such inhibitors as
discovered in the future, as can be identified by well-known
criteria in the art of pharmacology, such as the physiological
results of inhibition of a chitinase-like molecule as described in
detail herein and/or as known in the art. Therefore, the present
invention is not limited in any way to any particular
chitinase-like molecule inhibitor as exemplified or disclosed
herein; rather, the invention encompasses those inhibitors that
would be understood by the routineer to be useful as are known in
the art and as are discovered in the future.
[0127] Further methods of identifying and producing a
chitinase-like molecule inhibitor are well known to those of
ordinary skill in the art, including, but not limited, obtaining an
inhibitor from a naturally occurring source (i.e., Streptomyces
sp., Pseudomonas sp., Stylotella aurantium). Alternatively, a
chitinase-like molecule inhibitor can be synthesized chemically.
Further, the routineer would appreciate, based upon the teachings
provided herein, that a chitinase-like molecule inhibitor can be
obtained from a recombinant organism. Compositions and methods for
chemically synthesizing chitinase-like molecule inhibitors and for
obtaining them from natural sources are well known in the art and
are described in, among others, Yamada et al., U.S. Pat. Nos.
5,413,991, and 5,070,191.
[0128] The skilled artisan would also appreciate, based on the
disclosure provided herein, that a chitinase-like molecule
inhibitor encompasses an antibody that specifically binds with a
chitinase-like molecule, for example, AMCase, thereby inhibiting
the action of these proteins. For instance, antibodies that
specifically bind to YM are well known to those of ordinary skill
in the art (Webb et al., 2001, J. Biol. Chem. 276:41969-41976).
Similarly, antibodies to chitinase-like molecules can be produced
using standard methods disclosed herein or well known to those of
ordinary skill in the art (Harlow et al., 1988, Antibodies: A
Laboratory Manual, Cold Spring Harbor, N.Y.). Thus, the present
invention is not limited in any way to any particular antibody;
instead, the invention includes any antibody that specifically
binds with a chitinase-like molecule either known in the art and/or
identified in the future.
[0129] One of skill in the art will appreciate that an antibody can
be administered as a protein, a nucleic acid construct encoding a
protein, or both. Numerous vectors and other compositions and
methods are well known for administering a protein or a nucleic
acid construct encoding a protein to cells or tissues. Therefore,
the invention includes a method of administering an antibody or
nucleic acid encoding an antibody (e.g., synthetic antibody) that
is specific for a chitinase-like molecule. (Sambrook et al., 1989,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, New York; Ausubel et al., 1997, Current Protocols in
Molecular Biology, John Wiley & Sons, New York).
[0130] The skilled artisan would understand, based upon the
disclosure provided herein, that the invention encompasses
administering an antibody that specifically binds with a
chitinase-like molecule of interest, or a nucleic acid encoding the
antibody, wherein the antibody molecule further comprises an
intracellular retention sequence such that the antibody binds with
the chitinase-like molecule and prevents its expression at the cell
surface and/or its export from a cell. Such antibodies, frequently
referred to as "intrabodies", are well known in the art and are
described in, for example, Marasco et al. (U.S. Pat. No. 6,004,490)
and Beerli et al. (1996, Breast Cancer Research and Treatment
38:11-17). Thus, the invention encompasses methods comprising
inhibiting expression of a chitinase-like molecule on a cell and/or
its secretion from a cell, where the skilled artisan would
understand such inhibition would provide a benefit based upon the
disclosure provided herein.
[0131] The present invention is not limited to chemical compounds
and antibodies against a chitinase-like molecule. One of skill in
the art would appreciate that inhibiting the expression of a
polypeptide is likewise an effective method of inhibiting the
activity and function of the polypeptide. Thus, a method is
provided for the inhibition of a chitinase-like molecule by
inhibiting the expression of a nucleic acid encoding a
chitinase-like molecule. Methods to inhibit the expression of a
gene are well known to those of ordinary skill in the art, and
include the use of ribozymes or antisense oligonucleotide.
[0132] Antisense oligonucleotides are DNA or RNA molecules that are
complementary to some portion of an mRNA molecule. When present in
a cell, antisense oligonucleotides hybridize to an existing mRNA
molecule and inhibit translation into a gene product. Inhibiting
the expression of a gene using an antisense oligonucleotide is well
known in the art (Marcus-Sekura, 1988, Anal. Biochem. 172:289), as
are methods of expressing an antisense oligonucleotide in a cell
(Inoue, U.S. Pat. No. 5,190,931).
[0133] Contemplated in the present invention are antisense
oligonucleotides that are synthesized and provided to the cell by
way of methods well known to those of ordinary skill in the art. As
an example, an antisense oligonucleotide can be synthesized to be
between about 10 and about 100, more preferably between about 15
and about 50 nucleotides long. The synthesis of nucleic acid
molecules is well known in the art, as is the synthesis of modified
antisense oligonucleotides to improve biological activity in
comparison to unmodified antisense oligonucleotides (Tullis, 1991,
U.S. Pat. No. 5,023,243).
[0134] Similarly, the expression of a gene may be inhibited by the
hybridization of an antisense molecule to a promoter or other
regulatory element of a gene, thereby affecting the transcription
of the gene. Methods for the identification of a promoter or other
regulatory element that interacts with a gene of interest are well
known in the art, and include such methods as the yeast two hybrid
system (Bartel and Fields, eds., In: The Yeast Two Hybrid System,
Oxford University Press, Cary, N.C.).
[0135] Alternatively, inhibition of a gene expressing a
chitinase-like molecule can be accomplished through the use of a
ribozyme. Using ribozymes for inhibiting gene expression is well
known to those of skill in the art (see, e.g., Cech et al., 1992,
J. Biol. Chem. 267:17479; Hampel et al., 1989, Biochemistry 28:
4929; Altman et al., U.S. Pat. No. 5,168,053). Ribozymes are
catalytic RNA molecules with the ability to cleave other
single-stranded RNA molecules. Ribozymes are known to be sequence
specific, and can therefore be modified to recognize a specific
nucleotide sequence (Cech, 1988, J. Amer. Med. Assn. 260:3030),
allowing the selective cleavage of specific mRNA molecules. Given
the nucleotide sequence chitinase-like molecule, one of ordinary
skill in the art could synthesize an antisense oligonucleotide or
ribozyme without undue experimentation, provided with the
disclosure and references incorporated herein.
[0136] One of skill in the art will appreciate that inhibitors of
chitinase-like molecule gene expression can be administered singly
or in any combination thereof. Further, chitinase-like molecule
inhibitors can be administered singly or in any combination thereof
in a temporal sense, in that they may be administered
simultaneously, before, and/or after each other. One of ordinary
skill in the art will appreciate, based on the disclosure provided
herein, that chitinase-like molecule inhibitors to inhibit gene
expression can be used to treat asthma, COPD, and other
inflammatory diseases and that an inhibitor can be used alone or in
any combination with another inhibitor to effect a therapeutic
result.
[0137] B. Method of Preventing an Inflammatory Disease
[0138] It will be appreciated by one of skill in the art, when
armed with the present disclosure including the methods detailed
herein, that the invention is not limited to treatment of an
inflammatory disease once the disease is established. Particularly,
the symptoms of the disease need not have manifested to the point
of detriment to the mammal; indeed, the disease need not be
detected in a mammal before treatment is administered. That is,
significant pathology from an inflammatory disease does not have to
occur before the present invention may provide benefit. Therefore,
the present invention, as described more fully herein, includes a
method for preventing an inflammatory disease in a mammal, in that
a chitinase-like molecule inhibitor, as discussed previously
elsewhere herein, can be administered to a mammal prior to the
onset of an inflammatory disease, thereby preventing the disease as
demonstrated by the data disclosed herein.
[0139] One of skill in the art, when armed with the disclosure
herein, would appreciate that the prevention of inflammatory
disease encompasses administering to a mammal a chitinase-like
molecule inhibitor as a preventative measure against inflammatory
disease. As detailed herein, the symptoms and etiologies of
chitinase-like molecule-associated inflammatory disease include
tissue inflammation, increased lung volume, increased eosinophils
in bronchioalveolar lavage (BAL) fluid, increased lymphocytes in
BAL fluid, increased total cells in BAL fluid, increased alveolus
size, increased deposition of crystals comprised of chitinase-like
molecules in lung tissue, increased airway resistance, increased
mucus metaplasia, increased mucin expression, increased parenchymal
fibrosis, increased airway remodeling, increased subepithelial
fibrosis, increased collagen deposition in airway tissue,
epithelial hypertrophy in the lung tissue, focal organization of
crystalline material into Masson body-like fibrotic foci, and the
like. Given these etiologies and the methods disclosed elsewhere
herein, the skilled artisan can recognize and prevent an
inflammatory disease in a mammal using a chitinase-like molecule
inhibitor before the disease pathology can be detected. This is
because the data disclosed herein demonstrate that administration
of a chitinase-like molecule inhibitor, including, but not limited
to, allosamidin, prevented onset of an inflammatory disease in a
mammal, whether the disease was induced by an allergen (e.g.
ovalbumin sensitization) or whether the mammal was genetically
predisposed to the disease (e.g. transgenic mice constitutively or
inducibly overproducing IL-13). Accordingly, the skilled artisan
would appreciate, based on the disclosure provided elsewhere
herein, that the present invention includes a method of preventing
disease comprising inhibiting a chitinase-like molecule using a
chitinase-like molecule inhibitor. Further, as more fully discussed
elsewhere herein, methods of inhibiting a chitinase-like molecule
encompass a wide plethora of techniques for inhibiting not only
chitinase-like molecule activity, but also for inhibiting
expression of a nucleic acid encoding a chitinase-like molecule.
Additionally, as disclosed elsewhere herein, one skilled in the art
would understand, once armed with the teaching provided herein,
that the present invention encompasses a method of preventing a
wide variety of diseases where expression and/or activity of a
chitinase-like molecule mediates the disease. Methods for assessing
whether a disease relates to overexpression or increased activity
of a chitinase-like molecule are disclosed elsewhere herein and/or
are well known in the art. Further, the invention encompasses
treatment or prevention of such diseases discovered in the
future.
[0140] The invention further encompasses methods for treating an
IL-13 mediated inflammatory disease. This is because, as the data
disclosed herein demonstrate, IL-13 overexpression in the lungs,
among other tissues, whether inducible or constitutive, mediates or
is associated with the increased expression of chitinase-like
molecule in respiratory tissues, leading to, among other things,
the pathologies described elsewhere herein. Thereby, the present
invention includes methods of treating an IL-13 mediated
inflammatory disease using the methods of the present
invention.
[0141] The invention encompasses administration of a chitinase-like
molecule inhibitor to practice the methods of the invention; the
skilled artisan would understand, based on the disclosure provided
herein, how to formulate and administer the appropriate
chitinase-like molecule inhibitor to a mammal. Indeed, the
successful administration of chitinase-like molecule inhibitors has
been extensively reduced to practice as exemplified herein.
However, the present invention is not limited to any particular
method of administration or treatment regimen. This is especially
true where it would be appreciated by one skilled in the art,
equipped with the disclosure provided herein, including the
extensive reduction to practice using an art-recognized model of
inflammatory disease, that methods of administering a
chitinase-like molecule inhibitor can be readily determined by one
of skill in the pharmacological arts.
[0142] More specifically, the data disclosed herein demonstrate
that increased expression of IL-13 mediates or is correlated with
increased level of a chitinase-like molecule (e.g., Ym, AMCase, and
the like) and that inhibiting a chitinase-like molecule using,
among other things, an antibody that specifically binds with the
chitinase-like molecule, prevents, ameliorates, and/or treats
inflammatory disease. That is, for instance, AMCase mRNA is
expressed at a greater level in inflammatory disease cells and/or
tissues and administration of antibody that specifically binds with
AMCase treats the disease in an art-recognized animal model of
inflammatory disease. Further, the data disclosed herein
demonstrate similar results relating to expression of Ym and
inhibition of Ym using a chemical compound, i.e., allosamidin,
which is a known chitinase-like molecule inhibitor. The skilled
artisan will appreciate that the present invention is not limited
to these chitinase-like molecules or to these chitinase-like
molecule inhibitors, and the data disclosed herein amply
demonstrate that inhibition of a chitinase-like molecule can
effectively treat and/or prevent an inflammatory disease.
[0143] As used herein, the term "pharmaceutically-acceptable
carrier" means a chemical composition with which an appropriate
chitinase-like molecule inhibitor may be combined and which,
following the combination, can be used to administer the
appropriate chitinase-like molecule inhibitor to a mammal.
[0144] The pharmaceutical compositions useful for practicing the
invention may be administered to deliver a dose of between about
0.1 ng/kg/day and 100 mg/kg/day.
[0145] Pharmaceutical compositions that are useful in the methods
of the invention may be administered systemically in oral solid
formulations, ophthalmic, suppository, aerosol, topical or other
similar formulations. In addition to the appropriate chitinase-like
molecule inhibitor, such pharmaceutical compositions may contain
pharmaceutically acceptable carriers and other ingredients known to
enhance and facilitate drug administration. Other possible
formulations, such as nanoparticles, liposomes, resealed
erythrocytes, and immunologically based systems may also be used to
administer an appropriate chitinase-like molecule inhibitor
according to the methods of the invention.
[0146] Compounds which are identified using any method described
herein as potential useful compounds for treatment and/or
prevention of a disease of interest can be formulated and
administered to a mammal for treatment of the diseases disclosed
herein are now described.
[0147] The invention encompasses the preparation and use of
pharmaceutical compositions comprising a compound useful for
treatment of the diseases disclosed herein as an active ingredient.
Such a pharmaceutical composition may consist of the active
ingredient alone, in a form suitable for administration to a
subject, or the pharmaceutical composition may comprise the active
ingredient and one or more pharmaceutically acceptable carriers,
one or more additional ingredients, or some combination of these.
The active ingredient may be present in the pharmaceutical
composition in the form of a physiologically acceptable ester or
salt, such as in combination with a physiologically acceptable
cation or anion, as is well known in the art.
[0148] As used herein, the term "pharmaceutically acceptable
carrier" means a chemical composition with which the active
ingredient may be combined and which, following the combination,
can be used to administer the active ingredient to a subject.
[0149] As used herein, the term "physiologically acceptable" ester
or salt means an ester or salt form of the active ingredient which
is compatible with any other ingredients of the pharmaceutical
composition, which is not deleterious to the subject to which the
composition is to be administered.
[0150] The formulations of the pharmaceutical compositions
described herein may be prepared by any method known or hereafter
developed in the art of pharmacology. In general, such preparatory
methods include the step of bringing the active ingredient into
association with a carrier or one or more other accessory
ingredients, and then, if necessary or desirable, shaping or
packaging the product into a desired single- or multi-dose
unit.
[0151] Although the descriptions of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for ethical administration to
humans, it will be understood by the skilled artisan that such
compositions are generally suitable for administration to animals
of all sorts. Modification of pharmaceutical compositions suitable
for administration to humans in order to render the compositions
suitable for administration to various animals is well understood,
and the ordinarily skilled veterinary pharmacologist can design and
perform such modification with merely ordinary, if any,
experimentation. Subjects to which administration of the
pharmaceutical compositions of the invention is contemplated
include, but are not limited to, humans and other primates, mammals
including commercially relevant mammals such as cattle, pigs,
horses, sheep, cats and dogs, and birds including commercially
relevant birds such as chickens, ducks, geese, and turkeys.
[0152] Pharmaceutical compositions that are useful in the methods
of the invention may be prepared, packaged, or sold in formulations
suitable for oral, rectal, vaginal, parenteral, topical, pulmonary,
intranasal, buccal, intravenous, ophthalmic, intrathecal or another
route of administration. Other contemplated formulations include
projected nanoparticles, liposomal preparations, resealed
erythrocytes containing the active ingredient, and
immunologically-based formulations.
[0153] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in bulk, as a single unit dose, or as a
plurality of single unit doses. As used herein, a "unit dose" is
discrete amount of the pharmaceutical composition comprising a
predetermined amount of the active ingredient. The amount of the
active ingredient is generally equal to the dosage of the active
ingredient which would be administered to a subject or a convenient
fraction of such a dosage such as, for example, one-half or
one-third of such a dosage.
[0154] The relative amounts of the active ingredient, the
pharmaceutically acceptable carrier, and any additional ingredients
in a pharmaceutical composition of the invention will vary,
depending upon the identity, size, and condition of the subject
treated and further depending upon the route by which the
composition is to be administered. By way of example, the
composition may comprise between 0.1% and 100% (w/w) active
ingredient.
[0155] In addition to the active ingredient, a pharmaceutical
composition of the invention may further comprise one or more
additional pharmaceutically active agents. Particularly
contemplated additional agents include anti-emetics and scavengers
such as cyanide and cyanate scavengers.
[0156] Controlled- or sustained-release formulations of a
pharmaceutical composition of the invention may be made using
conventional technology.
[0157] A formulation of a pharmaceutical composition of the
invention suitable for oral administration may be prepared,
packaged, or sold in the form of a discrete solid dose unit
including, but not limited to, a tablet, a hard or soft capsule, a
cachet, a troche, or a lozenge, each containing a predetermined
amount of the active ingredient. Other formulations suitable for
oral administration include, but are not limited to, a powdered or
granular formulation, an aqueous or oily suspension, an aqueous or
oily solution, or an emulsion.
[0158] As used herein, an "oily" liquid is one which comprises a
carbon-containing liquid molecule and which exhibits a less polar
character than water.
[0159] A tablet comprising the active ingredient may, for example,
be made by compressing or molding the active ingredient, optionally
with one or more additional ingredients. Compressed tablets may be
prepared by compressing, in a suitable device, the active
ingredient in a free-flowing form such as a powder or granular
preparation, optionally mixed with one or more of a binder, a
lubricant, an excipient, a surface active agent, and a dispersing
agent. Molded tablets may be made by molding, in a suitable device,
a mixture of the active ingredient, a pharmaceutically acceptable
carrier, and at least sufficient liquid to moisten the mixture.
Pharmaceutically acceptable excipients used in the manufacture of
tablets include, but are not limited to, inert diluents,
granulating and disintegrating agents, binding agents, and
lubricating agents. Known dispersing agents include, but are not
limited to, potato starch and sodium starch glycollate. Known
surface active agents include, but are not limited to, sodium
lauryl sulphate. Known diluents include, but are not limited to,
calcium carbonate, sodium carbonate, lactose, microcrystalline
cellulose, calcium phosphate, calcium hydrogen phosphate, and
sodium phosphate. Known granulating and disintegrating agents
include, but are not limited to, corn starch and alginic acid.
Known binding agents include, but are not limited to, gelatin,
acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and
hydroxypropyl methylcellulose. Known lubricating agents include,
but are not limited to, magnesium stearate, stearic acid, silica,
and talc.
[0160] Tablets may be non-coated or they may be coated using known
methods to achieve delayed disintegration in the gastrointestinal
tract of a subject, thereby providing sustained release and
absorption of the active ingredient. By way of example, a material
such as glyceryl monostearate or glyceryl distearate may be used to
coat tablets. Further by way of example, tablets may be coated
using methods described in U.S. Pat. Nos. 4,256,108; 4,160,452; and
4,265,874 to form osmotically-controlled release tablets. Tablets
may further comprise a sweetening agent, a flavoring agent, a
coloring agent, a preservative, or some combination of these in
order to provide pharmaceutically elegant and palatable
preparation.
[0161] Hard capsules comprising the active ingredient may be made
using a physiologically degradable composition, such as gelatin.
Such hard capsules comprise the active ingredient, and may further
comprise additional ingredients including, for example, an inert
solid diluent such as calcium carbonate, calcium phosphate, or
kaolin.
[0162] Soft gelatin capsules comprising the active ingredient may
be made using a physiologically degradable composition, such as
gelatin. Such soft capsules comprise the active ingredient, which
may be mixed with water or an oil medium such as peanut oil, liquid
paraffin, or olive oil.
[0163] Liquid formulations of a pharmaceutical composition of the
invention which are suitable for oral administration may be
prepared, packaged, and sold either in liquid form or in the form
of a dry product intended for reconstitution with water or another
suitable vehicle prior to use.
[0164] Liquid suspensions may be prepared using conventional
methods to achieve suspension of the active ingredient in an
aqueous or oily vehicle. Aqueous vehicles include, for example,
water and isotonic saline. Oily vehicles include, for example,
almond oil, oily esters, ethyl alcohol, vegetable oils such as
arachis, olive, sesame, or coconut oil, fractionated vegetable
oils, and mineral oils such as liquid paraffin. Liquid suspensions
may further comprise one or more additional ingredients including,
but not limited to, suspending agents, dispersing or wetting
agents, emulsifying agents, demulcents, preservatives, buffers,
salts, flavorings, coloring agents, and sweetening agents. Oily
suspensions may further comprise a thickening agent. Known
suspending agents include, but are not limited to, sorbitol syrup,
hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone,
gum tragacanth, gum acacia, and cellulose derivatives such as
sodium carboxymethylcellulose, methylcellulose, and
hydroxypropylmethylcellulose. Known dispersing or wetting agents
include, but are not limited to, naturally-occurring phosphatides
such as lecithin, condensation products of an alkylene oxide with a
fatty acid, with a long chain aliphatic alcohol, with a partial
ester derived from a fatty acid and a hexitol, or with a partial
ester derived from a fatty acid and a hexitol anhydride (e.g.
polyoxyethylene stearate, heptadecaethyleneoxycetanol,
polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan
monooleate, respectively). Known emulsifying agents include, but
are not limited to, lecithin and acacia. Known preservatives
include, but are not limited to, methyl, ethyl, or
n-propyl-para-hydroxybenzoates, ascorbic acid, and sorbic acid.
Known sweetening agents include, for example, glycerol, propylene
glycol, sorbitol, sucrose, and saccharin. Known thickening agents
for oily suspensions include, for example, beeswax, hard paraffin,
and cetyl alcohol.
[0165] Liquid solutions of the active ingredient in aqueous or oily
solvents may be prepared in substantially the same manner as liquid
suspensions, the primary difference being that the active
ingredient is dissolved, rather than suspended in the solvent.
Liquid solutions of the pharmaceutical composition of the invention
may comprise each of the components described with regard to liquid
suspensions, it being understood that suspending agents will not
necessarily aid dissolution of the active ingredient in the
solvent. Aqueous solvents include, for example, water and isotonic
saline. Oily solvents include, for example, almond oil, oily
esters, ethyl alcohol, vegetable oils such as arachis, olive,
sesame, or coconut oil, fractionated vegetable oils, and mineral
oils such as liquid paraffin.
[0166] Powdered and granular formulations of a pharmaceutical
preparation of the invention may be prepared using known methods.
Such formulations may be administered directly to a subject, used,
for example, to form tablets, to fill capsules, or to prepare an
aqueous or oily suspension or solution by addition of an aqueous or
oily vehicle thereto. Each of these formulations may further
comprise one or more of dispersing or wetting agent, a suspending
agent, and a preservative. Additional excipients, such as fillers
and sweetening, flavoring, or coloring agents, may also be included
in these formulations.
[0167] A pharmaceutical composition of the invention may also be
prepared, packaged, or sold in the form of oil-in-water emulsion or
a water-in-oil emulsion. The oily phase may be a vegetable oil such
as olive or arachis oil, a mineral oil such as liquid paraffin, or
a combination of these. Such compositions may further comprise one
or more emulsifying agents such as naturally occurring gums such as
gum acacia or gum tragacanth, naturally-occurring phosphatides such
as soybean or lecithin phosphatide, esters or partial esters
derived from combinations of fatty acids and hexitol anhydrides
such as sorbitan monooleate, and condensation products of such
partial esters with ethylene oxide such as polyoxyethylene sorbitan
monooleate. These emulsions may also contain additional ingredients
including, for example, sweetening or flavoring agents.
[0168] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for rectal
administration. Such a composition may be in the form of, for
example, a suppository, a retention enema preparation, and a
solution for rectal or colonic irrigation.
[0169] Suppository formulations may be made by combining the active
ingredient with a non-irritating pharmaceutically acceptable
excipient which is solid at ordinary room temperature (i.e. about
20.degree. C.) and which is liquid at the rectal temperature of the
subject (i.e. about 37.degree. C. in a healthy human). Suitable
pharmaceutically acceptable excipients include, but are not limited
to, cocoa butter, polyethylene glycols, and various glycerides.
Suppository formulations may further comprise various additional
ingredients including, but not limited to, antioxidants and
preservatives.
[0170] Retention enema preparations or solutions for rectal or
colonic irrigation may be made by combining the active ingredient
with a pharmaceutically acceptable liquid carrier. As is well known
in the art, enema preparations may be administered using, and may
be packaged within, a delivery device adapted to the rectal anatomy
of the subject. Enema preparations may further comprise various
additional ingredients including, but not limited to, antioxidants
and preservatives.
[0171] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for vaginal
administration. Such a composition may be in the form of, for
example, a suppository, an impregnated or coated
vaginally-insertable material such as a tampon, a douche
preparation, or gel or cream or a solution for vaginal
irrigation.
[0172] Methods for impregnating or coating a material with a
chemical composition are known in the art, and include, but are not
limited to methods of depositing or binding a chemical composition
onto a surface, methods of incorporating a chemical composition
into the structure of a material during the synthesis of the
material (i.e. such as with a physiologically degradable material),
and methods of absorbing an aqueous or oily solution or suspension
into an absorbent material, with or without subsequent drying.
[0173] Douche preparations or solutions for vaginal irrigation may
be made by combining the active ingredient with a pharmaceutically
acceptable liquid carrier. As is well known in the art, douche
preparations may be administered using, and may be packaged within,
a delivery device adapted to the vaginal anatomy of the subject.
Douche preparations may further comprise various additional
ingredients including, but not limited to, antioxidants,
antibiotics, antifungal agents, and preservatives.
[0174] As used herein, "parenteral administration" of a
pharmaceutical composition includes any route of administration
characterized by physical breaching of a tissue of a subject and
administration of the pharmaceutical composition through the breach
in the tissue. Parenteral administration thus includes, but is not
limited to, administration of a pharmaceutical composition by
injection of the composition, by application of the composition
through a surgical incision, by application of the composition
through a tissue-penetrating non-surgical wound, and the like. In
particular, parenteral administration is contemplated to include,
but is not limited to, subcutaneous, intraperitoneal, intravenous,
intramuscular, intracisternal injection, and kidney dialytic
infusion techniques.
[0175] Formulations of a pharmaceutical composition suitable for
parenteral administration comprise the active ingredient combined
with a pharmaceutically acceptable carrier, such as sterile water
or sterile isotonic saline. Such formulations may be prepared,
packaged, or sold in a form suitable for bolus administration or
for continuous administration. Injectable formulations may be
prepared, packaged, or sold in unit dosage form, such as in ampules
or in multi-dose containers containing a preservative. Formulations
for parenteral administration include, but are not limited to,
suspensions, solutions, emulsions in oily or aqueous vehicles,
pastes, and implantable sustained-release or biodegradable
formulations. Such formulations may further comprise one or more
additional ingredients including, but not limited to, suspending,
stabilizing, or dispersing agents. In one embodiment of a
formulation for parenteral administration, the active ingredient is
provided in dry (i.e. powder or granular) form for reconstitution
with a suitable vehicle (e.g., sterile pyrogen-free water) prior to
parenteral administration of the reconstituted composition.
[0176] The pharmaceutical compositions may be prepared, packaged,
or sold in the form of a sterile injectable aqueous or oily
suspension or solution. This suspension or solution may be
formulated according to the known art, and may comprise, in
addition to the active ingredient, additional ingredients such as
the dispersing agents, wetting agents, or suspending agents
described herein. Such sterile injectable formulations may be
prepared using a non-toxic parenterally-acceptable diluent or
solvent, such as water or 1,3-butane diol, for example. Other
acceptable diluents and solvents include, but are not limited to,
Ringer's solution, isotonic sodium chloride solution, and fixed
oils such as synthetic mono- or di-glycerides. Other
parentally-administrable formulations which are useful include
those which comprise the active ingredient in microcrystalline
form, in a liposomal preparation, or as a component of a
biodegradable polymer systems. Compositions for sustained release
or implantation may comprise pharmaceutically acceptable polymeric
or hydrophobic materials such as an emulsion, an ion exchange
resin, a sparingly soluble polymer, or a sparingly soluble
salt.
[0177] Formulations suitable for topical administration include,
but are not limited to, liquid or semi-liquid preparations such as
liniments, lotions, oil-in-water or water-in-oil emulsions such as
creams, ointments or pastes, and solutions or suspensions.
Topically-administrable formulations may, for example, comprise
from about 1% to about 10% (w/w) active ingredient, although the
concentration of the active ingredient may be as high as the
solubility limit of the active ingredient in the solvent
Formulations for topical administration may further comprise one or
more of the additional ingredients described herein.
[0178] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for pulmonary
administration via the buccal cavity. Such a formulation may
comprise dry particles which comprise the active ingredient and
which have a diameter in the range from about 0.5 to about 7
nanometers, and preferably from about 1 to about 6 nanometers. Such
compositions are conveniently in the form of dry powders for
administration using a device comprising a dry powder reservoir to
which a stream of propellant may be directed to disperse the powder
or using a self-propelling solvent/powder-dispensing container such
as a device comprising the active ingredient dissolved or suspended
in a low-boiling propellant in a sealed container. Preferably, such
powders comprise particles wherein at least 98% of the particles by
weight have a diameter greater than 0.5 nanometers and at least 95%
of the particles by number have a diameter less than 7 nanometers.
More preferably, at least 95% of the particles by weight have a
diameter greater than 1 nanometer and at least 90% of the particles
by number have a diameter less than 6 nanometers. Dry powder
compositions preferably include a solid fine powder diluent such as
sugar and are conveniently provided in a unit dose form.
[0179] Low boiling propellants generally include liquid propellants
having a boiling point of below 65.degree. F. at atmospheric
pressure. Generally the propellant may constitute 50 to 99.9% (w/w)
of the composition, and the active ingredient may constitute 0.1 to
20% (w/w) of the composition. The propellant may further comprise
additional ingredients such as a liquid non-ionic or solid anionic
surfactant or a solid diluent (preferably having a particle size of
the same order as particles comprising the active ingredient).
[0180] Pharmaceutical compositions of the invention formulated for
pulmonary delivery may also provide the active ingredient in the
form of droplets of a solution or suspension. Such formulations may
be prepared, packaged, or sold as aqueous or dilute alcoholic
solutions or suspensions, optionally sterile, comprising the active
ingredient, and may conveniently be administered using any
nebulization or atomization device. Such formulations may further
comprise one or more additional ingredients including, but not
limited to, a flavoring agent such as saccharin sodium, a volatile
oil, a buffering agent, a surface active agent, or a preservative
such as methylhydroxybenzoate. The droplets provided by this route
of administration preferably have an average diameter in the range
from about 0.1 to about 200 nanometers.
[0181] The formulations described herein as being useful for
pulmonary delivery are also useful for intranasal delivery of a
pharmaceutical composition of the invention.
[0182] Another formulation suitable for intranasal administration
is a coarse powder comprising the active ingredient and having an
average particle from about 0.2 to 500 micrometers. Such a
formulation is administered in the manner in which snuff is taken
i.e. by rapid inhalation through the nasal passage from a container
of the powder held close to the nares.
[0183] Formulations suitable for nasal administration may, for
example, comprise from about as little as 0.1% (w/w) and as much as
100% (w/w) of the active ingredient, and may further comprise one
or more of the additional ingredients described herein.
[0184] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for buccal
administration. Such formulations may, for example, be in the form
of tablets or lozenges made using conventional methods, and may,
for example, contain 0.1 to 20% (w/w) active ingredient, the
balance comprising an orally dissolvable or degradable composition
and, optionally, one or more of the additional ingredients
described herein. Alternately, formulations suitable for buccal
administration may comprise a powder or an aerosolized or atomized
solution or suspension comprising the active ingredient. Such
powdered, aerosolized, or aerosolized formulations, when dispersed,
preferably have an average particle or droplet size in the range
from about 0.1 to about 200 nanometers, and may further comprise
one or more of the additional ingredients described herein.
[0185] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for
ophthalmic administration. Such formulations may, for example, be
in the form of eye drops including, for example, a 0.1-1.0% (w/w)
solution or suspension of the active ingredient in an aqueous or
oily liquid carrier. Such drops may further comprise buffering
agents, salts, or one or more other of the additional ingredients
described herein. Other opthalmically-administrable formulations
which are useful include those which comprise the active ingredient
in microcrystalline form or in a liposomal preparation.
[0186] As used herein, "additional ingredients" include, but are
not limited to, one or more of the following: excipients; surface
active agents; dispersing agents; inert diluents; granulating and
disintegrating agents; binding agents; lubricating agents;
sweetening agents; flavoring agents; coloring agents;
preservatives; physiologically degradable compositions such as
gelatin; aqueous vehicles and solvents; oily vehicles and solvents;
suspending agents; dispersing or wetting agents; emulsifying
agents, demulcents; buffers; salts; thickening agents; fillers;
emulsifying agents; antioxidants; antibiotics; antifungal agents;
stabilizing agents; and pharmaceutically acceptable polymeric or
hydrophobic materials. Other "additional ingredients" which may be
included in the pharmaceutical compositions of the invention are
known in the art and described, for example in Genaro, ed., 1985,
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., which is incorporated herein by reference.
[0187] Typically dosages of the compound of the invention which may
be administered to an animal, preferably a human, range in amount
from about 0.01 mg to 20 about 100 g per kilogram of body weight of
the animal. While the precise dosage administered will vary
depending upon any number of factors, including, but not limited
to, the type of animal and type of disease state being treated, the
age of the animal and the route of administration. Preferably, the
dosage of the compound will vary from about 1 mg to about 100 mg
per kilogram of body weight of the animal. More preferably, the
dosage will vary from about 1 .mu.g to about 1 g per kilogram of
body weight of the animal. The compound can be administered to an
animal as frequently as several times daily, or it can be
administered less frequently, such as once a day, once a week, once
every two weeks, once a month, or even less frequently, such as
once every several months or even once a year or less. The
frequency of the dose will be readily apparent to the skilled
artisan and will depend upon any number of factors, such as, but
not limited to, the type and severity of the disease being treated,
the type and age of the animal, etc.
[0188] C. Methods of Identifying a Useful Compound
[0189] The invention encompasses a method for identifying a
compound or intervention that treats an inflammatory disease. One
skilled in the art would appreciate, based upon the disclosure
provided herein, that assessing the expression and/or activity of a
chitinase-like molecule can be performed by assessing, among other
things, the levels of a chitinase-like molecule or the mRNA that
encodes it in a cell or tissue, and the like, and then the level
can be compared to the level in an otherwise identical cell or
tissue to which the compound is not administered. Alternatively,
the level of chitinase-like molecule or the mRNA that encode it in
a cell or tissue contacted with a compound can be compared with the
level of the chitinase-like molecule or its mRNA in the cell or
tissue prior to administration of the compound. One skilled in the
art would understand that such compound can be a useful potential
therapeutic for treating and/or preventing an inflammatory disease,
and for treating and preventing an IL-13 mediated inflammatory
disease, and/or for treating a disease associated with and/or
mediated by a Th2 inflammatory response.
[0190] The skilled artisan would further appreciate that the
methods for identifying a compound useful for inhibiting a
chitinase-like molecule include methods wherein a compound is
administered to a cell, tissue, or animal. That is, the skilled
artisan, when armed with the present disclosure, would recognize
that the teachings herein can be used to identify a compound useful
for inhibiting a chitinase-like molecule in a cell or tissue
expressing a chitinase-like molecule. Such cells and tissues are
well known in the art, and can include cells and tissues derived
from a transgenic non-human animal having altered expression IL-13,
IL-4, and/or a chitinase-like molecule, or a transgenic animal
comprising an inflammatory disease, and/or a cell or tissue derived
therefrom.
[0191] Additionally, a cell or tissue comprising expression of a
chitinase-like molecule can be contacted with a compound and the
level of the chitinase-like molecule can be assessed and compared
to the level of the chitinase-like molecule in the cell and/or
tissue prior to administration of the compound. Further, the level
of the chitinase-like molecule can be compared to the level of the
chitinase-like molecule in an otherwise identical cell or tissue
not contacted with the compound.
[0192] One skilled in the art would appreciate, based upon the
disclosure provided herein, that the cell or tissue can express
endogenous chitinase-like molecule, but the invention further
encompasses a cell or tissue that has been modified to express a
chitinase-like molecule not otherwise expressed in the tissue,
e.g., a nucleic encoding a chitinase-like molecule of interest can
be introduced and expressed in the cell or tissue where it is not
typically expressed, or is expressed at a different level than
after the nucleic acid is introduced into the cell or tissue. Thus,
the invention includes a wide plethora of assays, comprising a
cell, tissue, or an animal, wherein the level of a chitinase-like
molecule can be assessed in the presence or absence of a compound.
Accordingly, the skilled artisan would be able to identify a
compound using the methods disclosed herein and cell culture and
cell propagation techniques well known in the art to assess the
ability of a compound to affect the level of a chitinase-like
molecule. Therefore, the present invention further encompasses a
method of identifying a compound useful for inhibiting a
chitinase-like molecule in a cell or tissue, as well as in an
animal.
[0193] One of skill in the art would understand, based upon the
disclosure provided herein, that the invention includes a method of
identifying a compound useful for treating an inflammatory disease
in a mammal. As would be understood by one skilled in the art armed
with the teachings provided herein, the method encompasses
identifying a compound that treats an inflammatory disease in a
cell or tissue. The method comprises identifying a substance or
compound that inhibits the expression and/or activity of a
chitinase-like molecule in a mammal (including in a cell or tissue
thereof), preferably in the respiratory tract. This is because, as
discussed elsewhere herein, the data demonstrate that inhibiting
the expression or activity of a chitinase-like molecule provides a
therapeutic benefit thereby treating or preventing an inflammatory
disease mediated by or associated with increased expression or
activity of a chitinase-like molecule. This is because the present
invention discloses, for the first time, that increased level of a
chitinase-like molecule is associated with, or mediates, such
disease and that inhibiting the chitinase-like molecule (e.g., YM,
AMCase, and the like), using a chitinase-like molecule inhibitor
(e.g. allosamidin, an antibody specific for the chitinase-like
molecule, such as, but not limited to, an antibody that
specifically binds with AMCase) prevents and/or treats the
disease.
[0194] Thus, the skilled artisan, once armed with the teachings of
the invention, would appreciate that a compound that inhibits a
chitinase-like molecule is a powerful potential therapeutic or
prophylactic treatment of inflammatory disease, such that
identification of such a compound identifies a potential
therapeutic for such disease.
[0195] The method comprises administering to a mammal afflicted
with an inflammatory disease, a compound, and comparing the level
of a chitinase-like molecule in the mammal before and after
administration of the compound. The routineer would understand,
based on the disclosure provided herein, that a lower level of a
chitinase-like molecule or the mRNA that encodes it in the mammal
after administration of the compound compared with the level of a
chitinase-like molecule or its mRNA before administration of the
compound indicates that the compound is useful for treating an
inflammatory disease in a mammal.
[0196] This is because, as stated previously elsewhere herein, it
has been discovered that inhibiting a chitinase-like molecule in an
animal treats or prevents a disease associated with increased
chitinase-like molecule expression and/or activity, e.g., an
inflammatory disease with enhanced tissue remodeling and fibrosis.
The skilled artisan would also appreciate, in view of the
disclosure provided herein, that assays to determine the level of a
chitinase-like molecule in a mammal, including a cell or tissue
thereof, include those well known in the art, or those to be
developed in the future, all of which can be used to assess the
level of a chitinase-like molecule in a mammal (or cell or tissue
thereof) before and after administration of the compound. The
skilled artisan would further appreciate that the levels of a
chitinase-like molecule, as disclosed elsewhere herein, include
levels of chitinase-like molecule activity and levels of
chitinase-like molecule expression. Further, the invention
encompasses a compound identified using this method.
[0197] The invention further includes additional methods for
identifying a compound useful for inhibiting a chitinase-like
molecule and thereby an inflammatory disease in a mammal. More
specifically, the method comprises assessing the level of a
chitinase-like molecule expression, production, or activity in a
mammal (or a cell or tissue thereof) to which the compound is
administered in comparison to an identical mammal (or cell or
tissue thereof) to which the compound is not administered.
Additionally, the method comprises comparing the level of a
chitinase-like molecule in the same mammal, or cell or tissue
thereof, before and after administration of a compound of interest.
A lower level of a chitinase-like molecule expression, production,
or activity in the mammal administered the compound when compared
to an identical mammal not administered the compound, or to the
same mammal prior to administration of the compound, is an
indication that the compound is useful for inhibiting a chitinase
like molecule which is therefore a useful potential therapeutic to
treat and/or prevent inflammatory disease in a mammal. This is
because the present invention discloses, for the first time, that a
chitinase-like molecule plays a clear role in the pathology of
inflammatory diseases and that inhibiting a chitinase-like molecule
treats and/or prevents disease in an art-recognized animal model of
inflammatory disease. Clearly, as demonstrated elsewhere herein, a
compound that inhibits chitinase-like molecules is an important
potential therapeutic compound useful for treatment and prevention
of inflammatory disease as demonstrated by the data disclosed
herein.
[0198] As detailed elsewhere herein, the pathology of many
inflammatory diseases is mediated by the expression of IL-13 in an
affected cell or tissue. Further, as would be appreciated by the
skilled artisan equipped with the present disclosure, the pathology
of IL-13 mediated inflammatory diseases is due, in part, to the
expression of chitinase-like molecules in an affected cell, organ
or system. The methods detailed above include mammals in which the
levels of a chitinase-like molecule can be readily assessed using
the methods described herein. Thereby, the present invention
includes mammals useful for identifying a compound that can be used
for the treatment or prevention of inflammatory diseases. More
particularly, the invention includes transgenic animals either
constitutively or inducible expressing IL-13 in the respiratory
tract. Based on the disclosure provided herein, such transgenic
mammals, when administered a compound, can be readily assayed for
levels of a chitinase-like molecule, whether the assay be for
chitinase-like molecule expression or chitinase-like molecule
activity. And such methods of identifying a compound useful for
treating and/or preventing inflammatory disease relating to using
of transgenic non-human mammals to assess whether the compound
inhibits a chitinase-like molecule are encompassed in the present
invention.
II. Kits
[0199] The invention encompasses various kits relating to
inhibiting chitinase like molecules in a mammal which are useful,
because, as disclosed elsewhere herein, inhibiting chitinase-like
molecules provides a method of treating or preventing inflammatory
disease in a mammal. Thus, in one aspect, the invention includes a
kit for treating an inflammatory disease in a mammal. The kit
comprises an effective amount of a chitinase-like molecule
inhibitor. The kit further comprises an applicator and an
instructional material for the use thereof to be used in accordance
with the teachings provided herein.
[0200] The invention includes various kits which comprise a
compound, such as an antibody that specifically binds a
chitinase-like molecule, as well as a nucleic acid encoding such an
antibody, a nucleic acid complementary to a nucleic acid encoding a
chitinase-like molecule but in an antisense orientation with
respect to transcription, a ribozyme capable of cleaving a
single-stranded chitinase-like molecule RNA, an applicator, and
instructional materials which describe use of the compound to
perform the methods of the invention. Although exemplary kits are
described below, the contents of other useful kits will be apparent
to the skilled artisan in light of the present disclosure. Each of
these kits is included within the invention.
[0201] In one aspect, the invention includes kits for treating or
preventing an inflammatory disease and an inflammatory disease
mediated by IL-13. The kit is used pursuant to the methods
disclosed in the invention. Briefly, the kit may be used to contact
a mammal with a chemical compound that inhibits chitinase-like
molecules, or a nucleic acid complementary to a nucleic acid
encoding a chitinase-like molecule where the nucleic acid is in an
antisense orientation with respect to transcription to reduce
expression of a chitinase-like molecule, or with an antibody that
specifically binds with a chitinase-like molecule or a nucleic acid
encoding the antibody, wherein the decreased expression, amount, or
activity of a chitinase-like molecule mediates an beneficial effect
in the mammal. Moreover, the kit comprises an applicator and an
instructional material for the use of the kit. These instructions
simply embody the examples provided herein.
[0202] The kit includes a pharmaceutically-acceptable carrier. The
composition is provided in an appropriate amount as set forth
elsewhere herein. Further, the route of administration and the
frequency of administration are as previously set forth elsewhere
herein.
EXPERIMENTAL EXAMPLES
[0203] The invention is now described with reference to the
following examples. These examples are provided for the purpose of
illustration only and the invention should in no way be construed
as being limited to these examples but rather should be construed
to encompass any and all variations which become evident as a
result of the teaching provided herein.
[0204] The materials and methods used in the experiments presented
in this Example are now described.
[0205] Materials and Methods
[0206] GENERATION OF TRANSGENIC MICE: Transgenic mice
constitutively expressing lung-tissue specific IL-13 were generated
using the CC10-IL-13 construct. The construct comprising the Clara
cell 10 kDa protein (CC10) promoter, murine IL-13 cDNA, reverse
tetracycline transactivator (rtTA), and human growth hormone
intronic and polyadenylation sequences (hGH) was prepared as
described in Zhu et al. (1999, J. Clin. Invest. 103:779-788)
Standard pronuclear injection was performed as described in Hogan
et al. (1986, Manipulating the Mouse Embryo: A Laboratory Manual,
Cold Spring Harbor, N.Y.). Resultant mice were screened and founder
animals were identified using both Southern blot and PCR. The
founder mice were bred onto a C57BL/6 background as described in
Zhu et al. (1999, J. Clin. Invest. 103:779-788).
[0207] The generation of externally regulatable transgenic mouse
system comprised two constructs (FIG. 5). The first construct
(CC10-rtTA-hGH), as described in Zheng et al. (2000, J. Clin.
Invest. 106:1081-1093), comprised the CC10 promoter, the rtTA
transactivator, and the hGH intronic, nuclear localization and
polyadenylation sequences. The rtTA fusion protein comprised a
mutated tet operator binding protein (tet-OBP) and the herpesvirus
VP-16 transactivator (Gossen et al., 1995, Science 268:1766-1769).
The second construct (tet-O-CMV-IL-13), comprised a polymeric
tetracycline operator (tet-O), minimal cytomegalovirus (CMV)
promoter, IL-13 cDNA, and hGH intronic, polyadenylation and nuclear
localization signals, was prepared as described in Ray et al. and
Zheng et al. (1997, J. Clin. Invest. 100:2501-2511 and 2000, J.
Clin. Invest. 106:1081-1093). Transgenic mice were prepared by
simultaneous microinjection of constructs into oocytes, as
described in Hogan et al. (1986, Manipulating the Mouse Embryo: A
Laboratory Manual, Cold Spring Harbor, N.Y.). Mice were screened by
PCR and Southern blot from tail biopsy DNA as described in Zhu et
al. and Zheng et al. (1999, J. Clin. Invest., 103:779-788). Four
founder mice were then bred with C57BL/6 mice to create transgenic
mice with inducible IL-13 expression in the lungs.
[0208] Generation and Administration of Anti-AMCase Antibodies
[0209] Polyclonal antibodies to AMCase were generated by immunizing
rabbits with a peptide derived from AMCase (ADKADGLYPVADDRNAFWQ;
SEQ ID NO: 13) using methods well known in the art and described
in, for example, Harlow et al. (1989, Antibodies: A Laboratory
Manual, Cold Spring Harbor, N.Y.).
[0210] Wild type mice were sensitized to OVA and challenged with
OVA on three successive days as described elsewhere herein.
Sensitized mice were administered 0.5 ml of anti-AMCase antibodies
or control serum intraperitoneally every other day starting the day
before the first aerosol exposure.
[0211] HISTOLOGIC ANALYSIS: Mice were sacrificed by cervical
dislocation and a median sternotomy was performed. The right heart
was perfused with calcium and magnesium free phosphate buffered
saline (PBS). The heart and lungs were removed en bloc, and the
lungs were fixed to 25 cm pressure with neutral buffered 10%
formalin. They were then fixed overnight in 10% formalin, embedded
in paraffin, sectioned at 5 pm, and stained. Hematoxylin and eosin
(H & E), Mallory's trichrome, periodic acid-Schiff with
diastase (D-PAS), alcian blue at pH 2.5, PAS/alcian blue, modified
Congo red, and Papanicolau stains were used for histological
analysis.
[0212] Hydroxyproline Assays
[0213] Total lung collagen was determined by analysis of
hydroxyproline content. Briefly, lungs were harvested on specified
times and homogenized in 2 ml of PBS, pH 7.4, with a Tissue Tearor
(PRO-Scientific, Monroe, Conn.). One-half milliliter of each sample
(both lungs) was then digested in 1 ml of 6 N HCl for 8 hours at
120.degree. C. Five microliters of citrate/acetate buffer (5%
citric acid, 7.24% sodium acetate, 3.4% sodium hydroxide, and 1.2%
glacial acetic acid, pH 6.0) and 100 .mu.l of chloramine-T solution
(282 mg of chloramine-T, 2 ml of n-propanol, 2 ml of H2O, and 16 ml
of citrate/acetate buffer) were added to 5 .mu.l of sample, and the
samples were left at room temperature for 20 minutes. Next, 100
.mu.l of Ehrlich's solution (2.5 g of 4-(dimethylamino)
benzaldehyde (Aldrich, Milwaukee, Wis.), 9.3 ml of n-propanol, and
3.9 ml of 70% perchloric acid (Eastman Kodak, Rochester, N.Y.) were
added to each sample, and the samples were incubated for 15 minutes
at 65.degree. C. Samples were cooled for 10 minutes and read at 550
nm on a Beckman DU 640 spectrophotometer (Fullerton, Calif.).
Hydroxyproline (Sigma, St. Louis, Mo.) concentrations from 0-10
.mu.g/ml were used to construct a standard curve. (Keane et al. J.
Immunol. 1999, 163:5686-82.)
[0214] BRONCHOALVEOLAR LAVAGE (BAL) AND QUANTIFICATION OF IL-13
LEVELS: Mice were killed by cervical dislocation and a median
sternotomy was performed. The trachea was isolated by blunt
dissection and small caliber tubing was inserted and secured in his
airway. Three successive volumes of 0.75 ml of PBS with 0.1% bovine
serum albumin (BSA) were instilled and gently aspirated and pooled.
Each BAL sample was centrifuged and the supernatants were stored at
-70.degree. C. Cell numbers were assessed with hemocytometer and
cellular differential counts were undertaken on cytospin
preparations. IL-13 levels were determined by ELISA using a
commercial kit according to the manufacturer's instructions
(R&D Systems, Minneapolis, Minn.).
[0215] PHYSIOLOGICAL AIRWAY ASSESSMENT ASSAYS: Age- and
gender-matched littermates were evaluated by both invasive and
non-invasive physiological assessment techniques.
[0216] The non-invasive techniques were used to determine the
baseline airways resistance and the level of airways
hyperresponsiveness (AHR) in unrestrained, conscious mice. That is,
animals were assessed using barometric plethysmography using whole
body plethysmography (Buxco Electronics Inc., Troy, N.Y.) as
described in Hamelmann et al. (1997, Am. J. Resp. Crit. Care Med.
156:766-775) and Kline et al. (1998, J. Immunol. 160:2555-2559).
Briefly, mice were placed into whole body plethysmographs
interfaced with computers using different pressure transducers.
Tidal volume, respiratory rate, and enhanced pause (P.sub.enh)
measurements were made. Airway resistance is expressed as
P.sub.enh=[(T.sub.e/0.3T.sub.r)-1].times.[2 P.sub.ef/3 P.sub.if],
where P.sub.enh=enhanced pause, T.sub.e=expiratory time in seconds,
T.sub.r=relaxation time in seconds, P.sub.ef=peak expiratory flow
(ml), and P.sub.if=peak inspiratory flow (ml/s). Increasing doses
of methacholine (Sigma Chemical Company, St. Louis, Mo.) were
administered using a nebulizer for 120 seconds, and P.sub.enh was
determined over the following five minutes.
[0217] Invasive physiological assessments were performed in
anesthetized (pentobarbital, 90 mg/kg) and tracheostomized (18
gauge angiocatheter) age- and sex-matched mice. The changes in the
lung volume of the mice were measured plethysmographically by
determining the pressure in a Plexiglass chamber using an inline
microswitch pressure transducer. Flow was measured by the
difference between the volume signal and the transpulmonary
pressure as determined by a second microswitch pressure transducer
placed in line with the plethysmograph and animal ventilator.
Resistance (with resistance due to the tracheostomy catheter
eliminated) was measured using the method of Amdur and Mead (1958,
Am. J. Physiol. 192:364-368). Baseline measurements of pulmonary
resistance were obtained by ventilating the mouse at a volume 0.4
ml and a rate of 150 breaths per minute. Increasing concentrations
of methacholine in PBS were administered by nebulization (20 one-ml
breaths) using a Devilbiss Aerosonic nebulizer (Model 5000,
Devilbiss Health Care, Somerset, Pa.) that produces particles of
about 1-3 .mu.m in diameter. Pulmonary resistance was calculated
precisely 1 minute later. Stepwise increases in methacholine dose
were then administered until the pulmonary resistance, in
comparison with the baseline level, had at least doubled. All
animals received serial threefold increases in methacholine from 1
to 100 mg/ml. The data are expressed as the PC.sub.100 (provocative
challenge 100), which is the dose at which pulmonary resistance was
100% above the baseline level as calculated by linear regression
analysis.
[0218] LUNG VOLUME ASSESSMENT: Lung volume assessment was performed
exactly as described in Zheng et al. (2000, J. Clin. Invest.
106:1081-1093)
[0219] DOXYCYCLINE ADMINISTRATION: All inducible transgenic mice
were maintained on normal water until transgene activation was
desired. Doxycycline (dox) was administered in drinking water (0.5
mg/ml). Dox containing water bottles were wrapped in aluminum foil
to prevent light-induced dox breakdown.
[0220] MRNA ANALYSIS: mRNA levels were assessed using Northern blot
and reverse-transcriptase polymerase chain reaction (RT-PCR). Total
cellular RNA was extracted from mouse tissue using TRIZOL.TM.
(Invitrogen, Carlsbad, Calif.) per the manufacturer's instructions.
Primers specific for YM (YM-1 forward primer: TGGAATTGGTGCCCCTACAA;
SEQ ID NO:1, YM-1 reverse primer: AACTTGCACTGTGTATATTG; SEQ ID
NO:2, YM-2 forward primer: AACCTCAGACATTCATTA; SEQ ID NO:3, YM-2
reverse primer: TGGTCCTTCCAGTAGGTAATA; SEQ ID NO:4, YM-3 forward
primer: TATAAATCTCCATTTGACAC; SEQ ID NO:5, YM-3 reverse primer:
CCTAATTTATTGTCCTTGAC; SEQ ID NO:6) and AMCase (AMCase forward
primer: ATCTGCAGTGGACACACCTTCATCCTGA; SEQ ID NO:7, AMCase reverse
primer: ATGAATTCAACAAGCCCTGCTTGACAAT; SEQ ID NO:8) were used in
RT-PCR to amplify and detect these transcripts. Reverse
transcription and PCR were performed using the Access RT-PCR kit
from Promega (Madison, Wis.) per the manufacturer's
instructions.
[0221] IN SITU HYBRIDIZATION OF MURINE LUNGS: In situ hybridization
was used to localize expression of both YM and AMCase in transgenic
animals. Lung tissues were fixed in formaldehyde and processed into
paraffin. Five micron sections were cut, deparaffinized, and
treated with proteinase K (20 .mu.g/ml, 37.degree. C., 20 min).
Tissues were then treated with 0.1 M triethylnolamine/0.25% acetic
anhydride (pH 8) for 10 min at room temperature and rinsed in PBS.
Antisense and sense probes for YM (YM antisense probe:
TCCTCGAGACCCAGGGTACTGC; SEQ ID NO:9, YM sense probe:
TATCTAGAGGATCTTCCTACCAGC; SEQ ID NO:10) and AMCase (AMCase
antisense probe: TCGCTCGAGAACAAGCCCTGCTTGACAAT; SEQ ID NO:11,
AMCase sense probe: GCTCTAGATGGACACACCTTCATCCTGA; SEQ ID NO:12 were
generated by cloning a fragment of mouse AMCase cDNA or YM cDNA
into vector pBS II KS with T3 and T7 primer sequences flanking the
multiple cloning sites (Stratagene, La Jolla, Calif.). The
oligonucleotide primers with XbaI and XhoI restriction enzyme sites
incorporated, were used to amplify DNA fragments from total lung
RNA of an IL-13 transgene (+) mouse. The RT-PCR products were
digested with XbaI and XhoI and cloned into the vector pBS II KS.
Sense and antisense RNA probes were generated, labeled with a
digoxigenin RNA labeling kit (Roche, Indianapolis, Ind.), denatured
at 65.degree. C., and added to commercially available hybridization
buffer (Ambion, Austin, Tex.) at 6 ng/.mu.l, and the hybridization
mixture was incubated with tissue overnight at 52.degree. C. The
tissues were then washed twice with 4.times.SSC for 5 min at room
temperature, twice with 2.times.SSC for 10 min at 37.degree. C.,
and incubated with RNase A (10 .mu.g/ml) for 45 min at 37.degree.
C. This was followed by two 10-min washes in 2.times.SSC at room
temperature and three 20-minwashes in 0.2.times.SSC at 50.degree.
C. Probes were detected by overnight incubation with sheep
antibodies (Abs) to digoxigenin labeled with alkaline phosphatase
(Roche) followed by 4-nitroblue tetrazolium
chloride/5-bromo-4-chloro-3-indoylphosphate, as described by the
manufacturer.
[0222] CRYSTAL PURIFICATION AND ANALYSIS: Crystals were purified
using a ficoll-gradient washing procedure as described by Guo et
al. (2000, J. Biol. Chem. 275:8032-8037). Briefly, BAL fluid from
IL-13 transgenic mice was loaded, in a ratio of 1:5, on top of
Histopaque-1119 with a density of 1.119 grams/ml (Sigma, St. Louis,
Mo.) and centrifuged at 250.times.g for 10 minutes at 4.degree. C.
The supernatant was removed and the pellet was resuspended in PBS
and centrifuged twice more as above. The resulting pellet was
dissolved in SDS-PAGE sample buffer and boiled for 10 minutes
before electrophoresis. SDS-polyacrylamide gel electrophoresis was
performed under reducing conditions using Tris-glycine 4-20%
gradient gels (BioRad, Hercules, Calif.). Protein bands were
visualized by staining with Coomassie Blue, excised with a scalpel
and subjected to in-gel tryptic digestion before mass spectrometric
analysis. The Coomassie Blue stained protein band around 40 kDa was
excised and washed with 50 mM ammonium bicarbonate, 50%
acetonitrile for 30 minutes, followed by a 10 mM ammonium
bicarbonate, 50% acetonitrile wash for an additional 30 minutes.
After washing, the gel pieces were dried and re-hydrated with 0.1
mg modified trypsin (Promega, Madison, Wis.) in 15 .mu.l 10 mM
ammonium bicarbonate. Digestion was done at 37.degree. C. for 24
hours. Matrix assisted laser desorption ionization mass
spectrometry (MALDI-MS) was carried out on 1.0 .mu.l (<5%) of
the digest using a Micromass TofSpec SE mass spectrometer
(Micromass, Beverly, Mass.) in reflectron mode. Prior to MALDI-MS
the sample was mixed with 1.0 .mu.l of alpha-cyano-4-hydroxy
cinnamic acid matrix solution (4.5 mg/ml in 0.05% trifluoroacetic
acid, 50% acetonitrile) plus 1 .mu.l of internal calibrants and
then spotted onto a new single use target. The samples were then
allowed to air dry at room temperature. The internal calibrants
used were 50 femtomoles bradykinin (monoisotopic M+H is 1060.57)
and 125 fmols ACTH Clip 18-39 (monoisotopic M+H is 2465.20). A
total of 92 peptide masses (monoisotopic) were submitted for
peptide mass database searching using Peptide Search (non-redundant
database at the EMBL) and ProFound (at Rockefeller University for
non-redundant database at NCBI). By using either algorithm, 24 of
the 92 peptide masses matched mouse chitinase 3-like 3 protein
(also called YM-1 and ECFL-precursor) with a minimum coverage of
59%. A subsequent search using unmatched peptide masses of the
first pass did not yield any meaningful matches.
[0223] CHITINASE ACTIVITY ASSAYS: BAL fluid, collected as
previously described, was used in a chitinase activity assay. The
chitinase activity in BAL was assessed using a fluorescence assay.
Fluorogenic 4-methylumbelliferyl .beta.-D-N,N'-diacetylchitobioside
was used as a substrate. Assays were performed as the following.
BAL samples were incubated with the substrate at a concentration of
0.02 M in citrate/phosphate buffer (0.1 M/0.2 M), pH 5.2. After 15
min at 37.degree. C., the reaction was stopped by adding 1 ml of
0.3 M glycine/NaOH buffer, pH 10.6 and the fluorescent
4-methylumbelliferone was determined with a fluorimeter at
excitation of 350 nm and emission 450 nm. A standard curve was
generated using 4-methylumbelliferone (Sigma). Chitinase extract
from Serratia marcescens was used as a positive control
(Sigma).
[0224] AEROALLERGEN OVALBUMIN (OVA) SENSITIZATION AND CHALLENGE
TESTS: OVA sensitization and challenge were accomplished using
modifications of the protocols previously described by Yang et al.
(1998, J. Exp. Med. 188:1739-1750). Briefly, wild type mice
received intraperitoneal (i.p.) injections containing 20 .mu.g of
avian OVA (Sigma) complexed to alum (Resorptar; Indergen, New York,
N.Y.). This process was repeated 5 days later. After an additional
7 days, animals received aerosol challenge with OVA (1% w/v) in
endotoxin-free PBS or the animals received endotoxin-free PBS
alone. The aerosol challenge was accomplished in a closed
27.times.20.times.10 cm plastic aerosol chamber in which the mouse
was placed for 40 minutes. The aerosol was generated using an Omron
NE-U07 ultrasonic nebulizer (Omron Healthcare, Vernon Hills, Ill.).
Mice were sacrificed twenty-four hours, forty-eight hours, and
seven days after OVA challenge.
[0225] RELATIVE INDUCTION OF YM AND AMCASE: Affymetrix murine GENE
CHIP arrays (Santa Clara, Calif.) comprising 12,200
oligonucleotides were used to analyze IL-13 induced gene expression
in the murine lung. The levels of gene expression in IL-13
expressing, dox-inducible and control mice were analyzed. The
expression levels were standardized using housekeeping genes (e.g.
actin, GAPDH, hexokinase and the like), and a stimulation index was
calculated by dividing the target ratio in transgene (+) animals by
the target ratio in transgene (-) animals. Similar gene expression
studies were performed in mice constitutively expressing IL-13 and
controls. GENE CHIP assays were performed as follows. Total RNA was
isolated from the lungs of IL-13 transgenic mice and littermate
negative controls with Trizol reagent (Life Technologies,
Gaithersburg, Md.). To prepare samples for Affymetrix GENECHIP
analysis, cDNA was generated from 15 .mu.g of total RNA by use of a
modified oligo-dT primer and a 5' T7 15 RNA polymerase promoter
oligo primer with the Superscript Choice System for cDNA Synthesis
(Life Technologies). After phenol-chloroform extraction and ethanol
precipitation, one-half of the cDNA reaction (0.5-1.0 .mu.g) was
used as a template for an in vitro transcription reaction with
biotinylated UTP and CTP (BioArray High Yield kit, Enzo Biochem,
Farmingdale, N.Y.) by following the manufacturer's protocol. The
resulting cRNA was purified on an affinity resin column (RNeasy,
Qiagen, Valencia, Calif.) and quantified by ultraviolet (UV)
absorbance. For each reaction, 15 .mu.g of biotinylated cRNA were
randomly fragmented to an average size of 50 nucleotides by
incubating them at 94.degree. C. for 35 min in 40 mM Tris-acetate,
pH 8.1, 1,000 mM potassium acetate, and 30 mM magnesium acetate.
The fragmented cRNA was divided into two aliquots that were each
used for hybridization to an MullK Affymetrix GENECHIP according to
the manufacturer's protocol (Affymetrix, Santa Clara, Calif.), with
a duplicate data set generated for all samples. Each target array
was washed and scanned (Hewlett-Packard, GeneArray Scanner G2500A).
Data were analyzed with the Affymetrix GENECHIP software algorithm
to generate "average difference" and/or degree of difference after
the values were normalized. The values obtained from wild type
C57BL/6 littermate controls were used as baseline and the values
from IL-13 transgenic mice were expressed as relative
fold-increases.
[0226] RIBONUCLEASE PROTECTION ASSAY: Ribonuclease protection
assays were performed using the mCK-1 template kit (PharMingen San
Diego, Calif.). Ribonuclease protection assays were performed as
described in, for example, Sambrook et al. (1989, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New
York) and Ausubel et al., 1997 (Current Protocols in Molecular
Biology, John Wiley & Sons, New York).
[0227] ALLOSAMIDIN ADMINISTRATION: Allosamidin (Eli Lilly and Co.,
Greenfield, Ind. and Industrial Research Limited, Lower Hutt, New
Zealand) was administered to inducible IL-13 overexpressing mice
and OVA exposed wild type mice. Mice were given 0.1 mg/kg to 10
mg/kg allosamidin i.p. or vehicle control (PBS). The animals were
then sacrificed and BAL fluid analysis, histologic and morphometric
analysis, and lung volume assessment were performed as described
elsewhere herein.
[0228] The results of the experiments presented in this Example are
now described.
[0229] TRANSGENIC MICE CONSTITUTIVELY EXPRESSING IL-13: Transgene
(+) mice expressing IL-13 constitutively exhibited high levels of
IL-13 in BAL fluid (up to 2.1 ng/ml) and detectable IL-13 mRNA in
the lungs. IL-13 mRNA could not be detected in the skin and other
visceral organs of the transgenic mice, indicating lung-specific
expression of IL-13. Trangene (-) mice did not demonstrate
detectable levels of IL-13 or IL-13 mRNA in BAL fluid or in the
lungs.
[0230] Histologic analysis of transgene (+) mice demonstrated
multiple asthma-like features. These features include eosinophil,
lymphocyte, and macrophage-rich inflammatory responses around the
small and large airways and in the adjoining parenchyma. This
response was milder in young animals, or animals with low levels of
BAL IL-13, and more prominent in older animals or those with higher
BAL levels of IL-13. Epithelial hypertrophy was evident in the
conducting and small airways as well (FIG. 2).
[0231] Constitutive expression of lung-specific IL-13 also resulted
in COPD-like alveolar enlargement and wall rupture, as well as
focal organization of crystalline material into Masson body-like
fibrotic foci. Further, long, thin, needlelike crystals were seen
in the macrophages, alveoli, and occasionally, the airways of
transgene (+) animals.
[0232] As mucus metaplasia and enhanced mucin gene expression are
characteristic of both asthma and COPD, the effect of constitutive
IL-13 expression on airway mucus was undertaken. Both PAS and
alcian blue staining demonstrated that mucus accumulation was
prominent in the airways of transgene (+) mice, but not in
transgene (-) littermates (FIG. 3). Impressive increases in the
mucin genes MUC5AC, MUC2 and MUC4 mRNA were also evident in
transgene (+) mice.
[0233] Airway remodeling with subepithelial fibrosis is a well
documented feature of the asthmatic airway, and disordered repair
and parenchymal fibrosis are often noted as aspects of emphysema.
These features of inflammatory diseases are associated with
increased collagen deposition. Accordingly, Masson's trichrome
stains, sirius red, and hydroxyproline assays were used to evaluate
the collagen deposition in the airways of transgene (+) and (-)
animals.
[0234] A small amount of collagen was seen in and near the airway
wall in transgene (-) animals, and loosely packed collagen was
detected in the bronchovascular bundles. In sharp contrast,
enhanced collagen deposition was seen in the subepithelial region
and aventitia of the small and large airways of transgene (+)
animals (FIG. 4), similar to findings in human airway disorders.
Scarring and parenchymal fibrosis was observed in older animals,
and these features increased with age. Increased levels of
hydroxyproline could be detected as early as 4-6 weeks after IL-13
production, and three month old animals had significantly (4.1
fold, p<0.001) higher hydroxyproline levels than transgene (-)
animals.
[0235] Both asthma and COPD patients demonstrate airway obstruction
and AHR (an exaggerated bronchospastic response to non-specific
agonists like methacholine). Accordingly, studies were undertaken
to determine if these airway alterations were present in the IL-13
transgenic animal model. Baseline airway resistance was mildly
elevated in transgene (+) animals. In addition, AHR was also seen
after methacholine challenge, as determined using invasive and
non-invasive assessment methodologies. These data indicate asthma-
and COPD-like physiological alterations are present in the IL-13
transgenic model.
[0236] INDUCIBLE TRANSGENIC MICE: The lung-specific inducible
transgenic animal system allows for temporal control of IL-13
expression in the murine lungs. This mimics the waxing and waning
patterns of IL-13 expression seen in asthma and COPD and
circumvents the abnormalities caused by the in utero or neonatal
gene expression seen with other transgenic models.
[0237] Inducible transgenic mice were kept on normal (dox-free)
water until one month of age. IL-13 was not detected in the BAL
fluid from transgene (-) animals on dox or normal water. In the
absence of dox, levels of BAL IL-13.ltoreq.75 pg/ml were found in
transgene (+) animals. Within 24 hours of dox administration,
transgene (+) animals demonstrated increased BAL IL-13 levels, and
steady state levels ranging from about 0.5 to 1.5 ng/ml were
observed within 96 hours after dox administration. BAL IL-13 levels
returned to background levels within 96 hours after dox
administration ceased. IL-13 mRNA was only detectable in pulmonary
tissues of transgene (+) animals.
[0238] H&E and trichrome staining demonstrated that lungs
obtained from transgene (-) mice given normal water or
dox-containing water did not demonstrate any histological
abnormalities, nor could those lungs be distinguished from the
lungs obtained from transgene (+) mice given normal water. However,
transgene (+) mice given normal water did show mild mucus
metaplasia after D-PAS staining.
[0239] Conversely, transgene (+) mice given dox water exhibited
notable inflammatory, mucus, and structural alterations. As little
as seven days after dox administration, inflammation in BAL fluid
was prominent. At this time point, there was a 7.5 fold increase in
cell recovery from BAL fluid and a significant increase in the
percentage of BAL fluid eosinophils (63%, p<0.001) in transgene
(+) mice given dox water. Lymphocyte and macrophage recovery were
also significantly increased (p<0.01) in these mice. Also,
mononuclear, lymphocytic and eosinophilic infiltrates were
prominent in airway and peribroncheal structures, as was an
increase in mucus metaplasia. Additionally, substantial increases
in MUC-5AC, MUC-2, and MUC-4 mRNA were noted. Chronic
administration of dox resulted in subepithelial fibrosis, alveolar
enlargement, and crystal deposition, very similar to that observed
in transgenic mice constitutively expressing IL-13.
[0240] The emphysema in COPD is defined pathologically as the
abnormal enlargement of the airspaces distal to the terminal
bronchial of the lung (Senior and Shapiro, 1998, Fishman's
Pulmonary Diseases and Disorders, Vol. 1, McGraw-Hill, N.Y.). As
previously noted, mice expressing IL-13 constitutively displayed
enlarged alveoli. To determine whether this enlargement was due to
faulty development or to the destruction of lung tissue in a
normally formed lung, inducible transgenic (+) mice were given dox
water only after full lung development was completed. After dox
administration, IL-13 induced alveolar enlargement was apparent
using both histologic and morphometric techniques. In the absence
of dox, normal alveoli were seen in both transgene (-) and (+)
animals (FIG. 6).
[0241] YM CRYSTAL DEPOSITION IN IL-13 OVEREXPRESSING MICE: As
previously noted, crystals were seen in both inducible and
constitutive IL-13 transgene mice. The presence of the crystals was
both dose- and time-dependent. In constitutive IL-13 mice, crystals
could be seen at the earliest time point assessed (1 month), and
impressive crystal accumulation was evident in three month old
animals. Similarly, the inducible IL-13 mice displayed crystals in
various tissues and cells of the airway at about the same time
intervals after dox administration. In young mice, crystals were
most commonly seen in macrophages, parenchyma and alveoli, and less
commonly in distal airways. In older animals, considerable alveolar
and parenchymal crystal deposition was noted, including many
alveoli completely filled with crystalline deposits. Crystals were
multi-faceted, often needle shaped, and approximately 20-120 .mu.m
in length (FIG. 7).
[0242] Crystals were purified from BAL fluid from constitutive
IL-13 transgenic (+) mice using a ficoll density gradient method as
described elsewhere herein. These crystals were assayed and
determined to be comprised of YM proteins. No other peptides were
found in the sample, and YM proteins were not detected in transgene
(-) animals, indicating that the crystals in IL-13 transgene (+)
animals comprise YM proteins.
[0243] YM GENE EXPRESSION IN IL-13 OVEREXPRESSING MICE: RT-PCR was
performed as described herein to determine if YM protein expression
was induced by IL-13. In whole lung RNA from transgene (-) animals,
YM mRNA was at or near the lower sensitivity limits of the assay
(FIG. 9). In stark contrast, in transgenic mice constitutively
expressing IL-13, YM mRNA was detected in all time points assessed
(1 to 3 month old mice). Inducible transgene (+) mice that did not
receive dox demonstrated low levels of YM mRNA, indicating a mildly
"leaky" system. Upon administration of dox, striking increases in
YM mRNA were observed as little as 48 hours after dox introduction,
and high levels of YM mRNA expression continued throughout the
three month period in which dox was administered (FIG. 10).
[0244] In situ hybridization was used to localize the sites of YM
protein production in IL-13 transgenic animals. YM mRNA could not
be detected in transgene (-) mice, but impressive levels were
detected in transgene (+) animals using antisense probes. In
transgene (+) animals, YM localized intensely to macrophages and to
airway epithelial cells. It should be noted that YM staining was
not detected when the same tissues were probed using sense
oligonucleotides (FIG. 11), confirming the specificity of these
results.
[0245] To ascertain whether cytokine induction of YM mRNA
expression was IL-13 specific, RT-PCR analysis was undertaken using
whole lung RNA from a variety of other transgenic mice. IL-4
transgenic mice expressed exaggerated levels of YM in their lungs,
similar to IL-13 transgenic mice. This coincides with evidence
indicating that IL-4 is another important cytokine in human airway
disorders, as stated previously elsewhere herein. Transgenic mice
constitutively expressing IL-6, IL-11, vascular endothelial growth
factor.sub.165 (VEGF) and IL-10 demonstrated YM mRNA levels
comparable to that of IL-13 transgene (-) littermate controls,
further confirming that the cytokines postulated to play a role in
Th2 dominated respiratory inflammation, i.e., IL-13 and IL-4, are
also potent and specific inducers of YM expression.
[0246] CHITINASE ACTIVITY IN BAL FLUID FROM IL-13 OVEREXPRESSING
MICE: Chitinase activity in BAL fluids from transgene (+) and (-)
mice constitutively expressing IL-13 was assayed using methods
described elsewhere herein. BAL fluid obtained from transgene (-)
mice had levels of chitinase activity .ltoreq.75 units/ml. In
contrast, an impressive increase in chitinase activity in transgene
(+) mice was detected (FIG. 12). That is, chitinase activity was
detected in 1 month old transgene (+) animals, and continued to
increase as the animals aged. Similarly, chitinase activity was
detected in inducible transgene (+) animals as little as two days
after dox administration, and this activity also increased over
time. Transgenic mice overexpressing IL-4 also demonstrated
increased levels of chitinase activity. However, BAL fluid from
IL-6, IL-11, VEGF, and IL-10 transgene (+) animals had basal levels
of chitinase activity. These data indicate that increased chitinase
activity correlates with increased IL-13 and/or IL-4 expression and
with increased YM protein expression and crystal deposition in lung
tissues.
[0247] AMCASE EXPRESSION IN IL-13 TRANSGENIC MICE: Conflicting
reports have indicated that YM may or may not have chitinase
activity. For instance, both purified and recombinant YM have
failed to demonstrate chitinase activity in a number of assays,
indicating that it is not a chitinase, but rather a chitinase-like
molecule (Chang et al., 2001, J. Biol. Chem. 276:17497-17506). BAL
fluid from IL-13 transgene (+) mice demonstrates detectable
chitinase activity, indicating that a chitinase family protein may
be present in the BAL fluid of these mice. To date, AMCase is the
only enzyme identified in murine systems that demonstrates true
chitinase activity. To determine whether AMCase expression was
augmented in the IL-13 transgene (+) mouse lung, RT-PCR primers
specific for AMCase were used, as described above. mRNA levels in
transgene (-) littermate controls were near or below detection
levels in the assay employed. Conversely, impressive increases in
AMCase mRNA levels were found in both constitutive and inducible
IL-13 transgenic models. In the former it was noted in animals that
were one month to three months of age. In the latter as little as
seven days after dox administration, respectively. Similar to YM
protein expression, AMCase expression was specific to IL-13
transgenic animals, as it was not detected in lungs from the other
transgenic animals (IL-10, VEGF, IL-6, and IL-11) assessed
herein.
[0248] In situ hybridization was employed to localize AMCase
production in IL-13 transgenic mice. Prominent accumulation of
AMCase mRNA was detected in epithelial cells and, to a lesser
extent, in the macrophages. In contrast, AMCase mRNA was not
detected in transgene (-) mice (FIG. 14).
[0249] CHITINASE GENE EXPRESSION IN AN OVA-INDUCED MURINE ASTHMA
MODEL: Studies were performed to ascertain whether YM proteins
and/or AMCase were induced in the standard Th2-driven murine asthma
model. To this end, the chitinase activity of BAL fluid and the
expression of these two genes in lungs of OVA sensitized wild type
mice was investigated. In animals that were OVA sensitized, but did
not receive an OVA challenge, mRNA levels and BAL fluid chitinase
activity were near the limits of detection levels of the assays.
However, after OVA challenge, YM and AMCase mRNA levels were
readily detected and persisted for 7 days after antigen challenge.
BAL fluid chitinase activity increased accordingly as well (FIG.
15).
[0250] RELATIVE INDUCTION OF YM AND AMCASE: Affymetrix GENE CHIPS,
comprising 12,200 oligonucleotides, were used to assess the IL-13
induced gene expression alterations in inducible transgenic animals
that had been given dox from 1 month to 2 months of age, and
compared with transgene (-) littermate controls. The GENE CHIP
analysis indicated that over 200 genes were increased by at least
2.5 fold, and approximately 140 genes were downregulated by dox
administration. Importantly, the gene most prominently induced
after dox administration was YM (stimulation index of 64.1.+-.0.5).
AMCase was not present on the chip, but another chitinase family
gene, BRP39, was the twelfth most prominently induced gene in the
array (stimulation index of 7.1.+-.0.5). It should be noted that
dox administration did not cause significant alterations in gene
expression of transgene (-) animals.
[0251] As AMCase was not present on the GENE CHIP, other methods,
including RT-PCR, Northern blot analysis, and ribonuclease
protection assays were employed. All indicated that AMCase is an
important downstream target of IL-13. This further demonstrates
that AMCase is induced during the course of and potentially
involved in the pathogenesis of IL-13 induced respiratory
inflammation.
[0252] EFFECTS OF ALLOSAMIDIN IN MURINE ASTHMA MODELS: Allosamidin
is a known potent and selective inhibitor of chitinases. Wild type
mice were sensitized to OVA and challenged with OVA a number of
days later. One day prior to OVA challenge, mice were randomized
into two groups and received daily i.p. doses of allosamidin or of
vehicle control. Similar to the symptoms of human asthma, the OVA
sensitization and challenge model results in a brisk eosinophil-
and lymphocyte-rich inflammatory response with prominent mucus
metaplasia and goblet cell hyperplasia. Allosamidin administration
resulted in a dose-dependent inhibition of total cell, eosinophil
and lymphocyte influx in the OVA challenged lung (FIG. 16). The
inhibitory effect was most prominent in the highest dose tested (10
mg/kg), and was still prominent at the lowest (1 mg/kg). Therefore,
allosamidin inhibited antigen-induced inflammation in an
art-recognized murine model of human asthma.
[0253] Similarly, six-week old transgene (+) IL-13 mice were
randomized to receive fourteen daily doses i.p. of allosamidin (1
mg/kg) or vehicle control. The animals were then sacrificed and the
IL-13 phenotype was evaluated. In comparison to transgene (+) mice
that received the vehicle control, transgene (+) mice that received
allosamidin injections displayed markedly decreased BAL fluid cell
recovery, decreased tissue inflammation, and impressive decreases
in BAL and tissue eosinophils and lymphocytes. Morphometric,
histologic, and lung volume assessment analysis indicated that the
allosamidin treated animals had decreased lung volumes and smaller
alveoli than the littermate controls, indicating that allosamidin
is a potent inhibitor of both IL-13 induced inflammation and lung
remodeling. It is important to note that in these experiments,
allosamidin administration commenced six weeks after the birth of
the transgenic mice constitutively expressing IL-13, that is, after
the asthma-like phenotype had commenced. Thus allosamidin treatment
in these mice and COPD decreased the progression of lung pathology
even after the pathologic response had been initiated. This is
analogous to therapeutic situations in humans where pharmaceutical
compositions are administered after respiratory inflammatory
diseases have already been diagnosed and have progressed to some
degree. These results indicate that inhibitors of a chitinase-like
molecule can successfully treat diseases even after chronic
pathology has been established.
[0254] Effects of Anti-AMCase Antibodies in Murine Asthma
Models
[0255] Wild type mice were sensitized to OVA and challenged with
OVA a number of days later. One day prior to OVA challenge, mice
were randomized into two groups and received daily doses of
anti-AMCase antibodies or a serum control. Similar to the symptoms
of human asthma, the OVA sensitization and challenge model results
in a brisk eosinophil- and lymphocyte-rich inflammatory response
with prominent mucus metaplasia and goblet cell hyperplasia.
Anti-AMCase antibody administration resulted in a significant
inhibition of total cell and eosinophil influx into the BAL fluid
of these OVA challenged lungs (FIG. 18). A similar decrease in
total and eosinophilic inflammation was noted in OVA sensitized and
challenged long tissues. Therefore, anti-AMCase inhibited
antigen-induced inflammation in an art-recognized murine model of
human asthma.
[0256] AMCase Expression in Human Lung Tissue
[0257] The observations in the art-recognized mouse model of human
asthma were extended to assessing the expression of AMCase in human
lung tissue that was obtained at autopsy using in situ
hybridization. Briefly, similarly to the protocols described
previously elsewhere herein relating to in situ hybridization for
detection of mouse AMCase and Ym-1 mRNA, normal and asthmatic lung
tissues were obtained through biopsies and fixed in formaldehyde
and processed into paraffin. Five micron sections were cut,
deparaffinized, and treated with proteinase K (20 .mu.g/ml,
37.degree. C., 20 min). Tissues were then treated with 0.1 M
triethylnolamine/0.25% acetic anhydride (pH 8) for 10 min at room
temperature and rinsed in PBS.
[0258] The templates for ISH probes for human AMCase were purchased
from Research Genetics, Inc. (Huntsville, Ala.) as expressed
sequence tag (EST) clones 5182357. The clone was generated using
vector pCMV-SPORT6 comprising T7 and SP6 promoter sequences
flanking the insert fragment. The sequence of the clone matched
human AMCase mRNA from nucleotide 769-1538 (SEQ ID NO:14). The
sequence of the clone was confirmed by nucleotide sequencing at
Keck Biotechnology Laboratory at Yale University. Sense and
antisense RNA probes were in vitro transcribed and labeled with a
digoxigenin RNA labeling kit (Roche, Indianapolis, Ind.), denatured
at 65.degree. C., and added to commercially available hybridization
buffer (Ambion, Austin, Tex.) at 6 ng/.mu.l, and the hybridization
mixture was incubated with tissue overnight at 52.degree. C. The
tissues were then washed twice with 4.times.SSC for 5 minutes at
room temperature, twice with 2.times.SSC for 10 minutes at
37.degree. C., and incubated with RNase A (10 .mu.g/ml) for 45
minutes at 37.degree. C. This was followed by two 10-minute washes
in 2.times.SSC at room temperature and three 20-minute washes in
0.2.times.SSC at 50.degree. C. Probes were detected by overnight
incubation with sheep antibodies to digoxigenin conjugated with
alkaline phosphatase (Roche) followed by 4-nitroblue tetrazolium
chloride/5-bromo-4-chloro-3-indoylphosphate, as described by the
manufacturer.
[0259] Expression of AMCase in histologically normal human lung
tissue ("control tissue") was compared with AMCase expression in
tissues obtained from human patients that had succumbed due to
fatal asthma ("fatal asthma"). Using in situ hybridization, AMCase
mRNA was detected in fatal asthma lung samples but not in control
lung tissue using a sense probe (FIGS. 19A and 19B, respectively).
AMCase mRNA was localized to epithelial cells and macrophages in
fatal asthma tissue. Further, a sense probe did not detect mRNA
encoding AMCase in either fatal asthma or control lung tissue,
demonstrating the specificity of the probe. In addition, a poly-dT
probe highlighted intact mRNA in both samples.
[0260] Expression of AMCase mRNA in human alveolar macrophages was
also assessed. In situ hybridization using an AMCase antisense
probe demonstrated detectable AMCase mRNA in alveolar macrophages
in fatal asthma lung samples (FIG. 19E) but not in the control
samples. AMCase mRNA was not detected in fatal asthma lung samples
using a sense AMCase probe, demonstrating the specificity of the in
situ hybridization procedure.
[0261] These data confirm that the results obtained using the
art-recognized mouse model of human asthma are in accordance with
human in vivo data. That is, the data disclosed herein demonstrate,
for the first time, that AMCase mRNA expression is greatly
increased, and correlated with, asthma in humans, since AMCase mRNA
is present in detectable levels in fatal asthma lung tissue, but is
not detectable in histologically normal lung tissue. These results
further support the demonstration that expression of chitinase-like
molecules is associated with and/or mediates inflammatory disease
in mammals. Thus, the data disclosed herein further support that
inhibition of AMCase, using a chitinase-like molecule inhibitor,
can treat and/or prevent an inflammatory disease, such as, but not
limited to, asthma, in a mammal, including, a human patient.
Discussion
[0262] The present invention is based, in part, on experimental
evidence strongly suggesting that the Th2 inflammatory responses
characteristic of allergies, atopic asthma and the inflammatory and
ainvay remodeling responses associated with these disorders have
evolved from the Th2 inflammatory responses first developed to
combat parasites and other pathogens. Asthma and other inflammatory
diseases are thus the consequence of poorly controlled Th2
responses elicited in a parasite and pathogen-independent
manner.
[0263] A vast array of parasites and other pathogens contain
chitin. It is an essential component in the exoskeletons of
crustaceans and insects, the walls of fungi, the digestive tracts
of insects, the microfilarial sheath of parasitic nematodes and
components of helminthic parasites. Chitin is a polymer of
N-acetylglucosamine residues in a .beta.-1,4 linkage and is the
second most abundant polysaccharide in nature, behind cellulose,
and has no mammalian counterpart. Chitin often comprises the
exterior of parasites and other pathogens because, depending on its
thickness, it can be a rigid or flexible coating vital to
protecting the organisms from the host defenses and from the
surrounding environment. Thusly, because it is present at the
host/pathogen interface, chitin is a prominent antigen since it is
exposed to the immune system. In fact, chitin has demonstrated to
be a potent T and B cell adjuvant which augments immunoglobulin
responses to poorly immunogenic peptides, and which can shift
immune responses in a Th1 direction (Seferian and Martinez, 2000,
Vaccine 19:661-668; Shibata et al., 2000 J. Immunol.
164:1314-1321).
[0264] Given the enormous body of evidence demonstrating the
co-evolution of parasites and humans, especially in regards to host
immune responses, and the complete lack of chitin in mammals, it is
reasonable to believe, without intending to be bound by any
particular theory, that mammals developed chitinases as an innate
defense against chitin-bearing parasites. Chitinases have been
identified in mammals. Chitotriosidase and YKL-39 have been
described in humans, YM protein has been described in the mouse,
and acidic mammalian chitinase (AMCase), oviductin, and YKL-40 have
been described in both mice and humans (Boot et al., 2001, J. Biol.
Chem. 276:6770-6778; Boot et al., 1998, J. Biol. Chem.
273:25680-25685; Ward et al., 2001, Am. J. Pathol. 158:323-332;
Chang et al., 2001, J. Biol. Chem. 276:17497-17506; Jin et al.,
1998, Genetics 54:316-322; Bleau et al., 1999, EXS 87:211-221).
Despite conflicting reports and some sequence homology to microbial
chitinases, only chitotriosidase and AMCase have demonstrated true
chitinase activity (Boot et al., 2001, J. Biol. Chem.
276:6770-6778). Of the mammalian chitinases, both YM-1 and AMCase
have been identified as having chemotactic and growth factor-like
properties. YM-1 is a single chain peptide of 45 kDa that readily
forms crystals under physiological conditions. YM family proteins
have been identified as both eosinophilic and a CD4.sup.+ T-cell
attractant, as well as having lectin activity (Owhashi et al.,
2000, J. Biol. Chem. 275:12791286; Chang et al., 2001, J. Biol.
Chem. 276:17497-17506). AMCase is a 50 kDa protein that
demonstrates chitinase activity. It has also been reported as a
fibroblast growth promoting agent (Guoping et al., 1997, J. Cell.
Biochem. 67:257-264). As demonstrated by the data disclosed herein,
both YM family proteins and AMCase are highly expressed in the lung
of IL-13 induced, and Th2 mediated asthma models.
[0265] Without wishing to be bound by any particular theory, when
viewed in combination with the role of chitin in the asthmatic
condition, the novel discovery of the role of chitinases in asthma
and other respiratory inflammatory diseases may be viewed as
follows. In a non-atopic, non-asthmatic subject, exposure to chitin
as an antigen, possibly after exposure to a parasite or fungus,
polarizes the immune response towards a Th1 pathway, which may or
may not effectively combat the parasite. However, in the atopic
subject or one genetically disposed to asthma or atopy, IL-13
and/or IL-4 are produced which upregulate the expression of YM,
AMCase, and possibly other chitinases and chitinase-like molecules.
Chitin, as detailed earlier, augments IgE production. YM family
proteins, alone or in combination with other molecules, possess
eosinophil and CD4.sup.+ T cell chemotactic properties. Therefore,
YM proteins can attract eosinophils to the lung, as well as cause
tissue damage mediated by its carbohydrate-binding and
crystal-forming characteristics. AMCase eventually degrades the
chitin to eliminate the pathogen. Because of the Th1 inducing
properties of chitin, AMCase activity and subsequent chitin
degradation steers the immune system towards a Th2 response
characteristic of atopy and asthmatic inflammatory diseases.
[0266] The present invention includes methods and therapeutics for
the treatment of asthma, COPD, and other inflammatory diseases
using chitinase-like molecule inhibitors. The invention further
comprises methods of identifying novel therapeutics for the
treatment of asthma, COPD, and other inflammatory diseases relating
to IL-13, IL-4 chitinases and chitinase-like molecule
inhibitors.
[0267] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety.
[0268] While this invention has been disclosed with reference to
specific embodiments, it is apparent that other embodiments and
variations of this invention may be devised by others skilled in
the art without departing from the true spirit and scope of the
invention. The appended claims are intended to be construed to
include all such embodiments and equivalent variations.
Sequence CWU 1
1
16120DNAArtificial SequenceYM-1 Forward Primer 1tggaattggt
gcccctacaa 20220DNAArtificial SequenceYM-1 Reverse Primer
2aacttgcact gtgtatattg 20318DNAArtificial SequenceYM-2 Forward
Primer 3aacctcagac attcatta 18421DNAArtificial SequenceYM-2 Reverse
Primer 4tggtccttcc agtaggtaat a 21520DNAArtificial SequenceYM-3
Forward Primer 5tataaatctc catttgacac 20620DNAArtificial
SequenceYM-3 Reverse Primer 6cctaatttat tgtccttgac
20728DNAArtificial SequenceAMCase Forward Primer 7atctgcagtg
gacacacctt catcctga 28828DNAArtificial SequenceAMCase Reverse
Primer 8atgaattcaa caagccctgc ttgacaat 28922DNAArtificial
SequenceYM Antisense In Situ Hybridization Probe 9tcctcgagac
ccagggtact gc 221024DNAArtificial SequenceYM Sense In Situ
Hybridization Probe 10tatctagagg atcttcctac cagc
241129DNAArtificial SequenceAMCase Antisense In Situ Hybridization
Probe 11tcgctcgaga acaagccctg cttgacaat 291228DNAArtificial
SequenceAMCase sense In Situ Hybridization Probe 12gctctagatg
gacacacctt catcctga 281319PRTArtificial SequenceAnti-AMCase
Antibody Immunizing Peptide 13Ala Asp Lys Ala Asp Gly Leu Tyr Pro
Val Ala Asp Asp Arg Asn Ala1 5 10 15Phe Trp Gln141038DNAArtificial
SequenceAMCase sense in situ hybridization probe 14tggagagaac
agccccctct acaaataccc gactgacacc ggcagcaacg cctacctcaa 60tgtggattat
gtcatgaact actggaagga caatggagca ccagctgaga agctcatcgt
120tggattccct acctatggac acaacttcat cctgagcaac ccctccaaca
ctggaattgg 180tgcccccacc tctggtgctg gtcctgctgg gccctatgcc
aaggagtctg ggatctgggc 240ttactacgag atctgtacct tcctgaaaaa
tggagccact cagggatggg atgcccctca 300ggaagtgcct tatgcctatc
agggcaatgt gtgggttggc tatgacaacg tcaagagctt 360cgatattaag
gctcaatggc ttaagcacaa caaatctgga ggcgccatgg tctgggccat
420tgatctggat gacttcactg gcactttctg caaccagggc aagtttcccc
taatctccac 480cctgaagaag gccctcgggc tgcagagtgc aagttgcacg
gctccagctc agcccattga 540gccaataact gctgctccca gtggcagcgg
gaacgggagc gggagtagca gctctggagg 600cagctcggga ggcagtggat
tcttgtgctt ggcagagcaa acgagctcta accccgtggg 660caaattacca
gaagatgcct tctgggcact gcgtgaatgg agtcacgtac caggcagaac
720ttgccaggcc gggcttgtcc ttcgagacca gctgtgaatg ctgcaactgg
gcattaacct 780gacctggtct atattcccta gagttccagt ctctttggct
taggacatgg ttggccccta 840aacttaaagg ctcctggcaa gtagaaattc
aggcagctca aaaccagaac cgcaggagga 900caggaaagga gaagaacaaa
cagcgggggc ggcgcgcaat aaagacacac ccagagggcg 960caacacggag
aggaccccga gatagtcgaa ccagaggggc ccaaaaagag agagcggaat
1020aaaagagaga cggagcgg 1038151867DNAHomo sapiens 15cacatagctc
agttcccata aaagggctgg tttgccgcgt cggggagtgg agtgggacag 60gtatataaag
gaagtacagg gcctggggaa gaggccctgt ctaggtagct ggcaccagga
120gccgtgggca agggaagagg ccacaccctg ccctgctctg ctgcagccag
aatgggtgtg 180aaggcgtctc aaacaggctt tgtggtcctg gtgctgctcc
agtgctgctc tgcatacaaa 240ctggtctgct actacaccag ctggtcccag
taccgggaag gcgatgggag ctgcttccca 300gatgcccttg accgcttcct
ctgtacccac atcatctaca gctttgccaa tataagcaac 360gatcacatcg
acacctggga gtggaatgat gtgacgctct acggcatgct caacacactc
420aagaacagga accccaacct gaagactctc ttgtctgtcg gaggatggaa
ctttgggtct 480caaagatttt ccaagatagc ctccaacacc cagagtcgcc
ggactttcat caagtcagta 540ccgccatttc tgcgcaccca tggctttgat
gggctggacc ttgcctggct ctaccctgga 600cggagagaca aacagcattt
taccacccta atcaaggaaa tgaaggccga atttataaag 660gaagcccagc
cagggaaaaa gcagctcctg ctcagcgcag cactgtctgc ggggaaggtc
720accattgaca gcagctatga cattgccaag atatcccaac acctggattt
cattagcatc 780atgacctacg attttcatgg agcctggcgt gggaccacag
gccatcacag tcccctgttc 840cgaggtcagg aggatgcaag tcctgacaga
ttcagcaaca ctgactatgc tgtggggtac 900atgttgaggc tgggggctcc
tgccagtaag ctggtgatgg gcatccccac cttcgggagg 960agcttcactc
tggcttcttc tgagactggt gttggagccc caatctcagg accgggaatt
1020ccaggccggt tcaccaagga ggcagggacc cttgcctact atgagatctg
tgacttcctc 1080cgcggagcca cagtccatag aatcctcggc cagcaggtcc
cctatgccac caagggcaac 1140cagtgggtag gatacgacga ccaggaaagc
gtcaaaagca aggtgcagta cctgaaggac 1200aggcagctgg cgggcgccat
ggtatgggcc ctggacctgg atgacttcca gggctccttc 1260tgcggccagg
atctgcgctt ccctctcacc aatgccatca aggatgcact cgctgcaacg
1320tagccctctg ttctgcacac agcacggggg ccaaggatgc cccgtccccc
tctggctcca 1380gctggccggg agcctgatca cctgccctgc tgagtcccag
gctgagcctc agtctccctc 1440ccttggggcc tatgcagagg tccacaacac
acagatttga gctcagccct ggtgggcaga 1500gaggtaggga tggggctgtg
gggatagtga ggcatcgcaa tgtaagactc gggattagta 1560cacacttgtt
gattaatgga aatgtttaca gatccccaag cctggcaagg gaatttcttc
1620aactccctgc cccccagccc tccttatcaa aggacaccat tttggcaagc
tctatcacca 1680aggagccaaa catcctacaa gacacagtga ccatactaat
tataccccct gcaaagccca 1740gcttgaaacc ttcacttagg aacgtaatcg
tgtcccctat cctacttccc cttcctaatt 1800ccacagctgc tcaataaagt
acaagagctt aacagtgaaa aaaaaaaaaa aaaaaaaaaa 1860aaaaaaa
186716383PRTHomo sapiens 16Met Gly Val Lys Ala Ser Gln Thr Gly Phe
Val Val Leu Val Leu Leu1 5 10 15Gln Cys Cys Ser Ala Tyr Lys Leu Val
Cys Tyr Tyr Thr Ser Trp Ser20 25 30Gln Tyr Arg Glu Gly Asp Gly Ser
Cys Phe Pro Asp Ala Leu Asp Arg35 40 45Phe Leu Cys Thr His Ile Ile
Tyr Ser Phe Ala Asn Ile Ser Asn Asp50 55 60His Ile Asp Thr Trp Glu
Trp Asn Asp Val Thr Leu Tyr Gly Met Leu65 70 75 80Asn Thr Leu Lys
Asn Arg Asn Pro Asn Leu Lys Thr Leu Leu Ser Val85 90 95Gly Gly Trp
Asn Phe Gly Ser Gln Arg Phe Ser Lys Ile Ala Ser Asn100 105 110Thr
Gln Ser Arg Arg Thr Phe Ile Lys Ser Val Pro Pro Phe Leu Arg115 120
125Thr His Gly Phe Asp Gly Leu Asp Leu Ala Trp Leu Tyr Pro Gly
Arg130 135 140Arg Asp Lys Gln His Phe Thr Thr Leu Ile Lys Glu Met
Lys Ala Glu145 150 155 160Phe Ile Lys Glu Ala Gln Pro Gly Lys Lys
Gln Leu Leu Leu Ser Ala165 170 175Ala Leu Ser Ala Gly Lys Val Thr
Ile Asp Ser Ser Tyr Asp Ile Ala180 185 190Lys Ile Ser Gln His Leu
Asp Phe Ile Ser Ile Met Thr Tyr Asp Phe195 200 205His Gly Ala Trp
Arg Gly Thr Thr Gly His His Ser Pro Leu Phe Arg210 215 220Gly Gln
Glu Asp Ala Ser Pro Asp Arg Phe Ser Asn Thr Asp Tyr Ala225 230 235
240Val Gly Tyr Met Leu Arg Leu Gly Ala Pro Ala Ser Lys Leu Val
Met245 250 255Gly Ile Pro Thr Phe Gly Arg Ser Phe Thr Leu Ala Ser
Ser Glu Thr260 265 270Gly Val Gly Ala Pro Ile Ser Gly Pro Gly Ile
Pro Gly Arg Phe Thr275 280 285Lys Glu Ala Gly Thr Leu Ala Tyr Tyr
Glu Ile Cys Asp Phe Leu Arg290 295 300Gly Ala Thr Val His Arg Ile
Leu Gly Gln Gln Val Pro Tyr Ala Thr305 310 315 320Lys Gly Asn Gln
Trp Val Gly Tyr Asp Asp Gln Glu Ser Val Lys Ser325 330 335Lys Val
Gln Tyr Leu Lys Asp Arg Gln Leu Ala Gly Ala Met Val Trp340 345
350Ala Leu Asp Leu Asp Asp Phe Gln Gly Ser Phe Cys Gly Gln Asp
Leu355 360 365Arg Phe Pro Leu Thr Asn Ala Ile Lys Asp Ala Leu Ala
Ala Thr370 375 380
* * * * *