U.S. patent application number 12/152561 was filed with the patent office on 2009-06-04 for recombinant gelatins.
This patent application is currently assigned to FibroGen, Inc.. Invention is credited to Robert C. Chang, Kari Kivirikko, Thomas B. Neff, David R. Olsen, James W. Polarek.
Application Number | 20090143568 12/152561 |
Document ID | / |
Family ID | 26861120 |
Filed Date | 2009-06-04 |
United States Patent
Application |
20090143568 |
Kind Code |
A1 |
Chang; Robert C. ; et
al. |
June 4, 2009 |
Recombinant gelatins
Abstract
The present invention relates to recombinant gelatins and
compositions thereof, and methods of producing and using the
same.
Inventors: |
Chang; Robert C.;
(Burlingame, CA) ; Kivirikko; Kari; (Oulu, FI)
; Neff; Thomas B.; (Atherton, CA) ; Olsen; David
R.; (Menlo Park, CA) ; Polarek; James W.;
(Sausalito, CA) |
Correspondence
Address: |
FIBROGEN, INC.
409 Illinois Street
San Francisco
CA
94158
US
|
Assignee: |
FibroGen, Inc.
South San Francisco
CA
|
Family ID: |
26861120 |
Appl. No.: |
12/152561 |
Filed: |
May 15, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11139377 |
May 27, 2005 |
7393928 |
|
|
12152561 |
|
|
|
|
09710239 |
Nov 10, 2000 |
6992172 |
|
|
11139377 |
|
|
|
|
60204437 |
May 15, 2000 |
|
|
|
60165114 |
Nov 12, 1999 |
|
|
|
Current U.S.
Class: |
530/354 |
Current CPC
Class: |
C07K 14/78 20130101;
A61K 38/00 20130101; A61P 31/04 20180101; A61P 31/14 20180101; A61P
31/16 20180101; A61P 19/02 20180101; A61K 2800/86 20130101; G03C
1/047 20130101; A61P 31/12 20180101; A61Q 19/00 20130101; A61K
9/0019 20130101; A61K 9/0014 20130101; C08L 89/06 20130101; A61P
31/20 20180101; A61K 8/65 20130101; A61K 47/42 20130101; A23L
29/284 20160801; A61P 31/22 20180101; C08H 1/06 20130101 |
Class at
Publication: |
530/354 |
International
Class: |
C07K 14/00 20060101
C07K014/00 |
Claims
1. A recombinant gelatin comprising the amino acid sequence of SEQ
ID NO:15.
2. An encapsulant comprising the recombinant gelatin of claim
1.
3. A stabilizing agent comprising the recombinant gelatin of claim
1.
4. A film-forming agent comprising the recombinant gelatin of claim
1.
5. An emulsifier comprising the recombinant gelatin of claim 1.
6. A thickening agent comprising the recombinant gelatin of claim
1.
7. A colloidal agent comprising the recombinant gelatin of claim
1.
8. A hard gel capsule comprising the recombinant gelatin of claim
1.
9. A soft gel capsule comprising the recombinant gelatin of claim
1.
10. A plasma expander comprising the recombinant gelatin of claim
1.
11. A colloidal volume replacement material comprising the
recombinant gelatin of claim 1.
12. A medical sponge comprising the recombinant gelatin of claim
1.
13. A pharmaceutical stabilizer comprising the recombinant gelatin
of claim 1.
14. The pharmaceutical stabilizer of claim 13, wherein the
pharmaceutical stabilizer is a vaccine stabilizer.
15. A microcarrier comprising the recombinant gelatin of claim
1.
16. An edible composition comprising the recombinant gelatin of
claim 1.
17. A protein supplement comprising the recombinant gelatin of
claim 1.
18. A fat substitute comprising the recombinant gelatin of claim
1.
19. A nutritional supplement comprising the recombinant gelatin of
claim 1.
20. An edible coating comprising the recombinant gelatin of claim
1.
21. A photographic composition comprising the recombinant gelatin
of claim 1.
22. A cosmetic composition comprising the recombinant gelatin of
claim 1.
23. An industrial composition comprising the recombinant gelatin of
claim 1.
24. A cell culture composition comprising the recombinant gelatin
of claim 1.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 11/139,377, filed on 27 May 2005, which is a continuation of
U.S. application Ser. No. 09/710,239, filed on 10 Nov. 2000, now
U.S. Pat. No. 6,992,172, issued 31 Jan. 2006, which claims the
benefit of U.S. Provisional Application Nos. 60/204,437, filed 15
May 2000, and 60/165,114, filed 12 Nov. 1999, the specifications of
which are incorporated herein by reference in their entireties.
FIELD OF THE INVENTION
[0002] This invention relates to recombinant gelatins and to
compositions and agents comprising recombinant gelatins, to methods
of producing recombinant gelatins, and to the use of these gelatins
in various applications.
BACKGROUND OF THE INVENTION
[0003] Gelatin is a derivative of collagen, a principal structural
and connective protein in animals. Gelatin is derived from
denaturation of collagen and contains polypeptide sequences having
Gly-X--Y repeats, where X and Y are most often proline and
hydroxyproline residues. These sequences contribute to triple
helical structure and affect the gelling ability of gelatin
polypeptides. Currently available gelatin is extracted through
processing of animal hides and bones, typically from bovine and
porcine sources. The biophysical properties of gelatin make it a
versatile material, widely used in a variety of applications and
industries. Gelatin is used, for example, in numerous
pharmaceutical and medical, photographic, industrial, cosmetic, and
food and beverage products and processes of manufacture. Gelatin is
thus a commercially valuable and versatile product.
Manufacture of Gelatin
[0004] Gelatin is typically manufactured from naturally occurring
collagen in bovine and porcine sources, in particular, from hides
and bones. In some instances, gelatin can be extracted from, for
example, piscine, chicken, or equine sources. Raw materials of
typical gelatin production, such as bovine hides and bones,
originate from animals subject to government-certified inspection
and passed fit for human consumption. There is concern over the
infectivity of this raw material, due to the presence of
contaminating agents such as transmissible spongiform
encephalopathies (TSEs), particularly bovine spongiform
encephalopathy (BSE), and scrapie, etc. (See, e.g., Rohwer, R. G.
(1996), Dev Biol Stand 88:247-256.) Such issues are especially
critical to gelatin used in pharmaceutical and medical
applications.
[0005] Recently, concern about the safety of these materials, a
significant portion of which are derived from bovine sources, has
increased, causing various gelatin-containing products to become
the focus of several regulatory measures to reduce the potential
risk of transmission of bovine spongiform encephalopathy (BSE),
linked to new variant Creutzfeldt-Jakob disease (nvCJD), a fatal
neurological disease in humans. There is concern that purification
steps currently used in the processing of extracting gelatin from
animal tissues and bones may not be sufficient to remove the
likelihood of infectivity due to contaminating SE-carrying tissue
(i.e., brain tissue, etc.). U.S. and European manufacturers specify
that raw material for gelatin to be included in animal or human
food products or in pharmaceutical, medical, or cosmetic
applications must not be obtained from a growing number of BSE
countries. In addition, regulations specify that certain materials,
e.g., bovine brain tissue, are not used in the production of
gelatin.
[0006] Current production processes involve several purification
and cleansing steps, and can require harsh and lengthy modes of
extraction. The animal hides and bones are treated in a rendering
process, and the extracted material is subjected to various
chemical treatments, including prolonged exposure to highly acidic
or alkaline solutions. Numerous purification steps can involve
washing and filtration and various heat treatments. Acid
demineralization and lime treatments are used to remove impurities
such as non-collagenous proteins. Bones must be degreased.
Additional washing and filtration steps, ion exchanges, and other
chemical and sterilizing treatments are added to the process to
further purify the material. Furthermore, contaminants and
impurities can still remain after processing, and the resultant
gelatin product must thus typically be clarified, purified, and
often further concentrated before being ready for use.
[0007] Commercial gelatin is generally classified as type A or type
B. These classifications reflect the pre-treatment extraction
sources receive as part of the extraction process. Type A is
generally derived from acid-processed materials, usually porcine
hides, and type B is generally derived from alkaline- or
lime-processed materials, usually bovine bones (ossein) and
hides.
[0008] In extracting type A gelatin, the process generally involves
subjecting fresh or frozen porcine hides to successive washings
with water and treatments with dilute acids. The acid-treated skins
are washed again and are then subject to repeated extraction steps
in which they are treated with hot water, partially hydrolyzing the
collagen present. The resultant extracts, dilute solutions of
gelatin, are filtered and evaporated, and the resultant
concentrates are allowed to cool or chilled to a gel. The gel is
subsequently treated in drying tunnels, or by continuous dryers or
other drying devices.
[0009] In the limed process, type B gelatin is derived from donor
hides and skin trimmings washed and then treated with lime. The
lime treatment can take as long as from one to three months, and is
usually around sixty days. The limed hides are washed and treated
with dilute acids. The hides are then hydrolyzed with hot water and
the resulting extracts are processed as described above for the
acid-treatment process.
[0010] Type B gelatin can also be processed from ossein sources.
The hard bones are washed, degreased, and leached with successive
treatments of dilute acids, such as hydrochloric acid. The acid
treatment reacts with the mineral contents of bone, which are
removed along with the acidic solution, leaving ossein, or
demineralized bones. This organic bone matter, washed free of
residual acid, is dried for storage or immediately limed. After
liming, ossein is subsequently treated as described above for the
production of gelatin from bovine hides. In all cases, after final
filtering, demineralization, concentration, and drying steps, the
resultant gelatin product is divided into batches, subjected to
various physical, chemical, and bacteriological tests to determine
grade and purity, and ground and blended according to commercial
requirements. In both type A and B extraction processes, the
resultant gelatin product typically comprises a mixture of gelatin
molecules, in sizes of from a few thousand up to several hundred
thousand Daltons.
[0011] Fish gelatin, classified as gelling or non-gelling types,
and typically processed as Type A gelatin, is also used in certain
commercial applications. Gelling types are usually derived from the
skins of warm water fish, while non-gelling types are typically
derived from cold water fish. Fish gelatins have widely varying
amino acid compositions, and differ from animal gelatins in having
typically lower proportions of proline and hydroxyproline residues.
In contrast to animal gelatins, fish gelatins typically remain
liquid at much lower temperatures, even at comparable average
molecular weights. As with other animal gelatins, fish gelatin is
extracted by treatment and subsequent hydrolyzation of fish skin.
Again, as with animal extraction processes, the process of
extracting fish gelatin results in a product that lacks
homogeneity.
SUMMARY
[0012] Gelatin is an essential product used in wide-ranging
applications. The diverse uses of gelatin rely on different
characteristics and properties of this ubiquitous mixture of
proteins. Current methods of extraction result in a gelatin product
that is a heterogeneous mixture of proteins, containing
polypeptides with molecular weight distributions of varying ranges.
It is sometimes necessary to blend various lots of product in order
to obtain a gelatin mixture with the physical properties
appropriate for use in a desired application.
[0013] A more homogeneous product, and one produced by more
reproducible means, would be desirable. The availability of a
homogeneous material with reproducible physical characteristics
would be desirable, for example, in various products and processes,
where the availability of gelatin with specific characteristics,
such as a fixed range of molecular weight, would allow for a
reproducible and controlled performance. There is thus a need for a
reliable and reproducible means of gelatin production that provides
a homogeneous product with controlled characteristics.
[0014] In addition, in the pharmaceutical, cosmetic, and food and
beverage industries, especially, there is a need for a source of
gelatin other than that obtained through extraction from animal
sources, e.g., bovine and porcine bones and tissues. Further, as
currently available gelatin is manufactured from animal sources
such as bones and tissues, there are concerns relating to the
undesirable immunogenicity and infectivity of gelatin-containing
products. (See, e.g., Sakaguchi, M. et al. (1999) J. Aller. Clin.
Immunol. 104:695-699; Miyazawa et al. (1999) Vaccine 17:2176-2180;
Sakaguchi et al. (1999) Immunology 96:286-290; Kelso (1999) J.
Aller. Clin Immunol. 103:200-202; Asher (1999) Dev Biol Stand
99:41-44; and Verdrager (1999) Lancet 354:1304-1305.) In addition,
the availability of a substitute material that does not undergo
extraction from animal sources, e.g., tissues and bones, will
address various ethical, religious, and social dictates. A
recombinant material that does not require extraction from animal
sources, such as tissues and bones, could be used, for example, in
the manufacture of foods and other ingested products, including
encapsulated medicines, that are appropriate for use by people with
dietary restrictions, for example, those who follow Kosher and
Halal law.
[0015] While gelatin producers and end-users have searched for and
tested a number of natural and synthetic substitutes for the
animal-source gelatin currently available, a universal substitute
has not yet been found. Alternatives have been identified for a few
applications, such as the use of cellulosic raw materials in VCAPS
capsules (CAPSUGEL; Morris Plains, N.J.), or the proposed use of
non-natural gelatin-like proteins from mouse and rat collagen
sequences in photographic emulsions. (See, e.g., Werten, M. W. et
al. (1999) Yeast 15:1087-1096; and De Wolf, Anton et al., European
Application No. EP1014176A2.) However, for most gelatin-based
processes and products, the performance characteristics of this key
material have not been duplicated, and substitutes have not been
adopted. Thus, there is a need for a means of producing gelatin in
a synthetic and reproducible manner wherein the resultant product
can serve as a rational substitute with the desired performance
characteristics.
[0016] In summary, there is a need for a universal replacement
material that can provide performance characteristics of gelatin
while allowing for a more reproducible and controlled source of
product. There is a need for methods of producing gelatin that do
not require harsh and lengthy processing, and for methods of
manufacturing gelatin that result in a more uniform product and
that are capable of stably producing significant amounts and
different types of gelatin appropriate for diverse applications.
There is a need for a versatile gelatin product that is readily
adaptable for different uses and that answers existing health and
other concerns.
[0017] The present invention solves these and other needs by
providing a universal replacement material, obtained recombinantly,
appropriate for use in the extraordinarily diverse spectrum of
applications in which gelatin is currently used. The present
materials can be designed to possess the properties and
characteristics desired for particular applications, and can thus
provide new properties and uses previously unavailable.
SUMMARY OF THE INVENTION
[0018] The present invention is directed to recombinant gelatins,
to compositions and agents comprising recombinant gelatin, and to
methods of producing and using recombinant gelatins.
[0019] In one aspect, the present invention provides a composition
comprising recombinant gelatin. In one embodiment, the recombinant
gelatin has a molecular weight selected from the group consisting
of about 5 kDa, 8 kDa, 9 kDa, 14 kDa, 16 kDa, 22 kDa, 23 kDa, 36
kDa, 44 kDa, and 65 kDa. In another embodiment, the recombinant
gelatin has a molecular weight range selected from the group
consisting of about 0 to 50 kDa, about 10 to 30 kDa, about 30 to 50
kDa, about 10 to 70 kDa, about 50 kDa to 70 kDa about 50 to 100
kDa, about 100 to 150 kDa, about 150 to 200 kDa, about 200 to 250
kDa, about 250 to 300 kDa, and about 300 to 350 kDa. In one aspect,
the recombinant gelatin has a molecular weight greater than 300
kDa.
[0020] In another aspect, the invention encompasses a recombinant
gelatin having a Bloom strength selected from the group consisting
of 50, 100, 150, 200, 250, and 300. In further embodiment, the
Bloom strength is between 0 and 100.
[0021] In certain embodiments, the present invention provides a
composition comprising recombinant gelatin wherein the recombinant
gelatin is non-hydroxylated, fully hydroxylated, or partially
hydroxylated. In various aspects, the recombinant gelatin has a
percentage hydroxylation selected from the group consisting of 20
to 80%, 30 to 80%, 40 to 80%, 60 to 80%, 20 to 60%, 30 to 60%, 40
to 60%, 20 to 30%, 20 to 40%, and 30 to 40%. In other embodiments,
the recombinant gelatin is fully hydrolyzed, partially hydrolyzed,
or non-hydrolyzed.
[0022] In one aspect, the present invention provides a composition
comprising recombinant gelatin, wherein the recombinant gelatin
comprises a homogeneous mixture of recombinant gelatin
polypeptides. In another aspect, the recombinant gelatin comprises
a heterogeneous mixture of recombinant gelatin polypeptides.
[0023] In one embodiment, the present invention provides a
composition comprising recombinant gelatin wherein the recombinant
gelatin is derived from one type of collagen free of any other
collagen. In particular embodiments, the one type of collagen is
selected from the group consisting of type I, type II, type III,
type IV, type V, type VI, type VII, type VIII, type IX, type X,
type XI, type XII, type XIII, type XIV, type XV, type XVI, type
XVII, type XVIII, type XIX, and type XX collagen. Compositions of
recombinant gelatin wherein the recombinant gelatin has endotoxin
levels of below 1.000 EU/mg, below 0.500 EU/mg, below 0.050 EU/mg,
and below 0.005 EU/mg are contemplated.
[0024] In specific embodiments, the recombinant gelatin of the
present invention comprises an amino acid sequence selected from
the group consisting of SEQ ID NOs:15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 30, 31, and 33. Polynucleotides encoding these amino
acid sequences are also provided, as are expression vectors and
host cells containing the polynucleotides. In certain aspects, the
host cells of the present invention are prokaryotic or eukaryotic.
In one embodiment, a eukaryotic host cell is selected from the
group consisting of a yeast cell, an animal cell, an insect cell, a
plant cell, and a fungal cell. The present invention further
provides transgenic animals and transgenic plants comprising the
polynucleotides. Recombinant gelatins comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs:26, 27,
28, and 29 are also provided.
[0025] In one aspect, the present invention encompasses methods of
producing the recombinant gelatins. One method comprises providing
recombinant collagen or procollagen or fragments or variants
thereof; and processing the recombinant collagen or procollagen or
fragments or variants thereof to produce recombinant gelatin. In
one aspect, the recombinant collagen processed to recombinant
gelatin is recombinant human collagen. In a further aspect, the
recombinant collagen is produced by co-expressing at least one
polynucleotide encoding a collagen or procollagen and at least one
polynucleotide encoding a collagen post-translational enzyme or
subunit thereof. In a certain embodiment, the post-translational
enzyme is prolyl hydroxylase.
[0026] In another method according to the present invention,
recombinant gelatin is produced directly from an altered collagen
construct. In a further embodiment, the recombinant gelatin is
produced by co-expressing the altered collagen construct and at
least one polynucleotide encoding a post-translational enzyme or
subunit thereof. In one embodiment, the post-translational enzyme
is prolyl hydroxylase.
[0027] Methods of producing recombinant gelatins having selected
melting temperatures are also provided. In one embodiment, the
method comprises conferring on the recombinant gelatin a percentage
hydroxylation that corresponds to the selected melting temperature.
In a further embodiment, the conferring step comprises producing
recombinant gelatin from an altered collagen construct in the
presence of prolyl hydroxylase. In other aspects, the conferring
step comprises deriving recombinant gelatin from hydroxylated
recombinant collagen, or comprises hydroxylating non-hydroxylated
recombinant gelatin.
[0028] Various uses of the recombinant gelatins of the present
invention are contemplated. In particular, the present invention
comprises encapsulants, stabilizing agents, film-forming agents,
moisturizing agents, emulsifiers, thickening agents, gelling
agents, colloidal agents, adhesive agents, flocculating agents, and
refining agents comprising recombinant gelatin.
[0029] The present invention provides in one embodiment a
pharmaceutical composition comprising recombinant gelatin. In a
further embodiment, the recombinant gelatin is human recombinant
gelatin. In another embodiment, the recombinant gelatin is
non-immunogenic. In specific embodiments, the present invention
provides a hard gel capsule, a soft gel capsule, a tablet coating,
a plasma expander, a colloidal volume replacement material, a graft
coating, a medical sponge, a medical plug, a pharmaceutical
stabilizer, and a microcarrier comprising recombinant gelatin. In
one aspect, the present invention encompasses a kit comprising a
composition comprising recombinant gelatin, and a device for
delivering the composition to a subject.
[0030] An edible composition comprising recombinant gelatin is also
contemplated, as are protein supplements, fat substitutes,
nutritional supplements, edible coatings, and various
microencapsulants comprising recombinant gelatin. Photographic
compositions comprising recombinant gelatin are also contemplated,
as are embodiments in which recombinant gelatin is partially or
fully hydroxylated. The invention further provides a cosmetic
composition comprising recombinant gelatin.
[0031] In other embodiments, the invention encompasses a cosmetic
composition comprising recombinant gelatin, an industrial
composition comprising recombinant gelatin, a cell culture
composition comprising recombinant gelatin, and a composition for
laboratory use comprising recombinant gelatin. Further embodiments,
such as microarrays comprising the recombinant gelatins of the
present invention or polynucleotides encoding these recombinant
gelatins, are contemplated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1 sets forth results showing the expression of
recombinant gelatins.
[0033] FIGS. 2A and 2B set forth results demonstrating that
recombinant gelatins support cell attachment.
[0034] FIG. 3 sets forth results demonstrating the production of
proteolytically stable recombinant gelatins.
[0035] FIGS. 4A and 4B set forth results demonstrating the
production of hydroxylated recombinant gelatins.
[0036] FIG. 5 sets forth results showing the purification of
recombinant gelatin following in vitro hydroxylation.
[0037] FIGS. 6A, 6B, and 6C set forth results showing the stability
of recombinant gelatins expressed in the presence or absence of
prolyl 4-hydroxylase.
[0038] FIGS. 7A and 7B set forth results demonstrating enhanced
recombinant gelatin expression by supplementation of expression
media
[0039] FIG. 8 sets forth results comparing commercially available
gelatins to cross-linked recombinant gelatin.
[0040] FIG. 9 sets forth results comparing the molecular weight
distribution of commercially available gelatins.
[0041] FIGS. 10A, 10B, 10C, 10D, 10E, and 10F set forth results
showing the hydrolysis of commercially available gelatins performed
at 120.degree. C.
[0042] FIGS. 11A, 11B, 11C, and 11D set forth results showing the
hydrolysis of commercially available gelatins performed at
150.degree. C.
[0043] FIGS. 12A and 12B set forth results showing the acid and
thermal hydrolysis of recombinant human collagen type I and type
III.
[0044] FIG. 13 sets forth results showing the enzymatic hydrolysis
of recombinant human collagen type 1.
[0045] FIG. 14 sets forth a Western blot analysis of recombinant
human collagens and recombinant human gelatins using antisera from
Guinea pigs immunized with recombinant human collagen type I.
[0046] FIGS. 15A and 15B set forth results showing antisera from
Guinea pigs immunized with recombinant human collagen type I is
reactive to specific cyanogen bromide fragments of collagen type
I.
[0047] FIG. 16 sets forth ELISA results showing antisera from
Guinea pigs immunized with recombinant human collagen type I is not
reactive to recombinant human gelatins.
DESCRIPTION OF THE INVENTION
[0048] Before the present proteins, nucleotide sequences, and
methods are described, it is understood that this invention is not
limited to the particular methodology, protocols, cell lines,
vectors, and reagents described, as these may vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
limit the scope of the present invention.
[0049] It must be noted that as used herein, and in the appended
claims, the singular forms "a," "an," and "the" include plural
reference unless the context clearly dictates otherwise. Thus, for
example, reference to "a host cell" is reference to one or more of
such host cells and equivalents thereof known to those skilled in
the art, and reference to "an antibody" is a reference to one or
more antibodies and equivalents thereof known to those skilled in
the art, and so forth.
[0050] Unless defined otherwise, all technical and scientific terms
used herein have the meanings as commonly understood by one of
ordinary skill in the art to which the invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods, devices, and materials are now
described. All publications mentioned herein are incorporated
herein by reference for the purpose of describing and disclosing
the cell lines, vectors, and methodologies, etc., which are
reported in the publications which might be used in connection with
the invention. Nothing herein is to be construed as an admission
that the invention is not entitled to antedate such disclosure by
virtue of prior invention. Each reference cited herein is
incorporated herein by reference in its entirety.
[0051] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of chemistry,
biochemistry, molecular biology, immunology and pharmacology,
within the skill of the art. Such techniques are explained fully in
the literature. See, e.g., Gennaro, A. R., ed. (1990) Remington's
Pharmaceutical Sciences, 18.sup.th ed., Mack Publishing Co.;
Colowick, S. et al., eds., Methods In Enzymology, Academic Press,
Inc.; Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir
and C. C. Blackwell, eds., 1986, Blackwell Scientific
Publications); Maniatis, T. et al., eds. (1989) Molecular Cloning:
A Laboratory Manual, 2.sup.nd edition, Vols. I-III, Cold Spring
Harbor Laboratory Press; Ausubel, F. M. et al., eds. (1999) Short
Protocols in Molecular Biology, 4.sup.th edition, John Wiley &
Sons; Ream et al., eds. (1998) Molecular Biology Techniques: An
Intensive Laboratory Course, Academic Press); PCR (Introduction to
Biotechniques Series), 2nd ed. (Newton & Graham eds., 1997,
Springer Verlag).
DEFINITIONS
[0052] The term "collagen" refers to any one of the known collagen
types, including collagen types I through XX, as well as to any
other collagens, whether natural, synthetic, semi-synthetic, or
recombinant. The term also encompasses procollagens. The term
collagen encompasses any single-chain polypeptide encoded by a
single polynucleotide, as well as homotrimeric and heterotrimeric
assemblies of collagen chains. The term "collagen" specifically
encompasses variants and fragments thereof, and functional
equivalents and derivatives thereof, which preferably retain at
least one structural or functional characteristic of collagen, for
example, a (Gly-X--Y).sub.n domain.
[0053] The term "procollagen" refers to a procollagen corresponding
to any one of the collagen types I through XX, as well as to a
procollagen corresponding to any other collagens, whether natural,
synthetic, semi-synthetic, or recombinant, that possesses
additional C-terminal and/or N-terminal propeptides or telopeptides
that assist in trimer assembly, solubility, purification, or any
other function, and that then are subsequently cleaved by
N-proteinase, C-proteinase, or other enzymes, e.g., proteolytic
enzymes associated with collagen production. The term procollagen
specifically encompasses variants and fragments thereof, and
functional equivalents and derivatives thereof, which preferably
retain at least one structural or functional characteristic of
collagen, for example, a (Gly-X--Y).sub.n domain.
[0054] "Gelatin" as used herein refers to any gelatin, whether
extracted by traditional methods or recombinant or biosynthetic in
origin, or to any molecule having at least one structural and/or
functional characteristic of gelatin. Gelatin is currently obtained
by extraction from collagen derived from animal (e.g., bovine,
porcine, chicken, equine, piscine) sources, e.g., bones and
tissues. The term gelatin encompasses both the composition of more
than one polypeptide included in a gelatin product, as well as an
individual polypeptide contributing to the gelatin material. Thus,
the term recombinant gelatin as used in reference to the present
invention encompasses both a recombinant gelatin material
comprising the present gelatin polypeptides, as well as an
individual gelatin polypeptide of the present invention.
[0055] Polypeptides from which gelatin can be derived are
polypeptides such as collagens, procollagens, and other
polypeptides having at least one structural and/or functional
characteristic of collagen. Such a polypeptide could include a
single collagen chain, or a collagen homotrimer or heterotrimer, or
any fragments, derivatives, oligormers, polymers, or subunits
thereof, containing at least one collagenous domain (a Gly-X--Y
region). The term specifically contemplates engineered sequences
not found in nature, such as altered collagen constructs, etc. An
altered collagen construct is a polynucleotide comprising a
sequence that is altered, through deletions, additions,
substitutions, or other changes, from a naturally occurring
collagen gene.
[0056] An "adjuvant" is any agent added to a drug or vaccine to
increase, improve, or otherwise aid its effect. An adjuvant used in
a vaccine formulation might be an immunological agent that improves
the immune response by producing a non-specific stimulator of the
immune response. Adjuvants are often used in non-living
vaccines.
[0057] The terms "allele" or "allelic sequence" refer to
alternative forms of genetic sequences. Alleles may result from at
least one mutation in the nucleic acid sequence and may result in
altered mRNAs or polypeptides whose structure or function may or
may not be altered. Any given natural or recombinant gene may have
none, one, or many allelic forms. Common mutational changes which
give rise to alleles are generally ascribed to natural deletions,
additions, or substitutions of nucleotides. Each of these types of
changes may occur alone, or in combination with the others, one or
more times in a given sequence.
[0058] "Altered" polynucleotide sequences include those with
deletions, insertions, or substitutions of different nucleotides
resulting in a polynucleotide that encodes the same or a
functionally equivalent polypeptide. Included within this
definition are sequences displaying polymorphisms that may or may
not be readily detectable using particular oligonucleotide probes
or through deletion of improper or unexpected hybridization to
alleles, with a locus other than the normal chromosomal locus for
the subject polynucleotide sequence.
[0059] "Altered" polypeptides may contain deletions, insertions, or
substitutions of amino acid residues which produce a silent change
and result in a functionally equivalent polypeptide. Deliberate
amino acid substitutions may be made on the basis of similarity in
polarity, charge, solubility, hydrophobicity, hydrophilicity,
and/or the amphipathic nature of the residues as long as the
biological or immunological activity of the encoded polypeptide is
retained. For example, negatively charged amino acids may include
aspartic acid and glutamic acid; positively charged amino acids may
include lysine and arginine; and amino acids with uncharged polar
head groups having similar hydrophilicity values may include
leucine, isoleucine, and valine, glycine and alanine, asparagine
and glutamine, serine and threonine, and phenylalanine and
tyrosine.
[0060] "Amino acid" or "polypeptide" sequences or "polypeptides,"
as these terms are used herein, refer to oligopeptide, peptide,
polypeptide, or protein sequences, and fragments thereof, and to
naturally occurring or synthetic molecules. Polypeptide or amino
acid fragments are any portion of a polypeptide which retains at
least one structural and/or functional characteristic of the
polypeptide. In at least one embodiment of the present invention,
polypeptide fragments are those retaining at least one
(Gly-X--Y).sub.n region.
[0061] The term "animal" as it is used in reference, for example,
to "animal collagens" encompasses any collagens, derived from
animal sources, whether natural, synthetic, semi-synthetic, or
recombinant. Animal sources include, for example, mammalian
sources, including, but not limited to, bovine, porcine, and ovine
sources, and other animal sources, including, but not limited to,
chicken and piscine, equine, rodent, and non-vertebrate
sources.
[0062] "Antigenicity" relates to the ability of a substance to,
when introduced into the body, stimulate the immune response and
the production of an antibody. An agent displaying the property of
antigenicity is referred to as being antigenic. Antigenic agents
can include, but are not limited to, a variety of macromolecules
such as, for example, proteins, lipoproteins, polysaccharides,
nucleic acids, bacteria and bacterial components, and viruses and
viral components.
[0063] The terms "complementary" or "complementarity," as used
herein, refer to the natural binding of polynucleotides by
base-pairing. For example, the sequence "A-G-T" binds to the
complementary sequence "T-C-A." Complementarity between two
single-stranded molecules may be "partial," when only some of the
nucleic acids bind, or may be complete, when total complementarity
exists between the single stranded molecules. The degree of
complementarity between nucleic acid strands has significant
effects on the efficiency and strength of hybridization between
nucleic acid strands. This is of particular importance in
amplification reactions, which depend upon binding between nucleic
acids strands, and in the design and use, for example, of peptide
nucleic acid (PNA) molecules.
[0064] A "deletion" is a change in an amino acid or nucleotide
sequence that results in the absence of one or more amino acid
residues or nucleotides.
[0065] The term "derivative," as applied to polynucleotides, refers
to the chemical modification of a polynucleotide encoding a
particular polypeptide or complementary to a polynucleotide
encoding a particular polypeptide. Such modifications include, for
example, replacement of hydrogen by an alkyl, acyl, or amino group.
As used herein to refer to polypeptides, the term "derivative"
refers to a polypeptide which is modified, for example, by
hydroxylation, glycosylation, pegylation, or by any similar
process. The term "derivatives" encompasses those molecules
containing at least one structural and/or functional characteristic
of the molecule from which it is derived.
[0066] A molecule is said to be a "chemical derivative" of another
molecule when it contains additional chemical moieties not normally
a part of the molecule. Such moieties can improve the molecule's
solubility, absorption, biological half-life, and the like. The
moieties can alternatively decrease the toxicity of the molecule,
eliminate or attenuate any undesirable side effect of the molecule,
and the like. Moieties capable of mediating such effects are
generally available in the art and can be found for example, in
Remington's Pharmaceutical Sciences, supra. Procedures for coupling
such moieties to a molecule are well known in the art.
[0067] An "excipient" as the term is used herein is any inert
substance used as a diluent or vehicle in the formulation of a
drug, a vaccine, or other pharmaceutical composition, in order to
confer a suitable consistency or form to the drug, vaccine, or
pharmaceutical composition.
[0068] The term "functional equivalent" as it is used herein refers
to a polypeptide or polynucleotide that possesses at least one
functional and/or structural characteristic of a particular
polypeptide or polynucleotide. A functional equivalent may contain
modifications that enable the performance of a specific function.
The term "functional equivalent" is intended to include fragments,
mutants, hybrids, variants, analogs, or chemical derivatives of a
molecule.
[0069] A "fusion protein" is a protein in which peptide sequences
from different proteins are operably linked.
[0070] The term "hybridization" refers to the process by which a
nucleic acid sequence binds to a complementary sequence through
base pairing. Hybridization conditions can be defined by, for
example, the concentrations of salt or formamide in the
prehybridization and hybridization solutions, or by the
hybridization temperature, and are well known in the art.
Hybridization can occur under conditions of various stringency.
[0071] In particular, stringency can be increased by reducing the
concentration of salt, increasing the concentration of formamide,
or raising the hybridization temperature. For example, for purposes
of the present invention, hybridization under high stringency
conditions occurs in about 50% formamide at about 37.degree. C. to
42.degree. C., and under reduced stringency conditions in about 35%
to 25% formamide at about 30.degree. C. to 35.degree. C. In
particular, hybridization occurs in conditions of highest
stringency at 42.degree. C. in 50% formamide, 5.times.SSPE, 0.3%
SDS, and 200 .mu.g/ml sheared and denatured salmon sperm DNA.
[0072] The temperature range corresponding to a particular level of
stringency can be further narrowed by methods known in the art, for
example, by calculating the purine to pyrimidine ratio of the
nucleic acid of interest and adjusting the temperature accordingly.
To remove nonspecific signals, blots can be sequentially washed,
for example, at room temperature under increasingly stringent
conditions of up to 0.1.times.SSC and 0.5% SDS. Variations on the
above ranges and conditions are well known in the art.
[0073] "Immunogenicity" relates to the ability to evoke an immune
response within an organism. An agent displaying the property of
immunogenicity is referred to as being immunogenic. Agents can
include, but are not limited to, a variety of macromolecules such
as, for example, proteins, lipoproteins, polysaccharides, nucleic
acids, bacteria and bacterial components, and viruses and viral
components. Immunogenic agents often have a fairly high molecular
weight (usually greater than 10 kDa).
[0074] "Infectivity" refers to the ability to be infective or the
ability to produce infection, referring to the invasion and
multiplication of microorganisms, such as bacteria or viruses
within the body.
[0075] The terms "insertion" or "addition" refer to a change in a
polypeptide or polynucleotide sequence resulting in the addition of
one or more amino acid residues or nucleotides, respectively, as
compared to the naturally occurring molecule.
[0076] The term "isolated" as used herein refers to a molecule
separated not only from proteins, etc., that are present in the
natural source of the protein, but also from other components in
general, and preferably refers to a molecule found in the presence
of, if anything, only a solvent, buffer, ion, or other component
normally present in a solution of the same. As used herein, the
terms "isolated" and "purified" do not encompass molecules present
in their natural source.
[0077] The term "microarray" refers to any arrangement of nucleic
acids, amino acids, antibodies, etc., on a substrate. The substrate
can be any suitable support, e.g., beads, glass, paper,
nitrocellulose, nylon, or any appropriate membrane, etc. A
substrate can be any rigid or semi-rigid support including, but not
limited to, membranes, filters, wafers, chips, slides, fibers,
beads, including magnetic or nonmagnetic beads, gels, tubing,
plates, polymers, microparticles, capillaries, etc. The substrate
can provide a surface for coating and/or can have a variety of
surface forms, such as wells, pins, trenches, channels, and pores,
to which the nucleic acids, amino acids, etc., may be bound.
[0078] The term "microorganism" can include, but is not limited to,
viruses, bacteria, Chlamydia, rickettsias, mycoplasmas,
ureaplasmas, fungi, and parasites, including infectious parasites
such as protozoans.
[0079] The terms "nucleic acid" or "polynucleotide" sequences or
"polynucleotides" refer to oligonucleotides, nucleotides, or
polynucleotides, or any fragments thereof, and to DNA or RNA of
natural or synthetic origin which may be single- or double-stranded
and may represent the sense or antisense strand, to peptide nucleic
acid (PNA), or to any DNA-like or RNA-like material, natural or
synthetic in origin. Polynucleotide fragments are any portion of a
polynucleotide sequence that retains at least one structural or
functional characteristic of the polynucleotide. In one embodiment
of the present invention, polynucleotide fragments are those that
encode at least one (Gly-X--Y).sub.n region. Polynucleotide
fragments can be of variable length, for example, greater than 60
nucleotides in length, at least 100 nucleotides in length, at least
1000 nucleotides in length, or at least 10,000 nucleotides in
length.
[0080] The phrase "percent similarity" (% similarity) refers to the
percentage of sequence similarity found in a comparison of two or
more polypeptide or polynucleotide sequences. Percent similarity
can be determined by methods well-known in the art. For example,
percent simularity between amino acid sequences can be calculated
using the clustal method. (See, e.g., Higgins, D. G. and P. M.
Sharp (1988) Gene 73:237-244.) The algorithm groups sequences into
clusters by examining the distances between all pairs. The clusters
are aligned pairwise and then in groups. The percentage similarity
between two amino acid sequences, e.g., sequence A and sequence B,
is calculated by dividing the length of sequence A, minus the
number of gap residues in sequence A, minus the number of gap
residues in sequence B, into the sum of the residue matches between
sequence A and sequence B, times one hundred. Gaps of low or of no
homology between the two amino acid sequences are not included in
determining percentage similarity. Percent similarity can be
calculated by other methods known in the art, for example, by
varying hybridization conditions, and can be calculated
electronically using programs such as the MEGALIGN program (DNASTAR
Inc., Madison, Wis.).
[0081] As used herein, the term "plant" includes reference to one
or more plants, i.e., any eukaryotic autotrophic organisms such as
angiosperms and gymnosperms, monotyledons and dicotyledons,
including, but not limited to, soybean, cotton, alfalfa, flax,
tomato, sugar, beet, sunflower, potato, tobacco, maize, wheat,
rice, lettuce, banana, cassaya, safflower, oilseed, rape, mustard,
canola, hemp, algae, kelp, etc. The term "plant" also encompasses
one or more plant cells. The term "plant cells" includes, but is
not limited to, vegetative tissues and organs such as seeds,
suspension cultures, embryos, meristematic regions, callus tissue,
leaves, roots, shoots, gametophytes, sporophytes, pollen, tubers,
corms, bulbs, flowers, fruits, cones, microspores, etc.
[0082] The term "post-translational enzyme" refers to any enzyme
that catalyzes post-translational modification of, for example, any
collagen or procollagen. The term encompasses, but is not limited
to, for example, prolyl hydroxylase, peptidyl prolyl isomerase,
collagen galactosyl hydroxylysyl glucosyl transferase, hydroxylysyl
galactosyl transferase, C-proteinase, N-proteinase, lysyl
hydroxylase, and lysyl oxidase.
[0083] As used herein, the term "promoter" generally refers to a
regulatory region of nucleic acid sequence capable of initiating,
directing, and mediating the transcription of a polynucleotide
sequence. Promoters may additionally comprise recognition
sequences, such as upstream or downstream promoter elements, which
may influence the transcription rate.
[0084] The term "non-constitutive promoters" refers to promoters
that induce transcription via a specific tissue, or may be
otherwise under environmental or developmental controls, and
includes repressible and inducible promoters such as
tissue-preferred, tissue-specific, and cell type-specific
promoters. Such promoters include, but are not limited to, the AdH1
promoter, inducible by hypoxia or cold stress, the Hsp70 promoter,
inducible by heat stress, and the PPDK promoter, inducible by
light.
[0085] Promoters which are "tissue-preferred" are promoters that
preferentially initiate transcription in certain tissues. Promoters
which are "tissue-specific" are promoters that initiate
transcription only in certain tissues. "Cell type-specific"
promoters are promoters which primarily drive expression in certain
cell types in at least one organ, for example, vascular cells.
[0086] "Inducible" or "repressible" promoters are those under
control of the environment, such that transcription is effected,
for example, by an environmental condition such as anaerobic
conditions, the presence of light, biotic stresses, etc., or in
response to internal, chemical, or biological signals, e.g.,
glyceraldehyde phosphate dehydrogenase, AOX1 and AOX2
methanol-inducible promoters, or to physical damage.
[0087] As used herein, the term "constitutive promoters" refers to
promoters that initiate, direct, or mediate transcription, and are
active under most environmental conditions and states of
development or cell differentiation. Examples of constitutive
promoters, include, but are not limited to, the cauliflower mosaic
virus (CaMv) 35S, the 1'- or 2'-promoter derived from T-DNA of
Agrobacteriuam tumefaciens, the ubiquitin 1 promoter, the Smas
promoter, the cinnamyl alcohol dehydrogenase promoter,
glyceraldehyde dehydrogenase promoter, and the Nos promoter,
etc.
[0088] The term "purified" as it is used herein denotes that the
indicated molecule is present in the substantial absence of other
biological macromolecules, e.g., polynucleotides, proteins, and the
like. The term preferably contemplates that the molecule of
interest is present in a solution or composition at least 80% by
weight; preferably, at least 85% by weight; more preferably, at
least 95% by weight; and, most preferably, at least 99.8% by
weight. Water, buffers, and other small molecules, especially
molecules having a molecular weight of less than about one kDa, can
be present.
[0089] The term "substantially purified", as used herein, refers to
nucleic or amino acid sequences that are removed from their natural
environment, isolated or separated, and are at least 60% free,
preferably 75% free, and most preferably 90% free from other
components with which they are naturally associated.
[0090] A "substitution" is the replacement of one or more amino
acids or nucleotides by different amino acids or nucleotides,
respectively.
[0091] The term "transfection" as used herein refers to the process
of introducing an expression vector into a cell. Various
transfection techniques are known in the art, for example,
microinjection, lipofection, or the use of a gene gun.
[0092] "Transformation", as defined herein, describes a process by
which exogenous nucleic acid sequences, e.g., DNA, enters and
changes a recipient cell. Transformation may occur under natural or
artificial conditions using various methods well known in the art.
Transformation may rely on any known method for the insertion of
foreign nucleic acid sequences into a prokaryotic or eukaryotic
host cell. The method is selected based on the type of host cell
being transformed and may include, but is not limited to, viral
infection, electroporation, heat shock, lipofection, and particle
bombardment. Such "transformed" cells include stably transformed
cells in which the inserted DNA is capable of replication either as
an autonomously replicating plasmid or as part of the host
chromosome, and also include cells which transiently express the
inserted nucleic acid for limited periods of time.
[0093] As used herein, the term "vaccine" refers to a preparation
of killed or modified microorganisms, living attenuated organisms,
or living fully virulent organisms, or any other agents, including,
but not limited to peptides, proteins, biological macromolecules,
or nucleic acids, natural, synthetic, or semi-synthetic,
administered to produce or artificially increase immunity to a
particular disease, in order to prevent future infection with a
similar entity. Vaccines can contain live, or inactive
microorganisms, or other agents, including viruses and bacteria, as
well as subunit, synthetic, semi-synthetic, or recombinant
DNA-based.
[0094] Vaccines can be monovalent (a single
strain/microorganism/disease vaccine) consisting of one
microorganism or agent (e.g., poliovirus vaccine) or the antigens
of one microorganism or agent. Vaccines can also be multivalent,
e.g., divalent, trivalent, etc. (a combined vaccine), consisting of
more than one microorganism or agent (e.g., a measles-mumps-rubella
(MMR) vaccine) or the antigens of more than one microorganism or
agent.
[0095] Live vaccines are prepared from living microorganisms.
Attenuated vaccines are live vaccines prepared from microorganisms
which have undergone physical alteration (such as radiation or
temperature conditioning) or serial passage in laboratory animal
hosts or infected tissue/cell cultures, such treatments producing
avirulent strains or strains of reduced virulence, but maintaining
the capability of inducing protective immunity. Examples of live
attenuated vaccines include measles, mumps, rubella, and canine
distemper. Inactivated vaccines are vaccines in which the
infectious microbial components have been destroyed, e.g., by
chemical or physical treatment (such as formalin,
beta-propiolactone, or gamma radiation), without affecting the
antigenicity or immunogenicity of the viral coat or bacterial outer
membrane proteins. Examples of inactivated or subunit vaccines
include influenza, Hepatitis A, and poliomyelitis (IPV)
vaccines.
[0096] Subunit vaccines are composed of key macromolecules from,
e.g., the viral, bacterial, or other agent responsible for
eliciting an immune response. These components can be obtained in a
number of ways, for example, through purification from
microorganisms, generation using recombinant DNA technology, etc.
Subunit vaccines can contain synthetic mimics of any infective
agent. Subunit vaccines can include macromolecules such as
bacterial protein toxins (e.g., tetanus, diphtheria), viral
proteins (e.g., from influenza virus), polysaccharides from
encapsulated bacteria (e.g., from Haemophilus influenzae and
Streptococcus pneumonia), and viruslike particles produced by
recombinant DNA technology (e.g., hepatitis B surface antigen),
etc.
[0097] Synthetic vaccines are vaccines made up of small synthetic
peptides that mimic the surface antigens of pathogens and are
immunogenic, or may be vaccines manufactured with the aid of
recombinant DNA techniques, including whole viruses whose nucleic
acids have been modified.
[0098] Semi-synthetic vaccines, or conjugate vaccines, consist of
polysaccharide antigens from microorganisms attached to protein
carrier molecules.
[0099] DNA vaccines contain recombinant DNA vectors encoding
antigens, which, upon expression of the encoded antigen in host
cells having taken up the DNA, induce humoral and cellular immune
responses against the encoded antigens.
[0100] Vaccines have been developed for a variety of infectious
agents. The present invention is directed to recombinant gelatins
that can be used in vaccine formulations regardless of the agent
involved, and are thus not limited to use in the vaccines
specifically described herein by way of example. Vaccines include,
but are not limited to, vaccines for vacinnia virus (small pox),
polio virus (Salk and Sabin), mumps, measles, rubella, diphtheria,
tetanus, Varicella-Zoster (chicken pox/shingles), pertussis
(whopping cough), Bacille Calmette-Guerin (BCG, tuberculosis),
haemophilus influenzae meningitis, rabies, cholera, Japanese
encephalitis virus, salmonella typhi, shigella, hepatitis A,
hepatitis B, adenovirus, yellow fever, foot-and-mouth disease,
herpes simplex virus, respiratory syncytial virus, rotavirus,
Dengue, West Nile virus, Turkey herpes virus (Marek's Disease),
influenza, and anthrax. The term vaccine as used herein includes
reference to vaccines to various infectious and autoimmune diseases
and cancers that have been or that will be developed, for example,
vaccines to various infectious and autoimmune diseases and cancers,
e.g., vaccines to HIV, HCV, malaria, and vaccines to breast, lung,
colon, renal, bladder, and ovarian cancers.
[0101] A polypeptide or amino acid "variant" is an amino acid
sequence that is altered by one or more amino acids from a
particular amino acid sequence. A polypeptide variant may have
conservative changes, wherein a substituted amino acid has similar
structural or chemical properties to the amino acid replaced, e.g.,
replacement of leucine with isoleucine. A variant may also have
nonconservative changes, in which the substituted amino acid has
physical properties different from those of the replaced amino
acid, e.g., replacement of a glycine with a tryptophan. Analogous
minor variations may also include amino acid deletions or
insertions, or both. Preferably, amino acid variants retain certain
structural or functional characteristics of a particular
polypeptide. Guidance in determining which amino acid residues may
be substituted, inserted, or deleted may be found, for example,
using computer programs well known in the art, such as LASERGENE
software (DNASTAR Inc., Madison, Wis.).
[0102] A polynucleotide variant is a variant of a particular
polynucleotide sequence that preferably has at least about 80%,
more preferably at least about 90%, and most preferably at least
about 95% polynucleotide sequence similarity to the particular
polynucleotide sequence. It will be appreciated by those skilled in
the art that as a result of the degeneracy of the genetic code, a
multitude of variant polynucleotide sequences encoding a particular
protein, some bearing minimal homology to the polynucleotide
sequences of any known and naturally occurring gene, may be
produced. Thus, the invention contemplates each and every possible
variation of polynucleotide sequence that could be made by
selecting combinations based on possible codon choices. These
combinations are made in accordance with the standard codon triplet
genetic code, and all such variations are to be considered as being
specifically disclosed.
Invention
[0103] The present invention provides recombinant gelatins and
methods for producing these gelatins. The recombinant gelatins of
the present invention provide consistent and improved performance,
and are able to address various health and other concerns. Using
the present methods, gelatin can be directly manufactured, rather
than extracted from animal sources through lengthy and harsh
processes. The recombinant gelatin of the present invention is free
of pathogens, for example, pathogenic bacteria, transmissible
spongiform encephalopathies (TSEs), etc. The present methods
minimize variability and allow for a degree of reproducibility
unattainable in current extraction methods.
[0104] Safety issues, such as concern over potential immunogenic,
e.g., antigenic and allergenic, responses, have arisen regarding
the use of animal-derived products. The inability to completely
characterize, purify, or reproduce animal-source gelatin mixtures
used currently is of ongoing concern in the pharmaceutical and
medical communities. Additional safety concerns exist with respect
to bacterial contamination and endotoxin loads resulting from the
extraction and purification processes.
[0105] The recombinant gelatins of the present invention address
these concerns as they are virtually free of bacterial
contamination or endotoxins. Furthermore, the recombinant human
gelatins of the present invention will offer distinct advantages
over animal-derived counterparts currently in use, as the use of
gelatins derived from native human sequence can eliminate the risk
of immune response due to the use of non-human, animal-derived
proteins.
[0106] In addition, the present gelatins can be produced as various
and distinct materials, with characteristics optimized for
particular applications. The resultant products are internally more
consistent and uniform than are currently available gelatins
derived from animal sources.
[0107] In one embodiment, the present invention provides a
recombinant gelatin. The gelatin can be produced using sequences
from various species including, but not limited to, human, bovine,
porcine, equine, rodent, chicken, ovine, and piscine species, or
from non-vertebrate species. The gelatin of the present invention
has increased purity as compared to the gelatin products of current
methods of manufacture, and has a reduced protein load and reduced
levels of endotoxins and other contaminants, including nucleic
acids, polysaccharides, prions, etc. The present gelatin is thus
safer to use than gelatin manufactured by current methods, and can
be administered to or ingested by humans and animals at a higher
dosage while minimizing the risk of negative side effects.
[0108] The gelatins of the present invention have increased
activity and workability compared to commercial gelatins, as the
present gelatin can be produced directly with characteristics
optimized for specific uses, improving one's ability to use and
formulate the gelatin. While gelatins currently extracted from
animal sources are heterogeneous products with a wide range in
molecular weights throughout a given batch or sample, the gelatins
of the present invention include consistent, homogeneous, and
reproducible products.
[0109] The recombinant gelatins of the present invention can be
produced using a variety of methods. In one method, the recombinant
gelatin is produced through processing of recombinant collagen.
(See, e.g., Examples 9, 10, and 11.) In another method, the
recombinant gelatin is produced directly from the expression of
altered collagen constructs, i.e., constructs containing a
polynucleotide encoding at least one collagenous domain, but not
encoding naturally occurring collagen. (See, e.g., Examples 1, 4,
and 6.) In another aspect, the recombinant gelatin is derived from
polypeptides which are not full-length naturally occurring collagen
or procollagen, but which contain at least one collagenous domain.
(See, e.g., SEQ ID NOs:15 through 25, 30, 31, and 33.) Recombinant
gelatins can also comprise sequences containing additional
N-terminal or C-terminal propeptides. (See, e.g., SEQ ID NOs:26
through 29.)
[0110] In one aspect, the recombinant gelatin of the present
invention is derived from recombinant collagens or procollagens.
Collagen molecules generally result from trimeric assembly of
polypeptide chains containing (Gly-X--Y--).sub.n repeats which
allow for the formation of triple helical domains under normal
biological conditions. (See, e.g., van der Rest et al., (1991),
FASEB J. 5:2814-2823.) At present, about twenty distinct collagen
types have been identified in vertebrates, including bovine, ovine,
porcine, chicken and human collagens. A detailed description of
structure and biological functions of the various types of
naturally occurring collagens can be found, among other places, in
Ayad et al., The Extracellular Matrix Facts Book, Academic Press,
San Diego, Calif.; Burgeson, R. E., and Nimmi (1992) "Collagen
types: Molecular Structure and Tissue Distribution," Clin. Orthop.
282:250-272; Kielty, C. M. et al. (1993) "The Collagen Family:
Structure, Assembly And Organization In The Extracellular Matrix,"
in Connective Tissue And Its Heritable Disorders, Molecular
Genetics, And Medical Aspects, Royce, P. M. and Steinmann, B.,
Eds., Wiley-Liss, NY, pp. 103-147; and Prockop and Kivirikko (1995)
"Collagens: Molecular biology, diseases, and potentials for
therapy", Annu Rev Biochem 64:403-434.
[0111] Type I collagen is the major fibrillar collagen of bone and
skin, comprising approximately 80-90% of an organism's total
collagen. Type I collagen is the major structural macromolecule
present in the extracellular matrix of multicellular organisms and
comprises approximately 20% of total protein mass. Type I collagen
is a heterotrimeric molecule comprising two .alpha.1(I) chains and
one .alpha.2(I) chain, which are encoded by the COL1A1 and COL1A2
genes, respectively. Other collagen types are less abundant than
type I collagen and exhibit different distribution patterns. For
example, type II collagen is the predominant collagen in cartilage
and vitreous humor, while type III collagen is found at high levels
in blood vessels and to a lesser extent in skin.
[0112] Type III collagen is a major fibrillar collagen found in
skin and vascular tissues. Type II collagen is a homotrimeric
collagen comprising three identical .alpha.1(III) chains encoded by
the COL3A1 gene. Methods for purifying various collagens from
tissues can be found, for example, in, Byers et al. (1974)
Biochemistry 13:5243-5248; and Miller and Rhodes (1982) Methods in
Enzymology 82:33-64.
[0113] Post-translational enzymes are important to the biosynthesis
of procollagens and collagens. For example, prolyl 4-hydroxylase is
a post-translational enzyme necessary for the synthesis of
procollagen or collagen by cells. This enzyme hydroxylates prolyl
residues in the Y-position of repeating Gly-X--Y sequences to
4-hydroxyproline. (See, e.g., Prockop et al. (1984) N. Engl. J.
Med. 311:376-386.) Unless an appropriate number of Y-position
prolyl residues are hydroxylated to 4-hydroxyproline by prolyl
4-hydroxylase, the newly synthesized chains cannot maintain a
stable triple-helical conformation. Moreover, if no hydroxylation
or under-hydroxylation occurs, the polypeptides are not secreted
properly and may be degenerated.
[0114] Vertebrate prolyl 4-hydroxylase is an
.alpha..sub.2.beta..sub.2 tetramer. (See, e.g. Berg and Prockop
(1973) J. Biol. Chem. 248:1175-1192; and Tuderman et al. (1975)
Eur. J. Biochem. 52:9-16.) The .alpha. subunits contain the
catalytic sites involved in the hydroxylation of prolyl residues,
but are insoluble in the absence of .beta. subunits. The .beta.
subunits, protein disulfide isomerases, catalyze thiol/disulfide
interchanges, leading to formation of disulfide bonds essential to
establishing a stable protein. The .beta. subunits retain 50% of
protein disulfide isomerase activity when part of the prolyl
4-hydroxylase tetramer. (See, e.g., Pihlajaniemi et al. (1987) Embo
J. 6:643-649; Parkkonen et al. (1988) Biochem. J. 256:1005-1011;
and Koivu et al. (1987) J. Biol. Chem. 262:6447-6449.)
[0115] Active recombinant human prolyl 4-hydroxylase has been
produced in, e.g., Sf9 insect cells and in yeast cells, by
simultaneously expressing the .alpha. and .beta. subunits. (See,
e.g., Vuori et al. (1992) Proc. Natl. Acad. Sci. USA 89:7467-7470;
U.S. Pat. No. 5,593,859.) In addition to prolyl 4-hydroxylase,
other collagen post-translational enzymes have been identified and
reported in the literature, including C-proteinase, N-proteinase,
lysyl oxidase, lysyl hydroxylase, etc. (See, e.g., Olsen et al.
(1991) Cell Biology of Extracellular Matrix, 2.sup.nd ed., Hay
editor, Plenum Press, New York.)
[0116] The present invention specifically contemplates the use of
any compound, biological or chemical, that confers hydroxylation,
e.g., proline hydroxylation and/or lysyl hydroxylation, etc., as
desired, to the present recombinant gelatins. This includes, for
example, prolyl 4-hydroxylase from any species, endogenously or
exogenously supplied, including various isoforms of prolyl
4-hydroxylase and any variants or fragments or subunits of prolyl
4-hydroxylase having the desired activity, whether native,
synthetic, or semi-synthetic, and other hydroxylases such as prolyl
3-hydroxylase, etc. (See, e.g., U.S. Pat. No. 5,928,922,
incorporated by reference herein in its entirety.) In one
embodiment, the prolyl hydroxylase activity is conferred by a
prolyl hydroxylase derived from the same species as the
polynucleotide encoding recombinant gelatin or encoding a
polypeptide from which recombinant gelatin can be derived. In a
further embodiment, the prolyl 4-hydroxylase is human and the
encoding polynucleotide is derived from human sequence.
[0117] The present invention provides methods for manipulating the
thermoplasticity of gelatin in order to produce a material with the
desired physical characteristics. In one method, the encoding
polynucleotides are expressed in a host system having endogenous
prolyl hydroxylase or alternate hydroxylases, such as certain
mammalian or insect cells, or transgenic animals, or plants or
plant cells. In such a system, the present invention provides
methods for producing a mixture of recombinant gelatins having a
range of percentages of hydroxylation, i.e., non-hydroxylated,
partially hydroxylated, and fully hydroxylated portions. For
example, in one method of producing recombinant gelatins with
varying percentages of hydroxylation, the hydroxylation is
conferred by endogenous prolyl hydroxylase in, e.g., a transgenic
animal, and the distribution of percentage hydroxylation ranges
from non-hydroxylated to fully-hydroxylated, and the melting
temperatures of the material produced range from 28.degree. C. to
36.degree. C., with a median T.sub.m value of around 30.degree. C.
to 32.degree. C. If desired, different fractions of the material
can be isolated along a temperature gradient, as might be necessary
if downstream uses require selecting, for example, the more fully
hydroxylated materials, such as those sufficiently hydroxylated to
retain triple helical structure at, e.g., body temperature
(37.degree. C.).
[0118] In another embodiment, recombinant gelatins are produced in
a system, e.g., a transgenic animal, in which hydroxylation is
supplemented with exogenous prolyl hydroxylase. In one aspect, such
a method of producing recombinant gelatins provides recombinant
gelatins ranging from non-hydroxylated to fully-hydroxylated. The
fraction of recombinant gelatins more fully hydroxylated will be
substantially larger in recombinant material produced in the
presence of exogenous prolyl hydroxylase than in recombinant
material produced only in the presence of endogenous prolyl
hydroxylase. Therefore, the melting temperatures of the material
produced can range from, for example, 28.degree. C. to 40.degree.
C., having a median T.sub.m value of around 34.degree. C. to
36.degree. C. Such a gelatin mixture could be appropriate for use
in a variety of applications, such as gel capsule manufacture,
without requiring any fractionation or separation of differently
hydroxylated portions.
[0119] The above methods provide for production of recombinant
materials with a range of melting temperatures, that can be easily
divided, for example, using a temperature gradient to separate
materials solid at a particular temperature, e.g., 36.degree. C.,
from those liquid at a particular temperature. Furthermore, the
present invention provide for cost-effective methods of producing a
material which, without separation, is suitable for use in bulk
applications. For example, the manufacture of gel capsules could
involve the use of recombinant gelatin produced by the above
methods, wherein the recombinant material, having a range of
melting temperatures, had a desirable melting temperature of around
33.degree. C., such gelatin melting at body temperatures, and thus
being suitable for swallowing and digestion. In the present
methods, the recombinant gelatin can be produced directly in the
desired system, e.g., a transgenic animal, or can be derived, for
example, through hydrolysis, e.g., acid, thermal, or enzymatic,
from recombinant collagens produced in the desired system.
[0120] In one embodiment, the present invention provides a method
of producing recombinant gelatin comprising producing recombinant
collagen and deriving recombinant gelatin from the recombinant
collagen. In one aspect, the method comprises the expression of at
least one polynucleotide sequence encoding a collagen or
procollagen, or fragment or variant thereof, and at least one
polynucleotide encoding a collagen post-translational enzyme or a
subunit thereof. (See, e.g., U.S. Pat. No. 5,593,859, incorporated
by reference herein in its entirety.) The present recombinant
gelatins can be derived from recombinant collagens using procedures
known in the art. (See, e.g., Veis (1965) Int Rev Connect Tissue
Res, 3:113-200.) For example, a common feature of all
collagen-to-gelatin extraction processes is the loss of the
secondary structure of the collagen protein, and in the majority of
instances, an alteration in collagen structure. The collagens used
in producing the gelatins of the present invention can be processed
using different procedures depending on the type of gelatin
desired.
[0121] Gelatin of the present invention can be derived from
recombinantly produced collagen, or procollagens or other
collagenous polypeptides, or from cell cultures, e.g., vertebrate
cell cultures, by a variety of methods known in the art. For
example, gelatin may be derived directly from the cell mass or the
culture medium by taking advantage of gelatin's solubility at
elevated temperatures and its stability under conditions of low or
high pH, low or high salt concentrations, and high temperatures.
Methods, processes, and techniques of producing gelatin
compositions from collagen include digestion with proteolytic
enzymes at elevated temperatures denaturing the triple helical
structure of the collagen utilizing detergents, heat, or various
denaturing agents well known in the art, etc. In addition, various
steps involved in the extraction of gelatin from animal or
slaughterhouse sources, including treatment with lime or acids,
heat extraction in aqueous solution, ion exchange chromatography,
cross-flow filtration, and various methods of drying can be used to
derive the gelatin of the present invention from recombinant
collagen.
[0122] In one aspect, the gelatin of the present invention is
comprised of denatured triple helices, and comprises at least one
collagen subunit, collagen chain, or fragment thereof. The Gly-X--Y
units within a particular collagen chain, subunit, or fragment
thereof may be the same or different. Preferably, X and Y are
either proline or hydroxyproline, and glycine appears in about
every third residue position of the component chain. The amino
acids of X and Y are proline or hydroxyproline, and each Gly-X--Y
unit is the same or different. In another embodiment, the
recombinant gelatin of the present invention comprises an amino
acid sequence of (Gly-X--Y).sub.n,, wherein X and Y are any amino
acid.
[0123] In one embodiment, the present gelatin is derived from a
recombinant collagen of one type that is substantially free from
collagen of any other collagen type. In one aspect, the recombinant
collagen is type I collagen. In another aspect, the recombinant
collagen is type III collagen. In another embodiment of the present
invention, the recombinant collagen is human recombinant collagen.
Further embodiments of the invention, in which the recombinant
collagen is of any one collagen type, such as any one of collagen
types I through XX, inclusively, or any other collagen, natural,
synthetic, or semi-synthetic, are specifically contemplated.
Embodiments in which the recombinant gelatin is derived from
specified mixtures of any one or more of any of collagen types I
through XX, inclusively, or any other collagen, natural, synthetic,
or semi-synthetic, are specifically contemplated.
[0124] The present methods of producing recombinant gelatin have a
number of advantages over traditional methods of gelatin
extraction. Most importantly, the present methods provide a
reliable non-tissue source of gelatin containing native collagen
sequence. In addition, current methods of extraction do not allow
for any natural source of human gelatin, such as might be
advantageous for use in various medical applications. The present
invention specifically provides recombinant gelatins derived from
human sequences, compositions comprising recombinant human
gelatins, and methods of producing these gelatins. The recombinant
human gelatin is non-immunogenic as applied in pharmaceutical and
medical processes, and various uses thereof are also
contemplated.
[0125] In another aspect, the present invention provides for the
production of the present gelatin from engineered constructs
capable of expressing gelatin in various forms. This invention
specifically contemplates methods of producing gelatin using
recombinant prolyl hydroxylase and various synthetic constructs,
including non-native collagen constructs. Further, the present
invention provides recombinant gelatins that can be designed to
possess the specific characteristics needed for a particular
application. Methods for producing these gelatins are also
contemplated. Using the current methods, one could produce a
gelatin with the desired gel strength, viscosity, melting
characteristics, isoelectric profile, pH, degree of hydroxylation,
amino-acid composition, odor, color, etc. In one method according
to the present invention, non-hydrolyzed gelatin is produced, and
can be subsequently hydrolyzed fully or partially, if desired.
Properties of Gelatin
[0126] The various physical properties of gelatin define its
usefulness in particular applications. Gelatin provides unique
performance based on, for example, its amphoteric nature, its
ability to form thermo-reversible gels, its protective colloidal
and surface active properties, and its contribution to viscosity
and stability. In a number of applications, gelatin is used, for
example, as an emulsifier, thickener, or stabilizer; as an agent
for film or coating formation; as a binding agent; as an adhesive
or glue; or as a flocculating agent.
[0127] Raw materials, types of pre-treatment, and extraction
processes all effect the composition of gelatin polypeptides
obtained during conventional manufacture. Currently available
animal products are thus heterogeneous protein mixtures of
polypeptide chains. Gelatin molecules can be fairly large, with the
molecular weight within a particular sample ranging from a few to
several hundred kDa. The molecular weight distribution of gelatin
in a particular lot can be critical, as weight distribution can
influence, for example, the viscosity and/or gel strength of a
gelatin sample.
[0128] In general, the viscosity of a gelatin solution increases
with increasing concentration and with decreasing temperature. A
higher viscosity solution would be preferred, for example, for
gelatin used as a stabilizer or thickener. In some applications,
liquid gelatins are preferred, such as in various emulsifying
fluids, etc. Viscosity of a gelatin solution increases with
increasing molecular weight of the gelatin components. A
high-viscosity gelatin solution could consist, therefore, of a high
concentration of low molecular weight gelatins, or of a lower
concentration of high molecular weight gelatins. Viscosity also
affects gel properties including setting and melting point.
High-viscosity gelatin solutions provide gels with higher melting
and setting rates than do lower viscosity gelatin solutions.
[0129] The thermoreversibility and thermoplasticity of gelatin are
properties exploited in a number of applications, for example, in
the manufacture of gel capsules and tablets. Gelatin can be heated,
molded or shaped as appropriate, and cooled to form a capsule or
tablet coating that has unique properties at homeostatic
temperatures. The gelatin will begin to melt at mouth temperature,
easing swallowing, and become liquid at body temperatures.
[0130] Gelatins of various gel strengths are suitable for use in
different applications. The firmness or strength of the set gel is
typically measured by calculating the Bloom value, which can be
determined using international standards and methodology. Briefly,
the Bloom strength is a measurement of the strength of a gel formed
by a 6.67% solution of gelatin in a constant temperature bath over
18 hours. A standard Texture Analyzer is used to measure the weight
in grams required to depress a standard AOAC (Association of
Official Agricultural Chemists) plunger 4 millimeters into the gel.
If the weight in grams required for depression of the plunger is
200 grams, the particular gelatin has a Bloom value of 200. (See,
e.g., United States Pharmacopoeia and Official Methods of Analysis
of AOAC International, 17.sup.th edition, Volume II.)
[0131] Commercial gelatins can thus be graded and sold on Bloom
strength. Different ranges of Bloom values are appropriate for
different uses of gelatin; for example, gelatins for use in various
industrial applications, e.g., concrete stabilization, sand
casting, molds, glues, coatings, etc., will be selected from a wide
range of varying Bloom strengths, depending on the performance
characteristics desired. Gelatins with varying Bloom strengths are
also desired in the manufacture of various pharmaceutical products.
For example, soft gel capsules are typically manufactured using
ossein or skin gelatin with a Bloom value of about 150 to 175
and/or porcine-derived gelatin with a Bloom value of about 190 to
210, or blends thereof, while hard gel capsules might use a gelatin
with a Bloom value of about 220 to 260. In food applications,
gelatin used, for example, as a thickener in marshmallows or other
confectionary products might have a Bloom strength of around 250.
Various applications, including certain emulsifying fluids in
photographic applications, and various industrial coatings, involve
the use of non-gelling gelatins.
[0132] The present invention provides for the production of
recombinant gelatins with different Bloom strengths. In one aspect,
the present invention provides, for example, for the manufacture of
gelatins with Bloom strengths of around 50, 100, 150, 200, 250, and
300. In one embodiment, the present invention provides for the
production of a recombinant gelatin having a Bloom strength of
around 400. Such a gelatin can be used, for example, in the
manufacture of gel capsules, and could allow for the manufacture of
a lighter and thinner capsule, as less material would need to be
used to provide a gel of sufficient strength. Recombinant gelatins
with Bloom strengths of under 100, and from 0 to 100, inclusively,
are also contemplated.
[0133] The present invention provides methods for designing
recombinant gelatins with the physical properties desired for
particular applications. In one embodiment, the present invention
provides recombinant gelatins comprising uniform molecules of a
specified molecular weight or range of molecular weights, and
methods for producing these recombinant gelatins. Such homogeneous
and uniform materials are advantageous in that they provide a
reliable source of product with predictable performance, minimizing
variability in product performance and in manufacturing parameters.
Currently, gelatin from different lots must sometimes be blended in
order to produce a mixture with the desired physical
characteristics, such as the viscosity or gel strength, etc.,
provided by a particular molecular weight or molecular weight
range.
[0134] In applications in which a specific molecular weight range
of recombinant gelatin would be preferred to a recombinant gelatin
with a specific molecular weight, the present invention provides
such materials. Using the recombinant gelatins of the present
invention, a manufacturer could, for example, mix recombinant
gelatins from lots with specified molecular weights, in certain
percentages, in order to achieve a mixture with the desired
molecular weight range. Additionally, the present recombinant
gelatins are inherently more uniform and of greater consistency
than currently available commercial products. In one method of the
present invention, recombinant collagen is processed, such as by
acid or heat hydrolysis, to produce recombinant gelatin of a
molecular weight range narrower than that of currently available
gelatin products. Using suitable and controllable hydrolysis
conditions, the present methods produced recombinant human gelatins
with molecular weight distributions similar to those of
commercially available gelatins, as well as recombinant gelatins
with ranges narrower than those of the molecular weight ranges of
currently available products. (See Examples 9 and 10.)
[0135] The present invention provides recombinant gelatins of
uniform molecular weight or specified ranges of molecular weights,
removing variability and unpredictability, and allowing for
fine-tuning of processes and predictable behavior. The present
methods allow for the production of recombinant gelatins of any
desired molecular weight or range of molecular weights. For
example, in one embodiment, the recombinant gelatin has a molecular
weight greater than 300 kDa. In another embodiment, the recombinant
gelatin has a molecular weight range of from about 150 to 250 kDa,
or of from about 250 to 350 kDa. Other molecular weight ranges are
specifically contemplated, including, but not limited to, the
following molecular weight ranges: about 0 to 50 kDa, about 50 to
100 kDa, about 100 to 150 kDa, about 150 to 200 kDa, about 200 to
250 kDa, about 250 to 300 kDa, and about 300 to 350 kDa.
[0136] In another aspect, recombinant gelatin with a molecular
weight similar to that of some commercially available gelatins, of
from about 10 to 70 kDa, could be produced. In preferred
embodiments, the present invention provides recombinant gelatins
narrower molecular weight ranges, not currently available in
commercial products, such as from about 10 to 30 kDa, about 30 to
50 kDa, and about 50 to 70 kDa. In a particular embodiment, a
recombinant gelatin with a chain length conferring specific
properties appropriate to the intended application is provided. In
various embodiments of the present invention, recombinant gelatins
with uniform molecular weights of approximately 1 kDa, 5 kDa, 8
kDa, 9 kDa, 14 kDa, 16 kDa, 22 kDa, 23 kDa, 44 kDa, and 65 kDa are
contemplated. (See, e.g., Table 2.)
[0137] In particular, in one method of the present invention,
gelatin is produced from shortened collagen sequences, for example,
the sequences identified in Table 2. These sequences represent
specific collagenous domains and encode short forms of gelatin.
[0138] The present gelatins are capable of retaining valuable
physical characteristics of gelatin, for example, film-forming
abilities, while possessing average molecular weights lower or
higher than those of conventionally derived animal gelatin. Various
modifications of collagen sequences, including, for example,
denaturing of the collagen, collagen chain, subunit, or fragments
thereof, or varying degrees of hydroxylation, can be made that will
produce gelatin with specific physical properties, i.e., a higher
or lower melting point than conventional gelatin, different amino
acid compositions, specific molecular weights or ranges of
molecular weights, etc., and such variations are specifically
contemplated herein.
[0139] The molecular weight of a typical fibril-forming collagen
molecule, such as type I collagen, is 300 kDa. In some
applications, such as those in which high molecular weight gelatins
are used, it might be desirable to produce a gelatin with a greater
molecular weight than that of currently available extracted
gelatin. Therefore, in one embodiment of the present invention,
gelatin can be produced containing molecules larger than the
collagen from which commercial gelatin is currently extracted. The
resultant higher molecular weight gelatin product can be used
directly in various applications in which its physical properties
would be desirable, or can be divided and subsequently treated to
produce molecules of a smaller sizes.
[0140] In one embodiment, gelatin can be produced using collagens
larger than those available in conventional animal sources. For
example, the present methods of production could be adapted to
produce the acid-soluble cuticle collagens derived from the body
walls of vestimentiferan tube worm Riftia pachyptila (molecular
weight 2600 kDa) and annelid Alvinella pompejana (molecular weight
1700 kDa). These collagens could be adapted to the present methods
of production to produce larger molecules than those from which
currently available gelatin is extracted, and the resultant product
could be treated to produce gelatins as desired.
[0141] It is specifically contemplated that gelatins of various
molecular weights can be produce by a variety of methods according
to the present invention. For example, characteristics of the
present recombinant gelatins, e.g., percentage hydroxylation,
degrees of cross-linking, etc., can be varied to produce
recombinant gelatins with the desired molecular weights. In one
aspect, for example, the present invention provides a method for
producing large molecular weight recombinant gelatins by using
cross-linking agents known in the art to cross-link gelatin
polypeptides. (See discussion, infra.)
[0142] In another aspect of the present invention, polypeptides
from which gelatins could be derived are expressed from engineered
constructs containing multiple copies of all or fragments of native
collagen sequence. For example, in one embodiment, the present
invention provides an altered collagen construct comprising
multiple copies of the collagenous domain of type I collagen. In
another embodiment, the construct comprises multiple copies of the
collagenous domain of type III collagen. In a further embodiment,
the construct comprises copies of type I and type III collagenous
domains. The present invention provides for the use of single or
multiple copies of all or portions of sequences encoding any
collagen, including collagens type I through XX, inclusive. It is
specifically contemplated that the present methods allow for the
production of gelatins derived from more than one type of collagen.
In one embodiment, recombinant gelatins derived from more than one
type of collagen are co-expressed in an expression system, e.g., a
host cell, transgenic animal, etc., such that a mixture of gelatins
is produced.
[0143] In another embodiment, the present invention provides a
method for producing gelatin without derivation from a collagen or
procollagen triple helical stage. In one aspect, this involves
production of recombinant gelatin by expression of various
constructs in a high-temperature expression system, such as one
relying on thermophilic organisms, that does not allow the
formation of triple helical structures, but permits the activity of
prolyl hydroxylase. The present gelatin could also be derived from
collagen constructs containing mutations, additions, or deletions
that prevent triple helical formation. In another aspect, this
involves production of gelatin from shortened constructs that do
not allow for formation of triple helices at regular temperatures,
i.e., 37.degree. C. Alternatively, gelatin can be produced in the
presence of inhibitors of triple helix formation, for example,
polyanions, that are co-expressed with the biosynthetic collagen
constructs. Additionally, the biosynthetic gelatin of the present
invention could be derived from recombinantly produced collagen
chains that do not form triple helices.
[0144] In another embodiment, the invention provides a method of
deriving gelatin from non-hydroxylated collagen or collagen in
which there is partial rather than full hydroxylation of proline
residues. In one aspect, this method comprises deriving gelatin
from collagen expressed in the absence of prolyl hydroxylase, for
example, in an insect expression system without prolyl hydroxylase.
(See, e.g., Myllyhaiju et al. (1997) J. Biol. Chem. 272,
21824-21830.) In one method according to the present invention,
gelatin is derived from the partially hydroxylated or
non-hydroxylated collagen. Hydroxylation can be conferred, for
example, by in vitro administration of hydroxylases. In one method,
a low degree of substitution of hydroxyproline for proline can be
forced by providing hydroxyproline to, e.g., bacterial or yeast
host cells.
[0145] The present invention comprises fully-hydroxylated,
partially-hydroxylated, and non-hydroxylated recombinant gelatins.
In another embodiment, the method of the present invention
comprises producing a gelatin or gelatin precursor having a
specific degree of hydroxylation. In a further aspect, the
invention relates to a method of producing gelatin having from 20
to 80 percent hydroxylation, preferably, from about 30 to 60
percent hydroxylation, and, most preferably, about 40 percent
hydroxylation. (See Examples 4 and 5.) The partially-hydroxylated
recombinant gelatins of the present invention can be obtained
through mixing specified percentages of recombinant gelatins with
different degrees of hydroxylation, or can be obtained directly.
(See Examples 4 and 5.) Further, the invention provides methods for
achieving partial hydroxylation of recombinant gelatins by
administering prolyl hydroxylase to non-hydroxylated recombinant
gelatins in vitro, and controlling the length of the reaction.
[0146] There are limits to the extent to which the thermal
characteristics of currently available animal-source gelatins can
be altered. The present invention specifically provides for methods
of producing recombinant gelatin, wherein the recombinant gelatin
has the specific thermal characteristics desired for a particular
application. Using the methods of the present invention, for
example, the melting point and/or gel strength of the recombinant
gelatin can be manipulated in a variety of ways. The temperature
stability and/or gel strength of recombinant gelatin can be
measured by a variety of techniques well-known in the art.
[0147] Generally, the melting point of gelatin increases as the
degree of hydroxylation increases. Using the methods of the present
invention, it is possible to produce high molecular weight gelatins
that, due to manipulation of hydroxylation and/or cross-linking,
etc., have a lower gel strength and/or lower melting point than
those of currently available animal-source gelatins. Therefore, the
present invention provides a recombinant gelatin with properties
unattainable in various commercial products, suitable for use in
applications where a higher molecular weight gelatin is desired, in
order to provide increased film strength, etc., but a non-gelling
or low strength gel product is desired. In one embodiment, the
present invention provides recombinant gelatin that has lower
temperature stability due to incomplete hydroxylation of proline
residues.
[0148] Such a recombinant gelatin could be useful in a variety of
applications. In gelatin produced by current extraction methods,
only fish gelatin provides a high average molecular weight
film-forming protein that is non-gelling. The non-gelling and cold
water-solubility characteristics offered by non-gelling fish
gelatin can be matched by currently available hydrolyzed bovine and
porcine gelatins, but with corresponding loss of film strength and
flexibility, as the hydrolyzed gelatins are of lower average
molecular weight. Therefore, in one embodiment, the present
invention provides a partially-hydroxylated recombinant gelatin
with lower gel strength and higher molecular weight than that
provided by currently available animal-source materials.
[0149] A higher molecular weight, lower gel strength recombinant
gelatin could also be useful in various pharmaceutical
applications, in which stability is desired, but non- or
low-gelling properties are desired in order to maintain the
malleability and integrity of the pharmaceutical product. Such a
recombinant gelatin could be used, for example, as a plasma
expander, as its molecular weight could provide stability,
increasing the residence time in circulation, and the altered
setting point would prevent the material from gelling at room
temperature, allowing the expander to be administered without
warming. In one embodiment, the present invention provides a
partially-hydroxylated recombinant gelatin suitable for use in
pharmaceutical applications, for example, as a plasma expander.
[0150] In another aspect, partially-hydroxylated recombinant
gelatin is obtained through expression of recombinant gelatin, or
expression of polypeptides from which the present recombinant
gelatin can be derived, in the absence of prolyl hydroxylase, for
example, in an insect expression system without prolyl hydroxylase.
(See, e.g., Myllyhaiju et al. (1997) J. Biol. Chem. 272,
21824-21830.) Hydroxylation can occur at the time of production or
can be subsequently imposed through, e.g., in vitro biological or
chemical modification. In one method of the present invention,
recombinant gelatins are derived from partially-hydroxylated or
from fully hydroxylated collagen.
[0151] Gelatins derived from natural sources by currently available
methods are greatly strengthened by the existence of covalent
cross-links between lysine residues of the constituent collagen
molecules. Cross-linking occurs naturally in the extracellular
space following collagen secretion and fibril formation, as prior
to secretion, certain lysine residues are hydroxylated by the
enzyme lysyl hydroxylase. The extracellular enzyme lysyl oxidase
subsequently deamidates certain lysine and hydroxylysine residues
in the collagen molecules, yielding highly reactive aldehyde groups
that react spontaneously to form covalent bonds. The resulting
cross-linked collagens yield gelatins of increased gel strength and
increased viscosity. Specifically, a higher degree of cross-linking
results in gelatins with higher melting temperatures and greater
gel strength.
[0152] In one aspect, the present invention provides recombinant
gelatins that are cross-linked, resulting in higher molecular
weight gelatins. (See Example 7.) Cross-linking can be imposed by
different methods, such as by biological or chemical modification.
For example, in one embodiment, recombinant gelatin or a
polypeptide from which gelatin can be derived is expressed in the
presence of lysyl hydroxylase and lysyl oxidase. In another
embodiment, the polypeptide is modified by cross-linking after
expression. In a further aspect, the present invention provides for
imposition of cross-linking by chemical means, such as by reactive
chemical cross-linkers, for example 1-ethyl-3-(dimethylaminopropyl)
carbodiimide hydrochloride (EDC). (See Example 7.) Other chemical
cross-linking agents, such as bis(sulfosuccinimidyl) suberate
(BS.sup.3), 3,3'-dithiobis(sulfosuccinimidyl) propionate (DTSSP),
and Tris-sulfosuccinimidyl aminotriacetate (Sulfo-TSAT) may also be
used, as can various agents known in the art. Additionally, the
present invention provides methods of producing recombinant
gelatins with varying degrees of cross-linking, useful for
obtaining recombinant gelatins of desired melting points, gel
strength, and viscosity.
[0153] The present invention provides methods to manipulate the
molecular weight, the level of hydroxylation, and the degree of
cross-linking of the recombinant gelatins to allow for creation of
recombinant gelatins of different and specific Bloom strengths, as
well as recombinant gelatins of different and specific levels of
viscosity.
[0154] Proline hydroxylation plays central role in natural collagen
formation. Hydroxylation of specific lysyl residues in the sequence
X-Lys-Gly also performs an important function in collagen synthesis
and fibril formation. The hydroxyl groups on modified lysine
residues function as both attachment sites for carbohydrates and as
essential sites for the formation of stable intermolecular
cross-links. These modifications require the expression of specific
enzymes, lysyl hydroxylase and lysyl oxidase.
[0155] Therefore, in one aspect of the invention, the co-expression
of these enzymes with the polypeptides of the present invention is
contemplated. The gene encoding lysyl hydroxylase (Hautala et al.
(1992) Genomics 13:62-69) is expressed in a host cell, which is
then further modified by the introduction of a sequence encoding a
gelatin or polypeptide from which gelatin can be derived, as
described in the present invention. The recombinant gelatins of the
present invention can therefore be post-translationally modified by
the activity of endogenously expressed lysyl hydroxylase and lysyl
oxidase. The recombinant gelatins of the present invention can also
be modified by the expression of exogenous lysyl hydroxylase and
lysyl oxidase. In one embodiment, recombinant gelatins produced are
non-hydroxylated, and subsequently altered by imposing the desired
degree of hydroxylation of lysine residues by the enzymatic
activity of lysyl hydroxylase. The ability to alter the degree of
lysyl hydroxylation is desirable in producing gelatins, and
polypeptides from which gelatin can be derived, with various
degrees of cross-linking that lead to the desired gel strengths and
viscosities.
[0156] In further embodiments, a polypeptide containing
hydroxylysine residues can also be expressed in, for example, a
yeast cell, in which hydroxyproline is produced by the activity of
prolyl hydroxylase. (See Examples 1 and 4.) In some embodiments,
the modified recombinant gelatin or polypeptide from which gelatin
can be derived can be formulated and administered to an animal or
human, thus serving as a substrate for the activities of endogenous
enzymes, such as lysyl oxidase, thus allowing the collagenous
polypeptide to be incorporated into tissues in a stabilized
cross-linked form. Therefore, one aspect of the present invention
provides for the production of recombinant gelatins of desirable
gel strengths and viscosity for commercial use, without the need
for lysyl hydroxylase or lysyl oxidase activities.
[0157] The invention also provides for the production of gelatin
having a particular gelling point. In one embodiment, the present
methods provide for the production of gelatin having a setting or
gelling point of from 15 to 35.degree. C. In further embodiments,
the recombinant gelatin has a setting point of from 15 to
25.degree. C., from 25 to 35.degree. C., and from 20 to 30.degree.
C.
[0158] In various aspects, the present invention provides
recombinant gelatin that is non-hydrolyzed, fully hydrolyzed, or
hydrolyzed to varying degrees, such as gelatins that are a mixture
of hydrolyzed and non-hydrolyzed products. Additionally, the
present invention provides methods of producing recombinant
gelatins with varying degrees of hydrolysis. (See Examples 9 and
10.) Gelatin hydrosylates are typically cold water-soluble and are
used in a variety of applications, particularly in the
pharmaceutical and food industries, in which a gelatin with
non-gelling properties is desirable. Gelatin hydroslyates are used
in the pharmaceutical industry in film-forming agents,
microencapsulation processes, arthritis and joint relief formulas,
tabletting, and various nutritional formulas. In the cosmetics
industry, gelatin hydrolysates are used in shampoos and
conditioners, lotions and other formulations, including lipsticks,
and in fingernail formulas, etc. Gelatin hydrolysates appear as
nutritional supplements in protein and energy drinks and foods; are
used as fining agents in wine, beer, and juice clarification; and
are used in the microencapsulation of additives such as food
flavorings and colors. Gelatin hydrosylates are used in industrial
applications for their film-forming characteristics, such as in
coatings of elements in semiconductor manufacture, etc.
[0159] In one embodiment of the present invention, gelatin is
produced from collagen sequences in which particular native domains
have been deleted or have been added in order to alter the behavior
of the expressed product. The invention further contemplates
methods of producing recombinant gelatin wherein the gelatin is
produced directly from an altered collagen construct, without
production of an intact triple helical collagen. In particular, the
present invention contemplates methods of producing recombinant
gelatin comprising the expression of various engineered constructs
that do not encode standard triple helical collagen. For example,
specific deletions can eliminate collagenase-responsive regions,
and various regions eliciting immunogenic, e.g., antigenic and
allergenic, responses.
[0160] Specific domains of various collagens have been associated
with specific activities. (See, e.g., Shahan et al. (1999) Con.
Tiss. Res. 40:221-232; Raff et al. (2000) Human Genet. 106:19-28,
both of which references are incorporated by reference herein in
their entireties.) In particular, the present invention
specifically provides for methods of producing recombinant gelatins
derived from collagen constructs altered to eliminate or to reduce
or increase specific regions of a collagen gene associated with a
specific activity. Specifically, such regions could be deleted in
full or in part to produce a gelatin lacking or with reduced
specific activity, or additional copies of the specific region
could be added to produce a gelatin with enhanced activity. For
example, sequences in types I and III collagen recognized by the
.alpha.2.beta.1 integrin receptor on the platelet cell surface have
been identified. (Knight et al. (1998) J. Biol. Chem.
273:33287-33294; and Morton et al. (1997) J. Biol. Chem.
272:11044-11048, which references are incorporated by reference
herein in their entirety.)
[0161] In one aspect of the present invention, it is desirable to
create a homogeneous gelatin composed of fragments synthesized from
collagen constructs lacking platelet activation regions. Such
gelatin could be included, for example, in products associated with
anastomosis and vascular grafting, etc., including coatings for
stent and graft devices. Such products can be associated with
deleterious side effects, for example, thrombosis, that can develop
in association with the use of such products as a result of the
platelet-aggregating regions present in the collagenous product. In
one aspect, the present invention provides for a method of
producing a recombinant gelatin which can provide support for cell
attachment when used in a stent or similar device, but which does
not include platelet-reactive regions, thus minimizing the risk of
platelet aggregation. (See Example 2.) Therefore, the present
invention provides in one embodiment for a stent coating comprising
recombinant gelatin. In a preferred embodiment, the recombinant
gelatin is recombinant human gelatin. In some instances, such as
various wound care applications, it could be desirable to provide
recombinant gelatin comprising domains capable of inducing specific
aggregating activities.
[0162] A gelatin of the present invention could be expressed from
collagen constructs that did not encode the regions recognized by
the .alpha.2.beta.1 receptor, or from constructs with one or with
multiple copies of such regions, thus providing a homogeneous and
consistent gelatin product without or with reduced platelet
aggregation and activation. In one aspect, the present invention
provides for the production of recombinant gelatin, either through
direct expression of gelatin or through processing of gelatin from
collagenous polypeptides, through the use of highly efficient
recombinant expression. The present production methods, as opposed
to current methods of extraction, offer extreme flexibility, as any
one of a number of expression systems can be used. The production
material is accessible, for example, in yeast or plant biomass.
Secretion in certain production systems can be optimized, for
example, by dictating the uniform size of particular gelatin
molecules to be produced according to the present methods. In
various embodiments, the present gelatins or the polypeptides from
which these gelatins are derived, are produced in expression
systems including, but not limited to, prokaryotic expression
systems, such as bacterial expression systems, and eukaryotic
expression systems, including yeast, animal, plant, and insect
expression systems. Expression systems such as transgenic animals
and transgenic plants are contemplated.
[0163] The present invention provides for expression of at least
one polynucleotide encoding a gelatin or a polypeptide from which
gelatin can be derived in a cell. In one embodiment, the present
invention provides for the expression of more than one
polynucleotide encoding a gelatin or a polypeptide from which
gelatin can be derived in a cell, such that recombinant gelatin
[that has containing homogeneous or heterogeneous polypeptides is
produced. The present invention further provides for expression of
a polynucleotide encoding a collagen processing or
post-translational enzyme or subunit thereof in a cell. Different
post-translational modifications, and different post-translational
enzymes, e.g., prolyl hydroxylase, lysyl hydroxylase, etc., can
effect, for example, Bloom strength and other physical
characteristics of the present gelatins.
[0164] The recombinant gelatins of the present invention are
derived from collagenous sequences. The sequences from which the
encoding polynucleotides of the invention are derived can be
selected from human or from non-human sequences, depending on the
characteristics desired for the intended use of the ultimate
gelatin product. For pharmaceutical and medical uses, recombinant
human gelatin is preferred. Non-human sources include non-human
mammalian sources, such as bovine, porcine, and equine sources, and
other animal sources, such as chicken and piscine sources.
Non-native sequences are specifically contemplated.
[0165] Nucleic acid sequences encoding collagens have been
generally described in the art. (See, e.g., Fuller and Boedtker
(1981) Biochemistry 20:996-1006; Sandell et al. (1984) J Biol Chem
259:7826-34; Kohno et al. (1984) J Biol Chem 259:13668-13673;
French et al. (1985) Gene 39:311-312; Metsaranta et al. (1991) J
Biol Chem 266:16862-16869; Metsaranta et al. (1991) Biochim Biophys
Acta 1089:241-243; Wood et al. (1987) Gene 61:225-230; Glumoff et
al. (1994) Biochim Biophys Acta 1217:41-48; Shirai et al. (1998)
Matrix Biology 17:85-88; Tromp et al. (1988) Biochem J 253:919-912;
Kuivaniemi et al. (1988) Biochem J 252:633-640; and Ala-Kokko et
al. (1989) Biochem J 260:509-516.) See also co-pending,
commonly-owned application U.S. patent application Ser. No.
09/709,700, entitled "Animal Collagens and Gelatins," filed 10 Nov.
2000, incorporated herein by reference in its entirety.)
[0166] The nucleic acid sequences of the invention may be
engineered in order to alter the coding sequences used to produce
recombinant gelatin, or polypeptides from which the recombinant
gelatin can be derived, for a variety of ends including, but not
limited to, alterations which modify processing and expression of
the gene product. For example, alternative secretory signals may be
substituted for any native secretory signals. Mutations may be
introduced using techniques well known in the art, e.g.,
site-directed mutagenesis, PCR-directed mutagenesis, cassette
mutagenesis, and other techniques well-known in the art to insert
new restriction sites, or to alter glycosylation patterns,
phosphorylation, proteolytic turnover/breakdown, etc. Additionally,
when producing gelatin in an expression system using particular
host cells, the polynucleotides of the invention may be modified in
the silent position of any triplet amino acid codon so as to better
conform to the codon preference of a particular host organism.
[0167] Altered polynucleotide sequences which may be used in
accordance with the invention include sequences containing
deletions, additions, or substitutions of nucleotide residues in
native collagen sequences. Such polynucleotides can encode the same
or a functionally equivalent gene product. The gene product itself
may contain deletions, additions or substitutions of amino acid
residues within a collagen sequence.
[0168] The polynucleotide sequences of the invention are further
directed to sequences which encode variants of the encoded
polypeptides. The encoded amino acid variants may be prepared by
various methods known in the art for introducing appropriate
nucleotide changes for encoding variant polypeptides. Two important
variables in the construction of amino acid sequence variants are
the location of the mutation and the nature of the mutation. The
amino acid sequence variants of the gelatins of the present
invention, or of the polypeptides from which the present gelatins
are derived, are preferably constructed by mutating the
polynucleotide to give an amino acid sequence that does not occur
in nature. These amino acid alterations can be made at sites that
differ in, for example, collagens from different species (variable
positions), or in highly conserved regions (constant regions).
Sites at such locations will typically be modified in series, e.g.,
by substituting first with conservative choices (e.g., hydrophobic
amino acid to a different hydrophobic amino acid) and then with
more distant choices (e.g., hydrophobic amino acid to a charged
amino acid), and then deletions or insertions may be made at the
target site.
[0169] Due to the inherent degeneracy of the genetic code, other
nucleic acid sequences which encode substantially the same or a
functionally equivalent amino acid sequence or polypeptide,
natural, synthetic, semi-synthetic, or recombinant in origin, may
be used in the practice of the claimed invention. Degenerate
variants are specifically contemplated by the present invention,
including codon-optimized sequences. In addition, the present
invention specifically provides for polynucleotides which are
capable of hybridizing to a particular sequence under stringent
conditions.
Expression
[0170] The present methods are suitably applied to the range of
expression systems available to those of skill in the art. While a
number of these expression systems are described below, it is to be
understood that application of the present methods not limited to
the specific embodiments set forth below.
[0171] A variety of expression systems may be utilized to contain
and express sequences encoding the recombinant gelatins of the
present inventions or encoding polypeptides from which these
gelatins can be derived. These include, but are not limited to,
microorganisms such as bacteria transformed with recombinant
bacteriophage, plasmid, or cosmid nucleic acid expression vectors;
yeast transformed with yeast expression vectors; insect cell
systems infected with virus expression vectors (e.g., baculovirus);
filamentous fungi transformed with fungal vectors; plant cell
systems transformed with virus expression vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with
bacterial expression vectors (e.g., pET or pBR322 plasmids); or
animal cell systems.
[0172] Control elements or regulatory sequences suitable for use in
expressing the polynucleotides of the present invention are those
non-translated regions of the vector, including enhancers,
promoters, and 5' and 3' untranslated regions, which interact with
host cellular proteins to carry out transcription and translation.
Such elements may vary in strength and specificity. Depending on
the vector system and host utilized, any number of suitable
transcription and translation elements may be used.
[0173] Promoters are untranslated sequences located upstream from
the start codon of the structural gene that control the
transcription of the nucleic acid under its control. Inducible
promoters are promoters that alter their level of transcription
initiation in response to a change in culture conditions, e.g., the
presence or absence of a nutrient. One of skill in the art would
know of a large number of promoters that would be recognized in
host cells suitable for use in the methods of the present
invention.
[0174] Promoter, enhancer, and other control elements can be
selected as suitable by one skilled in the art. For example, when
cloning in bacterial systems, inducible promoters such as the
hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, La
Jolla, Calif.) or pSPORT1 plasmid (GIBCO BRL) and the like may be
used. In insect cells, the baculovirus polyhedrin promoter may be
used. In plant systems, promoters or enhancers derived from the
genomes of plant cells (e.g., heat shock promoter, the promoter for
the small subunit of RUBISCO; the promoter for the chlorophyll a/b
binding protein; promoters for various storage protein genes, etc.)
or from plant viruses (e.g., viral promoters or leader sequences,
the 35S RNA promoter of CaMV, the coat protein promoter of TMV,
etc.) may be cloned into the vector. In mammalian cell systems,
promoters from mammalian genes (e.g., metallothionein promoter,
.alpha.-actin promoter, etc.) or from mammalian viruses (e.g., the
adenovirus late promoter, CMV, SV40, LTR, TK, and the vaccinia
virus 7.5 K promoters, etc.) are preferable. If it is necessary to
generate a cell line that contains multiple copies of the sequence
encoding the desired polypeptide, vectors based on SV40 or EBV may
be used with an appropriate selectable marker.
[0175] Such promoters can be are operably linked to the
polynucleotides encoding the gelatin or gelatin precursors of the
present invention, such as by removing the promoter from its native
gene and placing the encoding polynucleotide at the 3' end of the
promoter sequence. Promoters useful in the present invention
include, but are not limited to, prokaryotic promoters, including,
for example, the lactose promoter, arabinose promoter, alkaline
phosphatase promoter, tryptophan promoter, and hybrid promoters
such as the tac promoter; yeast promoters, including, for example,
the promoter for 3-phosphoglycerate kinase, other glycolytic enzyme
promoters (hexokinase, pyruvate decarboxylase,
phophofructosekinase, glucose-6-phosphate isomerase, etc.), the
promoter for alcohol dehydrogenase, the alcohol oxidase (AOX) 1 or
2 promoters, the metallothionein promoter, the maltose promoter,
and the galactose promoter; and eukaryotic promoters, including,
for example, promoters from the viruses polyoma, fowlpox,
adenovirus, bovine papilloma virus, avian sarcoma virus,
cytomegalovirus, retroviruses, SV40, and promoters from the target
eukaryote, for example, the glucoamylase promoter from Aspergillus,
actin or ubiquitin promoters, an immunoglobin promoter from a
mammal, and native collagen promoters. (See, e.g., de Boer et al.
(1983) Proc. Natl. Acad. Sci. USA 80:21-25; Hitzeman et al. (1980)
J. Biol. Chem. 255:2073); Fiers et al. (1978) Nature 273:113;
Mulligan and Berg (1980) Science 209:1422-1427; Pavlakis et al.
(1981) Proc. Natl. Acad. Sci. USA 78:7398-7402; Greenway et al.
(1982) Gene 18:355-360; Gray et al. (1982) Nature 295:503-508;
Reyes et al. (1982) Nature 297:598-601; Canaani and Berg (1982)
Proc. Natl. Acad. Sci. USA 79:5166-5170; Gorman et al. (1982) Proc.
Natl. Acad. Sci. USA 79:6777-6781; and Nunberg et al. (1984) Mol.
and Cell. Biol. 11(4):2306-2315.)
[0176] The polynucleotide sequences encoding the gelatins and
gelatin precursors of the present methods may be under the
transcriptional control of a constitutive promoter, directing
expression generally. Alternatively, the polynucleotides employed
in the present methods are expressed in a specific tissue or cell
type, or under more precise environmental conditions or
developmental controls. Promoters directing expression in these
instances are known as inducible promoters. In the case where a
tissue-specific promoter is used, protein expression is
particularly high in the tissue from which extraction of the
protein is desired. In plants, for example, depending on the
desired tissue, expression may be targeted to the endosperm,
aleurone layer, embryo (or its parts as scutellum and cotyledons),
pericarp, stem, leaves tubers, roots, etc. Examples of known
tissue-specific promoters in plants include the tuber-directed
class I patatin promoter, the promoters associated with potato
tuber ADPGPP genes, the soybean promoter of .beta.-conglycinin (7S
protein), which drives seed-directed transcription, and
seed-directed promoters from the zein genes of maize endosperm.
(See, e.g., Bevan et al. (1986) Nucleic Acids Res. 14: 4625-4638;
Muller et al. (1990) Mol. Gen. Genet. 224: 136-146; Bray (1987)
Planta 172:364-370; and Pedersen et al. (1982) Cell
29:1015-1026.)
[0177] Transcription of the sequences encoding the gelatins or
gelatin precursors of the present invention from the promoter is
often increased by inserting an enhancer sequence in the vector.
Enhancers are cis-acting elements, usually about from 10 to 300 bp,
that act to increase the rate of transcription initiation at a
promoter. Many enhancers are known for both eukaryotes and
prokaryotes, and one of ordinary skill could select an appropriate
enhancer for the host cell of interest. (See, e.g., Yaniv (1982)
Nature 297:17-18.)
[0178] The gelatins and gelatin precursors of the present invention
may be expressed as secreted proteins. When the engineered cells
used for expression of the proteins are non-human host cells, it is
often advantageous to replace the secretory signal peptide of the
collagen protein with an alternative secretory signal peptide which
is more efficiently recognized by the host cell's secretory
targeting machinery. The appropriate secretory signal sequence is
particularly important in obtaining optimal fungal expression of
mammalian genes. (See, e.g., Brake et al. (1984) Proc. Natl. Acad.
Sci. USA 81:4642.) Other signal sequences for prokaryotic, yeast,
fungi, insect or mammalian cells are well known in the art, and one
of ordinary skill could easily select a signal sequence appropriate
for the host cell of choice.
[0179] The efficiency of expression may be enhanced by the
inclusion of enhancers appropriate for the particular cell system
which is used, such as those described in the literature. (See,
e.g., Scharf, D. et al. (1994) Results Probl. Cell Differ.
20:125-162.) In addition, a host cell strain may be chosen for its
ability to modulate the expression of the inserted sequences or to
process the expressed protein in the desired fashion. Such
modifications of the polypeptide include, but are not limited to,
acetylation, carboxylation, glycosylation, phosphorylation,
lipidation, prenylation, and acylation. Post-translational
processing which cleaves a "prepro" form of the protein may also be
used to facilitate correct insertion, folding, and/or function.
Different host cells such as CHO, HeLa, MDCK, HEK293, and WI38,
which have specific cellular machinery and characteristic
mechanisms for such post-translational activities, may be chosen to
ensure the correct modification and processing of the foreign
protein.
[0180] In accordance with the invention, polynucleotide sequences
encoding recombinant gelatins or polypeptides from which gelatins
can be derived may be expressed in appropriate host cells. In
preferred embodiments of the invention, the recombinant gelatin is
human gelatin. In other preferred embodiments of the invention, the
polynucleotide sequences are derived from type I collagen sequence,
free of coding sequence for any other type of collagen, or from
type II collagen, free of coding sequence for any other type of
collagen, or from type III collagen, free of coding sequence for
any other type of collagen. In another embodiment, the encoding
polynucleotides are derived from type I and type III collagen in
specified quantities, such that the gelatin produced by or derived
from the encoded polypeptides comprises a mixture of type I and
type III collagens in defined quantities.
[0181] In order to express the collagens from which the present
gelatins are derived, or to express sequences other than natural
collagen sequences leading to the production of the present
gelatin, nucleotide sequences encoding the collagen, or a
functional equivalent, or other sequence, for example, a shortened
collagen sequence, such as those presented in Table 2, is inserted
into an appropriate expression vector, i.e., a vector which
contains the necessary elements for the transcription and
translation of the inserted coding sequence, or in the case of an
RNA viral vector, the necessary elements for replication and
translation.
[0182] Methods well-known to those skilled in the art can be used
to construct expression vectors containing the desired coding
sequence and appropriate transcriptional/translational control
signals. These methods include standard DNA cloning techniques,
e.g., in vitro recombinant techniques, synthetic techniques, and in
vivo recombination. See, for example, the techniques described in
Maniatis et al., supra; Ausubel et al., supra; and Ausubel, F. M.
(1997) Short Protocols in Molecular Biology, John Wiley and Sons,
New York, N.Y.
[0183] Various expression vectors may be used to express the
present polypeptides. For example, a typical expression vector
contains elements coding for a replication origin; a cloning site
for insertion of an exogenous nucleotide sequence; elements that
control initiation of transcription of the exogenous gene, such as
a promoter; and elements that control the processing of
transcripts, such as a transcription/termination/polyadenylation
sequence. An expression vector for use in the present invention can
also contain such sequences as are needed for the eventual
integration of the vector into the chromosome. In addition, a gene
that codes for a selection marker which is functionally linked to
promoters that control transcription initiation may also be within
the expression vector, for example, an antibiotic resistance gene
to provide for the growth and selection of the expression vector in
the host.
[0184] The vectors of this invention may autonomously replicate in
the host cell, or may integrate into the host chromosome. Suitable
vectors with autonomously replicating sequences are well known for
a variety of bacteria, yeast, and various viral replications
sequences for both prokaryotes and eukaryotes. Vectors may
integrate into the host cell genome when they have a DNA sequence
that is homologous to a sequence found in host cell genomic
DNA.
[0185] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the present polypeptides may be transformed
using expression vectors containing viral origins of replication or
appropriate expression elements (e.g., promoters, enhancers,
transcription terminators, polyadenylation sites, etc.) and a
selectable marker gene on the same or on a separate vector.
Following the introduction of the vectors, cells may be allowed to
grow for 1-2 days in enriched media, and are then switched to
selective media. The selectable marker in the recombinant plasmid
confers resistance to selection, allowing growth and recovery of
cells that successfully express the introduced sequences. Resistant
clones of stably transformed cells may be proliferated using tissue
culture techniques appropriate to the cell type. This method may
advantageously be used to produce cell lines which express a
desired polypeptide.
[0186] Expression of the various sequences used in the methods of
the present invention driven by, for example, the galactose
promoters can be induced by growing the culture on a
non-repressing, non-inducing sugar so that very rapid induction
follows addition of galactose; by growing the culture in glucose
medium and then removing the glucose by centrifugation and washing
the cells before resuspension in galactose medium; and by growing
the cells in medium containing both glucose and galactose so that
the glucose is preferentially metabolized before
galactose-induction can occur.
[0187] Any number of selection systems may be used to recover
transformed cell lines. These include, but are not limited to, the
herpes simplex virus thymidine kinase and adenine
phosphoribosyl-transferase genes which can be employed in tk.sup.-
or aprt.sup.- cells, respectively. (See, e.g., Wigler, M. et al.
(1977) Cell 11:223-32; Lowy, I. et al. (1980) Cell 22:817-23.)
Also, antimetabolite, antibiotic, or herbicide resistance can be
used as the basis for selection. Therefore, the present invention
contemplates the use of such selectable markers, for example: dhfr,
which confers resistance to methotrexate; npt, which confers
resistance to the aminoglycosides neomycin and G418; and als or
pat, which confer resistance to chlorsulfuron and to
phosphinotricin acetyltransferase, respectively. (See, e.g.,
Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77:3567-3570; and
Colbere-Garapin, F. et al. (1981) J. Mol. Biol. 150:1-14.)
[0188] Additional selectable genes have been described, for
example, trpB, which allows cells to utilize indole in place of
tryptophan, or hisD, which allows cells to utilize histinol in
place of histidine. (See, e.g., Hartman, S. C. and R. C. Mulligan
(1988) Proc. Natl. Acad. Sci. 85:8047-51.) Recently, the use of
visible markers has gained popularity with such markers as
anthocyanins, .beta.-glucuronidase and its substrate GUS, and
luciferase and its substrate luciferin, now widely used not only to
identify transformants, but also to quantify the amount of
transient or stable protein expression attributable to a specific
vector system. (See, e.g., Rhodes, C. A. et al. (1995) Methods Mol.
Biol. 55:121-131.)
[0189] As noted above, the expression vectors for use in the
present methods of production can typically comprise a marker gene
that confers a selectable phenotype on cells. Usually, the
selectable marker gene will encode antibiotic resistance, with
suitable genes including at least one set of genes coding for
resistance to the antibiotic spectinomycin, the streptomycin
phophotransferase (SPT) gene coding for streptomycin resistance,
the neomycin phophotransferase (NPTH) gene encoding kanamycin or
geneticin resistance, the hygromycin resistance gene, genes coding
for resistance to herbicides which act to inhibit the action of
acetolactate synthase (ALS), in particular, the sulfonylurea-type
herbicides (e.g., the S4 and/or Hra mutations), genes coding for
resistance to herbicides which act to inhibit action of glutamine
synthase, such as phosphinothricin or basta (e.g. the bar gene), or
other similar genes known in the art. The bar gene encodes
resistance to the herbicide basta, the nptII gene encodes
resistance to the antibiotics kanamycin and geneticin, and the ALS
gene encodes resistance to the herbicide chlorsulfuron.
[0190] Other methods for determining which host cells, subsequent
to transformation, contain the polynucleotides of interest include
a variety of procedures known to those of skill in the art. These
procedures include, but are not limited to, nucleic acid
hybridizations, including DNA-DNA or DNA-RNA hybridizations, and
various protein bioassay or immunoassay techniques including
membrane-, solution-, or chip-based technologies for the detection
and/or quantification of polynucleotides or polypeptides.
[0191] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins. Appropriate cell lines or host systems can be chosen
to ensure the correct modification and processing of the foreign
protein expressed. To this end, eukaryotic host cells that possess
the cellular machinery for proper processing of the primary
transcript, including various modifications such as protein
folding, disulfide bond formation, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include, but are not limited to, CHO, VERO, BHK, HeLa,
COS, MDCK, 293, WI38, etc.
[0192] Specific initiation signals may also be used to achieve more
efficient translation of the polynucleotides of the present
invention. Such signals include the ATG initiation codon and
adjacent sequences. In cases where sequences encoding the present
polypeptides, along with any initiation or upstream sequences
required for translation, etc., are inserted into the appropriate
expression vector, no additional transcriptional or translational
control signals may be needed. However, in cases where only coding
sequences, or portions thereof, are inserted, exogenous
translational control signals including the ATG initiation codon
should be provided. Furthermore, the initiation codon should be in
the correct reading frame to ensure translation of the entire
insert. Exogenous translational elements and initiation codons may
be of various origins, both natural and synthetic. (See, e.g.,
Bittner et al. (1987) Meth. in Enzymol. 153:516-544.)
[0193] A host cell of the present invention can be infected,
transfected, or transformed with at least one polynucleotide
encoding a post-translational enzyme, in addition to at least one
polynucleotide encoding a gelatin of the present invention or a
polypeptide from which the gelatin can be derived. Such
polynucleotides include those encoding collagen post-translational
enzymes, such as prolyl 4-hydroxylase, collagen glycosyl
transferase, C-proteinase, N-proteinase, lysyl oxidase, or lysyl
hydroxylase, and can be inserted into cells that do not naturally
produce post-translational enzymes, for example, into yeast cells,
or cells that may not naturally produce sufficient amounts of
post-translational enzymes, for example, various insect and
mammalian cells, such that exogenous enzyme may be required to
produce certain post-translational effects. In one embodiment of
the present invention, the post-translational enzyme is prolyl
4-hydroxylase, and the polynucleotide encodes the .alpha. or the
.beta. subunit of prolyl hydroxylase. In a preferred embodiment,
polynucleotides encoding the .alpha. subunit and the .beta. subunit
of prolyl 4-hydroxylase are inserted into a cell to produce a
biologically active prolyl 4-hydroxylase enzyme, co-expressed with
a polynucleotide encoding a gelatin or a polypeptide from which
gelatin can be derived.
[0194] The polynucleotides encoding post-translational enzymes may
be derived from any source, whether natural, synthetic, or
recombinant. In a preferred embodiment, the post-translational
enzyme is derived from the same species as is the recombinant
gelatin to be produced. In one embodiment, the recombinant gelatin
to be produced is human recombinant gelatin, and the post
translational enzyme is human prolyl 4-hydroxylase.
[0195] The expressed gelatins or gelatin precursors of the present
invention are preferably secreted into culture media and can be
purified to homogeneity by methods known in the art, for example,
by chromatography. In one embodiment, the recombinant gelatin or
gelatin precursors are purified by size exclusion chromatography.
However, other purification techniques known in the art can also be
used, including, but not limited to, ion exchange chromatography,
hydrophobic interaction chromatography (HIC), and reverse-phase
chromatography. (See, e.g., Maniatis et al., supra; Ausubel et al.,
supra; and Scopes (1994) Protein Purification: Principles and
Practice, Springer-Verlag New York, Inc., NY.)
Prokaryotic
[0196] In prokaryotic systems, such as bacterial systems, any one
of a number of expression vectors may be selected, depending upon
the use intended for the polypeptides to be expressed. For example,
when large quantities of the recombinant gelatins of the present
invention, or polypeptides from which these recombinant gelatins
can be derived, are needed, vectors which direct high-level
expression of fusion proteins that can be readily purified may be
used. Such vectors include, but are not limited to, multifunctional
E. coli cloning and expression vectors such as BLUESCRIPT
(Stratagene), in which the encoding sequence may be ligated into
the vector in frame with sequences for the amino-terminal Met and
the subsequent seven residues of .beta.-galactosidase so that a
hybrid protein is produced; pIN vectors (Van Heeke, G. and S. M.
Schuster (1989) J. Biol. Chem. 264:5503-5509); and the like. pGEX
(Promega, Madison, Wis.) and pET (Invitrogen) vectors may also be
used to express foreign polypeptides as fusion proteins with
glutathione S-transferase (GST). In general, such fusion proteins
are soluble and can easily be purified from lysed cells by a
variety of methods known in the art, for example, by adsorption to
glutathione-agarose beads followed by elution in the presence of
free glutathione. Proteins made in such systems may be designed to
include heparin, thrombin, or factor XA protease cleavage sites so
that the cloned polypeptide of interest can be released from the
GST moiety.
Yeast
[0197] In preferred embodiments, the present invention provides
methods of producing recombinant gelatin using a yeast expression
system. In preferred embodiments, gelatin is produced directly from
altered collagen constructs or derived from processing of
collagenous polypeptides. A number of vectors containing
constitutive, non-constitutive, or inducible promoters may be used
in yeast systems. (See, e.g., Ausubel et al., supra, Chapter 13.)
In some aspects, vectors containing sequences which direct DNA
integration into the chromosome are used for expression in S.
cerevisiea.
[0198] In one embodiment, the recombinant gelatins of the
invention, or the polypeptides from which these gelatins can be
derived, are expressed using host cells from the yeast
Saccharomyces cerevisiae. Saccharomyces cerevisiae can be used with
any of a large number of expression vectors available in the art,
including a number of vectors containing constitutive or inducible
promoters such as a factor, AOX, GAL1-10, and PGH. (See, e.g.,
Ausubel et al., supra, and Grant et al. (1987) Methods Enzymol.
153:516-544.) Commonly employed expression vectors are shuttle
vectors containing the 2.mu. origin of replication for propagation
both in yeast and the ColE1 origin for E. coli, including a yeast
promoter and terminator for efficient transcription of the foreign
gene. Vectors incorporating 2.mu. plasmids include, but are not
limited to, pWYG4 and pYES2, which have the 2.mu. ORI-STB elements,
the GAL1-10, etc. In one method of the present invention, in which
a hydroxylated product is desired, involves the co-expression of a
collagen post-translational enzyme, for example, prolyl
4-hydroxylase. In one such method, using the pWYG4 vector, the NcoI
cloning site is used to insert the gene for either the .alpha. or
.beta. subunit of prolyl 4-hydroxylase, and to provide the ATG
start codon for either the .alpha. or .beta. subunit. In one
method, expression plasmids are used which direct integration into
the chromosome of the host.
[0199] The expression vector pWYG7L, which has intact 2.alpha. OR1,
STB, REP1 and REP2, the GAL7 promoter, and the FLP terminator, can
also be used. When the co-expression of a post-translational
enzyme, for example, prolyl 4-hydroxylase, is desired, the gene for
either the .alpha. or .beta. subunit of prolyl 4-hydroxylase is
inserted in the polylinker with its 5' ends at a BamHI or NcoI
site. The vector containing the prolyl 4-hydroxylase gene is
transformed into S. cerevisiae either before or after removal of
the cell wall to produce spheroplasts that take up DNA on treatment
with calcium and polyethylene glycol or by treatment of intact
cells with lithium ions. Alternatively, DNA can be introduced by
electroporation. Transformants can be selected by using host yeast
cells that are auxotrophic for leucine, tryptophane, uracil or
histidine together with selectable marker genes such as LEU2, TRP1,
URA3, HIS3 or LEU2-D.
[0200] In another preferred embodiment, the methods of producing
recombinant gelatin according to the present invention use host
cells from the yeast Pichia pastoris, or from other species of
non-Saccharomyces yeast, that possess advantages in producing high
yields of recombinant protein in scaled-up procedures. Pichia
expression systems include advantages of both prokaryotic (e.g., E.
coli) expression systems--high-level expression, easy scale-up, and
inexpensive growth--and eukaryotic expression systems--protein
processing, folding, and post-translational modifications. Such
expression systems can be constructed using various methods and
kits available to those skilled in the art, for example, the PICHIA
EXPRESSION kits available from Invitrogen Corporation (San Diego,
Calif.).
[0201] There are a number of methanol responsive genes in
methylotrophic yeasts such as Pichia pastoris, or Pichia
methanolica, etc., the expression of each being controlled by
methanol responsive regulatory regions (also referred to as
promoters). Any of such methanol responsive promoters are suitable
for use in the practice of the present invention. Examples of
specific regulatory regions include the promoter for the primary
alcohol oxidase gene from Pichia pastoris AOX1, the promoter for
the secondary alcohol oxidase gene from Pichia pastoris AOX2, the
FLD1 promoter, the promoter for the dihydroxyacetone synthase gene
from Pichia pastoris (DAS), the promoter for the P40 gene, etc.
Typically, expression in Pichia pastoris is obtained by the
promoter from the tightly regulated AOX1 gene. (See, e.g., Ellis et
al. (1985) Mol. Cell. Biol. 5:1111; and U.S. Pat. No. 4,855,231.)
Constitutive expression can also be achieved using, e.g., the GPH
promoter.
[0202] Another yeast expression system preferred for use in the
methods of the present invention makes use of the methylotrophic
yeast Hansenula polymorpha. This system can be used, for example,
in a method of production of the present invention where high yield
is desirable. Growth on methanol results in the induction of
enzymes key in, such as MOX (methanol oxidase), DAS
(dihydroxyacetone synthase), and FMHD (formate dehydrogenase).
These enzymes can constitute up to 30-40% of the total cell
protein. The genes encoding MOX, DAS, and FMDH production are
controlled by strong promoters induced by growth on methanol and
repressed by growth on glucose. Any or all three of these promoters
may be used to obtain high level expression of heterologous
sequences in H. polymorpha, according to methods known in the
art.
[0203] In one method of the present invention, the encoding
polynucleotides are cloned into an expression vector under the
control of an inducible H. polymorpha promoter. If secretion of the
product is desired, a polynucleotide encoding a signal sequence for
secretion in yeast, such as MF.alpha.1, is fused in frame with the
coding sequence for the polypeptides of the invention. The
expression vector preferably contains an auxotrophic marker gene,
such as URA3 or LEU2, or any other marker known in the art, which
may be used to complement the deficiency of an auxotrophic host.
Alternatively, dominant selectable markers such as zeocin or
blastacin may be used.
[0204] The expression vector is then used to transform H.
polymorpha host cells using techniques known to those of skill in
the art. An interesting and useful feature of H. polymorpha
transformation is the spontaneous integration of up to 100 copies
of the expression vector into the genome. In most cases, the
integrated sequences form multimers exhibiting a head-to-tail
arrangement. The integrated foreign DNA has been shown to be
mitotically stable in several recombinant strains, even under
non-selective conditions. This phenomenon of high copy integration
further adds to the productivity potential of the system.
Plant
[0205] The present invention also contemplates the production of
the recombinant gelatin of the present invention, or polypeptides
from which the recombinant gelatin can be derived, in plant
expression systems, including plant host cells and transgenic
plants. (See, e.g., Transgenic Plants: A Production System for
Industrial and Pharmaceutical Proteins, Owen and Pen, eds., John
Wiley & Sons, 1996; Transgenic Plants, Galun and Breiman, eds.,
Imperial College Press, 1997; and Applied Plant Biotechnology,
Chopra et al. eds., Science Publishers, Inc., 1999.) In cases where
plant expression vectors are used, the expression of sequences may
be driven by any of a number of promoters. For example, viral
promoters such as the 35S and 19S promoters of CaMV may be used
alone or in combination with the omega leader sequence from TMV.
(See, e.g., Brisson et al. (1984) Nature 310:511-514; and
Takamatsu, N. (1987) EMBO J. 6:307-311.) Plant expression vectors
and reporter genes are generally known in the art. (See, e.g.,
Gruber et al. (1993) in Methods of Plant Molecular Biology and
Biotechnology, CRC Press.)
[0206] Alternatively, plant promoters such as the small subunit of
RUBISCO or heat shock promoters e.g., soybean hsp17.5-E or
hsp17.3-B may be used. (See, e.g., Coruzzi, G. et al. (1984) EMBO
J. 3:1671-1680; Broglie, R. et al. (1984) Science 224:838-843;
Winter, J. et al. (1991) Results Probl. Cell Differ. 17:85-105; and
Gurley et al. (1986) Mol. Cell. Biol. 6:559-565.) These constructs
can be introduced into plant cells using Ti plasmids, Ri plasmids,
plant virus vectors, direct DNA transformation, microinjection,
electroporation, pathogen-mediated transfection, particle
bombardment, or any other means known in the art, such as are
described in a number of generally available reviews. (See, e.g.,
Hobbs, S. or Murry, L. E. in McGraw Hill Yearbook of Science and
Technology (1992) McGraw Hill, New York, N.Y., pp. 191-196;
Weissbach and Weissbach (1988) Methods for Plant Molecular Biology,
Academic Press, NY, Section VIII, pp. 421-463; and Grierson and
Corey, Plant Molecular Biology, 2d Ed., Blackie, London, Ch.
7-9.)
[0207] In various embodiments, the recombinant gelatin of the
present invention, or polypeptides from which the present
recombinant gelatin can be derived, is produced from seed by way of
available seed-based production techniques using, for example,
canola, corn, soybeans, rice, and barley seed. In such embodiments,
the protein is recovered during seed germination/molting. In other
embodiments, the protein is expressed directly into the endosperm
or into other parts of the plant so that the gelatin is
non-extracted, and the plant itself can serve as, for example, a
dietary supplement such as a source of protein.
[0208] Promoters that may be used to direct the expression of the
polynucleotides may be heterologous or non-heterologous. These
promoters can also be used to drive expression of antisense nucleic
acids to reduce, increase, or alter expression as desired. Other
modifications may be made to increase and/or maximize transcription
of sequences in a plant or plant cell are standard and known to
those in the art. For example, the polynucleotide sequences
operably linked to a promoter may further comprise at least one
factor that modifies the transcription rate of the encoded
polypeptides, such as, for example, peptide export signal sequence,
codon usage, introns, polyadenylation signals, and transcription
termination sites. Methods of modifying nucleic acid constructs to
increase expression levels in plants are generally known in the
art. (See, e.g. Rogers et al. (1985) J. Biol. Chem. 260:3731;
Cornejo et al. (1993) Plant Mol Biol 23:567-568.) In engineering a
plant system that affects the rate of transcription of the
polynucleotides, various factors known in the art, including
regulatory sequences such as positively or negatively acting
sequences, enhancers and silencers, chromatin structure, etc., can
be used.
[0209] Typical vectors useful for expression of foreign genes in
plants are well known in the art, including, but not limited to,
vectors derived from the tumor-inducing (Ti) plasmid of
Agrobacterium tumefaciens. These vectors are plant integrating
vectors, that upon transformation, integrate a portion of the DNA
into the genome of the host plant. (See, e.g., Rogers et al. (1987)
Meth. In Enzymol. 153:253-277; Schardl et al. (1987) Gene 61: 1-11;
and Berger et al. (1989) Proc. Natl. Acad. Sci. U.S.A.
86:8402-8406.)
[0210] Procedures for transforming plant cells are available in the
art, including, for example, direct gene transfer, in vitro
protoplast transformation, plant virus-mediated transformation,
liposome-mediated transformation, microinjection, electroporation,
Agrobacterium-mediated transformation, and ballistic particle
acceleration. (See, e.g., Paszkowski et al. (1984) EMBO J.
3:2717-2722; U.S. Pat. No. 4,684,611; European Application No. 0 67
553; U.S. Pat. No. 4,407,956; U.S. Pat. No. 4,536,475; Crossway et
al. (1986) Biotechniques 4:320-334; Riggs et al. (1986) Proc. Natl.
Acad. Sci. USA 83:5602-5606; Hinchee et al. (1988) Biotechnology
6:915-921; and U.S. Pat. No. 4,945,050.) Standard methods for the
transformation of rice, wheat, corn, sorghum, and barley are
described in the art. (See, e.g., Christou et al. (1992) Trends in
Biotechnology 10:239; Casas et al. (1993) Proc. Nat'l Acad. Sci.
USA 90:11212; Wan et al. (1994) Plant Physiol. 104:37; and Lee et
al. (1991) Proc. Nat'l Acad. Sci. USA 88: 6389.) Wheat can be
transformed by techniques similar to those employed for
transforming corn or rice. (See, e.g., Fromm et al. (1990)
Bio/Technology 8:833; and Gordon-Kamm et al., supra.)
[0211] Additional methods that may be used to generate plants or
plant cells that can express the present recombinant gelatins, or
polypeptides from which these recombinant gelatins can be derived,
are well-established in the art. (See, e.g., U.S. Pat. No.
5,959,091; U.S. Pat. No. 5,859,347; U.S. Pat. No. 5,763,241; U.S.
Pat. No. 5,659,122; U.S. Pat. No. 5,593,874; U.S. Pat. No.
5,495,071; U.S. Pat. No. 5,424,412; U.S. Pat. No. 5,362,865; and
U.S. Pat. No. 5,229,112.)
[0212] The present invention further provides a method of producing
polypeptides by providing a biomass from plants or plant cells
which are comprised of at least one polynucleotide sequence
encoding a recombinant gelatin, or a polypeptide from which
recombinant gelatin can be derived, wherein such polynucleotide
sequence is operably linked to a promoter to effect the expression
of the polypeptide. In a further embodiment, the method
additionally comprises co-expression of at least one polynucleotide
sequence encoding an enzyme that catalyzes a post-translational
modification, or subunit thereof, wherein such polynucleotide
sequence is operably linked to a promoter. In these methods, the
recombinant gelatins or collagenous polypeptides are extracted from
the biomass.
Fungi
[0213] Filamentous fungi may also be used to produce the
polypeptides of the instant invention. Vectors for expressing
and/or secreting recombinant proteins in filamentous fungi are well
known in the art, and one of skill in the art could, using methods
and products available in the art, use these vectors in the
presently recited methods. (See, e.g., U.S. Pat. No.
5,834,191.)
Insect
[0214] Insect cell systems allow for the polypeptides of the
present invention to be produced in large quantities. In one such
system, Autographa californica nuclear polyhedrosis virus (AcNPV)
is used as a vector to express foreign genes in, for example,
Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences
encoding the gelatins or gelatin precursors of the present
invention may be cloned into non-essential regions of the virus,
for example, the polyhedron gene, and placed under control of an
AcNPV promoter, for example, the polyhedron promoter. Successful
insertion of a coding sequence will result in inactivation of the
polyhedron gene and production of non-occluded recombinant virus
(i.e., virus lacking the proteinaceous coat encoded by the
polyhedron gene). These recombinant viruses are then used to infect
Spodoptera frugiperda cells or Trichoplusia larvae in which
polynucleotides encoding the gelatins or gelatin precursors are
expressed. (See, e.g., Engelhard, E. K. et al. (1994) Proc. Nat.
Acad. Sci. 91:3224-3227; Smith et al. (1983) J. Virol. 46:584; and
U.S. Pat. No. 4,215,051). Further examples of this expression
system may be found in, e.g. Ausubel et al. (1995), supra.
[0215] Recombinant production of the polypeptides of the present
invention can be achieved in insect cells, for example, by
infection of baculovirus vectors containing the appropriate
polynucleotide sequences, including those encoding any
post-translational enzymes that might be necessary. Baculoviruses
are very efficient expression vectors for the large-scale
production of various recombinant proteins in insect cells. Various
methods known in the art can be employed to construct expression
vectors containing a sequence encoding a gelatin or gelatin
precursor of the present invention and the appropriate
transcriptional/translational control signals. (See, e.g., Luckow
et al. (1989) Virology 170:31-39; and Gruenwald, S, and J. Heitz
(1993) Baculovirus Expression Vector System: Procedures &
Methods Manual, Pharmingen, San Diego, Calif.)
Animal
[0216] The present invention provides methods of expressing the
recombinant gelatins of the present invention, or polypeptides from
which the recombinant gelatins of the present invention can be
derived, in animal systems. Such systems include mammalian and
non-vertebrate host cells and transgenic animals. In mammalian host
cells, a number of expression systems may be utilized. In cases
where an adenovirus is used as an expression vector, sequences
encoding the polypeptides of the present invention may be ligated
into an adenovirus transcription/translation complex consisting of
the late promoter and tripartite leader sequence. This chimeric
gene may then be inserted in the adenovirus genome by in vitro or
in vivo recombination. Insertion into a non-essential E1 or E3
region of the viral genome may be used to obtain a viable virus
which is capable of expressing the polypeptides of the present
invention in infected host cells. (See, e.g., Logan, J. and Shenk,
T. (1984) Proc. Natl. Acad. Sci. 81:3655-3659.) Alternatively, the
vaccinia 7.5 K promoter may be used. (See, e.g., Mackett et al.
(1982) Proc. Natl. Acad. Sci. USA 79:7415-7419 (1982); Mackett et
al. (1984), J. Virol. 49:857-864; and Panicali et al., (1982) Proc.
Natl. Acad. Sci. USA 79:4927-4931.) In addition, various
transcription enhancers known in the art, such as the Rous sarcoma
virus (RSV) enhancer, may be used to increase expression in, for
example, mammalian host cells.
[0217] Semliki Forest virus is a preferred expression system as the
virus has a broad host range such that infection of mammalian cell
lines will be possible. Infection of mammalian host cells, for
example, baby hamster kidney (BHK) cells and Chinese hamster ovary
(CHO) cells, using such a viral vector can yield very high
recombinant expression levels. More specifically, it is
contemplated that Semliki Forest virus can be used in a wide range
of hosts, as the system is not based on chromosomal integration,
and therefore will be a quick way of obtaining modifications of the
recombinant gelatins in studies aimed at identifying
structure-function relationships and testing the effects of various
hybrid molecules. Methods for constructing Semliki Forest virus
vectors for expression of exogenous proteins in mammalian host
cells are known in the art and are described in, for example,
Olkkonen et al. (1994) Methods Cell Biol 43:43-53.
[0218] Additionally, CHO cells deficient in dihydrofolate reductase
(dhfr) can be transfected with an expression plasmid containing a
dhfr gene and the desired polynucleotide. Selection of CHO cells
resistant to increasing concentrations of methotrexate will undergo
gene amplification, providing higher expression levels of the
desired recombinant protein, as known in the art.
[0219] Transgenic animal systems may also be used to express the
recombinant gelatins of the present invention or the polypeptides
from which these recombinant gelatins can be derived. Such systems
can be constructed, for example, in mammals by operably linking an
encoding polypeptide to a promoter and other required or optional
regulatory sequences capable of effecting expression in mammary
glands. Likewise, required or optional post-translational enzymes
that effect post-translational modifications, may be produced
simultaneously in the target cells employing suitable expression
systems. Methods of using transgenic animals to recombinantly
produce proteins are known in the art. (See, e.g., U.S. Pat. No.
4,736,866; U.S. Pat. No. 5,824,838; U.S. Pat. No. 5,487,992; and
U.S. Pat. No. 5,614,396; and co-pending U.S. application Ser. No.
08/987,292.)
Uses of Gelatin
[0220] Gelatin appears in the manufacture or as a component of
various pharmaceutical and medical products and devices. It is
estimated that about 85% of pharmaceutical products contain
bovine-derived materials in some form, including the bovine gelatin
currently used in various products, for example, pharmaceutical
stabilizers, plasma extenders, sponges, hard and soft gelatin
capsules, suppositories, etc. Gelatin's film-forming capabilities
are employed in various film coating systems designed specifically
for pharmaceutical oral solid dosage forms, including controlled
release capsules and tablets, and other numerous pharmaceutical
products in which gelatin serves as a coating intended to improve
ease of administration and delivery, etc. Gelatin appears as a
stabilizer in various forms, for example, in the pharmaceutical
industry, e.g., in drugs and vaccines, in food and beverage
products and processes, in industrial applications, e.g., concrete
stabilization, and as a stabilizer in various laboratory solutions,
e.g., various cell preparations.
[0221] Gelatin in various edible forms has long been used in the
food and beverage industries. Gelatin is used widely in various
confectionery and dessert products, particularly in puddings,
frostings, cream fillings, and dairy and frozen products. Gelatin
serves as an emulsifier and thickener in various whipped toppings,
as well as in soups and sauces. Gelatin is used as a flocculating
agent in clarifying and fining various beverages, including wines
and fruit juices. Gelatin is used in various low and reduced fat
products, such as mayonnaise and salad dressings, as a thickener
and stabilizer, and appears elsewhere as a fat substitute. Gelatin
is also widely used in microencapsulation of flavorings, colors,
and vitamins. Gelatin can also be used as a protein supplement in
various high energy and nutritional beverages and foods, such as
those prevalent in the weight-loss and athletic industries. As a
film-former, gelatin is used in coating fruits, meats, deli items,
and in various confectionery products, including candies and gum,
etc.
[0222] In the cosmetics industry, gelatin appears in a variety of
hair care and skin care products. Gelatin is used as a thickener
and bodying agent in a number of shampoos, mousses, creams,
lotions, face masks, lipsticks, manicuring solutions and products,
and other cosmetic devices and applications. Gelatin is also used
in the cosmetics industry in microencapsulation and packaging of
various products.
[0223] Gelatin is used in a wide range of industrial applications.
For example, gelatin is widely used as a glue and adhesive in
various manufacturing processes. Gelatin can be used in various
adhesive and gluing formulations, such as in the manufacture of
remoistenable gummed paper packaging tapes, wood gluing, paper
bonding of various grades of box boards and papers, and in various
applications which provide adhesive surfaces which can be
reactivated by remoistening.
[0224] Gelatin serves as a light-sensitive coating in various
electronic devices and is used as a photoresist base in various
photolithographic processes, for example, in color television and
video camera manufacturing. In semiconductor manufacturing, gelatin
is used in constructing lead frames and in the coating of various
semiconductor elements. Gelatin is used in various printing
processes and in the manufacturing of special quality papers, such
as that used in bond and stock certificates, etc.
[0225] Use of gelatin in photographic applications is
long-established. Gelatin is used as a carrier for various active
components in photographic solutions, including solutions used in
X-ray and photographic film development. Gelatin, long used in
various photoengraving techniques, is also included as a component
of various types of film, and is heavily used in silver halide
chemistry in various layers of film and paper products. Silver
gelatin film appears in the form of microfiche film and in other
forms of information storage. Gelatin is used as a self-sealing
element of various films, etc.
[0226] Gelatin has also been a valuable substance for use in
various laboratory applications. For example, gelatin can be used
in various cell culture applications, providing a suitable surface
for cell attachment and growth, e.g., as a coating for plates,
flasks, microbeads, or other substrates, or providing a suitable
protein source in growth media. Hydrolyzed or low gel strength
gelatin is used as a biological buffer in various processes, for
example, in coating and blocking solutions used in assays such as
enzyme-linked immunosorbent assays (ELISAs) and other immunoassays.
Gelatin is also a component in various gels used for biochemical
and electrophoretic analysis, including enzymography gels.
Pharmaceutical
[0227] The present invention also contemplates the use of
recombinant gelatin in various pharmaceutical and medical
applications. In particular, in one embodiment, the present
invention provides for a pharmaceutical composition comprising
recombinant gelatin. In a preferred embodiment, the recombinant
gelatin is derived from human sources. The present recombinant
gelatins offer an advantage previously unavailable in the art: that
of using gelatins derived from native human collagen sequence, thus
reducing the risk of immunogenecity to the gelatin material. In
addition, as the present gelatins are produced recombinantly in a
controlled environment, risks of infectivity, from agents such as
TSEs or from pathogens and endotoxins introduced during processing,
are minimized.
[0228] Endotoxin levels of commercial materials typically range
from about 1.0 to 1.5 EU/mg of gelatin. (See, e.g., Schagger, H.
and G. von Jagow (1987) Anal. Biochem. 166:368-379; Friberger, P.
et al. (1987) Prog. Clin. Biol. Res. 231:149-169.) In the methods
of the present invention, the endotoxin levels can be reduced by
two to three orders of magnitude. (See Example 8.) The present
invention thus provides, in one embodiment, a recombinant gelatin
derived from human sources that is virtually endotoxin-free.
[0229] In addition to providing a gelatin material without the
immunogenecity and infectivity issues associated with
animal-derived materials, the present invention allows for a
reproducible source of consistent product. Specifically, the
present gelatins can be presented as a homogeneous mixture of
identical molecules. The physical characteristics desired in a
particular medical application can be specifically introduced and
achieved consistently. The present invention is thus able to
provide a reliable and consistent product will minimize variability
associated with the availability and use of current gelatin
products.
[0230] In specific embodiments, the recombinant gelatin of the
present invention can be used in the manufacture of capsules,
including hard shell or hard capsules, typically produced from
gelatin solutions, and soft shell or soft capsules, typically made
from gelatin films. In specific embodiments of the present
invention, a hard gel capsule comprising recombinant gelatin and a
soft gel capsule comprising recombinant gelatin are provided, as
are methods for manufacturing these capsules. The
thermoreversibility of gelatin is a property exploited in a number
of applications, for example, in the manufacture of such gel
capsules and tablets. Gelatin can be heated, molded, or shaped as
appropriate, and can be used to form a capsule or tablet coating
that has unique properties at homeostatic temperatures. A selected
gelatin can begin to melt at mouth temperature, easing swallowing,
and become liquid at internal body temperature, such as within the
stomach. In one embodiment, the present invention provides
recombinant gelatins with the dissolution rates of commercially
available capsules and coatings. In another embodiment, the present
invention provides recombinant gelatins with improved resiliency,
appropriate for use in capsules and tabletting.
[0231] In certain applications, such as the manufacture of gel
capsules, the brittleness and hardness developed by gelatin over
time is an important parameter that can limit the shelf-life and
usefulness of currently available animal-source gelatins. The
ability to maintain viscosity over time would be a valuable asset,
especially for manufacturers of gelatin-containing products, who
currently buy gelatin in sizable lots in order to maintain
consistency of manufactured products. Furthermore, some
manufacturing processes, such as the manufacture of hard gel
capsules, currently require a blend of gelatin types, e.g., of type
A and type B gelatins, in order to produce a material with the
desired properties, as the use of type B gelatin alone results, for
example, in a hard gel capsule that is too brittle for manufacture
and use.
[0232] The recombinant gelatins of the present invention are of
greater purity and are better characterized than currently
available materials. Thus, the present gelatins can provide a
stable material, and one more reproducible and predictable in its
behavior. Furthermore, using the methods of the present invention,
one could engineer a recombinant gelatin that possessed the
structural features of both types of gelatin in a single molecule
or in a well-characterized mixture of molecules.
[0233] The recombinant gelatin of the present invention can also be
used as a stabilizer in various pharmaceutical products, for
example, in drugs or vaccines. (See, e.g., co-pending,
commonly-owned U.S. patent application Ser. No. 09/710,249,
entitled "Recombinant Gelatins in Vaccines," filed 10 Nov. 2000,
incorporated herein by reference in its entirety.) Therefore, in
one embodiment, the present invention provides a stabilizing agent
comprising recombinant gelatin, wherein the stabilizer is suitable
for use in pharmaceutical applications. In a preferred embodiment,
the recombinant gelatin is recombinant human gelatin.
[0234] Different regions of various collagens are associated with
various activities, for example, various regions of type III
collagen have been associated with active sites involved in the
clotting cascade. Therefore, in one embodiment, the present
invention contemplates the use of polynucleotides encoding
recombinant gelatins that contain specific active regions of a
particular collagen or of particular collagens. Such
polynucleotides can be used in a variety of ways, for example, in
microarrays. Such polynucleotides could thus be used as a
diagnostic tool to identify altered links of mRNA polynucleotides
corresponding to collagenous domains of interest in a sample. The
encoded polypeptides could be used in various methods of screening
for drugs or compounds that could inhibit or enhance the activity
and/or expression associated with particular collagenous
domains.
[0235] The present gelatin can also be used in encapsulation,
including microencapsulation, and in tabletting, suppositories, and
various medical emulsions. The present invention also contemplates
the use of the recombinant gelatin provided herein in medical
sponges, e.g., hemostatic sponges, etc., in wound treatment and in
various surgical applications, e.g., as sponges used to prevent
leakage after port removal in fetoscopy and other procedures.
Therefore, in one aspect, the present invention comprises a sponge
comprising recombinant gelatin, wherein the sponge is suitable for
use in medical procedures. In a preferred embodiment, the
recombinant gelatin is recombinant human gelatin.
[0236] The recombinant gelatins of the present invention can be
designed to possess specific physical properties suitable for use
in particular applications. The present invention provides methods
for varying characteristics such as molecular weight, gel strength,
and pH of the final gelatin formulation to produce gelatins with
specific properties as desired, and to thus meet customer's
specifications to a degree unattainable with currently available
materials. Moreover, such formulations allow the customer to
explore refinements of existing processes and formulations, as well
as to develop new applications, for the present recombinant
gelatins.
[0237] The molecular weight distributions of commercially available
animal-derived soluble gelatins, such as those used in formulation
of vaccines, range from about 0 to 30 kD and from about 0 to 60 kD.
(See Examples 7 and 9.) The present invention provides for a method
of producing recombinant human gelatins, under suitable hydrolysis
conditions, that results in recombinant human gelatins with
molecular weight distributions which correspond with the
commercially available gelatins, and can be used for the same
purposes. Additionally, the present invention provides methods for
producing gelatins with a narrower molecular weight distribution,
for example, about 10 to 30 kDa, or about 30 to 50 kDa, not
available from commercial materials.
[0238] The recombinant gelatin of the present invention, and
compositions thereof, can also be used in various surgical
procedures, including in biodegradable conduits for directing and
supporting nerve regeneration, in colloidal volume replacement in
major surgeries, in gelatin sponge plugs used to seal various port
sites, such as catheterization sites and other incisions or wounds,
and in polyester grafts as an infection-resistant sealant. (See,
e.g., Mligilche, N. L. et al. (1999) East Afr. Med. J.
76(7):400-406; Beyer et al. (1997) Br. J. Anaesth. 78(1):4-50; Luks
et al. (1999) Am. J. Obstet. Gynecol. 181(4):995-996; and Farooq et
al. (1999) J. Surg. Res. 87(1):57-61.)
[0239] The present pharmaceutical compositions can be administered
to a subject for treatment of various joint conditions, including
arthritis, athrosis, and other conditions related to the
degeneration of cartilage and joint flexibility. In a preferred
embodiment, the recombinant gelatin contains a modified amino acid
sequence which possesses higher concentrations of arginine,
hydroxyproline, and hydroxylysine, and other amino acids related to
the production of collagens and proteoglycans in cartilage. (See,
e.g., Oesser et al. (1999) J. Nutr. 129(10):1891-1895.)
Microspheres synthesized with the gelatins of the present invention
are also contemplated. Such microencapsulated particles can be
used, for example, in directed delivery of therapeutic proteins or
small molecules, providing a noninflammatory and biocompatible
delivery system. (See, e.g., Brown et al., (1998) Arthritis Rheum,
41:2185-2195.). In another aspect, the present invention
contemplates oral administration of the recombinant gelatins of the
present invention to alleviate disease activity in rheumatoid
arthritis. (Arborelius et al. (1999) Rheumatol Int 18:129-135.) In
ingested pharmaceutical products, it might be desirable to provide
recombinant gelatin having stability against degradation in the
acidic environment of the stomach, gut, etc.
[0240] Techniques for encapsulation, and various formulations and
drug delivery systems, are available in the art and are described
in numerous sources. (See, e.g., Gennaro, A. R., ed. (1990)
Remington's Pharmaceutical Sciences, 18.sup.th ed., Mack Publishing
Co., Easton Pa.) The most effective and convenient route of
administration and the most appropriate formulation for a
particular situation can be readily determined by methods known in
the art.
[0241] Suitable routes of administration may, for example, include
oral, rectal, transmucosal, or intestinal administration and
parenteral delivery, including intramuscular, subcutaneous,
intramedullary injections, as well as intrathecal, direct
intraventricular, intravenous, intraperitoneal, intranasal, or
intraocular injections. Vaccines, for example, can be delivered
intravenous, nasal, or oral, and can take the form of live
attenuated, subunit, monovalent, divalent, trivalent vaccines, etc.
Formulations for enteric release, etc., are also contemplated. The
composition may be administered in a local rather than a systemic
manner. The present invention also provides a pharmaceutical
composition comprising recombinant gelatin wherein the composition
is suitable for delivery as a spray, for lingual or nasal
delivery.
Food
[0242] In the food industry, gelatin's physical properties and pure
protein composition make it suitable for use in a variety of ways,
including as a component of various edible products and nutritional
supplements. Gelatin can be a food product in its own right,
providing a carbohydrate-free, pure protein source. In addition,
gelatin's physical and structural characteristics are useful in
various food preparation and packaging applications. For example,
gelatin is used as a gelling and thickening agent; as an emulsifier
and foaming agent; to prevent curdling or protein-liquid
separation; for "feel," or to improve consistency and texture; to
retain moisture; and in adhesion and packaging, for example, as an
edible film.
[0243] Edible gelatin can serve as a particularly valuable source
of pure protein. Therefore, in one aspect, the present invention
provides a protein supplement comprising recombinant gelatin. The
gelatin of the present invention can be produced with, for example,
specific and desired amounts of essential amino acids. The present
invention provides for the production of various edible gelatins,
whether in gel, leaf, or powder form, with characteristics optimal
for a particular application or end product.
[0244] The present invention provides for recombinant gelatin
products comprising different ratios of amino acid residues.
Typically, gelatin contains most of the amino acids essential for
humans, including for example, lysine, arginine, leucine, and
isoleucine. In one embodiment, the present invention provides
recombinant gelatin comprising the specific ratios of amino acids
desired. For example, gelatin used in foods intended to supplement
an athlete's diet might comprise higher levels of residues such as
lysine, which is beneficial to muscle growth, and arginine, which,
as a precursor to creatine, is involved in the energy metabolism of
muscle cells. Gelatin can serve to enhance the nutritional value of
foods in general by completing and increasing the amino acid
composition of other protein sources, for example, meats and dairy
products.
[0245] Gelatin has minimal or bland taste, and can thus serve as a
palatable and nutritional food supplement. Hydrolyzed gelatin, for
example, is used as a substitute for more concentrated solutions of
carbohydrates in desserts and candies and in other caloric foods,
reducing the caloric content. Gelatin can also serve as a source of
protein in foods with high nutritional value, for example,
low-calorie foods produced in the diet industry or high-energy
foods. In addition to serving as a protein source, gelatin can
serve as a carbohydrate-free carrier or filler substance in, for
example, spray or dried instant food products and flavorings, or as
a clarifying and fining agent in, for example, wines and
juices.
[0246] The ability of gelatin to impart desirable characteristics,
including, for example, texture, color, and clarity, is highly
valued. The texture of such products depends to a large degree on
the types of ingredients used, formulation variables, and how the
products are processed and handled. In confectionery applications,
for example, gelatin appears in a variety of gelled products, such
as pastilles and popular gummy products. Gelatin is used as a
gelling agent, providing textures ranging from soft and elastic to
short and hard. The texture and mouth-feel of the finished product
is dependent on the bloom strength, concentration, and formulation
of gelatin used. In addition, gelatin's colloidal properties
provide a substrate for colors and dyes, allowing the desired
opacity or clarity, as well as color, of the end product.
Therefore, in one aspect, the present invention allows for the use
of a gelatin that provides the desired textural properties,
brilliance, and clarity, in the manufacture of gelled confectionery
products. In another aspect, an appropriate gelatin is selected
which has a relatively low viscosity, as high viscosity can produce
undesirable `tailing` of the depositing syrup during manufacture,
causing defective products. Generally speaking, the higher the
bloom value of the gelatin, the harder the product becomes, so that
by increasing the gelatin content, the product becomes harder and
chewier in texture.
[0247] A property of gelatin widely exploited in, for example, the
production of aerated confectionary products, is its ability to
produce and support a foam, and to promote rapid setting at the
air/liquid interface by forming a film around entrapped air
bubbles. Aerated products constitute a large family of
confectionery products, including marshmallows, frostings, nougats,
and cookie and wafer fillings. The degree of aeration and setting
time required for a particular product depends on the type and
grade of gelatin used, together with the concentration of gelatin
in the final product. Altering the type and proportion of gelatin
used can vary the texture of aerated products. For example,
gelatins with high bloom values, or gel strength, produce a shorter
chew, whereas gelatins with lower bloom values provide a more
elastic texture.
[0248] Gelatin serves a number of functions in the manufacture of
fruit chews, and other sugar-pulled confectionery product types,
such as toffees and caramels, which contain fats and are slightly
aerated. For example, gelatin assists in the emulsification of
fats, improving dispersion and stability; provides desirable
texture and chewiness, as well as foaming ability; and contributes
to the shelf-life of the final product, such as by controlling
sucrose crystallization. Gelatins with a Bloom of about 150 to 200
to are typically used in these products at usage levels of 0.5-1.5%
w/w. Therefore, in one aspect, the present invention contemplates a
recombinant gelatin with a Bloom of about 150 to 200 for use in
edible products.
[0249] Gelatin provides cohesive texture in cream pastes, which
contain both solid and liquid phases consisting of powdered sugar
and fats dispersed in a sugar syrup. Gelatin acts as a binder to
prevent a crumbly texture and to inhibit cracking. Gelatin's
binding properties are also utilized in lozenges and compressed
tablets. In products such as licorice, gelatin, often combined with
an agent such as wheat flour, acts as a binder, greatly improving
moisture retention, and preventing cracking and crumbling during
manufacture. Gelatin also helps prevent confectionary products,
such as, for example, licorice, from drying out in storage,
improving product shelf life. The present invention thus provides,
in one embodiment, a binding agent comprising recombinant gelatin,
which binding agent can be a component of edible products. The
present invention further provides a moisturizing agent comprising
recombinant gelatin, which moisturizing agent is suitable for use
in edible products.
[0250] Gelled products are available in various forms, including
ready-to-eat products, dry blended powdered mixtures, or tablets in
which the sugars, gelatin, acids, flavoring, and coloring have been
dissolved and gelled. Gelatin's ability to form elastic-textured
thermo-reversible gels with melting points around 25-35.degree. C.
is exploited in such uses. The final texture, rigidity, and setting
rate of these gelling products are controlled by the concentration
and physical properties of the gelatin, most particularly, bloom
strength and viscosity levels. In the production of gelatin
desserts, the use of a lower concentration of a higher-grade
gelatin to produce a gelled product of a particular rigidity would
provide advantages, including economic advantage, as well as
improved clarity and color development, compared to the use of a
higher concentration of a lower strength gelatin. Therefore, in one
embodiment, the present invention provides a gelling agent
comprising recombinant gelatin, wherein the gelling agent is
suitable for use in an edible product.
[0251] Gelatin is often used in the manufacture of various dairy
products, such as ice cream, yoghurt, and puddings, in which a
particular texture and mouth feel is desired; in particular,
gelatin provides a smooth, even-textured consistency and creamy
mouth feel. Gelatin is used in combination with other hydrocolloids
as a thickener and stabilizer in low fat mayonnaise and salad
dressings.
[0252] With the expansive growth in the number and desirability of
low- and no-fat dairy products, gelatin can make an outstanding
contribution to the product texture, body, and mouth feel of a
finished product. With its fat-like melting characteristics, a
gelatin having a melting point of around 25-35.degree. C. provides
the desirable sensory properties, or `melt-in-the-mouth`
characteristics, thus simulating the texture of the full-fat
product.
[0253] In a health-conscious society, gelatin is well-suited for
use as a stabilizer in low or reduced fat and non-fat yoghurt
products, adding to the body and mouth-feel, and creating a smooth,
delicate, and creamy texture in the absence of fat. Additionally,
gelatin stabilizes these products by preventing syneresis, or the
separation of whey proteins. In this regard, gelatin products
function to form a gel network which binds water, preventing
exudation and separation of the whey proteins, thus helping product
shelf-life. Gelatin is also used in the manufacture of thickened
creams, in which the gelling and emulsifying properties of gelatin
are used to increase cream viscosity. Gelatin also has widespread
use in sour cream, soft cheese products, and acidic milk desserts,
such as cheesecakes, and in flavored milk-based desserts, such as
mousses, chiffons and souffles. The cream viscosity can be varied
as desired by altering the concentration and gelling properties of
the gelatin used. Typical gelatin levels for such uses range from
0.2-0.8% w/w, although higher or lower gel strengths could be
desired in various products. The present invention provides a
stabilizing agent comprising recombinant gelatin.
[0254] There is increasing demand in the food and health industries
for reduced fat or fat-free products. Gelatin's dietetic
properties, including its ability to provide protein in the absence
of fat, make it useful in the weight-loss industry, as well as in
products designed for patients, convalescents, and individuals with
special dietary sensitivities or needs. Gelatin's protein content
adds carbohydrate-free nutritional value. In addition to its
nutritional value, gelatin is highly digestible and can thus be
administered in liquid foods that are easily absorbed. Pure gelatin
contains no fats, sugars, purines, or cholesterols. Gelatin's
physical properties, protein content, and lack of strong taste make
it a preferable fat substitute in many products. Gelatin is widely
used as an emulsion stabilizer in, for example, products such as
low-fat butters and margarines. As a thickening and binding agent,
gelatin can replace in whole or in part the fat content in various
food products. For example, gelatin can replace highly caloric
binders such as cream, butter, and other dairy fats; egg yolks; and
other starchy products. In addition, gelatin's moisture retaining
qualities are helpful in binding large amounts of water, allowing
for greater post-prandial satisfaction and fullness.
[0255] The sensory or mouth feel of gelatin is critical, as many
fat-free or reduced fat products seek to mimic as closely as
possible the mouth feel, as well as the taste, of fats. By using
gelatin in a low-fat formulation, it is possible to achieve a
texture comparable to a full-fat product, thereby achieving a lower
calorie content while preserving a preferred texture and
mouth-feel. The amount of gelatin used is dependent on the
percentage of fat, if any, contained in the finished product. For
instance, at a fat content of 60%, 0.5% w/w gelatin is used, while
at lower fat levels of 25%, approximately 3.5% w/w gelatin is used
to maintain product integrity and sensory appeal. Gelatin produced
according to the present invention can possess a melting-point
similar to that of the food products in which it is included or,
preferably, the body or mouth temperature of humans, resulting in
melting of gelatin at eating temperatures and a correspondingly
rich mouth-feel. In addition, gelatin's bland taste will not
interfere with the flavorings of a particular food product.
Finally, gelatin is highly digestible.
[0256] Using gelatin as a fat substitute thus allows for a
reduction in calories without a corresponding reduction in texture
and richness, and without corresponding negative effects on taste
and digestibility. The present invention, in one aspect, provides a
fat substitute comprising recombinant gelatin, wherein the fat
substitute is intended for use in edible products. In a preferred
embodiment, the recombinant gelatin has a melting point of from
about 25 to about 35.degree. C.
[0257] Gelatin improves the appearance and slicing characteristics
of various canned and preserved foods, including meats such as
cooked ham, by penetrating and filling any cavities in the tissue.
In canned meat products, gelatin serves to absorb the juices that
are released during the retorting process, improving the slicing
properties and giving a pleasing appearance to the product. In
these instances, a gelatin should be selected that has a low
calcium content as precipitation of calcium phosphate from the
phosphates in the meat juices can occur. In canning applications,
such as canned seafood, a gelatin with a high gel strength is used
to withstand the thermal treatment applied during the sterilization
process. Depending on the extent of sterilization and the get
strength selected, gelatin levels usually range from 0.5-5.0% w/w.
Gelatin also serves as a binder and a gelling agent in canned
seafoods and meats and in a variety of jelled (aspic) products.
[0258] Gelatin finds application for sausage coatings, where it is
used as an adhesive agent in binding spices to the surface of
products such as salamis. The sausage is dip-coated in a
concentration solution of gelatin that typically has a high bloom
and high viscosity giving the gelatin time to set and inhibiting
run-off from the product surface. Such coatings are also used, for
example, in the manufacture of soybean and other substitute meat
products, and in the coating of various fruits, meats, and
delicatessen items. In one aspect, the present invention provides
an edible coating comprising recombinant gelatin.
[0259] Gelatin is also used in microencapsulation of various
flavors, colors, and other additives, and of vitamins.
[0260] Specifically contemplated are various recombinant gelatins
that can be used as stabilizing agents, thickening agents,
film-forming agents, binding agents, edible coatings, gelling
agents, protein supplements, emulsifying agents, microencapsulants
for colors, flavors, and vitamins, etc., and can be used in various
food supplements, including nutritional and diet supplements, and
fat substitutes. In one embodiment, the gelatin of the present
invention is used in the processing or packaging of, or as a
component in, foods prepared for consumers with Kosher, Halal,
vegetarian, or other diets that restrict the ingestion of food
containing specific animal-source products.
[0261] In addition to being used in edible products intended for
human consumption, gelatins are used as binding agents in the
manufacture of bars and pellets in pet foods, snacks, and
chewables. In addition to the structural advantages gelatin offers
in these products, gelatin's high protein content can contribute
positive effects such alleviating symptoms of degenerative diseases
of the animal skeletal system, as well as improving pelt growth and
texture.
Photographic
[0262] In another aspect, the present invention comprises a
photographic composition comprising recombinant gelatin.
Preferably, the recombinant gelatin is partially hydroxylated.
Gelatin is a key component of various photographic processes and
products, including, for example, films and paper. Gelatin is used
as a binder in light-sensitive products, where its gel-setting and
film-forming properties make for clear, uniform, and durable
coatings which can involve multiple coatings in a single
application. Gelatin as a binding agent creates and provides the
uniform consistency, solidification, or cohesion desired. Gelatin
also stabilizes coupler and dye emulsions in color photographic
products.
[0263] Gelatin is indispensable in photographic coatings including
silver halide emulsion layers, top coat or surface layers,
inter-layers, and back-coats. The chemical and colloidal properties
of gelatin enable precise precipitation and chemical ripening of
photographic silver halide emulsions. Some emulsifying fluids use
non-gelling fish gelatins, which may remain liquid in solutions at
concentrations as high as 40%, and at temperatures as low as
20.degree. C.
[0264] In one embodiment, the recombinant gelatin has a low
molecular weight and a low setting temperature. In another
embodiment, the recombinant gelatin has a low setting point, but a
higher molecular weight than available in current non-gelling
piscine-derived gelatins or in animal-derived gelatin
hydrolysates.
[0265] The recombinant gelatin of the present invention can be used
in various photographic applications, for example, for the support
of silver halides on both film and paper. In one embodiment, the
recombinant gelatin has a setting temperature of between 15.degree.
and 25.degree. C. The recombinant gelatin can be spray-dried and
offered as a low density, cold water soluble powder or film, and is
thus advantageous for use in various technical applications, for
example, photoresist systems. The present gelatin can also be used
in gelatin filters. The present invention contemplates photographic
gelatin products custom-designed to meet the exacting properties of
each particular need, as well as methods for making such
gelatins.
Other
[0266] The recombinant gelatins of the present invention offer
various technical advantages over commercially available gelatin
due to its more particular and integrated chemical make-up, and the
corresponding consistency in its physical properties. The
recombinant gelatin of the present invention can thus be used in
technical applications which currently involve extracted gelatin.
For example, the present gelatin can be used in a variety of
industrial processes, including, but not limited to, paper sizing
and photogravure, collotype, screen printing processes,
microencapsulated dyes, copy transfer papers and other papers and
boards coated with gelatin through the formation of a coacervate
complex with gum arabic. Gelatins of the present invention can also
be used in electroplating to ensure smooth deposition and as a
protective colloid in some polymerization reactions, and as a
coating or film-forming agent in semiconductor manufacture.
[0267] In another embodiment, the present gelatin is used as a
binder for special quality papers, including stock certificates,
bank notes, etc. The present gelatin further serves as a bonding
agent for use in match paste, providing a lower density and more
even combustion for matches, as well as fastening of abrasive
particles on a canvas or paper backing to produce abrasive
papers.
[0268] The distinctive properties of gelatin, including its ability
to serve as a protective colloid, and to alter its electrical
charge with changes in pH, combine to make gelatin a material
suitable for use in microencapsulation. Gelatin and its derivatives
can thus be used in a variety of microencapsulation devices and
techniques, for example, in the microencapsulation of inks for
carbon-free paper; fragrances for advertising and sample
manufacture; chemicals used in multi-component adhesives; and
vitamins and nutritional supplements. The microencapsulation
capabilities of gelatin and its derivatives are also useful in the
manufacture of packaging materials, including packaging allowing
minimal permeability for oxygen, aromas, and water vapor. Gelatin
is thus widely used in flexible packaging, such as packaging for
food, pharmaceuticals, and other sensitive products.
[0269] The adhesive effect and reduction of surface tension
provided by gelatins render them useful in leaf fertilizers. Due to
the stability and slow degradation of the amino acids of gelatin,
the precisely adjusted nitrogen concentration provided by the
fertilizer is thus maintained and made available of a longer period
of time. Gelatins are also useful as a biologically degradable
binding agent in the manufacture of fertilizer pellets.
[0270] Due to its amino acid composition, gelatins can serve as
complex sources of nitrogen, useful, for example, in the synthesis
of penicillin by Penicillium chrysogenum, as well as, for example,
in the manufacture of various starter cultures and antibiotics.
(See, e.g., Leonhartsberger, et al. (1993) J Biotechnol
30:299-313.)
[0271] The recombinant gelatins of the present invention can be
used in various laboratory applications, in which the
reproducibility and uniformity of the recombinant gelatins of the
present invention will be greatly valued, minimizing unwanted
variability in laboratory processes and compositions. For example,
the present recombinant gelatins can be used in various tissue
culture applications, providing a suitable protein source in growth
media, and, in some applications, providing a cell growth matrix or
scaffolding, or other surface for cell attachment and growth. The
present invention also provides a cell preservation formulation
comprising recombinant gelatin. Such formulation could, for
example, be used to preserve a preparation of platelet cells,
protecting the solution until administration and use. The present
invention contemplates biological buffers comprising hydrolyzed or
low gel strength recombinant gelatins, such as various blocking and
coating solutions. In further embodiments, the present invention
provides reproducible recombinant gelatins for use in various gels
used for biochemical and electrophoretic analysis, including
enzymography gels.
[0272] The present invention also encompasses microcarrier beads
coated with recombinant gelatin. Such microcarriers, used, e.g., in
mammalian cell culture, provide a growth surface for
attachment-dependent cells. Polysaccharide and polystyrene beads,
for example, can be coated with the recombinant gelatins of the
present invention to provide a suitable surface for cell attachment
and growth. In one embodiment, the microcarrier beads of the
present invention are coated with specific recombinant gelatins
containing active collagenous domains capable of inducing
differentiation and growth of particular cells.
[0273] Different regions of various collagens are associated with
various activities, for example, various regions of type III
collagen have been associated with active sites involved in the
clotting cascade. Therefore, in one embodiment, the present
invention contemplates the use of polynucleotides encoding
recombinant gelatins that contain specific active regions of a
particular collagen or of particular collagens. Such
polynucleotides can be used in a variety of ways, for example, in
microarrays.
[0274] Recombinant gelatins, polypeptides, and polynucleotides
encoding the recombinant gelatins of the present invention can be
used in novel microarray technologies and screening methodologies.
Collagen fibrils and immobilized collagen bind strongly to
platelets, as platelets have multiple binding sites for collagen
that encompass several collagen molecules polymerized to each
other. The interaction of platelets with collagen through their
collagen receptors results in activation of the platelets and
subsequent formation of platelet aggregates.
[0275] Recombinant gelatins consisting of biologically active
regions of collagen type III, for example, can be prepared as
microfibers that consist of a uniformity, purity, and
reproducibility unattainable with current collagen and gelatin
sources. Microfibers derived from the present recombinant gelatins
can be presented on substrates, e.g., arrays or chips, used to
screen for compounds that prevent platelet aggregation through
interaction with, e.g., type III collagen, or any other
fibril-forming collagen. Chemical compounds, small molecules,
peptides, or other biological molecules (such as antibodies) can be
screened for their ability to prevent, reduce, or slow the process
of clot formation or platelet aggregation, mediated by platelet
interactions with specific regions within a collagen fiber, such
as, for example, RGD sequences. Additionally, microarrays would
also be useful for examination of the interaction of different
types of integrins with various regions of collagens and gelatin
micro-fibers. Microfibers produced from recombinant gelatins from
any of the fibril-forming collagens, e.g., collagen type I, type
II, type III, type V, or type XI, could be used in screening for
collagen-induced platelet aggregation antagonists.
[0276] Also contemplated are microarrays of polynucleotides
encoding recombinant gelatins or fragments thereof. Such
microarrays are useful in screening for and isolation of variants
of collagen- or gelatin-encoding polynucleotides, e.g. DNA or RNA,
and in determining differential levels of expression in, for
example, normal vs. diseased tissue.
[0277] In another embodiment, the present invention provides
purified recombinant human gelatins for use in the differentiation
of progenitor cells, for tissue regeneration therapies, and for
tissue engineering. Components of the extracellular matrix are
involved in the regulation of cell proliferation and
differentiation. The use of gelatin microspheres implanted with
basic fibroblast growth factor accelerated fibroblast proliferation
and capillary formation in an artificial dermis model. (Kawai et
al. (2000) Biomaterials, 21:489-499.) Collagen type IV inhibited
cell proliferation and glial cell differentiation, while promoting
the differentiation of neuronal progenitors. (Ali et al. (1998)
Brain Res Dev Brain Res 110:31-38.) Additionally, collagen type I
induced the osteogenic differentiation of bone marrow stromal
cells, while collagen types II, III, and V did not. (Mizuno and
Kuboki (1995) Biochem Biophys Res Commun 211:1091-1098; and Mizuno
et al. (1997) Bone 20:101-107.)
[0278] In general, the use of gelatins in cell culture lead to
higher cell density and increased and prolonged cell viability in
hematopoietic stem cells and other progenitor cells. (Tun et al.
(2000) ASAIO J 46:522-526.) Gelatins used as a carrier matrix or
delivery vehicle have supported osteochondrial differentiation in
the delivery of bone marrow-derived mesenchymal progenitor cells
and for mesenchymal cell based cartilage regeneration therapies.
(Angele et al. (1999) Tissue Eng 5:545-554; Ponticiello et al.
(2000), J Biomed Mater Res 52:246-255; and Young et al. (1998) J
Orthop Res 16:406-413.) The present invention provides recombinant
gelatins for use in cell culture, such as, for example, in
promoting cell attachment, cell proliferation, and cell
differentiation. In certain embodiments, the present invention
provides methods for producing specific recombinant gelatins
designed to provide the desired cell attachment, cell
proliferation, or cell differentiation activities. For example, if
promoting the differentiation of neuronal progenitor cells was
desired, a recombinant gelatin could be produced containing the
specific regions of collagen type IV responsible for this
activity.
[0279] The present invention provides a cosmetic composition
comprising recombinant gelatin. This composition can be
administered to a subject to improve and repair rough and broken
nails and to improve the texture of hair. Gelatin's hypoallergenic
and hydrating properties, and its ability to provide texture,
color, and clarity, and to form films, make it an essential
ingredient in various cosmetics and toiletries. For example,
gelatins are valuable components of hair care products, such as
shampoos and conditioners. In one embodiment, the present invention
provides a moisturizing agent comprising recombinant gelatin, which
moisturizing agent is appropriate for use in cosmetic applications.
The film forming properties of gelatin can improve the gloss and
handling of hair, especially in damaged hair previously treated
with chemical preparations. Gelatin is also used in various
cosmetic processes, including hair treatment procedures such as
permanent waving and bleaching, in which proteins such as gelatin
are used to protect hair structure. The use of recombinant gelatin
in lotions, masks, creams, lipsticks, and other cosmetic products
is also contemplated, as the film-forming properties of gelatin
contributes to skin smoothness and softness. In one aspect, the
present invention contemplates a cosmetic composition comprising
recombinant gelatin, which is administered to treat roughened or
weak nails, etc.
[0280] The distinctive properties of gelatin, including its ability
to serve as a protective colloid, and to alter its electrical
charge with changes in pH, combine to make gelatin a material
suitable for use in microencapsulation. Gelatin and its derivatives
can thus be used in a variety of microencapsulation devices and
techniques, for example, in the microencapsulation of fragrances
for advertising and sample manufacture.
[0281] The following examples explain the invention in more detail.
The following preparations and examples are given to enable those
skilled in the art to more clearly understand and to practice the
present invention. The present invention, however, is not limited
in scope by the exemplified embodiments, which are intended as
illustrations of single aspects of the invention only, and methods
which are functionally equivalent are within the scope of the
invention. Indeed, various modifications of the invention in
addition to those described herein will become apparent to those
skilled in the art from the foregoing description and accompanying
drawings. Such modifications are intended to fall within the scope
of the appended claims.
EXAMPLES
[0282] Unless otherwise stated, the following materials and methods
were used in the examples of the present invention.
Example 1
Direct Expression of Recombinant Gelatins
[0283] Specific fragments of the .alpha.1(I) cDNA from human type I
collagen were amplified by PCR and cloned into the plasmid
pPICZ.alpha.A or pPIC9K (Invitrogen Corp., Carlsbad, Calif.). The
specific PCR primers used in cloning are set forth in Table 1
below. Specific recombinant gelatins are identified in Table 2 as
SEQ ID NOs: 15 through 25, and 30, 31, and 33. These recombinant
gelatins are additionally identified by reference to human
prepro-.alpha.1(I) collagen. (Genbank Accession No. CAA98968.) The
expression plasmids used contained .alpha.1(I) cDNA sequences of
different sizes fused to the yeast mating factor alpha prepro
secretion sequence. Other signal sequences known in the art can
also be used, for example, the yeast invertase (SUC2), the yeast
acid phosphatase (PHO) sequences, the native pro-collagen signal
sequence, and the signal sequence for human serum albumin. A signal
sequence that provides the optimal level of expression for a
specific gelatin fragment in a specific expression system should be
chosen.
TABLE-US-00001 TABLE 1 SEQ ID NO: SEQUENCE 1
GTATCTCTCGAGAAGAGAGAGGCTGAAGCTGGTCTGCCTGGTGCCAAGGGT 2
TAGACTATTATCTCTCGCCAGCGGGACCAGCAGG 3
GTATCTCTCGAGAAGAGAGAGGCTGAGGCTGGAGCTCAGGGACCCCCTGGC 4
ATGCTCTAGATTATTACTTGTCACCAGGGGCACCAGCAGG 5
GTATCTCTCGAGAAGAGAGAGGCTGAAGCTGGCCCCATGGGTCCCTCTGGT CCT 6
TGCTCTAGATCATTAAGCATCTCCCTGGCACCATCCAA 7
TGCTCTAGACTATTAAGGCGCGCCAGCATCACCCTTAGCACCATC 8
TGCTCTAGATCATTAAGGCGCGCCAGGTTCACCGCTGTTACCCTTGGG 9
TGCTCTAGATCATTATCTCTCGCCTCTTGCTCCAGAGGG 10
GTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTG CTTAAT 11
CTAGATTAAGCAGCACCTTTAGGTCCAGGGAATCCCATCACACCAGCCTGA CCACGGGCACCAG
12 ATGCTCTAGATTATTAAGGAGAACCGTCTCGTCCAGGGGA 13
CTAGTCTAGATTATCTTGCTCCAGAGGGGCCAGGGGC 14
CTAGTCTAGATTAGCGAGCACCTTTGGCTCCAGGAGC 32
AGCTTCTAGATTATTAGGGAGGACCAGGGGGACCAGGAGGTCC
TABLE-US-00002 TABLE 2 SEQ ID MOLECULAR NO: PCR PRIMERS USED AMINO
ACID SEQUENCE WEIGHT 15 SEQ ID NO: 5 and SEQ ID NO: 6 residue 179
to residue 280 9,447 Da 16 SEQ ID NO: 5 and SEQ ID NO: 8 residue
179 to residue 439 23,276 Da 17 SEQ ID NO: 5 and SEQ ID NO: 9
residue 179 to residue 679 44,737 Da 18 SEQ ID NO: 10 and SEQ ID
NO: 11 residue 531 to residue 589 5,250 Da 19 SEQ ID NO: 1 and SEQ
ID NO: 2 residue 531 to residue 631 8,947 Da 20 SEQ ID NO: 1 and
SEQ ID NO: 7 residue 531 to residue 715 16,483 Da 21 SEQ ID NO: 1
and SEQ ID NO: 4 residue 531 to residue 781 22,373 Da 22 SEQ ID NO:
1 and SEQ ID NO: 12 residue 531 to residue 1030 44,216 Da 23 SEQ ID
NO: 3 and SEQ ID NO: 7 residue 615 to residue 715 8,213 Da 24 SEQ
ID NO: 3 and SEQ ID NO: 4 residue 615 to residue 781 14,943 Da 25
SEQ ID NO: 3 and SEQ ID NO: 12 residue 615 to residue 1030 36,785
Da 30 SEQ ID NO: 3 and SEQ ID NO: 13 residue 615 to residue 676
5,517 Da 31 SEQ ID NO: 3 and SEQ ID NO: 14 residue 615 to residue
865 22,126 Da 33 SEQ ID NO: 1 and SEQ ID NO: 32 residue 531 to
residue 1192 ~65 kDa
[0284] The expression plasmids were introduced into Pichia pastoris
cells by electroporation, and transformants were selected by
complementation of a his4 auxotrophy (pPIC9K vectors) or by
resistance to zeocin (pPICZ.alpha.A vectors). Recombinant protein
expression was regulated by the methanol-inducible alcohol oxidase
promoter (P.sub.AOX1). The Pichia pastoris host cells contained
integrated copies of the .alpha. and .beta. subunits of human
prolyl 4-hydroxylase (P4H), the enzyme responsible for the
post-translational synthesis of hydroxyproline in collagen, and
have been previously described. (See, e.g., Vuorela, M. et al.
(1997) EMBO J. 16:6702-6712.)
[0285] The yeast strains were grown in buffered minimal glycerol
media, and recombinant protein expression was induced using the
same media with methanol (0.5%) substituted for glycerol as the
carbon source, as described in the Invitrogen Pichia Expression
Manual. Gelatin-producing strains were identified by 10-20% Tricine
SDS-PAGE analysis of conditioned media and prolyl 4-hydroxylase
activity in extracts from shake flask cultures. Co-expression of
prolyl 4-hydroxylase and the collagen fragments resulted in the
expression of recombinant gelatins with native human sequences.
[0286] The fragments were expressed and secreted into the media.
Recombinant gelatin was recovered and purified from the media by
acetone precipitation, anion or cation exchange chromatography, or
any combination thereof. Acetone precipitation was performed at
4.degree. C. by addition of acetone to cell-free culture
supernatants to a final concentration of 40%. The resulting
precipitate, consisting primarily of endogenous yeast proteins, was
collected by centrifugation. Acetone was then added to this
supernatant to a final concentration of 80%, causing the gelatin to
precipitate, which was then collected by centrifugation, dialyzed
overnight against water, and lyophilized. High purity gelatin was
obtained by a combination of anion and cation exchange
chromatography. Chromatographic purifications were performed at
room temperature.
[0287] Estimation of the sizes of collagenous proteins by
electrophoresis, compared to calculation of molecular weight based
on amino acid composition, is known in the art (Butkowski et al.
(1982) Methods Enzymol 82:410-423) N-terminal sequence analysis of
the recombinant gelatins demonstrated correct processing of the
prepro sequence which was fused to the gelatin fragments in order
to direct the protein to the yeast secretory pathway. The gelatins
produced in this system contained only sequences derived from human
collagen. Additionally, the recombinant gelatins represented the
major component of the conditioned media, as Pichia pastoris cells
secrete very few proteins.
[0288] The expressed recombinant gelatins were of discrete sizes,
ranging from about 5 kDa to about 65 kDa as measured on SDS-PAGE,
corresponding, for example, to gelatins of .about.5 kDa (lane 2,
SEQ ID NO:18), .about.10 kDa (lane 3, SEQ ID NO:19), .about.16 kDa
(lane 4, SEQ ID NO:24), .about.18 kDa (lane 5, SEQ ID NO:20),
.about.20 kDa (lane 6, SEQ ID NO:28) (also having a calculated
molecular weight of 17,914 Da, not set forth in Table 1), .about.33
kDa (lane 7, SEQ ID NO:27) (also having a calculated molecular
weight of 29,625 Da, not set forth in Table 1), .about.41 kDa (lane
8, SEQ ID NO:25), and .about.50 kDa (lane 9, SEQ ID NO:22), as
indicated in FIG. 1 (lane 10 represents hydrolyzed recombinant
human collagen type I, prepared as described in Example 10).
Example 2
Human Recombinant Gelatins Support Cell Attachment Activity
[0289] The recombinant human gelatin fragments of the present
invention demonstrated in vitro cell attachment activity. In the
following assay, 96-well Maxisorp plates (Nunc) were coated with
the following recombinant human gelatin domains from the .alpha.1
chain of human type I collagen, as described in Example 1 and
listed in Table 2: SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, and
SEQ ID NO:22. VITROGEN bovine collagen (Cohesion Technologies; Palo
Alto Calif.) and bovine serum albumin served as positive and
negative controls, respectively. Each of the proteins was diluted
to 0.1 mg/ml in 0.1 M NaHCO.sub.3, pH 10.0, and the plates coated
overnight at 4.degree. C. Human foreskin fibroblasts (HFF) or human
umbilical vein endothelial cells (HUVEC, from Clonetics, passage
5), were seeded onto the coated plates and incubated for 60 minutes
at 37.degree. C. Experiments were performed in triplicate.
[0290] The degree of cell attachment was then measured using
Reagent WST-1, the absorbance of which was read at 450 mM in an
ELISA reader. FIG. 2A shows that recombinant human gelatins
supported HFF attachment to Maxisorp plates, and, for these cells,
attachment was directly proportional to the molecular weight of the
recombinant human gelatin coated in each well. Specifically, the
recombinant gelatins of SEQ ID NO: 19, SEQ ID NO:20, and SEQ ID
NO:21 supported HFF attachment to a higher extent than that seen
with BSA. FIG. 2B shows that the different recombinant human
gelatins supported endothelial cell attachment. Cell attachment
activity was also demonstrated with recombinant human gelatin
prepared by thermal hydrolysis of recombinant human collagen
(described below in Example 9), using recombinant gelatins having
molecular weight ranges of 0-30 kDa and 0-50 kDa.
Example 3
Identification of a Proteolytically Stable Gelatin Fragment
[0291] Recombinant gelatin fragments were found to be
proteolytically modified during their expression and accumulation
in the media of recombinant Pichia pastoris cells. Expression of
several different portions of the helical domain of the .alpha.1
chain of type I collagen lead to the identification of a
recombinant gelatin that had superior stability with respect to
proteolysis. Three different gelatin fragments were cloned into
plasmid pPICZ.alpha.A, and their relative stabilities evaluated
during recombinant protein expression in Pichia pastoris cells.
[0292] The first strain used is described above in Example 2,
corresponding to SEQ ID NO:19. Additional strains were created
using plasmids encoding human .alpha.1(I) helical domain amino acid
residues 179-280 (SEQ ID NO:15) and 615-715 (SEQ ID NO:23). These
recombinant gelatins were constructed as described in Example 1,
using primers SEQ ID NO:5 and SEQ ID NO:6, and SEQ ID NO:3 and SEQ
ID NO:7. The PCR products were digested with XhoI and XbaI, cloned,
and prepared for electroporation as described above. The strains
were grown, protein expression induced, and the expressed gelatin
fragments compared by SDS-PAGE. FIG. 3 shows that the recombinant
gelatin of SEQ ID NO:15 (lane 2) and the recombinant gelatin of SEQ
ID NO:19 (lane 3) underwent proteolysis, while the recombinant
gelatin of SEQ ID NO:23 (lane 4) remained completely intact. This
result demonstrated that recombinant gelatin fragments of the
present invention could be produced which have superior
stability.
Example 4
Expression of Hydroxylated Recombinant Human Gelatin
[0293] Prolyl 4-hydroxylase activity has not been detected in
yeast. A Pichia pastoris strain has been engineered to express
active prolyl 4-hydroxylase and has been used previously to produce
hydroxylated collagen. (See U.S. Pat. No. 5,593,859.) To express
hydroxylated recombinant human gelatin, this strain was transformed
with a gelatin expression cassette encoding 100 amino acids of a
recombinant of human .alpha.1(I) collagen (SEQ ID NO:19, Table 2),
generated by PCR using the primers SEQ ID NO:1 and SEQ ID NO:2. The
PCR DNA product (.about.330 bp) was digested with XhoI-XbaI and
ligated into the XhoI-XbaI sites of pPICZ.alpha.A (Invitrogen),
creating plasmid pDO7.
[0294] A 1048 bp Cel II-AgeI fragment was isolated from pDO7 which
contained the 3' portion of the AOX1 promoter region, the mating
factor alpha secretion signal, the recombinant gelatin of SEQ ID
NO:19, the polylinker sequence from pPICZ.alpha.A, and 56 base
pairs of the AOX1 transcription terminator. This fragment was
ligated into the Cel II-AgeI sites of pPIC9K (Invitrogen) to create
pDO41. Pichia pastoris strain .alpha..beta.8 (his4) was transformed
with StuI-linearized plasmid pDO41 by electroporation, plated on
minimal dextrose plates, and transformants were selected that
complemented the his4 auxotrophy. Approximately 20 his.sup.+
transformants were grown and induced with methanol as described in
Example 1. Strains that expressed SEQ ID NO:19 were identified by
SDS-PAGE analysis of the conditioned media. (FIGS. 4a and 4b.)
[0295] Recombinant gelatin fragments from positive strains were
purified from the media by acetone precipitation, and analyzed
further by amino acid analysis, as described, e.g., in Hare, P E.
(1977) Methods in Enzymology 47:3-18. Amino acid analysis of the
gelatin product from one of the strains demonstrated the presence
of hydroxyproline in the secreted recombinant gelatins. The ratio
of hydroxyproline to proline was determined to be 0.29 in gelatin
isolated from the strain shown in shown in FIGS. 4A and 4B, isolate
#2, indicating co-expression of gelatin and prolyl
4-hydroxylase.
[0296] Non-hydroxylated recombinant gelatins were expressed and
purified from a Pichia pastoris strain that does not express prolyl
4-hydroxylase. Proline residues within this recombinant gelatin
were subsequently converted to hydroxyproline residues in vitro
using prolyl. 4-hydroxylase enzyme activity. A gelatin expression
plasmid was created by PCR using primers SEQ ID NO:3 and SEQ ID
NO:4, leading to the expression of recombinant gelatin of SEQ ID
NO:24. The 525 base pair PCR product was purified and digested with
XhoI-XbaI and ligated to XhoI-XbaI digested pPICZ.alpha.A. The
plasmid was linearized with PmeI and electroporated into Pichia
pastoris strain X-33 (Invitrogen). Transformants were selected by
growth on YPD plates containing 500 .mu.g/ml zeocin. Strains were
tested for gelatin expression as described above and recombinant
non-hydroxylated gelatin was purified from the media of a positive
isolate. Conditioned media was concentrated 10-fold by pressure
dialysis using a 10 kDa molecular weight cut-off membrane, and the
sample was dialyzed against Buffer A (50 mM Tris-HCl pH 9.0, 50 mM
NaCl). The dialyzed material was chromatographed on a Q-sepharose
column equilibrated in Buffer A. Gelatin does not bind to this
column under these conditions, and therefore, was present in the
flow-through fraction. The majority of the contaminating yeast
proteins bound to the column and eluted with Buffer B (Buffer A+0.5
M NaCl).
[0297] The flow-through fraction was dialyzed against 50 mM sodium
acetate, pH 4.5, and the recombinant gelatin further purified on a
SP-sepharose column equilibrated in the same buffer. The
recombinant gelatin bound to the column, and was step-eluted with
0.2 M NaCl. The purified gelatin, at 1 mg/ml, was heat denatured
(100.degree. C. for 10 minutes) and mixed with purified P4H at a
enzyme to substrate ratio of 1:30 in the presence of the following
components: 50 mM Tris-HCl pH 7.8, 2 mM ascorbate, 2 mM
.alpha.-ketoglutarate, 0.1 mM FeSO.sub.4, 10 .mu.M DTT, 10 mg/ml
bovine serum albumin, and 100 units of catalase (Sigma Chemical
Co., St Louis, Mo.). (See, e.g., Kivirikko, K. I. and Myllyla, R.
(1982) Methods in Enzymology 82:245-304; and Vuori, K., et. al.
(1992) Proc. Natl. Acad. Sci. 89:7467-7470.) The reaction was
allowed to proceed at 37.degree. C. for 16 hours.
[0298] The recombinant gelatin was then purified by chromatography
on Q-sepharose as described above. The bound proteins were eluted
from the column with 0.5 M NaCl and collected. (FIG. 5, lanes 7, 8,
and 9.) The flow-through and eluate fractions were analyzed by
SDS-PAGE to demonstrate the purity of the recovered gelatin. (FIG.
5.) Amino acid analysis of the gelatin was performed following
dialysis of the flow-through fractions. (FIG. 5; lanes 3 through
6.) The amino acid analysis showed that the gelatin was 87%
hydroxylated. Hydroxylation of 100% is achieved when the number of
moles of hydroxyproline/moles of proline+moles of hydroxyproline in
gelatin equals 0.5.
Example 5
Stability of Gelatins in the Presence or Absence of Prolyl
4-hydroxylase
[0299] An 18 kDa recombinant gelatin (SEQ ID NO:20) was expressed
according to the methods described above. The expressed fragments
were analyzed by gel electrophoresis. Recombinant gelatin expressed
in the presence of prolyl 4-hydroxylase had markedly greater
stability than the gelatin expressed in the absence of prolyl
4-hydroxylase. (See FIGS. 6A, 6B, and 6C.)
[0300] A role of proline hydroxylation on recombinant human gelatin
stability and an enhancement of stability was explored in prolyl
4-hydroxylase-expressing Pichia pastoris strains. A plasmid
encoding SEQ ID NO:20 (pDO32) was constructed by PCR using primers
SEQ ID NO:1 and SEQ ID NO:7. The PCR product was purified,
digested, and cloned as described above. The same .alpha.1(I) cDNA
fragment was expressed in host cells lacking prolyl hydroxylase,
and in host cells containing the .alpha. and .beta. prolyl
4-hydroxylase subunits. Three Pichia pastoris strains were
electroporated with PmeI-linearized pDO32: strain X-33 (wild-type
Pichia pastoris), two prolyl 4-hydroxylase-expression strains:
strain P4H-2, and strain .alpha..beta.8, as described in the U.S.
Pat. No. 5,593,859 and in Vourela et al. (1997) EMBO J.
16:6702-6712.
[0301] Transformants were selected by resistance to 500 .mu.g/ml
zeocin. Eight isolates from each transformation were grown and
induced as described, and the stability of the expressed
recombinant human gelatin was analyzed by SDS-PAGE. (See FIGS. 6A,
6B, 6C.) In wild-type Pichia pastoris strain X-33, approximately
equimolar amounts of intact recombinant gelatin and a proteolytic
fragment (which migrated just below the recombinant gelatin on the
gel, indicated by the arrow at the right of the figure) were
observed. (FIG. 6A, strain X-33.) In both strains that co-express
prolyl 4-hydroxylase, the amount of the proteolytic fragment was
significantly reduced, demonstrating that co-expression of prolyl
4-hydroxylase along with recombinant human gelatin enhanced gelatin
stability by substantially reducing proteolysis of the gelatin.
(FIGS. 6B and 6C, strain P4H-2 and strain .alpha..beta.8,
respectively.)
Example 6
Enhanced Recombinant Human Gelatin Expression by Supplementation of
Expression Media
[0302] Previous reports have indicated that casamino
acid-supplemented media decreased the amount of proteolysis seen
during expression of certain proteins in Pichia pastoris. (Clare,
J. J. et al. (1991) Gene 105:202-215.) The breakdown of the present
recombinant human gelatin expressed in Pichia pastoris was measured
following enrichment of the expression media with various
supplements. In this particular study, the Pichia pastoris strain
.alpha..beta.8 described in Example 5, which expressed recombinant
human gelatin fragment SEQ ID NO:20 was employed. (Example 5 and
Table 2.) Recombinant gelatin was induced in media supplemented
with a range of concentrations (0-2%) of various supplemental
components, including casamino acids, casitone, yeast extract,
peptone, peptamin, tryptone, Gelatone, lactalbumin, and soytone.
Several formulations, including lactalbumin hydrolysate, soytone,
casitone, and peptamin (Difco Laboratories, Detroit, Mich.)
increased recombinant gelatin expression levels. (FIGS. 7A and 7B,
lactalbumin and soytone, respectively.)
[0303] These results indicate that specific media supplements
employed during the expression of recombinant gelatins can lead to
increased production. In one aspect, the use of soytone as a media
supplement provided a plant-derived (rather than animal-derived)
media component that lead to increased expression of recombinant
gelatin. This would provide an animal material-free environment for
production of recombinant gelatin that could be used in a variety
of applications.
Example 7
Cross-Linking of Recombinant Human Gelatins
[0304] A slurry of recombinant human collagen (obtained as
described in U.S. Pat. No. 5,593,859) was prepared by dissolving
10.8 mg of recombinant human collagen type I in 5 ml of water,
followed by dialysis against 20 mM sodium phosphate, pH 7.2. The
final recombinant human collagen concentration of the slurry was
approximately 2 mg/ml. Preparation of cross-linked recombinant
human gelatin was performed by adding 10 .mu.l or 5 .mu.l of a 20%
solution of 1-ethyl-3-(3-dimethlyaminopropyl) carbodiimide
hydrochloride (EDC, Pierce Chemical Co.) to 1 ml of the recombinant
human collagen slurry described above. The cross-linking reaction
occurred overnight at room temperature. Unreacted EDC was removed
by dialysis against water.
[0305] The resulting cross-linked recombinant human gelatins were
analyzed by 6% glycine SDS-PAGE analysis. FIG. 8 shows an SDS-PAGE
comparison of recombinant human gelatin (lane 6, labeled UNL-5-4),
cross-linked recombinant human gelatin (lane 5, labeled UNL 5-4,
0.1% EDC; lane 4, labeled UNL 5-4, 0.2% EDC), commercially
available hard capsule gelatin (lane 3), and commercially available
gelatin (Type A, from porcine skin, approximately 300 Bloom, lane
2) obtained from Sigma Chemical Co. As shown in the SDS-PAGE
analysis of FIG. 8, the commercial capsule gelatin and Sigma
gelatin contained .alpha.-chain (molecular weight of approximately
110 kDa) as a major component, as well as a smear of higher
molecular weight gelatin components (with molecular weight ranging
from approximately 200-250 kDa). The recombinant human collagen was
composed of .alpha.-chain only. Following cross-linking, however,
the cross-linked recombinant gelatin was composed of .alpha.-chain
as well as a smear of higher molecular weight gelatins, similar to
that observed in commercial gelatin and commercial capsule gelatin.
This indicated that recombinant human gelatins displaying a
molecular weight distribution similar to that of commercial capsule
gelatins could be produced by cross-linking recombinant human
collagen. Cross-linked recombinant gelatins would have use in
applications in which increased gel strength and increased
viscosity would be desirable.
Example 8
Endotoxin Levels of Commercially Available Gelatin and Soluble
Recombinant Human Gelatin
[0306] Endotoxin levels of soluble gelatin obtained commercially
from Kind & Knox (K&K) and the recombinant human gelatins
of the present invention (made as described in Example 9) were
determined using the Limulus Ameobocyte Lysate test, as known in
the art. (See, e.g., Friberger, P. et al. (1987) Prog. Clin. Biol.
Res. 231:149-169.) Three different gelatin concentrations were
examined. As shown in Table 3, the recombinant human gelatins
generated by thermal hydrolysis of recombinant human collagen type
I (rhcI) of the present invention were virtually endotoxin-free.
The endotoxin levels of commercially available materials were about
1 to 1.5 EU/mg of protein. The methods for producing gelatin as
described in the present invention resulted in gelatins having
substantially lower endotoxin levels, by two to three orders of
magnitude, than those of the commercial preparations. Such low
endotoxin levels make the recombinant gelatins of the present
invention especially attractive for use in certain applications,
such as use in pharmaceutical stabilization.
TABLE-US-00003 TABLE 3 Gelatin Concentration Recombinant Human
(mg/ml) K&K Gelatin (EU/mg) Gelatin (EU/mg) 3 1.03 <0.005
1.5 1.41 <0.005 0.75 1.29 <0.006
Example 9
Derivation of Gelatins by Thermal and Acid Hydrolysis
[0307] Hydrolysis procedures (acid, thermal, and enzymatic) were
developed to produce soluble recombinant human gelatins with
molecular weight distributions similar to those of currently
available soluble animal-derived gelatins, used, for example, as
stabilizers in the formulation of vaccines. For these experiments,
intact recombinant human collagen type I and type III were used as
starting materials. By varying the hydrolysis conditions, it was
possible to vary the molecular weights of the final materials,
producing materials of defined molecular weights.
Molecular Weight Distribution of Commercially Available
Gelatins:
[0308] These recombinant human gelatins were compared against
commercially available gelatins. Four low molecular weight gelatin
samples produced by Leiner Davis, Great Lake, Kind & Knox, and
Dynagel, were obtained for characterization. All gelatins examined
were soluble at room temperature. The molecular weight
distributions of the gelatins on a Tricine SDS-PAGE gel are shown
on FIG. 9 and listed in Table 4. The gel profiles indicated the
molecular weight distributions of commercially available gelatins
were approximately 0-55 kDa, with the exception of the Dynagel-1
sample, which had a molecular weight distribution of 0-30 kDa. The
gel profiles also revealed two patterns of molecular weight
distribution. In one example, derived from the samples from Leiner
Davis and Great Lakes, several discrete molecular bands were
observed by SDS-PAGE. The pattern in the second example, derived
from the Dynagel and Kind & Knox samples, showed a continuous
distribution of material on the gel, with no discrete banding. The
molecular weight distributions of Dynagel-1 and Dynagel-2 were
quite different, despite being produced by the same manufacturer
for the same application. This result indicated that batch-to-batch
variation could be quite significant in currently available
gelatins.
TABLE-US-00004 TABLE 4 Maximum Apparent Relative Molecular
Molecular Weight* Company Mobility Weight (Da) Distribution (Da)
K&K 0.3410 70,000 0-55,500 Leiner Davis 0.3410 70,000 0-55.500
Great Lake 0.3693 60,000 0-47,600 Sol-U-Por, # 1 0.3483 65,000
0-51,600 Sol-U-Por, # 2 0.4972 37,000 0-29,400 *The molecular
weight was adjusted by a factor of 1.26, which is the ratio of the
mean residue weight of the standard proteins (115) over the mean
residue weight of the collagenous proteins (91.6).
[0309] Heat hydrolysis of gelatins was performed as follows. The
commercially available dry gelatins were dissolved in
40.degree.-50.degree. C. water to make a 5% gelatin solution. The
pH of the solution was adjusted with either 0.1N NaOH or 0.1N HCl
in preparation for heat hydrolysis. Both type I and type III
recombinant human collagens were expressed in Pichia pastoris and
purified, as described in U.S. Pat. No. 5,593,859. The final
recombinant human collagen was dissolved in 10 mM HCl, dialyzed
against water, and lyophilized. The lyophilized recombinant human
collagen was dissolved in 40.degree.-50.degree. C. water to make a
3% solution. The pH of the solution was adjusted as indicated below
prior to heat hydrolysis.
[0310] Heat hydrolysis was performed in 1 ml Reacti-Vials (Pierce).
The hydrolysis temperature varied from 100.degree. C. to
150.degree. C., depending on the experiment. The pH of the
hydrolysis solution varied from pH 2 to pH 7, as indicated. The
hydrolysis time was also varied from one to thirty-two hours,
depending on the temperature and pH of the solution. The gelatin
hydrolysates were sampled at various time intervals and analyzed by
SDS-PAGE.
Hydrolysis of Commercially Available Gelatins at 120.degree. C.
[0311] Samples of high molecular weight gelatin from Sigma (Type A
from porcine skin, 250 kDa) were dissolved in six different pH
solutions (5% gelatin) and hydrolyzed at 120.degree. C. The pH 2
and pH 3 solutions were hydrolyzed for two and a half hours and
sampled every half hour. The pH 4 solutions were hydrolyzed for
five hours and sampled every hour. The pH 5, pH 6, and pH 7
solutions were hydrolyzed for 24 hours and sampled every two hours
after 14 hours of hydrolysis.
[0312] The hydrolysis patterns were analyzed on Tricine 10-20%
SDS-gels as shown in FIGS. 10A, 10B, 10C, 10D, 10E, and 10F. The
gel profiles show that the lower the pH of the solution, the more
quickly the hydrolysis of the gelatin occurred. The gel profiles
also revealed two hydrolysis patterns among the hydrolysates. One
pattern showed several discrete molecular bands on the gel (see the
acid hydrolysis results of the pH 2 and pH 3 solutions, FIGS. 10A
and 10B), while the other pattern showed a continuous distribution
of material on the gel (see the hydrolysis results of the pH 4, pH
5, pH 6, and pH 7 solutions, FIGS. 10C, 10D, 10E, and 10F).
[0313] These results showed that the process outlined above, or
variations thereof, produced two different types of material, as
seen in the analysis of the commercially available gelatins
(discrete bands vs. a continuous distribution of material on
SDS-PAGE). These experimental results also indicated that heat
degradation of high molecular weight gelatin generated various
sizes of soluble gelatins. Table 5 shows the molecular weight
distributions obtained using Sigma Gelatin, following hydrolysis at
120.degree. C., in pH 6.0 solution.
TABLE-US-00005 TABLE 5 Max. App. Hydrolysis Relative Mol. Weight
Molecular Weight Time (hr) Mobility (Da) Distribution (Da) 4 0.2356
140,000 0-111,000 8 0.2890 90,000 0-71,400 11.5 0.3372 75,000
0-59,500 16 0.3837 47,000 0-37,300 20 0.4186 40,000 0-31,700 24
0.4525 33,000 0-26,200
Hydrolysis of Commercially Available Gelatins at 150.degree. C.
[0314] Samples of high molecular weight gelatin from Sigma (Type A
from porcine skin, 250 kDa) were dissolved in four different pH
solutions (5% gelatin) and hydrolyzed at 150.degree. C. for up to
ten hours. The hydrolysates were sampled every two hours for
analysis. The hydrolysis patterns were analyzed by Tricine 10-20%
SDS-PAGE gels as shown in FIGS. 11A, 11B, 11C, and 11D. The gel
profiles indicated that the degradation of gelatin occurred much
more rapidly at 150.degree. C. than at 120.degree. C. Additionally,
hydrolysis of gelatins performed at 150.degree. C. produced gelatin
fragments of lower molecular weights. Table 6 shows the molecular
weight distributions of Sigma Gelatin, following hydrolysis at
150.degree. C. in pH 6.0 solution:
TABLE-US-00006 TABLE 6 Max. App. Hydrolysis Relative Mol. Weight
Molecular Weight Time (hr) Mobility (Da) Distribution (Da) 2 0.2833
95,000 0-75,400 4.5 0.4555 41,000 0-32,500 6 0.5277 32,000 0-25,400
8 0.5833 24,000 0-19,000 10 0.6611 15,000 0-11,900
Example 10
Acid and Thermal Hydrolysis of Recombinant Human Collagen I and
III
[0315] Recombinant human collagen type I was hydrolyzed at
120.degree. C. for up to 8 hours under neutral pH conditions (pH
7), or up to 3 hours in acidic pH conditions (pH 2). Recombinant
human collagen type III was also hydrolyzed at 120.degree. C. for
up to six hours in both neutral and acidic conditions. Hydrolysis
was performed as described in Example 9. The human recombinant type
I and type II hydrolysates were analyzed by Tricine 10-20% SDS-PAGE
gels, shown in FIGS. 12A and 12B. The SDS-PAGE gel patterns
indicated that the heat hydrolysis of recombinant human collagen
was identical to the hydrolysis patterns of high molecular weight
gelatins derived from natural sources. (FIG. 9, FIGS. 10A through
10F, and FIGS. 11A through 11D, to FIGS. 12A and 12B.) Similar to
the hydrolysis of natural gelatins (pH 7), the acid hydrolysates of
recombinant human collagen showed several discrete molecular weight
bands, while the neutral hydrolysates showed a more continuous
molecular weight distribution. The molecular weight distribution of
the neutral hydrolysates of recombinant human gelatin was around
0-70 kDa after six to eight hours of heat degradation. The
hydrolysis under acidic conditions occurred much faster. The
molecular weight distributions of the acidic hydrolysates of
recombinant human gelatin were much narrower, around 0-10 kDa,
after two to three hours of heat treatment.
[0316] As a further refinement of the heat hydrolyzed recombinant
human gelatins discussed, we have demonstrated the utility of a
yeast multi-gene recombinant expression methodology for the
production of human gelatins with discrete fragments of the
.alpha.1(I) chain of human type I collagen. This technology allowed
us to produce well-defined, highly homogeneous gelatin fragments
ranging in size from 6-65 kDa. This presents unsurpassed
flexibility in terms of the size and biophysical properties of the
gelatin that can be used for specific applications.
Example 11
Enzymatic Hydrolysis of Recombinant Human Collagen Type I
[0317] Recombinant human collagen type I was hydrolyzed
enzymatically, using the proteases set forth in Table 7.
Recombinant human collagen type I was incubated with each enzyme at
37.degree. C., using a substrate to enzyme ratio (w/w) as indicated
in Table 7. The human recombinant type I hydrolysates obtained by
treatment were analyzed by Tricine 10-20% SDS-PAGE gels. The
results obtained from papain and protease X treatment are shown in
FIG. 13. The SDS-PAGE gel patterns indicated that the enzymatic
hydrolysis of recombinant human collagen lead to different
molecular weight distributions of the gelatins. Enzymatic
hydrolysis using papain resulted in a continuous hydrolysis
pattern, as indicated in FIG. 13 and in Table 7, while hydrolysis
using protease X resulted in several discrete molecular weight
bands. As indicated in Table 7, the recombinant gelatins produced
by this method had different hydrolysis patterns as a result of the
particular enzymatic hydrolysis treatment. This presents great
flexibility in producing sizes and biophysical properties of the
gelatin that can be used for specific applications.
TABLE-US-00007 TABLE 7 Enzyme Activity/ Substrate to Hydrolysis
Enzyme mg Protein Enzyme Ratio Pattern Chymo-papain 1 U @
37.degree. C., 500:1 Continuous pH 6.5 Bromelain 8 U @ 37.degree.
C., 5,000:1 Banding & pH 4.6 Continuous Protease VIII 12 U @
37.degree. C., 7,000:1 Banding pH 8.5 Papain 17 U @ 37.degree. C.,
10,000:1 Continuous pH 6.5 Protease X 42 U @ 37.degree. C.,
20,000:1 Banding pH 8.5
Example 12
Antibodies to Recombinant Human Collagen Type I Directed Against
Different Recombinant Gelatins
[0318] Human recombinant type I collagen produced in the yeast
Pichia pastoris was tested for its potential allergic reaction as a
contact sensitizer on guinea pig, known as Maximization Study.
After the duration of the study, the sera were collected to
investigate the immunogenecity of recombinant human type I collagen
in guinea pig. One gram of rhCI was immersed in 10 ml of either
0.9% Sodium Chloride Injection (SCI) or sesame oil, and incubated
for 72 hours at 37.degree. C. The extract was then centrifuge at
3000 rpm for 15 minutes and the supernatant collected for
dosing.
[0319] Hartley pigs were exposed to the test article and control
solution by an induction phase. This phase involved three pairs of
intradermal (ID) injections on clipped areas. The first pair of ID
injections (cranial) consisted of an emulsion of Freud's Complete
Adjuvant (FCA) in an equal volume of SCI. The second pair of ID
injections (middle) consisted of the test extract (recombinant
human type I collagen). The third pair (caudal) consisted of an
emulsion of the test extract article and equal volume of FCA.
Positive and negative control animals were treated in a similar
manner as the test animals, except that the test extract was not
included in the second and third pair of injections.
[0320] On the sixth day after ID injections, the test sites were
evaluated for evidence of irritation. The test sites were then
pretreated with 10% SLS in petroleum and massaged into the skin
using a glass rod, and then left uncovered for 24 hours. On the
seventh day, a topical application was administered on the shaved
areas of each test animals with 4.25 cm diameter disk of Whatman #3
filter paper soaked with 0.4 ml the test article extract. Thirteen
days after the topical induction application, the animals were
challenged. An area on the right side of each animal was clipped.
On the next day, Hill Top chambers containing 0.3 ml of test
extract, vehicle control extract, or positive control solutions
were applied to clipped areas and remained on the animals for 24
hours. The dosing sites were scored for erythema and edema 24, 48,
and 72 hours after removal of the chambers.
[0321] After 72 hours, the blood was collected and allowed to clot,
then centrifuged at 2800 rpm for 15 minutes. The serum was removed
from each tube and serum samples were stored at -70.degree. C.
until use.
[0322] Sera from the immunized Guinea pigs were then analyzed for
the presence of antibodies directed against recombinant human
collagen type I (rhcI), recombinant human collagen type III
(rhcIII), VITROGEN bovine collagen (Cohesion Technologies; Palo
Alto, Calif.), and various fragments of recombinant human gelatins
of the present invention, including 6 kDa (SEQ ID NO:18), 10 kDa
(SEQ ID NO:19), 18 kDa (SEQ ID NO:20), 33 kDa (SEQ ID NO:27), 50
kDa (SEQ ID NO:22), and 65 kDa (SEQ ID NO:33) fragments. (See Table
2 and Example 1.) Recombinant collagen and recombinant gelatin were
electrophoresed on 8% Tris-Glycine or 10-20% Tricine SDS-PAGE gels.
Western blot analysis was performed using anti-serum from each of
the Guinea pigs used in the study. FIG. 14 shows that recombinant
human type I collagen-specific antibodies were present in the sera
of Guinea pigs immunized with recombinant human type I collagen. No
antibody reactivity to any of the recombinant gelatins analyzed by
Western blot analysis was observed in any of the sera of examined.
FIG. 14 shows Western blot results using the antisera from one
Guinea pig in the study. The sera from at least 4 different Guinea
pigs were analyzed, each of which showed identical results to that
disclosed in FIG. 14.
[0323] It was desirable to elucidate possible epitopes of the type
I collagen responsible for the antigenic response observed
following injection of rhcI into Guinea pigs. Recombinant human
collagen type I was separated into its .alpha.1(I) and .alpha.2(I)
components following denaturation and column chromatography.
Cyanogen bromide (CNBr) cleavage of the .alpha.1(I) chain of
recombinant type I collagen and the .alpha.2(I) chain of
recombinant type I collagen was performed as described in Bornstein
and Piez (1966) Biochemistry 5:3460. The intact .alpha. chains and
the resulting peptide fragments were separated by SDS-PAGE and
analyzed by Western blot analysis for reactivity to the Guinea pig
sera described above. FIG. 15A shows a coomassie-stained SDS-PAGE
of intact and CNBr-cleaved .alpha.1(I) and .alpha.2(I) chains of
recombinant human type I collagen. Western blot analysis showed
that the Guinea pig antisera reactive to rhcI were directed against
the .alpha.2 chain of type I collagen and specific CNBr fragments
thereof. No reactivity against the .alpha.1 chain of type I
collagen was detected. (FIG. 15B.)
[0324] The Western blot analyses described above examined the
reactivity of the Guinea pig sera to recombinant human type I
collagen, CNBr fragments, and recombinant human gelatins by virtue
of electrophoretic separation on SDS-PAGE. To examine the
reactivity of the Guinea pig antisera to these polypeptides under
non-denatured conditions, a direct ELISA analysis was performed.
(FIG. 16.) The data showed that the Guinea pig antisera recognized
the native conformation of rhcI. None of the recombinant gelatins
of the present invention reacted with the Guinea pig antisera by
ELISA, regardless of whether the gelatin fragments were presented
before or after thermal denaturation. The rhcI was even more
reactive in the ELISA if heat-denatured prior to analysis (data not
shown). This indicated the polyclonal antibodies in the sera
recognized primarily sequenced epitopes, rather than helical
structures. Together, these results indicated that the concerns
associated with having an antigenic site(s) present on human
collagen type I, specifically to the .alpha.2 chain as shown in the
current example, could be avoided by the methods of the present
invention. The present invention thus provides methods for
generating recombinant gelatins lacking antigenic sites, which
would be useful for specific applications in which gelatin of low
antigenicity is desired.
[0325] Various modifications and variations of the described
methods and systems of the invention will be apparent to those
skilled in the art without departing from the spirit and scope of
the invention. Although the invention has been described in
connection with specific preferred embodiments, it should be
understood that the invention as claimed should not be unduly
limited to such specific embodiments. Various modifications of the
described modes for carrying out the invention which are obvious to
those skilled in the present art and related fields are intended to
be within the scope of the following claims. All references cited
herein are incorporated by reference herein in their entirety.
Sequence CWU 1
1
33151DNAhuman 1gtatctctcg agaagagaga ggctgaagct ggtctgcctg
gtgccaaggg t 51234DNAhuman 2tagactatta tctctcgcca gcgggaccag cagg
34351DNAhuman 3gtatctctcg agaagagaga ggctgaggct ggagctcagg
gaccccctgg c 51440DNAhuman 4atgctctaga ttattacttg tcaccagggg
caccagcagg 40554DNAhuman 5gtatctctcg agaagagaga ggctgaagct
ggccccatgg gtccctctgg tcct 54639DNAhuman 6tgctctagat cattaagcat
ctcccttggc accatccaa 39745DNAhuman 7tgctctagac tattaaggcg
cgccagcatc acccttagca ccatc 45848DNAhuman 8tgctctagat cattaaggcg
cgccaggttc accgctgtta cccttggg 48939DNAhuman 9tgctctagat cattatctct
cgcctcttgc tccagaggg 391057DNAhuman 10gtgcccgtgg tcaggctggt
gtgatgggat tccctggacc taaaggtgct gcttaat 571164DNAhuman
11ctagattaag cagcaccttt aggtccaggg aatcccatca caccagcctg accacgggca
60ccag 641240DNAhuman 12atgctctaga ttattaagga gaaccgtctc gtccagggga
401337DNAhuman 13ctagtctaga ttatcttgct ccagaggggc caggggc
371437DNAhuman 14ctagtctaga ttagcgagca cctttggctc caggagc
3715102PRThuman 15Gly Pro Met Gly Pro Ser Gly Pro Arg Gly Leu Pro
Gly Pro Pro Gly 1 5 10 15Ala Pro Gly Pro Gln Gly Phe Gln Gly Pro
Pro Gly Glu Pro Gly Glu 20 25 30Pro Gly Ala Ser Gly Pro Met Gly Pro
Arg Gly Pro Pro Gly Pro Pro 35 40 45Gly Lys Asn Gly Asp Asp Gly Glu
Ala Gly Lys Pro Gly Arg Pro Gly 50 55 60Glu Arg Gly Pro Pro Gly Pro
Gln Gly Ala Arg Gly Leu Pro Gly Thr 65 70 75 80Ala Gly Leu Pro Gly
Met Lys Gly His Arg Gly Phe Ser Gly Leu Asp 85 90 95Gly Ala Lys Gly
Asp Ala 10016261PRThuman 16Gly Pro Met Gly Pro Ser Gly Pro Arg Gly
Leu Pro Gly Pro Pro Gly 1 5 10 15Ala Pro Gly Pro Gln Gly Phe Gln
Gly Pro Pro Gly Glu Pro Gly Glu 20 25 30Pro Gly Ala Ser Gly Pro Met
Gly Pro Arg Gly Pro Pro Gly Pro Pro 35 40 45Gly Lys Asn Gly Asp Asp
Gly Glu Ala Gly Lys Pro Gly Arg Pro Gly 50 55 60Glu Arg Gly Pro Pro
Gly Pro Gln Gly Ala Arg Gly Leu Pro Gly Thr 65 70 75 80Ala Gly Leu
Pro Gly Met Lys Gly His Arg Gly Phe Ser Gly Leu Asp 85 90 95Gly Ala
Lys Gly Asp Ala Gly Pro Ala Gly Pro Lys Gly Glu Pro Gly 100 105
110Ser Pro Gly Glu Asn Gly Ala Pro Gly Gln Met Gly Pro Arg Gly Leu
115 120 125Pro Gly Glu Arg Gly Arg Pro Gly Ala Pro Gly Pro Ala Gly
Ala Arg 130 135 140Gly Asn Asp Gly Ala Thr Gly Ala Ala Gly Pro Pro
Gly Pro Thr Gly145 150 155 160Pro Ala Gly Pro Pro Gly Phe Pro Gly
Ala Val Gly Ala Lys Gly Glu 165 170 175Ala Gly Pro Gln Gly Pro Arg
Gly Ser Glu Gly Pro Gln Gly Val Arg 180 185 190Gly Glu Pro Gly Pro
Pro Gly Pro Ala Gly Ala Ala Gly Pro Ala Gly 195 200 205Asn Pro Gly
Ala Asp Gly Gln Pro Gly Ala Lys Gly Ala Asn Gly Ala 210 215 220Pro
Gly Ile Ala Gly Ala Pro Gly Phe Pro Gly Ala Arg Gly Pro Ser225 230
235 240Gly Pro Gln Gly Pro Gly Gly Pro Pro Gly Pro Lys Gly Asn Ser
Gly 245 250 255Glu Pro Gly Ala Pro 26017501PRThuman 17Gly Pro Met
Gly Pro Ser Gly Pro Arg Gly Leu Pro Gly Pro Pro Gly 1 5 10 15Ala
Pro Gly Pro Gln Gly Phe Gln Gly Pro Pro Gly Glu Pro Gly Glu 20 25
30Pro Gly Ala Ser Gly Pro Met Gly Pro Arg Gly Pro Pro Gly Pro Pro
35 40 45Gly Lys Asn Gly Asp Asp Gly Glu Ala Gly Lys Pro Gly Arg Pro
Gly 50 55 60Glu Arg Gly Pro Pro Gly Pro Gln Gly Ala Arg Gly Leu Pro
Gly Thr 65 70 75 80Ala Gly Leu Pro Gly Met Lys Gly His Arg Gly Phe
Ser Gly Leu Asp 85 90 95Gly Ala Lys Gly Asp Ala Gly Pro Ala Gly Pro
Lys Gly Glu Pro Gly 100 105 110Ser Pro Gly Glu Asn Gly Ala Pro Gly
Gln Met Gly Pro Arg Gly Leu 115 120 125Pro Gly Glu Arg Gly Arg Pro
Gly Ala Pro Gly Pro Ala Gly Ala Arg 130 135 140Gly Asn Asp Gly Ala
Thr Gly Ala Ala Gly Pro Pro Gly Pro Thr Gly145 150 155 160Pro Ala
Gly Pro Pro Gly Phe Pro Gly Ala Val Gly Ala Lys Gly Glu 165 170
175Ala Gly Pro Gln Gly Pro Arg Gly Ser Glu Gly Pro Gln Gly Val Arg
180 185 190Gly Glu Pro Gly Pro Pro Gly Pro Ala Gly Ala Ala Gly Pro
Ala Gly 195 200 205Asn Pro Gly Ala Asp Gly Gln Pro Gly Ala Lys Gly
Ala Asn Gly Ala 210 215 220Pro Gly Ile Ala Gly Ala Pro Gly Phe Pro
Gly Ala Arg Gly Pro Ser225 230 235 240Gly Pro Gln Gly Pro Gly Gly
Pro Pro Gly Pro Lys Gly Asn Ser Gly 245 250 255Glu Pro Gly Ala Pro
Gly Ser Lys Gly Asp Thr Gly Ala Lys Gly Glu 260 265 270Pro Gly Pro
Val Gly Val Gln Gly Pro Pro Gly Pro Ala Gly Glu Glu 275 280 285Gly
Lys Arg Gly Ala Arg Gly Glu Pro Gly Pro Thr Gly Leu Pro Gly 290 295
300Pro Pro Gly Glu Arg Gly Gly Pro Gly Ser Arg Gly Phe Pro Gly
Ala305 310 315 320Asp Gly Val Ala Gly Pro Lys Gly Pro Ala Gly Glu
Arg Gly Ser Pro 325 330 335Gly Pro Ala Gly Pro Lys Gly Ser Pro Gly
Glu Ala Gly Arg Pro Gly 340 345 350Glu Ala Gly Leu Pro Gly Ala Lys
Gly Leu Thr Gly Ser Pro Gly Ser 355 360 365Pro Gly Pro Asp Gly Lys
Thr Gly Pro Pro Gly Pro Ala Gly Gln Asp 370 375 380Gly Arg Pro Gly
Pro Pro Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly385 390 395 400Val
Met Gly Phe Pro Gly Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys 405 410
415Ala Gly Glu Arg Gly Val Pro Gly Pro Pro Gly Ala Val Gly Pro Ala
420 425 430Gly Lys Asp Gly Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro
Ala Gly 435 440 445Pro Ala Gly Glu Arg Gly Glu Gln Gly Pro Ala Gly
Ser Pro Gly Phe 450 455 460Gln Gly Leu Pro Gly Pro Ala Gly Pro Pro
Gly Glu Ala Gly Lys Pro465 470 475 480Gly Glu Gln Gly Val Pro Gly
Asp Leu Gly Ala Pro Gly Pro Ser Gly 485 490 495Ala Arg Gly Glu Arg
5001859PRThuman 18Glu Ala Gly Leu Pro Gly Ala Lys Gly Leu Thr Gly
Ser Pro Gly Ser 1 5 10 15Pro Gly Pro Asp Gly Lys Thr Gly Pro Pro
Gly Pro Ala Gly Gln Asp 20 25 30Gly Arg Pro Gly Pro Pro Gly Pro Pro
Gly Ala Arg Gly Gln Ala Gly 35 40 45Val Met Gly Phe Pro Gly Pro Lys
Gly Ala Ala 50 5519101PRThuman 19Glu Ala Gly Leu Pro Gly Ala Lys
Gly Leu Thr Gly Ser Pro Gly Ser 1 5 10 15Pro Gly Pro Asp Gly Lys
Thr Gly Pro Pro Gly Pro Ala Gly Gln Asp 20 25 30Gly Arg Pro Gly Pro
Pro Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly 35 40 45Val Met Gly Phe
Pro Gly Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys 50 55 60Ala Gly Glu
Arg Gly Val Pro Gly Pro Pro Gly Ala Val Gly Pro Ala 65 70 75 80Gly
Lys Asp Gly Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly 85 90
95Pro Ala Gly Glu Arg 10020185PRThuman 20Glu Ala Gly Leu Pro Gly
Ala Lys Gly Leu Thr Gly Ser Pro Gly Ser 1 5 10 15Pro Gly Pro Asp
Gly Lys Thr Gly Pro Pro Gly Pro Ala Gly Gln Asp 20 25 30Gly Arg Pro
Gly Pro Pro Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly 35 40 45Val Met
Gly Phe Pro Gly Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys 50 55 60Ala
Gly Glu Arg Gly Val Pro Gly Pro Pro Gly Ala Val Gly Pro Ala 65 70
75 80Gly Lys Asp Gly Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala
Gly 85 90 95Pro Ala Gly Glu Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro
Gly Phe 100 105 110Gln Gly Leu Pro Gly Pro Ala Gly Pro Pro Gly Glu
Ala Gly Lys Pro 115 120 125Gly Glu Gln Gly Val Pro Gly Asp Leu Gly
Ala Pro Gly Pro Ser Gly 130 135 140Ala Arg Gly Glu Arg Gly Phe Pro
Gly Glu Arg Gly Val Gln Gly Pro145 150 155 160Pro Gly Pro Ala Gly
Pro Arg Gly Ala Asn Gly Ala Pro Gly Asn Asp 165 170 175Gly Ala Lys
Gly Asp Ala Gly Ala Pro 180 18521251PRThuman 21Glu Ala Gly Leu Pro
Gly Ala Lys Gly Leu Thr Gly Ser Pro Gly Ser 1 5 10 15Pro Gly Pro
Asp Gly Lys Thr Gly Pro Pro Gly Pro Ala Gly Gln Asp 20 25 30Gly Arg
Pro Gly Pro Pro Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly 35 40 45Val
Met Gly Phe Pro Gly Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys 50 55
60Ala Gly Glu Arg Gly Val Pro Gly Pro Pro Gly Ala Val Gly Pro Ala
65 70 75 80Gly Lys Asp Gly Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro
Ala Gly 85 90 95Pro Ala Gly Glu Arg Gly Glu Gln Gly Pro Ala Gly Ser
Pro Gly Phe 100 105 110Gln Gly Leu Pro Gly Pro Ala Gly Pro Pro Gly
Glu Ala Gly Lys Pro 115 120 125Gly Glu Gln Gly Val Pro Gly Asp Leu
Gly Ala Pro Gly Pro Ser Gly 130 135 140Ala Arg Gly Glu Arg Gly Phe
Pro Gly Glu Arg Gly Val Gln Gly Pro145 150 155 160Pro Gly Pro Ala
Gly Pro Arg Gly Ala Asn Gly Ala Pro Gly Asn Asp 165 170 175Gly Ala
Lys Gly Asp Ala Gly Ala Pro Gly Ala Pro Gly Ser Gln Gly 180 185
190Ala Pro Gly Leu Gln Gly Met Pro Gly Glu Arg Gly Ala Ala Gly Leu
195 200 205Pro Gly Pro Lys Gly Asp Arg Gly Asp Ala Gly Pro Lys Gly
Ala Asp 210 215 220Gly Ser Pro Gly Lys Asp Gly Val Arg Gly Leu Thr
Gly Pro Ile Gly225 230 235 240Pro Pro Gly Pro Ala Gly Ala Pro Gly
Asp Lys 245 25022500PRThuman 22Glu Ala Gly Leu Pro Gly Ala Lys Gly
Leu Thr Gly Ser Pro Gly Ser 1 5 10 15Pro Gly Pro Asp Gly Lys Thr
Gly Pro Pro Gly Pro Ala Gly Gln Asp 20 25 30Gly Arg Pro Gly Pro Pro
Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly 35 40 45Val Met Gly Phe Pro
Gly Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys 50 55 60Ala Gly Glu Arg
Gly Val Pro Gly Pro Pro Gly Ala Val Gly Pro Ala 65 70 75 80Gly Lys
Asp Gly Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly 85 90 95Pro
Ala Gly Glu Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro Gly Phe 100 105
110Gln Gly Leu Pro Gly Pro Ala Gly Pro Pro Gly Glu Ala Gly Lys Pro
115 120 125Gly Glu Gln Gly Val Pro Gly Asp Leu Gly Ala Pro Gly Pro
Ser Gly 130 135 140Ala Arg Gly Glu Arg Gly Phe Pro Gly Glu Arg Gly
Val Gln Gly Pro145 150 155 160Pro Gly Pro Ala Gly Pro Arg Gly Ala
Asn Gly Ala Pro Gly Asn Asp 165 170 175Gly Ala Lys Gly Asp Ala Gly
Ala Pro Gly Ala Pro Gly Ser Gln Gly 180 185 190Ala Pro Gly Leu Gln
Gly Met Pro Gly Glu Arg Gly Ala Ala Gly Leu 195 200 205Pro Gly Pro
Lys Gly Asp Arg Gly Asp Ala Gly Pro Lys Gly Ala Asp 210 215 220Gly
Ser Pro Gly Lys Asp Gly Val Arg Gly Leu Thr Gly Pro Ile Gly225 230
235 240Pro Pro Gly Pro Ala Gly Ala Pro Gly Asp Lys Gly Glu Ser Gly
Pro 245 250 255Ser Gly Pro Ala Gly Pro Thr Gly Ala Arg Gly Ala Pro
Gly Asp Arg 260 265 270Gly Glu Pro Gly Pro Pro Gly Pro Ala Gly Phe
Ala Gly Pro Pro Gly 275 280 285Ala Asp Gly Gln Pro Gly Ala Lys Gly
Glu Pro Gly Asp Ala Gly Ala 290 295 300Lys Gly Asp Ala Gly Pro Pro
Gly Pro Ala Gly Pro Ala Gly Pro Pro305 310 315 320Gly Pro Ile Gly
Asn Val Gly Ala Pro Gly Ala Lys Gly Ala Arg Gly 325 330 335Ser Ala
Gly Pro Pro Gly Ala Thr Gly Phe Pro Gly Ala Ala Gly Arg 340 345
350Val Gly Pro Pro Gly Pro Ser Gly Asn Ala Gly Pro Pro Gly Pro Pro
355 360 365Gly Pro Ala Gly Lys Glu Gly Gly Lys Gly Pro Arg Gly Glu
Thr Gly 370 375 380Pro Ala Gly Arg Pro Gly Glu Val Gly Pro Pro Gly
Pro Pro Gly Pro385 390 395 400Ala Gly Glu Lys Gly Ser Pro Gly Ala
Asp Gly Pro Ala Gly Ala Pro 405 410 415Gly Thr Pro Gly Pro Gln Gly
Ile Ala Gly Gln Arg Gly Val Val Gly 420 425 430Leu Pro Gly Gln Arg
Gly Glu Arg Gly Phe Pro Gly Leu Pro Gly Pro 435 440 445Ser Gly Glu
Pro Gly Lys Gln Gly Pro Ser Gly Ala Ser Gly Glu Arg 450 455 460Gly
Pro Pro Gly Pro Met Gly Pro Pro Gly Leu Ala Gly Pro Pro Gly465 470
475 480Glu Ser Gly Arg Glu Gly Ala Pro Ala Ala Glu Gly Ser Pro Gly
Arg 485 490 495Asp Gly Ser Pro 5002391PRThuman 23Glu Ala Gly Ala
Gln Gly Pro Pro Gly Pro Ala Gly Pro Ala Gly Glu 1 5 10 15Arg Gly
Glu Gln Gly Pro Ala Gly Ser Pro Gly Phe Gln Gly Leu Pro 20 25 30Gly
Pro Ala Gly Pro Pro Gly Glu Ala Gly Lys Pro Gly Glu Gln Gly 35 40
45Val Pro Gly Asp Leu Gly Ala Pro Gly Pro Ser Gly Ala Arg Gly Glu
50 55 60Arg Gly Phe Pro Gly Glu Arg Gly Val Gln Gly Pro Pro Gly Pro
Ala 65 70 75 80Gly Pro Arg Gly Ala Asn Gly Ala Pro Gly Asn 85
9024167PRThuman 24Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly
Pro Ala Gly Glu 1 5 10 15Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro
Gly Phe Gln Gly Leu Pro 20 25 30Gly Pro Ala Gly Pro Pro Gly Glu Ala
Gly Lys Pro Gly Glu Gln Gly 35 40 45Val Pro Gly Asp Leu Gly Ala Pro
Gly Pro Ser Gly Ala Arg Gly Glu 50 55 60Arg Gly Phe Pro Gly Glu Arg
Gly Val Gln Gly Pro Pro Gly Pro Ala 65 70 75 80Gly Pro Arg Gly Ala
Asn Gly Ala Pro Gly Asn Asp Gly Ala Lys Gly 85 90 95Asp Ala Gly Ala
Pro Gly Ala Pro Gly Ser Gln Gly Ala Pro Gly Leu 100 105 110Gln Gly
Met Pro Gly Glu Arg Gly Ala Ala Gly Leu Pro Gly Pro Lys 115 120
125Gly Asp Arg Gly Asp Ala Gly Pro Lys Gly Ala Asp Gly Ser Pro Gly
130 135 140Lys Asp Gly Val Arg Gly Leu Thr Gly Pro Ile Gly Pro Pro
Gly Pro145 150 155 160Ala Gly Ala Pro Gly Asp Lys 16525416PRThuman
25Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly Pro Ala Gly Glu 1
5 10 15Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro Gly Phe Gln Gly Leu
Pro 20 25 30Gly Pro Ala Gly Pro Pro Gly Glu Ala Gly Lys Pro Gly Glu
Gln Gly 35 40 45Val Pro Gly Asp Leu Gly Ala Pro Gly Pro Ser Gly Ala
Arg Gly Glu 50 55 60Arg
Gly Phe Pro Gly Glu Arg Gly Val Gln Gly Pro Pro Gly Pro Ala 65 70
75 80Gly Pro Arg Gly Ala Asn Gly Ala Pro Gly Asn Asp Gly Ala Lys
Gly 85 90 95Asp Ala Gly Ala Pro Gly Ala Pro Gly Ser Gln Gly Ala Pro
Gly Leu 100 105 110Gln Gly Met Pro Gly Glu Arg Gly Ala Ala Gly Leu
Pro Gly Pro Lys 115 120 125Gly Asp Arg Gly Asp Ala Gly Pro Lys Gly
Ala Asp Gly Ser Pro Gly 130 135 140Lys Asp Gly Val Arg Gly Leu Thr
Gly Pro Ile Gly Pro Pro Gly Pro145 150 155 160Ala Gly Ala Pro Gly
Asp Lys Gly Glu Ser Gly Pro Ser Gly Pro Ala 165 170 175Gly Pro Thr
Gly Ala Arg Gly Ala Pro Gly Asp Arg Gly Glu Pro Gly 180 185 190Pro
Pro Gly Pro Ala Gly Phe Ala Gly Pro Pro Gly Ala Asp Gly Gln 195 200
205Pro Gly Ala Lys Gly Glu Pro Gly Asp Ala Gly Ala Lys Gly Asp Ala
210 215 220Gly Pro Pro Gly Pro Ala Gly Pro Ala Gly Pro Pro Gly Pro
Ile Gly225 230 235 240Asn Val Gly Ala Pro Gly Ala Lys Gly Ala Arg
Gly Ser Ala Gly Pro 245 250 255Pro Gly Ala Thr Gly Phe Pro Gly Ala
Ala Gly Arg Val Gly Pro Pro 260 265 270Gly Pro Ser Gly Asn Ala Gly
Pro Pro Gly Pro Pro Gly Pro Ala Gly 275 280 285Lys Glu Gly Gly Lys
Gly Pro Arg Gly Glu Thr Gly Pro Ala Gly Arg 290 295 300Pro Gly Glu
Val Gly Pro Pro Gly Pro Pro Gly Pro Ala Gly Glu Lys305 310 315
320Gly Ser Pro Gly Ala Asp Gly Pro Ala Gly Ala Pro Gly Thr Pro Gly
325 330 335Pro Gln Gly Ile Ala Gly Gln Arg Gly Val Val Gly Leu Pro
Gly Gln 340 345 350Arg Gly Glu Arg Gly Phe Pro Gly Leu Pro Gly Pro
Ser Gly Glu Pro 355 360 365Gly Lys Gln Gly Pro Ser Gly Ala Ser Gly
Glu Arg Gly Pro Pro Gly 370 375 380Pro Met Gly Pro Pro Gly Leu Ala
Gly Pro Pro Gly Glu Ser Gly Arg385 390 395 400Glu Gly Ala Pro Ala
Ala Glu Gly Ser Pro Gly Arg Asp Gly Ser Pro 405 410
41526510PRThuman 26Gly Glu Arg Gly Val Gln Gly Pro Pro Gly Pro Ala
Gly Pro Arg Gly 1 5 10 15Ala Asn Gly Ala Pro Gly Asn Asp Gly Ala
Lys Gly Asp Ala Gly Ala 20 25 30Pro Gly Ala Pro Gly Ser Gln Gly Ala
Pro Gly Leu Gln Gly Met Pro 35 40 45Gly Glu Arg Gly Ala Ala Gly Leu
Pro Gly Pro Lys Gly Asp Arg Gly 50 55 60Asp Ala Gly Pro Lys Gly Ala
Asp Gly Ser Pro Gly Lys Asp Gly Val 65 70 75 80Arg Gly Leu Thr Gly
Pro Ile Gly Pro Pro Gly Pro Ala Gly Ala Pro 85 90 95Gly Asp Lys Gly
Glu Ser Gly Pro Ser Gly Pro Ala Gly Pro Thr Gly 100 105 110Ala Arg
Gly Ala Pro Gly Asp Arg Gly Glu Pro Gly Pro Pro Gly Pro 115 120
125Ala Gly Phe Ala Gly Pro Pro Gly Ala Asp Gly Gln Pro Gly Ala Lys
130 135 140Gly Glu Pro Gly Asp Ala Gly Ala Lys Gly Asp Ala Gly Pro
Pro Gly145 150 155 160Pro Ala Gly Pro Ala Gly Pro Pro Gly Pro Ile
Gly Asn Val Gly Ala 165 170 175Pro Gly Ala Lys Gly Ala Arg Gly Ser
Ala Gly Pro Pro Gly Ala Thr 180 185 190Gly Phe Pro Gly Ala Ala Gly
Arg Val Gly Pro Pro Gly Pro Ser Gly 195 200 205Asn Ala Gly Pro Pro
Gly Pro Pro Gly Pro Ala Gly Lys Glu Gly Gly 210 215 220Lys Gly Pro
Arg Gly Glu Thr Gly Pro Ala Gly Arg Pro Gly Glu Val225 230 235
240Gly Pro Pro Gly Pro Pro Gly Pro Ala Gly Glu Lys Gly Ser Pro Gly
245 250 255Ala Asp Gly Pro Ala Gly Ala Pro Gly Thr Pro Gly Pro Gln
Gly Ile 260 265 270Ala Gly Gln Arg Gly Val Val Gly Leu Pro Gly Gln
Arg Gly Glu Arg 275 280 285Gly Phe Pro Gly Leu Pro Gly Pro Ser Gly
Glu Pro Gly Lys Gln Gly 290 295 300Pro Ser Gly Ala Ser Gly Glu Arg
Gly Pro Pro Gly Pro Met Gly Pro305 310 315 320Pro Gly Leu Ala Gly
Pro Pro Gly Glu Ser Gly Arg Glu Gly Ala Pro 325 330 335Ala Ala Glu
Gly Ser Pro Gly Arg Asp Gly Ser Pro Gly Ala Lys Gly 340 345 350Asp
Arg Gly Glu Thr Gly Pro Ala Gly Pro Pro Gly Ala Pro Gly Ala 355 360
365Pro Gly Ala Pro Gly Pro Val Gly Pro Ala Gly Lys Ser Gly Asp Arg
370 375 380Gly Glu Thr Gly Pro Ala Gly Pro Ala Gly Pro Val Gly Pro
Val Gly385 390 395 400Ala Arg Gly Pro Ala Gly Pro Gln Gly Pro Arg
Gly Asp Lys Gly Glu 405 410 415Thr Gly Glu Gln Gly Asp Arg Gly Ile
Lys Gly His Arg Gly Phe Ser 420 425 430Gly Leu Gln Gly Pro Pro Gly
Pro Pro Gly Ser Pro Gly Glu Gln Gly 435 440 445Pro Ser Gly Ala Ser
Gly Pro Ala Gly Pro Arg Gly Pro Pro Gly Ser 450 455 460Ala Gly Ala
Pro Gly Lys Asp Gly Leu Asn Gly Leu Pro Gly Pro Ile465 470 475
480Gly Pro Pro Gly Pro Arg Gly Arg Thr Gly Asp Ala Gly Pro Val Gly
485 490 495Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro
500 505 51027333PRThuman 27Gly Ala Lys Gly Ala Arg Gly Ser Ala Gly
Pro Pro Gly Ala Thr Gly 1 5 10 15Phe Pro Gly Ala Ala Gly Arg Val
Gly Pro Pro Gly Pro Ser Gly Asn 20 25 30Ala Gly Pro Pro Gly Pro Pro
Gly Pro Ala Gly Lys Glu Gly Gly Lys 35 40 45Gly Pro Arg Gly Glu Thr
Gly Pro Ala Gly Arg Pro Gly Glu Val Gly 50 55 60Pro Pro Gly Pro Pro
Gly Pro Ala Gly Glu Lys Gly Ser Pro Gly Ala 65 70 75 80Asp Gly Pro
Ala Gly Ala Pro Gly Thr Pro Gly Pro Gln Gly Ile Ala 85 90 95Gly Gln
Arg Gly Val Val Gly Leu Pro Gly Gln Arg Gly Glu Arg Gly 100 105
110Phe Pro Gly Leu Pro Gly Pro Ser Gly Glu Pro Gly Lys Gln Gly Pro
115 120 125Ser Gly Ala Ser Gly Glu Arg Gly Pro Pro Gly Pro Met Gly
Pro Pro 130 135 140Gly Leu Ala Gly Pro Pro Gly Glu Ser Gly Arg Glu
Gly Ala Pro Ala145 150 155 160Ala Glu Gly Ser Pro Gly Arg Asp Gly
Ser Pro Gly Ala Lys Gly Asp 165 170 175Arg Gly Glu Thr Gly Pro Ala
Gly Pro Pro Gly Ala Pro Gly Ala Pro 180 185 190Gly Ala Pro Gly Pro
Val Gly Pro Ala Gly Lys Ser Gly Asp Arg Gly 195 200 205Glu Thr Gly
Pro Ala Gly Pro Ala Gly Pro Val Gly Pro Val Gly Ala 210 215 220Arg
Gly Pro Ala Gly Pro Gln Gly Pro Arg Gly Asp Lys Gly Glu Thr225 230
235 240Gly Glu Gln Gly Asp Arg Gly Ile Lys Gly His Arg Gly Phe Ser
Gly 245 250 255Leu Gln Gly Pro Pro Gly Pro Pro Gly Ser Pro Gly Glu
Gln Gly Pro 260 265 270Ser Gly Ala Ser Gly Pro Ala Gly Pro Arg Gly
Pro Pro Gly Ser Ala 275 280 285Gly Ala Pro Gly Lys Asp Gly Leu Asn
Gly Leu Pro Gly Pro Ile Gly 290 295 300Pro Pro Gly Pro Arg Gly Arg
Thr Gly Asp Ala Gly Pro Val Gly Pro305 310 315 320Pro Gly Pro Pro
Gly Pro Pro Gly Pro Pro Gly Pro Pro 325 33028200PRThuman 28Glu Arg
Gly Pro Pro Gly Pro Met Gly Pro Pro Gly Leu Ala Gly Pro 1 5 10
15Pro Gly Glu Ser Gly Arg Glu Gly Ala Pro Ala Ala Glu Gly Ser Pro
20 25 30Gly Arg Asp Gly Ser Pro Gly Ala Lys Gly Asp Arg Gly Glu Thr
Gly 35 40 45Pro Ala Gly Pro Pro Gly Ala Pro Gly Ala Pro Gly Ala Pro
Gly Pro 50 55 60Val Gly Pro Ala Gly Lys Ser Gly Asp Arg Gly Glu Thr
Gly Pro Ala 65 70 75 80Gly Pro Ala Gly Pro Val Gly Pro Val Gly Ala
Arg Gly Pro Ala Gly 85 90 95Pro Gln Gly Pro Arg Gly Asp Lys Gly Glu
Thr Gly Glu Gln Gly Asp 100 105 110Arg Gly Ile Lys Gly His Arg Gly
Phe Ser Gly Leu Gln Gly Pro Pro 115 120 125Gly Pro Pro Gly Ser Pro
Gly Glu Gln Gly Pro Ser Gly Ala Ser Gly 130 135 140Pro Ala Gly Pro
Arg Gly Pro Pro Gly Ser Ala Gly Ala Pro Gly Lys145 150 155 160Asp
Gly Leu Asn Gly Leu Pro Gly Pro Ile Gly Pro Pro Gly Pro Arg 165 170
175Gly Arg Thr Gly Asp Ala Gly Pro Val Gly Pro Pro Gly Pro Pro Gly
180 185 190Pro Pro Gly Pro Pro Gly Pro Pro 195 20029100PRThuman
29Arg Gly Asp Lys Gly Glu Thr Gly Glu Gln Gly Asp Arg Gly Ile Lys 1
5 10 15Gly His Arg Gly Phe Ser Gly Leu Gln Gly Pro Pro Gly Pro Pro
Gly 20 25 30Ser Pro Gly Glu Gln Gly Pro Ser Gly Ala Ser Gly Pro Ala
Gly Pro 35 40 45Arg Gly Pro Pro Gly Ser Ala Gly Ala Pro Gly Lys Asp
Gly Leu Asn 50 55 60Gly Leu Pro Gly Pro Ile Gly Pro Pro Gly Pro Arg
Gly Arg Thr Gly 65 70 75 80Asp Ala Gly Pro Val Gly Pro Pro Gly Pro
Pro Gly Pro Pro Gly Pro 85 90 95Pro Gly Pro Pro 1003062PRThuman
30Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly Pro Ala Gly Glu 1
5 10 15Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro Gly Phe Gln Gly Leu
Pro 20 25 30Gly Pro Ala Gly Pro Pro Gly Glu Ala Gly Lys Pro Gly Glu
Gln Gly 35 40 45Val Pro Gly Asp Leu Gly Ala Pro Gly Pro Ser Gly Ala
Arg 50 55 6031251PRThuman 31Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro
Ala Gly Pro Ala Gly Glu 1 5 10 15Arg Gly Glu Gln Gly Pro Ala Gly
Ser Pro Gly Phe Gln Gly Leu Pro 20 25 30Gly Pro Ala Gly Pro Pro Gly
Glu Ala Gly Lys Pro Gly Glu Gln Gly 35 40 45Val Pro Gly Asp Leu Gly
Ala Pro Gly Pro Ser Gly Ala Arg Gly Glu 50 55 60Arg Gly Phe Pro Gly
Glu Arg Gly Val Gln Gly Pro Pro Gly Pro Ala 65 70 75 80Gly Pro Arg
Gly Ala Asn Gly Ala Pro Gly Asn Asp Gly Ala Lys Gly 85 90 95Asp Ala
Gly Ala Pro Gly Ala Pro Gly Ser Gln Gly Ala Pro Gly Leu 100 105
110Gln Gly Met Pro Gly Glu Arg Gly Ala Ala Gly Leu Pro Gly Pro Lys
115 120 125Gly Asp Arg Gly Asp Ala Gly Pro Lys Gly Ala Asp Gly Ser
Pro Gly 130 135 140Lys Asp Gly Val Arg Gly Leu Thr Gly Pro Ile Gly
Pro Pro Gly Pro145 150 155 160Ala Gly Ala Pro Gly Asp Lys Gly Glu
Ser Gly Pro Ser Gly Pro Ala 165 170 175Gly Pro Thr Gly Ala Arg Gly
Ala Pro Gly Asp Arg Gly Glu Pro Gly 180 185 190Pro Pro Gly Pro Ala
Gly Phe Ala Gly Pro Pro Gly Ala Asp Gly Gln 195 200 205Pro Gly Ala
Lys Gly Glu Pro Gly Asp Ala Gly Ala Lys Gly Asp Ala 210 215 220Gly
Pro Pro Gly Pro Ala Gly Pro Ala Gly Pro Pro Gly Pro Ile Gly225 230
235 240Asn Val Gly Ala Pro Gly Ala Lys Gly Ala Arg 245
2503243DNAhuman 32agcttctaga ttattaggga ggaccagggg gaccaggagg tcc
4333662PRThuman 33Glu Ala Gly Leu Pro Gly Ala Lys Gly Leu Thr Gly
Ser Pro Gly Ser 1 5 10 15Pro Gly Pro Asp Gly Lys Thr Gly Pro Pro
Gly Pro Ala Gly Gln Asp 20 25 30Gly Arg Pro Gly Pro Pro Gly Pro Pro
Gly Ala Arg Gly Gln Ala Gly 35 40 45Val Met Gly Phe Pro Gly Pro Lys
Gly Ala Ala Gly Glu Pro Gly Lys 50 55 60Ala Gly Glu Arg Gly Val Pro
Gly Pro Pro Gly Ala Val Gly Pro Ala 65 70 75 80Gly Lys Asp Gly Glu
Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly 85 90 95Pro Ala Gly Glu
Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro Gly Phe 100 105 110Gln Gly
Leu Pro Gly Pro Ala Gly Pro Pro Gly Glu Ala Gly Lys Pro 115 120
125Gly Glu Gln Gly Val Pro Gly Asp Leu Gly Ala Pro Gly Pro Ser Gly
130 135 140Ala Arg Gly Glu Arg Gly Phe Pro Gly Glu Arg Gly Val Gln
Gly Pro145 150 155 160Pro Gly Pro Ala Gly Pro Arg Gly Ala Asn Gly
Ala Pro Gly Asn Asp 165 170 175Gly Ala Lys Gly Asp Ala Gly Ala Pro
Gly Ala Pro Gly Ser Gln Gly 180 185 190Ala Pro Gly Leu Gln Gly Met
Pro Gly Glu Arg Gly Ala Ala Gly Leu 195 200 205Pro Gly Pro Lys Gly
Asp Arg Gly Asp Ala Gly Pro Lys Gly Ala Asp 210 215 220Gly Ser Pro
Gly Lys Asp Gly Val Arg Gly Leu Thr Gly Pro Ile Gly225 230 235
240Pro Pro Gly Pro Ala Gly Ala Pro Gly Asp Lys Gly Glu Ser Gly Pro
245 250 255Ser Gly Pro Ala Gly Pro Thr Gly Ala Arg Gly Ala Pro Gly
Asp Arg 260 265 270Gly Glu Pro Gly Pro Pro Gly Pro Ala Gly Phe Ala
Gly Pro Pro Gly 275 280 285Ala Asp Gly Gln Pro Gly Ala Lys Gly Glu
Pro Gly Asp Ala Gly Ala 290 295 300Lys Gly Asp Ala Gly Pro Pro Gly
Pro Ala Gly Pro Ala Gly Pro Pro305 310 315 320Gly Pro Ile Gly Asn
Val Gly Ala Pro Gly Ala Lys Gly Ala Arg Gly 325 330 335Ser Ala Gly
Pro Pro Gly Ala Thr Gly Phe Pro Gly Ala Ala Gly Arg 340 345 350Val
Gly Pro Pro Gly Pro Ser Gly Asn Ala Gly Pro Pro Gly Pro Pro 355 360
365Gly Pro Ala Gly Lys Glu Gly Gly Lys Gly Pro Arg Gly Glu Thr Gly
370 375 380Pro Ala Gly Arg Pro Gly Glu Val Gly Pro Pro Gly Pro Pro
Gly Pro385 390 395 400Ala Gly Glu Lys Gly Ser Pro Gly Ala Asp Gly
Pro Ala Gly Ala Pro 405 410 415Gly Thr Pro Gly Pro Gln Gly Ile Ala
Gly Gln Arg Gly Val Val Gly 420 425 430Leu Pro Gly Gln Arg Gly Glu
Arg Gly Phe Pro Gly Leu Pro Gly Pro 435 440 445Ser Gly Glu Pro Gly
Lys Gln Gly Pro Ser Gly Ala Ser Gly Glu Arg 450 455 460Gly Pro Pro
Gly Pro Met Gly Pro Pro Gly Leu Ala Gly Pro Pro Gly465 470 475
480Glu Ser Gly Arg Glu Gly Ala Pro Ala Ala Glu Gly Ser Pro Gly Arg
485 490 495Asp Gly Ser Pro Gly Ala Lys Gly Asp Arg Gly Glu Thr Gly
Pro Ala 500 505 510Gly Pro Pro Gly Ala Pro Gly Ala Pro Gly Ala Pro
Gly Pro Val Gly 515 520 525Pro Ala Gly Lys Ser Gly Asp Arg Gly Glu
Thr Gly Pro Ala Gly Pro 530 535 540Ala Gly Pro Val Gly Pro Val Gly
Ala Arg Gly Pro Ala Gly Pro Gln545 550 555 560Gly Pro Arg Gly Asp
Lys Gly Glu Thr Gly Glu Gln Gly Asp Arg Gly 565 570 575Ile Lys Gly
His Arg Gly Phe Ser Gly Leu Gln Gly Pro Pro Gly Pro 580 585 590Pro
Gly Ser Pro Gly Glu Gln Gly Pro Ser Gly Ala Ser Gly Pro Ala 595 600
605Gly Pro Arg Gly Pro Pro Gly Ser Ala Gly Ala Pro Gly Lys Asp Gly
610 615 620Leu Asn Gly Leu Pro Gly Pro Ile Gly Pro Pro Gly Pro Arg
Gly Arg625 630
635 640Thr Gly Asp Ala Gly Pro Val Gly Pro Pro Gly Pro Pro Gly Pro
Pro 645 650 655Gly Pro Pro Gly Pro Pro 660
* * * * *