U.S. patent application number 12/168755 was filed with the patent office on 2009-06-04 for alien sequences.
This patent application is currently assigned to MODULAR GENETICS, INC.. Invention is credited to Sean Quinlan, Temple Smith, Prashanth Vishwanath.
Application Number | 20090143242 12/168755 |
Document ID | / |
Family ID | 37865535 |
Filed Date | 2009-06-04 |
United States Patent
Application |
20090143242 |
Kind Code |
A1 |
Quinlan; Sean ; et
al. |
June 4, 2009 |
ALIEN SEQUENCES
Abstract
The present invention provides sequences and reagents for
preparing microarrays with internal controls. Specifically, the
present invention defines and provides sequences that are not
present in the hybridizing mRNA or cDNA, and therefore can be used
both as hybridization controls and for inter-spot
normalization.
Inventors: |
Quinlan; Sean; (Melrose,
MA) ; Smith; Temple; (Marblehead, MA) ;
Vishwanath; Prashanth; (Brighton, MA) |
Correspondence
Address: |
CHOATE, HALL & STEWART LLP
TWO INTERNATIONAL PLACE
BOSTON
MA
02110
US
|
Assignee: |
MODULAR GENETICS, INC.
Cambridge
MA
TRUSTEES OF BOSTON UNIVERSITY
Boston
MA
|
Family ID: |
37865535 |
Appl. No.: |
12/168755 |
Filed: |
July 7, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11224573 |
Sep 12, 2005 |
7396646 |
|
|
12168755 |
|
|
|
|
10763039 |
Jan 22, 2004 |
|
|
|
11224573 |
|
|
|
|
60441832 |
Jan 22, 2003 |
|
|
|
Current U.S.
Class: |
506/9 ;
506/17 |
Current CPC
Class: |
Y10S 707/99936 20130101;
C12Q 1/6837 20130101; C12Q 1/6837 20130101; C12Q 2545/101 20130101;
C12Q 1/6837 20130101; C12Q 2545/114 20130101; C12Q 2545/101
20130101 |
Class at
Publication: |
506/9 ;
506/17 |
International
Class: |
C40B 30/04 20060101
C40B030/04; C40B 40/08 20060101 C40B040/08 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 22, 2004 |
US |
PCT/US04/01911 |
Claims
1. A nucleic acid array comprising: a solid support a plurality of
nucleic acid probes attached to the solid support at discrete
locations, wherein at least one of the probes is an alien probe in
that it has a sequence that is alien to a hybridizing mixture to be
hybridized to the array.
2. The nucleic acid array of claim 1, wherein the hybridizing
mixture comprises nucleic acids from a source selected from the
group consisting of human mRNA, human cDNA, mouse cDNA, mouse mRNA,
and combinations thereof.
3. The nucleic acid array of claim 1, wherein the alien probe is
present in each discrete location on the solid support.
4. A method comprising steps of: providing a hybridizing mixture
comprising a plurality of nucleic acids; and hybridizing the
hybridizing mixture to a nucleic acid array comprising: a solid
support; and a plurality of nucleic acid probes attached to the
solid support at discrete locations, wherein at least one of the
probes is an alien probe in that it has a sequence that is alien to
a hybridizing mixture to be hybridized to the array.
5. The method of claim 4, wherein the step of providing a
hybridizing mixture comprises providing a mixture containing at
least one anti-alien hybridizing nucleic acid whose sequence
comprises a sequence complementary to the alien probe.
6. The method of claim 4, further comprising a step of: measuring
hybridization between the anti-alien hybridizing nucleic acid and
the alien probe.
7. The method of claim 6, wherein: the hybridizing mixture contains
both the anti-alien hybridizing nucleic acid and at least one
experimental hybridizing nucleic acid of unknown quantity; and the
plurality of probes attached to the microarray includes at least
one cognate probe whose sequence is complementary to at least part
of the experimental hybridizing nucleic acid.
8. The method of claim 7, further comprising a step of: measuring
hybridization between the experimental hybridizing nucleic acid and
the cognate probe.
9. The method of claim 8, further comprising a step of: comparing
the measured hybridization between the anti-alien hybridizing
nucleic acid and the alien probe with the measured hybridization
between the experimental hybridizing nucleic acid, thereby
determining how much hybridizing nucleic acid was present in the
hybridizing mixture.
10. The method of claim 5, wherein the step of providing a
hybridizing mixture comprises providing a mixture containing at
least one anti-alien hybridizing nucleic acid whose sequence
comprises a sequence complementary to the alien probe and also
containing at least one experimental hybridizing nucleic acid, the
method further comprising steps of: processing the hybridizing
mixture such that the anti-alien and experimental hybridizing
nucleic acids are simultaneously subjected to identical treatments;
hybridizing the hybridizing mixture to the array; and measuring
hybridization of the anti-alien hybridizing nucleic acid to the
alien probe such that information about efficiency or accurateness
of the processing or hybridizing steps is revealed.
11. The method of claim 5, wherein the step of providing a
hybridizing mixture comprises providing a known amount of at least
one anti-alien hybridizing nucleic acid whose sequence comprises a
sequence complementary to the alien probe, the method further
comprising steps of: hybridizing the hybridizing mixture to the
array; and measuring hybridization of the anti-alien hybridizing
nucleic acid to the alien probe such that information about quality
of the array is revealed.
12. The method of claim 11, wherein the step of providing a
hybridizing mixture does not include providing experimental
hybridizing nucleic acids, and the hybridizing step is performed
prior to exposing the array to experimental hybridizing nucleic
acids.
13. The method of claim 11, wherein at least one alien probe is
present in each discrete location on the array.
Description
RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
patent application Ser. No. 11/224,573, filed Sep. 12, 2005, which
is a continuation-in-part of U.S. patent application Ser. No.
10/763,039, filed Jan. 22, 2004, and International Application No.
PCT/US04/01911, filed Jan. 22, 2004, both of which claim the
benefit of U.S. Provisional Application No. 60/441,832. The entire
contents of the prior applications are herein incorporated by
reference.
BACKGROUND
[0002] The proper and harmonious expression of a large number of
genes is a critical component of normal growth and development and
the maintenance of proper health. Disruptions or changes in gene
expression are responsible for many diseases. Using traditional
methods to assay gene expression, researchers were able to survey a
relatively small number of genes at a time. Microarrays allow
scientists to analyze expression of many genes in a single
experiment quickly and efficiently. A microarray works by
exploiting the ability of a given mRNA molecule to bind
specifically to, or hybridize to, the DNA template from which it
originated.
[0003] DNA arrays are commonly used to study gene expression. In
this type of study, mRNA is extracted from a sample (for example,
blood cells or tumor tissue), converted to complementary DNA (cDNA)
and tagged with a fluorescent label. In a typical microarray
experiment, cDNA from one sample (sample A) is labeled with a first
dye that fluoresces in the red and cDNA from another sample (sample
B) is labeled with a different dye that fluoresces in the green.
The fluorescent red and green cDNA samples are then applied to a
microarray that contains DNA fragments (oligonucleotides)
corresponding to thousands of genes. If a DNA sequence probe is
present on the microarray and its complement is present in one or
both samples, the sequences bind, and a fluorescent signal can be
detected at the specific spot on the array, where the DNA sequence
probe is located. The signals are generally picked up using a
"scanner" which creates a digital image of the array. The red to
green fluorescence ratio in each spot reflects the relative
expression of a given gene in the two samples. The result of a gene
expression experiment is referred to as a gene expression "profile"
or "signature".
[0004] This technology, though widely used, is not without its
problems. Almost every procedure in the methodology is a potential
source of fluctuation leading to a lot of noise in the system as a
whole. The major sources of fluctuations to be expected are in mRNA
preparation, reverse transcription leading to cDNA of varying
lengths, systemic variation in pin geometry, random fluctuations in
spot volume, target fixation, slide non-homogeneities due to
unequal distribution of the probe, hybridization parameters and
non-specific hybridization. Some of the errors mentioned above can
be minimized by performing replicates of experiments or by using a
flipped dye design.
[0005] Biological replicates are arrays that each use RNA samples
from different individual organisms, pools of organisms or flasks
of cells, but yet compare the same treatments or control/treatment
combinations. Technical replicates are arrays that each use the
same RNA samples and also the same treatment. Thus, in this
setting, the only differences in measurements are due to technical
differences in array processing. The rationale for the flipped dye
design is that it allows for the estimation and removal of gene
specific dye effects. These dye effects have been shown to be
reproducible across independent arrays by the use of Control vs.
Control arrays. Any deviation from a ratio of 1 in these arrays is
due to either dye effect or residual error. However, none of these
methods will account accurately for chip manufacturing error.
[0006] Therefore, there remains a need for the development of
improved microarray technologies, and particularly technologies
that allow researchers to control for errors and/or to normalize
signals.
SUMMARY OF THE INVENTION
[0007] The present invention provides reagents and methods that are
useful in normalizing and standardizing data from nucleic acid
hybridization studies, and particularly from microarray-based
hybridizations. The present invention teaches that it is useful to
define nucleotide sequences that are "alien" to the sequence
population under analysis. Such alien sequences may be included on
microarrays and will not hybridize with the nucleic acid population
under study. Alternatively or additionally, sequences complementary
to the alien sequences may be mixed together with (i.e., "spiked"
into) the hybridizing population in order to control for processing
and hybridization events.
[0008] Use of the alien sequences (and/or their complements)
according to the present invention provides a number of advantages.
For instance, when an alien sequence is included in a microarray
and its complement is not included in the hybridizing sample, the
alien sequence may act as a negative control, revealing defects in
hybridization conditions that could affect the experimental
outcome.
[0009] Furthermore, when an alien oligonucleotide is present on an
array, its complement may be added to the hybridizing sample, and
processed and hybridized together with that sample, as a control
for the processing/hybridization steps. If the alien
oligonucleotide is present in spots at different locations on the
chip, this strategy can also be used to control intra-chip
hybridization variations.
[0010] Moreover, when the amount of anti-alien spiking nucleic acid
(and/or alien oligonucleotide) is known in advance, the degree of
anti-alien/alien hybridization may be relied upon to establish the
amount of non-alien sequences present in the hybridizing sample
based on the relative extent of their hybridization to
complementary oligonucleotides. In fact, in some embodiments,
multiple alien/anti-alien pairs at different amounts are utilized
in order to provide multiple points for comparative quantitation of
other nucleic acids. In certain preferred embodiments, the alien
sequence probe and the probe detecting the target sequence to be
quantified are mixed together in the same spot to allow in situ
comparisons. This approach also provides a consistent standard (the
fixed amount of alien probe) that can be relied upon to allow
inter-slide comparisons and inter-experiment comparisons even when
the experiments are carried out using rare samples (i.e., in a
situations where the number of experimental replicates that can be
performed for control purposes is limited), or over long time
spans, etc.
[0011] Thus, alien sequence probes and their complements can be
used to normalize the data obtained from array hybridizations. For
instance, if every spot in an array contains a defined ratio of
experimental probes to alien probes, the presence of the alien
probes allows the researcher to control for variations between or
among spots (e.g., by hybridizing the array with a sample
containing anti-alien sequences that are differently labeled from
the nucleic acid sequences under study).
[0012] Additionally, the presence of alien probes in microarray
spots allows researchers to assess the quality and consistency of
microarray fabrication and/or printing/spotting techniques. For
example, when alien sequences are present in all or a
representative collection of spots, the presence or absence of
particular spots, overall spot morphology, and slide quality can
often be assessed by hybridization (in parallel or simultaneously
with experimental hybridization) with an anti-alien nucleic acid.
Even random spotting of alien sequences can provide information
about the overall integrity or uniformity of a slide. Often,
however, it will at least be desirable to include alien sequences
in one or more spots containing experimental samples so as to
provide a direct assessment of an experimentally relevant spot.
DESCRIPTION OF THE DRAWING
[0013] FIG. 1 shows 100 sequences identified according to the
present invention as "alien" to mouse cDNA.
[0014] FIG. 2 shows about 50 oligonucleotides identified according
to the present invention as alien to mouse cDNA and useful for
hybridization applications.
[0015] FIG. 3 shows that inventive alien oligonucleotides, selected
as alien to both mouse and human cDNAs, do not hybridize with
commercially available universal mouse and human mRNA sets. The
presence of alien oligonucleotide probes on the slide is
demonstrated on FIG. 3A, by detection of fluorescent signals over
the whole array, after enzymatic 3'-OH labeling with terminal
deoxynucleotidyl transferase in the presence of dCTP-Cy3. FIG. 3B
shows that in the absence of such treatment the alien probe
sequences failed to yield appreciable signal intensity above
background threshold, while the human and mouse positive control
sequence probes were detectable.
[0016] FIG. 4 ranks the alien oligonucleotides depicted in FIG. 2
based on normalized median fluorescence intensity minus background
when hybridized with standard human and mouse mRNA samples.
[0017] FIG. 5 ranks the alien oligonucleotides depicted in FIG. 2
based on their percentage of hybridization with standard human and
mouse mRNA samples, as compared with the positive control
oligonucleotides designed to hybridize with those samples.
[0018] FIG. 6 illustrates the inventive anti-alien in-spike control
concept. Panels A-C show sequences of alien genes designed by
linking four 70 mer alien sequences together. Panel D shows a
microarray containing four alien oligonucleotides whose sequences
are present in one of the alien genes, and four that are unrelated.
Panel E shows that cDNAs corresponding to the non-coding strand of
the alien gene hybridize with the expected alien oligonucleotides
on the chip, and not with the unrelated alien oligonucleotides.
[0019] FIG. 7 illustrates the inventive concept of using alien
sequences as internal controls for microarray spotting and
hybridization. Microarrays were constructed in which a single alien
oligonucleotide, AO892, was spotted by itself or with a mixture of
other 70 mer oligonucleotide probes. AO892 alone or the probe
mixture containing AO892 was spotted in concentrations ranging from
2 to 20 .mu.M. The figure insert presents a small area of such a
microarray. The graph shows the variations of the normalized signal
intensity as a function of concentration of probe mixture, for
AO892-alone spots and mixture spots.
[0020] FIG. 8 illustrates the inventive concept of using an alien
oligonucleotide and its complementary sequence as controls for in
situ normalization. In such experiments, a microarray, to which an
alien 70 mer probe has been co-printed with different gene specific
probes, is contacted with a hybridization mixture containing the
complementary sequence of the alien oligo labeled with Alexa-488,
and two different nucleic acid test samples labeled with Cy3 and
Cy5, respectively. A 3 color laser scanner is used to analyze the
hybridized microarray.
[0021] FIG. 9 shows a comparison of the use of alien sequences as a
reference to Stratagene Universal Mm RNA. FIG. 9A shows the
log.sub.10 intensity distribution of the reference channel. The
Universal Mouse RNA channel is labeled Cy5 and Cy3 in different
experiments and is normalized for dye effects. The aliens were
labeled with Alexa488. The alien hybridization intensities are
within the range of the scanner. FIG. 9B shows a histogram
depicting the number of spots in the final analysis as compared to
the total number of spots on the array. There are totally 19,552
spots on the array. Hybridization signal intensities were
measurable from 18,268 spots in the case of the aliens and 8,667
spots in the case of Stratagene Universal RNA. Of these, 6,866
alien spots and 5,302 universal spots were used in the final
analysis for indirect comparisons.
[0022] FIG. 10 shows the log.sub.2 ratio of hybridization signal
intensity of mouse liver mRNA to macrophage RNA. Comparison of
ratios measured from direct comparison on microarrays to (A)
indirect ratios using alien oligos and signals as reference and (B)
using Stratagene Universal Mouse RNA as reference. The correlation
coefficient for each plot is given in the plot.
[0023] FIG. 11 shows the relationship between the mean intensity
values from spike-in control spots to copy number.
DEFINITIONS
[0024] Throughout the specification, several terms are employed,
that are defined in the following paragraphs.
[0025] Alien gene--As used herein, the term "alien gene" refers to
a nucleotide molecule comprised of at least two concatermerized
alien sequences. The gene may contain multiple copies of a single
alien sequence, or alternatively may contain a plurality of
different alien sequences. An alien gene may be single or double
stranded, and may contain or be associated with a promoter or other
control sequence that will direct the production of a template of
either strand of the gene. In particular, as will be clear from
discussions herein, in some embodiments of the invention it will be
desirable to produce an alien gene transcript that is an alien
sequence, whereas in other embodiments it will be desirable to
produce an alien gene transcript that is complementary to an alien
sequence.
[0026] Alien sequence--A nucleotide sequence is considered "alien"
to a particular source or collection of nucleic acids if it does
not hybridize with nucleic acids in the source or collection. For
example, if the source or collection is mRNA from normal kidney
cells, an oligonucleotide will have a sequence that is "alien" to
the mRNA if its complement is not present in the mRNA. Conversely,
if the source or collection is cDNA from the same cells, then an
oligonucleotide will have a sequence that is "alien" to the cDNA if
its complement is not present in the cDNA. In certain preferred
embodiments of the invention, the source or collection comprises
expressed nucleic acids (e.g., mRNA or cDNA) of a target organism
(e.g., mouse, dog, human, etc), tissue (e.g., breast, lung, colon,
liver, brain, kidney, etc), or cell type (e.g., before or after
exposure to a particular stimulus or treatment). Alternatively or
additionally, the source or collection may preferably be a
plurality of nucleic acids to be hybridized to an array.
[0027] Hybridizing sample--The terms "hybridizing sample" and
"hybridizing mixture" are used herein interchangeably. They refer
to the nucleic acid sample being or intended to be hybridized to a
microarray. Those of ordinary skill in the art will appreciate that
the hybridizing sample may contain DNA, RNA, or both, but most
commonly contains cDNA. Those of ordinary skill in the art will
further appreciate that the hybridizing sample typically contains
nucleic acids whose hybridization with probes on an array is
detectable. For example, in many embodiments, the hybridizing
sample comprises or consists of detectably labeled nucleic
acids.
[0028] Detectably labeled--The terms "labeled", "detectably
labeled" and "labeled with a detectable agent" are used herein
interchangeably. They are used to specify that a nucleic acid
molecule or individual nucleic acid segments from a sample can be
detected and/or visualized following binding (i.e., hybridization)
to probes immobilized on an array. Nucleic acid samples to be used
in the methods of the invention may be detectably labeled before
the hybridization reaction or a detectable label may be selected
that binds to the hybridization product. Preferably, the detectable
agent or moiety is selected such that it generates a signal which
can be measured and whose intensity is related to the amount of
hybridized nucleic acids. Preferably, the detectable agent or
moiety is also selected such that it generates a localized signal,
thereby allowing spatial resolution of the signal from each spot on
the array. Methods for labeling nucleic acid molecules are well
known in the art (see below for a more detailed description of such
methods). Labeled nucleic acids can be prepared by incorporation of
or conjugation to a label, that is directly or indirectly
detectable by spectroscopic, photochemical, biochemical,
immunochemical, radiochemical, electrical, optical, or chemical
means. Suitable detectable agents include, but are not limited to:
various ligands, radionuclides, fluorescent dyes, chemiluminescent
agents, microparticles, enzymes, calorimetric labels, magnetic
labels, and haptens. Detectable moieties can also be biological
molecules such as molecular beacons and aptamer beacons.
[0029] Fluorescent Label--The terms "fluorophore", "fluorescent
moiety", "fluorescent label", "fluorescent dye" and "fluorescent
labeling moiety" are used herein interchangeably. They refer to a
molecule which, in solution and upon excitation with light of
appropriate wavelength, emits light back. Numerous fluorescent dyes
of a wide variety of structures and characteristics are suitable
for use in the practice of this invention. Similarly, methods and
materials are known for fluorescently labeling nucleic acids (see,
for example, R. P. Haugland, "Molecular Probes: Handbook of
Fluorescent Probes and Research Chemicals 1992-1994", 5.sup.th Ed.,
1994, Molecular Probes, Inc.). In choosing a fluorophore, it is
generally preferred that the fluorescent molecule absorbs light and
emits fluorescence with high efficiency (i.e., it has a high molar
absorption coefficient and a high fluorescence quantum yield,
respectively) and is photostable (i.e., it does not undergo
significant degradation upon light excitation within the time
necessary to perform the array-based hybridization). Suitable
fluorescent labels for use in the practice of the methods of the
invention include, for example, Cy-3.TM., Cy-5.TM., Texas red,
FITC, Spectrum Red.TM., Spectrum Green.TM., Alexa-488,
phycoerythrin, rhodamine, fluorescein, fluorescein isothiocyanine,
carbocyanine, merocyanine, styryl dye, oxonol dye, BODIPY dye, and
equivalents, analogues or derivatives of these molecules.
[0030] Microarray--The terms "microarray", "chip" and "biochip" are
used herein interchangeably. They refer to an arrangement, on a
substrate surface, of multiple nucleic acid molecules of known or
unknown sequences. These nucleic acid molecules are immobilized to
discrete "spots" (i.e., defined locations or assigned positions) on
the substrate surface. A discrete spot may contain a single nucleic
acid molecule or a mixture of different nucleic acid molecules.
Spots on an array may be arranged on the substrate surface at
different densities. In general, microarrays with probe pitch
smaller than 500 .mu.m (i.e., density larger than 400 probes per
cm.sup.2) are referred to as high density microarrays, otherwise,
they are called low density microarrays. Arrays come as
two-dimensional probe matrices (or supports), which can be solid or
porous, planar or non-planar, unitary or distributed. The term
"micro-array" more specifically refers to an array that is
miniaturized so as to require microscopic examination for visual
evaluation. Arrays used in the methods of the invention are
preferably microarrays. The present invention provides microarrays
in which at least one spot contains an alien oligonucleotide. Other
types of microarrays and sets of microarrays provided by the
invention are described below.
[0031] Oligonucleotide--As used herein, the term "oligonucleotide",
refers to usually short strings of DNA or RNA to be used as
hybridizing probes or nucleic acid molecule array elements. These
short stretches of sequence are often synthesized chemically. As
will be appreciated by those skilled in the art, the length of the
oligonucleotide (i.e., the number of nucleotides) can vary widely,
often depending on its intended function or use. Generally,
oligonucleotides of at least 6 to 8 bases are used, with
oligonucleotides ranging from about 10 to 500 bases being
preferred, with from about 20 to 200 bases being particularly
preferred, and 40 to 100 bases being especially preferred. Longer
oligonucleotide probes are usually preferred in array-based
hybridization reactions, since higher stringency hybridization and
wash conditions can be used, which decreases or eliminates
non-specific hybridization.
[0032] Probe--For the purposes of the present invention, a "probe"
is a nucleic acid, often an oligonucleotide that is, or is intended
to be, attached to a solid support in an array. Preferably, the
probes that comprise a microarray or biochip are of a defined
length and similarity. This allows for similar hybridization
characteristics. As is well known to those skilled in the art, for
the hybridization characteristics to be similar across a wide range
of oligonucleotides, it is typically required that the probes on
the array be of the substantially same length, have a similar
percentage of Guanine to Cytosine content and lack any extensive
runs of poly A, poly G, poly C, or poly T tracts. The goal of
controlling these parameters is to produce probes that have similar
melting and hybridization temperatures. Additionally, these probes
should, preferably, lack length complementary regions and not form
hairpin structures.
[0033] Target--The term "target" refers to nucleic acids intended
to be hybridized (or bound) to probes immobilized on microarrays by
sequence complementarity. As is well-known in the art, target
nucleic acids may be obtained from a wide variety of organisms,
tissues or cells. Methods and techniques for the extraction,
manipulation and preparation of nucleic acids for hybridization
reactions are well-known in the art (see, for example, J. Sambrook
et al., "Molecular Cloning: A Laboratory Manual", 1989, 2.sup.nd
Ed., Cold Spring Harbour Laboratory Press: New York, N.Y.; "PCR
Protocols: A Guide to Methods and Applications", 1990, M. A. Innis
(Ed.), Academic Press: New York, N.Y.; P. Tijssen "Hybridization
with Nucleic Acid Probes--Laboratory Techniques in Biochemistry and
Molecular Biology (Parts I and II)", 1993, Elsevier Science; "PCR
Strategies", 1995, M. A. Innis (Ed.), Academic Press: New York,
N.Y.; and "Short Protocols in Molecular Biolog", 2002, F. M.
Ausubel (Ed.), 5.sup.th Ed., John Wiley & Sons).
[0034] Hybridization--The term "hybridization" has herein its art
understood meaning and refers to the binding of two single stranded
nucleic acids via complementary base pairing. A hybridization
reaction is called specific when a nucleic acid molecule
preferentially binds, duplexes, or hybridizes to a particular
nucleic acid sequence under stringent conditions (e.g., in the
presence of competitor nucleic acids with a lower degree of
complementarity to the hybridizing strand).
[0035] High stringency conditions--For microarray-based
hybridization, standard "high stringency conditions" are defined
for solution phase hybridization as aqueous hybridization (i.e.,
free of formamide) in 6.times.SSC (where 20.times.SSC contains 3.0
M NaCl and 0.3 M sodium citrate), 1% SDS at 65.degree. C. for at
least 8 hours, followed by one or more washes in 0.2.times.SSC,
0.1% SDS at 65.degree. C. "Moderate stringency conditions" are
defined for solution phase hybridization as aqueous hybridization
(i.e., free of formamide) in 6.times.SSC, 1% SDS at 65.degree. C.
for at least 8 hours, followed by one or more washes in
2.times.SSC, 0.1% SDS at room temperature.
DESCRIPTION OF CERTAIN PREFERRED EMBODIMENTS OF THE INVENTION
[0036] The present invention provides reagents and methods that are
useful in normalizing and standardizing data from nucleic acid
hybridization studies, and particularly from microarray
hybridizations. The present invention teaches that it is useful to
define nucleotide sequences that are "alien" to the sequence
population under analysis.
[0037] In particular, the use of such alien oligonucleotide
sequences in micro-array based hybridization is herein described to
be able to serve several distinct control purposes. For example,
(1) when spotted on microarrays, alien sequences can serve as
negative controls during the course of hybridization
experimentation to assess the stringency (i.e., specificity) of
target-to-probe hybridization. (2) Alien oligonucleotides spotted
on micro-arrays, in combination with their complementary sequences
used as in-spike controls can enable the experimenter to gauge the
robustness of both the overall target labeling and hybridization
efficiency. (3) When alien probe sequences are present within each
sub-array on the biochip, they allow regional (intra-slide) effects
of hybridization to be ascertained. (4) Alien oligonucleotides can
also be used as in-spot controls and act as references so that
inter-slide differences can be measured relative to a consistent
control. (5) Detectably labeled alien sequences can be used to
normalize the signal intensities of the samples under analysis on a
per spot basis. Also, (6) in situ alien sequences may also be used
to quality control the DNA microarray printing process.
[0038] In a first aspect, the present invention provides methods of
identifying nucleotide sequences that are alien to a selected
population.
Generating or Selecting Alien Sequences
[0039] As mentioned above, a nucleotide sequence is considered
"alien" to a particular source or collection of nucleic acids if it
does not hybridize with nucleic acids in the source or collection.
For example, if the source or collection is mRNA or cDNA, then an
oligonucleotide has a sequence that is "alien" to the mRNA or cDNA
if its complement is not present in the mRNA or cDNA. Preferred
alien oligonucleotides of the invention have complementary
sequences that are maximally dissimilar from (i.e., non-identical
to) those present in the source or collection.
[0040] When comparing polynucleotide sequences, two sequences are
said to be "identical" if the sequence of nucleotides in the two
sequences is the same when aligned for maximum correspondence.
Comparisons between two sequences are typically performed by
comparing the sequences over a comparison window to identify and
compare local regions of sequence similarity. A "comparison window"
refers to a segment of at least about 20 contiguous positions,
usually 30 to about 75, or 40 to about 50, in which a sequence may
be compared to a reference sequence of the same number of
contiguous positions after the two sequences are optimally
aligned.
[0041] Any of a wide variety of selection methods, systems or
strategies that lead to the generation of oligonucleotides alien to
a source or collection of nucleic acids can be used in the practice
of the present invention. Such methods may, for example, be based
on the use of an algorithm.
[0042] The present invention provides such an algorithm, in which
the underlying logic is that of "partially reversing" the
mathematical logic of the standard Hidden Markov Model. Such
standard models are used to generate model sequences of DNA, RNA,
proteins as well as other biological molecules, based on the
statistics of known real (i.e., naturally occurring) sequences.
Model sequences are generated based on sets of sequence symbol
occurrences. For example, given the measured nearest neighbor
frequencies (i.e., how often one nucleotide follows another) one
then draws and outputs "randomly" from that set proportional to
those frequencies. A very wide range of sequences statistics can be
employed, from the simplest, the occurrence frequencies of the
individual symbols, through all possible nearest neighbor
frequencies to arbitrary spaced sequences frequencies.
[0043] A first approach used by the Applicants with the goal of
generating "alien" or maximally dissimilar sequences from known
real sequences was to perform a complete "reversal" of the
statistics (i.e., to invert the sets of occurrence probability from
most likely to least likely). However, when this strategy was
tested over a very large set of sequences statistics, it did not
work.
[0044] What did work in generating model sequences which are
maximally dissimilar from those employed to obtain the sequence
statistics, was to use a Markov process, in which, at an adjustable
frequency, one draws from the measured real statistics but
inversely proportional to those frequencies (or probability
distributions). The sequence generated by this process contains,
scattered throughout its length, intermittent highly improbable
sequence patterns or subsequences. The frequency with which one
switches between draws from the measured real sequence occurrence
frequencies proportional to those frequencies and inversely
proportional to those frequencies and inversely, ranges from one in
five to one in ten. The selection of this ratio is partly a
function of which sets of sequence statistics are used.
[0045] In the generation of maximally dissimilar DNA or mRNA
complement sequences for microarray controls, preferably in the
length range of 50 to 70 nucleotides, codon occurrence and codon
boundary di-nucleotide frequencies were used for a range of inverse
proportional inverse probability draws on these two statistics.
This process was then followed by two filters, including: (1) a
full genome sequence similarity search of all known or predicted
protein coding regions, and (2) the calculation of TMs for all
possible mRNA annealings for those with any sequence similarities
above 60% identity and/or with matching runs longer than 18
nucleotides. All generated sequences with predicted annealing
temperature above 37.degree. C. or runs of twenty identities were
eliminated. The TMs (i.e., midpoint disassociation temperatures)
were calculated using multiple public domain software which
included nucleotide stacking energies. This resulted in
approximately one predicted "alien" or non-mRNA annealing oligo for
every 5,000 genome coding regions in the higher animal and plant
eukaryotic genomes currently known. Sets of these alien sequences
were then synthesized and placed on "long oligo" microarray chips
and physically tested for their annealing to real mRNA and/or cDNA
samples. With rare exceptions (of one in ten), no detectable
annealing was observed under standard experimental conditions for
70 mer oligo array chips for 21,000 mouse genes. These alien
sequences then define a set of negative controls.
[0046] A set of microarray "alien positive controls" was then
generated from the above set of alien oligo negative control
sequences using the following algorithm. First all possible set of
three to five sequentially concatenated alien oligos as defined
above were generated in silico. These were investigated for the
incidental creation of a sequence crossing the boundary between the
concatenated alien oligos that have a significant match or
predicted annealing TM above 37.degree. C. to any of the non-alien
oligos on the micro-array targeted. Only those that showed no such
matches or higher TMs were selected. These oligos were then
physically synthesized as "positive alien gene" controls and tested
for their ability to only anneal to their complementary alien
oligos.
[0047] FIG. 1 shows about 100 sequences (of about 1000) that were
generated using the inventive alien cDNA algorithm described above,
by inverting sequences 35% of the time. FIG. 2 shows about 50
oligonucleotides identified as alien to mouse cDNA by the inventive
algorithm and useful for hybridization applications.
[0048] In light of the inventive results described herein, those of
ordinary skill in the art will appreciate that other algorithms may
be employed or developed, for example, to include filter steps
that, for example, verify the degree of "alien"ness of the selected
sequence by comparing the generated oligonucleotide sequences to
the organism's genome (if available) or cDNA by using any of a
large number of sequence comparison programs.
[0049] A variety of methods for determining relationships between
two or more sequences (e.g., identity, similarity and/or homology)
are available, and well known in the art. The methods include
manual alignment, computer assisted sequence alignment and
combinations thereof. A number of algorithms (which are generally
computer implemented) for performing sequence alignment are widely
available, or can be produced by one of skill in the art. These
methods include, e.g., the local homology algorithm of Smith and
Waterman (Adv. Appl. Math., 1981, 2: 482); the homology alignment
algorithm of Needleman and Wunsch (J. Mol. Biol., 1970, 48: 443);
the search for similarity method of Pearson and Lipman (Proc. Natl.
Acad. Sci. (USA), 1988, 85: 2444); and/or by computerized
implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package Release 7.0,
Genetics Computer Group, 575 Science Dr., Madison, Wis.).
[0050] For example, a software for performing sequence identity
(and sequence similarity) analysis using the BLAST algorithm is
described in Altschul et al., J. Mol. Biol., 1990, 215: 403-410.
This software is publicly available, e.g., through the National
Center for Biotechnology Information on the World Wide Web at
ncbi.nlm.nih.gov. This algorithm involves first identifying high
scoring sequence pairs (HSPs) by identifying short words of length
W in the query sequence, which either match or satisfy some
positive-valued threshold score T when aligned with a word of the
same length in a database sequence. T is referred to as the
neighborhood word score threshold. These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are then extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always>0) and N (penalty score for
mismatching residues; always<0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score.
Extensions of the word hits in each direction are halted when: the
cumulative alignment score falls off by the quantity X from its
maximum achieved value; the cumulative score goes to zero or below,
due to the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both
strands. For amino acid sequences, the BLASTP (BLAST Protein)
program uses as defaults a wordlength (W) of 3, an expectation (E)
of 10, and the BLOSUM62 scoring matrix (see, Henikoff &
Henikoff, Proc. Natl. Acad. Sci. USA, 1989, 89:10915).
[0051] Additionally, the BLAST algorithm performs a statistical
analysis of the similarity between two sequences (see, e.g., Karlin
& Altschul, Proc. Natl. Acad. Sci. USA, 1993, 90: 5873-5787).
One measure of similarity provided by the BLAST algorithm is the
smallest sum probability (P(N)), which provides an indication of
the probability by which a match between two nucleotide or amino
acid sequences would occur by chance. For example, a nucleic acid
is considered similar to a reference sequence if the smallest sum
probability in a comparison of the test nucleic acid to the
reference nucleic acid is less than about 0.1, or less than about
0.01, and or even less than about 0.001.
[0052] Another example of a useful sequence alignment algorithm is
PILEUP. PILEUP creates a multiple sequence alignment from a group
of related sequences using progressive, pairwise alignments. It can
also plot a tree showing the clustering relationships used to
create the alignment. PILEUP uses a simplification of the
progressive alignment method of Feng & Doolittle (J. Mol. Evol.
1987, 35: 351-360). The method used is similar to the method
described by Higgins & Sharp (CABIOS, 1989, 5: 151-153). The
program can align, e.g., up to 300 sequences of a maximum length of
5,000 letters. The multiple alignment procedure begins with the
pairwise alignment of the two most similar sequences, producing a
cluster of two aligned sequences. This cluster can then be aligned
to the next most related sequence or cluster of aligned sequences.
Two clusters of sequences can be aligned by a simple extension of
the pairwise alignment of two individual sequences. The final
alignment is achieved by a series of progressive, pairwise
alignments. The program can also be used to plot a dendogram or
tree representation of clustering relationships. The program is run
by designating specific sequences and their nucleotide coordinates
for regions of sequence comparison.
[0053] An additional example of an algorithm that is suitable for
multiple DNA sequence alignments is the CLUSTALW program (J. D.
Thompson et al., Nucl. Acids. Res. 1994, 22: 4673-4680). CLUSTALW
performs multiple pairwise comparisons between groups of sequences
and assembles them into a multiple alignment based on homology. Gap
open and Gap extension penalties can be, e.g., 10 and 0.05
respectively.
[0054] An algorithm for the selection of alien sequences may also
include filter steps that check for TM, % GC content,
low-complexity regions and self hybridization. A large number of
software programs (including those described above) are available
and can be used to carry out these steps.
Alien Oligonucleotide Preparation
[0055] In another aspect, the present invention provides isolated
oligonucleotides or nucleic acids that are alien to a given source
or collection of nucleic acids. As will be appreciated by one
skilled in the art, alien oligonucleotides may be of different
lengths, depending on their intended use (as negative control,
normalization and/or quantification tool or as in-spike control).
For example, alien oligonucleotides may contain a single alien
sequence. Alternatively, an alien oligonucleotide may contain at
least two alien sequences linked to one another. Inventive
oligonucleotides provided herein also include those polynucleotides
that contain anti-alien sequences. For example, as described
herein, it will often be desirable to prepare anti-alien sequences
for use in hybridization reactions. In some embodiments, such
sequences are prepared by polymerization directed by an alien
gene.
[0056] Alien and anti-alien oligonucleotides of the invention may
be prepared by any of a variety of chemical techniques well-known
in the art, including, for example, chemical synthesis and
polymerization based on a template (see, for example, S. A. Narang
et al., Meth. Enzymol. 1979, 68: 90-98; E. L. Brown et al., Meth.
Enzymol. 1979, 68: 109-151; E. S. Belousov et al., Nucleic Acids
Res. 1997, 25: 3440-3444; D. Guschin et al., Anal. Biochem. 1997,
250: 203-211; M. J. Blommers et al., Biochemistry, 1994, 33:
7886-7896; and K. Frenkel et al., Free Radic. Biol. Med. 1995, 19:
373-380; see also for example, U.S. Pat. No. 4,458,066).
[0057] For example, oligonucleotides may be prepared using an
automated, solid-phase procedure based on the phosphoramidite
approach. In such a method, each nucleotide is individually added
to the 5'-end of the growing oligonucleotide chain, which is
attached at the 3'-end to a solid support. The added nucleotides
are in the form of trivalent 3'-phosphoramidites that are protected
from polymerization by a dimethoxytrityl (or DMT) group at the
5'-position. After base base-induced phosphoramidite coupling, mild
oxidation to give a pentavalent phosphotriester intermediate and
DMT removal provides a new site for oligonucleotide elongation. The
oligonucleotides are then cleaved off the solid support, and the
phosphodiester and exocyclic amino groups are deprotected with
ammonium hydroxide. These syntheses may be performed on commercial
oligo synthesizers such as the Perkin Elmer/Applied Biosystems
Division DNA synthesizer. Such a synthesis is described in Example
2.
[0058] Oligonucleotides can also be custom made and ordered from a
variety of commercial sources well-known in the art, including, for
example, the Midland Certified Reagent Company (mcrc@oligos.com),
The Great American Gene Company (available on the World Wide Web at
genco.com), ExpressGen Inc. (available on the World Wide Web at
expressgen.com), Operon Technologies Inc. (Alameda, Calif.) and
many others.
[0059] Purification of oligonucleotides of the invention, where
necessary, may be carried out by any of a variety of methods
well-known in the art. Purification of oligonucleotides is
typically performed by either by native acrylamide gel
electrophoresis or by anion-exchange HPLC as described, for
example, by Pearson and Regnier (J. Chrom. 1983, 255: 137-149). The
sequence of the synthetic oligonucleotides can be verified using
the chemical degradation method of Maxam and Gilbert (in Grossman
and Moldave (Eds.), Academic Press, New York, Methods in
Enzymology, 1980, 65: 499-560).
Assembling Arrays
[0060] The present invention provides nucleic acid arrays in which
at least one spot contains an alien oligonucleotide. More
specifically, inventive nucleic acids arrays comprise a solid
support, and a plurality of nucleic acid probes attached to the
solid support at discrete locations, wherein at least one the
probes is an alien probe in that it has a sequence that is alien to
a hybridizing mixture to be hybridized to the array.
[0061] Microarrays generally have sample spot sizes of less than
200 .mu.m diameter, and generally contain thousands of spots per
slide. For gene-expression analysis, each microarray preferably
contains at least about 1,000, 5,000, 10,000, 50,000, 100,000, or
500,000 spots. The probes are printed (or attached) to the surface
of the substrate, and the number of probes per unit area of the
print surface is called the print density. The print surface
corresponds to that area of the substrate on which the individual
probes are printed, plus the surface area between the individual
probes. If there are two or more groupings of a substantial number
of probes on the substrate surface separated by surface area in
which few or no probes are printed, the print surface includes the
surface area between probes of a group but not the surface area of
the substrate between groupings. For gene expression analysis, the
print density is preferably high so that a large number of probes
can fit on the substrate. Preferably, the print density is at least
about 200, 500, 1,000, 5,000, 10,000, 20,000, or 40,000 probes per
cm.sup.2.
[0062] There are two standard types of DNA microarray technology in
terms of the nature of the arrayed DNA sequence. In the first
format, probe cDNA sequences (typically 500 to 5,000 bases long)
are immobilized to a solid surface and exposed to a plurality of
targets either separately or in a mixture. In the second format,
oligonucleotides (typically 20-80-mer oligos) or peptide nucleic
acid (PNA) probes are synthesized either in situ (i.e., directly
on-chip) or by conventional synthesis followed by on-chip
attachment, and then exposed to labeled samples of nucleic acids.
In the present invention, microarrays of the second type are
preferably used.
[0063] In the practice of the methods of the invention,
investigators may either buy commercially available arrays (for
example, from Affymetrix Inc. (Santa Clara, Calif.), Illumina, Inc.
(San Diego, Calif.), Spectral Genomics, Inc. (Houston, Tex.), and
Vysis Corporation (Downers Grove, Ill.)), or generate their own
starting microarrays (i.e., arrays to which at least one alien
oligonucleotide is to be spotted). Methods of making and using
arrays are well known in the art (see, for example, S. Kern and G.
M. Hampton, Biotechniques, 1997, 23:120-124; M. Schummer et al.,
Biotechniques, 1997, 23:1087-1092; S. Solinas-Toldo et al., Genes,
Chromosomes & Cancer, 1997, 20: 399-407; M. Johnston, Curr.
Biol. 1998, 8: R171-R174; D. D. Bowtell, Nature Gen. 1999, Supp.
21:25-32; D. J. Lockhart and E. A. Winzeler, Nature, 2000, 405:
827-836; M. Cuzin, Transfus. Clin. Biol. 2001, 8:291-296; M. Gabig
and G. Wegrzyn, Acta Biochim. Pol. 2001, 48: 615-622; and V. G.
Cheung et al., Nature, 2001, 40: 953-958).
[0064] Arrays comprise a plurality of probes immobilized to
discrete spots (i.e., defined locations or assigned positions) on a
substrate surface. Substrate surfaces for use in the present
invention can be made of any of a variety of rigid, semi-rigid or
flexible materials that allow direct or indirect attachment (i.e.,
immobilization) of probes (including alien oligonucleotides) to the
substrate surface. Suitable materials include, but are not limited
to: cellulose (see, for example, U.S. Pat. No. 5,068,269),
cellulose acetate (see, for example, U.S. Pat. No. 6,048,457),
nitrocellulose, glass (see, for example, U.S. Pat. No. 5,843,767),
quartz or other crystalline substrates such as gallium arsenide,
silicones (see, for example, U.S. Pat. No. 6,096,817), various
plastics and plastic copolymers (see, for example, U.S. Pat. Nos.
4,355,153; 4,652,613; and 6,024,872), various membranes and gels
(see, for example, U.S. Pat. No. 5,795,557), and paramagnetic or
supramagnetic microparticles (see, for example, U.S. Pat. No.
5,939,261). When fluorescence is to be detected, arrays comprising
cyclo-olefin polymers may preferably be used (see, for example,
U.S. Pat. No. 6,063,338).
[0065] The presence of reactive functional chemical groups (such
as, for example, hydroxyl, carboxyl, amino groups and the like) on
the material can be exploited to directly or indirectly attach
probes including alien oligonucleotide sequences to the substrate
surface. Methods of attachment (or immobilization) of
oligonucleotides on substrate supports have been described and are
well-known to those skilled in the art (see, for example, U. Maskos
and E. M. Southern, Nucleic Acids Res. 1992, 20: 1679-1684; R. S.
Matson et al., Anal. Biochem. 1995, 224; 110-116; R. J. Lipshutz et
al., Nat. Genet. 1999, 21: 20-24; Y. H. Rogers et al., Anal.
Biochem. 1999, 266: 23-30; M. A. Podyminogin et al., Nucleic Acids
Res. 2001, 29: 5090-5098; Y. Belosludtsev et al., Anal. Biochem.
2001, 292: 250-256).
[0066] Methods of preparation of oligonucleotide-based arrays that
can be used to attach probes to surface support of microarrays
include: synthesis in situ using a combination of photolithography
and oligonucleotide chemistry (see, for example, A. C. Pease et
al., Proc. Natl. Acad. Sci. USA 1994, 91: 5022-5026; D. J. Lockhart
et al., Nature Biotech. 1996, 14: 1675-1680; S. Singh-Gasson et
al., Nat. Biotechn. 1999, 17: 974-978; M. C. Pirrung et al., Org.
Lett. 2001, 3: 1105-1108; G. H. McGall et al., Methods Mol. Biol.
2001, 170; 71-101; A. D. Barone et al., Nucleosides Nucleotides
Nucleic Acids, 2001, 20: 525-531; J. H. Butler et al., J. Am. Chem.
Soc. 2001, 123: 8887-8894; E. F. Nuwaysir et al., Genome Res. 2002,
12: 1749-1755). The chemistry for light-directed oligonucleotide
synthesis using photo labile protected 2'-deoxynucleoside
phosphoramides has been developed by Affymetrix Inc. (Santa Clara,
Calif.) and is well known in the art (see, for example, U.S. Pat.
Nos. 5,424,186 and 6,582,908).
[0067] Alternatively or additionally, oligo probes may first be
prepared or print-ready oligonucleotide (e.g., 60-70 mers) sets
that are commercially available for human, mouse and other organism
(see, for example, http://www.cgen.com, http://www.operon.com) may
be obtained and then attached to the array surface. Similarly,
alien oligonucleotides are first synthesized and then immobilized
on the surface of a microarray.
[0068] In these cases, the preparation of microarrays is preferably
carried out by high-speed printing robotics. The established
robotic spotting technique (U.S. Pat. No. 5,807,522) uses a
specially designed mechanical robot, which produces a probe spot on
the microarray by dipping a pin head into a fluid containing an
off-line synthesized nucleic acid molecule and then spotting it
onto the slide at a pre-determined position. Washing and drying of
the pins are required prior to the spotting of a different probe in
the microarray. In current designs of such robotic systems, the
spotting pin, and/or the stage carrying the microarray substrates
move along the XYZ axes in coordination to deposit samples at
controlled positions of the substrates.
[0069] In addition to the established quill-pin spotting
technologies, there are a number of microarray fabrication
techniques that are being developed. These include the inkjet
technology and capillary spotting.
[0070] Example 2 describes the printing of alien oligonucleotides
to the surface of oligo slides (CodeLink, Amersham Biosciences,
Piscataway, N.J.), which also contain human and mouse positive
control spots.
[0071] As mentioned above, microarrays provided by the present
invention are arrays containing a plurality of oligo probes and in
which at least one spot contains an alien oligonucleotide. In
certain preferred embodiments, an alien oligonucleotide is printed
at more than one spot on the array. For example, an inventive
microarray may contain, in addition to a plurality of oligo probes,
a representative collection of spots containing the same or
different concentrations of the alien oligonucleotide.
Alternatively, all the spots on an inventive microarray may contain
the same or different concentrations of the alien
oligonucleotide.
[0072] In other embodiments, an inventive microarray contains at
least two different alien oligonucleotides. These alien
oligonucleotides may be spotted randomly throughout the whole array
or they may be present in specific areas of the substrate surface,
for example, forming probe elements (i.e., sub-arrays) containing
only one type of alien oligonucleotide.
[0073] In still other embodiments, an inventive microarray contains
alien oligonucleotides of different sizes. For example, an
inventive microarray may contain a first oligonucleotide comprising
a single alien sequence and a second oligonucleotide comprising at
least two different alien sequences. The presence of both types of
alien oligonucleotides on the microarray may, for example, allow
two different types of controls to be performed.
[0074] The present invention also provides sets of microarrays that
all contain identical probe elements (i.e., defined sets of spots)
except for one microarray (or part of one microarray), which
contains no alien oligonucleotide and another microarray (or part
of a microarray) that contains the same probe elements but with
fixed amount(s) of alien oligonucleotide.
Labeling of Nucleic Acid Molecules
[0075] In certain embodiments, nucleic acid molecules of the
hybridizing mixture are labeled with a detectable agent before
hybridization. In other embodiments, complementary sequences of
alien oligonucleotides (i.e., anti-alien oligonucleotides), which
are added to the hybridization sample before hybridization, are
also labeled. In both cases, the role of a detectable agent is to
facilitate detection and to allow visualization of hybridized
nucleic acids. Preferably, the detectable agent is selected such
that it generates a signal which can be measured and whose
intensity is related to the amount of labeled nucleic acids present
in the sample being analyzed. The detectable agent is also
preferably selected such that it generates a localized signal,
thereby allowing spatial resolution of the signal from each spot on
the array.
[0076] The association between the nucleic acid molecule and
detectable agent can be covalent or non-covalent. Labeled nucleic
acids can be prepared by incorporation of or conjugation to a
detectable moiety. Labels can be attached directly to the nucleic
acid or indirectly through a linker. Linkers or spacer arms of
various lengths are known in the art and are commercially
available, and can be selected to reduce steric hindrance, or to
confer other useful or desired properties to the resulting labeled
molecules (see, for example, E. S. Mansfield et al., Mol. Cell.
Probes, 1995, 9: 145-156).
[0077] Many methods for labeling nucleic acid molecules are
well-known in the art. For a review of labeling protocols, label
detection techniques and recent developments in the field, see, for
example, L. J. Kricka, Ann. Clin. Biochem. 2002, 39: 114-129; R. P.
van Gijlswijk et al., Expert Rev. Mol. Diagn. 2001, 1: 81-91; and
S. Joos et al., J. Biotechnol. 1994, 35: 135-153. Standard nucleic
acid labeling methods include: incorporation of radioactive agents,
direct attachment of fluorescent dyes or of enzymes; chemical
modifications of nucleic acids making them detectable
immunochemically or by other affinity reactions; and
enzyme-mediated labeling methods, such as random priming, nick
translation, PCR and tailing with terminal transferase. More
recently developed nucleic acid labeling systems include, but are
not limited to: ULS (Universal Linkage System; see, for example, R.
J. Heetebrij et al., Cytogenet. Cell. Genet. 1999, 87: 47-52),
photoreactive azido derivatives (see, for example, C. Neves et al.,
Bioconjugate Chem. 2000, 11: 51-55), and alkylating agents (see,
for example, M. G. Sebestyen et al., Nat. Biotechnol. 1998, 16:
568-576).
[0078] Any of a wide variety of detectable agents can be used in
the practice of the present invention. Suitable detectable agents
include, but are not limited to: various ligands, radionuclides
(such as, for example, .sup.32P, .sup.35S, .sup.3H, .sup.14C,
.sup.125I, .sup.131I and the like); fluorescent dyes (for specific
exemplary fluorescent dyes, see below); chemiluminescent agents
(such as, for example, acridinium esters, stabilized dioxetanes and
the like); microparticles (such as, for example, quantum dots,
nanocrystals, phosphors and the like); enzymes (such as, for
example, those used in an ELISA, e.g., horseradish peroxidase,
beta-galactosidase, luciferase, alkaline phosphatase); colorimetric
labels (such as, for example, dyes, colloidal gold and the like);
magnetic labels (such as, for example, Dynabeads.TM.); and biotin,
dioxigenin or other haptens and proteins for which antisera or
monoclonal antibodies are available.
[0079] In certain preferred embodiments, nucleic acid molecules (or
anti-alien oligonucleotides) are fluorescently labeled. Numerous
known fluorescent labeling moieties of a wide variety of chemical
structures and physical characteristics are suitable for use in the
practice of this invention. Suitable fluorescent dyes include, but
are not limited to: Cy-3.TM., Cy-5.TM., Texas red, FITC, Alexa-488,
phycoerythrin, rhodamine, fluorescein, fluorescein isothiocyanine,
carbocyanine, merocyanine, styryl dye, oxonol dye, BODIPY dye
(i.e., boron dipyrromethene difluoride fluorophore), and
equivalents, analogues, derivatives or combinations of these
molecules. Similarly, methods and materials are known for linking
or incorporating fluorescent dyes to biomolecules such as nucleic
acids (see, for example, R. P. Haugland, "Molecular Probes:
Handbook of Fluorescent Probes and Research Chemicals 1992-1994",
5.sup.th Ed., 1994, Molecular Probes, Inc.). Fluorescent labeling
dyes as well as labeling kits are commercially available from, for
example, Amersham Biosciences, Inc. (Piscataway, N.J.), Molecular
Probes, Inc. (Eugene, Oreg.), and New England Biolabs, Inc.
(Berverly, Mass.).
[0080] Favorable properties of fluorescent labeling agents to be
used in the practice of the invention include high molar absorption
coefficient, high fluorescence quantum yield, and photostability.
Preferred labeling fluorophores exhibit absorption and emission
wavelengths in the visible (i.e., between 400 and 750 nm) rather
than in the ultraviolet range of the spectrum (i.e., lower than 400
nm).
[0081] Hybridization products may also be detected using one of the
many variations of the biotin-avidin technique system, which that
are well known in the art. Biotin labeling kits are commercially
available, for example, from Roche Applied Science (Indianapolis,
Ind.) and Perkin Elmer (Boston, Mass.).
[0082] Detectable moieties can also be biological molecules such as
molecular beacons and aptamer beacons. Molecular beacons are
nucleic acid molecules carrying a fluorophore and a non-fluorescent
quencher on their 5' and 3' ends. In the absence of a complementary
nucleic acid strand, the molecular beacon adopts a stem-loop (or
hairpin) conformation, in which the fluorophore and quencher are in
close proximity to each other, causing the fluorescence of the
fluorophore to be efficiently quenched by FRET (i.e., fluorescence
resonance energy transfer). Binding of a complementary sequence to
the molecular beacon results in the opening of the stem-loop
structure, which increases the physical distance between the
fluorophore and quencher thus reducing the FRET efficiency and
allowing emission of a fluorescence signal. The use of molecular
beacons as detectable moieties is well-known in the art (see, for
example, D. L. Sokol et al., Proc. Natl. Acad. Sci. USA, 1998, 95:
11538-11543; and U.S. Pat. Nos. 6,277,581 and 6,235,504). Aptamer
beacons are similar to molecular beacons except that they can adopt
two or more conformations (see, for example, O. K. Kaboev et al.,
Nucleic Acids Res. 2000, 28: E94; R. Yamamoto et al., Genes Cells,
2000, 5: 389-396; N. Hamaguchi et al., Anal. Biochem. 2001, 294:
126-131; S. K. Poddar and C. T. Le, Mol. Cell. Probes, 2001, 15:
161-167).
[0083] Multiple independent or interacting labels can also be
incorporated into the nucleic acids. For example, both a
fluorophore and a moiety that in proximity thereto acts to quench
fluorescence can be included to report specific hybridization
through release of fluorescence quenching (see, Tyagi et al.,
Nature Biotechnol. 1996, 14: 303-308; Tyagi et al., Nature
Biotechnol. 1998, 16: 49-53; Kostrikis et al., Science, 1998, 279:
1228-1229; Marras et al., Genet. Anal. 1999, 14: 151-156; U.S. Pat.
Nos. 5,846,726, and 5,925,517)
[0084] A "tail" of normal or modified nucleotides may also be added
to nucleic acids for detectability purposes. A second hybridization
with nucleic acid complementary to the tail and containing a
detectable label (such as, for example, a fluorophore, an enzyme or
bases that have been radioactively labeled) allows visualization of
the nucleic acid molecules bound to the array (see, for example,
system commercially available from Enzo Biochem Inc., New York,
N.Y.).
[0085] The selection of a particular nucleic acid labeling
technique will depend on the situation and will be governed by
several factors, such as the ease and cost of the labeling method,
the quality of sample labeling desired, the effects of the
detectable moiety on the hybridization reaction (e.g., on the rate
and/or efficiency of the hybridization process), the nature of the
detection system to be used, the nature and intensity of the signal
generated by the detectable label, and the like.
Hybridization
[0086] According to the methods provided, an inventive nucleic acid
array (i.e., a microarray in which at least one spot contains an
alien oligonucleotide) is contacted with a hybridizing mixture
comprising a plurality of nucleic acids under conditions wherein
the nucleic acids in the mixture hybridize to the probes on the
array.
[0087] The hybridization reaction and washing step(s), if any, may
be carried out under any of a variety of experimental conditions.
Numerous hybridization and wash protocols have been described and
are well-known in the art (see, for example, J. Sambrook et al.,
"Molecular Cloning: A Laboratory Manual", 1989, 2.sup.nd Ed., Cold
Spring Harbour Laboratory Press: New York; P. Tijssen
"Hybridization with Nucleic Acid Probes--Laboratory Techniques in
Biochemistry and Molecular Biology (Part II)", Elsevier Science,
1993; and "Nucleic Acid Hybridization", M. L. M. Anderson (Ed.),
1999, Springer Verlag: New York, N.Y.).
[0088] The hybridization and/or wash conditions may be adjusted by
varying different factors such as the hybridization reaction time,
the time of the washing step(s), the temperature of the
hybridization reaction and/or of the washing process, the
components of the hybridization and/or wash buffers, the
concentrations of these components as well as the pH and ionic
strength of the hybridization and/or wash buffers.
[0089] In certain cases, the specificity of hybridization may
further be enhanced by inhibiting or removing repetitive sequences.
By excluding repetitive sequences from the hybridization reaction
or by suppressing their hybridization capacity, one prevents the
signal from hybridized nucleic acids to be dominated by the signal
originating from these repetitive-type sequences (which are
statistically more likely to undergo hybridization).
[0090] Removing repetitive sequences from a mixture or disabling
their hybridization capacity can be accomplished using any of a
variety of methods well-known to those skilled in the art.
Preferably, the hybridization capacity of highly repeated sequences
is competitively inhibited by including, in the hybridization
mixture, unlabeled blocking nucleic acids.
[0091] Microarray-based hybridization reactions in which alien
oligonucleotides may serve as controls include a large variety of
processes. For example, they may be useful in gene expression
methods, such as those developed and used in pharmacogenomic
research (see, for example, M. Srivastava et al., Mol. Med. 1999,
5: 753-767; and P. E. Blower et al., Pharmacogen. J. 2002, 2:
259-271); in drug discovery (see, for example, C. Debouk and P. N.
Goodfellow, Nat. Genet. 1999, 21: 48-50; and A. Butte, Nat. Rev.
Drug Discov. 2002, 1: 951-960), or in medicine and clinical
research, for example, in cancer research (see, for example, J.
DeRisi et al., Nat. Genet. 1996, 14: 457-460; C. S. Cooper, Breast
Cancer Res. 2001, 3: 158-175; S. B. Hunter and C. S. Moreno, Front
Biosci. 2002, 7: c74-c82; R. Todd and D. T. Wong, J. Dent. Res.
2002, 81: 89-97).
[0092] In another aspect, the inventive provides methods of using
alien oligonucleotides and their complements in microarray-based
hybridization experiments for different control purposes.
Alien Sequences as Negative Controls
[0093] In certain embodiments of the invention, alien
oligonucleotide sequences are used to serve as a negative control
during the course of the microarray experimentation. Negative
controls are valuable when assessing the stringency of
target-to-probe hybridization. For example, the selectivity of
hybridization is known to be paramount to the accurate reflection
of differential gene expression.
[0094] When present on a microarray, inventive alien
oligonucleotides (i.e., molecules comprising sequences selected for
their inability to hybridize nucleic acids of the source or
collection under analysis) can act as negative controls. If a
detectable signal can be measured from spots containing alien
sequences, then hybridization conditions are not stringent and lead
to significant cross-hybridization reactions, which, in turn,
adversely affect the measured differential gene expression.
Use of Alien Sequences to Quantify Hybridization Sample
Components
[0095] The present invention also provides methods that allow
quantification of hybridizing sample components. Such methods are
based on the use of microarrays containing alien oligonucleotides
and on the addition of their complements (i.e., anti-alien
sequences) to the hybridizing mixture before hybridization.
[0096] More specifically, inventive methods comprise providing a
hybridizing mixture comprising a plurality of nucleic acids; and
hybridizing the hybridizing mixture to a nucleic acid array of the
invention, wherein the step of providing a hybridizing mixture
comprises providing a mixture containing at least one anti-alien
hybridizing nucleic acid whose sequence comprises a sequence
complementary to the alien probe present on the inventive nucleic
acid array.
[0097] In certain preferred embodiments, a known amount of an
anti-alien oligonucleotide is added to a sample containing at least
one experimental hybridizing nucleic acid of unknown quantity, and
the mixture thus obtained is processed and prepared for
hybridization to a microarray containing the alien oligonucleotide.
The processing and preparation include labeling of both the
anti-alien sequence and test nucleic acids with the same detectable
agent. The degree of anti-alien/alien hybridization may be relied
upon to establish the amount of test sequences present in the
hybridizing sample based on the relative extent of their
hybridization to complementary oligo probes present on the
microarray.
[0098] In preferred embodiments, the degree of hybridization
between the anti-alien and alien oligonucleotides and/or between
the hybridizing nucleic acid and oligonucleotide probe present on
the array is determined by measuring the signal intensities from
the detectable label attached to the hybridized targets.
[0099] More specifically, if, for example, the target nucleic acids
have been fluorescently labeled, the amount of a particular
sequence in the hybridizing mixture is determined by comparing the
intensity of the fluorescence signal measured for the hybridized
sequence to the intensity of the fluorescence signal measured for
the anti-alien sequence hybridized to the alien oligonucleotide
present on the microarray.
[0100] In other preferred embodiments, an unknown amount of the
anti-alien oligonucleotide is added to a nucleic acid sample to be
analyzed and the resulting mixture is processed as above, before
hybridization to a microarray containing a known amount of the
alien oligonucleotide. The quantification of hybridization sample
components may then be carried out as described above.
[0101] In other preferred embodiments of the invention, different
amounts of multiple alien/anti-alien pairs are used for comparative
quantification of nucleic acids of the test sample. Using amounts
of multiple alien/anti-alien pairs, that vary from rare, to low, to
abundant and highly abundant provides reference signal intensities
for widely different ranges of target amounts (or concentrations),
and therefore can help improve the accuracy of the quantification
of test sequences. Such a method may be particularly useful when
the signal intensity vs. detectable label amount (which is
equivalent to hybridized target amount) exhibits a deviation from
linearity in one or more concentration ranges.
Use of Alien Sequences for Normalization
[0102] Also provided by the present invention are methods wherein
alien oligonucleotides are used as controls for in situ
normalization.
[0103] At present, differential gene expression relies on changes
in the relative abundance of any given mRNA between a test and
reference total RNA sample. Usually ratios are derived that
identify if a test sample mRNA is up- or down-regulated with
respect to a reference sample, however in many instances no
appropriate reference sample exists. Such a problem is typically
encountered when samples are collected over extended periods of
time (i.e., clinical studies) and need to be compared to a common
reference or in diseased patients where no applicable reference is
available.
[0104] In certain preferred embodiments, a microarray has spots
containing a mixture of known amounts of the alien oligonucleotide
and of a probe able to detect target (or hybridizing) sequences.
Such an arrangement allows in situ comparisons. This approach also
provides a consistent standard (the fixed amount of alien
oligonucleotide) that can be relied upon to allow inter-slide
comparisons and inter-experiment comparisons even when experiments
are carried out with rare samples, or over a long time spans.
[0105] In these particular instances, an alien sequence can be used
as an in-spot control and act as the reference so that inter-slide
expression differences can be measured relative to a consistent
control.
[0106] For instance, if every spot in an array has a defined
mixture of experimental probes to alien probes, the presence of the
alien oligonucleotides allows the researcher to control for
variations between and among spots (e.g., by hybridizing the array
with a sample containing anti-alien sequences that are differently
labeled from the target sequences.
[0107] Those of ordinary skill in the art will appreciate that it
is not essential that every spot on the array contain alien
oligonucleotide, though it will typically be desirable that the
alien oligo be present in a representative collection of spots, for
example, so that the researcher can have reasonable confidence in
the general uniformity of the spots. It will also be appreciated
that, although convenient, it is not essential that every spot
containing the alien sequence contain the same ratio of alien and
experimental probes; so long as the ratio for each spot is defined
and known.
[0108] In these methods, normalization is performed according to
standard techniques.
[0109] As shown on the scheme presented in FIG. 8, an alien 70 mer
probe can be co-printed with a gene specific probe on the
microarray so that the two independent hybridizations can be
measured within the same spot. A complementary alien
oligonucleotide labeled with a fluorescent dye can be employed to
serve as the reference, and can be simply mixed with the labeled
target at known concentration prior to hybridization. The test RNA
signal intensity is then compared to the alien control allowing
like inter-slide comparisons to be made across a large data
sets.
Controlling Hybridization Sample Processing and Hybridization with
Alien Sequences
[0110] Furthermore, when an alien oligonucleotide is present on an
array, its complement may be added to the hybridizing sample, and
processed (i.e., subjected to different treatments including
labeling) together with the sample, and hybridized to an inventive
microarray as a control for the processing/hybridization steps. If
the alien oligonucleotide is present in spots at different
locations on the chip, this strategy can also control intra-chip
hybridization variation.
[0111] To give but one example, as described in the Examples, the
present inventors have designed alien sequences that consist of
four alien sequences that have been concatemerized behind a T7
promoter and to maintain polyadenylated tails. Upon transcription
of the alien genes with T7 RNA polymerase, an alien transcript can
be added to the total RNA input and act as an internal control
during the course of cDNA generation, labeling, and hybridization.
When alien probes, complementary to the alien gene, are included on
the microarray, the experimenter can measure the extent of
hybridization between the alien probe and the anti-alien nucleic
acid in the labeled cDNA milieu to ascertain the overall labeling
and hybridization efficiency. While this control does not
definitively identify whether the labeling or hybridization may be
at fault when there is a failure to detect fluorescent signal, it
does allow the experimenter to identify if a problem has occurred
and to compare the relative labeling efficiencies from experiment
to experiment. One would anticipate that when the labeling and
hybridization are successful, the relative signal intensity from
the alien probe would be similar between slides. Similarly,
regional effects of hybridization can be ascertained by including
alien probe sequences within each sub-array on the chip. This
comparative metric for inter-slide and intra-slide comparison is
beneficial for quality control purposes.
Controlling for Array Manufacture Using Alien Sequences
[0112] In another aspect, the invention provides methods that allow
control of array manufacture. More specifically, when an alien
oligonucleotide is present on an array, a standardized (i.e., a
known amount, optionally labeled) complementary nucleic acid may be
added to the hybridizing sample, and the extent of its
hybridization to the alien sequence on the microarray can be used
to assess the quantity of the array manufacture (e.g., the extent
to which oligonucleotides were effectively coupled to the surface,
etc).
[0113] Thus, according to the present invention, it is possible to
analyze printed microarrays (e.g., prior to their experimental use,
for example to ascertain if any spots are missing (and if so which
ones), as well as to judge overall spot morphology and slide
quality.
EXEMPLIFICATION
[0114] The following examples describe modes of making and
practicing the present invention. However, it should be understood
that these examples are for illustrative purposes only and are not
meant to limit the scope of the invention. Furthermore, unless the
description in an Example is presented in the past tense, the text,
like the rest of the specification, is not intended to suggest that
experiments were actually performed or data were actually
obtained.
Example 1
Identification of Alien Sequences
[0115] The present invention provides systems for identifying
"alien" sequences that are not found in the relevant population of
nucleic acids being hybridized to an array. For instance, the
invention provides systems for identifying sequences that are not
present in the cDNA of a selected organism.
[0116] In particular, a software program was developed that allows
the user to generate "alien" cDNAs for a particular organism. The
program, the algorithm of which was described above, takes in a
list of all known cDNA sequences for that particular organism
(e.g., mouse). From this list, the program calculates the codon
frequency of the sequences as well as dinucleotide or transition
sequences at the codon boundary. These files can be stored and are
specific for the organism from which the frequencies are generated.
The program then generates cDNA (with start and stop codons) using
the above frequencies. A small percentage of the time (as may be
specified by the user), the generated frequencies are flipped such
that the least frequent codon is now generated in the middle of the
sequence. Such a sequence should be different from any cDNA
occurring in the genome. The degree of "alien"ness of the sequence
can be verified by comparing the generated sequences to the
organism's genome (if available) or cDNA by using BLAST or another
sequence comparison program. Oligos are then generated from the
sequences by using another software program which checks for Tm and
% GC content. The generated oligos are also compared to the
organism genome or cDNA to verify that they do not hybridize to any
part of the genome.
[0117] For example, FIG. 1 shows about 100 sequences (of about
1000) that were generated using the inventive alien cDNA software,
by inverting sequences 35% of the time.
[0118] FIG. 2 shows about 50 sequences that were identified as
alien to mouse cDNA and desirable for use in hybridization
applications. The sequences were passed through oligo selection
software to check Tm, % GC content, low-complexity regions and self
hybridization. The software also checks by using two programs,
Fuzznuc (EBI tool) and BLAST, whether the sequences have any
similarity to cDNA from the organism in question. The oligos are
then filtered by comparing them using BLAST against the organism's
genome if available.
Example 2
Attaching Alien Sequences to Chips
[0119] Synthesis of alien oligonucleotides. Each of the 47 70 mer
alien oligonucleotide probes depicted in FIG. 2 was synthesized
using an Expedite DNA synthesizer (Applied Biosystems, Framingham,
Mass.) following standard protocols of phosphoramidite chemistry at
a 200 nmol scale (S. L. Beaucage and R. P Iyer, Tetrahedron, 1992,
48: 2223-2311; S. L. Beaucage and R. P. Iyer, Tetrahedron, 1993,
49: 6123-6194). All alien oligonucleotides were modified at the 5'
terminus with a TFA-amino-C-6-phosphoramidite (Prime Organics,
Lowell, Mass.) to enable subsequent covalent attachment of the
oligonucleotide to a CodeLink (Amersham Biosciences) slide surface.
After synthesis, oligonucleotides were cleaved and deprotected from
the CPG support with concentrated ammonium hydroxide at 80.degree.
C. for 16 hours and lyophilized. The oligonucleotides were
re-dissolved in 300 .mu.L of water and then desalted on Performa SR
DNA synthesis cleanup plates (EdgeBiosystems, Gaithersburg, Md.).
All oligonucleotides were quality assessed by capillary
electrophoresis (CombiSep, Ames, Iowa) and quantified by UV
spectroscopic measurement.
[0120] Preparation of Oligo Slide. Alien Oligonucleotides were then
Printed and linked to the surface of oligos slides (CodeLink,
Amersham Biosciences, Piscataway, N.J.), which also contained human
and mouse positive control spots. All the plates were prepared
following the same protocol.
[0121] Alien oligonucleotides were arrayed in Greiner 384-well
flat-bottom plates (600 pmol of alien oligonucleotide per well).
After resuspension in water to 20 .mu.M, the oligonucleotides (5
.mu.L) were re-arrayed into 384-well, Genetix polystyrene V-bottom
plates, which were then allowed to dry in a chemical hood. Before
printing, 5 .mu.L of 1.times. Printing Buffer (150 mM sodium
phosphate, 0.0005% Sarcosyl) were added to each well. The plates
were incubated at 37.degree. C. for 30 minutes to aid resuspension
of DNA, vigorously shaken on a flat-bed shaker for 1 minute, and
centrifuged at 2000 rpm for 3 minutes. These plates were then
placed into an OmniGrid.RTM. 100 microarrayer (GeneMachines, San
Carlos, Calif.) for the preparation of oligos slides.
[0122] After completion of each print run, the slides were removed
from the microarrayer and placed overnight in a sealed
humidification chamber containing a saturated brine solution and
lined with moist paper towels. The slides were then transferred to
a slide rack (25 slides per rack), which was placed into a
container filled with Pre-warmed Blocking Solution (50 mM
2-aminoethanol; 0.1 M Tris pH 9, 0.1% N-Lauroyl sarcosine) to
completely cover the slides, and then shaken for 15 minutes. The
slides were rinsed twice with de-ionised water by transferring the
slide rack to water filled containers. The slide rack was then
transferred to another container filled with pre-warmed Washing
Solution (4.times.SSC, 0.1% N-Lauroyl sarcosine) to completely
cover the slides, and then shaken for 30 minutes. After the slides
were rinsed twice with de-ionized water, they were dried by
centrifugation at 800 rpm for 5 minutes, and stored in a
dessicator.
[0123] Terminal Deoxynucleotidyl Transferase Quality Control. A
first set of slides were treated with Terminal Deoxynucleotidyl
Transferase in the presence of dCTP-Cy3, so that all
oligonucleotides attached to the slide could be visualized and
their attachment assessed. The labeling was performed by adding 10
.mu.L of 5.times. reaction buffer (containing 500 mM sodium
cacodylate, pH 7.2, 1 mM 2-mercaptoethanol, and 10 mM CoCl.sub.2),
0.5 .mu.L of Cy3-dCTP (Amersham), 2 .mu.L of Terminal
Deoxynucleotidyl Transferase (Amersham, 12 units/mL) and water to a
final volume of 124 .mu.L. The reaction solution was briefly
vortexed and spun. The slides were boiled for 10 minutes in
ddH.sub.2O and dried with a gentle air stream. The Terminal
Transferase hybridization procedure, which was performed using a
GeneTac Hybridization station (BST Scientific, Singapore), included
an incubation cycle carried out at 37.degree. C. for 2 hours
followed by three washing steps.
[0124] After the slides were rinsed with 0.06.times.SSC, and then
dried by centrifugation, they were scanned within the next 24 hours
using an Axon GenePix 4000B scanner (Axon Instruments, Union City,
Calif.). The resulting images were analyzed using the GenePix 3.0
software package.
[0125] As shown in FIG. 3A, the labeled alien oligonucleotides
attached to slides having undergone such a Terminal
Deoxynucleotididyl Transferase process were readily detectable, as
were the human and mouse positive controls.
[0126] A second set of slides was not treated with terminal
deoxynucleotidyl transferase, and instead was hybridized with
labeled mRNA from human (Stratagene's Universal RNA Human) and
mouse (Stratagene's Universal RNA Mouse).
[0127] Labeling of Universal Mouse/Human RNA. Before hybridization,
samples of both types of mRNA were labeled using the standard
indirect labeling method developed by J. B. Randolph and A. S.
Waggoner (Nucleic Acids Res. 1997, 25: 2923-2929). Human mRNA was
labeled with Cy5.TM. and mouse mRNA was labeled with Cy3.TM..
Briefly, aminoallyl dUTP was incorporated during the reverse
transcription of the total RNAs. This modified cDNA in turn was
labeled via a coupling between an N-hydroxysuccinimide activated
ester of a fluorescent dye (Monoreactive Cy3 and Cy5 from Amersham)
and the aminoallyl moiety of the dUTP, following a modified version
of the Atlas Powerscript Fluorescent Labeling Kit (BD Biosciences
Clontech, Palo Alto, Calif.) protocol.
[0128] Hybridization to alien oligonucleotide microarrays.
Hybridizations were performed on a Genomic Solutions GeneTac
Hybridization Station (BST Scientific). A competitive DNA mix
(containing salmon sperm DNA, Poly-A DNA and optionally Cot-1 DNA
when the nucleic acid population under analysis was human) was
added to hybridizing mixtures before hybridization. After
hybridization, the slides were rinsed with 0.06.times.SSC, dried by
centrifugation and scanned within the next 24 hours as described
above.
[0129] As shown in FIG. 3B, although the alien oligonucleotides
were present on the chip, they did not cross-hybridize to any known
transcript in either the human or mouse universal total RNA set,
while the human and mouse control probes did.
[0130] The results presented in FIG. 3 were quantified in different
ways in order to evaluate the alien sequences employed.
Specifically, as shown in FIG. 4, the 47 alien oligonucleotide
probes were ranked according to the normalized median fluorescent
signal intensity derived from the hybridization of the Universal
Human and Mouse total RNA sets. While most probes gave signals
slightly above background, three alien sequences (AO568, AO554, and
AO597) exhibited significantly greater levels of hybridization
(2-80 fold higher).
[0131] Also, as shown in FIG. 5, the alien oligonucleotide probes
generally showed higher levels of hybridization with the mouse mRNA
sample than with the human mRNA sample, and no probe other than
AO597 hybridized at a level that was as much as 1% of the positive
control.
Example 3
Using Alien Gene Transcripts as In-Spike Controls
[0132] As described herein, one advantage of using alien sequences
in microarray experiments is that their complements may serve as an
in-spike control, enabling the experimenter to gauge the robustness
of the target labeling and hybridization. Specifically, if an alien
oligonucleotide is present on a chip or slide, then a known amount
of its complement may be added to the population of nucleic acids
(e.g., mRNA or cDNA) to be hybridized to the slide. The population,
now spiked with a known amount of anti-alien nucleic acid, is then
labeled and hybridized to the chip or slide. Global problems in
labeling or hybridization are revealed through the extent of
alien/anti-alien hybridization on the chip or slide.
[0133] In order to create an in-spike control that would mimic an
experimental cDNA sample to the greatest extent possible, three
alien genes have been designed to consist of four different 70 mer
alien sequences linked to one another in series and to a T7
promoter. The three alien genes also contained a polyadenylated
tail to facilitate oligo(dT) priming. Alien gene A (321 bp), Alien
gene B (322 bp) and Alien gene C (322 bp) are presented in FIG. 6
on Panels A, B and C, respectively.
[0134] The alien gene shown in FIG. 6B was constructed, and was
used as a template for runoff transcription such that a single
transcript containing four alien sequences followed by a polyA tail
was generated.
[0135] More specifically, 10 ng of alien B was PCR amplified with a
forward primer (5'-TTCTAATACGACTCACTATAGGGCATCTATCTATGTCAGTTACCGGC)
and a reverse primer
(5'-TTTTTTTTTTTTTTTTTTTTTTTTCTAATAACTGAGGTGATTTCCGAC) using the
SuperMix High fidelity polymerase (Invitrogen, Carlsbad, Calif.)
and the Manufacturer's suggested protocol (which included the
following cycle program: 94.degree. C. for 30 sec, 55.degree. C.
for 55 sec, and 72.degree. C. for 1 min) was followed. The reaction
was performed for 30 cycles followed by a 3 min. final elongation
incubation. The PCR product was analyzed on a 1.5% agarose gel and
quantified according to quantitative low range DNA markers
(Invitrogen).
[0136] The PCR product was then used as a template for in vitro
transcription. In a reaction volume of 50 .mu.L, 500 nM of PCR
product was combined with 200 mM HEPES, pH 7.5, 7 mM NTPs, 20 mM
MgCl.sub.2, 40 mM dithiothreitol, 2 mM spermidine, 100 .mu.g/mL
bovine serum albumin (Roche, Nutley, N.J.), 8 units RNasin
inhibitor (Promega, Madison Wis.), 0.5 units inorganic
pyrophosphatase (Sigma, St. Louis, Mo.), and 500 units of T7 RNA
polymerase (Epicentre, Madison, Wis.). The reaction was incubated
for 16 h at 37.degree. C. Following transcription, the reaction was
phenol:chloroform extracted and LiCl precipitated. The pellet was
rinsed with 70% aqueous ethanol, dissolved in 25 .mu.L of buffer
and quantified using UV spectroscopic methods.
[0137] The alien gene B run-off transcript was then reverse
transcribed in the presence of amino-allyl dUTP (to allow for the
incorporation of a label), using either a polyT primer or a
collection of random hexamer primers. The resulting oligodT-primed
cDNA was labeled with N-hydroxysuccinamide-Cy3; the resulting
random-primed cDNA was labeled with N-hydroxysuccinamide-Cy5.
[0138] Microarrays were prepared by linking 8 different alien 70
mers, four of which were present in the alien gene and four of
which were not, to a slide as described above in Example 2. As also
described in Example 2, linkage of the 8 different oligonucleotides
to the slide was assessed via enzymatic labeling with terminal
transferase. As shown in FIG. 6D, detectable oligonucleotide was
observed at each location.
[0139] A comparable chip was then hybridized with a mixture of the
labeled oligodT-primed cDNA and the labeled random-primed cDNA.
FIG. 6E shows that the cDNA mixture hybridized with the expected
alien oligonucleotides, and not with the unrelated
oligonucleotides. Furthermore, upon analysis, normalized median
signal intensities from both the random and oligodT-primed cDNAs
were similar for all four alien oligonucleotides present in the
gene, indicating that, regardless of priming strategy, all four
alien sequences were well represented with no positional bias
within the alien gene.
Example 4
Alien Sequences as Internal Controls
[0140] In order to demonstrate the use of alien sequences as
internal controls for microarray spotting and hybridization, alien
oligonucleotides were first shown to be able to effectively
hybridize with their targets even when included in spots containing
other oligonucleotides. Specifically, microarrays were constructed
in which a single alien oligonucleotide, AO892 (5'
GGTACGAATCTCCCATTGCATGGACAAATATAGTCCACGCATTGGACGC
ACCCACCGATGGCTCTCCAAT), was spotted by itself in concentrations
ranging from 2 to 20 .mu.M, and was also spotted with a mixture of
other 70 mer probes, whose concentrations also increased.
[0141] An 70 mer oligonucleotide whose sequence was complementary
to that of AO892 was prepared, modified at the 5'-terminus with a
C-6 amino linker, and labeled with N-hydroxysuccinimide Alexa-488.
This labeled complement was hybridized to the array under standard
hybridization conditions, and differences between its hybridization
to the pure AO892 spots and the mixture spots were assessed. As can
be seen in the insert of FIG. 7, which shows one subarray, little
change in signal intensity was observed as the concentration of the
probe mixture increased. As shown in the graph presented in FIG. 7,
there was no significant difference in normalized signal density
between the AO892-alone spots and the mixture spots. These data
demonstrate that hybridization to an alien oligonucleotide can be
detected even in spots containing other sequences, such that alien
sequences should be useful in the normalization of gene chip data
on a per-spot basis.
Example 5
Using Alien Oligos as In-Site Controls and for Normalization
Methods:
[0142] Microarray fabrication, hybridization and scanning: The
process of microarray fabrication, alien oligo synthesis,
hybridization and scanning was carried out by the Massachusetts
General Hospital, DNA Core Group. The protocols used for each of
the following steps are described in detail at their website
(dnacore.mgh.harvard.edu/microarray/protocols.shtml).
[0143] Alien oligo synthesis: The alien oligonucleotide probes were
synthesized using an Expedite DNA synthesizer following standard
protocols of phosphoramidite chemistry. All oligonucleotides were
modified at the 5' terminus with a
trifluoroacetamidohexyl-amino-C6-phosphoramidite which
functionalizes the terminus and enables subsequent covalent
attachment of the oligonucleotide to a CodeLink slide surface.
[0144] Preparation of the oligo slide: Briefly, alien oligos were
arrayed in 384-well plates and mixed with printing buffer. These
plates were then placed onto an Omnigrid 100 microarrayer for the
preparation of oligo slides. After each print run, the slides were
placed in a sealed humidification chamber. The slides were immersed
in blocking solution, washed in 4.times.SSC and 0.1% N-lauroyl
sacrosine and then stored in a dessicator. The alien oligos were
printed along with a mouse oligonucleotide probe set which has
19,549 probes on the array providing complete coverage of the 2002
Mouse genome. Alien oligo 892 ("AO892") was printed in known
concentrations in all spots of the microarray that contained mouse
probes. Oligos that make up the alien gene transcripts were printed
in separate spots on the slide. To act as print quality control and
to check the attachment of all nucleotides to the slide, a few
slides were treated with terminal deoxynucleotidyl transferase in
the presence of dCTP-Cy3.
[0145] Labeling of RNA: Before hybridization, mRNA samples were
labeled using the standard indirect labeling method developed by
Randolph and Waggoner, Stability, specificity and fluorescence
brightness of multiply-labeled fluorescent DNA probes, Nucleic
Acids Research, 15; 25(14):2923-9, 1997. Briefly, aminoallyl dUTP
was incorporated during the reverse transcription of total RNA. The
modified cDNA was labeled via a coupling between an
N-hydroxysuccinimide-activated ester of a fluorescent dye (Cy3 or
Cy5) and the aminoallyl moiety of the dUTP. The anti-alien to oligo
AO892 and the three alien gene transcripts were mixed in known
concentrations with the extracted mouse RNA. The anti-alien to
oligo AO892 was labeled with Alexa488 while the alien gene
transcripts were labeled with both Cy5 and Cy3.
[0146] Hybridization reactions: Hybridizations were performed on a
Genomic Solutions GeneTac Hybridization Station. Cy3 and
Cy5-labeled RNA were mixed with a competitive DNA mix containing
salmon-sperm DNA, Poly-A DNA and Cot-1 DNA before hybridization
[0147] Scanning: After hybridization and washing, the microarrays
were scanned using the ProScanArray HT microarray scanner and the
resulting images analyzed using ScanArray.RTM. Express v3.0
software.
[0148] Data Normalization and Filtering: Data from image analysis
was stored for further processing in BASE (BioArray Software
Environment). All spots flagged as unusable by the ScanArray
software were excluded from further analysis. All array images were
also analyzed manually to check for hybridization artifacts and to
identify bad spots that had not been identified by the ScanArray
program. The identified spots were also excluded from further
analysis. Using BASE, all reference spots that had hybridization
intensity readings less than 300 and all test sample spots that had
hybridization intensity readings less than 50 were also removed
from the dataset for analysis.
[0149] Typically, the first transformation applied to expression
data, referred to as normalization, adjusted the individual
hybridization intensities to balance them appropriately so that
meaningful biological comparisons could be made. The filtered data
was normalized in two ways depending on the presence or absence of
information from alien/anti-alien hybridization.
[0150] Data normalization and replicate filtering in the absence of
alien control data: Microarray data was normalized initially by
scaling all individual intensities such that the total intensity
was the same for both comparative samples (control and treatment)
within a single array and across replicate arrays. This was based
on the assumption that the starting amounts of RNA in each sample
were equal. Using this approach, a normalization factor was
calculated by summing the measured intensities in both
channels:
N total = i = 1 Narray R i i = 1 Narray G i , ##EQU00001##
where G.sub.i and R.sub.i are the measured green and red
fluorescence intensities for the i.sup.th array element and Narray
is the total number of elements represented in the microarray. One
or both intensities were appropriately scaled to adjust for the
normalization factor.
[0151] In addition to total intensity normalization, locally
weighted linear regression (lowess) analysis was used to remove
systematic, intensity-dependent effects in the data. The starting
point for the lowess analysis, the `R-I` (for ratio-intensity)
plot, can reveal intensity-specific artifacts in the log.sub.2
(ratio) measurements. The RI or MA plot shows the measured
log.sub.2 (R.sub.i/G.sub.i) for each element on the array as a
function of the log.sub.10(R.sub.i*G.sub.i) product intensities.
Lowess detects systematic deviations in the R-I plot and corrects
them by carrying out a local weighted linear regression as a
function of the log.sub.10 (intensity) and subtracting the
calculated best-fit average log.sub.2 (ratio) from the
experimentally observed ratio for each data point. The data was
normalized globally.
[0152] The replicates per treatment and per time point when
available were then combined to reduce the complexity of the data
set. Genes with only one data point across all replicates after
initial selection were excluded. Genes with more than one replicate
data point were then analyzed for outliers and discarded if
necessary. The data was combined using the geometric mean of the
replicate ratios.
[0153] Data normalization and replicate filtering in the presence
of alien controls: Two different methodologies were used to
normalize data using alien hybridization intensities. Due to
experimental design, the amount of anti-alien to alien
hybridization in every spot on the array should be equal. This
implies that the recorded alien hybridization (Alexa488)
intensities should also be equal. One normalization procedure is to
calculate the average alien hybridization intensity across all
spots on the array and then normalize the alien hybridization
intensity at a spot to that average intensity. The normalization
factor for each spot can then be used to scale the treatment and
control intensities for that spot. This normalization algorithm can
be applied globally or locally. Local normalization can be applied
to each group of array elements deposited by a single spotting
pen.
[0154] Another method of normalization is to scale all alien
hybridization intensities to an arbitrary constant intensity value.
In the analyses conducted here, the second method was used. All
alien hybridization intensities were scaled to a uniform intensity
value of 1000. The normalization factor used to scale each
individual spot was then used to adjust the other channel
intensities at that spot. Replicates were then combined and genes
with only one data point across all replicates after initial
selection were excluded. Genes with more than one data point were
analyzed for outliers using intensities from all three channel. The
data from replicates were combined by calculating the geometric
means of the individual intensities.
[0155] Identifying differentially expressed genes: The log.sub.2
ratio of gene expression for each spot for each gene was calculated
either using direct or indirect comparison. Assuming there are two
samples A and B, while using direct comparisons, the ratio T of
gene i in sample A to sample B is T.sub.i=A.sub.i/B.sub.i, where
A.sub.i and B.sub.i are the normalized intensity values.
[0156] Further assuming that U is the universal reference sample
used in two separate microarray experiments 1 and 2 to compare
sample A to sample B indirectly, if T.sub.11 is the ratio of
intensities of gene i in sample A to gene i in the universal
reference, and T.sub.2i is the ratio of intensities of gene i in
sample B to gene i in the universal reference, then the ratio
T.sub.i of gene i in sample A to gene i in sample B is
T.sub.i=T.sub.1i/T.sub.2i.
[0157] When using the aliens as the reference channel for indirect
comparison, the intensity of gene i in sample A and the intensity
of gene i in sample B can be compared directly. This is possible as
all spots in all arrays have been scaled such that the alien
hybridization intensities are all equal to 1000. Therefore
T.sub.i=A.sub.1i/B.sub.2i, where A.sub.1i and B.sub.2i are
intensity normalized and scaled values.
[0158] The standard log.sub.2 ratios were then calculated for each
gene in each of the above cases. The mean and standard deviation of
the distribution of log.sub.2(ratio) values was then calculated.
The Z-score value for each gene was then used to determine if the
gene was differentially expressed. Genes with log.sub.2 ratios over
2 standard deviations from the mean were identified as
differentially expressed and chosen for further analysis. This
allowed us to identify genes that were expressed sufficiently above
the noise without having to resort to an arbitrary minimum ratio
value.
RESULTS AND CONCLUSIONS
[0159] The alien oligos can be used as internal controls for
microarray spotting and hybridization, by spotting them in a
mixture with the probes used to hybridize to the sample. This
arrangement allows for in situ comparisons of every spot on a
microarray. The aliens thus spotted can also act as references for
inter-slide expression measurement and for inter-experiment
expression measurement even when the experiment has been carried
out over a long time span. Spotting a known amount of oligo in
every spot and hybridizing to it a known amount of anti-alien along
with the experimental sample, allows one to normalize for
variations between spots. This would also serve to control for
errors in the hybridization and labeling steps and for controlling
intra-chip hybridization variation.
[0160] To demonstrate this, alien genes were first shown to
hybridize to their targets even when other probes were present in
the same spot. A single alien oligo, AO892, was used for this
experiment. A sequence complementary to the oligo was synthesized
and labeled with Alexa488. This sample was then hybridized to a
slide which had pure alien oligo spots as well as spots with
mixtures of the alien and normal probes. There was no significant
change in normalized signal intensity between the two types of
spots (data not shown).
[0161] To determine whether alien AO892 could be used as an in-spot
reference, it was tested against another sample that could be used
for an indirect reference, Stratagene's Universal Mouse.RTM.
Reference RNA mix. A twelve-slide experiment was designed and
carried out using mouse liver and macrophage RNA samples. All
slides had spots with mixtures of the alien oligo and probes for
mouse RNA. Alien oligo AO892 was printed in known concentrations in
spots of the microarray that contained mouse gene-specific probes.
It was printed at 10% final concentration of the mouse
gene-specific probes in that spot. In four slides, Universal Mouse
Reference RNA was used as the reference sample and liver RNA was
used as test. Another four slides used mouse macrophage RNA as test
samples and Universal Mouse as reference. A transcript
complementary to AO892 and labeled with Alexa488 was added to all
pre-hybridization mixes of labeled cDNA. These set of slides
permitted comparison of differential expression between mouse liver
and mouse macrophage samples by using both the Universal Mouse
Reference RNA as well as the aliens as references. The last four
slides directly compared liver RNA samples to macrophage RNA
samples. A dye-swap was incorporated in each set of
experiments.
[0162] The RNA was labeled and then hybridized on a chip containing
the probe mixtures. The intensity readings were collected and
quantified. Genes with low intensities not significantly above
background were excluded from analysis. This reduced the number of
spots from 19,552 to 18,268 for aliens and to 8,667 for the
Universal RNA. The log.sub.10 of the intensities was then
calculated and their frequency plotted (see FIG. 9). The readings
for the aliens varied over two orders of magnitude but were within
the linear range of the scanner. Also, there were few spots with
very low intensities. The intensities of the Universal Mouse
Reference RNA channel were bimodal and varied over a wide range.
There were also many spots with very low intensities.
[0163] When using Universal Mouse RNA as reference, the microarray
data was normalized by scaling all individual intensities such that
the total intensity of the all channels was the same across
replicate arrays for that experiment. Data from the replicate
arrays were then combined to identify outliers and reduce
statistical variation. When using the alien channel as reference, a
spot to spot comparison across the two experiments was done and all
intensities adjusted such that the alien intensity was set to 1000.
For the final analysis, spots were chosen such that data was
available for both direct and indirect comparisons. 6,866 spots
were selected for comparison through the alien channel and 5,322
through the Universal RNA channel. The data was compared using
log.sub.2 ratios of test RNA intensity to reference intensity and
plotted (see FIG. 10). As can be seen from FIG. 10, there is a
definite decrease in correlation when comparing the direct ratios
to indirect ratios through the Universal RNA reference data than
through the alien data. Thus, this example demonstrated that the
alien data can be used as a reference channel to compare data from
multiple chips and multiple experiments.
Example 6
Using Alien Oligos as controls for TNF-.alpha. in Fracture Healing
Mice
[0164] In the most widely used experimental design for microarrays,
all the direct comparisons are made to a single reference sample.
By following this method, the path connecting any two samples is
always two steps. Thus, all comparisons are made with equal
efficiency. In experiments that analyze RNA samples from two
different conditions or two different treatments and when these
samples derive from a series of time points, the most commonly used
reference is the wild-type or untreated sample. This is inefficient
because fully half of the measurements are made on the reference
sample, which is presumably of little or no interest. Alien
sequences could be used as a common reference in this experiment
design as well. In this example, we have designed an experiment to
compare fracture healing in wild-type and TNF-.alpha.
receptor-deficient mice that would also allow us to test the use of
the alien sequences as a common reference.
[0165] A total of 56 DNA arrays were divided into five sections
(Table 1). RNA extracted from the tibia of wild type mice before
fracture was used as the universal reference. All microarrays had
the alien oligo AO892 mixed in with the gene-specific probes. The
complementary sequence to AO892 was labeled with Alexa 488 and
mixed into all hybridizing samples. The alien oligos that can bind
the three alien transcripts to be used as in-spike controls were
deposited in separate spots on the array. The alien transcripts
were mixed with the sample and reference RNA before labeling in all
experiments other than those in Experiment E of Table 1.
TABLE-US-00001 TABLE 1 Experimental design to compare mRNA
expression levels in fractured vs. un-fractured tibia in wild-type
vs. TNF.alpha. receptor knockout mice. Experiment E A B C D 1 2 Ch1
TNF-.alpha. receptor Wild-type Wild TNF-.alpha. WT KO KO fracture
fracture type receptor KO (T = 0) (T = 0) (T = 0) (T = 0) Ch2 Wild
type (T = 0) Wild TNF-.alpha. In-spike transcripts type receptor KO
only (T = 0) (T = 0) Ch3 Anti-alien to AO892 Time points 5 5 1 1 1
1 Replicates 4 4 4 4 4 4
[0166] In Experiment A, the different time points of fracture
healing for the TNF-.alpha. receptor knockout mice were compared to
the reference. There were four replicates per time point, including
a dye swap. In Experiment B, the time points of fracture healing in
wild-type mice were compared to the reference again with four
replicates per time point. The microarray datasets in Experiments A
and B enabled a differential expression comparison of fracture
healing in the transgenic mice as compared to the wild type mice at
each time point, using either the common reference channel or the
alien channel as control. The two references, wild type mice at
time zero and the alien channel can also be used to compare across
time points to generate a time series profile of gene expression
during fracture healing.
[0167] Experiments C and D compared healthy tissues in wild type
mice and knockout strains with themselves. This method identified
genes that could cause problems during analysis. Ideally, ratios of
the test channel intensity to the reference channel intensity in
the case of these experiments should be 1. However, this was not
true for some genes, due to factors beyond the control of the
experiment. These genes were removed from the dataset before
analysis. Also, differential mRNA expression between healthy
knockout strains and knockout strains undergoing fracture healing
can be measured using datasets from Experiments A and C.
[0168] Experiment E checked whether the alien oligos
cross-hybridize to RNA from the two test samples. The test samples
used here were not mixed with the in-spike alien transcripts.
Analysis of channel 1 intensities from spots that contain the only
alien oligos as well as analysis of channel 2 intensities of spots
that don't have in-spike controls showed any non-specific
hybridization to the alien sequences. The RNA was labeled and then
hybridized on a chip containing the probe mixtures. The intensity
readings were collected and quantified. Genes with low intensities
in each of the reference channels were filtered out from the
dataset. This reduced the dataset by approximately 10% when using
the aliens as reference as opposed to more than 50% when using the
sample from unfractured tibia.
[0169] The data was normalized as discussed in the Methods section
of Example 5 above, using both the sample from unfractured tibia as
well as the alien reference. Data from the microarrays in
Experiment A was concatenated with data from microarrays in
Experiment B and a common list of genes for which information was
available from both set of experiments for each time point was
identified. This helped in performing an indirect comparison of the
genes in each of the knock-out time points to those in the
wild-type. Differentially expressed genes were then identified
using both indirect comparisons to the sample of unfractured tibia
as well as the alien channel. Table 2 compares the data available
from indirect comparisons for each of the time-points of fracture
healing.
TABLE-US-00002 TABLE 2 Results from indirect comparison of fracture
healing in TNF-.alpha. receptor deficient mice to that in wild-type
mice. The table compares results from using unfractured tibia RNA
and alien sequences as common reference. Unfractured tibia as Alien
sequences as Genes identified using reference reference both
methods Genes Genes Genes identified as identified as identified as
Time- Total No differentially Total No differentially Total No
differentially point of spots expressed of spots expressed of spots
expressed 3 7704 374 10687 528 6382 200 7 7981 378 11752 567 6823
147 10 7950 385 11486 552 6657 165 14 8026 379 11664 546 6887 197
21 9010 339 12644 593 7871 86
[0170] As can be seen from the data in Table 2, more genes were
available for analysis when using the alien sequences as reference.
Most of the missing data in either method is due to the initial
filtering step when spots with low intensities are removed. Since
there were more genes available for analysis while using the aliens
as reference, that method also identified more genes as
differentially expressed as compared to using the sample from
unfractured tibia as reference. There were some genes that were
identified as differentially expressed by one method but not by the
other. RT-PCR experiments would need to be performed to verify
which of the methods provided better results. Some cytokine-related
genes were identified as differentially expressed only when the
alien sequences were used as reference. These genes showed little
or no expression in the sample from unfractured tibia.
[0171] Data from the in-spike control spots on the microarray was
also analyzed. The three alien transcripts were spiked into the
test samples at different concentrations. The mean normalized
log.sub.10[intensity] values for the spike-in control probes was
used to define a standard curve relating signal intensity to copy
number (see FIG. 11) for estimation of endogenous transcript
abundances. There was a large variation observed in the raw
intensity values but there was a good correlation between mean
log.sub.10[intensity] and log.sub.10[input copy number], with
r.sup.2.gtoreq.0.90. This correlation increased to
r.sup.2.gtoreq.0.98 when data from alien oligo AO732 was removed
from analysis. AO732 was present in alien genes A and B. There may
have been some competitive hybridization between the two
transcripts for the alien oligo and this may have affected the
analysis.
Sequence CWU 1
1
1531174DNAArtificialAlien to Mouse cDNA 1atggttgggg actgcctctc
cccagtcgga tggtccacct ctgcgtacac cccacctgat 60ccggatgagg ccagatacac
ctgtaaggct cctgaccaat tcaaaaagac acgcacctgt 120ttgcgatccc
caaagccttg cctgtcgata agtgcagagg aactcttaat gtga
1742651DNAArtificialAlien to Mouse cDNA 2atggcctgca ccctggtggt
agaggccccc ttgtcaaaaa ctcccgactt gactggtgac 60ttcaatagct ccttgtcctg
gtcttgcctc gacaataacc cggttttggg attagtgcag 120ctcaaggtgg
cctcctcctc tagctataag tcggaggaac ttgatctgga gcttcccaag
180cgagccaaga ttctggattc gatcagtggc acttggaaac tccatcttcg
caaggagttc 240cgcctcattg tgtgtatgtc gcatgcctgg aaccggcggc
atgcagctga tttgaaccgg 300tgcaaatgga agggcaagag ggcaggctgg
agaggggccc ccgtgctttt tgctcccatg 360caggtgacgc gcaagtgtgc
accagacccc acagagcagt caggcctctt cgataactct 420ttcctggatc
actaccagag tctggcctgc atttacctag gctcccttgc ccgaaagggc
480tcttctctga ccaaggatgg aaaggtggat tttcagggcc cttgccttcg
tggtggccag 540aattattcga acttttctca gagctcagcg tgttggaaac
cgctggacga ccaggaacag 600atcgcccgtc ccctcagtgt ctcgttgtac
tatgcagcct tagtgggctg a 6513228DNAArtificialAlien to Mouse cDNA
3atgccaaagt tgttaaacct gattcgggca gtcggctgct gtgagaaaca gaccctcctg
60gctgccgaga gcctcaatga ccgggaggaa atctcctgtt tgttccggcg aaacctcctc
120cagggaatgc ttctgggaga cagagcagat gacaatacca gtgaccacac
gatagtctgc 180tacaccttca tgatcccctc ccacgccagg atgcctggaa gtaggtag
2284174DNAArtificialAlien to Mouse cDNA 4atggaagcag agctctgttc
acgaggcgtc aacagacgtg acaatactaa acttccactt 60tcgtctttgc cttcagcttc
tcctcatgat tccaagagat gtccgcgctc taagatcgct 120cacgtctggg
acaccagggc cgacggtgag atcgattcgc gaatcttgta ctga
1745306DNAArtificialAlien to Mouse cDNA 5atgaactctc tgtctgaata
cgagacctta aggcggacca tgctgcagag ctctaacaag 60tgtaactctc tgtgccaaat
tgtacaaact tgggttgagg gtggcaaggc caaggccaat 120atgaatggct
accagaagca tttggttcca cttcgcgttc aaatgtggga gatggcaatg
180cgacttaatg gaacccagcc aaatgaattc cacccggcag tccagcagtg
catcctggct 240ccttacctaa agactttcct cagtatgcgt cctgattcgc
aaacttaccc ggccaagctg 300agctga 3066156DNAArtificialAlien to Mouse
cDNA 6atgcctcgag ggcgtactct ggtatctcgt caagcatggc gaacagtgac
cggtaaggcg 60ggatgctctg ggcggtatcc aagagagagc gggaccttga gtctatcgca
tttttccctg 120gggattatgt ctaagcggag ccaggaggag ctctga
1567135DNAArtificialAlien to Mouse cDNA 7atgatgcagc cttgctccaa
acaagaaaga atatgcggac ctcctgactc cagcatcgag 60tccgcgtacc gctcagcctc
tctcacttct agccctgcca cgcttgctcc ggccttctct 120gcctgcccct gctaa
1358144DNAArtificialAlien to Mouse cDNA 8atgaggcgag ccctggtagt
gtgccccttg gcgggaccct ggaagaacca gcggtccatt 60gccctggtga aagatcttcc
catgaacgcc agcgttgcct catactttat agaaaggggg 120agcatcagct
ggcatttctc atga 1449165DNAArtificialAlien to Mouse cDNA 9atggggtggg
tcaaggccct gcagagtgaa agcggctggt ggtttgtatt ttctcagggt 60cgagtgagcc
tgaaacccga gccgggccta gcgctggttg tacaccaggg ctttgaccaa
120acagtcacag aatgtctaag cttcacagga aagcccatgt attag
16510561DNAArtificialAlien to Mouse cDNA 10atgatgagct tcgaacattc
cgacttctcc aatgtcgagg accgcaagct cttaacggaa 60gcgatgtcca caggcttcga
agtaatcgag tcgccgtgca agatctgcat gccaagcttt 120ggaggtaaaa
caactgcgga tggcaaactc acttccgtga ctcagggcat gaaacactgg
180tctctcacca gagctagtcc cccggaccag tcgcaaaagg gccgacccta
caggagcacg 240gtgcaagggg agattgaagc gggacagccc ccacatgaaa
tctcctccga ctggtacccc 300atgttcaaga tggaaacaga cagcccgatt
aagaatgttc cccaggcaca catgggggag 360ttcgggcact gcgacaatct
ccccaatggc aacacagtga gcaacccgga gcctagggag 420aatgggaatg
tggcgccggg agtgggctta gacggacagg aagaaatggg ctggctttgg
480ccggttcgtc cttcttgtat gaactatttc tttaaagcat ccactctctc
cttttggatg 540ggctttcttg agcgccgcta g 56111480DNAArtificialAlien to
Mouse cDNA 11atgggaaaat ctcgctttga gtatgcagtg acgccccttc aagcccaagc
ccgcagtttg 60ggcagatccc tgaataaaag cccggtgttc ttgttttact ctgagactac
atccctgcca 120gccaaggatc tcccgtgtga gtcaggactt gctgtgagag
acctgagcaa caggacacag 180aacagtctag ctatgttttt ggcttcacgg
gggatcaaag accctgaaat gaagatgaat 240tattccatct atttggggca
acccttgcaa gaaggtctgt cccccgtgca ggagaacttt 300tctcaatggg
aactcccact cgtggcttac atgagctttt tctgtccctt ccgtgcgggc
360gaccggggtt cgatccataa tcatctctcc acggtcagag cgaagattga
ctactgtggt 420cagcggtgca gtgcctcaga tccaaggagg ggccctcagg
actattctca aatgctctga 48012231DNAArtificialAlien to Mouse cDNA
12atgcgggaag agtccaagac tatctcgatc aatggtgtga aatggctcat tgatttgcca
60gctgaaaaaa tcttcacgag gaactatggt gttgccgact gcaggagaag cttctacatc
120ctgggcctgt ttggttgcca cctggtgact ggagggtacc gaacattcat
gatctacatc 180gggtccattt cttctttcat catgtatgtg ggggtccgga
tcattcgttg a 23113426DNAArtificialAlien to Mouse cDNA 13atggtgcccc
aagtgtgcga gcagtggagc ctgtgttggt cctcgggcgg gttcccaaat 60cctgcaggct
cttatttaga gccgtggtca agcgacttgt ccagggagct tcagtgcccc
120ggctacagcg gcttcttaag tggccccacg gattttctct ctatgggagt
gtcatgtcac 180ctagcacagg aatcatttcg gttcccactg caggatgatt
gcctcctgac caagatgcac 240aggttgaaag atttctggga ctccaccagc
aggtttaagc agctgggcga atctgaggcc 300cctcagcaga ttcgcaagaa
aaaatcatcg tttagtttct ggggctcatc ggagaactct 360gcgcccgcaa
ccgaaaatac cagcaagaag tcccaggatt ccttctttga tgccatcctc 420aagtga
42614192DNAArtificialAlien to Mouse cDNA 14atgggtgtgt cgatggccag
cttcatgctc tcttctggcc tcctggatgc agagggagaa 60agcttcatgt cttggcatct
cagcagccct ggaacagccg tggaccgaac ggcccaaatg 120tttattcact
tcagaatgat ggggtcaatc ttcagtgtta ccctgacgct tgaagtcatg
180cggtctctgt ga 19215351DNAArtificialAlien to Mouse cDNA
15atgacaatgg aaacagggag gcacccggtc atgaaggacc aagcccttga cgaatgcgaa
60cggtcgatgt ggccggtccc ttcttgggcc tgggagagtt cttgttctca tcgtgtcgat
120gagggagatg tatcggtact gctggaacag tttcggcacc agactgaaca
gctcccgccc 180atgagctact ttttggacaa gccaaagctg tcttcgttcc
aggaagagcc acggctgtgg 240gtgactttat gccaggagac attgccattt
cccctgggta attctgggta tgatgagcag 300gaagaggagg gcctgtgtct
ggtctgtccg ttgcccagac ttcagacatg a 35116153DNAArtificialAlien to
Mouse cDNA 16atgggtaaaa tcaatcacac cacatcgaca cctaccttga gcactttaaa
aatccccaca 60tttgaggcct tacgcccgct actatgccct agactggatc cccccacctc
gtctgtccgc 120ctggcatttg aaggccagtc tcagaaattg tag
15317324DNAArtificialAlien to Mouse cDNA 17atggttcgca aggttgctca
caatgttctg tatgagacca tgggtcagaa agctgactca 60aagtggggaa ccagaaagaa
gcagccacaa gggacccgcc tgagcaaacc ttgcaccacg 120gtggtggagt
ggctgtctgc cttcatgtac cgatcccgca agaaactgac gagccgcttc
180tatctgaaac ctaacatgtc ttccggttct atccgctacg gagagcggca
accactcttt 240ttggacagcc tgctttggtc cgacagtgga aagggagcct
ttgcctcctg caaatgctct 300tatgctaaat cattttttga ctga
32418450DNAArtificialAlien to Mouse cDNA 18atgagcaact acctccacat
tcgttccccg gagtcggtcc ataacacctt tcctttgtgg 60gtccatattg ctcaagcaaa
gttcggtcac ctacaagcct tgttaaagcg cgagagtggg 120tttgaagcca
acaccgcgaa tgctgggccg ctaggccccc gcatcagcga tgacactcgc
180aatatccttt tgactggatt gttcctctcc ctgaccaaga agtgtggatg
tgtccagtta 240cagtgtggcc gacagagtag cctcgatgcc aaaatgccat
gtgaccagca ctatagaaag 300gtgcagtctg ccctcagcca gggtctgcag
atgggtggtg cgtgggtgaa gcagaaagca 360agccaggaga ttgccgggtg
gctccacagc agcagccttc aagagcaggc cttggatgga 420tcatccaact
tcgccactct gtccgtttaa 45019720DNAArtificialAlien to Mouse cDNA
19atgcggagaa ttaagtttga gttcaagaaa ataccttctg ttcgtttgta ccggttcttc
60ttcggttctt gggctaagat ttctaccctg gcatttgtgg aggacaccta tacctatgcc
120ttctggatgg aaggagcagg cttcactctt gtctcagctg actgcattac
ttcccggacc 180tttaggagtc cacttgccaa ggacccgctg gcttggcggc
tcctggatct tgtgcgggca 240aaaactcaag aagcgcggac gaactcagct
ttgtccttga agtgctccct gcctgatttt 300ggtccactcg gggagatcaa
cagagcccag gcctctgaag gccagcagac ctttggctcc 360tttgagaagc
cgtcagagca tgtcctaaca gcaaagaatc agctccaggt gatcataagt
420tatcccttct gctatctgct catcataccg gaacgtccat tcgacagtag
caatatgtcc 480ttgttcagta agccaagggt gccggccttg gaagtgattg
gagtacgcct caagacccag 540atgctagtca cgcctttcag tgagttccag
ctatattccc gtgcatttct cagagaatca 600gatttgtctg agagctccct
ctgggtgacg atctcttttg acacggcgaa tctgtcttat 660gtccaagcgg
ctgaggaaga gtgttcattg agaagttccc tggcttacac gtggtcttga
72020465DNAArtificialAlien to Mouse cDNA 20atggggatga tgctcaactt
ttgtctgaga atctactcca gcagaaaggg agacgccatc 60atgtctggcc cttctgggtc
tttccttaga aaaaagagtg tgccctacca aacctggcga 120gcggagcagt
ctcgtaaggt aagcgtgtgc tcctcgcagt tttactccca gaccatcttg
180cgttggcggc cccaggatgc cgaaacagag agacagagga gaagcggctt
caagctggcc 240atgatggcag cgggcaagtg ccagcctgtg aacgacccca
cctcttgctc ttatgaagct 300tacctaaggc ccatctggaa tggtatgagc
tttcttgatt ggctgatctt tgtccccatg 360aaccttggtg gacacagaca
cagcacctcc ctgagcgcga acaaggtcac gtccatttac 420aaggaatatg
caggctattc cacctgctcg tctaccagag gctga 46521216DNAArtificialAlien
to Mouse cDNA 21atgcagtact gcgcagctgc cgcttccaag ctgttcccag
ccttgccgtt aagggcccaa 60accctcagac actacctaaa tgtggcccta cacaagtctg
ccctcctggg agatctggcc 120tggcggcgga actcggcagg gggccagggc
tttatgactc tagggccaaa agagattctg 180ccagctcagg tggccccagg
tggagagttt ggatga 216221188DNAArtificialAlien to Mouse cDNA
22atgtatgcct gtgctgctct cagttcattc cttgccttcc caaagtacgg actgactgcc
60aagagatacc caaccctgag aacctattgc ctctgcttat tgtggaagtg tgagaagcat
120attttgtggc aggggatcaa tctaacgatg cgacaggtga gtgccaatgg
gacgcccatg 180gtgaactggg gggtgctgaa gcccaccact caccagattc
tcaatggtga cacagactgt 240ctgtgccgcc cgaggtcatt tggtttgaag
gccaatcagg cccgccgacc gaagaagtac 300caaggctgcc tctcacggag
gtgctctgct gacttcctct gttcccatgg ggctgttgta 360agagatcagt
gctcgatgat tcaagtgtct ttgagcaccc ggctgccgtt ctctaatcca
420tggattcagg tcgctgtcat gaagttcttt tgttacagaa ccaaggcctg
cgcatgtaat 480ggggggggta aaaaagccct atctgtgagt tggcaaaaat
tccagaactt gtacgtgaca 540cggaaagcaa tcctagtttt cagcatagct
aacaagggtt ccctgactaa gataaacatc 600cagcggaaga agctcagtaa
cagggactca gtgacagagt gcgtcttcgg actaacctat 660aggagctttc
taggtaaacg ccatgtattc gaaggagcct cactcttgac gaacggaccc
720aacccaggga ggagcaagtg gccctgtgaa acaataagcg atcagtatta
ctgtttcaac 780aggaagttgt ctgagagcgg catgtgcttc atgttgtgta
gtacctgcag agggtacctg 840ccgccggact acctgtttgc agctctgctc
aagacagtca gccggcacat cgttaaagtc 900cgccaggtgt tgcttttttt
agaactttac cctggctcga aggctagatc aagcgatgaa 960attccccacg
agcacaataa gacgcctgag ctggaggaac ttccgcctat caacagctgt
1020acccagattg ccatgctcct ttgcagccgc tcctcagtga aaaccaagga
cagtacgacg 1080gcacctgttc tgtgttcttt tttccttaga ctgtttgctg
aggaaatccg gctgcgctct 1140tttgaacggg agtaccgcaa agattcttac
aagtacctgc gggtgtga 118823126DNAArtificialAlien to Mouse cDNA
23atggatctcg atctgcggtt cattctgtta tggaaacagg aggagctggg gctgtgtcgg
60tacctgaaaa tgagaaaatt tagtctgcag tatgggaaga caaaaaaatg ttcctcaccg
120gcctga 12624951DNAArtificialAlien to Mouse cDNA 24atgggcagtc
gcgccccatc gtctggtgat gaaactcaaa tccacgaact ctcactcacc 60ccccgggatc
ccaccttaaa ggaggggacc aagaagggcc agctaagggc atccccgtac
120ttccttcgtg caatgccgtc cttcctttca gtcaacacac cccaccagca
gttctaccac 180cgtcagcggg ccagctttca ggactacgcg ggagatatgg
cctacatcga acttttcagt 240cagatcagtc ctactgcgca aagagcacta
cagatgccaa tcaaccctgc gaacgcgggc 300gcggtatcca tggggaaatc
tttccccttc tccatgcttt tgcctcgcaa ctccgtgtta 360cccccaacca
agcgcccgtt ccaaagactt tccattccgc aatctctgac cagcaagggc
420cactacctga gcctgtatct gctggaagga gaaatcttag caggaaccat
ctccaccgta 480gcggtggtga ccaaatggac atctcagttc tacatgtgtg
tgctggctgt cctttacggt 540caacacgcac cttccttcag tcagagggct
gttgaggttg accggaagtc ccaatccaag 600gccccaaagg ttcaggaaat
gtggcgagac gggattaaat tcacgtctgg taaactcctc 660tcctgttgtg
aggggcaccg catcgccttt gactggtcct tcccaaccag gttcatacag
720attggacgtc cgggggagta cattgcagaa tgcttccagc ggtcccggag
aaaggctaac 780ttcctgaacg ttgacataaa cagctgtctg cgcaagagca
ttgaaacttt ttttgggaga 840aactatatgc acccgccgcg cgacccgctc
tttttcaggg tgagtatccc ttgctgctat 900tgggcactag agggaccctt
ctgtgaatac cccaaattcc ttcacgctta a 95125273DNAArtificialAlien to
Mouse cDNA 25atggaaccaa tcgcgcttaa catcaactac cagcggatgc tgctatcggg
gcatagctca 60aaccagatga ttcatattgt gaacaaaatt gatcttgcga ggaccccctc
ttctgtaacc 120agatcccggc tcaatgactg tagaggccct ttatgcagaa
aggaccaaaa ggctgagcgc 180gacagccagc ttggcaagcg ggtgcactat
gcattgatcc ttcggttcaa tcggccaaat 240gcgcctgaca gccaggacta
ttcgctaact tga 27326198DNAArtificialAlien to Mouse cDNA
26atgcggaagt cgctttcgcg caaactgcgg atggcctgct ccaagggcct ctccggggtt
60cctgtctcct cttgtcacat gcactacttc gacgggtccc tggtggtgcg gctgacctgt
120aagaggagac atggcttgtg caaagaacag cagggtatcg cgggcaccat
cagacagaac 180ggcaccatcc taagttag 19827213DNAArtificialAlien to
Mouse cDNA 27atgtattatc cagatattac gtatcccaag cccagcagaa ttattgagaa
cttagatgaa 60attgtttctc agtcaggatc gattgaaaat cactcccgac cgatgattgg
tctgcgtgtc 120aactctaagt ggatgccact tggagggggc ccctacaaga
tgatgcgaag cagtagaaaa 180aaggtgagtc agtgccttct gaatgacatg taa
21328675DNAArtificialAlien to Mouse cDNA 28atgggtgatg tggtcatgac
ggaggaaagc tgcagcgcct tggtgtttga aacatctgca 60atgtctgggt tttacaagac
atggacaccc cggttctacg gagtgcaggg gcatcgtgtc 120tcggacctcg
ctgctgttca acagccggcg cgcggtgagt ttcgaaggca cccttcaccc
180tctcaacgac tgtgggcact cctgggtgca tggtggcgtg gatctggcat
cctggactcc 240ggggccctgc gtgaaatgga gctgggcatc cagggtacca
tacgattctg gctacctact 300gcgcgctcgc ggagttgctt gctctgccga
tgcctggggg ctgagatcca ggctctcaag 360ggcaacaacc agaactcatt
ctatcgtcag ctcttccgcc aagcttcgta ccgttatctg 420agatgtagtt
tggcgtaccc atcgatgggt gacttcttgc cattgcagcg cggcaagtgg
480gttctcctgg gcagagggaa gcctccaggg caagctcgag ctctgaagcg
cacaggggat 540ggcaaggggc aggctcgatt aagaacaagt caacttgttc
attccctggg agagtatgtg 600caggttttcc ctttctatcc agaggaccta
atgctgagta aagaccagga agacagccaa 660cagagagtga actag
67529609DNAArtificialAlien to Mouse cDNA 29atgtcaagtg aaacttcacc
ccgcctgatc cctaagtcct ggagtagagg gcgcagcgaa 60atttcaatcc cttccatcat
tgccctgggt gagctgcttg cccgttggag gctagtttct 120ctctccattg
gcaaacgtct tatgcatcct ctgcgccaga catacatgcg aatttttcca
180cgaaccttta ttgtcagtaa gatccctgat ggcatggaga tcatgctaag
caagtggtat 240gtggctaatg gaactcccga gcccaagagg ttctgcctga
caaccagtca atggctgagc 300ctttacatga tttccccatg cacatcatac
tgcagactcc gcgcatcagc aatgccgcga 360ggcaggcggc ttgaagcctg
gcacggactg agcaaggctg ccaaggagat cactgcatct 420cggatgtatg
cggagatcct cttgtccgag ttaatgccgg tggagactta tatctgttac
480ttcccgaacc tcgaagccag atgtccacga aaatccccgt tttcgcgtga
tgaatggagc 540atgataagcg tacctttgat caacagtgtg ttccgcttgc
gcttctcctg gcttgcctct 600gggccttga 60930789DNAArtificialAlien to
Mouse cDNA 30atgttcacat tcaccagagt tgggtggcct cggtcccatt ggagatccgc
cgtggggaac 60agtgaacgac ccctcttcat atgggcagcc ggtgccctgc ggcccaagga
acctcttctg 120tttcggttgg aaaaaggccg gggtgtggcc gagctgcgga
gaaggctgag atttttacag 180tgtgaagcta tgtattcgaa atttctgggg
atccctgaaa tgatggaaaa ctccaaggcc 240gtgatcgtca atttttgcac
caaaatcgga cgcagggaat gggagtcgca agcgtcaatg 300ctcccacagc
tgtcaaattt catgacaccg cccagtgaaa gcacgctaag cagctcagcc
360actttgagga tgagcctcct gtacttcgct tctgcaccca ctaacaagac
aaaaattaag 420ggtgtgaatt tctactcgcc tcccaaccac atgcccctta
agctgctaga gtgcttgaga 480catgtgaacc gcgagtgctt caccaacctg
ggataccttc tggcttatat gaattgcagc 540atggacatcc ttaagggcaa
gatttctgac gtgatgggac cgcgtgcctc agaagtcaac 600tcaacagaca
gtactatgtg ggtcctgtca acaggagcca cccccaccgt ggttctcatg
660gaaacaacat gtgcccccct gtcttggagc tacctgcctg ctctgtatga
tgcaccgcgc 720ttcacatccg aaacctacat ctcccttgct gaagcctgtt
atcgaagcca ggcctttcag 780caaatgtaa 78931258DNAArtificialAlien to
Mouse cDNA 31atgtacctca tggcactgaa tatagagcct gaagatctgg cgggattcag
caaactcact 60atggacctgt attttgatga atatgcagat tccatgttgg acaagagtcc
cggcctgatc 120gaatttctga ccgttgggac tccgaagtgt cttctggggc
ctcggctgag tggtagcgat 180gcccatcggg ccagtatcgc tcgggactat
cgccccatga tccaacaggt gggtctgggt 240gtcaacttgg tcacatag
25832264DNAArtificialAlien to Mouse cDNA 32atgatttccc acacaatctc
cgagatcctc accgaagttc agcggcagtt cttctttctg 60gcctgcaggg gcttcttcta
tccgcctctc atgggtggcc gtgaagcttc tgaaactcag 120ggaatggaat
acggcaaggg gtggaacacc catgtccagt gtcgtaagtg caatgattgt
180gtgtgtctgt tgggggaggt ttatgagaaa ggcataagat acagttgcag
tgtgagttac 240agatccctgg cctacctgca atga 26433210DNAArtificialAlien
to Mouse cDNA 33atggaaccta tgtctgcatt accactcgag agcgcattga
atgacaaaaa gttcagtacc 60aagacggggt tgccaagcgg acttaaattt ggagaggttg
ctccagcccg agcccccaat 120ggcttgtcta ggaaagcttc caccaggttc
caacagacgg acgttcgtgg caaccagcag 180catggtctta tcatgatgca
gatttgttga 21034375DNAArtificialAlien to Mouse cDNA 34atgcacggca
tccactactc gctccccacc cagactgctg acaaagcctt aggtgtgggc 60atttcctccc
aaggccagat tcctcaggca aatgctggca acctcccctt cgccgatgag
120ccgggatggc agatgctcag gatgggtggt ggagaagacc agtcccggtt
cacaacattt 180gtcttgattc gattctgtgt aatcttcgtc ggcaggtgcc
aggatatgta cctgctcaaa 240acaacgccac ctgaactgcg ccagaatctc
atgtgcctga agatggagtg cactagcgct 300ctcaagctta aggatgcgca
ggtgcagctt gacctcacgc ttcccttttg ctacgccgcc 360acggtgtcgg cctaa
37535135DNAArtificialAlien to Mouse cDNA 35atgtcaagct tcaactcaca
gtacttcttc ttcgcactgg aacccacgtg gtggttctct 60atgggacctg aggacattgt
gatgcaccag ctcctctctt ttttcaggct gtgtggagct 120gccagttacc ggtga
13536231DNAArtificialAlien to Mouse cDNA 36atgtgccaga gggagagacg
attcacatac ccgcagatta gccactgcag ggaattctgc 60agaggcttca cccaaagtaa
agaacctgga ggacatgaca cagctgagta caaggatctg 120gctgaagccc
tgccaatgaa gaacttcagc tgtccggtgc tggaggagag tttcctttac
180gcaagcgaaa tgagagcttt tctcaagcag caattcgata gttggaggta g
23137180DNAArtificialAlien to Mouse cDNA 37atgtcctggg tgctcaaaca
gtttaaggta atgcgagcca gacctcaatt cctgatggca 60acttcaacac agggggaatg
caccaagaac tggaatgtga ggtggaaaat atgggatctc 120tcaatgctgc
ttgactctca taacacctct tacttttaca tttgcgatcc ggtagtttag
18038123DNAArtificialAlien to Mouse cDNA 38atgcattggt cccaggtgaa
actgttggag cgcttcagta atagcaaaga gacgggtgct 60gaagatgtgc tagaaaatgc
catgccttct gaaatggcct ctacccttgg agaaagcccc 120tag
12339147DNAArtificialAlien to Mouse cDNA 39atggattcgc ccacgacatt
cacaaagttc acaaactgga ttttccttta ttctgtgagg 60gacgaccacg tgtggctggt
atctccattc cagcagttct gcttcccctt atcctctgcc 120gcacctgggc
cgctggcatg caattaa 14740339DNAArtificialAlien to Mouse cDNA
40atgagaaagg atttggagtg cctcctgtcc aaaggcacat cgaatatgct gaagagtttt
60ctgatctgct gggggaaggc taccctccgc ttctgcgaag aaatgcctct cacccttgag
120atggttcacc tctacatgga catccctgat gaacgctggc ctccctctaa
ccagccattc 180tttggaaagt tctactcgac tttcttcagc cgccacagcc
ctgggcccaa gctccaccgc 240cctcagggtg caggaaggac acagctgtca
gaggtcgtgg gcaacttgcg gtgggatcaa 300tactgttggg gcaatcctca
aacgcgcagg cccagttga 33941354DNAArtificialAlien to Mouse cDNA
41atgccctgcc tgggccgaca ggaactcgcc cgcgcgggag gtgtgccagg aagtgcggat
60cggaggaaga aagcgttcag gttggaagaa gccagatatc ccctgtacat ggagggtctt
120ggatctgaga cgcaaggggc agcaaaggat caggccccct cgttccggag
cccgagaatg 180gccctgccct acctaagact ccggcccatc aagagagtcc
ccatcatctg gcggatagtt 240tttcagagcc tccaccctgg cgagaagccc
agggagacgt atggaaacgc ataccgggga 300gaagcggcca gggcagagtt
cacccaagag tctgcaagcc aaagcttcac ttga 35442267DNAArtificialAlien to
Mouse cDNA 42atgaccttca tgaacgtatg tatagccggg caagatgcaa cgcagccata
ttatagggcc 60agttacaata gccacagtaa agttcacacc ttggaatgtc gagttgagct
caaactcaca 120gaattaatgc gctgtgcgca tagaggaaag ggcacccgta
ccacgcgctg tcttatcact 180gccgccttaa ttctgtgtcc ccccacctcc
aaagaattcg cgtacaacaa cttgctcatt 240gcttcccaca cttggggcaa tgattag
26743210DNAArtificialAlien to Mouse cDNA 43atggcaccgg acaggtccac
attctcttac ctgtgggatc ctcaggatca ccatcaggac 60gcctccccta gttctccaat
tgccagggtg tcatcacctg ccttccgggg ttatgactca 120gaggacctcg
catgcagccc cccctttcag aatgcccagc tttggtgcaa ttcgagaaac
180tcaactgtaa tgctgtacct cacactgtag 21044942DNAArtificialAlien to
Mouse cDNA 44atgagcgtga gggaacgtga ggcttcagac aaatctttct ttttggtctt
tgcatttttt 60ttacgaagca gtttcattgg gttcatgaga cagtctttgc atagctgtgc
gaaagcacgc 120tgcgcgacgt tcaagcccca ggaacgaatg tgtaaccagc
ggaccatggt tgccaacgct 180ccggaaccca ggctgatgac actggttgtc
cgcttggtcg gccatggcgg ttgcacaata 240gtcacttctg acccccgatc
cccccagggt gagaaggccc aggatcgcta caacctcatt 300cgggtgcccc
tgtacccggc tgcctacatc ccctgttact acatgaatgt gctatccatc
360tcaagggaac ttgagctgct attgagctca atccaggttg aaatgagaca
cccagtgagc 420aacccgggac agttatacta tatctctggt caggtggatc
ccggctgtga caggagaatt 480gccaagtcgc ctcgggatga ccagtcggga
tctccccggc agagagatgc acccagctac 540aaggtttcca cgttttaccg
ggctagcaga gctaagagta gactaaaacg gacagacccc 600aagaggacct
catccagtca ttccacgttg attttgttta tgctaatctt ggacacttcg
660aagttcatgg tgaagtccag ccggactttc actctccttc ttcaggactt
ccattcagtg 720acacggaatc agagctccag atttcagttc aggcggaatc
aggaaacagc gagatctcct 780ggagtggcca ctaaggagac gggagcgttg
acacagatgt cacccctttc tccgcagtac 840cgcagagtga ctgagtcgtt
tttcttagtg cacggttctc tctctccacg tcggtgcctg 900gagccctacc
ctttagccca actggaggaa atccagaagt ga 94245357DNAArtificialAlien to
Mouse cDNA 45atgacctacc tgtggatgaa ggcgatcagc agtcatgcca agctgccggc
aaacttcacg 60atacagtcat tctcccagtg cattcaggaa acaaccgcaa gtcctgatag
agaactcctg 120acgatgctga agcccacaag atctcaagaa gagacggacc
tactgaatag actgtggccg 180gataacctct cttctctgac ggagatgcca
atctcccgtt gtctgtgcag aagcatccgc 240ccttacacct cttcagcgga
ctccgtgtct aaagagatgt gccagttttg gcaggtggcc 300tttggcgagg
ctggcaagcg tgaggactgt cctctttacc ccaggtcaat cctgtaa
35746129DNAArtificialAlien to Mouse cDNA 46atgaaatcct gcgtggatga
agaatcaagt cattgctatg ggtccgcgcg gtgggaagcg 60cttaagcaga gcacgggttt
tttcgccact cgtgagcgag agagcggctt caagcaggat 120gggtcctga
12947156DNAArtificialAlien to Mouse cDNA 47atgctgctga tgccagagtt
gttagaaaca aaggactcaa tggaagccga atccaaattg 60aagagcatca gcatgcagaa
ggctgagttc aaagaggggg gcatttcttt aggaaaacgg 120ctcacatcgt
acccgaaggt ccctctggaa tcttga 15648240DNAArtificialAlien to Mouse
cDNA 48atgttcgcct tcttagatct gactagtttc attctcgcgg gccgggcttg
gtacactacc 60tcaccctctc ctgacaccga aatctggcat ttaccgcctt ctggtgctga
gctgtgcaaa 120gcttgcctct tgcgaacccg caatgcgaca acagactctg
agtaccacac tatttcccgg 180aagtacttaa ttgaccccat ctcacagctt
tcgctgttta ccttaatgca cctgctctga 24049138DNAArtificialAlien to
Mouse cDNA 49atgatgagca agcatcacac cccaaccacg gtactctgct gccaaaatga
agacctgcag 60ggaaccccga ggctgcgagt gctgaaccca aatcaaaata cctggggcat
catcaacttg 120gcctacagaa gcatgtga 13850201DNAArtificialAlien to
Mouse cDNA 50atgaacgaca tgcatgcgct ctttgcgacc aaaacacgta tcaccgagag
gggaaataag 60ttcttctccc agccctcgac caactggaac acgttccagg cagaggagca
ctgtcagtcc 120ctcagagcgc cactccgtac cagcggtatg tatggcccct
catgctcagc gtacctcttt 180gatatacttc tgatctcgtg a
20151240DNAArtificialAlien to Mouse cDNA 51atgatgacgc ttggttttgt
ggaggcccaa atccactctt tacctctgac tctgagcgtc 60ctctgctgtt tgaaaatgga
tcagatggga tccattgagc ctgacagaaa gaaaacccca 120gagctcgagc
tgatgcccgc actcttggcc ccgagtcgtc agccaaagtt cctgccagcg
180gcggatcttc tcccagaggg tgctcagacg tctaccctcc tcctgggtca
ggcaggttga 24052123DNAArtificialAlien to Mouse cDNA 52atggaagaga
atggcctggc acattcctac actggggtga agttacgggc caatgacact 60ggctccctgg
cgctgcgtaa gcagtcagat gtctgtgttg agtcccagac agcaagtgcg 120tga
12353156DNAArtificialAlien to Mouse cDNA 53atgaccttgt tcctttccgg
cctgtacccc aagtgggccg tgagccagag ccactatcaa 60tcctgggagg gacccgacat
cgctgaaggg accatcgagg atcacctgga gcgcctcaaa 120ccggtcatga
gagccttgat taatggtggg acgtaa 15654225DNAArtificialAlien to Mouse
cDNA 54atgacacagt actggaggat tttgatcgtg ctgcgaattg atctgccggt
ctccttccta 60cagttctatg gagagagccc ccctcagtgg ttttgccgcc ccaaacgctg
cttaaaaagg 120tctcggtcga acggactaaa ggcacgatgc aattggcccc
ctgttagctc tcgcacctac 180atcaagttca agacaatgtc ctatgctctg
aagtggacac cctga 22555882DNAArtificialAlien to Mouse cDNA
55atgattgtgt tgaagtacat cctcttgctg tgtatttaca taaacctcct ggggtgcaga
60aatgcaaaga ctagctgtga gtgtcccagg ccgaccatta ggaagtatgt caggcagcct
120tcaatctctt gttacatgca ctggtgctgc catcggaaca caggtgagca
gactgacagt 180ggtcttacac ccaggcatga tcggcgtagc cctgacatgg
ctaagggtca gcaatgggtt 240gtcccggcaa tgggcagttc cgggggccat
gagccgaact catctgcata cttatgctcc 300agaggaatat acttcagaga
ccggaatgaa tgtgccgagg gcctgctcca cacttggccc 360ctggtgtatg
acttcgtgat agaactaaca caacggttcc cttacaactc ctcgggtcac
420ggcattgaag acatagaatc cttcaaaaat tggaacttgt accggacttt
cgtcatctcg 480gagggctata aactactgaa catcaagaga tcaccaaagt
ctgagttatg ctcaggacgt 540atggcttttt ctttcctccg gctgtttctg
ttccacaaga gacagccccg tggtaaaatg 600gcaatgcgct atgagggcaa
gtggatcttt cgtggggaag gcacagagag tggcgttgtc 660cctctcaggg
tcggactttc caagagcgca ggcaaagata ggatgtgtca gacccccatg
720accttagcaa ccaagggtcg aaatacccga ggcctgcagg gctaccgcct
catcaagctg 780aagtgtgctc acctgtgccg gatggatgat caggagaggg
cggtccgggc catggccatc 840ccattcaatg gcaagggtgg ggtgacactg
tctatgctgt aa 88256264DNAArtificialAlien to Mouse cDNA 56atgaagcttt
gtcctatgag gtggctaggc ccgaacaagc caaacaacct ccacctgtat 60ttgccgccta
tggtcccata ccgccacgga ttgaggtgca catttttcaa ggccgacttc
120tgcagggacc cctgttggac aaatatgtgg ccaatcctca ggcgaaatct
gattgcgcag 180gcagggctgt actgtccgtt tcaggtccca ctcctggaga
tgtctgattt ctccgctaac 240cgagaagaaa tctgggctgc ctga
26457327DNAArtificialAlien to Mouse cDNA 57atgccggttg cgcggtatcc
cagtgacagt ctcaaactgt ctctgaaatc caaggcctgg 60gtgttccatc aaaaccctac
tgggcccttc acgacaaccc ggcccgtcgg ccgcctgcag 120gggcggcagc
agccccccct tggaggtcag aagaagttgg ccgaggagca tcctagacgc
180tccctggcca aactgaaatc ggctggggcg agcactgggg gacttaatat
tggggatgat 240cggaccttcc cgctgtgcac gtcggcctcg ctcagcagac
ccctcaaccc taagagtaaa 300cagagcaaca ttatttgcat ctcctga
32758225DNAArtificialAlien to Mouse cDNA 58atgacaggta tcttttgctc
ttatgccact aaagctggaa ctgcaatgtc cttgagattg 60ccccctgtaa aggccagcaa
tgcctgtgac ctgagccctg gaacatgtcc tcaggaccta 120gatagtgaaa
tgatcaatca ccagtattgg aatcgcctgc ggcagattca atgcggtttg
180aaatctattg acatctttgt caaactaaga ccttctgtca gctga
22559339DNAArtificialAlien to Mouse cDNA 59atgaaatacc ggtgcttggg
gcagctcact gcctcttaca ccatggcgga atatttggca 60ttggcaaaaa caggattatt
tcccaatagg ggttttcctc gcaagacaga ggggacttgg 120gagtccagcc
tgcctcagtc cttcgaagat aggggaggct caggacgcct gacctcactg
180caccagttcc ctgatgtgat ggccaaagag gaccggaaaa ccgaggactt
tgcggtcagc 240tctctcccag agatccagcg cgtctccacg ggccggccag
atatgagata tatgccggaa 300tacattgata atggccccgg cagcaactgt gtgttttag
33960321DNAArtificialAlien to Mouse cDNA 60atggacggag actcccacta
tcgcacaggg gggaccaagc aggataccct ggtccagtac 60acattgctcc ctgaaattga
ctttttcggg gggattgctc agaatatgat gatcatgcga 120gttgccagaa
cccccccatt tgttgcagaa caccgtcagc ttatgcagga tggagggcca
180gagcagagaa atatggaggc ccgtgaacca gcccaccggc tcactaaggc
gatgtatgtg 240tcatgcaaag cagaagtcaa ggggatggtg acgagcctct
ctggggtgcc gacctgcggc 300ctgccatcgg aaaaggagtg a
32161192DNAArtificialAlien to Mouse cDNA 61atgcagatga ttgtcccaag
tggggagaca aagatgtacc ctccgctgga ggccctccag 60gaggatgact gtatccaggc
ccagtggctg cacacaacct cccaaagctt ccatgagtta 120gtgttaagga
atgcagtccg cacaccatca aaggttacca aattcccttg caaaaagttc
180tgcgtcattt ga 19262666DNAArtificialAlien to Mouse cDNA
62atgagctgcc cttttcttct tcgtggcatt cagatgcctt ctctggagag aaccttcgtg
60tcagatcctg gctattccat ccattttgga tctgaaatgc ttgatgttgc tcatcttgct
120tctggcacag agcaagtcca ctgggcgaca ctagaatgtg actcgcagct
cggaaggaca 180cttgagcctc ttgaggagat cactctaagt tgggtgttgt
tcctcctcaa gttcttttca 240gaagacatct ggaaacttaa atccaaagaa
cgttccggcg atgacatgct tgagaggatc 300acatcaatgg agctcttgct
gccactgaga cggctagaac agctaagctt ctattccttc 360ttctctcagt
gtactgccct tcgccggagc aagaccagcc caccaattcc tctgtgcgtg
420tccctgggca gttgccataa gcagcaaaga acctggctgt acaatgcact
gatcaagtac 480ggggcttcga ggagaaggaa ggtccccaag cggatgccca
ttgagagtcc gttcagcctt 540gatgaggagt gtcttccatt ttcagtaatg
cggcaaaggg agacacggac aattggcctc 600acacccatca tgcagttcct
gacctgttcg cccgtaaaga gtgtggatcc gagccggagg 660gcatga
666631311DNAArtificialAlien to Mouse cDNA 63atgatcactg ccaaagatga
gaccagatgt ctgcattcct cccgagtaga tcggtatcgg 60acacttgcgg acccgatgtc
tgaggagatg tcgtgttgcc tcctggttgg gcgcgttcac 120gccaagggcc
tctttgacaa aattgtccta atccagaatc ccttcatcct ccacgacttt
180ttcatgcggt tcccttctcc ctcccaggta cctctatatc agcgctacaa
acaagacctt 240gataaggacc tgtgttccag cctgccttgg tactacaacc
cgaagctgcg gcagcgcact 300tcgcagctca cctacaagct ccgcacaatc
tctgttggcc caagacaaga ccatggcacg 360aagacgtctc tcccaatgct
gactattacc caggtgactg cactgagcga cctgagaatt 420tttttctctg
gatttgggga ggacctcccc ctggagccct ttttctcact cctttcgtgt
480tatcggtgcg ctttctgggt tttacagttc ctgctctata caaggaatgg
cctcaagtac 540agcaaggcgc atgacaaaga gtgtccatgg cccttcatgt
ccaacttccc acatgcccgg 600gcctgtcggg gttggctgtt ttcgtgcttc
agaaagacaa gaactttacc ctcattcgac 660agcgtgaggg agatagtctt
agcctcaaag tcctccgata ggtacatgaa gcattcagtg 720catcggagct
gcagttcaac agagggtgcc gaatccaaga cgagcctgga ctgtcttaat
780tcaatgcaga agaagaagcg tagagatgaa gaattactcc aaacaaatga
atttatgatc 840tcctgtggat ccctggctgt gcaataccga agcatctccg
gcataattta tttgctccgg 900gagcagcatt acatgcacca gacccgcacc
agttttcagt ttacccagga ccaatcgttc 960ctggctcggg agaatcacaa
ttgggggggt gcctctaatg actacctcct gcgcgagaag 1020ctggatggga
agccaatgag aggcatgatg ctgtcccaac acagcgtggc atgtggtttg
1080cagggcaaac ccattgcaac caacctgttc aagccttcag tgaacttggc
agaagagttg 1140tctgtgaaat acactggagc tttcctgcgc tcagacgccc
tgctacagct ggctcaggcc 1200ggactgtggc cccagaagcc gtacctgatt
tggagaatca gggtggaaaa gacccacgaa 1260tggggcacgg gtgaactggc
gctgagcatg gtcctgagct gcttagactg a 131164306DNAArtificialAlien to
Mouse cDNA 64atgtgctatc catcgcctga ctggagaatt gtgataataa cccagttact
gaatacgaga 60tggatcgcag tcagggcact cttcatggca agtggacgca agccttgttc
aaaggtgatc 120caagccgcca ttgcctcaat ggcacagctg ctctatgtgt
caaaggccag cacattagta 180gggtcagtga tggagggaag cgaggactgc
agttgcgagt ttcctgatat gcctggtatt 240atgggagatg tcccttcccc
aatgttcact cttggcatga tcctgccatt aaccttgttt 300caataa
30665264DNAArtificialAlien to Mouse cDNA 65atgctgacac tttgcatgat
cctccaggcc ccgacaaaga gaatgatgga tggatctgaa 60agtggagtgt tgcagttcct
gcggagtcgc tactcagggt acctgggaga tcccatggca 120tttctcgagg
atgattccag aagtaagccg acggagagaa ccggccttcc tgtggagatc
180cacatgatgt cgtttctgga ataccatggt gaactggtca acttcttctg
gcgcagaagg 240cagcttcagg acgaaggact ttaa 26466360DNAArtificialAlien
to Mouse cDNA 66atgcacaggc cactggggac taacaaggga agtgccccag
tggagggtta ctctcgtcgg 60cccaggccaa aaaaagagcc aaattccctc ggccgcatgt
tctgcatccg ctcagcttcg 120aacaccaatg agccttacac cttagatcct
gaagactaca tgaaagcaga cgggagagta 180actgtggtcc cgggaagccc
agcaggcctg acatccagaa gttacttaga agcgccccca 240ggggaacaaa
cacgggagcg gcccttaggc attttggtcc cttatatgcg agccccgaag
300aaatactctg actacctgat gacattctgc acgcgtaagc ccttccataa
gtccccatga 36067285DNAArtificialAlien to Mouse cDNA 67atgcacttgc
actacgatcg catgttattt atgcagcacg aaacgttggt tatatctatt 60tcgcagatca
atgacctctc ttgcaccacg tcaccagcca cgatgggcag gtgcataacc
120tgggggccca cgaggacaac ttttctgctc tttcgggaga ctgatgtcag
ccacctgtgt 180ttgatcaaac agctgagctt cttcagtcag atcctgcagt
acaagcagct catgtcgaac 240atatcggagc gcacgggacg atacatcaga
agctaccatc tctaa 28568663DNAArtificialAlien to Mouse cDNA
68atgaggcact accctgcttg gcaagcctca gccatgctct ttgagtacac tggggatggt
60ctccagcagt cccctagtct tctgagtctg ggctcaattg ccaatacggt gatcatacga
120acggaccggg ccccacagga gcgaacgtcc tgccataatg gtgaccttat
caagagtgcc 180ggcacctccc tgctggatat gcgagatccg catgtgtcag
cggagggagt gactccctcg 240aacctgatga tctgcaagac tccaccctct
ggtttctgcc tgtctcactc ggactgctct 300ggagaaaagc agatggctct
gagaatgtca gccagcaata tctttcaggg tcggaaaacc 360ccggcctctc
cttgccagtc gacagctacc tgcattctct ggtactccac ctcaacccgt
420gctgactata ttcggcagtt ttacctgtgc acccgagcga atgggcgagc
tccccgccag 480aactgcattg gcatgggcat actgtcattg tattctccgg
tccagatcga ctcccctccg 540ccccagtgcc caacacccct gttgagcctg
gtcggccggg tgacgaggga gtcacagcag 600gttggggtgc aacgagccct
aatgctgggt acgagcaccc ctctgctcaa ccgccgcaag 660taa
66369120DNAArtificialAlien to Mouse cDNA 69atgcggattg atgaagggac
ccaggaggag tgtgagctct gcgctctggg cacgaagagc 60ccagccatca tttcgcctcg
acagtacaga attcgaactg tgggtttcat gctcagctga
12070249DNAArtificialAlien to Mouse cDNA 70atgctatcgg aggcctcgag
agatcgcgtg acggaaatgg ccatgatgac agattcttat 60cacctgccaa ccatgcctct
ggcccctgag tactctggca cgtttaggga aagctcttgg 120cgaacatctc
cacatgcgat tgatccaggc tggcagagcc aggtgtgtga gcagcatgat
180aaccgcttga acagggagtc aatcgctcag gtcgcttatc agagagggat
ctggatgagc 240aagaactga 24971438DNAArtificialAlien to Mouse cDNA
71atgtacatgc cgatttacga gcccaagatg gagatgtccg gtcagcccag aatcgaaaag
60gcccatcggg atggcaagtt agcgacccag ctctcttccg aatatttcac cgagaaggag
120ctagacctgg ttgaccatgc tgagtcttac ccaatgatag tgggagattt
tgggggcacg 180cccaccaaga attcaataca gaccccaggc ggatcgatct
acggcctggc tcagagggac 240atcagcttta aattaatgtc catgtccagc
agttggaaga atgtgggaag gtatgcagcc 300cccttttgct taggtctctt
tccgcactac gggaacatgg aactacggga acttctgttt 360tcccacatga
aagcgcgcga aaccagaacc acgtcaaccg agtctctgac atccatcaga
420ctcaggtcag gctggtga 43872489DNAArtificialAlien to Mouse cDNA
72atgctgagat acagccggat ggccatcaag caacagcttg accaggtggt ttacacacgg
60tccctttcat tcacggacct ccacttgcag aacaagcagg caggccctga aaaacatggt
120aacttcaacc tctggggccg catccgggat ctcaggatgc ggtgtatcct
gaagttcagc 180tggggaggag aggtttttgt tcttcaatca agttgttcct
ctgactcttt ctcagttgag 240attgagttgg cagaggtgag attcctatcc
taccagaact cacggttgcc agcgccacgc 300accgactatc tgagtgcgag
ccgcacttct aaaacaagct gttctctgcg cgtgttcata 360ttgggacacc
agctaaactg ccctctgtgc actgctgctt cttttattga
agggaaacta 420tgtagcaacg atactggaga ctacagctgg ccgcaagcgg
gcccctgtaa ctggtccgct 480tatctgtaa 48973303DNAArtificialAlien to
Mouse cDNA 73atgattggaa aagatgagat ctatatgctg tcaaagggac atcagccaag
acgtaggact 60ctgaaggcct caacccccaa cctggtcagg cccaagccgc cctgcaccat
ctctgtgcgg 120gccaccttaa tgctaatctg gtttcccttc cagtgcctga
tagctaagat gcagttgacc 180ctggagacct ggtctccctg gattatctgg
ctcaatctta agggatggcc ctgccggatc 240ctgccgctta tgtacccatc
aagaaagtct gcagctgact acactgactc tgtggaaaac 300tga
30374141DNAArtificialAlien to Mouse cDNA 74atggggctct ggcggaccct
gagggccgat gtcaagaaca gcgatccatc ccctttacag 60aaagggacga aagctaagca
ggtggagagc cggaaaatca tggagtacgc gcagacagag 120gggcacatca
cgttggagta g 14175180DNAArtificialAlien to Mouse cDNA 75atggctcgga
acctcctggg aacaggaccc ttttcgcacg aacgccggaa ccagcaaaac 60gctgagttgg
gaactgagag tattatcctt ctggatggag ataggagaag tgcgcgcaca
120tctggcaaga ggttcaagaa ggtatcttat tacttccagt gtgactgcct
gacgctgtag 18076141DNAArtificialAlien to Mouse cDNA 76atggagcttc
cccgctccag taagcctatg accccgtatc ctgagcgcag cgggatgggg 60cactggtgga
ttatctatac caagcattcc tccagagggt cctctaatat gatctgctgt
120ggtccagact ctagcaaatg a 14177123DNAArtificialAlien to Mouse cDNA
77atgctccagg accgctgctt cctcgcaaag tgcctcttat ccagcatgtt atgctattac
60aaaaaaggct tgagcgaggc ttttggcgaa cccaatgaac agagctgcaa catgcggatg
120tga 12378177DNAArtificialAlien to Mouse cDNA 78atggaacaag
gacctgccct ggaggaggaa aagtcagctt gccagagcct gaccttcacg 60tttctgagtc
cctcgagagg caaccagatg cagtggaact cccaggttgg aagaaactgg
120actgtactgg tgccaaagga ttgtgctagt gtgtttaaga gttccatgaa cggctga
17779174DNAArtificialAlien to Mouse cDNA 79atgcagcagc cgttcgccag
ttactccacc agtttcaagt caagtgatct ggcgactaac 60tccagcacgc agctggtctg
ttctggccat ccctcgggac ttcccttcgc ttcaatgttc 120attagggctt
tgtcgccccc tgcgctgcgt ggccccccaa agctcggatc atag
17480363DNAArtificialAlien to Mouse cDNA 80atgctgagcc ggtttcttaa
ggcctttctg tttcggtgct ttcagtgttc tgagcgggaa 60aaggtggtga agaagctctc
aaccatccag attgagaagg aggagccgat cgccctgtct 120tgtggtaagg
ccccccattc tgacctgaac caagtgctcc ccatgtttaa tttcgagttt
180tttcatgggc tcaacgtggc cgagaacctg gtgtctggaa ctgcttcgca
ggagaaggga 240caatgctgct atggtttcaa cagcaaaggc cgctctgtcc
gggcactgga attcgtgtgt 300atcagggcct tcagcaacat ccaatcggat
gactccagtg acgccccttt tggcctggtt 360tga 36381462DNAArtificialAlien
to Mouse cDNA 81atgagcggga acctccgtat caacccatgg ctgactgcct
gcatctgtgg ggaaaagtcg 60actcagtgtg ggcctgctaa ggccgccaac aacaaacgct
ttcccaggga tcaggccaga 120aagcggctgt attcgccatc cccacccatc
ctgaacacaa tgatcctctc ccctaaaagt 180tgggtcacgc tgcatgttgc
gaagaagcag gcccccacgt gttggctgct ctccaccgcc 240aacttaaaat
tccttccatc ccagttgcaa ccggaggcag atcgaaactt ttgtagctct
300gattaccacc gcactctccc ttgtgcgcag gctatcatca caaatttgga
gctgaaaatc 360tggacctcca ccaaagcgaa cagtcccgaa cctgtggcga
aagccctgga gttcaacacg 420atagtgccat tgtgcaactc agaggaccgc
tttattgggt ag 46282168DNAArtificialAlien to Mouse cDNA 82atgtctccca
acgacattca ggtgattaca ggcttgcacc aacgcttgcc agtgcttctc 60aacacccttc
gtatgtctga caaggcattc actctttgct gcaagaagac caaccctggc
120agcctgaaaa tgcagatgcg gaaccgtcac ccggatcttc agaaatag
16883207DNAArtificialAlien to Mouse cDNA 83atgatgaaga ggcgaactct
ctctcggatc tgcgacatat ggacagtgta cggatgcagg 60aaatgtaacc attacagaaa
cactattctt cagtccctgt ttctcatctt ctggattgaa 120atttgtgagg
agcattccct tcattcatca ccgaggcaga ccgcctcctc ccagttctac
180tcaccgagac tcaactccta cgagtaa 20784144DNAArtificialAlien to
Mouse cDNA 84atggaccgcc cacacatcgt gtccatggcc tttttgaact gcgcttcctc
agcggccatc 60ttgaagggcc ataaaatccc cctgcccata aagatcctgc gcttcgatcc
actctctcaa 120agtactgaat ttcctcgggg gtag 14485132DNAArtificialAlien
to Mouse cDNA 85atgatttttc acctgctgtg ctttgctaca ctcgatgtga
ccgtgacgca cacagtggcc 60actgaagcct cgaatggaat gctgatcacg ccctctgaag
aaatcaccag caccaggccc 120gtgatattgt ga 13286192DNAArtificialAlien
to Mouse cDNA 86atgtgtggca caggggttag tttaccttct cagataaaac
atgaaaacaa ctttttattt 60cccgactgga caatgctaaa caagccggaa ctgtacattg
gcgggattga ggagaactac 120tgccagtaca agggtcccat ctggatcttc
agggtggacc cgcagtcaga aggccagcgt 180ctgaagttat ga
19287492DNAArtificialAlien to Mouse cDNA 87atgatgtttg aggcctgctg
cccactcgcg gattcgcagg ggaagagcaa gtccaagggt 60ctgaggaagg gagaatctac
cccgcttgga ggggggcgga agttcctgat gctgtctacc 120agcctcagca
tctactcgtg tattaacatg ggccccatct cccttaacgc acacattgat
180gataacacac tccatcagac attcatgtcg cgctcagtgc ttgagcggct
agttggaacc 240tctcaaaagt tcgatacaca ccctcatatg tgtgctgcag
atgctcagta cacaaagtct 300agacggtgtg agcaggcctt ttgggcaccc
ttgtcgcctg cgcttgtttt ctccatcctc 360tctcaagaaa tgggcgacac
ccccaagaaa aaccggtgtc tgaagggtcc ccagtgcctc 420aagcgctgtt
gtcaagagtc ctgcctctct ggtggctttg taatctttga caatccagtc
480tgctacttat ga 49288222DNAArtificialAlien to Mouse cDNA
88atgaatgcag aggacatgct ggggaaacac tgcgcttatg ctttttgcac agtccctatc
60ccgaagggag ctgtgaactt gaaaaccgag tttgagagtg gctgtgcgaa gtctgccaac
120ggcaactccc gcaaagacag tgtttcaggt ccatgcccta agatgaggca
gaagtgggac 180tggggacccc gagaaggagt ggctcggaca ggagaattct ag
22289150DNAArtificialAlien to Mouse cDNA 89atgagagtga gggcacggct
gtcaatcccc ttcaccacga gatccatggc cctttgctac 60cggaagtcgg gggacaccgg
ttttgttgtg cagaaggagc cccaggatcg gtacacggga 120aggaaatgtc
aacccgtact gatgacctga 15090297DNAArtificialAlien to Mouse cDNA
90atggagaagc tgtcctggcg tgctggcctc ctccactctc aggatggaat aaccagggcc
60gcctacccgg gaaaagagca gtcttcccgg ggccgcaatg cgaccttttg gacagctcag
120cctgactccc gggcggcctc ttactcccag ctctctgtcc agaagtatcg
aacaacagcg 180atgtgcctgc ctgtgtccat gtctagtaat ctggtctcca
tggagcagcg gttccggcac 240aagctcatcc agtggcggtt gtgtctgaga
atgtctagtc taaccattat gtcatag 29791129DNAArtificialAlien to Mouse
cDNA 91atgtctttga cagattttct ttctttctgt gttctgagag taatggccaa
acatctcaca 60gactataggg cctcagctca gcttgggtgc tgtgaacagc aggcttctgc
atcccgaccg 120gaggaatga 12992123DNAArtificialAlien to Mouse cDNA
92atgacggcct tgggggctgc aagttatagc cgttctgttg tctatgatgg ccatccgtct
60gcgccagagg gtggggccaa gcgtggcaag caggtgaagc catggttcaa gcaattggaa
120tga 12393435DNAArtificialAlien to Mouse cDNA 93atggtgtggc
tcctaccccc cttaccattg agccactgta agaatccttt ccttcgtaag 60tgcttcaagt
ttgagcgctc gtgtgcagga atttcttgct ctgatacgcc gccctactcc
120tgccgtcagg ccgagagctc cacttcatat ttttacccat tctcaatgac
cagaagcacc 180atgaccatcc cagaccaaac caaaacctgc caggcgtgtt
ctgtgacccg gttcccctcc 240cgggaggaaa agaccaagaa cctgatgaca
ttctgttaca agatgcatct gcagatggtc 300ggctatccgg tcaaagacac
gttcctcaaa gaggccaagg actctgattc ttcagggact 360gagtttgagc
tggtgaatgg gccacctttt tgtgggctcg ggattcagtt gaactgctgt
420tcccccagtg cctga 43594198DNAArtificialAlien to Mouse cDNA
94atgtccaagg agattcatct gcctgttctg agccgggccg gactccctcc gagttgtgag
60aagcttcgag gctccccctc tgtgctctcc atgacatttg cctaccccct gcccaagcgg
120agccaccagg caatcgccac ggcgtcccgg gagctcatgc taaccttgga
cccctcggcc 180aaaggaccgg ggtattga 19895726DNAArtificialAlien to
Mouse cDNA 95atgcccgcga tggccactgg cgcggagtgg gcctctgcca cacggatatg
cgaccgttat 60gcgacttccc acgtgaggcg catgagatca ggggcaagac tgatcaaaca
gggagtggag 120ctgatcaagt accgccccac cacttgcccc tacatagcca
tggatgctcg cgaccttttg 180cgacacattc ggagccccga atgggaaccc
tactgctact gtctgacagc tatctcaagc 240tcaaagaact atcttctgct
gtccgtcagg gcccctccat tctcgcaaaa gaaacgactt 300cccgtggagt
gggtccttca gtgtaccccc atctgcaagg cctttcaagg gtcaacttca
360tacaagctga acatgttctc ctcttgcgcg cacactagcg ctttgacttc
aagggattgc 420aaaaagtcaa tcatgaggcg caaccattgc tacttttatc
ctttcctgga tggagcagga 480ttcccggggg ccattacatg caaaatcaga
ggatgcattc tgggcatgca gaactctccg 540gtgggccgcc ttaatgggtg
ctgcaagcag tctgtcaggg atgatgagac aaaggcattc 600ctgcagcccc
gtttggtcgg gacgtcaatg gtggattatg tgccgctgca actattctgg
660gagcaagttc cgctcctcaa gtgttctctt aacccaataa gcttgaaagc
cgcagggacg 720cagtga 72696158DNAArtificialAlien to Mouse cDNA
96atgtcttatg acttacggtg gcttcaccgt ggggccacaa tcacagccga aatcatctta
60tcttgtaagc tcccaaaagt gagaatggat ttctgctggg tgaagcagtc catggaggcc
120atggtggcca tgaaggacca gaaagacgcc ttttgctg
15897318DNAArtificialAlien to Mouse cDNA 97atgaccagaa gctgggccct
ggtgccaccc cacctgttgg ttggagccga aacaacccct 60gtgacttcat atgggtacaa
agcgaagagc aacatacgct ttgtgttctc tgaggctttt 120gaggctcaac
agaggcacga aagccgttca accaaccatg cctgggccca gccagcaggt
180cgaccggtcc atctcattaa ggggcaggag aaatctaggg aaaatttaga
tccgagctgt 240cccaaaccaa agggagcgga ccggagtctc acaaaggatg
gaacaatgaa gcaacgatac 300gacttctacc tgccgtaa
31898732DNAArtificialAlien to Mouse cDNA 98atgaagtatg tttcccagga
agcccacctg gtctatgttt atatgtatgc ggatcactac 60ctcagcagtg tgctgtcttc
ccaagatggg cgcccctcaa acttcatcac gcgcctgaca 120aatgcgagtg
acaagtggac taacaagacg aagtccatga aggacagcta tcagggtttg
180tgggagttgc ctgggatcct ggagctgaga gcacctgaca tggagctgga
acttctgacg 240aatgggaaag ccctgatggc gatccgcatg atcaacatga
agaattcccc gcaggatgcc 300aaagaggcct cgtctgcgat catggccaaa
gttcccagtt tagttgtgcc atgctccggc 360tactttgcct ggcggcagaa
gggcttggag cgcaactttg atctgaaagg ccaaagtgtc 420aaatacagaa
aaaatacagg tcctggcctg tctccacctc aggtgaggac ctcctatcag
480gaaaacctgg ggacacccct tctgccacca attcagatga tgagctacct
agtgatttcg 540gacctccccc ggaggtctaa acgtgattgc aggcgggccc
gtggagtctt tgccccacgc 600gagggactag ccaaagaaca gggcaaaagc
aagctccgcg cagcttacat tcacaacaag 660ggtttcgagg gcctgactcg
tgaacaagtc caggggtatg ctgagagctg tgacgttctg 720ccacagcagt ag
73299132DNAArtificialAlien to Mouse cDNA 99atgggcacaa agcccttctc
actcaaggga aagagctaca agcagcctaa cctgaaaatg 60caccccctcg tgcctccctt
aaacagattc ttgtgtcagg gtgctgcagt tgcagagcgg 120aaaatgcggt aa
132100441DNAArtificialAlien to Mouse cDNA 100atgaatgggc tcctgcacac
gacatataag gagaagacgt cgtatccgcg tgaggtgttt 60gggcatagtg cagaaatttc
ccgcctgtgt cctctgcctt ccagttccat ggcaaccccg 120ccaaatgacg
tgaatatggt gatccccctc aaaagacgtg cgctgacgaa cacctatggg
180tctgcttcga ttcgtcagat gacgccgatt tacaacccta ccgtctctgc
ctgggtttac 240tcgagccaag aggcactcaa gtgtcgttac ctgggcttcc
ggcggagaat tgaaatgccc 300ttttgtttta gtggtgcggc caacagatcc
tacaactttt ctgctaagga acgcttgggt 360cacgcacctg cctgtatccg
atggcacaga tatttatgga tgaacttgga catgaaaatg 420ttgactgccc
ttcgcatctg a 44110170DNAArtificialOligonucleotides identified
according to the present invention as alien to mouse cDNA and
useful for hybridization applications. 101aaccaatccc atcccaggtg
tgcggcgaat cggtcgatct agtcctaatt agccggatag 60gaaaacctca
7010270DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 102aagaacccac gccgtctaca tatcgggcac
gtgctataac gactcaggag tatttaacga 60ccgcacggaa
7010370DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 103acaggtgtcc tcaaaccagc ctgaaacgtt
actaggtgaa gaatcaccgc ggttgtcggt 60agttaagcga
7010470DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 104acccgcgtac acagtaggca ctctacggcg
cgtttagcgt taatcaccaa ttttgcaata 60gtcaccagag
7010570DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 105acggactacc tcggccactt catttggcga
cctgcggata ttgcttacga atctcgatct 60tccggattat
7010670DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 106agaagtcgtg tgatcgaggt agcactggga
tttacgaaaa ttgccctacc ggtatacgct 60aggccatacc
7010770DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 107agcccacata tagcccacgc gggtgtcgac
aacatatgtc gtatgcgagt aacgttttcg 60tttgagatgg
7010870DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 108atactacttt tgggtatgct agctacgtag
tacccttcaa tagccgtcgc ttggtctctt 60gcgcgtcacg
7010970DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 109catctatcta tgtaagttac cggcatgggt
tatggattcg tggaccgcga tgtgacgtag 60gggtttccac
7011070DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 110cattttaccg ttaccgggaa gcgtgtgtgt
ctttatttgc gcgtacccag tgttgagaac 60gacggaacag
7011170DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 111ccatccgggc cataagttta tagtagcgat
tgttttgccc ctaccagcga atcgcgccca 60gttagtaatc
7011270DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 112cccgagcttg cgctagtacg attatgtacc
gctatgtcaa tttgacgccc tcgcactgcg 60gcactttatt
7011370DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 113ccggctcggt gtcaccgcgg aagtaccttt
gagtatcgca cttatcggct ttaacctgga 60cgtaactaaa
7011470DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 114ccttggatgg gtaaattccc tcgtctacgc
gtaacaactg aacgcgtagc gcgacggtct 60caggaaatta
7011570DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 115cctttccgtg ttactcggcc ggcaaggacg
cctcgtacca tctttgatag atgtatttgc 60gtaaattcgg
7011670DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 116cgcgaccccg actggtagtt gcgcgctcgc
attaccgagt tcacatcgca tgtactacat 60tagagaaata
7011770DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 117cggccacaac tctcaggacg catataagac
gcggaaaggc atacacgtct acttagagac 60accgagactt
7011870DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 118ctgcttaacc gttccagagg ggcgttcgta
tcaaaaaggg tgcgatttcg atcacgtcgc 60agtgactcat
7011970DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 119gaatggcatc aacggcgctg tacatagtct
tctcgcctac ataatagcgc tagttgatag 60gaaccagggg
7012070DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 120gagctgcaca cccgcagaca tcatagtgag
tgtaatcacg cacgtgacca gttaacccat 60ttcgtggaga
7012170DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 121gatggattca cgaacgagca cttagtaacg
cctggtactg acatcttatt gcacgtagtg 60gagagcctgg
7012270DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 122gcaacgacca gctacctgtt aaccgtatat
cagagtcgaa tgctcgcggt actgttcgaa 60gtactcatcg
7012370DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 123gcagaattcc taaccatgca agcgtggcga
ctcgtctctc gcaaagttct atacgaatca 60gcgatgggta
7012470DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 124gccctctcgt cccacgttcg ctcgtcttgt
tgacactact gacgggtatc cctctaaata 60cttctctttt
7012570DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 125gcctcttcga tggggtccgt ctggtcagta
ccgacgaaaa tgcgacggta gatgtcagaa 60ttgattctgt
7012670DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 126gcgggctctt gtgcaaactt atggggctag
tgactcgggt gtagcacgtt ttgcgaagac 60taagacagta
7012770DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 127gcgtctatga caggtcgggc acttaggcgg
cgacgcttga tgtttgagtc gcagatatta 60gtttataagg
7012870DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 128gctatctaac gcggtcttgc caatactacg
aatggttgct acaggatatc gagtaccgca 60aaatgggggc
7012970DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 129gggggcaact ctccaaccga gcgtgaatcc
agcgattatt atcctactcc atactattag 60cgggtatacg
7013070DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 130ggtacgaatc tcccattgca tggacaaata
tagtccacgc attggacgca cccaccgatg 60gctctccaat
7013170DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 131ggtcgtaccc aacctgacac gagatgtcgg
cgctcgtttc gattggacga tcggatatat 60gatcaagcaa
7013270DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 132ggttgttcca tgtactcgat actacctagg
catcaggtgt atacgccggt ttggatgggc 60gttcggcaaa
7013370DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 133gtgccacccc aattagtctt ttgtccgggc
caagagtacg acaacggggt attttggtac 60tatatcccac
7013470DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 134gttaagggtc tcgaaagatt tctactctcg
acgtaccgtt ggcagcgcac taagaacggg 60taatgtgctg
7013570DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 135gttaggcact tgcgcgtcaa gcgcgcaaac
cctaattacg ttctgtccac gcgctaggga 60tattcgtata
7013670DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 136taagatgcct gacgaaaaag tcccgtgtac
ccacaacgga aagcgtgatc tagatagttc 60ccttagcgcc
7013770DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 137taattttggg ttgtcgaggc ataaactggt
atgctcgtct cgctcgacga gcggttgaac 60gcctatcgct
7013870DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 138tattggccgc ggcgctaact tatatcgaga
gatgtctagt ttccccaccc gttacatatt 60ctacggggag
7013970DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 139tattttccgg tactgagtgg aacgacatga
agttggcggt caggtcgtta tttcgcagcc 60acgcaccact
7014070DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 140tcagatgtcg ttattaacgg gaaggtatcc
ggttcactat cacggcgatt acttcgcgtt 60gcgaaagggc
7014170DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 141tccggctccg cagacggttt aactcgaacc
ttaaaagtcg tgtgaagcta cttcgagacc 60atgcgctctt
7014270DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 142tctgttaccc acattgtcac cacttgacag
gcgcacggtc gtttgtaaag cgactagcta 60cgcaggtata
7014370DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 143tggagatgcg aacgttggga gtatcaatcc
ccggtgcaac cccctaatcc gacatgccgc 60aagtatatat
7014470DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 144tgggcgccta gagccagcat attacaggcg
agctgttttc gcgtctctaa tgacgtgtac 60gcgattctat
7014570DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 145tgtagacagg gcgcgattgt atgggacagt
ttacgcacta accgactcta caatgtagtg 60tttgtcgggc
7014670DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 146ttccgcatga gatcaacgcg tggtcaatac
gtgttaagaa ccggtcgacg ccagctagac 60ctaatgcgtt
7014770DNAArtificialOligonucleotides identified according to the
present invention as alien to mouse cDNA and useful for
hybridization applications. 147tttcgactgg gggtacaaag ctccctattt
gccgttcacg aagctacata ctggtctagc 60gcgtgcacaa
70148318DNAArtificialalien oligonucleotides 148ttctaatacg
actcactata gggccatccg ggccatacgt ttatagtagc gattgtttgc 60ccctaccagc
aatcgcgccc agttagtaat ctaattttgg gttgtcgagg cataaactgg
120tatgctcgtc tcgctcgacg agcggttgac gcctatcgct gtgccacccc
aatttgtctt 180ttgtccgggc caagagtacg acaacggggt attttggtac
tatatcccac gcgggctctt 240gtgcaaatta tggggctggt tactcgggtg
tagcacgttt tgcgaagact acgacagtaa 300aaaaaaaaaa aaaaaaaa
318149321DNAArtificialalien oligonucleotides 149ttctaatacg
actcactata gggcatctat ctatgtcagt taccggcatg ggttatggat 60tcgtggaccg
cgatgtgacg ttggggtttc cactcagatg tcgttattat cgggaaggta
120tccggttcac tatcacggcg attacttcgc gttgcgaagg gctaattttg
ggttgtcgag 180gcataaactg gtatgctcgt ctcgctcgac gagcggttgc
acgcctatcg cttccgcatg 240cgatcaacgc gtggtcaata cgtgtttaga
accggtcgac gccagcttga cctactgcgt 300taaaaaaaaa aaaaaaaaaa a
321150323DNAArtificialalien oligonucleotides 150ttctaatacg
actcactata gggccctctc gtcccacgtt cgctcgtctt gttgacacta 60ctgacgggta
tccctctaaa tacttctctt ttgttaaggg tctcgaaaga tttctactct
120cgacgtacgt tggcagcgca ctaagaacgg gtaatgtgct gtattttccg
gtactgagtg 180gaacgacatg aagttggcgg tcaggtcgtt atttcgcagc
cacgcaccac tcggccacaa 240ctctcaggac gcatatataa gacgcggaaa
ggcatacacg tctacttaga gacaccgaga 300cttaaaaaaa aaaaaaaaaa aaa
32315147DNAArtificialforward primer 151ttctaatacg actcactata
gggcatctat ctatgtcagt taccggc 4715248DNAArtificialreverse primer
152tttttttttt tttttttttt ttttctaata actgaggtga tttccgac
4815370DNAArtificialalien oligonucleotide 153ggtacgaatc tcccattgca
tggacaaata tagtccacgc attggacgca cccaccgatg 60gctctccaat 70
* * * * *
References