U.S. patent application number 12/111008 was filed with the patent office on 2009-06-04 for methods and kits for methylation detection.
This patent application is currently assigned to Applera Corporation. Invention is credited to Mark R. Andersen, Jer-Kang Chen, Michael W. Hunkapiller, Steven M. Menchen.
Application Number | 20090142761 12/111008 |
Document ID | / |
Family ID | 34968813 |
Filed Date | 2009-06-04 |
United States Patent
Application |
20090142761 |
Kind Code |
A1 |
Andersen; Mark R. ; et
al. |
June 4, 2009 |
METHODS AND KITS FOR METHYLATION DETECTION
Abstract
Ligation-based methods and kits are disclosed for determining
the degree of methylation of one or more target nucleotides. In
certain embodiments, the methylation status of one or more target
nucleotides is determined by generating misligation products. In
certain embodiments, at least one target nucleotide is amplified
prior to the ligation reaction. In certain embodiments, at least
one ligation product, at least one ligation product surrogate, at
least one misligation product, at least one misligation product
surrogate, or combinations thereof are amplified. In certain
embodiments, one or more ligation probes comprise at least one
nucleotide analog, at least one Modification, at least one
mismatched nucleotide, or combinations thereof.
Inventors: |
Andersen; Mark R.;
(Carlsbad, CA) ; Chen; Jer-Kang; (Palo Alto,
CA) ; Hunkapiller; Michael W.; (San Carlos, CA)
; Menchen; Steven M.; (Fremont, CA) |
Correspondence
Address: |
MILA KASAN, PATENT DEPT.;APPLIED BIOSYSTEMS
850 LINCOLN CENTRE DRIVE
FOSTER CITY
CA
94404
US
|
Assignee: |
Applera Corporation
Foster City
CA
|
Family ID: |
34968813 |
Appl. No.: |
12/111008 |
Filed: |
April 28, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11119985 |
May 2, 2005 |
7364855 |
|
|
12111008 |
|
|
|
|
60567396 |
Apr 30, 2004 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/6.13 |
Current CPC
Class: |
C12Q 1/6827 20130101;
C12Q 1/6862 20130101; C12Q 1/68 20130101; C12Q 1/6862 20130101;
C12Q 2537/164 20130101; C12Q 1/6827 20130101; C12Q 2537/164
20130101; C12Q 2521/501 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for determining the degree of methylation of at least
one target nucleotide in at least one target nucleic acid sequence,
comprising: forming a ligation reaction composition comprising (a)
the at least one target nucleic acid sequence, (b) at least one
ligation probe set comprising at least one first probe and at least
one second probe, wherein the at least one first probe comprises at
least one first target-specific portion and the at least one second
probe comprises at least one second target-specific portion, and
(c) at least one ligation agent; subjecting the ligation reaction
composition to at least one cycle of ligation to generate at least
one ligation product; and determining the degree of methylation of
the at least one target nucleotide.
2. The method of claim 1, wherein at least one probe of at least
one ligation probe set comprises at least one target-specific
portion comprising: at least one Modification, at least one
mismatched nucleotide relative to at least one portion of the at
least one target nucleic acid sequence, or at least one
Modification and at least one mismatched nucleotide.
3. The method of claim 2, wherein the at least one Modification
comprises at least one substituted hydrocarbon, at least one
ribonucleotide, at least one amide bond, at least one glycosidic
bond, at least one locked nucleic acid (LNA), at least one
nucleotide analog, at least one groove binder, or combinations
thereof.
4. The method of claim 2, wherein at least one ligation product
further comprises at least one primer-binding portion, at least one
reporter group, at least one mobility modifier, at least one
hybridization tag, at least one reporter probe-binding portion, at
least one affinity tag, or combinations thereof.
5. The method of claim 4, wherein the determining comprises
detecting the at least one reporter group of at least some ligation
products and comparing the ratio of the ligation products of at
least one ligation probe set.
6. The method of claim 4, further comprising combining at least
some of the ligation products with at least one reporter probe.
7. The method of claim 6, wherein the determining comprises
detecting the at least one reporter probe and comparing the ratio
of the ligation products of at least one ligation probe set.
8. The method of claim 4, further comprising, combining at least
one hybridization tag complement comprising at least one reporter
group with the at least one ligation product; and wherein the
determining comprises detecting the at least one reporter group of
the at least one hybridization tag complement.
9. The method of claim 4, further comprising amplifying at least
one ligation product to generate at least one amplified ligation
product.
10. The method of claim 9, wherein the amplifying comprises at
least one primer, at least one universal primer, or at least one
primer and at least one universal primer.
11. The method of claim 9, wherein the at least one amplified
ligation product comprises at least one primer-binding portion, at
least one reporter group, at least one mobility modifier, at least
one hybridization tag, at least one reporter probe-binding portion,
at least one affinity tag, or combinations thereof.
12. The method of claim 11, wherein the determining comprises
detecting the at least one reporter group of at least some
amplified ligation products and comparing the ratio of the
amplified ligation products of at least one ligation probe set.
13. The method of claim 11, further comprising, combining at least
one hybridization tag complement comprising at least one reporter
group with the at least one amplified ligation product; and wherein
the determining comprises detecting the at least one reporter group
of the at least one hybridization tag complement.
14. The method of claim 11, further comprising combining at least
some of the amplified ligation products with at least one reporter
probe.
15. The method of claim 14, wherein the determining comprises
detecting at least one reporter probe and comparing the ratio of
the amplified ligation products of at least one ligation probe
set.
16. The method of claim 1, wherein the ligation agent comprises at
least one thermostable ligase, at least one chemical ligation
agent, at least one photoligation agent, or combinations
thereof.
17. The method of claim 16, wherein the at least one thermostable
ligase comprises at least one of: Afu ligase, Pfu ligase, Taq
ligase, Thermus species ligase AK16D, Tth ligase, Tsc ligase, Tfi
ligase, Mth ligase, Ape ligase, TS2126 ligase, or combinations
thereof.
18. The method of claim 1, wherein the at least one cycle of
ligation comprises a multiplicity of cycles of ligation.
19. The method of claim 1, wherein the determining comprises
separating the at least one ligation product using at least one
mobility dependent analytical technique.
20. The method of claim 19, wherein the at least one mobility
dependent analytical technique comprises capillary
electrophoresis.
21. The method of claim 1, wherein the determining comprises
quantifying at least one ligation product.
22. The method of claim 21, wherein the quantifying comprises
quantitative polymerase chain reaction (Q-PCR).
23. The method of claim 22, wherein the Q-PCR comprises at least
one 5'-exonuclease probe, at least one molecular beacon probe, at
least one peptide nucleic acid (PNA) probe, at least one LNA probe,
at least one nucleic acid dye, or combinations thereof.
24. The method of claim 2, wherein the ligation agent comprises at
least one thermostable ligase; at least one ligation product
comprises at least one primer-binding portion, at least one
reporter group, at least one mobility modifier, at least one
hybridization tag, at least one reporter probe-binding portion, at
least one affinity tag, or combinations thereof; and further
comprising amplifying at least one ligation product to generate at
least one amplified ligation product, wherein the at least one
amplified ligation product comprises at least one primer-binding
portion, at least one reporter group, at least one mobility
modifier, at least one hybridization tag, at least one reporter
probe-binding portion, at least one affinity tag, or combinations
thereof.
25. The method of claim 24, wherein the determining comprises: (a)
separating the at least one ligation product or the at least one
amplified ligation product, or the at least one ligation product
and the at least one amplified ligation product using at least one
mobility dependent analytical technique, (b) detecting the at least
one reporter group on at least one ligation product, at least one
amplified ligation product, or at least one ligation product and at
least one amplified ligation product, and (c) comparing the ratio
of: (i) the ligation products of at least two probe sets, (ii) the
amplified ligation products from the at least two probe sets, or
(iii) the ligation products from the at least two probe sets and
the amplified ligation products from the at least two probe
sets.
26. The method of claim 25, wherein the at least one thermostable
ligase comprises Afu ligase and the mobility dependent analytical
technique comprises capillary electrophoresis.
27. The method of claim 24, further comprising, combining at least
one hybridization tag complement comprising at least one reporter
group with the at least one amplified ligation product; and wherein
the determining comprises detecting the at least one reporter group
of the at least one hybridization tag complement.
28. The method of claim 24, further comprising combining at least
some of the amplified ligation product with at least one reporter
probe.
29. The method of claim 28, wherein the determining comprises
detecting the at least one reporter probe and comparing ligation
rate of the amplified ligation products of at least two ligation
probe sets.
30. The method of claim 28, wherein the thermostable ligase
comprises Afu ligase and the determining comprises quantifying the
amplified ligation product using Q-PCR.
31. The method of claim 4, further comprising: digesting the at
least one ligation product with at least one 3'-5' exonuclease, at
least one 5'-3' exonuclease, or at least one 3'-5' exonuclease and
at least one 5'-3' exonuclease, to generate at least one digested
ligation product; amplifying the at least one digested ligation
product to generate at least one amplified digested ligation
product; combining at least one hybridization tag complement
comprising at least one reporter group with the at least one
amplified digested ligation product; and wherein the determining
comprises detecting the at least one reporter group of the at least
one hybridization tag complement.
32. A method for determining the degree of methylation of at least
one target nucleotide in at least one target nucleic acid sequence,
comprising: forming a ligation reaction composition comprising the
at least one target nucleic acid sequence; at least two competing
ligation probe sets, wherein each competing probe set comprises at
least one first probe and at least one second probe and wherein the
at least one first probe comprises at least one target-specific
portion and the at least one second probe comprises at least one
target-specific portion; and at least one ligation agent;
subjecting the ligation reaction composition to at least one cycle
of ligation to generate at least one ligation product; and
determining the degree of methylation of the at least one target
nucleotide.
33. The method of claim 32, wherein the at least two competing
probe sets do not share the same ligation site on the at least one
target nucleic acid sequence.
34. The method of claim 32, wherein at least one probe of at least
one competing probe set comprises at least one target-specific
portion comprising: at least one Modification, at least one
mismatched nucleotide relative to at least one portion of the at
least one target nucleic acid sequence, or at least one
Modification and at least one mismatched nucleotide.
35. The method of claim 34, wherein the at least one Modification
comprises at least one substituted hydrocarbon, at least one
ribonucleotide, at least one amide bond, at least one glycosidic
bond, at least one LNA, at least one nucleotide analog, at least
one groove binder, or combinations thereof.
36. The method of claim 32, wherein at least one ligation product
further comprises at least one primer-binding portion, at least one
reporter group, at least one mobility modifier, at least one
hybridization tag, at least one reporter probe-binding portion, at
least one affinity tag, or combinations thereof.
37. The method of claim 36, further comprising: digesting the at
least one ligation product with at least one 3'-5' exonuclease, at
least one 5'-3' exonuclease, or at least one 3'-5' exonuclease and
at least one 5'-3' exonuclease, to generate at least one digested
ligation product; amplifying the at least one digested ligation
product to generate at least one amplified digested ligation
product; combining at least one hybridization tag complement
comprising at least one reporter group with the at least one
amplified digested ligation product; and wherein the determining
comprises detecting the at least one reporter group of the at least
one hybridization tag complement.
38. The method of claim 36, wherein the determining comprises
detecting the at least one reporter group of at least some ligation
products and comparing the ratio of the ligation products of at
least two ligation probe sets.
39. The method of claim 36, further comprising, combining at least
one hybridization tag complement comprising at least one reporter
group with the at least one ligation product; and wherein the
determining comprises detecting the at least one reporter group of
the at least one hybridization tag complement.
40. The method of claim 36, further comprising combining at least
some of the ligation product and at least one reporter probe.
41. The method of claim 40, wherein the determining comprises
detecting the at least one reporter probe and comparing the ratio
of the ligation products of at least two ligation probe sets.
42. The method of claim 36, further comprising amplifying at least
one ligation product to generate at least one amplified ligation
product.
43. The method of claim 42, wherein the amplifying comprises at
least one primer, at least one universal primer, or at least one
primer and at least one universal primer.
44. The method of claim 42, wherein the at least one amplified
ligation product comprises at least one primer-binding portion, at
least one reporter group, at least one mobility modifier, at least
one hybridization tag, at least one reporter probe-binding portion,
at least one affinity tag, or combinations thereof.
45. The method of claim 42, wherein the determining comprises
detecting the at least one reporter group of at least some
amplified ligation products and evaluating the ligation rate of the
amplified ligation products of at least two ligation probe
sets.
46. The method of claim 44, further comprising, combining at least
one hybridization tag complement comprising at least one reporter
group with the at least one amplified ligation product; and wherein
the determining comprises detecting the at least one reporter group
of the at least one hybridization tag complement.
47. The method of claim 44, further comprising combining at least
some of the amplified ligation product with at least one reporter
probe.
48. The method of claim 47, wherein the determining comprises
detecting the at least one reporter probe and evaluating the
ligation rate of the amplified ligation products of at least two
probe sets.
49. The method of claim 32, wherein the ligation agent comprises at
least one thermostable ligase, at least one chemical ligation
agent, at least one photoligation agent, or combinations
thereof.
50. The method of claim 49, wherein the at least one thermostable
ligase comprises at least one of: Afu ligase, Pfu ligase, Taq
ligase, Thermus species ligase AK16D, Tth ligase, Tsc ligase, Tfi
ligase, Mth ligase, Ape ligase, TS2126 ligase, or combinations
thereof.
51. The method of claim 32, wherein the at least one cycle of
ligation comprises a multiplicity of cycles of ligation.
52. The method of claim 32, wherein the determining comprises
separating the at least one ligation product using at least one
mobility dependent analytical technique.
53. The method of claim 52, wherein the at least one mobility
dependent analytical technique comprises capillary
electrophoresis.
54. The method of claim 32, wherein the determining comprises
quantifying at least one ligation product.
55. The method of claim 54, wherein the quantifying comprises
Q-PCR.
56. The method of claim 55, wherein the Q-PCR comprises at least
one 5'-exonuclease probe, at least one molecular beacon probe, at
least one PNA probe, at least one LNA probe, at least one nucleic
acid dye, or combinations thereof.
57. The method of claim 32, wherein the ligation agent comprises at
least one thermostable ligase; at least one ligation product
comprises at least one primer-binding portion, at least one
reporter group, at least one mobility modifier, at least one
hybridization tag, at least one reporter probe-binding portion, at
least one affinity tag, or combinations thereof; and further
comprising amplifying at least one ligation product to generate at
least one amplified ligation product, wherein the at least one
amplified ligation product comprises at least one primer-binding
portion, at least one reporter group, at least one mobility
modifier, at least one hybridization tag, at least one reporter
probe-binding portion, at least one affinity tag, or combinations
thereof.
58. The method of claim 57, further comprising, combining at least
one hybridization tag complement comprising at least one reporter
group with the at least one amplified ligation product; and wherein
the determining comprises detecting the at least one reporter group
of the at least one hybridization tag complement.
59. The method of claim 58, wherein the determining comprises: (a)
separating the at least one ligation product or the at least one
amplified ligation product, or the at least one ligation product
and the at least one amplified ligation product using at least one
mobility dependent analytical technique, (b) detecting the at least
one reporter group on at least some ligation products, at least
some amplified ligation products, or at least some ligation
products and at least some amplified ligation products, and (c)
comparing the ratio of: (i) the ligation products of at least two
competing probe sets, (ii) the amplified ligation products from the
at least two competing probe sets, or (iii) the ligation products
formed from the at least two competing probe sets and the amplified
ligation products from the at least two competing probe sets.
60. The method of claim 59, wherein the at least one thermostable
ligase comprises Afu ligase and the mobility dependent analytical
technique comprises capillary electrophoresis.
61. The method of claim 57, further comprising combining at least
some of the amplified ligation product with at least one reporter
probe.
62. The method of claim 61, wherein the determining comprises
detecting the at least one reporter probe and comparing the
amplified ligation products of at least two ligation probe
sets.
63. The method of claim 61, wherein the thermostable ligase
comprises Afu ligase and the determining comprises quantifying the
amplified ligation product using Q-PCR.
64. The method of claim 33, wherein at least one ligation product
further comprises at least one primer-binding portion, at least one
reporter group, at least one mobility modifier, at least one
hybridization tag, at least one reporter probe-binding portion, at
least one affinity tag, or combinations thereof.
65. The method of claim 64, further comprising: digesting the at
least one ligation product with at least one 3'-5' exonuclease, at
least one 5'-3' exonuclease, or at least one 3'-5' exonuclease and
at least one 5'-3' exonuclease, to generate at least one digested
ligation product; amplifying the at least one digested ligation
product to generate at least one amplified digested ligation
product; combining at least one hybridization tag complement
comprising at least one reporter group with the at least one
amplified digested ligation product; and wherein the determining
comprises detecting the at least one reporter group of the at least
one hybridization tag complement.
66. A method for determining the degree of methylation of at least
one target nucleotide in at least one target nucleic acid sequence,
comprising: at least one step for interrogating the at least one
target nucleotide; at least one step for generating at least one
ligation product; and at least one step for determining the degree
of methylation of the at least one target nucleotide.
67. A method for determining the degree of methylation of at least
one target nucleotide in at least one target nucleic acid sequence,
comprising: at least one step for interrogating the at least one
target nucleotide; at least one step for generating at least one
ligation product; at least one step for generating the at least one
amplified ligation product; and at least one step for determining
the degree of methylation of the at least one target
nucleotide.
68. A method for determining the degree of methylation of at least
one target nucleotide in at least one target nucleic acid sequence,
comprising: at least one step for interrogating the at least one
target nucleotide; at least one step for generating at least one
ligation product; at least one step for generating at least one
digested ligation product; and at least one step for determining
the degree of methylation of the at least one target
nucleotide.
69. A method for determining the degree of methylation of at least
one target nucleotide in at least one target nucleic acid sequence,
comprising: at least one step for interrogating the at least one
target nucleotide; at least one step for generating at least one
ligation product; at least one step for generating at least part of
the at least one digested ligation product; at least one step for
generating at least one amplified digested ligation product; and at
least one step for determining the degree of methylation of the at
least one target nucleotide.
70. A kit for determining the degree of methylation of at least one
target nucleotide in at least one target nucleic acid sequence,
comprising at least one ligation probe set and at least one
ligation agent.
71. The kit of claim 70, wherein the at least one thermostable
ligase comprises Afu ligase.
72. The kit of claim 70, further comprising: at least one
amplifying agent; at least one primer; at least one reporter group;
at least one reporter probe; at least one mobility modifier moiety;
at least one hybridization tag; at least one hybridization tag
complement; or combinations thereof.
73. The kit of claim 72, wherein the at least one amplifying agent
comprises at least one thermostable polymerase.
74. A kit for determining the degree of methylation of at least one
target nucleotide comprising: at least one means for ligating, at
least one means for amplifying, at least one means for separating,
at least one means for digesting, at least one means for
quantifying, or combinations thereof.
75. The method of claim 1, wherein the at least one target
nucleotide comprises a multiplicity of different target
nucleotides, the at least one probe set comprises a multiplicity of
different probe sets, and the degree of methylation of a
multiplicity of different target nucleotides is determined.
76. The method of claim 32, wherein the at least two competing
probe sets comprises at least two different competing probe sets
and the degree of methylation of a multiplicity of different target
nucleotides is determined.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of application Ser. No.
11/119,985, filed May 2, 2005, which claims a priority benefit
under 35 U.S.C. .sctn. 119(e) from application No. 60/567,396,
filed Apr. 30, 2004, which are all incorporated herein by
reference.
FIELD
[0002] The present teachings generally relate to methods and kits
for determining the methylation state of at least one nucleotide in
nucleic acid sequences of interest. More specifically, the
teachings relate to ligation-based methods and kits for determining
the degree of methylation of target nucleotides.
BACKGROUND
[0003] The methylation of cytosine residues in DNA is an important
epigenetic alteration in eukaryotes. In humans and other mammals
methylcytosine is found almost exclusively in cytosine-guanine
(CpG) dinucleotides. DNA methylation plays an important role in
gene regulation and changes in methylation patterns are reportedly
involved in human cancers and certain human diseases. Among the
earliest and most common genetic alterations observed in human
malignancies is the aberrant methylation of CpG islands, causing
the over-expression or silencing of many genes. Subsequently, there
is great interest in using DNA methylation markers as diagnostic
indicators for early detection, risk assessment, therapeutic
evaluation, recurrence monitoring, and the like. (See generally,
Laird, Nature Reviews, 3:253-266, 2003; Fraga et al., BioTechniques
33:632-49, 2002; Adorjan et al., Nucleic Acids Res. 30(5):e21,
2002; and Colella et al., BioTechniques, 35(1):146-150, 2003).
There is also great scientific interest in DNA methylation for
studying and modifying gene regulation, among other things.
SUMMARY
[0004] Methods and kits are provided for determining the degree of
methylation of specific target nucleotides, generally but not
exclusively cytosine residues, in target nucleic acid sequences,
typically genomic DNA (gDNA). The methods and kits generally employ
at least one probe set comprising at least one first probe and at
least one second probe that, under appropriate conditions, are
ligated together using at least one ligation agent, to form at
least one (mis)ligation product. By detecting at least some of
these ligation products or their surrogates (e.g., digested
ligation products, amplified ligation products, digested amplified
ligation products, reporter probes or at least portions of reporter
probes, and the like), one can determine the degree of methylation
for the corresponding target nucleotide(s).
[0005] In certain embodiments, the presence of a methyl group on at
least one target nucleotide affects the ability of at least one
ligation agent to generate one or more ligation product species. By
comparing the experimentally determined ligation rate for a given
ligation agent and one or more probe sets with the control ligation
rates (typically using the same probe set with control target
nucleic acid sequences of known methylation status and the same
ligation agent), the degree of methylation of at least one target
nucleotide species can be determined. In certain embodiments, the
presence of a methyl group on at least one target nucleotide
affects the ability of at least one ligation agent to generate one
or more misligation product species. That is, at least one
nucleotide in the target-specific portion of at least one probe in
a probe set is not fully complementary with the corresponding
binding region of the target nucleic acid sequence, for example but
not limited to the target nucleotide, yet the two corresponding
probes are nevertheless joined, i.e., misligated by a ligation
agent. By comparing the experimental misligation rate with the
control misligation rates or appropriate standard curves, the
degree of methylation of at least one target nucleotide can be
determined. Control ligation/misligation rates can be
pre-determined, analyzed in one or more parallel reaction, or
determined subsequently. In certain embodiments, ligation and/or
misligation occurs when the target nucleotide is not methylated but
does not occur or occurs at a lower rate than when the target
nucleotide is methylated. In certain embodiments,
ligation/misligation is enhanced when the target nucleotide is
methylated relative to the ligation/misligation rate when the
target nucleotide is not methylated.
[0006] In certain embodiments, the (mis)ligation rate is affected
by the presence of one or more Modifications in at least one probe
of at least one probe set. In certain embodiments, the 3'-end of
the hybridized upstream probe, the 5'-end of the hybridized
downstream probe, or both (i.e., the ligation site), is directly
opposite one or more target nucleotide. In certain embodiments, at
least one ligation site is upstream from or downstream from one or
more target nucleotide being interrogated. In certain embodiments,
at least two probe sets for interrogating the same target
nucleotide have different ligation sites. These at least two probe
sets may, but need not be, competed against each other in an
assay.
[0007] In certain embodiments, (mis)ligation products are amplified
using at least one polymerase to generate amplified (mis)ligation
products. In certain embodiments, at least one amplified
(mis)ligation product or other (mis)ligation product surrogate is
amplified using an amplifying means such as at least one
polymerase. In certain embodiments, at least one (mis)ligation
product, at least one amplified (mis)ligation product, or at least
one (mis)ligation product and at least one amplified (mis)ligation
product, is combined with at least one digestion means, such as an
enzyme (including but not limited to at least one endonuclease, at
least one exonuclease, at least one restriction enzyme, or
combinations thereof or chemical digesting means, to generate at
least one digested (mis)ligation product, at least one digested
amplified (mis)ligation product, or at least one digested
(mis)ligation product and at least one digested amplified
(mis)ligation product. At least one (mis)ligation product, at least
one (mis)ligation product surrogate, or combinations thereof, are
detected and the degree of methylation of the corresponding target
nucleotides are determined. In certain embodiments, at least one
(mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof, comprises at least one reporter
group, at least one mobility modifier, at least one hybridization
tag, at least one reporter probe-binding portion, at least one
affinity tag, or combinations thereof that, among other things,
facilitate determining the degree of target nucleotide methylation.
Competitive ligation reactions, wherein at least two competing
ligation probes compete with each other to hybridize with the same
or substantially the same target nucleic acid sequence comprising
at least one target nucleotide are within the scope of the
teachings herein. In certain embodiments, determining the degree of
methylation of at least one target nucleotide comprises comparing
the ratio of (mis)ligation products, (mis)ligation product
surrogates, or combinations thereof, for example but not limited to
visual, automated, or semi-automated comparison of peak heights,
peak areas, signal intensity, and the like. In certain embodiments,
determining comprises using one or more computer algorithm.
[0008] Pretreatment of the target nucleic acid sequences with
sodium bisulfite or other chemical modifying agent is not required
(and generally not preferred), nor is enzymatic cleavage with
methylation sensitive restriction endonuclease pairs, such as the
isoschisomers HpaII/MspI, EcoRII/BstNI, or the like (see REBASE
database at "rebase.neb.com" on the world wide web for additional
information on the methylation sensitivity of specific restriction
endonucleases; see also, Roberts et al., Nucleic Acids Res.
29:268-69, 2001). Thus, while the disclosed methods and kits have
been designed to work with unmodified gDNA, those in the art will
appreciate, that in certain instances the disclosed methods and
kits can be used with such pretreated nucleic acid sequences
although pretreatment is not necessary and generally is not useful
in implementing the teaching herein.
[0009] In certain embodiments, methods for determining the degree
of target nucleotide methylation are disclosed comprising at least
one step for interrogating at least one target nucleotide; at least
one step for generating at least one (mis)ligation product; and at
least one step for determining the degree of methylation of at
least one target nucleotide. In certain embodiments, such methods
further comprise at least one step for generating at least one
amplified (mis)ligation product; at least one step for generating
at least one digested (mis)ligation product; or combinations
thereof. Those skilled in the art will appreciate that the at least
one step for interrogating can be performed using the probes and
probe sets disclosed herein; that the at least one step for
generating at least one (mis)ligation product can be performed
using the ligation means and/or ligation techniques disclosed
herein; that the at least one step for generating at least one
amplified (mis)ligation product can be performed using the
amplification means, amplification techniques, ligation means,
and/or ligation techniques disclosed herein, including combinations
thereof; that the at least one step for generating at least one
digested (mis)ligation product can be performed using the digesting
means and/or digestion techniques disclosed herein; and that the at
least one step for determining the degree of methylation of at
least one target nucleotide can be performed using the determining
means and techniques disclosed herein. In certain embodiments,
determining can, but need not, comprise substeps for separating,
detecting, and/or analyzing/comparing. In certain embodiments, the
separating is performed independently, i.e., is not a substep of
the determining. Certain of the disclosed methods and kits comprise
at least two separating steps and can, but need not, include at
least two separating technique.
[0010] Kits for determining the degree of methylation of at least
one target nucleotide are also provided. Kits serve to expedite the
performance of the disclosed methods by assembling two or more
components required for carrying out the methods. Kits generally
contain components in pre-measured unit amounts to minimize the
need for measurements by end-users. Kits preferably include
instructions for performing one or more of the disclosed methods.
Typically, the kit components are optimized to operate in
conjunction with one another.
[0011] In certain embodiments, kits comprise at least one probe, at
least one probe set, at least one primer, at least one
hybridization tag, at least one hybridization tag complement, at
least one mobility modifier, at least one reporter probe, at least
one affinity tag, or combinations thereof. In certain embodiments,
kits comprise at least one ligation agent, at least one polymerase,
at least one nuclease, at least one restriction enzyme, at least
one chemical digestion means, at least one nucleotide, at least one
substrate, at least one of reporter group, or combinations thereof.
In certain embodiments, kits are disclosed that comprise at least
one means for ligating, at least one means for amplifying, at least
one means for separating, at least one means for digesting, at
least one detection means, or combinations thereof.
[0012] Certain embodiments of the disclosed methods and kits
comprise at least one ligation agent. In certain embodiments, the
ligation agent comprises at least one ligase, such as DNA ligase or
RNA ligase, including, without limitation, the bacteriophage T4
(T4) DNA ligase, T4 RNA ligase, E. coli DNA ligase, or E. coli RNA
ligase. In certain embodiments at least one ligase comprises at
least one thermostable ligase. Exemplary thermostable ligases
include without limitation, Thermus species ligases, Pfu ligase,
Afu ligase, and the like, including ligases of bacteriophages that
infect thermophilic or hyperthermophilic eubacteria and viruses
that infect archaea, formerly known as archaebacteria. For a
description of Afu ligase, see co-filed U.S. Provisional Patent
Application Ser. No. 60/567,120, filed Apr. 30, 2004, for
"Compositions, Methods, and Kits for (Mis)ligating
Oligonucleotides, by Karger et al. and co-filed U.S. Patent
Provisional Application Ser. No. 60/567,068, filed Apr. 30, 2004
for "Methods and Kits for Identifying Target Nucleotides in Mixed
Populations," by Karger et al.
[0013] In certain embodiments, ligation is performed
non-enzymatically. While not limiting, non-enzymatic ligation
typically includes both photoligation and chemical ligation, such
as, autoligation and ligation in the presence of an "activating"
and/or reducing agent. Non-enzymatic ligation can utilize specific
reactive groups on the respective 3' and 5' ends of the probes to
be ligated. Thus, in certain embodiments of the disclosed methods
and kits, the ligation agent comprises one or more "activating" or
reducing agent. In certain embodiments, the at least one ligation
agent comprises at least one photoligation source. In certain
embodiments, one or more probes suitable for ligation are provided
that comprise appropriate reactive groups for non-enzymatic
ligation. Thus, the disclosed ligation means comprise a wide range
of enzymatic, chemical and photochemical techniques and reagents
for joining the ends of suitable probes.
[0014] In certain embodiments the disclosed methods and kits
further comprise at least one amplifying means, for example at
least one polymerase, including, but not limited to at least one
DNA polymerase, at least one RNA polymerase, at least one reverse
transcriptase, or combinations thereof. Such polymerases provide a
means for amplifying at least one nucleotide. Exemplary polymerases
include DNA polymerase I, T4 DNA polymerase, SP6 RNA polymerase, T3
RNA polymerase, T7 RNA polymerase, AMV reverse transcriptase, M-MLV
reverse transcriptase, and the like. In certain embodiments, at
least one DNA polymerase lacks 5'->3' exonuclease activity, for
example, but not limited to Klenow fragment of DNA polymerase,
9.degree.N.sub.m.TM. DNA polymerase, Vent.sub.R.RTM. (exo.sup.-)
DNA polymerase, Deep Vent.sub.R.RTM. (exo.sup.-) DNA polymerase,
Therminator.TM. DNA polymerase, and the like. In certain
embodiments, at least one polymerase is thermostable. Exemplary
thermostable polymerases include Taq polymerase, Tfl polymerase,
Tth polymerase, Tli polymerase, Pfu polymerase, AmpliTaq Gold.RTM.
polymerase, 9.degree.N.sub.m.TM. DNA polymerase, Vent.sub.R.RTM.
DNA polymerase, Deep Vent.sub.R.RTM. DNA polymerase, UlTma
polymerase, and the like.
[0015] In certain embodiments, the disclosed methods and kits
comprise at least one digestion means, for example but not limited
to enzymatic and chemical means for digesting at least part of at
least one probe, at least part of at least one (mis)ligation
product, at least part of at least one amplified (mis)ligation
product, or combinations thereof. Exemplary enzymatic means for
performing a digestion step include without limitation nucleases,
for example but not limited to, endonucleases and exonucleases,
such as BAL-31 nuclease, mung bean nuclease, exonuclease 1,
exonuclease III, .lamda. exonuclease, T7 exonuclease, exonuclease
T, recJ, and RNase H; restriction enzymes; and the like, including
enzymatically active variants or mutants thereof. An alkaline
hydrolysis step for digesting the RNA portion of at least one
RNA-DNA hybrid or RNA:DNA duplex is one example of chemical
digestion means.
[0016] The skilled artisan will understand that any of a number of
nucleases, polymerases, and ligases could be used in the methods
and kits of the invention, including without limitation, those
isolated from thermostable or hyperthermostable prokaryotic,
eukaryotic, or archaeal organisms. The skilled artisan will also
understand the terms "ligase", "nuclease" and "polymerase" include
not only naturally occurring enzymes, but also recombinant enzymes;
and enzymatically active fragments, cleavage products, mutants, or
variants of such enzymes, for example but not limited to Klenow
fragment, Stoffel fragment, Taq FS (Applied Biosystems, Foster
City, Calif.), 9.degree.N.sub.m.TM. DNA Polymerase (New England
BioLabs, Beverly, Mass.), and mutant enzymes described in Luo and
Barany, Nucl. Acids Res. 24:3079-3085 (1996), and U.S. Pat. Nos.
6,265,193 and 6,576,453. Reversibly modified nucleases, ligases,
and polymerases, for example but not limited to those described in
U.S. Pat. No. 5,773,258, are also within the scope of the disclosed
teachings. Those in the art will understand that any protein with
the desired enzymatic activity, be it ligating, amplifying, or
digesting, can be used in the disclosed methods and kits.
Descriptions of nucleases, ligases, and polymerases can be found
in, among other places, Twyman, Advanced Molecular Biology, BIOS
Scientific Publishers (1999); Enzyme Resource Guide, rev. 092298,
Promega (1998); Sambrook and Russell, Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Press, 3d ed.
(2001)(hereinafter "Sambrook and Russell"); Sambrook, Fritsch, and
Maniatis, Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Press, 2d ed. (1989) (hereinafter "Sambrook et al."); Ausbel
et al., Current Protocols in Molecular Biology, John Wiley &
Sons, Inc. (including supplements through the March 2004)
(hereinafter "Ausbel et al.").
[0017] In certain embodiments, the methods and kits disclosed
herein comprise at least one polymerase, at least one ligation
agent, at least one digestion agent, or combinations thereof. In
certain embodiments, the methods disclosed herein comprise ligation
reactions and can further comprise primer extension, including but
not limited to "gap filling" reactions and the polymerase chain
reaction (PCR); transcription, including but not limited to reverse
transcription; digestion reactions, including enzymatic or chemical
digesting agents; or combinations thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1: Schematically depicts an illustrative competing
ligation reaction comprising two probe sets. The target nucleotide
(in this example the nucleotide "C") in the target nucleic acid
sequence is underlined (top line). Probe set 1 comprises an
upstream probe with a 3'-end comprising the nucleotides --C-G and a
downstream probe comprising a 5'-end comprising the nucleotides
T-A-C-- (middle line). The ligation site for probe set 1 is between
G and T, as shown by arrow 1. Probe set 2 comprises an upstream
probe with a 3'-end comprising the nucleotides --C-G-T-A and a
downstream probe with a 5'-end comprising the nucleotide C--
(bottom line). The ligation site for probe set 2 is between the A
and the second C (left to right), as shown by arrow 2.
[0019] FIG. 2: Schematically depicts an exemplary misligation
reaction comprising an upstream probe with a 3'-end comprising
--C-H and a downstream probe with a 5'-end comprising A--. The
ligation site is shown with an arrow and the target nucleotide is
underlined. H represents any of A, C, T, or U, including but not
limited to analogs and Modifications thereof; but not G.
[0020] FIG. 3: Schematically depicts an exemplary misligation
reaction with probes from two competing probe sets. The target
nucleotide in the target nucleic acid sequence is underlined. The
3'-end of the upstream probe for probe set 1 comprises the
nucleotide --T and the 5'-end of the downstream probe comprises
B-C-G-T-T-C--. B represents any of C, G, T, or U, including but not
limited to analogs and Modifications thereof; but not A. The 3'-end
of the upstream probe for probe set 2 comprises the nucleotides
--G-T-V and the 5'-end of the downstream probe comprises C--. V
represents any of A, C, or G, including but not limited to analogs
and Modifications thereof; but not T or U. The ligation sites for
probe sets 1 and 2 are shown by arrows 1 and 2, respectively.
[0021] FIG. 4: Depicts an electropherogram showing ligation product
peaks obtained from an illustrative ligation assay, described in
Example 1. The upper panel shows the results obtained using a
non-methylated synthetic model template ("Template") and the lower
panel shows the results obtained when the synthetic model template
comprised 5-methylcytosine as the target nucleotide
(".sup.MeTemplate"). The peak corresponding to the ligation product
of Probe Set 1 is marked "1", the peak corresponding to the
ligation product of Probe Set 2 is marked "2", and the peak
corresponding to the ligation product of Probe Set 3 is marked "3".
The peak marked 4 is the internal size standard.
[0022] FIGS. 5A-C: Depict electropherograms showing misligation
product peaks obtained from an exemplary competitive ligation
assay, described in Example 2. The upper panels show the results
obtained using a non-methylated synthetic P16 template ("Template")
and the lower panels and the lower panels show the results obtained
when the synthetic P16 template comprised 5-methylcytosine as the
target nucleotide (".sup.MeTemplate"). The peak corresponding to
the misligation product generated using ligation probes 8 and 10 is
marked "LP 8-10", the peak corresponding to the misligation product
generated using ligation probes 9 and 10 is marked "LP 9-100", and
the peak corresponding to the misligation product generated using
ligation probes 10 and 11 is marked "LP 11-10".
[0023] FIGS. 6A-C: depict electropherograms showing misligation
product peaks obtained from an exemplary misligation assay,
described in Example 3. The peak corresponding to the misligation
product generated using ligation probes 13 and 16 is marked "LP
13-16", the peak corresponding to the misligation product generated
using ligation probes 14 and 16 is marked "LP 14-16", and the peak
corresponding to the misligation product generated using ligation
probes 15 and 16 is marked "LP 15-16". The upper panels show the
results obtained using non-methylated templates ("Template") and
the lower panels show the results obtained using methylated
templates (".sup.MeTemplate").
[0024] FIGS. 7A-C: Depict electropherograms showing misligation
product peaks obtained from an exemplary competitive ligation
assay, described in Example 4. The upper panels show the results
obtained using a non-methylated synthetic E2F2 template
("Template") and the lower panels show the results obtained when
the synthetic E2F2 template comprised 5-methylcytosine as the
target nucleotide (".sup.MeTemplate"). The peak corresponding to
the misligation product generated using ligation probes 21 and 22
is marked "LP 21-22", the peak corresponding to the misligation
product generated using ligation probes 22 and 23 is marked "LP
22-23", the peak corresponding to the misligation product peak
generated using ligation probes 22 and 24 is marked "LP 22-24".
[0025] FIGS. 8A-B: Depict electropherograms showing misligation
product peaks obtained from an exemplary competitive misligation
assay, described in Example 5. The upper panels show the results
obtained using a non-methylated synthetic E2F2 template
("Template") and the lower panels show the results obtained when
the synthetic E2F2 template comprised 5-methylcytosine as the
target nucleotide (".sup.MeTemplate"). The peak corresponding to
the misligation product generated using ligation probes 22* and 21
is marked "LP 22*-21", the peak corresponding to the misligation
product generated using ligation probes 22* and 23 is marked "LP
22*-23", and the peak corresponding to the misligation product
generated using ligation probes 22* and 24 is marked "LP
22*-24".
[0026] FIGS. 9A-C: Depict electropherograms showing the peaks
obtained from an exemplary competitive misligation assay described
in Example 6. The upper panel shows the misligation product
surrogate peak heights obtained using non-methylated gDNA ("gDNA")
and the lower panel shows the misligation product surrogate peak
heights obtained using methylated gDNA (".sup.MegDNA"). The
detected peak corresponding to the misligation product surrogate
generated using ligation probes 25 and 26 is marked "LPS 25-26",
the detected peak corresponding to the misligation product
surrogate generated using probes 25 and 27 is marked "LP 25-27",
and so forth.
[0027] FIGS. 10A-C: Depicts electropherograms showing the peaks
obtained from an exemplary competitive misligation assay described
in Example 7. The upper panels show the peaks obtained using "gDNA"
and the lower panels show the peaks obtained using ".sup.MegDNA".
The detected peak corresponding to the misligation product
surrogate generated using probes 25 and 31 is marked "LPS 25-31",
the detected peak corresponding to the misligation product
surrogate generated using probes 25 and 32 is marked "LP 25-32",
and so forth.
[0028] FIGS. 11A-C: Depict electropherograms showing the peaks
obtained from an exemplary competitive misligation assay described
in Example 8. The upper panels show the peaks obtained using gDNA
and the lower panels show the peaks obtained using methylated gDNA
(.sup.MegDNA). The detected peak corresponding to the misligation
product surrogates generated using probes 36 and 37 is marked "LPS
36-37"; the detected peak corresponding to misligation product
surrogate generated using probes 38 and 37 is marked "LP 38-37",
and so forth.
[0029] FIGS. 12A-D: depict electropherograms showing the ligation
product peaks obtained from an illustrative analysis of four
ligases in an exemplary methylation detection ligation assay,
described in Example 10. The upper panels show the ligation product
peaks LP 2-3 (probe set 1), LP 4-5 (probe set 2), and LP 6-7 (probe
set 3) obtained using non-methylated template and the lower panels
show the results obtained using the methylated synthetic template.
FIG. 12A depicts the results obtained using Afu ligase; FIG. 12B
depicts the results obtained using Thermus sp. AK16D ligase; FIG.
12C depicts the results obtained using Tth ligase; and FIG. 12D
depicts the results obtained using Taq ligase.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0030] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the described
subject matter in any way. All literature and similar materials
cited in this application, including but not limited to, patents,
patent applications, articles, books, treatises, and internet web
pages are expressly incorporated by reference in their entirety for
any purpose. In the event that one or more of the incorporated
literature and similar materials conflicts with or contradicts this
application, including but not limited to defined terms, term
usage, described techniques, or the like, this application
controls.
I. DEFINITIONS
[0031] The term "affinity tag" as used herein refers to at least
one component of a multi-component complex, wherein the components
of the multi-component complex specifically interact with or bind
to each other, for example but not limited to a capture moiety and
its corresponding capture ligand. Exemplary multiple-component
complexes include without limitation, ligands and their receptors,
including but not limited to, avidin-biotin, streptavidin-biotin,
and derivatives of biotin, streptavidin and/or avidin, including
but not limited to desthiobiotin, NeutrAvidin (Molecular Probes,
Eugene, Oreg.), CaptAvidin (Molecular Probes), and the like;
binding proteins/peptides, including but not limited to
maltose-maltose binding protein (MBP), calcium-calcium binding
protein/peptide (CBP); antigen-antibody, including but not limited
to epitope tags, including but not limited to c-MYC (e.g.,
EQKLISEEDL), HA (e.g., YPYDVPDYA), VSV-G (e.g., YTDIEMNRLGK), HSV
(e.g., QPELAPEDPED), V5 (e.g., GKPIPNPLLGLDST), and FLAG Tag.TM.
(e.g., DYKDDDDKG), and their corresponding anti-epitope antibodies;
haptens, for example but not limited to dinitrophenyl and
digoxigenin, and their corresponding antibodies; aptamers and their
corresponding targets; poly-His tags (e.g., penta-His and hexa-His)
and their binding partners, including without limitation,
corresponding immobilized metal ion affinity chromatography (IMAC)
materials and anti-poly-His antibodies; fluorophores and
anti-fluorophore antibodies; and the like. In certain embodiments,
affinity tags are used as at least part of a means for separating,
as at least part of a means for detecting, or as at least part of:
a means for separating and as a means for detecting.
[0032] The terms "annealing" and "hybridization" are used
interchangeably and mean the base-pairing interaction of one
nucleic acid with another nucleic acid that results in formation of
a duplex, triplex, or other higher-ordered structure. In certain
embodiments, the primary interaction is base specific, e.g., A:T,
A:U and G:C, by Watson/Crick and Hoogsteen-type hydrogen bonding.
In certain embodiments, base-stacking and hydrophobic interactions
may also contribute to duplex stability. Conditions for hybridizing
nucleic acid probes and primers to complementary and substantially
complementary target sequences are well known, e.g., as described
in Nucleic Acid Hybridization, A Practical Approach, B. Hames and
S. Higgins, eds., IRL Press, Washington, D.C. (1985) and J. Wetmur
and N. Davidson, Mol. Biol. 31:349 et seq. (1968). In general,
whether such annealing takes place is influenced by, among other
things, the length of the probes and the complementary target
sequences, the pH, the temperature, the presence of mono- and
divalent cations, the proportion of G and C nucleotides in the
hybridizing region, the viscosity of the medium, and the presence
of denaturants. Such variables influence the time required for
hybridization. Thus, the preferred annealing conditions will depend
upon the particular application. Such conditions, however, can be
routinely determined by persons of ordinary skill in the art,
without undue experimentation.
[0033] The term "or combinations thereof" as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof" is intended
to include at least one of: A, B, C, AB, AC, BC, or ABC, and if
order is important in a particular context, also BA, CA, CB, CBA,
BCA, BAC, ACB, or CAB. Continuing with this example, expressly
included are combinations that contain repeats of one or more item
or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so
forth. The skilled artisan will understand that typically there is
no limit on the number of items or terms in any combination, unless
otherwise apparent from the context.
[0034] The term "corresponding" as used herein refers to at least
one specific relationship between the elements to which the term
refers. For example, at least one first probe of a particular probe
set corresponds to at least one second probe of the same probe set,
and vice versa. At least one primer is designed to anneal with the
primer-binding portion of at least one corresponding probe, at
least one corresponding (mis)ligation product, at least one
corresponding amplified (mis)ligation product, at least one
corresponding digested (mis)ligation product, at least one
corresponding digested amplified (mis)ligation product, or
combinations thereof. The target-specific portions of the probes of
a particular probe set are designed to hybridize with a
complementary or substantially complementary region of the
corresponding target nucleic acid sequence. A particular affinity
tag binds to the corresponding affinity tag, for example but not
limited to, biotin binding to streptavidin. A particular
hybridization tag anneals with its corresponding hybridization tag
complement; and so forth.
[0035] The term "enzymatically active mutants or variants thereof"
when used in reference to one or more enzyme, such as one or more
polymerase, one or more ligase, one or more nuclease, or the like,
refers to one or more polypeptide derived from the corresponding
enzyme that retains at least some of the desired enzymatic
activity, such as ligating, amplifying, or digesting, as
appropriate. Also within the scope of this term are: enzymatically
active fragments, including but not limited to, cleavage products,
for example but not limited to Klenow fragment, Stoffel fragment,
or recombinantly expressed fragments and/or polypeptides that are
smaller in size than the corresponding enzyme; mutant forms of the
corresponding enzyme, including but not limited to,
naturally-occurring mutants, such as those that vary from the
"wild-type" or consensus amino acid sequence, mutants that are
generated using physical and/or chemical mutagens, and genetically
engineered mutants, for example but not limited to random and
site-directed mutagenesis techniques; amino acid insertions and
deletions, and changes due to nucleic acid nonsense mutations,
missense mutations, and frameshift mutations (see, e.g., Sriskanda
and Shuman, Nucl. Acids Res. 26(2):525-31, 1998; Odell et al.,
Nucl. Acids Res. 31(17):5090-5100, 2003); reversibly modified
nucleases, ligases, and polymerases, for example but not limited to
those described in U.S. Pat. No. 5,773,258; biologically active
polypeptides obtained from gene shuffling techniques (see, e.g.,
U.S. Pat. Nos. 6,319,714 and 6,159,688), splice variants, both
naturally occurring and genetically engineered, provided that they
are derived, at least in part, from one or more corresponding
enzymes; polypeptides corresponding at least in part to one or more
such enzymes that comprise modifications to one or more amino acids
of the native sequence, including without limitation, adding,
removing or altering glycosylation, disulfide bonds, hydroxyl side
chains, and phosphate side chains, or crosslinking, provided such
modified polypeptides retain at least some of the desired catalytic
activity; and the like.
[0036] The skilled artisan will readily be able to measure
enzymatic activity using an appropriate assay known in the art.
Thus, an appropriate assay for polymerase catalytic activity might
include, for example, measuring the ability of a variant to
incorporate, under appropriate conditions, rNTPs or dNTPs into a
nascent polynucleotide strand in a template-dependent manner.
Likewise, an appropriate assay for ligase catalytic activity might
include, for example, the ability to ligate adjacently hybridized
oligonucleotides comprising appropriate reactive groups, such as
disclosed herein. Protocols for such assays may be found, among
other places, in Sambrook et al., Sambrook and Russell, Ausbel et
al., and Housby and Southern, Nucl. Acids Res. 26:4259-66,
1998).
[0037] The terms "fluorophore" and "fluorescent reporter group" are
intended to include any compound, label, or moiety that absorbs
energy, typically from an illumination source or energy transfer,
to reach an electronically excited state, and then emits energy,
typically at a characteristic wavelength, to achieve a lower energy
state. For example but without limitation, when certain
fluorophores are illuminated by an energy source with an
appropriate excitation wavelength, typically an incandescent or
laser light source, photons in the fluorophore are emitted at a
characteristic fluorescent emission wavelength. Fluorophores,
sometimes referred to as fluorescent dyes, may typically be divided
into families, such as fluorescein and its derivatives; rhodamine
and its derivatives; cyanine and its derivatives; coumarin and its
derivatives; Cascade Blue.TM. and its derivatives; Lucifer Yellow
and its derivatives; BODIPY and its derivatives; and the like.
Exemplary fluorophores include indocarbocyanine (C3),
indodicarbocyanine (C5), Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Texas Red,
Pacific Blue, Oregon Green 488, Alexa Fluor 488, Alexa Fluor 532,
Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647,
Alexa Fluor 660, Alexa Fluor 680, JOE, Lissamine, Rhodamine Green,
BODIPY, fluorescein isothiocyanate (FITC), carboxy-fluorescein
(FAM), phycoerythrin, rhodamine, dichlororhodamine
(dRhodamine.TM.), carboxy tetramethylrhodamine (TAMRA.TM.),
carboxy-X-rhodamine (ROX.TM.), LIZ.TM., VIC.TM., NED.TM., PET.TM.,
SYBR, PicoGreen, RiboGreen, and the like. Descriptions of
fluorophores and their use, can be found in, among other places, R.
Haugland, Handbook of Fluorescent Probes and Research Products,
9.sup.th ed. (2002), Molecular Probes, Eugene, Oreg. (hereinafter
"Molecular Probes Handbook"); M. Schena, Microarray Analysis
(2003), John Wiley & Sons, Hoboken, N.J.; Synthetic Medicinal
Chemistry 2003/2004 Catalog, Berry and Associates, Ann Arbor,
Mich.; U.S. Pat. No. 6,025,505; G. Hermanson, Bioconjugate
Techniques, Academic Press (1996; hereinafter "Bioconjugate
Techniques"); and Glen Research 2002 Catalog, Sterling, Va.
Near-infrared dyes are expressly within the scope of the terms
fluorophore and fluorescent reporter group, as are combination
labels, such as combinatorial fluorescence energy transfer tags
(see, e.g. Tong et al., Nat. Biotech. 19:756-59, 2001).
[0038] The terms "groove binder" and "minor groove binder" refer to
small molecules that fit into the minor groove of double-stranded
DNA, typically in a sequence specific manner. Generally, minor
groove binders are long, flat molecules that can adopt a
crescent-like shape and thus, snugly fit into the minor groove of a
double helix, often displacing water. Minor groove binding
molecules typically comprise several aromatic rings connected by
bonds with torsional freedom, such as but not limited to, furan,
benzene, or pyrrole rings. Exemplary minor groove binders include
without limitation, antibiotics such as netropsin, distamycin,
berenil, pentamidine and other aromatic diamidines, Hoechst 33258,
SN 6999, aureolic anti-tumor drugs such as chromomycin and
mithramycin, CC-1065, dihydrocyclopyrroloindole tripeptide
(DPI.sub.3), 1,2-dihydro-(3H)-pyrrolo[3,2-e]indole-7-carboxylate
(CDPI.sub.3), and related compounds and analogues. In certain
embodiments, at least one probe, at least one primer, at least one
reporter probe, or combinations thereof, comprises at least one
minor groove binder. Detailed descriptions of minor groove binders
can be found in, among other places, Nucleic Acids in Chemistry and
Biology, 2d ed., Blackburn and Gait, eds., Oxford University Press,
1996 (hereinafter "Blackburn and Gait"), particularly in section
8.3; Kumar et al., Nucl. Acids Res. 26:831-38, 1998; Kutyavin et
al., Nucl. Acids Res. 28:655-61, 2000; Turner and Denny, Curr. Drug
Targets 1:1-14, 2000; Kutyavin et al., Nucl. Acids Res. 25:3718-25,
1997; Lukhtanov et al., Bioconjug. Chem. 7:564-7, 1996; Lukhtanov
et al., Bioconjug. Chem. 6: 418-26, 1995; U.S. Pat. No. 6,426,408;
and PCT Published Application No. WO 03/078450. Primers and
reporter probes comprising minor groove binders are commercially
available from, among other places, Applied Biosystems and Epoch
Biosciences, Bothell, Wash.
[0039] The term "hybridization tag" as used herein refers to an
oligonucleotide sequence that can be used for separating the
element (e.g., (mis)ligation products, (mis)ligation product
surrogates, ZipChutes.TM., etc.) of which it is a component or to
which it is bound, including without limitation, bulk separation;
for tethering or attaching the element to which it is bound to a
substrate, which may or may not include separating; for annealing a
hybridization tag complement that may comprise at least one moiety,
such as a mobility modifier, one or more reporter groups, and the
like; or combinations thereof. In certain embodiments, the same
hybridization tag is used with a multiplicity of different elements
to effect: bulk separation, substrate attachment, or combinations
thereof. A "hybridization tag complement" typically refers to at
least one oligonucleotide that comprises at least one sequence of
nucleotides that are at least substantially complementary to and
hybridize with the corresponding hybridization tag. In various
embodiments, hybridization tag complements serve as capture
moieties for attaching at least one hybridization tag:element
complex to at least one substrate; serve as "pull-out" sequences
for bulk separation procedures; or both as capture moieties and as
pull-out sequences. In certain embodiments, at least one
hybridization tag complement comprises at least one reporter group
and serves as a label for at least one (mis)ligation product, at
least one (mis)ligation product surrogate, or combinations thereof.
In certain embodiments, determining comprises detecting one or more
reporter groups on or attached to at least one hybridization tag
complement or at least part of a hybridization tag complement.
[0040] Typically, hybridization tags and their corresponding
hybridization tag complements are selected to minimize: internal
self-hybridization; cross-hybridization with different
hybridization tag species, nucleotide sequences in a reaction
composition, including but not limited to gDNA, different species
of hybridization tag complements, target-specific portions of
probes, and the like; but should be amenable to facile
hybridization between the hybridization tag and its corresponding
hybridization tag complement. Hybridization tag sequences and
hybridization tag complement sequences can be selected by any
suitable method, for example but not limited to, computer
algorithms such as described in PCT Publication Nos. WO 96/12014
and WO 96/41011 and in European Publication No. EP 799,897; and the
algorithm and parameters of SantaLucia (Proc. Natl. Acad. Sci.
95:1460-65 (1998)). Descriptions of hybridization tags can be found
in, among other places, U.S. Pat. Nos. 6,309,829 (referred to as
"tag segment" therein); 6,451,525 (referred to as "tag segment"
therein); 6,309,829 (referred to as "tag segment" therein);
5,981,176 (referred to as "grid oligonucleotides" therein);
5,935,793 (referred to as "identifier tags" therein); and PCT
Publication No. WO 01/92579 (referred to as "addressable
support-specific sequences" therein); and Gerry et al., J. Mol.
Biol. 292:251-262 (1999; referred to as "zip-codes" and "zip-code
complements" therein). Those in the art will appreciate that a
hybridization tag and its corresponding hybridization tag
complement are, by definition, complementary to each other and thus
the terms hybridization tag and hybridization tag complement are
relative and can typically be used interchangeably in most
contexts.
[0041] Hybridization tags can be located on at least one end of at
least one probe, at least one primer, at least one (mis)ligation
product, at least one (mis)ligation product surrogate, or
combinations thereof; or they can be located internally. In certain
embodiments, at least one hybridization tag is attached to at least
one probe, at least one primer, at least one (mis)ligation product,
at least one (mis)ligation product surrogate, or combinations
thereof, via at least one linker arm. In certain embodiments, at
least one linker arm is cleavable.
[0042] In certain embodiments, hybridization tags are at least 12
bases in length, at least 15 bases in length, 12-60 bases in
length, or 15-30 bases in length. In certain embodiments, at least
one hybridization tag is 12, 15, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 45, or 60 bases in length. In certain embodiments, at
least two hybridization tag:hybridization tag complement duplexes
have melting temperatures that fall within a .DELTA. T.sub.m range
(T.sub.max-T.sub.min) of no more than 10.degree. C. of each other.
In certain embodiments, at least two hybridization
tag:hybridization tag complement duplexes have melting temperatures
that fall within a .DELTA. T.sub.m range of 5.degree. C. or less of
each other.
[0043] In certain embodiments, at least one hybridization tag
complement comprises at least one reporter group, at least one
mobility modifier, at least one reporter probe-binding portion, or
combinations thereof. In certain embodiments, at least one
hybridization tag complement is annealed to at least one
corresponding hybridization tag and, subsequently, at least part of
that hybridization tag complement is released and detected.
[0044] The term "ligation product" refers to a molecule that is
generated when an internucleotide linkage is formed between two
corresponding probes by the action of one or more ligation agents.
Those in the art understand that, under certain conditions, such an
internucleotide linkage can be formed between: (i) at least one
pair of matched probes (i.e., the target-specific portions of both
probes are fully complementary with the corresponding sequences of
the target), or (ii) at least one pair of mismatched probes (that
is at least one of the two probes comprises at least one nucleotide
or nucleotide analog that is mismatched with the corresponding
template or at least one Modification). Thus, the term
(mis)ligation is used herein to collectively refer to at least one
match ligation, at least one mismatch ligation (sometimes referred
to as misligation), or at least one match ligation and at least one
misligation. Hence, by way of illustration but without limitation,
at least one "(mis)ligation product" refers to at least one
ligation product, at least one misligation product, or at least one
ligation product and at least one misligation product; at least one
"(mis)ligation product surrogate" refers to at least one ligation
product surrogate, at least one misligation product surrogate, or
at least one ligation product surrogate and at least one
misligation product surrogate; and so forth. The term "misligation"
is generally intended to refer to products, surrogates, and the
like that result from mismatch ligation reaction, but not match
ligation reactions.
[0045] The term "ligation product surrogate" as used herein refers
to any molecule or moiety whose detection or identification
indicates the existence of one or more corresponding ligation
products. Exemplary ligation product surrogates include but are not
limited to, digested ligation products; amplified ligation
products; digested amplified ligation products; one or more
moieties cleaved or released from a ligation product or ligation
product surrogate; one or more complementary strand or counterpart
of a ligation product or ligation product surrogate; reporter
probes, including but not limited to cleavage and amplification
products thereof; hybridization tag complements, including but not
limited to ZipChutes.TM. (typically a molecule or complex
comprising at least one hybridization tag complement, at least one
mobility modifier, and at least one reporter group, generally a
fluorescent reporter group; see, e.g., Applied Biosystems Part
Number 4344467 Rev. C; see also U.S. Provisional Patent Application
Ser. No. 60/517,470); and the like. The term "digested amplified
ligation product" is intended to include a ligation product that is
digested then amplified as well as a ligation product that is
amplified then digested.
[0046] As used herein, "ligation rate" or "rate" are relative terms
that are determined by evaluating at least one measurable parameter
of at least one (mis)ligation product or its surrogate. In certain
embodiments, a "ligation rate ratio" or "ratio" is obtained by
comparing at least one quantifiable parameter of at least one first
(mis)ligation product with the same measurable parameter of at
least one second (mis)ligation product generated under the same
conditions. By way of illustration, without limitation, if the
integrated area under the curve corresponding to exemplary
(mis)ligation product A is 10 and the integrated area under the
curve corresponding to exemplary (mis)ligation product B generated
under the same conditions is 1, the corresponding ligation rate
ratio is 10:1 (A/B) or 1:10 (B/A). In certain embodiments, the
ligation rate for a given ligation product is compared to at least
one corresponding standard curve. Those in the art appreciate that
numerous measurable parameters exist that can be used to compare
the amounts of two or more (mis)ligation products generated under
the same conditions, including without limitation, (mis)ligation
product peak height, integrated area under the curve for the
(mis)ligation products, and so forth. By evaluating the ligation
rate or the ligation rate ratio, one can determine the degree of
methylation for at least one target nucleotide.
[0047] The term "mobility-dependent analytical technique" as used
herein refers to any means for separating different molecular
species based on differential rates of migration of those different
molecular species in one or more separation techniques. Exemplary
mobility-dependent analysis techniques include electrophoresis,
chromatography, mass spectroscopy, sedimentation, e.g., gradient
centrifugation, field-flow fractionation, multi-stage extraction
techniques and the like. Descriptions of mobility-dependent
analytical techniques can be found in, among other places, U.S.
Pat. Nos. 5,470,705, 5,514,543, 5,580,732, 5,624,800, and
5,807,682; PCT Publication No. WO 01/92579; D. R. Baker, Capillary
Electrophoresis, Wiley-Interscience (1995); Biochromatography:
Theory and Practice, M. A. Vijayalakshmi, ed., Taylor &
Francis, London, U.K. (2003); Krylov and Dovichi, Anal. Chem.
72:111R-128R (2000); Swinney and Bornhop, Electrophoresis
21:1239-50 (2000); Crabtree et al., Electrophoresis 21:1329-35
(2000); and A. Pingoud et al., Biochemical Methods: A Concise Guide
for Students and Researchers, Wiley-VCH Verlag GmbH, Weinheim,
Germany (2002).
[0048] The term "mobility modifier" as used herein refers to at
least one molecular entity, for example but not limited to, at
least one polymer chain, that when added to at least one element
(e.g., at least one probe, at least one primer, at least one
(mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof) affects the mobility of the
element to which it is hybridized or bound, covalently or
non-covalently, in at least one mobility-dependent analytical
technique. Typically, a mobility modifier changes the
charge/translational frictional drag when hybridized or bound to
the element; or imparts a distinctive mobility, for example but not
limited to, a distinctive elution characteristic in a
chromatographic separation medium or a distinctive electrophoretic
mobility in a sieving matrix or non-sieving matrix, when hybridized
or bound to the corresponding element; or both (see, e.g., U.S.
Pat. Nos. 5,470,705 and 5,514,543; Grossman et al., Nucl. Acids
Res. 22:4527-34 (1994)). In certain embodiments, a multiplicity of
probes exclusive of mobility modifiers, a multiplicity of primers
exclusive of mobility modifiers, a multiplicity of (mis)ligation
products exclusive of mobility modifiers, a multiplicity of
(mis)ligation product surrogates exclusive of mobility modifiers,
or combinations thereof, have the same or substantially the same
mobility in at least one mobility-dependent analytical
technique.
[0049] In certain embodiments, a multiplicity of probes, a
multiplicity of primers, a multiplicity of ligation products, a
multiplicity of ligation product surrogates, or combinations
thereof, have substantially similar distinctive mobilities, for
example but not limited to, when a multiplicity of elements
comprising mobility modifiers have substantially similar
distinctive mobilities so they can be bulk separated or they can be
separated from other elements comprising mobility modifiers with
different distinctive mobilities. In certain embodiments, a
multiplicity of probes comprising mobility modifiers, a
multiplicity of primers comprising mobility modifiers, a
multiplicity of (mis)ligation products comprising mobility
modifiers, a multiplicity of (mis)ligation product surrogates
comprising mobility modifiers, or combinations thereof, have
different distinctive mobilities.
[0050] In certain embodiments, at least one mobility modifier
comprises at least one nucleotide polymer chain, including without
limitation, at least one oligonucleotide polymer chain, at least
one polynucleotide polymer chain, or both at least one
oligonucleotide polymer chain and at least one polynucleotide
polymer chain. For example but not limited to a series of
additional non-target sequence-specific nucleotides in one or more
probes such as "TTTT", shown in Table 7; or nucleotide spacers (see
e.g., Tong et al., Nat. Biotech. 19:756-759 (2001)). In certain
embodiments, at least one mobility modifier comprises at least one
non-nucleotide polymer chain. Exemplary non-nucleotide polymer
chains include, without limitation, peptides, polypeptides,
polyethylene oxide (PEO), or the like. In certain embodiments, at
least one polymer chain comprises at least one substantially
uncharged, water-soluble chain, such as a chain composed of one or
more PEO units; a polypeptide chain; or combinations thereof.
[0051] The polymer chain can comprise a homopolymer, a random
copolymer, a block copolymer, or combinations thereof. Furthermore,
the polymer chain can have a linear architecture, a comb
architecture, a branched architecture, a dendritic architecture
(e.g., polymers containing polyamidoamine branched polymers,
Polysciences, Inc. Warrington, Pa.), or combinations thereof. In
certain embodiments, at least one polymer chain is hydrophilic, or
at least sufficiently hydrophilic when hybridized or bound to an
element to ensure that the element-mobility modifier is readily
soluble in aqueous medium. Where the mobility-dependent analytical
technique is electrophoresis, in certain embodiments, the polymer
chains are uncharged or have a charge/subunit density that is
substantially less than that of its corresponding element.
[0052] The synthesis of polymer chains useful as mobility modifiers
will depend, at least in part, on the nature of the polymer.
Methods for preparing suitable polymers generally follow well-known
polymer subunit synthesis methods. These methods, which involve
coupling of defined-size, multi-subunit polymer units to one
another, either directly or through charged or uncharged linking
groups, are generally applicable to a wide variety of polymers,
such as PEO, polyglycolic acid, polylactic acid, polyurethane
polymers, polypeptides, oligosaccharides, and nucleotide polymers.
Such methods of polymer unit coupling are also suitable for
synthesizing selected-length copolymers, e.g., copolymers of PEO
units alternating with polypropylene units. Polypeptides of
selected lengths and amino acid composition, either homopolymer or
mixed polymer, can be synthesized by standard solid-phase methods
(see, e.g., Int. J. Peptide Protein Res., 35: 161-214 (1990)).
[0053] One method for preparing PEO polymer chains having a
selected number of hexaethylene oxide (HEO) units, an HEO unit is
protected at one end with dimethoxytrityl (DMT), and activated at
its other end with methane sulfonate. The activated HEO is then
reacted with a second DMT-protected HEO group to form a
DMT-protected HEO dimer. This unit-addition is then carried out
successively until a desired PEO chain length is achieved (see,
e.g., U.S. Pat. No. 4,914,210; see also, U.S. Pat. No.
5,777,096).
[0054] As used herein, the term "Modification" refers to at least
one substituted hydrocarbon, at least one ribonucleotide, at least
one amide bond (including but not limited to at least one PNA, at
least one pcPNA, or both), at least one nucleotide analog, at least
one groove binder, or combinations thereof. In certain embodiments,
at least one probe comprises at least one Modification, sometimes
referred to as a "Modified probe." In certain embodiments, at least
one Modification comprises at least one structure shown below,
##STR00001##
wherein: (a) R.sub.1 comprises at least one hydrogen, alkyl,
substituted alkyl, alkene, substituted alkene, alkyne, substituted
alkyne, aromatic ring, substituted aromatic ring, heteroaromatic
ring, substituted heteroaromatic ring, halogen, nitro, cyano,
oxygen, substituted oxygen, nitrogen, substituted nitrogen,
divalent sulfur, substituted divalent sulfur, sulfonate, sulfonate
ester, aldehyde, ketone carbon with R.sub.2, carboxylate carbon as
carboxylic acid and ester with R.sub.2, or combinations thereof;
(b) R.sub.2, a substituent on R.sub.1, comprises at least one
hydrogen, alkyl, substituted alkyl, alkene, substituted alkene,
alkyne, substituted alkyne, aromatic ring, substituted aromatic
ring, heteroaromatic ring, substituted heteroaromatic ring,
halogen, nitro, cyano, alcohol, ether substituted with R.sub.3,
amine, secondary, tertiary, and quaternary amines substituted with
R.sub.3, amido substituted with R.sub.3, thiol, thioether
substituted with R.sub.3, sulfonate, sulfonate ester substituted
with R.sub.3, phosphate and phosphate esters substituted with
R.sub.3, phosphonate and phosphonate esters substituted with
R.sub.3, aldehyde, ketone substituted with R.sub.3, carboxylate,
carboxylate esters substituted with R.sub.3, carboxyamides
substituted with R.sub.3., or combinations thereof; and (c)
R.sub.3, a substituent on R.sub.2, comprises at least one hydrogen,
alkyl, substituted alkyl, alkene, substituted alkene, alkyne,
substituted alkyne, aromatic ring, substituted aromatic ring,
heteroaromatic ring, substituted heteroaromatic ring, halogen,
nitro, cyano, alcohol, ether as defined in R.sub.2, amine,
secondary, tertiary, and quaternary amines as defined in R.sub.2,
amido as defined in R.sub.2, thiol, thioether as defined in
R.sub.2, sulfonate, sulfonate ester as defined in R.sub.2,
phosphate and phosphate esters as defined in R.sub.2, phosphonate
and phosphonate esters as defined in R.sub.2, aldehyde, ketone as
defined in R.sub.2, carboxylate, carboxylate esters as defined in
R.sub.2, carboxyamides as defined in R.sub.2.
[0055] The term "nucleotide base", as used herein, refers to a
substituted or unsubstituted aromatic ring or rings. In certain
embodiments, the aromatic ring or rings contain at least one
nitrogen atom. In certain embodiments, the nucleotide base is
capable of forming Watson-Crick and/or Hoogsteen-type hydrogen
bonds with a complementary nucleotide base. Exemplary nucleotide
bases and analogs thereof include, but are not limited to,
naturally occurring nucleotide bases adenine, guanine, cytosine, 5
methyl-cytosine, uracil, thymine, and analogs of the naturally
occurring nucleotide bases, including without limitation,
7-deazaadenine, 7-deazaguanine, 7-deaza-8-azaguanine,
7-deaza-8-azaadenine, N6-.DELTA.2-isopentenyladenine (6iA),
N6-.DELTA.2-isopentenyl-2-methylthioadenine (2 ms6iA),
N2-dimethylguanine (dmG), 7-methylguanine (7mG), inosine,
nebularine, 2-aminopurine, 2-amino-6-chloropurine,
2,6-diaminopurine, hypoxanthine, pseudouridine, pseudocytosine,
pseudoisocytosine, 5-propynylcytosine, isocytosine, isoguanine,
7-deazaguanine, 2-thiopyrimidine, 6-thioguanine, 4-thiothymine,
4-thiouracil, O6-methylguanine, N6-methyladenine, O4-methylthymine,
5,6-dihydrothymine, 5,6-dihydrouracil, pyrazolo[3,4-D]pyrimidines
(see, e.g., U.S. Pat. Nos. 6,143,877 and 6,127,121 and PCT
published application WO 01/38584), ethenoadenine, indoles such as
nitroindole and 4-methylindole, and pyrroles such as nitropyrrole.
Certain exemplary nucleotide bases can be found, e.g., in Fasman,
1989, Practical Handbook of Biochemistry and Molecular Biology, pp.
385-394, CRC Press, Boca Raton, Fla., and the references cited
therein.
[0056] The term "nucleotide", as used herein, refers to a compound
comprising a nucleotide base linked to the C-1' carbon of a sugar,
such as ribose, arabinose, xylose, and pyranose, and sugar analogs
thereof. The term nucleotide also encompasses nucleotide analogs.
The sugar may be substituted or unsubstituted. Substituted ribose
sugars include, but are not limited to, those riboses in which one
or more of the carbon atoms, for example the 2'-carbon atom, is
substituted with one or more of the same or different, --R, --OR,
--NR2 azide, cyanide or halogen groups, where each R is
independently H, C1-C6 alkyl, C2-C7 acyl, or C5-C14 aryl. Exemplary
riboses include, but are not limited to, 2'-(C1-C6)alkoxyribose,
2'-(C5-C14)aryloxyribose, 2',3'-didehydroribose,
2'-deoxy-3'-haloribose, 2'-deoxy-3'-fluororibose,
2'-deoxy-3'-chlororibose, 2'-deoxy-3'-aminoribose,
2'-deoxy-3'-(C1-C6)alkylribose, 2'-deoxy-3'-(C1-C6)alkoxyribose and
2'-deoxy-3'-(C5-C14)aryloxyribose, ribose, 2'-deoxyribose,
2',3'-dideoxyribose, 2'-haloribose, 2'-fluororibose,
2'-chlororibose, and 2'-alkylribose, e.g., 2'-O-methyl,
4'-.alpha.-anomeric nucleotides, 1'-.alpha.-anomeric nucleotides,
2'-4'- and 3'-4'-linked and other "locked" or "LNA", bicyclic sugar
modifications (see, e.g., PCT published application nos. WO
98/22489, WO 98/39352; and WO 99/14226). Exemplary LNA sugar
analogs within a polynucleotide include, but are not limited to,
the structures:
##STR00002##
where B is any nucleotide base.
[0057] [m]odifications at the 2'- or 3'-position of ribose include,
but are not limited to, hydrogen, hydroxy, methoxy, ethoxy,
allyloxy, isopropoxy, butoxy, isobutoxy, methoxyethyl, alkoxy,
phenoxy, azido, cyano, amido, imido, amino, alkylamino, fluoro,
chloro and bromo. Nucleotides include, but are not limited to, the
natural D optical isomer, as well as the L optical isomer forms
(see, e.g., Garbesi Nucl. Acids Res. 21:4159-65 (1993); Fujimori
(1990) J. Amer. Chem. Soc. 112:7435; Urata, (1993) Nucleic Acids
Symposium Ser. No. 29:69-70). When the nucleotide base is purine,
e.g. A or G, the ribose sugar is attached to the N.sup.9-position
of the nucleotide base. When the nucleotide base is pyrimidine,
e.g. C, T, or U, the pentose sugar is attached to the
N.sup.1-position of the nucleotide base, except for pseudouridines,
in which the pentose sugar is attached to the C5 position of the
uracil nucleotide base (see, e.g., Kornberg and Baker, (1992) DNA
Replication, 2.sup.nd Ed., Freeman, San Francisco, Calif.).
[0058] One or more of the pentose carbons of a nucleotide may be
substituted with a phosphate ester having the formula:
##STR00003##
where .alpha. is an integer from 0 to 4. In certain embodiments,
.alpha. is 2 and the phosphate ester is attached to the 3'- or
5'-carbon of the pentose. In certain embodiments, the nucleotides
are those in which the nucleotide base is a purine, a
7-deazapurine, a pyrimidine, or an analog thereof. "Nucleotide
5'-triphosphate" refers to a nucleotide with a triphosphate ester
group at the 5' position, and is sometimes denoted as "NTP", or
"dNTP" and "ddNTP" to particularly point out the structural
features of the ribose sugar. The triphosphate ester group may
include sulfur substitutions for the various oxygens, e.g.
.alpha.-thio-nucleotide 5'-triphosphates. Reviews of nucleotide
chemistry can be found in, among other places, Shabarova, Z. and
Bogdanov, A. Advanced Organic Chemistry of Nucleic Acids, VCH, New
York, 1994; and Blackburn and Gait.
[0059] The term "nucleotide analog", as used herein, refers to
embodiments in which the pentose sugar and/or the nucleotide base
and/or one or more of the phosphate esters of a nucleotide may be
replaced with its respective analog. In certain embodiments,
exemplary pentose sugar analogs are those described above. In
certain embodiments, the nucleotide analogs have a nucleotide base
analog as described above. In certain embodiments, exemplary
phosphate ester analogs include, but are not limited to,
alkylphosphonates, methylphosphonates, phosphoramidates,
phosphotriesters, phosphorothioates, phosphorodithioates,
phosphoroselenoates, phosphorodiselenoates, phosphoroanilothioates,
phosphoroanilidates, phosphoramidates, boronophosphates, etc., and
may include associated counterions.
[0060] Also included within the definition of "nucleotide analog"
are nucleotide analog monomers that can be polymerized into
polynucleotide analogs in which the DNA/RNA phosphate ester and/or
sugar phosphate ester backbone is replaced with a different type of
internucleotide linkage. Exemplary polynucleotide analogs include,
but are not limited to, peptide nucleic acids, in which the sugar
phosphate backbone of the polynucleotide is replaced by a peptide
backbone comprising at least one amide bond. (See, e.g., Datar and
Kim, Concepts in Applied Molecular Biology, Eaton Publishing,
Westborough, Mass., 2003, particularly at pages 74-75; Verma and
Eckstein, Ann. Rev. Biochem. 67:99-134, 1998; Goodchild, Bioconj.
Chem., 1:165-187, 1990).
[0061] As used herein, the terms "polynucleotide",
"oligonucleotide", "nucleic acid", and "nucleic acid sequence" are
generally used interchangeably and include single-stranded and
double-stranded polymers of nucleotide monomers, including
2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by
internucleotide phosphodiester bond linkages, or internucleotide
analogs, and associated counter ions, e.g., H+, NH4+,
trialkylammonium, tetraalkylammonium, Mg2+, Na+ and the like. A
nucleic acid may be composed entirely of deoxyribonucleotides,
entirely of ribonucleotides, or chimeric mixtures thereof. The
nucleotide monomer units may comprise any of the nucleotides
described herein, including, but not limited to, naturally
occurring nucleotides and nucleotide analogs. Nucleic acids
typically range in size from a few monomeric units, e.g. 5-40 when
they are sometimes referred to in the art as oligonucleotides, to
several thousands of monomeric nucleotide units. Nucleic acid
sequence are shown in the 5' to 3' orientation from left to right,
unless otherwise apparent from the context or expressly indicated
differently; and in such sequences, "A" denotes deoxyadenosine, "C"
denotes deoxycytidine, "G" denotes deoxyguanosine, "T" denotes
thymidine, and "U" denotes uridine.
[0062] Nucleic acids include, but are not limited to, genomic DNA,
cDNA, hnRNA, mRNA, rRNA, tRNA, fragmented nucleic acid, nucleic
acid obtained from subcellular organelles such as mitochondria or
chloroplasts, and nucleic acid obtained from microorganisms or DNA
or RNA viruses that may be present on or in a biological
sample.
[0063] Nucleic acids may be composed of a single type of sugar
moiety, e.g., as in the case of RNA and DNA, or mixtures of
different sugar moieties, e.g., as in the case of RNA/DNA chimeras.
In certain embodiments, nucleic acids are ribopolynucleotides and
2'-deoxyribopolynucleotides according to the structural formulae
below:
##STR00004##
wherein each B is independently the base moiety of a nucleotide,
e.g., a purine, a 7-deazapurine, a purine or purine analog
substituted with one or more substituted hydrocarbons, a
pyrimidine, a pyrimidine or pyrimidine analog substituted with one
or more substituted hydrocarbons, or an analog nucleotide; each m
defines the length of the respective nucleic acid and can range
from zero to thousands, tens of thousands, or even more; each R is
independently selected from the group comprising hydrogen, halogen,
--R'', --OR'', and --NR''R'', where each R'' is independently
(C1-C6)alkyl, (C2-C7)acyl or (C5-C14)aryl, cyanide, azide, or two
adjacent Rs are taken together to form a bond such that the ribose
sugar is 2',3'-didehydroribose; and each R' is independently
hydroxyl or
##STR00005##
where .alpha. is zero, one or two.
[0064] In certain embodiments of the ribopolynucleotides and
2'-deoxyribopolynucleotides illustrated above, the nucleotide bases
B are covalently attached to the C1' carbon of the sugar moiety as
previously described.
[0065] The terms "nucleic acid", "nucleic acid sequence",
"polynucleotide", and "oligonucleotide" can also include nucleic
acid analogs, polynucleotide analogs, and oligonucleotide analogs.
The terms "nucleic acid analog", "polynucleotide analog" and
"oligonucleotide analog" are used interchangeably and, as used
herein, refer to a nucleic acid that contains at least one
nucleotide analog and/or at least one phosphate ester analog and/or
at least one pentose sugar analog. Also included within the
definition of nucleic acid analogs are nucleic acids in which the
phosphate ester and/or sugar phosphate ester linkages are replaced
with other types of linkages, such as N-(2-aminoethyl)-glycine
amides and other amides (see, e.g., Nielsen et al., 1991, Science
254: 1497-1500; PCT Publication No. WO 92/20702; U.S. Pat. Nos.
5,719,262 and 5,698,685); morpholinos (see, e.g., U.S. Pat. No.
5,698,685; U.S. Pat. No. 5,378,841; U.S. Pat. No. 5,185,144);
carbamates (see, e.g., Stirchak & Summerton, J. Org. Chem. 52:
4202, 1987); methylene(methylimino) (see, e.g., Vasseur et al., J.
Am. Chem. Soc. 114:4006, 1992); 3'-thioformacetals (see, e.g.,
Jones et al., 1993, J. Org. Chem. 58: 2983); sulfamates (see, e.g.,
U.S. Pat. No. 5,470,967); 2-aminoethylglycine, commonly referred to
as PNA (see, e.g., PCT Publication No. WO 92/20702; Nielsen,
Science 254:1497-1500, 1991); and others (see, e.g., U.S. Pat. No.
5,817,781; Frier & Altman, Nucl. Acids Res. 25:4429, 1997 and
the references cited therein). Phosphate ester analogs include, but
are not limited to, (i) C.sub.1-C.sub.4 alkylphosphonate, e.g.
methylphosphonate; (ii) phosphoramidate; (iii) C.sub.1-C.sub.6
alkyl-phosphotriester; (iv) phosphorothioate; and (v)
phosphorodithioate. See also, Scheit, Nucleotide Analogs, John
Wiley, New York, (1980); Englisch, Agnew. Chem. Int. Ed. Engl.
30:613-29, 1991; Agarwal, Protocols for Polynucleotides and
Analogs, Humana Press, 1994; and S. Verma and F. Eckstein, Ann.
Rev. Biochem. 67:99-134, 1999.
[0066] The term "polymerase" is used in a broad sense herein and
includes amplifying means such as DNA polymerases, enzymes that
typically synthesize DNA by incorporating deoxyribonucleotide
triphosphates or analogs in the 5'=>3' direction in a
template-dependent and primer-dependent manner; RNA polymerases,
enzymes that typically synthesize RNA by incorporating
ribonucleotide triphosphates or analogs, generally in a
template-dependent manner; and reverse transcriptases, also known
as RNA-dependent DNA polymerases, that synthesize DNA by
incorporating deoxyribonucleotide triphosphates or analogs in the
5'=>3' direction in primer-dependent manner, typically using an
RNA template. Descriptions of polymerases can be found in, among
other places, R. M. Twyman, Advanced Molecular Biology, Bios
Scientific Publishers Ltd. (1999); Polymerase Enzyme Resource
Guide, Promega, Madison, Wis. (1998); P. C. Turner et al., Instant
Notes in Molecular Biology, Bios Scientific Publishers Ltd. (1997);
and B. D. Hames et al., Instant Notes in Biochemistry, Bios
Scientific Publishers Ltd. (1997).
[0067] The term "primer" as used herein refers to an
oligonucleotide comprising at least one region that is
complementary or substantially complementary to the primer-binding
portion of at least one probe, at least one (mis)ligation product,
at least one (mis)ligation product surrogate, or combinations
thereof, including sequences that are complementary to any of
these, and that can anneal with such primer-binding portions or
their complements under appropriate conditions. Primers typically
serve as initiation sites for certain amplification techniques,
including but not limited to, primer extension and PCR. A primer
that hybridizes with a multiplicity of different probe species,
(mis)ligation product species, (mis)ligation product surrogate
species, or combinations thereof, is referred to as a "universal
primer". In certain embodiments, at least one primer comprises at
least one additional component, including but not limited to, at
least one primer-binding portion, at least one reporter
probe-binding portion, at least one reporter group, at least one
hybridization tag, at least one mobility modifier, at least one
affinity tag, or combinations thereof.
[0068] The term "probe" as used herein, refers to an
oligonucleotide comprising a target-specific portion that is
capable, under appropriate conditions, of hybridizing with at least
a part of at least one corresponding target nucleic acid sequence.
As used herein, the terms probe and probes generally refer to
ligation probes and misligation probes, including competing
ligation probes and competing misligation probes, unless otherwise
apparent from the context. A probe may include Watson-Crick bases
or modified bases, including but not limited to, the AEGIS bases
(from Eragen Biosciences), described, e.g., in U.S. Pat. Nos.
5,432,272; 5,965,364; and 6,001,983. Additionally, bases may be
joined by a natural phosphodiester bond or a different chemical
linkage. Different chemical linkages include, but are not limited
to, at least one amide linkage or at least one Locked Nucleic Acid
(LNA) linkage, described in, e.g., published PCT Applications WO
00/56748 and WO 00/66604.
[0069] Probes typically are part of at least one ligation probe set
or at least one competing ligation probe set, comprising at least
one first probe and at least one second probe. In certain
embodiments, at least one probe comprises at least one nucleotide
in its target-specific portion that is mismatched relative to at
least one portion of its corresponding target nucleic acid
sequence, at least one Modification, or both at least one
mismatched nucleotide and at least one Modification. In certain
embodiments, at least one mismatched nucleotide also comprises at
least one Modification.
[0070] In certain embodiments, at least one probe comprises at
least one additional component, including but not limited to, at
least one primer-binding portion, at least one reporter
probe-binding portion, at least one reporter group, at least one
hybridization tag, at least one mobility modifier, at least one
affinity tag, or combinations thereof. In certain embodiments, such
additional components are within the target-specific portion,
coextensive with the target-specific portion, overlaps at least
part of the target-specific portion, or combinations thereof.
[0071] The target-specific portions of ligation probes are of
sufficient length to permit specific annealing to complementary
sequences in corresponding target nucleic acid sequences. Likewise,
primers are of sufficient length to permit specific annealing to
complementary sequences in corresponding (mis)ligation products,
corresponding (mis)ligation product surrogates, or combinations
thereof. The criteria for designing sequence-specific nucleic acid
probes (including but not limited to ligation probes and reporter
probes) and primers are well known to those in the art. In certain
embodiments, at least one probe, at least one primer, or at least
one probe and at least one primer comprises at least one region
that is fully complementary with the corresponding sequences in at
least one target nucleic acid sequence, at least one (mis)ligation
product, at least one (mis)ligation product surrogate, or
combinations thereof. In certain embodiments, at least one probe
contains at least one mismatched nucleotide relative to at least
one corresponding nucleotide in the target nucleic acid sequence,
at least one Modification, at least one additional component, or
combinations thereof. Detailed descriptions of nucleic acid probe
and primer design can be found in, among other places, Diffenbach
and Dveksler, PCR Primer, A Laboratory Manual, Cold Spring Harbor
Press (1995); R. Rapley, The Nucleic Acid Protocols Handbook
(2000), Humana Press, Totowa, N.J. (hereinafter "Rapley"); Schena;
and Kwok et al., Nucl. Acid Res. 18:999-1005 (1990). Primer and
probe design software programs are also commercially available,
including without limitation, Primer Express, Applied Biosystems,
Foster City, Calif.; Primer Premier and Beacon Designer software,
PREMIER Biosoft International, Palo Alto, Calif.; Primer Designer
4, Sci-Ed Software, Durham, N.C.; Primer Detective, ClonTech, Palo
Alto, Calif.; Lasergene, DNASTAR, Inc., Madison, Wis.; Oligo
software, National Biosciences, Inc., Plymouth, Minn.; iOligo,
Caesar Software, Portsmouth, N.H.; and RTPrimerDB on the world wide
web at realtimeprimerdatabase.ht.st or at
medgen31.urgent.be/primerdatabase/index (see also, Pattyn et al.,
Nucl. Acid Res. 31:122-23, 2003).
[0072] A "probe set" according to the present teachings comprises
at least one first probe and at least one second probe that
typically adjacently hybridize to the same target sequence, but not
always, and are generally used for interrogating at least one
target nucleotide. The first probe of each probe set is designed to
hybridize with the downstream region of the target sequence in a
sequence-specific manner. The second probe in the probe set is
designed to hybridize with the upstream region of the target
sequence in a sequence-specific manner. The use of the terms first
and second with respect to probed and primers is to distinguish one
from the other and is generally not intended to be limiting. The
sequence-specific portions of these probes are of sufficient length
to permit specific annealing with complementary sequences in
targets and primers, as appropriate. In certain embodiments, both
the at least one first probe and the at least one second probe in a
probe set further comprise primer-specific portions suitable for
hybridizing with primers.
[0073] Under appropriate conditions, adjacently hybridized probes
can be ligated together by one or more ligation agents to form a
ligation product, provided that they comprise appropriate reactive
groups, for example, without limitation, a free 3'-hydroxyl or
5'-phosphate group. Some probe sets may comprise more than one
first probe or more than one second probe or both, to aid in
determining the degree of methylation at one or more target
nucleotide. Certain of the disclosed methods comprise a
multiplicity of different probe sets for determining a multiplicity
of different target nucleotides in a multiplex ligation reaction.
Certain embodiments comprise at least one multiplex amplification
reaction, at least one multiplex ligation reaction, or at least one
multiplex amplification reaction and at least one multiplex
ligation reaction. In certain embodiments, at least one multiplex
amplification reaction and at least one multiplex ligation reaction
are performed in the same tube.
[0074] Those in the art understand that probes and probe sets that
are suitable for use with the disclosed methods and kits can be
identified empirically using the current teachings and routine
methods known in the art, without undue experimentation. For
example, suitable probes and probe sets can be obtained by
selecting appropriate target nucleotides and target nucleotide
sequences by searching relevant scientific literature, including
but not limited to appropriate databases (see, e.g., DNA
Methylation Database (MethDB), on the web at methdb.de or
methdb.net; CpG Island Searcher, on the web at cpgislands.com; the
NCBI Entrez Nucleotide database), or by experimental analysis. When
target nucleic acid sequences of interest are identified, test
probes can be synthesized (and Modified if desired) using well
known oligonucleotide synthesis and organic chemistry techniques
(see, e.g., Current Protocols in Nucleic Acid Chemistry, Beaucage
et al., eds., John Wiley & Sons, New York, N.Y., including
updates through April 2004 (hereinafter "Beaucage et al.");
Blackburn and Gait; Glen Research 2002 Catalog, Sterling, Va.; and
Synthetic Medicinal Chemistry 2003/2004, Berry and Associates,
Dexter, Mich.). Test probes and/or probe sets are employed in the
disclosed assays using appropriate target sequences and their
suitability for interrogating the target nucleotide is evaluated.
Standard curves for determining the degree of target nucleotide
methylation can then be generated, if desired, using pre-determined
mixtures of methylated and non-methylated synthetic templates or
gDNA as the target nucleic acid sequences in one or more of the
disclosed ligation assays under standard conditions. Those in the
art are familiar with generating and using standard curves (see,
e.g., Overholtzer et al., Proc. Natl. Sci. 100:11547-52, 2003).
[0075] According to certain embodiments, the primer sets comprise
at least one first primer and at least one second primer. The first
primer of a primer set is designed to hybridize with the complement
of the 5' primer-specific portion of a (mis)ligation product,
appropriate (mis)ligation product surrogates, or combinations
thereof, in a sequence-specific manner. The second primer in that
primer set is designed to hybridize with a 3' primer-specific
portion of the same (mis)ligation product, appropriate
(mis)ligation product surrogates, or combinations thereof, in a
sequence-specific manner. In certain embodiments, at least one
primer of the primer set further comprises at least one reporter
group, at least one hybridization tag, at least one affinity tag,
or combinations thereof. Suitable probes and primers can be
synthesized using methods well known on the art. Detailed
descriptions of probe and primer synthesis and phosphorylation can
be found in, among other places, Beaucage et al., Tong et al.,
Nucl. Acids Res. 27:788-94 (1999), Housby and Southern, Nucl. Acids
Res. 26:4259-66 (1998), and Grossman et al., Nucl. Acids Res.
22:4527-34 (1994).
[0076] The term "reporter group" is used in a broad sense herein
and refers to any identifiable tag, label, or moiety. The skilled
artisan will appreciate that many different species of reporter
groups can be used in the present teachings, either individually or
in combination with one or more different reporter group. Exemplary
reporter groups include, but are not limited to, fluorophores,
radioisotopes, chromogens, enzymes, antigens including but not
limited to epitope tags, heavy metals, dyes, phosphorescence
groups, chemiluminescent groups, electrochemical detection
moieties, affinity tags, binding proteins, phosphors, rare earth
chelates, near-infrared dyes, including but not limited to,
"Cy.7.5Ph.NCS," "Cy.7.OphEt.NCS," "Cy7.OphEt.CO.sub.2Su", and
IRD800 (see, e.g., J. Flanagan et al., Bioconjug. Chem. 8:751-56
(1997); and DNA Synthesis with IRD800 Phosphoramidite, LI-COR
Bulletin #111, LI-COR, Inc., Lincoln, Nebr.),
electrochemiluminescence labels, including but not limited to,
tris(bipyridyl) ruthenium (II), also known as Ru(bpy).sub.3.sup.2+,
Os(1,10-phenanthroline).sub.2bis(diphenylphosphino)ethane.sup.2+,
also known as Os(phen).sub.2(dppene).sup.2+, luminol/hydrogen
peroxide, Al(hydroxyquinoline-5-sulfonic acid),
9,10-diphenylanthracene-2-sulfonate, and
tris(4-vinyl-4'-methyl-2,2'-bipyridyl) ruthenium (II), also known
as Ru(v-bpy.sub.3.sup.2+), and the like.
[0077] The term reporter group also encompasses at least one
element of multi-element indirect reporter systems, including
without limitation, affinity tags such as biotin:avidin,
antibody:antigen, ligand:receptor including but not limited to
binding proteins and their ligands, enzyme:substrate, and the like,
in which one element interacts with one or more other elements of
the system in order to effect the potential for a detectable
signal. Exemplary multi-element reporter systems include an
oligonucleotide comprising at least one biotin reporter group and a
streptavidin-conjugated fluorophore, or vice versa; an
oligonucleotide comprising at least one dinitrophenyl (DNP)
reporter group and a fluorophore-labeled anti-DNP antibody; and the
like. In certain embodiments, reporter groups, particularly
multi-element reporter groups, are not necessarily used for
detection, but rather serve as affinity tags for
isolation/separation, for example but not limited to, a biotin
reporter group and a streptavidin coated substrate, or vice versa;
a digoxygenin reporter group and an anti-digoxygenin antibody or a
digoxygenin-binding aptamer; a DNP reporter group and an anti-DNP
antibody or a DNP-binding aptamer; and the like. Detailed protocols
for attaching reporter groups to oligonucleotides, polynucleotides,
peptides, antibodies and other proteins, mono-, di- and
oligosaccharides, organic molecules, and the like can be found in,
among other places, Bioconjugate Techniques; Beaucage et al.;
Molecular Probes Handbook; and Pierce Applications Handbook and
Catalog 2003-2004, Pierce Biotechnology, Rockford, Ill., 2003
(hereinafter "Pierce Applications Handbook").
[0078] In certain embodiments, at least one reporter group
comprises at least one electrochemiluminescent moiety that can,
under appropriate conditions, emit detectable electrogenerated
chemiluminescence (ECL). In ECL, excitation of the
electrochemiluminescent moiety is electrochemically driven and the
chemiluminescent emission can be optically detected. Exemplary
electrochemiluminescent reporter group species include:
Ru(bpy).sub.3.sup.2+ and Ru(v-bpy).sub.3.sup.2+ with emission
wavelengths of 620 nm; Os(phen).sub.2(dppene).sup.2+ with an
emission wavelength of 584 nm; luminol/hydrogen peroxide with an
emission wavelength of 425 nm; Al(hydroxyquinoline-5-sulfonic acid)
with an emission wavelength of 499 nm; and
9,10-diphenylanthracene-2-sulfonate with an emission wavelength of
428 nm; and the like. Forms of these three electrochemiluminescent
reporter group species that are modified to be amenable to
incorporation into probes are commercially available or can be
synthesized without undue experimentation using techniques known in
the art. For example, a Ru(bpy).sub.3.sup.2+ N-hydroxy succinimide
ester for coupling to nucleic acid sequences through an amino
linker group has been described (see, U.S. Pat. No. 6,048,687); and
succinimide esters of Os(phen).sub.2(dppene).sup.2+ and
Al(HQS).sub.3.sup.3+ can be synthesized and attached to nucleic
acid sequences using similar methods. The Ru(bpy).sub.3.sup.2+
electrochemiluminescent reporter group can be synthetically
incorporated into nucleic acid sequences using commercially
available ru-phosphoramidite (IGEN International, Inc.,
Gaithersburg, Md.).
[0079] Additionally other polyaromatic compounds and chelates of
ruthenium, osmium, platinum, palladium, and other transition metals
have shown electrochemiluminescent properties. Detailed
descriptions of ECL and electrochemiluminescent moieties can be
found in, among other places, A. Bard and L. Faulkner,
Electrochemical Methods, John Wiley & Sons (2001); M. Collinson
and M. Wightman, Anal. Chem. 65:2576 (1993); D. Brunce and M.
Richter, Anal. Chem. 74:3157 (2002); A. Knight, Trends in Anal.
Chem. 18:47 (1999); B. Muegge et al., Anal. Chem. 75:1102 (2003);
H. Abrunda et al., J. Amer. Chem. Soc. 104:2641 (1982); K. Maness
et al., J. Amer. Chem. Soc. 118:10609 (1996); M. Collinson and R.
Wightman, Science 268:1883 et seq. (1995); and U.S. Pat. No.
6,479,233.
[0080] The term "reporter probe" refers to a biomolecule, typically
an oligonucleotide, that binds to or anneals with at least one
(mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof, and is used to determine the
degree of methylation of at least one target nucleotide. Most
reporter probes can be categorized based on their mode of action,
for example but not limited to: nuclease probes, including without
limitation TaqMan.RTM. probes and the like (see, e.g., Livak,
Genetic Analysis: Biomolecular Engineering 14:143-149 (1999); Yeung
et al., BioTechniques 36:266-75 (2004)); extension probes such as
scorpion primers, LuX.TM. primers, Amplifluors, and the like;
hybridization probes such as molecular beacons, Eclipse probes, and
the like; or combinations thereof. Quantitative PCR methods,
particularly real-time PCR methods, typically comprise at least one
reporter probe, for example but not limited to, at least one
nuclease probe, at least one hybridization probe, at least one
extension probe, at least one probe comprising at least one amide
bond, at least one probe comprising at least one PNA, at least one
probe comprising at least one LNA, at least one nucleic acid dye,
or combinations thereof, including stem-loop and stem-less reporter
probes.
[0081] In certain embodiments, at least one reporter probe
comprises at least one reporter group, at least one quenching
agent, at least one affinity tag, at least one hybridization tag,
at least one hybridization tag complement, or combinations thereof.
In certain embodiments, at least one hybridization tag complement
anneals with at least one hybridization tag, at least one member of
a multi-component reporter group binds to at least one reporter
probe, or combinations thereof. Exemplary reporter probes include
TaqMan.RTM. probes; Scorpion probes (also referred to as scorpion
primers); LuX.TM. primers; FRET primers; Eclipse probes; molecular
beacons, including but not limited to conventional FRET-based
molecular beacons, multicolor molecular beacons, aptamer beacons,
PNA beacons, antibody beacons, and probes comprising metallic
nanoparticles and similar hybrid probes (see, e.g., Dubertret et
al., Nature Biotech. 19:365-70, 2001). In certain embodiments, such
reporter probes further comprise groove binders, including but not
limited to minor groove binders, such as but not limited to
TaqMan.RTM.MGB probes (Applied Biosystems). In certain embodiments,
reporter probes further comprise spanning or bridging
oligonucleotides, and enhancer probes, for example but not limited
to LNA-enhancer probes (see, e.g., Jacobsen et al., Nucl. Acid
Res., 30(19):e100, 2002).
[0082] A "substituted hydrocarbon", as that term is used herein,
comprises a hydrocarbon where at least one of the hydrogen atoms in
the hydrocarbon assembly is replaced by: a hydrocarbon; a
heterocyclic hydrocarbon; a substituted heterocyclic hydrocarbon;
halogen; azide, cyanide, isocyanide, isocyanate, isothiocyanate,
--OSO3-, --OSO3R, --SO3-, --SO3R, --OC(O)R, --OC(O)OR, --OR,
--CO2R, --C(O)NR2, --NR2, --NRC(O)R, --N(C(O)R)2, --SR,
--OP(O)(OR)2, --OP(O)(OR)R, --OP(O)R2, --P(O)(OR)2, --P(O)(OR)R,
--P(O)R2, where R comprises hydrogen, hydrocarbon, heterocyclic
hydrocarbon, substituted heterocyclic hydrocarbon, or substituted
hydrocarbon. A hydrocarbon comprises an assembly of at least one
carbon atoms where any carbon valences not used for forming one or
more bonds with another carbon atom are used for bonding with
hydrogen atoms. A hydrocarbon assembly comprises: a linear chain of
carbon atoms where each of the carbon atoms is connected to a
neighboring carbon atom by a single, double, or triple bond; a
cyclic chain of carbon atoms where each of the carbon atoms is
connected to at least two other carbon atom by a single, double, or
in some unusual cases a triple bond; multiple cyclic chains of
carbon atoms as described above where at least two of the cyclic
chains share at least one common carbon-carbon single or multiple
bond to form a fused ring system; multiple cyclic chains of carbon
atoms as describe above where at least two cyclic chains are
connected together by at least one carbon-carbon single or double
bond, but where two bound cyclic chains do not share a common
carbon-carbon single or double bond.
[0083] The term "target nucleic acid sequence" or "target" as used
herein refers to a specific nucleic acid oligomer, typically
genomic DNA, that contains one or more target nucleotides. A target
nucleotide is that nucleotide in the target nucleic acid sequence
that is interrogated by one or more probes of one or more probe
sets to determine its methylation state. Generally, a target
nucleotide is a cytosine or a 5-methylcytosine in a CpG motif, but
not always. While the target nucleic acid sequence is generally
described as a single-stranded molecule, it is to be understood
that double-stranded molecules that contain one or more target
nucleotides are also considered target nucleic acid sequences.
Target nucleic acid sequences can include both naturally-occurring
and synthetic sequences. The term "template", when used in
reference to interrogating at least one target nucleotide,
typically refers to a synthetic target nucleic acid sequence.
[0084] A target nucleic acid sequence according to the present
teachings may be derived from any living, or once living, organism,
including but not limited to, prokaryotes, archaea, viruses, and
eukaryotes. The target nucleic acid may originate from the nucleus,
typically genomic DNA, or may be extranuclear, e.g., plasmid,
mitochondrial, viral, etc. The skilled artisan appreciates that
genomic DNA includes not only full length material, but also
fragments generated by any number of means, for example but not
limited to, enzyme digestion, sonication, shear force, and the
like. In certain embodiments, the target nucleic acid sequence may
be replicated in vitro provided that it retains its methylation
state, for example without limitation, amplification in the
presence of S-adenyosyl methionine and an appropriate methylase,
such as CpG Methylase (M.Sss I) or Human DNA (cytosine-5)
Methyltransferase (Dnmt1), commercially available with appropriate
reagents from New England Biolabs.
[0085] A wide variety of nucleic acid isolation techniques are well
known in the art and are useful in generating target nucleic acid
sequences for use in the teachings herein. Detailed descriptions of
such techniques can be found in, among other places, Ausbel et al.;
Rapley; Sambrook et al.; see also, ABI PRISM.TM. 6100 Nucleic Acid
PrepStation and ABI PRISM.TM. 6700 Automated Nucleic Acid
Workstation (Applied Biosystems, Foster); BloodPrep.TM. Chemistry
and NucPrep.TM. Chemistry kits (Applied Biosystems).
II. TECHNIQUES
[0086] A. Ligation
[0087] Ligation according to the present teachings comprises any
enzymatic or non-enzymatic means wherein an inter-nucleotide
linkage is formed between the opposing ends of nucleic acid probes
that are adjacently hybridized on a target nucleic acid sequence
(i.e., generating a (mis)ligation product). Typically, the opposing
ends of the annealed nucleic acid probes are suitable for ligation
(suitability for ligation is a function of the ligation means
employed). In certain embodiments, ligation also comprises at least
one gap-filling procedure, wherein the ends of the two probes are
not adjacently hybridized initially but the 3'-end of the upstream
probe is extended by one or more nucleotide until it is adjacent to
the 5'-end of the downstream probe, typically by a polymerase (see,
e.g., U.S. Pat. No. 6,004,826). The internucleotide linkage can
include, but is not limited to, phosphodiester bond formation. Such
bond formation can include, without limitation, those created
enzymatically by at least one DNA ligase or at least one RNA
ligase, for example but not limited to, T4 DNA ligase, T4 RNA
ligase, Thermus thermophilus (Tth) ligase, Thermus aquaticus (Taq)
DNA ligase, Thermus scotoductus (Tsc) ligase, TS2126 (a
thermophilic phage that infects Tsc) RNA ligase, Archaeoglobus
flugidus (Afu) ligase, Pyrococcus furiosus (Pfu) ligase,
Thermococcus kodakaraensis KOD1 ligase (lig.sub.Tk), Rhodothermus
marinus (Rm) ligase, Methanobacterium thermoautotrophicum (Mth)
ligase, Aquifex aeolicus (Aae) ligase, Aeropyrum pemix K1 (Ape)
ligase, or the like, including but not limited to, reversibly
inactivated ligases (see, e.g., U.S. Pat. No. 5,773,258), and
enzymatically active mutants or variants thereof.
[0088] Other internucleotide linkages include, without limitation,
covalent bond formation between appropriate reactive groups such as
between an .alpha.-haloacyl group and a phosphothioate group to
form a thiophosphorylacetylamino group, a phosphorothioate a
tosylate or iodide group to form a 5'-phosphorothioester, and
pyrophosphate linkages.
[0089] Chemical ligation can, under appropriate conditions, occur
spontaneously such as by autoligation. Alternatively, "activating"
or reducing agents can be used. Examples of activating and reducing
agents include, without limitation, carbodiimide, cyanogen bromide
(BrCN), imidazole, 1-methylimidazole/carbodiimide/cystamine,
N-cyanoimidazole, dithiothreitol (DTT) and ultraviolet light, such
as used for photoligation.
[0090] Ligation generally comprises at least one cycle of ligation,
i.e., the sequential procedures of: hybridizing the target-specific
portions of a first probe and a corresponding second probe to their
respective complementary regions on the corresponding target
nucleic acid sequences; ligating the 3' end of the upstream probe
with the 5' end of the downstream probe to form a ligation product;
and denaturing the nucleic acid duplex to release the ligation
product from the ligation product:target nucleic acid sequence
duplex. The ligation cycle may or may not be repeated, for example,
without limitation, by thermocycling the ligation reaction to
amplify the ligation product using ligation probes (as distinct
from using primers and polymerase to generate amplified ligation
products). In certain embodiments, ligating or generating a
(mis)ligation product comprises a multiplicity of cycles of
ligation.
[0091] Also within the scope of the current teachings are ligation
means such as gap-filling ligation, including, without limitation,
gap-filling OLA and LCR, bridging oligonucleotide ligation, and
correction ligation. Descriptions of these techniques can be found
in, among other places, U.S. Pat. Nos. 5,185,243 and 6,004,826;
published European Patent Applications EP 320308 and EP 439182; and
PCT Publication Nos. WO 90/01069 and WO 01/57268.
[0092] A "ligation agent", according to the present invention, can
comprise any number of enzymatic or non-enzymatic reagents. For
example, ligase is an enzymatic ligation reagent that, under
appropriate conditions, forms phosphodiester bonds between the
3'-OH and the 5'-phosphate of adjacent nucleotides in DNA
molecules, RNA molecules, or hybrids (depending on the ligase).
Temperature sensitive ligases, include, but are not limited to,
bacteriophage T4 ligase and E. coli ligase. Thermostable ligases
include, but are not limited to, Afu ligase, Taq ligase, Tfl
ligase, Mth ligase, Tth ligase, Tth HB8 ligase, Thermus species
AK16D ligase, Ape ligase, Lig.sub.Tk ligase Aae ligase, Rm ligase,
and Pfu ligase (see, e.g., Housby et al., Nucl. Acids Res. 28:e10,
2000; Tong et al., Nucl. Acids Res. 28:1447-54, 2000; Nakatani et
al., Eur, J. Biochem. 269:650-56, 2002; Zirvi et al., Nucl. Acids
Res. 27:e40, 1999; Sriskanda et al., Nucl. Acids Res. 11:2221-28,
2000; and co-filed U.S. Provisional Patent Application Ser. No.
60/567,120, filed Apr. 30, 2004, entitled "Compositions, Methods,
and Kits for (Mis)ligating Oligonucleotides, by Karger et al.). The
skilled artisan will appreciate that any number of thermostable
ligases, including DNA ligases and RNA ligases, can be obtained
from thermophilic or hyperthermophilic organisms, for example,
certain species of eubacteria and archaea, including viruses that
infect such thermophilic or hyperthermophilic organisms; and that
such ligases can be employed in the disclosed methods and kits.
[0093] Chemical ligation agents include, without limitation,
activating, condensing, and reducing agents, such as carbodiimide,
cyanogen bromide (BrCN), N-cyanoimidazole, imidazole,
1-methylimidazole/carbodiimide/cystamine, dithiothreitol (DTT) and
ultraviolet light. Autoligation, i.e., spontaneous ligation in the
absence of a ligating agent, is also within the scope of the
teachings herein. Detailed protocols for chemical ligation methods
and descriptions of appropriate reactive groups can be found in,
among other places, Xu et al., Nucl. Acids Res., 27:875-81 (1999);
Gryaznov and Letsinger, Nucl. Acids Res. 21:1403-08 (1993);
Gryaznov et al., Nucleic Acid Res. 22:2366-69 (1994); Kanaya and
Yanagawa, Biochemistry 25:7423-30 (1986); Luebke and Dervan, Nucl.
Acids Res. 20:3005-09 (1992); Sievers and von Kiedrowski, Nature
369:221-24 (1994); Liu and Taylor, Nucl. Acids Res. 26:3300-04
(1999); Wang and Kool, Nucl. Acids Res. 22:2326-33 (1994); Purmal
et al., Nucl. Acids Res. 20:3713-19 (1992); Ashley and Kushlan,
Biochemistry 30:2927-33 (1991); Chu and Orgel, Nucl. Acids Res.
16:3671-91 (1988); Sokolova et al., FEBS Letters 232:153-55 (1988);
Naylor and Gilham, Biochemistry 5:2722-28 (1966); James and
Ellington, Chem. & Biol. 4:595-605 (1997); and U.S. Pat. No.
5,476,930.
[0094] Photoligation using light of an appropriate wavelength as a
ligation agent is also within the scope of the teachings. In
certain embodiments, photoligation comprises probes comprising
nucleotide analogs, including but not limited to, 4-thiothymidine
(s.sup.4T), 5-vinyluracil and its derivatives, or combinations
thereof. In certain embodiments, the ligation agent comprises: (a)
light in the UV-A range (about 320 nm to about 400 nm), the UV-B
range (about 290 nm to about 320 nm), or combinations thereof, (b)
light with a wavelength between about 300 nm and about 375 nm, (c)
light with a wavelength of about 360 nm to about 370 nm; (d) light
with a wavelength of about 364 nm to about 368 nm, or (e) light
with a wavelength of about 366 nm. In certain embodiments,
photoligation is reversible. Descriptions of photoligation can be
found in, among other places, Fujimoto et al., Nucl. Acid Symp.
Ser. 42:39-40 (1999); Fujimoto et al., Nucl. Acid Res. Suppl.
1:185-86 (2001); Fujimoto et al., Nucl. Acid Suppl., 2:155-56
(2002); Liu and Taylor, Nucl. Acid Res. 26:3300-04 (1998) and on
the world wide web at: sbchem.kyoto-u.ac.jp/saito-lab.
[0095] When used in the context of the present teachings, "suitable
for ligation" refers to at least one first probe and at least one
corresponding second probe, wherein each probe comprises an
appropriately reactive group based on the ligation means employed.
Exemplary reactive groups include, but are not limited to, a free
hydroxyl group on the 3' end of the upstream probe and a free
phosphate group on the 5' end of the downstream probe,
phosphorothioate and tosylate or iodide, esters and hydrazide,
RC(O)S.sup.-, haloalkyl, RCH.sub.2S and .alpha.-haloacyl,
thiophosphoryl and bromoacetoamido groups, and
S-pivaloyloxymethyl-4-thiothymidine.
[0096] B. Amplification
[0097] Amplification according to the present invention encompasses
any means by which at least a part of at least one (mis)ligation
product, at least one (mis)ligation product surrogate, or
combinations thereof, is reproduced, typically in a
template-dependent manner, including without limitation, a broad
range of techniques for amplifying nucleic acid sequences, either
linearly or exponentially (i.e., generating an amplified
(mis)ligation product or generating an amplified digested
(mis)ligation product). Exemplary means for performing an
amplifying step include ligase chain reaction (LCR), PCR, primer
extension, strand displacement amplification (SDA), multiple
displacement amplification (MDA), nucleic acid strand-based
amplification (NASBA), rolling circle amplification (RCA),
transcription-mediated amplification (TMA), and the like, including
multiplex versions or combinations thereof, for example but not
limited to, OLA/PCR, PCR/OLA, LDR/PCR, PCR/LDR, LCR/PCR, PCR/LCR
(also known as combined chain reaction or "CCR"), and the like.
Descriptions of such techniques can be found in, among other
places, Sambrook and Russell; Sambrook et al.; Ausbel et al.; PCR
Primer: A Laboratory Manual, Diffenbach, Ed., Cold Spring Harbor
Press (1995); The Electronic Protocol Book, Chang Bioscience
(2002); Msuih et al., J. Clin. Micro. 34:501-07 (1996); Rapley;
U.S. Pat. No. 6,027,998; PCT Publication Nos. WO 97/31256 and WO
01/92579; Ehrlich et al., Science 252:1643-50 (1991); Innis et al.,
PCR Protocols: A Guide to Methods and Applications, Academic Press
(1990); Favis et al., Nature Biotechnology 18:561-64 (2000); and
Rabenau et al., Infection 28:97-102 (2000); Belgrader, Barany, and
Lubin, Development of a Multiplex Ligation Detection Reaction DNA
Typing Assay, Sixth International Symposium on Human
Identification, 1995 (available on the world wide web at:
promega.com/geneticidproc/ussymp6proc/blegrad.html); LCR Kit
Instruction Manual, Cat. #200520, Rev. #050002, Stratagene, 2002;
Barany, Proc. Natl. Acad. Sci. USA 88:188-93 (1991); Bi and
Sambrook, Nucl. Acids Res. 25:2924-2951 (1997); Zirvi et al., Nucl.
Acid Res. 27:e40i-viii (1999); Dean et al., Proc Natl Acad Sci USA
99:5261-66 (2002); Barany and Gelfand, Gene 109:1-11 (1991); Walker
et al., Nucl. Acid Res. 20:1691-96 (1992); Polstra et al., BMC Inf.
Dis. 2:18-(2002); and Schweitzer and Kingsmore, Curr. Opin.
Biotechnol. 12:21-7 (2001).
[0098] In certain embodiments, amplification comprises at least one
cycle of the sequential steps of: hybridizing at least one primer
with complementary or substantially complementary sequences in at
least one (mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof; synthesizing at least one
strand of nucleotides in a template-dependent manner using a
polymerase; and denaturing the newly-formed nucleic acid duplex to
separate the strands. The cycle may or may not be repeated.
Amplification can comprise thermocycling or can be performed
isothermally. In certain embodiments, newly-formed nucleic acid
duplexes are not initially denatured, but are used in their
double-stranded form in one or more subsequent steps and either or
both strands can, but need not, serve as (mis)ligation product
surrogates. In certain embodiments, single-stranded amplicons are
generated and can, but need not, serve as (mis)ligation product
surrogates.
[0099] Primer extension is an amplifying technique that comprises
elongating at least one probe or at least one primer that is
annealed to a template in the 5'=>3' direction using an
amplifying means such as a polymerase. According to certain
embodiments, with appropriate buffers, salts, pH, temperature, and
nucleotide triphosphates, including analogs thereof, i.e., under
appropriate conditions, a polymerase incorporates nucleotides
complementary to the template strand starting at the 3'-end of an
annealed probe or primer, to generate a complementary strand. In
certain embodiments, primer extension can be used to fill a gap
between two probes of a probe set that are hybridized to target
sequences of at least one target nucleic acid sequence so that the
two probes can be ligated together. In certain embodiments, the
polymerase used for primer extension lacks or substantially lacks
5'-exonuclease activity.
[0100] The term "quantitative PCR", or "Q-PCR" refers to a variety
of methods used to quantify the results of the polymerase chain
reaction for specific nucleic acid sequences. Such methods
typically are categorized as kinetics-based systems, that generally
determine or compare the amplification factor, such as determining
the threshold cycle (C.sub.t), or as co-amplification methods, that
generally compare the amount of product generated from simultaneous
amplification of target and standard templates. Many Q-PCR
techniques comprise reporter probes, intercalating dyes, or both.
For example but not limited to TaqMan.RTM. probes (Applied
Biosystems), i-probes, molecular beacons, Eclipse probes, scorpion
primers, LuX.TM. primers, FRET primers, ethidium bromide, SYBR.RTM.
Green I (Molecular Probes), and PicoGreen.RTM. (Molecular
Probes).
[0101] C. Separation
[0102] Separating comprises any process that removes at least some
unreacted components, at least some reagents, or both some
unreacted components and some reagents from at least one
(mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof. In certain embodiments, at
least one (mis)ligation product, at least one amplified
(mis)ligation product, at least one digested (mis)ligation product,
at least one digested amplified (mis)ligation product, or
combinations thereof, are separated from unreacted components and
reagents, including but not limited to unreacted molecular species
present in the sample, ligation reagents, amplification reagents,
for example, but not limited to, unbound/unhybridized ligation
probes, primers, enzymes, co-factors, unbound sample components,
nucleotides, and the like. The skilled artisan will appreciate that
a number of well-known separation means can be used in the methods
disclosed herein.
[0103] Exemplary means/techniques for performing a separation step
include gel electrophoresis, including but not limited to
isoelectric focusing and capillary electrophoresis;
dielectrophoresis; sorting, including but not limited to
fluorescence-activated sorting techniques; chromatography,
including but not limited to HPLC, FPLC, size exclusion (gel
filtration) chromatography, affinity chromatography, ion exchange
chromatography, hydrophobic interaction chromatography,
immunoaffinity chromatography, and reverse phase chromatography;
affinity tag binding, such as biotin-avidin, biotin-streptavidin,
maltose-maltose binding protein (MBP), and calcium-calcium binding
peptide; aptamer-target binding; hybridization tag-hybridization
tag complement annealing; and the like. In certain embodiments, at
least one (mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof are bound to one or more
substrates and separated from unbound components. Detailed
discussion of separation techniques can be found in, among other
places, Rapley; Sambrook et al.; Sambrook and Russell; Ausbel et
al.; Molecular Probes Handbook; Pierce Applications Handbook;
Capillary Electrophoresis: Theory and Practice, P. Grossman and J.
Colburn, eds., Academic Press (1992); PCT Publication No. WO
01/92579; and M. Ladisch, Bioseparations Engineering: Principles,
Practice, and Economics, John Wiley & Sons (2001).
[0104] In certain embodiments, at least one separating step
comprises at least one mobility-dependent analytical technique, for
example but not limited to capillary electrophoresis. In certain
embodiments, at least one separating step comprises at least one
substrate, for example but not limited to binding at least one
biotinylated nucleic acid molecule to at least one
streptavidin-coated substrate. Suitable substrates include but are
not limited to microarrays, appropriately treated or coated
reaction vessels and surfaces, beads, for example but not limited
to magnetic beads, latex beads, metallic beads, polymer beads,
microbeads, and the like (see, e.g., Tong et al., Nat. Biotech.
19:756-59 (2001); Gerry et al., J. Mol. Biol. 292:251-62 (1999);
Srisawat et al., Nucl. Acids Res. 29:e4 (2001); Han et al., Nat.
Biotech. 19:631-35, 2001; and Stears et al., Nat. Med. 9:140-45,
including supplements, 2003). Those in the art will appreciate that
the shape and composition of the substrate is generally not
limiting. In certain embodiments, a plurality of (mis)ligation
products, (mis)ligation product surrogates, or combinations thereof
are resolved via a mobility-dependent analytical technique.
[0105] In certain embodiments, at least one (mis)ligation product,
at least one (mis)ligation product surrogate, or combinations
thereof are resolved (separated) by liquid chromatography.
Exemplary stationary phase chromatography media for use in the
teachings herein include reversed-phase media (e.g., C-18 or C-8
solid phases), ion-exchange media (particularly anion-exchange
media), and hydrophobic interaction media. In certain embodiments,
at least one (mis)ligation product, at least one (mis)ligation
product surrogate, or combinations thereof can be separated by
micellar electrokinetic capillary chromatography (MECC).
[0106] Reversed-phase chromatography is carried out using an
isocratic, or more typically, a linear, curved, or stepped solvent
gradient, wherein the level of a nonpolar solvent such as
acetonitrile or isopropanol in aqueous solvent is increased during
a chromatographic run, causing analytes to elute sequentially
according to affinity of each analyte for the solid phase. For
separating polynucleotides, including (mis)ligation products and at
least some (mis)ligation product surrogates, an ion-pairing agent
(e.g., a tetra-alkylammonium) is typically included in the solvent
to mask the charge of phosphate.
[0107] The mobility of (mis)ligation products and at least some
(mis)ligation product surrogates can be varied by using mobility
modifiers comprising polymer chains that alter the affinity of the
probe for the solid, or stationary phase. Thus, with reversed phase
chromatography, an increased affinity of the (mis)ligation products
and at least some (mis)ligation product surrogates for the
stationary phase can be attained by adding a moderately hydrophobic
tail (e.g., PEO-containing polymers, short polypeptides, and the
like) to the mobility modifier. Longer tails impart greater
affinity for the solid phase, and thus require higher non-polar
solvent concentration for the (mis)ligation products and/or
(mis)ligation product surrogates to be eluted (and a longer elution
time).
[0108] In certain embodiments, at least one (mis)ligation product,
at least one (mis)ligation product surrogate, or combinations
thereof are resolved by electrophoresis in a sieving or non-sieving
matrix. In certain embodiments, the electrophoretic separation is
carried out in a capillary tube by capillary electrophoresis (see,
e.g., Capillary Electrophoresis: Theory and Practice, Grossman and
Colburn eds., Academic Press (1992)). Exemplary sieving matrices
for use in the disclosed teachings include covalently crosslinked
matrices, such as polyacrylamide covalently crosslinked with
bis-acrylamide; gel matrices formed with linear polymers (see,
e.g., U.S. Pat. No. 5,552,028); and gel-free sieving media (see,
e.g., U.S. Pat. No. 5,624,800; Hubert and Slater, Electrophoresis,
16: 2137-2142 (1995); Mayer et al., Analytical Chemistry, 66(10):
1777-1780 (1994)). The electrophoresis medium may contain a nucleic
acid denaturant, such as 7M formamide, for maintaining
polynucleotides in single stranded form. Suitable capillary
electrophoresis instrumentation are commercially available, e.g.,
the ABI PRISM.TM. Genetic Analyzer series (Applied Biosystems).
[0109] In certain embodiments, at least one hybridization tag
complement includes at least one hybridization enhancer, where, as
used herein, the term "hybridization enhancer" means moieties that
serve to enhance, stabilize, or otherwise positively influence
hybridization between two polynucleotides, e.g. intercalators (see,
e.g., U.S. Pat. No. 4,835,263), minor-groove binders (see, e.g.,
U.S. Pat. No. 5,801,155), and cross-linking functional groups. The
hybridization enhancer may be attached to any portion of a mobility
modifier, so long as it is attached to the mobility modifier is
such a way as to allow interaction with the hybridization
tag-hybridization tag complement duplex. In certain embodiments, at
least one hybridization enhancer comprises at least one
minor-groove binder, e.g., netropsin, distamycin, and the like.
[0110] The skilled artisan will appreciate that at least one
(mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof can also be separated based on
molecular weight and length or mobility by, for example, but
without limitation, gel filtration, mass spectroscopy, or HPLC, and
detected using appropriate methods. In certain embodiments, at
least one (mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof are separated using at least one
of the following forces: gravity, electrical, centrifugal,
hydraulic, pneumatic, or magnetism.
[0111] In certain embodiments, at least one affinity tag is used to
separate the element to which it is bound, e.g., at least one
(mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof, from at least one component of
a ligation reaction composition, a digestion reaction composition,
an amplified ligation reaction composition, or the like. In certain
embodiments, at least one affinity tag is used to bind at least one
(mis)ligation product, at least one (mis)ligation product
surrogate, or combinations thereof to at least one substrate, for
example but not limited to at least one biotinylated (mis)ligation
product, at least one biotinylated (mis)ligation product surrogate,
or combinations thereof, to at least one substrate comprising
streptavidin. In certain embodiments, at least one aptamer is used
to bind at least one (mis)ligation product, at least one
(mis)ligation product surrogate, or combinations thereof, to at
least one substrate (see, e.g., Srisawat and Engelke, RNA 7:632-641
(2001); Holeman et al., Fold Des. 3:423-31 (1998); Srisawat et al.,
Nucl. Acid Res. 29(2):e4, 2001).
[0112] In certain embodiments, at least one hybridization tag, at
least one hybridization tag complement, or at least one
hybridization tag and at least one hybridization tag complement, is
used to separate the element to which it is bound from at least one
component of a ligation reaction composition, a digestion reaction
composition, an amplified ligation reaction composition, or the
like. In certain embodiments, hybridization tags are used to attach
at least one (mis)ligation product, at least one (mis)ligation
product surrogate, or combinations thereof, to at least one
substrate. In certain embodiments, at least one (mis)ligation
product, at least one (mis)ligation product surrogate, or
combinations thereof, comprise the same hybridization tag. For
example but not limited to, separating a multiplicity of different
element:hybridization tag species using the same hybridization tag
complement, tethering a multiplicity of different
element:hybridization tag species to a substrate comprising the
same hybridization tag complement, or both.
[0113] D. Determining
[0114] Determining comprises any means by which the methylation
state of one or more target nucleotide is identified or inferred,
including but not limited to evaluating the degree of methylation
of one or more target nucleotides. In certain embodiments,
determining comprises detecting at least one (mis)ligation product,
at least one (mis)ligation product surrogate, or combinations
thereof. In certain embodiments, determining further comprises
quantifying the at least one detected (mis)ligation product, the at
least one detected (mis)ligation product surrogate, or combinations
thereof, for example but not limited to graphically displaying the
quantified at least one (mis)ligation product, at least one
(mis)ligation product surrogate, or combinations thereof on a
graph, monitor, electronic screen, magnetic media, scanner
print-out, or other two- or three-dimensional display. Typically
the peak height, the area under the peak, the signal intensity of
one or more detected reporter group on the (mis)ligation product or
(mis)ligation product surrogate, or other quantifiable parameter of
the (mis)ligation product or surrogate are measured and the amount
of (mis)ligation product that was produced in a particular ligation
assay is inferred. Generally, at least one quantified parameter for
at least one (mis)ligation product, at least one (mis)ligation
product surrogate, or combinations thereof, is compared to the same
parameter(s) from a second (mis)ligation product, a second
(mis)ligation product surrogate, or combinations thereof, for
example but not limited to, a competing (mis)ligation product, and
a ratio of the two (mis)ligation products is obtained.
[0115] By comparing the (mis)ligation product ratio obtained from
an unknown sample with control ratios or standard curves for the
same target nucleotide and using the same probes and assay
conditions, one can determine the methylation state of the target
nucleotide. For example, consider an illustrative competing
misligation assay with two possible (mis)ligation products, e.g.,
LP1 and LP2. Assume in this illustration that the LP1:LP2 ratio for
a particular unknown sample is 5:1 and the LP1:LP2 ratio obtained
using a control target nucleic acid sequence known to be fully
methylated was 5:1 and with a control target nucleic acid sequence
known to be non-methylated was 1:1. By comparing the (mis)ligation
product ratio obtained using the unknown sample with the two
control samples, one can determine that the target nucleotide in
the unknown sample was fully methylated. When the ligation product
ratio obtained using the unknown sample is between 5:1 and 1:1 in
this example, one can infer that the degree of target nucleotide
methylation has an intermediate value that depends on those two
control ratios. Using the standard curve for that probe set and
assay conditions, one can plot the experimentally determined
ligation product ratio on the curve and determine the corresponding
degree of methylation.
[0116] In certain embodiments, at least one determining step
comprises detecting and quantifying at least one (mis)ligation
product parameter using at least one instrument, i.e., using an
automated or semi-automated determining means that can, but need
not, comprise a computer algorithm. In certain embodiments, the
determining step is combined with or is a continuation of at least
one separating step, for example but not limited to a capillary
electrophoresis instrument comprising at least one fluorescent
scanner and at least one graphing, recording, or readout component;
a chromatography column coupled with an absorbance monitor or
fluorescence scanner and a graph recorder; or a microarray with a
data recording device such as a CCD camera. Exemplary means for
performing a determining step include the ABI PRISM.RTM. 3100
Genetic Analyzer, ABI PRISM.RTM. 3100-Avant Genetic Analyzer, ABI
PRISM.RTM. 3700 DNA Analyzer, ABI PRISM.RTM.) 3730 DNA Analyzer,
ABI PRISM.RTM. 3730xl DNA Analyzer (all from Applied Biosystems);
the ABI PRISM.RTM. 7300 Real-Time PCR System; and microarrays and
related software such as the ABI PRISM.RTM. 1700 (Applied
Biosystems) and other commercially available array systems
available from Affymetrix, Agilent, and Amersham Biosciences, among
others (see also Gerry et al., J. Mol. Biol. 292:251-62, 1999; De
Bellis et al., Minerva Biotec 14:247-52, 2002; and Stears et al.,
Nat. Med. 9:140-45, including supplements, 2003). Exemplary
software includes GeneMapper.TM. Software, GeneScan.RTM. Analysis
Software, and Genotyper.RTM. software (all from Applied
Biosystems).
[0117] The generation and use of standard curves is well known to
those in the art (see, e.g., Overholtzer et al., Proc. Natl. Acad.
Sci. 100:11547-52, 2003). Typically, a standard curve is generated
by plotting experimentally obtained results for a particular set of
reagents and under defined assay conditions on an X-Y graph or
other coordinate system and then generating a curve, generally
either manually or using one or more mathematical formula or
algorithm, for example but not limited to graphing and/or line
drawing software, linear regression analysis and similar
mathematical calculations, computer algorithms, or the like. Once a
standard curve have been generated for a given target nucleotide
and at least one corresponding probe set or at least an appropriate
subset of at least one corresponding probe set,
experimentally-determined results obtained from test (unknown)
samples using the same probes under the same assay conditions can
be evaluated using the standard curve and the degree of target
nucleotide methylation determined. The skilled artisan will
appreciate that a "curve" can actually be a straight or
substantially straight line or it can be curvilinear and assume a
wide range of shapes.
[0118] To generate a standard curve for determining the degree of
target nucleotide methylation, (mis)ligation assays are performed
under set ("standard") conditions using appropriate probes, but
with at least two target compositions comprising different known
amounts of methylated target nucleotide sequences. For example but
not limited to, a three sample assay where a first ligation
reaction composition comprises non-methylated target nucleic acid
sequences (0% target nucleic acid methylation), a second ligation
reaction composition comprises a 1:1 mixture of
methylated:non-methylated target nucleotide sequences (50% target
nucleotide methylation), and the third ligation reaction
composition comprises methylated target nucleic acid sequences
(100% target nucleotide methylation) and a three point standard
curve, using the ligation product ratios corresponding to 0, 50 and
100% target nucleic acid methylation, is generated; a four sample
assay where a first ligation reaction composition comprises
non-methylated target nucleic acid sequences (0% target nucleic
acid methylation), a second ligation reaction composition comprises
a 1:2 mixture of methylated:non-methylated target nucleotide
sequences (33.3% target nucleotide methylation), a third product
reaction composition comprises a 2:1 mixture of
methylated:non-methylated target nucleotide sequences (66.6% target
nucleotide methylation) and the fourth ligation reaction
composition comprises methylated target nucleic acid sequences
(100% target nucleotide methylation) a four point standard curve,
based on the ligation product ratios corresponding to 33.3, 50 and
100% target nucleic acid methylation, is generated; and so forth.
The skilled artisan appreciates that the accuracy of standard
curves generally increases as the number of data points used to
generate the curve increases and also as the number of replicate
assays are performed. The skilled artisan also appreciates that
controls and/or calibration standards can be included either with
unknowns or run in parallel.
[0119] According to the present teachings, at least one step for
interrogating at least one target nucleotide is performed using the
disclosed probes and probe sets; at least one step for generating
at least one (mis)ligation product is performed using the disclosed
ligation agents and ligation techniques; at least one step for
generating at least one amplified (mis)ligation product and/or
(mis)ligation product surrogate is performed using the disclosed
amplifying means and amplification techniques; at least one step
for generating at least one digested (mis)ligation product is
performed using the disclosed nucleases, restriction enzymes,
chemical digesting means, and digestion techniques; and at least
one step for determining the degree of methylation of at least one
target nucleotide is performed using at least one disclosed
detecting technique, at least one quantifying technique, at least
one disclosed separating technique, or combinations thereof.
[0120] Aspects of the present teachings may be further understood
in light of the following examples, which should not be construed
as limiting the scope of the teachings in any way.
III. Exemplary Embodiments
[0121] The present teachings are directed to methods, reagents, and
kits that are useful for determining the degree of target
nucleotide methylation. The skilled artisan will appreciate that
when analyzing genomic DNA there are typically multiple copies of
the same nucleic acid sequence in the sample being evaluated, each
containing the target nucleotide. The degree of methylation for
that target nucleotide is generally determined from the sum of at
least some of the (mis)ligation products obtained using at least
part of that population of target nucleic acid sequences.
[0122] In certain embodiments, for each target nucleotide to be
interrogated, there are at least two probe sets, a first probe set
and at least one second probe set. In certain embodiments, when the
upstream and downstream probes of the first probe set are
hybridized with the target nucleic acid sequence, the first probe
set ligation site includes the complement of the target nucleotide.
The ligation site for the second probe set(s) is a few nucleotides
upstream or downstream from the target nucleotide, as shown in FIG.
1. The first probe set and at least one second probe set compete
with one another to hybridize with the target nucleic acid sequence
and be ligated. The ligation rate of the first probe set compared
to the second probe set, i.e., the ligation rate ratios, can differ
depending on whether the target nucleotide is methylated.
[0123] In certain embodiments, the degree of target nucleotide
methylation is determined by comparing one or more quantified
parameters between two or more (mis)ligation products or their
surrogates, at least one quantified (mis)ligation product parameter
and one or more standard curve, or both. In certain embodiments, at
least one probe set comprises one or more nucleotides on or near
the 3'-end of the upstream probe, on or near the 5'-end of the
downstream probe, or both, that is not complementary to the
corresponding nucleotide(s) on the target nucleic acid sequence.
The corresponding nucleotide on the target nucleic acid sequence
can, but need not, be the target nucleotide. In certain
embodiments, the ligation site (in these embodiments, where the
misligation occurs), comprises the nucleotide opposing the target
nucleotide, as shown in FIG. 2. In certain embodiments, the
ligation site is upstream or downstream of the target nucleotide
and can (as shown in FIG. 3), but need not, comprise one or more
mismatched nucleotide. Those in the art will appreciate that the
terms upstream or 5' probe and downstream or 3' probe are used in
reference to their annealing position on the corresponding target
nucleic acid sequence in the 3'=>5' orientation.
[0124] In certain embodiments, at least one ligation rate, at least
one misligation rate, or combinations thereof are changed by the
presence of at least one Modification in at least one probe set. In
certain embodiments, at least one ligation rate, at least one
misligation rate, or combinations thereof are changed due to
changing the hybridization and or ligation reaction composition or
conditions, for example but not limited to, salt concentration,
temperature, changes in one or more cofactor (e.g., .alpha.-thio
ATP, .gamma.-thio ATP), addition of one or more denaturant, or the
like. In certain embodiments, changing the divalent cation, for
example without limitation, substituting a manganese or calcium
salt for a magnesium salt, changes at least one ligation rate, at
least one misligation rate, or combinations thereof (see, e.g.,
Tong et al., Nucl. Acids Res. 28:1447-54, 2000; Nakatani et al.,
Eur. J. Biochem. 269:650-56, 2002; Tong et al., Nucl. Acids Res.
27:788-94, 1999). In certain embodiments, changing at least one
ligation rate, at least one misligation rate, or combinations
thereof also changes at least one ligation rate ratio, at least one
misligation rate ratio, or combinations thereof.
Example 1
Ligation Assay
[0125] The degree of target nucleotide methylation was determined
using a methylated (comprising a 5-.sup.MeC) or non-methylated
synthetic model template: TTATTATGTGGGGCGGACCGCGTGCGCTTACTTAT (SEQ
ID NO:1). The underlined cytosine is the methylated/non-methylated
target nucleotide in this exemplary target nucleic acid sequence.
The probe sets used are shown in Table 1. The underlined nucleotide
in each probe set is designed to be the hybridization partner of
the target nucleotide. The upstream probes in each probe set
comprised the fluorescent reporter group FAM.RTM.. The 5'-end of
all of the downstream (3'-) probes in this and all other examples
described herein were phosphorylated to render them suitable for
ligation. Each assay in this example was performed with at least
two competing probe sets.
TABLE-US-00001 TABLE 1 Ligation Probe Sets Probe Set upstream probe
downstream probe 1 FAM-AGCGCACGCG GTCCGCCCCAC (SEQ ID NO:2) (SEQ ID
NO:3) probe 2 probe 3 2 FAM-AGCGCACGCGGT CCGCCCCACAT (SEQ ID NO:4)
(SEQ ID NO:5) probe 4 probe 5 3 FAM-AGCGCACGCGGTC CGCCCCACATA (SEQ
ID NO:6) (SEQ ID NO:7) probe 6 probe 7
[0126] In this exemplary embodiment, ligation reaction compositions
were formed by combining either the methylated or non-methylated
synthetic model template with 12.5 nM of each probe from two of the
probe sets shown in Table 1, less than 12.5 nM template, 2 or 4
units of Afu ligase, and ligase buffer (50 mM Tris-HCl (pH 7.5), 10
mM MgCl.sub.2, 10 mM dithiothreitol (DTT), 1 mM ATP, and 25
.mu.g/ml bovine serum albumin) in a final volume of 20 .mu.l. To
generate ligation products, the ligation reaction composition was
cycled at (65.degree. C. for 5 seconds and 45.degree. C. for 1
minute) for 50 cycles, heated to 99.degree. C. for 10 minutes, then
cooled to 4.degree. C.
[0127] Two .mu.L of the ligation product composition was combined
with 18 .mu.L Hi-Di formamide (Applied Biosystems) and the diluted
ligation products were separated and detected using capillary
electrophoresis in 36 cm capillaries with POP-6.TM. polymer on the
ABI PRISM.RTM. 3100 Genetic Analyzer in the gene scan mode using
GeneScan.RTM. Analysis Software according to the manufacturer's
instructions (Applied Biosystems). The software determines, among
other things, peak height and peak area (integrated area under the
peak). As shown in FIG. 4, the peak height for the ligation product
of probes 2 and 3 ("1") was two to three times higher with the
methylated template than with the non-methylated template,
indicating that the ligation rate for Probe Set 1 was enhanced when
the target nucleotide was methylated. The ligation rates for the
other two probe sets in this example were much less effected by the
methylation state of the target nucleotide. The ligation product
ratios for probe set 1:probe set 2 ("1"/"2") was 0.6 with the
synthetic model template comprising the non-methylated target
nucleotide and 1.22 with the synthetic template comprising the
methylated target nucleotide; and for probe set 1:probe set 3
("1"/"3"), 0.36 with the non-methylated template and 0.81 with the
methylated template (see FIG. 4).
[0128] The skilled artisan will appreciate that not every probe or
every probe set will satisfactory distinguish the methylated target
nucleotide from the non-methylated target nucleotide. The skilled
artisan understands, however, that appropriate probes and probe
sets can be obtained by routine evaluation of candidate probes and
probe sets, without undue experimentation. Additionally, when using
an NAD.sup.+-dependent ligase, those in the art will understand
that NAD+ is generally used as the co-factor in the ligation
buffer, rather than ATP. Typically, eubacterial ligases are
NAD.sup.+-dependent while eukaryotic, viral, and archaeal ligases
are ATP-dependent (see, e.g., Weller and Dohertry, FEBS Letters
505:340-342, 2002).
Example 2
Competing Misligation Assay
[0129] A probe set comprising a single base mismatch at the 3' end
of each of the upstream probes was prepared for interrogating the
target nucleotide in the methylated or non-methylated synthetic
template corresponding to a segment of the promoter of the P16
tumor suppressor gene: CCAGAGGGTGGGGCGGACCGAGTGCGCTCGGCGGCT (SEQ ID
NO:17), where the underlined "C" is either cytosine (non-methylated
template) or 5-methylcytosine (methylated template). This probe set
comprised three different upstream probes and one downstream probe,
shown in Table 2. Each of the upstream probes comprised the
fluorescent reporter group FAM and two of the upstream probes
comprised polyethylene oxide mobility modifiers, shown as (PEO) and
(PEO).sub.2.
TABLE-US-00002 TABLE 2 Probe Set 4 5' probes 3' probe
FAM-AGCGCACTCA (SEQ ID NO:8) probe 8 FAM(PEO)-AGCGCACTCC
GTCCGCCCCAC (SEQ ID NO:9) (SEQ ID NO:10) probe 9 probe 10
FAM-(PEO).sub.2-AGCGCACTCT (SEQ ID NO:11) probe 11
[0130] In each assay, two competing upstream probes and the
downstream probe were used. The ligation reaction composition was
generally as described in Example 1 except that 2 units of Afu
ligase, 12.5 nM template, and probes from Probe Set 4 were used for
interrogating the target nucleotide, in a reaction volume of 10
.mu.L. To generate ligation products, the ligation reaction
composition was heated to 90.degree. C. for 3 minutes, thermocycled
(90.degree. C. for 10 seconds, 45.degree. C. for 5 minutes) for 40
cycles, heated to 99.9.degree. C. for 20 minutes, then cooled to
4.degree. C. The ligation products were diluted in formamide,
separated, detected, and analyzed as described in Example 1. The
ligation product ratio for the ligation product of probes 8 and 10
compared to the ligation product of probes 9 and 10 (LP 8-10/LP
9-10) was 4.38 when the template comprising the non-methylated
target nucleotide was interrogated and 8.94 when the template
comprising the methylated target nucleotide was interrogated (see
FIG. 5A). The ligation product ratio for the ligation product of
probes 11 and 10 (LP 11-10) compared to LP 8-10 (LP 11-10/LP 8-10)
was 0.16 when the non-methylated template was used and 0.54 when
the template was methylated (see FIG. 5B). The ligation product
ratio for LP 11-10 compared to LP 9-10 was 0.83 when the
non-methylated template was used and 9.82 when the template
comprising the methylated target nucleotide was interrogated (see
FIG. 5C).
Example 3
Competing Misligation Assay
[0131] A probe set comprising a single base mismatch at the 3' end
of each of the upstream probes (shown underlined in Table 3) was
prepared for interrogating the methylated or unmethylated target
nucleotide (underlined) in a synthetic template derived from the
transcriptional regulator gene E2F2:
TCCGGGATGCACAGTGCAGAGGCGGCCAGAGCAGTGCACAGCG (SEQ ID NO:12). The
probe set comprised three different upstream probes and one
downstream probe. Each of the upstream probes comprised a
mismatched nucleotide on its 3' end (shown underlined) and the
fluorescent reporter group FAM and two of the upstream probes
comprised polyethylene oxide mobility modifiers, shown as (PEO) and
(PEO).sub.2 in Table 3.
TABLE-US-00003 TABLE 3 Probe Set 5 5' probes 3' probe
FAM-CACTGCTCTGGCCA (SEQ ID NO:13) probe 13 FAM-(PEO)-CACTGCTCTGGCCC
CCTCTGCACTGTGCAT (SEQ ID NO:14) (SEQ ID NO:16) probe 14 probe 16
FAM-(PEO).sub.2-CACTGCTCTGGCCT (SEQ ID NO:15) probe 15
[0132] In each assay there were at least two upstream probes
competing to be misligated to the downstream probe. The ligation
reaction composition, reaction conditions, separation, detection
and methylation analysis were generally as described in Example 2,
except that the reaction composition was cycled for forty cycles
between 90.degree. C. for ten seconds and 50.degree. C. for five
minutes.
[0133] When probes 13 and 14 were used with probe 16 in this
competition misligation assay, the ligation product ratio for the
ligation product of probes 13 and 16 compared to the ligation
product for probes 14 and 16 (LP 13-16/LP 14-16) was 4.28 using the
non-methylated template and 12.18 using the methylated template
(see FIG. 6A). When probes 13 and 15 were competed, the ligation
product ratio (LP 13-16/LP 15-16) was 1.33 using the non-methylated
template and 4.06 using the methylated template (see FIG. 6B). When
probes 14 and 15 were competed, the ligation product ratio (LP
14-16/LP 15-16) was 0.35 using the non-methylated template and 0.45
using the methylated template (see FIG. 6C).
Example 4
Competing Misligation Assay
[0134] A probe set comprising a single base mismatch at the 5' end
of each of the downstream probes was prepared for interrogating the
target nucleotide in the synthetic methylated or non-methylated
E2F2 template, SEQ ID NO:12. The probe set comprised one upstream
probe and three downstream probes. The upstream probe comprised the
fluorescent reporter group FAM.RTM. and the target nucleotide
complement (shown underlined), each of the downstream probes
comprised a mismatched nucleotide on the 5'-end and polyethylene
oxide mobility modifiers, shown as (PEO), (PEO).sub.2, and
(PEO).sub.3 in Table 4.
TABLE-US-00004 TABLE 4 Probe Set 6 5' probes 3' probe
ACTCTGCACTGTGCAT-(PEO) (SEQ ID NO:21) probe 21 FAM-CACTGCTCTGGCCG
GCTCTGCACTGTGCAT-(PEO).sub.2 (SEQ ID NO:22) (SEQ ID NO:23) probe 22
probe 23 TCTCTGCACTGTGCAT-(PEO).sub.3 (SEQ ID NO:24) probe 24
[0135] Three competition misligation assays (CMAs) were performed
in parallel. The first CMA (CMA 1) was performed as follows. A
ligation reaction composition comprising 12.5 nM upstream probe 22,
12.5 nM downstream probe 21, 12.5 nM downstream probe 23, 2 units
of Afu ligase, and either 0.25 nM methylated E2F2 synthetic
template or 0.25 nM non-methylated E2F2 synthetic template was
formed in the ligase buffer described in Example 1, in a final
volume of 10 .mu.L. This reaction composition was heated to
90.degree. C. for three minutes, then cycled between 90.degree. C.
for ten seconds and 50.degree. C. for five minutes, for sixty
cycles, heated to 99.9.degree. C. for twenty minutes, then cooled
to 4.degree. C. Two microliters of this cooled ligation product
composition were combined with 18 .mu.L Hi-Di formamide (Applied
Biosystems) and loaded onto an ABI PRISM.RTM. 3100 Genetic Analyzer
(Applied Biosystems). The remaining reaction conditions,
separation, detection and analysis were generally as described in
Example 2. As shown in the top panel of FIG. 7A, the peaks detected
for the two misligation products (LP 22-21 and LP 22-23) obtained
with the template comprising the non-methylated target nucleotide
are approximately equal, i.e., the misligation product peak ratio
is about 1:1. However, the parallel assay using templates
comprising methylated target nucleotides (lower panel) resulted in
a misligation product peak ratio of approximately 3:1 (LP 22-23:LP
22-21).
[0136] The second CMA was performed in parallel, as described for
CMA 1, except that the 12.5 nM downstream probe 24 was used in
place of 12.5 nM downstream probe 23 and the two possible
misligation products were LP 22-21 and 22-24. As shown in FIG. 7B,
the LP 22-24 peak was slightly higher than the LP 22-21 peak with
the non-methylated template (top panel). However, the misligation
product peak height ratio was approximately 4.5:1 (LP 22-24:LP
22-21) with the methylated template (bottom panel).
[0137] The third CMA (CMA 3) was performed using 107 copies of
either the methylated or unmethylated E2F2 synthetic template, 4
units of Afu ligase, upstream probe 22, downstream probes 21 and
24, and cycling conditions of 90.degree. C. for ten seconds, then
50.degree. C. for two and a half minutes for 120 cycles, heated at
99.9.degree. C. for 20 minutes, then cooled to 4.degree. C. All
other parameters were as described for CMA 1. As shown in FIG. 7C,
the misligation product 22-21 peak (LP 22-21) was several times
higher than the misligation product 22-24 peak (LP 22-24) with the
template comprising the non-methylated target nucleotide (top
panel). With the template comprising the methylated target
nucleotide, however, the height of the LP 22-21 peak was
essentially unchanged while the height of the LP 22-24 peak was
dramatically higher (bottom panel) and the ligation product peak
ratio was approximately 4:1 (LP 22-24:LP 22-21). Therefore, under
these conditions, each of the competitive misligation assays
described in this illustrative embodiment can be used to determine
whether the target nucleotide is methylated or not based on the
respective misligation product peak ratios. Further, the
methylation state of this exemplary target nucleotide can also be
determined by comparing the peak height for LP 22-23 or LP 22-24
using the methylated template with the corresponding peak height
obtained using the non-methylated template.
Example 5
Competitive Misligation Assay Using Modified Probes
[0138] A probe set comprising three downstream probes, each with a
single base mismatch at the 5' end (probes 21, 23, and 24), and a
Modified upstream probe (probe 22*) comprising a
2'-methoxy-cytosine Modification (shown as C* in Table 5) and a FAM
reporter group was synthesized for interrogating the target
nucleotide in the synthetic E2F2 template, SEQ ID NO:12. Probe 22
(shown in Table 4) and probe 22* (shown in Table 5) differ only by
the presence (probe 22*) or absence (probe 22) of the 2'-methoxy
Modification on the penultimate 3' cytosine residue. The ligation
products were separable in mobility dependent analysis techniques
based, at least in part, on the complexity of the polyethylene
oxide mobility modifiers on the respective ligation products, shown
in Table 5 as (PEO), (PEO).sub.2, and (PEO).sub.3 on the downstream
probes.
TABLE-US-00005 TABLE 5 Probe Set 7 5' probes 3' probe
ACTCTGCACTGTGCAT-(PEO) (SEQ ID NO:21) probe 21 FAM-CACTGCTCTGGCC*G
GCTCTGCACTGTGCAT-(PEO).sub.2 probe 22* (SEQ ID NO:23) probe 23
TCTCTGCACTGTGCAT-(PEO).sub.3 (SEQ ID NO:24) probe 24
Each assay included two competing downstream probes and the
upstream probe. The ligation reaction composition, reaction
conditions, separation, detection and analysis were generally as
described in Example 4.
[0139] When probes 21 and 23 were used with probe 22* in this
competition misligation assay, the ligation product ratio for the
ligation product of probes 22* and 23 compared to the ligation
product for probes 22* and 23 (LP 22*-23/LP 22*-21) was 1.13 using
the synthetic E2F2 template comprising the non-methylated target
nucleotide and 3.09 using the methylated template (see FIG. 8A).
When probes 21 and 24 were used with probe 22* in this competition
misligation assay, the ligation product ratio for the ligation
product of probes 22* and 24 compared to the ligation product for
probes 22* and 21 (LP 22*-24/LP 22*-21) was 2.69 using the
synthetic template comprising the non-methylated target nucleotide
and 7.9 using the methylated template (see FIG. 8B).
Example 6
Competing Misligation Assay with Amplification Using gDNA
[0140] To evaluate the competing misligation assay for
interrogating the same E2F2 target nucleotide in gDNA instead of a
synthetic oligonucleotide, non-methylated and methylated human gDNA
was obtained from public sources (Coriell Institute for Medical
Research, Camden, N.J. and Serologicals Corp. Nocross, Ga.,
respectively). Due to possible low copy number of a particular
target nucleic acid sequence in gDNA an amplification step was
included in this exemplary embodiment. A probe set comprising two
upstream probes and three downstream probes was synthesized, as
shown in Table 6. Each of the probes comprised either a "universal"
upstream primer-binding portion or a "universal" downstream
primer-binding portion (shown in brackets) and each the downstream
probes comprised a mismatched nucleotide on its 5' end. Probes 27
and 28 also included a mobility modifier comprising several
non-sequence related nucleotides (underlined) to enhance ligation
product separation. The target nucleotide complement was on the
3'-end of the upstream probe (underlined). A Modified version of
probe 25 (probe 25*) was synthesized with a 2-methoxy Modification
on the penultimate cytosine (shown as C*).
TABLE-US-00006 TABLE 6 Probe Set 8 5' probes 3' probe
[CTCGTAGACTGCGTACCGATC]CA ACTCTGCACTGTGCAT- CTGCTCTGGCCG
[TTACTCAGGACTCATCGTCGC] (SEQ ID NO:25) (SEQ ID NO:26) probe 25
probe 26 [CTCGTAGACTGCGTACCGATC]CA GCTCTGCACTGTGCATTTTT-
CTGCTCTGGCC*G [TTACTCAGGACTCATCGTCGC] probe 25* (SEQ ID NO:27)
probe 27 TCTCTGCACTGTGCATTTTT- [TTACTCAGGACTCATCGTCGC] (SEQ ID
NO:28) probe 28
Two sets of parallel ligation reaction compositions (four reaction
compositions) were prepared in a final volume of 10 .mu.L as
follows: 25 nanograms (ng) of either (i) methylated or (ii)
unmethylated gDNA target nucleic acid sequences; 12.5 nM probe 25;
12.5 nM of other either (iii) probe 26 or (iv) probe 27; and 2-4
units of Afu ligase, all in reaction buffer as described in Example
1. To generate misligation products, the ligation reaction
compositions were heated to 90.degree. C. for three minutes, cycled
one hundred twenty times between 90.degree. C. for ten seconds and
50.degree. C. for two and a half minutes, heated to 99.9.degree. C.
for twenty minutes, then cooled to 4.degree. C.
[0141] Amplification reaction compositions were formed by
separately combining each of these ligation product compositions
with 0.5 units of Taq Gold.TM. polymerase (Applied Biosystems) and
0.5 .mu.M of each of the universal amplification primers,
FAM-CTCGTAGACTGCGTACCGATC (SEQ ID NO:29; FAM: fluorescent reporter
group FAM.RTM., Applied Biosystems) and GCGACGATGAGTCCTGAGTAA (SEQ
ID NO:30). To generate amplified misligation products, the
amplification reaction compositions were then heated to 95.degree.
C. for ten minutes, and cycled between 94.degree. C. for ten
seconds and 68.degree. C. for one minute for 25-30 cycles, then
cooled to 4.degree. C. Two .mu.L of the amplified misligation
products were diluted with 18 .mu.L Hi-Di.TM. formamide. The
diluted amplified misligation products were loaded onto an ABI
PRISM.RTM. 3100 Genetic Analyzer and separated and analyzed, as
described in Example 1. By comparing the ratio of the amplified
misligation product (i.e., one form of misligation product
surrogate) peaks shown in FIGS. 9A and 9B (LPS 25-26, LPS 25-27,
and LPS 25-28), one can determine the methylation state of the
target nucleotide.
[0142] The ligation product ratio, based on the peak area of the
misligation product surrogate for the misligation product of probes
25 and 27 (LPS 25-27) compared to the misligation product of probes
25 and 26 (LPS 25-26) was 1.72 when the gDNA comprising the
non-methylated target nucleotide was interrogated and 4.37 when the
gDNA comprising the methylated target nucleotide was interrogated
(see FIG. 9A). The ligation product ratio, based on the peak area
of LPS 25-26 compared to that for the misligation product surrogate
for the ligation product of probes 25 and 28 (LPS 25-28) was 3.38
when the gDNA comprising the non-methylated target nucleotide was
interrogated and 7.24 when the gDNA comprising the methylated
target nucleotide was interrogated (see FIG. 9B).
[0143] To evaluate the use of Modified probes for methylation
determinations using gDNA target nucleic acid sequences, an
upstream probe comprising a Modification was prepared by adding a
2'-methoxy Modification to the penultimate nucleotide of probe 25
(see probe 25* in Table 7). The ligation reaction composition was
prepared as previously described in this example except that probe
25* was used in place of probe 25 and downstream probes 27 and 28
were competed against each other. All other aspects of the
misligation assay and amplification were the same.
[0144] As shown in FIG. 9C, Modified probe 25* also affected the
misligation rate, allowing the methylation status of the exemplary
target nucleotide to be determined. The ligation product ratio,
based on the area under the peak of the misligation product
surrogate for the misligation product of probes 25* and 28 (LPS
25*-28) compared to that of the misligation product surrogate for
the misligation product of probes 25* and 27 (LPS 25*-27) was 1.41
with the gDNA comprising the non-methylated target nucleotide and
2.24 with the gDNA comprising the methylated target nucleotide (see
FIG. 9C).
Example 7
Competing Misligation Assay with Amplification Using gDNA
[0145] A second competing misligation assay followed by digestion
and amplification was performed to determine the methylation status
of the same E2F2 target nucleotide in gDNA as in Example 6. Two
ligation reaction compositions were formed as described in Example
6 except that probes 31, 32, and 25 were combined in one ligation
reaction composition and probes 31, 33, and 25 were combined in the
other. As shown in Table 7, probes 31, 32, and 33 each comprise a
universal downstream primer-binding portion (shown in brackets),
one of two hybridization tags (shown in italics), and a mismatched
nucleotide at the 5'-end of the probe. Probes 25 and 25* contain a
universal upstream primer-binding portion (shown in brackets) and
the target nucleotide complement at the 3'-end (underlined).
TABLE-US-00007 TABLE 7 Probe Set 9 5' probe 3' probes
[CTCGTAGACTGCGTACCGATC] ACTGTGCACTGTGCAT- CACTGCTCTGGCCG
TCGCAGATTGTGTCTCACCGAGGA- probe 25 [TTACTCAGGACTCATCGTCGC] (SEQ ID
NO:31) probe 31 [CTCGTAGACTGCGTACCGATC] GCTCTGCACTGTGCAT-
CACTGCTCTGGCC*G CGATTCAAACTGAAGCGTGCCGACG- probe 25*
[TTACTCAGGACTCATCGTCGC] (SEQ ID NO:32) probe 32 TCTCTGCACTGTGCAT-
CGATTCAAACTGAAGCGTGCCCACG- [TTACTCAGGACTCATCGTCGC] (SEQ ID NO:33)
probe 33
[0146] The misligation products were generated as described in
Example 6, except downstream probes 31, 32, and 33 were used. Each
of these misligation product compositions were then digested with
exonuclease by combining five .mu.L of ligation reaction
composition with five .mu.L of exonuclease solution (0.2 .mu.L
.lamda. exonuclease (1 Unit; New England BioLabs), 0.5 .mu.L
10.times..lamda. exonuclease buffer (New England Biolabs), 4.3
.mu.L distilled water). To generate digested misligation products,
the two digestion compositions were heated to 37.degree. C. for
ninety minutes, then heated to 80.degree. C. for ten minutes. Each
of the digested misligation product compositions were diluted by
adding 15 .mu.L of distilled water.
[0147] Digested amplification reaction compositions were formed by
combining 2.08 .mu.L of the diluted digested misligation product
composition with 7.92 .mu.L PCR premix (0.5 Units AmpliTaq Gold.TM.
DNA Polymerase (Applied Biosystems), 50 nM Tris-HCl, pH 8.0 at
25.degree. C., 2.5 mM MgCl.sub.2, 0.01% sodium azide, 0.01% Tween
20, 8% glycerol (v/v), 0.1 mM deferoxamine mesylate, 0.2 mM dATP,
0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dUTP and 0.5 .mu.M each of
biotin-CTCGTAGACTGCGTACCGATC (SEQ ID NO:34) comprising a biotin
moiety at its 5'-end, and GCGACGATGAGTCCTGAGTAA (SEQ ID NO:35)). To
generate digested amplified misligation products, the digested
amplification reaction compositions were heated to 95.degree. C.
for ten minutes, then cycled between 94.degree. C. for ten seconds
and 68.degree. C. for one minute for 25-30 cycles to generate
double-stranded amplicons comprising one biotinylated strand (i.e.,
a form of misligation product surrogate).
[0148] The wells of a streptavidin plate (Roche Bioscience) were
washed three times with 25 .mu.L Wash Buffer ( 1/10 dilution of
1.times.SSC, 0.1% Tween 20). One part of the biotinylated amplicons
was diluted in seven parts hybridization buffer (1.times.SSC, 0.01%
Tween 20) to form a hybridization mix. Twenty .mu.L of this
hybridization mix was added to wells of the washed streptavidin
plate and incubated at room temperature on an orbital shaker. After
a 30 minute incubation, the liquid in each well was removed and the
wells were washed three times with 30 .mu.L Wash Buffer. Fifty
.mu.L of 0.1N NaOH was added to the wells and the plate was
incubated at room temperature on an orbital shaker. After five
minutes, the wells were emptied then washed five times with 50
.mu.L Wash Buffer.
[0149] ZipChute solution was prepared by combining 6.576 mL
7.3.times. ZipChute dilution buffer, 5.40 mL omnipure formamide,
and 0.024 mL of 250 nM ZipChute stock solution (Applied
Biosystems). Twenty-five .mu.L ZipChute solution was added to the
wells and the plate was incubated at 37.degree. C. After one hour,
the wells were emptied, washed four times with 25 .mu.L Wash
Buffer, then spin dried. Next, 17.5 .mu.L SNPlex loading reagent
(Applied Biosystems) was added to the individual wells and the
plate was incubated at 37.degree. C. to release the ZipChutes
(i.e., a form of (mis)ligation product surrogate) from the wells of
the plate into the loading reagent. After a thirty minute
incubation, ten .mu.L of the loading reagent comprising released
ZipChutes from individual wells of the streptavidin plates were
transferred to individual wells of a 384 well plate. These samples
were analyzed on an ABI PRISM.RTM. 3100 Genetic Analyzer,
essentially as described above.
[0150] As shown in FIG. 10A, the LPS 25-32:LPS 25-31 peak area
ratio was 0.95 with the non-methylated gDNA and 1.66 with
methylated gDNA. The LPS 25-33:LPS 25-31 peak area ratio was 2.31
with the non-methylated gDNA and 6.22 with methylated gDNA (see
FIG. 10B). The LPS 25*-33:LPS 25*-31 peak area ratio was 0.53 with
the non-methylated gDNA and 2.49 with methylated gDNA (see FIG.
10C).
Example 8
Competing Misligation Assay with Amplification Using gDNA
[0151] To evaluate the competing misligation assay with the P16
target nucleotide shown in SEQ ID NO:17 in the context of gDNA,
three parallel ligation reaction compositions were formed as
described in Example 7 except that probes 36, 37 and 38 were
combined in a first ligation reaction composition, probes 36, 37,
and 40 were combined in a second ligation reaction composition, and
probes 37, 39, and 40 were combined in a third ligation reaction
composition. As shown in Table 8, probes 36, 38, 39, and 40 each
comprise a universal upstream primer-binding portion (shown in
brackets), one of two hybridization tags (shown in italics), and a
mismatched nucleotide at the 3'-end of the probe. Probe 37 contains
a universal downstream primer-binding portion (shown in brackets)
and the target nucleotide complement at its 5'-end
(underlined).
TABLE-US-00008 TABLE 8 Probe Set 10 5' probes 3' probe
[CTCGTAGACTGCGTACCGATC] GTCCGCCCCAC[TTACT TCCTCGGTGAGACACAATCTGCG
CAGGACTCATCGTCGC] AAGCGCACTCA (SEQ ID NO:37) (SEQ ID NO:36) probe
37 [CTCGTAGACTGCGTACCGATC] CGTCGGCACGCTTCAGTTTGAAT CGAGCGCACTCC
(SEQ ID NO:38) probe 38 [CTCGTAGACTGCGTACCGATC]
TCCTCGGTGAGACACAATCTGCG AAGCGCACTCC (SEQ ID NO:39) probe 39
[CTCGTAGACTGCGTACCGATC] CGTCGGCACGCTTCAGTTTGAAT CGAGCGCACTCT (SEQ
ID NO:20) probe 40
The remainder of the misligation assay, digestion, amplification,
separation, detection and determination were performed as described
in Example 6, except that the primers used were
biotin-GCGACGATGAGTCCTGAGTAA (SEQ ID NO:18) and
CTCGTAGACTGCGTACCGATC (SEQ ID NO:19). As shown in FIG. 11A, the
digested amplified misligation product (i.e., a form of misligation
product surrogate) peak height ratios obtained from the first
ligation product reaction composition (LPS 36-37:LPS 38-37) shows
little to no change between the methylated and non-methylated
target. As shown in FIG. 11B, the ligation product surrogate peak
height ratio obtained from the second ligation reaction composition
for the non-methylated template is approximately 3:4 (LPS 36-37:LPS
40-37), but shifts to 4:2 (LPS 36-37:LPS 40-37) with the methylated
gDNA. The misligation product surrogate peak height ratios for the
third ligation reaction composition also varied between the
non-methylated and methylated gDNA, as shown in FIG. 11C. With the
non-methylated gDNA (upper panel), the ligation product surrogate
peak height ratio was approximately 1:3 (LPS 39-37:LPS 40-37),
while it was approximately 3:2 (LPS 39-37:LPS 40-37) with the
methylated gDNA (lower panel). Thus, under these conditions, the
competing probes used in the second and third of these misligation
assays are useful in determining the methylation of the
illustrative P16 target nucleotide in gDNA while those used in the
first reaction composition of this example were less effective. As
the person in the art appreciates, identification of useful probes
and probe sets can be determined through routine evaluation using
the disclosed teachings and without undue experimentation.
Example 9
Generating a Standard Curve
[0152] One way to determine the degree of target nucleotide
methylation is to compare the experimental results obtained
according to the present teachings with a corresponding standard
curve. A standard curve can be generated by combining at least one
upstream probe and at least one corresponding downstream probe from
a probe set with a target comprising a pre-determined mixture of
methylated and non-methylated target nucleic acid sequences. For
example, for each of the ligation reaction compositions of Example
8, six parallel compositions are prepared with the gDNA target
comprising: (i) 25 ng methylated gDNA, (ii) 20 ng methylated gDNA
and 5 ng non-methylated gDNA, (iii) 15 ng methylated gDNA and 10 ng
non-methylated gDNA, (iv) 10 ng methylated gDNA and 15 ng
non-methylated gDNA, (v) 5 ng methylated gDNA and 20 ng
non-methylated gDNA, or (vi) 25 ng non-methylated gDNA,
respectively. The remainder of the reaction conditions and
techniques are as described in Example 8.
[0153] For each of the possible (mis)ligation products in each set
of ligation reaction compositions, e.g., LP 36-37 and LP 38-37,
there are six (mis)ligation product peak height ratios
corresponding to 0, 20, 40, 60, 80 and 100% methylated target (or
vice versa). A plot of, for example, percent methylation versus
(mis)ligation product peak ratio is generated and the data points
fit to a curve, i.e., a "standard curve" for the probes tested.
Using this standard curve, one can determine the degree of target
nucleotide methylation in an unknown sample by locating the
experimentally determined (mis)ligation product peak ratio at the
appropriate point on the curve and identifying the corresponding
degree of methylation, provided that the same probes and assay
conditions are used for creating the standard curve and obtaining
the unknown sample's ligation product ratio. Those skilled in the
art understand that the reliability of standard curves is improved
by, among other things, increasing the number of data points used
to generate the "curve" and the number of replicates obtained for
each data point. Those in the art also understand that standard
curves can be generated using any or a number of measurable
parameters, not just (mis)ligation product peak height. For example
but without limitation, peak height and peak area may be routinely
determined using software such as GeneScan.TM. or GeneMapper.TM.
software and provided as part of a system printout or graphic
display.
Example 10
Evaluating the Methylation Detection Potential of Four Ligases
[0154] The methylation detection potential of Afu, AK16D, Taq, and
Tth ligases were evaluated in a series of ligation assays using
probe sets 1, 2, and 3 (shown in Table 1) with either the
methylated or the unmethylated synthetic model template, SEQ ID
NO:1. Each 20 .mu.L ligation reaction composition comprised 4 Units
of ligase (Afu, AK16D, Taq, or Tth), 12.5 nM template (either
methylated or unmethylated SEQ ID NO:1), and 12.5 nM of each of the
six probes from probe sets 1-3 in 1.times. ligase buffer (for Afu
ligase: 50 mM Tris-HCl, pH 7.5, 10 mM MgCl.sub.2, 10 mM
dithiothreitol (DTT), 1 mM ATP, 25 .mu.g/ml bovine serum albumin;
for AK16D, Taq, and Tth ligases: 20 mM Tris-HCl, pH 7.6, 25 mM
potassium acetate, 10 mM magnesium acetate, 10 mM DTT, 1 mM NAD,
0.1% Triton X-100). Ligation products were generated by heating the
ligation reaction compositions at 85.degree. C. for 3 minutes,
cycling twenty-five times at (85.degree. C. for five seconds,
40.degree. C. for 2 minutes), heating at 95.degree. C. for ten
minutes, then cooled to 4.degree. C. Two .mu.L of the ligation
products were diluted in 18 .mu.L Hi-Di.TM. formamide, then the
diluted (mis)ligation products were loaded onto capillaries and
separated on the ABI PRISM.RTM. 3100 Genetic Analyzer, as
described.
[0155] The detected ligation product peaks obtained with Afu ligase
are shown in FIG. 12A. The ligation product ratio with the
non-methylated and methylated template for LP 2-3/LP4-5 was 0.44
(non-methylated) and 0.78 (methylated); for LP 2-3/LP 6-7 was 0.32
(non-methylated) and 0.78 (methylated); and for LP 4-5/LP 6-7 was
0.72 (non-methylated) and 0.76 (methylated). The detected ligation
product peaks obtained with AK16D ligase are shown in FIG. 12B. The
ligation product ratio with the non-methylated and methylated
template for LP 2-3/LP4-5 was 0.30 and 0.41, respectively; for LP
2-3/LP 6-7 was 0.37 and 0.46, respectively; and for LP 4-5/LP 6-7
was 1.24 and 1.12, respectively. The detected ligation product
peaks obtained with Tth ligase are shown in FIG. 12C. The ligation
product ratio with the non-methylated and methylated template for
LP 2-3/LP4-5 was 0.50 and 0.53, respectively; for LP 2-3/LP 6-7 was
0.41 and 0.42, respectively; and for LP 4-5/LP 6-7 was 0.82 and
0.79, respectively. The detected ligation product peaks obtained
with Taq ligase are shown in FIG. 12D. The ligation product ratio
with the non-methylated and methylated template for LP 2-3/LP4-5
was 0.58 and 0.60, respectively; for LP 2-3/LP 6-7 was 0.51 and
0.47, respectively; and for LP 4-5/LP 6-7 was 0.87 and 0.78,
respectively. Those in the art will appreciate that similar
evaluations of additional ligases can be preformed using the same
or different templates and/or probes to evaluate the potential of
those ligases for detecting methylated target nucleotides under a
given set of experimental conditions.
[0156] While the present teachings have been described in terms of
these exemplary embodiments, the skilled artisan will readily
understand that numerous variations and modifications of these
exemplary embodiments are possible without undue experimentation.
All such variations and modifications are within the scope of the
current teachings.
Sequence CWU 1
1
39135DNAArtificial SequenceSynthetic DNA 1ttattatgtg gggcggaccg
cgtgcgctta cttat 35210DNAArtificial SequenceSynthetic DNA
2agcgcacgcg 10311DNAArtificial SequenceSynthetic DNA 3gtccgcccca c
11412DNAArtificial SequenceSynthetic DNA 4agcgcacgcg gt
12511DNAArtificial SequenceSyntetic DNA 5ccgccccaca t
11613DNAArtificial SequenceSynthetic DNA 6agcgcacgcg gtc
13711DNAArtificial SequenceSynthetic DNA 7cgccccacat a
11810DNAArtificial SequenceSynthetic DNA 8agcgcactca
10910DNAArtificial SequenceSynthetic DNA 9agcgcactcc
101011DNAArtificial SequenceSynthetic DNA 10gtccgcccca c
111110DNAArtificial SequenceSynthetic DNA 11agcgcactct
101243DNAArtificial SequenceSynthetic DNA 12tccgggatgc acagtgcaga
ggcggccaga gcagtgcaca gcg 431314DNAArtificial SequenceSynthetic DNA
13cactgctctg gcca 141414DNAArtificial SequenceSynthetic DNA
14cactgctctg gccc 141514DNAArtificial SequenceSynthetic DNA
15cactgctctg gcct 141616DNAArtificial SequenceSynthetic DNA
16cctctgcact gtgcat 161736DNAArtificial SequenceSynthetic DNA
17ccagagggtg gggcggaccg agtgcgctcg gcggct 361821DNAArtificial
SequenceSynthetic DNA 18gcgacgatga gtcctgagta a 211921DNAArtificial
SequenceSynthetic DNA 19ctcgtagact gcgtaccgat c 212056DNAArtificial
SequenceSynthetic DNA 20ctcgtagact gcgtaccgat ccgtcggcac gcttcagttt
gaatcgagcg cactct 562116DNAArtificial SequenceSynthetic DNA
21actctgcact gtgcat 162214DNAArtificial SequenceSynthetic DNA
22cactgctctg gccg 142316DNAArtificial SequenceSynthetic DNA
23gctctgcact gtgcat 162416DNAArtificial SequenceSynthetic DNA
24tctctgcact gtgcat 162535DNAArtificial SequenceSynthetic DNA
25ctcgtagact gcgtaccgat ccactgctct ggccg 352637DNAArtificial
SequenceSynthetic DNA 26actctgcact gtgcatttac tcaggactca tcgtcgc
372741DNAArtificial SequenceSynthetic DNA 27gctctgcact gtgcattttt
ttactcagga ctcatcgtcg c 412841DNAArtificial SequenceSynthetic DNA
28tctctgcact gtgcattttt ttactcagga ctcatcgtcg c 412921DNAArtificial
SequenceSynthetic DNA 29ctcgtagact gcgtaccgat c 213021DNAArtificial
SequenceSynthetic DNA 30gcgacgatga gtcctgagta a 213161DNAArtificial
SequenceSynthetic DNA 31actctgcact gtgcattcgc agattgtgtc tcaccgagga
ttactcagga ctcatcgtcg 60c 613262DNAArtificial SequenceSynthetic DNA
32gctctgcact gtgcatcgat tcaaactgaa gcgtgccgac gttactcagg actcatcgtc
60gc 623362DNAArtificial SequenceSynthetic DNA 33tctctgcact
gtgcatcgat tcaaactgaa gcgtgccgac gttactcagg actcatcgtc 60gc
623421DNAArtificial SequenceSynthetic DNA 34ctcgtagact gcgtaccgat c
213521DNAArtificial SequenceSynthetic DNA 35gcgacgatga gtcctgagta a
213655DNAArtificial SequenceSynthetic DNA 36ctcgtagact gcgtaccgat
ctcctcggtg agacacaatc tgcgaagcgc actca 553732DNAArtificial
SequenceSynthetic DNA 37gtccgcccca cttactcagg actcatcgtc gc
323856DNAArtificial SequenceSynthetic DNA 38ctcgtagact gcgtaccgat
ccgtcggcac gcttcagttt gaatcgagcg cactcc 563955DNAArtificial
SequenceSynthetic DNA 39ctcgtagact gcgtaccgat ctcctcggtg agacacaatc
tgcgaagcgc actcc 55
* * * * *