U.S. patent application number 12/318805 was filed with the patent office on 2009-05-28 for biochemical synthesis of 6-amino caproic acid.
This patent application is currently assigned to DSM IP ASSETS B.V.. Invention is credited to Paul M. Brandts, Sandra Ernste, Petrus M.M. Nossin, Wijnand P.H. Peeters, Petronella C. Raemakers-Franken, Martin Schuermann, Stefaan M.A. Wildeman De, Marcel G. Wubbolts.
Application Number | 20090137759 12/318805 |
Document ID | / |
Family ID | 34778191 |
Filed Date | 2009-05-28 |
United States Patent
Application |
20090137759 |
Kind Code |
A1 |
Raemakers-Franken; Petronella C. ;
et al. |
May 28, 2009 |
Biochemical synthesis of 6-amino caproic acid
Abstract
The invention relates to biochemical synthesis of 6-amino
caproic acid from 6-aminohex-2-enoic acid compound or from
6-amino-2-hydroxyhexanoic acid, by treatment with an enzyme having
.alpha.,.beta.-enoate reductase activity towards molecules
containing an .alpha.,.beta.-enoate group and a primary amino
group. The invention also relates to processes for obtaining
suitable genetically engineered cells for being used in such
biotransformation process, and to precursor fermentation of 6-amino
caproic acid from intermediates leading to 6-amino caproic acid.
Finally, the invention relates to certain novel biochemically
produced compounds, namely 6-aminohex-2-enoic acid, 6-aminohexanoic
acid, as well as to caprolactam produced therefrom and to nylon-6
and other derivatives produced from such biochemically produced
compounds or caprolactam.
Inventors: |
Raemakers-Franken; Petronella
C.; (Budel, NL) ; Nossin; Petrus M.M.;
(Nederweert, NL) ; Brandts; Paul M.; (Limbricht,
NL) ; Wubbolts; Marcel G.; (Sittard, NL) ;
Peeters; Wijnand P.H.; (Maasbree, NL) ; Ernste;
Sandra; (Landgraaf, NL) ; Wildeman De; Stefaan
M.A.; (Kessel-Lo, BE) ; Schuermann; Martin;
(Juelich, DE) |
Correspondence
Address: |
NIXON & VANDERHYE, PC
901 NORTH GLEBE ROAD, 11TH FLOOR
ARLINGTON
VA
22203
US
|
Assignee: |
DSM IP ASSETS B.V.
Heerlen
NL
|
Family ID: |
34778191 |
Appl. No.: |
12/318805 |
Filed: |
January 8, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10586132 |
Nov 28, 2006 |
7491520 |
|
|
PCT/EP2005/000555 |
Jan 17, 2005 |
|
|
|
12318805 |
|
|
|
|
Current U.S.
Class: |
526/312 ;
528/310; 528/323; 540/604; 562/553 |
Current CPC
Class: |
C12P 13/02 20130101;
C12P 13/005 20130101; C12N 9/001 20130101; C07D 223/10
20130101 |
Class at
Publication: |
526/312 ;
562/553; 540/604; 528/310; 528/323 |
International
Class: |
C08F 26/02 20060101
C08F026/02; C07C 205/00 20060101 C07C205/00; C08G 73/02 20060101
C08G073/02; C07D 223/08 20060101 C07D223/08 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 19, 2004 |
EP |
04075079.6 |
Claims
1-23. (canceled)
24. Biochemically produced 6-aminohex-2-enoic acid, having a
.sup.12C versus .sup.13C versus .sup.14C isotope ratio of about the
same value as occurring in environmental carbon dioxide.
25. Biochemically produced 6-amino-hexanoic acid having a .sup.12C
versus .sup.13C versus .sup.14C isotope ratio of about the same
value as occurring in environmental carbon dioxide.
26. .epsilon.-Caprolactam produced from biochemically produced
6-aminohex-2-enoic acid or 6-amino-hexanoic acid, and having a
.sup.12C versus .sup.13C versus .sup.14C isotope ratio of about the
same value as occurring in environmental carbon dioxide.
27. Nylon-6 and other derivatives produced from the biochemically
produced product of claim 24, and having a .sup.12C versus .sup.13C
versus .sup.14C isotope ratio of about the same value as occurring
in environmental carbon dioxide.
28. Nylon-6 and other derivatives produced from the biochemically
produced product of claim 25, and having a .sup.12C versus .sup.13C
versus .sup.14C isotope ratio of about the same value as occurring
in environmental carbon dioxide.
29. Nylon-6 and other derivatives produced from
.epsilon.-caprolactam according to claim 26, and having a .sup.12C
versus .sup.13C versus .sup.14C isotope ratio of about the same
value as occurring in environmental carbon dioxide.
Description
[0001] The present invention relates to a new process for
biochemical synthesis of 6-amino caproic acid. 6-Amino caproic acid
is hereinafter also referred to as 6-ACA. The compound 6-amino
caproic acid (IUPAC name: 6-amino-hexanoic acid) is a possible
intermediate for the production of .epsilon.-caprolactam
(hereinafter more briefly referred to as caprolactam), which is the
basis for nylon-6 production. On the other hand, 6-amino caproic
acid also may be formed by hydrolysis of caprolactam. Caprolactam
is a bulk chemical and is being produced at very large scale
throughout the world.
[0002] Basic chemicals for the industrial production of caprolactam
generally are bulk chemicals such as benzene, cyclohexane,
cyclohexanone, etc. from which cyclohexanone oxime is being
produced, that is then converted into caprolactam via a so-called
Beckmann rearrangement. However, in the recycling of nylon-6 carpet
waste materials, for instance, 6-amino caproic acid (as well as
some other products formed in the depolymerization step of nylon-6)
may be used for the synthesis of caprolactam by a cyclization
reaction. In the industrial recycling of nylon-6 the production of
caprolactam is often the last synthesis step. 6-Amino caproic acid
(6-ACA) is thus suitable for the synthesis of caprolactam, and
subsequently for the production of nylon-6. 6-ACA, however, also
can be used directly as raw material for the production of
nylon-6.
[0003] For the cyclization of 6-ACA and/or esters thereof, various
processes are known to the skilled man. For instance, reference can
be made to the processes as are being described in U.S. Pat. No.
6,194,572 wherein 6-ACA and/or esters thereof are treated in a
reaction zone, in the absence of a catalyst, with superheated steam
at a temperature in the range of from 270 to 400.degree. C. and a
pressure in the range of from 0.5 to 2 MPa. These processes can be
operated continuously and the caprolactam formed can be isolated by
partial condensation at a temperature in the range of from 100 to
170.degree. C. immediately after the reaction mixture leaves the
reaction zone. Direct conversion of 6-ACA into nylon-6, for
instance can be done as described in JP-4050232-A.
[0004] As meant in the present patent application, the term
"biochemical synthesis" (a term that, in the context of this patent
application, alternatively is referred to as "biotransformation")
includes not only processes which involve--besides a number of
purely chemical reaction steps--one or more biocatalytic reactions,
but also purely biochemical processes using whole cells of suitable
production strains. Such purely biochemical processes,
respectively, are referred to as fermentations in case the
biochemical synthesis starts from a suitable carbon source, or are
referred to as precursor fermentations in case the biosynthesis
starts from an intermediate product already having a carbon
skeleton from which the target molecule to be synthesized can be
obtained. The processes may be carried out either under aerobic or
under anaerobic conditions.
[0005] Biochemical synthesis can be carried out either in vivo or
in vitro. Generally, in vivo processes are processes carried out
when using living cells (the term "living cells" thereby also
including so-called resting cells); in vitro processes, on the
other hand, usually are being carried out using cell lysates or
(partly) purified enzymes. The biochemical synthesis as meant
herein, however, also may be carried out using permeabilized cells;
the differentiation between in vivo and in vitro, however, does not
make much sense for processes being carried out with permeabilized
cells.
[0006] The present invention also relates to processes for
obtaining suitable genetically engineered host cells for being used
in a biotransformation process for the synthesis of 6-amino caproic
acid, and also specifically to hitherto unknown processes for
precursor fermentation of 6-amino caproic acid from intermediates
leading to 6-amino caproic acid namely from 6-aminohex-2-enoic
acid, or from a compound capable of being converted thereto one,
namely 6-amino-2-hydroxyhexa-noic acid. The said compounds
6-aminohex-2-enoic acid and 6-amino-2-hydroxy-hexanoic acid (as
will be explained hereinafter) are being referred to, respectively,
as 6-AHEA and 6-AHHA in the context of the present application. In
precursor fermentation of 6-amino caproic acid suitable
intermediates, as described below, are being made available for the
precursor fermentation in such way that they are present therein at
a non-limiting and non-inhibiting concentration, for instance by
feeding into the reaction vessel wherein the biochemical synthesis
(i.e. conversion) is being carried out.
[0007] The present invention further also specifically relates to
novel host cells having enoate reductase activity towards
6-aminohex-2-enoic acid, i.e. towards 6-AHEA. Especially it also
relates to novel host cells having aerostable enoate reductase
activity towards 6-AHEA. As used herein, the term "aerostable"
means oxygen-tolerant.
[0008] Finally, as also will be explained hereinafter, the present
invention relates to the novel biochemically produced compounds
6-AHEA and 6-ACA, as well as to caprolactam produced from such
6-ACA, and to nylon-6 or other derivatives produced from such
biochemically produced compounds or such caprolactam.
[0009] In general, the routes to 6-ACA as are known until today are
quite laborious and troublesome. Usually, if 6-ACA is not being
produced from waste nylon-6 materials, these known routes require
relatively expensive starting materials and reactants (e.g.
butadiene and hydrogen gas), and relatively severe reaction
conditions of temperature and pressure in a multi-step and
multi-reactor design, as well as the use of expensive catalyst
systems. Accordingly, there remains a need for alternative routes
to 6-ACA, preferably from much less expensive raw materials. It is
well known that naturally growing, and thus renewable, materials
from agricultural production are the basis for carbon sources such
as glucose (or other appropriate carbon sources and mixtures
thereof) that can be used in fermentation or precursor
fermentation. Such renewable materials are relatively cheap and
abundantly available. In general, it is considered to be very
advantageous if renewable materials can be used as starting
materials for all kinds of chemical materials.
[0010] It is an aim of the present invention to enable the--so far
unknown--production of 6-ACA by biochemical synthesis (i.e. by
biotransformation).
[0011] The present inventors surprisingly have found a novel
process for the biochemical synthesis of 6-amino caproic acid
wherein either 6-aminohex-2-enoic acid of formula [1] (6-AHEA)
H.sub.2N--CH.sub.2--CH.sub.2--CH.sub.2--CH.dbd.CH--COOH [1]
or wherein 6-amino-2-hydroxyhexanoic acid (6-AHHA), a compound
capable of being transformed into 6-aminohex-2-enoic acid, is
treated with an enzyme having .alpha.,.beta.-enoate reductase
activity towards molecules containing an .alpha.,.beta.-enoate
group and a primary amino group, in particular with an enzyme
having .alpha.,.beta.-enoate reductase activity towards
6-aminohex-2-enoic acid.
[0012] As meant herein, enzymes having .alpha.,.beta.-enoate
reductase activity towards molecules containing an
.alpha.,.beta.-enoate group and a primary amino group are
understood to be enzymes that are capable of converting the
.alpha.,.beta.-carbon-carbon double bond at the
.alpha.,.beta.-position next to a carboxylic acid (--COOH) (or
carboxylate (--COO.sup.-), or ester (--COOR, with R representing a
lower alkyl group of at most 6 C-atoms)) group into a carbon-carbon
single bond in molecules also containing a primary amino group,
i.e. an --NH.sub.2 group not forming part of an amide group. Mono-
or disubstituted amino groups are not comprised in the definition
of primary amino groups as used herein. The term
.alpha.,.beta.-enoate reductase activity is meant to include such
activity at all possible levels of measurable activity, including
increased levels of activity as can be achieved by methods known to
the skilled man, such as by overexpression, induction or otherwise
regulating of the relevant gene, increasing the copy number of the
relevant gene, increasing the endogenous activity of the relevant
enzyme, etc., or by optimizing the assay conditions.
[0013] In addition to 6-AHEA, also the corresponding saturated,
.alpha.-hydroxy-substituted compound 6-AHHA, capable of being
transformed into 6-AHEA by dehydratation may be applied in the
process of the present invention. Within the context of this patent
application this compound is considered to be equivalent to the
.alpha.-unsubstituted .alpha.,.beta.-enoate 6-AHEA.
[0014] It is to be noticed, that the biochemical reaction as has
been found by the present inventors, has not yet been described nor
suggested in the prior art for the conversion of molecules
containing an .alpha.,.beta.-enoate group and a primary amino
group, even though enzymes having .alpha.,.beta.-enoate reductase
activity, most often specifically for .alpha.,.beta.-enoates
containing an .alpha.-substituent not being equal to hydrogen,
already were known to the skilled man for other types of reactions
for a broad range of substrates. Generally such known reactions of
enzymes with .alpha.,.beta.-enoate reductase activity were aimed at
creating enantiospecific enzymatic syntheses. For instance see H.
Simon et al. in Angew. Chem. Int. Ed. Engl., Vol. 13 (1974), p.
608-609; B. Rambeck et al., ibid. at page 609; I. Thanos et al. in
J. Biotechnol. 9, 13-29 (1987); H. Simon et al. in Angew. Chem.
Int. Ed. Engl., Vol. 24 (1985), p. 539-553; and U.S. Pat. No.
4,464,235. A survey dealing with enzymes having
.alpha.,.beta.-enoate reductase activity can be found in Chem.
Biochem. Flavoenzymes (1991), Chapter 11, pages 317-328 by H.
Simon; publisher: CRC, Boca Raton. The latter of these references
suggests, that the enoate reductase activity will involve a
hydride-transfer from the reduced enzyme to the enoate compound. I.
Thanos et al. (cited above) focused on the electroenzymatic
reduction aspects when using enoate reductase from Clostridium
tyrobutyricum DSM1460 for .alpha.-substituted enoates. Other
examples of enzymes having .alpha.,.beta.-enoate reductase activity
are being shown for the synthesis of stereochemically pure
.alpha.-substituted carbonyl compounds in WO-03/066863. This
reference does not show any primary amino group-containing
substrate for the enoate reductases used. There is, thus, no
indication at all, that enzymes with .alpha.,.beta.-enoate
reductase activity can suitably be used for the biochemical
synthesis of compounds that are unsubstituted at the
.alpha.-position next to a carboxylic group and that also contain a
primary amino group, for instance, 6-ACA. In fact, the skilled man,
taking into account the abovementioned presumable hydride-transfer
mechanism, would rather expect that the presence of a primary amino
group in a molecule to be converted by means of an enzyme having
.alpha.,.beta.-enoate reductase activity would have negative effect
on such reaction. The expectedly positively charged amino group
would seem to be the preferred acceptor for the hydride to be
transferred, thereby negatively interfering with the enoate
reductase activity.
[0015] It is further to be noticed, that the remark made by
Steinbacher et al. (see STN Database accession no. 2003:101473)
that enoate reductases have broad substrate specificity, a remark
that is also consistent with the data from other references, e.g.
of H. Simon et al. cited above, where the use of a broad range of
substrates for the enoate reductase reaction in the strain
Clostridium tyrobutyricum DSM1460 (the same strain as also had been
used in the work of 1. Thanos et al., cited above) is being shown,
does not change said view.
[0016] Moreover, in literature, cloning, sequencing and expression
of enoate reductases from different clostridia has been described
(see F. Rohdich, et al. in J. Biol. Chem. 276(6), 5779-5787 (2001).
Especially, the enoate reductase (enr) genes of Clostridium
tyrobutyricum DSM1460 and Clostridium thermoaceticum DSM1974 (a
strain quite recently also having been renamed together with a
number of Clostridium species, and thus now also is being referred
to, as Moorella thermoacetica) were cloned and sequenced.
[0017] However, such cloning so far never has been carried out in
any species from either of, for instance, the genera Bacillus,
Corynebacterium, or Pichia. In particular, however, as to the
cloning of the enr-gene from Moorella thermoacetica and from
Clostridium tyrobutyricum in E. coli as has been described by F.
Rohdich. As to these clonings it is to be noticed, that the latter
(from C. tyrobutyricum) has not been tested by Rohdich et al. under
anaerobic conditions (i.e. with growth under anaerobic conditions),
and--in tests under aerobic conditions--resulted in an inactive
form of the enoate reductase, whereas the former (from M.
thermoacetica) gave the same result when expressed aerobically, and
only yielded an active form of the enoate reductase under anaerobic
conditions. Moreover, in WO-03/066863 cloning in E. coli of enoate
reductase enzymes obtained from Burkholderia species is being
described, and these enzymes have been sequenced.
[0018] Accordingly, none of the cited references teaches the 6-ACA
forming reaction as forms the basis of the present invention.
[0019] As the inventors have found, the enzyme having
.alpha.,.beta.-enoate reductase activity (as used in the process of
the present invention) can be any suitable enzyme (i.e. the enzyme
is suitable if it can be confirmed to have .alpha.,.beta.-enoate
reductase activity towards towards molecules containing an
.alpha.,.beta.-enoate group and a primary amino group, especially
towards 6-aminohex-2-enoic acid) originating from a large group of
genera of microorganisms (anaerobic ones as well as aerobic ones),
such as, for instance, of Acetobacterium, Achromobacter,
Acremonium, Agrobacterium, Alcaligenes, Bacillus, Bradyrhizobium,
Burkholderia, Caloramator, Cephalosporium, Clostridium,
Escherichia, Eubacterium, Filifactor, Fusobacterium, Kluyveromyces,
Mesorhizobium, Moorella, Ochrobactrum, Oxalophagus, Oxobacter,
Paenibacillus, Pseudomonas, Ralstonia, Rhizobium, Rhodotorula,
Salmonella, Shigella, Sinorhizobium, Sporohalobacter,
Syntrophosphora, Thermoanaerobacter, Thermoanaerobacterium,
Tilachlidium, Vibrio, Xanthobacter, or Yersinia.
[0020] Preferably in the process of the present invention, the
enzyme having .alpha.,.beta.-enoate reductase activity is an enzyme
originating from a microorganism from the group of species of
Acetobacterium sp., Acremonium sp., Agrobacterium sp., Burkholderia
sp., Cephalosporium sp., Clostridium sp., Escherichia sp., Moorella
sp., Ochrobactrum sp., Pseudomonas sp., Salmonella sp., Shigella
sp., Tilachlidium sp., Yersinia sp., and Vibrio sp.
[0021] More preferably, the enzymes having .alpha.,.beta.-enoate
reductase activity are enzymes originating from Acremonium sp.,
Clostridium sp., Moorella sp. or Ochrobactrum sp.
[0022] Most preferably, the enzyme having .alpha.,.beta.-enoate
reductase activity is an enzyme from Acremonium strictum CBS114157
(deposit date Dec. 19, 2003; deposited under the terms of the
Budapest treaty), Clostridium tyrobutyricum DSM1460 (available from
the Deutsche Sammlung Mikroorganismen und Zellkulturen), Moorella
thermoacetica DSM1974 (available from the Deutsche Sammlung
Mikroorganismen und Zellkulturen) (an enzyme which--also under
DSM1974--until Jan. 1, 1980, was named Clostridium thermoaceticum),
Ochrobactrum anthropi NCIMB41200 (deposit date Dec. 16, 2003;
deposited under the terms of the Budapest treaty), or Clostridium
kluyveri DSM555 (available from the Deutsche Sammiung
Mikroorganismen und Zellkulturen). In this context it is to be
noticed that a number of Clostridium species quite recently have
been renamed. The names given hereinabove are thus meant to be
indicative of the variety of species and strains (cells) that can
be considered for obtaining therefrom enzymes with
.alpha.,.beta.-enoate reductase activity.
[0023] Good results in the biochemical conversion to 6-ACA
according to the present invention have been achieved by the
inventors when using an enzyme having .alpha.,.beta.-enoate
reductase activity from Clostridium tyrobutyricum DSM1460, or from
Moorella thermoacetica DSM1974.
[0024] Preferably the enzyme having .alpha.,.beta.-enoate reductase
activity towards molecules containing an .alpha.,.beta.-enoate
group and a primary amino group has aerostable
.alpha.,.beta.-enoate reductase activity. This means, that the
enzyme, without any significant deactivation, i.e. the deactivation
will be not more than the standard deviation of enzyme activity
during the biotransformation process, will be able to catalyze the
desired biotransformation under conditions where free oxygen is
present. Such enzymes having aerostable activity also may be called
oxygen-tolerant enzymes.
[0025] Accordingly, in a preferred embodiment of the present
invention, the enzyme having .alpha.,.beta.-enoate reductase
activity has aerostable .alpha.,.beta.-enoate reductase activity
and is an enzyme originating from a microorganism from the group of
species of Agrobacterium sp., Burkholderia sp., Escherichia sp.,
Pseudomonas sp., Salmonella sp., Shigella sp., Yersinia sp., and
Vibrio sp. More preferably, the enzyme having aerostable
.alpha.,.beta.-enoate reductase activity is an enzyme originating
from an Escherichia coli species, and most preferably the enzyme
originates from Escherichia coli K12.
[0026] The process of the present invention very suitably can be
carried out by conversion of 6-aminohex-2-enoic acid into 6-amino
caproic acid at a pH in the range of from 3 to 9, preferably of
from 4 to 8, more preferably of from 5 to 8, and most preferably of
from 5.5 to 7 under anaerobic conditions and of from 6.5 to 8 under
aerobic conditions.
[0027] The starting material 6-aminohex-2-enoic acid (6-AHEA) can
be made available for the biochemical conversion according to the
present invention by providing this compound, or a product capable
of being metabolized thereto (but being different from a mere
carbon source, such as for instance glucose), in such way that it
is present in the reactor used at a non-limiting and non-inhibiting
concentration, for instance by feeding into the reaction vessel,
e.g. a fermentor, where the biochemical process is being carried
out. Processes according to the invention in which the 6-AHEA (or a
metabolisable precursor thereof) is used in such way in the
reaction vessel, can also be referred to as "precursor
fermentations".
[0028] Of course, as meant herein, 6-AHEA (or any product capable
of being metabolized thereto, and being different from a mere
carbon source) also can be made available for the conversion
according to the present invention by any suitable biochemical
process occurring in the microorganism containing the
.alpha.,.beta.-enoate reductase activity. It is known, for
instance, that lysine can be produced by biotransformation in
Corynebacterium glutamicum cells (for instance, see Pfefferle W.,
in Adv. Biochem. Eng. (2003), Vol. 79, p. 59-112). The fact that
the complete genome sequence of Corynebacterium glutamicum now has
become available has had major impact on the improvement of the
biotechnological manufacture of lysine. Assuming that lysine in the
microorganism then subsequently can be converted into 6-AHEA, a
process that hitherto has not been disclosed nor suggested, this
can be a suitable method for making 6-AHEA available for the
conversion of the present invention.
[0029] Lysine produced by biochemical synthesis (biotransformation)
can be converted into 6-AHEA by chemical methods readily available
to the skilled man. For instance, by first protecting the E-amino
group using the lysine-copper(II) complex method as described in
Houben-Weyl, Methods of Organic Chemistry (4th edition), Vol E22a,
Thieme, Stuttgart, 2002, page 166-191. Optional protecting groups
are acetyl, benzoyl, phenylacetyl, benzyloxycarbonyl or
phthaloylimide. Subsequent nitrosation reaction of thea-amino-group
in the presence of mercaptans or selenols then results in the
formation of the corresponding .alpha.-thio or .alpha.-seleno
ether. This nitrosation can be performed either in aqueous medium
with NaNO.sub.2/H.sub.2SO.sub.4 or under anhydrous conditions
using, for example, iso-amylnitrite. Suitable examples of
mercaptans are (substituted) thiophenol and benzylmercaptan;
benzeneselenol is preferred as selenol in this reaction. Subsequent
oxidation of the .alpha.-thio ether or .alpha.-seleno ether with
H.sub.2O.sub.2 followed by an in situ elimination reaction will
result in E-protected 6-AHEA. An example of this procedure is
described by S. Bory, M. Gaudry, A. Marquet; Nouveau Journal de
Chimie (1986), 10, 709-713. By acid or base catalysed hydrolysis of
the E-protecting group 6-AHEA is obtained.
[0030] In such case where 6-AHEA is being produced biochemically in
the cell (or from lysine that has been produced by
biotransformation), the resulting 6-ACA (and the caprolactam
derived therefrom after excretion from the cell and cyclization by
any known methods) will be easily distinguishable from 6-ACA
(and/or caprolactam obtained therefrom, respectively products
derived therefrom, for instance nylon-6 obtained from such
caprolactam) as is being obtained by chemical routes from fossile
feedstock. In the latter case absence of .sup.14C in the carbon
chains of the molecules will be easily demonstrable. Alternatively,
the .sup.12C versus .sup.13C versus .sup.14C isotope ratio (as can
be determined by Stable Isotope Ratio Mass Spectrometry (SIRMS)
methods, or by so-called Site-Specific Natural Isotopic
Fractionation studied by Nuclear Magnetic Resonance (SNIF-NMR.RTM.
as are being used for identification of biosubstances) may be used
as a fingerprint for the origin of the 6-ACA (and/or caprolactam)
because the .sup.12C versus .sup.13C versus .sup.14C isotope ratio
will have about the same value as is occurring in environmental
carbon dioxide.
[0031] The starting material, 6-aminohex-2-enoic acid (6-AHEA),
also can be obtained purely chemically, for instance, analogous to
steps a and from scheme 2 in the method described by P. Hughes et
al. for the synthesis of threo-3-hydroxylysine in J. Org. Chem.
vol. 59 (1994), pages 5799-5802. This is being shown in the
experimental part of this application.
[0032] The process according to the invention is preferably carried
out in a host organism selected from the group of genera consisting
of Aspergillus, Bacillus, Corynebacterium, Escherichia, and Pichia.
Host organisms belonging to the group of Corynebacterium sp., for
instance, C. glutamicum, are especially preferred because these
microorganisms are known to be suitable for biosynthetic production
of lysine.
[0033] In a particularly preferred embodiment of the present
invention, the host strain and, thus, host cell suitable for the
biochemical synthesis of 6-amino caproic acid is selected from the
group of Escherichia coli, Bacillus, Corynebacterium glutamicum,
Aspergillus niger or Pichia pastoris host cells, in which an
.alpha.,.beta.-enoate reductase gene encoding an enzyme having
.alpha.,.beta.-enoate reductase activity towards molecules
containing an .alpha.,.beta.-enoate group and a primary amino group
is cloned and expressed. Instead of any of such said
.alpha.,.beta.-enoate reductase gene also any other gene coding for
an enzyme having .alpha.,.beta.-enoate reductase activity and
capable of converting 6-AHEA into 6-ACA at an adequate degree, may
be used and is deemed to be encompassed in the scope of this
claimed embodiment. From the cells mentioned in the present
application only Escherichia coli cells cloned with either the
.alpha.,.beta.-enoate reductase gene from Moorella thermoacetica
DSM1974, or from Clostridium tyrobutyricum, have been described in
the prior art; the other cells mentioned are novel cells.
[0034] Moreover, as the present inventors have found, also genes
encoding for enzymes having aerostable .alpha.,.beta.-enoate
reductase activity towards molecules containing an
.alpha.,.beta.-enoate group and a primary amino group, can be
applied in the process according to the present invention. For
instance, the inventors have found that the Escherichia coli K12
(strain W3110) nemA gene (accession number: D86931), a gene that is
known to have N-ethylmaleimide reductase activity, also has
.alpha.,.beta.-enoate reductase activity towards molecules
containing an .alpha.,.beta.-enoate group and a primary amino
group. Such .alpha.,.beta.-enoate reductase activity of the nemA
gene has not been known so far. Based on sequence homology with the
nemA gene from E. coli, other genes encoding for enzymes having
aerostable .alpha.,.beta.-enoate reductase activity towards
molecules containing an .alpha.,.beta.-enoate group and a primary
amino group will be available from strains from, for instance, the
genera Agrobacterium, Escherichia, Pseudomonas, Salmonella,
Shigella, Yersinia, and Vibrio. All such further genes encoding for
enzymes having aerostable .alpha.,.beta.-enoate reductase activity
towards molecules containing an .alpha.,.beta.-enoate group and a
primary amino group are, for the purposes of this patent
application, considered to be equivalent to nemA.
[0035] Accordingly, the present invention also specifically relates
to the following novel cells: [0036] an Escherichia coli host cell
in which the .alpha.,.beta.-enoate reductase gene from Ochrobactrum
anthropi NCIMB41200, or from Acremonium strictum CBS114157 is
cloned and expressed; [0037] a Bacillus host cell in which the
.alpha.,.beta.-enoate reductase gene from Moorella thermoacetica
DSM1974, or from Clostridium tyrobutyricum DSM1460, or from
Ochrobactrum anthropi NCIMB41200, or from Acremonium strictum
CBS114157 is cloned and expressed; [0038] a Corynebacterium
glutamicum host cell in which the .alpha.,.beta.-enoate reductase
gene from Moorella thermoacetica DSM1974, or from Clostridium
tyrobutyricum DSM1460, or from Ochrobactrum anthropi NCIMB41200, or
from Acremonium strictum CBS114157 is cloned and expressed; [0039]
an Aspergillus niger host cell in which the .alpha.,.beta.-enoate
reductase gene from Acremonium strictum CBS114157, or from Moorella
thermoacetica DSM1974, or from Clostridium tyrobutyricum DSM1460,
or from Ochrobactrum anthropi NCIMB41200 is cloned and expressed;
[0040] a Pichia pastoris host cell in which the
.alpha.,.beta.-enoate reductase gene from Acremonium strictum
CBS114157, or from Moorella thermoacetica DSM1974, or from
Clostridium tyrobutyricum DSM1460, or from Ochrobactrum anthropi
NCIMB41200 is cloned and expressed; and [0041] a host cell selected
from the group of Aspergillus, Bacillus, Corynebacterium, and
Pichia host cells, in which the aerostable .alpha.,.beta.-enoate
reductase gene nemA from E. coli K12 is cloned and expressed.
[0042] In general, enzymes having aerostable .alpha.,.beta.-enoate
reductase activity are clearly preferred in the context for the
present invention. That is because they can be expressed and used
in microorganisms that are cultivated and/or used under aerobic
conditions.
[0043] Escherichia coli, or Bacillus, or Corynebacterium
glutamicum, or Aspergillus niger or Pichia pastoris host cells, in
which the .alpha.,.beta.-enoate reductase gene from Moorella
thermoacetica DSM1974, or from Clostridium tyrobutyricum DSM1460,
or from Ochrobactrum anthropi NCIMB41200, respectively from
Acremonium strictum CBS114157 is cloned and expressed (or any such
genes being homologous therewith and coding for enzymes having
.alpha.,.beta.-enoate reductase activity and capable of converting
6-AHEA into 6-ACA at an adequate degree), can be obtained by means
of any suitable cloning strategy known to the skilled man, for
instance, by the methods described in the experimental part hereof.
Reference is also made to the well-known handbook of Sambrook, J.,
Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Laboratory
Manual. 2.sup.nd ed., Cold Spring Harbor Laboratory, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Similarly,
such cloning strategies also can be applied for the construction of
the aforementioned nemA clones (or clones equivalent therewith).
Moreover, especially in cases where a gene originating from a
fungus is cloned into a bacterial species, the skilled man will
take appropriate measures to not only adapt the transcriptional and
translational control sequences, but in addition use isolated or
synthetically obtained cDNA sequences, in order to achieve
functional expression of the enzyme to be produced.
[0044] The present invention, moreover, also relates to a process
for precursor fermentation of 6-amino caproic acid (6-ACA) starting
either from 6-aminohex-2-enoic acid (6-AHEA) or from
6-amino-2-hydroxyhexanoic acid (6-AHHA), and applying at least an
enzymatic step with an enzyme having .alpha.,.beta.-enoate
reductase activity towards molecules containing an
.alpha.,.beta.-enoate group and a primary amino group, in
particular with an enzyme having .alpha.,.beta.-enoate reductase
activity towards 6-aminohex-2-enoic acid.
[0045] In the most preferred embodiment, such precursor
fermentation is performed in a microorganism wherein
6-aminohex-2-enoic acid (6-AHEA) is being formed in vivo. In fact,
in such case, the formation of 6-ACA according to the present
invention, is a biotransformation into 6-ACA starting from any
suitable carbon source.
[0046] Carbon sources which can suitably be used in these specific
embodiments of the process according to the invention are:
oligosaccharides and disaccharides, for example maltose,
.beta.-galactoside, melibiose, epimelibiose, galactinol, melibitol,
galactosylglycerol and trehalose, hexoses, for example D-glucose,
D-fructose, D-mannose, L-sorbose and D-galactose, glucose
containing solutions or slurries, starch, carbon source containing
solutions or slurries, amino sugars, for example
N-acetyl-D-glucosamine and D-glucosamine, methylpentoses, for
example L-fucose and L-rhamnose, pentoses and trioses, for example
L-arabinose, D-arabinose, D-xylose, xylitol, D-lyxose, D-ribose,
2-deoxy-D-ribose and dihydroxyacetone, pentoses in nucleosides and
deoxynucleosides, for example cytidine, deoxycytidine, adenosine,
deoxyadenosine, uridine, xanthosine, thymidine (deoxyuridine),
purine (adenine, hypoxanthine, guanine ribonucleoside),
hexuronides, hexuronates and hexonates, for example D-gluconate and
D-galactonate, phosphorylated sugars and carboxylates, for example
hexose phosphates, and sn-glycerol 3-phosphate, dicarboxylates, for
example succinate, fumarate and L-malate, tricarboxylic acids,
polyols, for example D-mannitol, D-glucitol, D-sorbitol,
galactitol, dulcitol, D-arabitol, ribitol and xylitol, glycerol,
two-carbon compounds, for instance ethanol and acetate, fatty
acids, glycolate and glyoxylate, but also methanol, edible oils, or
mixtures of any of the above compounds.
[0047] Most preferably, the 6-aminohex-2-enoic acid (6-AHEA) is
being formed in vivo from a solution or slurry containing a
suitable carbon source. Such suitable carbon sources may be
selected from the group of glucose, glucose containing solutions or
slurries, (m)ethanol, gluconate, pentoses, hexoses, starch and
fatty acids. In particular, the carbon source used is glucose.
[0048] Because, as mentioned above, enzymes having enoate reductase
activity towards 6-AHEA which are tolerant against free oxygen
(and, thus can be said to be aerostable) are preferred in the
context of the present invention (i.e. enzymes that can be
expressed and used in microorganisms which are cultivated and/or
used under aerobic conditions), preferably microorganisms are being
used that can be used under aerobic conditions. The efficiency of
growth (i.e. also of biomass production) under aerobic conditions,
as well as the efficiency of production of relevant enzyme(s)
and/or of substances to be produced, is generally much higher than
for growth under anaerobic conditions. For instance, much better
yields on glucose (or other carbon sources) are achieved. Such
advantages are being described, for instance, in the general
textbook "Allgemeine Mikrobiologie" of H. Schlegel, Thieme, Germany
(1981).
[0049] Further the present invention relates to the novel,
biochemically produced, substances as disclosed herein, and to
products derived therefrom and having a .sup.12C versus .sup.13C
versus .sup.14C isotope ratio of about the same value as occurring
in environmental carbon dioxide, namely to biochemically produced
6-aminohex-2-enoic acid having a .sup.12C versus .sup.13C versus
.sup.14C isotope ratio of about the same value as occurring in
environmental carbon dioxide; biochemically produced
6-amino-hexanoic acid having a .sup.12C versus .sup.13C versus
.sup.14C isotope ratio of about the same value as occurring in
environmental carbon dioxide; .epsilon.-caprolactam having a
.sup.12C versus .sup.13C versus .sup.14C isotope ratio of about the
same value as occurring in environmental carbon dioxide, produced
from biochemically produced 6-carboxy-6-aminohex-2-enoic acid, or
6-amino-hexanoic acid; and to nylon-6 and other derivatives having
a .sup.12C versus .sup.13C versus .sup.14C isotope ratio of about
the same value as occurring in environmental carbon dioxide,
produced from biochemically produced 6-aminohex-2-enoic acid or
6-amino-hexanoic acid, or from .epsilon.-caprolactam that has been
produced from biochemically produced 6-aminohex-2-enoic acid or
6-amino-hexanoic acid.
[0050] Each of these novel substances can be readily identified by
means of methods as have been described above, for instance by
Stable Isotope Ratio Mass Spectrometry (SIRMS) methods or by
Site-Specific Natural isotope Fractionation studied by NMR. These
novel substances are clearly different (namely in their .sup.12C
versus .sup.13C versus .sup.14C isotope ratio) from the known
substances of corresponding chemical structure and formula as have
been obtained by chemical synthesis from fossile carbon sources and
are being described in prior art references.
[0051] The invention will now be elucidated by means of the
following experimental results, without, however, being restricted
by any means to the methods or principles of this experimental
part. It will, moreover, be clear that the present invention also
will be applicable--by analogy--for the (bio)synthesis of higher
.alpha.,.omega.-amino carboxylic acids from .omega.-amino 2-alkene
carboxylic acids (and subsequent production of polyamides
therefrom). For instance 11-amino-2-undecenoic acid could be a
starting compound for the synthesis of polyamide-11. Embodiments
for producing such higher .alpha.,.omega.-amino carboxylic acids by
treatment of their corresponding .alpha.,.beta.-unsaturated
carboxylic acids are considered to be falling within the scope of
the present claims.
I Preparation of 6-aminohex-2-enoic acid (6-ahea) from
4-aminobutyraldehyde Diethylacetal
[0052] The relevant reaction steps are described in R. Hamilton et
al., Tet. Letters 1993 (34), p. 2847-2850; in P. Hughes et al., J.
Org. Chem. 1994 (59), p. 5799-5802; and in C. Stammer et al., J.
Org. Chem. 1969 (34), p. 2306-2311, respectively.
[0053] 4-Aminobutyraldehyde diethylacetal (technical, 90%; 202.4 g,
1130 mmol) and phthalic anhydride (186 g, 1256 mmol) were reacted
under Dean-Stark conditions for 4 h in toluene (1700 ml),
containing about 10 wt. % of triethylamine (TEA; 166 g, 1640 mmol).
After cooling to room temperature (RT) the solvent and excess of
TEA were evaporated in vacuo. The residue was dissolved and
refluxed for 20 min. in a mixture of 2M aqueous HCl (2000 ml) and
acetone (2800 ml). After cooling to RT the acetone was removed in
vacuo and the residue was extracted with CH.sub.2Cl.sub.2
(5.times.200 ml). The organic phase was washed with 2M aqueous HCl
(3.times.200 ml) and with saturated aqueous NaHCO.sub.3
(2.times.200 ml). After drying of the solution over
Na.sub.2SO.sub.4 the 4-phtalimidobutanal was isolated by
evaporating the CH.sub.2Cl.sub.2 in vacuo. After drying in an
exsiccator over P.sub.2O.sub.5 in vacuo 240.5 g of
4-phtalimidobutanal were obtained (yield: 98%).
[0054] 4-Phthalimidobutanal (120.9 g, 556 mmol) was then dissolved
in 600 ml of CH.sub.2Cl.sub.2 and treated with
methyl(triphenylphosphoranylidene) acetate (186 g, 556 mmol) in 600
ml of CH.sub.2Cl.sub.2. After 1 h the mixture was concentrated in
vacuo and chromatographed in seven equal portions (Merck Kieselgel
60; 7.times.14 cm column; eluent 30% ethyl acetate in hexane) to
give 145.6 g (96%) of methyl-6-phtalimidohex-2-enoate as a white
solid.
[0055] Methyl-6-phtalimidohex-2-enoate (145.6 g; 533 mmol) was
dissolved in methanol (900 ml) and stirred with 71.6 g NaOH (1790
mmol) in 1700 ml of distilled water at RT for 8 h. The solution was
treated with charcoal and filtered. The filtrate was acidified with
260 ml of 37% aqueous HCl and then refluxed for 3 h. After cooling
to RT a small amount of precipitate was filtered off and the
solution was concentrated in vacuo until crystallization began. The
precipitate was filtered off and the solution was evaporated to
dryness in vacuo. The residue was boiled with a 7:1 (vol/vol)
mixture of 2-propanol and ethyl acetate (2.times.800 ml) in order
to extract the product. After filtration the solvents were
evaporated in vacuo and the residue was recrystallized from
2-propanol (385 ml) to give 36.7 g (42%) of 6-amino-hex-2-enoic
acid HCl salt.
[0056] The NMR data for 6-AHEA, measured using 250 MHz NMR in
CD.sub.3OD, were as follows:
TABLE-US-00001 d = doublet, Protons Chemical shift (ppm) t =
triplet, q = quartet b 6.93 d .times. t a 5.88 d e 2.95 t c 2.34 q
d 1.84 quintet Protons a, b, c, d, and e are located, respectively,
at the .alpha., .beta., .gamma., .delta., and .epsilon. carbon
atom.
II Media and Preparation Thereof
II.1 PYG Medium (Non-Selective):
[0057] To 1 l deionized water is added: 1.25 g pepton, 1.25 g yeast
extract and 3 g glucose; pH is adjusted to pH 5.8. Divide over
penicillin bottles (50 ml medium in 100 ml bottle), heat (by
placing in a boiling water bath, but without boiling the samples in
the bottles) to remove O.sub.2 and flush (through the medium, and
under slight N.sub.2 overpressure above the medium) with N.sub.2.
Sterilize at 121.degree. C. for 15 minutes. Optionally last traces
of O.sub.2 may be removed by adding 0.05% of sterile sodium
thioglycolate.
II.2 Selective Medium (Crotonate Medium; (According to F. Rohdich
et al.,
[0058] J. Biol. Chem. 276(6), 5779-5787 (2001); and Bader, J. et
al., Hoppe-Seyler's Z. Physiol. Chem., Bd. 359, pages 19-27,
(1978)):
[0059] To 1 liter deionized water is added: 6 g crotonic acid, 0.3
g NaOH, 150 mg (NH.sub.4).sub.2HPO.sub.4, 100 mg K.sub.2HPO.sub.4,
33 mg MgCl.sub.2.6H.sub.2O, 50 mg NH.sub.4Cl, 1 g yeast extract, 1
g tryptic caseine, 40 mg CaCl.sub.2.2H.sub.2O, 0.4 mg
MnSO.sub.4.2H.sub.2O, 0.4 mg FeSO.sub.4.2H.sub.2O, 10 mg
(NH.sub.4).sub.6MO.sub.7O.sub.24.4H.sub.2O, 0.04 mg biotin, 0.8 mg
p-aminobenzoic acid, 0.5 mg resazurin, 8 ml 50% K.sub.2CO.sub.3 and
0.05% sodium thioglycolate.
[0060] All ingredients (except for the vitamin-, K.sub.2CO.sub.3--
and sodium thioglycolate solution) were mixed and divided over some
penicillin bottles (50 ml in 100 ml bottles). After this, the
bottles were flushed with a stream of N.sub.2 and sterilized (for
15 minutes at 121.degree. C.). Subsequently, a sterilized and
O.sub.2-free mixture of the other compounds was added. The pH was
checked and, if needed, additional sterile K.sub.2CO.sub.3 solution
was added to adjust the pH to about pH 6.4.
[0061] For larger scale (500 ml cultures) the same procedure was
followed, except for the procedure for the addition of crotonate
and FeSO.sub.4. According to Arch. Microbiol, 127, 279-287 (Bader,
J. et al. (1980)) the amount of enoate reductase increases if an
optimal cultivation procedure is followed i.e. starting with 35 mM
crotonate instead of 70 mM and 1.8*10.sup.-5 M FeSO.sub.4. When the
culture becomes stationary, 35 mM crotonate and 2*10.sup.-5 M
FeSO.sub.4 are added. The best time to harvest the cells is 12 h
after stationary growth phase.
II.3 Medium for E. coli TOP10 Clones:
[0062] A rich medium, Luria Bertani medium (LB-medium; also called
Luria broth or Lenox broth; containing per I: 10 g bacto tryptone,
5 g yeast extract and 5 g NaCl), under N.sub.2 atmosphere, was used
for cultivation of E. coli TOP10/pBAD-Ctyr(1)-enr-DEST, E. coli
TOP10/pBAD-Mther(1)-enr-DEST, and E. coli TOP10/pBAD-nemA_Eco. Each
medium contains an appropriate antibiotic, as indicated in part III
below.
11.4 Cultivation Conditions:
[0063] C. tyrobutyricum DSM1460 was cultivated, under anaerobic
conditions (N.sub.2 atmosphere), on selective medium (see
above).
[0064] M. thermoacetica DSM1974 was cultivated, under anaerobic
conditions (N.sub.2 atmosphere), on non-selective (PYG) medium (see
above).
[0065] C. tyrobutyricum DSM1460 was incubated at 37.degree. C., and
Moorella thermoacetica DSM1974 at 55-60.degree. C.
[0066] E. coli TOP10/pBAD-Ctyr(1)-enr-DEST and E. coli
TOP10/pBAD-Mther(1)-enr-DEST were cultivated under anaerobic
conditions (N.sub.2 atmosphere), at 28.degree. C.
[0067] E. coli TOP10/pBAD-nemA_Eco was cultivated under aerobic
conditions, at 28.degree. C.
III Construction of Vectors and Plasmids
III.1 General Procedures
[0068] Standard molecular cloning techniques such as plasmid DNA
isolation, gel electrophoresis, enzymatic restriction modification
of nucleic acids, E. coli transformation etc. were performed as
described by Sambrook, J., Fritsch, E. F., and Maniatis, T.
Molecular Cloning: A Laboratory Manual.2nd, ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989 or the supplier's manual. Standard molecular
cloning enzymes such as restriction endonucleases, T4 DNA ligase,
etc. were obtained from Invitrogen (Breda, The Netherlands) unless
otherwise stated. Synthetic oligodeoxynucleotides were obtained
from Sigma-Genosys (Cambridge, UK), and Invitrogen (Paisley,
Scotland, UK). DNA sequence analyses were performed by BaseClear
(Leiden, The Netherlands) using the chain termination method with
dye-labeled dideoxy-terminators.
III.2 Construction of Gateway.TM. Destination Vector
pBAD/Myc-His-DEST
[0069] Destination vector pBAD/Myc-His-DEST, that was used for the
expression of the enoate reductase genes from Clostridium
tyrobutyricum DSM1460 and Moorella thermoacetica DSM1974 in E. coli
as well as for the N-ethylmaleimide reductase gene (nemA) from
Escherichia coli K12 in E. coli TOP10, was prepared by introducing
a cat/ccdB cassette into the commercially available E. coli
expression vector pBAD/Myc-His C. The cat/ccdB cassette was
amplified by PCR using
TABLE-US-00002 [SEQ ID: No.1] 5'-
AAGAAGACCGGATCCTACCTGACGCTTTTTATCGCAACTCTC-
TACTGTTTCTCCATACCCGTTTTTTGGGCTAACACAAGTTTGT- ACAAAAAAGCTGAAC-3'
as forward primer (with promoter sequence double underlined, Bpi I
recognition and cleavage site underlined and attR sequences in
italics), and
TABLE-US-00003 [SEQ ID. No.2] 5'-
TTGTTCTACGTAACCACTTTGTACAAGAAAGCTGAAC-3'
as reverse primer (with SnaB I cleavage site underlined and attR
sequences in italic), and vector pDEST15 (Invitrogen) as template.
The PCR, which was performed with Expand High Fidelity polymerase
(Roche Applied Science, Mannheim, Germany) according to the
supplier's protocol, yielded a single fragment. Correct size (1792
bp) of the amplified fragment was confirmed by agarose gel
electrophoresis. After purification of the amplified fragment from
a preparative agarose gel with the QIAquick Gel Extraction Kit
(QIAGEN GmbH, Hilden, Germany), the fragment was digested to
completion with Bpi I (MBI Fermentas, St.Leon-Rot, Germany)
(resulting in a overhang complementary to BamH I) and SnaB I (New
England Biolabs, Frankfurt, Germany) and ligated with T4 DNA ligase
into the E. coli expression vector pBAD/Myc-His C (Invitrogen),
which had been digested with BamH I and SnaB I. The ligation mix
was subsequently used to transform Chemically Competent E. coli
DB3.1 cells (Invitrogen). Recombinant cells were selected by
plating the whole transformation mixture on 2*TY plates containing
35 .mu.g/ml chloramphenicol followed by overnight incubation at
37.degree. C. After isolation of the recombinant plasmid from three
individual colonies, the inserts were sequenced. One of these
clones proved to contain the desired insert, and was named
pBAD/Myc-His-DEST. Although 7 aberrations were observed between the
nucleotide sequence of the sequenced part of plasmid
pBAD/Myc-His-DEST and the reference sequence
(Invitrogen--nucleotide sequence of pDEST15), all the essential
features (chloramphenicol resistance, ccdB selection and attR
recombination) of pBAD/Myc-His-DEST were fully functional. III.3
Construction of Plasmid pBAD-Ctyr(1)-enr-DEST
[0070] The C. tyrobutyricum enoate reductase gene was cloned into
E. coli expression vector pBAD/Myc-His-DEST using PCR and
Gateway.TM. Technology (Invitrogen Corp., Carlsbad, Calif., USA)
for cloning. The enoate reductase open reading frame was first PCR
amplified using
TABLE-US-00004 [SEQ ID: No.3] 5'-
GGGACAAGTTTGTACAAAAAAGCAGGCTAGGAGGAATTAACC-
ATGAAAAACAAATCTTTATTTGAACC-3'
as forward primer (with Shine-Delgarno site underlined, ATG start
codon in italic and attB1 site double underlined) and
TABLE-US-00005 [SEQ ID: No.4] 5'-
GGGGACCACTTTGTACAAGAAAGCTGGGTCTAACAGTTAAGT- CCAATTTCATTTCC-3'
as reverse primer (with stop codon in italics and attB2 site double
underlined), and genomic DNA as template. The start codon was
changed (GTG towards ATG).
[0071] The genomic DNA was isolated following a universal protocol
using Promega products. For this, 50 ml selective crotonate medium
was inoculated with C. tyrobutyricum, followed by subsequent growth
overnight at 28.degree. C. During the last half h of this growth
carbenicillin (final concentration 200 .mu.g/ml) was added to
weaken the cell wall. All cells were harvested by centrifugation,
and the received pellet was resuspended in 2.5 ml 50 mM Tris-HCl,
pH 8.0 containing 50 mM EDTA. After addition of 50 .mu.l lysozyme
(100 mg/ml) and 12.5 .mu.l proteinase K (20 mg/ml) the suspension
was incubated for 30 minutes at 37.degree. C. Addition of 3 ml
Nuclei Lysis Solution (Promega Corporation, Madison, USA) followed
by incubation for 15 minutes at 80.degree. C. led to complete
lysis. After RNase treatment (final concentration of 4 .mu.g/ml)
incubated for 30 minutes at 37.degree. C., 1 ml Protein
Precipitation Solution (Promega Corporation, Madison, USA) was
added, and the solution was vortexed for 20 seconds and incubated
on ice for 15 minutes. After centrifugation (15 minutes at
4000.times.g, 4.degree. C.), the supernatant was transferred to a
mixture of 0.1 volumes NaAc (3M, pH 5) and 2 volumes absolute
ethanol. The precipitated DNA was collected by centrifugation
(14000.times.g for 15 minutes at 4.degree. C.). Finally, the pellet
was dissolved in 1 ml 10 mM Tris-HCl (pH 8).
[0072] The PCR, which was performed with PCR Supermix High Fidelity
(Invitrogen) according to the supplier's protocol, yielded a single
fragment. Correct size (2076 bp) of the amplified fragment was
confirmed by agarose gel electrophoresis.
[0073] After purification of the amplified fragment PCR
purification kit of QIAGEN GmbH, the fragment was used as a
substrate for the so-called BP in-vitro recombination reaction,
which was performed according to the Gateway.TM. manual of the
supplier (Invitrogen). Recombination between the attB-PCR fragment
and the pDONR201 Donor Vector and subsequent transformation of the
obtained mixture into E. coli TOP10 competent cells (Invitrogen)
resulted in the ENTRY clone pDONR-Ctyr(1)enr. Recombinant cells
were selected by plating the whole transformation mixture on LB
plates containing 50 .mu.g/ml of kanamycin, followed by cultivation
at 20.degree. C. over the weekend. All colonies were collected from
the LB agar plate and plasmid DNA was isolated using the QIAprep
Spin Miniprep Kit (QIAGEN GmbH).
[0074] Subsequently, the enoate reductase containing PCR fragment
was introduced in Destination vector pBAD/Myc-His-DEST (vide infra)
via the so-called LR in-vitro recombination reaction using a
mixture of pDONR-Ctyr(1)enr clones and pBAD/Myc-His-DEST. Also this
reaction was performed according to the supplier's procedure. The
recombination mix was used to transform One Shot.TM. Chemically
Competent E. coli TOP10 Cells (Invitrogen). Recombinant cells were
selected by plating the whole transformation mixture on LB agar
plates containing 100 .mu.g/ml carbenicillin followed by overnight
incubation at 28.degree. C. After overnight cultivation of 16
colonies in LB medium containing 100 .mu.g/ml carbenicillin,
plasmid DNA was isolated using the QIAprep Spin Miniprep Kit
(QIAGEN GmbH). Digestion with restriction enzymes Acc I and Rsr II,
respectively, proved that 11 of the 16 tested colonies contained
the desired recombinant plasmid pBADCtyr(1)enr-DEST.
[0075] A single colony of strain E. coli TOP10/pBAD-Ctyr(1)enr-DEST
was used to inoculate under N.sub.2 atmosphere 5 ml LB medium
supplemented with 50 mM potassium phosphate and 100 .mu.g/ml
carbenicillin. After overnight growth, 2.5 ml of this preculture
was used to inoculate 500 ml of the same medium under N.sub.2
atmosphere. When, after a few h incubation at 28.degree. C., an
OD.sub.620 nm of 0.4 was reached, 0.005% arabinose was added to
start the induction. After overnight incubation at 28.degree. C.,
cells were harvested via centrifugation (10 min. at 4000.times.g,
4.degree. C.). After resuspending the cell pellets in oxygen-free
potassium phosphate buffer (100 mM, pH 7.0) with about one weight
volume buffer, cell pellets were stored at -20.degree. C., until
use in bioconversion reactions.
III.4 Construction of Plasmid pBAD-Mther(1)-enr-DEST
[0076] The Moorella thermoacetica enoate reductase gene was
subcloned into E. coli expression vector pBAD/Myc-His-DEST using
PCR and Gateway.TM. Technology (Invitrogen). The enoate reductase
open reading frame was first PCR amplified using
TABLE-US-00006 [SEQ ID: No.5] 5'-
GGGACAAGTTTGTACAAAAAAGCAGGCTAGGAGGAATTAACC-
ATGGTAGCCTATACCAGACTTTTTG-3'
as forward primer (with Shine-Delgarno site underlined, ATG start
codon in italic and attB1 site double underlined, and
TABLE-US-00007 [SEQ ID: No.6] 5'-
GGGGACCACTTTGTACAAGAAAGCTGGGTCTAAATCCCTCGCCCTA CCTC-3'
as reverse primer (with stop codon in italics and attB2 site double
underlined), and genomic DNA is template. The start codon was
changed (GTG towards ATG).
[0077] The genomic DNA was isolated following a universal protocol
using Promega products. For this, Moorella thermoacetica was
isolated from glycerol stock made after growth on PYG medium. All
cells were harvested by centrifugation, and the received pellet was
resuspended in 0.25 ml 50 mM Tris-HCl, pH 8.0 containing 50 mM
EDTA. After addition of 0.5 .mu.l lysozyme (100 mg/ml) and 1.25
.mu.l proteinase K (20 mg/ml) the suspension was incubated for 30
minutes at 37.degree. C. Addition of 0.3 ml Nuclei Lysis Solution
(Promega Corporation, Madison, USA) followed by incubation for 15
minutes at 80.degree. C. led to complete lysis. After RNase
treatment (final concentration of 4 .mu.g/ml) and incubation for 30
minutes at 37.degree. C., 1 ml Protein Precipitation Solution
(Promega Corporation, Madison, USA) was added, and the solution was
vortexed for 20 seconds and incubated on ice for 15 minutes. After
centrifugation (15 minutes at 4000.times.g, 4.degree. C.), the
supernatant was transferred to a mixture of 0.1 volumes NaAc (3M,
pH 5) and 2 volumes absolute ethanol. The precipitated DNA was
collected by centrifugation (at 14000.times.g for 15 minutes; at
4.degree. C.). Finally, the pellet was dissolved in 0.05 ml 10 mM
Tris-HCl (pH 8).
[0078] The PCR, which was performed with PCR Supermix High Fidelity
(Invitrogen) according to the supplier's protocol, yielded not in
enough fragments. However, after a second PCR enough PCR fragments
were received. Furthermore, the correct size (2045 bp) of the
amplified fragment was confirmed by agarose gel
electrophoresis.
[0079] After purification of the amplified fragment PCR
purification kit of QIAGEN GmbH, the fragment was used as a
substrate for the so-called BP in-vitro recombination reaction,
which was performed according to the Gateway.TM. manual of the
supplier (Invitrogen). Recombination between the attB-PCR fragment
and the pDONR201 Donor Vector and subsequent transformation of the
obtained mixture into E. coli TOP10 competent cells (Invitrogen)
resulted in the ENTRY clone pDONR-Mther(1)enr. Recombinant cells
were selected by plating the whole transformation mixture on LB
plates containing 50 .mu.g/ml of kanamycin, followed by cultivation
at 20.degree. C. over the weekend. All colonies were collected from
the LB agar plate and plasmid DNA was isolated using the QIAprep
Spin Miniprep Kit (QIAGEN GmbH).
[0080] Subsequently, the enoate reductase containing PCR fragment
was introduced in Destination vector pBAD/Myc-His-DEST (vide infra)
via the so-called LR in-vitro recombination reaction using a
mixture of pDONR-Mther(1)enr clones and pBAD/Myc-His-DEST. Also
this reaction was performed according to the supplier's procedure.
The recombination mix was used to transform One Shot.TM. Chemically
Competent E. coli TOP10 Cells (Invitrogen). Recombinant cells were
selected by plating the whole transformation mixture on LB agar
plates containing 100 .mu.g/ml carbenicillin followed by overnight
incubation at 28.degree. C. After overnight cultivation of 16
colonies in LB medium containing 100 .mu.g/ml carbenicillin,
plasmid DNA was isolated using the QIAprep Spin Miniprep Kit
(QIAGEN GmbH). Digestion with restriction enzymes XmaI and BamHI,
respectively, proved that 4 of the 16 tested colonies contained the
desired recombinant plasmid pBAD-Mther(1)enr-DEST.
[0081] A single colony of strain E. coli
TOP10/pBAD-Mther(1)enr-DEST was used to inoculate under N.sub.2
atmosphere 5 ml LB medium supplemented with 50 mM potassium
phosphate and 100 .mu.g/ml carbenicillin. After overnight growth,
2.5 ml of this preculture was used to inoculate 500 ml of the same
medium under N.sub.2 atmosphere. When, after a few h incubation at
28.degree. C., an OD.sub.620 nm of 0.4 was reached, 0.005%
arabinose was added to start the induction. After overnight
incubation at 28.degree. C., cells were harvested via
centrifugation (10 min. at 4000.times.g, 4.degree. C.). After
resuspending the cell pellets in oxygen-free potassium phosphate
buffer (100 mM, pH 7.0) with about one weight volume buffer, cell
pellets were stored at -20.degree. C., until use in bioconversion
reactions.
III.5 Construction of Plasmid pBAD-nemA_Eco
[0082] The Escherichia coli K12 (strain W3110) nemA gene (accession
number: D86931) for N-ethylmaleimide reductase was cloned into E.
coli expression vector pBAD/Myc-His-DEST using PCR and Gateway.TM.
Technology (Invitrogen). The nemA open reading frame was first PCR
amplified using
TABLE-US-00008 [SEQ ID: No.7] 5'-
GGGGACAAGTTTGTACAAAAAAGCAGGCTAGGAGGAATTAACC
ATGTCATCTGAAAAACTGTATTCCCC-3'
as forward primer (with Shine-Delgarno site underlined, ATG start
codon in italic and attB1 site double underlined, and
TABLE-US-00009 [SEQ ID: No.8] 5'-
GGGGACCACTTTGTACAAGAAAGCTGGGTTTACAACGTCGGGTAAT CGGTATAGC-3'
as reverse primer (with stop codon in italics and attB2 site double
underlined), and genomic DNA of Escherichia coli K12 (strain W3110)
as template.
[0083] The PCR, performed with AccuPrime Pfx DNA Polymerase
(Invitrogen) according to the supplier's protocol, yielded a single
product fragment. Correct size (1169 bp) of the amplified fragment
was confirmed by agarose gel electrophoresis.
[0084] After purification of the amplified fragment using the PCR
purification kit of QIAGEN GmbH, the fragment was used as a
substrate for the so-called BP in-vitro recombination reaction,
which was performed according to the Gateway.TM. manual of the
supplier (Invitrogen). Recombination between the attB-PCR fragment
and the pDONR201 Donor Vector and subsequent transformation of the
obtained mixture into E. coli DH5.alpha. competent cells
(Invitrogen) resulted in the ENTRY clone pENTR-nemA_Eco.
Recombinant cells were selected by plating the whole transformation
mixture on LB plates containing 50 .mu.g/ml of kanamycin, followed
by cultivation at 20.degree. C. over the weekend. All colonies were
collected from the LB agar plate and plasmid DNA was isolated using
the QIAprep Spin Miniprep Kit (QIAGEN GmbH).
[0085] Subsequently, the nemA containing fragment was introduced in
Destination vector pBAD/Myc-His-DEST (vide infra) via the so-called
LR in-vitro recombination reaction using a mixture of
pENTR-nemA_Eco clones and pBAD/Myc-His-DEST. Also this reaction was
performed according to the supplier's procedure. The recombination
mix was used to transform One Shot.TM. Chemically Competent E. coli
TOP10 Cells (Invitrogen). Recombinant cells were selected by
plating the aliquots of the transformation mixture on LB agar
plates containing 100 .mu.g/ml carbenicillin followed by overnight
incubation at 28.degree. C. After overnight cultivation of 3 clones
in LB medium containing 100 .mu.g/ml carbenicillin, plasmid DNA was
isolated using the QIAprep Spin Miniprep Kit (QIAGEN GmbH).
Digestion with restriction enzymes EcoRV and FspI, respectively,
proved that all tested colonies contained the desired recombinant
plasmid pBAD-nemA_Eco.
[0086] Additionally these clones of strain E. coli
TOP10/pBAD-nemA_Eco were used to inoculate 50 ml LB medium
supplemented with 100 .mu.g/ml carbenicillin in sterile 500 ml
Erlenmeyer flasks to a cell density of OD.sub.620 of 0.05. These 50
ml cultures were incubated at 28.degree. C. on an orbital shaker
with 180 rotations per minute (rpm). At an OD.sub.620 nm of 0.6,
0.02% arabinose was added to start the induction. After overnight
incubation at 28.degree. C., cells were harvested via
centrifugation (10 min. at 4000.times.g, 4.degree. C.). After
resuspending the cell pellets in 2 ml potassium phosphate buffer
(100 mM, pH 7.0), cell pellets were stored at -20.degree. C. in 1
ml portions until further use.
[0087] Cells were subsequently disrupted by sonification (using an
MSE Soniprep 150 with a small nozzle; 10 seconds of sonification
with an altitude of 5-10 microns followed by 10 seconds break. The
total cycle lasted 5 minutes. During this procedure the solution
was kept cool using an acetone-ice bath). The disrupted cells were
centrifuged (16,000.times.g for one hour) and the cell free extract
was stored at 4.degree. C. until the assay for reduction of 6-ACA
was performed.
IV Analytical Methods
[0088] Depending of the components to be analysed, some different
HPLC (High Performance Liquid Chromatography) methods, and LC-MS
(Liquid Chromatography coupled with Mass Spectrometry), using
multiple stage MS techniques as MS.sup.2-SRM (Selective Reaction
Monitoring) and/or MS.sup.3-CRM (Consecutive Reaction Monitoring),
were used, the conditions of which are being shown below.
IV.a. HPLC-Analysis for Measuring of 6-AHEA and 6-ACA: Column:
Prevail C18 from Alltech (250 mm.times.4.6 mm I.D., 5.mu.) Column
temperature: Ambient (.+-.22.degree. C.) Flow: 1.0 ml/min.
Injection volume: 20 or 100 .mu.l (higher sensitivity of the method
at 100 .mu.l) Run time: 20 to 40 min. [0089] (depending on the
background of the matrix, i.e. longer run time in case more side
peaks present) Eluent: 100 mM perchloric acid in water pH 1.0
[0090] (16.3 g 70% perchloric acid/liter water)
Sample Solution: Eluent
[0091] Detection: Post column reaction/fluorescence (simultaneously
at .lamda.ex 338 nm/.lamda.em>420 nm) (Post column reaction with
ortho-phthalic aldehyde/mercaptoethanol (OPA/MCE), ambient
temperature, at 1.0 ml/min.). Retention times: 14.2 minutes for
6-ACA; 11.7 minutes for 6-AHEA. IV.b1. LC-MS.sup.2-Analysis was
Used Under the Following LC-, Resp. MS-Conditions:
[0092] Equipment: LCQ ion trap mass spectrometer from Thermo
Finnigan. [0093] LC Column: 250.times.4.6 mm Prevail C18 (Alltech)
[0094] Eluent: 0.025% (v/v) formic acid in water (pH 3.2) [0095]
Flow: 1 ml/min. before entering the MS the flow is split 1:5 [0096]
Inj. Vol.: 100 .mu.l. [0097] MS Electrospray in positive ion mode:
in LC-MS.sup.2-SRM mode (a highly selective and sensitive
analysis), with MS conditions as follows:
TABLE-US-00010 [0097] Ionization: Positive ion electrospray Source
conditions: sheath gas: 60 aux/sweep gas: 25 spray voltage: 5 kV
capillary temperature: 300.degree. C. capillary voltage: 5 V tube
lens offsett: 25 V Scan event: parent mass: 132.0 isolation width:
1.1 amu norm. collision energy: 28% activation Q: 0.250 activation
energy: 30 msec. SRM range: 114, width 1.2 (113.4-114.6 amu).
IV.b2. LC-MS.sup.3-Analysis was Used (in Other Analyses, as
Indicated Below) Under the Following LC-, Resp. MS-Conditions,
Differing from those Mentioned in IV.b1.:
[0098] Equipment:: HP1100 LC system (Agilent Technologies) coupled
to a LCQ
[0099] Deca XP ion trap mass spectrometer from Thermo Finnigan.
LC Column: 50.times.4.6 mm Nucleosil 120-5 C18 (Machery&Nagel)
in series with 150.times.4 mm Atlantis dC18, 5 .mu.m (Waters)
Column temperature: ambient (+/-22.degree. C.) Eluent: 0.025% (v/v)
formic acid+1% acetonitrile in water (pH 3.2) Flow: 1 ml/min,
before entering the MS the flow is split 1:5 Inj. Vol.: 2 .mu.l. MS
CRM (Consecutive Reaction Monitoring) mode (a highly selective and
sensitive mode of analysis) was used to selectively detect the
6-ACA, with MS conditions as follows:
TABLE-US-00011 Ionization technique: positive ion electrospray
Source conditions: sheath gas: 60 aux/sweep gas: 10 spray voltage:
4 kV capillary temperature: 330.degree. C. capillary voltage: 5 V
tube lens offset: 15 V Scan mode CRM: MS.sup.1: parent mass 132.0
isolation width: 1.0 amu norm. collision energy: 26% MS.sup.2:
parent mass 114.0 isolation width: 1.0 amu norm, collision energy:
26% CRM ranges: 78.5-79.5 and 95.5-96.5 amu
[0100] Under the chromatographic conditions as described in IV.b1.
6-ACA eluted at 3.5 minutes. 6-ACA then was determined
quantitatively using the chromatographic conditions under IV.b.2
combined with the mass spectrometric SRM conditions as described
under IV.b.1. The presence of 6-ACA in positive samples from the
SRM analysis is confirmed by performing the CRM MS.sup.3 experiment
and checking the presence and intensity ratio of ions m/z 79 and
96.
IV.c. GC-MS-Analysis was Performed in Most of the Analyses, Using a
HP6890 Gas Chromatograph Under the Following GC-, Resp.
MS-Conditions:
TABLE-US-00012 GC conditions: GC type: HP6890 GC + Ata Focus
autosampler Column type: CPSIL8CB, Low Bleed/MS Column dimensions:
30 m .times. 0.25 mm i.d. .times. 1.0 .mu.l Oven temperature:
60.degree. C. (1 min) .fwdarw. 20.degree. C./ min .fwdarw.
280.degree. C. (0 min) Column flow: 1.2 ml/min, helium, constant
flow Injection type : Splitless (splitless time 1 min) Liner:
Altech (art.4928) filled with a plug of deactivated glass wool
Injection temperature: 300.degree. C. Injection volume: 0.5 .mu.l
MS conditions: MS type: HP5973 MSD MS source temperature:
230.degree. C. MS quad temperature: 150.degree. C. Aux temperature:
250.degree. C. Scan mode: SIM, m/z 113
V Bioconversions:
[0101] V.(a) Bioconversion of 6-AHEA to 6-ACA by C. tyrobutyricum;
analysis by HPLC:
[0102] O.sub.2-free buffer (100 mM potassium phosphate, pH 6.0) was
transferred into penicillin bottles under a stream of nitrogen in a
glove box. The bottles were closed with butyl rubber stoppers.
After this, reactions were started by injection of substrate 6-AHEA
(100 mM stock solution; adjusted to pH 6) and/or cells (cell
pellets of C. tyrobutyricum stored at -20.degree. C., and
resuspended in 100 mM potassium phosphate, pH 7) through the
stopper. Finally, NADH was added (110 .mu.l of a 5 mM stock
solution). The reaction mixture (total volume of 2.3 ml) consisted
of potassium phosphate buffer (100 mM, pH 6.0), 5 mM
6-amino-hex-2-enoic acid and 0.23 mM NADH.
[0103] Furthermore, a blanc cell mixture (without substrate) and a
chemical blanc mixture (without cells) were made. All reaction
bottles were incubated at 37.degree. C. At different time intervals
0.5 ml samples were taken, from which cells were subsequently
removed by centrifugation (Eppendorf 5415 C centrifuge, 10 minutes,
max. rpm, 4.degree. C.) and the samples were stored at -20.degree.
C. till analysis. Just before HPLC analysis, samples were diluted 5
to 10 times with eluent (100 mM perchloric acid in water pH 1.0).
Results are summarized in Table 1.
TABLE-US-00013 TABLE 1 6-ACA formation by bioreduction of 6-AHEA by
Clostridium tyrobutyricum cells. Time (h) Concentration 6-ACA (ppm)
0 <0.1 24 1.0 48 1.7
[0104] Table 1 shows that Clostridium tyrobutyricum can perform the
bioreduction of 6-AHEA to 6-ACA. The concentration of 6-ACA
increases in time. No 6-ACA could be observed in the blanc cell
mixture or in the chemical blanc mixture. The chemical identity of
the product 6-ACA was confirmed with LC-MS-MS using selective
reaction monitoring at the source conditions and scan event as
described in IV.b.
V.(b) Bioconversion of 6-AHEA to 6-ACA by E. coli
pBAD-Ctyr(1)-enr-DEST and E. coli pBAD-Mther(1)-enr-DEST; Analysis
by HPLC and LC-MS-MS SRM:
[0105] An O.sub.2-- free solution of 6-AHEA (20 mM in 100 mM
potassium phosphate buffer, pH 6.0) was transferred into penicillin
bottles under a stream of nitrogen in a glove box. The bottles were
closed with butyl rubber stoppers. Hereafter, reactions were
started by injection of cells (cell pellets stored at -20.degree.
C., resuspended in 100 mM potassium phosphate buffer pH 7.0) and
NADH solution through the stopper. The reaction mixture (having a
total volume of about 3 ml) contained potassium phosphate buffer
(100 mM, pH 6.0), 20 mM 6-AHEA and 0.23 mM NADH.
[0106] Furthermore, a blanc cell mixture (without substrate) and a
chemical blanc mixture (without cells) were performed. After 44 h
of incubation 0.5 ml samples were taken, from which cells were
subsequently removed by centrifugation (Eppendorf 5415 R
centrifuge, 14,000 rpm, 10 min., 4.degree. C.) and the samples were
stored at -20.degree. C. till analysis. Just before HPLC analysis,
samples were diluted 5 to 10 times with HPLC eluent (100 mM
perchloric acid in water pH 1.0) and just before LC-MS-MS analysis,
samples were diluted 5 to 10 times with MS eluent (0.025% (v/v)
formic acid in water (pH 3.2)). Results are summarized in table
2.
TABLE-US-00014 TABLE 2 6-ACA formed by bioreduction of 6-AHEA by
the enoate reductase clones E. coli pBAD-Ctyr(1)-enr-DEST and E.
coli pBAD-Mther(1)-enr-DEST. 6-ACA conc. 6-ACA conc. measured
measured by LC- by HPLC MS-MS SRM Sample (ppm) (ppm) E. coli
pBAD-Ctyr(1)-enr-DEST 12 11 E. coli pBAD-Mther(1)-enr-DEST 31
29
[0107] Table 2 shows that both E. coli pBAD-Ctyr(1)-enr-DEST and E.
coli pBAD-Mther(1)-enr-DEST perform the bioreduction of 6-AHEA to
6-ACA. No 6-ACA could be observed in the blanc cell mixture or in
the chemical blanc mixture.
V.(c) Bioconversion of 6-AHEA to 6-ACA by E. coli
TOP10/pBAD-nemA_Eco; Analysis by LC-MS.sup.3 CRM
[0108] A reaction mixture consisting of 100 mM Tris-buffer, pH 7.5,
including 20 mM glucose, 5 mM 6-AHEA, 7.0 mM NADPH, 7.0 mM NADH,
and 10 U/ml glucose oxidase, was prepared. To start the
bioconversion of 6-AHEA to 6-ACA 400 .mu.l cell free extract of E.
coli TOP10/pBAD-nemA_Eco was added (total reaction volume 1 ml).
After 23 h and 48 h 250-300 .mu.l samples were taken for
LC-MS.sup.2 SRM analysis. Furthermore, a chemical blanc mixture
(without cell free extract) was incubated under the same conditions
and sampled after the same incubation times. Results are summarized
in table 3.
TABLE-US-00015 TABLE 3 6-ACA formation by bioreduction of 6-AHEA by
cell free extract of E. coli TOP10/pBAD-nemA_Eco. Time 6-ACA
concentration (in ppm) (h) measured by LC-MS.sup.3 CRM 23 0.6 48
0.9
Table 3 shows that cell free extract of E. coli TOP10/pBAD-nemA_Eco
performs the bioreduction of 6-AHEA to 6-ACA. No 6-ACA could be
observed in the chemical blanc mixture.
[0109] Confirmation of 6-ACA in these samples was carried out by
determining the presence and intensity ratio of the MS.sup.3
fragment ions with m/z 96 and 79 as determined in the CRM analysis
and comparing the ratio's with those from a calibration standard
6-ACA treated in the same manner. Results are summarized in Table
4.
TABLE-US-00016 TABLE 4 Intensity ratio's for fragment ions m/z 96
and 79 from the CRM analyses Time (h) Intensity ratio m/z 96:m/z 79
23 3 48 3 calibration sample 3
VI Biotransformation of 6-AHEA into 6-ACA; Cyclization of 6-ACA
[0110] An O.sub.2-free solution of 6-AHEA (20 mM in 100 mM
potassium phosphate buffer, pH 6.0) was transferred into penicillin
bottles under a stream of N.sub.2 in a glove box. The bottles were
closed with butyl rubber stoppers. Hereafter the biotransformation
was started by injection of cells of the enoate reductase clone E.
coli pBAD-Ctyr(1)-enr-DEST (cell pellets stored at -20.degree. C.,
resuspended in 100 mM potassium phosphate buffer, pH 7.0) and NADH
solution through the stopper. The reaction mixture, having a total
volume of about 3 ml, contained potassium phosphate buffer (100 ml,
pH 6.0), 20 mM 6-AHEA and 0.23 mM NADH.
[0111] After 44 h of incubation a sample of 0.5 ml was taken, from
which cells were removed by centrifugation (Eppendorf 5415 R
centrifuge; 14,000 rpm; 10 min.; 4.degree. C.) and the sample was
stored at -20.degree. C. until cyclization of the 6-ACA formed into
caprolactam was started by injecting the sample onto a gas
chromatograph coupled to a mass spectrometer (GC-MS as described
above). By comparing the results with those obtained with injection
onto the same gas chromatograph of a chemical blanc solution
consisting of potassium phosphate buffer (100 ml, pH 6.0), 20 mM
6-AHEA and 0.23 mM NADH the cyclization of the 6-ACA formed in the
biotransformation could be confirmed. The amount of caprolactam so
obtained was calculated at about 2.7 ppm.
Sequence CWU 1
1
81100DNAArtificial Sequenceprimer 1aagaagaccg gatcctacct gacgcttttt
atcgcaactc tctactgttt ctccataccc 60gttttttggg ctaacacaag tttgtacaaa
aaagctgaac 100237DNAArtificial Sequenceprimer 2ttgttctacg
taaccacttt gtacaagaaa gctgaac 37368DNAArtificial Sequenceprimer
3gggacaagtt tgtacaaaaa agcaggctag gaggaattaa ccatgaaaaa caaatcttta
60tttgaacc 68456DNAArtificial Sequenceprimer 4ggggaccact ttgtacaaga
aagctgggtc taacagttaa gtccaatttc atttcc 56567DNAArtificial
Sequenceprimer 5gggacaagtt tgtacaaaaa agcaggctag gaggaattaa
ccatggtagc ctataccaga 60ctttttg 67650DNAArtificial Sequenceprimer
6ggggaccact ttgtacaaga aagctgggtc taaatccctc gccctacctc
50769DNAArtificial Sequenceprimer 7ggggacaagt ttgtacaaaa aagcaggcta
ggaggaatta accatgtcat ctgaaaaact 60gtattcccc 69855DNAArtificial
Sequenceprimer 8ggggaccact ttgtacaaga aagctgggtt tacaacgtcg
ggtaatcggt atagc 55
* * * * *