U.S. patent application number 11/976019 was filed with the patent office on 2009-05-28 for method for generating hypermutable organisms.
This patent application is currently assigned to The John Hopkins University School of Medicine. Invention is credited to Luigi Grasso, Kenneth W. Kinzler, Nicholas C. Nicolaides, Philip M. Sass, Bert Vogelstein.
Application Number | 20090137427 11/976019 |
Document ID | / |
Family ID | 26899022 |
Filed Date | 2009-05-28 |
United States Patent
Application |
20090137427 |
Kind Code |
A1 |
Nicolaides; Nicholas C. ; et
al. |
May 28, 2009 |
Method for generating hypermutable organisms
Abstract
Dominant negative alleles of human mismatch repair genes can be
used to generate hypermutable cells and organisms. By introducing
these genes into cells and transgenic animals, new cell lines and
animal varieties with novel and useful properties can be prepared
more efficiently than by relying on the natural rate of mutation.
The enhanced rate of mutation can be further augmented using
mutagens. Moreover, the hypermutability of mismatch repair
deficient cells can be remedied to stabilize cells or mammals with
useful mutations.
Inventors: |
Nicolaides; Nicholas C.;
(Boothwyn, PA) ; Sass; Philip M.; (Audubon,
PA) ; Grasso; Luigi; (Philadelphia, PA) ;
Vogelstein; Bert; (Baltimore, MD) ; Kinzler; Kenneth
W.; (Bel Air, MD) |
Correspondence
Address: |
BANNER & WITCOFF, LTD.
1100 13th STREET, N.W., SUITE 1200
WASHINGTON
DC
20005-4051
US
|
Assignee: |
The John Hopkins University School
of Medicine
Baltimore
MD
|
Family ID: |
26899022 |
Appl. No.: |
11/976019 |
Filed: |
October 19, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10873114 |
Jun 23, 2004 |
7319036 |
|
|
11976019 |
|
|
|
|
09853646 |
May 14, 2001 |
6825038 |
|
|
10873114 |
|
|
|
|
60203905 |
May 12, 2000 |
|
|
|
60204769 |
May 17, 2000 |
|
|
|
60203905 |
May 12, 2000 |
|
|
|
Current U.S.
Class: |
506/26 ;
435/6.12 |
Current CPC
Class: |
C07K 14/47 20130101;
C12N 15/01 20130101; C12N 15/102 20130101; C12N 15/1024
20130101 |
Class at
Publication: |
506/26 ;
435/6 |
International
Class: |
C40B 50/06 20060101
C40B050/06; C12Q 1/68 20060101 C12Q001/68 |
Claims
1. A method for generating a mutation in a gene of interest in a
cell comprising the steps of: growing a cell comprising (a) a gene
of interest and (b) a polynucleotide encoding a polypeptide
comprising the N-terminal 133 amino acids of PMS2, said
polynucleotide operably linked to a promoter, wherein said
polypeptide is capable of inhibiting mismatch repair; testing the
cell to determine whether the gene of interest harbors a mutation
that results in a detectable phenotype; and restoring mismatch
repair activity to said cell.
2. The method of claim 1 wherein said polynucleotide encodes
PMS2.
3. The method of claim 1 wherein said polynucleotide encodes
PMS2-134.
4. The method of claim 1 wherein said cells are prokaryotic
cells.
5. The method of claim 1 wherein said cells are eukaryotic
cells.
6. The method of claim 5 wherein said eukaryotic cells are
mammalian cells.
7. The method of claim 1 further comprising the step of treating
said cell with a mutagen.
8. The cell produced according to the method of claim 1.
9. A method for generating a library of genetically stable,
hypermutated cells comprising: expressing in cells a polynucleotide
encoding a polypeptide comprising the N-terminal 133 amino acids of
PMS2, wherein said expression inhibits mismatch repair of said
cells, and restoring mismatch repair activity to said cells,
thereby producing a library of genetically stable, hypermutated
cells.
10. The method of claim 9 wherein said polynucleotide encodes
PMS2.
11. The method of claim 9 wherein said polynucleotide encodes
PMS2-134.
12. The method of claim 9 wherein said cells are prokaryotic
cells.
13. The method of claim 9 wherein said cells are eukaryotic
cells.
14. The method of claim 13 wherein said eukaryotic cells are
mammalian cells.
15. The method of claim 9 further comprising the step of treating
said cells with a mutagen.
16. A method for generating a genetically altered cell line
comprising: introducing a polynucleotide encoding a polypeptide
comprising the N-terminal 133 amino acids of PMS2, said
polynucleotide operably linked to a promoter, wherein said
polypeptide is capable of inhibiting mismatch repair, in a
population of cells in culture, thereby inhibiting mismatch repair
in said cells, separating said population into individual members
of the population, identifying members of the population comprising
a mutation in a gene of interest, restoring mismatch repair
activity to said members of the population comprising a mutation in
the gene of interest, and expanding said members comprising a
mutation in the gene of interest, thereby generating a genetically
altered cell line.
17. The method of claim 16 wherein said polynucleotide encodes
PMS2.
18. The method of claim 16 wherein said polynucleotide encodes
PMS2-134.
19. The method of claim 16 wherein said cells are prokaryotic
cells.
20. The method of claim 16 wherein said cells are eukaryotic
cells.
21. The method of claim 20 wherein said eukaryotic cells are
mammalian cells.
22. The method of claim 16 further comprising the step of treating
said cell with a mutagen.
23. The genetically altered cell line produced according to the
method of claim 16.
Description
[0001] This application is a continuation application of Ser. No.
10/873,114 filed Jun. 23, 2004, which is a divisional application
of Ser. No. 09/853,646 filed May 14, 2001, which claims the benefit
of 60/203,905 filed May 12, 2000 and 60/204,769 filed May 17, 2000,
the disclosures of which are explicitly incorporated herein.
TECHNICAL FIELD OF THE INVENTION
[0002] The invention is related to the area of mismatch repair
genes. In particular it is related to the field of mutagenesis.
BACKGROUND OF THE INVENTION
[0003] Within the past four years, the genetic cause of the
Hereditary Nonpolyposis Colorectal Cancer Syndrome (HNPCC), also
known as Lynch syndrome II, has been ascertained for the majority
of kindreds affected with the disease (13). The molecular basis of
HNPCC involves genetic instability resulting from defective
mismatch repair (MMR). Many genes have been identified in rodents
and humans that encode for proteins that appear to participate in
the MMR process, including the mutS homologs GTBP, hMSH2, and hMSH3
and the mutL homologs hMLH1, hPMS1, and hPMS2
(2,7,11,17,20,21,22,24). Germ line mutations in four of these genes
(hMSH2, hMLH1, hPMS1, and hPMS2) have been identified in HNPCC
kindreds (2,11,13,17,24). Though the mutator defect that arises
from the MMR deficiency can affect any DNA sequence, microsattelite
sequences are particularly sensitive to MMR abnormalities (14).
Microsattelite instability is therefore a useful indicator of
defective MMR. In addition to its occurrence in virtually all
tumors arising in HNPCC patients, Microsattelite instability is
found in a small fraction of sporadic tumors with distinctive
molecular and phenotypic properties (27).
[0004] HNPCC is inherited in an autosomal dominant fashion, so that
the normal cells of affected family members contain one mutant
allele of the relevant MMR gene (inherited from an affected parent)
and one wildtype allele (inherited from the unaffected parent).
During the early stages of tumor development, however, the wildtype
allele is inactivated through a somatic mutation, leaving the cell
with no functional MMR gene and resulting in a profound defect in
MMR activity. Because a somatic mutation in addition to a germline
mutation is required to generate defective MMR in the tumor cells,
this mechanism is generally referred to as one involving two hits,
analogous to the biallelic inactivation of tumor suppressor genes
that initiate other hereditary cancers (11,13,25). In line with
this two hit mechanism, the non-neoplastic cells of HNPCC patients
generally retain near normal levels of MMR activity due to the
presence of the wildtype allele.
[0005] A wide range of organisms with defective MMR have been found
to have widespread genetic mutations throughout their genome. In
all cases, these organisms have germline mutations within both
copies of a particular MMR gene. Recently, work done by Nicolaides
et al have shown that a decrease in MMR can be achieved within
cells from higher order organisms by introducing a dominant
negative allele of a MMR gene. These data suggest that the use of
such an approach can generate genetically altered organisms to
produce new output traits. There is a need in the art for
additional methods with which to generate genetic diversity.
SUMMARY OF THE INVENTION
[0006] It is an object of the present invention to provide a method
for rendering cells hypermutable.
[0007] It is another object of the present invention to provide
genetically altered cell lines.
[0008] It is another object of the present invention to provide
phenotypically altered cell lines.
[0009] It is yet another object of the present invention to provide
a method to produce an enhanced rate of genetic hypermutation in a
cell.
[0010] It is a further object of the invention to provide a method
of mutating a gene(s) of interest in a cell.
[0011] It is a further object of the invention to claim composition
of matter for a genetically altered bacterial purine
phosphorlyase.
[0012] It is a further object of the invention to claim composition
of matter for a genetically altered bacterial purine phosphorlyase
as a diagnostic tool for monitoring mismatch repair deficiency of a
eucaryotic cell.
[0013] It is a further object of the invention to claim composition
of matter for a generating genetically altered genes by
incorporating a polymononucleotide tract to measure for altered
mismatch repair in eucaryotic cells.
[0014] Yet another object of the invention is to provide a method
of creating cells with new phenotypes.
[0015] Yet another object of the invention is to provide a method
of creating cells with new phenotypes and a stable genome.
[0016] Yet another object of the invention is to provide a method
of regulating the genetic stability of a cell or organism's
genome.
[0017] It is a further object of the invention to generate
hypermutable cell lines using inducible vectors containing dominant
negative mismatch repair gene mutants.
[0018] It is a further object of the invention to screen for
hypermutable cell lines containing inducible vectors with dominant
negative mismatch repair gene mutants under induced gene expression
conditions.
[0019] It is a further object of the invention to screen for
hypermutable cell lines containing inducible vectors with dominant
negative mismatch repair gene mutants under induced gene expression
conditions for altered gene structure and/or new phenotypes.
[0020] It is a further object of the invention to turn off
expression of a dominant negative MMR gene in cells containing
structurally altered target genes and/or new phenotypes to restore
genomic stability.
[0021] It is a further object of the invention to screen
hypermutable cell lines containing an inducible vector comprising a
dominant negative mismatch repair gene mutant under inducing
conditions in the presence of chemical mutagens or ionizing
radiation for structurally altered target genes and/or new
phenotypes. Cells containing altered gene structure and/or new
phenotype are then removed from inducer molecule and genetic
stability is restored.
[0022] These and other objects of the invention are provided by one
or more of the embodiments described below. In one embodiment of
the invention, a method for making a hypermutable cell is provided.
A polynucleotide encoding a dominant negative allele of a mismatch
repair gene is introduced into a cell. The cell becomes
hypermutable as a result of the introduction of the gene.
[0023] In another embodiment of the invention, an isolated
hypermutable cell will be provided. The cell comprises a dominant
negative allele of a mismatch repair gene. The cell is exposed to
DNA alkylating agents. The cell exhibits an enhanced rate of
hypermutation.
[0024] In another embodiment of the invention, a method is provided
for introducing a mutation into a gene of interest. A
polynucleotide encoding a dominant negative allele of a mismatch
repair gene is introduced into a cell. The cell becomes
hypermutable as a result of the introduction of the gene. The cell
further comprises a gene of interest. The cell is grown. The cell
is tested to determine whether the gene of interest harbors a
mutation.
[0025] In another embodiment of the invention, a method is provided
for inserting a polymononucleotide tract in a gene to measure for
mismatch repair activity of a eucaryotic cell. A polynucleotide
tract is inserted out-of-frame into the coding region of a gene or
a cDNA. The gene is introduced into a cell. The polymononucleotide
tract is altered by mismatch repair deficiency. An in-frame altered
gene is produced.
[0026] In another embodiment of the invention, a method is provided
for producing new phenotypes of a cell. A polynucleotide encoding a
dominant negative allele of a mismatch repair gene is introduced
into a cell. The cell becomes hypermutable as a result of the
introduction of the gene. The cell is grown. The cell is tested for
the expression of new phenotypes. Another embodiment of the
invention is the use of cells containing an inducible vector
consisting of a dominant negative mismatch repair gene mutants
under inducing conditions in the presence of chemical mutagens or
ionizing radiation for altered target genes and/or new phenotypes.
Cells containing altered gene structure and/or new phenotype are
then removed from inducer molecule and genetic stability is
restored. The cells are now used for commercial properties such as
but not limited to recombinant manufacturing and/or gene
discovery.
[0027] Another embodiment of the invention is the use of MMR
defective cells containing a gene of interest in the presence of
chemical mutagens or ionizing radiation for altered target genes
and/or new phenotypes. Cells containing altered gene structure
and/or new phenotype are then stably transduced with a wildtype MMR
complementing gene and genetic stability is restored. The cells are
now used for recombinant manufacturing or gene discovery.
[0028] In another embodiment of the invention, a method is provided
for restoring genetic stability in a cell with defective mismatch
repair gene. The activity of the mismatch repair process is
restored and its genome is stable.
[0029] In another embodiment of the invention, a method is provided
for restoring genetic stability in a cell with defective mismatch
repair activity and a newly selected phenotype. The MMR deficiency
can occur through the inactivation of endogenous MMR genes via
genomic mutations or through the introduction of an eucaryotic
expression vector producing a dominant negative MMR gene allele. In
the case of cells lacking endogenous MMR due to a defect in an
endogenous MMR gene, the cell is selected for a new phenotype or
altered gene, RNA, or polypeptide. The cell becomes genetically
stable through the introduction of a normal functioning MMR gene
that complements the genomic defect of the host cell. This
complementation group can include the use of any gene known to
participate in mismatch repair deficiency. In the case were the
expression of the dominant negative mismatch repair gene is used to
induce DNA hypermutability, the dominant negative MMR gene
expression will be suppressed by removal of the inducer molecule or
by knocking out the expression of the dominant negative gene allele
using standard gene knockout technology used by those skilled in
the art (Waldman, T., et. al. Cancer Res 55:5187-5190, 1995). In
any case, the cell restores its genetic stability and the new
phenotype is stable.
[0030] These and other embodiments of the invention provide the art
with methods that can generate enhanced mutability in organisms,
cells and animals as well as providing genetically altered stable
organisms cells and animals harboring potentially useful genome
alterations.
[0031] The use of a dominant negative MMR gene allele is important
in generating global mutations throughout the genome of a host
organism in a regulated fashion. While the use of dominant negative
alleles have been previously demonstrated to be capable of inducing
global mutagenesis in a wide range of hosts (bacteria, yeast,
mammals, plants) the use of inducible vectors to turn the dominant
negative MMR gene mutant on to generate genome-wide mutation
followed by selection for new biochemical output traits (e.g.,
resistance to chemical mutagens) and turning off of the dominant
negative MMR gene allele to restore genetic stability is a new
aspect of the invention. This method is now suitable for generating
genetically diverse prokaryotic, eucaryotic and mammalian cells
that can be screened for genetic mutations in genes involved in new
phenotypes. In addition, this application teaches of the use of
introducing dominant negative MMR alleles under control of
inducible expression elements into MMR proficient cells. Stable or
transiently transduced cells are then exposed to inducer molecule
resulting in expression of the dominant negative MMR gene.
Expression of the dominant negative product interferes with the
endogenous MMR machinery, thereby causing genetic instability that
leads to genetically diverse sublines. These cells are then put
under specific selective assays and screened for new phenotypes
and/or altered gene structures. After the establishment of sublines
containing altered target genes and/or new phenotypes, cells are
then rendered genetically stable by removal of the inducer molecule
and a stable cell line is now produced that contains an altered
gene and/or exhibits a new phenotype. This cell line can be used
for gene discovery, drug target discovery, recombinant gene
mutagenesis, and/or recombinant protein production.
[0032] It is well established that MMR deficient organisms are more
tolerant to DNA damaging agents such as alkylating agents or
ionizing radiation thereby leading to enhanced levels of
genome-wide or locus-specific mutagenesis. Here we teach the use of
exposing cell lines expressing dominant negative MMR under control
of an inducible expression element to DNA damaging agents that can
lead to enhanced genome wide mutagenesis. Cell lines are then
screened for mutations in target genes or screened for novel
phenotypes. Sublines with altered genes or phenotypes are then
removed from inducer agent to "turn off" the dominant negative MMR
gene allele to restore genetic stability. This cell line can be
used for gene discovery, drug target discovery, recombinant gene
mutagenesis, and/or recombinant protein production.
[0033] Finally, the use of mammalian cell lines that are naturally
defective for MMR can be used to introduce a plasmid containing a
gene of interest. The gene can be introduced and expressed
transiently or stably. The cell now grows and the structure and/or
function of the introduced gene is screened to identify those with
structural and/or functional alterations. To enhance mutation rate,
cells can be further exposed to DNA damaging agents such as but not
limited to alkylating chemical mutagens or ionizing radiation to
produce enhanced genome wide mutation rate in the host. Once a cell
line(s) containing mutations within the gene of interest are
generated, the cell is stably transduced with a gene that
complements for the endogenous MMR defect. The cell line is now
genetically stable and the cell line is suitable for producing
altered gene products for gene discovery, recombinant gene
mutagenesis, and/or recombinant protein production.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIGS. 1A and 1B. Diagrams of PMS2 expression vectors (FIG.
1A) and pCAR reporters (FIG. 1B).
[0035] FIG. 2A-2C. SH cells cotransfected with pCAR reporters and
PMS2 expression vectors after 17 days of drug selection. (FIG. 2A)
Western blots of lysates from untransfected SH cells (lane 1) or SH
cells transfected with PMS2NOT (lane 2) or PMS2 WT (lane 3). The
arrow indicates the 110 kD protein expected for hPMS2. (FIG. 2B)
Western blots of lysates from untransfected SH cells (lane 1) or SH
cells transfected with PMS2NOT (lane 2) or PMS2134 (lane 3). The
arrow indicates the 14 kD protein expected for hPMS-134. Both A and
B were probed with an antibody generated against the N terminus of
hPMS2. The upper polypeptides in A and the lower polypeptides in B
represent crossreactive hamster proteins. (FIG. 2C)
.beta.-galactosidase activity in lysates derived from SH cells
cotransfected with PMS2NOT (lane 1), PMS2WT (lane 2), or PMS2134
(lane 3) plus reporter plasmid. Relative .beta.-galactosidase
activities are defined as the ratio of .beta.-galactosidase
activity in cells transfected with pCAROF compared to that in cells
transfected with pCARIF; this normalization controlled for
transfection efficiency and controlled for .beta.-galactosidase
activity in the cells expressing the various PMS2 effector
genes.
[0036] FIGS. 3A and 3B. In situ .beta.-galactosidase activity of
pooled clones of SH cells stably transduced with the PMS2WT (FIG.
3A), or PMS2134 (FIG. 3B) expression vectors, then retransfected
with pCAROF reporter. After 17 days of drug selection, the colonies
were pooled, cultured, and stained for .beta.-galactosidase
activity. A pooled culture of PMS2134 transduced SH cells
expressing .beta.-galactosidase from pCAROF is visible in FIG. 3B.
Each of the fields illustrated is representative of that found in
triplicate experiments.
[0037] FIG. 4. Generation of inducible mammalian expression vectors
containing dominant negative mismatch repair gene alleles. The
PMS134 cDNA with or without a V5 epitope at the C-terminus was
cloned into the ecdysone-steroid regulated pIND mammalian
expression vector. The PMS134 cDNA was cloned into the unique BamHI
site of the vector in the sense orientation to the Heat shock
Minimal Promoter. The resultant vectors are referred to as
pINDPMS134V5 or pINDPMS134, respectively. The pIND vector contains
that neomycin resistance gene as selectable marker.
[0038] FIG. 5. Generation of altered gene sequences upon induction
of PMS134. Cells containing pIND empty vector or pINDPMS134 were
transfected with the pCAR-OF plasmid containing the
.beta.-galactosidase reporter plasmid with a polyCA repeat in the
N-terminus of the .beta.-gal gene, which disrupts the open reading
frame to produce a frameshift. The plasmid also contains the
hygromycin resistance gene to select for stable lines. Cells that
were G418/hygromycin resistant were expanded and grown for 10 days
with or without 1 .mu.M ecdysone. At day 14, cells were stained in
situ for foci that produced functional .beta.-gal. As shown, a
significant number (25/field) of .beta.-gal positive foci were
observed in cells grown in the presence of the steroid inducer
while little were observed in cultures grown without the inducer
molecule.
[0039] FIG. 6. Re-establishment of genetically stable cells after
selection. To determine if clones were genetically stable after
removal of chemical inducer (and subsequent shut down of dominant
negative MMR allele), pINDPMS134/pCAR-OF clones were isolated and
tested for functional .beta.-gal activity. Clones with .beta.-gal
expression were plated in 96 well plates at limiting dilution
yielding roughly 45 well with clones per dish. Clones were again
grown 14 generations (1 generation/day) with or without ecdysone
and stained for .beta.-gal activity in situ. As shown, a
significant number of .beta.-gal positive clones were observed in
cells grown in the absence of the steroid inducer (42/45 wells were
positive for .beta.-gal) while a larger number of clones lost
.beta.-gal activity under constant inducer exposure (18/45 wells
were positive for .beta.-gal). These data demonstrate the ability
to restore genetic stability in clones that have been genetically
altered in vivo via blockade of MMR.
[0040] FIG. 7. Diagram of the genetically altered purine
phosphorlyase (PNP) gene with an out-of-frame poly A tract inserted
in the N-terminus (referred to as polyPNP) (SEQ ID NO: 3). This
gene encodes for a non-functional PNP gene. When the polyA tract is
randomly altered by a defective MMR, the tract is shifted and
allows for the production of a functional PNP gene. PNP can convert
the non-toxic prodrug
9-(.beta.-D-2-deoxyerythropentofuranosyl)-6-methyl-purine (referred
to as MPD) to the toxic 6-methyl purine analog (referred to as
(MP). The construct has a hemaglutinin (HA) tag at the C-terminus
for western blot analysis. A control construct with an in-frame
polyA tract encoding a full-length polypeptide (SEQ ID NO: 4) is
shown on the bottom.
[0041] FIGS. 8A and 8B. Toxicity assay of MMR defective or
proficient cells expressing polyPNP with or without exposure to
MPD. (FIG. 8A) Graph shows that in MMR-defective cells expressing
the polyPNP gene, cells are killed in the presence of the MPD
prodrug in contrast to MMR-proficient cells. (FIG. 8B) Western blot
that shows production of a polyPNP-HA-tagged polypeptide in the MMR
defective cells in contrast to MMR-proficient cells.
[0042] FIG. 9. Toxicity assay of a MMR defective or proficient cell
line expressing polyPNP with or without exposure to MPD. The graph
shows that in MMR-defective HCT116 cells (genetically deficient for
MLH1), the introduction of a functional MLH1 gene restores the
genetic stability of the cell as indicated by the fact that the
polyPNP gene is not converted to an active form as seen in HCT116
cells transfected with a truncated (non-functional) MLH1 cDNA
(pC9MLHstop). These data demonstrate that MMR deficiency can be
complemented with a functional MMR gene (HCT116/pC9MLH1), therefore
maintaining the genomic integrity of a gene or locus that has been
altered.
[0043] FIGS. 10A and 10B. Western blot of cells transfected with an
MLH1 expression construct and the polyPNP gene. (FIG. 10A) Cell
lysates from cells transfected with the MLHstop expression vector
(lane 1) or the MLH1 vector (lane 2) were lysed and probed for MLH1
protein expression in HCT116 cells. As shown in FIG. 10A, the cells
transfected with the MLH1 full-length expression construct produced
a polypeptide of the expected molecular weight (arrow).
[0044] (FIG. 10B) Cell lysates from HCT116 cells transfected with
the MLHstop expression vector (lane 1) or the MLH1 vector (lane 2)
plus the polyPNP gene were lysed and probed for polyPNP using an
anti-HA monoclonal antibody that can detect the HA tag at the
C-terminus of the PNP protein. As shown in FIG. 10B, the cells
transfected with the MLHstop expression construct produced a
polypeptide of the expected molecular weight (arrow) in contrast to
cells transfected with the functional MLH1 cDNA, which restored
genomic stability of the cell therefore maintaining the genomic
structure of the polyPNP gene.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The inventors have discovered a method for developing
hypermutable cells by taking advantage of cells with mismatch
repair deficiency to create altered genes, RNAs, polypeptides and
cells or whole organisms with new phenotypes. Dominant negative
alleles of such genes, when introduced into cells or transgenic
animals, increase the rate of spontaneous mutations by reducing the
effectiveness of DNA repair and thereby render the cells or animals
hypermutable. Hypermutable cells or animals can then be utilized to
develop new mutations in a gene(s) to produce new output traits of
a host cell or organism. The inventors will show that the use of
chemical agents that cause damage to DNA can enhance the rate of
hypermutability in cells expressing dominant negative mismatch
repair gene alleles. The inventors also show that the selection of
altered genes and restoration of genetic stability of a host cell
or organism by restoring MMR can lead to stable biological products
consisting of altered genes, RNAs, or polypeptides.
[0046] Protein complexes in cells ranging from bacteria to
mammalian cells carry out the process of mismatch repair, also
called mismatch proofreading. A mismatch repair gene is a gene that
encodes one of the proteins of such a mismatch repair complex.
Although not wanting to be bound by any particular theory of
mechanism of action, a mismatch repair complex is believed to
detect distortions of the DNA helix resulting from
non-complementary pairing of nucleotide bases. The
non-complementary base on the newer DNA strand is excised, and the
excised base is replaced with the appropriate base which is
complementary to the older DNA strand. In this way, cells eliminate
many mutations that occur as a result of mistakes in DNA
replication.
[0047] Dominant negative alleles cause a mismatch repair defective
phenotype even in the presence of a wild-type allele in the same
cell. An example of a dominant negative allele of a mismatch repair
gene is the human gene hPMS2-134, which carries a truncation
mutation at codon 134. The mutation causes the product of this gene
to abnormally terminate at the position of the 134th amino acid,
resulting in a shortened polypeptide containing the N-terminal 133
amino acids. Such a mutation causes an increase in the rate of
mutations which accumulate in cells after DNA replication.
Expression of a dominant negative allele of a mismatch repair gene
results in impairment of mismatch repair activity, even in the
presence of the wild-type allele. Any allele which produces such
effect can be used in this invention.
[0048] Dominant negative alleles of a mismatch repair gene can be
obtained from the cells of humans, animals, yeast, bacteria, or
other organisms. Screening cells for defective mismatch repair
activity can identify such alleles. Cells from animals or humans
with cancer can be screened for defective mismatch repair. Cells
from colon cancer patients may be particularly useful. Genomic DNA,
cDNA, or mRNA from any cell encoding a mismatch repair protein can
be analyzed for variations from the wild type sequence. Dominant
negative alleles of a mismatch repair gene can also be created
artificially, for example, by producing variants of the hPMS2-134
allele or other mismatch repair genes. Various techniques of
site-directed mutagenesis can be used. The suitability of such
alleles, whether natural or artificial, for use in generating
hypermutable cells or animals can be evaluated by testing the
mismatch repair activity caused by the allele in the presence of
one or more wild-type alleles, to determine if it is a dominant
negative allele.
[0049] A cell, an organism, or an animal into which a dominant
negative allele of a mismatch repair gene has been introduced will
become hypermutable. This means that the spontaneous mutation rate
of such cells or animals is elevated compared to cells or animals
without such alleles. The degree of elevation of the spontaneous
mutation rate can be at least 2-fold, 5-fold, 10-fold, 20-fold,
50-fold, 100-fold, 200-fold, 500-fold, or 1000-fold that of the
normal cell or animal.
[0050] According to one aspect of the invention, a polynucleotide
encoding a dominant negative form of a mismatch repair protein is
introduced into any eucaryotic cell or a transgenic animal. The
gene can be any dominant negative allele encoding a protein, which
is part of a mismatch repair complex, for example, PMS2, PMS1,
MLH1, GTBP, MSH3 or MSH2. The dominant negative allele can be
naturally occurring or made in the laboratory. The polynucleotide
can be in the form of genomic DNA, cDNA, RNA, or a chemically
synthesized polynucleotide. The polynucleotide can be cloned into
an expression vector containing a constitutively active promoter
segment (such as but not limited to CMV, SV40, EF-1.quadrature. or
LTR sequences) or to inducible promoter sequences such as the
tetracycline, or ecdysone/glucocorticoid inducible vectors, where
the expression of the dominant negative mismatch repair gene can be
regulated. The polynucleotide can be introduced into the cell by
transfection.
[0051] Transfection is any process whereby a polynucleotide is
introduced into a cell. The process of transfection can be carried
out in a living animal, e.g., using a vector for gene therapy, or
it can be carried out in vitro, e.g., using a suspension of one or
more isolated cells in culture. The cell can be any type of
eucaryotic cell, including, for example, cells isolated from humans
or other primates, mammals or other vertebrates, invertebrates, and
single celled organisms such as protozoa or yeast.
[0052] In general, transfection will be carried out using a
suspension of cells, or a single cell, but other methods can also
be applied as long as a sufficient fraction of the treated cells or
tissue incorporates the polynucleotide so as to allow transfected
cells to be grown and utilized. The protein product of the
polynucleotide may be transiently or stably expressed in the cell.
Techniques for transfection are well known. Available techniques
for introducing polynucleotides include but are not limited to
electroporation, transduction, cell fusion, the use of calcium
chloride, and packaging of the polynucleotide together with lipid
for fusion with the cells of interest. Once a cell has been
transfected with the mismatch repair gene, the cell can be grown
and reproduced in culture. If the transfection is stable, such that
the gene is expressed at a consistent level for many cell
generations, then a cell line results.
[0053] An isolated cell is a cell obtained from a tissue of humans
or animals by mechanically separating out individual cells and
transferring them to a suitable cell culture medium, either with or
without pretreatment of the tissue with enzymes, e.g., collagenase
or trypsin. Such isolated cells are typically cultured in the
absence of other types of cells. Cells selected for the
introduction of a dominant negative allele of a mismatch repair
gene may be derived from a eucaryotic organism in the form of a
primary cell culture or an immortalized cell line, or may be
derived from suspensions of single-celled organisms.
[0054] A polynucleotide encoding a dominant negative form of a
mismatch repair protein can be introduced into the genome of an
animal by producing a transgenic animal. The animal can be any
species for which suitable techniques are available to produce
transgenic animals. For example, transgenic animals can be prepared
from domestic livestock, e.g., cows, pigs, sheep, goats, horses,
etc.; from animals used for the production of recombinant proteins,
e.g., cows, pigs, or goats that express a recombinant protein in
their milk; or experimental animals for research or product
testing, e.g., mice, rats, hamsters, guinea pigs, rabbits, etc.
[0055] Any method for making transgenic animals known in the art
can be used. According to one process of producing a transgenic
animal, the polynucleotide is injected into a fertilized egg of the
animal and the injected egg is placed into a pseudo-pregnant
female. The egg develops into a mature animal in which the
polynucleotide is incorporated and expressed. The fertilized egg is
produced in vitro from the egg and sperm of donor animals of the
same species as the pseudo-pregnant female, who is prepared by
hormone treatments to receive the fertilized egg and become
pregnant. An alternative method for producing transgenic animals
involves introducing the polynucleotide into embryonic cells by
injection or transfection and reintroducing the embryonic cells
into the developing embryo. With this method, however, if the
polynucleotide is not incorporated into germ line cells, the gene
will not be passed on to the progeny. Therefore, a transgenic
animal produced by this method must be evaluated to determine
whether the gene is incorporated into germ cells of the animal.
Once transgenic animals are produced, they can be grown to
reproductive age, when they can be mated to produce and maintain a
colony of transgenic animals.
[0056] Once a transfected cell line or a colony of transgenic
animals has been produced, it can be used to generate new mutations
in one or more gene(s) of interest. A gene of interest can be any
gene naturally possessed by the cell line or transgenic animal or
introduced into the cell line or transgenic animal. An advantage of
using such cells or animals to induce mutations is that the cell or
animal may have a wide spectrum of genetic alterations that may
produce commercially beneficial biological products. Hypermutable
animals can then be bred and selected for new desired output traits
(such as milk production, pest resistance, etc.). Once a new trait
is identified, the dominant negative allele can be removed by
directly knocking out the allele by technologies used by those
skilled in the art or by breeding to mates lacking the dominant
negative allele to select for offspring with a desired trait and a
stable genome. Another alternative is to use a CRE-LOX expression
system, whereby the dominant negative allele is spliced from the
animal genome once a new output trait has been established.
[0057] Another aspect of the invention is the use of cells lacking
MMR (due to mutated endogenous MMR gene or genes or through the
introduction of a dominant negative MMR gene) and chemical mutagens
to cause an enhanced rate of mutations in a host's genome. The lack
of MMR activity has been known to make cells more resistant to the
toxic effects of DNA damaging agents. This invention teaches of the
use of making proficient MMR cells; mismatch repair defective via
the expression of a dominant negative MMR gene allele and then
enhancing the genomic hypermutability with the use of a DNA
mutagen. This application also teaches us of the use of employing
cells that are naturally deficient in MMR and exposure of chemical
mutagens to increase the rate of genomic alterations to generate
cells with new genetic structures and/or new phenotypes. Chemical
mutagens are classifiable by chemical properties, e.g., alkylating
agents, cross-linking agents, etc. The following chemical mutagens
are useful, as are others not listed here, according to the
invention. N-ethyl-N-nitrosourea (ENU), N-methyl-N-nitrosourea
(MNU), procarbazine hydrochloride, chlorambucil, cyclophosphamide,
methyl methanesulfonate (MMS), ethyl methanesulfonate (EMS),
diethyl sulfate, acrylamide monomer, triethylene melamin (TEM),
melphalan, nitrogen mustard, vincristine, dimethylnitrosamine,
N-methyl-N'-nitro-Nitrosoguanidine (MNNG), 7,12 dimethylbenz (a)
anthracene (DMBA), ethylene oxide, hexamethylphosphoramide,
bisulfan. In a preferred aspect of the invention, a mutagenesis
technique is employed that confers a mutation rate in the range of
1 mutation out of every 100 genes; 1 mutation per 1,000 genes. The
use of such combination (MMR deficiency and chemical mutagens will
allow for the generation of a wide array of genome alterations
(such as but not limited to expansions or deletions of DNA segments
within the context of a gene's coding region, a gene's intronic
regions, or 5' or 3' proximal and/or distal regions, point
mutations, altered repetitive sequences) that are preferentially
induced by each particular agent.
[0058] Mutations can be detected by analyzing for alterations in
the genotype of the cells or animals, for example by examining the
sequence of genomic DNA, cDNA, messenger RNA, or amino acids
associated with the gene of interest. Mutations can also be
detected by screening the phenotype of the gene. An altered
phenotype can be detected by identifying alterations in
electrophoretic mobility, spectroscopic properties, or other
physical or structural characteristics of a protein encoded by a
mutant gene. One can also screen for altered function of the
protein in situ, in isolated form, or in model systems. One can
screen for alteration of any property of the cell or animal
associated with the function of the gene of interest, such as but
not limited to measuring protein secretion, chemical-resistance,
pathogen resistance, etc.
[0059] Another invention of the application is the use of inducible
vectors that control the expression of a dominant negative and
normally functioning MMR gene. This application teaches of the
utility of using such a strategy to restore DNA stability once a
host cell or organism exhibiting a new output trait, altered gene,
RNA or polypeptide has been generated via trait selection with or
without the combination of chemical mutagens to establish a
genetically stable version of this cell or organism. In the case of
MMR defective cells as a result of ectopically expressing a
dominant negative MMR gene allele, the MMR activity is decreased or
completely eliminated by removing the inducer molecule from the
cell culture or organism's environment. In addition, the expression
of a dominant negative MMR gene can be suppressed by knocking out
the MMR gene allele using methods that are standard to those
skilled in the art of DNA knockout technology in germ or somatic
cells (Waldman, T., et. al. Cancer Res 55:5187-5190, 1995).
[0060] Yet another invention teaches us of the use of restoring MMR
activity in a MMR defective cell line such as HCT116, DLD-1, etc.,
whereby the cell is treated with chemical mutagens, selected for a
new output trait such as pathogen-resistance, chemical-resistance,
etc. The cell is then transfected with a copy of a wild type MMR
gene that complements the endogenous MMR defect and restores DNA
stability of a cell or an organism exhibiting a new output trait,
an altered gene sequence, an altered RNA expression and/or an
altered protein expression.
[0061] The above disclosure generally describes the present
invention. A more complete understanding can be obtained by
reference to the following specific examples which are provided
herein for purposes of illustration only, and are not intended to
limit the scope of the invention.
EXAMPLE 1
Use of Dominant Negative Mismatch Repair Protein to Cause
Hypermutability in Mismatch Repair Proficient Cells
[0062] A profound defect in MMR was found in the normal cells of
two HNPCC patients. That this defect was operative in vivo was
demonstrated by the widespread presence of microsattelite
instability in normeoplastic cells of such patients. One of the two
patients had a germline truncating mutation of the hPMS2 gene at
codon 134 (the hPMS2134 mutation), while the other patient had a
small germline deletion within the hMLH1 gene (26). These data thus
contradicted the two hit model generally believed to explain the
biochemical and biological features of HNPCC patients. The basis
for this MMR deficiency in the normal cells of these patients was
unclear, and several potential explanations were offered. For
example, it was possible that the second allele of the relevant MMR
gene was inactivated in the germline of these patients through an
undiscovered mechanism, or that unknown mutations of other genes
involved in the MMR process were present that cooperated with the
known germline mutation. It is clear from knockout experiments in
mice that MMR deficiency is compatible with normal growth and
development, supporting these possibilities (1,3,6). Alternatively,
it was possible that the mutant alleles exerted a dominant negative
effect, resulting in MMR deficiency even in the presence of the
wildtype allele of the corresponding MMR gene and all other genes
involved in the MMR process. To distinguish between these
possibilities, we expressed the truncated polypeptide encoded by
the hPMS2134 mutation in an MMR proficient cell line and analyzed
its affect on the cell's MMR activity. The results showed that this
mutant could indeed exert a dominant negative effect, resulting in
biochemical and genetic manifestations of MMR deficiency.
[0063] The MMR proficient Syrian hamster TKts13 cell line
(hereafter called SH cells) was cotransfected with various hPMS2
expression plasmids plus reporter constructs for assessing MMR
activity. The hPMS2 expression plasmids contained the normal hPMS2
gene product or the truncated hPMS2 gene identified in the patient
described above (PMS2WT and PMS2134, respectively, FIG. 1A). An
"empty" vector devoid of hPMS2 sequences (PMS2NOT, FIG. 1A) served
as an additional control. The reporter construct pCAROF (out of
frame) contained a hygromycin resistance gene plus a
.beta.-galactosidase gene containing a 29 bp outofframe polyCA
tract at the 5' end of its coding region. The reporter construct
pCARIF (in frame) was identical except that the polyCA tract was 27
bp and therefore did not disrupt the .beta.-galactosidase reading
frame (FIG. 1B). The pCAROF reporter would not generate
.beta.-galactosidase activity unless a frame restoring mutation
(i.e., insertion or deletion) arose following transfection.
[0064] Different transfection schemes were used to evaluate the
effects of the PMS2134 mutation on SH cells. In the first scheme,
the expression vectors plus the reporters were cotransfected
together. Pools containing greater than 100 clones and individual
clones were generated following selection with hygromycin for 17
days and harvested for Western blot and .beta.-galactosidase
assays. SH cells transduced with PMS2WT and PMS2134 synthesized
polypeptides of the expected size, as assessed with antihPMS2
antibodies on Western blots (FIGS. 2A and 2B). As expected,
virtually no .beta.-galactosidase activity was observed in SH cells
transfected with the pCAROF reporter plus PMS2NOT (FIG. 2C).
However, SH cells transfected with PMS2134 expressed considerable
.beta.-galactosidase activity, significantly more than those
transfected with PMS2WT (FIG. 2C). These results suggested that the
truncated polypeptide encoded by the PMS2134 construct perturbs the
endogenous MMR machinery, resulting in deletions or insertions that
restored the reading frame. The exact nature of these presumed
deletions or insertions could not be assessed, as multiple copies
of the reporter constructs were transduced under our conditions,
and the wild type .beta.-galactosidase sequence was in great excess
over the expected mutants, precluding their demonstration by direct
sequencing.
[0065] In the second scheme, SH cells were cotransfected with each
of the PMS2 expression vectors plus the hygromycinresistance
plasmid pLHL4. Hygromycin resistant cultures containing greater
than 100 clones were pooled and expanded. These cultures were then
cotransfected with pCARIF or pCAROF reporters plus a separate
plasmid allowing geneticin selection. Two weeks later, the pooled
cells, each containing more than 100 colonies resistant to both
hygromycin and geneticin, were stained with Xgal to assess
.beta.-galactosidase activity. As shown in FIG. 3, the cultures
transfected with PMS2134 (panel B) contained many blue cells, while
virtually no cells were blue in the cultures transfected with
PMS2WT (panels A). In each case, transfection efficiency was
controlled by parallel transfections using pCARIF, which also
served as a control for .beta.-galactosidase activity of cells
expressing the various PMS2 effector genes, which resulted in
similar .beta.-galactosidase expression levels in all cases (not
shown). Increases in .beta.-galactosidase activity after PMS2134
transfection compared to PMS2WT transfection were also observed
when a similar experimental protocol was applied to the MMR
proficient human embryonic kidney cell line 293. These cells were
cotransfected with the pCAROF plus the various PMS2 effector
plasmids and selected for 17 days in hygromycin. At day 17,
colonies were stained with Xgal to assess .beta.-galactosidase
activity and scored for .beta.-galactosidase expressing cells. As
shown in Table 1, only those cells expressing the PMS2134
polypeptide expressed a detectable .beta.-galactosidase activity.
These data demonstrate a similar dominant negative effect of the
hPMS2134 protein in both rodent and human systems and validate the
utility of the rodent system in these studies.
TABLE-US-00001 TABLE 1 .beta.-galactosidase expression of 293
clones transfected with pCAROF reporter construct plus PMS2
effector plasmids. 293 cells were cotransfected with the pCAROF
.beta.-galactosidase reporter plasmid plus the PMS2NOT, WT, or -134
effector plasmids. Transfected cells were selected in hygromycin
for 17 days and stained with xgal for .beta.-galactosidase activity
(blue colored cells). The results below represent the mean +/
standard deviation of triplicate experiments. Sample Blue colonies
White colonies PMS2NOT 0 +/ 0 17 +/ 2.7 PMS2WT 0 +/ 0 18 +/ 4.0
PMS2134 15 +/ 2.1 6 +/ 2.1
[0066] Plasmids. The full length wildtype hPMS2 cDNA was obtained
from a human HeLa cDNA library as described (18). An hPMS2 cDNA
containing a termination codon at amino acid 134 was obtained via
RTPCR from the patient in which the mutation was discovered (9).
The cDNA fragments were cloned into the BamHI site into the pSG5
vector, which contains an SV40 promoter followed by an SV40
polyadenylation signal (8). The pCAR reporter vectors described in
FIG. 1 were constructed as described in ref. 21 and 25.
[0067] Cell lines and transfection. Syrian Hamster fibroblast
Tkts13 and Human HEK293 cells were obtained from ATCC and cultured
as described (15). Stably transfected cell lines expressing hPMS2
were created by cotransfection of the PMS2 expression vectors and
the pLHL4 plasmid encoding the hygromycin resistance gene at a
ratio of 3:1 (pCAR:pLHL4) and selected with hygromycin. Stably
transfected cell lines containing pCAR reporters were generated by
cotransfection of pCAR vectors together with either pNTK plasmid
encoding the neomycin resistance plasmid or with pLHL4. All
transfections were performed using calcium phosphate as previously
described (15).
[0068] .beta.-galactosidase assay. Seventeen days following
transfection with pCAR, .beta.-galactosidase assays were performed
using 20 g of protein in 45 mM 2mercaptoethanol, 1 mM MgCl.sub.2,
0.1 M NaPO.sub.4 and 0.6 mg/ml Chlorophenol red
.beta.-D-galatopyranoside (CPRG, Boehringer Mannheim). Reactions
were incubated for 1 hour, terminated by the addition of 0.5 M
Na.sub.2CO.sub.3, and analyzed by spectrophotometry at 576 nm (16).
For in situ .beta.-galactosidase staining, cells were fixed in 1%
glutaraldehyde in PBS and incubated in 0.15 M NaCl, 1 mM
MgCl.sub.2, 3.3 mM K.sub.4Fe(CN).sub.6, 3.3 mM K.sub.3Fe(CN).sub.6,
0.2% XGal for 2 hours at 37.degree. C.
Western Blot.
[0069] Western blots for PMS2 were performed as described in
example 5 using a polyclonal anti-human PMS2 raised against the
codons 1-20 of the human full-length polypeptide.
EXAMPLE 2
Dominant Negative Mismatch Repair Gene Alleles Cause a Defect in
MMR Activity
[0070] The most likely explanation for the differences in
.beta.-galactosidase activity between PMS2WT and PMS2134
transfected cells was that the PMS2134 protein disturbed MMR
activity, resulting in a higher frequency of mutation within the
pCAROF reporter and reestablishing the ORF. To directly test the
hypothesis that MMR was altered, we employed a biochemical assay
for MMR with individual clones from cells containing the PMS2-WT,
PMS2-134 or PMS2-NOT empty vectors as described in example 1.
Nuclear extracts were prepared from the clones and incubated with
heteroduplex substrates containing either a /CA\insertion deletion
or a G/T mismatch under conditions described previously. The /CA\
and G/T heteroduplexes were used to test repair from the 3' and 5'
directions, respectively. There was a dramatic difference between
the PMS2-134 expressing clones and the other clones in these assays
(Table 2A). While all clones repaired substrates from the 3'
direction (/CA\heteroduplex), cells expressing the PMS2134
polypeptide had very little 5' repair activity. A similar
directional defect in mismatch repair was evident with pooled
clones resulting from PMS2134 transfection, or when the
heteroduplex contained a 24 base pair loop, examples of which are
shown in Table 2B. A small decrease in MMR activity was observed in
the 3'/CA\PMS2-WT repair assays, perhaps a result of interference
in the biochemical assays by over expression of the PMS2 protein.
No significant activity was caused by PMS2-WT in the in situ
.beta.-galactosidase assays (FIG. 3; Table 1), a result more likely
to reflect the in vivo condition.
TABLE-US-00002 TABLE 2 Mismatch repair activity of nuclear extracts
from SH clones (A) or pooled cultures (B). The extracts were tested
for MMR activity with 24 fmol of heteroduplex. A. SH clones*
Repaired substrate (fmol/15 min) Cell Line 3'/CA\5' G/T PMS2-NOT
clone A 10.2 3.5 clone B 12.7 2.9 clone C 13.5 5.5 PMS2-WT clone A
2.8 2.2 clone B 5.7 4.8 clone C 4.7 2.9 PMS2-134 clone A 2.5 0.0
clone B 2.4 0.0 clone C 5.0 0.5 B. Pooled cultures Repaired
substrate (fmol/15 min) Cell Line 3'G/T 5'G/T 3'/CTG\ 5'/CTG\
PMS2-NOT 2.07 +/- 0.09 2.37 +/- 0.37 3.45 +/- 1.35 2.77 +/- 1.37
PMS2-WT 1.65 +/- 0.94 1.86 +/- 0.57 1.13 +/- 0.23 1.23 +/- 0.65
PMS2-134 0.14 +/- 0.2 0.0 +/- 0.0 1.31 +/- 0.66 0.0 +/- 0.0 *These
data represent similar results derived from greater than five
independent experiments.
[0071] Biochemical assays for mismatch repair. MMR activity in
nuclear extracts was performed as described, using 24 fmol of
substrate (12,25). Complementation assays were done by adding
.about.100 ng of purified MutL .alpha. or MutS.alpha. components to
100 .mu.g of nuclear extract, adjusting the final KCl concentration
to 100 mM (4,10,30). The substrates used in these experiments
contain a strand break 181 nucleotides 5' or 125 nucleotides 3' to
the mismatch. Values represent experiments performed at least in
duplicate.
EXAMPLE 3
Use of MMR Defective Cells and Chemical Mutagens to Enhance
Mutations in Genetic Loci
[0072] To enhance the rate of genetic mutations and produce cells
with altered genes, RNA expression, or polypeptides, the use of MMR
deficiency and chemical mutagens is a powerful tool to generate
such diversity. The advantages of using MMR defective cells is that
the decrease of this activity renders cells more resistant to the
toxic effects of such compounds yet allows for the increase in
genetic and phenotypic alterations of a host organism or cell. The
following experiments are performed to demonstrate the utility of
the invention. Cells that are genetically defective for MMR such as
but not limited to HCT116, DLD-1, etc. or cells such as those
described in example 1 and 2 that are made MMR defective by ectopic
expression of a dominant negative allele is covered under this
invention. Briefly, MMR proficient and deficient cells are
incubated with a range (1 nm to 1 mM) of chemical mutagens for 1
hour to 24 hours at 37 C at 5% CO.sub.2 in growth medium. After
incubation is complete, chemical mutagens are washed from medium
and cells are grown in the presence of hypoxanthine, aminopterin,
and thymine to score for HPRT mutant cells as previously described
(Walker, V E et. al. Mutat Res. 17:371-388, 1999.) and known to
those skilled in the art. Cells are plated at 1.times.10.sup.5 cell
ml in 10 cm tissue culture dishes and grown for 14 days at 37 C at
5% CO.sub.2 in growth medium. After 14 days, the numbers of
HAT-resistant colonies are determined by counting under the
microscope. A typical experiment will demonstrate that a
significantly greater number of HAT resistant colonies (due to
altered HPRT gene) are formed in chemically treated MMR defective
cells than in control cells, demonstrating the ability to increase
mutations within an endogenous gene of the host cell/organism. The
use of MMR defective cells plus exposure to chemical or ionizing
radiation can also be used to enhance genetic mutation in vivo
within target genes introduced via transfection and screening of
transient or stable cell lines. In order to demonstrate the ability
of MMR deficiency plus chemical mutagens to enhance genetic
mutation within a transduced target gene, we employed the use of
cells described above, whereby the pCAROF vector (see EXAMPLE 1)
was transfected into HCT116 cells. Cells were selected for pCAR-OF
positive clones via hygromycin resistance. Hygromycin-resistant
cells were grown to confluence and 100,000 cells were exposed to 10
.mu.M ethyl-methane-sulfonate (EMS) alkylating compound for 8 hours
and returned to growth medium. Cells were then grown overnight and
then plated at a density of 1,000 cells plate in 10 cm dishes in
triplicate. Cells were grown for 10 days and scored for .beta.-gal
activity using methods described in EXAMPLE 1. The results showed
that cells grown in the absence of the compound the number of
.beta.-gal positive foci were 92+/-10 per dish. In contrast, cells
exposed to EMS resulted in a significant increase in the number of
.beta.-gal positive cells (205+/-18). These data demonstrate the
use of MMR defective cells plus chemical mutagens to generate
genetic mutations in target genes in vivo. This method is useful
for generating genetic diversity in target genes for commercial
purposes.
EXAMPLE 4
Restored DNA Stability of a Mismatch Repair Deficient Cell
Expressing a Dominant Negative MMR Gene Allele by Inducible
Vector
[0073] The ability to induce DNA hypermutability using ectopic
expression of a dominant negative MMR gene allele has many
important commercial applications for generating eucaryotic cells
with genetically diverse subtypes. The following experiments
demonstrate the ability to permanently imprint a genetic change in
the genome of a MMR defective cell as described in Examples 1 and 2
by restoring its MMR proficiency. First, the PMS2-134 dominant
negative allele was cloned into the eucaryotic inducible vector
systems pcDNA4/TO (tetracycline-inducible vector) (Invitrogen),
referred to as pcDNA4/TO/PMS134S, the pIND/V5-His glucocorticoid
inducible vector (Invitrogen), referred to as pIND/PMS134S. Tk-ts13
or HEK293 cells were cotransfected with each vector plus the
pCAR-OF (contains hygromycin-resistance gene as selectable marker)
as described below. An empty vector was used as control for each
combination. Transfected cells were selected for 10-14 days for
zeocin/hygromycin (Z/H) or neomycin/hygromycin (N/H) resistant
cells. Clones were picked and expanded as individual clones or
pools. Cells were expanded and plated in 6-well tissue culture
plates at 1.times.10.sup.5 cell/ml in growth medium (DMEM plus 10%
fetal bovine serum) with or without inducer chemicals (1 .mu.g/ml
of tetracycline for pcDNA4/TO/PMS134S and 1 .mu.M ecdysone for
pIND/PMS134S). Cell cultures were harvested and analyzed for
PMS2-134 induced protein expression via western (as described in
example 5) after 24 hours of culture at 37.degree. C. in 5%
CO.sub.2. Western analysis of extracts of PIND/PMS134S cells
revealed production of a protein of .about.17 kd when grown in the
presence of ecdysone, while those grown without ecdysone had no
detectable levels. Clones that have inducible PMS2-134 expression
were expanded and grown in the presence of ecdysone or tetracycline
for 24 hours. Cells were harvested for 72 hours to identify the
kinetics of loss of PMS2-134 expression via western blot in the
absence of inducer. These data demonstrated undetectable levels of
protein ater 72 hours.
[0074] To demonstrate the ability to induce genetic instability
using an inducible vector system, cells containing the pIND/PMS134S
or pIND/V5-His were grown for 14 days with or without ecdysone and
stained to measure .beta.-gal activity in situ as described (MCB
paper). As shown in FIG. 5, a significant number of cellular foci
stained positive blue in pIND/PMS134S cells grown in the presence
of ecdysone (25 cells/field as observed under inverted microscopic
evaluation) in contrast to empty vector controls which had no
observable blue foci. In contrast, neither the pIND/PMS134S nor the
pIND/V5-His cells grown in the absence of the inducer stained
positive. These data demonstrate the ability of using dominant
negative MMR genes under control of inducible vectors to generate
genomic instability and genetic diversity in genes to produce
altered biochemical functions and/or new phenotypes.
[0075] To demonstrate that suppressing PMS2-134 expression can
restore MMR proficiency in these cells, the following experiment
was performed. Cells were maintained in inducer medium plus Z/H or
N/H for 14 days. A subset of each clone or pool was plated into
24-well falcon dishes at 5.times.10.sup.4 cell/ml. Cells were grown
overnight at 37.degree. C. in 5% CO.sub.2 The next day, cells were
stained in vivo for .beta.-galactosidase expression as previously
described (Nicolaides et. al. Mol. Cell Biol. 18:1635-1641, 1998).
Cells that turn blue have done so because of a decrease in their
endogenous MMR activity due to the dominant negative effects of
PMS2-134 on the MMR machinery. These cells were subcloned by
limiting dilution in 96 well plates in the presence or absence of
inducer molecule. Restored genetic stability was demonstrated in
the PMS2-134 expressing clones when a lower number of revertants
(non-blue cells) were found in the clones where the inducer agent
was removed (42 out of 45 wells in contrast to plates where clones
were under constant exposure to inducer (18 out of 45 wells)).
These data demonstrate the ability to regulate genomic stability
and genetic evolution using regulated MMR gene expression.
[0076] The use of chemical mutagens as described EXAMPLE 3 in
combination with the inducible MMR gene strategy described above
are also taught in the application as a method for generating
genetically diverse host organisms with new phenotypes and/or for
stable production of altered gene expression. To demonstrate this
effect, cells containing inducible dominant negative expression are
exposed to inducer molecule and subsequently exposed to chemical
mutagen or ionizing radiation. Cells are then expanded in the
presence of inducer molecule and cultures are selected for cells
with new phenotypes and/or altered gene structure as determined by
sequence analysis or biochemical activity. Cells with altered gene
or phenotype are then removed from inducer molecule and genetic
stability and phenotype are restored.
Transfections
[0077] Generation of stable HEK293 cells containing the ecdysone
receptor with the pIND/PMS134S or pcDNA/TO/PMS134S inducible
vector. HEK293-ecdysoneR cells were transfected with the pIND or
pcDNA/TO empty vector or the pIND/PMS134S or pcDNA/TO/PMS134S
vector using Lipofectamine 2000 (Gibco/BRL). Cells were selected
for selectable marker resistance and clones and pools were
expanded. Stable lines were then exposed to 1 .mu.M ecdysone for 48
hours and extracts were isolated and analyzed by western blot to
identify clones with induced PMS134 expression using antiserum
directed to the N-terminus of the PMS134 polypeptide as described
below.
Plasmids
[0078] The PMS2-134 was cloned as a BamHI fragment from the
pSG5PMS134 (described in example 1) vector into the following
inducible expression vectors. The tetracycline inducible vector
(pcDNA4/TO/PMS134S) contains the zeocin selectable marker under
control of the EM-7 promoter and SV40 polyA sequences. The
structure of the plasmid was confirmed by endonuclease restriction
analysis and sequencing. The glucocorticoid inducible vector
(pIND/PMS134S) contains the neomycin selectable marker under
control of the SV40 early promoter and polyA sequences. A schematic
figure of the vector is presented in FIG. 4.
Transfections
[0079] Inducible expression vectors were co-transfected into
Tk-ts13 cells and HEK293 cells following the methods described
above either alone or in combination with the pCAR-OF vector as
described in EXAMPLE 1. Cells were selected for zeocin/hygromycin
(pcDNA4/TO/PMS134S) or neomycin/hygromycin (pIND/PMS134S) resistant
clones as described (ref 15, Grasso et. al. J. Biol. Chem.
273:24016-24024, 1998). Resistant clones are picked and/or pooled
and expanded for protein analysis.
EXAMPLE 5
Restoration of MMR and Restoration of a Genetic Stability by
Expressing a MMR Gene Complementing Gene and Establishment of a
Fixed Genomic Structure
[0080] The use of cells with defective MMR repair due to defects of
endogenous genes such as but not limited to the HCT116, DLD-1, and
HEC-1-A cells lines (ref. 12, 25 and Kondo, et. al. J Biochem
125:818-825, 1999) can be useful for altering the genetic structure
of genes to produce commercially viable variant molecules such as
novel anti-microbial agents, bioactive growth factors or hormones,
altered antibody structures, etc. The utility and value of such a
cell is that once an altered gene structure has been produced, the
integrity of this gene alteration can be preserved in the cell's
genome by making the cell genetically stable via the introduction
of a functional complementing MMR gene. This example demonstrates
that the introduction of a genetically altered bacterial purine
nucleotide phosphorlyase (PNP) gene, where an out-of-frame poly-A
tract is inserted at the N-terminus of the gene (referred to as
polyPNP), can be genetically altered in a MMR deficient cell and
also be genetically stable when a MMR defective cell is made MMR
proficient by the direct expression of a complementing MMR gene.
The polyPNP gene encodes for a non-functional PNP gene. When the
poly-A tract is randomly altered by genetic alterations due to
defective MMR, the tract is randomly altered, allowing for the
production of a functional PNP gene and polypeptide. PNP converts
the non-toxic
9-(.beta.-D-2-deoxy-erythro-pento-furanosyl)-6-methyl-purine
prodrug (referred to as MPD) substrate to the toxic 6-methyl purine
analog (referred to as MP) (Sorscher, E J, et. al. Gene Therapy
1:233-238, 1994). The polyPNP gene was engineered to contain a
hemaglutinin epitope tag at the C-terminus to facilitate the
detection of the encoded polypeptide via western blot analysis
using an anti-HA antibody. The polyPNP gene was cloned into the
pCEP4 expression vector, which has a hygromycin resistance (Hyg)
gene for selection. The schematic diagram showing this gene is
given in FIG. 7. A homologous gene called PNP was also made in
which an in-frame polyA tract is cloned into the N-terminus of the
gene as a positive control for PNP activity. Briefly, the MMR
defective HCT116 cell line and the MMR proficient HEK293 cell line
were transfected with the polyPNP, the PNP expression vector, or an
empty pCEP4 vector. Cells were then selected for Hyg resistance and
clones were isolated. Expanded cells were grown in the presence of
increasing amounts of MPD (0, 1, 10, 50, 100, 300 .mu.M) for 10
days. After treatment period, cells were counted by hemocytometer
and trypan blue exclusion. As shown in FIG. 8A, a 20% and 30%
decrease in cell numbers were observed when HCT116/polyPNP cells
were cultured in the presence of 100 .mu.M or 300 .mu.M MPD,
respectively. In contrast no decrease in cell growth was observed
with the MMR proficient HEK293/polyPNP cells even at the highest
concentration (300 .mu.M) of MPD used. For both cell lines, the
expression of PNP resulted in 100% growth suppression when cells
were grown in the presence of 50-300 .mu.M MPD, demonstrating the
toxic effects of the converted MP on both cell lines. Western blot
confirmed that a polypeptide containing the HA epitope was indeed
produced in the HCT116/polyPNP cells, thus demonstrating that that
the polyPNP gene structure was altered to produce a functional and
full-length PNP enzyme (FIG. 8B).
[0081] The restoration of genetic stability and the subsequent
imprint of an altered gene locus or loci is an important invention
of this application for producing viable biological products,
whereby altered biomolecules, cells or whole organisms with desired
altered output traits are made genetically stable for long term
use. To generate stable MMR defective cell lines that has or has
not been exposed to chemical mutagens and selected for desired
genetic changes, the introduction of a complementing MMR gene that
can substitute for the mutated endogenous MMR gene locus is taught
in this application. This is demonstrated by the example using
HCT116 cells, which are genetically deficient for the human MutL
homolog MLH1 (12, 24, 25). In this example, a mammalian expression
vector is used that encodes for the functional MLH1 polypeptide
(pC9MLH1) or an expression vector that encodes for a MLH1 cDNA with
a premature stop codon (pC9MLHstop). These expression vectors
contain a neomycin (neo) resistance gene that allows for selection
of cells containing this vector. To demonstrate the ability of
complementing MMR activity in an otherwise MMR defective cell and
to permanently imprint the altered structure(s) of a gene locus,
the polyPNP and pC9MLH constructs were cotransfected into HCT116
cells. Cells were selected for 10 days in neo and Hyg and resistant
clones were isolated and expanded. Cells were then cultured in the
presence of MPD and counted for growth after 10 days. As
demonstrated in FIG. 9, cells transfected with the MLH1 wild type
cDNA expressed MLH1 as determined by western, in contrast to cells
transfected with MLHstop. In addition, when cells were grown in the
presence of 300 .mu.M MPD, those cells expressing MLH1 showed a 2%
decrease in total cell growth as compared to cells grown in medium
alone, while cells transfected with the MLHstop or empty vector and
polyPNP had a 35% reduction in cell growth in comparison to cells
grown in medium alone. These data demonstrate that complementing
the MMR defect with an ectopically expressed wild type MMR gene or
cDNA can establish genomic stability of a MMR defective cell line
and establish long term stable lines that have been selected for to
produce new output traits and/or modified genomic or polypeptide
structures, such as biologically active or inactive PNP.
Plasmids.
[0082] The full-length wildtype hMLH1 cDNA was obtained from a
human Hela cDNA library as described (18). A MLH1 cDNA containing a
termination condon was obtained via RTPCR from the patient in which
the mutation was discovered (24). The cDNA fragments were cloned
into the XhoI site of the pCEP9 vector (Invitrogen), which contains
CMV promoter followed by an SV40 polyadenylation signal (8) and a
gene, which encodes for neomycin resistance. The pC9MLH1 vector
produces the full-length function MLH1 protein, while the pC9MLH1
stop produces the non-functional truncated MLH1 polypeptide. The
polyPNP and PNP vectors are described in FIG. 4. The polyPNP
contains a 21 base out-of-frame polyA tract inserted after codon 2
of the bacterial PNP gene which results in a truncated polypeptide
(Sorscher, E J, et. al. Gene Therapy 1:233-238, 1994). The polyPNP
contains a 20base in-frame polyA tract inserted after condon 2 of
the bacterial PNP gene which results in a full-length functionally
active PNP protein. Both the polyPNP and PNP gene have a
hemaglutinin (HA) epitope fused in-frame at the C-terminus followed
by a termination codon. The polyPNP and the PNP gene was
constructed by polymerase chain reaction using a sense primer:
5'-ccaagcttagaccaccatggcaaaaaaaaaaaaaaaaaaaaatcgctaccccacacattaatgc-3'
(SEQ ID NO: 1), where the polyA tract is underlined while the
primer for PNP contains 1 less A in the polyA tract. The antisense
primer for both constructs is
5'ataagaatgcggccgctatccttagctaggtaatctggaacatcgtaagcgtaatctggaacatcgtactc-
atcgcccagcag-3' (SEQ ID NO: 2). DH5.alpha. bacterial DNA was used a
template for amplification. The modified PNP gene was produced by
amplification USING 95.degree. C. FOR 30 SEC, 54.degree. C. FOR 1
MINUTE, 72.degree. C. for 1 min for 25 cycles in buffers as
previously described (19). Amplified genomic inserts were cloned
into T-tailed vectors (TA cloning, Invitrogen) and recombinant
clones were sequenced to identify vectors with correct nucleotide
sequences. PNP fragments were then subcloned into the KpnI-XhoI
sites of the pCeP4 vector (Invitrogen) using sites from the TA
cloning vector polylinker. Recombinant PNP expression vectors were
sequenced to ensure sequence authenticity using internal primer
sequences.
Cell Lines and Transfection.
[0083] Human HCT116 and HEK293 cells were obtained from ATCC and
cultured as suggested by the vendor in RPMI plus 10% fetal bovine
serum. Cells were transfected with PNP and/or MLH1 expression
vectors using liposomes following the manufacturer's protocol
(Gibco/BRL). Stably transfected cell lines were generated that
express empty vector, PNP or polyPNP by transfection followed by
hygromycin selection. For complementation experiments, HCT116 cells
were transfected with PNP/MLH1, PNP/MLH1stop, polyPNP/MLH1 or
polyPNP/MLH1 stop at a 1:1 ratio using 5 .mu.g of each plasmid and
cells were selected for hygromycin and neomycin resistance. After
10 days, drug-resistant colonies were observed and picked for
analysis.
MPD Killing Assay
[0084] For MPD killing assay, cells were plated at 2.times.10.sup.4
cell/ml and 1 ml aliquots were plated in 24-well costar tissue
culture dishes. For killing assays, cells were plated in 0, 1, 10,
50, 100, and 300 .mu.M MPD in triplicate. Cells were grown for 10
days trypsinized and counted on hemocytometer using trypan blue
exclusion. Data are presented as a mean+/-SD for each study.
Western Blot
[0085] After counting equal cell numbers from each 0 .mu.M MPD
treated cell was lysed directly in sample buffer (60 mM Tris, pH
6.8, 2% SDS, 10% glycerol, 0.1 M 2-mercaptoethanol, 0.001%
bromophenol blue) and boiled for 5 minutes. Protein lysates were
separated by electrophoresis on 18% Tris-glycine gels (Novex). Gels
were electroblotted onto Immobilon-P (Millipore) in 48 mM Tris, 40
mM glycine, 0.0375% SDS, 20% methanol and blocked at room
temperature for 1 hour in Tris-buffered saline plus 0.05% Tween-20
and 5% condensed milk. Filters were probed with monoclonal
antibodies (.alpha.MLH14) generated against human MLH1 or
Hemaglutinin (HA) (Boehringer Manheim) and a horseradish peroxidase
conjugated rabbit anti-mouse secondary antibody, using
chemiluminescence for detection (Pierce). Mouse IgG was used as
control for all experiments to assess for non-specific antibody
interactions of the primary antibody and ensure that the antiserum
used were detecting expected proteins.
REFERENCES
[0086] 1. Baker S. M., Bronner, C. E., Zhang, L., Plug, A. W.,
Robatez, M., Warren, G., Elliott, E. A., Yu, J., Ashley, T.,
Arnheim, N., Bradley, N., Flavell, R. A., and Liskay, R. M. 1995.
Male defective in the DNA mismatch repair gene PMS2 exhibit
abnormal chromosome synapsis in meiosis. Cell 82:309-319. [0087] 2.
Bronner, C. E., Baker, S. M., Morrison, P. T., Warren, G., Smith,
L. G., Lescoe, M. K., Kane, M., Earabino, C., Lipford, J.,
Lindblom, A., Tannergard, P., Bollag, R. J., Godwin, A., R., Ward,
D. C., Nordenskjold, M., Fishel, R., Kolodner, R., and Liskay, R.
M. 1994. Mutation in the DNA mismatch repair gene homologue hMLH1
is associated with hereditary nonpolyposis colon cancer. Nature
368:258-261. [0088] 3. de Wind N., Dekker, M., Bems, A., Radman,
M., and Riele, H. T. 1995. Inactivation of the mouse Msh2 gene
results in mismatch repair deficiency, methylation tolerance,
hyperrecombination, and predisposition to cancer. Cell 82:321-330.
[0089] 4. Drummond, J. T., Li, G. M., Longley, M. J., and Modrich,
P. 1995. Isolation of an hMSH2p160 heterodimer that restores
mismatch repair to tumor cells. Science 268:1909-1912. [0090] 5.
Drummond, J. T., Anthoney, A., Brown, R., and Modrich, P. 1996.
Cisplatin and adriamycin resistance are associated with
MutL.quadrature. and mismatch repair deficiency in an ovarian tumor
cell line. J. Biol. Chem. 271:9645-9648. [0091] 6. Edelmann, W.,
Cohen, P. E., Kane, M., Lau, K., Morrow, B., Bennett, S., Umar, A.,
Kunkel, T., Cattoretti, G., Chagnatti, R., Pollard, J. W.,
Kolodner, R. D., and Kucherlapati, R. 1996. Meiotic pachytene
arrest in MLH1 deficient mice. Cell 85: 1125-1134. [0092] 7.
Fishel, R., Lescoe, M., Rao, M. R. S., Copeland, N. J., Jenkins, N.
A., Garber, J., Kane, M., and Kolodner, R. 1993. The human mutator
gene homolog MSH2 and its association with hereditary nonpolyposis
colon cancer. Cell 7:1027-1038. [0093] 8. Green, S., Issemann, I.,
and Sheer, E. 1988. A versatile in vivo eucaryotic expression
vector for protein engineering. Nuc. Acid Res. 16:369. [0094] 9.
Hamilton, S. R., Liu, B., Parsons, R. E., Papadopoulos, N., Jen,
J., Powell, S. M., Krush, A. J., Berk, T., Cohen, Z., tetu, B.,
Kinzler, K. W., and Vogelstein, B. 1995. The molecular basis of
Turcot's syndrome. N. Eng. J. Med. 332:839-847. [0095] 10. Holmes,
J., Clark, S., and Modrich, P. Strand specific mismatch correction
in nuclear extracts of human and Drosophila melanogaster cell
lines. (1990). Proc. Natl. Acad. Sci. USA 87:5837-5841. [0096] 11.
Leach, F. S., Nicolaides, N. C, Papadopoulos, N., Liu, B., Jen, J.,
Parsons, R., Peltomaki, P., Sistonen, P., Aaltonen, L. A.,
NystromLahti, M., Guan, X. Y., Zhang, J., Meltzer, P. S., Yu, J.
W., Kao, F. T., Chen, D. J., Cerosaletti, K. M., Fournier, R. E.
K., Todd, S., Lewis, T., Leach R. J., Naylor, S. L., Weissenbach,
J., Mecklin, J. P., Jarvinen, J. A., Petersen, G. M., Hamilton, S.
R., Green, J., Jass, J., Watson, P., Lynch, H. T., Trent, J. M., de
la Chapelle, A., Kinzler, K. W., and Vogelstein, B. 1993. Mutations
of a mutS homolog in hereditary nonpolyposis colorectal cancer.
Cell 75:1215-1225. [0097] 12. Li, G. M., and Modrich, P. 1995.
Restoration of mismatch repair to nuclear extracts of H6 colorectal
tumor cells by a heterodimer of human mutL homologs. Proc. Natl.
Acad. Sci. USA 92:1950-1954. [0098] 13. Liu, et al. 1996. Nat. Med.
2:169-174 [0099] 14. Modrich, P. 1994. Science 266:1959-1960 [0100]
15. Nicolaides, N. C. et al., 1991. Mol. Cell. Biol. 11:6166-6176
[0101] 16. Nicolaides, N. C. et al., 1992. J. Biol. Chem.
267:19665-19672 [0102] 17. Nicolaides N. C., et al., 1994. Nature
371:75-80 [0103] 18. Nicolaides N. C., et al., 1995. Genomics
29:329-334 [0104] 19. Nicolaides N. C., et al., 1995. Genomics
30:195-206. [0105] 20. Nicolaides N. C., et al., 1995. Genomics
31:395-397. [0106] 21. Palombo et al., 1994. Nature 36:417. [0107]
22. Palombo et al., 1995. Science 268:1912-1914. [0108] 23. Pang et
al., 1997. Mol. Cell. Biol. 17:4465-4473. [0109] 24. Papadopoulos,
N. et al., 1994. Science 263:1625-1629. [0110] 25. Parsons, R. et.
al. 1993. Cell 75:1227-1236. [0111] 26. Parsons, R. et al. 1995.
Science 268:738-740. [0112] 27. Perucho, M. 1996. Biol. Chem.
377:675-684. [0113] 28. Prolla, T. A. et al. 1994. Science
264:1091-1093. [0114] 29. Strand, M. et al., 1993. Nature
365:274-276. [0115] 30. Su et al., 1988. J. Biol. Chem. 263:
6829-6835.
Sequence CWU 1
1
4164DNAArtificial SequencePCR primer 1ccaagcttag accaccatgg
caaaaaaaaa aaaaaaaaaa aatcgctacc ccacacatta 60atgc
64287DNAArtificial SequencePCR primer 2ataagaatgc ggccgctatc
cttagctagc gtaatctgga acatcgtaag cgtaatctgg 60aacatcgtac tctttatcgc
ccagcag 87326DNAArtificial SequenceRecombinant DNA 3atggcaaaaa
aaaaaaaaaa aaaaaa 26425DNAArtificial SequenceRecombinant DNA
4atggcaaaaa aaaaaaaaaa aaaaa 25
* * * * *