U.S. patent application number 11/724180 was filed with the patent office on 2009-05-21 for methods for detecting nucleic acid sequence variations.
Invention is credited to Tobin J. Hellyer, James G. Nadeau.
Application Number | 20090131647 11/724180 |
Document ID | / |
Family ID | 23310785 |
Filed Date | 2009-05-21 |
United States Patent
Application |
20090131647 |
Kind Code |
A1 |
Nadeau; James G. ; et
al. |
May 21, 2009 |
Methods for detecting nucleic acid sequence variations
Abstract
The invention employs an unlabeled signal primer comprising a 5'
adapter sequence for detection of variations in nucleic acid target
sequences. The detection system further comprises a reporter probe,
the 3' end of which hybridizes to the complement of the 5' adapter
sequence of the signal primer to produce a 5' overhang. Polymerase
is used to fill in the overhang and synthesize the complement of
the 5' overhang of the reporter probe. Synthesis of the reporter
probe complement is detected, either directly or indirectly, as an
indication of the presence of the target.
Inventors: |
Nadeau; James G.; (Ellicott
City, MD) ; Hellyer; Tobin J.; (Owings Mills,
MD) |
Correspondence
Address: |
PATTON BOGGS LLP
8484 WESTPARK DRIVE, SUITE 900
MCLEAN
VA
22102
US
|
Family ID: |
23310785 |
Appl. No.: |
11/724180 |
Filed: |
March 15, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10202896 |
Jul 26, 2002 |
|
|
|
11724180 |
|
|
|
|
09894788 |
Jun 28, 2001 |
6656680 |
|
|
10202896 |
|
|
|
|
09590061 |
Jun 8, 2000 |
6316200 |
|
|
09894788 |
|
|
|
|
09335218 |
Jun 17, 1999 |
|
|
|
09590061 |
|
|
|
|
Current U.S.
Class: |
536/24.31 |
Current CPC
Class: |
C12Q 1/6827 20130101;
C12Q 1/6827 20130101; C12Q 2565/1025 20130101; C12Q 2535/125
20130101; C12Q 2531/119 20130101; C12Q 2531/101 20130101 |
Class at
Publication: |
536/24.31 |
International
Class: |
C07H 21/04 20060101
C07H021/04 |
Claims
1-23. (canceled)
24. A set of oligonucleotides for detecting a target sequence
comprising: a) a first unlabeled signal primer comprising a single
oligonucleotide having a 3' target binding sequence and a 5'
adapter sequence, b) a second signal primer having an adapter
sequence which is substantially identical to an adapter sequence of
the first signal primer: and; c) a reporter probe comprising a 5'
reporter moiety and 3' sequence which is substantially identical to
the adapter sequence.
25. The set of oligonucleotides of claim 24, wherein the reporter
moiety is labeled.
26. The set of oligonucleotides of claim 25, wherein the reporter
moiety is labeled with a fluorescent donor/quencher dye pair.
27. The set of oligonucleotides of claim 24, wherein the reporter
moiety is selected from the group consisting of secondary
structures and specialized sequences.
28. The set of oligonucleotides of claim 27, wherein the reporter
moiety is selected from the group consisting of G-quartets and
restriction endonuclease recognition sites.
29. The set of oligonucleotides of claim 24, wherein the reporter
probe is non-extendible.
30. A set of oligonucleotides for detecting a target sequence
comprising: a) an unlabeled signal primer comprising a single
oligonucleotide having a 3' target-binding sequence and a 5'
adapter sequence, b) a second signal primer having an adapter
sequence which is different from an adapter sequence of a first
signal primer; and b) a reporter probe comprising a 5' reporter
moiety and 3' sequence which is substantially identical to the
adapter sequence.
Description
[0001] This application is a continuation application of U.S. Ser.
No. 10/202,896, filed Jul. 26, 2002, which is a
continuation-in-part of U.S. Ser. No. 09/894,788 filed Jun. 28,
2001, which is a divisional of U.S. Ser. No. 09/590,061 filed Jun.
8, 2000, now U.S. Pat. No. 6,316,200, issued Nov. 13, 2001, and is
a continuation-in-part of U.S. Ser. No. 09/335,218, the entire
contents of which are incorporated by reference herein.
FIELD OF THE INVENTION
[0002] The present invention relates to oligonucleotides and
methods for amplifying and detecting sequence variations in target
nucleic acids such as the human .beta..sub.2-adrenergic receptor
(.beta..sub.2AR) gene. The preferred method involves using
fluorescent real-time thermophilic Strand Displacement
Amplification (SDA) with nucleic acid primers and adapter-mediated
universal detector probes to amplify and detect allele-specific
sequences from blood, tissue and bodily fluids.
BACKGROUND OF THE INVENTION
[0003] Sequence-specific hybridization of labeled oligonucleotide
probes has long been used as a means for detecting and identifying
selected nucleotide sequences, and labeling of such probes with
fluorescent labels has provided a relatively sensitive,
nonradioactive means for facilitating detection of probe
hybridization. Recently developed detection methods employ the
process of fluorescence energy transfer (FET) rather than direct
detection of fluorescence intensity for detection of probe
hybridization. Fluorescence energy transfer occurs between a donor
fluorophore and a quencher dye (which may or may not be a
fluorophore) when the absorption spectrum of one (the quencher)
overlaps the emission spectrum of the other (the donor) and the two
dyes are in close proximity. Dyes with these properties are
referred to as donor/quencher dye pairs or energy transfer dye
pairs. The excited-state energy of the donor fluorophore is
transferred by a resonance dipole-induced dipole interaction to the
neighboring quencher. This results in quenching of donor
fluorescence. In some cases, if the quencher (also referred to as
an "acceptor") is also a fluorophore, the intensity of its
fluorescence may be enhanced. The efficiency of energy transfer is
highly dependent on the distance between the donor and quencher,
and equations predicting these relationships have been developed by
Forster (1948. Ann. Phys. 2, 55-75). The distance between donor and
quencher dyes at which energy transfer efficiency is 50% is
referred to as the Forster distance (R.sub.O). Other mechanisms of
fluorescence quenching are also known including, for example,
charge transfer and collisional quenching. In these cases the
quencher may be a fluorescent dye but it need not be. Fluorescence
quenching mechanisms that are not based on FET typically do not
require appreciable overlap between the absorption spectrum of the
quencher and the emission spectrum of the donor fluorophore.
[0004] Energy transfer and other mechanisms which rely on the
interaction of two dyes in close proximity to produce quenching are
an attractive means for detecting or identifying nucleotide
sequences, as such assays may be conducted in homogeneous formats.
Homogeneous assay formats are simpler than conventional probe
hybridization assays which rely on detection of the fluorescence of
a single fluorophore label, as heterogeneous assays generally
require additional steps to separate hybridized label from free
label. Typically, FET and related methods have relied upon
monitoring a change in the fluorescence properties of one or both
dye labels when they are brought together by the hybridization of
two complementary oligonucleotides. In this format, the change in
fluorescence properties may be measured as a change in the amount
of energy transfer or as a change in the amount of fluorescence
quenching, typically indicated as an increase in the fluorescence
intensity of one of the dyes. In this way, the nucleotide sequence
of interest may be detected without separation of unhybridized and
hybridized oligonucleotides. The hybridization may occur between
two separate complementary oligonucleotides, one of which is
labeled with the donor fluorophore and one of which is labeled with
the quencher. In double-stranded form there is decreased donor
fluorescence (increased quenching) and/or increased energy transfer
as compared to the single-stranded oligonucleotides. Several
formats for FET hybridization assays are reviewed in Nonisotopic
DNA Probe Techniques (1992. Academic Press, Inc., pgs. 311-352).
Alternatively, the donor and quencher may be linked to a single
oligonucleotide such that there is a detectable difference in the
fluorescence properties of one or both when the oligonucleotide is
unhybridized vs. when it is hybridized to its complementary
sequence. In this format, donor fluorescence is typically increased
and energy transfer/quenching are decreased when the
oligonucleotide is hybridized. For example, an oligonucleotide
labeled with donor and quencher dyes may contain self-complementary
sequences that base-pair to form a hairpin which brings the two
dyes into close spatial proximity where energy transfer and
quenching can occur. Hybridization of this oligonucleotide to its
complementary sequence in a second oligonucleotide disrupts the
hairpin and increases the distance between the two dyes, thus
reducing quenching. See Tyagi and Kramer (1996. Nature Biotech. 14,
303-308) and B. Bagwell, et al. (1994. Nucl. Acids Res. 22,
2424-2425; U.S. Pat. No. 5,607,834). Homogeneous methods employing
energy transfer or other mechanisms of fluorescence quenching for
detection of nucleic acid amplification have also been described.
L. G. Lee, et al. (1993. Nuc. Acids Res. 21, 3761-3766) disclose a
real-time detection method in which a doubly-labeled detector probe
is cleaved in a target amplification-specific manner during PCR.
The detector probe is hybridized downstream of the amplification
primer so that the 5'-3' exonuclease activity of Taq polymerase
digests the detector probe, separating two fluorescent dyes which
form an energy transfer pair. Fluorescence intensity increases as
the probe is cleaved. Signal primers (sometimes also referred to as
detector probes) which hybridize to the target sequence downstream
of the hybridization site of the amplification primers have been
described for homogeneous detection of nucleic acid amplification
(U.S. Pat. No. 5,547,861 which is incorporated herein by
reference). The signal primer is extended by the polymerase in a
manner similar to extension of the amplification primers. Extension
of the amplification primer displaces the extension product of the
signal primer in a target amplification-dependent manner, producing
a double-stranded secondary amplification product which may be
detected as an indication of target amplification. Examples of
homogeneous detection methods for use with single-stranded signal
primers are described in U.S. Pat. No. 5,550,025 (incorporation of
lipophilic dyes and restriction sites) and U.S. Pat. No. 5,593,867
(fluorescence polarization detection). More recently signal primers
have been adapted for detection of nucleic acid targets using
FET/fluorescence quenching methods which employ unfolding of
secondary structures (e.g., U.S. Pat. No. 5,691,145 and U.S. Pat.
No. 5,928,869). Partially single-stranded, partially
double-stranded signal primers labeled with donor/quencher dye
pairs have also recently been described. For example, U.S. Pat. No.
5,846,726 discloses signal primers with donor/quencher dye pairs
flanking a single-stranded restriction endonuclease recognition
site. In the presence of the target, the restriction site becomes
double-stranded and cleavable by the restriction endonuclease.
Cleavage separates the dye pair and decreases donor quenching. U.S.
Pat. No. 6,130,047 (incorporated herein by reference) describes a
detector nucleic acid comprised of two complementary
oligonucleotides that are hybridized to form a duplex. One of the
oligonucleotides is longer than the other and contains a
single-stranded tail sequence capable of binding target sequences.
The two oligonucleotides also comprise a fluorophore/quencher dye
pair such that when the two oligonucleotides are hybridized to each
other fluorescence remains substantially quenched, because
fluorophore and quencher remain in close spatial proximity.
Hybridization of a target sequence to the single-stranded tail of
the longer oligonucleotide enables a polymerase-mediated
displacement of the shorter oligonucleotide from the longer one,
resulting in separation of quencher from fluorophore and a
corresponding increase in fluorescence of the sample.
[0005] U.S. Pat. No. 6,379,888 (incorporated herein by reference)
also discloses a signal primer comprised of two complementary
oligonucleotides that are hybridized to form a duplex with one of
the oligonucleotides containing in addition a single-stranded tail
capable of binding target sequences. In this case, however, the
shorter of the two oligonucleotides contains both a fluorophore and
a quencher which are held spatially apart when the shorter
oligonucleotide is hybridized to the longer, unlabeled
oligonucleotide. Hybridization of a target sequence to the
single-stranded tail of the longer oligonucleotide triggers a
polymerase-mediated displacement of the shorter oligonucleotide.
Upon displacement, the shorter oligonucleotide adopts a
conformation that brings the fluorophore and quencher into close
proximity so fluorescence decreases in the presence of target. U.S.
Pat. No. 5,866,336 describes use of a fluorescently labeled hairpin
on an amplification primer in PCR. The 3' end of the hairpin primer
hybridizes to the complement of a non-target sequence appended to
the target by a second primer. In this system, the hairpin primer
plays an integral part in amplification of the target sequence and
must be extendible. In contrast, in the present invention it is not
necessary for the reporter probe to be extendible, as it does not
participate in amplification of the target sequence but generates
signal in a separate series of reaction steps which occur
concurrently with target amplification. In further contrast, the
signal primers of the invention hybridize to an internal sequence
of the target (i.e., between the amplification primers), so that
the signal generation reaction detects a subsequence of the target,
not the amplification product itself.
[0006] Detecting and identifying variations in DNA sequences among
individuals and species has provided insights into evolutionary
relationships, inherited disorders, acquired disorders and other
aspects of molecular genetics including predisposition to
infectious or non-infectious disease and prediction of therapeutic
efficacy. Analysis of sequence variation has routinely been
performed by analysis of restriction fragment length polymorphism
(RFLP) which relies on a change in restriction fragment length as a
result of a change in sequence. RFLP analysis requires
size-separation of restriction fragments on a gel and Southern
blotting with an appropriate probe. This technique is slow and
labor intensive and cannot be used if the sequence change does not
result in a new or eliminated restriction site.
[0007] More recently, PCR has been used to facilitate sequence
analysis of DNA. For example, allele-specific oligonucleotides have
been used to probe dot blots of PCR products for disease diagnosis.
If a point mutation creates or eliminates a restriction site,
cleavage of PCR products may be used for genetic diagnosis (e.g.,
sickle cell anemia). General PCR techniques for analysis of
sequence variations have also been reported. S. Kwok, et al. (1990.
Nucl. Acids Res. 18:999-1005) evaluated the effect on PCR of
various primer-template mismatches for the purpose of designing
primers for amplification of HIV which would be tolerant of
sequence variations. The authors also recognized that their studies
could facilitate development of primers for allele-specific
amplification. Kwok, et al. report that a 3' terminal mismatch on
the PCR primer produced variable results. In contrast, with the
exception of a 3' T mismatch, a 3' terminal mismatch accompanied by
a second mismatch within the last four nucleotides of the primer
generally produced a dramatic reduction in amplification product.
The authors report that a single mismatch one nucleotide from the
3' terminus (N-1), two nucleotides from the 3' terminus (N-2) or
three nucleotides from the 3' terminus (N-3) had no effect on the
efficiency of amplification by PCR. C. R. Newton, et al. (1989.
Nucl. Acids Res. 17:2503-2516) report an improvement in PCR for
analysis of any known mutation in genomic DNA. The system is
referred to as Amplification Refractory Mutation System or ARMS and
employs an allele-specific PCR primer. The 3' terminal nucleotide
of the PCR amplification primer is allele specific and therefore
will not function as an amplification primer in PCR if it is
mismatched to the target. The authors also report that in some
cases additional mismatches near the 3' terminus of the
amplification primer improve allele discrimination.
SUMMARY OF THE INVENTION
[0008] The present invention provides methods for identifying
sequence variations in a nucleic acid sequence of interest using an
unlabeled signal primer comprising a 5' adapter sequence to mediate
detection by genetic or universal labeled reporter probes. The
method is based upon the universal detection system described in
U.S. Pat. No. 6,316,200 (herein incorporated by reference) (FIG.
1A, B). The 3' end of the reporter probe hybridizes to the
complement of the 5' adapter sequence to produce a 5' overhang.
Polymerase is used to fill in the overhang and synthesize the
compliment of the 5' overhang of the reporter probe. Synthesis of
the reporter probe compliment is detected, directly or indirectly,
as an indication of the presence of the specific target allele.
[0009] The 5' tail sequence of the signal primer comprises a
sequence which does not hybridize to the target (the adapter
sequence). The adapter sequence may be selected such that it is the
same in a variety of signal primers which have different 3' target
binding sequences (i.e., a "universal" 5' tail sequence). This
allows a single reporter probe sequence to be used for detection of
any desired target sequence, which is an advantage in that
synthesis of the reporter probe is more complex due to the
labeling. Further, the invention simplifies the synthesis of the
target-specific signal primer. As the signal primer is not labeled,
signal primers with different target binding sequences specific for
different targets may be more easily and efficiently synthesized.
The methods of the invention therefore permit the detection of many
different mutations using a single pair of detectable reporter
probes and this offers a particular advantage over other systems
that use target-specific reporter probes for the detection of
allelic variations. The present invention offers significant
benefits over such techniques in terms of cost and speed of
development of novel assays.
[0010] The methods of the invention are particularly well suited,
but are not limited to, the detection and identification of single
nucleotide differences between the target sequence being evaluated
(e.g., a mutant allele of a gene) and a second nucleic acid
sequence (e.g., a wild-type allele for the same gene), as they make
use of nucleotide mismatches near the 3' end of the signal primer
to discriminate between a first nucleotide and a second nucleotide
at the site of interest in the target. Both the wild-type and
mutant alleles can be detected in the same reaction by
incorporating signal primers specific for each target (FIG. 2A, B).
In a preferred embodiment, the diagnostic nucleotide (SNP-site) is
located one base (N-1) from the 3' terminus of the signal primer.
This reduces the efficiency of non-specific polymerase extension by
reducing the stability of base pairing and base stacking
interactions at the 3' end of the signal primer. A further
embodiment of the invention involves the creation of artificial
mismatches in the signal primer sequence at one or more nucleotides
(e.g., N-2, N-3, N-4, and N-5) near the SNP-site N-1). This further
reduces the stability of hybridization at the 3' end of the signal
primer and lowers the melting temperature of the primer:target
hybrid. This embodiment has no impact on the amplification
efficiency of the target nucleic acid as this occurs independently
of hybridization of the signal primer. However, the efficiency of
detection, particularly that of a target sequence containing
multiple mismatches with the signal primer is diminished, thereby
enhancing allelic discrimination. This may be of particular
importance in systems designed to discriminate sequence variations
located in G-C rich regions of DNA and in which base pairing and
base stacking interactions are very strong. Such mismatches may
also be introduced in the signal primer downstream of the
diagnostic nucleotide (e.g., at positions .delta.+1, .delta.+2,
.delta.+3 or .delta.8+4 relative to the diagnostic nucleotide,
.delta.) to bring about a similar reduction in the efficiency of
polymerase extension. The disclosed methods have distinct
advantages over other primer extension-based systems for allelic
discrimination in which the diagnostic nucleotide is incorporated
in an amplification primer. In the method of the present invention,
multiple mutations can be detected within the target sequence using
the same amplification primers in conjunction with unlabeled signal
primers that are specific for each mutation. This obviates the need
to design and optimize multiple amplification systems for the
detection of each individual mutation.
[0011] In a preferred embodiment, the method of the invention
employs Strand Displacement Amplification (SDA) as the means of
target amplification. SDA relies upon the coordinated activity of a
DNA polymerase and restriction enzyme to amplify target nucleic
acid. A limitation of SDA therefore, is that the target sequence
ideally should not contain the SDA restriction enzyme recognition
site. For many applications, this limitation can be overcome
through careful selection of the target region. However, for SNP
analysis in which a specific mutation at a particular site must be
identified, it is not always possible to avoid undesirable
restriction sites. To overcome this obstacle, artificially created
mismatches in bumper and amplification primer sequences can be used
to protect the amplicon from the digestion by the restriction
enzyme used in SDA (FIGS. 3A and B).
[0012] In the isothermal amplification methods of the present
invention a mismatch on the detector/amplification primer at N-1 to
N-4 and a complementary 3' terminal nucleotide results in excellent
allele discrimination, particularly if an optional second
nondiagnostic mismatch is included. This embodiment is therefore
preferred for detector/amplification primers of the invention.
[0013] In an alternative preferred embodiment, the detector primer
is used in an isothermal amplification reaction as a signal primer
(also referred to as a detector probe) as taught in U.S. Pat. No.
5,547,861, the disclosure of which is hereby incorporated by
reference. In the amplification reaction, the signal primer
hybridizes to the target sequence downstream of an amplification
primer such that extension of the amplification primer displaces
the signal primer and its extension product. After extension, the
signal primer includes the downstream sequence which is the
hybridization site for the second amplification primer. The second
amplification primer hybridizes to the extended signal primer and
primes synthesis of its complementary strand. Production of these
double-stranded secondary amplification products may be detected
not only as an indication of the presence of the target sequence,
but in the methods of the invention a signal primer which has the
sequence characteristics of a detector primer (a detector/signal
primer) also facilitates detection and/or identification of SNP's
within the target sequence. In this embodiment, a diagnostic
mismatch at either the 3' terminus (N) or at N-1 to N-4 provides
excellent allele discrimination.
[0014] Applicants hypothesize that the different results obtained
with a diagnostic mismatch at the 3' terminus of a detector/signal
primer as compared to a diagnostic mismatch at the 3' terminus of a
detector/amplification primer may be at least partially due to a
kinetic effect. If a signal primer is not efficiently extended on a
target to which it is hybridized (e.g., when it contains
mismatches), it will be quickly displaced from the template by
extension of the upstream amplification primer. If the signal
primer is efficiently extended, extension will occur before the
signal primer is displaced from the target. That is, the upstream
amplification primer (which is typically perfectly matched and
efficiently extended) imposes a "time-limit" for extension on the
detector/signal primer. In contrast, the amplification primer in an
isothermal amplification reaction does not have a time-limit for
extension imposed upon it by additional components of the
isothermal amplification reaction or by thermocycling. Therefore,
with sufficient time available, a detector/amplification primer may
eventually be extended even when the extension reaction is
inefficient. This phenomenon could reduce discrimination between
alleles when a detector/amplification primer with a 3' terminal
mismatch is employed in isothermal amplification reactions. In
addition, the ability of amplification primers to correct a
mismatch with the target may contribute to these observations.
Amplification primers produce amplicons that are perfectly matched
with the amplification primers which produced them, thus
eliminating the basis of allele discrimination. In contrast, such
"correction" does not occur with signal primers.
[0015] Another embodiment uses signal primers with target binding
sequences that are at least partially identical to the target
binding sequence of an amplification primer (FIG. 4). Competitive
hybridization between two oligonucleotides in an
amplification/detection system has been described previously (U.S.
Pat. No. 6,258,546 herein incorporated by reference) for
qualitative and quantitative detection of nucleic acids. This
approach provides detection efficiency that is equal to or better
than that of conventional signal primers that lie entirely between
the amplification primers, while still maintaining the specificity
derived from use of an internal probe. Overlap between the
hybridization regions of the amplification and signal primers
allows for flexibility in assay design and a reduction in overall
amplicon length, with the resulting potential for enhanced
amplification efficiency. This is important because flexibility in
system design is necessary to avoid primer:primer interactions,
restriction enzyme recognition sites, amplicon secondary structure
and regions of excessively high G-C content. Overlap of the signal
primer and an amplification primer may also enhance allelic
discrimination by providing competition between closely related
sequences for hybridization to the target sequence. In such a
system containing two signal primers, one specific for each of two
alleles at a given locus, hybridization of the specific signal
primer is thermodynamically favored but formation of this structure
is the result of competition for hybridization to the target of
both the amplification primer and the mismatched signal primer.
[0016] An advantage of the preferred embodiments of the disclosed
methods is the ability to detect sequence variations in a broad
range of clinical samples without the need for extensive sample
processing. The disclosed methods for detection of SNPs using
specific signal primers in conjunction with SDA offer the ability
to perform genotyping with a variety of sample types including
blood, urine and buccal swabs without prior purification of nucleic
acid. The lack of a significant sample processing required greatly
reduces cost and provides improved turnaround time for results.
[0017] The signal primer adapter-mediated universal detection
system of the invention provides a simple, rapid, sensitive and
specific method for SNP analysis, haplotyping and detection of
other nucleotide acid sequence variations. The most preferred
embodiment of the invention involves homogeneous real-time
genotyping of a sample including forensic samples such as blood,
tissue and body fluid samples using SDA with minimal sample
processing. The present invention is a powerful tool for genotyping
in clinical diagnostics, forensics and drug discovery with or
without nucleic acid sample preparation.
DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1A illustrates detection of a nucleic acid target
sequence in a Strand Displacement Amplification (SDA) reaction
according to the method of the invention.
[0019] FIG. 1B illustrates the additional reaction steps which may
occur when the fluorescently labeled sequence in the reporter probe
is a nickable RERS.
[0020] FIGS. 2A and 2B illustrate detection of sequence variations
according to the method of the invention.
[0021] FIGS. 3A and 3B illustrate protection of target sequences
from digestion by the restriction enzyme(s) involved in strand
displacement amplification.
[0022] FIG. 4 illustrates use of overlapping amplification and
signal primers (SEQ ID NOs: 21 and 22, as utilized in Example 8)
for detection of sequence variations.
[0023] FIG. 5 illustrates the results of Example 1.
[0024] FIG. 6A and FIG. 6B illustrate the results of Example 2.
[0025] FIG. 7 illustrates the positions of six key .beta.2AR SNPs
involved in haplotype analysis.
[0026] FIG. 8 illustrates the results obtained in Example 5 from 6
.beta.2AR SNP assays using the Maximum Density algorithm.
[0027] FIGS. 9A-D illustrate the amplification curves obtained in
Example 5 from the assay for the -654 .beta.2AR SNP.
[0028] FIG. 10 illustrates a comparison of signals obtained in
Example 8 using conventional and overlapping signal primers in the
detection of the -367 .beta.2AR SNP.
[0029] FIG. 11 illustrates the introduction in Example 9 of
additional mismatches in the signal primer to enhance allelic
discrimination.
[0030] FIG. 12A illustrates the use in Example 11 of opposing
signal primers directed towards opposite strands of the target
sequence for detection of the +46 .beta.2AR SNP.
[0031] FIG. 12B illustrates the results obtained in Example 11
using the opposing signal primer configuration in the +46 .beta.2AR
assay system.
DETAILED DESCRIPTION OF THE INVENTION
[0032] Certain terms used herein are defined as follows:
[0033] An "amplification primer" is a primer for amplification of a
target sequence by primer extension. For SDA, the 3' end of the
amplification primer (the target binding sequence) hybridizes at
the 3' end of the target sequence. The amplification primer
comprises a recognition site for a restriction endonuclease near
its 5' end. The recognition site is for a restriction endonuclease
which will cleave one strand of a DNA duplex when the recognition
site is hemimodified ("nicking"), as described in U.S. Pat. No.
5,455,166; U.S. Pat. No. 5,270,184 and EP 0 684 315. As no special
sequences or structures are required to drive the amplification
reaction, amplification primers for PCR may consist only of target
binding sequences. Amplification primers for 3SR and NASBA, in
contrast comprise an RNA polymerase promoter near the 5' end. The
promoter is appended to the target sequence and serves to drive the
amplification reaction by directing transcription of multiple RNA
copies of the target.
[0034] "Extension products" are nucleic acids which comprise a
primer or a portion of a primer and a newly synthesized strand
which is the complement of the sequence downstream of the primer
binding site. Extension products result from hybridization of a
primer to a template containing a complementary sequence and
extension of the primer by polymerase using the template.
[0035] The terms "target" or "target sequence" refer to nucleic
acid sequences to be amplified or detected. These include the
original nucleic acid sequence to be amplified, its complementary
second strand and either strand of a copy of the original sequence
which is produced by replication or amplification. A target
sequence may also be referred to as a template for extension of
hybridized primers.
[0036] A "signal primer" according to the present invention
comprises a 3' target binding sequence which hybridizes to a
complementary sequence in the target and further comprises a 5'
tail sequence which is not complementary to the target (the adapter
sequence). The adapter sequence is selected such that its
complementary sequence will hybridize to the 3' end of the reporter
probe described below. In some embodiments of the invention the
adapter sequence is selected such that its complementary sequence
binds to both the 3' end of the reporter probe and to a sequence
within the reporter moiety of the reporter probe, as described
below. In preferred embodiments of the invention, the signal primer
does not comprise a detectable label.
[0037] A "diagnostic nucleotide" of the present invention is a
nucleotide of the signal primer that forms a Watson-Crick
complementary base pair, when signal primer and target sequence are
hybridized, with the polymorphic or variant nucleotide of interest
in the target sequence. The diagnostic nucleotide permits different
alleles, SNPs or sequence variants to be distinguished from each
other because the diagnostic nucleotide will only participate in a
Watson-Crick base pair if the signal primer is hybridized to the
correct target allele, SNP or sequence variant. Hybridization of
the signal primer to an incorrect allele, SNP or sequence variant
will cause the diagnostic nucleotide to form a mismatch, rather
than a base-pair, with the variant nucleotide of the incorrect
target. For example, if the correct target allele contains the base
G at the variant nucleotide site, then the signal primer for this
allele will contain base C as the diagnostic nucleotide, such that
hybridization of the signal primer with correct target allele will
form a C:G base pair between the diagnostic nucleotide of the
signal primer and the variant nucleotide of the target.
Hybridization of this signal primer with an incorrect allele
containing, for example, base A as the variant nucleotide would
create an C:A mismatch between the diagnostic nucleotide and
incorrect target. Efficient extension of the signal primer will
occur only if the diagnostic nucleotide participates in a
Watson-Crick base pair when the signal primer is hybridized to a
potential target sequence. If the diagnostic nucleotide
participates in a mismatch rather than a proper Watson-Crick pair,
extension of the signal primer will be retarded.
[0038] A "reporter probe" according to the present invention
comprises a label which is preferably at least one donor/quencher
dye pair, i.e., a fluorescent donor dye and a quencher for the
donor fluorophore. The label is linked to a sequence or structure
in the reporter probe (the reporter moiety) which does not
hybridize directly to the target sequence. The sequence of the
reporter probe 3' to the reporter moiety is selected to hybridize
to the complement of the signal primer adapter sequence. In
general, the 3' end of the reporter probe does not contain
sequences with any significant complementarity to the target
sequence. In some instances, however, the reporter probe may
contain the sequence that hybridizes to the adapter complement and
another short sequence at the 3' end that hybridizes to a short
segment of the target complement. In this case, the region of
target complementarity is not large enough to permit significant
hybridization without concurrent hybridization of the
adapter-specific region of the reporter probe. The label of the
reporter probe is detected as an indication of the presence of a
complement of the reporter moiety which renders it double-stranded,
thereby indicating the presence of or the amplification of the
target. The 3' terminus of the reporter probe may be capped to
prevent extension by polymerase or it may be extendible. Capping
may enhance performance by reducing background signal and the
nonproductive consumption of reagents in spurious side-reactions
resulting from the formation of primer dimers and other errant
priming events.
[0039] Any nucleic acid sequence or structure which can be labeled
such that the presence of its complement, generated according to
the methods of the invention, indicates the presence of the target
sequence can serve as the reporter moiety of the reporter probe.
Preferably, the reporter moiety is labeled with a donor/quencher
dye pair such that donor fluorescence is quenched prior to
detection of a target and such that quenching of donor fluorescence
is reduced as an indication of the presence of the target. The
reporter moiety may be a secondary structure at the 5' end of the
reporter probe, such as a stem-loop (or hairpin) as described in
U.S. Pat. No. 5,928,869 or a G-quartet as described in U.S. Pat.
No. 5,691,145. The secondary structure is labeled such that the
donor and quencher are in close proximity when the secondary
structure is folded, resulting in quenching of donor fluorescence.
In the presence of target, the secondary structure is unfolded in a
target-dependent primer extension reaction so that the distance
between the donor and quencher is increased. This decreases
quenching and produces an increase in donor fluorescence which can
be detected as an indication of the presence of the target
sequence. Alternatively, the reporter moiety may be a
single-stranded sequence at the 5' end of the reporter probe which
is labeled with the donor and quencher in sufficiently close
proximity to produce quenching and which contains a single-stranded
restriction endonuclease recognition site (RERS) as described in
U.S. Pat. No. 5,846,726 and U.S. Pat. No. 5,919,630. In the
single-stranded reporter probe, the RERS is not cleavable. However,
in the presence of target, the single-stranded RERS is converted to
double-stranded form in a target-dependent primer extension
reaction and thereby becomes cleavable. Treatment with the
appropriate restriction endonuclease cleaves the RERS between the
two dyes, separating them into separate nucleic acid fragments. The
associated increase in distance between the dyes results in reduced
quenching of donor fluorescence which can be detected as an
indication of the presence of the target sequence. In a further
embodiment, an RERS reporter moiety may be rendered nickable in the
target-dependent primer extension reaction, as taught in U.S. Pat.
No. 5,846,726 and U.S. Pat. No. 5,919,630. In this embodiment, when
the RERS is rendered double-stranded the restriction endonuclease
nicks the strand to which the donor and quencher are linked.
Polymerase extends from the nick, displacing from the reporter
probe a single-stranded fragment linked to one of the dyes. This
also increases the distance between the donor and quencher and
results in an increase in donor fluorescence due to decreased
quenching. A reporter moiety may also be a double stranded sequence
at the 5' end of the reporter probe as disclosed by U.S. Pat. No.
6,130,047. In this case, fluorophore and quencher reside on
different oligonucleotides, comprising the 5' end of the reporter
probe, and are held in close spatial proximity by hybridization of
the two oligonucleotides. Hybridization of target to the 3' end of
the reporter probe triggers polymerase-mediated separation of the
two oligonucleotides and separation of quencher from fluorophore,
resulting in increased fluorescence. U.S. Pat. No. 6,379,888
describes another double-stranded reporter moiety at the 5' end of
the reporter probe. In this case, fluorophore and quencher reside
on the same oligonucleotide but are held apart when this
oligonucleotide hybridizes to the complementary oligonucleotide
comprising the second oligonucleotide of the reporter probe. The
second oligonucleotide is unlabeled, longer than the labeled
oligonucleotide, and also contains a single-stranded sequence
comprising the 3' end of the reporter probe. Hybridization of the
target to the 3' end triggers polymerase-mediated displacement of
the shorter, labeled oligonucleotide which then folds into a
conformation that brings quencher and fluorophore into close
spatial proximity, decreasing fluorescence. In this case, the
presence of target is thus indicated by reduced fluorescence of the
sample.
[0040] One embodiment of the method of the invention as applied to
SDA is illustrated schematically in FIG. 1A. The initial steps of
the reaction correspond to the signal primer reaction described in
U.S. Pat. No. 5,547,861. A signal primer having a 3' target binding
sequence (B) and a noncomplementary 5' tail (A) hybridizes to the
target downstream from an amplification primer (S.sub.1) (Step 1).
As illustrated, the entire hybridization site of the signal primer
is downstream from the hybridization site of the amplification
primer. However, the hybridization sites of the signal primer and
the amplification primer on the target may also partially overlap
(typically only by several nucleotides) without significantly
affecting the methods of the invention. As used herein, the term
"downstream from" with respect to the hybridization sites of the
signal primer and the amplification primer on the target is
intended to encompass nonoverlapping and partially overlapping
sites in the target. Following hybridization to the target, the
amplification primer and the signal primer are simultaneously
extended on the target sequence, and extension of the amplification
primer displaces the single-stranded signal primer extension
product (Step 2). The second amplification primer (S.sub.2)
hybridizes to the signal primer extension product (Step 3) and both
the signal primer extension product and the amplification primer
are extended to produce a double-stranded secondary amplification
product with a hemimodified RERS at one end (Step 4). In SDA,
nicking of the unmodified S.sub.2 strand of the RERS (shown as an
arrow in Step 4) and displacement of the strand downstream from the
nick produces a single-stranded oligonucleotide which comprises the
complement of the signal primer (Step 5). The complement of the
signal primer and the double-stranded secondary amplification
product are produced only when the target is present and amplified.
They may therefore be detected as an indication of target
amplification.
[0041] In the detection method taught in U.S. Pat. No. 5,547,861,
the double-stranded secondary amplification product is detected. In
contrast, the present invention detects the single-stranded
oligonucleotide which is displaced from the double-stranded
secondary amplification product after nicking. As this
oligonucleotide comprises the complement of the signal primer, the
3' end of the reporter probe hybridizes to it (Step 6). The 5' end
of the reporter probe, containing the labeled structure or
sequence, forms an overhang with two recessed 3' ends which are
appropriate substrates for polymerase. If the reporter probe is not
capped to prevent extension, both the reporter probe and the
single-stranded oligonucleotide are extended to produce a
completely double-stranded molecule (Step 7). If the reporter probe
is not extendible, only the recessed 3' end of the single-stranded
oligonucleotide (which comprises the complement of the signal
primer) is extended and the product is partially single-stranded
and partially double-stranded. In either case, the sequence
complementary to the labeled structure or sequence of the reporter
probe is synthesized, rendering it double-stranded. FIG. 1A
exemplifies the invention using a hairpin reporter moiety labeled
with a donor/quencher dye pair such that donor fluorescence is
quenched. It will be appreciated from this example that it may not
be necessary for the reporter moiety to be rendered entirely
double-stranded to be detected. For example, a partial complement
of the hairpin structure can be sufficient to keep the arms of the
stem from hybridizing to each other. As used herein,
"double-stranded reporter moiety" is intended to encompass both
fully and partially double-stranded reporter moieties provided they
are sufficiently double-stranded to render the reporter moiety
detectable. When the reporter moiety is rendered double-stranded in
the primer extension reaction, the hairpin is unfolded. Upon
unfolding, the two dyes become sufficiently spatially separated to
reduce or eliminate quenching of donor fluorescence by the
quencher. The resulting increase in donor fluorescence, or a change
in another fluorescence parameter associated with a change in
fluorescence quenching (such as fluorescence lifetime, fluorescence
polarization or a change in emission of the quencher/acceptor dye),
may be detected as an indication of amplification of the target
sequence. In addition, as illustrated in FIG. 1A, multiple reporter
moieties may be combined in a single reporter probe, for example a
labeled hairpin may comprise a single-stranded RERS in the
single-stranded "loop." In this embodiment synthesis of the
complement of the reporter moiety not only unfolds the hairpin to
produce an increase in fluorescence, the RERS concurrently becomes
cleavable or nickable, generally producing an additional
fluorescence increase.
[0042] As depicted in FIG. 1A, the folded reporter moiety (e.g., a
hairpin) of the reporter probe does not hybridize to the complement
of the adapter sequence. However, the adapter sequence may be
selected so that its complementary sequence will hybridize to all
or part of a folded reporter moiety of the reporter probe. In this
case, hybridization alone will unfold or partially unfold the
reporter moiety producing signal without the need for
polymerase-catalyzed extension following hybridization. The folded
reporter moiety in this embodiment may comprise all or part of the
reporter probe sequence. In an example of such an embodiment, the
reporter probe may be a molecular beacon as described by Tyagi and
Kramer, supra, in which the loop of the beacon hairpin comprises
all or part of the adapter sequence. As the complement of the
adapter sequence is synthesized during target amplification, it
binds to the molecular beacon and unfolds the structure, producing
increased fluorescence. In another embodiment the reporter probe
contains a single-stranded sequence 3' to the folded reporter
moiety such that both the single-stranded sequence and all or part
of the folded reporter moiety hybridize to the sequence
complementary to the adapter sequence as it is produced during
amplification.
[0043] In other alternative embodiments, other reporter moieties
may be substituted in the reaction scheme shown in FIG. 1A. For
example, other folded nucleic acid structures such as G-quartets
may be substituted and unfolded in a similar target-dependent
manner to reduce fluorescence quenching. Alternatively, a
specialized linear sequence may be used as the reporter moiety, for
example an RERS. When an RERS is used as the reporter moiety the
donor and quencher are linked flanking the cleavage site so that
when the RERS is rendered double-stranded and cleaved in a
target-dependent manner the two dyes are separated onto separate
nucleic acid fragments (Step 8, FIG. 1A). These alternative
secondary structures may also be combined with specialized
sequences, such as an RERS in a G-quartet. The RERS may
alternatively be rendered nickable rather than cleavable in its
double-stranded form. This is a particularly suitable embodiment
for use in SDA, as incorporation of modified nucleotides and
production of nickable RERS's are an integral part of the
amplification reaction. Generation of a nickable RERS in the
reporter probe adds some additional side reactions to the reaction
scheme of FIG. 1A (shown in FIG. 1B). FIG. 1B illustrates the
reaction if the RERS of the double-stranded molecule illustrated in
Step 7 of FIG. 1A is nicked rather than cleaved. Referring to FIG.
1B, as polymerase extends from the nick two products are produced:
the double-stranded molecule is regenerated (now carrying only one
of the two dyes) and the single-stranded molecule downstream from
the nick is displaced (Step 9, carrying the other of the two dyes).
The double-stranded molecule can be renicked with displacement of
additional single-stranded molecules and the displaced
single-stranded molecules hybridize to an amplification primer
(Step 10) and be extended to produce a nickable RERS in a fully
double-stranded molecule (Steps 11 and 12). Further nicking and
displacement produces single-stranded molecules with a partial RERS
derived from the previous reporter probe at one end and no label
(Step 13). This hybridizes to a new reporter probe (Step 14) and
the recessed end becomes extendible as the hairpin breathes and
allows the partial RERS to hybridize. Filling-in of the recessed
end renders the RERS nickable (Step 15) and the displaced
single-stranded molecule re-enters the reaction and the cycle
repeats. This amplifies the signal initially produced from a single
signal primer/target interaction by means of a separate reaction
occurring independently of any further target amplification.
[0044] In yet other embodiments, double-stranded reporter moieties
may be substituted in the reaction scheme shown in FIG. 1A. For
example, the double-stranded reporter moieties of U.S. Pat. Nos.
6,130,047 and 6,379,888 may be substituted for the hairpin moiety
depicted in FIG. 1A. In this case, the 3' tail of the reporter
probe will hybridize to the complement of the adapter sequence
produced in step 5 (FIG. 1A). Extension of the adapter complement
sequence will then separate the shorter oligonucleotide (or
oligonucleotides) of the double-stranded reporter moiety from the
longer oligonucleotide, resulting in either increased or decreased
fluorescence, depending on the particular mechanism described in
U.S. Pat. Nos. 6,130,047 and 6,379,888.
[0045] In general, the length of the sequences involved in
intermolecular base-pairing between the complement of the adapter
sequence of the signal primer and the reporter probe is not
critical. For the signal primer, however, it has been observed that
in general the T.sub.m of the target binding sequence has a greater
influence on assay efficiency and that longer target binding
sequences generally produce more fluorescent signal in the assay.
This may be due to the competition between the signal primer and
the extension product of the upstream amplification primer for
hybridization to the target sequence. The appropriate length for
the signal primer and the reporter probe is determined by the
number of nucleotides required for stable base-pairing to maintain
a partially double-stranded molecule under the selected reaction
conditions and is within the ordinary skill in the art. For
convenience, the sequences involved in base-pairing are typically
between about 8 and 75 nucleotides in length. The maximum length is
limited only by practical concerns such as the ease and efficiency
of oligonucleotide synthesis and recovery.
[0046] Selection of the appropriate concentrations of signal primer
and reporter probe in the reaction is also within the ordinary
skill in the art. Preferably the concentration of signal primer and
reporter probe is relatively high and the concentration of upstream
amplification primer is relatively low, as this generally provides
higher fluorescent signal generation in the reaction.
[0047] A second signal primer which hybridizes to the second,
complementary strand of a double-stranded target sequence may
optionally be included in the reaction provided that the first and
second signal primers do not hybridize to each other. The second
signal primer hybridizes to the second strand of the target
sequence downstream of the second amplification primer and is
extended and displaced by extension of the second amplification
primer. The second signal primer extension product is rendered
double-stranded by hybridization and extension of the first
amplification primer. Generation of the double-stranded labeled
structure or sequence and separation of the dye pair proceed as for
the first strand of the target sequence. The second signal primer
preferably comprises the same 5' adapter sequence as the first
signal primer to allow detection of the products of amplification
of both target strands with a single reporter probe.
[0048] In addition, multiple signal primers per strand of target
may be employed if desired, each hybridizing to the target sequence
downstream of the other on the same strand, with all signal primers
being hybridized downstream of the amplification primer. In this
manner, each signal primer is displaced by extension of the
upstream detector nucleic acid and the most 5' signal primer is
displaced by the amplification primer. Use of multiple signal
primers has the advantage of increasing or amplifying the signal
generated pet target, with an increase in sensitivity of the assay.
Again, it is preferable, but not necessary, that all of the signal
primers comprise the same 5' adapter sequence to allow detection of
all reaction products using a single reporter probe.
[0049] Multiple signal primers may also be used to simultaneously
detect a plurality of different target sequences. In this case, the
5' adapter sequences of the signal primers are preferably different
for each target to be detected. By labeling reporter probes
specific for the 5' adapter sequence of each target-specific signal
primer with donor/quencher dye pairs which are distinguishable, the
presence of each target may be determined by detecting changes in
the extent of fluorescence quenching in the reporter probe directed
to each target. This embodiment of the invention is particularly
useful for detection of single nucleotide sequence variations such
as are associated with certain disease states and conditions. The
target binding sequence of each signal primer may be selected to be
specific for a specific sequence variant of the target. Only those
signal primers which comprise the correct target binding sequence
for hybridization to the target will hybridize, be extended and
result in a complement of the adapter sequence being produced. The
reporter probe specific for that adapter sequence complement will
then produce a signal indicating which sequence variant(s) is/are
present by virtue of its distinguishing label.
[0050] Alternatively, for separate assay of multiple different
targets, the same 5' adapter sequence may be used in signal primers
directed to the multiple different target sequences. Specificity
for the different target sequences is conferred by varying the 3'
target binding sequence of the signal primer. This approach not
only simplifies the design and synthesis of signal primers, it
allows the same reporter probe to be used to detect any desired
target sequence. Commercially, this has the advantage that
production of only a single reporter probe is necessary to produce
assay systems for a variety of targets, thus lowering production
costs and simplifying the development of assays for new targets.
Further, synthesis of the various signal primers is simplified and
less expensive because they do not require labeling.
[0051] The methods of the invention are useful for detecting
variants of a nucleic acid sequence contained in a target nucleic
acid. In particular, the methods of the invention are directed to
detecting SNPs in a nucleic acid sequence of interest (e.g.,
alleles) and, optionally, to identifying such SNPs or alleles. Such
nucleotide sequence variants may be detected directly in a sample
to be analyzed during amplification of the target sequence. The
inventive methods are based upon the relative inefficiency of
primer extension by DNA polymerases when there are mismatches at or
near the 3' end of a primer hybridized to an otherwise
complementary sequence. The applicants have found that by selecting
nucleotides at or near the 3' end of a signal primer such that one
or more mismatches will occur when the signal primer is hybridized
to a first allele of a target nucleic acid and correct base pairing
will occur when the signal primer is hybridized to a second allele
of the target nucleic acid, the difference in the efficiency of
polymerase extension when the signal primer is hybridized to the
two different alleles may be used to indicate which allele the
target nucleic acid contains. When any one of multiple alleles may
be present, multiple signal primers are employed in the analysis,
each with a different potential mismatch at or near the 3' end. The
signal primer which is most efficiently extended provides the
identity of the allele (i.e., the identity of the nucleotide
present in the target sequence being analyzed). For example, if a
set of signal primers comprising A, G, C and T at the site of the
allele to be identified is hybridized to the target of interest and
extended, the identity of the allele will be the complement of the
nucleotide in the signal primer which was most efficiently extended
by the polymerase. For identification of the allele in a single
reaction, multiple signal primers are present in the reaction, each
with a separately detectable adapter sequence and reporter probe
(i.e., the adapter tails of the signal primers differ and are
detectable using reporter probes that are labeled with different
fluorophores which can be distinguished individually from within
the mixture of reporter probes).
[0052] More specifically, the signal primers of the invention are
oligonucleotides which hybridize to the target sequence of interest
and are extended by DNA polymerase during the amplification
reaction. The nucleotide sequence of the signal primer is selected
such that it hybridizes specifically to the target nucleic acid of
interest with the majority of the signal primer bases pairing
correctly in typical Watson-Crick fashion with the target. The
nucleotide sequence of the signal primer at or near the 3' end is
selected to discriminate between different alleles, SNPs or other
variants of the target sequence. Accordingly, the signal primer
contains a "diagnostic nucleotide" (defined above) at or near its
3' end. The diagnostic nucleotide permits analysis (e.g. detection
or identification) of a particular allele in a selected target. The
diagnostic nucleotide is chosen so that it forms a proper
Watson-Crick base pair with the selected nucleotide variant of the
intended target when the signal primer is hybridized to the target.
In contrast, hybridization of the signal primer to an incorrect
sequence variant will result in formation of a mismatch, rather
than a Watson-Crick base pair, between the diagnostic nucleotide
and the variant nucleotide of the (incorrect) target. Efficient
signal primer extension will occur only when the diagnostic
nucleotide participates in a proper Watson-Crick base pair with the
variant nucleotide of the target. If the signal primer hybridizes
to the incorrect sequence variant, the diagnostic nucleotide
participates in a mismatch rather than a proper Watson-Crick pair,
and extension of the signal primer is retarded. This difference in
efficiency of signal primer extension arising from participation of
the diagnostic nucleotide in a base pair or a mismatch with the
target sequence facilitates discrimination between allelic or
single nucleotide variants. As an example of how mismatches in the
primer allow allele discrimination in amplification reactions, if a
signal primer having a C residue at the diagnostic nucleotide
position produces a high signal indicative of efficient extension
of the signal primer, this indicates that the target allele is G.
In contrast, low signal for the extended signal primer indicates
that the target allele is not G. Use of a single signal primer to
make the analysis allows identification of an allele if only one
SNP is expected to occur in the target. If there may be multiple
different alleles present at the same nucleotide position, a single
signal primer will provide information on the presence or absence
of the allele for which the signal primer is diagnostic. To
identify the allele when multiple SNPs are possible, multiple
signal primers containing A, T and G at the site of the SNP may be
used to identify the allele in the target, i.e., the signal primer
which produces the highest signal associated with signal primer
extension product contains the nucleotide which is the complement
of the SNP in the target. In the present invention, the potentially
mismatched nucleotide of the signal primer is placed at the 3'
terminus or about one to four nucleotide residues from the 3'
terminus (i.e., at the N, N-1, N-2, N-3 or N-4 position).
[0053] It has been found that in many cases it is preferable to
place a second mismatch in the sequence of the signal primer that
is not directed to detection or identification of the allele of
interest. The second, non-diagnostic mismatch often improves the
level of discrimination between the SNPs being detected or
identified and is preferably selected based on a region of the
target sequence which is not expected to vary so that the
non-diagnostic mismatch will occur regardless of the target allele
being analyzed. The second mismatch may occur at any site within
the signal primer that produces a positive effect on allele
discrimination, but typically produces the greatest improvement
when it is near the diagnostic nucleotide. This is typically within
one to fifteen nucleotides from the diagnostic nucleotide, but
preferably within about 1-5 nucleotides of the diagnostic
nucleotide of the detector primer. The non-diagnostic mismatch may
be placed either 5' or 3' of the diagnostic nucleotide in the
signal primer. Applicants believe that the second, non-diagnostic
mismatch has a positional effect rather than a general effect on
the T.sub.m of the signal primer, based on the observation that as
the non-diagnostic mismatch is moved away from the diagnostic
mismatch its positive effect on allele discrimination diminishes.
Those skilled in the art are capable of determining through routine
experimentation the appropriate placement of the non-diagnostic
mismatch in a signal primer by evaluating its effect on allele
discrimination using the signal primer.
[0054] Although it is known that a mismatch in a shorter
oligonucleotide will have a greater effect on hybridization than a
mismatch in a longer oligonucleotide, allele discrimination using
the signal primers of the invention cannot be attributed entirely
to a T.sub.m-associated hybridization effect. For example, moving
the position of the diagnostic nucleotide away from the 3' end of
the signal primer toward the center of the molecule substantially
reduces discrimination. If the sole mechanism of discrimination
between alleles was T.sub.m-associated hybridization efficiency,
this repositioning should increase rather than decrease allele
discrimination.
[0055] When the signal primer forms a mismatch with the target at
or near it's 3' end, the detection efficiency of the mismatched
target is reduced. The accompanying reduction in signal upon
detection of the extended signal primer (i.e., the amplification
product or amplicon) indicates the presence or the identity of a
SNP at the position in the target sequence at which the diagnostic
mismatch with the signal primer occurred. If the signal primer
comprises an adapter tail such that, when the complement of the
adapter is synthesized as a result of extension of the signal
primer, a signal change is produced then the extension products may
be detected in real-time as amplification of the target occurs.
This eliminates the additional steps of post-amplification
detection of extension products. In isothermal amplification
reactions such as SDA, a single mismatch at N-1 or N-2 in the
signal primer in general may provide more efficient allele
discrimination than a single mismatch at the 3' terminus. In the
isothermal amplification methods of the present invention a
mismatch on the signal primer in close proximity to the diagnostic
nucleotide also results in excellent allele discrimination. The
latter configuration therefore represents a preferred embodiment
for signal primers of the invention.
[0056] In the above embodiments, the signal primer is typically
hybridized to the target downstream from any primer which is
extendible by polymerase such that extension of the second primer
displaces the signal primer and any signal primer extension
products which may be produced. Another embodiment uses signal
primers with target binding sequences that are at least partially
identical to the target binding sequence of an amplification primer
FIG. 4). Competitive hybridization between two oligonucleotides in
an amplification/detection system has been described previously
(U.S. Pat. No. 6,258,546 herein incorporated by reference) for
qualitative and quantitative detection of nucleic acids. This
approach provides detection efficiency that is equal to or better
than that of conventional signal primers that lie entirely between
the amplification primers, while still maintaining the specificity
derived from use of an internal probe. Overlap between the
hybridization regions of the amplification and signal primers
allows for flexibility in assay design and a reduction in overall
amplicon length, with the resulting potential for enhanced
amplification efficiency. This is important because flexibility in
system design is necessary to avoid primer:primer interactions,
restriction enzyme recognition sites, amplicon secondary structure
and regions of excessively high G-C content. Overlap of the signal
primer and an amplification primer may also enhance allelic
discrimination by providing additional competition between closely
related sequences for hybridization to the target sequence. In a
conventional system containing two signal primers, each specific
for one of two alleles at a given locus, and an upstream
amplification primer, there is competition between the two signal
primers for hybridization to the target sequence. Hybridization of
the specific oligonucleotide is, however, thermodynamically
favored, resulting in elevated signals for the specific allele. In
a further embodiment of the invention, an increase in specific
signal (or reduction in non-specific signal) may be expected when
additional competition for hybridization of the signal primer to
the target is provided by an overlapping amplification primer.
[0057] The applicants hypothesize that efficiency of allelic
discrimination obtained with the signal primers of the invention
are at least partially due to a kinetic effect. If a signal primer
is not efficiently extended on a target to which it is hybridized
(e.g., when it contains mismatches), it will be quickly displaced
from the template by extension of the upstream (or overlapping)
amplification primer. If the signal primer is efficiently extended,
extension will occur before the signal primer is displaced from the
target. That is, the upstream (or overlapping) amplification
primer, (which is typically perfectly matched and efficiently
extended) imposes a "time-limit" for extension on the signal
primer. This is an improvement over methods of allelic
discrimination that rely upon terminal or near-terminal mismatches
in amplification primers. In such systems, the amplification primer
in an isothermal reaction does not have a time-limit for extension
imposed upon it by additional components of the isothermal
amplification reaction or by thermocycling. Therefore, with
sufficient time available, an imperfectly matched amplification
primer may eventually be extended even when the extension reaction
is inefficient. This phenomenon could impair the ability to
discriminate between alleles when an amplification primer with a 3'
terminal mismatch is employed in isothermal amplification
reactions. In addition, the ability of amplification primers to
correct a mismatch with the target may contribute to these
observations. Amplification primers produce amplicons that are
perfectly matched with the amplification primers that produced
them, thus eliminating the basis of allelic discrimination. In
contrast, such "correction" does not occur with signal primers.
[0058] Whether hybridization of the signal primer results in
correct base-pairing or a mismatch at the diagnostic nucleotide
position of the target being analyzed is determined by evaluating
the relative efficiency of detector primer extension by DNA
polymerase. This determination may be quantitative or qualitative.
Signal primer extension is less efficient in the presence of a
mismatch at or near the 3' end and more efficient when the entire
3' end is correctly base-paired with the target. That is,
relatively more extended signal primer product is synthesized with
correct base-pairing near the 3' terminus. According to the method
of the invention, the extended signal primer is typically detected
by means of its 5' adapter tail sequence. The adapter tail is
copied during the course of amplification to generate a
complementary oligonucleotide that may be detected by hybridization
to a reported probe. The relative amount of signal generated by the
reporter probe is correlated with the amount of extended signal
primer in the reaction. Comparison of signals associated with
different signal primer/reporter combinations indicates the
relative efficiency of signal primer extension and permits
discrimination of alternative alleles.
[0059] There are many techniques known in the art for determining
the presence or amount of extended signal primer product produced
in the amplification reaction. First, the extension products of the
signal primer may be detected and/or quantified by their increased
size, for example by separation from unextended detector primer by
gel electrophoresis or by selectively capturing the extended signal
primer on a solid phase. However, in the preferred embodiment the
signal primers comprise a 5' adapter sequence that is detectable
only when the signal primer has been extended and its complement
synthesized during the course of the reaction. The signal primer
compliment is detected by hybridization to a detectable reporter
probe. One example of such detectable labels are fluorescent dyes
which undergo changes in fluorescence polarization when the
oligonucleotides to which they are linked have been hybridized to
and extended on a target sequence. Methods employing changes in
fluorescence polarization to detect hybridization and extension of
a signal primer are described in U.S. Pat. No. 5,800,989; U.S. Pat.
No. 5,593,867; and U.S. Pat. No. 5,641,633. These patents describe
using changes in fluorescence polarization which occur when the
signal primer becomes double-stranded (made possible by its
successful extension on the target sequence) to detect target
amplification. In the methods of the invention, changes in
fluorescence polarization of a fluorescently-labeled reporter
primer may be used to evaluate extension efficiency and to detect
or identify a SNP in the target being amplified.
[0060] A second example of labels which undergo a detectable change
in signal indicative of primer extension are fluorescent
donor/quencher dye pairs. The quencher dye may also, but need not
necessarily, be fluorescent. When the donor and quencher are in
close proximity, fluorescence of the donor is quenched. As the dyes
are moved farther apart, quenching is reduced and donor
fluorescence increases. The use of such donor/quencher dye pairs in
a variety of mechanisms for increasing the distance between the
dyes in the presence of target for detection of target nucleic
acids is described in U.S. Pat. No. 5,846,726; U.S. Pat. No.
5,691,145, and EP 0 881 302. Both the use of donor/quencher dye
pairs in signal primer amplification systems and in extendible
primer/probes for detection of unamplified or post-amplification
targets are disclosed. In the present invention, the reporter
probes of the invention may be labeled with donor/quencher dye
pairs and employed for detection and/or identification of SNPs in
the target as is known in the art.
[0061] As disclosed in the foregoing references, a variety of
primer extension detection systems are known for use in essentially
any nucleic acid amplification reaction. They are particularly
well-suited to isothermal amplification reactions where they
provide rapid, real-time detection of primer extension. In the
methods of the present invention, signal primers may comprise
adapter sequences that are detectable only upon successful
extension of the signal primer. Preferred embodiments employ
donor/quencher dye pairs to detect signal primer extension
products. It will be apparent that, in addition to SDA, the signal
primers of the invention may be adapted for use in other primer
extension amplification methods (e.g., PCR, 3SR, TMA or NASBA). For
example, the methods may be adapted for use in PCR by substituting
PCR amplification primers and employing a strand displacing DNA
polymerase which lacks 5'.fwdarw.3' exonuclease activity (e.g.,
Sequencing Grade Taq from Promega or exo.sup.- Vent or exo.sup.-
Deep Vent from New England BioLabs) in the PCR. The signal primers
hybridize to the target downstream from the PCR amplification
primers. They are extended, displaced from the target and rendered
double-stranded essentially as described for SDA. The
single-stranded oligonucleotide comprising the complement of the
signal primer 5' adapter sequence is generated by denaturing the
double-stranded secondary amplification product, followed by
hybridization of the reporter probe and polymerase extension to
synthesize the complementary strand of the labeled reporter moiety
in the reporter probe. As in SDA systems, synthesis of the
complementary strand either directly or indirectly provides a
change in the proximity of donor and quencher dyes and changes the
degree of fluorescence quenching. An associated change in a
fluorescence parameter, such as intensity, serves as an indication
of target amplification.
[0062] For adaptation of the inventive methods to 3SR, TMA or
NASBA, a 5'.fwdarw.3' exonuclease deficient reverse transcriptase
with strand displacing activity is employed, with hybridization of
the signal primer to the RNA target downstream of an amplification
primer. In a reaction scheme similar to that previously described,
the hybridized signal primer is 1) extended, and 2) displaced by
extension of the upstream amplification primer. The displaced
signal primer extension product is then made entirely
double-stranded by hybridization and extension of the second
amplification primer which contains an RNA polymerase promoter. The
promoter sequence, which is located on the 5' tail of the second
amplification primer, is made double-stranded by extension of the
3' end of the signal primer extension product. From the
double-stranded promoter, RNA polymerase generates RNA copies
complementary to the signal primer extension product. The 3' end of
each RNA copy contains a sequence complementary to the adapter
sequence of the signal primer. This sequence then hybridizes to a
complementary region of the reporter probe. If the reporter probe
is extendible, reverse transcriptase will extend the 3' end of the
probe upon the RNA template to produce a reporter probe extension
product. RNase H will then degrade the RNA strand of this
heteroduplex, freeing the reporter probe extension product to
hybridize with the second amplification primer containing the
promoter sequence. Conversion of the promoter sequence to the
double-stranded form will initiate a new round of RNA synthesis,
yielding products that are complementary to the reporter probe
extension product, including the full reporter moiety sequence.
Hybridization of reporter probes to these RNA targets will cause
the reporter moiety to unfold, producing signal as donor and
quencher dyes are separated and quenching is reduced. In addition,
the reporter probes will be extended upon the RNA target as
described above and the cycle will be repeated.
[0063] If the reporter probes are not extendible (capped) the
adapter sequence of the signal primer must be selected to contain
sequences such that the complement of the adapter sequence will
hybridize to the reporter moiety of the reporter probe. The
reaction will proceed as described above, except that the capped
reporter probes will not be extended and the RNA complements of the
signal primer extension product will hybridize to the capped
reporter probe (including the reporter moiety). Signal will be
produced as the reporter moiety unfolds and quenching of donor
fluorescence is relieved during hybridization.
[0064] For reduced background, it is preferred that the signal
primers of the invention be used as described above, with the
signal primer extension product being separated from the target
sequence by displacement due to extension of the upstream
amplification primer. However, it will be apparent that the
amplification primers known for use in the various nucleic acid
amplification reactions may themselves be used for hybridization of
the reporter probe if the primers contain appropriate adapter
sequences. In this embodiment, the adapter sequence of an SDA
primer is located between the nickable restriction endonuclease
site that drives SDA and the target binding sequence. SDA with this
primer will produce an amplified product that contains at its 3'
end a sequence complementary to the reporter probe. Binding of the
reporter probe to this complementary sequence will produce signal
as described above. For PCR and NASBA the amplification primers are
modified by addition of a noncomplementary 5' tail as described
above for the signal primer. In the case of NASBA, the primer
lacking the RNA polymerase promoter is the primer modified with the
5' adapter sequence. During PCR and NASBA, complements of the
adapter-containing primer extension products are produced as
described above for the signal primers. These complementary
sequences are made single-stranded either by heat denaturation
(PCR) or enzymatic digestion of RNA template (RNase H in NASBA),
and the single-stranded complement then binds to reporter probe as
described above for signal primers. The use of amplification
primers as signal primers eliminates the need for the additional
signal primer in the reaction, but because background may be higher
in this embodiment the sensitivity of the assay may be
decreased.
[0065] In other alternative embodiments, the signal primers of the
invention may be used in non-amplification based assay formats to
detect target sequences. In a first non-target amplification
embodiment, the 3' single-stranded target binding sequence of the
signal primer hybridizes to the 3' end of the target sequence such
that the 5' adapter sequence forms a 5' overhang. The target
sequence functions as a primer for synthesis of a strand
complementary to the signal primer using a polymerase to extend the
target sequence using the 5' overhang as a template. If the target
binding sequence of the signal primer hybridizes to only a portion
of the target sequence, the target sequence also forms a 5'
overhang and the signal primer may be similarly extended using the
5' overhang of the target as a template. Alternatively, the signal
primer may be non-extendible as synthesis of a copy of the target
sequence is not required in this embodiment of the invention. In
either case, the complement of the adapter sequence of the signal
primer is synthesized. Upon separation of the two strands, the
complement of the signal primer adapter sequence in the target will
hybridize to the 3' end of the reporter probe, rendering the
labeled reporter moiety double-stranded upon polymerase extension
of the recessed 3' end of the adapter sequence complement. An
advantage of this embodiment over the reaction described in U.S.
Pat. No. 5,866,336 is that use of the overhang allows synthesis of
the complement of the adapter sequence in a single extension step
rather than two. That is, the complement of the adapter sequence is
appended directly to the original target, thus allowing target
detection without requiting amplification. In a second preferred
non-target amplification embodiment of the invention the signal
primer is hybridized to an internal sequence of the target with an
additional primer hybridized upstream to displace it (commonly
referred to as a "bumper" primer). The signal primer and bumper
primer are extended such that the signal primer extension product
is displaced from the target sequence. A second pair of primers are
hybridized to the extension product and extended such that the
downstream primer extension product contains the complement of the
adapter sequence and is displaced from the signal primer extension
product by extension of its bumper primer. The reporter probe
hybridizes to the complement of the adapter sequence and the
adapter sequence is extended as described herein to synthesize the
complement of the reporter moiety. Because this is an isothermal
reaction which depends on strand displacement to separate
complementary strands, extension of the first bumper primer renders
the target double-stranded and unable to participate in any further
reaction steps. Although a copy is generated and displaced, this is
not considered target amplification because the copy represents a
subsequence of the original target which is detected as an
indication of the presence of the target and only one copy of the
subsequence is generated per original target sequence.
[0066] The foregoing disclosure primarily relates to preferred
embodiments in which the reporter moiety is labeled with a
fluorescent donor/quencher dye pair and synthesis of the complement
of the reporter moiety is detected by an increase in fluorescence.
This label system allows synthesis of the complement to be detected
in real-time and/or in a homogeneous assay (i.e., without
separation of the label prior to detection). However, other labels
useful in the invention will be apparent to those skilled in the
art. For example, a single fluorescent label may be employed on the
reporter moiety with detection of a change in fluorescence
polarization in the presence of the complement of the reporter
moiety (see U.S. Pat. No. 5,593,867). Non-fluorescent labels are
also useful. For example, the reporter moiety may be labeled with a
lipophilic dye and contain a restriction site which is cleaved in
the presence of the complement of the reporter moiety (see U.S.
Pat. No. 5,550,025). Alternatively, the reporter probe may be
radiolabeled and the products resulting from synthesis of the
complement of the reporter moiety may be resolved by
electrophoresis and visualized by autoradiography. Immunological
labels may also be employed. A reporter probe labeled with a hapten
can be detected after synthesis of the complement of the reporter
moiety by first removing unreacted reporter probe (for example by
adapter-specific capture on a solid phase) and then detecting the
hapten label on the reacted reporter probe using standard
chemiluminescent or colorimetric ELISAs. A biotin label may be
substituted for the hapten and detected using methods known in the
art.
[0067] The label indicating the presence of the complement of the
reporter moiety may be detected at a selected endpoint in the
reaction. However, because oligonucleotides with increased distance
between the donor and the quencher are produced concurrently with
hybridization and primer extension, the label may also be monitored
as the reaction is occurring, i.e., in "real-time". This
homogeneous, real-time assay format can be used to provide
semi-quantitative or quantitative information about the initial
amount of target present. For example, the rate at which the label
(e.g., fluorescence intensity) changes during the reaction (either
as part of target amplification or in non-amplification detection
methods) is an indication of initial target levels. As a result,
when more initial copies of the target sequence are present, the
label more rapidly reaches a selected threshold value (i.e.,
shorter time to positivity). In addition, the rate of change in the
label during the course of the reaction is more rapid in samples
containing higher initial amounts of target than in samples
containing lower initial amounts of target. These or other
measurements as are known in the art may be made as an indication
of the presence of target or as an indication of target
amplification. The initial amount of target is typically determined
by comparison of the experimental results to results for known
amounts of target.
[0068] Many donor/quencher dye pairs known in the art are useful in
preferred embodiments of the present invention. These include, for
example, fluorescein isothiocyanate (FITC)/tetramethylrhodamine
isothiocyanate (TRITC), FITC/Texas Red.TM. (Molecular Probes),
FITC/N-hydroxysuccinimidyl 1-pyrenebutyrate (PYB), FITC/eosin
isothiocyanate (FITC), N-hydroxysuccinimidyl 1-pyrenesulfonate
(PYS)/FITC, FITC/Rhodamine X, FITC/tetramethylrhodamine (TAMRA),
and others. The selection of a particular donor/quencher pair is
not critical. For energy transfer quenching mechanisms it is only
necessary that the emission wavelengths of the donor fluorophore
overlap the excitation wavelengths of the quencher, i.e., there
must be sufficient spectral overlap between the two dyes to allow
efficient energy transfer, charge transfer or fluorescence
quenching. P-(dimethyl aminophenylazo) benzoic acid (DABCYL) is a
non-fluorescent quencher dye which effectively quenches
fluorescence from an adjacent fluorophore, e.g., fluorescein or
5-(2'-aminoethyl) aminonaphthalene (EDANS). Certain donor/quencher
pairs are exemplified above and in the following Examples, however,
others will be apparent to those skilled in the art and are also
useful in the invention. Any dye pair which produces fluorescence
quenching in the reporter probes of the invention are suitable for
use in the methods of the invention, regardless of the mechanism by
which quenching occurs. Terminal and internal labeling methods are
also known in the art and may be routinely used to link the donor
and quencher dyes at their respective sites in the reporter
probe.
EXAMPLE 1
[0069] Strand Displacement Amplification reactions containing
signal primers according to the invention were run essentially as
described in U.S. Pat. No. 5,547,861 for detection of a synthetic
target sequence. A first reaction contained 10.sup.6 copies of the
target sequence, SDA amplification primers appropriate for
amplification of the synthetic target sequence, 100 nm of a signal
primer according to the invention comprising a target binding
sequence specific for the target and a 5' tail sequence identical
to the 3' sequence of a reporter probe, and 200 nm of the reporter
probe. The sequence of the reporter probe contained an RERS in the
5' region flanked by fluorescein and Rhodamine X (Rox) such that
fluorescence of fluorescein was quenched when the RERS was intact.
The sequences of the signal primer and reporter probe (shown in the
5' to 3' direction) are shown below. The target binding sequence is
shown in italics, the 5' adapter sequence of the signal primer and
the identical 3' sequence of the reporter probe are underlined and
the RERS of the reporter probe is bolded.
TABLE-US-00001 Signal Primer (SEQ ID NO:1):
CCAAAATGACAGCTTCTGATGGAATGACTCACTGAGTTGGAACGT Reporter Probe (SEQ
ID NO:2): (fluorescein)TACCTCGAGT(rox)GCAGCCAAAAGACAGCTTCTGA
TGGAA
[0070] A second reaction contained no target and the same signal
primer as in the first reaction. A third reaction was a control
reaction which contained only 10.sup.6 copies of target and the
reporter probe (i.e., no signal primer). Fluorescein fluorescence
was detected in real-time during the amplification reactions. As
shown in FIG. 5, donor fluorescence remained low and constant in
the absence of target, indicating quenching of fluorescence
throughout the reaction due to failure of the RERS of the reporter
probe to be converted to double-stranded form and cleaved. In the
absence of signal primer donor fluorescence also remained quenched
throughout the amplification reaction. In the presence of target,
signal primer and reporter probe, however, donor fluorescence was
initially low but increased during the time course of the
amplification reaction as the RERS of the reporter probe was
converted to double-stranded form and cleaved to reduce the extent
of fluorescence quenching. These results demonstrate that the
signal primers and reporter probes of the invention can be used to
detect a nucleic acid target sequence by monitoring changes in the
extent of fluorescence quenching.
[0071] In a similar experiment, 0 and 250 copies of cloned HIV
target DNA were detected using a variety of signal primers in
combination with one of two reporter probes, each having the same
sequence but labeled with different donor/quencher dye pairs. The
sequences of the signal primers and reporter probes are shown in
the 5' to 3' direction below. The target binding sequence is shown
in italics, the 5' adapter sequence of the signal primer and the
identical 3' sequence of the reporter probe are underlined and the
RERS of the reporter probe is bolded.
Signal Primers:
TABLE-US-00002 [0072] (SEQ ID NO:3, UA1)
GAAAGACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATTGTG (SEQ ID NO:4, UA2)
GAAAGACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATTGTGGA TG (SEQ ID NO:5,
UA3) GAAAGACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATT (SEQ ID NO:6,
UA3.1) GAAAGACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATTG (SEQ ID NO:7,
UA4) ACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATTGTG (SEQ ID NO:8, UA5)
ACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATTGTGGATG (SEQ ID NO:9, UA6)
ACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATT (SEQ ID NO:10, UA6.1)
ACGTTAGCCACCATACGGATACCCCTTTTCTTTTAAAATTG (SEQ ID NO:11, UA7)
AGCCACCATACGGATACCCCTTTTCTTTTAAAATTGTG (SEQ ID NO:12, UA8)
AGCCACCATACGGATACCCCTTTTCTTTTAAAATTGTGGATG (SEQ ID NO:13, UA9)
AGCCACCATACGGATACCCCTTTTCTTTTAAAATT (SEQ ID NO:14, UA9.1)
AGCCACCATACGGATACCCCTTTTCTTTTAAAATTG Reporter Probes (SEQ ID NO:15)
(fluorescein)TGCCCGAGT(dabcyl)GAAAGACGTTAGCCACCATA CGGAT
(fluorescein)TGCCCGAGT(rox)GAAAGACGTTAGCCACCATACGG AT
[0073] The signal primers differed in length and T.sub.m of the
target binding sequence and of the reporter binding sequence.
Fluorescein fluorescence was monitored during amplification. To
compare the reporter probe/signal primer combinations, results were
expressed as the area under the fluorescence curve or "MOTA". The
more area under the curve, the more fluorescence generated by a
particular reporter probe/signal primer combination and the more
efficient the detection of amplified products. Both reporter probes
worked well in combination with all signal primers for detection of
the HIV target, although performance was generally not as good as
for reporter probes containing hairpin reporter moieties. However,
linear reporter probes such as these are shorter than reporter
probes containing secondary structures and are therefore easier to
synthesize with higher yield. Higher MOTA values were obtained
using the fluorescein-dabcyl reporter probe, suggesting that this
dye pair may have a higher quenching efficiency.
EXAMPLE 2
[0074] SDA reactions were prepared to contain the different signal
primers shown in Example 1, either 0 or 5,000 copies of the cloned
HIV target, and a reporter probe. The sequence of the reporter
probe was as follows:
TABLE-US-00003 (SEQ ID NO:16, TBD9)
(dabcyl)TAGTGCCCGAGCACT(rox)GAAAGACGTTAGCCACCATACG GAT
[0075] SEQ ID NO:16 contains a BsoBI RERS in the single-stranded
loop of a hairpin structure at the 5' end. The SDA reactions
contained 500 nM SDA amplification primers, 50 nM bumper primers,
and 200 nM each signal primers and reporter probes. Rhodamine
fluorescence was monitored during amplification. For each signal
primer/reporter probe combination rhodamine fluorescence increased
in the presence of target during the amplification reaction. In the
absence of target rhodamine fluorescence remained low throughout
the reaction. The results of one of the reactions are shown in FIG.
6A, for signal primer SEQ ID NO:3, with the multiple curves
representing replicate samples. Results indicated that the length
and T.sub.m of the adapter sequence did not significantly affect
assay performance. However, the T.sub.m of the target binding
sequence of the signal primer influenced signal generation, with
signal primers comprising longer target binding sequences
performing better than those with shorter target binding
sequences.
[0076] The experiment was repeated using three different reporter
probes, including SEQ ID NO:16. The additional reporter probes were
as follows:
TABLE-US-00004 (SEQ ID NO:17, TBD10)
(fluorescein)TAGTGCCCGAGCACT(dabcyl)ACGTTAGCCACCAT ACGGAT (SEQ ID
NO:18, TBD11) (fluorescein)TAGTGCCCGAGCACT(dabcyl)AGCCACCATACGGA
T
[0077] In this experiment the concentration of the upstream
amplification primer was reduced to 100 nM. Amplification was
performed in the presence of either 0 or 250 copies of target DNA.
Reactions containing target showed a rapid increase in fluorescein
fluorescence after as little as 5 min. of incubation. In contrast,
reactions without target exhibited low fluorescein fluorescence
throughout the reaction period. Results for a reaction containing
SEQ ID NO:8 and SEQ ID NO:17 are shown in FIG. 6B, with the
multiple curves representing replicate samples. The reporter
probe/signal primer combinations SEQ ID NO:16/SEQ ID NO:4 and SEQ
ID NO:17/SEQ ID NO:8 produced similar MOTA values (62,147 and
66,051 respectively), whereas the SEQ ID NO:18/SEQ ID NO:12
combination was less efficient (MOTA=49,879) suggesting less
efficient hybridization and conversion due to the shorter probe and
primer length.
EXAMPLE 3
[0078] In this experiment a reporter probe comprising a hairpin and
a nickable rather than cleavable BsoBI RERS was tested in SDA. The
reporter probe had the following sequence (SEQ ID NO:19,
TBD13.1):
TABLE-US-00005 (flourescein)TAGTGCTCGGGCACT(dabcyl)GAAAGACGTTAGCC
ACCATACGGAT
[0079] This reporter probe was used with SEQ ID NO:4 as the signal
primer in the amplification reaction. A mean MOTA value of 48,000
was obtained in the presence of 250 copies of HIV target DNA,
compared with a score of less than 150 from negative controls. The
lower MOTA score observed as compared to reporter probe SEQ ID
NO:16, which has the same 3' tail sequence may be due to
inefficient priming of the polymerase off the short oligonucleotide
that is left after nicking of the BsoBI site. Performance of the
reaction may be enhanced by increasing the length of the hairpin to
stabilize this oligonucleotide and provide a larger region for
binding of the polymerase.
EXAMPLE 4
[0080] In this experiment SDA was performed using a reporter probe
containing a G-quartet structure and an RERS as the reporter
moiety. This reporter probe had the following sequence (SEQ ID
NO:20, TBD14):
TABLE-US-00006 (fluorescein)GGTTGGCTCGAGGTTGGT(dabcyl)GAAAGACGTTA
GCCACCATACGGAT
[0081] An increase in fluorescein fluorescence was observed during
the course of amplification of 250 copies of HIV target DNA. No
such increase in fluorescence was observed in the absence of
target.
EXAMPLE 5
[0082] In this experiment, sequence variations within the human
.beta..sub.2AR gene and its upstream 5' untranslated region were
used as targets for the development of six different
adapter-mediated SNP detection systems according to the method of
the invention. SDA systems comprising two bumper primers, two
amplification primers and two allele-specific signal primers were
designed for each of six SNP sites (-654, -367, -47, +46, +491 and
+523) (Table 1, FIG. 7). Within each system, the two signal primers
comprised identical sequences except for the diagnostic nucleotide
that was positioned one base upstream from the 3' terminus (N-1).
In each SDA system, the same pair of adapter sequences was appended
to the 5' ends of the signal primers to permit detection using a
common pair of universal reporter probes. The variant position of
the signal oligonucleotide contained either adenosine (A), cytosine
(C), guanine (G) or thymine (T). For the purposes of this study,
"wild-type" allele (or allele A) refers to the sequence illustrated
in GeneBank (Accession #M15169) while "mutant" (or allele B)
represents the alternative nucleotide (SNP). .beta..sub.2AR target
sequences containing allele A and/or allele B of each of the six
targeted SNPs were cloned in to pUC19 from pooled human genomic
DNA.
[0083] SDA analysis of the six SNPs was carried out as follows. In
brief, cloned .beta..sub.2AR SNPs targets (1.times.10.sup.5 copies
per reaction) in a common SDA buffer were denatured for 5 min at
95.degree. C. and cooled to room temperature. The denatured target
was added to Priming Microwells containing SDA primers, bumper
primers, the two allele-specific signal primers and universal
reporter probes (Table 1). The target-primer mixture was incubated
for 5 min at room temperature. Priming Microwells were then heated
at 72.degree. C. for 10 min to denature any non-specific
hybridization that might have occurred. At the same time,
Amplification Microwells containing dried Bst DNA polymerase and
BsoBI restriction enzyme were pre-equilibrated at 52.degree. C. One
hundred microliters of the target-primer mix was transferred to the
Amplification Microwells, sealed and incubated at 52.degree. C. in
a ProbeTec.TM. ET System. The final reactions contained; 24.5 mM
potassium phosphate (pH 7.6), 101 mM Bicine, 82 mM potassium
hydroxide, 12.5% dimethylsulfoxide (DMSO), 5 mM magnesium acetate,
10 .mu.g acetylated bovine serum albumin, 100-500 nM upstream
primer, 100-500 nM downstream primer, 50 nM bumper primers, 100-250
nM signal primers, 150-500 nM reporter probes, 0.1 mM
deoxyadenosine triphosphate, 0.1 mM deoxyguanosine triphosphate,
0.1 mM thymidine triphosphate, 0.5 mM 2'-Deoxycytidine
5'-O-(1-Thiotriphosphate) S-isomer, approximately 120 units of Bst
DNA polymerase and 300 units of BsoBI restriction enzyme.
[0084] Specific amplification products were detected by monitoring
the change in fluorescence intensity associated with the
hybridization of a reporter probe to the complement of the
appropriate signal primer, the subsequent extension of the signal
primer complement and cleavage of the resultant double stranded
product. For each well, one fluorescein (FAM) (mutant signal) and
one rhodamine (ROX) (wild-type signal) reading was made every
minute during the course of the reaction. The FAM and ROX
fluorescence readings for each sample were plotted over 60 minutes.
For SNP reactions containing wild-type target only, there was a
significant increase in ROX fluorescence, over time, compared to a
minor increase FAM. In contrast, the fluorescence profile was
reversed for samples containing mutant target DNA. In samples
containing both wild-type and mutant DNA target, fluorescence
increased in both optical ranges, indicating the presence of both
alleles in the sample.
[0085] The allele specific fluorescence signals were analyzed using
the SNP V2.6 Algorithm (Docket No. 020187.0150). The Maximum
Density metric (derived from the ratio of ROX and FAM signals
(ln(ROX/FAM)) was used to determine which allele was present in the
sample. High positive values (typically >1.0) indicated allele A
(homozygous wild-type), low negative values (typically <-1.0)
indicated allele B (homozygous mutant) and values close to zero
(typically -1.0 to +1.0) indicated the presence of a mixture of
both allele A and B (heterozygous) (FIG. 8).
[0086] FIGS. 9A-D show the results obtained from genotyping cloned
.beta..sub.2AR targets containing the -654 SNP. In each case, SDA
results correlated with those based on sequence analysis of the
cloned DNA target. Signal primers with perfect complimentarity to
the target sequence were preferentially extended and detected over
those that contained a mismatch at the position of the diagnostic
nucleotide.
EXAMPLE 6
[0087] Sequence variation at two SNP sites within the same
amplified target region of the .beta..sub.2AR gene was detected by
designing a single pair of SDA primers that spanned the region of
interest together with signal primers that were specific for each
of the individual SNPs. As in Example 5, the diagnostic nucleotides
in the signal primers were positioned at the penultimate (N-1) 3'
residue. The amplification primer, bumper primer, signal primer and
reporter probe sequences are listed in Table 1. Use of common
amplification primers allows the simultaneous identification of
multiple sequence alleles or sequence variations in close
proximity. According to the method of the invention, a single
reaction under one set of amplification conditions (buffer, enzyme
concentrations, temperature, etc.) can provide a convenient,
reliable, and inexpensive method for identifying multiple sequence
alleles.
[0088] Single nucleotide variations at amino acids 164 (nucleotide
+491) and amino acid 175 (nucleotide +523) of the .beta..sub.2AR
gene were detected and identified using common amplification
primers, bumper primers and reporter probes in conjunction with
allele-specific diagnostic signal primers that were specific for
the two targeted SNPs. As in Example 5, the term wild-type refers
to the sequence recorded in GeneBank Accession #M15169 while mutant
represents the alternative allele. For the +491 nucleotide
position, the wild-type allele is a C, whereas the mutant allele is
a T at this position. This nucleotide change results in a threonine
to isoleucine amino acid change. For the +523 nucleotide position,
the wild-type allele is a C, whereas the mutant allele is an A at
this position.
[0089] SDA was generally performed as described in Example 5. The
final concentrations of components in each 100 .mu.L reaction were
101 mM bicine, 82 mM KOH, 24.5 mM KiPO.sub.4 (pH 7.6), 5.0 mM
MgOAc, 0.1 mM each dTTP, dGTP, dATP, 0.5 mM dCTP.alpha.S, 10 .mu.g
acetylated BSA, approximately 300 units of BsoBI, approximately 120
units of Bst polymerase. The target for amplification consisted of
a cloned double stranded DNA sequence containing the wild-type or
mutant nucleotides at positions 491 and 523 of the .beta..sub.2AR
gene.
[0090] SDA reactions were carried out at 52.degree. C. in the
presence of 105 copies of target. Control reactions contained no
target DNA. For each well, one FAM (detects mutant signal) and one
ROX (detects wild-type signal) reading was made every minute during
the course of the reaction. Fluorescent readings for each sample
type were plotted over 60 minutes. For both SNP assays, in
reactions containing wild-type target only there was a significant
increase in ROX fluorescence over time compared to a relatively
minor increase FAM signal. In contrast, the fluorescence profile
was reversed for samples containing mutant target DNA. In the
sample containing both wild-type and mutant DNA, fluorescence
increased in both optical ranges indicating the presence of both
alleles in the sample. Maximum Density results obtained from cloned
.beta..sub.2AR SNP targets for SNP +491 and +523 systems are shown
in Table 2. These results confirm the feasibility of the method of
the invention for detecting multiple allelic variations within a
region of DNA that is spanned by two amplification primers.
EXAMPLE 7
[0091] This example demonstrates the detection of six SNPs within
the human .beta..sub.2AR gene according to the method of the
invention. The disclosed primers and assay systems permit the
identification of the five most common .beta..sub.2AR haplotype
pairs (Drysdale et al., Proc. Natl. Acad. Sci., 2000; 97:
10483-10488). Haplotype analysis has become increasingly important
in the emerging field of pharmacogenomics in which phenotypes
typically involve the interaction of several loci throughout the
genome. Multiple SNP detection is important for circumstances in
which individual SNPs have poor predicative power. The advantage of
the disclosed invention is the ability to genotype multiple loci
using common amplification conditions (buffer, enzymes,
temperature, etc.), thereby providing an improved workflow and ease
of use over existing methods. The primer, adapter and probe
sequences of the six SNP assays are listed in Table 1. In each
assay system the diagnostic nucleotide of the signal primers was
positioned at the penultimate (N-1) 3' residue, thereby reducing
non-specific priming and enhancing discriminatory power.
[0092] Single nucleotide variations in the 5' upstream and coding
sequences of the .beta..sub.2AR gene at nucleotides -654, -367,
-47, +46, +491 and +523 of the .beta..sub.2AR were detected
essentially as described in Example 2. The target for amplification
consisted of two cloned double stranded DNA sequences of
approximately 1.5 kb that spanned all six targeted SNP loci of the
.beta..sub.2AR gene. The individual clones were genotyped by
sequence analysis. To create a heterozygous target pool for each
SNP, equal mixtures of wild-type and mutant clones were prepared.
Reactions were carried out at 52.degree. C. in the presence of 105
copies of target as described in Example 5. Control reactions
contained no target DNA. For each well, one FAM (mutant signal) and
one ROX (wild-type signal) reading was made every minute during the
course of the 60 minute reaction time. For SDA reactions containing
only wild-type target for a given locus, there was a significant
increase in ROX fluorescence over time compared to a relatively
minor increase FAM signal. In contrast, the fluorescence profile
was reversed for samples containing only mutant target DNA. In
samples containing both wild-type and mutant target for a specific
locus, fluorescence increased in both optical ranges, indicating
the presence of both alleles in the sample.
[0093] As described in Example 5, the ratio of ROX to FAM
fluorescence was used to determine the nucleotide base present at
each SNP locus. Results from all six SNP sites were combined to
provide a haplotype for each of the cloned targets. In both cases,
the specific alleles at each locus and overall haplotypes agreed
with DNA sequence analysis (Table 3).
EXAMPLE 8
[0094] Modified SDA primers were designed for the -367
.beta..sub.2AR SNP such that the target hybridization region of the
amplification primers overlapped that of the signal primers (Table
1, FIG. 4). Competitive hybridization between two oligonucleotides
in an amplification/detection system has been described previously
(U.S. Pat. No. 6,258,546 herein incorporated by reference) for the
qualitative and quantitative detection of nucleic acids. The
extensive overlap between the amplification and signal primers in
the -367 system provided for an overall shorter amplicon than is
possible with conventional designs. This is an important attribute
because the sequence around this SNP is approximately 78% G-C rich,
which is far beyond the 60% cutoff suggested for most amplification
methods. The ability to reduce amplicon size has the potential to
provide a more robust amplification reaction and does not appear to
impair analytical sensitivity. Importantly, the design of
amplification and signal primers that almost completely overlap
limits the amount of sequence available for non-specific
interactions, which inevitably inhibit the efficiency of
amplification and detection.
[0095] Apart from inclusion of the new SDA primer in one of the
reaction mixtures, amplification conditions were the same as those
described in Example 5. Reactions were carried out at 52.degree.
C., in the presence of 106 copies of oligonucleotides containing
target allele A (homozygous), allele B (homozygous) or a mixture of
alleles A and B (heterozygous). Control reactions contained no
target DNA. FIG. 10 shows the amplification curves for the
conventional -367 SNP assay and those obtained with an overlapping
primer design. Good discrimination of alleles A and B was obtained
with both SDA systems.
EXAMPLE 9
[0096] The experiment described in Example 5 was repeated for the
-654 SNP assay except that the two signal primers were modified to
include additional mismatches towards the 3' terminus of the target
binding sequence (FIG. 11). The artificially created mismatches
were introduced 3 bases from the 3' terminus (N-3 position), and 2
bases upstream of the diagnostic nucleotide (N-1). Each of the two
allele-specific signal primers was used in conjunction with the
other SDA primers employed in the -654 SNP assay system described
in Example 5. SDA reactions were performed containing 104 or 106
copies of synthetic target oligonucleotides representing allele A
(homozygous), allele B (homozygous), or a mixture of
oligonucleotides representing alleles A and B (heterozygous).
Results showed that signal intensities obtained using primers
containing the additional non-diagnostic mismatch with the target
sequence were lower than those achieved with the original primer
design. However, allelic discrimination with the modified signal
primers was vastly improved (Table 4). For reactions containing
just the allele A target, a strong ROX signal was obtained while
the FAM signal was efficiently suppressed. The opposite was true in
reactions containing just the allele B target. When a mixture of
alleles A and B was present, signals were obtained with both the
ROX and FAM channels.
[0097] This example illustrates that an artificially created
mismatch in the signal primer of the inventive method can be used
to enhance allelic discrimination. Such mismatches may be located
upstream or downstream of the diagnostic nucleotide and serve to
destabilize the base pairing at the 3' end of the signal primer,
thereby reducing the efficiency of polymerase extension. This may
be of particular importance in systems designed to discriminate
SNPs in highly G-C rich DNA in which base pairing and base stacking
interactions are particularly strong.
EXAMPLE 10
[0098] This example illustrates the use of non-diagnostic
mismatches in amplification primers to modify or eliminate
restriction enzyme sites that would preclude detection by SDA. In
the SDA systems described in the previous examples, amplification
is achieved through the coordinated activity of Bst DNA polymerase
and the restriction enzyme, BsoBI. Hybridization of a target
nucleic acid containing a BsoBI recognition sequence to a
complementary primer would result in the formation of a double
stranded substrate for enzymatic cleavage (FIG. 3A, B).
Alternatively, hybridization of a primer upstream of a BsoBI
recognition sequence site and extension of the primer by polymerase
through the restriction site would also result in formation of a
cleavable substrate. Were either of these scenarios to occur, the
target sequence would be unable to serve as a template for SDA. For
most diagnostic applications this limitation on SDA system design
is easily overcome by careful selection of target sequences that
lack recognition sites for the SDA enzyme(s). For SNP analysis,
however, it represents a more challenging problem because with
these assays there is no latitude in selection of the target
sequence. To overcome this problem, SDA systems can be designed
with deliberate mismatches with the target in either the bumper or
amplification primer hybridization sequences (FIGS. 3A and 3B). In
the SNP -367 system described in the previous examples, a mismatch
was synthesized in the left amplification primer target binding
sequence 3 bases from the 5' end of the target hybridization region
(Table 1). This creates a C:A mismatch in the BsoBI recognition
sequence, thereby preventing cleavage of the primer:target hybrid.
Similarly, in the +46, +491, and +523 systems, mismatches were
synthesized in the middle of the left bumper sequence, preventing
restriction by the BsoBI enzyme.
EXAMPLE 11
[0099] This example illustrates detection of sequence variations
using signal primers that hybridize to opposite strands of the
target DNA. This approach can help modify or eliminate intra- or
inter-molecular interactions (e.g., hairpin formation or primer
dimers) that could reduce the efficiency of polymorphism detection.
In the SDA systems described in the above examples, pairs of signal
primers to detect a specific polymorphism were designed with target
hybridizing regions that were identical except for the diagnostic
nucleotide at the 3' end of the sequence. When this approach was
used for the design of signal primers to the +46 SNP, the signal
primer for allele B was found to form a strong intra-molecular
secondary structure (i.e., a hairpin) which impaired detection of
the allele (FIG. 12A, B). To alleviate this interaction, signal
primers were designed for the +46 .beta..sub.2AR SNP such that the
target hybridization regions complimented opposite strands of the
target sequence either side of the SNP site. One signal primer,
designed to identify allele A, overlapped the target hybridization
region of the forward amplification primer while a second signal
primer, designed to identify allele B, overlapped the hybridization
region of the reverse amplification primer (FIG. 12A). In order to
reduce intra- and inter-molecular interactions even further, the 5'
adapter tails of the signal primers used to detect alleles A and B
were swapped (i.e, the adapter sequence for the ROX reporter probe
was appended to the signal primer for allele B, while the adapter
sequence for the FAM reporter was appended to the signal primer for
allele A). Because the sequence around the +46 SNP locus is
approximately 68% G-C rich, this region is prone to severe intra-
and inter-molecular interactions which are known to impair
amplification and/or detection. The ability to develop an assay
system with signal primers on opposing strands therefore provides
important flexibility in assay optimization.
[0100] SDA was generally performed as described in Example 5.
Reactions were carried out at 52.degree. C., in the presence of 105
copies of cloned target containing target allele A (homozygous),
allele B (homozygous) or a mixture of alleles A and B
(heterozygous). Control reactions contained no target DNA. The
Maximum Density metric was used to determine the identity of the
nucleotide present at the +46 SNP locus. In order to standardize
the results, data from the conventional signal primer system were
analyzed using the ratio ln(ROX/FAM) while data from the system
based on opposing signal primers were analyzed using the ratio
ln(FAM/ROX). This reflected the reversal of the optics for alleles
A and B caused by swapping of the signal primer tail sequences.
With the conventional assay system, signals for allele B were
suppressed. In contrast, with the opposing signal primer design,
signals were obtained for both allele A and allele B, with good
discrimination between the two. This example illustrates that
signal primers designed to opposite strands of a SNP locus can be
used to eliminate strong base pairing and base stacking
interactions that may inhibit amplification and/or detection.
EXAMPLE 12
[0101] Six SNPs within the .beta..sub.2AR gene were detected
directly in human blood samples using the adapter-mediated
detection system of the invention. SDA was performed as described
in Example 7 with some modifications. Whole blood, from 8
individuals, was mixed with SDA components for a final 100 .mu.L
reaction volume which contained 101 mM Bicine, 82 mM KOH, 24.5 mM
KiPO.sub.4 (pH 7.6), 5.0 mM MgOAc, 0.1 mM each dTTP, dGTP, dATP,
0.5 mM dCTP.alpha.S, 10 .mu.g acetylated BSA, approximately 300
units of BsoBI, and 120 units of Bst polymerase. For each reaction,
20 .mu.L blood was mixed directly with SDA amplification buffer,
heated for 5 minutes at 100.degree. C., centrifuged at
10,000.times.g for 1 minute, and transferred directly into the SDA
reaction. The final reaction mixture contained 13% blood by volume.
Results from analysis of the 6 SNP loci by SDA were compared with
direct sequencing of PCR products and with those obtained from
blood that was processed according to a commercial DNA purification
procedure (QIAamp.RTM. DNA Blood Mini Kit). For each assay system,
SDA reactions containing wild-type target only exhibited a
significant increase in ROX fluorescence over time compared to a
minor increase FAM signal. In contrast, The reverse was true for
samples containing mutant target DNA. In samples containing
heterozygous target, fluorescence increased in both optical
channels indicating the presence of both alleles in the sample.
Data were collected and analyzed as described in Example 5 and the
results of SDA-based analysis of all 6 SNP loci are summarized in
Table 5. In all cases, the SDA-based analysis was in complete
concordance with sequence data. Table 6 shows representative data
comparing SDA SNP detection with DNA sequencing analysis for
nucleotide -654 of the B.sub.2AR gene.
[0102] The ability of the assays to amplify successfully directly
from blood without sample processing was unexpected. There is
extensive literature to suggest that blood which has not undergone
significant manipulation and from which the nucleic acid has been
isolated and purified, inhibits most amplification procedures.
These results suggest that the SDA-based systems of the invention
are likely to have a distinct advantage in terms of workflow and
time-to-result over procedures that require minutes to hours of DNA
purification prior to nucleic acid amplification and detection.
EXAMPLE 13
[0103] SNPs within the .beta..sub.2AR gene were analyzed according
to the method of the invention using target nucleic acid from
expressed buccal swab samples. Buccal swabs from 4 individuals were
expressed in 1 ml of SDA buffer which was then heated for 5 min in
a boiling water bath and centrifuged for 1 min at 10,000.times.g to
pellet cellular debris. The denatured target DNA in the supernatant
was then mixed with additional reaction components to provide a
final 100 .mu.L reaction volume containing: 101 mM Bicine, 82 mM
KOH, 24.5 mM KiPO.sub.4 (pH 7.6), 5.0 mM MgOAc, 0.1 mM each dTTP,
dGTP, dATP, 0.5 mM dCTP.alpha.S, 10 .mu.g acetylated BSA,
approximately 300 units of BsoBI and 120 units of Bst polymerase.
Data were collected and analyzed as described in Example 5. SDA
results were compared with direct sequence analysis of PCR
amplified target. SDA reactions containing wild-type target only
showed a significant increase in ROX fluorescence over time
compared to a minor increase FAM signal. The reverse was true for
samples containing mutant target DNA. In samples containing
heterozygous target DNA fluorescence increased in both optical
ranges, indicating the presence of both alleles in the sample. The
results of SDA-based analysis for the -654 locus from buccal swab
samples were in complete concordance with sequence data (Table 6).
Analysis of SNPs directly from buccal swabs provides a distinct
advantage in terms of workflow and time-to-result over procedures
that require minutes to hours of DNA purification prior to nucleic
acid amplification and detection. The non-evasive nature buccal
swab collection, as well as the lack of sample processing, makes
this an attractive sample type for genotyping and haplotype
analysis.
EXAMPLE 14
[0104] The .beta..sub.2AR -654 SNP locus was analyzed according to
the method of the invention with target DNA recovered from
first-catch urine. SDA was performed as described in Example 5 with
some modifications. Two milliliters of urine from each of 4
individuals were centrifuged at 1000.times.g to concentrate any
human cells present. The supernatant was decanted and the cellular
pellet was resuspended in 50 .mu.L TE and 250 .mu.L SDA buffer. The
cell suspension was then heated for 5 min at 100.degree. C. to lyse
the cells and denature the target nucleic acid. One hundred and
twenty microliters of the target-buffer mixture were added to a
Priming Microwell as described in Example 5. Amplification was then
initiated by transferring the contents of the Priming Microwell to
an Amplification Microwell. Each final 100 .mu.L reaction volume
contained: 101 mM Bicine, 82 mM KOH, 24.5 mM KiPO4 (pH 7.6), 5.0 mM
MgOAc, 0.1 mM each dTTP, dGTP, dATP, 0.5 mM dCTP.alpha.S, 10 .mu.g
acetylated BSA and approximately 300 units of BsoBI and 120 units
of Bst polymerase. The results of SDA-based SNP analysis were
compared to those obtained by direct sequencing of genomic DNA
obtained from the blood of the individuals who donated the urine.
In all cases, the SDA-based results were in complete concordance
with the sequence data. Representative data for the -654 SNP of the
.beta..sub.2AR gene are shown in Table 6. SDA reactions containing
wild-type target only showed a significant increase in ROX
fluorescence over time compared to relatively minor increase in FAM
signal. The reverse was true for samples containing mutant target
DNA. In the sample containing both wild-type and mutant DNA,
fluorescence increased in both optical ranges, indicating the
presence of both alleles in the sample.
[0105] As with the ability to genotype directly from buccal swabs
(Example 13), the use of urine as a sample type has distinct
advantages in terms of ease of collection. In conjunction with
this, the minimal sample processing that is required for the
disclosed procedure offers advantages in terms of workflow and
time-to-results over amplification methods that require minutes to
hours of DNA purification prior to nucleic acid amplification and
detection. The ready availability of urine samples and minimal
sample processing requirements makes them an attractive sample type
for genotyping and haplotype analysis. Other sample types (e.g.,
fingernails, hair, blood drops, sputum) may also be appropriate for
analysis of sequence variations according to the method of the
invention with little or no sample processing.
EXAMPLE 15
[0106] SNP -654 within the .beta..sub.2AR gene was analyzed
according to the method of the invention, using target nucleic acid
from an expressed skin swab sample. A skin swab from subject D in
Table 6 was expressed in 0.4 mL of SDA buffer which was then heated
for 5 min in a boiling water bath. The denatured target DNA was
then mixed with additional reaction components to provide a final
100 .mu.L reaction volume containing: 101 mM Bicine, 82 mM KOH,
24.5 mM KiPO4 (pH 7.6), 5.0 mM MgOAc, 0.11 mM each dTTP, dGTP,
dATP, 0.5 mM dCTP.alpha.S, 10 .mu.g acetylated BSA, SDA primers,
bumper primers, two allele-specific signal primers, two universal
reporter probes and approximately 300 units of BsoBI and 120 units
of Bst polymerase. Data were collected and analyzed as described in
Example 5. Fluorescence increased in both optical ranges (ROX and
FAM, indicating the presence of both alleles in the sample. These
results agreed with those obtained by direct sequencing of genomic
DNA obtained from the blood and with other SDA-based genotyping
results obtained from blood, buccal swabs and urine (Table 6).
Analysis of SNPs directly from skin swabs provides a distinct
advantage in terms of workflow and time-to-result over procedures
that require minutes to hours of DNA purification prior to nucleic
acid amplification and detection. The non-evasive nature of skin
swab collection, as well as the lack of sample processing, makes
this an attractive sample type for genotyping and haplotype
analysis.
TABLE-US-00007 TABLE 1 SDA Primers SNP 654 Bumper primers mLB AGT
GTG CAT GTC GGT GA (SEQ ID NO:23) RB GAG GCA CGC ACA TAC AG (SEQ ID
NO:24) Amplification Primers LP ACC GCA TCG AAT GAC TGT CTC GGG TGT
GTC TCA GTG TCT (SEQ ID NO:25) RP CGA TTC CGC TCC AGT CTT CTC GGG
ATA CAC CCT GGC AG (SEQ ID NO:26) Signal Primers AD2 ACG TTA GCC
ACC ATA CGG ATT GTG GTT CGG TAT AAG TaT GA (SEQ ID NO:27) mClD2 AGC
TAT CCG CCA TAA GCC ATT GTG GTT CGG TAT AAG TgTAA (SEQ ID NO:28)
SNP 367 Bumper primers LB TCC AGG GAG CAG TTG (SEQ ID NO:29) RB AAC
TTT CGG CCA ATG (SEQ ID NO:30) Amplification Primers mLP1
##STR00001## (SEQ ID NO:31) RP2 CGA TTC CGC TCC AGA CTT CTC GGG CTC
GCC CTC CTT CT (SEQ ID NO:22) Signal Primers AD5 ACG TTA GCC ACC
ATA CGG ATC CTC CTT CTC CTG GG (SEQ ID NO:21) mAD2 AGC TAT CCG CCA
TAA GCC ATC CCT CCT TCT CCT GAG (SEQ ID NO:32) SNP 47 Bumpers
Primers LB ACA GCC GCT GAA TGA G (SEQ ID NO:33) RB TGG CAG GTA AGC
GCA CT (SEQ ID NO:34) Amplification Primers LP CGA TTC CGC TCC AGA
CTT CTC GGG tCC GCA GAG CC (SEQ ID NO:35) mRP ACC GCA TCG AAT GAC
TGT CTC GGG aGC GCC TCA G (SEQ ID NO:36) Signal Primers AD4 ACG TTA
GCC ACC ATA CGG ATT CCG TGG GTC CGC CCG (SEQ ID NO:37) MAD AGC TAT
CCG CCA TAA GCC ATC CGT GGG TCC GCC TG (SEQ ID NO:38) SNP 46 Bumper
primers mLB ##STR00002## (SEQ ID NO:39) RB CAC ACC TCG TCC CCT T
(SEQ ID NO:40) Amplification primers LP CGA TTC CGC TCC AGA CTT CTC
GGG TGG CAG CGC CTT CTT (SEQ ID NO:41) RP ACC GCA TCG AAT GAC TGT
CTC GGG GTG GTC CGG CGC AT (SEQ ID NO:42) Signal Primers AD4 ACG
TTA GCC ACC ATA CGG ATC TTG CTG GCA CCC AAa AG (SEQ ID NO:43) mAD4
AGC TAT CCG CCA TAA GCC ATC TTG CTG GCA CCC AAa GG (SEQ ID NO:44)
SNP 491 Bumper prirmrs LB ##STR00003## (SEQ ID NO:45) RB TTG GTT
CGT GAA GAA GT (SEQ ID NO:46) Amplification Primers LP CGA TTC CGC
TCC AGA CTT CTC GGG TGG TGT GGA TTG TGT C (SEQ ID NO:47) RP ACC GCA
TCG AAT GAC TGT CTC GGG TCT CAT TGG CAT AGC A (SEQ ID NO:48) Signal
Primers WTAD ACG TTA GCC ACC ATA CGG ATA ATG GGC AAG AAG GAG GT
(SEQ ID NO:49) MTAD AGC TAT CCG CCA TAA GCC_ ATA ATG GGC AAG AAG
GAG AT (SEQ ID NO:50) SNP 523 Bumper primers LB ##STR00004## (SEQ
ID NO:45) RB TTG GTT CGT GAA GAA GT (SEQ ID NO:46) Amplification
Primers LP CGA TTC CGC TCC AGA CTT CTC GGG TGG TGT GGA TTG TGT C
(SEQ ID NO:47) RP ACC GCA TCG AAT GAC TGT CTC GGG TCT CAT TGG CAT
AGC A (SEQ ID NO:48) Signal Primers WTAD AGC TAT CCG CCA TAA GCC
ATA CAG ATG CAC TAG TAC CG (SEQ ID NO:51) MTAD AGC TAT CCG CCA TAA
GCC ATA CAG ATG CAC TAG TAC AG (SEQ ID NO:52) Reporter Probes
TBD10.2 D/R (Dabcyl)-TAG CGC CCG A C GCT-(Rox)-ACG TTA GCC ACC (SEQ
ID NO:53) ATA CGG AT AltD6.9 F/D (Fam)-AGT TGC CC GA GCA
ACT-(Dabcyl)-AGC TAT CCG (SEQ ID NO:54) CCA TAA GCC AT Sequences
complementary to the target DNA in the amplification and signal
primers are underlined. The diagnostic nucleotide within the signal
primers is underlined twice and shown in bold face type.
Non-diagnostic mismatches with the target sequence in the signal
primers, amplification primers and bumper primers are shown in
lowercase. BsoBI recognition sequences are italicized. Mutated
BsoBI recognition sequences are boxed. Sequences forming the
complementary stem of a hairpin structure in the reporter probes
are shown in bold-face type.
TABLE-US-00008 TABLE 2 Maximum Density of 2 SNP Detection within a
Single Amplified Target Sequence. Cloned Tarqet WT MT WT/MT
Neqative SNP 491 3.67 -1.59 -0.92 indet SNP 523 3.51 -1.88 -0.55
indet
TABLE-US-00009 TABLE 3 SDA haplotyping results match DNA sequence
analysis Nucleotide: -1023 -709 -654 -468 -406 -367 -47 -20 +46 +79
+252 +491 +523 alleles: G/A C/A G/A G/C C/T C/T C/T T/C A/G C/G G/A
C/T C/A Ca AA As HL Haplotype 1 A C G C C T T T A C G C C 0.7 25.0
12.5 10.0 2 A C G G C C C C G G G C C 48.3 6.3 10.0 26.7 3 G A A C
C T T T A C G C C 0.7 0.0 0.0 0.0 4 G C A C C T T T A C G C C 33.0
29.7 45.0 40.0 5 G C A C C T T T G C G C C 1.4 0.0 0.0 0.0 6 G C G
C C T T T G C A C A 13.2 31.3 30.0 13.3 Nucleotide: -1023 -709 -654
-468 -406 -367 -47 -20 +46 +79 +252 +491 +523 Haplotype of .dwnarw.
.dwnarw. .dwnarw. .dwnarw. .dwnarw. .dwnarw. cloned target: 2 G C C
G C C by SDA 2 C G G C C C C G G A C C by sequencing 4 A T T A C C
by SDA 4 C A C C T T T A C G C C by sequencing
TABLE-US-00010 TABLE 4 Maximum Density of the effect of
non-diagnostic mismatches in signal primers Samples Urine B Urine C
Urine D Urine E water AD/mAD 2.77 3.02 -0.23 -1.27 indet AD2/mAD2
3.37 3.41 -0.16 -3.01 indet Genotype G/G G/G G/A A/A indet
Diagnostic mismatch primers AD1 5'-ACG TTA GCC ACC ATA CGG ATT GTG
GTT CGG TAT AAG TCT GA-3' (SEQ ID NO:55) mAD1 5'-AGC TAT CCG CCA
TAA GCC ATT GTG GTT CGG TAT AAG TCT AA-3' (SEQ ID NO:56)
Non-diagnostic Mismatch primers AD2 5'-ACG TTA GCC ACC ATA CGG ATT
GTG GTT CGG TAT AAG TaT GA-3' (SEQ ID NO:27) mAD2 3'-AGC TAT CCG
CCA TAA GCC ATT GTG GTT CGG TAT AAG TgT AA-3' (SEQ ID NO:28) In
each signal primer, the diagnostic nucleotide is located 1 base
from the 3' end (N-1 position). Lower case letters indicate the
non-diagnostic mismatched nucleotides. Underlined sequences
hybridize to the target nucleic acid. indet = indeterminate
TABLE-US-00011 TABLE 5 Haplotyping of Individuals from Blood SNP
2.6 Maximum Density Blood -654 -367 -47 46 491 523 A 0.3 -1.9 -2.7
-0.1 3.71 0.23 B 3.2 3.2 2.5 -2.9 3.78 3.36 C 3.2 -0.2 0.1 -2.9
3.75 0.19 D 0.2 -2.0 -2.8 -0.1 3.61 0.15 E -3.0 -2.0 -3.0 1.9 3.74
3.46 F 3.3 -0.2 0.2 -2.8 3.71 0.19 G 0.2 -0.1 0.1 0.1 3.68 3.4 H
3.4 3.8 2.5 -2.3 3.66 3.66 SNP Genotype Blood -654 -367 -47 46 491
523 Haplotype A G/A T T A/G C C/A 4/6 B G C C G C C 2/2 C G C/T C/T
G C C/A 2/6 D G/A T T A/G C C/A 4/6 E A T T A C C 4/4 F G C/T C/T G
C C/A 2/6 G G/A C/T C/T A/G C C 2/4 H G C C G C C 2/2
TABLE-US-00012 TABLE 6 Subject Sample type A B C D A. Genotyping of
the -654 B.sub.2AR locus From Matched Samples Blood (processed) G/G
G/G G/A A/A Blood G/G G/G G/A A/A Buccal Swab G/G G/G G/A A/A Urine
G/G G/G G/A A/A Skin Swab G/A Sequencing G G G/A A B. Maximum
Density Values from Geneotyping of the B.sub.2AR Locus in Matched
Samples Blood (processed) 3.23 3.23 0.17 -3.00 Blood 3.18 3.16
-0.13 -2.49 Buccal Swab 3.40 3.43 -0.30 -6.47 Urine 4.40 3.00 -0.10
-1.30 Skin Swab -0.30
Sequence CWU 1
1
56145DNAArtificial SequenceDescription of Artificial Sequence
Synthetic signal primer 1ccaaaatgac agcttctgat ggaatgactc
actgagttgg aacgt 45237DNAArtificial SequenceDescription of
Artificial Sequence Synthetic reporter probe 2tacctcgagt gcagccaaaa
gacagcttct gatggaa 37348DNAHuman immunodeficiency virus 3gaaagacgtt
agccaccata cggatacccc ttttctttta aaattgtg 48452DNAHuman
immunodeficiency virus 4gaaagacgtt agccaccata cggatacccc ttttctttta
aaattgtgga tg 52545DNAHuman immunodeficiency virus 5gaaagacgtt
agccaccata cggatacccc ttttctttta aaatt 45646DNAHuman
immunodeficiency virus 6gaaagacgtt agccaccata cggatacccc ttttctttta
aaattg 46743DNAHuman immunodeficiency virus 7acgttagcca ccatacggat
accccttttc ttttaaaatt gtg 43847DNAHuman immunodeficiency virus
8acgttagcca ccatacggat accccttttc ttttaaaatt gtggatg 47940DNAHuman
immunodeficiency virus 9acgttagcca ccatacggat accccttttc ttttaaaatt
401041DNAHuman immunodeficiency virus 10acgttagcca ccatacggat
accccttttc ttttaaaatt g 411138DNAHuman immunodeficiency virus
11agccaccata cggatacccc ttttctttta aaattgtg 381242DNAHuman
immunodeficiency virus 12agccaccata cggatacccc ttttctttta
aaattgtgga tg 421335DNAHuman immunodeficiency virus 13agccaccata
cggatacccc ttttctttta aaatt 351436DNAHuman immunodeficiency virus
14agccaccata cggatacccc ttttctttta aaattg 361534DNAHuman
immunodeficiency virus 15tgcccgagtg aaagacgtta gccaccatac ggat
341640DNAHuman immunodeficiency virus 16tagtgcccga gcactgaaag
acgttagcca ccatacggat 401735DNAHuman immunodeficiency virus
17tagtgcccga gcactacgtt agccaccata cggat 351830DNAHuman
immunodeficiency virus 18tagtgcccga gcactagcca ccatacggat
301940DNAHuman immunodeficiency virus 19tagtgctcgg gcactgaaag
acgttagcca ccatacggat 402043DNAHuman immunodeficiency virus
20ggttggctcg aggttggtga aagacgttag ccaccatacg gat
432135DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 21acgttagcca ccatacggat cctccttctc ctggg
352238DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22cgattccgct ccagacttct cgggctcgcc ctccttct
382317DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 23agtgtgcatg tcggtga 172417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24gaggcacgca catacag 172539DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 25accgcatcga atgactgtct
cgggtgtgtc tcagtgtct 392638DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 26cgattccgct ccagtcttct
cgggatacac cctggcag 382741DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 27acgttagcca ccatacggat
tgtggttcgg tataagtatg a 412841DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 28agctatccgc cataagccat
tgtggttcgg tataagtgta a 412915DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 29tccagggagc agttg
153015DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 30aactttcggc caatg 153137DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31cgattccgct ccagacttct cgggcgaccg ggccagc 373236DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32agctatccgc cataagccat ccctccttct cctgag 363316DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33acagccgctg aatgag 163417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 34tggcaggtaa gcgcact
173535DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 35cgattccgct ccagacttct cgggtccgca gagcc
353634DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36accgcatcga atgactgtct cgggagcgcc tcag
343736DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 37acgttagcca ccatacggat tccgtgggtc cgcccg
363835DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 38agctatccgc cataagccat ccgtgggtcc gcctg
353916DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 39tggggcaatc cgggaa 164016DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40cacacctcgt cccctt 164139DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 41cgattccgct ccagacttct
cgggtggcag cgccttctt 394238DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 42accgcatcga atgactgtct
cggggtggtc cggcgcat 384338DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 43acgttagcca ccatacggat
cttgctggca cccaaaag 384438DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 44agctatccgc cataagccat
cttgctggca cccaaagg 384515DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 45aataaggcac gggtg
154617DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 46ttggttcgtg aagaagt 174740DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
47cgattccgct ccagacttct cgggtggtgt ggattgtgtc 404840DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
48accgcatcga atgactgtct cgggtctcat tggcatagca 404938DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
49acgttagcca ccatacggat aatgggcaag aaggaggt 385038DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
50agctatccgc cataagccat aatgggcaag aaggagat 385138DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51agctatccgc cataagccat acagatgcac tagtaccg 385238DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52agctatccgc cataagccat acagatgcac tagtacag 385335DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
53tagcgcccga gcgctacgtt agccaccata cggat 355438DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
54agttgccccg aggcaactag ctatccgcca taagccat 385541DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
55acgttagcca ccatacggat tgtggttcgg tataagtctg a 415641DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
56agctatccgc cataagccat tgtggttcgg tataagtcta a 41
* * * * *