U.S. patent application number 11/978614 was filed with the patent office on 2009-05-21 for circular dna molecule having a conditional origin of replication, process for their preparation and their use in gene therapy.
This patent application is currently assigned to Centelion. Invention is credited to Fabienne Soubrier.
Application Number | 20090130674 11/978614 |
Document ID | / |
Family ID | 9482580 |
Filed Date | 2009-05-21 |
United States Patent
Application |
20090130674 |
Kind Code |
A1 |
Soubrier; Fabienne |
May 21, 2009 |
Circular DNA molecule having a conditional origin of replication,
process for their preparation and their use in gene therapy
Abstract
A prokaryotic recombinant host cell comprising a heterologous
replication initiation protein that activates a conditional origin
of replication and an extrachromosomal DNA molecule comprising a
heterologous therapeutic gene and a conditional origin of
replication whose functionality in the prokaryotic recombinant host
cell requires a replication initiating protein which is foreign to
the host cell is described. The host cell may comprise a pir gene
having at least one mutation, which may occur in the pir gene copy
number control region, the pir gene leucine zipper-like motif, or
the pir gene DNA binding region.
Inventors: |
Soubrier; Fabienne; (Thiais,
FR) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER;LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
Centelion
|
Family ID: |
9482580 |
Appl. No.: |
11/978614 |
Filed: |
October 30, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10684830 |
Oct 15, 2003 |
7364894 |
|
|
11978614 |
|
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/243; 435/320.1 |
Current CPC
Class: |
C12N 15/70 20130101;
A61P 31/12 20180101; A61P 25/28 20180101; C12N 15/69 20130101; A61P
25/00 20180101; A61P 31/18 20180101; A61P 43/00 20180101; C07K
14/82 20130101; C07K 14/501 20130101; A61P 21/00 20180101; A61P
25/16 20180101; A61P 3/06 20180101; A61P 21/04 20180101; A61P 35/00
20180101; A61K 48/00 20130101; A61P 21/02 20180101; A61P 7/02
20180101 |
Class at
Publication: |
435/6 ;
435/320.1; 435/243 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12N 15/00 20060101 C12N015/00; C12N 1/00 20060101
C12N001/00 |
Claims
1-49. (canceled)
50. A plasmid comprising a heterologous pir gene having at least
one mutation in the pir gene leucine zipper-like motif or the pir
gene DNA binding region.
51. The plasmid of claim 50, wherein the heterologous pir gene
comprises at least one mutation in the pir gene leucine zipper-like
motif.
52. The plasmid of claim 51, further comprising a mutation in the
pir gene DNA binding region.
53. The plasmid of claim 50, wherein the heterologous pir gene
comprises at least one mutation in the DNA binding region and the
leucine zipper-like motif.
54. The plasmid of claim 50, wherein the mutation in the DNA
binding region is the 114C mutation.
55. The plasmid of claim 50, wherein the mutation in the DNA
binding region is the 100B mutation.
56. The plasmid of claim 50, wherein the mutation in the DNA
binding region is the 201C mutation.
57. A prokaryotic recombinant host cell comprising a heterologous
pir gene encoding a .pi. protein and a DNA molecule comprising a
heterologous gene encoding a protein, a selection gene, a target
region for a site-specific recombinase, and a conditional origin of
replication whose functionality in a prokaryotic host cell requires
a .pi. protein, wherein the heterologous pir gene comprises at
least one mutation in the pir gene leucine zipper-like motif or the
pir gene DNA binding region.
58. The prokaryotic recombinant host cell of claim 57, wherein the
heterologous pir gene comprises at least one mutation in the
leucine zipper-like motif.
59. The prokaryotic recombinant host cell of claim 58, further
comprising a mutation in the pir gene DNA binding region.
60. The prokaryotic recombinant host cell of claim 57, wherein the
heterologous pir gene is in a plasmid.
61. The prokaryotic recombinant host cell of claim 57, wherein the
heterologous pir gene is in the genome of the host cell.
62. The prokaryotic recombinant host cell of claim 57, wherein the
mutation in the DNA binding region is the 114C mutation.
63. The prokaryotic recombinant host cell of claim 57, wherein the
mutation in the DNA binding region is the 100B mutation.
64. The prokaryotic recombinant host cell of claim 57, wherein the
mutation in the DNA binding region is the 201C mutation.
65. A method for detecting a plasmid copy-up mutation comprising:
(a) introducing at least one mutation into a target sequence; (b)
transforming the mutated target sequence into a host cell
comprising a plasmid, wherein the plasmid comprises a nucleotide
sequence encoding urolll methyltransferase and the copy number of
the plasmid is effected by the target sequence; (c) growing the
host cell under conditions wherein the nucleotide sequence is
expressed to produce a culture of host cells; (d) exposing the
culture of host cells to UV light; and (e) detecting fluorescence
produced by the culture of host cells.
66. The method of claim 65, wherein the nucleotide sequence is the
cobA gene from Pseudomonas denitrificans.
67. The method of claim 65, further comprising comparing the
fluorescence detected in (e) with fluorescence produced by a
culture of host cells comprising an non-mutated target sequence.
Description
[0001] This application is a continuation-in-part of application
Ser. No. 10/268,948, filed Oct. 11, 2002, which is a
continuation-in-part of application Ser. No. 09/043,193, filed Mar.
13, 1998, which is a 371 of application no. PCT/FR96/01414, filed
Sep. 13, 1996, each of which is incorporated by reference
herein.
[0002] The present invention relates to a novel conditional
replication DNA molecule which can be used in gene therapy or for
the production of recombinant proteins. The novel DNA molecules
according to the present invention are designated pCOR.TM. herein
after.
[0003] Gene therapy consists in correcting a deficiency or an
anomaly by introducing genetic information into the affected organ
or cell. This information may be introduced either in vitro into a
cell extracted from the organ and then reinjected into the body, or
in vivo, directly into the target tissue. As a molecule of high
molecular weight and of negative charge, DNA has difficulty in
spontaneously crossing phospholipid cell membranes. Various vectors
are thus used in order to enable gene transfer to take place: viral
vectors, on the one hand, and natural or synthetic chemical and/or
biochemical vectors, on the other hand.
[0004] Viral vectors (retroviruses, adenoviruses, adeno-associated
viruses, etc.) are very effective, in particular for crossing
membranes, but present a certain number of risks such as
pathogenicity, recombination, replication, and immunogenicity.
[0005] Chemical and/or biochemical vectors allow these risks to be
avoided (for reviews, see Behr, 1993, Cotten and Wagner 1993).
These are, for example, cations (calcium phosphate, DEAE-dextran,
etc.) which act by forming precipitates with DNA, which may be
"phagocytosed" by the cells. They may also be liposomes in which
the DNA is incorporated and which fuse with the plasma membrane.
Synthetic gene-transfer vectors are generally lipids or cationic
polymers which complex the DNA and form with it a particle bearing
positive surface charges. As illustrations of vectors of this type,
mention may be made in particular of dioctadecylamidoglycylspermine
(DOGS, Transfectam.TM.) or
N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA,
Lipofectin.TM.).
[0006] However, the use of chemical and/or biochemical vectors or
naked DNA implies the possibility of producing large amounts of DNA
of pharmacological purity. The reason for this is that in gene
therapy techniques, the medicinal product consists of the DNA
itself and it is essential to be able to manufacture, in suitable
amounts, DNAs having properties which are appropriate for
therapeutic use in man.
[0007] In the case of non-viral vectorology, the vectors used are
plasmids of bacterial origin. The plasmids generally used in gene
therapy carry (i) an origin of replication, (ii) a marker gene such
as a gene for resistance to an antibiotic (kanamycin, ampicillin,
etc.) and (iii) one or more transgenes with sequences necessary for
their expression (enhancer(s), promoter(s), polyadenylation
sequences, etc.). However, the technology currently available is
not entirely satisfactory.
[0008] On the one hand, the risk remains of dissemination in the
body. Thus, a bacterium which is present in the body can, at low
frequency, receive this plasmid. There is a greater likelihood of
this taking place if it involves an in vivo gene therapy treatment
in which the DNA may be disseminated in the body of the patient and
may come into contact with bacteria which infect this patient or
bacteria of the commensal flora. If the bacterium receiving the
plasmid is an enterobacterium, such as E. coli, this plasmid can be
replicated. Such an event then leads to dissemination of the
therapeutic gene. Insofar as the therapeutic genes used in gene
therapy treatments can code, for example, for a lymphokine, a
growth factor, an anti-oncogene or a protein whose function is
defective in the host and which thus makes it possible to correct a
genetic defect, the dissemination of some of these genes could have
unforeseeable and worrying effects (for example if a pathogenic
bacterium acquired a human growth factor gene).
[0009] On the other hand, the plasmids generally used in non-viral
gene therapy also possess a marker for resistance to an antibiotic
(ampicillin, kanamycin, etc.). The bacterium acquiring such a
plasmid thus has an undeniable selective advantage since any
antibiotic therapy, using an antibiotic from the same family as
that which selects the plasmid resistance gene, will lead to
selection of the plasmid in question. In this respect, ampicillin
belongs to the .alpha.-lactams, which is the family of antibiotics
which is most frequently used worldwide. The use in bacteria of
selection markers which are not antibiotic-resistance genes would
thus be particularly advantageous. This would avoid the selection
of bacteria which may have received a plasmid carrying such a
marker.
[0010] It is thus particularly important to seek to limit the
dissemination of therapeutic genes and resistance genes as much as
possible.
[0011] The subject of the present invention is specifically to
propose novel DNA molecules which can be used in gene therapy or
for the production of recombinant proteins in vitro and which
replicate only in cells which can complement certain functions of
these non-viral vectors.
[0012] The invention also relates to a particularly effective
method for preparing these DNA molecules.
[0013] The DNA molecules claimed have the advantage of removing the
risks associated with dissemination of the plasmid, such as (1)
replication and dissemination, which can lead to uncontrolled
overexpression of the therapeutic gene, (2) dissemination and
expression of resistance genes. The genetic information contained
in the DNA molecules according to the invention effectively
comprises the therapeutic gene(s) and the signals for regulating
its (their) expression, a functional conditional origin of
replication which greatly limits the host cell spectrum of this
plasmid, a selection marker of reduced size which is preferably
different from a gene which imparts resistance to an antibiotic
and, where appropriate, a DNA fragment which allows the resolution
of plasmid multimers. The probability of these molecules (and thus
the genetic information which they contain) being transferred to a
microorganism, and maintained stably, is very limited.
[0014] Lastly, the vectors according to the invention, also
referred to as miniplasmids on account of their circular structure,
their reduced size and their supercoiled form, have the following
additional advantages: on account of their size which is reduced in
comparison with the ColE1-derived plasmids used conventionally, the
DNA molecules according to the invention potentially have better in
vivo bioavailability, and the DNA molecules or pCOR stay in a
stable extrachromosomal form in the host prokaryotic or eukaryotic
cells that do not contain the initiating protein. In particular,
they have improved capacities of cell penetration and distribution.
Thus, it is acknowledged that the diffusion coefficient in tissues
is inversely proportional to the molecular weight (Jain, 1987).
Similarly, in the cell, high molecular weight molecules have poorer
permeability across the plasma membrane. In addition, in order for
the plasmid to pass into the nucleus, which is essential for its
expression, the high molecular weight is also a disadvantage, the
nuclear pores imposing a size limit for diffusion into the nucleus
(Landford et al., 1986). The reduction in size of the
non-therapeutic parts of the DNA molecule (origin of replication
and selection gene in particular) according to the invention also
makes it possible to decrease the size of the DNA molecules. The
part which allows the replication and selection of this plasmid in
the bacterium (1 kb) is decreased by a factor of 3, counting, for
example, 3 kb for the origin of replication and the resistance
marker vector part. This decrease (i) in molecular weight and (ii)
in negative charge imparts improved tissue, cellular and nuclear
bioavailability and diffusion to the molecules of the
invention.
[0015] More precisely, the present invention relates to a circular
DNA molecule, which is useful in gene therapy, this molecule
comprising at least one nucleic acid sequence of interest,
characterized in that the region which allows its replication
comprises an origin of replication whose functionality in a host
cell requires the presence of at least one specific protein which
is foreign to the said host cell.
[0016] This DNA molecule may be in single- or double-stranded form
and advantageously possesses a supercoiled form.
[0017] For the purposes of the present invention, the host cells
used can be of various origins. They can be eukaryotic or
prokaryotic cells. According to a preferred embodiment of the
invention, they are prokaryotic cells.
[0018] The replication of bacterial plasmids conventionally
requires the presence of at least one protein, which is coded for
by the host cell, of the RNA polymerase, Rnase, DNA polymerase,
etc. type. For the reasons already explained above, it is not
possible to overcome entirely, with this type of replication, any
possible risks of dissemination in the treated organism.
Advantageously, the functionality of the origin of replication of
the DNA molecule according to the invention requires the presence
of a specific protein which is foreign to the host cell. The
significance of this characteristic is to reduce the host spectrum
of the claimed plasmid to specific strains that express this
initiator protein. The DNA molecule developed within the context of
the present invention thus advantageously possesses a so-called
conditional origin of replication.
[0019] The conditional origin of replication used according to the
present invention may originate from plasmids or bacteriophages
which share the following characteristics: they contain in their
origin of replication repeat sequences, or iterons, and they code
for at least one replication-initiating protein (Rep) which is
specific to them. By way of example, mention may be made of the
conditional replication systems of the following plasmids and
bacteriophages:
TABLE-US-00001 specific initiator plasmid or bacteriophage protein
RK2 (Stalker et al., 1981) TrfA R1 (Ryder et al., 1981) RepA pSC101
(Vocke and Bastia, 1983) RepA F (Murotsu et al., 1981) protein E
Rts1 (Itoh et al., 1982, 1987) RepA RSF1010 (Miao et al., 1995)
RepC P1 (Abeles et al., 1984) RepA P4 (Flensburg and Calendar,
1987) alpha protein lambda (Moore et al., 1981) protein O phi 82
(Moore et al., 1981) protein O from phi 82 phi 80 protein O from
phi 80
[0020] According to a preferred embodiment of the invention, the
origin of replication used in the DNA molecules claimed is derived
from a natural E. coli plasmid referred to as R6K.
[0021] The replication functions of R6K are grouped together in a
5.5 kbp DNA fragment (FIG. 1) comprising 3 origins of replication
.alpha., .beta., and .gamma. (.gamma. and .alpha. providing 90% of
the replication) and an operon coding for the .PI.
replication-initiator protein and the protein Bis. The minimum
amount of genetic information required to maintain this plasmid at
its characteristic number of copies (15 copies per genome) is
contained in two elements: the 400 bp of ori .gamma. and the gene
pir, whose product is the .PI. initiator protein.
[0022] Ori .gamma. may be divided into two functional parts: the
core part and the activator element (FIG. 1). The core part, which
is essential for replication, contains the iterons (7 direct
repeats of 22 bp) to which the .left brkt-top. protein represented
in SEQ ID No. 1 becomes bound, and flanking segments, which are
targets of the host proteins (IHF, DnaA).
[0023] According to a preferred mode of the invention, the origin
of replication of the vector claimed consists entirely or partially
of this .gamma. origin of replication of the plasmid R6K and more
preferably, entirely or partially of SEQ ID No. 1 or one of its
derivatives.
[0024] The origin of replication described above, which has the
advantage of being of very limited size, is functional solely in
the presence of a specific initiator protein, protein Pi, produced
by the gene pir (SEQ ID No. 2). Since this protein can act in
trans, it is possible to physically dissociate the ori gamma from
the pir gene, which may be introduced into the genome of the cell
which is chosen as the specific host for these plasmids. Mutations
in .PI. may alter its inhibitory functions (Inuzuka and Wada, 1985)
and lead to an increase in the number of copies of the R6K
derivatives, up to more than 10 times the initial number of copies.
These substitutions may be within a domain of 40 amino acids, which
therefore appears to be responsible for the control by .PI. of the
number of plasmid copies (FIG. 2), or in other regions of the .PI.
protein.
[0025] According to an advantageous embodiment of the present
invention, the .PI. protein, expressed in the host cell, results
from the expression of the gene represented in SEQ ID No. 2 or one
of its derivatives as defined above and more particularly of the
gene pir 116 which comprises a mutation when compared with the pir
gene. This mutation corresponds to the replacement of a proline by
a leucine at position 106 from the start codon. In this context,
the number of copies of the R6K derivatives is about 250 copies per
genome.
[0026] For the purposes of the present invention, the term
derivative denotes any sequence which differs from the sequence
considered, obtained by one or more modifications of genetic and/or
chemical nature, as well as any sequence which hybridizes with
these sequences or fragments thereof and whose product possesses
the activity indicated with regard to the replication-initiator
protein .PI.. The term modification of the genetic and/or chemical
nature may be understood to refer to any mutation, substitution,
deletion, addition and/or modification of one or more residues. The
term derivative also comprises the sequences homologous with the
sequence considered, derived from other cellular sources and in
particular cells of human origin, or from other organisms, and
possessing an activity of the same type. Such homologous sequences
may be obtained by hybridization experiments. The hybridizations
may be performed starting with nucleic acid libraries, using the
native sequence or a fragment thereof as probe, under conventional
conditions of stringency (Maniatis et al., cf. General techniques
of molecular biology), or, preferably, under conditions of high
stringency.
[0027] Besides a conditional origin of replication as defined
above, the DNA molecules claimed contain a region comprising one
(or more) gene(s) which make it possible to ensure selection of the
DNA molecule in the chosen host.
[0028] This may be a conventional marker of gene type which imparts
resistance to an antibiotic, such as kanamycin, ampicillin,
chloramphenicol, streptomycin, spectinomycin, lividomycin or the
like.
[0029] However, according to a preferred embodiment of the
invention, this region is different from a gene which imparts
resistance to an antibiotic. It may thus be a gene whose product is
essential for the viability of the host envisaged, under defined
culturing conditions. It may be, for example:
[0030] a gene coding for a suppressor tRNA, of natural or synthetic
origin. This is, more preferably, an amber codon tRNA (TAG)
[0031] a gene whose product is necessary for metabolism of the
cell, under certain culturing conditions, namely a gene involved in
the biosynthesis of a metabolite (amino acid, vitamin, etc.), or a
catabolism gene which makes it possible to assimilate a substance
present in the culture medium (specific nitrogen or carbon source),
etc.
[0032] According to a preferred mode of the invention, this region
contains an expression cassette of a gene coding for a suppressor
tRNA for specific codons. This latter may be chosen, in particular,
from those coding for phenylalanine, cysteine, proline, alanine and
histidine amino acids. It is more particularly a suppressor tRNA
for amber codons (TAG).
[0033] In this particular case, the system used to select, in the
host cells, the DNA molecules which are the subject of the present
invention includes two elements: 1) on the DNA molecule, a gene
coding for a suppressor transfer RNA for the amber codon (TAG)
which constitutes the selection marker, known as (sup) gene and 2)
a specific host, one of whose genes, which is essential under
certain culture conditions, contains an amber TAG codon. This cell
may grow, under the culture conditions for which the product of the
gene containing the TAG codon is essential, only if the plasmid
allowing the expression of sup is present in the cell. The culture
conditions thus constitute the pressure for selection of the DNA
molecule. The sup genes used may be of natural origin (Glass et
al., 1982) or may originate from a synthetic construction (Normanly
et al., 1986, Kleina et al., 1990).
[0034] Such a system offers great flexibility insofar as, depending
on the gene containing an amber mutation, it is possible to
determine various selective media. In the bacterium Lactococcus
lactis for example, the amber codon is located in a purine
biosynthesis gene. This allows the selection of the plasmid
carrying the gene coding for the suppressor tRNA when the bacteria
multiply in milk. Such a marker has the advantage of being very
small and of containing no "foreign" sequences, originating from
phages or transposons.
[0035] According to a particular embodiment of the invention, the
DNA molecule also comprises a DNA fragment, the target for
site-specific recombinases, which allows the resolution of plasmid
multimers.
[0036] Thus, such a fragment, introduced on to a DNA molecule which
is circular and whose origin of replication is, for example, ori
gamma, allows the resolution of multimers of such a plasmid. Such
multimers are observed, in particular, when the DNA molecule is
prepared in a strain carrying a mutated allele of pir, such as
pir116, which makes it possible to increase the number of copies of
the R6K derivatives.
[0037] This recombination may be achieved by means of various
systems which entail site-specific recombination between sequences.
More preferably, the site-specific recombination of the invention
is obtained by means of specific intramolecular recombination
sequences which are capable of recombining with each other in the
presence of specific proteins, generally referred to as
recombinases. In this specific case, these are the recombinases
XerC and XerD. For this reason, the DNA molecules according to the
invention generally also comprise a sequence which allows this
site-specific recombination. The specific recombination system
present in the genetic constructions according to the invention
(recombinases and specific recognition site) may be of different
origins. In particular, the specific sequences and the recombinases
used may belong to different structural classes, and in particular
to the transposon Tn3 resolvase family or to the bacteriophage
lambda integrase family. Among the recombinases belonging to the
transposon Tn3 family, mention may be made in particular of the
resolvase of transposon Tn3 or of transposons Tn21 and Tn522 (Stark
et al., 1992); the Gin invertase of bacteriophage mu or
alternatively plasmid resolvases, such as that of the par fragment
of RP4 (Abert et al., Mol. Microbiol. 12 (1994) 131). Among the
recombinases belonging to the bacteriophage .lamda. integrase
family, mention may be made in particular of the integrase of the
phages lambda (Landy et al., Science 197 (1977) 1147), P22 and
.PHI.80 (Leong et al., J. Biol. Chem. 260 (1985) 4468), HP1 of
Haemophilus influenzae (Hauser et al., J. Biol. Chem. 267 (1992)
6859), the Cre integrase of phage P1, the integrase of plasmid
pSAM2 (EP 350 341) or alternatively the FLP recombinase of the
2.mu. plasmid and the XerC and XerD recombinases from E. coli.
[0038] Preferably, the DNA molecules which form the subject of the
present invention contain the fragment cer from the natural E. coli
plasmid ColE1. The cer fragment used is a 382 bp HpaII fragment
from ColE1 which has been shown to bring about, in cis, the
resolution of plasmid multimers (Summers et al., 1984; Leung et
al., 1985). It is also possible to use a HpaII-TaqI fragment of
smaller size (280 bp) or a smaller fragment (about 220 bp),
contained in the HpaII fragment, which fragments possess the same
properties (Summers and Sherratt, 1988). This resolution takes
place by way of a specific intramolecular recombination, which
involves four proteins encoded by the genome of E. coli: ArgR,
PepA, XerC and XerD (Stirling et al., 1988, 1989; Colloms et al.,
1990, Blakely et al., 1993). It was found that insertion of the
fragment cer from the natural E. coli plasmid ColE1 allows to
obtain a high resolution of plasmids multimers, thereby resulting
in high proportion of monomers in a reproducible manner. This is
particularly unexpected as it has been shown that the insertion of
the cer site into a minicircle which contains the ColE1 origin of
replication from pBluescript SK+ did not result in efficient
multimer resolution (Kreiss et al., Appl. Microbiol. Biotechnol,
49:560-567 (1998)), and thus effective resolution in cis of
plasmids is unpredictable and seems to depend on the plasmid
conformation. In the case of the pCOR plasmid, an effective cis
resolution is reached when cer is present on the pCOR, thereby
resulting in a unexpectedly high monomers of pCOR in a reproducible
manner.
[0039] In this respect, it is particularly advantageous to use all
or part of the cer fragment of ColE1 or one of its derivatives as
defined above.
[0040] According to an implementation variant, the DNA molecules of
the invention may also comprise a sequence capable of interacting
specifically with a ligand. Preferably, this is a sequence capable
of forming, by hybridization, a triple helix with a specific
oligonucleotide. This sequence thus makes it possible to purify the
molecules of the invention by selective hybridization with a
complementary oligonucleotide immobilized on a support (see
application WO 96/18744 and WO 02/07727). The sequence may be
naturally present in the origin of replication of the plasmid as
described in US publication application 2003/186268 of the
Applicant, or naturally present in the transgene as described in WO
02/07721, and alternatively can be positioned at any site in the
DNA molecule of the invention, provided that it does not affect the
functionality of the gene of interest and of the origin of
replication. Formation of a triple helix by hybridization thus
occurs between the oligonucleotide and the specific complementary
sequence present in the DNA. In this connection, to obtain the best
yields and the best selectivity, an oligonucleotide and a specific
sequence which are fully complementary are used in the method of
the invention. These can be, in particular, an oligonucleotide
poly(CTT) and a specific sequence poly(GAA). For example,
oligonucleotides containing repeated motifs such as CTT are capable
of forming a triple helix with a specific sequence containing
complementary units (GAA). The sequence in question can, in
particular, be a region containing 7, 14 or 17 GAA units, and in
the oligonucleotides a corresponding numbers of repeat CTT. In this
case, the oligonucleotide binds in an antiparallel orientation to
the polypurine strand. These triple helices are stable only in the
presence of Mg.sup.2+ (Vasquez et al., Biochemistry, 34: 7243-7251
(1995); Beal and Dervan, Science, 251: 1360-1363 (1991)).
[0041] As stated above, the specific sequence can be a sequence
naturally present in the pCOR, or may be a synthetic sequence
introduced artificially in the latter. It is especially
advantageous to use an oligonucleotide capable of forming a triple
helix with a sequence naturally present in the pCOR, for example in
the origin of replication of a plasmid or in a marker gene. The
synthesis of oligonucleotides capable of forming triple helices
with these natural homopurine-homopyrimidine regions is
particularly advantageous, as it may be applied to unmodified pCOR
plasmids. Particularly preferred target sequences which can form
triplex structures with particular oligonucleotides have been
identified in ColE1 and in pCOR origins of replication.
ColE1-derived plasmids contain a 12-mer homopurine sequence
(5'-AGAAAAAAAGGA-3') (SEQ ID NO: 33) mapped upstream of the RNA-II
transcript involved in plasmid replication (Lacatena et al.,
Nature, 294: 623 (1981)). This sequence forms a stable triplex
structure with the 12-mer complementary 5'-TCTTTTTTTCCT-3' (SEQ ID
NO: 34) oligonucleotide. The pCOR backbone contains a homopurine
stretch of 14 non repetitive bases (5'-AAGAAAAAAAAGAA-3') (SEQ ID
NO: 35) located in the A+T-rich segment of the .gamma. origin
replicon of pCOR (Levchenko et al., Nucleic Acids Res., 24:1936
(1996)). This sequence forms a stable triplex structure with the
14-mer complementary oligonucleotide 5'-TTCTTTTTTTTCTT-3' (SEQ ID
NO: 36). The corresponding oligonucleotides 5'-TCTTTTTTTCCT-3' (SEQ
ID NO: 37) and 5'-TTCTTTTTTTTCTT-3' (SEQ ID NO: 38) efficiently and
specifically target their respective complementary sequences
located within the origin of replication of either ColE1 ori or
pCOR (ori.gamma.). Also, use of an oligonucleotide capable of
forming a triple helix with a sequence present in an origin of
replication or a marker gene is especially advantageous, since it
makes it possible, with the same oligonucleotide, to purify any DNA
containing the said origin of replication or said marker gene.
Hence it is not necessary to modify the plasmid or the
double-stranded DNA in order to incorporate an artificial specific
sequence in it.
[0042] Although fully complementary sequences are preferred, it is
understood, however, that some mismatches may be tolerated between
the sequence of the oligonucleotide and the sequence present in the
DNA, provided they do not lead to too great a loss of affinity. The
sequence 5'-AAAAAAGGGAATAAGGG-3' (SEQ ID NO: 39) present in the E.
coli .beta.-lactamase gene may be mentioned. In this case, the
thymine interrupting the polypurine sequence may be recognized by a
guanine of the third strand, thereby forming a G*TA triplet which
it is stable when flanked by two T*AT triplets (Kiessling et al.,
Biochemistry, 31: 2829-2834 (1992)).
[0043] According to a particular embodiment, the oligonucleotides
used may comprise the sequence (CCT).sub.n, the sequence (CT).sub.n
or the sequence (CTT).sub.n, in which n is an integer between 1 and
1.5 inclusive. It is especially advantageous to use sequences of
the type (CT).sub.n or (CTT).sub.n. Oligonucleotides may also
combine (CCT), (CT) or (CTT) units.
[0044] The oligonucleotides used may be natural (composed of
unmodified natural bases) or chemically modified. In particular,
the oligonucleotide may advantageously possess certain chemical
modifications enabling its resistance to or its protection against
nucleases, or its affinity for the specific sequence, to be
increased.
[0045] As a DNA molecule representative of the present invention,
the plasmid pXL2774 and its derivatives may be claimed most
particularly. For the purposes of the invention, the term
derivative is understood to refer to any construction derived from
pXL2774 and containing one or more genes of interest other than the
luciferase gene. Mention may also be made of the plasmids pXL3029,
pXL3030, and plasmid pXL3179 or NV1FGF containing an expression
cassette of a therapeutic gene. In a most preferred embodiment, the
invention relates to a pCOR comprising the FGFa or FGF-1 gene as
described in U.S. Pat. No. 4,686,113 of the Applicant, which is
designated pXL 3179 or NV1FGF.
[0046] The present invention also relates to the development of a
process for the construction of specific host cells, which are
particularly effective for the production of these therapeutic DNA
molecules.
[0047] Another subject of the present invention relates to a
process for the production of a circular DNA molecule,
characterized in that a host cell is cultured containing at least
one DNA molecule as defined above and a protein, which may or may
not be expressed in situ, which conditions the functionality of the
origin of replication of the said DNA molecule, which is specific
and which is foreign to the said host cell, under conditions which
allow the selection of host cells transformed by the said DNA
molecules.
[0048] More preferably, the protein which conditions the
functionality of the origin of replication of the DNA molecule is
expressed in situ from a corresponding gene. The gene coding for
the replication-initiating protein may be carried by a subsidiary
replicon, which is compatible with the derivatives of the
conditional origin of replication used or which may be introduced
into the genome of the host cell by recombination, by means of a
transposon, a bacteriophage or any other vector. In the particular
case in which the gene expressing the protein is placed on a
subsidiary replicon, the latter also contains a promoter region for
functional transcription in the cell, as well as a region which is
located at the 3' end and which specifies a transcription
termination signal. As regards the promoter region, this may be a
promoter region which is naturally responsible for expressing the
gene under consideration when the latter is capable of functioning
in the cell. It may also be a case of regions of different origin
(responsible for expressing other proteins), or even of synthetic
origin. In particular, it may be a case of promoter sequences for
prokaryotic or bacteriophage genes. For example, it may be a case
of promoter sequences obtained from the cell genome.
[0049] As genes coding for the replication-initiating protein, use
may be made either of wild-type genes or of mutated alleles which
make it possible to obtain an increased number of copies of the
plasmids (or derivatives) specific for the initiator protein which
conditions the functionality of the origin of replication used in
the DNA molecule.
[0050] Such mutants have been described in particular for the
plasmids R6K (Inuzuka and Wada, 1985; Greener et al., (1990), Rts1
(Terawaki and Itoh, 1985, Terawaki et al., 1990; Zeng et al.,
1990), F (Seelke et al., 1982; Helsberg et al., 1985; Kawasaki et
al., 1991), RK2 (Durland et al., 1990; Haugan et al., 1992, 1995),
pSC101 (Xia et al., 1991; Goebel et al., 1991; Fang et al.,
1993).
[0051] In the particular case in which the DNA molecule used
possesses an origin of replication derived from the plasmid R6K,
the initiator protein is a derivative of the .PI. protein of this
same plasmid. It is particularly advantageous to express a mutated
form of this protein which is capable of increasing the number of
initial copies appreciably. To do this, the gene incorporated into
the host cell is preferably represented by all or part of the
sequence represented in SEQ ID No. 2 or one of its derivatives and
more preferably by the pir116 gene. The associated mutation
corresponds to the replacement of a proline by a leucine. According
to a particular embodiment of the invention, this pir116 gene is
directly incorporated into the host cell genome.
[0052] Advantageously, one of the genes of the specific host cell,
which is essential under the culture conditions chosen, contains a
specific codon which is recognizable by the selected suppressor
tRNA in the DNA molecule. According to a preferred mode of the
invention, this is an amber TAG codon. In this particular case, the
cell may grow, under culture conditions for which the product of
the gene containing the TAG codon is essential, only if the plasmid
allowing the expression of sup is present in the host cell. The
culture conditions thus constitute the pressure for selection of
the DNA molecule.
[0053] Preferably, the gene containing the amber codon is a gene
involved in the biosynthesis of an amino acid, arginine. This gene,
argE, codes for an N-acetylornithinase (Meinnel et al., 1992) and
in this case contains a TAG codon corresponding to a point mutation
Gln-53 (CAG)->TAG; the pressure for selection of the plasmid
carrying the sup gene is then provided by culturing in minimal M9
medium (Maniatis et al., 1989). However, this could also be, for
example, a gene for biosynthesis of a vitamin or a nucleic acid
base, or alternatively a gene which allows a specific nitrogen or
carbon source to be used or any other gene whose functionality is
essential for cellular viability under the chosen culture
conditions.
[0054] The host cell is preferably chosen from E. coli strains and
is more preferably represented by the strain E. coli XAC-1.
[0055] According to a specific embodiment of the invention, the
host cell used in the claimed process is a cell of the E. coli
strain XAC-1, containing the pir116 gene in its genome and
transformed by the plasmid pXL2774 or one of its derivatives.
[0056] According to an advantageous variant of the invention, the
host cell used in the process claimed is a prokaryotic cell in
which the endA1 gene or a homologous gene is inactivated. The endA
gene codes for endonuclease I of E. coli. This periplasmic enzyme
has a non-specific activity of cleaving double-stranded DNA
(Lehman, I. R., G. G. Roussos and E. A. Pratt (1962) J. Biol. Chem.
237: 819-828; Wright M. (1971) J. Bacteriol. 107: 87-94). A study
carried out on various strains of Escherichia coli (wild-type or
endA) showed that the degradation of plasmid DNA incubated in
extracts of these bacterial strains existed in the endA+ strains
but not in the endA mutants. (Wnendt S. (1994) BioTechniques 17:
270-272). The quality of the plasmid DNA isolated from endA+
strains or from endA mutants was studied by the company Promega
using their purification system (Shoenfeld, T., J. Mendez, D.
Storts, E. Portman, B. .dagger.Patterson, J. Frederiksen and C.
Smith. 1995. Effects of bacterial strains carrying the endA1
genotype on DNA quality isolated with Wizard plasmid purification
systems. Promega notes 53). Their conclusion is as follows: the
quality of the DNA prepared from endA mutants is, overall, better
than that of DNA prepared in the endA+ strains tested.
[0057] The quality of the plasmid DNA preparations is thus affected
by any contamination with this endonuclease (relatively long-term
degradation of the DNA).
[0058] The deletion or mutation of the endA gene can be envisaged
without difficulty insofar as the mutants no longer having this
endonuclease activity behave on the whole like wild-type bacteria
(Duriwald, H. and H. Hoffmann-Berling (1968) J. Mol. Biol. 34:
331-346).
[0059] The endA1 gene can be inactivated by mutation, total or
partial deletion, disruption, etc. Inactivation of the endA gene of
the E. coli strain chosen to produce the pCOR plasmids can be
achieved more particularly by transferring, by means of the P1
bacteriophage, the .DELTA.endA::Tc.sup.R deletion described by
Cherepanov and Wackernagel (Cherepanov, P. P. and W. Wackernagel.
1995. Gene disruption in Escherichia coli: Tc.sup.R and Km.sup.R
cassettes with the option of Flp-catalyzed excision of the
antibiotic-resistance determinant. Gene 158:9-14) or by exchanging
the wild-type allele present in the genome of the bacterium of
interest with a mutated or deleted allele of endA, by homologous
recombination. The use of this type of strain in the context of the
present invention makes it possible advantageously to improve the
quality of the DNA produced.
[0060] The invention also relates to any recombinant cell
containing a DNA molecule as defined above. This may be a cell of
various origins, of eukaryotic, prokaryotic, etc. type.
[0061] According to another embodiment of the invention, the E.
coli XAC-1 host cell used in the process claimed is designated
TEX1, and comprises a traD gene, or a homologous gene thereof,
inactivated to abolish F transfer. The traD is at the 5' end of one
of the tra operon and encodes a 81.7 kDa membrane protein that is
directly involved in DNA transfer and DNA metabolism (Frost et al.,
Microbiology Reviews, 1994, 58: 162-210). traD mutants do not
transfer DNA (Panicker et al., J. Bacteriol., 1985, 162:584-590).
The episomal traD gene may be inactivated by mutation, total or
partial deletion, or disruption using methods well known to those
of skill in the art (See Example 9). One method of inactivating
this gene is described in Example 1, and the resulting E. coli
XAC-1 pir116 endA.sup.- traD.sup.- strain so obtained is designated
TEX1 (Soubrier et al., Gene Therapy, 1999, 6: 1482-1488).
[0062] According to one embodiment of the invention, the host cell
used in the claimed process is a cell of the E. coli strain XAC-1,
containing the pir116 mutation combined with the pir42 mutation.
The pir116 and pir42 mutations affect different domains of the pi
protein. The pir116 mutation affects the copy number control
region, whereas the pir42 mutation affects the putative leucine
zipper motif, as displayed in FIG. 11. The nucleotide and amino
acid sequences of the pir gene containing the pir116 and pir42
mutations are set forth in FIG. 12 and SEQ ID NOs: 21 and 22,
respectively. The pir42 mutation comprises a C to T transition at
position 124 from the methionine initiator codon, and thus results
in substitution of the proline at position 42 by a leucine. The
pir42 mutation was described by Miron et al. (Proc Natl Acad Sci
USA, 1994. 91(14): p. 6438-42; EMBO J, 1992. 11(3): p. 1205-16),
and was reported to increase the copy number of an "ori gamma
R6K-Km.sup.R-pir42" plasmid by 2.5 fold as compared to the same
plasmid harboring the wild-type pir gene. However the pir42
mutation was never used or described in combination with the pir116
mutation and while other copy-up mutations such as cop21 in the pir
gene combined with the pir116 do not exhibit an increase of the
plasmid copy number, combination of the pir116 and pir42 mutations
in a E. coli XAC-1 endA.sup.- traD.sup.- strain surprisingly showed
a significant increase of the plasmid copy number. Applicants have
thus shown unexpected results of this combination in terms of copy
number of the plasmids produced in E. coli host strains comprising
the mutated pir116 and pir42 gene as compared with strains
harboring pir116 alone, or in a host cell comprising the pir116
mutation combined with another mutation of the pir gene, such as
the mutation cop21 (Inuzuka et al., FEBS Lett, 1988. 228(1): p.
7-11). For example, E. coli TEX 1pir42 (=XAC-1 endA.sup.-
traD.sup.- pir116 pir42) exhibited a 2-5 fold increase in the
number of plasmids, as compared to a pir116 strain, or strains
comprising combined pir116 and cop21 mutations (See Example 11). In
other embodiments, the pir gene comprises at least one mutation,
which, for example, may occur in the copy number control region, in
the leucine zipper-like motif, in the DNA binding region, or in one
or more of these regions or another region of the protein pi coded
by the pir gene.
[0063] The prokaryotic host cell according to the present invention
also comprises one or more mutations in the same or a different
domain of the protein pi, coded by the pir gene copy, such as the
DNA binding domain, and/or the copy number control region and/or
the leucine-zipper motif. The prokaryotic recombinant host cell may
comprise the heterologous pir gene is in a plasmid or in the genome
of the host cell.
[0064] Such mutations may be screened by using the
fluorescence-based screening method according to one aspect of the
present invention as described thereafter. As shown in the Example
13, host cells comprising at least one mutation in the pir gene,
the mutation pir116 and a mutation in the DNA binding domain were
screened using the fluorescence-based screening method according to
the present invention. Host cells comprising mutations present in
the DNA binding domain in addition to the pir116, i.e., as for
example in the construct 100B, wherein the tyrosine (K) at position
292 is replaced by a methionine (M), in the construct 114C, wherein
a glutamic acid (E) at position 130 is replaced by a valine (V), or
in the construct 201C, wherein an aspartic acid (D) at position 117
is replaced by a glycine (G) (FIG. 26) are tested for their
capacity to produce high copy number of plasmid using the
fluorescence-based screening method.
[0065] According to another embodiment of the present invention,
the host cell used in the process claimed is a prokaryotic host
cell in which the recA gene or a homologous gene has been
inactivated. Preferably, the host cell according to the present
invention is E. coli strain XAC-1 comprising mutations pir116,
pir42, endA.sup.-, traD.sup.-, recA.sup.-. Such a strain is
designated TEX2pir42. recA may be inactivated by methods well known
to those in the art. recA encodes a major recombination protein and
mutations in this gene reduce the frequency of
recombination-mediated alteration in plasmids and intramolecular
recombination that could lead to the multimerization of plasmids.
As described in Example 12, a deleted recA gene containing 3
translation stop codons (one in each frame) at its 5' end may be
obtained by PCR. The resulting inactivated gene was then introduced
by gene replacement into TEX1 genome (Example 12.1).
[0066] These cells are obtained by any technique known to those
skilled in the art which allows the introduction of the said
plasmid into a given cell. Such a technique may be, in particular,
transformation, electroporation, conjugation, fusion of protoplasts
or any other technique known to those skilled in the art.
[0067] Strain XAC-1pir116 was deposited under the terms of the
Budapest Treaty with the Collection Nationale De Cultures de
Micro-organisms (CNCM), Institut Pasteur, 28, rue Dr. Roux, 75724
Paris Cedex 15, France, on Oct. 10, 2003 under accession no.
I-3108.
[0068] Strain TEX2pir42 was deposited under the terms of the
Budapest Treaty with the Collection Nationale De Cultures de
Micro-organisms (CNCM), Institut Pasteur, 28, rue Dr. Roux, 75724
Paris Cedex 15, France, on Oct. 10, 2003, under accession no.
I-3109.
[0069] The DNA molecules according to the invention may be used in
any application of vaccination or of gene and cell therapy for
transferring a gene to a given cell, tissue or organism, or for the
production of recombinant proteins in vitro.
[0070] In particular, they may be used for direct in vivo
administration or for the modification of cells in vitro or ex
vivo, for the purpose of implanting them into a patient.
[0071] In this respect, another subject of the present invention
relates to any pharmaceutical composition comprising at least one
DNA molecule as defined above. This molecule may or may not be
associated therein with a chemical and/or biochemical transfection
vector. This may in particular involve cations (calcium phosphate,
DEAE-dextran, etc.) or liposomes. The associated synthetic vectors
may be cationic polymers or lipids. Examples of such vectors which
may be mentioned are DOGS (Transfectam.TM.) or DOTMA
(Lipofectin.TM.).
[0072] The pharmaceutical compositions according to the invention
may be formulated for the purpose of topical, oral, parenteral,
intranasal, intravenous, intramuscular, subcutaneous, intraocular,
or transdermal administrations. The claimed plasmid is preferably
used in an injectable form or in application. It may be mixed with
any vehicle which is pharmaceutically acceptable for an injectable
formulation, in particular for a direct injection to the site to be
treated. This may involve, in particular, sterile, isotonic
solutions or dry compositions, in particular freeze-dried
compositions, which, by addition, depending on the case, of
sterilized water or of physiological saline, allow injectable
solutions to be made up. This may in particular involve Tris or PBS
buffers diluted in glucose or in sodium chloride. A direct
injection into the affected region of the patient is advantageous
since it allows the therapeutic effect to be concentrated at the
level of the affected tissues. The doses used may be adapted as a
function of various parameters, and in particular as a function of
the gene, the vector, the mode of administration used, the
pathology concerned or the desired duration of the treatment.
[0073] The DNA molecules of the invention may contain one or more
genes of interest, that is to say one or more nucleic acids
(synthetic or semi-synthetic DNA, gDNA, cDNA, etc.) whose
transcription and, possibly, whose translation in the target cell
generate products of therapeutic, vaccinal, agronomic or veterinary
interest.
[0074] Among the genes of therapeutic interest which may be
mentioned more particularly are genes coding for enzymes, blood
derivatives, hormones and lymphokines: interleukins, interferons,
TNF, etc. (FR 92/03120), growth factors, neurotransmitters or their
precursors or synthetic enzymes, and trophic factors (BDNF, CNTF,
NGF, IGF, GMF, aFGF, bFGF, NT3, NT5, VEGF-B, VEGF-C etc.;
apolipoproteins: ApoAI, ApoAIV, ApoE, etc. (FR 93/05125),
dystrophin or a minidystrophin (FR 91/11947), tumour-suppressing
genes: p53, Rb, Rap1A, DCC, k-rev, etc. (FR 93/04745), genes coding
for factors involved in coagulation: factors VII, VIII, IX, etc.,
suicide genes: thymidine kinase, cytosine deaminase, etc.; or
alternatively all or part of a natural or artificial immunoglobulin
(Fab, ScFv, etc.), an RNA ligand (WO 91/19813), etc. The
therapeutic gene may also be an antisense sequence or gene, whose
expression in the target cell makes it possible to control the
expression of genes or the transcription of cellular mRNAs. Such
sequences may, for example, be transcribed, in the target cell,
into RNAs which are complementary to cellular mRNAs and thus block
their translation into protein, according to the technique
described in patent EP 140,308. A insert of interest that may be
carried by the pCOR of the invention is a RNAi, whose is capable of
interfering with the translation of a target gene (Wilson et al.,
Curr Opin Mol Ther. 2003 August; 5(4):389-96) and thereby
regulating the expression of such gene.
[0075] The gene of interest may also be a vaccinating gene, that is
to say a gene coding for an antigenic peptide, capable of
generating an immune response in man or animals, for the purpose of
producing vaccines. These antigenic peptides may in particular be
specific antigenic peptides of Epstein-Barr virus, HIV virus,
hepatitis B virus (EP 185,573), or pseudorabies virus, or
alternatively specific antigenic peptides of tumours (EP
259,212).
[0076] Generally, in the DNA molecules of the invention, the gene
of therapeutic, vaccinal, agronomic or veterinary interest also
contains a promoter region for functional transcription in the
target organism or cell, as well as a region located at the 3' end
which specifies a transcription termination signal and a
polyadenylation site. As regards the promoter region, it may be a
promoter region naturally responsible for expression of the gene
under consideration when this region is capable of functioning in
the cell or the organism concerned. The promoter regions may also
be regions of different origin (responsible for the expression of
other proteins) or even of synthetic origin. In particular, they
may be promoter sequences from eukaryotic or viral genes. For
example, they may be promoter sequences obtained from the genome of
the target cell. Among the eukaryotic promoters which may be used
are any promoters or derived sequence which stimulates or
suppresses the transcription of a gene in a specific or
non-specific, inducible or non-inducible, strong or weak manner.
The eukaryotic promoters may in particular be ubiquitous promoters
(promoters of the genes for HPRT, PGK, .alpha.-actin, tubulin,
etc.), intermediate filament promoters (promoters of the genes for
GFAP, desmin, vimentin, neurofilaments, keratin, etc.), therapeutic
gene promoters (for example the promoters of the genes for MDR,
CFTR, factor VIII, ApoAI, etc.) tissue-specific promoters
(promoters of the genes for pyruvate kinase, villin, intestinal
fatty acid-binding protein, .alpha.-actin of smooth muscle, etc.)
or alternatively promoters which respond to a stimulus (steroid
hormone receptor, retinoic acid receptor, etc.). Similarly, they
may be promoter sequences obtained from the genome of a virus, such
as, for example, the promoters of the adenovirus E1A and MLP genes,
the CMV early promoter or alternatively the LTR promoter of RSV,
etc. In addition, these promoter regions may be modified by
addition of activating or regulatory sequences or sequences which
allow tissue-specific expression or expression which is
predominantly tissue-specific.
[0077] Moreover, the gene of interest may also contain a signal
sequence which directs the synthesized product into the secretory
pathways of the target cell. This signal sequence may be the
natural signal sequence of the synthesized product, but it may also
be any other functional signal sequence or an artificial signal
sequence. Preferred signal sequence used according to the present
invention is the secretion signal peptide of human interferon as
described Taniguchi et al. (Gene, 1980, 233 (4763):541-5)
[0078] Depending on the gene of interest, the DNA molecules of the
invention may be used for the treatment or prevention of several
pathologies, including genetic diseases (dystrophy, cystic
fibrosis, etc.), neurodegenerative diseases (Alzheimer's disease,
Parkinson's disease, ALS, etc.), cancers, pathologies associated
with coagulation disorders or with dyslipoproteinaemias,
pathologies associated with viral infections (hepatitis, AIDS,
etc.), or in the agronomic and veterinary fields, etc.
[0079] According a preferred embodiment, the DNA molecules of the
present invention are used for treating critical limb ischemia
pathologies such as for example peripheral arterial occlusive
disease and intermittent claudication.
[0080] Moreover, the present invention also relates to the use of
conditional replication DNA molecules for the production of
recombinant proteins. Bacteria can be used to produce proteins of
various origins, eukaryotic or prokaryotic. Among the bacteria, E.
coli constitutes the organism of choice for expressing heterologous
genes on account of its ease of manipulation, the large number of
expression systems available and the large amounts of proteins
which can be obtained. It is understood that the system of the
invention can be used in other organisms, the tropism being
determined by the nature of the origin of replication, as indicated
above. For this use, the nucleic acid sequence of interest
comprises a coding region under the control of expression signals
that are appropriate for the host chosen, in particular a
prokaryotic host. These may be, for example, Plac, Ptrp, PT7, Ptrc,
Ptac, PL, P.sub.BAD or PR promoters, the Shine-Dalgarno sequence,
etc. (this set constitutes the expression cassette). The nucleic
acid sequence of interest can be any sequence coding for a protein
which is of value in the fields of pharmacy, agri-foods, chemistry
or agrochemistry. This may be a structural gene, a complementary
DNA sequence, a synthetic or semi-synthetic sequence, etc.
[0081] The expression cassette can be introduced onto the
conditional replication vector which is the subject of the
invention, thus constituting a conditional replication vector which
allows the expression of proteins of interest in E. coli. This
vector has several advantages: no use of antibiotic to select it in
the bacterium (reduced cost, no need for a study regarding the
presence of antibiotic or of potentially toxic derived products in
the finished product), virtually no probability of dissemination of
the plasmid in nature (conditional origin of replication), possible
fermentation in entirely defined medium. The examples given show
the advantageous properties of these conditional vectors for the
production of recombinant proteins.
[0082] As described above, the DNA molecule according to the
present invention comprises an origin of replication ORI.gamma.
derived from R6K wherein the pir gene is removed and is introduced
into the genome of a specific host cell that is used for the
production of the DNA molecules at large scale. There is always a
need to produce increasing quantities of plasmid for clinical
trials and/or for use in DNA-based gene therapy. Production host
cells have been engineered to carry the pir gene containing at
least one mutation, such as the mutation pir116 and/or pir42. Use
of such mutated host strain results in an increase of the plasmids
copy number and thus significantly raises the yield of production.
Also, conformation of the plasmids so produced is very
satisfying.
[0083] According to a particular aspect, a novel fluorescence-based
method of screening for copy-up mutant is provided. This
fluorescence-based screening method is far superior to the
classical method of screening based on the level of resistance to
antibiotic in the bacteria, which may not be used when the basal
copy number of plasmid is already very high such as the one
obtained using the mutant pir116, e.g., around 400 copies of
plasmid per cell. The fluorescence-based method of screening
according to the present invention preferably uses the cobA gene as
red fluorescence reporter gene of copy-up number. The cobA gene
which is a gene from Pseudomonas denitrificans (Crouzet et al., J.
Bacteriol. 1999, 172: 5968-79) encodes uro III methyltransferase,
an enzyme of the vitamin B12 pathway, which adds two methyl groups
to urogen III molecule. Wildt et al. (Nature Biotechnology, vol.
17, 1999, pp 1175) has described the use of cobA as a fluorescent
transcriptional reporter gene for E. coli, yeast and mammalian
cells. For example, such fluorescent reporter gene was used for the
selection of recombinant plasmids containing E. coli strains which
accumulate fluorescent porhyrinoid compounds due to overexpression
of the cobA gene encoding the uroIII methyltransferase. When
illuminated with UV light, the cells fluoresced with a bright red
color (Biotechniques, 1995, vol 19, no. 7, p. 760).
[0084] The Applicant has surprisingly found a close correlation
between the copy number of plasmid carrying the cobA gene and the
level of fluorescence from pink to red. The fluorescence-based
method of screening of copy-up mutants according to the present
invention is thus useful for screening various mutants which can
then be evaluated in the genome of the production host cell, such
as E. coli, or mutants of any genes such as in the pir gene, which
are inserted in the genome of the production host cell or carried
in a plasmid.
[0085] In addition to the correlation with the copy number of
plasmids, the fluorescence-based method of screening of the present
invention is easily and rapidly conducted as it is only requires
plating and culturing the transformed host cells overnight and
exposing to UV lights, to reveal intensity of the fluorescence
produced, thereby deducing directly the number of copy of plasmids
in the host cell.
[0086] Thus, the present invention provides for a method for
detecting a plasmid copy-up mutation comprising: [0087] (a)
introducing at least one mutation into a target sequence; [0088]
(b) transforming the mutated target sequence into a host cell
comprising a plasmid, wherein the plasmid comprises a nucleotide
sequence encoding uroIII methyltransferase and the copy number of
the plasmid is effected by the target sequence; [0089] (c) growing
the host cell under conditions wherein the nucleotide sequence is
expressed to produce a culture of host cells; [0090] (d) exposing
the culture of host cells to UV light; and [0091] (e) detecting
fluorescence produced by the culture of host cells.
[0092] According to the present invention, the method further
comprises comparing the fluorescence detected in (e) with
fluorescence produced by a culture of host cells comprising an
non-mutated target sequence.
[0093] Preferably, the uroIII methyltransferase gene is coded by
the cobA gene from Pseudomonas denitrificans.
[0094] The mutation may be present in a plasmid comprising a
heterologous pir gene comprising at least one mutation. The plasmid
may comprise at least one mutation in the pir other regions such as
in the copy control region and/or in the DNA binding domain, and/or
in the leucine-zipper motif and/or in another region of the pir
gene. Also, the plasmid may comprise at least one mutation in the
heterologous pir gene copy number control region and the leucine
zipper-like motif. The plasmid may further comprise a mutation in
the pir gene DNA binding region. Furthermore, the plasmid may
comprise one or more mutations in the same or a different region of
the pir gene coding for the copy control region and/or the DNA
binding region, and/or the leucine zipper-like motif, or other
region of the protein H.
[0095] Within limitation, the prokaryotic recombinant host cell
according to the present invention comprises the pir116 mutation
and a second mutation in the DNA binding region such as pir292,
pir130, or pir117 (FIG. 26).
[0096] Such mutated production host strain may be advantageously
produced using an universal plasmid tool such as the minicircle.
The minicircle technology is described inter alia in U.S. Pat. Nos.
6,143,530 and 6,492,164 of the Applicant or in PCT application WO
96/26270.
[0097] Minicircles are recombinant DNA molecules that do not
contain any origin of replication, and thus represent excellent
suicide vector for gene replacement of the genome of any
microorganisms. In particular, the gene or genes of interest are
flanked by the two sequences permitting site-specific
recombination, positioned in the direct orientation in the
minicircle. The position in the direct orientation indicates that
the two sequences follow the same 5'-3' polarity in the recombinant
DNA minicircle. The minicircle genetic constructions are generally
circular double-stranded DNA molecules devoid of origin of
replication, but may also be in linear form and contain the gene or
genes of interest flanked by the two sequences permitting
site-specific recombination, positioned in the direct orientation.
According to this particular embodiment of the invention, the
minicircle may be used to transform any competent microorganisms
for the purpose of the gene replacement within the genome thereof
(FIG. 31).
[0098] The minicircle for gene replacement is generated from a
parent plasmid comprising at least: [0099] a) an origin of
replication and, a selection marker gene, [0100] b) two sequences
permitting site-specific recombination, positioned in the direct
orientation, and, [0101] c) placed between said sequences b), one
or more genes of interest.
[0102] The specific recombination system present in the genetic
constructions can be of different origins. In particular, the
specific sequences and the recombinases used can belong to
different structural classes, and in particular to the integrase
family of bacteriophage .lamda. or to the resolvase family of the
transposon Tn3. Among recombinases belonging to the integrase
family of bacteriophage .lamda., there may be mentioned, in
particular, the integrase of the phages lambda (Landy et al.,
Science 197: 1147, 1977), P22 and .PHI.80 (Leong et al., J. Biol.
Chem. 260: 4468, 1985), HP1 of Haemophilus influenza (Hauser et
al., J. Biol. Chem. 267 6859, 1992), the Cre integrase of phage P1,
the integrase of the plasmid pSAM2 (EP 350,341) or alternatively
the FLP recombinase of the 2.mu. plasmid. The minicircles are thus
prepared by recombination by means of a site-specific system of the
integrase family of bacteriophage .lamda., the DNA molecules
according to the invention generally comprise, in addition, a
sequence resulting from the recombination between two att
attachment sequences of the corresponding bacteriophage or
plasmid.
[0103] Among recombinases belonging to the family of the transposon
Tn3, there may be mentioned, in particular, the resolvase of the
transposon Tn3 or of the transposons Tn21 and Tn522 (Stark et al.,
Trends Genet, 8, 432-439, 1992); the Gin invertase of bacteriophage
mu, or, alternatively, the resolvase of plasmids, such as that of
the par fragment of RP4 (Albert et al., Mol. Microbiol. 12: 131,
1994). When the minicircles are prepared by recombination by means
of a site-specific system of the family of the transposon Tn3, they
generally comprise, in addition to the gene of interest that is
aimed to be inserted in a microorganism genome, a sequence
resulting from the recombination between two recognition sequences
of the resolvase of the transposon in question. Sequences
permitting site-specific recombination may also be derived from the
loxP region of phage P1, which is composed essentially of two
repeat sequences capable of recombining specifically with one
another in the presence of a protein, designated Cre (Sternberg et
al., J. Mol. Biol. 150: 467, 1971). The plasmid used to produce the
minicircle thus comprises (a) a bacterial origin of replication
and, a selection marker gene; (b) the repeat sequences of
bacteriophage P1 (loxP region); and (c), placed between said
sequences (b), one or more genes of interest that one's wish to
insert in a microorganism genome.
[0104] Minicircles may comprise sequences permitting site-specific
recombination are derived from a bacteriophage, such as attachment
sequences (attP and attB sequences) of a bacteriophage or sequences
derived from such attachment sequences. These sequences are capable
of recombining specifically with one another in the presence of a
recombinase referred to as an integrase with or without an
excisionase. The term "sequences derived from such attachment
sequences" includes the sequences obtained by modification(s) of
the attachment sequences of the bacteriophages that retain the
capacity to recombine specifically in the presence of the
appropriate recombinase. Thus, such sequences can be reduced
fragments of these sequences or, alternatively, fragments extended
by the addition of other sequences (restriction sites, and the
like). They can also be variants obtained by mutation(s), in
particular by point mutation(s). The terms attP and attB sequences
of a bacteriophage or of a plasmid denote, according to the
invention, the sequences of the recombination system specific to
said bacteriophage or plasmid, that is to say the attP sequence
present in said phage or plasmid and the corresponding chromosomal
attB sequence. Attachment sequences are well known in the art, and
include inter alia the attachment sequences of the phages .lamda.,
P22, .PHI.80, P1, and HP1 of Haemophilus influenzae or,
alternatively, of plasmid pSAM2 or the 2.mu. plasmid.
[0105] The minicircles are easily produced from the parent plasmid
described above. The method for the production of the minicircle
consists in bringing into contact culture of cells that are
transformed with the parent plasmid with the integrase with or
without the excisionase, so as to induce the site-specific
recombination. The culture and the integrase with or without the
excisionase are brought into contact either by transfection or
infection with a plasmid or a phage containing the gene for said
integrase and when applicable the gene for the excisionase.
Alternatively, for example, the expression of genes coding for said
integrase and when applicable the excisionase, present in the host
cell, are induced. As mentioned below, these genes may be present
in the host cell in integrated form in the genome, on a replicative
plasmid, or, alternatively, on the plasmid of the invention, in the
non-therapeutic portion.
[0106] To permit the production of the minicircles according to the
invention by site-specific recombination in vivo, the integrase
with/without the excisionase used are introduced into, or induced
in, cells or the culture medium at a particular instant. For this
purpose, different methods may be used. According to a first
method, a host cell is used containing, for example, the
recombinase gene, i.e., the integrase gene with or without the
excisionase gene, in a form permitting its regulated expression.
The integrase gene with or without the excisionase gene may, for
example, be introduced under the control of a promoter, or of a
system of inducible promoters, or, alternatively, in a
temperature-sensitive system.
[0107] In particular, the integrase gene may be present in a
temperature-sensitive phage, latent during the growth phase, and
induced at a suitable temperature (for example, lysogenic phage
.lamda. Xis.sup.- cI857).
[0108] Alternatively, the gene may be under the control of a
regulated promoter, for example, the placUV5 promoter, the host
cell is designated E. coli G6191.
[0109] Preferably, the integrase with or without the excisionase
gene may be under the control of a regulated promoter, for example
the P.sub.BAD promoter of the araBAD (arabinose) operon, which is
regulated by arabinose (Guzman et al., J. Bacteriol, 1995,
41214130; U.S. Pat. No. 5,028,530). Particularly, use of P.sub.BAD
promoter allows sufficient expression of excisionase and integrase
in presence of arabinose, as the inducing agent, and thus more than
90% of recombination of the plasmids which are present in high
copies number in the bacteria, whereas in absence of arabinose, the
promoter is tightly inhibited. The cassette for expression of the
integrase with/without excisionase may be carried by a plasmid, a
phage, or even by the plasmid of the invention in the
non-therapeutic region. It may be integrated in the genome of the
host cell or maintained in replicative form. Such host cells are in
particular E. coli G6264 and E. coli G6289. According to another
method, the cassette for expression of the gene(s) is carried by a
plasmid or a phage used to transfect or infect the cell culture
after the growth phase. In this case, it is not necessary for the
gene to be in a form permitting its regulated expression. In
particular, any constitutive promoter may be used. The DNA may also
be brought into contact with the integrase and when applicable the
excisionase in vitro, on a plasmid preparation, by direct
incubation with the protein.
[0110] The minicircle so produced thus comprises an expression
cassette containing one or more genes of interest to be inserted in
the targeted microorganism, lacks an origin of replication and
comprises a sequence attR resulting from site-specific
recombination between an attB and an attP sequence, or a sequence
attL resulting from site-specific recombination between an attB and
an attP sequence. The minicircle may thus be used as universal
suicide vector for gene replacement in any microorganisms. In
effect, the minicircle carrying a gene for replacement flanked by
homologous sequences and a antibiotic resistance gene will easily
integrate in a targeted site of the genome of any microorganism by
homologous recombination as represented in FIG. 31. A second event
of excision which may be triggered by a second selection pressure
may then efficiently select the microorganisms only carrying the
new inserted gene within their genome.
[0111] The present invention thus also relates to a method of gene
engineering of a microorganism. This novel method may used to
engineer any microorganism regardless of their origin. In effect,
the minicircle does not contain any origin of replication, and thus
can be used universally for gene replacement in any types of
microorganisms. This method represents an advantageous alternative
to the use of the bacteriophage M13 for gene replacement by double
homologous recombination in a micro-organism.
[0112] According to a particular embodiment of the present
invention, the minicircle comprises a first selectable marker such
as an antibiotic resistance gene, allowing selecting for the first
recombination event. Preferred second selectable marker is the gene
III or the functional deleted gene III'. The gene III or its
functional variant is capable of conferring sensibility to
deoxycholate as described in Boecke et al. (Mol. Gen. Genet., 186,
185-92, 1982) and thus allows for counter-selecting the second
event of recombination (FIG. 31). The method thus consists in
introducing the minicircle into the microorganism by any
transformation method well known in the art, and preferably by
electroporation, selecting the event of integration of the
minicircle in a culture supplemented with an antibiotic or under
another pression of selection, and selecting a second event of
excision by treating with deoxycholate or another appropriate
pression of selection.
[0113] The present invention will be described more fully with the
aid of the examples which follow, which should be considered as
non-limiting illustrations.
BRIEF DESCRIPTION OF THE DRAWINGS
[0114] FIG. 1: Functional organization of the region of R6K
involved in replication.
[0115] FIG. 2: Organization of the functional domains of the .PI.
protein of the plasmid R6k.
[0116] FIG. 3: Representation of the protocol for introducing the
pir gene into the genome of E. coli XAC1.
[0117] FIG. 4: Construction scheme for vectors pXL2666, 2730 and
2754.
[0118] FIG. 5: Construction of pXL2774.
[0119] FIG. 6: Growth and production kinetics in a 2 L
fermenter.
[0120] FIG. 7: Growth and production kinetics in an 800 L
fermenter.
[0121] FIG. 8: Construction of pXL3056.
[0122] FIG. 9: Visualization of the aFGF protein produced by E.
coli XAC-1pir116 (pXL3056+PT7pol23) after induction. The denatured
total cell extracts are deposited on 12.5%-SDS polyacrylamide gel.
M: molecular mass marker (Biorad, Low range). Each band is
identified by an arrow and a figure which indicates its mass in
kDaltons. 1: XAC-1pir116 (pXL3056+pUC4K) not induced; 2:
XAC-1pir116 (pXL3056+pUC4K) induced at 42.degree. C.; 3:
XAC-1pir116 (pXL3056+PT7pol23) clone 1, not induced; 4: XAC-1pir116
(pXL3056+PT7pol23) clone 1, induced at 42.degree. C.; 5: XAC-1pir16
(pXL3056+PT7pol23) clone 2, not induced; 6: XAC-1pir116
(pXL3056+PT7pol23) clone 2, induced at 42.degree. C.; t1: 1 .mu.g
of purified aFGF; t4: 4 .mu.g of purified aFGF.
[0123] FIG. 10: Schematic representations for vectors pXL3029,
pXL3030, and pXL3179 or NV1FGF.
[0124] FIG. 11: Schematic representation of the functional domains
of R6K .pi. initiator proteins.
[0125] FIG. 12: Nucleotide and amino acid sequences of the pir gene
comprising the pir116 and pir42 mutations.
[0126] FIG. 13: Construction of pir116pir42 suicide vector for
homologous recombination.
[0127] FIG. 14: Schematic representation of the PCR products
obtained when amplifying the region uidA::pir116+/-pir42.
[0128] FIG. 15: Agarose gel electrophoresis showing the topology of
pCOR plasmid pXL3179 produced in TEX1 or TEX 1pir42.
[0129] FIG. 16: Schematic representation of the pXL3749 suicide
plasmid carrying pir116cop21 gene.
[0130] FIG. 17: Agarose gel electrophoresis showing the plasmid
copy number of pXL2979 when produced in E. coli host cell TEX1cop21
(lines 14), in E. coli host cell XAC1pir (lines 5-8), in E. coli
TEX1 (lines 9-12).
[0131] FIG. 18: Representation of the cloning strategy for the
construction of the recA-suicide vector.
[0132] FIG. 19: Schematic representation of the PCR products
obtained when amplifying regions of E. coli TEX2 strain.
[0133] FIG. 20: Agarose gel electrophoresis showing the topology of
pCOR pXL3179 produced in E. coli TEX2pir42 (line B), in E. coli
TEX1pir42 (line C), in E. coli TEX1 (line D).
[0134] FIG. 21: Analysis of plasmid pXL3179 produced by
fermentation in E. coli TEX2pir42.
[0135] FIG. 22: Fluorescence-based assay showing that fluorescence
increases with plasmid copy number.
[0136] FIG. 23: Diagram of plasmids screened in the
fluorescence-based assay.
[0137] FIG. 24: Diagram of plasmid pXL3830.
[0138] FIG. 25: Agar plate demonstrating fluorescence-based
screening for copy-up mutants generated by random mutagenesis.
[0139] FIG. 26: Evaluation of copy-up mutants identified by the
fluorescence-based screening method.
[0140] FIG. 27: Diagram of the strategy for evaluating pir116
mutants inserted into the bacterial genome.
[0141] FIG. 28: Evaluation of pXL3179 copy number in different
pir116* mutant E. coli strains.
[0142] FIG. 29: Construction of a plasmid used to generate
minicircle vectors for homologous recombination in E. coli.
[0143] FIG. 30: Construction of a minicircle vector used to
generate pir 16* mutant E. coli strains.
[0144] FIG. 31: Diagram of gene replacement by homologous
recombination using a minicircle vector.
[0145] FIG. 32: Demonstration of double recombinant clones grown on
medium containing sodium deoxycholate.
[0146] FIGS. 33A and B: The results of control PCR on double
recombinants.
I--MATERIALS AND METHODS
A) Materials
[0147] 1) Culture Media
[0148] Complete LB, 2XTY and SOC media and minimal M9 medium
(Maniatis et al., 1989) were used. Agar media were obtained by
addition of 15 g of Difco agar. Furthermore, if necessary, these
media were supplemented with antibiotics (ampicillin or kanamycin)
at respective concentrations of 100 mg/l and 50 mg/l. The
chromogenic substrates X-Gal and X-Gluc were used at a
concentration of 40 mg/l.
[0149] 2) E. coli Strains, Plasmids and Bacteriophages
[0150] The E. coli strains, plasmids and bacteriophages used are
respectively identified in the examples below.
B) Methods
[0151] 1) Manipulation of the DNA
[0152] The isolation of bacterial DNA (plasmid and genomic) and
phage DNA (replicative form of M13), digestion with restriction
endonucleases, ligation of the DNA fragments, agarose gel
electrophoresis (in TBE buffer) and other standard techniques were
carried out according to the manufacturers' recommendations, for
the use of enzymes, or in accordance with the procedures described
in "Molecular Cloning: a Laboratory Manual" (Maniatis et al.,
1989).
[0153] The DNA size markers used during the electrophoreses are as
follows: 1 kb ladder (BRL) for the linear fragments and the
supercoiled DNA marker (Stratagene) for the undigested
plasmids.
[0154] Sequencing was carried out according to the Sanger technique
(Sanger et al., 1977) adapted to the automated method using
fluorescent dideoxynucleotides and Taq DNA polymerase (PRISM Ready
Reaction DyeDideoxy Terminator Cycle Sequencing Kit, Applied
Biosystems).
[0155] The oligodeoxynucleotides used (designated by "seq+no.", see
below) were synthesized on the "Applied Biosystems 394 DNA/RNA
Synthesizer" by the phosphoramidite method, using
.alpha.-cyanoethyl protecting groups (Sinha et al., 1984). After
synthesis, the protecting groups are removed by treatment with
ammonia. Two precipitations with butanol allow the oligonucleotide
to be purified and concentrated (Sawadogo et al., 1991).
Sequences of the oligonucleotides used for the PCR
amplification:
TABLE-US-00002 SEQ ID No. 3 5'-GACCAGTATTATTATCTTAATGAG-3' SEQ ID
No. 4 5'-GTATTTAATGAAACCGTACCTCCC-3' SEQ ID No. 5
5'-CTCTTTTAATTGTCGATAAGCAAG-3' SEQ ID No. 6
5'-GCGACGTCACCGAGGCTGTAGCCG-3'
[0156] The PCR reactions (Saiki et al., 1985) were performed under
the following conditions, in a total volume of 100 .mu.l. The
reaction mixture comprises 150 ng of genomic DNA from the strain to
be studied, 1 .mu.g of each of the two oligonucleotide primers
(24-mer), 10 .mu.l of 10.times.PCR buffer, the composition of which
is as follows "500 mM KCl, 0.1% gelatin, 20 mM MgCl.sub.2, 100 mM
Tris-HCl pH 7.5", and 2.5 units of Taq DNA polymerase (Amplitaq
Perkin-Elmer). The PCR conditions, on the Perkin-Elmer Cetus DNA
Thermal Cycler machine are as follows: 2 min at 91.degree. C., 30
successive cycles of denaturation (1 min at 91.degree. C.),
hybridization (2 min at 42.degree. C.) and elongation (3 min at
72.degree. C.), and finally 5 min at 72.degree. C. The products
thus obtained, which are or are not digested with a restriction
enzyme, are analysed by agarose gel electrophoresis.
[0157] Analysis of the various plasmid species by DNA
topoisomerases was performed according to the following procedure:
the enzymes, purified in the laboratory, are incubated for 1 hour
at 37.degree. C. The reaction mixtures (total volume: 40 .mu.l)
have the following composition: 150 ng of plasmid, 300 ng of DNA
topoisomerase I or 150 ng of E. coli DNA gyrase, or 160 ng of S.
aureus DNA topoisomerase IV and 20 .mu.l of buffer specific for
each enzyme. The composition of these buffers is indicated
below:
for DNA topoisomerase I: 50 mM Tris-HCl pH 7.7, 40 mM KCl, 1 mM
DTT, 100 .mu.g/ml BSA, 3 mM MgCl.sub.2, 1 mM EDTA; for DNA
topoisomerase IV: 60 mM Tris-HCl pH 7.7, 6 mM MgCl.sub.2, 10 mM
DTT, 100 .mu.g/ml BSA, 1.5 mM ATP, 350 mM potassium glutamate; for
DNA gyrase: 50 mM Tris-HCl pH 7.7, 5 mM MgCl.sub.2, 1.5 mM ATP, 5
mM DTT, 100 .mu.g/ml BSA, 20 mM KCl.
[0158] 2) Transformation of E. coli
[0159] This was performed routinely according to the TSB
(Transformation and Storage Buffer) method described by Chung and
Miller (1988). For a strain such as TG1 (Gibson et al., 1984), the
transformation efficiency obtained is about 10.sup.5-10.sup.6
transformants per .mu.g of pUC4K (Vieira and Messing; 1982). When a
higher transformation efficiency was necessary, the bacteria were
transformed by electroporation according to the procedure
recommended by the electroporator manufacturer (Biorad). This
method makes it possible to achieve efficiencies of from 10.sup.8
to 10.sup.10 transformants per .mu.g of pUC4K.
[0160] 3) Cellular Transfection Mediated by a Cationic
Lipofectant
[0161] The cells used are NIH 3T3 mouse fibroblasts seeded the day
before into 24-well plates, at a density of 50,000 cells per well.
The culture medium used is DMEM medium, containing 4.5 g/l of
glucose and supplemented with 10% fetal calf serum and 1% of
solutions of 200 mM glutamine and antibiotics (5.10.sup.3 .mu./ml
streptomycin, 5.10.sup.3 .mu.g/ml penicillin) (Gibco). The plasmid
DNA (1 .mu.g in 25 .mu.l of 9% NaCl) is mixed, on a
volume-for-volume basis, with a suspension of lipofectant. Four
"lipofectant charges/DNA charges" ratios are tested: 0, 3, 6 and 9.
These ratios are calculated by considering that 1 .mu.g of plasmid
DNA carries 3.1 nmol of negative charges and that the lipofectant
contains 3 positive charges per molecule. After a contact time of
10 minutes to allow formation of the DNA/lipid complex, 50 .mu.l of
DNA-lipofectant mixture are introduced onto the cells in serum-free
culture medium (500 .mu.l). The cells were prerinsed twice with
this same medium. Inhibition of transfection by the serum is thus
avoided. After incubation (2 hours at 37.degree. C. in the CO.sub.2
incubator), 10% fetal calf serum is added to the medium. The cells
are then reincubated for 24 hours.
[0162] 4) Measurement of the Luciferase Activity of Eukaryotic
Cells
[0163] This is carried out 24 hours after the transfection.
Luciferase catalyses the oxidation of luciferin in the presence of
ATP, Mg.sup.2+ and O.sub.2, with concomitant production of a
photon. The total amount of light emitted, measured by a
luminometer, is proportional to the luciferase activity of the
sample. The reagents used are supplied by Promega (luciferase assay
system) and used according to the recommended procedure. After
lysis of the cells, the insoluble fraction from each extract is
eliminated by centrifugation. The assay is carried out on 5 .mu.l
of supernatant, which may or may not be diluted in the cell lysis
buffer.
[0164] 5) Measurement of the Protein Concentration in the Cell
Extracts
[0165] This is carried out according to the BCA method (Pierce)
using bicinchoninic acid (Wiechelman et al., 1988). The standard
BSA range is prepared in the lysis buffer (cf. III-B-4). The
samples to be assayed and those of the range are pretreated, on a
volume-for-volume basis, with 0.1 M iodoacetamide/0.1 M Tris
buffer, pH 8.2, for 1 hour at 37.degree. C. This treatment makes it
possible to prevent interference, during the assay, of the reducing
agent (DTT) present in the lysis buffer. The assay result is read
at 562 nm.
EXAMPLE 1
Construction of XAC-1 pir and pir116 Host Strains by Homologous
Recombination
[0166] The strain used was the E. coli strain XAC-1 (Normanly et
al., 1980). The argE gene of this strain advantageously includes a
mutation of glutamine-53 (CAG) into the amber codon (TAG) (Meinnel
et al., 1992). The argE gene belongs to the argECBH divergent
operon and codes for an arginine biosynthesis enzyme,
N-acetylornithinase. XAC-1 cannot therefore synthesize arginine
and, consequently, grow in minimal medium. This auxotrophy will be
relieved if the strain harbors a plasmid which allows the
expression of a suppressor tRNA. It will thus be possible, by
culturing in minimal medium, to select bacteria that carry such a
plasmid. In order to allow the replication therein of plasmids
derived from R6K, it was necessary to introduce, by homologous
recombination, the pir gene into the genome of XAC-1. The pir gene
(wild-type or mutated) is introduced at the uidA locus by exchange
between the wild-type uidA gene and a copy interrupted by the pir
(or pir116) gene. The uidA gene codes for .beta.-glucuronidase, the
enzyme for hydrolysis of .beta.-glucuronides. This gene may be
inactivated without any problem since it is not essential for
growth in standard synthetic media, in which .beta.-glucuronides
are not used. Furthermore, the .beta.-glucuronidase activity can be
monitored by means of a chromogenic substrate, X-Gluc, whose
hydrolysis releases a blue pigment.
[0167] 1) Construction of a Suicide Vector Carrying the Cassette
Km.sup.R-uidA::pir (or pir116)
[0168] We used a strategy involving a single bacterial host and
minimizing the modifications to the genome of the strain of
interest. The phage M13 mp10 (Messing et Vieira; 1982) was used as
a suicide vector (Blum et al., 1989). An amber mutation in the gene
II, which is essential for replication, reduces the host spectrum
of this M13 to the strains, such as TG1 (supE), which produce an
amber suppressor tRNA; it will therefore not be able to replicate
in E. coli sup+ strains, such as XAC-1.
[0169] The 3.8 kb BamHI cassettes, containing the
kanamycin-resistance gene of Tn5 and _uidA::pir or pir116, were
respectively purified from M13wm34 and 33 (Metcalf et al., 1994).
They were cloned into M13 mp10 linearized with BamHI. The
recombinant clones were selected by plating on LB agar medium
supplemented with kanamycin, after electroporating the ligation
mixtures into TG1. The conformity of the clones obtained was shown
by analysing the restriction profile and by sequencing the region
corresponding to the pir116 mutation.
[0170] 2) Introduction of the pir or pir116 Genes into the Genome
of E. coli XAC-1 by Homologous Recombination
[0171] The strategy adopted and the various events involved are
presented in FIG. 3.
[0172] a) First Recombination Event
[0173] The XAC-1 strain was transformed by electroporation with 10,
100 or 2000 ng of each RF (mp10-_uidA::pir or pir116). One-third of
each expression mixture was plated out on LB plates containing
kanamycin and incubated overnight at 37.degree. C. The
mp10-_uidA::pir or pir116 phages cannot replicate in the strain
XAC-1 (sup+). The kanamycin resistance ("Km.sup.R") marker can
therefore only be maintained by integration into the genome of the
bacterium via a homologous recombination with the wild-type copy of
the gene uidA. The results of the electroporations of XAC-1 are
presented in Table 1. The transformation efficiency obtained was
4.10.sup.9 transformants per .mu.g of pUC4K.
TABLE-US-00003 TABLE 1 Number of colonies obtained with the amounts
of DNA transformed CONSTRUCT 10 ng 100 ng 200 ng M13mp10-_uidA::pir
1 41 146 M13mp10-_uidA::pir116 0 16 124
[0174] Under the test conditions, the number of integrants
increased in a non-linear manner with the amount of DNA. Given the
transformation efficiency and the size of the RFs (11.7 kbp), it
was possible to have an approximate idea of the level of
recombination. By considering the point at 100 ng, a recombination
frequency of about 10.sup.-6 was obtained.
[0175] b) Second Recombination Event
[0176] The second recombination event will then be selected by the
resistance of the strains to deoxycholate ("Doc.sup.R").
[0177] To do this, five integrants of each construct were cultured
in 2XTY medium supplemented with 0.2% sodium deoxycholate. Two
distinct populations appear. Certain clones gave quite visible
cloudiness after about 8 hours at 37.degree. C. (two clones for the
pir construction and three for the pir116 construction). The other
clones gave a dense culture only after one night at 37.degree. C.
They were virtually all sensitive to kanamycin ("Km.sup.s"), as
expected. For each of the electroporants studied, 50 Km.sup.S
descendants were streaked onto LB medium supplemented with X-Gluc.
After 48 hours at 37.degree. C., the UidA.sup.+ clones were pale
blue whereas those which had undergone an allele replacement (case
No. 1, FIG. 3) remained white on this medium (UidA.sup.-). Table 2
summarizes the phenotypic analysis of the double recombinants
obtained. From 18 to 30% of the double recombinants underwent an
allele replacement.
TABLE-US-00004 TABLE 2 Number of Km.sup.S Percentage of UidA.sup.-
Strain among the Doc.sup.R among the Km.sup.S XAC-1 pir-2 50/50 18
XAC-1 pir-3 50/50 24 XAC-1 pir-4 50/50 34 XAC-1 pir116-1 50/50 32
XAC pir116-4 35/50 30
[0178] 3) Checking the Pir+ Character Nature of the Strains
Obtained by Recombination
[0179] To ensure the Pir+ character of the strains obtained by
double recombination, we transformed three clones of each construct
with pBW30 (Metcalf et al., 1994). The fact that transformants were
obtained for all the test strains made it possible to show the
functionality of the pir and pir116 genes, which were integrated
into the genome of XAC-1. Under the same conditions, no
transformant was obtained with the parental strain XAC-1. We
continued to study two XAC-1pir clones (B and C) and two
XAC-1pir116 clones (E and D).
[0180] 4) Checking, by PCR Amplification, of the Strains Obtained
by Recombination
[0181] To confirm the allele replacement, we checked the genomic
regions on either side of the uidA locus by PCR amplification. Each
pair of oligonucleotides consisted of an oligonucleotide
corresponding to an internal region of pir and a second
oligonucleotide corresponding to a region, close to chromosomal
uidA, but not within the fragment which served for the
recombination. The sequence of the latter oligonucleotide was
determined by means of the ECOUIDAA sequence from Genbank (access
number: M14641). We were thus able to verify the exact location of
the pir gene in the bacterial genome. The nature of the amplified
fragments, whose size is in accordance with that which might be
expected, was confirmed by digestion with MluI.
EXAMPLE 2
Construction of Plasmid Vectors Derived from R6K Carrying the
Selection Marker sup Phe
[0182] Vectors were constructed containing ori .gamma. from R6K and
the kanamycin-resistance gene (pXL2666). The observation of pXL2666
multimers in the strain BW19610 (pir116) 5 (Metcalf et al., 1993)
led us to study the effect of the cer fragment from ColE1 on this
phenomenon. We then introduced the expression cassette of the
phenylalanine suppressor tRNA (sup Phe) onto the vector ori
.gamma.-Km.sup.R-cer (pXL2730). This vector, pXL2760, serves as a
basis for the construction of vectors which can be used in gene
therapy.
[0183] 1) Construction and Analysis of Vectors Containing Ori
.gamma. from R6K and the Kanamycin Resistance Gene
[0184] a) Constructs
[0185] In the first plasmid constructed, pXL2666, the kanamycin
resistance gene originated from pUC4K (Vieira and Messing; 1982)
and the origin of replication, contained in a 417 bp EcoRI-BamHI
fragment, originated from the suicide vector pUT-T7pol (Herrero et
al., 1990) (FIG. 4). The transfer of pXL2666 into the strains
BW19094 and 19610 (Metcalf et al., 1994) made it possible to show
that the amount of plasmid is indeed increased in a pir116 strain,
when compared with the same plasmid in a pir strain. However,
electrophoretic analysis of the undigested plasmids showed that
this increase goes hand in hand with the appearance of a few
multimeric forms. This phenomenon is quite probably associated with
intermolecular recombination between the multiple copies of the
plasmid. Thus, we constructed pXL2730 by cloning the cer fragment
of the natural E. coli plasmid, ColE1, which had been shown to
permit, in cis, the resolution of plasmid dimers (Summers and
Sherrat, 1984), into pXL2666. The fragment used corresponds to a
382 bp HpaII fragment from ColE1 (Leung et al., 1985). It contains
a specific intermolecular recombination site; in order to function,
it involves only host proteins including the recombinases XerC and
XerD and the accessory factors ArgR and PepA (Stirling et al.,
1988, 1989; Colloms et al., 1990). To ensure that the effects
observed are indeed due to the cer fragment, we also constructed
the control plasmid pXL2754, in which the cer fragment has a 165 bp
deletion. This deletion was shown to abolish the action of cer on
the resolution of the multimers (Leung et al., 1985). The various
cloning steps leading to the construction of these plasmids are
presented in FIG. 4.
[0186] b) Quantitative and Qualitative Analysis of the Plasmid
Species
[0187] (i) Analysis by Agarose Gel Electrophoresis
[0188] Electrophoretic analysis of the different plasmids
constructed allowed the demonstration of various plasmid species,
which are variable according to the strains used. The size of the
undigested plasmids was evaluated relative to a supercoiled DNA
marker. In the pir strain (BW19094), the plasmids pXL2666, 2754 and
2730 were almost entirely in monomeric form. The bands above each
main band correspond to various slightly less supercoiled
topoisomers, as confirmed by the profile observed after the action
of DNA gyrase on pXL2730.
[0189] In the case of the pir116 strain (BW19610), the profiles
were different: with the plasmids pXL2666 and 2754 different
species were observed ranging from the monomer to multimers (2, 3
or 4 units), the major form being the dimer. After digestion with
EcoRI, only the linear plasmid DNA was found; these plasmid species
correspond either to plasmid multimers or to various topoisomers.
However, since the size of the forms determined according to the
supercoiled DNA marker was a whole product of that of the monomer
plasmid, it is highly probable that they are multimers. The
formation of multimers was most probably attributable to the pir116
mutation, although the two strains BW19094 and BW19610 are not
strictly isogenic (BW19610 is recA). The profile obtained with
pXL2730 was different: although multimeric forms were still
visible, the major form is the monomeric form. The cer fragment can
thus facilitate resolution of the plasmid multimers which we have
constructed, independently of recA, in BW19610.
[0190] (ii) Analysis after Treatment with DNA Topoisomerases
[0191] To disprove the theory that the forms observed in the
strains carrying the pir116 allele are specific topoisomers, each
plasmid preparation was subjected to the action of DNA
topoisomerases. The activities of the various enzymes under the
experimental conditions were as follows: relaxing of DNA for E.
coli DNA topoisomerase I, negative supercoiling of relaxed DNA for
E. coli DNA gyrase, and disentanglement of interlaced DNAs and
relaxation of supercoiled DNA by S. aureus DNA topoisomerase IV.
The action of DNA topoisomerase IV made it possible to show that
the high-molecular-weight plasmid forms did not result from the
entanglement of several plasmid molecules; in this case, they would
then have been converted into the monomeric species. The
functionality of the enzyme was, of course, checked on a
preparation of kinetoplast DNA, composed of entangled DNA molecules
(not shown). The relaxation activity was also visible since species
are obtained which migrate less than in the untreated controls. The
action of DNA gyrase made it possible to convert the slightly
relaxed topoisomers into the more supercoiled species extracted
from the bacterium (monomer or dimer mainly). Furthermore, it made
it possible to verify that the DNAs prepared were mainly in
supercoiled form. The samples thus treated allowed the above
results to be confirmed as regards the major species for each
construct. DNA topoisomerase I did indeed relax DNA, but only
partially. This could be due to the fact that the plasmids studied
contain only a few single-stranded regions, to which this enzyme
preferably binds (Roca, 1995).
[0192] 2) Introduction of the Selection Marker sup Phe into
pXL2730
[0193] We used the expression cassette of the synthetic suppressor
tRNA gene (Phe) (Kleina et al., 1990). This introduced a
phenylalanine into the growing polypeptide chain in response to a
TAG codon. Furthermore, it allowed the production in XAC-1 of an
ArgE protein that was sufficiently active to allow good growth in
arginine-deficient medium. sup Phe was expressed constitutively on
the plasmid pCT-2-F (Normanly et al., 1986) from a synthetic
promoter derived from the promoter sequence, Plpp, of the E. coli
lpp gene. Downstream of this gene, transcription was stopped by the
synthetic terminator, T.sub.rrnC, of the E. coli operon rrnC
(Normanly et al., 1986). The various cloning steps are indicated in
FIG. 5.
[0194] The various subclonings were performed in XAC-1. The
functionality of the suppressor tRNA expression cassette was thus
checked by means of the .alpha.-galactosidase activity of this
strain, which only exists if there is suppression of the amber
codon of the gene lacZ.sub.u118am. The final step consists of the
introduction of the sup Phe expression cassette into pXL2730. The
results obtained with the cer fragment (B-1-b) led us to select
this plasmid rather than pXL2666. We retained the kanamycin
resistance gene for ease of subsequent cloning, in particular in
order to have available additional screening during the final
cloning (loss of Km.sup.R).
EXAMPLE 3
Validation of the Plasmid Vector for Applications in Gene Therapy
by Transfection of Mouse Fibroblasts
[0195] 1) Construction of the Reporter Vector pXL2774
[0196] To test the validity for gene therapy of the system for
producing plasmid DNA, we introduced a reporter gene, which can be
used in eukaryotic cells, into pXL2760. We used the gene luc, which
codes for Photinus pyralis luciferase, since the bioluminescence
measurement test is very sensitive and is linear over a large
range, and the background noise due to the endogenous activity of
eukaryotic cells is very low. The luc gene was controlled by
promoter-enhancer sequences of a human cytomegalovirus early gene
(CMV promoter), which allowed a high level of expression. There was
an untranslated region at the 3' end of luc, originating from the
virus SV40, which contained the polyadenylation signal (poly(A)+).
After intermediate cloning, which allowed the number of available
restriction sites to be increased, the "CMV promoter-luc-poly(A)+"
cassette was introduced into the minimal vector ori .gamma.-cer-sup
Phe (pXL2760) in place of the Km.sup.R marker. The resulting
plasmid has been named pXL2774. FIG. 6 shows the various cloning
steps. The ligation mixtures were transformed into XAC-1pir116 by
electroporation. Incubation allowing the bacteria to express
selection markers was carried out in rich medium (SOC medium); it
was thus necessary to wash the cells twice with M9 medium before
plating out. This made it possible to remove the residual medium,
which would have resulted in culture background noise on minimal
medium.
[0197] The medium chosen to plate out the electroporated cells was
M9 minimal medium, which makes it possible to select bacteria
expressing a suppressor tRNA and thus the presence of our plasmids.
The addition of X-Gal made it possible, by means of the blue
colouration, to visualize the expression of the suppressor tRNA.
The dishes were analysed after about 20 hours at 37.degree. C. The
absence of colonies on the DNA-free control assures us that the
selection was correct, even with dense seedings. All the clones
examined by restriction (8) do indeed carry a plasmid,
corresponding to the expected profile. The plasmid thus
constructed, pXL2774, was prepared from a clone cultured in one
liter of liquid M9 medium (about 18 hours at 37.degree. C.), by a
technique involving, inter alia, an ion-exchange step (Promega kit,
MegaPreps). The amount of DNA collected was 2 mg.
[0198] 2) Analysis of the Reporter Vector pXL2774 Transfected into
Mammalian Cells.
[0199] The capacity of pXL2774 to transfect eukaryotic cells and to
allow the expression of luciferase was evaluated by transfection
into NIH 3T3 mouse fibroblasts. The vector chosen as reference was
the plasmid pXL2622 (this is the plasmid pGL2 from Promega whose
SV40 promoter has been replaced by the CMV promoter), which carries
the same luciferase expression cassette as pXL2774, but on a
different replicon. This is a 6.2 kb ColE1 derivative which carries
the ampicillin-resistance gene. This plasmid serveed as a control.
The luciferase activities (expressed as RLU, or relative
luminescence units) are indicated in Table 3.
[0200] The best results were obtained with a "lipofectant
charges/DNA charges" ratio of 6; under these conditions, pXL2622
and 2774 appear to be equivalent.
TABLE-US-00005 TABLE 3 pXL2622 pXL2774 RLU/.mu.g of Coefficient
RLU/.mu.g of Coefficient Charge proteins and of variation proteins
and of variation ratios per well Average (%) per well Average (%) 0
0.0 not 0.0 not 0.0 detectable 0.0 detectable 0.0 0.0 3 9.9
10.sup.6 7.6 10.sup.6 22 3.3 10.sup.6 2.9 10.sup.6 13 6.2 10.sup.6
2.9 10.sup.6 6.6 10.sup.6 2.4 10.sup.6 6 1.2 10.sup.7 1.5 10.sup.7
19 9.4 10.sup.6 1.0 10.sup.7 7 1.5 10.sup.7 9.9 10.sup.6 1.9
10.sup.7 1.1 10.sup.7 9 9.5 10.sup.6 1.0 10.sup.7 26 1.1 10.sup.7
6.4 10.sup.6 13 7.5 10.sup.6 8.3 10.sup.6 1.4 10.sup.7 8.5
10.sup.6
EXAMPLE 4
Verification of the Suicide Vector Nature in E. coli of the pCOR
Plasmids
[0201] The non-replicative nature of the pCOR-type plasmids derived
from R6K was verified by an electroporation experiment in JM109 E.
coli (Yanisch-Perron et al., 1985) of plasmids pUC4K (ori
ColEI-KmR, (Vieira and Messing, 1982)) and pXL2730 (ori gamma from
R6K-KmR, see Example 2). The electroporator used was the Biorad
Gene Pulser and the electrocompetent JM109 cells were prepared and
used according to the manufacturer's procedure (Bacterial
electro-transformation and pulse controller instruction manual.
catalog number 165-2098).
[0202] The electrotransformed cells were plated out on LB medium
supplemented with kanamycin (50 mg/l) and incubated overnight at
37.degree. C. The results obtained are presented below.
Results
TABLE-US-00006 [0203] Efficacy (number of Amount transformed Number
of transformants/ Plasmid (ng) transformants ng of plasmid) pUC4K
0.01 >>2000 >2105 pXL2730 5 0 0
[0204] These results show that there was a minimum of 5 logs of
difference between the efficacy of transformation of a ColE1
derivative (pUC4K) and that of an R6K derivative (pXL2730) in a
strain which does not express the pir gene. In a pir+ strain such
as XAC-1pir116, the electrotransformation efficacy of R6K-derived
plasmids conventionally reaches or exceeds the 108
transformants/.mu.g of plasmid.
EXAMPLE 5
Production of Plasmid DNA by High-Density Culturing of the E. coli
Strain XAC-1pir116 (pXL2774): Fermentation Process
[0205] 5.1. Strains:
[0206] Production in XAC-1pir116 E. coli (Example 1) of a minimal
plasmid, pXL2774; this plasmid comprises the following elements:
ori R6K-cer-tRNAamsupPhe and an expression cassette of the luc
reporter gene under the control of the CMV promoter (Example 3). A
high-productivity process for the production of plasmids of this
type was developed.
[0207] 5.2. Culturing Media and Conditions:
[0208] a) Growth Medium:
[0209] Composition of the medium defined used for the inoculum
cultures (g/l): Na.sub.2HPO.sub.4 6, KH.sub.2PO.sub.4 3, NaCl 0.5,
NH.sub.4Cl 1, NH.sub.4H.sub.2PO.sub.4 3, glucose 5,
MgSO.sub.4.7H.sub.20 0.24, CaCl.sub.2.2H.sub.2O 0.015, thiamine HCl
0.010
[0210] Composition of the complex medium used for the fed-batch
cultures (g/l): KH.sub.2PO.sub.4 8, K.sub.2HPO.sub.4 6.3,
Na.sub.2HPO.sub.4 1.7, (NH.sub.4).sub.2SO.sub.4 0.74, NH.sub.4Cl
0.12, yeast extract 3, glucose 2, MgSO.sub.4.7H.sub.20 2.4 g/l,
CaCl.sub.2.2H.sub.2O 0.015, thiamine 0.010, solution of salts (Fe,
Mn, Co, Zn, Mo, Cu, B, Al).
[0211] Composition of the medium defined for the cultures in
fed-batch medium identical to the complex medium, but the yeast
extract is replaced by 2.5 g/l of NH.sub.4Cl.
[0212] b) Conditions of Fed-Batch Culturing:
[0213] Studies in 2-liter fermenters (Setric France) containing 1 l
of medium were carried out in order to define the optimum
conditions for growing and producing plasmid DNA. The fermenter was
inoculated with 80 ml of an inoculum culture arrived at the start
of the stationary phase of growth.
[0214] During the fermentation, the pH was controlled and adjusted
automatically between 6.9 and 7.0 with 10% (w/v) aqueous ammonia;
the temperature was maintained at 37.degree. C.; the aeration was
set at 75 l/h ((1.1 vvm) at a pressure of 0.2 bar and the dissolved
oxygen was adjusted to (40% of air saturation by retroaction on the
stirring rate and, if necessary, by enrichment with pure
oxygen.
[0215] All the parameters (pH, temperature, stirring, OD, O.sub.2
and CO.sub.2 in the effluent gases) were collected and calculated
in line via an HP3852 interface connected to a Hewlett-Packard
9000.
[0216] The base composition of the supply medium was as follows:
50% carbon source, 0.7% magnesium sulphate, 0.02% thiamine; for the
complex medium, yeast extract was added to a concentration
preferably of between 5 and 10%.
[0217] To adapt the culture conditions to 800-liter fermenters,
production sequences composed of two successive inoculum cultures
were carried out, on a laboratory scale: inoculum I in an agitated
conical flask and inoculum II in a 2-liter fermenter (batch
culturing), followed by fed-batch production culturing, in a
7-liter fermenter.
[0218] 5.3. Results
[0219] Various culture conditions were studied in complex medium,
in defined medium, and at various growth rates. In all cases, after
initial batch culturing of the bacterial strain and consumption of
the carbon source, the supply medium was added to the fermenter by
means of a peristaltic pump coupled to a pre-programmed addition
profile. This profile was deduced from previous experiments in
which the supply rate had been controlled either by the level of
dissolved oxygen or by a constant growth rate.
[0220] Furthermore, in order to extrapolate without difficulty the
2-liter fermentation condition to an 8001 fermenter without
overoxygenation of the medium, the maximum oxygen demand at the end
of the culturing was set at 2.5-3 mM/min. For this, the growth rate
of the microorganism was reduced, if necessary, by varying the
supply rate of the complementary charge.
[0221] As seen in Table 4, very good results were obtained both in
complex medium and in defined medium, both on the laboratory scale
and on the 800-liter fermenter scale; furthermore, the plasmid DNA
growth and production kinetics are entirely comparable (cf. FIGS. 6
and 7).
TABLE-US-00007 TABLE 4 Defined Complex medium medium 2 or 7 l 800 l
2 l fermenter fermenter fermenter Duration of 40 39 48 fermentation
(hours) .mu.h-l 0.130 0.132 0.124 OD (600 nm) 114 100 94 X g/l 44
37 30 Plasmid DNA 115 100 100 (mg/l medium) Plasmid DNA 2.6 2.7 3.3
(mg/gX) X = Biomass (weight of dry cells)
[0222] From the overall results it emerges that: [0223] changing
the scale of the fermenter from 2 liters to 800 liters can be
carried out without any problem, [0224] the oxygen consumed is
strongly correlated to the biomass produced (1.08 g O.sub.2/g of
biomass produced), [0225] the plasmid was stable for at least 50
generations without selection pressure, [0226] a high biomass,
greater than 40 g of dry cells/liter, can be obtained in complex
medium, [0227] the plasmid DNA production reaches 100 mg of
supercoiled DNA/l of medium, [0228] there was very good correlation
between the DNA production and the biomass: the production can be
estimated to (1 mg of plasmid DNA/OD unit, or alternatively (2.7 mg
of plasmid DNA/g of biomass, irrespective of the duration of
fermentation, [0229] the use of a defined medium also makes it
possible to achieve a high biomass (30 g of dry cells/l) and high
plasmid DNA production (100 mg/l), without any loss of
productivity.
EXAMPLE 6
Transfer of pXL2774 into Animal Cells, In Vitro and In Vivo
[0230] 6.1. In Vitro Transfer of pXL2774 into Animal Cells
[0231] The capacity of the minimal plasmid pXL2774 to transfect
various cell lines was tested in vitro, on cells of both human
origin and murine origin. The pXL2784 plasmid was used as control.
It contains the same eukaryotic expression cassette (CMV
promoter-luciferase-polyA) as pXL2774, but this is a 6.4 kb ColE1
derivative which comprises the gene for imparting kanamycin
resistance in E. coli.
[0232] The cells tested are the following:
TABLE-US-00008 Atcc ref./ Cells Type literature ref. 3LL Mouse
pulmonary carcinoma NIH 3T3 Mouse embryo fibroblasts CCL92 293
Human embryo renal cells transformed CRL1573 with type-5 adenovirus
HeLa Human carcinoma from the neck of the CCL2 womb Caco-2 Human
colon adenocarcinoma HTB37 H460 Human lung carcinoma with no small
HTB177 cells ECV 304 Human umbilical cord endothelial cells
Takahashi et al., 1990
[0233] The transfection conditions were as follows:
[0234] D-1: Inoculation of the cells at a density of 100,000 cells
per 2 cm.sup.2 well (24-well plate) in DMEM medium (Dulbecco's
modified Eagle Medium) supplemented with 10% fetal calf serum
(FCS).
[0235] D-3: Transfection of the cells, by 10 .mu.l of a
transfection solution containing: 0.5 .mu.g of DNA, 150 mM NaCl, 5%
glucose and 3 nmol of RPR120 535 lipofectant per .mu.g of DNA, in
250 .mu.l of culture medium, which was or was not supplemented with
10% FCS. After incubation for 2 hours, the medium was replaced by
500 .mu.l of DMEM medium supplemented with 10% FCS.
[0236] D4: Renewal of the culture medium
[0237] D-5: Washing of the cells with PBS, followed by lysis with
100 .mu.l of Promega lysis buffer (Promega Cell Lysis Buffer E153
A). Assay of the luciferase activity was carried out in a Lumat LB
9501 luminometer (Berthold) on 10 .mu.l of lysate, with a 10-second
duration of integration. The reactant used was that from Promega
(Promega Luciferase Assay Substrate). The results, collated in the
following tables 5-8, are expressed in RLU (Relative Lights Units)
for 10 .mu.l of lysate (average of measurement on 4 wells). The
coefficients of variation (CV) are also given.
[0238] The results of transfections in the absence of serum are
presented below.
TABLE-US-00009 CELL TYPES NIH 3T3 3LL 293 pXL2774 37 763 380 559
270 1 884 200 RLU 16 25 73 CV pXL2784 113 764 1 723 546 RLU 24 101
CV
Cell Types
TABLE-US-00010 [0239] HeLa CaCo2 H460 ECV304 pXL2774 11 000 000 1
108 422 1 459 501 36 450 15 14 5 23 pXL2784 557 930 93 610 7 563
168 795 87 40 11 40
[0240] The results of transfections in the presence of serum (10%)
are presented below:
Cell Types
TABLE-US-00011 [0241] NIH 3T3 3LL 293 pXL2774 50 612 590 566 377
992 500 12 18 59 PXL2784 12 693 780 436 704 2 300 000 38 12 47
Cell Types
TABLE-US-00012 [0242] HeLa H460 ECV304 pXL2774 9 490 000 857 385 18
021 25 16 30 PXL2784 1 508 480 433 023 32 074 23 27 47
[0243] These results reveal the capacity of pXL2774 to transfect
effectively, in vitro, various cell types of both murine and human
origin. The expression of the luc reporter gene made it possible to
show that its transfection efficacy is at least as good as that of
a "standard" plasmid, derived from ColE1, which carries the same
expression cassette of luciferase.
[0244] 6.2. In Vivo Transfer, in Animals (Mice), of pXL2774
[0245] a) Model 1: Naked DNA in Mouse Cranial Tibial Muscle
[0246] Naked plasmid DNA, dissolved in "5% glucose, 150 mM NaCl"
was injected into the cranial tibial muscle of OF1 mice. The
muscles were removed 7 days after injection, chopped up,
homogenized in 750 .mu.l of lysis buffer (Promega Cell Lysis Buffer
E153A) and then centrifuged at 20,000.times.g for 10 minutes.
[0247] Assay of the luciferase activity was carried out on 10 .mu.l
of supernatant after addition of 50 .mu.l of reagent (Promega
Luciferase Assay Substrate). The reading was carried out on a Lumat
LB9501 luminometer (Berthold) with a 10-second duration of
integration.
[0248] The results are presented in the table below.
TABLE-US-00013 Plasmid pXL2784 pXL2774 pXL2784 pXL2774 Number of 8
8 10 10 muscles: Volume injected 30 30 33 33 (il): .mu.g of 19 13.5
10 6.25 DNA/muscle RLU (for 10 .mu.l) Average 80 922 471 733 35329
30569 Standard deviation 104 573 402 602 37041 35774
[0249] These results show that a conditional replication plasmid
such as pXL2774 was indeed capable of transfecting mouse muscle
cells in vivo and of doing so with comparable, or even superior,
efficacy to that of a "standard" plasmid derived from ColE1, which
carries the same expression cassette of the luciferase gene.
[0250] b) Model 2: 3T3 HER2 Tumour Model
[0251] The model is as follows: [0252] Swiss/nude adult female type
mice [0253] Experimental tumours induced after injection of 107 3T3
HER2 cells subcutaneously into the flank. [0254] The transfection
mixture was injected 7 days after injection of the cells. [0255]
Solutions injected: The DNA was first dissolved in the buffer.
After addition of all the products, the mixture contained, besides
the DNA, NaCl (150 mM) and 5% D-glucose in water or 5 mM HEPES
buffer. [0256] Two days after the injection, the tumour tissue was
removed, weighed and then chopped up and homogenized in 750 l of
lysis buffer (Promega Cell Lysis Buffer E153 A). After
centrifugation (20,000.times.g for 10 minutes), 10 .mu.l of
supernatant was removed and luciferase activity was evaluated. This
activity was determined by measuring the total light emission
obtained after mixing with 50 .mu.l of reagent (Promega Luciferase
Assay Substrate) in a Lumat LB 9501 luminometer (Berthold) with a
10-second duration of integration.
[0257] The resulting activity was expressed in RLU (Relative Light
Units) estimated in the entire tumour lysis supernatant.
Results
TABLE-US-00014 [0258] Plasmid RLU/tumour Buffer [DNA] results H20
or final in standard HEPES reference .mu.g/tumour inj. sol. average
deviation +/n HEPES pXL2784 10 0.5 .mu.g/.mu.l 744 150 682 434 6/6
pXL2774 10 0.5 .mu.g/.mu.l 1 016 380 1 322 500 5/6 H2O pXL2784 24
0.6 .mu.g/.mu.l 2 906 073 1 745 857 8/8 pXL2774 16.8 0.4
.mu.g/.mu.l 4 292 043 4 995 187 6/6 H2O pXL2784 7.5 0.3 .mu.g/.mu.l
702 554 552 207 6/7 pXL2774 5 0.2 .mu.g/.mu.l 3 413 430 4 000 875
6/6
[0259] These results show that a conditional replication plasmid,
such as pXL2774, was indeed capable of transfecting mouse tumour
cells in vivo and of doing so with an efficacy at least comparable
to that of a "standard" plasmid, derived from ColE1, which carries
the same expression cassette of the luciferase gene.
[0260] These various experiments demonstrate that the conditional
replication plasmids, and more particularly pXL2774, did indeed
have animal cell transfection characteristics that are essential
for use in gene therapy. More precisely, the following were shown:
[0261] 1) the capacity of pXL2774 to transfect efficiently, in
vitro, various cell types of human or murine origin; [0262] 2) the
capacity of pXL2774 to transfect, in vivo, mouse muscle; [0263] 3)
the capacity of pXL2774 to transfect, in vivo, tumour cells
implanted into mice.
[0264] The electrotransformation, fermentation and transfection
experiments thus made it possible to validate conditional
replication plasmids as vectors which can be used in gene therapy
by showing:
[0265] i) that they did not replicate detectably in an E. coli
strain that does not express the pir gene (conditional origin of
replication)
[0266] ii) that they could be produced on a scale compatible with
industrial production, in a defined medium that does not contain
antibiotics;
[0267] iii) that these plasmids could transfect, in vitro and
especially in vivo, mammalian cells.
EXAMPLE 7
In Vitro Production of Recombinant Proteins
[0268] 7.1. Construction of the Expression Vector
[0269] To show the feasibility of such an approach, we constructed
an expression vector according to the criteria described above
(Examples 2 and 3). This vector, pXL3056, contains:
[0270] 1) the bacterial part which comprises the conditional origin
of replication (ori gamma), the cer fragment of ColE1, and the gene
which ensures selection in bacteria (sup)
[0271] 2) the expression cassette, based on the system described by
Studier (Studier et al., 1990), comprising the promoter of gene 10
of bacteriophage T7, the lacO operator, the gene coding for aFGF
154 (acidic Fibroblast Growth factor, form containing 154 amino
acids) (Jaye et al., 1986), and the TF terminator of bacteriophage
T7. This expression cassette is identical to the one present on the
pXL2434 plasmid, which is described in application WO 96/08572.
[0272] The construction of pXL3056 is presented in FIG. 8. The
EcoRI-BglII fragment of pXL2434 (1.1 kb) containing the aFGF
expression cassette was cloned in the pXL2979 conditional
replication vector (1.1 kb purified fragment) at the BglII and
EcoRI sites to generate pXL3056.
[0273] pXL2979 results from the ligation of 3 fragments: i)
AccI-XbaI fragment of pXL2730 (0.8 kb, which provides ori gamma and
cer), ii) NarI-SalI fragment of pXL2755 (0.18 kb, which provides
the sup Phe gene), iii) SalI-SpeI fragment of pXL2660 (1.5 kb,
which provides the kanamycin resistance gene).
[0274] pXL2660 results from the cloning of the 1.2 kb PstI fragment
of pUC4K (Vieira and Messing, 1982) in pMTL22 (Chambers et al.,
1988) linearized with PstI.
[0275] 7.2. Production of the Expression Strain
[0276] Plasmid pXL3056 was introduced by transformation into the
XAC-1pir116 strain. The resulting strain was then transformed by
the plasmid PT7pol23 (Mertens et al., 1995), at 30.degree. C. In
order to express the gene of interest under control of the T7
promoter, the bacterium must contain in its genome, on a plasmid,
or a bacteriophage, a cassette allowing expression of the RNA
polymerase of bacteriophage T7. In the example described, we used
the plasmid pT7pol23, which is compatible with R6K derivatives such
as pXL3056, and which allows the temperature-inducible expression
of bacteriophage T7 RNA polymerase. However, it can also be
envisaged to lysogenize the XAC-1pir116 strain with lambda DE3
(Studier et al., 1990) to conserve only one plasmid and to induce
the production of T7 RNA polymerase by IPTG rather than by
temperature.
[0277] 7.3. Expression of aFGF
[0278] The XAC-1pir116 strain (pXL3056+PT7pol23) was cultured at
30.degree. C. in M9 minimum medium supplemented with 0.2% of
casamino acids (DIFCO) and kanamycin (25 .mu.g/ml), up to an
optical density at 600 nm of 0.6-1.0. Half of the culture was then
placed at 42.degree. C. (induction of the T7 RNA polymerase), while
the other half remained at 30.degree. C. (negative control). The
same experiment was carried out with the XAC-1pir116
(pXL3056+pUC4K) strain which constitutes a control for the
expression of aFGF in the absence of T7 RNA polymerase.
[0279] The results obtained are presented in FIG. 9. They show that
the production; of aFGF was comparable or superior to that observed
with BL21(DE3)(pXL2434) (WO 96/08572), which clearly shows the
potential of conditional replication plasmids for the expression of
recombinant proteins in vitro, especially in E. coli.
EXAMPLE 8
Construction of a pCOR Vector which Expresses a Wild-Type or Hybrid
p53 Protein or the FGF1 Human Protein
[0280] This example describes the construction of conditional
replication vectors according to the invention containing a nucleic
acid coding for a p53 protein. These vectors can be used to restore
a p53-type activity in deficient (mutated, deleted) cells such as,
in particular, tumour cells.
[0281] The eukaryotic expression cassette contains the following
elements:
[0282] 1) CMV "immediate early" promoter (positions -522 to +72)
followed by the leader sequence of the thymidine kinase gene of
type I herpes simplex virus (position -60 to +1 of the gene, with
reference to the sequence in the article by McKnight, S. .dagger.L.
(1980) Nucleic Acids Res. 8:5949-5964);
[0283] 2a) a nucleic acid which codes for wild-type p53 protein or
for a p53 variant, as described in application PCT/FR 96/01111
(V325K variant=V325 with a Kozak sequence with ATG);
[0284] 2b) a nucleic acid which codes for the human FGFa or FGF-1
as described in Jaye M. (Sciences 1986; 233(4763):451, U.S. Pat.
No. 4,686,113, and European Patent No: 259 475;
[0285] 2c) a nucleic acid which codes for a fusion gene between
human fibroblast interferon secretion signal (Taniguchi et al.) and
the naturally occurring truncated form of human FGF-1 from amino
acid 21 to 154 as described by Jaye et al., and U.S. Pat. No.
5,849,538.
[0286] 3) the polyA polyadenylation sequence of SV40.
[0287] These elements were placed in the form of a fragment
AscI-XbaI on the pCOR vector pXL2988 between the sites BssHII and
SpeI. pXL2988 is identical to pXL2979 (Example 7.1.) apart from the
presence of an additional element, a sequence capable of forming a
DNA triple helix composed of 17 copies of the trinucleotide GAA,
placed alongside the gamma origin of replication.
[0288] The resulting plasmids were named pXL3029, pXL3030, pXL3179
or NV1FGF (FIG. 10).
[0289] The functionality of these constructions was verified in
vitro on p53-SAOS2 cells in culture by measuring the
transcriptional-activator activity of p53 or p53superWT, or by
measuring the secretion of FGF1 for example by ELISA experiments
which is well known in the art.
EXAMPLE 9
Construction of TEX 1 (XAC1 pir116, endA.sup.-, traD.sup.-)
[0290] The E. coli XAC-1pir116 contains an F episome, a circular
DNA molecule of approximately 100 kb, that carries proB.sup.+
lacI.sub.373lacZ.sub.u118am. Many male E. coli laboratory strains
carry a traD36 mutation on their episome, but no mutation affecting
F' transfer ability has been described for XAC-1. The gene traD is
at the 5' end of one of the tra (transfer) operons and encodes a
membrane protein directly involved in DNA transfer and DNA
metabolism (Frost et al., BBRC, 1994, 58:162-210). A 2 kb central
fragment from traD, comprising 92% of the gene, was replaced with
the 2 kb omega element (Genbank accession number M60473) from
pHP45.OMEGA. (Prentki and Krisch, 1984, Gene, 29:303-313) by
homologous recombination in XAC-1pir116 endA.sup.-. The omega
element contains the aadA antibiotic resistance gene flanked by
short inverted repeats. The gene aadA encodes aminoglycoside-3
adenyltransferase and confers resistance to streptomycin and
spectinomycin ("Sp.sup.R"). The omega fragment was used because it
prematurely terminates RNA and protein synthesis leading to the
inactivation of the whole traD operon. This new pCOR strain
XAC-1pir116 endA- traD::SpR was designated TEX1. Transfer of any
resident plasmids, either pCOR, or pUC, was undetectable when the
donor was TEX1.
[0291] The new pCOR host strain TEX1 was assessed in fermentation
experiments. Complex media containing yeast extract were used for
fed-batch fermentation with XAC-1pir116. pCOR stability (more than
50 generations) makes it possible to use a non-selective media.
Under these conditions, XAC-1pir116 produced more than 40 g/l dry
cell weight and 100 mg/l of pCOR pXL2774 were obtained from 2-liter
fermenters. pCOR copy number was estimated at 400-500 copies per
cell and the rate of plasmid DNA synthesis was constant throughout
fermentation. These results were extrapolated to an 800-liter
fermenter suitable for manufacturing. The fermentation was also
performed in the absence of yeast extract or any raw material from
animal origin. Similar results (30 g/l dry cell weight and 100 mg/l
of plasmid DNA) were obtained using a defined medium in 2-liter
cultures with no loss of productivity.
EXAMPLE 10
Construction of XAC-1pir116pir42 Host Strains by Homologous
Recombination
[0292] 1) Construction of a Suicide Vector Carrying the Cassette
"KmR-uidA:pir116;pir42"
[0293] The Km.sup.R-uidA::pir116 cassette from M13wm33 as described
in Example 1 (Metcalf W. et al. Gene, 1994, 138(1-2): p. 1-7), was
modified by site-directed mutagenesis using PCR (QuickChange
site-directed mutagenesis kit, Stratagene, La Jolla, Calif.) to
introduce the pir42 mutation into the pir116 gene. The different
cloning/mutagenesis steps are described in FIG. 13
[0294] The oligonucleotides used for mutagenesis contained the
pir42 mutation along with a silent mutation that created a ClaI
site to easily indicate the processing of pir42 by restriction
analysis when needed.
[0295] The sense and antisense oligonucleotides used are as
follows:
TABLE-US-00015 Sense oligonucleotide number 11076 (SEQ ID NO: 7)
5'-G TAT ATG GCG CTT GCT CTC ATC GAT AGC AAA GAA pir42 ClaI CC-3'
Antisense oligonucleotide number 11077 (SEQ ID NO: 8) 5'-GG TTC TTT
GCT ATC GAT GAG AGC AAG CGC CAT ATA ClaI pir42 C-3'
[0296] The technique used to replace pir116 by pir116pir42 in the
genome of E. coli pCOR host TEX1 was based on that of Blum et al.
(J. Bacteriol. 1989, 171, pp 538-46). The recombinant bacteriophage
pXL3723 shown in FIG. 13 is a suicide vector in all non-suppressor
E. coli strains, because it has a non-sense mutation in gene II
encoding M13 nickase that prevents viral genome replication.
[0297] Double recombination was performed as described for the
construction of XAC-1pir116 (Example 1, point 2). Clones that had
undergone double homologous recombination events were screened by
PCR to test for the presence of the pir42 mutation in the genome of
TEX1. Genomic DNA isolated from double recombination candidates was
used as a template for PCR. Secondly, sequencing was done on each
unique amplified fragment, all of which were of the expected size.
The PCR fragments are shown in FIG. 14.
[0298] The PCR primers were the following:
TABLE-US-00016 Primer 11088 (SEQ ID NO: 9):
5'-GAGATCGCTGATGGTATCGG-3' Primer 11089 (SEO ID NO: 10):
5'-TCTACACCACGCCGAACACC-3'
[0299] This analysis showed that one out of the six double
recombinants tested had undergone the allele exchange. This new
strain, named TEX 1pir42, was further evaluated for its ability to
replicate pCOR plasmids compared to the parental strain TEX1.
[0300] 2) Evaluation of TEX1pir42
[0301] pCOR plasmids were transformed in parallel into TEX1 and
TEX1pir42 and grown overnight in 2 ml of selective M9 medium. Then,
the plasmid DNA was extracted with the Wizard SV plus minipreps kit
(Promega) to evaluate the relative plasmid copy number and topology
of the pCOR plasmids in both strains.
[0302] A 2-fold increase in copy number was obtained reproducibly
in TEX1pir42 transformed with the pCOR plasmid pXL3516 (2.56 kb).
To further characterize TEX1pir42, the copy number and topology of
pCOR plasmids such as pXL3179 and pXL2774 were evaluated by agarose
gel electrophoresis analysis after small scale purification of
plasmid DNA (4 to 6 clones/strain). Copy number was evaluated on
plasmids linearized with EcoRI restriction enzyme. A topology test
was run on non-digested plasmids, in the absence of ethidium
bromide. The resulting agarose gel is displayed in FIG. 15, and
clearly shows a higher plasmid copy number when the plasmid pXL3179
was produced in TEX1pir42, than when produced in TEX1 strain. FIG.
15 also displays the topology of the plasmid pXL3179, and shows
that an increase in plasmid copy number, which were essentially in
the form of monomers, with few plasmids in the form of multimers.
The results obtained with these pCOR plasmids are also summarized
in Table 5. Relative copy number was calculated in comparison with
the same plasmid in TEX1. A 2-3 fold increase in plasmid copy
number was observed with plasmids pXL3179 and 2774 produced in
TEX1pir42.
TABLE-US-00017 TABLE 5 Replication and copy number of pCOR plasmids
produced in TEX1pir42 RELATIVE COPY PLASMIDS SIZE (kb) NUMBER*
pXL3179 2.4 x3 pXL2774 4.5 x2 *copy number was compared to the same
plasmid in TEX1.
EXAMPLE 11
Comparative Experiments: Construction of TEX1cop21
(XAC-1endA-traD-pir116cop21)
[0303] 1) Construction of TEX1cop21
[0304] The TEX1cop21 strain was constructed similarly as that
described in Example 10 for TEX1pir42. The following
oligonucleotides used to introduced cop21 into the pir116 gene by
directed mutagenesis were as follows:
TABLE-US-00018 Sense oligonucleotides: 11153 (SEQ ID NO: 11) 5'-CG
CAA TTG TTA ACG TCC AGC TTA CGC TTA AGT AGC cop21 C-3' Antisense
oligonucleotide: 11154 (SEQ ID NO: 12) 5'-G GCT ACT TAA GCG TAA GCT
GGA CGT TAA CAA TTG CG-3'
[0305] The cop21 mutation was introduced as a TCC serine codon
instead of the TCA serine codon to eliminate a HindIII restriction
site close to the mutation.
[0306] The template used for directed mutagenesis was pXL3395 (see
FIG. 13). The resultant plasmid named pXL3432 was used to construct
the suicide M13 vector in a similar way as to what is shown for
pir42 in FIG. 13. The suicide vector pXL3749 is shown in FIG.
16.
[0307] The E. coli clones obtained after homologous recombination
with pXL3749 were screened by PCR and subsequent restriction with
HindIII and sequencing to monitor the cop21 and pir116 mutations.
One clone out of the six double recombinants tested had undergone
the gene replacement. The resulting strain was named TEX1cop21.
[0308] 2) Evaluation of TEX1cop21
[0309] TEX1cop21 was transformed by various pCOR plasmids,
including pXL2979, a 2.5 kb Km.sup.R pCOR vector (See Example 7.1),
and assayed for increased copy number by gel electrophoresis. Such
an experiment with pXL2979 is shown in FIG. 17. Plasmid DNA from
four independent clones for each strain prepared with Promega
miniprep kit was linearized with EcoRI, electrophoresed on agarose
gel and then stained with ethidium bromide. Each sample represented
a similar amount of bacteria, as measured by optical density at 600
mm. The agarose gel electrophoresis obtained for the pCOR plasmid
pXL2979 produced in E. coli TEX1cop21, XAC1pir, and TEX1 is
displayed in FIG. 17. It clearly shows there was no increase in
plasmid copy number when the plasmids are produced in the TEX1cop21
strain, as compared with TEX1.
EXAMPLE 12
Construction of TEX2pir42 (XAC-1pir116 pir42 recA.sup.-)
[0310] Firstly, a recA- derivative of TEX1 was constructed. The
pir42 mutation was then introduced into the resulting strain named
TEX2 to generate TEX2pir42.
[0311] 1) Construction of E. coli TEX2, a recA- Derivative of
TEX1
[0312] A deleted recA gene containing 3 translation stop codons
(one in each frame) at its 5' end was obtained by PCR. This deleted
recA gene was introduced by gene replacement (Blum et al., J.
Bacteriol., 1989, 171, pp. 538-46) into the TEX1 genome. The
construction of the suicide vector for homologous recombination is
shown in FIG. 18.
PCR primers used for the amplification of recA fragments are shown
in the following Table 6:
TABLE-US-00019 TABLE 6 primers DNA sequences seq 10930
5'CCCTCTAGATCGATAGCCATTTTTACTCCTG 3' SEQ ID NO: 13 seq 10931
5'CGGGATCCTGATTATGCCGTGTCTATTAG 3' SEQ ID NO: 14 seq 10932
5'CCCAAGCTTCTTCGTTAGTTTCTGCTACGCCTTCG SEQ ID NO: 15 C 3' seq 10933
5'GGTCTAGAACGTGAAAGTGGTGAAGAACAAAATC SEQ ID NO: 16 G 3'
[0313] Restriction sites added to the recA sequence are
underlined.
[0314] To maintain the RecA+ phenotype necessary for homologous
recombination to occur, the recA function was provided to E. coli
TEX1 with a plasmid containing a heterologous recA gene that can
complement E. coli recA mutants, such as for example the recA gene
of the bacterium Agrobacterium radiobacter, and an antibiotic gene
resistance, such as the ampicillin resistance gene. After gene
replacement, the plasmid was eliminated from the recombinant strain
by culture-dilution in non-selective medium (LB). The absence of
the plasmid was screened for the loss of antibiotic resistance.
[0315] The resulting strain was named TEX2. Gene replacement was
monitored by PCR in FIG. 19. PCR Primers are described in the
following Table 7.
TABLE-US-00020 TABLE 7 Primers 11355-11354 Primers 11355-11354 Wild
type 1117 bp 1089 bp recA Deleted recA 404 bp 376 bp
[0316] The first primer was based on the sequence of the recA gene.
The second one was based on a sequence close to but outside the
homology region present in the suicide vector pXL3457 (immediately
5' or 3' of recA) to ensure that amplification can only occur on a
genomic fragment. The sequence of both oligonucleotides was chosen
according to the sequence of E. coli, which comprises the recA
locus (Genbank ECAE000354).
[0317] The PCR fragments obtained from a recA-deleted strain were
shorter as compared to those obtained with a wild-type strain, as
presented in the following Table 8.
TABLE-US-00021 TABLE 8 PCR primers for amplication of recA primers
5'->3' sequence seq 11352-SEQ ID NO: 17 GCGACCCTTGTGTATCAAAC seq
11353-SEQ ID NO: 18 GGTATTACCCGGCATGACAG seq 11355-SEQ ID NO: 19
GTGGTGGAAATGGCGATAGG seq 11354-SEQ ID NO: 20
GCGATTTTGTTCTTCACCAC
[0318] The PCR profile obtained was as expected and demonstrated
the presence of a truncated recA gene in the genome of TEX2. The
recA- phenotype (sensitivity to UV light), as well as phenotypic
characteristics of TEX2, were checked. Phenotypic characteristics
of TEX2 were the same as those of TEX1 strain, i.e., ara- ,
Rif.sup.R, Nal.sup.R, Sp.sup.R, UidA-, Arg-, Km.sup.S Amp.sup.S),
as expected.
[0319] B) Construction of E. coli TEX2pir42
[0320] A TEX2pir42 strain was constructed by double homologous
recombination, according to the strategy described in Example 10,
with the exception that recombination in TEX2 was carried out in
presence of a plasmid carrying a heterologous recA gene capable of
complementing the E. coli recA mutants, in order to maintain a
recA+ phenotype required for homologous recombination.
[0321] Gene replacement was monitored by restriction analysis of
the PCR product digested with ClaI (see FIG. 14). Gene replacement
had occurred in two out of the four-studied double recombinant
clones.
[0322] C) Evaluation of E. coli TEX2pir42
[0323] 1) Evaluation at Lab Scale Plasmid Production:
[0324] TEX2pir42 was transformed by the pCOR plasmid pXL3179 (2.4
kb). Production of pXL3179 in TEX2pir42 was intensively studied at
the lab scale, in terms of reproducibility of the improvement of
plasmid copy number, conditions of culture, as well as stability
(number of generations). All the studies consistently showed a 2 to
5-fold increase of plasmid copy number as compared to production of
pXL3179 in TEX1 under the same conditions. Plasmid copy number was
assessed further to the production of pXL3179 in TEX2pir42, and
TEX1pir42 and TEX1 as comparative experiments. In this experiment,
plasmids were extracted from identical bacterial biomass, based on
the OD at 600 nm, and analyzed by agarose gel electrophoresis. The
gel was stained with ethidium bromide after electrophoresis. The
agarose gel electrophoresis, which is displayed in FIG. 20, clearly
shows that plasmids are produced in TEX2pir42 at high copy number,
and advantageously shows that plasmid multimers are reduced when
produced in TEX2pir42 instead of TEX1pir42.
2) Evaluation in Fermenters:
[0325] These results were confirmed at a larger scale in 7-liter
fermenters, as described below.
[0326] a) Composition of Fermentation Media
[0327] The composition of the medium used for inoculum cultures
was: Na.sub.2HPO.sub.4 6 g/l, KH.sub.2PO.sub.4 3 g/l, NaCl 0.5 g/l,
NH.sub.4Cl 1 g/l, NH.sub.4H.sub.2PO.sub.4 3 g/l, glucose 5 g/l,
MgSO.sub.4,7H.sub.20 0.24 g/l, CaCl.sub.2,2H.sub.2O 0.015 g/l,
thiamine HCl 0.010 g/l.
[0328] The composition of the medium used for fed-batch culture was
as follows: KH.sub.2PO.sub.4 8 g/l, K.sub.2HPO.sub.4 6.3 g/l,
Na.sub.2HPO.sub.4 1.7 g/l, NH.sub.4Cl 2.5 g/l, glucose 10 g/l,
MgSO.sub.4,7H.sub.20 2.6 g/l, thiamine 0.011 g/l, Biospumex36
antifoam 0.1 ml/l, salt mix (see table 9) 2.5 ml/l.
TABLE-US-00022 TABLE 9 Composition of salt mix Salt mix Solution
Final concentration (g/100 ml) in fed-batch medium FeSO.sub.4,
7H.sub.2O 1.6 40 CaCl.sub.2, 2H.sub.2O 1.6 40 MnSO.sub.4, H.sub.2O
0.4 10 CoCl.sub.2, 6H.sub.2O 0.16 4 ZnSO.sub.4, 7H.sub.2O 0.08 2
MoO.sub.4Na.sub.2, 2H.sub.2O 0.072 1.8 CuCl.sub.2, 2H.sub.2O 0.04 1
H.sub.3BO.sub.3 0.02 0.5 AlCl.sub.3, 6H.sub.2O 0.04 1
[0329] The composition of the supply medium was as follows: 50%
glucose, 0.7%, magnesium 0.02% thiamine-HCl, 1% Biospumex36
antifoam.
[0330] b) Fermentation Parameters
[0331] A 7-liter fermenter containing 3 liters of the fed-batch
medium was inoculated with 1.2% of the inoculum culture. Inoculum
was prepared as follows: 250 ml of the inoculum medium in a 2-liter
flask was inoculated with 0.25 ml of a frozen cell suspension of
the E. coli strain TEX2pir42 (pXL3179).
[0332] Flasks were incubated for 24 hours at 37.degree. C. at 220
rpm. After 24 hours, different parameters were measured: residual
glucose: 0 g/l, OD.sub.600nm was 2.7 and pH 6.24. During
fermentation, the pH was controlled and adjusted automatically
between 6.9 and 7 with NH.sub.3. The temperature was maintained at
37.degree. C. and the dissolved oxygen adjusted to a 45% pO2 by
retroaction on the stirring rate.
[0333] After initial batch culturing of the bacterial strain for
about 17 hours and consumption of the carbon source (glucose), the
supply medium was added. Glucose and acids, such lactate and
acetate, were maintained at a concentration close to 0.
[0334] c) Results
[0335] Final results are presented in Table 10, as compared to
production in a 100-liter fermenter with E. coli TEX1 (pXL3179) in
optimized conditions.
[0336] As for XAC-1pir116, there was no difference between 7-liter
and 800-liter fermenters in terms of plasmid copy number of pXL3179
produced in TEX1.
[0337] Plasmids pXL3179 produced in a 7-liter fermenter using a E.
coli TEX2pir42 was compared to the production of pXL3179 in a
100-liter fermenter with E. coli TEX1, in optimized conditions. It
was demonstrated that as for XAC-1pir116 (See Example 5.3), there
is a stable plasmid production rate in a 7-liter, 100-liter, or
800- liter fermenter in TEX1.
TABLE-US-00023 TABLE 10 Characteristics of the fermentation of TEX1
and TEX2pir42 strains containing pXL3179. Estimated Duration
Concentration copy of Final Cell of number fermentation OD Dry DNA
(copy/ Reference (h) (600 nm) weight (mg/l) bacterium) TEX1
OpGen090 43.00 104 33.1 96 616-627 (pXL3179) TEX2pir42 Op1328S5
48.47 72 27.1 205 1896-1904 (pXL3179)
There were 3-fold more copies of plasmid pXL3179 per bacterium in
TEX2pir42 as compared to TEX1.
[0338] Plasmids corresponding to different fermentation time points
were extracted from identical bacterial biomass, based on the OD at
600 nm, and analyzed by agarose gel electrophoresis. FIG. 21
clearly shows an increase of the plasmid copy number with the
duration of the fermentation. Also, FIG. 21 shows the topology of
the pXL3179 plasmid produced in Op1328S5 TEX2pir42, which was
nearly exclusively in a monomeric form.
[0339] In conclusion, the E. coli host strain TEX2pir42 according
to the present invention provided an unexpectedly high plasmid copy
number improvement of pCOR plasmids, such as pXL3179, of 2 to
5-fold in TEX2pir42 as compared to TEX1, at a lab scale and in
fermenters. Furthermore, while the plasmid copy number was greatly
improved, plasmids so produced exhibited a monomeric topology, not
only at lab-scale but also at a larger scale (7-liter fermenter)
compatible with industrial production.
EXAMPLE 13
New Copy-Up Mutants of pir116 Identified by a Novel
Fluorescence-Based Screening Method
[0340] To increase pCOR plasmid copy number in bacterial host
cells, we have mutagenized the pir116 gene, which encodes a copy-up
mutated version of the pir gene. To date all of the mutations
increasing the copy number of R6K-derived plasmids, such as
embodiments of pCOR, have been found within the pir gene.
[0341] After random mutagenesis by PCR, mutated pir116 genes were
introduced into a pCOR vector containing the cobA reporter gene,
which is described below. After fluorescence based screening, the
copy number and topology of the selected mutant plasmid were
evaluated. We obtained three different mutants of pir116 gene that
increase plasmid copy number. These novel mutations have not been
described previously.
[0342] A classical screening method for copy-up mutants is based on
antibiotic resistance. In this method, the level of resistance of a
host bacterium to an antibiotic is a function of the copy number of
an antibiotic resistance gene located on a plasmid within the cell.
As the copy number of the plasmid, and therefore the antibiotic
resistance gene, increases, the level of antibiotic resistance also
increases. This method, however, was not applicable for R6K-derived
plasmids in host cells containing the pir116 mutation due to a too
high baseline copy number of the plasmid (about 400 copies/cell) in
these cells. Accordingly a new screening method based on
fluorescence to identify copy-up mutations of the pir116 gene was
developed.
[0343] For this new method, the cobA gene was introduced into a
pCOR vector to provide a simple means of monitoring improvement in
plasmid copy number. The cobA gene was obtained from Pseudomonas
denitrificans (Crouzet et al., J. Bacteriol, 172:5968-79 (1990)).
It encodes uroIII methyltransferase, an enzyme of the vitamin B12
pathway that adds two methyl groups to the urogen III molecule.
When overexpressed in E. coli, cobA leads to the accumulation of
red products that are fluorescent under near UV light. When exposed
to UV, bacterial colonies overexpressing this gene appear pink to
red. We tested this gene to determine if it could serve as a
reporter gene for plasmid copy number in the pCOR system.
[0344] To evaluate the relationship between plasmid copy number and
level of fluorescence of transformed bacteria exposed to UV light a
control plasmid (pXL3767) was constructed comprising cobA deleted
of its own promoter (FIG. 22). This plasmid was transformed into
three different host strains (XAC1pir, XAC1pir116 and TEX1pir42).
These strains were selected based on previous experiments showing
that the average copy number of a pCOR plasmid in XAC 1pir is 1, it
is approximately five to ten fold higher in TEX1, and 15 to 30 fold
higher in TEX1pir42.
[0345] Recombinant colonies were streaked on M9 minimal medium and
exposed to UV light on a transilluminator as shown in FIG. 22. We
observed that the fluorescence intensity of the colonies was
positively correlated with the plasmid copy number, with XAC1pir116
exhibiting more fluorescence than XACpir, and TEX1pir42 exhibiting
more fluorescence than XAC1pir116.
[0346] The results shown in FIG. 22 demonstrate that this
fluorescence-based assay method easily discriminates between the
tested plasmid copy numbers, especially between the plasmid copy
number found in strains TEX1 and TEX1pir42. That is, the intensity
of red fluorescence observed in this assay increases with the
plasmid pCOR-cobA copy-number.
[0347] Having demonstrated a positive correlation between
fluorescence and cobA copy number, we constructed a plasmid into
which mutagenized pir116 genes were introduced for screening. Four
plasmids with different combinations of constitutive modules, as
shown in FIG. 23, were constructed and tested. One of these
plasmids demonstrated a significantly different level of
fluorescence when transformed into pir116 and pir116pir42 isogenic
strains. This plasmid, pXL3830, is shown in pertinent part in FIG.
24.
[0348] Control plasmids were used during the screening and
evaluation experiments. First, a baseline level control plasmid,
pXL3830, containing "wild type" pir116 was used to set a baseline
fluorescence level. Second, pXL3795, that contains the double
mutation pir116-pir42 which increases the copy number of the
plasmid by 4 to 6 as compared to pXL3830, was used as a positive
control.
[0349] Random mutagenesis was performed on pir116 gene using the
Diversify PCR random mutagenesis kit (BD Biosciences Clontech, Palo
Alto, Calif., USA). Condition 1, which introduced an average of 2
mutations per 1000 base pairs, was used. A preliminary experiment
run using "condition 1" has shown by sequencing of 12 mutants that
the mutation rate was actually about 2 mutations in the pir116
gene. The pir116 gene was amplified as an EcoRI-SstI fragment with
oligonucleotides C8832 (5-CTTAACGGCTGACATGGGAATTC-3') (SEQ ID NO:
23) and C8833 (5'-CGATGGGCGAGCTCCACCG-3') (SEQ ID NO: 24). After
digestion with EcoRI and SstI, the mutagenized fragment containing
pir116 was cloned into pXL3830 in place of the "wild-type" pir116
gene.
[0350] Plasmids carrying mutagenized pir116 ("pir116*") were
transformed into E. coli strain XAC-1, the parent of pCOR host
XAC1pir116. Transformants were screened for increased fluorescence
under UV light and compared to XAC1(pXL3830) and XAC1(pXL3795)
controls. A duplicate plate was not exposed to UV to minimize
secondary mutations. A representative screening plate under UV
light is shown in FIG. 25.
[0351] The following flow chart summarizes the results of the
screening experiment.
##STR00001##
[0352] The evaluation of the three selected mutants is summarized
in FIG. 26. Each mutant showed an increase in copy number as
compared to the pir116 plasmid. In the case of mutants 114C and
100B, the plasmid was essentially in monomeric form. This could be
an advantage as compared to a pir116pir42 plasmid, which has an
increased copy number and a high multimer content, like mutant
201C.
[0353] The pir116* gene of each mutant was sequenced. Each clone
contains a single non-isocodant mutation in pir116 ORF. All three
of the mutations affect the C terminus of the pi protein, which is
involved in DNA binding. None of these mutations have been
described before.
[0354] Once detected by screening in a plasmid system, these
mutations were evaluated in a production system, that is, where the
pir116* gene is introduced into the genome of an E. coli pCOR host
strain. The strategy for this evaluation is summarized in FIG.
27.
[0355] For this evaluation, plasmid pXL3179 plasmid was transformed
into each of the three E. coli strains bearing the mutations
identified in FIG. 26, and assessed for plasmid copy number and
topology. The results of these experiments are presented in FIG.
28. It was observed that plasmid copy number was significantly
increased relative to XAC1pir116 only for 201C mutant.
EXAMPLE 14
Minicircle with M13 Gene III as a Tool for Integration by
Homologous Recombination in E. coli
[0356] 1. Suicide Vectors
[0357] Gene replacement by double homologous recombination in E.
coli requires the use of a suicide vector. These vectors are
constructed and produced in a host capable of replicating them and
used subsequently for recombination into the chromosome of a host
unable to replicate them.
[0358] Bacteriophage M13 is a very useful genetic tool that can be
used in rep mutants (Metcalf, W., W. Jiang, et al., Gene 138:1-7
(1994)) or in non-suppressor strains of E. coli when M13 mp 8
through 11 are used (Blum, P. et al., J Bacteriol., 171:538-46
(1989)). Certain limitations in terms of construction, insert size,
and instability are frequently encountered. Plasmids carrying the
R6K gamma DNA replication origin are well known suicide vectors
(Miller, V. and J. Mekalanos, J Bacteriol., 170:2575-83 (1988)),
but they are not useful for modifying E. coli strains that express
the pi protein, which permits such plasmids to replicate.
[0359] A universal suicide vector was engineered with a novel
counter selectable marker and used to construct E. coli strains
wherein mutants of the pir116 gene (pir116*) are inserted into a
bacterial genome by homologous recombination. The strategy
presented here is demonstrated for mutant 114C, but has also been
used to produce strains bearing other pir116* mutants.
[0360] 2. Counter-Selectable Marker
[0361] Different markers can be used to select for bacteria having
undergone a second recombination event. This event leads to the
loss of this marker and in some cases to gene replacement after
recombination between the chromosome and a suicide vector. For
instance, the SacB gene from Bacillus is lethal when bacteria
expressing the gene are plated on a medium containing sucrose
(Ried, J. L. and A. Collmer, Gene 57:239-46 (1987)). As another
example, the tetracycline resistance gene confers sensitivity to
fusaric acid (Bochner, B. R., et al., J Bacteriol. 143(2):926-3
(1980)). The infection by the bacteriophage M13 confers the
sensitivity to the detergent deoxycholate (Blum, P., et al., J
Bacteriol. 171:538-46 (1989)).
[0362] Due to a lack of efficiency in some E. coli strains, a
positive selection method for double recombinants was developed.
Gene III from bacteriophage M13 was evaluated as a
counter-selectable marker. This gene encodes a minor virion
component responsible for the infectivity of the particles. When
overexpressed from the multicopy plasmid pBR322, gene III confers
deoxycholate sensitivity on the cells due to insertion of the gene
III protein into the membrane of the bacteria (Boeke, J. D. et al.,
Mol Gen Genet 186:185-92 (1982)). No report indicated if this gene
could be used as an efficient counter-selectable marker when
present as a single copy in the genome of the E. coli. Therefore,
we tested this hypothesis with a minicircle suicide vector.
[0363] 3. Amplification by PCR of the Deleted Version of Gene III
from M13
[0364] To reduce the size of the minicircle vector to be
constructed, a deleted version of gene III (gene III') that is
still able to confer sensitivity to deoxycholate (Boeke, J. D., P.
Model, et al., Mol Gen Genet 186:185-92 (1982)) was chosen. It was
amplified by PCR along with its own promoter from M13 mp18
(Yanisch-Perron, C., J. Vieira, et al., Gene 33:103-19 (1985)) as a
BglII- XhoI fragment (see FIG. 29).
The oligonucleotides were as follows:
TABLE-US-00024 C19519: (SEQ ID NO: 25)
5'-GGCAGATCTTAAACCGATACAATTAAAGG-3' BglII C19520: (SEQ ID NO: 26)
5'-CCGCTCGAGTTACGATTGGCCTTGATATTCACAAAC-3' XhoI
[0365] The amplified fragment was cloned by T-A cloning into
pGEMT-easy (Promega Corporation, Madison, Wis., USA) to generate
pXL4230 (FIG. 29). The nucleotide sequence of the insert was found
to agree with that described in GenBank under accession no. VB0018.
pXLA230 confers sensitivity to deoxycholate when transformed in E.
coli strain DH10B (Invitrogen), indicating that it functions as
expected.
[0366] 4. Minicircle-Based Suicide Vector
[0367] As it does not contain any origin of replication, a
minicircle plasmid may be used as a universal suicide vector. For
this purpose, a selectable marker such as the kanamycin resistance
gene must be added to select for a first homologous recombination
event. To counter-select for bacteria that have not undergone a
second event of recombination, the gene III' was added to the
minicircle vector. The construction of the plasmid used to produce
minicircle for recombination is shown in FIG. 29.
[0368] The minicircle is generated from a plasmid, such as pXL4235,
after induction of the bacteriophage lambda integrase, which
recombines between attP and attB on the plasmid (Darquet, A. M et
al., Gene Ther 4(12):1341-9 (1997)). This recombinase is expressed
under the control of P.sub.BAD in a arabinose-dependent manner in
E. coli strain G6264, which is described in U.S. application Ser.
No. 09/981,803. The resulting minicircle contains attL, a TH
(triple-helix) forming sequence for purification, the selectable
marker Tn903 kanamycin resistance gene, the counter-selectable
marker gene III' and the fragment of interest for homologous
recombination, cloned in the multi-cloning site of pXLA235 (FIG.
29).
[0369] As an example, the constructs used to generate E. coli
strains expressing a copy-up mutation of pir116 are described in
FIG. 30. These strains can be used to produce pCOR plasmids
(Soubrier, F. et al., Gene Ther 6:1482-1488 (1999)). Since there is
no homology between pir and the bacterial genome, the pir116*
sequences were inserted into the E. coli chromosomal uidA gene,
which encodes .beta.-D-glucuronidase. This gene provides sufficient
sequence similarity with the E. coli genome for homologous
recombination to occur.
[0370] The protocol for the purification of minicircle and
recombination occurred as follows. Plasmid pXLA256 (FIG. 30) was
transformed in E. coli strain G6264 to generate G6656. Fifty ml of
LB medium supplemented with ampicillin (100 mg/l) were inoculated
with 0.5 ml of an overnight culture of G6656 and incubated at
37.degree. C., with shaking at 200 rpm until the optical density at
600 nm reached 0.7. Minicircle production was induced by the
addition of 250 .mu.l of a sterile solution of 10% arabinose to the
medium. After 30 minutes at 37.degree. C., 200 rpm, total plasmid
DNA was extracted using the Wizard Plus Midipreps DNA Purification
system (Promega Corporation, Madison Wis., USA).
[0371] Six .mu.g of the plasmid DNA preparation were loaded onto a
0.8% agarose preparative gel. A supercoiled DNA ladder (Promega
Corporation, Madison Wis., USA) was used as a molecular weight
standard. After electrophoresis overnight at 50V, the supercoiled
minicircle construct (5.1 kb) was extracted and purified from the
gel using an SV gel purification kit (Promega Corporation, Madison
Wis., USA).
[0372] 5. Double Homologous Recombination with Minicircle 4256
(uidA::pir116* Minicircle Suicide Vector)
[0373] The recombination steps for constructing the strains and the
corresponding phenotypes are described in FIG. 31.
[0374] For the first recombination event (integration), 0.2, 1 and
5 .mu.l of purified minicircle 4256 were electroporated in E. coli
strain XAC1 (Normanly, J et al., Proc Natl Acad Sci USA 83:6548-52
(1986)), which is the parental strain for pCOR hosts. Kanamycin
resistant colonies were obtained on LB Agar supplemented with
kanamycin (50 mg/l) after overnight incubation at 37.degree. C.
[0375] To evaluate the number of colonies potentially containing
contaminant non-recombined pXL4256, 50 Km.sup.R colonies were
streaked in parallel on LB Agar supplemented with kanamycin or
ampicillin. Only 4 colonies out of 50 were resistant to kanamycin
and ampicillin and were shown by plasmid restriction analysis to
contain non-recombined pXL4256. This indicated that 46 colonies out
of 50 obtained by electroporation were actually minicircle 4256
integrants.
[0376] For the second recombination event (excision), all of the 46
Km.sup.R integrants were isolated on freshly prepared LB Agar
plates containing 1.5% sodium deoxycholate ("Doc"; Sigma) and
incubated at 37.degree. C. overnight. Only a few
deoxycholate-resistant (Doc.sup.R) colonies (1 to 15) were obtained
for each integrant, as shown in FIG. 32. This result was consistent
with the selection of a relatively rare event, such as the second
recombination event. 100 Doc.sup.R colonies obtained from 15
integrants were patched in parallel on LB Agar with 1.5% Doc and LB
Agar plus kanamycin to screen for Doc.sup.R and Km.sup.S double
recombinants. 86% of the screened colonies were Km.sup.S,
indicating that they had lost the suicide vector.
[0377] To screen for allele replacement, the chromosomal uidA locus
was amplified by PCR. If allele replacement has occurred, the
expected PCR fragment size is 1.3 kb. The fragment size
corresponding to wild-type uidA locus, that is, without an
integrated pir116* mutation, is 0.85 kb. The results presented in
FIG. 33-panel A indicate that allele replacement has occurred in
30% of the double recombinants. This was confirmed by phenotypic
analysis because these clones are also UidA- (beta glucuronidase-)
and give white colonies on LB agar supplemented with Xgluc.
[0378] The integrity of the bacterial genome in the region close to
the site of homologous recombination was checked by PCR on two
independent recombinants. The first primer (seq6113 or seq6115) was
based on the sequence of the pir gene and the second (seq6112 or
seq6116) had a sequence based on a sequence close to, but outside
of, the homology region (immediately 5' or 3' of uidA). XAC1 DNA
was used as a negative control, whereas XAC1pir116 or TEX1
(Soubrier, F. et al., Gene Ther 6:1482-1488 (1999)) were used as
positive controls.
[0379] The oligonucleotides used as PCR primers were the
following:
TABLE-US-00025 Seq11088: 5'-GAGATCGCTGATGGTATCGG-3' (SEQ ID NO: 27)
Seq11089: 5'-TCTACACCACGCCGAACACC-3' (SEQ ID NO: 28) Seq6112:
5'-GACCAGTATTATTATCTTAATGAG-3' (SEQ ID NO: 29) Seq6113:
5'-GTATTTAATGAAACCGTACCTCCC-3' (SEQ ID NO: 30) Seq6115:
5'-CTCTTTTAATTGTCGATAAGCAAG-3' (SEQ ID NO: 31) Seq6116:
5'-GCGACGTCACCGAGGCTGTAGCCG-3' (SEQ ID NO: 32)
[0380] The expected size for the PCR product is 0.83 kb using
primers seq6112 and seq6113, and 0.88 kb when using primers seq6114
and seq6115. Results are presented in FIG. 33-panel B. The two
double recombinants obtained with the minicircle suicide vector
showed the expected PCR profile. This demonstrates that double
homologous recombination can be easily achieved in E. coli using
minicircle plasmids as suicide vector and the M13 gene III' as a
counterselectable marker. This gene replacement technique can be
directly universally carried out in any micro-organisms genetic
background.
BIBLIOGRAPHY
[0381] Alting-Mees, M. A., J. A. Sorge, and J. M. Short. 1992.
Methods Enzymol. 216:483-495 [0382] Blum, P., D. Holzschu, H. S.
Kwan, D. Riggs, and S. Artz. 1989. J. Bacteriol. 171:538-546.
[0383] Brosius, J. 1989. Methods Enzymol. 216:469-483. [0384]
Chambers, S. P., S. E. Prior, D. A. Barstow, and N. P. Minton.
1988. Gene 68:139-149. [0385] Chung, C. T., and R. H. Miller. 1988.
Nucleic Acids Res. 16:3580. [0386] Colloms, S. D., P. Sykora, G.
Szatmari, and D. J. Sherrat. 1990 J. Bacteriol. 172:6973-6980.
[0387] Datta, N., and P. Kontomichalou. 1965. Nature 208:239-241.
[0388] Dickely, F., D. Nilsson, E. B. Hansen, and E. Johansen.
1995. Mol. Microbiol. 15:839-847. [0389] Filutowicz, M., S. Dellis,
I. Levchenko, M. Urh, F. Wu, and D. York. 1994. Prog. in Nucleic
Acid Res. and Mol. Biol. 48:239-273. [0390] Gibson, T. J. 1984.
Ph.D Thesis. University of Cambridge. [0391] Greener, A., M.
Filutowicz, M. McEachern, and D. Helsinki. 1990. Mol. Gen. Genet.
224:24-32. [0392] Herrero, M., V. de Lorenzo, and K. N. Timmis.
1990. J. Bacteriol. 172:6557-6567. [0393] Hodgson, C. P. 1995.
Bio/technology 13:222-225. [0394] Inuzuka, M., and Y. Wada. 1985.
EMBO J. 4:2301-2307. [0395] Jaye, M. et al., (1986) Science
233:541-5 [0396] Kleina, L. G., J. M. Masson, J. Normanly, J.
Abelson, and J. H. Miller. 1990. J. Mol. Biol. 213:705-717. [0397]
Kowalczykowski, S. C., and A. K Eggleston. 1994. Annu. Rev.
Biochem. 63:9991-10043. [0398] Leung, D. W., E. Chen, G. Cachianes,
and D. V. Goeddel. 1985. DNA 4:351-355. [0399] Maniatis, T., E. F.
Fritsch, and J. Sambrook. 1989. Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y. [0400] Meinnel, T., E. Schmitt, Y. Mechulam,
and S. Blanquet. 1992. J. Bacteriol. 174:2323-2331. [0401] Mertens,
N., E. Remant and W. Fiers. (1995) Bio/Technology 13:175-179 [0402]
Messing, J., and J. Vieira. 1982. Gene 19: 269-276. [0403] Metcalf,
W. W., W. Jiang, and B. L. Wanner. 1994. Gene 138:1-7. [0404]
Miller, V. L., and J. J. Mekalanos. 1988. J. Bacteriol.
170:2575-2583. [0405] Normanly, J., J. M. Masson, L. G. Kleina, J.
Abelson, and J. H. Miller. 1986. Proc. Natl. Acad. Sci. USA
83:6548-6552. [0406] Normanly, J., L. G. Kleina, J. M. Masson, J.
Abelson, and J. H. Miller. 1990. J. Mol. Biol. 213:719-726. [0407]
Roca, J. 1995. TIBS 20:156-160. [0408] Saiki, R. K., S. Scharf, F.
Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim.
1985. Science 230:1350-1354. [0409] Sanger, F., S. Nicklen, and A.
R. Coulson. 1977. Proc. Natl. Acad. Sci. USA 74:5463-5467. [0410]
Sawadogo, M., and M. W. Van Dyke. 1991. Nucleic Acids Res. 19:674.
[0411] Scott, J. R. 1984. Microbiol. Rev. 48:1-23. [0412] Simoes,
D. A., M. Dal Jensen, E. Dreveton, M. O. Loret, S. Blanchin-Roland,
J. L. Uribelarrea, and J. M. Masson. 1991. Ann. N.Y. Acad. Sci.
646:254-258. [0413] Simon, R., U. Priefer, and A. Puhler. 1983.
Bio/Technology 1:784-791. [0414] Sinha, N. D., J. Biernat, J.
McManus, and H. Koster. 1984. Nucleic Acids Res. 12:4539-4557.
[0415] Stirling, C. J. G. Stewart, and D. J. Sherrat. 1988. Mol.
Gen. Genet. 214:80-84. [0416] Stirling, C. J., S. D. Colloms, J. F.
Collins, G. Szatmari, and D. J. Sherrat. 1989. EMBO J. 8:1623-1627.
[0417] Studier, F. W., A. H. Rosenberg., J. J. Dunn and J. W.
Dubendorff (1990). Methods Enzymol 185:60-89. [0418] Summers, D.
K., and D. J. Sherrat. 1984. Cell 36:1097-1103. [0419] Takahashi,
K., Y. Sawasaki, J. Hata, K. Mukai and T. Goto. (1990) In Vitro
Cell Dev. Biol. 26:265-74. [0420] Vieira, J., and J. Messing. 1982.
Gene 19:259-268. [0421] Wiechelman, K., R. Braun, and J.
Fitzpatrick. 1988. Anal. Biochem. 175:231-237. [0422]
Yanisch-Perron, C. Vieira and J. Messing (1985) Gene 33:103-119 13.
Sequence CWU 1
1
391389DNAEscherichia coli 1tgtcagccgt taagtgttcc tgtgtcactg
aaaattgctt tgagaggctc taagggcttc 60tcagtgcgtt acatccctgg cttgttgtcc
acaaccgtta aaccttaaaa gctttaaaag 120ccttatatat tctttttttt
cttataaaac ttaaaacctt agaggctatt taagttgctg 180atttatatta
attttattgt tcaaacatga gagcttagta cgtgaaacat gagagcttag
240tacgttagcc atgagagctt agtacgttag ccatgagggt ttagttcgtt
aaacatgaga 300gcttagtacg ttaaacatga gagcttagta cgtgaaacat
gagagcttag tacgtactat 360caacaggttg aactgctgat cttcagatc
3892960DNAEscherichia coli 2tatacagaat gatgaggttt ttttatgaga
ctcaaggtca tgatggacgt gaacaaaaaa 60acgaaaattc gccaccgaaa cgagctaaat
cacaccctgg ctcaacttcc tttgcccgca 120aagcgagtga tgtatatggc
gcttgctccc attgatagca aagaacctct tgaacgaggg 180cgagttttca
aaattagggc tgaagacctt gcagcgctcg ccaaaatcac cccatcgctt
240gcttatcgac aattaaaaga gggtggtaaa ttacttggtg ccagcaaaat
ttcgctaaga 300ggggatgata tcattgcttt agctaaagag cttaacctgc
cctttactgc taaaaactcc 360cctgaagagt tagatcttaa cattattgag
tggatagctt attcaaatga tgaaggatac 420ttgtctttaa aattcaccag
aaccatagaa ccatatatct ctagccttat tgggaaaaaa 480aataaattca
caacgcaatt gttaacggca agcttacgct taagtagcca gtattcatct
540tctctttatc aacttatcag gaagcattac tctaatttta agaagaaaaa
ttattttatt 600atttccgttg atgagttaaa ggaagagtta acagcttata
cttttgataa agatggaaat 660attgagtaca aataccctga ctttcctatt
tttaaaaggg atgtgttaaa taaagccatt 720gctgaaatta aaaagaaaac
agaaatatcg tttgttggct tcactgttca tgaaaaagaa 780ggaagaaaaa
ttagtaagct gaagttcgaa tttgtcgttg atgaagatga attttctggc
840gataaagatg atgaagcttt ttttatgaat ttatctgaag ctgatgcagc
ttttctcaag 900gtatttaatg aaaccgtacc tcccaaaaaa gctaaggggt
gatatatggc taaaatttac 960324DNAEscherichia coli 3gaccagtatt
attatcttaa tgag 24424DNAEscherichia coli 4gtatttaatg aaaccgtacc
tccc 24524DNAEscherichia coli 5ctcttttaat tgtcgataag caag
24624DNAEscherichia coli 6gcgacgtcac cgaggctgta gccg
24736DNAEscherichia coli 7gtatatggcg cttgctctca tcgatagcaa agaacc
36836DNAEscherichia coli 8ggttctttgc tatcgatgag agcaagcgcc atatac
36920DNAEscherichia coli 9gagatcgctg atggtatcgg
201020DNAEscherichia coli 10tctacaccac gccgaacacc
201136DNAEscherichia coli 11cgcaattgtt aacgtccagc ttacgcttaa gtagcc
361236DNAEscherichia coli 12ggctacttaa gcgtaagctg gacgttaaca attgcg
361331DNAEscherichia coli 13ccctctagat cgatagccat ttttactcct g
311429DNAEscherichia coli 14cgggatcctg attatgccgt gtctattag
291536DNAEscherichia coli 15cccaagcttc ttcgttagtt tctgctacgc cttcgc
361635DNAEscherichia coli 16ggtctagaac gtgaaagtgg tgaagaacaa aatcg
351720DNAEscherichia coli 17gcgacccttg tgtatcaaac
201820DNAEscherichia coli 18ggtattaccc ggcatgacag
201920DNAEscherichia coli 19gtggtggaaa tggcgatagg
202020DNAEscherichia coli 20gcgattttgt tcttcaccac
2021918DNAEscherichia coli 21atgagactca aggtcatgat ggacgtgaac
aaaaaaacga aaattcgcca ccgaaacgag 60ctaaatcaca ccctggctca acttcctttg
cccgcaaagc gagtgatgta tatggcgctt 120gctctcatcg atagcaaaga
acctcttgaa cgagggcgag ttttcaaaat tagggctgaa 180gaccttgcag
cgctcgccaa aatcacccca tcgcttgctt atcgacaatt aaaagagggt
240ggtaaattac ttggtgccag caaaatttcg ctaagagggg atgatatcat
tgctttagct 300aaagagctta acctgctctt tactgctaaa aactcccctg
aagagttaga tcttaacatt 360attgagtgga tagcttattc aaatgatgaa
ggatacttgt ctttaaaatt caccagaacc 420atagaaccat atatctctag
ccttattggg aaaaaaaata aattcacaac gcaattgtta 480acggcaagct
tacgcttaag tagccagtat tcatcttctc tttatcaact tatcaggaag
540cattactcta attttaagaa gaaaaattat tttattattt ccgttgatga
gttaaaggaa 600gagttaatag cttatacttt tgataaagat ggaaatattg
agtacaaata ccctgacttt 660cctattttta aaagggatgt gttaaataaa
gccattgctg aaattaaaaa gaaaacagaa 720atatcgtttg ttggcttcac
tgttcatgaa aaagaaggaa gaaaaattag taagctgaag 780ttcgaatttg
tcgttgatga agatgaattt tctggcgata aagatgatga agcttttttt
840atgaatttat ctgaagctga tgcagctttt ctcaaggtat ttgatgaaac
cgtacctccc 900aaaaaagcta aggggtga 91822305PRTEscherichia coli 22Met
Arg Leu Lys Val Met Met Asp Val Asn Lys Lys Thr Lys Ile Arg1 5 10
15His Arg Asn Glu Leu Asn His Thr Leu Ala Gln Leu Pro Leu Pro Ala
20 25 30Lys Arg Val Met Tyr Met Ala Leu Ala Leu Ile Asp Ser Lys Glu
Pro 35 40 45Leu Glu Arg Gly Arg Val Phe Lys Ile Arg Ala Glu Asp Leu
Ala Ala 50 55 60Leu Ala Lys Ile Thr Pro Ser Leu Ala Tyr Arg Gln Leu
Lys Glu Gly65 70 75 80Gly Lys Leu Leu Gly Ala Ser Lys Ile Ser Leu
Arg Gly Asp Asp Ile 85 90 95Ile Ala Leu Ala Lys Glu Leu Asn Leu Leu
Phe Thr Ala Lys Asn Ser 100 105 110Pro Glu Glu Leu Asp Leu Asn Ile
Ile Glu Trp Ile Ala Tyr Ser Asn 115 120 125Asp Glu Gly Tyr Leu Ser
Leu Lys Phe Thr Arg Thr Ile Glu Pro Tyr 130 135 140Ile Ser Ser Leu
Ile Gly Lys Lys Asn Lys Phe Thr Thr Gln Leu Leu145 150 155 160Thr
Ala Ser Leu Arg Leu Ser Ser Gln Tyr Ser Ser Ser Leu Tyr Gln 165 170
175Leu Ile Arg Lys His Tyr Ser Asn Phe Lys Lys Lys Asn Tyr Phe Ile
180 185 190Ile Ser Val Asp Glu Leu Lys Glu Glu Leu Ile Ala Tyr Thr
Phe Asp 195 200 205Lys Asp Gly Asn Ile Glu Tyr Lys Tyr Pro Asp Phe
Pro Ile Phe Lys 210 215 220Arg Asp Val Leu Asn Lys Ala Ile Ala Glu
Ile Lys Lys Lys Thr Glu225 230 235 240Ile Ser Phe Val Gly Phe Thr
Val His Glu Lys Glu Gly Arg Lys Ile 245 250 255Ser Lys Leu Lys Phe
Glu Phe Val Val Asp Glu Asp Glu Phe Ser Gly 260 265 270Asp Lys Asp
Asp Glu Ala Phe Phe Met Asn Leu Ser Glu Ala Asp Ala 275 280 285Ala
Phe Leu Lys Val Phe Asp Glu Thr Val Pro Pro Lys Lys Ala Lys 290 295
300Gly3052323DNAEscherichia coli 23cttaacggct gacatgggaa ttc
232419DNAEscherichia coli 24cgatgggcga gctccaccg
192529DNABacteriophage M13mp18 25ggcagatctt aaaccgatac aattaaagg
292636DNABacteriophage M13mp18 26ccgctcgagt tacgattggc cttgatattc
acaaac 362720DNAEscherichia coli 27gagatcgctg atggtatcgg
202820DNAEscherichia coli 28tctacaccac gccgaacacc
202924DNAEscherichia coli 29gaccagtatt attatcttaa tgag
243024DNAEscherichia coli 30gtatttaatg aaaccgtacc tccc
243124DNAEscherichia coli 31ctcttttaat tgtcgataag caag
243224DNAEscherichia coli 32gcgacgtcac cgaggctgta gccg
243312DNAEscherichia coli 33agaaaaaaag ga 123412DNAEscherichia coli
34tctttttttc ct 123514DNAEscherichia coli 35aagaaaaaaa agaa
143614DNAEscherichia coli 36ttcttttttt tctt 143712DNAEscherichia
coli 37tctttttttc ct 123814DNAEscherichia coli 38ttcttttttt tctt
143917DNAEscherichia coli 39aaaaaaggga ataaggg 17
* * * * *