U.S. patent application number 12/234136 was filed with the patent office on 2009-04-30 for canine and feline immunoregulatory proteins, nucleic acid molecules, and uses thereof.
Invention is credited to Catherine A. McCall, Eric R. Weber, Shumin Yang.
Application Number | 20090111970 12/234136 |
Document ID | / |
Family ID | 46149927 |
Filed Date | 2009-04-30 |
United States Patent
Application |
20090111970 |
Kind Code |
A1 |
Yang; Shumin ; et
al. |
April 30, 2009 |
CANINE AND FELINE IMMUNOREGULATORY PROTEINS, NUCLEIC ACID
MOLECULES, AND USES THEREOF
Abstract
The present invention relates to canine interleukin-5 proteins;
canine interleukin-5 nucleic acid molecules, including those that
encode canine interleukin-5 proteins; to antibodies raised against
such proteins; and to inhibitory compounds that regulate such
proteins. The present invention also includes methods to identify
and obtain such proteins, nucleic acid molecules, antibodies, and
inhibitory compounds. Also included in the present invention are
therapeutic compositions comprising such proteins, nucleic acid
molecules, antibodies and/or inhibitory compounds as well as the
use of such therapeutic compositions to regulate an immune response
in an animal.
Inventors: |
Yang; Shumin; (Palo Alto,
CA) ; McCall; Catherine A.; (Boulder, CO) ;
Weber; Eric R.; (Fort Collins, CO) |
Correspondence
Address: |
SHERIDAN ROSS P.C.
1560 Broadway, Suite 1200
Denver
CO
80202-5141
US
|
Family ID: |
46149927 |
Appl. No.: |
12/234136 |
Filed: |
September 19, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11561562 |
Nov 20, 2006 |
7427661 |
|
|
12234136 |
|
|
|
|
10787382 |
Feb 24, 2004 |
7183080 |
|
|
11561562 |
|
|
|
|
09755633 |
Jan 5, 2001 |
|
|
|
10787382 |
|
|
|
|
09322409 |
May 28, 1999 |
6471957 |
|
|
09755633 |
|
|
|
|
60087306 |
May 29, 1998 |
|
|
|
Current U.S.
Class: |
530/324 ;
530/326 |
Current CPC
Class: |
C12N 2799/021 20130101;
C07K 14/56 20130101; C07K 14/535 20130101; C07K 14/5437 20130101;
C07K 14/5406 20130101; A61K 2039/51 20130101; C07K 14/70578
20130101; C07K 14/54 20130101; C07K 14/475 20130101; C07K 14/70575
20130101; C07K 14/5409 20130101; A61K 38/00 20130101 |
Class at
Publication: |
530/324 ;
530/326 |
International
Class: |
C07K 4/00 20060101
C07K004/00; C07K 14/00 20060101 C07K014/00 |
Claims
1-18. (canceled)
19. An isolated protein of at least 20 amino acids in length,
wherein said protein comprises an at least 20 contiguous amino acid
region identical in sequence to a 20 contiguous amino acid region
selected from SEQ ID NO:5 or SEQ ID NO:10, and wherein said
isolated protein elicits an immune response against a protein
consisting of SEQ ID NO:10 or is capable of stimulating TF-1 cell
proliferation.
20. The isolated protein of claim 19, wherein said protein
comprises an at least 60 contiguous amino acid region identical in
sequence to a 60 contiguous amino acid region selected from SEQ ID
NO:5 or SEQ ID NO:10.
21. The isolated protein from claim 19, wherein said protein
comprises an amino acid sequence that is at least 95% identical to
SEQ ID NO:5 or SEQ ID NO:10.
22. An isolated protein of at least 15 amino acids in length,
wherein said 15 amino acids are encoded by a nucleic acid molecule
that has an at least 45 contiguous nucleotide region identical in
sequence to a 45 contiguous nucleotide region of a nucleic acid
sequence selected from the group consisting of SEQ ID NO:4, SEQ ID
NO:7, SEQ ID NO:9 and SEQ ID NO:18, and wherein said isolated
protein elicits an immune response against a protein consisting of
SEQ ID NO:10 or is capable of stimulating TF-1 cell
proliferation.
23. The isolated protein of claim 22, wherein said protein
comprises an at least 60 contiguous amino acid region identical in
sequence to a 60 contiguous amino acid region selected from SEQ ID
NO:5 or SEQ ID NO:10.
24. The isolated protein of claim 22 wherein said protein is
encoded by a nucleic acid molecule at least 95% identical to SEQ ID
NO:4, SEQ ID NO:7 or SEQ ID NO:9.
25. An isolated protein consisting of an amino acid sequence at
least 95% identical to SEQ ID NO:5 or SEQ ID NO:10.
26. A fragment of the isolated protein of claim 25, wherein said
fragment is at least 20 amino acids in length.
27. A fragment of the isolated protein of claim 25, wherein said
fragment is at least 60 amino acids in length.
28. A fragment of the isolated protein of claim 25, wherein said
fragment is at least 100 amino acids in length.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to prior pending U.S. Ser.
No. 09/322,409, entitled "CANINE AND FELINE IMMUNOREGULATORY
PROTEINS, NUCLEIC ACID MOLECULES, AND USES THEREOF", which is
incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to canine interleukin-5
nucleic acid molecules, proteins encoded by such nucleic acid
molecules, antibodies raised against such proteins and/or
inhibitors of such proteins or nucleic acid molecules. The present
invention also includes therapeutic compositions comprising such
nucleic acid molecules, proteins, antibodies and/or inhibitors, as
well as their use to regulate an immune response in an animal.
BACKGROUND OF THE INVENTION
[0003] Regulating immune responses in animals is important in
disease management. Immune responses can be regulated by modifying
the activity of immunoregulatory molecules and immune cells.
[0004] Several immunoregulatory molecules have been found in humans
and other mammal species. Interleukin-4, produced by activated type
2 helper cells (T.sub.H2 cells), has a number of functions. These
functions include promotion of naive T cells and B cells to
differentiate and proliferate. IL-4 promotes T.sub.H2
differentiation and inhibits T.sub.H1 development. FMS-like
tyrosine kinase 3, (Flt-3 ligand) stimulates the expansion and
mobilization of hematopoetic precursor cell stimulating activity.
CD40 is a type I transmembrane protein expressed on antigen
presenting cells, such as B lymphocytes, and other types of cells
such as endothelial cells, epithelial cells, and fibroblasts. CD40
ligand (also known as CD154) is a type II transmembrane protein
that is preferentially expressed on activated T lymphocytes. The
CD40-CD154 interaction regulates diverse pathways of the immune
system, including B cell proliferation, immunoglobulin production
and class switching by B cells, activation and clonal expansion of
T cells, activity of antigen presenting cells, growth and
differentiation of epithelial cells, and regulation of inflammatory
responses at mucosal and cutaneous sites. Interleukin-5 is produced
by activated type 2 helper cells (T.sub.H2), mast cells, and
eosinophils. Its main functions include promotion of growth and
differentiation of eosinophils and generation of cytotoxic T cells
from thymocytes. Interleukin-13 is produced by T.sub.H1 and
T.sub.H2 cells, and promotes growth and differentiation of B cells,
up-regulation of MHC class II and CD23 expression on
monocytes/macrophages and B cells; and inhibition of production of
inflammatory cytokines such as IL-1.alpha., IL-1.beta., IL-6, IL-8,
IL-10, IL-12, among others. Interferon alpha is an antiviral
protein that has three major functions: it inhibits viral
replication by activating cellular genes that destroy mRNA and
inhibit protein translation, it induces MHC class I expression in
non virally-infected cells, increasing resistance to NK cells, and
can activate NK cells. GM-CSF, (granulocyte-macrophage
colony-stimulating factor) stimulates the production of
granulocytes and macrophages.
[0005] Prior investigators have disclosed sequences encoding feline
IL-4 (Lerner et al., Genbank Accession No. 139634); porcine IL-4
(Zhou et al., Genbank Accession No. L12991); bovine IL-4 (Heussler,
V. T., et al., Gene. vol. 114, pp. 273-278, 1992); ovine IL-4
(Seow, H.-F., et al., Gene, vol. 124, pp. 291-293, 1993); human
IL-4 (Yokota, T., et al., Proc. Natl. Acad. Sci. U.S.A., vol.
83(16), pp. 5894-5898, 1986); and murine IL-4 (Sideras, P., et al.,
Adv. Exp. Med. Biol., vol. 213, pp. 227-236, 1987). Prior
investigators have disclosed sequences encoding murine Flt-3 ligand
(McClanahan et al., Genbank Accession No. U44024); and human Flt-3
ligand (Lyman et al., Blood, vol. 83, pp. 2795-2801, 1994). Prior
investigators have disclosed sequences encoding human CD40
(Stamenkovic et al., EMBO J., vol. 8:1403-1410, 1989, GenBank
Accession No. (X60592), bovine CD40 (Hirano et al., Immunology,
vol. 90, pp. 294-300, 1997, GenBank Accession No. U57745), and
murine CD40 (Grimaldi et al., J. Immunol., vol. 143, pp. 3921-3926.
1992; Torres and Clark, J. Immunol., vol. 148, pp. 620-626, 1992,
GenBank Accession No. M83312). Prior investigators have disclosed
sequences encoding human CD154 (Graf et al., Eur. J. Immunol., vol.
22, pp. 3191-3194, 1992; Hollenbaugh, et al., EMBO J., vol.
11:4313-4321, 1992; Gauchat et al. FEBS lett., vol., 315, pp.
259-266, 1993; GenBank Accession Nos L07414, X68550, Z15017,
X67878, respectively); bovine CD154 (Mertens et al.,
Immunogenetics, vol. 42, pp. 430-431, GenBank Accession No.
Z48468); and murine CD154 (Armitage et al., Nature, vol. 357, pp.
80-82; 1992, GenBank Accession No. X65453). Prior investigators
have disclosed sequences encoding feline interleukin-5 (Padrid et
al., Am. J. Vet. Res., vol. 59, pp. 1263-1269, 1998, GenBank
Accession No. AF025436) and human interleukin-5 (Azuma et al.,
Nucleic Acids Res., vol. 14, pp. 9149-9158, 1986, GenBank Accession
No. X04688). Prior investigators have disclosed sequences encoding
human interleukin-13 (McKenzie et al., Proc. Natl. Acad. Sci. USA,
vol. 90, pp. 3735-3739, 1993; Minty et al., Nature, vol. 362, pp.
248-250, 1993, GenBank Accession Nos L06801 and X69079,
respectively); murine interleukin-13 (Brown et al., J. Immunol.,
vol. 142, pp. 679-687, 1989, GenBank Accession No M23504); and rat
interleukin-13 (Lakkis et al., Biochem. Biophys. Res. Commun., Vol.
197, pp. 612-618, 1993, GenBank Accession No. L26913). Prior
investigators have disclosed sequences encoding feline interferon
(Nakamura, N., Sudo, T., Matsuda, S., Yanai, A., Biosci.
Biotechnol. Biochem. (1992) Vol: 56 pp 211-214, GenBank accession #
E02521). Prior investigators have also disclosed sequences encoding
feline GM-CSF (direct submission to GenBank, Accession No.
AF053007)
[0006] There remains a need for compounds and methods to regulate
an immune response by manipulation of the function of canine
interleukin-5.
SUMMARY OF THE INVENTION
[0007] The present invention relates to canine interleukin-5
nucleic acids, proteins encoded by such nucleic acid molecules,
antibodies raised against such proteins and/or inhibitors of such
proteins or nucleic acid molecules. Identification of the nucleic
acid molecules of the present invention is unexpected because
initial attempts to obtain nucleic acid molecules using PCR were
unsuccessful. After numerous attempts, the inventors discovered
specific primers that were useful for isolating such nucleic acid
molecules.
[0008] One embodiment of the invention is an isolated nucleic acid
molecule comprising a nucleic acid sequence selected from the group
consisting of SEQ ID NO:18 and SEQ ID NO:19, and/or a homolog
thereof, wherein said homolog has an at least 45 contiguous
nucleotide region identical in sequence to a 45 contiguous
nucleotide region of a nucleic acid molecule having a nucleic acid
sequence selected from the group consisting of SEQ ID NO:18 and SEQ
ID NO:19.
[0009] A second embodiment of the present invention is a nucleic
acid molecule having a nucleic acid sequence that is at least about
90 percent identical to a nucleic acid sequence selected from the
group consisting of SEQ ID NO:18 and SEQ ID NO:19.
[0010] The present invention also includes methods to produce any
of the proteins of the present invention using nucleic acid
molecules of the present invention and recombinantly using such
nucleic acid molecules.
[0011] One aspect of the present invention is a therapeutic
composition that, when administered to an animal, regulates an
immune response in said animal, said therapeutic composition
comprising a therapeutic compound selected from the group
consisting of: an immunoregulatory protein of the present
invention; a mimetope of any of said immunoregulatory proteins; and
a multimeric form of any of said immunoregulatory proteins; an
isolated nucleic acid molecule of the present invention; an
antibody that selectively binds to any of said immunoregulatory
proteins; and/or an inhibitor of a immunoregulatory protein
activity identified by its ability to inhibit the activity of any
of said immunoregulatory proteins. Yet another aspect of the
present invention is a method to regulate an immune response in an
animal comprising administering to the animal a therapeutic
composition of the present invention.
[0012] The present invention also includes a method to produce an
immunoregulatory protein, said method comprising culturing a cell
capable of expressing said protein, said protein being encoded by a
nucleic acid molecule of the present invention.
[0013] One embodiment of the present invention is a method to
identify a compound capable of regulating an immune response in an
animal, said method comprising: contacting an isolated canine IL-5
protein of the present invention with a putative inhibitory
compound under conditions in which, in the absence of said
compound, said protein has TF-1 cell proliferation activity; and
determining if said putative inhibitory compound inhibits said
activity.
DETAILED DESCRIPTION OF THE INVENTION
[0014] The present invention provides for isolated canine
interleukin-5 proteins, isolated canine interleukin-5 nucleic acid
molecules, antibodies directed against canine interleukin-5
protein, and compounds derived therefrom that regulate the immune
response of an animal (e.g. inhibitors, antibodies and
peptides).
[0015] Canine IL-5 can refer to canine IL-5, including homologs
thereof. As used herein, the phrase "regulate an immune response"
refers to modulating the activity of cells or molecules involved in
an immune response. The term "regulate" can refer to increasing or
decreasing an immune response. Regulation of an immune response can
be determined using methods known in the art as well as methods
disclosed herein. The term, "immunoregulatory protein" refers to a
protein that can modulate the activity of cells or of molecules
involved in an immune response. An immunoregulatory protein of the
present invention refers to a canine IL-5 protein as described
herein. As used herein, the terms isolated canine interleukin-5
nucleic acid molecules refer to canine interleukin-5 nucleic acid
molecules derived from mammals and, as such, can be obtained from
their natural source, or can be produced using, for example,
recombinant nucleic acid technology or chemical synthesis. Also
included in the present invention is the use of these proteins,
nucleic acid molecules, antibodies, and/or compounds derived
therefrom as therapeutic compositions to regulate the immune
response of an animal as well as in other applications, such as
those disclosed below.
[0016] One embodiment of the present invention is an isolated
protein that includes a canine interleukin-5 protein. It is to be
noted that the term "a" or "an" entity refers to one or more of
that entity; for example, a protein refers to one or more proteins
or at least one protein. As such, the terms "a" (or "an"), "one or
more" and "at least one" can be used interchangeably herein. It is
also to be noted that the terms "comprising", "including", and
"having" can be used interchangeably. According to the present
invention, an isolated, or biologically pure, protein, is a protein
that has been removed from its natural milieu. As such, "isolated"
and/or "biologically pure" do not necessarily reflect the extent to
which the protein has been purified. An isolated protein of the
present invention can be obtained from its natural source, can be
produced using recombinant DNA technology, or can be produced by
chemical synthesis. Nucleic acid molecules of the present invention
of known length isolated from Canis familiaris are denoted as
follows: IL-5 is denoted as nCaIL-5.sub.x, for example,
nCaIL-5.sub.610, wherein "#" refers to the number of nucleotides in
that molecule. Similarly, proteins of the present invention of
known length isolated from Canis familiaris are denoted
PCaIL-5.sub.x.
[0017] As used herein, an isolated canine interleukin-5 protein of
the present invention can be a full-length protein or any homolog
of such a protein. An isolated IL-5 protein of the present
invention, including a homolog, can be identified in a
straight-forward manner by the protein's ability to elicit an
immune response to an IL-5 protein, bind to an IL-5 receptor,
and/or stimulate eosinophils and/or cause thymocytes to produce
cytotoxic T cells.
[0018] Examples of protein homologs of the present invention
include immunoregulatory proteins of the present invention in which
amino acids have been deleted (e.g., a truncated version of the
protein, such as a peptide), inserted, inverted, substituted and/or
derivatized (e.g., by glycosylation, phosphorylation, acetylation,
myristoylation, prenylation, palmitoylation, amidation and/or
addition of glycerophosphatidyl inositol) such that the protein
homolog includes at least one epitope capable of eliciting an
immune response against the parent protein, of binding to an
antibody directed against the parent protein and/or of binding to
the parent's receptor, where the term parent refers to the longer
and/or full-length protein that the homolog is derived from. That
is, when the homolog is administered to an animal as an immunogen,
using techniques known to those skilled in the art, the animal will
produce an immune response against at least one epitope of an
immunoregulatory protein of the present invention, depending upon
which protein is administered to an animal. The ability of a
protein to effect an immune response can be measured using
techniques known to those skilled in the art. As used herein, the
term "epitope" refers to the smallest portion of a protein capable
of selectively binding to the antigen binding site of an antibody.
It is well accepted by those skilled in the art that the minimal
size of a protein epitope capable of selectively binding to the
antigen binding site of an antibody is about five or six to seven
amino acids.
[0019] Homologs of immunoregulatory proteins of the present
invention can be the result of natural allelic variation, including
natural mutation. Protein homologs of the present invention can
also be produced using techniques known in the art including, but
not limited to, direct modifications to the protein and/or
modifications to the gene encoding the protein using, for example,
classic or recombinant DNA techniques to effect random or targeted
mutagenesis.
[0020] Immunoregulatory proteins of the present invention include
variants of a full-length protein of the present invention. Such
variants include proteins that are less than full-length. As used
herein, variants of the present invention refer to nucleic acid
molecules that are naturally-occurring as defined below, and may
result from alternative RNA splicing, alternative termination of an
amino acid sequence or DNA recombination. Examples of variants
include allelic variants as defined below. It is to be noted that a
variant is an example of a homolog of the present invention.
[0021] Immunoregulatory proteins of the present invention are
encoded by nucleic acid molecules of the present invention. As used
herein, an IL-5 nucleic acid molecule includes nucleic acid
sequences related to a natural IL-5 gene. As used herein, a canine
IL-5 gene refers to the natural genomic elements that encode a
canine IL-5 protein, and includes all regions such as regulatory
regions that control production of the protein encoded by the gene
(such as, but not limited to, transcription, translation or
post-translation control regions) as well as the coding region
itself and any introns or non-translated coding regions. As used
herein, a gene that "includes" or "comprises" a sequence may
include that sequence in one contiguous array, or may include the
sequence as fragmented exons. As used herein, the term "coding
region" refers to a continuous linear array of nucleotides that
translates into a protein. A full-length coding region is that
region that is translated into a full-length, i.e., a complete,
protein as would be initially translated in its natural milieu,
prior to any post-translational modifications.
[0022] In another embodiment, an IL-5 gene of the present invention
includes the nucleic acid sequence SEQ ID NO:18, as well as the
complement represented by SEQ ID NO:19.
[0023] Additional immunoregulatory nucleic acid molecules and
proteins of the present invention having specific sequence
identifiers are described in Table 1.
TABLE-US-00001 TABLE 1 Sequence identification numbers (SEQ ID NOs)
and their corresponding nucleic acid molecules or proteins. SEQ ID
Nos DESCRIPTION 1 primer (m) ATGCACTTT . . . 2 primer (n) CTGGAGGAA
. . . 3 primer (o) GTGACYCTT 4 nCaIL-5.sub.610 CDS 29-430 5
PCaIL-5.sub.134 6 reverse complement for nCaIL-5.sub.610 7
nCaIL-5.sub.402 (coding for PCaIL-5.sub.134) 8 reverse complement
of nIL-5.sub.402 9 nCaIL-5.sub.345 (mature sequence) CDS 1-345 10
PCaIL-5.sub.115 (mature protein) 11 reverse complement of
nCaIL-5.sub.345 12 primer (p) GGGCTCGAG . . . 13 primer (q)
CCCGCGGCC 14 5' AGGCAAACACTGAACATTTC3' 15 5'TCTCCAAAATCTTCCACTAC3'
16 5'TCAAGGGAGGCTATAAATTC3' 17 5'TTATAGTCAAGGGCATATCC3' 18
nCAIL-5.sub.1658 19 reverse complement of SEQ ID NO:18 20
N-terminal amino acid sequence 21 partially processed
transcript
[0024] In another embodiment, an IL-5 gene or nucleic acid molecule
can be an allelic variant that includes a similar but not identical
sequence to SEQ ID NO:18 and SEQ ID NO:19, and/or any other IL-5
nucleic acid sequence cited herein.
[0025] An allelic variant of a canine interleukin-5, including the
particular SEQ ID NO's cited herein, is a gene that occurs at
essentially the same locus (or loci) in the genome as the gene
including the particular SEQ ID NO's cited herein, but which, due
to natural variations caused by, for example, mutation or
recombination, has a similar but not identical sequence. Also
included in the term allelic variant are allelic variants of cDNAs
derived from such genes. Because natural selection typically
selects against alterations that affect function, allelic variants
usually encode proteins having similar activity to that of the
protein encoded by the gene to which they are being compared.
Allelic variants of genes or nucleic acid molecules can also
comprise alterations in the 5' or 3' untranslated regions of the
gene (e.g., in regulatory control regions), or can involve
alternative splicing of a nascent transcript, thereby bringing
alternative exons into juxtaposition. Allelic variants are well
known to those skilled in the art and would be expected to be found
within a given animal, since the respective genomes are diploid,
and sexual reproduction will result in the reassortment of
alleles.
[0026] The minimal size of an canine interleukin-5 protein homolog
of the present invention is a size sufficient to be encoded by a
nucleic acid molecule capable of forming a stable hybrid (i.e.,
hybridize under stringent hybridization conditions) with the
complementary sequence of a nucleic acid molecule encoding the
corresponding natural protein. Stringent hybridization conditions
are determined based on defined physical properties of the gene to
which the nucleic acid molecule is being hybridized, and can be
defined mathematically. Stringent hybridization conditions are
those experimental parameters that allow an individual skilled in
the art to identify significant similarities between heterologous
nucleic acid molecules. These conditions are well known to those
skilled in the art. See, for example, Sambrook, et al., 1989,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs
Press, and Meinkoth, et al., 1984, Anal. Biochem. 138, 267-284,
each of which is incorporated herein by this reference. As
explained in detail in the cited references, the determination of
hybridization conditions involves the manipulation of a set of
variables including the ionic strength (M, in moles/liter), the
hybridization temperature (.degree. C.), the concentration of
nucleic acid helix destabilizing agents, such as formamide, the
average length of the shortest hybrid duplex (n), and the percent
G+C composition of the fragment to which an unknown nucleic acid
molecule is being hybridized. For nucleic acid molecules of at
least about 150 nucleotides, these variables are inserted into a
standard mathematical formula to calculate the melting temperature,
or T.sub.m, of a given nucleic acid molecule. As defined in the
formula below, T.sub.m is the temperature at which two
complementary nucleic acid molecule strands will disassociate,
assuming 100% complementarity between the two strands:
T.sub.m=81.5.degree. C.+16.6 log M+0.41(% G+C)-500/n-0.61(%
formamide).
For nucleic acid molecules smaller than about 50 nucleotides,
hybrid stability is defined by the dissociation temperature
(T.sub.d), which is defined as the temperature at which 50% of the
duplexes dissociate. For these smaller molecules, the stability at
a standard ionic strength is defined by the following equation:
T.sub.d=4(G+C)+2(A+T).
A temperature of 5.degree. C. below T.sub.d is used to detect
hybridization between perfectly matched molecules.
[0027] Also well known to those skilled in the art is how base pair
mismatch, i.e. differences between two nucleic acid molecules being
compared, including non-complementarity of bases at a given
location, and gaps due to insertion or deletion of one or more
bases at a given location on either of the nucleic acid molecules
being compared, will affect T.sub.m or T.sub.d for nucleic acid
molecules of different sizes. For example, T.sub.m decreases about
1.degree. C. for each 1% of mismatched base pairs for hybrids
greater than about 150 bp, and T.sub.d decreases about 5.degree. C.
for each mismatched base pair for hybrids below about 50 bp.
Conditions for hybrids between about 50 and about 150 base pairs
can be determined empirically and without undue experimentation
using standard laboratory procedures well known to those skilled in
the art. These simple procedures allow one skilled in the art to
set the hybridization conditions, by altering, for example, the
salt concentration, the formamide concentration or the temperature,
so that only nucleic acid hybrids with greater than a specified %
base pair mismatch will hybridize. Stringent hybridization
conditions are commonly understood by those skilled in the art to
be those experimental conditions that will allow about 30% base
pair mismatch, i.e., about 70% identity. Because one skilled in the
art can easily determine whether a given nucleic acid molecule to
be tested is less than or greater than about 50 nucleotides, and
can therefore choose the appropriate formula for determining
hybridization conditions, he or she can determine whether the
nucleic acid molecule will hybridize with a given gene or specified
nucleic acid molecule under stringent hybridization conditions and
similarly whether the nucleic acid molecule will hybridize under
conditions designed to allow a desired amount of base pair
mismatch.
[0028] Hybridization reactions are often carried out by attaching
the nucleic acid molecule to be hybridized to a solid support such
as a membrane, and then hybridizing with a labeled nucleic acid
molecule, typically referred to as a probe, suspended in a
hybridization solution. Examples of common hybridization reaction
techniques include, but are not limited to, the well-known Southern
and northern blotting procedures. Typically, the actual
hybridization reaction is done under non-stringent conditions,
i.e., at a lower temperature and/or a higher salt concentration,
and then high stringency is achieved by washing the membrane in a
solution with a higher temperature and/or lower salt concentration
in order to achieve the desired stringency.
[0029] Preferred portions, or fragments, of a canine interleukin-5
protein of the present invention include at least 15 amino acids,
at least 20 amino acids, at least 25 amino acids, at least 30 amino
acids, at least 35 amino acids, at least 40 amino acids, at least
45 amino acids, at least 50 amino acids, at least 60 amino acids,
at least 75 amino acids or at least 100 amino acids. An IL-5
protein of the present invention can include at least a portion of
an IL-5 protein that is capable of binding to an IL-5 receptor.
IL-5 receptors are known to those of skill in the art, and are
described in Janeway et al., in Immunobiology, the Immune System in
Health and Disease, Garland Publishing, Inc., NY, 1996 (which is
incorporated herein by this reference in its entirety). The IL-5
receptor-binding portion of an IL-5 protein, can be determined by
incubating the protein with an isolated IL-5 receptor, or a cell
having an IL-5 receptor on its surface. IL-5 protein binding to
purified IL-5 receptor, can be determined using methods known in
the art including Biacore.RTM. screening, confocal
immunofluorescent microscopy, immunoprecipitation, gel
chromatography, determination of inhibition of binding of
antibodies that bind specifically to the IL-5 binding domain of an
IL-5 receptor, ELISA using an IL-5 receptor, labeled with a
detectable tag such as an enzyme or chemiluminescent tag or yeast-2
hybrid technology.
[0030] The present invention also includes mimetopes of canine
interleukin-5 proteins of the present invention. As used herein, a
mimetope of an immunoregulatory protein of the present invention
refers to any compound that is able to mimic the activity of such a
canine interleukin-5 protein, often because the mimetope has a
structure that mimics the particular protein. Mimetopes can be, but
are not limited to: peptides that have been modified to decrease
their susceptibility to degradation such as all-D retro peptides;
anti-idiotypic and/or catalytic antibodies, or fragments thereof;
non-proteinaceous immunogenic portions of an isolated protein
(e.g., carbohydrate structures); and/or synthetic or natural
organic molecules, including nucleic acids. Such mimetopes can be
designed using computer-generated structures of proteins of the
present invention. Mimetopes can also be obtained by generating
random samples of molecules, such as oligonucleotides, peptides or
other organic molecules, and screening such samples by affinity
chromatography techniques using the corresponding binding
partner.
[0031] One embodiment of an immunoregulatory protein of the present
invention is a fusion protein that includes a canine interleukin-5
protein-containing domain, attached to one or more fusion segments.
Suitable fusion segments for use with the present invention
include, but are not limited to, segments that can: link two or
more immunoregulatory proteins of the present invention, to form
multimeric forms of an immunoregulatory protein of the present
invention; enhance a protein's stability; act as an
immunopotentiator to enhance an immune response against an canine
interleukin-5 protein; and/or assist in purification of a canine
interleukin-5 protein (e.g., by affinity chromatography). A
suitable fusion segment can be a domain of any size that has the
desired function (e.g., imparts increased stability, imparts
increased immunogenicity to a protein, and/or simplifies
purification of a protein). Fusion segments can be joined to amino
and/or carboxyl termini of the IL-5-containing domain of a protein
and can be susceptible to cleavage in order to enable
straight-forward recovery of either canine interleukin-5 protein.
Fusion proteins are preferably produced by culturing a recombinant
cell transformed with a fusion nucleic acid molecule that encodes a
protein including the fusion segment attached to either the
carboxyl and/or amino terminal end of a canine
interleukin-5-containing domain. Preferred fusion segments include
a metal binding domain (e.g., a poly-histidine segment); an
immunoglobulin binding domain (e.g., Protein A; Protein G; T cell;
B cell; Fc receptor or complement protein antibody-binding
domains); a sugar binding domain (e.g., a maltose binding domain);
and/or a "tag" domain (e.g., at least a portion of -galactosidase,
a strep tag peptide, a T7 tag peptide, a Flag.TM. peptide, or other
domains that can be purified using compounds that bind to the
domain, such as monoclonal antibodies). More preferred fusion
segments include metal binding domains, such as a poly-histidine
segment; a maltose binding domain; a strep tag peptide, such as
that available from Biometra in Tampa, Fla.; and an S10
peptide.
[0032] A suitable fusion segment that links one IL-5 protein to
another IL-5 protein, and includes any amino acid sequence that
enables such proteins to be linked while maintaining the biological
function of the canine interleukin-5 protein. Selection of a
suitable linker is dependent upon how many proteins are to be
linked to form one multimeric molecule, and from where on either
the canine interleukin-5 molecule the linker extends. Preferably, a
linker fusion segment of the present invention comprises a peptide
of from about 6 amino acid residues to about 40 residues, more
preferably from about 6 residues to about 30 residues in
length.
[0033] In another embodiment, an canine interleukin-5 protein of
the present invention also includes at least one additional protein
segment that is capable of targeting canine interleukin-5 protein,
to a desired cell or receptive molecule. Such a multivalent
targeting protein can be produced by culturing a cell transformed
with a nucleic acid molecule comprising two or more nucleic acid
domains joined together in such a manner that the resulting nucleic
acid molecule is expressed as a multivalent targeting protein
containing a canine interleukin-5 protein or portion thereof and/or
at least one targeting compound capable of delivering the canine
interleukin-5 protein to a desired site in an animal.
[0034] Examples of multivalent targeting proteins include, but are
not limited to, a canine interleukin-5 protein of the present
invention attached to one or more compounds that can bind to a
receptive molecule on the surface of a cell located in an area of
an animal where regulation of an immune response is desired. One of
skill in the art can select appropriate targeting fusion segments
depending upon the cell or receptive molecule being targeted.
[0035] Another example of a multivalent protein of the present
invention includes, but is not limited to, a canine interleukin-5
protein of the present invention attached to one or more proteins
that are potentially antigenic in mammals. Thus, immunogenicity of
the potentially antigenic protein could be enhanced by
administering to a mammal together with an immunoregulatory protein
of the present invention.
[0036] A naturally-occurring variant of a canine interleukin-5
protein of the present invention is preferably isolated from
(including isolation of the natural protein or production of the
protein by recombinant or synthetic techniques) from mammals,
including but not limited to dogs (i.e., canids), cats (i.e.,
felids), horses (i.e., equids), humans, cattle, chinchillas,
ferrets, goats, mice, minks, rabbits, raccoons, rats, sheep,
squirrels, swine, chickens, ostriches, quail and/or turkeys as well
as other furry animals, pets, zoo animals, work animals and/or food
animals. Particularly preferred animals from which to isolate
canine interleukin-5 proteins are dogs, cats, horses and/or
humans.
[0037] A preferred isolated protein of the present invention is an
isolated protein that is encoded by a nucleic acid molecule the
having nucleic acid sequence SEQ ID NO:18 and SEQ ID NO:19, and/or
an allelic variant of such a nucleic acid molecule.
[0038] Translation of SEQ ID NO:4, the coding strand for
nCaIL-5.sub.610, yields a protein of about 134 amino acids, denoted
herein as PCaIL-5.sub.134, the amino acid sequence of which is
presented in SEQ ID NO:5, assuming an open reading frame having an
initiation codon spanning from nucleotide 29 through nucleotide 31
of SEQ ID NO:4, and a stop codon spanning from nucleotide 431
through nucleotide 433 of SEQ ID NO:4.
[0039] Preferred IL-5 proteins of the present invention includes
proteins that are at least about 85% identical, even more
preferably at least about 90%, and even more preferably at least
about 95% identical to PCaIL-5.sub.134, PCaIL-5.sub.115 and/or
fragments thereof.
[0040] More preferred are IL-5 proteins comprising PCaIL-5.sub.134,
PCaIL-5.sub.115 and/or proteins encoded by allelic variants of a
nucleic acid molecule encoding one of the proteins PCaIL-5.sub.134
and/or PCaIL-5.sub.115.
[0041] Preferred IL-5 proteins of the present invention includes
proteins that are at least about 85% identical, even more
preferably at least about 90%, and even more preferably at least
about 95% identical to SEQ ID NO:5, SEQ ID NO:10 and/or fragments
thereof.
[0042] More preferred are IL-5 proteins comprising SEQ ID NO:5, SEQ
ID NO:10 and/or proteins encoded by allelic variants of a nucleic
acid molecule encoding one of the proteins SEQ ID NO:5, and/or SEQ
ID NO:10.
[0043] Percent identities between amino acid or nucleic acid
sequences can be determined using standard methods known to those
of skill in the art. It is known in the art that methods to
determine the percentage identity and the number of gaps are
substantially similar when different methods for determining
sequence similarity are used and when the degree of similarity is
greater than 30% amino acid identity, as described by Johnson et
al., J. Mol. Biol., vol. 233, pages 716-738, 1993, and Feng et al.,
J. Mol. Evol., vol. 21, pages 112-125, 1985, which are incorporated
by reference herein in their entirety. Preferred methods to
determine percentage identities between amino acid sequences and
between nucleic acid sequences include comparisons using various
computer programs such as GCG.TM. program (available from Genetics
Computer Group, Madison, Wis.), DNAsis.TM. program (available from
Hitachi Software, San Bruno, Calif.) or the MacVector.TM. program
(available from the Eastman Kodak Company, New Haven, Conn.).
Preferred settings for sequence comparisons using the DNAsis.TM.
computer program or the GAP GCG.TM. program are disclosed herein in
the Examples section.
[0044] Additional preferred IL-5 proteins of the present invention
include proteins encoded by nucleic acid molecules encoding at
least a portion of nCaIL-5.sub.610, nCaIL-5.sub.402,
nCaIL-5.sub.345 and/or nCaIL-5.sub.1658 as well as IL-5 proteins
encoded by allelic variants of such nucleic acid molecules.
[0045] Also preferred are IL-5 proteins encoded by nucleic acid
molecules having nucleic acid sequences comprising at least a
portion of SEQ ID NO:4, SEQ ID NO:7, and/or SEQ ID NO:9, as well as
allelic variants of these nucleic acid molecules.
[0046] Another embodiment of the present invention is a canine
interleukin-5 nucleic acid molecule that includes one or more
regulatory regions, full-length or partial coding regions, or
combinations thereof. The minimal size of a nucleic acid molecule
of the present invention is a size sufficient to allow the
formation of a stable hybrid (i.e., hybridization under stringent
hybridization conditions) with the complementary sequence of
another nucleic acid molecule. As such, the minimal size of a
canine interleukin-5 nucleic acid molecule of the present invention
is from about 12 to about 18 nucleotides in length.
[0047] In accordance with the present invention, an isolated
nucleic acid molecule is a nucleic acid molecule that has been
removed from its natural milieu (i.e., that has been subjected to
human manipulation) and can include DNA, RNA, or derivatives of
either DNA or RNA. As such, "isolated" does not reflect the extent
to which the nucleic acid molecule has been purified. An isolated
canine interleukin-5 nucleic acid molecule of the present invention
can be isolated from its natural source or produced using
recombinant DNA technology (e.g., polymerase chain reaction (PCR)
amplification or cloning) or chemical synthesis. Isolated canine
interleukin-5 nucleic acid molecules can include, for example,
natural allelic variants and/or nucleic acid molecules modified by
nucleotide insertions, deletions, substitutions, and/or inversions
in a manner such that the modifications do not substantially
interfere with the nucleic acid molecule's ability to encode an
canine interleukin-5 protein of the present invention.
[0048] A canine interleukin-5 ligand nucleic acid molecule homolog
can be produced using a number of methods known to those skilled in
the art, see, for example, Sambrook et al., 1989, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press;
Sambrook et al., ibid., is incorporated by reference herein in its
entirety. For example, nucleic acid molecules can be modified using
a variety of techniques including, but not limited to, classic
mutagenesis and recombinant DNA techniques such as site-directed
mutagenesis, chemical treatment, restriction enzyme cleavage,
ligation of nucleic acid fragments, PCR amplification, synthesis of
oligonucleotide mixtures and ligation of mixture groups to "build"
a mixture of nucleic acid molecules, and combinations thereof,
Nucleic acid molecule homologs can be selected by hybridization
with a canine interleukin-5 nucleic acid molecule or by screening
the function of a protein encoded by the nucleic acid molecule
(e.g., ability to elicit an immune response against at least one
epitope of a canine interleukin-5 protein).
[0049] An isolated nucleic acid molecule of the present invention
can include a nucleic acid sequence that encodes at least one
canine interleukin-5 protein of the present invention, examples of
such proteins being disclosed herein. Although the phrase "nucleic
acid molecule" primarily refers to the physical nucleic acid
molecule and the phrase "nucleic acid sequence" primarily refers to
the sequence of nucleotides on the nucleic acid molecule, the two
phrases can be used interchangeably, especially with respect to a
nucleic acid molecule, or a nucleic acid sequence, being capable of
encoding a canine interleukin-5 protein.
[0050] A preferred nucleic acid molecule of the present invention,
when administered to an animal, is capable of regulating an immune
response in an animal. As will be disclosed in more detail below,
such a nucleic acid molecule can be, or encode, an antisense RNA, a
molecule capable of triple helix formation, a ribozyme, or other
nucleic acid-based drug compound. In additional embodiments, a
nucleic acid molecule of the present invention can encode an
immunoregulatory protein (e.g., a cell-bound or soluble protein of
the present invention), the nucleic acid molecule being delivered
to the animal, for example, by direct injection (i.e, as a genetic
vaccine) or in a vehicle such as a recombinant virus vaccine or a
recombinant cell vaccine.
[0051] One embodiment of the present invention is an IL-5 nucleic
acid molecule comprising all or part of nucleic acid molecules
nCaIL-5.sub.610, nCaIL-5.sub.402, nCaIL-5.sub.345, and/or
nCaIL-5.sub.1658 and/or allelic variants of these nucleic acid
molecules. Another preferred nucleic acid molecule of the present
invention includes at least a portion of (i.e., a fragment of the
nucleic acid molecule) nucleic acid sequence SEQ ID NO:4, SEQ ID
NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID
NO: 18 and SEQ ID NO:19, as well as allelic variants of nucleic
acid molecules having these nucleic acid sequences. Such nucleic
acid molecules can include nucleotides in addition to those
included in the SEQ ID NOs, such as, but not limited to, a
full-length gene, a full-length coding region, a nucleic acid
molecule encoding a fusion protein, and/or a nucleic acid molecule
encoding a multivalent therapeutic compound.
[0052] One embodiment of an isolated nucleic acid molecule of the
present invention is a nucleic acid molecule that can be any of the
following: an isolated nucleic acid molecule comprising a nucleic
acid sequence selected from the group consisting of SEQ ID NO:4,
SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11,
SEQ ID NO:18 and/or SEQ ID NO:19, and/or a homolog thereof, wherein
said homolog has an at least 45 contiguous nucleotide region
identical in sequence to a 45 contiguous nucleotide region of a
nucleic acid molecule having a nucleic acid sequence selected from
the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ
ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:18, and/or SEQ ID
NO:19. The phrase, a homolog having an at least "x" contiguous
nucleotide region identical in sequence to an "x" contiguous
nucleotide region of a nucleic acid molecule selected from the
group consisting of SEQ ID NO:"y", refers to an "x"-nucleotide in
length nucleic acid molecule that is identical in sequence to an
"x"-nucleotide portion of SEQ ID NO:"y", as well as to nucleic acid
molecules that are longer in length than "x". The additional length
may be in the form of nucleotides that extend from either the 5' or
the 3' end(s) of the contiguous identical "x"-nucleotide portion.
The 5' and/or 3' extensions can include one or more extensions that
have no identity to an immunoregulatory molecule of the present
invention, as well as extensions that show similarity or identity
to cited nucleic acids sequences or portions thereof.
[0053] In another embodiment, an isolated nucleic acid molecule of
the present invention can be any of the following: a nucleic acid
molecule having a nucleic acid sequence encoding an IL-5 protein
selected from the group consisting of (i) a protein having an amino
acid sequence that is at least about 85 percent identical to an
amino acid sequence selected from the group consisting of SEQ ID
NO:5 and/or SEQ ID NO:10 and/or (ii) a protein comprising a
fragment of at least 20 amino acids of an amino acid sequence
selected from the group consisting of SEQ ID NO:5 and/or SEQ ID
NO:10, wherein said IL-5 protein elicits an immune response against
a IL-5 protein selected from the group consisting of SEQ ID NO:5
and/or SEQ ID NO:10 and/or is a protein with IL-5 activity.
[0054] In one embodiment, an IL-5 nucleic acid molecule of the
present invention encodes a protein that is at least about 85%,
more preferably at least about 90%, and even more preferably at
least about 95% identical to PCaIL-5.sub.134, and/or
PCaIL-5.sub.115.
[0055] In another embodiment, an IL-5 nucleic acid molecule of the
present invention encodes a protein having an amino acid sequence
that is at least about at least about 85%, at least about 85%, more
preferably at least about 90%, and even more preferably at least
about 95% identical to SEQ ID NO:5 and/or SEQ ID NO:10. The present
invention also includes an IL-5 nucleic acid molecule encoding a
protein having at least a portion of SEQ ID NO:5 and/or SEQ ID
NO:10, as well as allelic variants of an IL-5 nucleic acid molecule
encoding a protein having these sequences, including nucleic acid
molecules that have been modified to accommodate codon usage
properties of the cells in which such nucleic acid molecules are to
be expressed.
[0056] In one embodiment, an IL-5 nucleic acid molecule of the
present invention is at least about 90% and preferably at least
about 95% identical to nCaIL-5.sub.610, nCaIL-5.sub.402,
nCaIL-5.sub.345, and nCaIL-5.sub.1658 and/or an allelic variant of
such a nucleic acid molecule.
[0057] In one embodiment, an IL-5 nucleic acid molecule of the
present invention comprises a nucleic acid sequence that is at
least about 90% and preferably at least about 95% identical to SEQ
ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID
NO:11, SEQ ID NO:18 and/or SEQ ID NO:19. The present invention also
includes an IL-5 nucleic acid molecule comprising at least a
portion of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ
ID NO:9, SEQ ID NO:11, SEQ ID NO:18 and/or SEQ ID NO:19, as well as
allelic variants of such IL-5 nucleic acid molecules, including
nucleic acid molecules that have been modified to accommodate codon
usage properties of the cells in which such nucleic acid molecules
are to be expressed.
[0058] Knowing the nucleic acid sequences of certain
immunoregulatory nucleic acid molecules of the present invention
allows one skilled in the art to, for example, (a) make copies of
those nucleic acid molecules, (b) obtain nucleic acid molecules
including at least a portion of such nucleic acid molecules (e.g.,
nucleic acid molecules including full-length genes, full-length
coding regions, regulatory control sequences, truncated coding
regions), and/or (c) obtain other immunoregulatory nucleic acid
molecules. Such nucleic acid molecules can be obtained in a variety
of ways including screening appropriate expression libraries with
antibodies of the present invention; traditional cloning techniques
using oligonucleotide probes of the present invention to screen
appropriate libraries; and PCR amplification of appropriate
libraries or DNA using oligonucleotide primers of the present
invention. Preferred libraries to screen or from which to amplify
nucleic acid molecules include mammalian cDNA libraries as well as
genomic DNA libraries. Similarly, preferred DNA sources from which
to amplify nucleic acid molecules include mammalian cDNA and
genomic DNA. Techniques to clone and amplify genes are disclosed,
for example, in Sambrook et al., ibid.
[0059] The present invention also includes nucleic acid molecules
that are oligonucleotides capable of hybridizing, under stringent
hybridization conditions, with complementary regions of other,
preferably longer, nucleic acid molecules of the present invention
such as those comprising canine interleukin-5 nucleic acid
molecules. Oligonucleotides of the present invention can be RNA,
DNA, or derivatives of either. The minimum size of such
oligonucleotides is the size required for formation of a stable
hybrid between an oligonucleotide and a complementary sequence on a
nucleic acid molecule of the present invention. A preferred
oligonucleotide of the present invention has a maximum size of
about 100 nucleotides. The present invention includes
oligonucleotides that can be used as, for example, probes to
identify nucleic acid molecules, primers to produce nucleic acid
molecules, or therapeutic reagents to inhibit canine interleukin-5
protein production or activity (e.g., as antisense-, triplex
formation-, ribozyme- and/or RNA drug-based reagents). The present
invention also includes the use of such oligonucleotides to protect
animals from disease using one or more of such technologies.
Appropriate oligonucleotide-containing therapeutic compositions can
be administered to an animal using techniques known to those
skilled in the art.
[0060] One embodiment of the present invention includes a
recombinant vector, which includes at least one isolated nucleic
acid molecule of the present invention, inserted into any vector
capable of delivering the nucleic acid molecule into a host cell.
Such a vector contains heterologous nucleic acid sequences, that is
nucleic acid sequences that are not naturally found adjacent to
nucleic acid molecules of the present invention and that preferably
are derived from a species other than the species from which the
nucleic acid molecule(s) are derived. The vector can be either RNA
or DNA, either prokaryotic or eukaryotic, and typically is a virus
or a plasmid. Recombinant vectors can be used in the cloning,
sequencing, and/or otherwise manipulating immunoregulatory nucleic
acid molecules of the present invention.
[0061] One type of recombinant vector, referred to herein as a
recombinant molecule, comprises a nucleic acid molecule of the
present invention operatively linked to an expression vector. The
phrase operatively linked refers to insertion of a nucleic acid
molecule into an expression vector in a manner such that the
molecule is able to be expressed when transformed into a host cell.
As used herein, an expression vector is a DNA or RNA vector that is
capable of transforming a host cell and of effecting expression of
a specified nucleic acid molecule. Preferably, the expression
vector is also capable of replicating within the host cell.
Expression vectors can be either prokaryotic or eukaryotic, and are
typically viruses or plasmids. Expression vectors of the present
invention include any vectors that function (i.e., direct gene
expression) in recombinant cells of the present invention,
including in bacterial, fungal, parasite, insect, other animal, and
plant cells. Preferred expression vectors of the present invention
can direct gene expression in bacterial, yeast, insect and
mammalian cells, and more preferably in the cell types disclosed
herein, more preferably in vivo.
[0062] In particular, expression vectors of the present invention
contain regulatory sequences such as transcription control
sequences, translation control sequences, origins of replication,
and other regulatory sequences that are compatible with the
recombinant cell and that control the expression of nucleic acid
molecules of the present invention. In particular, recombinant
molecules of the present invention include transcription control
sequences. Transcription control sequences are sequences which
control the initiation, elongation, and termination of
transcription. Particularly important transcription control
sequences are those which control transcription initiation, such as
promoter, enhancer, operator and repressor sequences. Suitable
transcription control sequences include any transcription control
sequence that can function in at least one of the recombinant cells
of the present invention. A variety of such transcription control
sequences are known to those skilled in the art. Preferred
transcription control sequences include those which function in
bacterial, yeast, helminth and/or other endoparasite, insect and
mammalian cells, such as, but not limited to, tac, lac, trp, trc,
oxy-pro, omp/lpp, rrnB, bacteriophage lambda (such as lambda
p.sub.L and lambda p.sub.R and fusions that include such
promoters), bacteriophage T7, T7lac, bacteriophage T3,
bacteriophage SP6, bacteriophage SP01, metallothionein,
alpha-mating factor, Pichia alcohol oxidase, alphavirus subgenomic
promoter, antibiotic resistance gene, baculovirus, Heliothis zea
insect virus, vaccinia virus, herpesvirus, raccoon poxvirus, other
poxvirus, adenovirus, cytomegalovirus (such as immediate early
promoter), simian virus 40, retrovirus, actin, retroviral long
terminal repeat, Rous sarcoma virus, heat shock, phosphate and
nitrate transcription control sequences as well as other sequences
capable of controlling gene expression in prokaryotic or eukaryotic
cells. Additional suitable transcription control sequences include
tissue-specific promoters and enhancers as well as
lymphokine-inducible promoters (e.g., promoters inducible by
interferons or interleukins). Transcription control sequences of
the present invention can also include naturally occurring
transcription control sequences naturally associated with mammals,
such as dog, cat, horse or human transcription control
sequences.
[0063] Suitable and preferred nucleic acid molecules to include in
recombinant vectors of the present invention are as disclosed
herein. Preferred nucleic acid molecules to include in recombinant
vectors, and particularly in recombinant molecules, include
nCaIL-5.sub.610, nCaIL-5.sub.402, nCaIL-5.sub.345, and
nCaIL-5.sub.1658.
[0064] Recombinant molecules of the present invention may also (a)
contain secretory signals (i.e., signal segment nucleic acid
sequences) to enable an expressed parasitic helminth protein of the
present invention to be secreted from the cell that produces the
protein and/or (b) contain fusion sequences which lead to the
expression of nucleic acid molecules of the present invention as
fusion proteins. Examples of suitable signal segments include any
signal segment capable of directing the secretion of a protein of
the present invention. Preferred signal segments include, but are
not limited to, tissue plasminogen activator (t-PA), interferon,
interleukin, growth hormone, histocompatibility and viral envelope
glycoprotein signal segments. Suitable fusion segments encoded by
fusion segment nucleic acids are disclosed herein. In addition, a
nucleic acid molecule of the present invention can be joined to a
fusion segment that directs the encoded protein to the proteosome,
such as a ubiquitin fusion segment. Eukaryotic recombinant
molecules may also include intervening and/or untranslated
sequences surrounding and/or within the nucleic acid sequences of
nucleic acid molecules of the present invention.
[0065] Another embodiment of the present invention includes a
recombinant cell comprising a host cell transformed with one or
more recombinant molecules of the present invention. Transformation
of a nucleic acid molecule into a cell can be accomplished by any
method by which a nucleic acid molecule can be inserted into the
cell. Transformation techniques include, but are not limited to,
transfection, electroporation, microinjection, lipofection,
adsorption, and protoplast fusion. A recombinant cell may remain
unicellular or may grow into a tissue, organ or a multicellular
organism. Transformed nucleic acid molecules of the present
invention can remain extrachromosomal or can integrate into one or
more sites within a chromosome of the transformed (i.e.,
recombinant) cell in such a manner that their ability to be
expressed is retained. Preferred nucleic acid molecules with which
to transform a cell include immunoregulatory nucleic acid molecules
of the present invention disclosed herein. Particularly preferred
nucleic acid molecules with which to transform a cell include
nCaIL-5.sub.610, nCaIL-5.sub.402, nCaIL-5.sub.345, and/or
nCaIL-5.sub.1658.
[0066] Suitable host cells to transform include any cell that can
be transformed with a nucleic acid molecule of the present
invention. Host cells can be either untransformed cells or cells
that are already transformed with at least one nucleic acid
molecule (e.g., nucleic acid molecules encoding one or more
proteins of the present invention and/or other proteins useful in
the production of multivalent vaccines). Host cells of the present
invention either can be endogenously (i.e., naturally) capable of
producing immunoregulatory proteins of the present invention or can
be capable of producing such proteins after being transformed with
at least one nucleic acid molecule of the present invention. Host
cells of the present invention can be any cell capable of producing
at least one protein of the present invention, and include
bacterial, fungal (including yeast), parasite (including helminth,
protozoa and ectoparasite), other insect, other animal and plant
cells. Preferred host cells include bacterial, mycobacterial,
yeast, helminth, insect and mammalian cells. More preferred host
cells include Salmonella, Escherichia, Bacillus, Listeria,
Saccharomyces, Spodoptera, Mycobacteria, Trichoplusia, BHK (baby
hamster kidney) cells, MDCK cells (Madin-Darby canine kidney cell
line), CRFK cells (Crandell feline kidney cell line), CV-1 cells
(African monkey kidney cell line used, for example, to culture
raccoon poxvirus), COS (e.g., COS-7) cells, chinese hamster ovary
(CHO) cells, Ltk cells and Vero cells. Particularly preferred host
cells are Escherichia coli, including E. coli K-12 derivatives;
Salmonella typhi; Salmonella typhimurium, including attenuated
strains such as UK-1.sub.03987 and SR-11.sub.04072; Spodoptera
frugiperda; Trichoplusia ni; BHK cells; MDCK cells; CRFK cells;
CV-1 cells; COS cells; Vero cells; and non-tumorigenic mouse
myoblast G8 cells (e.g., ATCC CRL 1246). Additional appropriate
mammalian cell hosts include other kidney cell lines, other
fibroblast cell lines (e.g., human, murine or chicken embryo
fibroblast cell lines), myeloma cell lines, Chinese hamster ovary
cells, mouse NIH/3T3 cells, LMTK.sup.31 cells and/or HeLa cells. In
one embodiment, the proteins may be expressed as heterologous
proteins in myeloma cell lines employing immunoglobulin
promoters.
[0067] A recombinant cell is preferably produced by transforming a
host cell with one or more recombinant molecules, each comprising
one or more nucleic acid molecules of the present invention
operatively linked to an expression vector containing one or more
transcription control sequences, examples of which are disclosed
herein.
[0068] A recombinant cell of the present invention includes any
cell transformed with at least one of any nucleic acid molecule of
the present invention. Suitable and preferred nucleic acid
molecules as well as suitable and preferred recombinant molecules
with which to transfer cells are disclosed herein.
[0069] Recombinant cells of the present invention can also be
co-transformed with one or more recombinant molecules including any
of canine interleukin-5 nucleic acid molecule encoding one or more
proteins of the present invention and/or one or more other nucleic
acid molecules encoding other therapeutic compounds, as disclosed
herein (e.g., to produce multivalent vaccines).
[0070] Recombinant DNA technologies can be used to improve
expression of transformed nucleic acid molecules by manipulating,
for example, the number of copies of the nucleic acid molecules
within a host cell, the efficiency with which those nucleic acid
molecules are transcribed, the efficiency with which the resultant
transcripts are translated, and the efficiency of
post-translational modifications. Recombinant techniques useful for
increasing the expression of nucleic acid molecules of the present
invention include, but are not limited to, operatively linking
nucleic acid molecules to high-copy number plasmids, integration of
the nucleic acid molecules into one or more host cell chromosomes,
addition of vector stability sequences to plasmids, substitutions
or modifications of transcription control signals (e.g., promoters,
operators, enhancers), substitutions or modifications of
translational control signals (e.g., ribosome binding sites,
Shine-Dalgarno sequences), modification of nucleic acid molecules
of the present invention to correspond to the codon usage of the
host cell, deletion of sequences that destabilize transcripts, and
use of control signals that temporally separate recombinant cell
growth from recombinant enzyme production during fermentation. The
activity of an expressed recombinant protein of the present
invention may be improved by fragmenting, modifying, or
derivatizing nucleic acid molecules encoding such a protein.
[0071] Isolated immunoregulatory proteins of the present invention
can be produced in a variety of ways, including production and/or
recovery of natural proteins, production and/or recovery of
recombinant proteins, and/or chemical synthesis of the proteins. In
one embodiment, an isolated protein of the present invention is
produced by culturing a cell capable of expressing the protein
under conditions effective to produce the protein, and recovering
the protein. A preferred cell to culture is a recombinant cell of
the present invention. Effective culture conditions include, but
are not limited to, effective media, bioreactor, temperature, pH
and oxygen conditions that permit protein production. An effective
medium refers to any medium in which a cell is cultured to produce
an immunoregulatory protein of the present invention. Such medium
typically comprises an aqueous medium having assimilable carbon,
nitrogen and phosphate sources, and appropriate salts, minerals,
metals and other nutrients, such as vitamins. Cells of the present
invention can be cultured in conventional fermentation bioreactors,
shake flasks, test tubes, microtiter dishes, and petri plates.
Culturing can be carried out at a temperature, pH and oxygen
content appropriate for a recombinant cell. Such culturing
conditions are within the expertise of one of ordinary skill in the
art.
[0072] Depending on the vector and host system used for production,
resultant proteins of the present invention may either remain
within the recombinant cell; be secreted into the fermentation
medium; be secreted into a space between two cellular membranes,
such as the periplasmic space in E. coli; or be retained on the
outer surface of a cell or viral membrane.
[0073] The phrase "recovering the protein", as well as similar
phrases, refers to collecting the whole fermentation medium
containing the protein and need not imply additional steps of
separation or purification. Proteins of the present invention can
be purified using a variety of standard protein purification
techniques, such as, but not limited to, affinity chromatography,
ion exchange chromatography, filtration, electrophoresis,
hydrophobic interaction chromatography, gel filtration
chromatography, reverse phase chromatography, concanavalin A
chromatography, chromatofocusing and/or differential
solubilization. Proteins of the present invention are preferably
retrieved in "substantially pure" form. As used herein,
"substantially pure" refers to a purity that allows for the
effective use of the protein as a therapeutic composition or
diagnostic. A therapeutic composition for animals, for example,
should exhibit no substantial toxicity and preferably should be
capable of stimulating the production of antibodies in a treated
animal.
[0074] The present invention also includes isolated (i.e., removed
from their natural milieu) antibodies that selectively bind to an
immunoregulatory protein of the present invention and/or a mimetope
thereof (e.g., anti-IL-5 antibodies). As used herein, the term
"selectively binds to" an immunoregulatory protein of the present
invention, refers to the ability of antibodies of the present
invention to preferentially bind to specified proteins and/or
mimetopes thereof of the present invention. Binding can be measured
using a variety of methods standard in the art including enzyme
immunoassays (e.g., ELISA), immunoblot assays, etc.; see, for
example, Sambrook et al., ibid., and Harlow, et al., 1988,
Antibodies, a Laboratory Manual, Cold Spring Harbor Labs Press;
Harlow et al., ibid., is incorporated by this reference herein in
its entirety. An anti-IL-5 antibody of the present invention
preferably selectively binds to an IL-5 protein in such a way as to
inhibit the function of that protein.
[0075] Isolated antibodies of the present invention can include
antibodies in serum, or antibodies that have been purified to
varying degrees. Antibodies of the present invention can be
polyclonal or monoclonal, or can be functional equivalents such as
antibody fragments and/or genetically-engineered antibodies,
including single chain antibodies or chimeric antibodies that can
bind to one or more epitopes.
[0076] A preferred method to produce antibodies of the present
invention includes (a) administering to an animal an effective
amount of a protein, peptide and/or mimetope thereof of the present
invention to produce the antibodies and (b) recovering the
antibodies. In another method, antibodies of the present invention
are produced recombinantly using techniques as heretofore disclosed
to produce any of the immunoregulatory proteins of the present
invention. Antibodies raised against defined proteins or mimetopes
can be advantageous because such antibodies are not substantially
contaminated with antibodies against other substances that might
otherwise cause interference in a diagnostic assay or side effects
if used in a therapeutic composition.
[0077] Antibodies of the present invention have a variety of
potential uses that are within the scope of the present invention.
For example, such antibodies can be used (a) as reagents in assays
to detect an immunoregulatory protein of the present invention, (b)
as reagents in assays to modulate cellular activity through an
immunoregulatory protein of the present invention (e.g., mimicking
ligand binding to a canine interleukin-5), and/or (c) as tools to
screen expression libraries and/or to recover desired proteins of
the present invention from a mixture of proteins and other
contaminants. Furthermore, antibodies of the present invention can
be used to target compounds (e.g., nucleic acid molecules, drugs or
proteins) to antigen presenting cells. Targeting can be
accomplished by conjugating (i.e., stably joining) such antibodies
to the compounds using techniques known to those skilled in the
art. Suitable compounds are known to those skilled in the art.
[0078] One embodiment of the present invention is a therapeutic
composition that, when administered to an animal in an effective
manner, is capable of regulating an immune response in an animal.
Therapeutic compositions of the present invention can include at
least one of the following therapeutic compounds: an isolated IL-5
protein of the present invention and/or a mimetope thereof; an
isolated IL-5 nucleic acid molecule of the present invention; an
isolated antibody that selectively binds to an IL-5 protein of the
present invention; an inhibitor of canine IL-5 function identified
by its ability to bind to an IL-5 protein, respectively, of the
present invention; such an inhibitor can inhibit binding of the
respective immunoregulatory protein with its respective receptor,
or inhibit the activity the respective protein. Methods to perform
such assays to measure binding and/or activity of an
immunoregulatory protein of the present invention are known to
those of skill in the art, and are described, for example, in
Janeway et al., ibid. As used herein, a therapeutic compound refers
to a compound that, when administered to an animal in an effective
manner, is able to treat, ameliorate, and/or prevent a disease.
Examples of proteins, nucleic acid molecules, antibodies and/or
inhibitors of the present invention are disclosed herein.
[0079] The present invention also includes a therapeutic
composition comprising at least one IL-5-based compound of the
present invention in combination with at least one additional
therapeutic compound. Examples of such compounds are disclosed
herein.
[0080] Therapeutic compositions of the present invention can be
administered to any animal susceptible to such therapy, preferably
to mammals, and more preferably to dogs, cats, humans, ferrets,
horses, cattle, sheep and/or other pets, economic food animals
and/or zoo animals. Preferred animals include dogs, cats, horses
and/or humans.
[0081] A therapeutic composition of the present invention is
administered to an animal in an effective manner such that the
composition is capable of regulating an immune response in that
animal. Therapeutic compositions of the present invention can be
administered to animals prior to onset of a disease (i.e., as a
preventative vaccine) and/or can be administered to animals after
onset of a disease in order to treat the disease (i.e., as a
therapeutic vaccine). Preferred diseases to prevent and/or treat
include autoimmune diseases, allergic reactions, infectious
diseases, tumor development, inflammatory diseases and/or graft
rejection. In one embodiment, a therapeutic composition of the
present invention is administered with an antigen to enhance an
immune response against that antigen.
[0082] Therapeutic compositions of the present invention can be
formulated in an excipient that the animal to be treated can
tolerate. Examples of such excipients include water, saline,
Ringer's solution, dextrose solution, Hank's solution, and/or other
aqueous physiologically balanced salt solutions. Nonaqueous
vehicles, such as fixed oils, sesame oil, ethyl oleate, or
triglycerides may also be used. Other useful formulations include
suspensions containing viscosity enhancing agents, such as sodium
carboxymethylcellulose, sorbitol, or dextran. Excipients can also
contain minor amounts of additives, such as substances that enhance
isotonicity and chemical stability. Examples of buffers include
phosphate buffer, bicarbonate buffer and/or Tris buffer, while
examples of preservatives include thimerosal, o-cresol, formalin
and/or benzyl alcohol. Standard formulations can either be liquid
injectables or solids which can be taken up in a suitable liquid as
a suspension or solution for injection. Thus, in a non-liquid
formulation, the excipient can comprise dextrose, human serum
albumin, preservatives, etc., to which sterile water or saline can
be added prior to administration.
[0083] In one embodiment of the present invention, a therapeutic
composition can include an adjuvant. Adjuvants are agents that are
capable of enhancing the immune response of an animal to a specific
antigen. Suitable adjuvants include, but are not limited to,
cytokines, chemokines, and/or compounds that induce the production
of cytokines and/or chemokines (e.g., granulocyte macrophage colony
stimulating factor (GM-CSF), granulocyte colony stimulating factor
(G-CSF), macrophage colony stimulating factor (M-CSF), colony
stimulating factor (CSF), erythropoietin (EPO), interleukin 2
(IL-2), interleukin-3 (IL-3), interleukin 5 (IL-5), interleukin 6
(IL-6), interleukin 7 (IL-7), interleukin 8 (IL-8), interleukin 10
(IL-10), interleukin 12 (IL-12), interferon gamma, interferon gamma
inducing factor I (IGIF), transforming growth factor beta, RANTES
(regulated upon activation, normal T cell expressed and presumably
secreted), macrophage inflammatory proteins (e.g., MIP-1 alpha and
MIP-1 beta), and Leishmania elongation initiating factor (LEIF));
bacterial components (e.g., endotoxins, in particular
superantigens, exotoxins and cell wall components); aluminum-based
salts; calcium-based salts; silica; polynucleotides; toxoids; serum
proteins, viral coat proteins; block copolymer adjuvants (e.g.,
Hunter's Titermax.TM. adjuvant (VaxCel.TM., Inc. Norcross, Ga.),
Ribi adjuvants (Ribi ImmunoChem Research, Inc., Hamilton, Mont.);
and saponins and their derivatives (e.g., Quil A (Superfos
Biosector A/S, Denmark). Protein adjuvants of the present invention
can be delivered in the form of the protein themselves or of
nucleic acid molecules encoding such proteins using the methods
described herein.
[0084] In one embodiment of the present invention, a therapeutic
composition can include a carrier. Carriers include compounds that
increase the half-life of a therapeutic composition in the treated
animal. Suitable carriers include, but are not limited to,
polymeric controlled release vehicles, biodegradable implants,
liposomes, bacteria, viruses, other cells, oils, esters, and
glycols.
[0085] One embodiment of the present invention is a controlled
release formulation that is capable of slowly releasing a
composition of the present invention into an animal. As used
herein, a controlled release formulation comprises a composition of
the present invention in a controlled release vehicle. Suitable
controlled release vehicles include, but are not limited to,
biocompatible polymers, other polymeric matrices, capsules,
microcapsules, microparticles, bolus preparations, osmotic pumps,
diffusion devices, liposomes, lipospheres, and transdermal delivery
systems. Other controlled release formulations of the present
invention include liquids that, upon administration to an animal,
form a solid or a gel in situ. Preferred controlled release
formulations are biodegradable (i.e., bioerodible).
[0086] A preferred controlled release formulation of the present
invention is capable of releasing a composition of the present
invention into the blood of the treated animal at a constant rate
sufficient to attain therapeutic dose levels of the composition to
regulate an immune response in an animal. The therapeutic
composition is preferably released over a period of time ranging
from about 1 to about 12 months. A controlled release formulation
of the present invention is capable of effecting a treatment
preferably for at least about 1 month, more preferably for at least
about 3 months, even more preferably for at least about 6 months,
even more preferably for at least about 9 months, and even more
preferably for at least about 12 months.
[0087] Therapeutic compositions of the present invention can be
administered to animals prior to and/or after onset of disease.
Acceptable protocols to administer therapeutic compositions in an
effective manner include individual dose size, number of doses,
frequency of dose administration, and/or mode of administration.
Determination of such protocols can be accomplished by those
skilled in the art. A suitable single dose is a dose that is
capable of regulating the immune response in an animal when
administered one or more times over a suitable time period. For
example, a preferred single dose of a protein, mimetope or antibody
therapeutic composition is from about 1 microgram (.mu.g) to about
10 milligrams (mg) of the therapeutic composition per kilogram body
weight of the animal. Booster vaccinations can be administered from
about 2 weeks to several years after the original administration.
Booster administrations preferably are administered when the immune
response of the animal becomes insufficient to protect the animal
from disease. A preferred administration schedule is one in which
from about 10 .mu.g to about 1 mg of the therapeutic composition
per kg body weight of the animal is administered from about one to
about two times over a time period of from about 2 weeks to about
12 months. Modes of administration can include, but are not limited
to, subcutaneous, intradermal, intravenous, intra nasal,
intraoccular, oral, transdermal and/or intramuscular routes.
[0088] According to one embodiment, a nucleic acid molecule of the
present invention can be administered to an animal in a fashion to
enable expression of that nucleic acid molecule into a therapeutic
protein or therapeutic RNA (e.g., antisense RNA, ribozyme, triple
helix forms or RNA drug) in the animal. Nucleic acid molecules can
be delivered to an animal in a variety of methods including, but
not limited to, (a) administering a naked (i.e., not packaged in a
viral coat or cellular membrane) nucleic acid as a genetic vaccine
(e.g., as naked DNA or RNA molecules, such as is taught for example
in Wolff et al., 1990, Science 247, 1465-1468) or (b) administering
a nucleic acid molecule packaged as a recombinant virus vaccine or
as a recombinant cell vaccine (i.e., the nucleic acid molecule is
delivered by a viral or cellular vehicle).
[0089] A genetic (i.e., naked nucleic acid) vaccine of the present
invention includes a nucleic acid molecule of the present invention
and preferably includes a recombinant molecule of the present
invention that preferably is replication, or otherwise
amplification, competent. A genetic vaccine of the present
invention can comprise one or more nucleic acid molecules of the
present invention in the form of, for example, a dicistronic
recombinant molecule. Preferred genetic vaccines include at least a
portion of a viral genome (i.e., a viral vector). Preferred viral
vectors include those based on alphaviruses, poxviruses,
adenoviruses, herpesviruses, picornaviruses, and/or retroviruses,
with those based on alphaviruses (such as sindbis or Semliki forest
virus), species-specific herpesviruses and/or poxviruses being
particularly preferred. Any suitable transcription control sequence
can be used, including those disclosed as suitable for protein
production. Particularly preferred transcription control sequences
include cytomegalovirus immediate early (preferably in conjunction
with Intron-A), Rous sarcoma virus long terminal repeat, and
tissue-specific transcription control sequences, as well as
transcription control sequences endogenous to viral vectors if
viral vectors are used. The incorporation of a "strong"
polyadenylation signal is also preferred.
[0090] Genetic vaccines of the present invention can be
administered in a variety of ways, with intramuscular,
subcutaneous, intradermal, transdermal, intra nasal and/or oral
routes of administration being preferred. A preferred single dose
of a genetic vaccine ranges from about 1 nanogram (ng) to about 600
.mu.g, depending on the route of administration and/or method of
delivery, as can be determined by those skilled in the art.
Suitable delivery methods include, for example, by injection, as
drops, aerosolized and/or topically. Genetic vaccines of the
present invention can be contained in an aqueous excipient (e.g.,
phosphate buffered saline) alone or in a carrier (e.g., lipid-based
vehicles).
[0091] A recombinant virus vaccine of the present invention
includes a recombinant molecule of the present invention that is
packaged in a viral coat and that can be expressed in an animal
after administration. Preferably, the recombinant molecule is
packaging- or replication-deficient and/or encodes an attenuated
virus. A number of recombinant viruses can be used, including, but
not limited to, those based on alphaviruses, poxviruses,
adenoviruses, herpesviruses, picornaviruses, and/or retroviruses.
Preferred recombinant virus vaccines are those based on
alphaviruses (such as Sindbis virus), raccoon poxviruses,
species-specific herpesviruses and/or species-specific poxviruses.
An example of methods to produce and use alphavirus recombinant
virus vaccines are disclosed in U.S. Pat. No. 5,766,602 by Xiong et
al., issued Jun. 16, 1998, which is incorporated by reference
herein in its entirety.
[0092] When administered to an animal, a recombinant virus vaccine
of the present invention infects cells within the immunized animal
and directs the production of a therapeutic protein or RNA nucleic
acid molecule that is capable of protecting the animal from disease
caused by a parasitic helminth as disclosed herein. For example, a
recombinant virus vaccine comprising an immunoregulatory nucleic
acid molecule of the present invention is administered according to
a protocol that results in the regulation of an immune response in
an animal. A preferred single dose of a recombinant virus vaccine
of the present invention is from about 1.times.10.sup.4 to about
1.times.10.sup.8 virus plaque forming units (pfu) per kilogram body
weight of the animal. Administration protocols are similar to those
described herein for protein-based vaccines, with subcutaneous,
intramuscular, intra nasal, intraoccular and/or oral administration
routes being preferred.
[0093] A recombinant cell vaccine of the present invention includes
recombinant cells of the present invention that express at least
one protein of the present invention. Preferred recombinant cells
for this embodiment include Salmonella, E. coli, Listeria,
Mycobacterium, S. frugiperda, yeast, (including Saccharomyces
cerevisiae and Pichia pastoris), BHK, CV-1, myoblast G8, COS (e.g.,
COS-7), Vero, MDCK and CRFK recombinant cells. Recombinant cell
vaccines of the present invention can be administered in a variety
of ways but have the advantage that they can be administered
orally, preferably at doses ranging from about 10.sup.8 to about
10.sup.12 cells per kilogram body weight. Administration protocols
are similar to those described herein for protein-based vaccines.
Recombinant cell vaccines can comprise whole cells, cells stripped
of cell walls or cell lysates.
[0094] The efficacy of a therapeutic composition of the present
invention to regulate the immune response in an animal can be
tested in a variety of ways including, but not limited to,
detection of cellular immunity within the treated animal,
determining lymphocyte or dendritic cell activity, detection of
immunoglobulin levels, determining hematopoietic stem cell or
hematopoietic early progenitor cell development, determining
dendritic cell development or challenge of the treated animal with
an infectious agent to determine whether the treated animal is
resistant to disease. In one embodiment, therapeutic compositions
can be tested in animal models such as mice. Such techniques are
known to those skilled in the art.
[0095] One embodiment of the present invention is an inhibitory
compound. Preferably, such an inhibitory compound is derived from
an IL-5 protein of the present invention. Examples of inhibitory
compounds include an antibody of the present invention, that is
administered to an animal in an effective manner (i.e., is
administered in an amount so as to be present in the animal at a
titer that is sufficient, upon interaction of that antibody with a
native IL-5 protein, to decrease the activity of such proteins in
an animal, at least temporarily). Oligonucleotide nucleic acid
molecules of the present invention can also be administered in an
effective manner, thereby reducing expression of an IL-5 protein,
in order to interfere with the protein activity targeted in
accordance with the present invention. Peptides of an IL-5 protein
of the present invention can also be administered in an effective
manner, thereby reducing binding of IL-5 proteins to the
appropriate receptor, in order to interfere with the protein
activity targeted in accordance with the present invention. An
inhibitory compound of an IL-5 function can be identified using
IL-5 proteins of the present invention.
[0096] Another embodiment of the present invention is a method to
identify a compound capable of inhibiting IL-5 function. Such a
method includes the steps of: (a) contacting an isolated IL-5
protein of the present invention, with a putative inhibitory
compound under conditions in which, in the absence of the compound,
the IL-5 protein binds to IL-5 receptor or stimulates T cells in a
T cell proliferation assay, and (b) determining if the putative
inhibitory compound inhibits the binding of IL-5 protein to IL-5
receptor or the stimulation of T cells in a T cell proliferation
assay.
[0097] Putative inhibitory compounds to screen include small
organic molecules, antibodies (including mimetopes thereof), and/or
ligand analogs. Such compounds are also screened to identify those
that are substantially not toxic in host animals.
[0098] Preferred IL-5 proteins to inhibit are those produced by
dogs, cats, horses or humans, even more preferred IL-5 proteins to
inhibit are those produced by domestic dogs or cats. A particularly
preferred inhibitor of the present invention is capable of
regulating an immune response in an animal. It is also within the
scope of the present invention to use inhibitors of the present
invention to target diseases involving undesired immune activity in
animals. Compositions comprising inhibitors of IL-5 function can be
administered to animals in an effective manner to regulate the
immune response in the animals, and preferably to prevent
autoimmune disease, allergy, infectious disease, inflammation or
prevent graft rejection in animals, or to treat animals with such
diseases. Effective amounts and/or dosing regimens can be
determined using techniques known to those skilled in the art.
[0099] It is also within the scope of the present invention to use
isolated proteins, mimetopes, nucleic acid molecules and/or
antibodies of the present invention as diagnostic reagents. Methods
to use such diagnostic reagents are well known to those skilled in
the art, see, for example, Janeway, et al., ibid., and/or PCT
Publication No. WO 98/23964, published Jun. 4, 1998, which is
herein incorporated by reference.
[0100] The following examples are provided for the purposes of
illustration and are not intended to limit the scope of the present
invention.
EXAMPLES
[0101] It is to be noted that the examples include a number of
molecular biology, microbiology, immunology and biochemistry
techniques considered to be familiar to those skilled in the art.
Disclosure of such techniques can be found, for example, in
Sambrook et al., ibid. and Ausubel, et al., 1993, Current Protocols
in Molecular Biology, Greene/Wiley Interscience, New York, N.Y.,
and related references. Ausubel, et al, ibid. is incorporated by
reference herein in its entirety.
Example 1
[0102] This example describes the isolation and sequencing of
certain canine IL-5 nucleic acid molecules and proteins of the
present invention. This example also describes expression of canine
IL-5 in a Pichia expression system.
[0103] A. Isolation and Sequencing of Canine IL-5 Nucleic Acid
Molecules and Proteins
[0104] A canine IL-5 cDNA nucleic acid molecule encoding a canine
IL-5 protein was isolated by PCR amplification from a canine PBMC
cDNA library. The library was a C. familiaris mitogen activated
PBMC cDNA library that was constructed in the Uni-ZAP.RTM. XR
vector (available from Stratagene Cloning Systems, La Jolla,
Calif.), using Stratagene's ZAP-cDNA.RTM. Synthesis Kit and the
manufacturer's protocol. The mRNA was isolated from C. familiaris
peripheral blood mononuclear cells about 18 hours after they were
activated by a polyclonal activating agent in culture.
[0105] The PCR products were cloned and sequenced using Amplitaq
DNA polymerase (available from PE Applied Biosystems Inc, Foster
City, Calif.) under the following PCR protocol: one initial
denaturation step at 95.degree. C. for 3 minutes; then 46 cycles of
the following: 94.degree. C. for 45 seconds, then 48.degree. C. for
45 seconds, then 72.degree. C. for 1 minute 45 seconds; followed by
a final extension at 72.degree. C. for 8 minutes. Degenerate
oligonucleotide primers were designed in accordance with conserved
regions of human and cat IL-5 gene sequences available in GenBank:
sense primer, 5' ATGCACTTTC TTTGCC 3', denoted herein as SEQ ID
NO:1; antisense primer 1, 5' CTGGAGGAAA AKACTTCRAT GATTCTGATA
TCTGAAATAT AT 3', denoted herein as SEQ ID NO:2; and antisense
primer 2, 5' CTGACYCTTK STTGGSCCTC ATTCTCA 3', denoted herein as
SEQ ID NO:3, where K was G or T, R was either A or G, S was either
G or C, and Y was either T or C.
[0106] An about 610-nucleotide canine IL-5 nucleic acid molecule,
denoted nCaIL-5.sub.610, was obtained using primers having SEQ ID
NO:1 and SEQ ID NO:2, respectively. The sequence of the coding
strand of nCaIL-5.sub.610 is represented herein as SEQ ID NO:4. The
reverse complement of SEQ ID NO:4 is referred to herein as SEQ ID
NO:6. Translation of SEQ ID NO:4 suggests that nucleic acid
molecule nCaIL-5.sub.610 encodes an IL-5 protein of 134 amino
acids, denoted herein as PCaIL-5.sub.134, the amino acid sequence
of which is presented in SEQ ID NO:5, assuming an open reading
frame having an initiation codon spanning from nucleotide 29
through nucleotide 31 of SEQ ID NO:4 and a stop codon spanning from
nucleotide 431 through nucleotide 433 of SEQ ID NO:4. The coding
region encoding PCaIL-5.sub.134, not including the termination
codon, is presented herein as nCaIL-5.sub.402, which has the
nucleotide sequence SEQ ID NO:7 (the coding strand) and SEQ ID NO:8
(the complementary strand).
[0107] An about 488-nucleotide fragment, denoted herein as
nCaIL-5.sub.488, isolated by PCR with primers having SEQ ID NO:1
and SEQ ID NO:2, respectively, corresponds to nucleotide 1 through
nucleotide 488 of nCaIL-5.sub.610.
[0108] A putative signal sequence coding region extends from
nucleotide 29 through nucleotide 85 of SEQ ID NO:4. The proposed
mature protein, denoted herein as PCaIL-5.sub.115, represented by
SEQ ID NO:10, contains about 115 amino acids, extending from
residue 20 though residue 134 of SEQ ID NO:5. The nucleotide
sequence encoding PCaIL-5.sub.115, which extends from nucleotide 86
through nucleotide 430 of SEQ ID NO:4, is denoted herein as nucleic
acid molecule nCaIL-5.sub.345, represented by SEQ ID NO:9 (coding
strand) and SEQ ID NO:11 (the complement strand).
[0109] Sequence analysis was performed with DNAsis.TM. using the
alignment settings of: gap penalty set at 5; number of top
diagonals set at 5; fixed gap penalty set at 10; k-tuple set at 2;
window size set at 5 and floating gap penalty set at 10. At the
amino acid level, PCaIL-5.sub.134 shared 82.8% and 57.4% identity
with feline and human IL-S proteins, respectively (Padrid et al.,
Am. J. Vet. Res., vol. 59, pp. 1263-1269, 1998; Azuma et al.,
Nucleic Acids Res., vol. 14, pp. 9149-9158, 1986). At the
nucleotide level, nCaIL-5.sub.610 shared 81.7% and 75% identity
with the cDNA sequences of the feline and human IL-5,
respectively.
[0110] B. Expression of Canine IL-5 in Pichia
[0111] This example describes the expression in Pichia of a canine
IL-5 cDNA fragment, namely a canine IL-5 nucleic acid molecule
denoted nCaIL-5.sub.348, the coding strand of which consists of
nucleotides 86-433 of SEQ ID NO:4, and as such, encodes a predicted
mature canine IL-5 protein having SEQ ID NO:10. Nucleic acid
molecule nCaIL-5.sub.348, was PCR amplified from nCaIL-5.sub.610
using sense primer 5' GGGCTCGAGA AAAGATTTGC TGTAGAAAAT CCCATG 3'
denoted herein as SEQ ID NO:12, with nucleotides 16-36
corresponding to nucleotides 86-106 of SEQ ID NO:4; and antisense
primer 5' CCCGCGGCCG CTCAACTTTC CGGTGTCCAC TC 3', denoted herein as
SEQ ID NO:13, with nucleotides 12-32 corresponding to the reverse
complement of nucleotides 413-433 of SEQ ID NO:4. To facilitate
cloning, an XhoI site (shown in bold) was added to the sense primer
and a NotI site (shown in bold) was added to the antisense primer.
The PCR-amplified fragment was digested with restriction
endonucleases XhoI and NotI, gel purified and ligated into
pPICZ.alpha.A plasmid vector, available from Invitrogen, that had
been digested by Xho I and Not I and gel purified, to produce
recombinant molecule pPICZ.alpha.A-nCaIL-5.sub.348. The insert in
the recombinant molecule was verified by DNA sequencing The
recombinant molecule was used to transform Pichia pastoris strain
X-33 by electroporation to produce recombinant cell
Pichia-pPICZ.alpha.A-nCaIL-5.sub.348. Recombinant cell
Pichia-pPICZ.alpha.A-nCaIL-5.sub.348 was cultured using techniques
known to those skilled in the art and IL-5 expression was induced
with methanol. The supernatant was recovered and submitted to
SDS-PAGE. Silver staining of the resultant gel indicated a band of
about 18 kDa only seen in the supernatant of Pichia transformed
with recombinant molecule pPICZ.alpha.A-nCaIL-5.sub.348.
Example 2
[0112] This example describes the isolation and characterization of
the canine IL-5 gene, its expression, and biological activity of
the recombinantly produced protein.
[0113] A. Cloning of Canine IL-5 Genomic DNA
[0114] In order to characterize the structure of the canine IL-5
gene, a DNA fragment was isolated from dog genomic DNA (Clontech,
Palo Alto, Calif.) by PCR using primers DF8, 5'
AGGCAAACACTGAACATTTC3', denoted herein as SEQ ID NO:14, and DB8,
5'TCTCCAAAATCTTCCACTAC3', denoted herein as SEQ ID NO:15, and the
methods described in Example 1. The PCR product was isolated,
subcloned into the pCR2.1 plasmid using TA cloning kit (Invitrogen,
Carlsbad, Calif.), and sequenced. Automated cycle sequencing of DNA
samples was performed using an ABI PRISM.TM. Model 377 and reaction
kit from PE Applied Biosystems (Foster City, Calif.). Sequence
analysis was performed with DNASIS (Hitachi, San Bruno, Calif.)
using default alignment settings.
[0115] A 1658-bp fragment, nCaIL-5.sub.1658, was isolated from
canine genomic DNA and sequenced. The coding strand of the genomic
sequence is designated herein as SEQ ID NO:18. The noncoding strand
is designated herein as SEQ ID NO:19. Alignment of genomic DNA
reveals three introns of 203 bp, 869 bp, and 118 bp, respectively,
in the coding region of canine IL-5. This gene structure is similar
to that of the previously characterized human and mouse IL-5 genes
(Campbell, H. D., et al., (1987) Proc. Natl. Acad. Sci., USA
84:6629-6633; Tanabe, T., et al (1987)., J. Biol. Chem.
262:16580-16584; Campbell, M. D., et al, (1988), Eur. J. Biochem).
Furthermore, the three introns are located at the same relative
sites, and the sequences surrounding the exon-intron junctions are
similar among IL-5 genes of the dog, human and mouse. Such
conservation also suggests that the expression of canine IL-5 genes
is likely subject to regulation similar to the well-studied
expression of mouse and human IL-5 genes. (Karlen, S., et al,
(1998), Int. Rev. Immunol. 16:227-247).
[0116] B. Detection of Canine IL-5 mRNA Expression by RT-PCR
[0117] Coupled reverse trancriptase-polymerase chain reaction
(RT-PCR) was carried out to detect the expression of canine IL-5
transcripts in cells from lymph nodes and peripheral blood.
Isolation of total RNA from lymph node cells and synthesis of first
strand cDNA were performed as described above using the canine
IL-5-specific primers DF8 and DB8. As a control, PCR was also
performed on the "house-keeping" gene HPRT using primers 3F,
5'TCAAGGGAGGCTATAAATTC3', denoted herein as SEQ ID NO:16, and 8R,
5'TTATAGTCAAGGGCATATCC3', denoted herein as SEQ ID NO:17.
Amplification of cDNA samples diluted at 1:10 (for IL-5) or 1:50
(for HPRT) and genomic DNA (Clontech) was performed in a 30 .mu.l
reaction. PCR conditions were as follows: One initial denaturation
step at 95.degree. C. for 3 min; then 38 cycles (for IL-5) or 35
cycles (for HPRT) at 94.degree. C. for 45 sec, 60.degree. C. (for
IL-5) or 63.degree. C. (for HPRT) for 45 sec, and 72.degree. C. for
1 min and 45 sec; and a final extension at 72.degree. C. for 8 min.
Half of the PCR product was analyzed by agarose gel electrophoresis
in the presence of ethidium bromide. Pfu DNA polymerase (2.5 U/100
.mu.l reaction)(Stratagene, La Jolla, Calif.) was used in the
RT-PCR.
[0118] A 468-bp band was predominantly amplified by RT-PCR using
primers DF8 and DB8. Sometimes a larger band of approximately
671-bp was also seen, using the same primers. DNA sequencing
indicated that this larger band was derived from transcripts that
contained unspliced intron 1. This incompletely spliced transcript
is designated SEQ ID NO: 21. When genomic DNA was used in the PCR,
the 1658-bp band characterized above was amplified.
[0119] C. TF-1 Cell Proliferation Assay
[0120] The protein produced according to Example 1 B was assayed
for biological activity. The N-terminal amino acid sequence
(FAVENPMNRLVAETL) (SEQ ID NO:20) confirmed the identity of this
protein as recombinant dog IL-5. The predicted molecular weight of
mature canine IL-5 polypeptide is 13 kDa, suggesting that the
recombinant canine IL-5 is glycosylated in P. pastoris.
[0121] A human erythroleukaemia cell line, TF-1 (Kitamura, T., et
al, (1989). J. Cell. Physiol. 140:323-334), (R&D Systems,
Minneapolis, Minn.), was maintained in RPMI-1640 media supplemented
with 2 mM L-glutamine, 5 .mu.g/ml gentamicin, 5% FBS and 2 ng/ml
recombinant human GM-CSF (rhuGM-CSE, R&D Systems) called Tissue
Culture Media-TF-1 (TCM-TF-1). Cells were grown in 5% CO.sub.2 at
37.degree. C.
[0122] Prior to cell proliferation assays, TF-1 cells were washed
extensively to remove rhuGM-CSF, and then plated at
1.times.10.sup.4 cells per well in 96-well flat bottom plates.
Supernatants from either P. pastoris X-33 or the recombinant P.
pastoris containing the canine IL-5 gene were dialyzed overnight
(using 10,000 MW cut-off membranes) at 4.degree. C. against
phosphate buffered saline, diluted to the appropriate concentration
in TCM-TF-1 without rhuGM-CSF, and filter sterilized. Cells and
supernatants were incubated for 48 hours in 5% CO.sub.2 at
37.degree. C., pulsed with 1 .mu.Ci/well tritiated thymidine (ICN
Pharmaceuticals, Irvine, Calif.), and incubated for an additional
18 hours. Contents of the wells were harvested onto glass fiber
filters and counted in a Wallac Trilux 1450 scintillation counter
(Wallac Inc., Gaithersburg, Md.).
[0123] The TF-1 cells respond in a dose-dependent fashion to the P.
pastoris expressed canine IL-5. In contrast, supernatants from the
induced P. pastoris X-33, transformed with the empty vector, failed
to stimulate TF-1 cell proliferation. The bioassay is extremely
sensitive; based on experiments with recombinant human IL-5, as
little as 150 pg/ml can stimulate TF-1 proliferation. Using human
IL-5 as the standard, and assuming that the IL-5 works equivalently
across species, it is estimated that the P. pastoris IL-5
supernatants contain around 20 ng/ml canine IL-5.
[0124] While various embodiments of the present invention have been
described in detail, it is apparent that modifications and
adaptations of those embodiments will occur to those skilled in the
art. It is to be expressly understood, however, that such
modifications and adaptations are within the scope of the present
invention, as set forth in the following claims.
Sequence CWU 1
1
21116DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 1atgcactttc tttgcc 16242DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
2ctggaggaaa akacttcrat gattctgata tctgaaatat at 42327DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
3ctgacycttk sttggscctc attctca 274610DNACanis
familiarisCDS(29)..(430) 4caaggcaaac actgaacatt tcagagct atg aga
atg ctt ctg aat ttg agt 52 Met Arg Met Leu Leu Asn Leu Ser 1 5ttg
cta gct ctt ggg gct gcc tat gtt tct gcc ttt gct gta gaa aat 100Leu
Leu Ala Leu Gly Ala Ala Tyr Val Ser Ala Phe Ala Val Glu Asn 10 15
20ccc atg aat aga ctg gtg gca gag acc ttg aca ctg ctc tcc act cat
148Pro Met Asn Arg Leu Val Ala Glu Thr Leu Thr Leu Leu Ser Thr
His25 30 35 40cga act tgg ctg ata ggc gat ggg aac ctg atg att cct
act cct gaa 196Arg Thr Trp Leu Ile Gly Asp Gly Asn Leu Met Ile Pro
Thr Pro Glu 45 50 55aat aaa aat cac caa ctg tgc att aaa gaa gtt ttt
cag ggt ata gac 244Asn Lys Asn His Gln Leu Cys Ile Lys Glu Val Phe
Gln Gly Ile Asp 60 65 70aca ttg aag aac caa act gcc cac ggg gag gct
gtg gat aaa cta ttc 292Thr Leu Lys Asn Gln Thr Ala His Gly Glu Ala
Val Asp Lys Leu Phe 75 80 85caa aac ttg tct tta ata aaa gaa cac ata
gag cgc caa aaa aaa agg 340Gln Asn Leu Ser Leu Ile Lys Glu His Ile
Glu Arg Gln Lys Lys Arg 90 95 100tgt gca gga gaa aga tgg aga gtg
aca aag ttc cta gac tac ctg caa 388Cys Ala Gly Glu Arg Trp Arg Val
Thr Lys Phe Leu Asp Tyr Leu Gln105 110 115 120gta ttt ctt ggt gta
ata aac acc gag tgg aca ccg gaa agt 430Val Phe Leu Gly Val Ile Asn
Thr Glu Trp Thr Pro Glu Ser 125 130tgagaacaaa ccggcttatt gtagtggaag
attttggaga agaatggttt tttggcgatg 490agaatgaggg ccaaccaaca
gtagggactt aatggccagt ataactaagc ttcagagaca 550aagtaaatat
ttcaggcatc ctactacttt atcacttcac acagatgaaa tatatttgag
6105134PRTCanis familiaris 5Met Arg Met Leu Leu Asn Leu Ser Leu Leu
Ala Leu Gly Ala Ala Tyr1 5 10 15Val Ser Ala Phe Ala Val Glu Asn Pro
Met Asn Arg Leu Val Ala Glu 20 25 30Thr Leu Thr Leu Leu Ser Thr His
Arg Thr Trp Leu Ile Gly Asp Gly 35 40 45Asn Leu Met Ile Pro Thr Pro
Glu Asn Lys Asn His Gln Leu Cys Ile 50 55 60Lys Glu Val Phe Gln Gly
Ile Asp Thr Leu Lys Asn Gln Thr Ala His65 70 75 80Gly Glu Ala Val
Asp Lys Leu Phe Gln Asn Leu Ser Leu Ile Lys Glu 85 90 95His Ile Glu
Arg Gln Lys Lys Arg Cys Ala Gly Glu Arg Trp Arg Val 100 105 110Thr
Lys Phe Leu Asp Tyr Leu Gln Val Phe Leu Gly Val Ile Asn Thr 115 120
125Glu Trp Thr Pro Glu Ser 1306610DNACanis familiaris 6ctcaaatata
tttcatctgt gtgaagtgat aaagtagtag gatgcctgaa atatttactt 60tgtctctgaa
gcttagttat actggccatt aagtccctac tgttggttgg ccctcattct
120catcgccaaa aaaccattct tctccaaaat cttccactac aataagccgg
tttgttctca 180actttccggt gtccactcgg tgtttattac accaagaaat
acttgcaggt agtctaggaa 240ctttgtcact ctccatcttt ctcctgcaca
cctttttttt tggcgctcta tgtgttcttt 300tattaaagac aagttttgga
atagtttatc cacagcctcc ccgtgggcag tttggttctt 360caatgtgtct
ataccctgaa aaacttcttt aatgcacagt tggtgatttt tattttcagg
420agtaggaatc atcaggttcc catcgcctat cagccaagtt cgatgagtgg
agagcagtgt 480caaggtctct gccaccagtc tattcatggg attttctaca
gcaaaggcag aaacataggc 540agccccaaga gctagcaaac tcaaattcag
aagcattctc atagctctga aatgttcagt 600gtttgccttg 6107402DNACanis
familiaris 7atgagaatgc ttctgaattt gagtttgcta gctcttgggg ctgcctatgt
ttctgccttt 60gctgtagaaa atcccatgaa tagactggtg gcagagacct tgacactgct
ctccactcat 120cgaacttggc tgataggcga tgggaacctg atgattccta
ctcctgaaaa taaaaatcac 180caactgtgca ttaaagaagt ttttcagggt
atagacacat tgaagaacca aactgcccac 240ggggaggctg tggataaact
attccaaaac ttgtctttaa taaaagaaca catagagcgc 300caaaaaaaaa
ggtgtgcagg agaaagatgg agagtgacaa agttcctaga ctacctgcaa
360gtatttcttg gtgtaataaa caccgagtgg acaccggaaa gt 4028402DNACanis
familiaris 8actttccggt gtccactcgg tgtttattac accaagaaat acttgcaggt
agtctaggaa 60ctttgtcact ctccatcttt ctcctgcaca cctttttttt tggcgctcta
tgtgttcttt 120tattaaagac aagttttgga atagtttatc cacagcctcc
ccgtgggcag tttggttctt 180caatgtgtct ataccctgaa aaacttcttt
aatgcacagt tggtgatttt tattttcagg 240agtaggaatc atcaggttcc
catcgcctat cagccaagtt cgatgagtgg agagcagtgt 300caaggtctct
gccaccagtc tattcatggg attttctaca gcaaaggcag aaacataggc
360agccccaaga gctagcaaac tcaaattcag aagcattctc at 4029345DNACanis
familiarisCDS(1)..(345) 9ttt gct gta gaa aat ccc atg aat aga ctg
gtg gca gag acc ttg aca 48Phe Ala Val Glu Asn Pro Met Asn Arg Leu
Val Ala Glu Thr Leu Thr1 5 10 15ctg ctc tcc act cat cga act tgg ctg
ata ggc gat ggg aac ctg atg 96Leu Leu Ser Thr His Arg Thr Trp Leu
Ile Gly Asp Gly Asn Leu Met 20 25 30att cct act cct gaa aat aaa aat
cac caa ctg tgc att aaa gaa gtt 144Ile Pro Thr Pro Glu Asn Lys Asn
His Gln Leu Cys Ile Lys Glu Val 35 40 45ttt cag ggt ata gac aca ttg
aag aac caa act gcc cac ggg gag gct 192Phe Gln Gly Ile Asp Thr Leu
Lys Asn Gln Thr Ala His Gly Glu Ala 50 55 60gtg gat aaa cta ttc caa
aac ttg tct tta ata aaa gaa cac ata gag 240Val Asp Lys Leu Phe Gln
Asn Leu Ser Leu Ile Lys Glu His Ile Glu65 70 75 80cgc caa aaa aaa
agg tgt gca gga gaa aga tgg aga gtg aca aag ttc 288Arg Gln Lys Lys
Arg Cys Ala Gly Glu Arg Trp Arg Val Thr Lys Phe 85 90 95cta gac tac
ctg caa gta ttt ctt ggt gta ata aac acc gag tgg aca 336Leu Asp Tyr
Leu Gln Val Phe Leu Gly Val Ile Asn Thr Glu Trp Thr 100 105 110ccg
gaa agt 345Pro Glu Ser 11510115PRTCanis familiaris 10Phe Ala Val
Glu Asn Pro Met Asn Arg Leu Val Ala Glu Thr Leu Thr1 5 10 15Leu Leu
Ser Thr His Arg Thr Trp Leu Ile Gly Asp Gly Asn Leu Met 20 25 30Ile
Pro Thr Pro Glu Asn Lys Asn His Gln Leu Cys Ile Lys Glu Val 35 40
45Phe Gln Gly Ile Asp Thr Leu Lys Asn Gln Thr Ala His Gly Glu Ala
50 55 60Val Asp Lys Leu Phe Gln Asn Leu Ser Leu Ile Lys Glu His Ile
Glu65 70 75 80Arg Gln Lys Lys Arg Cys Ala Gly Glu Arg Trp Arg Val
Thr Lys Phe 85 90 95Leu Asp Tyr Leu Gln Val Phe Leu Gly Val Ile Asn
Thr Glu Trp Thr 100 105 110Pro Glu Ser 11511345DNACanis familiaris
11actttccggt gtccactcgg tgtttattac accaagaaat acttgcaggt agtctaggaa
60ctttgtcact ctccatcttt ctcctgcaca cctttttttt tggcgctcta tgtgttcttt
120tattaaagac aagttttgga atagtttatc cacagcctcc ccgtgggcag
tttggttctt 180caatgtgtct ataccctgaa aaacttcttt aatgcacagt
tggtgatttt tattttcagg 240agtaggaatc atcaggttcc catcgcctat
cagccaagtt cgatgagtgg agagcagtgt 300caaggtctct gccaccagtc
tattcatggg attttctaca gcaaa 3451236DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
12gggctcgaga aaagatttgc tgtagaaaat cccatg 361332DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
13cccgcggccg ctcaactttc cggtgtccac tc 321420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
14aggcaaacac tgaacatttc 201520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Primer 15tctccaaaat cttccactac
201620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Primer 16tcaagggagg ctataaattc 201720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Primer
17ttatagtcaa gggcatatcc 20181658DNACanis
familiarisintron(171)..(373)intron(407)..(1275)intron(1405)..(1522)
18aggcaaacac tgaacatttc agagctatga gaatgcttct gaatttgagt ttgctagctc
60ttggggctgc ctatgtttct gcctttgctg tagaaaatcc catgaataga ctggtggcag
120agaccttgac actgctctcc actcatcgaa cttggctgat aggcgatggg
gtaattttct 180ttttgattcc tacagtcttt aaaatgcatg ggtaattggt
ggtggtggct agtttttaaa 240gatccattat caataatgaa gtaatgagtg
ttaataatat ataatgggta accatgttac 300tcagaagaat tatattaaaa
gttatgaacc ttacaataca ttaaaaatga atgttgtttc 360ctttcttttt
cagaacctga tgattcctac tcctgaaaat aaaaatgtaa gttaaattat
420gatttgataa aatgattaca tgaatcagtt tcatatttta agctataaag
tatcagttaa 480cattgggatg atttaatttt atctattttg tttttatgtg
tgcggatgta aattatgtgc 540ttatgaatat taggaatggt gttaggaatg
gctctacaat attaagtaga atccattaag 600caagtggatc aggccctttt
ttgatgttgt cagttctcca tctcaaagag cctcgtgtca 660ggcattcttt
ccaaaagaat tccatattgg gtcagagata cttcctaggc tccattcacc
720tctgtcgttg gctttcctca cctcaacgtt tttctgaaag tactagcaac
ttggggttat 780atttttagaa ttatggtcag tagacatgaa aatatacagt
gaagtcctat attaatagtc 840acttccacat atttaaatga tttttaactc
taatggaatc atatacatct ggagtatgtc 900atggtcatat taaaatgtta
aaaatgtgat atcattagtc taaatagaat aaaattacca 960gctagaacta
tacgaggaaa ttctgaggtg aggtaaatca gtaaggcagt tgtattatac
1020ctcgtaagca tttatttttc attaatcatt tcatttatat catttgtaac
acttctcagt 1080aattatataa acatcattta cttatggtaa ttatagctta
gtataaggtg gtttcccacc 1140tggaaaagac acaagtaaaa acctcttggg
agaagggaac ttgtgtaaac cccacaaaac 1200aaagtctaac tttttggacc
aaatttttat gccttgtttt gatgaattat attttttaaa 1260atcttcctca
tttagcacca actgtgcatt aaagaagttt ttcagggtat agacacattg
1320aagaaccaaa ctgcccacgg ggaggctgtg gataaactat tccaaaactt
gtctttaata 1380aaagaacaca tagagcgcca aaaagtaagt taaagacatt
tggcaaaaac ttaagtatat 1440ttgtctgact ctgcctgttt tttttttttt
tttttacaag aattgacagt ttcctacaat 1500atctcctctg ttcttttaac
agaaaaggtg tgcaggagaa agatggagag tgacaaagtt 1560cctagactac
ctgcaagtat ttcttggtgt aataaacacc gagtggacac cggaaagttg
1620agaacaaacc ggcttattgt agtggaagat tttggaga 1658191658DNACanis
familiaris 19tctccaaaat cttccactac aataagccgg tttgttctca actttccggt
gtccactcgg 60tgtttattac accaagaaat acttgcaggt agtctaggaa ctttgtcact
ctccatcttt 120ctcctgcaca ccttttctgt taaaagaaca gaggagatat
tgtaggaaac tgtcaattct 180tgtaaaaaaa aaaaaaaaaa acaggcagag
tcagacaaat atacttaagt ttttgccaaa 240tgtctttaac ttactttttg
gcgctctatg tgttctttta ttaaagacaa gttttggaat 300agtttatcca
cagcctcccc gtgggcagtt tggttcttca atgtgtctat accctgaaaa
360acttctttaa tgcacagttg gtgctaaatg aggaagattt taaaaaatat
aattcatcaa 420aacaaggcat aaaaatttgg tccaaaagtt agactttgtt
ttgtggggtt tacacaagtt 480cccttctccc aagaggtttt tacttgtgtc
ttttccgggt gggaaaccac cttatactaa 540gctataatta ccataagtaa
atgatgttta tataattact gagaagtgtt acaaatgata 600taaatgaaat
gattaatgaa aaataaatgc ttacgaggta taatacaact gccttactga
660tttacctcac ctcagaattt cctcgtatag ttctagctgg taattttatt
ctatttagac 720taatgatatc acatttttaa cattttaata tgaccatgac
atactccaga tgtatatgat 780tccattagag ttaaaaatca tttaaatatg
tggaagtgac tattaatata ggacttcact 840gtatattttc atgtctactg
accataattc taaaaatata accccaagtt gctagtactt 900tcagaaaaac
gttgaggtga ggaaagccaa cgacagaggt gaatggagcc taggaagtat
960ctctgaccca atatggaatt cttttggaaa gaatgcctga cacgaggctc
tttgagatgg 1020agaactgaca acatcaaaaa agggcctgat ccacttgctt
aatggattct acttaatatt 1080gtagagccat tcctaacacc attcctaata
ttcataagca cataatttac atccgcacac 1140ataaaaacaa aatagataaa
attaaatcat cccaatgtta actgatactt tatagcttaa 1200aatatgaaac
tgattcatgt aatcatttta tcaaatcata atttaactta catttttatt
1260ttcaggagta ggaatcatca ggttctgaaa aagaaaggaa acaacattca
tttttaatgt 1320attgtaaggt tcataacttt taatataatt cttctgagta
acatggttac ccatttatat 1380attattaaca ctcattactt cattattgat
aatggatctt taaaaactag ccaccaccac 1440caattaccca tgcattttaa
agactgtagg aatcaaaaag aaaattaccc catcgcctat 1500cagccaagtt
cgatgagtgg agagcagtgt caaggtctct gccaccagtc tattcatggg
1560attttctaca gcaaaggcag aaacataggc agccccaaga gctagcaaac
tcaaattcag 1620aagcattgtc atagctctga aatgttcagt gtttgcct
16582015PRTArtificial SequenceDescription of Artificial Sequence
N-terminal peptide 20Phe Ala Val Glu Asn Pro Met Asn Arg Leu Val
Ala Glu Thr Leu1 5 10 1521671DNACanis familiaris 21aggcaaacac
tgaacatttc agagctatga gaatgcttct gaatttgagt ttgctagctc 60ttggggctgc
ctatgtttct gcctttgctg tagaaaatcc catgaataga ctggtggcag
120agaccttgac actgctctcc actcatcgaa cttggctgat aggcgatggg
gtaattttct 180ttttgattcc tacagtcttt aaaatgcatg ggtaattggt
ggtggtggct agtttttaaa 240gatccattat caataatgaa gtaatgagtg
ttaataatat ataatgggta accatgttac 300tcagaagaat tatattaaaa
gttatgaacc ttacaataca ttaaaaatga atgttgtttc 360ctttcttttt
cagaacctga tgattcctac tcctgaaaat aaaaatcacc aactgtgcat
420taaagaagtt tttcagggta tagacacatt gaagaaccaa actgcccacg
gggaggctgt 480ggataaacta ttccaaaact tgtctttaat aaaagaacac
atagagcgcc aaaaaaaaag 540gtgtgcagga gaaagatgga gagtgacaaa
gttcctagac tacctgcaag tatttcttgg 600tgtaataaac accgagtgga
caccggaaag ttgagaacaa accggcttat tgtagtggaa 660gattttggag a 671
* * * * *