U.S. patent application number 11/933002 was filed with the patent office on 2009-04-30 for production of polyketides.
This patent application is currently assigned to Kosan Biosciences, Inc.. Invention is credited to Bryan Julien, Leonard Katz, Chaitan Khosla.
Application Number | 20090111151 11/933002 |
Document ID | / |
Family ID | 46149857 |
Filed Date | 2009-04-30 |
United States Patent
Application |
20090111151 |
Kind Code |
A1 |
Julien; Bryan ; et
al. |
April 30, 2009 |
Production of Polyketides
Abstract
Recombinant host cells of the suborder Cystobacterineae
containing recombinant expression vectors that encode heterologous
PKS genes can produce polyketides synthesized by the PKS enzymes
encoded on those vectors at high levels.
Inventors: |
Julien; Bryan; (Oakland,
CA) ; Katz; Leonard; (Hayward, CA) ; Khosla;
Chaitan; (Palo Alto, CA) |
Correspondence
Address: |
Fox Rothschild LLP;Bristol-Myers Squibb
2000 Market Street, 10th Floor
Philadelphia
PA
19103
US
|
Assignee: |
Kosan Biosciences, Inc.
Hayward
CA
|
Family ID: |
46149857 |
Appl. No.: |
11/933002 |
Filed: |
October 31, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11231735 |
Sep 20, 2005 |
|
|
|
11933002 |
|
|
|
|
10191694 |
Jul 8, 2002 |
7067286 |
|
|
11231735 |
|
|
|
|
09560367 |
Apr 28, 2000 |
6410301 |
|
|
10191694 |
|
|
|
|
09443501 |
Nov 19, 1999 |
6303342 |
|
|
09560367 |
|
|
|
|
60130560 |
Apr 22, 1999 |
|
|
|
60122620 |
Mar 3, 1999 |
|
|
|
60119386 |
Feb 10, 1999 |
|
|
|
60109401 |
Nov 20, 1998 |
|
|
|
Current U.S.
Class: |
435/119 ;
435/252.3; 435/320.1 |
Current CPC
Class: |
C12R 1/01 20130101; C12N
15/52 20130101; C12N 1/20 20130101; C07D 313/00 20130101; C07D
413/06 20130101; C07D 409/06 20130101; C07D 513/08 20130101; C12N
9/00 20130101; C12P 17/16 20130101; C12N 15/74 20130101; C07D
493/04 20130101; C07D 417/06 20130101; C12P 17/181 20130101; C07D
491/04 20130101; C12N 15/1058 20130101; C07D 493/08 20130101; C07D
405/06 20130101 |
Class at
Publication: |
435/119 ;
435/252.3; 435/320.1 |
International
Class: |
C12P 17/18 20060101
C12P017/18; C12N 1/21 20060101 C12N001/21; C12N 15/63 20060101
C12N015/63 |
Goverment Interests
REFERENCE TO GOVERNMENT FUNDING
[0002] This invention was supported in part by SBIR grant
1R43-CA79228-01. The U.S. government has certain rights in this
invention.
Claims
1. A recombinant host cell of the suborder Cystobacterineae
containing a recombinant expression vector that encodes a
heterologous PKS gene and produces a polyketide synthesized by a
PKS enzyme encoded on said vector.
2. The host cell of claim 1 selected from the group consisting of
the genus Myxococcus or and the genus Stigmatella.
3. The host cell of claim 2 that is a Myxococcus host cell.
4. The host cell of claim 2 that is a Stigmatella host cell.
5. The host cell of claim 3 that is selected from the group
consisting of M. stipitatus, M. fulvus, M. xanthus, and M.
virescens.
6. The host cell of claim that is selected from the group
consisting of S. erecta, and S. aurantiaca.
7. The host cell of claim 5 that is Myxococcux xanthus.
8. A recombinant DNA vector capable of chromosomal integration or
extrachromosomal replication in a host cell of claim 1, said vector
comprising at least a portion of a PKS coding sequence and capable
of directing expression of a functional PKS enzyme in said host
cell.
9. A method for producing a polyketide in a host cell of the
suborder Cystobacterineae, which polyketide is not naturally
produced in said host cell, said method comprising culturing a host
cell of claim 1 under conditions such that a PKS gene encoded on
the vector is expressed and said polyketide is produced.
10. The recombinant host cell of claim 1 that produces epothilone
or an epothilone derivative.
11. The host cell of claim 10 that produces epothilones at equal to
or greater than 10 mg/L.
12. The host cell of claim 10 that produces epothilones C and D but
not A and B.
13. The host cell of claim 10 that produces epothilones A and B but
not C and D.
14. The host cell of claim 10 that produces an epothilone
derivative selected from the group consisting of
9-oxo-11-hydroxy-epothilone D; 9-hydroxy-11-oxo-epothilone D; and
9,11-dihydroxy-epothilone D.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. patent application
Ser. No. 09/443,501, filed 19 Nov. 1999; PCT patent application
US99/27438, filed 19 Nov. 1999; and U.S. provisional application
Ser. Nos. 60/130,560, filed 22 Apr. 1999; 60/122,620, filed 3 Mar.
1999; 60/119,386, filed 10 Feb. 1999; and 60/109,401, filed 20 Nov.
1998, each of which is incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention provides recombinant methods and
materials for producing polyketides in recombinant host cells. The
recombinant host cells are from the suborder Cystobacterineae,
preferably from the genera Myxococcus and Stigmatella that have
been transformed with recombinant DNA expression vectors of the
invention that encode modular or iterative polyketide synthase
(PKS) genes. The recombinant host cells produce known and novel
polyketides, including but not limited to epothilone and epothilone
derivatives. The invention relates to the fields of agriculture,
chemistry, medicinal chemistry, medicine, molecular biology, and
pharmacology.
BACKGROUND OF THE INVENTION
[0004] Polyketides constitute a class of structurally diverse
compounds synthesized, at least in part, from two carbon unit
building block compounds through a series of Claisen type
condensations and subsequent modifications. Polyketides include
antibiotics such as tetracycline and erythromycin, anticancer
agents such as epothilone and daunomycin, and immunosuppressants
such as FK506 and rapamycin. Polyketides occur naturally in many
types of organisms, including fungi and mycelial bacteria.
Polyketides are synthesized in vivo by polyketides synthase enzymes
commonly referred to as PKS enzymes. Two major types of PKS are
known that differ in their structure and the manner in which they
synthesize polyketides. These two types are commonly referred to as
Type I or modular and Type II or iterative (aromatic) PKS
enzymes.
[0005] The present invention provides methods and recombinant
expression vectors and host cells for the production of modular or
iterative PKS enzymes and the polyketides produced by those
enzymes. Modular PKS enzymes are typically multi-protein complexes
in which each protein contains multiple active sites, each of which
is used only once during carbon chain assembly and modification.
Iterative PKS enzymes are typically multi-protein complexes in
which each protein contains only one or at most two active sites,
each of which is used multiple times during carbon chain assembly
and modification. As described in more detail below, a large number
of the genes for both modular and aromatic PKS enzymes have been
cloned.
[0006] Modular PKS genes are composed of coding sequences organized
to encode a loading module, a number of extender modules, and a
releasing domain. As described more fully below, each of these
domains and modules corresponds to a polypeptide with one or more
specific functions. Generally, the loading module is responsible
for binding the first building block used to synthesize the
polyketide and transferring it to the first extender module. The
building blocks used to form complex polyketides are typically
acylthioesters, most commonly acetyl, propionyl, malonyl,
methylmalonyl, hydroxymalonyl, methoxymalonyl, and ethylmalonyl
CoA. Other building blocks include amino acid-like acylthioesters.
PKSs catalyze the biosynthesis of polyketides through repeated,
decarboxylative Claisen condensations between the acylthioester
building blocks. Each module is responsible for binding a building
block, performing one or more functions on that building block, and
transferring the resulting compound to the next module. The next
module, in turn, is responsible for attaching the next building
block and transferring the growing compound to the next module
until synthesis is complete. At that point, the releasing domain,
often an enzymatic thioesterase (TE) activity, cleaves the
polyketide from the PKS.
[0007] The polyketide known as 6-deoxyerythronolide B (6-dEB) is
synthesized by a prototypical modular PKS enzyme. The genes, known
as eryAI, eryAII, and eryAIII, that code for the multi-subunit
protein known as deoxyerythronolide B synthase or DEBS (each
subunit is known as DEBS1, DEBS2, or DEBS3) that synthesizes 6-dEB
are described in U.S. Pat. Nos. 5,712,146 and 5,824,513,
incorporated herein by reference.
[0008] The loading module of the DEBS PKS consists of an
acyltransferase (AT) and an acyl carrier protein (ACP). The AT of
the DEBS loading module recognizes propionyl CoA (other loading
module ATs can recognize other acyl-CoAs, such as acetyl, malonyl,
methylmalonyl, or butyryl CoA) and transfers it as a thioester to
the ACP of the loading module. Concurrently, the AT on each of the
six extender modules of DEBS recognizes a methylmalonyl CoA (other
extender module ATs can recognize other CoAs, such as malonyl or
alpha-substituted malonyl CoAs, i.e., malonyl, ethylmalonyl, and
2-hydroxymalonyl CoA) and transfers it to the ACP of that module to
form a thioester. Once DEBS is primed with acyl- and
methylmalonyl-ACPs, the acyl group of the loading module migrates
to form a thioester (trans-esterification) at the KS of the first
extender module; at this stage, module one possesses an acyl-KS
adjacent to a methylmalonyl ACP. The acyl group derived from the
DEBS loading module is then covalently attached to the alpha-carbon
of the extender group to form a carbon-carbon bond, driven by
concomitant decarboxylation, and generating a new acyl-ACP that has
a backbone two carbons longer than the loading unit (elongation or
extension). The growing polyketide chain is transferred from the
ACP to the KS of the next module of DEBS, and the process
continues.
[0009] The polyketide chain, growing by two carbons for each module
of DEBS, is sequentially passed as a covalently bound thioester
from module to module, in an assembly line-like process. The carbon
chain produced by this process alone would possess a ketone at
every other carbon atom, producing a polyketone, from which the
name polyketide arises. Commonly, however, additional enzymatic
activities modify the beta keto group of each two carbon unit just
after it has been added to the growing polyketide chain but before
it is transferred to the next module. Thus, in addition to the
minimal module containing KS, AT, and ACP necessary to form the
carbon-carbon bond, modules may contain a ketoreductase (KR) that
reduces the keto group to an alcohol. Modules may also contain a KR
plus a dehydratase (DH) that dehydrates the alcohol to a double
bond. Modules may also contain a KR, a DH, and an enoylreductase
(ER) that converts the double bond to a saturated single bond using
the beta carbon as a methylene function. The DEBS modules include
those with only a KR domain, only an inactive KR domain, and with
all three KR, DH, and ER domains.
[0010] Once a polyketide chain traverses the final module of a PKS,
it encounters the releasing domain, typically a thioesterase, found
at the carboxyl end of most modular PKS enzymes. Here, the
polyketide is cleaved from the enzyme and, for many but not all
polyketides, cyclized. The polyketide can be modified further by
tailoring or modification enzymes; these enzymes add carbohydrate
groups or methyl groups, or make other modifications, i.e.,
oxidation or reduction, on the polyketide core molecule. For
example, 6-dEB is hydroxylated, methylated, and glycosylated
(glycosidated) to yield the well known antibiotic erythromycin A in
the Saccharopolyspora erythraea cells in which it is produced
naturally.
[0011] While the above description applies generally to modular PKS
enzymes and specifically to DEBS, there are a number of variations
that exist in nature. For example, many PKS enzymes comprise
loading modules that, unlike the loading module of DEBS, comprise
an "inactive" KS domain that functions as a decarboxylase. This
inactive KS is in most instances called KS.sup.Q, where the
superscript is the single-letter abbreviation for the amino acid
(glutamine) that is present instead of the active site cysteine
required for ketosynthase activity. The epothilone PKS loading
module contains a KS.sup.Y domain in which tyrosine has replaced
the cysteine. Moreover, the synthesis of other polyketides begins
with starter units that are unlike those bound by the DEBS or
epothilone loading modules. The enzymes that bind such starter
units can include, for example, an AMP ligase such as that employed
in the biosynthesis of FK520, FK506, and rapamycin, a non-ribosomal
peptide synthase (NRPS) such as that employed in the biosynthesis
of leinamycin, or a soluble CoA ligase.
[0012] Other important variations in PKS enzymes relate to the
types of building blocks incorporated as extender units. As for
starter units, some PKS enzymes incorporate amino acid like
acylthioester building blocks using one or more NRPS modules as
extender modules. The epothilone PKS, for example, contains an NRPS
module. Another such variation is found in the FK506, FK520, and
rapamycin PKS enzymes, which contain an NRPS that incorporates a
pipecolate residue and also serves as the releasing domain of the
PKS. Yet another variation relates to additional activities in an
extender module. For example, one module of the epothilone PKS
contains a methyltransferase (MT) domain, which incorporates a
methyl group into the polyketide.
[0013] Recombinant methods for manipulating modular and iterative
PKS genes that take advantage of the organization of those genes
and the multiple enzymatic activities they encode are described in
U.S. Pat. Nos. 5,672,491; 5,712,146; 5,830,750; and 5,843,718; and
in PCT patent publication Nos. 98/49315 and 97/02358, each of which
is incorporated herein by reference. These and other patents
describe recombinant expression vectors for the heterologous
production of polyketides as well as recombinant PKS genes
assembled by combining parts of two or more different PKS genes
that produce novel polyketides. To date, such methods have been
used to produce known or novel polyketides in organisms such as
Streptomyces, which naturally produce polyketides, and E. coli and
yeast, which do not naturally produce polyketides (see U.S. Pat.
No. 6,033,883, incorporated herein by reference). In the latter
hosts, polyketide production is dependent on the heterologous
expression of a phosphopantetheinyl transferase, which activates
the ACP domains of the PKS (see PCT publication No. 97/13845,
incorporated herein by reference).
[0014] While such methods are valuable and highly useful, certain
polyketides are expressed only at very low levels or are toxic to
the heterologous host cell employed. As an example, the anticancer
agent epothilone was produced in Streptomyces by heterologous
expression of the epothilone PKS genes (Tang et al., 28 Jan. 2000,
Cloning and heterologous expression of the epothilone gene cluster,
Science, 287:640-642, and U.S. patent application Ser. No.
09/443,501, filed 19 Nov. 1999, each of which is incorporated
herein by reference). However, the production of epothilone was
only about 50 to 100 .mu.g/L and appeared to have a deleterious
effect on the producer cells.
[0015] The epothilones were first identified as an antifungal
activity extracted from the myxobacterium Sorangium cellulosum (see
K. Gerth et al., 1996, J. Antibiotics 49: 560-563 and Germany
Patent No. DE 41 38 042, each of which is incorporated herein by
reference) and later-found to have activity in a tubulin
polymerization assay (see Bollag et al., 1995, Cancer Res.
55:2325-2333, incorporated herein by reference). The epothilones
have since been extensively studied as potential antitumor agents
for the treatment of cancer. The chemical structure of the
epothilones-produced by Sorangium cellulosum strain So ce 90 was
described in Hofle et al., 1996, Epothilone A and B--novel
16-membered macrolides with cytotoxic activity: isolation, crystal
structure, and conformation in solution, Angew. Chem. Int. Ed.
Engl. 35(13/14): 1567-1569, incorporated herein by reference. The
strain was found to produce two epothilone compounds, designated A
(R.dbd.H) and B (R.dbd.CH.sub.3), as shown below, which showed
broad cytotoxic activity against eukaryotic cells and noticeable
activity and selectivity against breast and colon tumor cell
lines.
##STR00001##
The desoxy counterparts of epothilones A and B, also known as
epothilones C(R.dbd.H) and D (R.dbd.CH.sub.3), are known to be less
cytotoxic, and the structures of these epothilones are shown
below.
##STR00002##
Two other naturally occurring epothilones have been described.
These are epothilones E and F, in which the methyl side chain of
the thiazole moiety of epothilones A and B has been hydroxylated to
yield epothilones E and F, respectively.
[0016] Because of the potential for use of the epothilones as
anticancer agents, and because of the low levels of epothilone
produced by the native So ce 90 strain, a number of research teams
undertook the effort to synthesize the epothilones. This effort has
been successful (see Balog et al., 1996, Total synthesis of
(-)-epothilone A, Angew. Chem. Int. Ed. Engl. 35(23/24): 2801-2803;
Su et al., 1997, Total synthesis of (-)-epothilone B: an extension
of the Suzuki coupling method and insights into structure-activity
relationships of the epothilones, Angew. Chem. Int. Ed. Engl.
36(7): 757-759; Meng et al., 1997, Total syntheses of epothilones A
and B, JACS 119(42): 10073-10092; and Balog et al., 1998, A novel
aldol condensation with 2-methyl-4-pentenal and its application to
an improved total synthesis of epothilone B, Angew. Chem. Int. Ed.
Engl. 37(19): 2675-2678, each of which is incorporated herein by
reference). Despite the success of these efforts, the chemical
synthesis of the epothilones is tedious, time-consuming, and
expensive. Indeed, the methods have been characterized as
impractical for the full-scale pharmaceutical development of an
epothilone.
[0017] A number of epothilone derivatives, as well as epothilones
A-D, have been studied in vitro and in vivo (see Su et al., 1997,
Structure-activity relationships of the epothilones and the first
in vivo comparison with paclitaxel, Angew. Chem. Int. Ed. Engl.
36(19): 2093-2096; and Chou et al., August 1998, Desoxyepothilone
B: an efficacious microtubule-targeted antitumor agent with a
promising in vivo profile relative to epothilone B, Proc. Natl.
Acad. Sci. USA 95: 9642-9647, each of which is incorporated herein
by reference). Additional epothilone derivatives and methods for
synthesizing epothilones and epothilone derivatives are described
in PCT patent publication Nos. 00/00485, 99/67253, 99/67252,
99/65913, 99/54330, 99/54319, 99/54318, 99/43653, 99/43320,
99/42602, 99/40047, 99/27890, 99/07692, 99/02514, 99/01124,
98/25929, 98/22461, 98/08849, and 97/19086; U.S. Pat. No.
5,969,145; and Germany patent publication No. DE 41 38 042, each of
which is incorporated herein by reference.
[0018] There remains a need for economical means to produce not
only the naturally occurring epothilones but also the derivatives
or precursors thereof, as well as new epothilone derivatives with
improved properties. There remains a need for a host cell that
produces epothilones or epothilone derivatives that is easier to
manipulate and ferment than the natural producer Sorangium
cellulosum yet produces more of the desired polyketide product. The
present invention meets these by providing host cells that produce
polyketides at high levels and are useful in the production of not
only epothilones, including new epothilone derivatives described
herein, but also other polyketides.
SUMMARY OF THE INVENTION
[0019] In one embodiment, the present invention provides
recombinant host cells of the suborder Cystobacterineae containing
recombinant expression vectors that encode heterologous PKS genes
and produce polyketides synthesized by the PKS enzymes encoded on
those vectors. In a preferred embodiment, the host cells are from
the genus Myxococcus or the genus Stigmatella. In especially
preferred embodiments, the host cells are selected from the group
consisting of M. stipitatus, M. fulvus, M. xanthus, M. virescens,
S. erects, and S. aurantiaca.
[0020] In another embodiment, the present invention provides
recombinant DNA vectors capable of chromosomal integration or
extrachromosomal replication in the host cells of the invention.
The vectors of the invention comprise at least a portion of a PKS
coding sequence and are capable of directing expression of a
functional PKS enzyme in the host cells of the invention.
[0021] In another embodiment, the present invention provides a
method for producing a polyketide in a host cell of the suborder
Cystobacterineae, which polyketide is not naturally produced in
said host cell, said method comprising culturing the host cell
transformed with a recombinant DNA vector of the invention under
conditions such that a PKS gene encoded on the vector is expressed
and said polyketide is produced.
[0022] In a preferred embodiment, the recombinant host cell of the
invention produces epothilone or an epothilone derivative. Thus,
the present invention provides recombinant host cells that produce
a desired epothilone or epothilone derivative. In a preferred
embodiment, the host cell produces the epothilones at equal to or
greater than 10 mg/L. In one embodiment, the invention provides
host cells that produce one or more of the epothilones or
epothilone derivatives at higher levels than produced in the
naturally occurring organisms that produce epothilones. In another
embodiment, the invention provides host cells that produce mixtures
of epothilones that are less complex than the mixtures produced by
naturally occurring host cells that produce epothilones.
[0023] In an especially preferred embodiment, the host cells of the
invention produce less complex mixtures of epothilones than do
naturally occurring cells that produce epothilones. Naturally
occurring cells that produce epothilones typically produce a
mixture of epothilones A, B, C, D, E, and F. The table below
summarizes the epothilones produced in different illustrative host
cells of the invention.
TABLE-US-00001 Cell Type Epothilones Produced Epothilones Not
Produced 1 A, B, C, D E, F 2 A, C B, D, E, F 3 B, D A, C, E, F 4 B
A, C, D, E, F 5 D A, B, C, E, F
Thus, the recombinant host cells of the invention also include host
cells that produce only one desired epothilone or epothilone
derivative.
[0024] In a related preferred embodiment, the invention provides
recombinant DNA expression vectors that encode all or a portion of
the epothilone PKS. Thus, the present invention provides
recombinant DNA expression vectors that encode the proteins
required to produce epothilones A, B, C, and D in the host cells of
the invention. The present invention also provides recombinant DNA
expression vectors that encode portions of these proteins. The
present invention also provides recombinant DNA compounds that
encode a hybrid protein, which hybrid protein includes all or a
portion of a protein involved in epothilone biosynthesis and all or
a portion of a protein involved in the biosynthesis of another
polyketide or non-ribosomal-derived peptide.
[0025] In another embodiment, the present invention provides novel
epothilone derivative compounds in substantially pure form useful
in agriculture, veterinary practice, and medicine. In one
embodiment, the compounds are useful as fungicides. In another
embodiment, the compounds are useful in cancer chemotherapy. In a
preferred embodiment, the compound is an epothilone derivative that
is at least as potent against tumor cells as epothilone B or D. In
another embodiment, the compounds are useful as immunosuppressants.
In another embodiment, the compounds are useful in the manufacture
of another compound. In a preferred embodiment, the compounds are
formulated in a mixture or solution for administration to a human
or animal.
[0026] In another embodiment, the present invention provides a
method of treating cancer, which method comprises administering a
therapeutically effective amount of a novel epothilone compound of
the invention.
[0027] These and other embodiments of the invention are described
in more detail in the following description, the examples, and
claims set forth below.
BRIEF DESCRIPTION OF THE FIGURES
[0028] FIG. 1 shows a number of precursor compounds to N-acetyl
cysteamine thioester derivatives that can be supplied to an
epothilone PKS of the invention in which the NRPS-like module one
or module 2 KS domain has been inactivated to produce a novel
epothilone derivative. A general synthetic procedure for making
such compounds is also shown.
[0029] FIG. 2 shows restriction site and function maps of plasmids
pKOS35-82.1 and pKOS35-82.2.
[0030] FIG. 3 shows restriction site and function maps of plasmids
pKOS35454 and pKOS90-22.
[0031] FIG. 4 shows a schematic of a protocol for introducing the
epothilone PKS and modification enzyme genes into the chromosome of
a Myxococcus xanthus host cell as described in Example 3.
DETAILED DESCRIPTION OF THE INVENTION
[0032] In one embodiment, the present invention provides
recombinant host cells of the suborder Cystobacterineae containing
recombinant expression vectors that encode heterologous PKS genes
and produce polyketides synthesized by the PKS enzymes encoded on
those vectors. As used herein, the term recombinant refers to a
compound or composition produced by human intervention, typically
by specific and directed manipulation of a gene or portion thereof.
The suborder Cystobacterineae is one of two (the other is
Sorangineae, which includes the epothilone producer Sorangium
cellulosum) in the order Myxococcales. The suborder
Cystobacterineae includes the family Myxococcaceae and the family
Cystobacteraceae. The family Myxococcacceae includes the genus
Angiococcus (i.e., A. disciformis), the genus Myxococcus, and the
genus Corallococcus (i.e., C. macrosporus, C. corralloides, and C.
exiguus). The family Cystobacteraceae includes the genus
Cystobacter (i.e., C. fuscus, C. ferrugineus, C. minor, C. velatus,
and C. violaceus), the genus Melittangium (i.e., M. boletus and M.
lichenicola), the genus Stigmatella (i.e., S. erecta and S.
aurantiaca), and the genus Archangium (i.e., A. gephyra).
Especially preferred host cells of the invention are those that
produce a polyketide at equal to or greater than 10 to 20 mg/L,
more preferably at equal to or greater than 100 to 200 mg/L, and
most preferably at equal to or greater than 1 to 2 g/L.
[0033] In a preferred embodiment, the host cells of the invention
are from the genus Myxococcus or the genus Stigmatella. In
especially preferred embodiments, the host cells are selected from
the group consisting of M. stipitatus, M. fulvus, M. xanthus, M.
virescens, S. erecta, and S. aurantiaca. Especially preferred
Myxococcus host cells of the invention are those that produce a
polyketide at equal to or greater than 10 to 20 mg/L, more
preferably at equal to or greater than 100 to 200 mg/L, and most
preferably at equal to or greater than 1 to 2 g/L. Especially
preferred are M. xanthus host cells that produce at these levels.
M. xanthus host cells that can be employed for purposes of the
invention include the DZ1 cell line (Campos et al., 1978, J. Mol.
Biol. 119:167-178, incorporated herein by reference), the
TA-producing cell line ATCC 31046, the DK1219 cell line (Hodgkin
and Kaiser, 1979, Mol. Gen. Genet. 171:177-191, incorporated herein
by reference), and the DK1622 cell line (Kaiser, 1979, Proc. Natl.
Acad. Sci. USA 76: 5952-5956, incorporated herein by
reference).
[0034] The host cells of the invention comprise a recombinant DNA
expression vector, and in another embodiment, the present invention
provides recombinant DNA vectors capable of chromosomal integration
or extrachromosomal replication in these host cells. The vectors of
the invention comprise at least a portion of a PKS coding sequence
and are capable of directing expression of a functional PKS enzyme
in the host cells of the invention. As used herein, the term
expression vector refers to any nucleic acid that can be introduced
into a host cell. An expression vector can be maintained stably or
transiently in a cell, whether as part of the chromosomal or other
DNA in the cell or in any cellular compartment, such as a
replicating vector in the cytoplasm. An expression vector also
comprises a gene that serves to direct the synthesis RNA that is
translated into a polypeptide in the cell or cell extract. Thus,
the vector either includes a promoter to enhance gene expression or
is integrated into a site in the chromosome such that gene
expression is obtained. Furthermore, expression vectors typically
contain additional functional elements, such as
resistance-conferring genes to act as selectable markers and
regulatory genes to enhance promoter activity.
[0035] Typically, the expression vector will comprise one or more
marker genes by which host cells containing the vector can be
identified and/or selected. Illustrative antibiotic resistance
conferring genes for use in vectors of the invention include the
ermE (confers resistance to erythromycin and lincomycin), tsr
(confers resistance to thiostrepton), aadA (confers resistance to
spectinomycin and streptomycin), aacC4 (confers resistance to
apramycin, kanamycin, gentamicin, geneticin (G418), and neomycin),
hyg (confers resistance to hygromycin), and vph (confers resistance
to viomycin) resistance conferring genes. Selectable markers for
use in Myxococcus xanthus include kanamycin, tetracycline,
chloramphenicol, zeocin, spectinomycin, and streptomycin resistance
conferring genes.
[0036] The various components of an expression vector can vary
widely, depending on the intended use of the vector. In particular,
the components depend on the host cell(s) in which the vector will
be used and the manner in which it is intended to function. For
example, certain preferred vectors of the invention are integrating
vectors: the vectors integrate into the chromosomal DNA of the host
cell. Such vectors can comprise a phage attachment site or DNA
segments complementary to segments of the host cell chromosomal DNA
to direct integration. Moreover, and as exemplified herein, a
series of such vectors can be used to build the PKS gene cluster in
the host cell, with each vector comprising only a portion of the
complete PKS gene cluster. Thus, the recombinant DNA expression
vectors of the invention may comprise only a portion of a PKS gene.
Homologous recombination can also be used to delete, disrupt, or
alter a gene, including a heterologous PKS gene previously
introduced into the host cell.
[0037] In a preferred embodiment, the present invention provides
expression vectors and recombinant Myxococcus, preferably M.
xanthus, host cells containing those expression vectors that
produce a polyketide. Presently, vectors that replicate
extrachromosomally in M. xanthus are not known. There are, however,
a number of phage known to integrate into M. xanthus chromosomal
DNA, including Mx8, Mx9, Mx81, and Mx82. The integration and
attachment functions of these phages can be placed on plasmids to
create phage-based expression vectors that integrate into the M.
xanthus chromosomal DNA. Of these, phage Mx9 and Mx8 are preferred
for purposes of the present invention. Plasmid pPLH343, described
in Salmi et al., February 1998, Genetic determinants of immunity
and integration of temperate Myxococcus xanthus phage Mx8, J. Bact.
180(3): 614-621, is a plasmid that replicates in E. coli and
comprises the phage Mx8 genes that encode the attachment and
integration functions.
[0038] A wide variety of promoters are available for use in the
preferred Myxococcus expression vectors of the invention. See
Example 8, below. For example, the promoter of the epothilone PKS
gene (see U.S. patent application Ser. No. 09/443,501, filed 19
Nov. 1999, incorporated herein by reference) functions in M.
xanthus host cells. The promoter can be used to drive expression of
one or more epothilone PKS genes or another PKS gene product in
recombinant host cells. Another preferred promoter for use in
Myxococcus xanthus host cells for purposes of expressing a
recombinant PKS of the invention is the promoter of the pilA gene
of M. xanthus. This promoter, as well as two M. xanthus strains
that express high levels of gene products from genes controlled by
the pilA promoter, a pilA deletion strain and a pilS deletion
strain, are described in Wu and Kaiser, December 1997, Regulation
of expression of the pilA gene in Myxococcus xanthus, J. Bact.
179(24):7748-7758, incorporated herein by reference. The invention
present invention also provides recombinant Myxococcus host cells
comprising both the pilA and pilS deletions. Another preferred
promoter is the starvation dependent promoter of the sdcK gene.
[0039] The present invention provides preferred expression vectors
for use in preparing the recombinant Myxococcus xanthus expression
vectors and host cells of the invention. These vectors, designated
plasmids pKOS35-82.1 and pKOS35-82.2 (FIG. 2), are able to
replicate in E. coli host cells as well as integrate into the
chromosomal DNA of M. xanthus. The vectors comprise the Mx8
attachment and integration genes as well as the pilA promoter with
restriction enzyme recognition sites placed conveniently
downstream. The two vectors differ from one another merely in the
orientation of the pilA promoter on the vector and can be readily
modified to include the epothilone PKS and modification enzyme
genes of the invention. The construction of the vectors is
described in Example 1.
[0040] In another embodiment, the present invention provides a
method for producing a polyketide in a host cell of the suborder
Cystobacterineae, which polyketide is not naturally produced in
said host cell, said method comprising culturing the host cell
transformed with a recombinant DNA vector of the invention under
conditions such that a PKS gene encoded on the vector is expressed
and said polyketide is produced. With this method, any of the
diverse members of the polyketides produced by modular PKS enzymes
can be prepared. In addition, novel polyketides derived from hybrid
or other recombinant PKS genes can also be prepared using this
method. In a preferred embodiment, the PKS genes encode a modular
PKS.
[0041] A large number of modular PKS genes have been cloned and are
immediately available for use in the vectors and methods of the
invention. The polyketides produced by PKS enzymes are often
further modified by polyketide modification enzymes, called
tailoring enzymes, that hydroxylate, epoxidate, methylate, and
glycosylate the polyketide product of the PKS. In accordance with
the methods of the invention, these genes can also be introduced
into the host cell to prepare a modified polyketide of interest.
The following Table lists references describing illustrative PKS
genes and corresponding enzymes that can be utilized in the
construction of the recombinant PKSs and the corresponding DNA
compounds that encode them of the invention. Also presented are
various references describing polyketide tailoring and modification
enzymes and corresponding genes that can be employed to make the
recombinant DNA compounds of the present invention.
PKS and Polyketide Tailoring Enzyme Genes
Avermectin
[0042] U.S. Pat. No. 5,252,474; U.S. Pat. No. 4,703,009; and EP
Pub. No. 118,367 to Merck.
[0043] MacNeil et al., 1993, Industrial Microorganisms: Basic and
Applied Molecular Genetics, Baltz, Hegeman, & Skatrud, eds.
(ASM), pp. 245-256, A Comparison of the Genes Encoding the
Polyketide Synthases for Avermectin, Erythromycin, and
Nemadectin.
[0044] MacNeil et al., 1992, Gene 115: 119-125, Complex
Organization of the Streptomyces avermtilis genes encoding the
avermectin polyketide synthase.
[0045] Ikeda and Omura, 1997, Chem. Res. 97: 2599-2609, Avermectin
biosynthesis.
Candicidin (FR008)
[0046] Hu et al., 1994. Mol. Microbiol. 14: 163-172.
Epothilone
[0047] PCT Pub. No. 99/66028 to Novartis.
[0048] PCT Pat. App. No. US99/27438 to Kosan.
Erythromycin
[0049] PCT Pub. No. 93/13663; U.S. Pat. No. 6,004,787; and U.S.
Pat. No. 5,824,513 to Abbott.
[0050] Donadio et al., 1991, Science 252:675-9.
[0051] Cortes et al., 8 Nov. 1990, Nature 348:1768, An unusually
large multifunctional polypeptide in the erythromycin producing
polyketide synthase of Saccharopolyspora erythraea.
[0052] Glycosylation Enzymes
[0053] PCT Pub. No. 97/23630 and U.S. Pat. No. 5,998,194 to
Abbott.
FK-506
[0054] Motamedi et al., 1998, The biosynthetic gene cluster for the
macrolactone ring of the immunosuppressant FK-506, Eur. J. biochem.
256: 528-534.
[0055] Motamedi et al., 1997, Structural organization of a
multifunctional polyketide synthase involved in the biosynthesis of
the macrolide immunosuppressant FK-506, Eur. J. Biochem. 244:
74-80.
[0056] Methyltransferase
[0057] U.S. Pat. No. 5,264,355 and U.S. Pat. No. 5,622,866 to
Merck.
[0058] Motamedi et al., 1996, Characterization of methyltransferase
and hydroxylase genes involved in the biosynthesis of the
immunosuppressants FK-506 and FK-520, J. Bacteriol. 178:
5243-5248.
FK-520
[0059] PCT Pub. No. 00/20601 and U.S. patent application Ser. No.
09/410,551, filed 1 Oct. 1999 to Kosan.
[0060] Nielsen et al., 1991, Biochem. 30:5789-96.
Lovastatin
[0061] U.S. Pat. No. 5,744,350 to Merck.
Narbomycin
[0062] U.S. patent application Ser. No. 09/434,288, filed 5 Nov.
1999 to Kosan.
Nemadectin
[0063] MacNeil et al., 1993, supra.
Niddamycin
[0064] PCT Pub. No. 98/51695 to Abbott.
[0065] Kakavas et al., 1997, Identification and characterization of
the niddamycin polyketide synthase genes from Streptomyces
caelestis, J. Bacteriol. 179: 7515-7522.
Oleandomycin
[0066] Swan et al., 1994, Characterisation of a Streptomyces
antibioticus gene encoding a type I polyketide synthase which has
an unusual coding sequence, Mol. Gen. Genet. 242: 358-362.
[0067] U.S. patent application Ser. No. 09/428,517, filed 28 Oct.
1999 to Kosan.
[0068] Olano et al., 1998, Analysis of a Streptomyces antibioticus
chromosomal region involved in oleandomycin biosynthesis, which
encodes two glycosyltransferases responsible for glycosylation of
the macrolactone ring, Mol. Gen. Genet. 259(3): 299-308.
[0069] PCT Pat. App. Pub. No. WO 99/05283 to Hoechst.
Picromycin
[0070] PCT Pub. No. 99/61599 to Kosan.
[0071] PCT Pub. No. 00/00620 to the University of Minnesota.
[0072] Xue et al., 1998, Hydroxylation of macrolactones YC-17 and
narbomycin is mediated by the pikC-encoded cytochrome P450 in
Streptomyces venezuelae, Chemistry & Biology 5(11):
661-667.
[0073] Xue et al., Oct. 1998, A gene cluster for macrolide
antibiotic biosynthesis in Streptomyces venezuelae: Architecture of
metabolic diversity, Proc. Natl. Acad. Sci. USA 95:12111 12116.
Platenolide
[0074] EP Pub. No. 791,656; and U.S. Pat. No. 5,945,320 to
Lilly.
Rapamycin
[0075] Schwecke et al., August 1995, The biosynthetic gene cluster
for the polyketide rapamycin, Proc. Natl. Acad. Sci. USA
92:7839-7843.
[0076] Aparicio et al., 1996, Organization of the biosynthetic gene
cluster for rapamycin in Streptomyces hygroscopicus: analysis of
the enzymatic domains in the modular polyketide synthase, Gene
169:9-16.
Rifamycin
[0077] PCT Pub. No. WO 98/07868 to Novartis.
[0078] August et al., 13 Feb. 1998, Biosynthesis of the ansamycin
antibiotic rifamycin: deductions from the molecular analysis of the
rif biosynthetic gene cluster of Amycolatopsis mediterranei S669,
Chemistry & Biology, 5(2): 69-79.
Sorangium PKS
[0079] U.S. patent application Ser. No. 09/144,085, filed 31 Aug.
1998 to Kosan.
Soraphen
[0080] U.S. Pat. No. 5,716,849 to Novartis.
[0081] Schupp et al., 1995, J. Bacteriology 177: 3673-3679. A
Sorangium cellulosum (Myxobacterium) Gene Cluster for the
Biosynthesis of the Macrolide Antibiotic Soraphen A: Cloning,
Characterization, and Homology to Polyketide Synthase Genes from
Actinomycetes.
Spinocyn
[0082] PCT Pub. No. 99/46387 to DowElanco.
Spiramycin
[0083] U.S. Pat. No. 5,098,837 to Lilly.
[0084] Activator Gene
[0085] U.S. Pat. No. 5,514,544 to Lilly.
Tylosin
[0086] U.S. Pat. No. 5,876,991; U.S. Pat. No. 5,672,497; U.S. Pat.
No. 5,149,638; EP Pub. No. 791,655; and EP Pub. No. 238,323 to
Lilly.
[0087] Kuhstoss et al., 1996, Gene 183:231-6., Production of a
novel polyketide through the construction of a hybrid polyketide
synthase.
[0088] Tailoring Enzymes
[0089] Merson-Davies and Cundliffe, 1994, Mol. Microbiol. 13:
349-355. Analysis of five tylosin biosynthetic genes from the tylBA
region of the Streptomyces fradiae genome.
Any of the above genes, with or without the genes for polyketide
modification, if any, can be employed in the recombinant DNA
expression vectors of the invention. Moreover, the host cells of
the invention can be constructed by transformation with multiple
vectors, each containing a portion of the desired PKS and
modification enzyme gene cluster; see U.S. Pat. No. 6,033,883,
incorporated herein by reference.
[0090] For improved production of a polyketide in a host cell of
the invention, including Myxococcus host cells, one can also
transform the cell to express a heterologous phosphopantetheinyl
transferase. PKS proteins require phosphopantetheinylation of the
ACP domains of the loading and extender modules as well as of the
PCP domain of any NRPS. Phosphopantetheinylation is mediated by
enzymes called phosphopantetheinyl transferases (PPTases). To
produce functional PKS enzyme in host cells that do not naturally
express a PPTase able to act on the desired PKS enzyme or to
increase amounts of functional PKS enzyme in host cells in which
the PPTase is limiting, one can introduce a heterologous PPTase,
including but not limited to Sfp, as described in PCT Pub. Nos.
97/13845 and 98/27203, and U.S. patent application Ser. No.
08/728,742, filed 11 Oct. 1996, and U.S. Pat. No. 6,033,883, each
of which is incorporated herein by reference.
[0091] The host cells of the invention can be used not only to
produce a polyketide found in nature but also to produce
polyketides produced from recombinant PKS genes and modification
enzymes. In one important embodiment, the present invention
provides recombinant DNA expression vectors that comprise a hybrid
PKS. For purposes of the present invention a hybrid PKS is a
recombinant PKS that comprises all or part of one or more extender
modules, loading module, and thioesterase/cyclase domain of a first
PKS and all or part of one or more extender modules, loading
module, and thioesterase/cyclase domain of a second PKS.
[0092] Those of skill in the art will recognize that all or part of
either the first or second PKS in a hybrid PKS of the invention
need not be isolated from a naturally occurring source. For
example, only a small portion of an AT domain determines its
specificity. See U.S. patent application Ser. No. 09/346,860 and
PCT Pub. No. 00/01838, each of which is incorporated herein by
reference. The state of the art in DNA synthesis allows the artisan
to construct de novo DNA compounds of size sufficient to construct
a useful portion of a PKS module or domain. For purposes of the
present invention, such synthetic DNA compounds are deemed to be a
portion of a PKS.
[0093] As the above Table illustrates, there are a wide variety of
PKS genes that serve as readily available sources of DNA and
sequence information for use in constructing the hybrid
PKS-encoding DNA compounds of the invention. Methods for
constructing hybrid PKS-encoding DNA compounds are described in
U.S. Pat. Nos. 6,022,731; 5,672,491; and 5,712,146 and U.S. patent
application Ser. No. 09/073,538, filed 6 May 1998, and 09/141,908,
filed 28 Aug. 1998, each of which is incorporated herein by
reference. The hybrid PKS-encoding DNA compounds of the invention
can be and often are hybrids of more than two PKS genes. Even where
only two genes are used, there are often two or more modules in the
hybrid gene in which all or part of the module is derived from a
second (or third) PKS gene. Those of skill in the art will
appreciate that a hybrid PKS of the invention includes but is not
limited to a PKS of any of the following types: (i) a PKS that
contains a module in which at least one of the domains is from a
heterologous module; (ii) a PKS that contains a module from a
heterologous PKS; (iii) a PKS that contains a protein from a
heterologous PKS; and (iv) combinations of the foregoing.
[0094] Hybrid PKS enzymes of the invention are often constructed by
replacing coding sequences for one or more domains of a module from
a first PKS with coding sequences for one or more domains of a
module from a second PKS to construct a recombinant coding
sequence. Generally, any reference herein to inserting or replacing
a KR, DH, and/or ER domain includes the replacement of the
associated KR, DH, or ER domains in that module, typically with
corresponding domains from the module from which the inserted or
replacing domain is obtained. The KS and/or ACP of any module can
also be replaced, if desired or beneficial, with another KS and/or
ACP. In each of these replacements or insertions, the heterologous
KS, AT, DH, KR, ER, or ACP coding sequence can originate from a
coding sequence from another module of the same or different PKS or
from chemical synthesis to obtain the hybrid PKS coding
sequence.
[0095] While an important embodiment of the present invention
relates to hybrid PKS genes, the present invention also provides
recombinant PKS genes in which there is no second PKS gene sequence
present but which differ from a naturally occurring PKS gene by one
or more deletions. The deletions can encompass one or more modules
or domains and/or can be limited to a deletion within one or more
modules or domains. When a deletion encompasses an entire extender
module (other than an NRPS module), the resulting polyketide
derivative is at least two carbons shorter than the compound
produced from the PKS from which the deleted version was derived.
The deletion can also encompass an NRPS module and/or a loading
module. When a deletion is within a module, the deletion typically
encompasses a KR, DH, or ER domain, or both DH and ER domains, or
both KR and DH domains, or all three KR, DH, and ER domains.
[0096] To construct any PKS of the invention, one can employ a
technique, described in PCT Pub. No. 98/27203 and U.S. Pat. No.
6,033,883, each of which is incorporated herein by reference, in
which the various genes of the PKS and optionally genes for one or
more polyketide modification enzymes are divided into two or more,
often three, segments, and each segment is placed on a separate
expression vector (see also, U.S. patent application Ser. No.
09/______, filed 14 Apr. 2000 (attorney docket no. 30062-20041,
which claims priority to Ser. No. 60/129,731, filed 16 Apr. 1999,
both of which are incorporated herein by reference). In this
manner, the full complement of genes can be assembled and
manipulated more readily for heterologous expression, and each of
the segments of the gene can be altered, and various altered
segments can be combined in a single host cell to provide a
recombinant PKS gene of the invention. This technique makes more
efficient the construction of large libraries of recombinant PKS
genes, vectors for expressing those genes, and host cells
comprising those vectors. In this and other contexts, the genes
encoding the desired PKS not only can be present on two or more
vectors, but also can be ordered or arranged differently from that
which exists in the native producer organism from which the genes
were derived.
[0097] In a preferred and illustrative embodiment, the recombinant
host cell of the invention produces epothilone or an epothilone
derivative. The epothilones (epothilone A, B, C, D, E, and F) and
compounds structurally related thereto (epothilone derivatives) are
potent cytotoxic agents specific for eukaryotic cells. These
compounds have application as anti-fungals, cancer
chemotherapeutics, and immunosuppressants. The epothilones are
produced at very low levels in the naturally occurring Sorangium
cellulosum cells in which they have been identified. Moreover, S.
cellulosum is very slow growing, and fermentation of S. cellulosum
strains is difficult and time-consuming. One important benefit
conferred by the present invention is the ability simply to produce
an epothilone or epothilone derivative in a non-S; cellulosum host
cell. Another advantage of the present invention is the ability to
produce the epothilones at higher levels and in greater amounts in
the recombinant host cells provided by the invention than possible
in the naturally occurring epothilone producer cells. Yet another
advantage is the ability to produce an epothilone derivative in a
recombinant host cell. Thus, the present invention provides
recombinant host cells that produce a desired epothilone or
epothilone derivative. In a preferred embodiment, the host cell
produces the epothilones at equal to or greater than 10 mg/L. In
one embodiment, the invention provides host cells that produce one
or more of the epothilones or epothilone derivatives at higher
levels than produced in the naturally occurring organisms that
produce epothilones. In another embodiment, the invention provides
host cells that produce mixtures of epothilones that are less
complex than the mixtures produced by naturally occurring host
cells that produce epothilones.
[0098] In an especially preferred embodiment, the host cells of the
invention produce less complex mixtures of epothilones than do
naturally occurring cells that produce epothilones. Naturally
occurring cells that produce epothilones typically produce a
mixture of epothilones A, B, C, D, E, and F. The table below
summarizes the epothilones produced in different illustrative host
cells of the invention.
TABLE-US-00002 Cell Type Epothilones Produced Epothilones Not
Produced 1 A, B, C, D E, F 2 A, C B, D, E, F 3 B, D A, C, E, F 4 B
A, C, D, E, F 5 D A, B, C, E, F
Thus, the recombinant host cells of the invention also include host
cells that produce only one desired epothilone or epothilone
derivative.
[0099] An analysis of the domains of the epothilone PKS suggests
that the PKS enzyme catalyzes the production of epothilones G and
H, which differ from one another in that epothilone G has a
hydrogen at C-12 and epothilone H has a methyl group at that
position. The variance at the C-12 position is predicted to arise
from the ability of the corresponding AT domain (extender module 4)
of the PKS to bind either malonyl CoA, leading to hydrogen, or
methylmalonyl CoA, leading to methyl. However, epothilones G and H
have not been observed in nature or in the recombinant host cells
of the invention; instead, the products of the PKS appear to be
epothilones C and D, which differ from epothilones G and H,
respectively, by having a C-12 to C-13 double bond and lacking a
C-13 hydroxyl substituent. Thus, the dehydration reaction that
would form epothilones C and D from epothilones G and H may be
carried out by the epothilone PKS itself or by another enzymatic
activity that is present in the host cells in which the epothilones
have been produced to date. Epothilones A and B are formed from
epothilones C and D, respectively, by epoxidation of the C-12 to
C-13 double bond by the epoK gene product. Epothilones E and F are
formed from epothilones A and B, respectively, by hydroxylation of
the C-21 methyl group.
[0100] Thus expression of the epothilone PKS genes and the epoK
gene in a host cell of the invention leads to the production of
epothilones A, B, C, and D. If the epoK gene is not present or is
rendered inactive by mutation, then only epothilones C and D are
produced. If the AT domain of extender module 4 is replaced by an
AT domain specific for malonyl Co A, then epothilones A and C only
are produced, and if there is no functional epoK gene, then only
epothilone C is produced. If the AT domain of extender module 4 is
replaced by an AT domain specific for methylmalonyl Co A, then
epothilones B and D only are produced, and if there is no
functional epoK gene, then only epothilone D is produced.
[0101] The epothilone PKS and modification enzyme genes were cloned
from the epothilone producing strain, Sorangium cellulosum SMP44.
Total DNA was prepared from this strain using the procedure
described by Jaoua et al., 1992, Plasmid 28:157-165, incorporated
herein by reference. A cosmid library was prepared from S.
cellulosum genomic DNA in pSupercos (Stratagene). The entire PKS
and modification enzyme gene cluster was isolated in four
overlapping cosmid clones (deposited with the American Type Culture
Collection (ATCC), Manassas, Va., USA, and assigned ATCC accession
numbers as follows pKOS35-70.1A2 (ATCC 203782), pKOS35-70.4 (ATCC
203781), pKOS35-70.8A3 (ATCC 203783), and pKOS35-79.85 (ATCC
203780)) and the DNA sequence determined, as set forth in U.S.
patent application Ser. No. 09/443,501, filed 19 Nov. 1999,
incorporated herein by reference. DNA sequence analysis revealed a
PKS gene cluster with a loading module and nine extender modules.
Downstream of the PKS sequence is an open reading frame (ORF),
designated epoK, that shows strong homology to cytochrome P450
oxidase-genes and encodes the epothilone epoxidase modification
enzyme.
[0102] The PKS genes are organized in 6 ORFs. At the polypeptide
level, the loading module and extender modules 1 (an NRPS), 2, and
9 appear on individual polypeptides; their corresponding genes are
designated epoA, epoB, epoC and epoF respectively. Modules 3, 4, 5,
and 6 are contained on a single polypeptide whose gene is
designated epoD, and modules 7 and 8 are on another polypeptide
whose gene is designated epoE. It is clear from the spacing between
ORFs that epoC, epoD, epoE and epoF constitute an operon. The epoA,
epoB, and epoK gene may be also part of the large operon, but there
are spaces of approximately 100 bp between epoB and epoC and 115 bp
between epoF and epoK which could contain a promoter. The
epothilone PKS gene cluster is shown schematically below.
##STR00003##
Immediately downstream of epoK, the P450 epoxidase gene, is ORF1,
which encodes a polypeptide that appears to include membrane
spanning domains and may be involved in epothilone transport. This
ORF is followed by a number of ORFs that include genes that may
encode proteins involved in transport and regulation.
[0103] A detailed examination of the modules shows an organization
and composition consistent with one able to be used for the
biosynthesis of epothilone. The description that follows is at the
polypeptide level. The sequence of the AT domain in the loading
module and in extender modules 3, 4, 5, and 9 shows similarity to
the consensus sequence for malonyl loading modules, consistent with
the presence of an H side chain at C-14, C-12 (epothilones A and
C), C-10, and C-2, respectively, as well as the loading module. The
AT domains in modules 2, 6, 7, and 8 resemble the consensus
sequence for methylmalonyl specifying AT domains, again consistent
with the presence of methyl side chains at C-16, C-8, C-6, and C-4
respectively.
[0104] The loading module contains a KS domain in which the
cysteine residue usually present at the active site is instead a
tyrosine. This domain is designated as KS.sup.y and serves as a
decarboxylase, which is part of its normal function, but cannot
function as a condensing enzyme. Thus, the loading module is
expected to load malonyl CoA, move it to the ACP, and decarboxylate
it to yield the acetyl residue required for condensation with
cysteine. Module 1 is the non-ribosomal peptide synthetase that
activates cysteine and catalyzes the condensation with acetate on
the loading module. The sequence contains segments highly similar
to ATP-binding and ATPase domains, required for activation of amino
acids, a phosphopantotheinylation site, and an elongation domain.
Module 2 determines the structure of epothilone at C-15-C-17. The
presence of the DH domain in module 2 yields the C-16-17 dehydro
moiety in the molecule. The domains in module 3 are consistent with
the structure of epothilone at C-14 and C-15; the OH that comes
from the action of the KR is employed in the lactonization of the
molecule. Module 4 controls the structure at C-12 and C-13 where a
double bond is found in epothilones C and D. Although the sequence
of the AT domain appears to resemble those that specify malonate
loading, it can also load methylmalonate, thereby accounting in
part for the mixture of epothilones found in the fermentation
broths of the naturally producing organisms.
[0105] A significant departure from the expected array of functions
was found in module 4. This module was expected to contain a DH
domain, thereby directing the synthesis of epothilones C and D as
the products of the PKS. Rigorous analysis revealed that the space
between the AT and KR domains of module 4 was not large enough to
accommodate a functional DH domain. Thus, the extent of reduction
at module 4 does not proceed beyond the ketoreduction of the
beta-keto formed after the condensation directed by module 4.
Because the C-12,13 unsaturation has been demonstrated (epothilones
C and D), there must be an additional dehydratase function that
introduces the double bond. The dehydration reaction that mediates
the formation of this double bond may be due to the action of an as
yet unrecognized domain of the epothilone PKS (for example,
dehydration could occur in the next module, which possesses an
active DH domain and could generate a conjugated diene precursor
prior to its dehydrogenation by an ER domain) or an endogenous
enzyme in the host cells in which it is observed. As shown herein,
the PKS genes and flanking sequences are sufficient to confer the
ability to produce epothilones C and D in a host cell of the
invention.
[0106] Thus, the action of the dehydratase could occur either
during the synthesis of the polyketide or after cyclization has
taken place. In the former case, the compounds produced at the end
of acyl chain growth would be epothilones C and D. If the C-12,13
dehydration were a post-polyketide event, the completed acyl chain
would have a hydroxyl group at C-13, as shown below. The names
epothilones G and H have been assigned to the 13-hydroxy compounds
produced in the absence of or prior to the action of the
dehydratase.
##STR00004##
[0107] Modules 5 and 6 each have the full set of reduction domains
(KR, DH and ER) to yield the methylene functions at C-11 and C-9.
Modules 7 and 9 have KR domains to yield the hydroxyls at C-7 and
C-3, and module 8 does not have a functional KR domain, consistent
with the presence of the keto group at C-5. Module 8 also contains
a methyltransferase (MT) domain that results in the presence of the
geminal dimethyl function at C-4. Module 9 has a thioesterase
domain that terminates polyketide synthesis and catalyzes ring
closure.
[0108] The genes, proteins, modules, and domains of the epothilone
PKS are summarized in the following Table.
TABLE-US-00003 Gene Protein Modules Domains Present epoA EpoA Load
KS.sup.Y mAT ER ACP epoB EpoB 1 NRPS, condensation,
heterocyclization, adenylation, thiolation, PCP epoC EpoC 2 KS mmAT
DH KR ACP epoD EpoD 3-6 KS mAT KR ACP; KS mAT KR ACP; KS mAT DH ER
KR ACP; KS mmAT DH ER KR ACP epoE EpoE 7-8 KS mmAT KR ACP; KS mmAT
MT DH* KR* ACP epoF EpoF 9 KS mAT KR DH* ER* ACP TE
NRPS--non-ribosomal peptide synthetase; KS--ketosynthase;
mAT--malonyl CoA specifying acyltransferase; mmAT--methylmalonyl
CoA specifying acyltransferase; DH--dehydratase;
ER--enoylreductase; KR--ketoreductase; MT--methyltransferase; TE
thioesterase; *inactive domain.
Inspection of the sequence has revealed translational coupling
between epoA and epoB (loading module and module 1) and between
epoC and epoD. Very small gaps are seen between epoD and epoE and
epoE and epoF but gaps exceeding 100 bp are found between epoB and
epoC and epoF and epoK. These intergenic regions may contain
promoters.
[0109] Thus, the epothilone PKS is multiprotein complex composed of
the gene products of the epoA, epoB, epoC, epoD, epoE, and epoF
genes. To confer the ability to produce epothilones to a host cell,
one provides the host cell with the recombinant epoA, epoB, epoC,
epoD, epoE, and epoF genes of the present invention, and optionally
other genes, capable of expression in that host cell. Those of
skill in the art will appreciate that, while the epothilone and
other PKS enzymes may be referred to as a single entity herein,
these enzymes are typically multisubunit proteins. Thus, one can
make a derivative PKS (a PKS that differs from a naturally
occurring PKS by deletion or mutation) or hybrid PKS (a PKS that is
composed of portions of two different PKS enzymes) by altering one
or more genes that encode one or more of the multiple proteins that
constitute the PKS.
[0110] The post-PKS modification or tailoring of epothilone
includes multiple steps mediated by multiple enzymes. These enzymes
are referred to herein as tailoring or modification enzymes.
Expression of the epothilone PKS genes epoA, epoB, epoC, epoD,
epoE, and epoF in certain host cells of the invention that do not
express epoK leads to the production of epothilones C and D, which
lack the C-12-C-13 epoxide of epothilones A and B, having instead a
C-12-C-13 double bond. Thus, epothilones C and D are converted to
epothilones A and B by an epoxidase encoded by the epoK gene.
Epothilones A and B are converted to epothilones E and F by a
hydroxylase gene, which may be encoded by a gene associated with
the epothilone PKS gene cluster or by another gene endogenous to
Sorangium cellulosum. Thus, one can produce an epothilone or
epothilone derivative modified as desired in a host cell by
providing that host cell with one or more recombinant modification
enzyme genes provided by the invention or by utilizing a host cell
that naturally expresses (or does not express) the modification
enzyme.
[0111] Thus, the present invention provides a wide variety of
recombinant DNA compounds and host cells for expressing the
naturally occurring epothilones A, B, C, and D and derivatives
thereof. The invention also provides recombinant host cells that
produce epothilone derivatives modified in a manner similar to
epothilones E and F. Moreover, the invention provides host cells
that can produce epothilones G and H, either by expression of the
epothilone PKS genes in host cells that do not express the
dehydratase that converts epothilones G and H to C and D or by
mutating or altering the PKS to abolish the dehydratase function,
if it is present in the epothilone PKS.
[0112] The present invention also provides a wide variety of
recombinant DNA compounds and host cells that make epothilone
derivatives. As used herein, the phrase epothilone derivative
refers to a compound that is produced by a recombinant epothilone
PKS in which at least one domain has been inserted or either
rendered inactive, mutated to alter its catalytic function, or
replaced by a domain with a different function. In any event, the
epothilone derivative PKS so produced functions to produce a
compound that differs in structure from a naturally occurring
epothilone and so is called an epothilone derivative. To facilitate
a better understanding of the recombinant DNA compounds and host
cells provided by the invention, a detailed discussion of the
loading module and each of the modules of the epothilone PKS, as
well as novel recombinant derivatives thereof, is provided
below.
[0113] The loading module of the epothilone PKS includes an
"inactive" KS domain, designated KS.sup.Y, that, due to the
presence of a tyrosine (Y) residue in place of the cysteine residue
found in "active" KS domains, is unable to perform the condensation
reaction mediated by active KS domains. The KS.sup.Y domain does
carry out the decarboxylation reaction mediated by KS domains. Such
"inactive" KS domains are found in other PKS enzymes, usually with
a glutamine (Q) residue in place of the active site cysteine, and
are called KS.sup.Q domains. The KS.sup.Q domain in rat fatty acid
synthase has been shown to be unable to perform condensation but
exhibits a 2 order of magnitude increase in decarboxylation. See
Witkowski et al., 7 Sep. 1999, Biochem. 38(36): 11643-11650,
incorporated herein by reference. A KS.sup.Q domain may be more
efficient at decarboxylation than a KS.sup.Y domain, so the
replacement of the KS.sup.Y domain in the epothilone PKS with a
KS.sup.Q domain may increase the efficiency of epothilone
biosynthesis. This can be accomplished merely by changing the codon
from a tyrosine to a glutamine codon, as described in Example 6,
below. This can also be accomplished by replacing the KS.sup.Y
domain with a KS.sup.Q domain of another PKS, such as the
oleandolide PKS or the narbonolide PKS (see the references cited in
the Table above in connection with the oleandomycin, narbomycin,
and picromycin PKS and modification enzymes).
[0114] The epothilone loading module also contains an AT domain
specific for malonyl CoA (which is believed to be decarboxylated by
the KS.sup.Y domain to yield an acetyl group), and an ACP domain.
The present invention provides recombinant epothilone derivative
loading modules or their encoding DNA sequences in which the
malonyl specific AT domain or its encoding sequence has been
changed to another specificity, such as methylmalonyl CoA,
ethylmalonyl CoA, and 2-hydroxymalonyl CoA. When expressed with the
other proteins of the epothilone PKS, such loading modules lead to
the production of epothilones in which the methyl substituent of
the thiazole ring of epothilone is replaced with, respectively,
ethyl, propyl, and hydroxymethyl. The present invention provides
recombinant PKS enzymes comprising such loading modules and host
cells for producing such enzymes and the polyketides produced
thereby. An AT domain specific for 2-hydroxymalonyl CoA will result
in a polyketide with a hydroxyl group at the corresponding location
in the polyketide produced; the hydroxyl group can be methylated to
yield a methoxy group by polyketide modification enzymes. See,
e.g., the references cited in connection with the FK-520 PKS in the
Table above. Consequently, reference to a PKS that has a
2-hydroxymalonyl specific AT domain herein similarly refers to
polyketides produced by that PKS that have either a hydroxyl or
methoxyl group at the corresponding location in the polyketide.
[0115] The loading module of the epothilone PKS also comprises an
ER domain. While, this ER domain may be involved in forming one of
the double bonds in the thiazole moiety in epothilone (in the
reverse of its normal reaction), it may be non-functional. In
either event, the invention provides recombinant DNA compounds that
encode the epothilone PKS loading module with and without the ER
region, as well as hybrid loading modules that contain an ER domain
from another PKS (either active or inactive, with or without
accompanying KR and DH domains) in place of the ER domain of the
epothilone loading module. The present invention also provides
recombinant PKS enzymes comprising such loading modules and host
cells for producing such enzymes and the polyketides produced
thereby.
[0116] The loading module of the epothilone PKS is followed by the
first extender module of the PKS, which is an NRPS module specific
for cysteine. This NRPS module is naturally expressed as a discrete
protein, the product of the epoB gene. In one embodiment, a portion
of the NRPS module coding sequence is utilized in conjunction with
a heterologous coding sequence. In this embodiment, the invention
provides, for example, changing the specificity of the NRPS module
of the epothilone PKS from a cysteine to another amino acid. This
change is accomplished by constructing a coding sequence in which
all or a portion of the epothilone PKS NRPS module coding sequences
have been replaced by those coding for an NRPS module of a
different specificity. In one illustrative embodiment, the
specificity of the epothilone NRPS module is changed from cysteine
to serine or threonine. When the thus modified NRPS module is
expressed with the other proteins of the epothilone PKS, the
recombinant PKS produces an epothilone derivative in which the
thiazole moiety of epothilone (or an epothilone derivative) is
changed to an oxazole or 5-methyloxazole moiety, respectively.
Alternatively, the present invention provides recombinant PKS
enzymes composed of the products of the epoA, epoC, epoD, epoE, and
epoF genes (or modified versions thereof) without an NRPS module or
with an NRPS module from a heterologous PKS. The heterologous NRPS
module can be expressed as a discrete protein or as a fusion
protein with either the epoA or epoC genes.
[0117] In another embodiment, the invention provides recombinant
epothilone PKS enzymes and corresponding recombinant DNA compounds
and vectors in which the NRPS module has been inactivated or
deleted. Inactive NRPS module proteins and the coding sequences
therefore provided by the invention include those in which the PCP
domain has been wholly or partially deleted or otherwise rendered
inactive by changing the active site serine (the site for
phosphopantetheinylation) to another amino acid, such as alanine,
or the adenylation domains have been deleted or otherwise rendered
inactive. In one embodiment, both the loading module and the NRPS
have been deleted or rendered inactive. In any event, the resulting
epothilone PKS can then function only if provided a substrate that
binds to the KS domain of module 2 (or a subsequent module) of the
epothilone PKS or a PKS for an epothilone derivative. In a method
provided by the invention, the thus modified cells are then fed
activated acylthioesters that are bound by preferably the second,
but potentially any subsequent, module and processed into novel
epothilone derivatives. The host cell is fed activated
acylthioesters to produce novel epothilone derivatives of the
invention. The host cells expressing, or cell free extracts
containing, the PKS can be fed or supplied with N-acylcysteamine
thioesters (NACS) of novel precursor molecules to prepare
epothilone derivatives. See U.S. patent application Ser. No.
09/492,733, filed 27 Jan. 2000, and PCT patent publication No.
US99/03986, both of which are incorporated herein by reference, and
Examples 9 and 10, below.
[0118] The second (first non-NRPS) extender module of the
epothilone PKS includes a KS, an AT specific for methylmalonyl CoA,
a DH, a KR, and an ACP. The second extender module of the
epothilone PKS is produced as a discrete protein by the epoC gene.
All or only a portion of the second extender module coding sequence
can be utilized in conjunction with other PKS coding sequences to
create a hybrid module. In this embodiment, the invention provides,
for example, either replacing the methylmalonyl CoA specific AT
with a malonyl CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA
specific AT; deleting either the DH or KR or both; replacing the DH
or KR or both with a DH or KR or both that specify a different
stereochemistry; and/or inserting an ER. The resulting heterologous
second extender module coding sequence can be coexpressed with the
other proteins that constitute a PKS that synthesizes epothilone,
an epothilone derivative, or another polyketide. Alternatively, one
can delete or replace the second extender module of the epothilone
PKS with a module from a heterologous PKS, which can be expressed
as a discrete protein or as a fusion protein fused to either the
epoB or epoD gene product.
[0119] Illustrative recombinant PKS genes of the invention include
those in which the AT domain encoding sequences for the second
extender module of the epothilone PKS have been altered or replaced
to change the AT domain encoded thereby from a methylmalonyl
specific AT to a malonyl specific AT. Such malonyl specific. AT
domain encoding nucleic acids can be isolated for example and
without limitation, from the PKS genes encoding the narbonolide
PKS, the rapamycin PKS (i.e., modules 2 and 12), and the FK-520 PKS
(i.e., modules 3, 7, and 8). When such a hybrid second extender
module is coexpressed with the other proteins constituting the
epothilone PKS, the resulting epothilone derivative produced is a
16-desmethyl epothilone. In a preferred embodiment, the hybrid PKS
also contains a methylmalonyl CoA specific AT domain in extender
module 4 and is expressed in a host cell lacking a functional epoK
gene such that the compound produced is 16-desmethyl epothilone
D
[0120] In addition, the invention provides DNA compounds and
vectors encoding recombinant epothilone PKS enzymes and the
corresponding recombinant proteins in which the KS domain of the
second (or subsequent) extender module has been inactivated or
deleted, as described in Example 9, below. In a preferred
embodiment, this inactivation is accomplished by changing the codon
for the active site cysteine to an alanine codon. As with the
corresponding variants described above for the NRPS module, the
resulting recombinant epothilone PKS enzymes are unable to produce
an epothilone or epothilone derivative unless supplied a precursor
that can be bound and extended by the remaining domains and modules
of the recombinant PKS enzyme. Illustrative precursor compounds are
described in Example 10, below. Alternatively, one could simply
provide such precursors to a host cell that expressed only the
epoD, epoE, and epoF genes.
[0121] The third extender module of the epothilone PKS includes a
KS, an AT specific for malonyl CoA, a KR, and an ACP. The third
extender module of the epothilone PKS is expressed as a protein,
the product of the epoD gene, which also contains modules 4; 5, and
6. To make a recombinant epothilone PKS that produces an epothilone
derivative due to an alteration in any of extender modules 3
through 6, one typically expresses a protein comprising all four
extender modules. In one embodiment, all or a portion of the third
extender module coding sequence is utilized in conjunction with
other PKS coding sequences to create a hybrid module. In this
embodiment, the invention provides, for example, either replacing
the malonyl CoA specific AT with a methylmalonyl CoA, ethylmalonyl
CoA, or 2-hydroxymalonyl CoA specific AT; deleting the KR;
replacing the KR with a KR that specifies a different
stereochemistry; and/or inserting a DH or a DH and an ER. The
resulting heterologous third extender module coding sequence can be
utilized in conjunction with a coding sequence for a PKS that
synthesizes epothilone, an epothilone derivative, or another
polyketide.
[0122] Illustrative recombinant PKS genes of the invention include
those in which the AT domain encoding sequences for the third
extender module of the epothilone PKS have been altered or replaced
to change the AT domain encoded thereby from a malonyl specific AT
to a methylmalonyl specific AT. Such methylmalonyl specific AT
domain encoding nucleic acids can be isolated, for example and
without limitation, from the PKS genes encoding DEBS, the
narbonolide PKS, the rapamycin PKS, and the FK-520 PKS. When
coexpressed with the remaining modules and proteins of the
epothilone PKS or an epothilone PKS derivative, the recombinant PKS
produces the 14-methyl epothilone derivatives of the invention.
[0123] Those of skill in the art will recognize that the KR domain
of the third extender module of the PKS is responsible for forming
the hydroxyl group involved in cyclization of epothilone.
Consequently, abolishing the KR domain of the third extender module
or adding a DH or DH and ER domains will interfere with the
cyclization, leading either to a linear molecule or to a molecule
cyclized at a different location than is epothilone.
[0124] The fourth extender module of the epothilone PKS includes a
KS, an AT that can bind either malonyl-CoA or methylmalonyl CoA, a
KR, and an ACP. In one embodiment, all or a portion of the fourth
extender module coding sequence is utilized in conjunction with
other PKS coding sequences to create a hybrid module. In this
embodiment, the invention provides, for example, either replacing
the malonyl CoA and methylmalonyl specific AT with a malonyl CoA,
methylmalonyl CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA
specific AT; deleting the KR; and/or replacing the KR, including,
optionally, to specify a different stereochemistry; and/or
inserting a DH or a DH and ER. The resulting heterologous fourth
extender module coding sequence is incorporated into a protein
subunit of a recombinant PKS that synthesizes epothilone, an
epothilone derivative, or another polyketide. Alternatively, the
invention provides recombinant PKS enzymes for epothilones and
epothilone derivatives in which the entire fourth extender module
has been deleted or replaced by a module from a heterologous
PKS.
[0125] In a preferred embodiment, the invention provides
recombinant DNA compounds comprising the coding sequence for the
fourth extender module of the epothilone PKS modified to encode an
AT that binds methylmalonyl CoA and not malonyl CoA. Thus, the
invention provides recombinant DNA compounds and expression vectors
and the corresponding recombinant PKS in which the hybrid fourth
extender module with a methylmalonyl specific AT has been
incorporated. The methylmalonyl specific AT coding sequence can
originate, for example and without limitation, from coding
sequences for the oleandolide PKS, DEBS, the narbonolide PKS, the
rapamycin PKS, or any other PKS that comprises a methylmalonyl
specific AT domain. In accordance with the invention, the hybrid
fourth extender module expressed from this coding sequence is
incorporated into the epothilone PKS (or the PKS for an epothilone
derivative), typically as a derivative epoD gene product that
comprises the modified fourth extender module as well as extender
modules 3, 5, and 6, any one or more of which can optionally be in
derivative form, of the epothilone PKS.
[0126] The recombinant methylmalonyl specific epothilone fourth
extender module coding sequences provided by the invention afford
important alternative methods for producing desired epothilone
compounds in host cells. Thus, the invention provides a hybrid
fourth extender module coding sequence in which, in addition to the
replacement of the endogenous AT coding sequence with a coding
sequence for an AT specific for methylmalonyl Co A, coding
sequences for a DH and KR for, for example and without limitation,
module 10 of the rapamycin PKS or modules 1 or 5 of the FK-520 PKS,
have replaced the endogenous KR coding sequences. When the gene
product comprising the hybrid fourth extender module and epothilone
PKS modules 3, 5, and 6 (or derivatives thereof) encoded by this
coding sequence is incorporated into a PKS comprising the other
epothilone PKS proteins (or derivatives thereof) produced in a host
cell, the cell makes either epothilone D or its trans stereoisomer
(or derivatives thereof, depending on the stereochemical
specificity of the inserted DH and KR domains.
[0127] Similarly, and as noted above, the invention provides
recombinant DNA compounds comprising the coding sequence for the
fourth extender module of the epothilone PKS modified to encode an
AT that binds malonyl CoA and not methylmalonyl CoA. The invention
provides recombinant DNA compounds and vectors and the
corresponding recombinant PKS in which this hybrid fourth extender
module has been incorporated into a derivative epoD gene product.
When incorporated into the epothilone PKS (or the PKS for an
epothilone derivative), the resulting recombinant epothilone PKS
produces epothilones C, A, and E, depending, again, on whether
epothilone modification enzymes are present. As noted above,
depending on the host, whether the fourth extender module includes
a KR and DH domain, and on whether and which of the dehydratase,
epoxidase, and oxidase activities are present, the practitioner of
the invention can produce one or more of the epothilone G, C, A,
and E compounds and derivatives thereof using the compounds, host
cells, and methods of the invention.
[0128] In another embodiment, the present invention provides the
13-oxo-epothilones by providing a recombinant epothilone PKS in
which the KR domain of extender module 4 has been rendered inactive
by mutation, delation, or replacement with a non-functional KR
domain from another PKS. In a preferred embodiment, the invention
provides a recombinant-host cell that produces only
13-oxo-epothilone D, because the recombinant PKS also has a
replacement of the AT domain of module 4 with a methylmalonyl
specific AT domain, and no functional epoK gene is present in the
cell. If the production of an epothilone derivative compound is low
due to an alteration in a module, production may be improved by
altering the KS and/or ACP domains of the succeeding module.
[0129] The fifth extender module of the epothilone PKS includes a
KS, an AT that binds malonyl CoA, a DH, an ER, a KR, and an ACP. In
one embodiment, a DNA compound comprising a sequence that encodes
the fifth extender module of the epothilone PKS is inserted into a
DNA compound that comprises coding sequences for the epothilone PKS
or a recombinant epothilone PKS that produces an epothilone
derivative. In another embodiment, a portion of the fifth extender
module coding sequence is utilized in conjunction with other PKS
coding sequences to create a hybrid module coding sequence and the
hybrid module encoded thereby. In this embodiment, the invention
provides, for example, either replacing the malonyl CoA specific AT
with a methylmalonyl CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA
specific AT; deleting any one, two, or all three of the ER, DH, and
KR; and/or replacing any one, two, or all three of the ER, DH, and
KR with either a KR, a DH and KR, or a KR, DH, and ER, including,
optionally, to specify a different stereochemistry. The resulting
hybrid fifth extender module coding sequence can be utilized in
conjunction with a coding sequence for a PKS that synthesizes
epothilone, an epothilone derivative, or another polyketide.
Alternatively, the fifth extender module of the epothilone PKS can
be deleted or replaced in its entirety by a module of a
heterologous PKS to produce a protein that in combination with the
other proteins of the epothilone PKS or derivatives thereof
constitutes a PKS that produces an epothilone derivative.
[0130] Illustrative recombinant PKS genes of the invention include
recombinant epoD gene derivatives in which the AT domain encoding
sequences for the fifth extender module of the epothilone PKS have
been altered or replaced to change the AT domain encoded thereby
from a malonyl specific AT to a methylmalonyl specific AT. Such
methylmalonyl specific AT domain encoding nucleic acids can be
isolated, for example and without limitation, from the PKS genes
encoding DEBS, the narbonolide PKS, the rapamycin PKS, and the
FK-520 PKS. When such recombinant epoD gene derivatives are
coexpressed with the epoA, epoB, epoC, epoE, and epoF genes (or
derivatives thereof), the PKS composed thereof produces the
10-methyl epothilones or derivatives thereof. Another recombinant
epoD gene derivative provided by the invention includes not only
this altered module 5 coding sequence but also module 4 coding
sequences that encode an AT domain that binds only methylmalonyl
CoA. When incorporated into a PKS with the epoA, epoB, epoC, epoE,
and epoF genes, the recombinant epoD gene derivative product leads
to the production of 10-methyl epothilone B and/or D
derivatives.
[0131] Other illustrative recombinant epoD gene derivatives of the
invention include those in which the ER, DH, and KR domain encoding
sequences for the fifth extender module of the epothilone PKS have
been: (i) replaced with those encoding a KR and DH domain; (ii)
either replaced with those encoding a KR domain or a KR domain and
an inactive DH domain or from which the DH domain coding sequence
has been deleted or rendered inactive by mutation; and (iii) either
replaced with those encoding an inactive KR domain or from which
the KR domain coding sequence has been deleted or rendered inactive
by mutation. These recombinant epoD gene derivatives of the
invention are coexpressed with the epoA, epoB, epoC, epoE, and epoF
genes to produce a recombinant PKS that makes the corresponding (i)
C-1 alkene, (ii) C-11 hydroxy (either epimer), and (iii) C-11 keto
epothilone derivatives. These recombinant epoD gene derivatives can
also be coexpressed with recombinant epo genes containing other
alterations or can themselves be further altered to produce a PKS
that makes the corresponding C-11 epothilone derivatives. For
example, one recombinant epoD gene derivative provided by the
invention also includes module 4 coding sequences that encode an AT
domain that binds only methylmalonyl CoA. When incorporated into a
PKS with the epoA, epoB, epoC, epoE, and epoF genes, the
recombinant epoD gene derivative product leads to the production of
the corresponding C-11 epothilone B and/or D derivatives, depending
on whether a functional epoK gene is present in the host cell.
[0132] As noted above, functionally similar epoD genes for
producing the epothilone C-11 derivatives can also be made by
inactivation of one, two, or all three of the ER, DH, and KR
domains of the epothilone fifth extender module. However, the
preferred mode for altering such domains in any module is by
replacement with the complete set of desired domains taken from
another module of the same or a heterologous PKS coding sequence.
In this manner, the natural architecture of the PKS is conserved.
Also, when present, KR and DH or KR, DH, and ER domains that
function together in a native PKS are preferably used in the
recombinant PKS. Illustrative replacement domains for the
substitutions described above include, for example and without
limitation, the inactive KR domain from the rapamycin PKS module 3
to form the ketone, the KR domain from the rapamycin PKS module 5
to form the alcohol, and the KR and DH domains from the rapamycin
PKS module 4 to form the alkene. Other such inactive KR, active KR,
and active KR and DH domain encoding nucleic acids can be isolated
from, for example and without limitation, the PKS genes encoding
DEBS, the narbonolide PKS, and the FK-520 PKS. Each of the
resulting PKS enzymes produces a polyketide compound that comprises
a functional group at the C-11 position that can be further
derivatized in vitro by standard chemical methodology to yield
semi-synthetic epothilone derivatives of the invention.
[0133] The sixth extender module of the epothilone PKS includes a
KS, an AT that binds methylmalonyl CoA, a DH, an ER, a KR, and an
ACP. In one embodiment, a portion of the sixth extender module
coding sequence is utilized in conjunction with other PKS coding
sequences to create a hybrid module. In this embodiment, the
invention provides, for example, either replacing the methylmalonyl
CoA specific AT with a malonyl CoA, ethylmalonyl CoA, or
2-hydroxymalonyl CoA specific AT; deleting any one, two, or all
three of the ER, DH, and KR; and/or replacing any one, two, or all
three of the ER, DH, and KR with either a KR, a DH and KR, or a KR,
DH, and ER, including, optionally, to specify a different
stereochemistry. The resulting heterologous sixth extender module
coding sequence can be utilized in conjunction with a coding
sequence for a protein subunit of a PKS that makes epothilone, an
epothilone derivative, or another polyketide. Alternatively, the
sixth extender module of the epothilone PKS can be deleted or
replaced in its entirety by a module from a heterologous PKS to
produce a PKS for an epothilone derivative.
[0134] Illustrative recombinant PKS genes of the invention include
those in which the AT domain encoding sequences for the sixth
extender module of the epothilone PKS have been altered or replaced
to change the AT domain encoded thereby from a methylmalonyl
specific AT to a malonyl specific AT. Such malonyl specific AT
domain encoding nucleic acids can be isolated from, for example and
without limitation, the PKS genes encoding the narbonolide PKS, the
rapamycin PKS, and the FK-520 PKS. When a recombinant epoD gene of
the invention encoding such a hybrid module 6 is coexpressed with
the other epothilone PKS genes, the recombinant PKS makes the
8-desmethyl epothilone derivatives. This recombinant epoD gene
derivative can also be coexpressed with recombinant epo gene
derivatives containing other alterations or can itself be further
altered to produce a PKS that makes the corresponding 8-desmethyl
epothilone derivatives. For example, one recombinant epoD gene
provided by the invention also includes module 4 coding sequences
that encode an AT domain that binds only methylmalonyl CoA. When
incorporated into a PKS with the epoA, epoB, epoC, epoE, and epoF
genes, the recombinant epoD gene product leads to the production of
the 8-desmethyl derivatives of epothilones B and D.
[0135] Other illustrative recombinant epoD gene derivatives of the
invention include those in which the ER, DH, and KR domain encoding
sequences for the sixth extender module of the epothilone PKS have
been replaced with those that encode (i) a KR and DH domain; (ii) a
KR domain; and (iii) an inactive KR domain. These recombinant epoD
gene derivatives of the invention, when coexpressed with the other
epothilone PKS genes make the corresponding (i) C-9 alkene, (ii)
C-9 hydroxy (both epimers, only one of which may be processed by
downstream modules, unless additional KS and/or ACP replacements
are made in the next module), and (iii) C-9 keto (C-9-oxo)
epothilone derivatives. Functionally equivalent sixth extender
modules can also be made by inactivation of one, two, or all three
of the ER, DH, and KR domains of the epothilone sixth extender
module. These recombinant epoD gene derivatives can also be
coexpressed with other recombinant epo gene derivatives containing
other alterations or can themselves be further altered to produce a
PKS that makes the corresponding C-9 epothilone derivatives. For
example, one recombinant epoD gene derivative provided by the
invention also includes module 4 coding sequences that encode an AT
domain that binds only methylmalonyl CoA. When incorporated into a
PKS with the epoA, epoB, epoC, epoE, and epoF genes, the
recombinant epoD gene product leads to the production of the C-9
derivatives of epothilones B and D, depending on whether a
functional epoK gene is present.
[0136] Illustrative replacement domains for the substitutions
described above include but are not limited to the inactive KR
domain from the rapamycin PKS module 3 to form the ketone, the KR
domain from the rapamycin PKS module 5 to form the alcohol, and the
KR and DH domains from the rapamycin PKS module 4 to form the
alkene. Other such inactive KR, active KR, and active KR and DH
domain encoding nucleic acids can be isolated from for example and
without limitation the PKS genes encoding DEBS, the narbonolide
PKS, and the FK-520 PKS. Each of the resulting PKSs produces a
polyketide compound that comprises a functional group at the C-9
position that can be further derivatized in vitro by standard
chemical methodology to yield semi-synthetic epothilone derivatives
of the invention.
[0137] The seventh extender module of the epothilone PKS includes a
KS, an AT specific for methylmalonyl CoA, a KR, and an ACP. The
seventh extender module of the epothilone PKS is contained in the
gene product of the epoE gene, which also contains the eighth
extender module. In one embodiment, a DNA compound comprising a
sequence that encodes the seventh extender module of the epothilone
PKS is expressed to form a protein that, together with other
proteins, constitutes the epothilone PKS or a PKS that produces an
epothilone derivative. In these and related embodiments, the
seventh and eighth extender modules of the epothilone PKS or a
derivative thereof are typically expressed as a single protein and
coexpressed with the epoA, epoB, epoC, epoD, and epoF genes or
derivatives thereof to constitute the PKS. In another embodiment, a
portion or all of the seventh extender module coding sequence is
utilized in conjunction with other PKS coding sequences to create a
hybrid module. In this embodiment, the invention provides, for
example, either replacing the methylmalonyl CoA specific AT with a
malonyl CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA specific AT;
deleting the KR; replacing the KR with a KR that specifies a
different stereochemistry; and/or inserting a DH or a DH and an ER.
The resulting heterologous seventh extender module coding sequence
is utilized, optionally in conjunction with other coding sequences,
to express a protein that together with other proteins constitutes
a PKS that synthesizes epothilone, an epothilone derivative, or
another polyketide. Alternatively, the coding sequences for the
seventh extender module in the epoE gene can be deleted or replaced
by those for a heterologous module to prepare a recombinant epoE
gene derivative that, together with the epoA, epoB, epoC, epoD, and
epoF genes, can be expressed to make a PKS for an epothilone
derivative.
[0138] Illustrative recombinant epoE gene derivatives of the
invention include those in which the AT domain encoding sequences
for the seventh extender module of the epothilone PKS have been
altered or replaced to change the AT domain encoded thereby from a
methylmalonyl specific AT to a malonyl specific AT. Such malonyl
specific AT domain encoding nucleic acids can be isolated from for
example and without limitation the PKS genes encoding the
narbonolide PKS, the rapamycin PKS, and the FK-520 PKS. When
coexpressed with the other epothilone PKS genes, epQA, epoB, epoC,
epoD, and epoF, or derivatives thereof, a PKS for an epothilone
derivative with a C-6 hydrogen, instead of a C-6 methyl, is
produced. Thus, if the genes contain no other alterations, the
compounds produced are the 6-desmethyl epothilones.
[0139] The eighth extender module of the epothilone PKS includes a
KS, an AT specific for methylmalonyl CoA, inactive KR and DH
domains, a methyltransferase (MT) domain, and an ACP. In one
embodiment, a DNA compound comprising a sequence that encodes the
eighth extender module of the epothilone PKS is coexpressed with
the other proteins constituting the epothilone PKS or a PKS that
produces an epothilone derivative. In another embodiment, a portion
or all of the eighth extender module coding sequence is utilized in
conjunction with other PKS coding sequences to create a hybrid
module. In this embodiment, the invention provides, for example,
either replacing the methylmalonyl CoA specific AT with a malonyl
CoA, ethylmalonyl CoA, or 2-hydroxymalonyl CoA specific AT;
deleting the inactive KR and/or the inactive DH; replacing the
inactive KR and/or DH with an active KR and/or DH; and/or inserting
an ER. The resulting heterologous eighth extender module coding
sequence is expressed as a protein that is utilized in conjunction
with the other proteins that constitute a PKS that synthesizes
epothilone, an epothilone derivative, or another polyketide.
Alternatively, the coding sequences for the eighth extender module
in the epoE gene can be deleted or replaced by those for a
heterologous module to prepare a recombinant epoE gene that,
together with the epoA, epoB, epoC, epoD, and epoF genes, can be
expressed to make a PKS for an epothilone derivative.
[0140] The eighth extender module of the epothilone PKS also
comprises a methylation or methyltransferase (MT) domain with an
activity that methylates the epothilone precursor. This function
can be deleted to produce a recombinant epoD gene derivative of the
invention, which can be expressed with the other epothilone PKS
genes or derivatives thereof that makes an epothilone derivative
that lacks one or both methyl groups, depending on whether the AT
domain of the eighth extender module has been changed to a malonyl
specific AT domain, at the corresponding C-4 position of the
epothilone molecule.
[0141] The ninth extender module of the epothilone PKS includes a
KS, an AT specific for malonyl CoA, a KR, an inactive DH, and an
ACP. The ninth extender module of the epothilone PKS is expressed
as a protein, the product of the epoF gene, that also contains the
TE domain of the epothilone PKS. In one embodiment a DNA compound
comprising a sequence that encodes the ninth extender module of the
epothilone PKS is expressed as a protein together with other
proteins to constitute an epothilone PKS or a PKS that produces an
epothilone derivative. In these embodiments, the ninth extender
module is typically expressed as a protein that also contains the
TE domain of either the epothilone PKS or a heterologous PKS. In
another embodiment, a portion or all of the ninth extender module
coding sequence is utilized in conjunction with other PKS coding
sequences to create a hybrid module. In this embodiment, the
invention provides, for example, either replacing the malonyl CoA
specific AT with a methylmalonyl CoA, ethylmalonyl CoA, or
2-hydroxy malonyl CoA specific AT; deleting the KR; replacing the
KR with a KR that specifies a different stereochemistry; and/or
inserting a DH or a DH and an ER. The resulting heterologous ninth
extender module coding sequence is coexpressed with the other
proteins constituting a PKS that synthesizes epothilone, an
epothilone derivative, or another polyketide. Alternatively, the
present invention provides a PKS for an epothilone or epothilone
derivative in which the ninth extender module has been replaced by
a module from a heterologous PKS or has been deleted in its
entirety. In the latter embodiment, the TE domain is expressed as a
discrete protein or fused to the eighth extender module.
[0142] Illustrative examples of recombinant epothilone derivative
PKS genes of the invention, which are identified by listing the
altered specificities of the hybrid modules (the other modules
having the same specificity as the epothilone PKS), include:
(a) module 4 with methylmalonyl specific AT (mmAT) and a KR and
module 2 with a malonyl specific AT (mAT) and a KR; (b) module 4
with mmAT and module 3 with mmAT; (c) module 4 with mmAT and module
5 with mmAT; (d) module 4 with mmAT and module 5 with mmAT and only
a DH and KR; (e) module 4 with mmAT and module 5 with mmAT and only
a KR; (f) module 4 with mmAT and module 5 with mmAT and only an
inactive KR; (g) module 4 with mmAT and module 6 with mAT; (h)
module 4 with mmAT and module 6 with mAT and only a DH and KR; (i)
module 4 with mmAT and module 6 with mAT and only a KR; (j) module
4 with mmAT and module 6 with mAT and only an inactive KR; (k)
module 4 with mmAT and module 7 with mAT; (l) hybrids (d) through
(f), except that module 5 has an mAT; (m) hybrids (h) through (j)
except that module 6 has an mmAT; and (n) hybrids (a) through (m)
except that module 4 has an mAT. The above list is illustrative
only and should not be construed as limiting the invention, which
includes other recombinant epothilone PKS genes and enzymes with
not only two hybrid modules other than those shown but also with
three or more hybrid modules.
[0143] The host cells of the invention can be grown and fermented
under conditions known in the art for other purposes to produce the
compounds of the invention. The compounds of the invention can be
isolated from the fermentation broths of these cultured cells and
purified by methods such as those in Example 3, below.
[0144] Thus, in another embodiment, the present invention provides
novel epothilone derivative compounds in isolated and substantially
pure forms useful in agriculture, veterinary practice, and
medicine. The term isolated refers to a compound or composition in
a preparation that is substantially free of contaminating or
undesired materials or, with respect to a compound or composition
found in nature, substantially free of the materials with which
that compound or composition is associated in its natural state. In
one embodiment, the compounds are useful as fungicides. In another
embodiment, the compounds are useful in cancer chemotherapy. In a
preferred embodiment, the compound is an epothilone derivative that
is at least as potent against tumor cells as epothilone B or D. In
another embodiment, the compounds are useful as immunosuppressants.
In another embodiment, the compounds are useful in the manufacture
of another compound. In a preferred embodiment, the compounds are
formulated in a mixture or solution for administration to a human
or animal.
[0145] The novel epothilone analogs of the present invention, as
well as the epothilones produced by the host cells of the
invention, can be derivatized and formulated as described in PCT
patent publication Nos. 93/10121, 97/19086, 98/08849, 98/22461,
98/25929, 99/01124, 99/02514, 99/07692, 99/27890, 99/39694,
99/40047, 99/42602, 99/43320, 99/43653, 99/54318, 99/54319,
99/54330, 99/65913, 99/67252, 99/67253, and 00/00485, and U.S. Pat.
No. 5,969,145, each of which is incorporated herein by
reference.
[0146] Preferred compounds of the invention include the 14-methyl
epothilone derivatives (made by utilization of the hybrid module 3
of the invention that has an AT that binds methylmalonyl CoA
instead of malonyl CoA); the 8,9-dehydro epothilone derivatives
(made by utilization of the hybrid module 6 of the invention that
has a DH and KR instead of an ER, DH, and KR); the 10-methyl
epothilone derivatives (made by utilization of the hybrid module 5
of the invention that has an AT that binds methylmalonyl CoA
instead of malonyl CoA); the 9-hydroxy epothilone derivatives (made
by utilization of the hybrid module 6 of the invention that has a
KR instead of an ER, DH, and KR); the 8-desmethyl-14-methyl
epothilone derivatives (made by utilization of the hybrid module 3
of the invention that has an AT that binds methylmalonyl CoA
instead of malonyl CoA and a hybrid module 6 that binds malonyl CoA
instead of methylmalonyl CoA); and the 8-desmethyl-8,9-dehydro
epothilone derivatives (made by utilization of the hybrid module 6
of the invention that has a DH and KR instead of an ER, DH, and KR
and an AT that specifies malonyl CoA instead of methylmalonyl CoA).
Illustrative examples of other preferred novel epothilones of the
invention that can be made using epothilone derivative PKS enzymes
of the invention include 9-oxo-11-hydroxy-epothilone D (module 4 AT
replacement, module 6 KR inactivation, and module 5 DH
inactivation); 9-hydroxy-11-oxo-epothilone D (module 4 AT
replacement, module 6 DH inactivation, and module 5 KR
inactivation); and 9,11-dihydroxy-epothilone D (module 4 AT
replacement, module 6 DH inactivation, and module 5 DH
inactivation).
[0147] The compounds of the invention can be readily formulated to
provide the pharmaceutical compositions of the invention. The
pharmaceutical compositions of the invention can be used in the
form of a pharmaceutical preparation, for example, in solid,
semisolid, or liquid form. This preparation will contain one or
more of the compounds of the invention as an active ingredient in
admixture with an organic or inorganic carrier or excipient
suitable for external, enteral, or parenteral application. The
active ingredient may be compounded, for example, with the usual
non-toxic, pharmaceutically acceptable carriers for tablets,
pellets, capsules, suppositories, pessaries, solutions, emulsions,
suspensions, and any other form suitable for use.
[0148] The carriers which can be used include water, glucose,
lactose, gum acacia, gelatin, mannitol, starch paste, magnesium
trisilicate, talc, corn starch, keratin, colloidal silica, potato
starch, urea, and other carriers suitable for use in manufacturing
preparations, in solid, semi-solid, or liquified form. In addition,
auxiliary stabilizing, thickening, and coloring agents and perfumes
may be used. For example, the compounds of the invention may be
utilized with hydroxypropyl methylcellulose essentially as
described in U.S. Pat. No. 4,916,138, incorporated herein by
reference, or with a surfactant essentially as described in EPO
patent publication No. 428,169, incorporated herein by
reference.
[0149] Oral dosage forms may be prepared essentially as described
by Hondo et al., 1987, Transplantation Proceedings XIX, Supp. 6:
17-22, incorporated herein by reference. Dosage forms for external
application may be prepared essentially as described in EP Pub. No.
423,714, incorporated herein by reference. The active compound is
included in the pharmaceutical composition in an amount sufficient
to produce the desired effect upon the disease process or
condition.
[0150] For the treatment of conditions and diseases caused by
infection, immune system disorder (or to suppress immune function),
or cancer, a compound of the invention may be administered orally,
topically, parenterally, by inhalation spray, or rectally in dosage
unit formulations containing conventional non-toxic
pharmaceutically acceptable carriers, adjuvant, and vehicles. The
term parenteral, as used herein, includes subcutaneous injections,
and intravenous, intrathecal, intramuscular, and intrasternal
injection or infusion techniques.
[0151] Dosage levels of the compounds of the present invention are
of the order from about 0.01 mg to about 100 mg per kilogram of
body weight per day, preferably from about 0.1 mg to about 50 mg
per kilogram of body weight per day. The dosage levels are useful
in the treatment of the above-indicated conditions (from about 0.7
mg to about 3.5 mg per patient per day, assuming a 70 kg patient).
In addition, the compounds of the present invention may be
administered on an intermittent basis, i.e., at semi-weekly,
weekly, semi-monthly, or monthly intervals.
[0152] The amount of active ingredient that may be combined with
the carrier materials to produce a single dosage form will vary
depending upon the host treated sand the particular mode of
administration. For example, a formulation intended for oral
administration to humans may contain from 0.5 mg to 5 gm of active
agent compounded with an appropriate and convenient amount of
carrier material, which may vary from about 5 percent to about 95
percent of the total composition. Dosage unit forms will generally
contain from about 0.5 mg to about 500 mg of active ingredient. For
external administration, the compounds of the invention may be
formulated within the range of, for example, 0.00001% to 60% by
weight, preferably from 0.001% to 10% by weight, and most
preferably from about 0.005% to 0.8% by weight.
[0153] It will be understood, however, that the specific dose level
for any particular patient will depend on a variety of factors.
These factors include the activity of the specific compound
employed; the age, body weight, general health, sex, and diet of
the subject; the time and route of administration and the rate of
excretion of the drug; whether a drug combination is employed in
the treatment; and the severity of the particular disease or
condition for which therapy is sought.
[0154] In another embodiment, the present invention provides a
method of treating cancer, which method comprises administering a
therapeutically effective amount of a novel epothilone compound of
the invention.
[0155] A detailed description of the invention having been provided
above, the following examples are given for the purpose of
illustrating the present invention and shall not be construed as
being a limitation on the scope of the invention or claims.
EXAMPLE 1
Construction of a Myxococcus xanthus Expression Vector
[0156] The DNA providing the integration and attachment function of
phage Mx8 was inserted into commercially available pACYC184 (New
England Biolabs). An .about.2360 bp MfeI-SmaI from plasmid pPLH343,
described in Salmi et al., February 1998, J. Bact. 180(3): 614-621,
was isolated and ligated to the large EcoRI-XmnI restriction
fragment of plasmid pACYC184. The circular DNA thus formed was
.about.6 kb in size and called plasmid pKOS35-77.
[0157] Plasmid pKOS35-77 serves as a convenient plasmid for
expressing recombinant PKS genes of the invention under the control
of the epothilone PKS gene promoter. In one illustrative
embodiment, the entire epothilone PKS gene with its homologous
promoter is inserted in one or more fragments into the plasmid to
yield an expression vector of the invention.
[0158] The present invention also provides expression vectors in
which the recombinant PKS genes of the invention are under the
control of a Myxococcus xanthus promoter. To construct an
illustrative vector, the promoter of the pilA gene of M. xanthus
was isolated as a PCR amplification product. Plasmid pSWU357, which
comprises the pilA gene promoter and is described in Wu and Kaiser,
December 1997, J. Bact. 179(24):7748-7758, was mixed with PCR
primers Seq1 and Mxpil1 primers:
TABLE-US-00004 Seq1: 5'-AGCGGATAACAATTTCACACAGGAAACAGC-3'; and
Mxpil1: 5'-TTAATTAAGAGAAGGTTGCAACGGGGGGC-3',
and amplified using standard PCR conditions to yield an .about.800
bp fragment. This fragment was cleaved with restriction enzyme KpnI
and ligated to the large KpnI-EcoRV restriction fragment of
commercially available plasmid pLitmus 28 (New England Biolabs).
The resulting circular DNA was designated plasmid pKOS35-71B.
[0159] The promoter of the pilA gene from plasmid pKOS35-71B was
isolated as an .about.800 bp EcoRV-SnaBI restriction fragment and
ligated with the large MscI restriction fragment of plasmid
pKOS35-77 to yield a circular DNA .about.6.8 kb in size. Because
the .about.800 bp fragment could be inserted in either one of two
orientations, the ligation produced two plasmids of the same size,
which were designated as plasmids pKOS35-82.1 and pKOS35-82.2.
Restriction site and function maps of these plasmids are presented
in FIG. 2.
[0160] Plasmids pKOS35-82.1 and pKOS35-82.2 serve as convenient
starting materials for the vectors of the invention in which a
recombinant PKS gene is placed under the control of the Myxococcus
xanthus pilA gene promoter. These plasmids comprise a single Pad
restriction enzyme recognition sequence placed immediately
downstream of the transcription start site of the promoter. In one
illustrative embodiment, the entire epothilone PKS gene without its
homologous promoter is inserted in one or more fragments into the
plasmids at the Pad site to yield expression vectors of the
invention.
[0161] The sequence of the pilA promoter in these plasmids is shown
below.
TABLE-US-00005 CGACGCAGGTGAAGCTGCTTCGTGTGCTCCAGGAGCGGAAGGTGAAGCCG
GTCGGCAGCGCCGCGGAGATTCCCTTCCAGGCGCGTGTCATCGCGGCAAC
GAACCGGCGGCTCGAAGCCGAAGTAAAGGCCGGACGCTTTCGTGAGGACC
TCTTCTACCGGCTAACGTCATCACGTTGGAGCTGCCTCCACTGCGCGAGC
GTTCCGGCGACGTGTCGTTGCTGGCGAACTACTTCCTGTCCAGACTGTCG
GAGGAGTTGGGGCGACCCGGTCTGCGTTTCTCCCCCGAGACACTGGGGCT
ATTGGAGCGCTATCCCTTCCCAGGCAACGTGCGGCAGCTGCAGAACATGG
TGGAGCGGGCCGCGACCCTGTCGGATTCAGACCTCCTGGGGCCCTCCACG
CTTCCACCCGCAGTGCGGGGCGATACAGACCCCGCCGTGCGTCCCGTGGA
GGGCAGTGAGCCAGGGCTGGTGGCGGCTTCAACCTGGAGCGGCATCTCGA
CGACAGCGAGCGGCGCTATCTCGTCGCGGCGATGAAGCAGGCCGGGGGCG
TGAAGACCCGTGCTGCGGAGTTGCTGGGCCTTTCGTTCCGTTCATTCCGC
TACCGGTTGGCCAAGCATGGGCTGACGGATGACTTGGAGCCCGGGAGCGC
TTCGGATGCGTAGGCTGATCGACAGTTATCGTCAGCGTCACTGCCGAATT
TTGTCAGCCCTGGACCCATCCTCGCCGAGGGGATTGTTCCAAGCCTTGAG
AATTGGGGGGCTTGGAGTGCGCACCTGGGTTGGCATGCGTAGTGCTAATC
CCATCCGCGGGCGCAGTGCCCCCCGTTGCAACCTTCTCTTAATTAA
[0162] To make the recombinant Myxococcus xanthus host cells of the
invention, M. xanthus cells are grown in CYE media (Campos and
Zusman, 1975, Regulation of development in Myxococcus xanthus:
effect of 3':5'-cyclic AMP, ADP, and nutrition, Proc. Natl. Acad.
Sci. USA 72: 518-522) to a Klett of 100 at 30.degree. C. at 300
rpm. The remainder of the protocol is conducted at 25.degree. C.
unless otherwise indicated. The cells are then pelleted by
centrifugation (8000 rpm for 10 min. in an SS34 or SA600 rotor) and
resuspended in deionized water. The cells are again pelleted and
resuspended in 1/100th of the original volume.
[0163] DNA (one to two .mu.L) is electroporated into the cells in a
0.1 cm cuvette at room temperature at 400 ohm, 25 .mu.FD, 0.65 V
with a time constant in the range of 8.8-9.4. The DNA is free of
salts and is resuspended in distilled and deionized water or
dialyzed on a 0.025 .mu.m Type VS membrane (Millipore). For low
efficiency electroporations, the DNA is spot dialyzed, and
outgrowth is in CYE. Immediately after electroporation, 1 mL of CYE
is added, and the cells in the cuvette pooled with an additional
1.5 mL of CYE previously added to a 50 mL Erlenmeyer flask (total
volume 2.5 ml). The cells are grown for four to eight hours (or
overnight) at 30 to 32.degree. C. at 300 rpm to allow for
expression of the selectable marker. Then, the cells are plated in
CYE soft agar on plates with selection. With kanamycin as the
selectable marker, typical yields are 10.sup.3 to 10.sup.5 per
.mu.g of DNA. With streptomycin as the selectable marker, it is
included in the top agar, because it binds agar.
[0164] With this procedure, the recombinant DNA expression vectors
of the invention are electroporated into Myxococcus host cells that
express recombinant PKSs of the invention and produce the
epothilone, epothilone derivatives, and other novel polyketides
encoded thereby.
EXAMPLE 2
Construction of a Bacterial Artificial-Chromosome (BAC) for
Expression of Epothilone in Myxococcus xanthus
[0165] To express the epothilone PKS and modification enzyme genes
in a heterologous host to produce epothilones by fermentation,
Myxococcus xanthus, which is closely related to Sorangium
cellulosum and for which a number of cloning vectors are available,
is employed in accordance with the methods of the invention. M.
xanthus and S. cellulosum are myxobacteria and so may share common
elements of gene expression, translational control, and post
translational modification (if any). M. xanthus has been developed
for gene cloning and expression: DNA can be introduced by
electroporation, and a number of vectors and genetic markers are
available for the introduction of foreign DNA, including those that
permit its stable insertion into the chromosome. M. xanthus can be
grown with relative ease in complex media in fermentors and can be
subjected to manipulations to increase gene expression, if
required.
[0166] To introduce the epothilone gene cluster into Myxococcus
xanthus, one can build the epothilone cluster into the chromosome
by using homologous recombination to assemble the complete gene
cluster. Alternatively, the complete epothilone gene cluster can be
cloned on a bacterial artificial chromosome (BAC) and then moved
into M. xanthus for integration into the chromosome.
[0167] To assemble the gene cluster from cosmids pKOS35-70.1A2, and
pKOS35-79.85, small regions (.about.2 kb or larger) of homology
from these cosmids are introduced into Myxococcus xanthus to
provide recombination sites for larger pieces of the gene cluster.
As shown in FIG. 3, plasmids pKOS35-154 and pKOS90-22 are created
to introduce these recombination sites. The strategy for assembling
the epothilone gene cluster in the M. xanthus chromosome is shown
in FIG. 4. Initially, a neutral site in the bacterial chromosome is
chosen that does not disrupt any genes or transcriptional units.
One such region is downstream of the devS gene, which has been
shown not to affect the growth or development of M. xanthus. The
first plasmid, pKOS35-154, is linearized with DraI and
electroporated into M. xanthus. This plasmid contains two regions
of the dev locus flanking two fragments of the epothilone gene
cluster. Inserted in between the epo gene regions is a cassette
composed of a kanamycin resistance marker and the E. coli galK
gene. See Ueki et al., 1996, Gene 183: 153-157, incorporated herein
by reference. Kanamycin resistance arises in colonies if the DNA
recombines into the dev region by a double recombination using the
dev sequence as regions of homology.
[0168] This strain, K35-159, contains small (.about.2.5 kb) regions
of the epothilone gene cluster that will allow for recombination of
pKOS35-79.85. Because the resistance markers on pKOS35-79.85 are
the same as that in K35-159, a tetracycline transposon was
transposed into the cosmid, and cosmids that contain the transposon
inserted into the kanamycin marker were selected. This cosmid,
pKOS90-23, was electroporated into K35459, and oxytetracycline
resistant colonies were selected to create strain K35-174. To
remove the unwanted regions from the cosmid and leave only the
epothilone genes, cells were plated on CYE plates containing 1%
galactose. The presence of the galK gene makes the cells sensitive
to 1% galactose. Galactose resistant colonies of K35474 represent
cells that have lost the galK marker by recombination or by a
mutation in the galK gene. If the recombination event occurs, then
the galactose resistant strain is sensitive to kanamycin and
oxytetracycline. Strains sensitive to both antibiotics are verified
by Southern blot analysis. The correct strain is identified and
designated K35-175 and contains the epothilone gene cluster from
module 7 to 4680 bp downstream of the stop codon of epoK.
[0169] To introduce modules 1 through module 7, the above process
is repeated once more. The plasmid pKOS90-22 is linearized with
DraI and electroporated into K35475 to create K111-13.2. This
strain is electroporated with the tetracycline resistant version of
pKOS35-70.1A2, pKOS90-38, and colonies resistant to oxytetracycline
are selected. This creates strain K111-13.23. Recombinants that now
have the whole epothilone gene cluster are selected by resistance
to 1% galactose. This results in clones K111-32.25, K111-32.26, and
K111-32.35. Strain K111-32.25 has been deposited with the ATCC in
compliance with the Budapest Treaty and is available under
accession No. ATCC ______. This strain contains all the epothilone
genes and their promoters.
[0170] Fermentation was performed by inoculating strains into 5 mL
of CYE in a 50 mL flask and growing overnight until the culture was
in mid log growth phase. A 100 .mu.L aliquot was spread onto a CTS
plate, and the plate incubated at 32.degree. C. for 4 to 5 days. To
extract epothilones, the agar plate with cells was macerated, put
in a 50 mL conical tube, and acetone added to fill the tube. The
solution was incubated with rocking for 4 to 5 hours, the acetone
evaporated, and the remaining liquid extracted twice with an equal
volume of ethyl acetate. The water was removed from the ethyl
acetate extract by adding magnesium sulfate. The magnesium sulfate
was filtered out, and the liquid was evaporated to dryness. The
epothilones were resuspended in 200 .mu.L of acetonitrile and
analyzed by LC/MS. The analysis showed that the strain produced
epothilones A and B, with epothilone B present at about 0.5 mg/L in
the culture, and epothilone A at 5 to 10-fold lower levels.
[0171] Alternatively, this strain can be used to produce
epothilones in liquid culture. A flask containing CYE is inoculated
with an epothilone producing strain. The next day, while the cells
are in mid-log growth phase, a 5% inoculum is added to a flask
containing 0.5% CMM (0.5% casitone, 0.2% MgSO4.7H2O, 10 mM MOPS
pH7.6) along with 1 mg/ml serine, alanine, and glycine and 0.1%
sodium pyruvate. The sodium pyruvate can be added to 0.5% to
increase epothilone B production but causes a decrease in the ratio
of epothilone B to epothilone A. The culture is grown at 30.degree.
C. for 60-72 hours. Longer incubations result in a decrease in
titers of epothilones. To recover epothilones, the cultures are
centrifuged at 10,000 rpm for 10 minutes in an SS34 rotor. The
supernatants are extracted twice with ethyl acetate and rotavaped
to dryness. Liquid cultures produced 2 to 3 mg/L of epothilones A
and B, with ratios similar to that observed with plate cultures. If
XAD (0.5-2%) was added to the culture, epothilones C and D were
observed, with epothilone D present at 0.5 to 1 mg/L and epothilone
C present at 5 to 10-fold lower levels.
[0172] To clone the whole gene cluster as one fragment, a bacterial
artificial chromosome (BAC) library is constructed. First, SMP44
cells are embedded in agarose and lysed according to the BIO-RAD
genomic DNA plug kit. DNA plugs are partially digested with
restriction enzyme, such as Sau3AI or HindIII, and electrophoresed
on a FIGE or CHEF gel. DNA fragments are isolated by electroeluting
the DNA from the agarose or using gelase to degrade the agarose.
The method of choice to isolate the fragments is electroelution, as
described in Strong et al., 1997, Nucleic Acids Res. 19: 3959-3961,
incorporated herein by reference. The DNA is ligated into the BAC
(pBeloBACII) cleaved with the appropriate enzyme. A map of
pBeloBACII is shown below.
##STR00005##
The DNA is electroporated into DH10B cells by the method of Sheng
et al., 1995, Nucleic Acids Res. 23: 1990-1996, incorporated herein
by reference, to create a Sorangium cellulosum genomic library.
Colonies are screened using a probe from the NRPS region of the
epothilone cluster. Positive clones are picked and DNA is isolated
for restriction analysis to confirm the presence of the complete
gene cluster. This positive clone is designated pKOS35-178.
[0173] To create a strain that can be used to introduce pKOS35-178,
a plasmid, pKOS35-164, is constructed that contains regions of
homology that are upstream and downstream of the epothilone gene
cluster flanked by the dev locus and containing the kanamycin
resistance galK cassette, analogous to plasmids pKOS90-22 and
pKOS35-154. This plasmid is linearized with DraI and electroporated
into Myxococcus xanthus, in accordance with the method of Kafeshi
et al., 1995, Mol. Microbiol. 15: 483-494, to create K35-183. The
plasmid pKOS35-178 can be introduced into K35-183 by
electroporation or by transduction with bacteriophage P1, and
chloramphenicol resistant colonies are selected. Alternatively, a
version of pKOS35-178 that contains the origin of conjugative
transfer from pRP4 can be constructed for transfer of DNA from E.
coli to K35-183. This plasmid is made by first constructing a
transposon containing the oriT region from RP4 and the tetracycline
resistance maker from pACYC184 and then transposing the transposon
in vitro or in vivo onto pKOS35-178. This plasmid is transformed
into S17-1 and conjugated into M. xanthus. This strain, K35-190, is
grown in the presence of 1% galactose to select for the second
recombination event. This strain contains all the epothilone genes
as well as all potential promoters. This strain is fermented and
tested for the production of epothilones A and B.
[0174] Alternatively, the transposon can be recombined into the BAC
using either the temperature sensitive plasmid pMAK705 or pKO3 by
transposing the transposon onto either pMAK705 or pKO3, selecting
for tetR and camS plasmids; the recombination is accomplished as
described in Hamilton et al., September 1989, J. Bact. 171(9):
4617-4622 and Link et al., October 1997, J. Bact. 179(20):
6228-6237, each of which is incorporated herein by reference.
[0175] Besides integrating pKOS35-178 into the dev locus, it can
also be integrated into a phage attachment site using integration
functions from myxophages Mx8 or Mx9. A transposon is constructed
that contains the integration genes and att site from either Mx8 or
Mx9 along with the tetracycline gene from pACYC184. Alternative
versions of this transposon may have only the attachment site. In
this version, the integration genes are then supplied in trans by
coelectroporation of a plasmid containing the integrase gene or
having the integrase protein expressed in the electroporated strain
from any constitutive promoter, such as the mgl promoter (see
Magrini et al., July 1999, J. Bact. 181(13): 4062-4070,
incorporated herein by reference). Once the transposon is
constructed, it is transposed onto pKOS35-178 to create pKOS35-191.
This plasmid is introduced into Myxococcus xanthus as described
above. This strain contains all the epothilone genes as well as all
potential promoters. This strain is fermented and tested for the
production of epothilones A and B.
[0176] Once the epothilone genes have been established in a strain
of Myxococcus xanthus, manipulation of any part of the gene
cluster, such as changing promoters or swapping modules, can be
performed using the kanamycin resistance and galK cassette, as
described below. Cultures of Myxococcus xanthus containing the epo
genes are grown in a number of media and examined for production of
epothilones. If the levels of production of epothilones (in
particular B or D) are low, then the M. xanthus-producing clones
are subjected to media development and mutation based strain
improvement.
EXAMPLE 3
Process for the Production of Epothilones B and D
[0177] A. Production of epothilone B
[0178] I. Flasks
[0179] A 1 mL vial of the K111-32-25 strain is thawed and the
contents transferred into 3 mL of CYE seed media in a glass tube.
This culture is incubated for 72.+-.12 hours at 30.degree. C.,
followed by the subculturing of 3 mL of this tube culture into 50
mL of CYE media within a 250 mL baffled Erlenmeyer flask. This CYE
flask is incubated for 24.+-.8 hours at 30.degree. C., and 2.5 mL
of this seed (5% v/v) used to inoculate the epothilone production
flasks (50 mL of CTS-TA media in a 250 mL baffled Erlenmeyer
flask). These flasks are then incubated at 30.degree. C. for
48.+-.12 hours, with a media pH at the beginning of 7.4. The peak
epothilone A titer is 0.5 mg/t, and the peak epothilone B titer is
2.5 mg/L.
[0180] II. Fermentors
[0181] A similar inoculum expansion of K111-32-25 as described
above is used, with the additional step that 25 mL of the 50 mL CYE
seed is subcultured into 500 Mt of CYE. This secondary seed is used
to inoculate a 10 L fermentor containing 9.5 L of CTS-TA, and 1 g/L
of sodium pyruvate. The process parameter setpoints for this
fermentation are: pH--7.4; agitation--400 rpm; sparge rate--0.15
vvm. These parameters were sufficient to maintain the DO at greater
than 80% of saturation. The pH control is provided by addition of
2.5 N sulfuric acid and sodium hydroxide to the cultures. Peak
epothilone titers are achieved at 48.+-.8 hours. The peak
epothilone A titer is 1.6 mg/L, and the peak epothilone B titer is
5.2 mg/L.
B. Production of Epothilone D
[0182] I. Flasks
[0183] A 1 mL vial of the K111-40-1 strain (described in a
following example) is thawed and the contents transferred into 3 mL
of CYE seed media in a glass tube. This culture is incubated for
72.+-.12 hours at 30.degree. C., followed by the subculturing of 3
mL of this tube culture into 50 mL of CYE media within a 250 mL
baffled Erlenmeyer flask. This CYE flask is incubated for 24.+-.8
hours at 30.degree. C., and 2.5 mL of this seed (5% v/v) used to
inoculate the epothilone production flasks (50 mL of 1.times. wheat
gluten media in a 250 mL baffled Erlenmeyer flask). These flasks
are then incubated at 30.degree. C. for 48.+-.12 hours, with a
media pH at the beginning of 7.4. The peak epothilone C titer is
1.4 mg/L, and the peak epothilone D titer is 7.2 mg/L.
[0184] II. Fermentors
[0185] A similar inoculum expansion of K111-40-1 as described above
is used, with the additional step that 25 mL of the 50 mL CYE seed
is subcultured into 500 mL of CYE. 250 mL of this secondary seed is
used to inoculate a 5 L fermentor containing 4.5 L of CIS-TA, with
a 1 g/L daily feed of sodium pyruvate. The process parameter
setpoints for this fermentation are: pH--7.4; agitation--400 rpm;
sparge rate--0.15 vvm. These parameters were sufficient to maintain
the DO at greater than 80% of saturation. The pH control is
provided by addition of 2.5 N sulfuric acid and sodium hydroxide to
the cultures. Peak epothilone titers are achieved at 36.+-.8 hours.
The peak epothilone C titer is 0.5 mg/L, and the peak epothilone D
titer is 1.6 mg/L.
TABLE-US-00006 CYE Seed Media Component Concentration Casitone
(Difco) 10 g/L Yeast Extract (Difco) 5 g/L MgSO.sub.4_7H.sub.20 (EM
Science) 1 g/L HEPES buffer 50 mM
Sterilized by autoclaving for 30 minutes at 121.degree. C.
TABLE-US-00007 CTS-TA Production Media Component Concentration
Casitone (Difco) 5 g/L MgSO.sub.4_7H.sub.20 (EM Science) 2 g/L
L-alanine, L-serine, glycine 1 mg/L HEPES buffer 50 mM
Sterilized by autoclaving for 30 minutes at 121.degree. C.
TABLE-US-00008 1x Wheat Gluten Production Media Component
Concentration Wheat Gluten (Sigma) 5 g/L MgSO.sub.4_7H.sub.20 (EM
Science) 2 g/L HEPES buffer 50 mM
Sterilized by autoclaving for 45 minutes at 121.degree. C.
EXAMPLE 4
Construction of a Myxococcus Strain with Non-Functional epoK
Gene
[0186] Strain K111-40-1 was constructed from strain K111-32.25 by
insertional inactivation of the epoK gene. To construct an epoK
mutant, a kanamycin resistance cassette was inserted into the epoK
gene. This was done by isolating the 4879 bp fragment from
pKOS35-79.85, which contains epoK, and ligating it into the NotI
site of pBluescriptSKII+. This plasmid, pKOS35-83.5, was partially
cleaved with ScaI, and the 7.4 kb fragment was ligated with the 1.5
kb EcoRI-BamHI fragment containing the kanamycin resistance gene
from pBJ180-2, which had the DNA ends made blunt with the Klenow
fragment of DNA polymerase I, to yield plasmid pKOS90-55. Finally,
the .about.400 bp RP4 oriT fragment from pBJ183 was ligated into
the XbaI and EcoRI sites to create pKOS90-63. This plasmid was
linearized with DraI and electroporated into the Myxococcus xanthus
strain K111-32.25.
[0187] To create a markerless epoK mutation, pKOS35-83.5 was
cleaved with ScaI and the 2.9 kb and 4.3 kb fragments were ligated
together. This plasmid, pKOS90-101, has an in-frame deletion in
epoK. Next, the 3 kb BamHI and NdeI fragment from KG2, which had
the DNA ends made blunt with the Klenow fragment of polymerase I
and contains the kanamycin resistance and galK genes, was ligated
into the DraI site of pKOS90-101 to create pKOS90-105. This plasmid
was electroporated into K111-32.25 and kanamycin resistant
electroporants were selected. To replace the wild type copy of epoK
with the deletion, the second recombination event was selected by
growth on galactose plates. These galactose resistant colonies are
tested for production of epothilone C and D, and a producing strain
is designated K111-72.
EXAMPLE 5
Addition of matBC
[0188] The matBC genes encode a malonyl-CoA synthetase and a
dicarboxylate carrier protein, respectively. See An and Kim, 1998,
Eur. J. Biochem. 257: 395-402, incorporated herein by reference.
These two proteins are responsible for the conversion of exogenous
malonate to malonyl-CoA inside the cell. The products of the two
genes can transport dicarboxylic acids and convert them to CoA
derivatives (see U.S. patent application Ser. No. 60/159,060, filed
13 Oct. 1999, incorporated herein by reference). These two genes
can be inserted into the chromosome of Myxococcus xanthus to
increase the cellular concentrations of malonyl-CoA and
methymalonyl-CoA to increase polyketide production. This is
accomplished by cleaving pMATOP-2 with BglII and SpeI and ligating
it into the BglII and SpeI sites of pKOS35-82.1, which contains the
tetracycline resistance conferring gene, the Mx8 att site and the
M. xanthus pilA promoter to drive expression of matBC. This plasmid
can be electroporated into M. xanthus. Because the pilA promoter is
highly transcribed, it may be necessary to insert a weaker promoter
in the event that too much MatB and MatC affect cell growth.
Alternative promoters include the promoter of the kanamycin
resistance conferring gene.
EXAMPLE 6
Mutation of the KS.sup.Y in the Loading Module
[0189] The proposed mechanism of initiation of epothilone
biosynthesis is the binding of malonate to the ACP of the loading
domain and the subsequent decarboxylation by the loading KS domain.
The loading KS domain contains a tyrosine at the active site
cysteine (KS.sup.Y) which renders it unable to perform the
condensation reaction. However, it is proposed to still perform the
decarboxylation. Recent work with rat fatty acid synthase has shown
that a KS domain which contains a glutamine in the active site
cysteine (KS.sup.Q) increases the decarboxylation by two orders of
magnitude whereas changing this amino acid to serine, alanine,
asparagine, glycine or threonine resulted in no increase relative
to wild type. Therefore, changing the KS.sup.Y to KS.sup.Q may
increase the priming of epothilone resulting in an increase in
epothilone production. To make the change in strain K111-32.25, the
plasmid pKOS39-148 was constructed that has .about.850 bp of the
epothilone KS loading module coding sequence. The KS.sup.Q mutation
was created in this plasmid by site directed mutagenesis. To
perform a gene replacement in K111-32.25, the kanamycin resistance
and galK genes from KG2 were inserted into the DraI sites of
pKOS39-148 to create plasmids pKOS111-56.2A and pKOS111-56.2B. The
plasmids differ in their orientation of the kanamycin-galK
cassette. These plasmids were electroporated into K111-32.25 and
kanamycin resistant colonies were selected to create strains
K111-63. To replace the wild type loading module KS, K111-63 was
plated on CYE galactose plates, and colonies were screened for the
presence of the KSQ mutation by PCR and sequencing.
EXAMPLE 7
Addition of mtaA
[0190] To increase the levels of P pant transferase protein, the
Ppant transferase from Stigmatella aurantiaca strain DW4 can be
added to K111-32.25. This is done by PCR amplification of mtaA from
DW4 chromosomal DNA using the primers 111-44.1
(AAAAGCTTCGGGGCACCTCCTGGCTGTCGGC) and 111-44.4
(GGTTAATTAATCACCCTCCTCCCACCCCGGGCAT). See Silakowski et al., 1999,
J. Biol. Chem. 274(52):37391-37399, incorporated herein by
reference. The .about.800 bp fragment was cleaved with NcoI and
ligated into the pUHE24-2B that had been cleaved with PstI, the DNA
ends made blunt with the Klenow fragment of DNA polymerase I, and
cleaved with NcoI. This plasmid is designated pKOS111-54. The mtaA
gene is transferred to plasmid pKOS35-82.1, which contains the
tetracycline resistance conferring gene, the Mx8 att site and the
Myxococcus xanthus pilA promoter to drive expression of mtaA. This
plasmid is introduced into M. xanthus and integrated into the Mx8
phage attachment site.
EXAMPLE 8
Construction of Promoter Replacement Plasmids
[0191] To improve epothilone production levels and to illustrate
the wide variety of promoters that can be used to express PKS genes
in host cells of the invention, a series of vectors and host cells
can be constructed to replace the Sorangium cellulosum epothilone
PKS gene promoter with other suitable promoters, as described in
this example.
A. Construction of Plasmid with Downstream Flanking Region
[0192] Cosmid pKOS35-70.8A3 was cut with NsiI and AvrII. The 9.5 kb
fragment was ligated with pSL1190 cut with PstI and AvrII to yield
pKOS90-13. Plasmid pKOS90-13 is .about.12.9 kb. Plasmid pKOS90-13
was cut with EcoRI/AvrII. The 5.1 kb fragment was ligated with
pBluescript digested with EcoRI/SpeI to create pKOS90-64
(.about.8.1 kb). This plasmid contains the downstream flanking
region for the promoter (epoA and some sequence upstream of the
start codon). The EcoRI site is .about.220 bp upstream from the
start codon for the epoA gene. The AvrII site is 5100 bp downstream
from the EcoRI site.
B. Cloning of Upstream Flanking Region
[0193] Primers 90-66.1 and 90-67 (shown below) were used to clone
the upstream flanking region. Primer 90-67 is at the 5' end of the
PCR fragment and 90-66.1 is at the 3' end of the PCR fragment. The
fragment ends 2481 bp before the start codon for the epoA gene. The
.about.2.2 kb fragment was cut with HindIII. Klenow polymerase was
added to blunt the HindIII site. This fragment was ligated into the
HincII site of pNEB193. Clones with the proper orientation, those
with the EcoRI site at the downstream end of the insert and HindIII
at the upstream end of the insert, were selected and named
pKOS90-90.
##STR00006##
C. Construction of Final Plasmid
[0194] Plasmid pKOS90-90 was cut with EcoRI and HindIII. The 2.2 kb
fragment was ligated with pKOS90-64 digested with EcoRI/HindIII to
create pKOS 90-91 (10.3 kb). Plasmid pKOS90-91 contains the
upstream flanking region of the promoter followed by the downstream
flanking region in pBluescript. There is a Pad site between the two
flanking regions to clone promoters of interest. The galK/kan.sup.r
cassette was then inserted to enable recombination into Myxococcus
xanthus. Plasmid pKOS90-91 was cut with DraI. DraI cuts once in the
amp gene and twice in the vector (near the amp gene). Plasmid KG-2
was cut with BamHI/NdeI and Klenow polymerase added to blunt the
fragment. The 3 kb fragment (containing galK/kan.sup.r genes) was
ligated with the .about.9.8 kb DraI fragment of pKOS90-91 to create
pKOS90-102 (12.8 kb).
D. Construction of Plasmid with Alternative Leader
[0195] The native leader region of the epothilone PKS genes can be
replaced a leader with a different ribosome binding site. Plasmid
pKOS39-136 (described in U.S. patent application Ser. No.
09/443,501, filed 19 Nov. 1999) was cut with PacI/AscI. The 3 kb
fragment containing the leader sequence and part of epoA was
isolated and ligated with the 9.6 kb PacI/AscI fragment of
pKOS90-102 to create pKOS90-106 (.about.12.7 kb).
E. Construction of Promoter Replacement Plasmids
[0196] I. MTA (myxothiazol) Promoter
[0197] The myxothiazol promoter was PCR amplified from Stigmatella
aurantiaca chromosomal DNA (strain DW4) using primers 111-44.3 and
111-44.5 (shown below). The 554 bp band was cloned into the HincII
site of pNEB193 to create pKOS90-107. Plasmid pKOS90-107 was cut
with PstI and XbaI and Klenow filled-in. The 560 bp band was cloned
into pKOS90-102 and pKOS90-106 cut with Pad and Klenow filled-in
(PacI cuts only once in pKOS90-102 and pKOS90-106). Plasmids were
screened for the correct orientation. The MTA promoter/pKOS90-102
plasmid was named pKOS90-114 (13.36 kb) and MTA promoter/pKOS90-106
plasmid was named pKOS90-113 (13.26 kb).
##STR00007##
[0198] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
[0199] II. TA Promoter
[0200] The putative promoter for TA along with taA, which encodes a
putative transcriptional anti-terminator, was PCR amplified from
strain TA using primers 111-44.8 (AAAGATCTCTCCCGATGCGGGAAGGC) and
11144.9 (GGGGATCCAATGGAAGGGGATGTCCGCGGAA). The ca. 1.1 kb fragment
was cleaved with BamHI and BglII and ligated into pNEB193 cleaved
with BamHI. This plasmid is designated pKOS111-56.1. The plasmid
pKOS111-56.1 was cut with EcoRI and HindIII and Klenow filled-in.
The 1.1 kb band was cloned into pKOS90-102 and pKOS90-106 cut with
PacI and Klenow filled-in (PacI cuts only once in pKOS90-102 and
pKOS90-106). Plasmids were screened for the correct orientation.
The TA promoter/90-102 plasmid was named pKOS90-115 (13.9 kb), and
the TA promoter/pKOS90-106 plasmid was named pKOS90-111 (13.8
kb).
[0201] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
[0202] III. pilA Promoter
[0203] Plasmid pKOS35-71B was cut with EcoRI and Klenow filled-in.
The 800 bp fragment was cloned into pKOS90-102 and pKOS90-106 cut
with Pad and Klenow filled-in. Plasmids were screened for the
correct orientation. The pilA promoter/pKOS90-102 plasmid was named
pKOS90-120 (13.6 kb), and the pilA promoter/pKOS90-106 plasmid was
named pKOS90-121 (13.5 kb).
[0204] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
[0205] IV. kan Promoter
[0206] Plasmid pBJ180-2 was cut with BamHI/BglII and Klenow
filled-in. The 350 bp fragment was cloned into pKOS90-102 and
pKOS90-106 cut with PacI and Klenow filled-in. Plasmids were
screened for the correct orientation. The kan promoter/pKOS90-102
plasmid was named pKOS90-126 (13.15 kb), and the kan promoter
pKOS/90-106 plasmid was named pKOS90-122 (13.05 kb).
[0207] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
[0208] V. So ce90 Promoter
[0209] The So ce90 promoter was amplified from So ce90 chromosomal
DNA using primers 111-44.6 and 111-44.7 (shown below). The
.about.900 bp band was cut with PacI and cloned into pNEB193 cut
with Pad to create pKOS90-125. Plasmid pKOS90-125 was cut with
PacI. The 924 bp band was cloned into pKOS90-102 and pKOS90-106 cut
with Pad. Plasmids were screened for the correct orientation. The
Soce90 promoter/pKOS90-102 plasmid was named pKOS90-127 (13.6 kb),
and the Soce90 promoter/pKOS90-106 plasmid was named pKOS90-128
(13.7 kb).
[0210] These plasmids are electroporated into Myxococcus host cells
containing the epothilone PKS genes, and kanamycin resistant
transformants selected to identify the single crossover
recombinants. These transformants are selected for galactose
resistance to identify the double crossover recombinants, which are
screened by Southern analysis and PCR to identify those containing
the desired recombination event. The desired recombinants are grown
and tested for epothilone production.
##STR00008##
EXAMPLE 9
Construction of a KS2 Knockout Strain
[0211] This example describes the construction of an epothilone PKS
derivative in which the KS domain of extender module 2 is rendered
inactive by a mutation changing the active site cysteine codon to
an alanine codon. The resulting derivative PKS can be provided with
synthetic precursors (as described in the following Example) to
make epothilone derivatives of the invention.
[0212] The downstream flanking region of the epothilone PKS gene
was PCR amplified using primers 90-103
(5'-AAAAAATGCATCTACCTCGCTCGTGGCGGTT-3') and 90-107.1 (5'-CCCCC
TCTAGA ATAGGTCGGCAGCGGTACCCG-3') from plasmid pKOS35-78.2. The
.about.2 kb PCR product was cut with NsiI/XbaI and ligated with
pSL1190 digested with NsiI and SpeI to create pKOS90-123
(.about.5.4 kb). A .about.2 kb PCR fragment amplified with primers
90-105 (5'-TTTTTATGCATGCGGCAGTITGAACGG-AGATGCT-3') and 90-106
(5'-CCCCCGAATTCTCCCGGAAGGCACACGGAGAC-3') from pKOS35-78.2 DNA was
cut with NsiI and ligated with pKOS90-123 digested with NsiI/EcoRV
to create pKOS90-130 (.about.7.5 kb). When this plasmid is cut with
NsiI, and the DNA ends made blunt with the Klenow fragment of DNA
polymerase I and religated, plasmid pKOS90-131 is created. To clone
the galK/kan.sup.r cassette into this plasmid, plasmid KG-2 is cut
with BamHI/NdeI and made blunt with the Klenow fragment of DNA
polymerase I. The 3 kb fragment is cloned into the DraI site of
pKOS90-131 (DraI cuts three times in the vector) to create plasmid
pKOS90-132 (10.5 kb). The NsiI site is used for the purpose of
creating the desired change from cysteine to alanine to effect the
KS2 knockout. When pKOS90-130 is cut with NsiI, made blunt with the
Klenow fragment from DNA polymerase I and religated, the codon for
cysteine is replaced with a codon for alanine.
EXAMPLE 10
Modified Epothilones from Chemobiosynthesis
[0213] This Example describes a series of thioesters for production
of epothilone derivatives via chemobiosynthesis. The DNA sequence
of the biosynthetic gene cluster for epothilone from Sorangium
cellulosum indicates that priming of the PKS involves a mixture of
polyketide and amino acid components. Priming involves loading of
the PKS-like portion of the loading module with malonyl CoA
followed by decarboxylation and loading of the module one NRPS with
cysteine, then condensation to form enzyme-bound N-acetylcysteine.
Cyclization to form a thiazoline is followed by oxidation to form
enzyme bound 2-methylthiazole-4-carboxylate, the product of the
loading module and NRPS. Subsequent condensation with methylmalonyl
CoA by the ketosynthase of module two provides the equivalent of a
diketide, as shown in the following diagram.
##STR00009##
[0214] The present invention provides methods and reagents for
chemobiosynthesis to produce epothilone derivatives in a manner
similar to that described to make 6-dEB and erythromycin analogs in
PCT Pub. Nos. 99/03986 and 97/02358. Two types of feeding
substrates are provided: analogs of the NRPS product, and analogs
of the diketide equivalent. The NRPS product analogs are used with
PKS enzymes with a mutated NRPS-like domain, and the diketide
equivalents are used with PKS enzymes with a mutated KS domain in
module two (as described in Example 9).
Loading Module Product Analogs:
##STR00010##
[0215] The loading module analogs are prepared by activation of the
corresponding carboxylic acid and treatment with
N-acetylcysteamine. Activation methods include formation of the
acid chloride, formation of a mixed anhydride, or reaction with a
condensing reagent such as a carbodiimide.
Diketide Equivalents:
##STR00011##
[0216] The diketide equivalents are prepared in a three-step
process. First, the corresponding aldehyde is treated with a Wittig
reagent or equivalent to form the substituted acrylic ester. The
ester is saponified to the acid, which is then activated and
treated with N-acetylcysteamine.
[0217] Illustrative reaction schemes for making loading module
product analogs and diketide equivalents follow. Additional
compound suitable for making diketide equivalents are shown in FIG.
1 as carboxylic acids (or aldehydes that can be converted to
carboxylic acids) that are converted to the N-acylcysteamides for
supplying to the host cells of the invention.
A. Thiophene-3-carboxylate N-acetylcysteamine thioester
[0218] A solution of thiophene-3-carboxylic acid (128 mg) in 2 mL
of dry tetrahydrofuran under inert atmosphere was treated with
triethylamine (0.25 mL) and diphenylphosphoryl azide (0.50 mL).
After 1 hour, N-acetylcysteamine (0.25 mL) was added, and the
reaction was allowed to proceed for 12 hours. The mixture was
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts were combined, washed
sequentially with water, 1 N HCl, sat. CuSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ether followed by ethyl acetate
provided pure product, which crystallized upon standing.
B. Furan-3-carboxylate N-acetylcysteamine thioester
[0219] A solution of furan-3-carboxylic acid (112 mg) in 2 mL of
dry tetrahydrofuran under inert atmosphere was treated with
triethylamine (0.25 mL) and diphenylphosphoryl azide (0.50 mL).
After 1 hour, N-acetylcysteamine (0.25 mL) was added and the
reaction was allowed to proceed for 12 hours. The mixture was
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts were combined, washed
sequentially with water, 1 N HCl, sat. CuSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ether followed by ethyl acetate
provided pure product, which crystallized upon standing.
C. Pyrrole-2-carboxylate N-acetylcysteamine thioester
[0220] A solution of pyrrole-2-carboxylic acid (112 mg) in 2 mL of
dry tetrahydrofuran under inert atmosphere was treated with
triethylamine (0.25 mL) and diphenylphosphoryl azide (0.50 mL).
After 1 hour, N-acetylcysteamine (0.25 mL) was added and the
reaction was allowed to proceed for 12 hours. The mixture was
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts were combined, washed
sequentially with water, 1 N HCl, sat. CuSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ether followed by ethyl acetate
provided pure product, which crystallized upon standing.
D. 2-Methyl-3-(3-thienyl)acrylate N-acetylcysteamine thioester
[0221] (1) Ethyl 2-methyl-3-(3-thienyl)acrylate: A mixture of
thiophene-3-carboxaldehyde (1.12 g) and
(carbethoxyethylidene)triphenylphosphorane (4.3 g) in dry
tetrahydrofuran (20 mL) was heated at reflux for 16 hours. The
mixture was cooled to ambient temperature and concentrated to
dryness under vacuum. The solid residue was suspended in 1:1
ether/hexane and filtered to remove triphenylphosphine oxide. The
filtrate was filtered through a pad of SiO.sub.2 using 1:1
ether/hexane to provide the product (1.78 g, 91%) as a pale yellow
oil.
[0222] (2) 2-Methyl-3-(3-thienyl)acrylic acid: The ester from (1)
was dissolved in a mixture of methanol (5 mL) and 8 N KOH (5 mL)
and heated at reflux for 30 minutes. The mixture was cooled to
ambient temperature, diluted with water, and washed twice with
ether. The aqueous phase was acidified using 1N HCl then extracted
3 times with equal volumes of ether. The organic extracts were
combined, dried with MgSO.sub.4, filtered, and concentrated to
dryness under vacuum. Crystallization from 2:1 hexane/ether
provided the product as colorless needles.
[0223] (3) 2-Methyl-3-(3-thienyl)acrylate N-acetylcysteamine
thioester: A solution of 2-Methyl-3-(3-thienyl)acrylic acid (168
mg) in 2 mL of dry tetrahydrofuran under inert atmosphere was
treated with triethylamine (0.56 mL) and diphenylphosphoryl azide
(0.45 mL). After 15 minutes, N-acetylcysteamine (0.15 mL) is added
and the reaction is allowed to proceed for 4 hours. The mixture is
poured into water and extracted three times with equal volumes of
ethyl acetate. The organic extracts are combined, washed
sequentially with water, 1 N HCl, sat. CuSO.sub.4, and brine, then
dried over MgSO.sub.4, filtered, and concentrated under vacuum.
Chromatography on SiO.sub.2 using ethyl acetate provided pure
product, which crystallized upon standing.
[0224] The above compounds are supplied to cultures of host cells
containing a recombinant epothilone PKS of the invention in which
either the NRPS or the KS domain of module 2 has been inactivated
by mutation to prepare the corresponding epothilone derivative of
the invention.
[0225] The invention having now been described by way of written
description and examples, those of skill in the art will recognize
that the invention can be practiced in a variety of embodiments and
that the foregoing description and examples are for purposes of
illustration and not limitation of the following claims.
Sequence CWU 1
1
17130DNAArtificialPrimer Seq1 1agcggataac aatttcacac aggaaacagc
30229DNAArtificialPrimer Mxpil1 2ttaattaaga gaaggttgca acggggggc
293848DNAArtificialpilA promoter 3cgacgcaggt gaagctgctt cgtgtgctcc
aggagcggaa ggtgaagccg gtcggcagcg 60ccgcggagat tcccttccag gcgcgtgtca
tcgcggcaac gaaccggcgg ctcgaagccg 120aagtaaaggc cggacgcttt
cgtgaggacc tcttctaccg gctcaacgtc atcacgttgg 180agctgcctcc
actgcgcgag cgttccggcg acgtgtcgtt gctggcgaac tacttcctgt
240ccagactgtc ggaggagttg gggcgacccg gtctgcgttt ctcccccgag
acactggggc 300tattggagcg ctatcccttc ccaggcaacg tgcggcagct
gcagaacatg gtggagcggg 360ccgcgaccct gtcggattca gacctcctgg
ggccctccac gcttccaccc gcagtgcggg 420gcgatacaga ccccgccgtg
cgtcccgtgg agggcagtga gccagggctg gtggcgggct 480tcaacctgga
gcggcatctc gacgacagcg agcggcgcta tctcgtcgcg gcgatgaagc
540aggccggggg cgtgaagacc cgtgctgcgg agttgctggg cctttcgttc
cgttcattcc 600gctaccggtt ggccaagcat gggctgacgg atgacttgga
gcccgggagc gcttcggatg 660cgtaggctga tcgacagtta tcgtcagcgt
cactgccgaa ttttgtcagc cctggaccca 720tcctcgccga ggggattgtt
ccaagccttg agaattgggg ggcttggagt gcgcacctgg 780gttggcatgc
gtagtgctaa tcccatccgc gggcgcagtg ccccccgttg caaccttctc 840ttaattaa
848431DNAArtificialPrimer 111-44.1 4aaaagcttcg gggcacctcc
tggctgtcgg c 31534DNAArtificialPrimer 111-44.4 5ggttaattaa
tcaccctcct cccaccccgg gcat 34633DNAArtificialPrimer 90-66.1
6gcgggaagct ttcacggcgc aggccctcgt ggg 33731DNAArtificialPrimer
90-67 7gcggtacctt caacaggcag gccgtctcat g 31832DNAArtificialPrimer
111-44.3 8aaaagcttag gcggtattgc tttcgttgca ct
32934DNAArtificialPrimer 111-44.5 9ggttaattaa ggtcagcaca cggtccgtgt
gcat 341026DNAArtificialPrimer 111-44.8 10aaagatctct cccgatgcgg
gaaggc 261131DNAArtificialPrimer 111-44.9 11ggggatccaa tggaagggga
tgtccgcgga a 311234DNAArtificialPrimer 111-44.6 12ggttaattaa
catcgcgcta tcagcagcgc tgag 341334DNAArtificialPrimer 111-44.7
13ggttaattaa tcctcagcgg ctgacccgct cgcg 341431DNAArtificialPrimer
90-103 14aaaaaatgca tctacctcgc tcgtggcggt t
311532DNAArtificialPrimer 90-107.1 15ccccctctag aataggtcgg
cagcggtacc cg 321634DNAArtificialPrimer 90-105 16tttttatgca
tgcggcagtt tgaacggaga tgct 341732DNAArtificialPrimer 90-106
17cccccgaatt ctcccggaag gcacacggag ac 32
* * * * *