U.S. patent application number 12/168563 was filed with the patent office on 2009-04-30 for vector system.
Invention is credited to Susan Mary Kingsman, James Miskin, Kyri Mitrophanous, Jonathan Rohll.
Application Number | 20090111106 12/168563 |
Document ID | / |
Family ID | 9900826 |
Filed Date | 2009-04-30 |
United States Patent
Application |
20090111106 |
Kind Code |
A1 |
Mitrophanous; Kyri ; et
al. |
April 30, 2009 |
Vector System
Abstract
The present invention provides a vector system comprising a
mutated post-transcriptional regulatory element. In particular, the
present invention relates to a mutated WPRE sequence that can
efficiently express nucleotides of interest in a retroviral vector
system. The present invention also relates to methods of delivering
and expressing nucleotides of interest to a target cell.
Inventors: |
Mitrophanous; Kyri; (Oxford,
GB) ; Rohll; Jonathan; (Oxford, GB) ; Miskin;
James; (Oxford, GB) ; Kingsman; Susan Mary;
(Oxford, GB) |
Correspondence
Address: |
FROMMER LAWRENCE & HAUG
745 FIFTH AVENUE- 10TH FL.
NEW YORK
NY
10151
US
|
Family ID: |
9900826 |
Appl. No.: |
12/168563 |
Filed: |
July 7, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10873573 |
Jun 21, 2004 |
7419829 |
|
|
12168563 |
|
|
|
|
10408456 |
Apr 7, 2003 |
7259015 |
|
|
10873573 |
|
|
|
|
PCT/GB01/04433 |
Oct 5, 2001 |
|
|
|
10408456 |
|
|
|
|
Current U.S.
Class: |
435/5 ;
435/235.1; 435/320.1; 435/325; 435/455; 536/23.5 |
Current CPC
Class: |
C12N 2840/206 20130101;
A61K 48/00 20130101; C12N 15/86 20130101; A61P 25/16 20180101; C12N
2830/48 20130101; C12N 2740/15043 20130101; C12N 9/0071 20130101;
A61P 25/28 20180101 |
Class at
Publication: |
435/6 ; 536/23.5;
435/320.1; 435/235.1; 435/325; 435/455 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12N 15/11 20060101 C12N015/11; C12N 15/00 20060101
C12N015/00; C12N 7/00 20060101 C12N007/00; C12N 5/06 20060101
C12N005/06; C12N 15/87 20060101 C12N015/87 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 6, 2000 |
GB |
0024550.6 |
Claims
1. An isolated nucleic acid molecule comprising a woodchuck
post-transcriptional regulatory element (WPRE) containing an X
region, wherein the WPRE has a mutation in the X region whereby
expression of a functional X protein is prevented.
2. The isolated nucleic acid molecule of claim 1, wherein the
mutation in the X region further prevents reversion to wild type
WPRE.
3. The isolated nucleic acid molecule of claim 1, comprising the
sequence of SEQ ID NO:1.
4. The isolated nucleic acid molecule of claim 1, wherein the X
region comprises a promoter sequence and wherein the mutation is in
the promoter sequence.
5. The isolated nucleic acid molecule of claim 1, wherein the X
region comprises an initiation codon and wherein the mutation is in
the initiation codon.
6. The isolated nucleic acid molecule of claim 1, wherein the X
protein is not expressed.
7. The isolated nucleic acid molecule of claim 1, wherein the X
protein is non-functional.
8. A retroviral vector genome comprising at least one NOI and the
isolated nucleic acid molecule of claim 1.
9. The retroviral vector genome of claim 8, which is a lentiviral
vector genome.
10. The retroviral vector genome of claim 8, wherein the retroviral
vector genome comprises a self-inactivating (SIN) LTR.
11. The retroviral vector genome of claim 9, wherein the lentiviral
vector genome is a minimal lentiviral vector genome.
12. The retroviral vector genome according to claim 9, wherein a
nucleic acid sequence encoding Rev, or a functional equivalent
thereof, is disrupted such that the nucleic acid sequence is
incapable of encoding the functional Rev or is removed from the
vector genome.
13. The retroviral vector genome according to claim 9, wherein a
nucleic acid sequence encoding Tat is disrupted such that the
nucleic acid sequence is incapable of encoding functional Tat or is
removed from the vector genome.
14. The retroviral vector genome of claim 9, wherein the lentiviral
vector genome is derived from a viral species selected from the
group consisting of human immunodeficiency virus (HIV), simian
immunodeficiency virus (SIV), visna/maedi virus (VMV), caprine
arthritis-encephalitis virus (CAEV), equine infectious anaemia
virus (EIAV), feline immunodeficiency virus (FIV) and bovine
immunodeficiency virus (BIV).
15. The retroviral vector genome of claim 9, wherein the lentiviral
vector genome is derived from a non-primate lentivirus.
16. The retroviral vector genome of claim 9, wherein the retroviral
vector genome comprises a central polypurine tract (cPPT)
sequence.
17. The retroviral vector genome of claim 9, wherein the retroviral
vector genome comprises a gag packaging signal having ATG motifs,
and wherein the ATG motifs are ATTG motifs.
18. The retroviral vector genome of claim 8, wherein the retroviral
vector genome is multicistronic.
19. The retroviral vector genome of claim 18, wherein the
retroviral vector genome comprises at least one internal regulatory
element.
20. The retroviral vector genome of claim 19, wherein the internal
regulatory element is a promoter or an internal ribosomal entry
site (IRES).
21. A retroviral vector system for producing a retrovirus-derived
vector particle, comprising: (i) the retroviral vector genome of
claim 8; (ii) a nucleotide sequence encoding retroviral gag and pol
proteins; and (iii) nucleotide sequences encoding other essential
viral packaging components not encoded by the nucleotide sequence
of ii).
22. The retroviral vector system of claim 21, wherein nucleic acid
sequence(s) encoding at least one of Vpr, Vif, Tat, Nef, or
analogous auxiliary genes, from the retrovirus from which the
particles are derived, are disrupted such as said nucleic acid
sequence(s) are incapable of encoding functional Vpr, Vif, Tat,
Nef, or analogous auxiliary proteins, or are removed from the
system.
23. The retroviral vector system of claim 21, wherein the vector
system is pseudotyped with at least part of a heterologous env
protein.
24. The retroviral vector system of claim 23, wherein the
heterologous env protein is derivable from Rabies-G or VSV-G.
25. A retroviral particle produced from the retroviral vector
system of claim 21.
26. A cell that has been transduced with the retroviral vector
system of claim 21.
27. A composition comprising the retroviral vector genome of claim
8, together with a carrier or diluent.
28. A composition comprising the viral particle of claim 25,
together with a carrier or diluent.
29. A method of delivering at least one NOI to a target cell,
comprising introducing the retroviral vector genome of claim 8 into
the target cell, whereby the NOI is delivered to the target
cell.
30. A retroviral vector comprising at least one NOI and a nucleic
acid molecule comprising a woodchuck post-transcriptional
regulatory element (WPRE) containing an X region, wherein the WPRE
has a mutation in the X region whereby expression of a functional X
protein is prevented.
31. The retroviral vector of claim 30, wherein the mutation in the
X region further prevents reversion to wildtype WPRE.
32. A method of making a retroviral particle comprising the steps
of: (i) introducing the retroviral vector of claim 30 into a
packaging cell, or introducing the retroviral vector of claim 30
together with nucleic acid sequence(s) encoding gag/pol and
envelope proteins into a producer cell; and (ii) obtaining the
retroviral vector particle therefrom, wherein said retroviral
vector particle comprises the at least one NOI and the nucleic acid
molecule comprising the mutated WPRE.
33. The method of claim 32, wherein the envelope is a heterologous
envelope protein selected from the group consisting of Rabies G and
VSV-G.
34. A method of delivering at least one NOI to a target cell,
comprising introducing the retroviral vector of claim 30 into the
target cell, whereby the NOI is delivered to the target cell.
35. A method of identifying a gene involved in tumorigenesis, said
method comprising the steps of: (i) introducing the isolated
nucleic acid of claim 1 into a cell of interest, whereby the
nucleic acid is recombined into chromosomal DNA of the cell of
interest; (ii) determining whether the cell of interest forms a
tumor; and, if the cell of interest forms a tumor; (iii) locating a
site of recombination in the chromosomal DNA; and (iv) identifying
a gene near or adjacent to the site of recombination; thereby
identifying the gene involved in tumorigenesis.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 10/408,456, filed on Apr. 7, 2003, which is a
continuation-in-part of International Application No.
PCT/GB01/04433, filed on Oct. 5, 2001, which claims priority to
British Application No. GB 0024550.6, filed on Oct. 6, 2000.
[0002] This application makes reference to U.S. application Ser.
No. 10/008,610, filed on Nov. 8, 2001, which claims priority to
U.S. Provisional Application Ser. No. 60/247,604, filed on Nov. 9,
2000.
[0003] This application also makes reference to U.S. application
Ser. No. 10/841,603, filed on May 7, 2004, which is a
continuation-in-part of International application No.
PCT/GB03/064665, filed on Feb. 3, 2003,which claims priority to
British application Nos. GB 0202403.2, filed on Feb. 1, 2002, and
GB 0212768.6, filed on May 31, 2002.
[0004] This application also makes reference to U.S. Pat. Nos.
6,312,682 and 6,312,683, the contents of which are expressly
incorporated herein by reference.
[0005] All of the foregoing applications, as well as all documents
cited in the foregoing applications ("application documents") and
all documents cited or referenced in the application documents are
incorporated herein by reference. Also, all documents cited in this
application ("herein-cited documents") and all documents cited or
referenced in herein-cited documents are incorporated herein by
reference. In addition, any manufacturer's instructions or
catalogues for any products cited or mentioned in each of the
application documents or herein-cited documents are incorporated by
reference. Documents incorporated by reference into this text or
any teachings therein can be used in the practice of this
invention. Documents incorporated by reference into this text are
not admitted to be prior art.
FIELD OF THE INVENTION
[0006] The present invention relates to a vector system comprising
a mutated post-transcriptional regulatory element. In particular,
the present invention relates to a mutated WPRE sequence that can
efficiently express nucleotides of interest in a retroviral vector
system. The present invention also relates to methods of delivering
and expressing nucleotides of interest to a target cells.
BACKGROUND OF THE INVENTION
[0007] Retroviral vector systems, such as lentiviral vector
systems, have been proposed as a delivery system for, inter alia,
the transfer of a nucleotide of interest to one or more sites of
interest. Indeed, the concept of using viral vectors for gene
therapy is well known (Verma and Somia (1997) Nature 389:239-242).
Retrovirus genomes contain accessory genes, such as a rev gene, a
tat gene, a vif gene, a nef gene, a vpr gene or an S2 gene. The
deletion of such accessory genes, particularly when using
retroviral vector systems in gene therapy, is highly advantageous.
Firstly, it permits vectors to be produced without genes normally
associated with disease in retroviral (e.g. HIV) infections.
Secondly, the deletion of accessory genes permits the vector to
package more heterologous DNA. Thirdly, genes whose function is
unknown such as dUTPase and S2, may be omitted, thus reducing the
risk of causing undesirable effects.
[0008] We have previously taught, e.g. in WO98/17815, how to remove
many of the accessory genes. Further, in WO99/45126, we describe
codon optimisation of the gag-pol sequence as a means of seeking to
overcome the Rev/RRE requirement for export and to enhance RNA
stability. However, the need remains to provide strategies for the
provision of useful and safe viral vectors, and efficient means for
their production.
[0009] WO 98/18934 involves gene transfer systems, such as
retroviral vectors; and there are other documents that may involve
retroviral vectors (See, e.g., Naldini et al., 1996 Science 272,
263; PCT/GB96/01230; Bowtell et al., 1988 J. Virol. 62, 2464;
Correll et al., 1994 Blood 84, 1812; Emerman and Temin 1984 Cell
39, 459; Ghattas et al., 1991 Mol. Cell. Biol. 11, 5848;
Hantzopoulos et al., 1989 PNAS 86, 3519; Hatzoglou et al., 1991 J.
Biol. Chem 266, 8416; Hatzoglou et al., 1988 J. Biol. Chem 263,
17798; Li et al., 1992 Hum. Gen. Ther. 3, 381; McLachlin et al.,
1993 Virol. 195, 1; Overell et al., 1988 Mol. Cell Biol. 8, 1803;
Scharfman et al., 1991 PNAS 88, 4626; Vile et al., 1994 Gene Ther
1, 307; Xu et al., 1989 Virol. 171, 331; Yee et al., 1987 PNAS 84,
5197; WO99/15683; Verma and Somia (1997) Nature 389:239-242; page
446, Chapter 9 of Coffin et al "Retroviruses" 1997 Cold Spring
Harbour Laboratory Press).
Post-Transcriptional Regulatory Elements
[0010] One shortcoming of retroviral vectors, whether based on
retroviruses or lentiviruses, is their frequent inability to
generate high levels of gene expression, particularly in vivo. Many
steps, both transcriptional and post-transcriptional, are involved
in regulating gene expression. Therefore, it is possible to enhance
expression of transgenes delivered by retroviral vectors through
the addition of elements known to post-transcriptionally increase
gene expression. The best-known example is the inclusion of introns
within the expression cassette (Choi, T. et al, (1991) Mol. Cell.
Biol. 9: 3070-3074). Many gene transfer experiments, performed both
in vitro and in vivo, have demonstrated that the presence of an
intron can facilitate gene expression.
[0011] Other types of elements can also be used to stimulate
heterologous gene expression post-transcriptionally. These
elements, unlike introns, are advantageous in that they do not
require splicing events. For instance, previous studies have
suggested that the hepatitis B virus (HBV) post-transcriptional
regulatory element (PRE) and an intron are functionally equivalent
(Huang, Z. M. and Yen, T. S. (1995) Mol. Cell. Biol. 15:
3864-3869). Woodchuck hepatitis virus (WHV), a close relative of
HBV, also harbors a PRE (hereinafter referred to as WPRE; see U.S.
Pat. Nos. 6,136,597 and 6,287,814). The WPRE has been shown to be
significantly more active than its HBV counterpart, correlating to
the presence of additional cis-acting sequences not found in the
HBV PRE. Insertion of the WPRE in lentiviral vectors resulted in
significant stimulation of expression of reporter genes such as
luciferase and green fluorescent protein (GFP) in a variety of
cells spanning different species (Zufferey, R. et al, (1999) J.
Virol 73: 2886-2892). Stimulation was irrespective of the cycling
status of transduced cells.
[0012] The WPRE contains three cis-acting sequences important for
its function in enhancing expression levels. However, in addition,
it contains a fragment of approximately 180 base pairs (bp),
comprising the 5' end of the WHV X protein open reading frame,
together with its associated promoter. The full-length X protein
has been implicated in tumorigenesis (Flajolet, M. et al, (1998) J.
Virol. 72: 6175-6180). Cis-activation of myc family oncogenes due
to the insertion of viral DNA into the host genome is known to be a
key mechanism of WHV-mediated carcinogenesis (Buendia, M. A. (1994)
In C. Brechot (ed.), Primary liver cancer: etiological and
progression factors, p. 211-224; CRC Press, Boca Raton, Fla.;
Fourel, G. (1994) In F. Tronche and M. Yaniv (ed.), Liver gene
expression, p. 297-343; R.G. Landes Company, Austin, Tex.).
[0013] The present inventors have now shown that mutation of a
region of the WPRE corresponding to the X protein ORF ablates the
tumorigenic activity of the X protein, thereby allowing the WPRE to
be used safely in retroviral and lentiviral expression vectors to
enhance expression levels of heterologous genes or nucleotides of
interest. Moreover, the modified WPRE can be used to identify genes
involved in tumorigenesis by identifying its integration site in
the chromosomal DNA of cells of interest.
SUMMARY OF THE INVENTION
[0014] According to a first aspect of the present invention, there
is provided an isolated nucleic acid molecule comprising a
woodchuck post-transcriptional regulatory element (WPRE) containing
an X region, wherein the WPRE has a mutation in the X region,
whereby expression of a functional X protein is prevented. In a
preferred embodiment, the isolated nucleic acid molecule comprises
the sequence of SEQ ID NO:1.
[0015] In a preferred embodiment, the X region comprises a
sufficient number of base pair changes such that reversion to the
wild type WPRE sequence is substantially prevented. In particularly
preferred embodiments, the X region sequence comprises at least
six, seven, eight, nine, ten, eleven, twelve or thirteen base pair
changes, relative to the wild type WPRE sequence. Preferably, the X
region of the invention comprises the sequence:
TABLE-US-00001 5 10 15 GTCTGCTGAGAGACTCGG (SEQ ID NO:2)
[0016] Preferably, the X region comprises a promoter sequence and
the mutation is partly or entirely in the promoter sequence.
Preferably, the wild type WPRE X region promoter sequence comprises
the sequence:
TABLE-US-00002 5 10 15 20 GGGGAAGCTGACGTCCTTTCC (SEQ ID NO:3)
[0017] Preferably, the X region promoter sequence comprises at
least six, seven, eight, nine, ten or eleven base pair changes
relative to the wild type WPRE sequence. Even more preferably, the
X region promoter sequence has a mutation at one or more of
positions 12, 13, 15, 16, 17, 18, 19 and/or 20 of the wild type
sequence. Advantageously, the X region promoter sequence of the
invention is:
TABLE-US-00003 5 10 15 20 GGGAAGGTCTGCTGAGACTC (SEQ ID NO:4)
[0018] Alternatively, or in addition, the X region comprises an
initiation codon and the mutation is partly or entirely in the
initiation codon. Preferably, the initiation codon of the wild type
WPRE is A at position 1, T at position 2 and G at position 3. In
one embodiment, the initiation codon comprises a nucleotide other
than T at position 2. In another embodiment, the mutation comprises
at least two base pair changes relative to the wild type WPRE
sequence. Preferably, the X region initiation codon is GGG.
[0019] Preferably, the X protein is not expressed or is
non-functional.
[0020] In a second aspect of the present invention, a retroviral
vector genome comprising at least one NOI and the isolated nucleic
acid molecule according to the first aspect of the invention is
provided.
[0021] Preferably, the retroviral vector genome is a lentiviral
vector genome. Particularly, the lentiviral vector genome can be a
minimal lentiviral vector genome. The lentiviral vector genome can
be derived from a viral species selected from the group consisting
of human immunodeficiency virus (HIV), simian immunodeficiency
virus (SIV), visna/maedi virus (VMV), caprine
arthritis-encephalitis virus (CAEV), equine infectious anaemia
virus (EIAV), feline immunodeficiency virus (FIV), and bovine
immunodeficiency virus (BIV). Preferably, the lentiviral vector
genome is derived from a non-primate lentivirus.
[0022] In another preferred embodiment, a nucleic acid sequence
encoding Rev, or a functional equivalent thereof, is disrupted such
that the nucleic acid sequence is incapable of encoding the
functional Rev or is removed from the vector genome.
[0023] In yet another preferred embodiment, a nucleic acid sequence
encoding Tat is disrupted such that the nucleic acid sequence is
incapable of encoding functional Tat or is removed from the vector
genome.
[0024] A preferred embodiment of the present invention provides a
retroviral vector genome that comprises a central polypurine tract
(cPPT) sequence. In another preferred embodiment, the retroviral
vector genome comprises a gag-packaging signal having ATG motifs,
and wherein the ATG motifs are ATTG motifs.
[0025] In another preferred embodiment, the retroviral vector
genome is multicistronic and can comprise at least one internal
regulatory element. Preferably, the internal regulatory element is
a promoter or an internal ribosomal entry site (IRES).
[0026] According to a third aspect of the present invention, there
is provided a retroviral vector system for producing a
retrovirus-derived vector particle, comprising (i) the retroviral
vector genome according to the second aspect of the invention, (ii)
a nucleotide sequence encoding retroviral gag and pol proteins;
(iii) nucleotide sequences encoding other essential viral packaging
components not encoded by the nucleotide sequence of (ii).
Preferably, nucleic acid sequence(s) encoding at least one of Vpr,
Vif, Tat, Nef, or analogous auxiliary genes, from the retrovirus
from which the particles are derived, are disrupted such as said
nucleic acid sequence(s) are incapable of encoding functional Vpr,
Vif, Tat, Nef, or analogous auxiliary proteins, or are removed from
the system.
[0027] Preferably, the vector system is pseudotyped with at least
part of a heterologous env protein. In particular, the heterologous
env protein is derivable from Rabies-G or VSV-G.
[0028] In a fifth aspect of the invention, a viral particle
produced from the retroviral vector system of the present invention
is provided.
[0029] A sixth aspect of the invention provides a cell that has
been transduced with the retroviral vector system of the present
invention.
[0030] In a seventh aspect of the invention, a composition
comprising the retroviral vector genome of the present invention,
together with a carrier or a diluent, is provided.
[0031] An eighth aspect of the invention provides a composition
comprising a viral particle of the present invention, together with
a carrier or a diluent.
[0032] A ninth aspect of the invention provides a method of
delivering at least one NOI to a target cells, comprising
introducing the retroviral vector genome of the present invention
into the target cell, whereby the NOI is delivered to the target
cell.
[0033] According to a tenth aspect, there is provided a method of
identifying genes involved in tumorigenesis, comprising the steps
of introducing the isolated nucleic acid molecule of the present
invention into a cell of interest, whereby the nucleic acid is
recombined into chromosomal DNA of the cell of interest;
determining whether the cell of interest forms a tumor; and, if the
cell of interest forms a tumor, locating a site of recombination in
the chromosomal DNA, and identifying a gene near or adjacent to the
site of recombination; thereby identifying the gene involved in
tumorigenesis.
[0034] The present invention will now be described only by way of
example, in which reference will be made to the following
Figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1 shows a schematic diagram of EIAV minimal
vectors.
[0036] FIG. 2 shows a plasmid map of pONY8G
[0037] FIG. 3 shows a plasmid map of pONY8.1G
[0038] FIG. 4 shows a plasmid map of pONY8Z
[0039] FIG. 5 shows the effect of mutations within the WPRE on the
expression level of a reporter gene, GFP. FACS analysis was used to
calculate the MFI of eGFP expression in D17 cells that were between
1% and 10% GFP-positive. The MFI.+-.SD of eGFP expression in
pSMART3G WPRE and pSMART3G WPREMut is shown.
[0040] FIG. 6 shows a comparison of the nucleotide sequence of
wild-type WPRE sequence from WHV8 (WT) (SEQ ID NO:5), WPRE from
SMART2 vectors (SMT) (SEQ ID NO:6), and WPRE incorporating
nucleotide changes designed to prevent transcription from the X
promoter and translation from the X protein initiation codon (MUT)
(SEQ ID NO:1). The region containing the X promoter and the X
protein initiation codon is underlined. Differences between the
WPRE nucleotide sequences are shown in bold type.
[0041] FIG. 7 shows a plasmid map of pONY8.9.4 MV opti Y. This
vector comprises a modified form of WPRE, at nucleotides 8206-8795
of the vector plasmid.
[0042] FIGS. 8A-8H show the sequence of pONY8.9.4 MV opti Y (SEQ ID
NO:7).
DETAILED DESCRIPTION OF THE INVENTION
[0043] Various preferred features and embodiments of the present
invention will now be described by way of non-limiting example.
Although in general, the techniques mentioned herein are well known
in the art, reference may be made in particular to Sambrook, et
al., Molecular Cloning, A Laboratory Manual (1989) and Ausubel et
al., Short Protocols in Molecular Biology (1999) 4.sup.th Ed., John
Wiley & Sons, Inc. (as well as the complete version of Current
Protocols in Molecular Biology).
[0044] As used herein, the term "operably linked" means that the
components described are in a relationship permitting them to
function in their intended manner.
Post-Transcriptional Regulatory Elements
[0045] The Woodchuck hepatitis virus (WHV) post-transcriptional
regulatory element (WPRE) can enhance expression from a number of
different vector types including lentiviral vectors (U.S. Pat. Nos.
6,136,597; 6,287,814; Zufferey, R., et al. (1999) J. Virol. 73:
2886-92). Without wanting to be bound by theory, this enhancement
is thought to be due to improved RNA processing at the
post-transcriptional level, resulting in increased levels of
nuclear transcripts. A two-fold increase in mRNA stability also
contributes to this enhancement (Zufferey, R., et al. ibid). The
level of enhancement of protein expression from transcripts
containing the WPRE versus those without the WPRE has been reported
to be around 2-to-5 fold, and correlates well with the increase in
transcript levels. This has been demonstrated with a number of
different transgenes (Zufferey, R., et al. ibid).
[0046] The WPRE contains three cis-acting sequences important for
its function in enhancing expression levels. In addition, it
contains a fragment of approximately 180 bp comprising the 5'-end
of the WHV X protein ORF (full length ORF is 425 bp), together with
its associated promoter. Translation from transcripts initiated
from the X promoter results in formation of a protein representing
the NH.sub.2-terminal 60 amino acids of the X protein. This
truncated X protein can promote tumorigenesis, particularly if the
truncated X protein sequence is integrated into the host cell
genome at specific loci (Balsano, C. et al, (1991) Biochem. Biophys
Res. Commun. 176: 985-92; Flajolet, M. et al, (1998) J. Virol. 72:
6175-80; Zheng, Y. W., et al, (1994) J. Biol. Chem. 269: 22593-8;
Runkel, L., et al, (1993) Virology 197: 529-36). Therefore,
expression of the truncated X protein could promote tumorigenesis
if delivered to cells of interest, precluding safe use of wild-type
WPRE sequences.
[0047] As used herein, the "X region" of the WPRE is defined as
comprising at least the first 60-amino acids of the X protein ORF,
including the translation initiation codon, and its associated
promoter. A "functional" X protein is defined herein as a truncated
X protein that is capable of promoting tumorigenesis, or a
transformed phenotype, when expressed in cells of interest. A
"non-functional" X protein in the context of this application is
defined as an X protein that is incapable of promoting
tumorigenesis in cells of interest.
[0048] The present inventors have introduced mutations into the
WPRE sequence, and found that the mutations prevent expression of a
functional X protein, thereby preventing tumorigenesis in the cells
of interest. Preferably, these mutations are introduced into the
promoter region of the X protein, or into the translation
initiation codon of the X protein. The present inventors have found
that the nature of these mutations, in addition to preventing
expression of a functional X protein, also prevents the reversion
back to the wild-type WPRE sequences, which can be accomplished by
the low-fidelity proofreading activity of viral-encoded reverse
transcriptase present in the vector genomes of the present
invention.
[0049] A "mutation" can comprise one or more amino acid deletions,
additions, or substitutions.
[0050] Accordingly, one aspect of the present invention provides an
isolated nucleic acid molecule comprising a WPRE containing an X
region, wherein the WPRE has a mutation in the X region whereby
expression of a functional X protein is prevented. In preferred
embodiments, the mutation is in the promoter sequence of the X
region or in the initiation codon of the X region. Preferably, as a
result of these mutations, the X protein is not expressed, or is
non-functional.
[0051] Liver tumours can occur sporadically when vectors expressing
the wild-type WPRE are transduced in utero. Despite the presence of
the wild-type WPRE, tumours do not occur in the case of every
integration event. Therefore, other secondary factors are
presumably required to promote tumorigenesis. These secondary
factors can include those arising from insertional mutagenesis as a
result of integration of the viral vector genome comprising the
wild-type WPRE. As a consequence, expression of a known factor that
is involved in, but not sufficient for, tumorigenesis (for example,
a mutated tumour suppressor gene) in the context of an integrating
vector can lead to integration within, or adjacent to, a secondary
gene that has a role in tumour generation and together with
expression of the known factor, can lead to tumorigenesis. The
tumour mass can then be removed and its genomic DNA isolated. Using
this material, the integration site can be located and the unknown
secondary factor can be identified. Location of the integration
site can be achieved by standard methods known to the skilled
artisan such as, but not limited to, Southern hybridisation and
genomic PCR.
[0052] Therefore, in an embodiment of the present invention,
methods for identifying a gene involved in tumorigenesis is
provided, comprising the steps of introducing the isolated nucleic
acid according to the first aspect of the invention, into a cell of
interest, whereby the nucleic acid is recombined into chromosomal
DNA of the cell of interest, determining whether the cell of
interest forms a tumor; and, if the cell of interest forms a tumor:
locating a site of recombination in the chromosomal DNA, and
identifying a gene near or adjacent to the site of recombination,
thereby identifying the gene involved in tumorigenesis.
Retroviruses
[0053] The concept of using viral vectors for gene therapy is well
known (Verma and Somia (1997) Nature 389:239-242).
[0054] There are many retroviruses. For the present application,
the term "retrovirus" includes: murine leukemia virus (MLV), human
immunodeficiency virus (HIV), equine infectious anaemia virus
(EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus
(RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus
(Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine
sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV),
Avian myelocytomatosis virus-29 (MC29), and Avian erythroblastosis
virus (AEV) and all other retroviridiae including lentiviruses.
[0055] A detailed list of retroviruses may be found in Coffin et al
("Retroviruses" 1997 Cold Spring Harbour Laboratory Press Eds: J M
Coffin, S M Hughes, H E Varmus pp 758-763).
[0056] Lentiviruses also belong to the retrovirus family, but they
can infect both dividing and non-dividing cells (Lewis et al (1992)
EMBO J. 3053-3058).
[0057] The lentivirus group can be split into "primate" and
"non-primate". Examples of primate lentiviruses include the human
immunodeficiency virus (HIV), the causative agent of human acquired
immunodeficiency syndrome (AIDS), and the simian immunodeficiency
virus (SIV). The non-primate lentiviral group includes the
prototype "slow virus" visna/maedi virus (VMV), as well as the
related caprine arthritis-encephalitis virus (CAEV), equine
infectious anaemia virus (EIAV) and the more recently described
feline immunodeficiency virus (FIV) and bovine immunodeficiency
virus (BIV).
[0058] Details on the genomic structure of some lentiviruses may be
found in the art. By way of example, details on HIV and EIAV may be
found from the NCBI Genbank database (i.e. Genome Accession Nos.
AF033819 and AF033820 respectively). Details of HIV variants may
also be found in the HIV databases maintained by Los Alamos
National Laboratory. Details of EIAV clones may be found at the
NCBI database maintained by the National Institutes of Health.
[0059] During the process of infection, a retrovirus initially
attaches to a specific cell surface receptor. On entry into the
susceptible host cell, the retroviral RNA genome is then copied to
DNA by the virally encoded reverse transcriptase, which is carried
inside the parent virus. This DNA is transported to the host cell
nucleus where it subsequently integrates into the host genome. At
this stage, it is typically referred to as the provirus. The
provirus is stable in the host chromosome during cell division and
is transcribed like other cellular genes. The provirus encodes the
proteins and other factors required to make more virus, which can
leave the cell by a process sometimes called "budding".
[0060] Each retroviral genome comprises genes called gag, pol and
env, which code for virion proteins and enzymes. These genes are
flanked at both ends by regions called long terminal repeats
(LTRs). The LTRs are responsible for proviral integration, and
transcription. They also serve as enhancer-promoter sequences. In
other words, the LTRs can control the expression of the viral
genes. Encapsidation of the retroviral RNAs occurs by virtue of a
psi sequence located at the 5' end of the viral genome.
[0061] The LTRs themselves are identical sequences that can be
divided into three elements, which are called U3, R and U5. U3 is
derived from the sequence unique to the 3' end of the RNA. R is
derived from a sequence repeated at both ends of the RNA and U5 is
derived from the sequence unique to the 5'end of the RNA. The sizes
of the three elements can vary considerably among different
retroviruses.
[0062] For the viral genome, the site of transcription initiation
is at the boundary between U3 and R in the left hand side LTR and
the site of poly (A) addition (termination) is at the boundary
between R and U5 in the right hand side LTR. U3 contains most of
the transcriptional control elements of the provirus, which include
the promoter and multiple enhancer sequences responsive to cellular
and in some cases, viral transcriptional activator proteins. Some
retroviruses have any one or more of the following genes that code
for proteins that are involved in the regulation of gene
expression: tat, rev, tax and rex.
[0063] With regard to the structural genes gag, pol and env
themselves; gag encodes the internal structural protein of the
virus. Gag protein is proteolytically processed into the mature
proteins MA (matrix), CA (capsid) and NC (nucleocapsid). The pol
gene encodes the reverse transcriptase (RT), which contains DNA
polymerase, associated RNase H and integrase (IN), which mediate
replication of the genome. The env gene encodes the surface (SU)
glycoprotein and the transmembrane (TM) protein of the virion,
which form a complex that interacts specifically with cellular
receptor proteins. This interaction leads ultimately to infection
by fusion of the viral membrane with the cell membrane.
[0064] Retroviruses may also contain "additional" genes, which code
for proteins other than gag, pol and env. Examples of additional
genes include in HIV, one or more of vif, vpr, vpx, vpu, tat, rev
and nef EIAV has, for example, the additional genes S2 and
dUTPase.
[0065] Proteins encoded by additional genes serve various
functions, some of which may be duplicative of a function provided
by a cellular protein. In EIAV, for example, tat acts as a
transcriptional activator of the viral LTR. It binds to a stable,
stem-loop RNA secondary structure referred to as TAR. Rev regulates
and co-ordinates the expression of viral genes through rev-response
elements (RRE). The mechanisms of action of these two proteins are
thought to be broadly similar to the analogous mechanisms in the
primate viruses. The function of S2 is unknown. In addition, an
EIAV protein, Ttm, has been identified that is encoded by the first
exon of tat spliced to the env coding sequence at the start of the
transmembrane protein.
Delivery Systems
[0066] Retroviral vector systems have been proposed as a delivery
system for, inter alia, the transfer of a NOI to one or more sites
of interest. The transfer can occur in vitro, ex vivo, in vivo, or
combinations thereof. Retroviral vector systems have even been
exploited to study various aspects of the retrovirus life cycle,
including receptor usage, reverse transcription and RNA packaging
(reviewed by Miller, 1992 Curr Top Microbiol Immunol 158:1-24).
[0067] A recombinant retroviral vector particle is capable of
transducing a recipient cell with an NOI. Once within the cell, the
RNA genome from the vector particle is reverse transcribed into DNA
and integrated into the DNA of the recipient cell.
[0068] As used herein, the term "vector genome" refers to the RNA
construct present in the retroviral vector particle and/or the
integrated DNA construct. The term also embraces a separate or
isolated DNA construct capable of encoding such an RNA genome. A
retroviral or lentiviral genome should comprise at least one
component part derivable from a retrovirus or a lentivirus. The
term "derivable" is used in its normal sense as meaning a
nucleotide sequence or a part thereof, which need not necessarily
be obtained from a virus such as a lentivirus but instead could be
derived therefrom. By way of example, the sequence may be prepared
synthetically or by use of recombinant DNA techniques. Preferably
the genome comprises a psi region (or an analogous component that
is capable of causing encapsidation).
[0069] The viral vector genome is preferably "replication
defective", by which we mean that the genome does not comprise
sufficient genetic information alone to enable independent
replication to produce infectious viral particles within the
recipient cell. In a preferred embodiment, the genome lacks a
functional env, gag or pol gene.
[0070] The viral vector genome may comprise some or all of the long
terminal repeats (LTRs). Preferably the genome comprises at least
part of the LTRs or an analogous sequence, which is capable of
mediating proviral integration, and transcription. The sequence may
also comprise or act as an enhancer-promoter sequence.
[0071] The viral vector genome of the second aspect of the
invention may be provided as a kit of parts. For example, the kit
may comprise (i) a plasmid or plasmids containing the NOIs and
internal regulatory sequences, such as, for example, a promoter or
an IRES sequence(s); and (ii) a retroviral genome construct with
suitable restriction enzyme recognition sites for cloning the NOIs
and internal regulatory sequence(s) into the viral genome.
[0072] It is known that the separate expression of the components
required to produce a retroviral vector particle on separate DNA
sequences cointroduced into the same cell will yield retroviral
particles carrying defective retroviral genomes that carry
therapeutic genes (e.g. Reviewed by Miller 1992). This cell is
referred to as the producer cell (see below).
[0073] There are two common procedures for generating producer
cells. In one, the sequences encoding retroviral Gag, Pol and Env
proteins are introduced into the cell and stably integrated into
the cell genome; a stable cell line is produced which is referred
to as the packaging cell line. The packaging cell line produces the
proteins required for packaging retroviral RNA but it cannot bring
about encapsidation due to the lack of a psi region. However, when
a vector genome having a psi region is introduced into the
packaging cell line, the helper proteins can package the
psi-positive recombinant vector RNA to produce the recombinant
virus stock. This can be used to transduce the NOI into recipient
cells. The recombinant virus whose genome lacks all genes required
to make viral proteins can infect only once and cannot propagate.
Hence, the NOI is introduced into the host cell genome without the
generation of potentially harmful retrovirus. A summary of the
available packaging lines is presented in "Retroviruses" (1997 Cold
Spring Harbour Laboratory Press Eds: J M Coffin, S M Hughes, H E
Varmus pp 449).
[0074] The present invention also provides a packaging cell line
comprising a viral vector genome of the present invention. For
example, the packaging cell line may be transduced with a viral
vector system comprising the genome or transfected with a plasmid
carrying a DNA construct capable of encoding the RNA genome. The
present invention also provides a retroviral (or lentiviral) vector
particle produced by such a cell.
[0075] The second approach is to introduce the three different DNA
sequences that are required to produce a retroviral vector particle
i.e. the env coding sequences, the gag-pol coding sequence and the
defective retroviral genome containing one or more NOIs into the
cell at the same time by transient transfection and the procedure
is referred to as transient triple transfection (Landau &
Littman 1992; Pear et al 1993). The triple transfection procedure
has been optimised (Soneoka et al 1995; Finer et al 1994). WO
94/29438 describes the production of producer cells in vitro using
this multiple DNA transient transfection method.
[0076] The components of the viral system, which are required to
complement the vector genome, may be present on one or more
"producer plasmids" for transfecting into cells.
[0077] The present invention also provides a vector system for
producing a retrovirus-derived particle, comprising [0078] (i) a
retroviral genome according to the second aspect of the invention;
[0079] (ii) a nucleotide sequence coding for retroviral gag and pol
proteins; [0080] (iii) nucleotide sequences encoding other
essential viral packaging components not encoded by the nucleotide
sequence of (ii).
[0081] Preferably, the nucleic acid sequence(s) encoding at least
one of Vpr, Vif, Tat, Nef, or analogous auxiliary genes, from the
retrovirus from which the particles are derived, are disrupted such
as said nucleic acid sequence(s) are incapable of encoding
functional Vpr, Vif, Tat, Nef, or analogous auxiliary proteins, or
are removed from the system.
[0082] The present invention also provides a cell transfected with
such a vector system and a retroviral vector particle produced by
such a cell. Preferably the gag-pol sequence is codon optimised for
use in the particular producer cell (see below).
[0083] The env protein encoded by the nucleotide sequence of iii)
may be a homologous retroviral or lentiviral env protein.
Alternatively, it may be a heterologous env, or an env from a
non-retro or lentivirus (see below under "pseudotyping").
[0084] The term "viral vector system" is used generally to mean a
kit of parts that can be used when combined with other necessary
components for viral particle production to produce viral particles
in host cells. For example, the retroviral vector genome may lack
one or more of the genes needed for viral replication. This may be
combined in a kit with a further complementary nucleotide sequence
or sequences, for example on one or more producer plasmids. By
cotransfection of the genome together with the producer plasmid(s),
the necessary components should be provided for the production of
infectious viral particles.
[0085] Alternatively, the complementary nucleotide sequence(s) may
be stably present within a packaging cell line that is included in
the kit.
[0086] The present invention also relates to a retroviral vector
system, which is capable of delivering an RNA genome to a recipient
cell, wherein the genome is longer than the wild type genome of the
lentivirus. The vector system may, for example, be an EIAV vector
system.
[0087] Preferably the RNA genome of the vector system has up to 5%,
more preferably up to 10% or even up to 30% more bases than the
wild-type genome. Preferably the RNA genome is about 10% longer
than the wild-type genome. For example, wild type EIAV comprises an
RNA genome of approximately 8 kb. An EIAV vector system of the
present invention may have an RNA genome of up to (preferably
about) 8.8 kb.
[0088] Preferably the retroviral vector system of the present
invention is a self-inactivating (SIN) vector system.
[0089] By way of example, self-inactivating retroviral vector
systems have been constructed by deleting the transcriptional
enhancers or the enhancers and promoter in the U3 region of the 3'
LTR. After a round of vector reverse transcription and integration,
these changes are copied into both the 5' and the 3' LTRs,
producing a transcriptionally inactive provirus. However, any
promoter(s) internal to the LTRs in such vectors will still be
transcriptionally active. This strategy has been employed to
eliminate effects of the enhancers and promoters in the viral LTRs
on transcription from internally placed genes. Such effects include
increased transcription or suppression of transcription. This
strategy can also be used to eliminate downstream transcription
from the 3' LTR into genomic DNA. This is of particular concern in
human gene therapy where it may be important to prevent the
adventitious activation of an endogenous oncogene (Yu et al.,
(1986) PNAS 83: 3194-98; Marty et al., (1990) Biochimie 72: 885-7;
Naviaux et al., (1996) J. Virol. 70: 5701-5; Iwakuma et al., (1999)
Virol. 261: 120-32; Deglon et al., (2000) Human Gene Therapy 11:
179-90).
[0090] Preferably a recombinase-assisted mechanism is used, which
facilitates the production of high titre regulated lentiviral
vectors from the producer cells of the present invention.
[0091] As used herein, the term "recombinase assisted system"
includes, but is not limited to, a system using the Cre
recombinase/1oxP recognition sites of bacteriophage P1 or the
site-specific FLP recombinase of S. cerevisiae, which catalyses
recombination events between 34 bp FLP recognition targets
(FRTs).
[0092] The site-specific FLP recombinase of S. cerevisiae, which
catalyses recombination events between 34 bp FLP recognition
targets (FRTs), has been configured into DNA constructs to generate
high level producer cell lines using recombinase-assisted
recombination events (Karreman et al (1996) NAR 24:1616-1624). A
similar system has been developed using the Cre recombinase/1oxP
recognition sites of bacteriophage P1 (Vanin et al (1997) J. Virol
71:7820-7826). This was configured into a lentiviral genome such
that high titre lentiviral producer cell lines were generated.
[0093] By using producer/packaging cell lines, it is possible to
propagate and isolate quantities of retroviral vector particles
(e.g. to prepare suitable titres of the retroviral vector
particles) for subsequent transduction of, for example, a site of
interest (such as adult brain tissue). Producer cell lines are
usually better for large-scale production or vector particles.
[0094] Transient transfection has numerous advantages over the
packaging cell method. In this regard, transient transfection
avoids the longer time required to generate stable vector-producing
cell lines and is used if the vector genome or retroviral packaging
components are toxic to cells. If the vector genome encodes toxic
genes or genes that interfere with the replication of the host
cell, such as inhibitors of the cell cycle or genes that induce
apoptosis, it may be difficult to generate stable vector-producing
cell lines, but transient transfection can be used to produce the
vector before the cells die. Also, cell lines have been developed
using transient infection that produce vector titre levels that are
comparable to the levels obtained from stable vector-producing cell
lines (Pear et al 1993, PNAS 90:8392-8396).
[0095] Producer cells/packaging cells can be of any suitable cell
type. Producer cells are generally mammalian cells, but can be, for
example, insect cells.
[0096] As used herein, the term "producer cell" or "vector
producing cell" refers to a cell that contains all the elements
necessary for production of retroviral vector particles.
[0097] Preferably, the producer cell is obtainable from a stable
producer cell line.
[0098] Preferably, the producer cell is obtainable from a derived
stable producer cell line.
[0099] Preferably, the producer cell is obtainable from a derived
producer cell line.
[0100] As used herein, the term "derived producer cell line" is a
transduced producer cell line that has been screened and selected
for high expression of a marker gene. Such cell lines support
high-level expression from the retroviral genome. The term "derived
producer cell line" is used interchangeably with the term "derived
stable producer cell line" and the term "stable producer cell
line.
[0101] Preferably the derived producer cell line includes, but is
not limited to, a retroviral and/or a lentiviral producer cell.
[0102] Preferably the derived producer cell line is an HIV or EIAV
producer cell line, more preferably an EIAV producer cell line.
[0103] Preferably the envelope protein sequences, and nucleocapsid
sequences are all stably integrated in the producer and/or
packaging cell. However, one or more of these sequences could also
exist in episomal form and gene expression could occur from the
episome.
[0104] As used herein, the term "packaging cell" refers to a cell
that contains those elements necessary for production of infectious
recombinant virus that are lacking in the RNA genome. Typically,
such packaging cells contain one or more producer plasmids, which
are capable of expressing viral structural proteins (such as codon
optimised gag-pol and env) but they do not contain a packaging
signal.
[0105] The term "packaging signal" which is referred to
interchangeably as "packaging sequence" or "psi" is used in
reference to the non-coding, cis-acting sequence required for
encapsidation of retroviral RNA strands during viral particle
formation. In HIV-1, this sequence has been mapped to loci
extending from upstream of the major splice donor site (SD) to at
least the gag start codon.
[0106] Packaging cell lines suitable for use with the
above-described vector constructs may be readily prepared (see also
WO 92/05266), and utilised to create producer cell lines for the
production of retroviral vector particles. As already mentioned, a
summary of the available packaging lines is presented in
"Retroviruses" (as above).
[0107] Also as discussed above, simple packaging cell lines,
comprising a provirus in which the packaging signal has been
deleted, have been found to lead to the rapid production of
undesirable replication competent viruses through recombination. In
order to improve safety, second-generation cell lines have been
produced, wherein the 3 'LTR of the provirus is deleted. In such
cells, two recombinations would be necessary to produce a wild type
virus. A further improvement involves the introduction of the
gag-pol genes and the env gene on separate constructs so-called
third generation packaging cell lines.
[0108] These constructs are introduced sequentially to prevent
recombination during transfection.
[0109] Preferably, the packaging cell lines are second-generation
packaging cell lines.
[0110] Preferably, the packaging cell lines are third generation
packaging cell lines.
[0111] In these split-construct, third generation cell lines, a
further reduction in recombination may be achieved by changing the
codons. This technique, based on the redundancy of the genetic
code, aims to reduce homology between the separate constructs, for
example, between the regions of overlap in the gag-pol and env open
reading frames.
[0112] The packaging cell lines are useful for providing the gene
products necessary to encapsidate and provide a membrane protein
for a high titre vector particle production. The packaging cell may
be a cell cultured in vitro, such as a tissue culture cell line.
Suitable cell lines include, but are not limited to, mammalian
cells, such as murine fibroblast derived cell lines or human cell
lines. Preferably the packaging cell line is a primate or human
cell line, such as for example: HEK293, 293-T, TE671, HT1080.
[0113] It is highly desirable to use high-titre virus preparations
in both experimental and practical applications. Techniques for
increasing viral titre include using a psi plus packaging signal as
discussed above and concentration of viral stocks.
[0114] As used herein, the term "high titre" means an effective
amount of a retroviral vector or particle that is capable of
transducing a target site such as a cell.
[0115] As used herein, the term "effective amount" means an amount
of a retroviral or lentiviral vector or vector particle that is
sufficient to induce expression of the NOIs at a target site.
[0116] A high-titre viral preparation for a producer/packaging cell
is usually on the order of 10.sup.5 to 10.sup.7 &retrovirus
particles per ml. For transduction in tissues such as the brain, it
is necessary to use very small volumes, so the viral preparation is
concentrated by ultracentrifugation. The resulting preparation
should have at least 10.sup.8 t.u./ml, preferably from 10.sup.8 to
10.sup.9 t.u./ml, more preferably at least 10.sup.9 t.u./ml. (The
titer is expressed in transducing units per ml (t.u./ml) as titred
on a standard D17 cell line). Other methods of concentration such
as ultrafiltration or binding to and elution from a matrix may be
used.
[0117] The expression products encoded by the NOIs may be proteins
that are secreted from the cell. Alternatively, the NOI expression
products are not secreted and are active within the cell. For some
applications, it is preferred for the NOI expression product to
demonstrate a bystander effect or a distant bystander effect; that
is the production of the expression product in one cell leading to
the modulation of additional, related cells, either neighbouring or
distant (e.g. metastatic), which possess a common phenotype. Zennou
et al., (2000) Cell 101: 173; Folleuzi et al., (2000) Nat. Genetics
25: 217; Zennou et al., (2001) Nat. Biotechnol. 19: 446.
[0118] The presence of a sequence termed the central polypurine
tract (cPPT) may improve the efficiency of gene delivery to
non-dividing cells. This cis-acting element is located, for
example, in the EIAV polymerase coding region element. Preferably
the genome of the present invention comprises a cPPT sequence.
[0119] In addition, the viral genome may comprise a translational
enhancer.
[0120] The NOIs may be operatively linked to one or more
promoter/enhancer elements. Transcription of one or more NOIs may
be under the control of viral LTRs or alternatively
promoter-enhancer elements. Preferably the promoter is a strong
viral promoter such as CMV, or is a cellular constitutive promoter
such as PGK, beta-actin or EF1 alpha. The promoter may be regulated
or tissue-specific. The control of expression can also be achieved
by using such systems as the tetracycline system that switches gene
expression on or off in response to outside agents (in this case
tetracycline or its analogues).
Pseudotyping
[0121] In the design of retroviral vector systems, it is desirable
to engineer particles with different target cell specificities to
the native virus, to enable the delivery of genetic material to an
expanded or altered range of cell types. One manner in which to
achieve this is by engineering the virus envelope protein to alter
its specificity. Another approach is to introduce a heterologous
envelope protein into the vector particle to replace or add to the
native envelope protein of the virus.
[0122] The term pseudotyping means incorporating in at least a part
of, or substituting a part of, or replacing all of, an env gene of
a viral genome with a heterologous env gene, for example, an env
gene from another virus. Pseudotyping is not a new phenomenon and
examples may be found in WO 99/61639, WO-A-98/05759, WO-A-98/05754,
WO-A-97/17457, WO-A-96/09400, WO-A-91/00047 and Mebatsion et al
1997 Cell 90, 841-847.
[0123] In a preferred embodiment of the present invention, the
vector system is pseudotyped with a gene encoding at least part of
the rabies G protein. Examples of rabies G pseudotyped retroviral
vectors may be found in WO99/61639. In a further preferred
embodiment of the present invention, the vector system is
pseudotyped with a gene encoding at least part of the VSV-G
protein. Examples of VSV-G pseudotyped retroviral vectors may be
found in U.S. Pat. No. 5,817,491.
[0124] It has been demonstrated that a retrovirus or lentivirus
minimal system can be constructed from HIV, SIV, FIV, and EIAV
viruses. Such a system requires none of the additional genes vif
vpr, vpx, vpu, tat, rev and nef for either vector production or for
transduction of dividing and non-dividing cells. It has also been
demonstrated that an EIAV minimal vector system can be constructed
which does not require S2 for either vector production or for
transduction of dividing and non-dividing cells. The deletion of
additional genes is highly advantageous. Firstly, it permits
vectors to be produced without the genes associated with disease in
lentiviral (e.g. HIV) infections. In particular, tat is associated
with disease. Secondly, the deletion of additional genes permits
the vector to package more heterologous DNA. Thirdly, genes whose
function is unknown, such as S2, may be omitted, thus reducing the
risk of causing undesired effects. Examples of minimal lentiviral
vectors are disclosed in WO-A-99/32646 and in WO-A-98/17815.
[0125] The absence of functional auxiliary genes from the
retroviral vector production system means that those functional
genes will also be absent from retroviral vector particles produced
by the system. Also, any auxiliary proteins that would otherwise be
encoded by those genes and incorporated into the vector particles
will be absent from the vector particles. In known retroviral
vector production systems, the auxiliary genes may be present as
part of the vector genome-encoding DNA, or together with the
packaging components. The location of an auxiliary gene in a vector
production system depends in part on its relationship with other
retroviral components. For example, vif is often part of a gag-pol
packaging cassette in a packaging cell. Thus, to remove a
functional auxiliary gene for the purposes of the invention may
involve its removal from the packaging components, or from the
vector genome, or perhaps both.
[0126] To remove a functional auxiliary gene may not require
removal of the gene in its entirety. Usually removal of part of the
gene, or disruption of the gene in some other way will be
sufficient. The absence of a functional auxiliary gene is
understood herein to mean that the gene is not present in a form in
which it is capable of encoding the functional auxiliary
protein.
[0127] In a preferred system according to the invention, functional
vpr and tat genes or analogous genes normally present in the
lentivirus on which the vector particles are based are both absent.
These two auxiliary genes are associated with characteristics of
lentiviruses that are particularly undesirable for a gene therapy
vector. However, other than by the proviso given above, the
invention is not limited with regard to the combination of
auxiliary genes that are absent in a system according to the
invention for producing HIV-1-based vector particles, any
combination of three, or more preferably four, of the genes may be
absent in their functional form. Most preferably, all five of the
auxiliary genes vpr, vif, tat, nef, and vpu are absent in their
functional form. Similarly, for systems concerned with other
lentiviruses, it is most preferable that all of the auxiliary genes
are absent in their functional form (except rev which is preferably
present unless replaced by a system analogous to the rev/RRE
system).
[0128] Thus, preferably, the delivery system used in the invention
is devoid of at least tat and S2 (if it is an EIAV vector system),
and possibly also vif, vpr, vpx, vpu and nef. More preferably, the
systems of the present invention are also devoid of rev. Rev was
previously thought to be essential in some retroviral genomes for
efficient virus production. For example, in the case of HIV, it was
thought that rev and RRE sequence should be included. However, it
has been found that the requirement for rev and RRE can be reduced
or eliminated by codon optimisation (see below) or by replacement
with other functional equivalent systems such as the MPMV system.
As expression of the codon-optimised gag-pol is rev-independent,
RRE can be removed from the gag-pol expression cassette, thus
removing any potential for recombination with any RRE contained on
the vector genome.
[0129] In a preferred embodiment, the viral genome of the present
invention lacks the Rev response element (RRE). In another
preferred embodiment, a nucleic acid sequence encoding Rev, or a
functional equivalent thereof, is disrupted such that the nucleic
acid sequence is incapable of encoding the functional Rev or is
removed from the vector genome.
[0130] In a preferred embodiment, the system used in the present
invention is based on a so-called "minimal" system in which some or
all of the additional genes have been removed. Preferably the viral
vector of the present invention has a minimal viral genome.
[0131] As used herein, the term "minimal viral genome" means that
the viral vector has been manipulated so as to remove the
non-essential elements and to retain the essential elements to
provide the required functionality to infect, transduce and deliver
a NOI to a target host cell.
[0132] Preferably the viral vector with the minimal viral genome is
a minimal lentiviral vector.
Codon Optimisation
[0133] Codon optimisation has previously been described in
WO99/41397. Different cells differ in their usage of particular
codons. This codon bias corresponds to a bias in the relative
abundance of particular tRNAs in the cell type. By altering the
codons in the sequence to match with the relative abundance of
corresponding tRNAs, it is possible to increase expression. By the
same token, it is possible to decrease expression by deliberately
choosing codons for which the corresponding tRNAs are known to be
rare in the particular cell type. Thus, an additional degree of
translational control is available.
[0134] Many viruses, including HIV and other lentiviruses, use a
large number of rare codons and by changing these to correspond to
commonly used mammalian codons, increased expression of the
packaging components in mammalian producer cells can be achieved.
Codon usage tables are known in the art for mammalian cells, as
well as for a variety of other organisms.
[0135] Codon optimisation has a number of other advantages. By
virtue of alterations in their sequences, the nucleotide sequences
encoding the packaging components of the viral particles required
for assembly of viral particles in the producer cells/packaging
cells have RNA instability sequences (INS) eliminated from them. At
the same time, the amino acid sequence coding sequence for the
packaging components is retained so that the viral components
encoded by the sequences remain the same, or at least sufficiently
similar that the function of the packaging components is not
compromised. Codon optimisation also overcomes the Rev/RRE
requirement for export, rendering optimised sequences Rev
independent. Codon optimisation also reduces homologous
recombination between different constructs within the vector system
(for example, between the regions of overlap in the gag-pol and env
open reading frames). The overall effect of codon optimisation is
therefore a notable increase in viral titre and improved
safety.
[0136] In one embodiment, only codons relating to INS are codon
optimised. However, in a much more preferred and practical
embodiment, the sequences are codon optimised in their entirety,
with the exception of the sequence encompassing the frameshift
site.
[0137] The gag-pol gene comprises two overlapping reading frames
encoding gag and pol proteins respectively. The expression of both
proteins depends on a frameshift during translation. This
frameshift occurs as a result of ribosome "slippage" during
translation. This slippage is thought to be caused at least in part
by ribosome-stalling RNA secondary structures. Such secondary
structures exist downstream of the frameshift site in the gag-pol
gene. For HIV, the region of overlap extends from nucleotide 1222
downstream of the beginning of gag (wherein nucleotide 1 is the A
of the gag ATG) to the end of gag (nt 1503). Consequently, a 281 bp
fragment spanning the frameshift site and the overlapping region of
the two reading frames is preferably not codon optimised. Retaining
this fragment will enable more efficient expression of the gag-pol
proteins.
[0138] For EIAV, the beginning of the overlap has been taken to be
nt 1262 (where nucleotide 1 is the A of the gag ATG). The end of
the overlap is at 1461 bp. To ensure that the frameshift site and
the gag-pol overlap are preserved, the wild type sequence has been
retained from nt 1156 to 1465.
[0139] Derivations from optimal codon usage may be made, for
example, to accommodate convenient restriction sites, and
conservative amino acid changes may be introduced into the gag-pol
proteins.
[0140] In a highly preferred embodiment, codon optimisation was
based on highly expressed mammalian genes. The third and sometimes
the second and third base may be changed.
[0141] Due to the degenerate nature of the Genetic Code, it will be
appreciated that a skilled worker can achieve numerous gag-pol
sequences. Also, there are many retroviral variants described that
can be used as a starting point for generating a codon optimised
gag-pol sequence. Lentiviral genomes can be quite variable. For
example, there are many quasi-species of HIV-1 that are still
functional. This is also the case for EIAV. These variants may be
used to enhance particular parts of the transduction process.
Details of HIV variants may also be found in the HIV databases
maintained by Los Alamos National Laboratory. Details of EIAV
clones may be found at the NCBI database maintained by the National
Institutes of Health.
[0142] The strategy for codon optimised gag-pol sequences can be
used in relation to any retrovirus. This would apply to all
lentiviruses, including EIAV, FIV, BIV, CAEV, VMR, SIV, HIV-1 and
HIV-2. In addition, this method could be used to increase
expression of genes from HTLV-1, HTLV-2, HFV, HSRV and human
endogenous retroviruses (HERV), MLV and other retroviruses.
[0143] Codon optimisation can render gag-pol expression Rev
independent. To enable the use of anti-rev or RRE factors in the
retroviral vector, however, it would be necessary to render the
viral vector generation system totally Rev/RRE independent. Thus,
the genome also needs to be modified. This is achieved by
optimising vector genome components. Advantageously, these
modifications can also lead to the production of a safer system
absent of all additional proteins both in the producer and in the
transduced cell.
[0144] As described above, the packaging components for a
retroviral vector include expression products of gag, pol and env
genes. In addition, efficient packaging depends on a short sequence
of 4 stem loops followed by a partial sequence from gag and env
(the "packaging signal"). Thus, inclusion of a deleted gag sequence
in the retroviral vector genome (in addition to the full gag
sequence on the packaging construct) will optimise vector titre. To
date, efficient packaging has been reported to require from 255 to
360 nucleotides of gag in vectors that still retain env sequences,
or about 40 nucleotides of gag in a particular combination of
splice donor mutation, gag and env deletions. It has surprisingly
been found that a deletion of all but the N-terminal 360
nucleotides or so in gag leads to an increase in vector titre.
Thus, preferably, the retroviral vector genome includes a gag
sequence that comprises one or more deletions, more preferably the
gag sequence comprises about 360 nucleotides derivable from the
N-terminus.
NOIs
[0145] In the present invention, the term NOI (nucleotide sequence
of interest) includes any suitable nucleotide sequence, which need
not necessarily be a complete naturally occurring DNA or RNA
sequence. Thus, the NOI can be, for example, a synthetic RNA/DNA
sequence, a codon optimised RNA/DNA sequence, a recombinant RNA/DNA
sequence (i.e. prepared by use of recombinant DNA techniques), a
cDNA sequence or a partial genomic DNA sequence, including
combinations thereof. The sequence need not be a coding region. If
it is a coding region, it need not be an entire coding region. In
addition, the RNA/DNA sequence can be in a sense orientation or in
an anti-sense orientation. Preferably, it is in a sense
orientation. Preferably, the sequence is, comprises, or is
transcribed from cDNA.
[0146] The NOI(s), also referred to as "heterologous sequence(s)",
"heterologous gene(s)" or "transgene(s)", may be any one or more
of, for example, a selection gene(s), marker gene(s) and
therapeutic gene(s).
[0147] The NOI may be a candidate gene that is of potential
significance in a disease process. Thus the vector system of the
present invention may, for example, be used for target validation
purposes.
[0148] The NOI may have a therapeutic or diagnostic application.
Suitable NOIs include, but are not limited to: sequences encoding
enzymes, cytokines, chemokines, hormones, antibodies, anti-oxidant
molecules, engineered immunoglobulin-like molecules, a single chain
antibody, fusion proteins, immune co-stimulatory molecules,
immunomodulatory molecules, anti-sense RNA, small interfering RNA
(siRNA), a transdominant negative mutant of a target protein, a
toxin, a conditional toxin, an antigen, a tumour suppresser protein
and growth factors, membrane proteins, pro- and anti-angiogenic
proteins and peptides, vasoactive proteins and peptides, anti-viral
proteins and ribozymes, and derivatives thereof (such as with an
associated reporter group). The NOIs may also encode pro-drug
activating enzymes. When used in a research context, the NOIs may
also encode reporter genes such as, but not limited to, green
fluorescent protein (GFP), luciferase, .beta.-galactosidase, or
resistance genes to antibiotics such as, for example, ampicillin,
neomycin, bleomycin, zeocin, chloramphenicol, hygromycin,
kanamycin, among others.
[0149] The NOI may encode all or part of the protein of interest
("POI"), or a mutant, homologue or variant thereof. For example,
the NOI may encode a fragment of the POI that is capable of
functioning in vivo in an analogous manner to the wild-type
protein.
[0150] The term "mutant" includes POIs that include one or more
amino acid variations from the wild-type sequence. For example, a
mutant may comprise one or more amino acid additions, deletions or
substitutions.
[0151] Here, the term "homologue" means an entity having a certain
homology with the NOI, or which encodes a protein having a degree
of homology with the POI. Here, the term "homology" can be equated
with "identity".
[0152] In the present context, a homologous sequence is taken to
include an amino acid sequence that may be at least 75, 85 or 90%
identical, preferably at least 95 or 98% identical to the subject
sequence. Typically, the homologues will comprise the same active
sites as the subject amino acid sequence. Although homology can
also be considered in terms of similarity (i.e. amino acid residues
having similar chemical properties/functions), in the context of
the present invention, it is preferred to express homology in terms
of sequence identity.
[0153] In the present context, a homologous sequence is taken to
include a nucleotide sequence that may be at least 75, 85 or 90%
identical, preferably at least 95 or 98% identical to the subject
sequence. Typically, the homologues will comprise the same
sequences that code for the active sites etc. as the subject
sequence. Although homology can also be considered in terms of
similarity (i.e. amino acid residues having similar chemical
properties/functions), in the context of the present invention it
is preferred to express homology in terms of sequence identity.
[0154] Homology comparisons can be conducted by eye, or more
usually, with the aid of readily available sequence comparison
programs. These commercially available computer programs can
calculate percent (%) homology between two or more sequences.
[0155] A suitable computer program for carrying out sequence
comparisons is the GCG Wisconsin Bestfit package (University of
Wisconsin, U.S.A.; Devereux et al., 1984, Nucleic Acids Research
12:387). Examples of other software than can perform sequence
comparisons include, but are not limited to, the BLAST package (see
Ausubel et al., 1999 ibid--Chapter 18), FASTA (Atschul et al.,
1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison
tools. Both BLAST and FASTA are available for offline and online
searching (see Ausubel et al., 1999 ibid, pages 7-58 to 7-60).
However, for some applications, it is preferred to use the GCG
Bestfit program. The BLAST 2 Sequences tool is also available for
comparing protein and nucleotide sequence (see FEMS Microbiol Lett
1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8).
[0156] The sequences may also have deletions, insertions or
substitutions of amino acid residues that produce a silent change
and result in a functionally equivalent substance. Deliberate amino
acid substitutions may be made on the basis of similarity in
polarity, charge, solubility, hydrophobicity, hydrophilicity,
and/or the amphipathic nature of the residues as long as the
secondary binding activity of the substance is retained. For
example, negatively charged amino acids include aspartic acid and
glutamic acid; positively charged amino acids include lysine and
arginine; and amino acids with uncharged polar head groups having
similar hydrophilicity values include leucine, isoleucine, valine,
glycine, alanine, asparagine, glutamine, serine, threonine,
phenylalanine, and tyrosine.
[0157] Conservative substitutions may be made, for example
according to the Table below. Amino acids in the same block in the
second column and preferably in the same line in the third column
may be substituted for each other:
TABLE-US-00004 ALIPHATIC Non-polar G A P I L V Polar-uncharged C S
T M N Q Polar-charged D E K R AROMATIC H F W Y
[0158] The present invention also encompasses homologous
substitution (substitution and replacement are both used herein to
mean the interchange of an existing amino acid residue, with an
alternative residue) may occur i.e. like-for-like substitution such
as basic for basic, acidic for acidic, polar for polar etc.
Non-homologous substitution may also occur i.e. from one class of
residue to another.
[0159] Preferably the NOI encodes a single POI or a mutant,
homologue or variant thereof. In a highly preferred embodiment, the
NOI does not encode a fusion protein. As used herein, the term
"fusion protein" is used in its conventional sense to mean an
entity that comprises two or more protein activities, joined
together by a peptide bond to form a single chimeric protein. A
fusion protein is encoded by a single polynucleotide driven by a
single promoter.
Internal Ribosome Entry Site (IRES)
[0160] The viral genome of the present invention comprises at least
one, but can optionally comprise two or more NOIs. In order for two
or more NOIs to be expressed, there may be two or more
transcription units within the vector genome, one for each NOI.
However, it is clear from the literature that retroviral vectors
achieve the highest titres and most potent gene expression
properties if they are kept genetically simple (PCT/GB96/01230;
Bowtell et al., 1988 J. Virol. 62, 2464; Correll et al., 1994 Blood
84, 1812; Emerman and Temin 1984 Cell 39, 459; Ghattas et al., 1991
Mol. Cell. Biol. 11, 5848; Hantzopoulos et al., 1989 PNAS 86, 3519;
Hatzoglou et al., 1991 J. Biol. Chem 266, 8416; Hatzoglou et al.,
1988 J. Biol. Chem 263, 17798; Li et al., 1992 Hum. Gen. Ther. 3,
381; McLachlin et al., 1993 Virol. 195, 1; Overell et al., 1988
Mol. Cell Biol. 8, 1803; Scharfman et al., 1991 PNAS 88, 4626; Vile
et al., 1994 Gene Ther 1, 307; Xu et al., 1989 Virol. 171, 331; Yee
et al., 1987 PNAS 84, 5197). Thus, it is preferable to use an
internal ribosome entry site (IRES) to initiate translation of the
second (and subsequent) coding sequence(s) in a poly-cistronic (or
as used herein, "multicistronic") message (Adam et al 1991 J.
Virol. 65, 4985).
[0161] Insertion of IRES elements into retroviral vectors is
compatible with the retroviral replication cycle and allows
expression of multiple coding regions from a single promoter (Adam
et al (as above); Koo et al (1992) Virology 186:669-675; Chen et al
1993 J. Virol 67:2142-2148). IRES elements were first found in the
non-translated 5' ends of picornaviruses where they promote
cap-independent translation of viral proteins (Jang et al (1990)
Enzyme 44: 292-309). When located between open reading frames in an
RNA, IRES elements allow efficient translation of the downstream
open reading frame by promoting entry of the ribosome at the IRES
element followed by downstream initiation of translation.
[0162] As used herein, the term "cistron" refers to a nucleic acid
segment corresponding to a polypeptide chain, comprising the
relevant translational start (initiation) and stop (termination)
codons. A multicistronic mRNA is an mRNA transcript with more than
one cistron and thus, encoding more than one polypeptide.
[0163] A review on IRES is presented by Mountford and Smith (TIG
May 1995 vol 11, No 5:179-184). A number of different IRES
sequences are known including those from encephalomyocarditis virus
(EMCV) (Ghattas, I. R., et al., Mol. Cell. Biol., 11:5848-5859
(1991); BiP protein [Macejak and Sarnow, Nature 353:91 (1991)]; the
Antennapedia gene of Drosophila (exons d and e) [Oh, et al., Genes
& Development, 6:1643-1653 (1992)] as well as those in
poliovirus (PV) [Pelletier and Sonenberg, Nature 334: 320-325
(1988); see also Mountford and Smith, TIG 11, 179-184 (1985)].
[0164] According to WO-A-97/14809, IRES sequences are typically
found in the 5' non-coding region of genes. In addition to those in
the literature they can be found empirically by looking for genetic
sequences that affect expression and then determining whether that
sequence affects the DNA (i.e. acts as a promoter or enhancer) or
only the RNA (acts as an IRES sequence).
[0165] IRES elements from PV, EMCV and swine vesicular disease
virus have previously been used in retroviral vectors (Coffin et
al, as above).
[0166] The term "IRES" includes any sequence or combination of
sequences which work as or improve the function of an IRES.
[0167] The IRES(s) may be of viral origin (such as EMCV IRES, PV
IRES, or FMDV 2A-like sequences) or cellular origin (such as FGF2
IRES, NRF IRES, Notch 2 IRES or EIF4 IRES).
[0168] For the IRES to be capable of initiating translation of each
NOI, it should be located between or prior to NOIs in the vector
genome. For example, for a multicistronic sequence containing n
NOIs, the genome may be as follows: [0169] [(NOI.sub.1-IRES.sub.1]
. . . NOI.sub.n n=1.fwdarw.n
[0170] For bi and tricistronic sequences, the order may be as
follows: [0171] NOI.sub.1-IRES.sub.1-NOI.sub.2 [0172]
NOI.sub.1-IRES.sub.1-NOI.sub.2-IRES.sub.2-NOI.sub.3
[0173] Alternative configurations of IRESs and NOIs can also be
utilised. For example transcripts containing the IRESs and NOIs
need not be driven from the same promoter.
[0174] An example of this arrangement may be: [0175]
IRES.sub.1-NOI.sub.1-promoter-NOI.sub.2-IRES.sub.2-NOI.sub.3.
[0176] Preferably, in any construct utilising an internal cassette
having more than one IRES and NOI, the IRESs may be of different
origins, that is, heterologous to one another. For example, one
IRES may be from EMCV and the other IRES may be from
poliovirus.
Other Methods of Expressing Multiple Genes from One Vector
[0177] Although IRESs are an efficient way to co-express multiple
genes from one vector, other methods are also useful, and may be
used alone or in conjunction with IRESs. These include the use of
multiple internal promoters in the vector (Overell et al., Mol Cell
Biol. 8: 1803-8 (1988)), or the use of alternate splicing patterns
leading to multiple RNA species derived from the single viral
genome that expresses the different genes. This strategy has
previously been used by itself for two genes (Cepko et al. Cell 37:
1053 (1984)).
Transduced Cells
[0178] The present invention also relates to a cell that has been
transduced with a vector system comprising a viral genome according
to the first aspect of the invention.
[0179] The cell may be transduced in vivo, in vitro or ex vivo. For
example, if the cell is a cell from a mammalian subject, the cell
may be removed from the subject and transduced ready for
reimplantation into the subject (ex vivo transduction).
Alternatively, the cell may be transduced by direct gene transfer
in vivo, using the vector system of the present invention in
accordance with standard techniques (such as via injection of
vector stocks expressing the NOIs). If the cell is part of a cell
line that is stable in culture (i.e. which can survive numerous
passages and can multiple in vitro) then it may be transduced in
vitro by standard techniques, for example, by exposure of the cell
to viral supernatants comprising vectors expressing the NOIs.
[0180] The cell may be any cell that is susceptible to
transduction. If the vector system is capable of transducing
non-dividing cells (for example if it is a lentiviral system) then
the cell may be a non-dividing cell, such as a neuron.
Cassettes
[0181] The present invention can employ cassettes comprising one or
more NOIs, which, in the case of two or more NOIs, can be operably
linked by an IRES. These cassettes may be used in a method for
producing the vector genome in a producer cell.
[0182] The present invention also provides an expression vector
comprising such a cassette. Transfection of a suitable cell with
such an expression vector should result in a cell that expresses
each POI encoded by the NOI in the cassette. The present invention
also provides such a transfected cell.
[0183] Cloning of the cassette into an expression vector and
transfection of cells with the vector (to give expression of the
cassette) can be carried out by techniques well known in the art
(such as those described in Sambrook et al. (Molecular Cloning: A
Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press
(1989)), and other laboratory textbooks).
[0184] Preferably the cassette comprises a promoter. A cassette
comprising two or more NOIs can be bicistronic or tricistronic, and
can comprises the following elements:
Promoter-(NOI.sub.1)-(IRES.sub.1)-(NOI.sub.2)
Promoter-(NOI.sub.1)-(IRES.sub.1)-(NOI.sub.2)-(IRES.sub.2)-(NOI.sub.3)
Pharmaceutical Compositions
[0185] The present invention provides a pharmaceutical composition,
which comprises a vector genome according to the second aspect of
the invention and a pharmaceutically acceptable carrier, diluent or
excipient (including combinations thereof).
[0186] The pharmaceutical compositions may be for human or animal
usage in human and veterinary medicine or research, and will
typically comprise any one or more of a pharmaceutically acceptable
diluent, carrier, or excipient. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in Remington's Pharmaceutical Sciences,
Mack Publishing Co. (A. R. Gennaro edit. 1985). The choice of
pharmaceutical carrier, excipient or diluent can be selected with
regard to the intended route of administration and standard
pharmaceutical practice. The pharmaceutical compositions may
comprise as--or in addition to--the carrier, excipient or diluent
any suitable binder(s), lubricant(s), suspending agent(s), coating
agent(s), solubilising agent(s).
[0187] Preservatives, stabilizers, dyes and even flavouring agents
may be provided in the pharmaceutical composition. Examples of
preservatives include sodium benzoate, sorbic acid and esters of
p-hydroxybenzoic acid. Antioxidants and suspending agents may be
also used.
[0188] There may be different composition/formulation requirements
dependent on the different delivery systems. By way of example, the
pharmaceutical composition of the present invention may be
formulated to be delivered using a mini-pump or by a mucosal route,
for example, as a nasal spray or aerosol for inhalation or
ingestible solution, or parenterally in which the composition is
formulated by an injectable form, for delivery, by, for example, an
intravenous, intramuscular or subcutaneous route. Alternatively,
the formulation may be designed to be delivered by both routes.
[0189] Where the pharmaceutical composition is to be delivered
mucosally through the gastrointestinal mucosa, it should be able to
remain stable during transit though the gastrointestinal tract; for
example, it should be resistant to proteolytic degradation, stable
at acid pH and resistant to the detergent effects of bile.
[0190] Where appropriate, the pharmaceutical compositions can be
administered by inhalation, in the form of a suppository or
pessary, topically in the form of a lotion, solution, cream,
ointment or dusting powder, by use of a skin patch, orally in the
form of tablets containing excipients such as starch or lactose or
chalk, or in capsules or ovules either alone or in admixture with
excipients, or in the form of elixirs, solutions or suspensions
containing flavouring or colouring agents, or they can be injected
parenterally, for example, intravenously, intramuscularly or
subcutaneously. For parenteral administration, the compositions may
be best used in the form of a sterile aqueous solution, which may
contain other substances, for example, enough salts or
monosaccharides to make the solution isotonic with blood. For
buccal or sublingual administration, the compositions may be
administered in the form of tablets or lozenges that can be
formulated in a conventional manner.
Administration
[0191] Typically, a physician will determine the actual dosage that
will be most suitable for an individual subject and it will vary
with the age, weight and response of the particular patient and
severity of the condition. The dosages below are exemplary of the
average case. There can, of course, be individual instances where
higher or lower dosage ranges are merited.
[0192] The compositions (or component parts thereof) of the present
invention may be administered orally. In addition, or in the
alternative, the compositions (or component parts thereof) of the
present invention may be administered by direct injection. In
addition, or in the alternative, the compositions (or component
parts thereof) of the present invention may be administered
topically. In addition, or in the alternative, the compositions (or
component parts thereof) of the present invention may be
administered by inhalation. In addition, or in the alternative, the
compositions (or component parts thereof) of the present invention
may also be administered by one or more of: parenteral, mucosal,
intramuscular, intravenous, subcutaneous, intraocular or
transdermal administration means, and are formulated for such
administration.
[0193] By way of further example, the pharmaceutical composition of
the present invention may be administered in accordance with a
regimen of 1 to 10 times per day, such as once or twice per day.
The specific dose level and frequency of dosage for any particular
patient may be varied and will depend upon a variety of factors
including the activity of the specific compound employed, the
metabolic stability and length of action of that compound, the age,
body weight, general health, sex, diet, mode and time of
administration, rate of excretion, drug combination, the severity
of the particular condition, and the host undergoing therapy.
[0194] The term "administered" also includes, but is not limited
to, delivery by a mucosal route, for example, as a nasal spray or
aerosol for inhalation or as an ingestible solution; a parenteral
route where delivery is by an injectable form, such as, for
example, an intravenous, intramuscular or subcutaneous route.
[0195] Hence, one or more of the following routes may administer
the pharmaceutical composition of the present invention: oral
administration, injection (such as direct injection), topical,
inhalation, parenteral administration, mucosal administration,
intramuscular administration, intravenous administration,
subcutaneous administration, intraocular administration or
transdermal administration.
Diseases
[0196] Pharmaceutical compositions comprising an effective amount
of vector comprising an identified modulating moiety operably
linked to an NOI may be used in the treatment of disorders, such as
those listed in WO-A-98/09985. For ease of reference, part of that
list is now provided: macrophage inhibitory and/or T cell
inhibitory activity and thus, anti-inflammatory activity;
anti-immune activity, i.e. inhibitory effects against a cellular
and/or humoral immune response, including a response not associated
with inflammation; diseases associated with viruses and/or other
intracellular pathogens; inhibit the ability of macrophages and T
cells to adhere to extracellular matrix components and fibronectin,
as well as up-regulated fas receptor expression in T cells; inhibit
unwanted immune reaction and inflammation including arthritis,
including rheumatoid arthritis, inflammation associated with
hypersensitivity, allergic reactions, asthma, systemic lupus
erythematosus, collagen diseases and other autoimmune diseases,
inflammation associated with atherosclerosis, arteriosclerosis,
atherosclerotic heart disease, reperfusion injury, cardiac arrest,
myocardial infarction, vascular inflammatory disorders, respiratory
distress syndrome or other cardiopulmonary diseases, inflammation
associated with peptic ulcer, ulcerative colitis and other diseases
of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or
other hepatic diseases, thyroiditis or other glandular diseases,
glomerulonephritis or other renal and urologic diseases, otitis or
other oto-rhino-laryngological diseases, dermatitis or other dermal
diseases, periodontal diseases or other dental diseases, orchitis
or epididimo-orchitis, infertility, orchidal trauma or other
immune-related testicular diseases, placental dysfunction,
placental insufficiency, habitual abortion, eclampsia,
pre-eclampsia and other immune and/or inflammatory-related
gynecological diseases, posterior uveitis, intermediate uveitis,
anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis,
optic neuritis, intraocular inflammation, e.g. retinitis or cystoid
macular oedema, sympathetic ophthalmia, scleritis, retinitis
pigmentosa, immune and inflammatory components of degenerative
fondus disease, inflammatory components of ocular trauma, ocular
inflammation caused by infection, proliferative
vitreo-retinopathies, acute ischaemic optic neuropathy, excessive
scarring, e.g. following glaucoma filtration operation, immune
and/or inflammation reaction against ocular implants and other
immune and inflammatory-related ophthalmic diseases, inflammation
associated with autoimmune diseases or conditions or disorders
where, both in the central nervous system (CNS) or in any other
organ, immune and/or inflammation suppression would be beneficial,
Parkinson's disease, complication and/or side effects from
treatment of Parkinson's disease, AIDS-related dementia complex
HIV-related encephalopathy, Devic's disease, Sydenham chorea,
Alzheimer's disease and other degenerative diseases, conditions or
disorders of the CNS, inflammatory components of stokes, post-polio
syndrome, immune and inflammatory components of psychiatric
disorders, myelitis, encephalitis, subacute sclerosing
pan-encephalitis, encephalomyelitis, acute neuropathy, subacute
neuropathy, chronic neuropathy, Guillain-Barre syndrome, Sydenham
chora, myasthenia gravis, pseudo-tumour cerebri, Down's Syndrome,
Huntington's disease, amyotrophic lateral sclerosis, inflammatory
components of CNS compression or CNS trauma or infections of the
CNS, inflammatory components of muscular atrophies and dystrophies,
and immune and inflammatory related diseases, conditions or
disorders of the central and peripheral nervous systems,
post-traumatic inflammation, septic shock, infectious diseases,
inflammatory complications or side effects of surgery, bone marrow
transplantation or other transplantation complications and/or side
effects, inflammatory and/or immune complications and side effects
of gene therapy, e.g. due to infection with a viral carrier, or
inflammation associated with AIDS, to suppress or inhibit a humoral
and/or cellular immune response, to treat or ameliorate monocyte or
leukocyte proliferative diseases, e.g. leukaemia, by reducing the
amount of monocytes or lymphocytes, for the prevention and/or
treatment of graft rejection in cases of transplantation of natural
or artificial cells, tissue and organs such as cornea, bone marrow,
organs, lenses, pacemakers, natural or artificial skin tissue.
Specific cancer related disorders include but not limited to: solid
tumours; blood born tumours such as leukemias; tumor metastases;
benign tumours, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas; rheumatoid
arthritis; psoriasis; ocular angiogenic diseases, for example,
diabetic retinopathy, retinopathy of prematurity, macular
degeneration, corneal graft rejection, neovascular glaucoma,
retrolental fibroplasia, rubeosis; Osler-Webber Syndrome;
myocardial angiogenesis; plaque neovascularization; telangiectasia;
hemophiliac joints; angiofibroma; wound granulation; coronary
collaterals; cerebral collaterals; arteriovenous malformations;
ischaemic limb angiogenesis; neovascular glaucoma; retrolental
fibroplasia; diabetic neovascularization; Helicobacter-related
diseases, fractures, vasculogenesis, hematopoiesis, ovulation,
menstruation and placentation.
[0197] Various preferred features and embodiments of the present
invention will now be described in more detail by way of
non-limiting examples.
EXAMPLES
Example 1
Alterations to the Woodchuck Hepatitis Virus Post-Transcriptional
Regulatory Element (WPRE) to Increase the Safety Profile of Viral
Vectors
[0198] A study was conducted to evaluate administration of our EIAV
vectors via the main artery to foetal mice in utero. After birth,
the mice were monitored for long periods. Mice transduced with an
EIAV vector containing the wild-type WPRE (pSMART2 and 3) developed
liver tumours while vectors that did not contain the WPRE (pONY8
series) did not. The tumours were associated only with the liver,
and were not observed in other organs. Use of the pSMART2Z vector
led to development of liver tumours within 3 months of birth. The
results indicate that the presence of a WPRE with the wild-type
nucleotide sequence often resulted in the development of liver
tumours following in utero administration of vector. This may be
due to effects resulting from partial functioning of the X promoter
and truncated X-polypeptide. This is a surprising observation given
that the X-protein promoter requires WHV proteins to function
fully. Insertion of the WPRE in retroviral or lentiviral vectors in
the reverse orientation leads to a reduction in protein expression,
as measured by marker gene expression studies (Zufferey, R., et al,
(1999) J. Virol. 73: 2886-92). The mechanism for this inhibition
may be due to antisense effects resulting from transcription from
the X promoter (Zufferey, R., et al, ibid). Therefore, it is
possible that low-level transcription from the X promoter leads to
accumulation of a truncated X protein polypeptide that contributes
to the formation of liver tumours.
[0199] Given this observation, the ability of the WPRE to express
the X-protein would need to be abrogated. To achieve this, mutation
of nucleotides within the X promoter region, or within the
translation initiation codon (ATG) of the X protein itself, or
preferably both could be introduced. Maximal diversity from the
wild type WPRE sequence would be the preferred option, as this will
prevent reversion to wild-type sequence from occurring.
[0200] Given that the retroviral reverse transcriptase (in this
case originating from the lentivirus, EIAV) has a low fidelity (an
average single mistake incorporated per 10,000 nucleotides reverse
transcribed), then the likelihood of a single base pair change
reverting an altered nucleotide back to wild type will occur at a
frequency of 1 per 40,000 integration events. Therefore, with each
change relative to the wild-type WPRE sequence comes an additive
reduction in the likely reversion to functional wild-type sequence.
However, balanced with the desire to maximise diversity from the
wild-type sequence is the need to retain WPRE functionality: there
are presumably a limited number of changes that can be made to the
WPRE without affecting its ability to enhance transgene
expression.
[0201] A set of nucleotide changes within the WPRE that maintain
its positive effects on transgene expression is provided, while
dramatically lowering the probability of reversion to wild type.
This altered WPRE sequence is referred to as WPREMut (SEQ ID
NO:1).
[0202] The mutations were inserted by overlap PCR using the
following primers:
TABLE-US-00005 1. 5'-GTG AAT TCG CGG CCG CAA TCA (SEQ ID NO:8) ACC
TCT 2. 5'-GGT GGC AAC ACA GGC GAG CAG (SEQ ID NO:9) CCC CGA GTC TCA
GCA GAC CTT CCC CGA CAA C 3. 5'-CCG TGG TGT TGT CGG GGA AGG (SEQ ID
NO:10) TCT GCT GAG ACT CGG 4. 5'-GCT GTC GAG CGG CCG CGA ATT (SEQ
ID NO:11) CAC TAG TGA TTC TCG AC
[0203] Primers 1 and 2 were used to amplify a 452 bp PCR product
using the wild-type WPRE sequence as template (PCR#1). Primers 3
and 4 were used to amplify a 260 bp PCR product using the wild-type
WPRE sequence as template (PCR#2). PCR#1 and PCR#2 were used in
overlap PCR to create WPREMut (652 bp). WPREMut was inserted into
vector genomes using the flanking Not I sites.
[0204] A comparison of the expression of a reporter gene (eGFP)
from pSMART3G vectors containing either wild-type WPRE, or WPREMut
was conducted. Transductions of D17 cells were conducted using
dilutions of the vector preps and pooled transduced cells were
analysed for eGFP expression by FACS from each dilution. Samples
containing between 1% and 10% GFP-positive cells were used in order
to compare the expression level of GFP, in order to control for
differences in vector titre. The mean fluorescence intensity (MFI)
of eGFP expression for each of these samples was used; the average
MFI.+-.SD is shown in FIG. 5.
[0205] The sum of the 13 changes within the WPREMut relative to
wild-type WPRE is predicted to reduce the probability of reversion
to wild-type sequence to a very small level. FIG. 6 shows an
alignment of WPRE sequences showing the mutations that have been
introduced into the WPRE.
[0206] To study the effects of using the WPRE with introduced
changes (WPREMut) in a relevant system, a study will compare
vectors containing the wild-type WPRE and those containing the
mutated WPRE. To achieve this, the WPRE in pSMART2Z has been
swapped with the WPREMut sequence to create pSMART2ZWPREMut. These
two vectors were made in parallel using the same production process
(co-transfection of HEK293T cells with pONY3.1 (wild-type Gag/Pol
expression construct) and pRV67 (VSV-G expression construct). In
addition to these two vectors, a latest generation EIAV vector
genome will be tested in parallel (pONYT9.1NCZ). This vector genome
differs from pSMART2Z in a number of ways (in addition to the
WPREMut sequence): i) a tetracycline resistance gene replacing the
ampicillin resistance gene in earlier vector genomes (eg.
pSMART2Z); ii) mutations within the major splice donor site to
prevent unwanted splicing; iii) mutations within the initiation
codon of the first exon of EIAV Tat (CTG) to prevent translation of
the truncated Tat polypeptide; iv) mutations of all the ATG
sequences within the packaging signal to ATTG (.PSI.; pSMART2Z
vectors contained the first two ATG sequences mutated in this
fashion); v) a neomycin transferase gene downstream of the .PSI.
site that allows production of high titre vector in the absence of
Rev; vi) minimal retained nucleotide sequence corresponding to a
small region of EIAV env (pSMART2 vectors contain a larger fragment
from this region of EIAV). The pONYT9.1NCZ vector is made by
transient transfection of HEK293T cells with pESGPK (the codon
optimised Gag/Pol expression construct, with a kanamycin resistance
gene) and pRVK (a kanamycin resistant variant of pRV67, the VSV-G
expression construct). The vectors to be compared in this study are
summarised in Table 1.
[0207] Mice will be treated as for the previous study
(administration of test article via the main artery to foetal mice
in utero) and observed for extended periods for the generation of
tumours. The results of this study will demonstrate whether the
wild-type WPRE sequence is indeed responsible for the generation of
tumours in this model. These results will provide evidence
supporting the use of vectors containing the improved WPRE
(WPREMut) rather than wild-type WPRE in vivo.
TABLE-US-00006 TABLE 1 Vectors to be used in comparative study of
EIAV vectors in the murine in utero transduction model. Gag/Pol
VSV-G Test expression expression WPRE article Vector genome
cassette cassette (WT/Mut) 1 pSMART2Z pONY3.1 pRV67 WT 2 pSMART2Z
WPREMut pONY3.1 pRV67 Mut 3 pONYT9.1NCZ pESGPK pRVK Mut 4
Formulation buffer N/A N/A N/A
[0208] All publications mentioned in the above specification are
herein incorporated by reference. Various modifications and
variations of the described methods and system of the invention
will be apparent to those skilled in the art without departing from
the scope and spirit of the invention. Although the invention has
been described in connection with specific preferred embodiments,
it should be understood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various
modifications of the described modes for carrying out the invention
which are obvious to those skilled in chemistry, biology or related
fields are intended to be within the scope of the following claims.
Sequence CWU 1
1
111593DNAWoodchuck hepatitis virus 1aatcaacctc tggattacaa
aaatttgtga aagattgact ggtattctta actatgttgc 60tccttttacg ctatgtggat
acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 120tatggctttc
attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt
180gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg
caacccccac 240tggttggggc attgccacca cctgtcagct cctttccggg
actttcgctt tccccctccc 300tattgccacg gcggaactca tcgccgcctg
ccttgcccgc tgctggacag gggctcggct 360gttgggcact gacaattccg
tggtgttgtc ggggaaggtc tgctgagact cggggctgct 420cgcctgtgtt
gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct
480caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc
ttccgcgtct 540tcgccttcgc cctcagacga gtcggatctc cctttgggcc
gcctccccgc ctg 593218DNAWoodchuck hepatitis virus 2gtctgctgag
agactcgg 18321DNAWoodchuck hepatitis virus 3ggggaagctg acgtcctttc c
21420DNAWoodchuck hepatitis virus 4gggaaggtct gctgagactc
205592DNAWoodchuck hepatitis virus 5aatcaacctc tggattacaa
aatttgtgaa agattgactg gtattcttaa ctatgttgct 60ccttttacgc tatgtggata
cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120atggctttca
ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg
180tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc
aacccccact 240ggttggggca ttgccaccac ctgtcagctc ctttccggga
ctttcgcttt ccccctccct 300attgccacgg cggaactcat cgccgcctgc
cttgcccgct gctggacagg ggctcggctg 360ttgggcactg acaattccgt
ggtgttgtcg gggaagctga cgtcctttcc atggctgctc 420gcctgtgttg
ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc
480aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct
tccgcgtctt 540cgccttcgcc ctcagacgag tcggatctcc ctttgggccg
cctccccgcc tg 5926593DNAWoodchuck hepatitis virus 6aatcaacctc
tggattacaa aaatttgtga aagattgact ggtattctta actatgttgc 60tccttttacg
ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg
120tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt
atgaggagtt 180gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg
tttgctgacg caacccccac 240tggttggggc attgccacca cctgtcagct
cctttccggg actttcgctt tccccctccc 300tattgccacg gcggaactca
tcgccgcctg ccttgcccgc tgctggacag gggctcggct 360gttgggcact
gacaattccg tggtgttgtc ggggaagctg acgtcctttc catggctgct
420cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc
cttcggccct 480caatccagcg gaccttcctt cccgcggcct gctgccggct
ctgcggcctc ttccgcgtct 540tcgccttcgc cctcagacga gtcggatctc
cctttgggcc gcctccccgc ctg 593711622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic nucleotide
sequence 7tttgagattt ctgtcgccga ctaaattcat gtcgcgcgat agtggtgttt
atcgccgata 60gagatggcga tattggaaaa attgatattt gaaaatatgg catattgaaa
atgtcgccga 120tgtgagtttc tgtgtaactg atatcgccat ttttccaaaa
gtgatttttg ggcatacgcg 180atatctggcg atagcgctta tatcgtttac
gggggatggc gatagacgac tttggtgact 240tgggcgattc tgtgtgtcgc
aaatatcgca gtttcgatat aggtgacaga cgatatgagg 300ctatatcgcc
gatagaggcg acatcaagct ggcacatggc caatgcatat cgatctatac
360attgaatcaa tattggccat tagccatatt attcattggt tatatagcat
aaatcaatat 420tggctattgg ccattgcata cgttgtatcc atatcgtaat
atgtacattt atattggctc 480atgtccaaca ttaccgccat gttgacattg
attattgact agttattaat agtaatcaat 540tacggggtca ttagttcata
gcccatatat ggagttccgc gttacataac ttacggtaaa 600tggcccgcct
ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt
660tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt
atttacggta 720aactgcccac ttggcagtac atcaagtgta tcatatgcca
agtccgcccc ctattgacgt 780caatgacggt aaatggcccg cctggcatta
tgcccagtac atgaccttac gggactttcc 840tacttggcag tacatctacg
tattagtcat cgctattacc atggtgatgc ggttttggca 900gtacaccaat
gggcgtggat agcggtttga ctcacgggga tttccaagtc tccaccccat
960tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa
aatgtcgtaa 1020caactgcgat cgcccgcccc gttgacgcaa atgggcggta
ggcgtgtacg gtgggaggtc 1080tatataagca gagctcgttt agtgaaccgg
gcactcagat tctgcggtct gagtcccttc 1140tctgctgggc tgaaaaggcc
tttgtaataa atataattct ctactcagtc cctgtctcta 1200gtttgtctgt
tcgagatcct acagttggcg cccgaacagg gacctgagag gggcgcagac
1260cctacctgtt gaacctggct gatcgtagga tccccgggac agcagaggag
aacttacaga 1320agtcttctgg aggtgttcct ggccagaaca caggaggaca
ggtaagattg ggagaccctt 1380tgacattgga gcaaggcgct caagaagtta
gagaaggtga cggtacaagg gtctcagaaa 1440ttaactactg gtaactgtaa
ttgggcgcta agtctagtag acttatttca ttgataccaa 1500ctttgtaaaa
gaaaaggact ggcagctgag ggattgtcat tccattgctg gaagattgta
1560actcagacgc tgtcaggaca agaaagagag gcctttgaaa gaacattggt
gggcaatttc 1620tgctgtaaag attgggcctc cagattaata attgtagtag
attggaaagg catcattcca 1680gctcctaaga gcgaaatatt gaaaagaaga
ctgctaataa aaagcagtct gagccctctg 1740aagaatatct ctagaactag
tggatccccc gggccaaaac ctagcgccac catgattgaa 1800caagatggat
tgcacgcagg ttctccggcc gcttgggtgg agaggctatt cggctatgac
1860tgggcacaac agacaatcgg ctgctctgat gccgccgtgt tccggctgtc
agcgcagggg 1920cgcccggttc tttttgtcaa gaccgacctg tccggtgccc
tgaatgaact gcaggacgag 1980gcagcgcggc tatcgtggct ggccacgacg
ggcgttcctt gcgcagctgt gctcgacgtt 2040gtcactgaag cgggaaggga
ctggctgcta ttgggcgaag tgccggggca ggatctcctg 2100tcatctcacc
ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat gcggcggctg
2160catacgcttg atccggctac ctgcccattc gaccaccaag cgaaacatcg
catcgagcga 2220gcacgtactc ggatggaagc cggtcttgtc gatcaggatg
atctggacga agagcatcag 2280gggctcgcgc cagccgaact gttcgccagg
ctcaaggcgc gcatgcccga cggcgaggat 2340ctcgtcgtga cccatggcga
tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt 2400tctggattca
tcgactgtgg ccggctgggt gtggcggacc gctatcagga catagcgttg
2460gctacccgtg atattgctga agagcttggc ggcgaatggg ctgaccgctt
cctcgtgctt 2520tacggtatcg ccgctcccga ttcgcagcgc atcgccttct
atcgccttct tgacgagttc 2580ttctgagcgg ccgcgaattc aaaagctaga
gtcgactcta gggagtgggg aggcacgatg 2640gccgctttgg tcgaggcgga
tccggccatt agccatatta ttcattggtt atatagcata 2700aatcaatatt
ggctattggc cattgcatac gttgtatcca tatcataata tgtacattta
2760tattggctca tgtccaacat taccgccatg ttgacattga ttattgacta
gttattaata 2820gtaatcaatt acggggtcat tagttcatag cccatatatg
gagttccgcg ttacataact 2880tacggtaaat ggcccgcctg gctgaccgcc
caacgacccc cgcccattga cgtcaataat 2940gacgtatgtt cccatagtaa
cgccaatagg gactttccat tgacgtcaat gggtggagta 3000tttacggtaa
actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc
3060tattgacgtc aatgacggta aatggcccgc ctggcattat gcccagtaca
tgaccttatg 3120ggactttcct acttggcagt acatctacgt attagtcatc
gctattacca tggtgatgcg 3180gttttggcag tacatcaatg ggcgtggata
gcggtttgac tcacggggat ttccaagtct 3240ccaccccatt gacgtcaatg
ggagtttgtt ttggcaccaa aatcaacggg actttccaaa 3300atgtcgtaac
aactccgccc cattgacgca aatgggcggt aggcatgtac ggtgggaggt
3360ctatataagc agagctcgtt tagtgaaccg tcagatcgcc tggagacgcc
atccacgctg 3420ttttgacctc catagaagac accgggaccg atccagcctc
cgcggcccca agctagtcga 3480ctttaagctt ctcgagaatt cgtgcaccat
ggtgaaggta ccctggttcc caagaaaagt 3540gtcagagctg gacaagtgtc
atcacctggt caccaagttc gaccccgacc tggacttgga 3600ccaccccggc
ttctcggacc aggtgtaccg ccagcgcagg aagctgatcg ctgagatcgc
3660cttccagtac aggcacggcg acccgatccc ccgtgtggag tacaccgccg
aggagatcgc 3720cacctggaag gaggtctaca ccaccctgaa gggcctctac
gccacccacg cctgcgggga 3780gcacctggag gcctttgctt tgctggagcg
cttcagcggc taccgggaag acaacatccc 3840ccagctggag gacgtctccc
gcttcctgaa ggagcgcaca ggcttccagc tgcggcccgt 3900ggccggcctg
ctgtccgccc gggacttcct ggccagcctg gccttccgcg tgttccagtg
3960cacccagtat atccgccacg cgtcctcgcc catgcactcc cctgagccgg
actgctgcca 4020cgagctgctg gggcacgtgc ccatgctggc cgaccgcacc
ttcgcgcagt tcagccagga 4080catcggcctg gcgtccctgg gggccagcga
tgaggaaatc gagaagctgt ccactctgta 4140ctggttcacg gtggagttcg
ggctgtgtaa gcagaacggg gaggtgaagg cctatggtgc 4200cgggctgctg
tcctcctacg gggagctcct gcactgcctg tctgaggagc ctgagatccg
4260ggccttcgac cctgaggctg cggccgtgca gccctaccaa gaccagacgt
accagtcagt 4320ctacttcgtg tctgagagct tcagcgacgc caaggacaag
ctcaggagct atgccagccg 4380catccagcgc cccttctccg tgaagttcga
cccgtacacc ctggccatcg acgtgctgga 4440cagcccccag gccgtgcggc
gctccctgga gggtgtccag gatgagctgg acacccttgc 4500ccatgcgctg
agcgccatcg gctgagcagt ggcggccgca ctagaggaat tcgcccctct
4560ccctcccccc cccctaacgt tactggccga agccgcttgg aataaggccg
gtgtgtgttt 4620gtctatatgt gattttccac catattgccg tcttttggca
atgtgagggc ccggaaacct 4680ggccctgtct tcttgacgag cattcctagg
ggtctttccc ctctcgccaa aggaatgcaa 4740ggtctgttga atgtcgtgaa
ggaagcagtt cctctggaag cttcttgaag acaaacaacg 4800tctgtagcga
ccctttgcag gcagcggaac cccccacctg gcgacaggtg cctctgcggc
4860caaaagccac gtgtataaga tacacctgca aaggcggcac aaccccagtg
ccacgttgtg 4920agttggatag ttgtggaaag agtcaaatgg ctctcctcaa
gcgtagtcaa caaggggctg 4980aaggatgccc agaaggtacc ccattgtatg
ggaatctgat ctggggcctc ggtgcacatg 5040ctttacatgt gtttagtcga
ggttaaaaaa gctctaggcc ccccgaacca cggggacgtg 5100gttttccttt
gaaaaacacg atgataccat ggacgccagt gagttccgaa ggcgcggcaa
5160ggagatggtg gactacgtgg ccaactacat ggaaggcatc gagggccgcc
aagtctaccc 5220cgacgtggag cccggctacc tgcgcccgct gatccccgcc
gctgcccctc aggagcccga 5280caccttcgag gacatcatca acgacgtgga
gaagatcatc atgcctggcg tgacgcactg 5340gcacagcccc tacttcttcg
cctacttccc caccgccagc tcgtacccgg ccatgctggc 5400ggacatgctg
tgcggggcca ttggctgcat cggcttctcc tgggcggcga gcccagcgtg
5460caccgagctg gagaccgtga tgatggactg gctcgggaag atgctggagc
tcccaaaggc 5520gttcttgaac gagaaggctg gcgagggggg cggcgtgatc
cagggcagcg ccagcgaggc 5580caccctggtg gccctgctgg ccgctcggac
caaagtgatc caccggctgc aggcagcgtc 5640cccagagctc acccaggccg
ctatcatgga gaagctggtg gcttactcct ccgatcaggc 5700acactcctcc
gtggaacgcg ctgggctcat tggtggagtg aagctcaagg ccatccccag
5760cgatggcaac ttcgccatgc gtgcgagcgc cctgcaggaa gccctggaga
gagacaaggc 5820ggctggcctg attcctttct tcatggtggc caccctgggg
accacaacat gctgctcctt 5880cgacaacctc ctcgaagtcg gtcctatctg
caacaaggaa gacatctggc tgcacgttga 5940tgcagcctac gcaggcagcg
cattcatctg ccctgagttc cggcaccttc tgaacggagt 6000ggagttcgca
gatagcttca acttcaatcc ccacaagtgg ctattggtga atttcgactg
6060cagcgccatg tgggtgaaga agcgcaccga cctcacggga gccttccgcc
tggaccccac 6120ttacctgaag cacagccacc aggattcagg gcttatcact
gactaccggc actggcagat 6180cccactgggc cgcagattcc gcagcttgaa
gatgtggttc gtattcagga tgtatggagt 6240caagggactg caggcttata
tccgcaagca tgtccagctg tcccatgagt ttgagtcact 6300ggtgcgccag
gatccccgct ttgaaatctg tgtggaagtc attctggggc ttgtctgctt
6360tcggctaaag ggttccaaca aagtgaatga agctcttctg caaaggatca
acagtgccaa 6420aaaaatccac ttggttccat gtcacctcag ggacaagttt
gtcctgcgct ttgccatctg 6480ttctcgcacc gtggaatctg cccatgtgca
gcgggcctgg gaacacatca aagagctggc 6540ggccgacgtg ctgcgagcag
agagggagta gctcgaaaac ccgctgatca gcctcgactg 6600tgccttctag
ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgagaattc
6660ctcgacgtag atatcttaaa acagctctgg ggttgtaccc accccagagg
cccacgtggc 6720ggctagtact ccggtattgc ggtacctttg tacgcctgtt
ttatactccc ttcccccgta 6780acttagaagc acaatgtcca agttcaatag
gagggggtac aaaccagtac caccacgaac 6840aagcacttct gttcccccgg
tgaggctgta taggctgttt ccacggctaa aagcggctga 6900tccgttatcc
gctcatgtac ttcgagaagc ctagtatcac cttggaatct tcgatgcgtt
6960gcgctcaaca ctcaacccca gagtgtagct taggtcgatg agtctggacg
ttcctcaccg 7020gcgacggtgg tccaggctgc gttggcggcc tacctgtggc
ccaaagccac aggacgctag 7080ttgtgaacaa ggtgtgaaga gcctattgag
ctacctgaga gtcctccggc ccctgaatgc 7140ggctaatcct aaccacggag
caggcagtgg caatccagcg accagcctgt cgtaacgcgc 7200aagttcgtgg
cggaaccgac tactttgggt gtccgtgttt ccttttattt ttacaatggc
7260tgcttatggt gacaatcatt gattgttatc ataaagcaaa ttggattggc
catccggtga 7320gaatttgatt attaaattac tctcttgttg ggattgctcc
tttgaaatct tgtgcactca 7380cacctattgg aattacctca ttgttaaacg
cgtctagcta gcgccaccat ggagaagggc 7440cctgtgcgcg ccccggccga
gaagccgcgc ggcgcccgct gcagcaatgg gttccccgag 7500cgcgacccgc
cgcgccccgg gcccagcagg ccggccgaga agcccccgcg ccccgaggcc
7560aagagcgcgc agcccgcgga cggctggaag ggcgagcgcc cccgcagcga
ggaggacaac 7620gagctgaacc tccctaacct ggccgccgcc tactcctcca
tcctgagctc gctgggcgag 7680aacccccagc ggcaggggct gctcaagacc
ccctggaggg cggcctcggc catgcagttc 7740ttcaccaagg gctaccagga
gaccatctca gacgtcctga acgacgctat cttcgacgaa 7800gatcacgatg
agatggtgat cgtgaaggac atagacatgt tctccatgtg cgagcaccac
7860ctggtgccat ttgtgggaaa ggtccatatc ggctacctgc ctaacaagca
ggtcctgggc 7920ctcagcaagc tggcgaggat tgtggaaatc tatagtagaa
gactacaggt tcaggagcgc 7980cttaccaaac aaattgctgt ggcaatcacg
gaagccttgc ggcctgctgg agtcggggtc 8040gtggtggaag caacacacat
gtgtatggtg atgcgaggtg tacagaaaat gaacagcaaa 8100accgtgacca
gcacaatgct gggtgtgttc cgggaggatc caaagactcg ggaagagttc
8160ctgactctca tcaggagctg aagaattcct cgacagctta tcgataatca
acctctggat 8220tacaaaattt gtgaaagatt gactggtatt cttaactatg
ttgctccttt tacgctatgt 8280ggatacgctg ctttaatgcc tttgtatcat
gctattgctt cccgtatggc tttcattttc 8340tcctccttgt ataaatcctg
gttgctgtct ctttatgagg agttgtggcc cgttgtcagg 8400caacgtggcg
tggtgtgcac tgtgtttgct gacgcaaccc ccactggttg gggcattgcc
8460accacctgtc agctcctttc cgggactttc gctttccccc tccctattgc
cacggcggaa 8520ctcatcgccg cctgccttgc ccgctgctgg acaggggctc
ggctgttggg cactgacaat 8580tccgtggtgt tgtcggggaa atcatcgtcc
tttccttggc tgctcgcctg tgttgccacc 8640tggattctgc gcgggacgtc
cttctgctac gtcccttcgg ccctcaatcc agcggacctt 8700ccttcccgcg
gcctgctgcc ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag
8760acgagtcgga tctccctttg ggccgcctcc ccgcatcgat accgtcgaat
tggaagagct 8820ttaaatcctg gcacatctca tgtatcaatg cctcagtatg
tttagaaaaa caagggggga 8880actgtggggt ttttatgagg ggttttatac
aattgggcac tcagattctg cggtctgagt 8940cccttctctg ctgggctgaa
aaggcctttg taataaatat aattctctac tcagtccctg 9000tctctagttt
gtctgttcga gatcctacag agctcatgcc ttggcgtaat catggtcata
9060gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac
gagccgggag 9120cataaagtgt aaagcctggg gtgcctaatg agtgagctaa
ctcacattaa ttgcgttgcg 9180ctcactgccc gctttccagt cgggaaacct
gtcgtgccag ctgcattaat gaatcggcca 9240acgcgcgggg agaggcggtt
tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 9300gctgcgctcg
gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg
9360gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag
gccagcaaaa 9420ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc
cataggctcc gcccccctga 9480cgagcatcac aaaaatcgac gctcaagtca
gaggtggcga aacccgacag gactataaag 9540ataccaggcg tttccccctg
gaagctccct cgtgcgctct cctgttccga ccctgccgct 9600taccggatac
ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg
9660ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
tgcacgaacc 9720ccccgttcag cccgaccgct gcgccttatc cggtaactat
cgtcttgagt ccaacccggt 9780aagacacgac ttatcgccac tggcagcagc
cactggtaac aggattagca gagcgaggta 9840tgtaggcggt gctacagagt
tcttgaagtg gtggcctaac tacggctaca ctagaaggac 9900agtatttggt
atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc
9960ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca
agcagcagat 10020tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc
ttttctacgg ggtctgacgc 10080tcagtggaac gaaaactcac gttaagggat
tttggtcatg agattatcaa aaaggatctt 10140cacctagatc cttttaaatt
aaaaatgaag ttttaaatca atctaaagta tatatgagta 10200aacttggtct
gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct
10260atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga
tacgggaggg 10320cttaccatct ggccccagtg ctgcaatgat accgcgagac
ccacgctcac cggctccaga 10380tttatcagca ataaaccagc cagccggaag
ggccgagcgc agaagtggtc ctgcaacttt 10440atccgcctcc atccagtcta
ttaattgttg ccgggaagct agagtaagta gttcgccagt 10500taatagtttg
cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt
10560tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
gatcccccat 10620gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc
gttgtcagaa gtaagttggc 10680cgcagtgtta tcactcatgg ttatggcagc
actgcataat tctcttactg tcatgccatc 10740cgtaagatgc ttttctgtga
ctggtgagta ctcaaccaag tcattctgag aatagtgtat 10800gcggcgaccg
agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag
10860aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct
caaggatctt 10920accgctgttg agatccagtt cgatgtaacc cactcgtgca
cccaactgat cttcagcatc 10980ttttactttc accagcgttt ctgggtgagc
aaaaacagga aggcaaaatg ccgcaaaaaa 11040gggaataagg gcgacacgga
aatgttgaat actcatactc ttcctttttc aatattattg 11100aagcatttat
cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa
11160taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctaaat
tgtaagcgtt 11220aatattttgt taaaattcgc gttaaatttt tgttaaatca
gctcattttt taaccaatag 11280gccgaaatcg gcaaaatccc ttataaatca
aaagaataga ccgagatagg gttgagtgtt 11340gttccagttt ggaacaagag
tccactatta aagaacgtgg actccaacgt caaagggcga 11400aaaaccgtct
atcagggcga tggcccacta cgtgaaccat caccctaatc aagttttttg
11460gggtcgaggt gccgtaaagc actaaatcgg aaccctaaag ggagcccccg
atttagagct 11520tgacggggaa agccaacctg gcttatcgaa attaatacga
ctcactatag ggagaccggc 11580agatcttgaa taataaaatg tgtgtttgtc
cgaaatacgc gt 11622827DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 8gtgaattcgc ggccgcaatc aacctct
27952DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9ggtggcaaca caggcgagca gccccgagtc tcagcagacc
ttccccgaca ac 521036DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 10ccgtggtgtt gtcggggaag gtctgctgag actcgg
361138DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11gctgtcgagc ggccgcgaat tcactagtga ttctcgac 38
* * * * *