U.S. patent application number 12/332174 was filed with the patent office on 2009-04-23 for human g-protein coupled receptors.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Yi Li, Steven M. Ruben.
Application Number | 20090104619 12/332174 |
Document ID | / |
Family ID | 25314306 |
Filed Date | 2009-04-23 |
United States Patent
Application |
20090104619 |
Kind Code |
A1 |
Li; Yi ; et al. |
April 23, 2009 |
Human G-Protein Coupled Receptors
Abstract
Two human G-Protein coupled receptor polypeptides and DNA (RNA)
encoding each of such polypeptides and a procedure for producing
such polypeptides by recombinant techniques is disclosed. Also
disclosed are methods for utilizing such polypeptides for
identifying antagonists and agonists to such polypeptides. Also
disclosed are diagnostic methods for detecting a mutation in the
nucleic acid sequence of each of the G-protein coupled
receptors.
Inventors: |
Li; Yi; (Sunnyvale, CA)
; Ruben; Steven M.; (Brookeville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
25314306 |
Appl. No.: |
12/332174 |
Filed: |
December 10, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10968990 |
Oct 21, 2004 |
|
|
|
12332174 |
|
|
|
|
09518381 |
Mar 3, 2000 |
|
|
|
10968990 |
|
|
|
|
08852824 |
May 7, 1997 |
6060272 |
|
|
09518381 |
|
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/252.3; 435/320.1; 435/69.1; 530/350; 530/387.9; 536/23.5 |
Current CPC
Class: |
C07K 14/705
20130101 |
Class at
Publication: |
435/6 ; 536/23.5;
435/320.1; 435/252.3; 435/69.1; 530/350; 530/387.9 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04; C12N 1/21 20060101
C12N001/21; C12P 21/06 20060101 C12P021/06; C07K 14/435 20060101
C07K014/435; C07K 16/00 20060101 C07K016/00 |
Claims
1. An isolated polynucleotide comprising a polynucleotide having at
least 95% identity to a member selected from the group consisting
of: (a) a polynucleotide encoding a polypeptide comprising amino
acids 2 to 342 of SEQ ID NO:2; (b) a polynucleotide encoding a
polypeptide comprising amino acids 1 to 260 of SEQ ID NO:4; (c) a
polynucleotide encoding the same polypeptide encoded by the human
cDNA in ATCC.TM. Deposit No. 209003; (d) a polynucleotide encoding
the same polypeptide encoded by the human cDNA in ATCC.TM. Deposit
No. 209004; and (e) the complement of (a), (b), (c), or (d).
2. The isolated polynucleotide of claim 1 wherein said member is
(a).
3. The isolated polynucleotide of claim 1 wherein said member is
(b).
4. The isolated polynucleotide of claim 1 wherein said member is
(c).
5. The isolated polynucleotide of claim 1 wherein said member is
(d).
6. The isolated polynucleotide of claim 1 comprising a
polynucleotide, which includes nucleotides 226-1251 of SEQ ID
NO:1.
7. The isolated polynucleotide of claim 1 comprising a
polynucleotide, which includes nucleotides 2 to 827 of SEQ ID
NO:3.
8. A method of making a recombinant vector comprising inserting the
isolated polynucleotide of claim 1 into a vector, wherein said
polynucleotide is DNA.
9. A recombinant vector comprising the polynucleotide of claim 1,
wherein said polynucleotide is DNA.
10. A recombinant host cell, comprising the recombinant vector of
claim 9.
11. A method of producing a host cell, comprising transducing,
transforming or transfecting a host cell with the vector of claim
9.
12. A method for producing a polypeptide, comprising: (a) culturing
the recombinant host cell of claim 10 under conditions suitable to
produce a polypeptide encoded by the polynucleotide; and (b)
recovering the polypeptide from the cell culture.
13. An isolated polypeptide comprising a mature polypeptide having
an amino acid sequence encoded by a polynucleotide which is at
least 95% identical to a member selected from the group consisting
of: (a) a polynucleotide encoding a polypeptide comprising amino
acids 2 to 342 of SEQ ID NO:2; (b) a polynucleotide encoding a
polypeptide comprising amino acids 1 to 260 of SEQ ID NO:4; and (c)
the complement of (a) or (b).
14. An antibody against the polypeptide of claim 13.
15. An antagonist against the polypeptide of claim 13.
16. An agonist against the polypeptide of claim 13.
17. A process for diagnosing a disease condition or a
susceptibility to a disease condition in a subject related to the
under-expression of the polypeptide of claim 13 comprising
determining a mutation in a nucleic acid sequence encoding said
polypeptide.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 09/518,381, filed Mar. 3, 2000, which is a continuation of U.S.
application Ser. No. 08/852,824, filed May 7, 1997, now U.S. Pat.
No. 6,060,272, the disclosures of which are incorporated herein by
reference in their entireties.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptides of the present invention are a human EBV-induced
G-protein coupled receptor (EBI-2) and a human EDG-1-like G-protein
coupled receptor, sometimes hereinafter referred to singularly as
"GPR" or "GPCR" and collectively as "GPRs." The invention also
relates to inhibiting the action of such polypeptides.
[0004] 2. Related Art
[0005] At least nine genes have been identified that are apparently
activated in response to an Epstein-Barr Virus (EBV) infection. One
of two novel genes also identified in such studies of EBV
infections was a novel GPCR-like cDNA molecule designated
EBV-induced G-protein coupled receptor (EBI)-1.
[0006] Additionally, previously identified was an
endothelium-differentiation gene (EDG) that was obtained from
PMA-simulated human endothelial cells. Rat and sheep homologs of
EDG-1 have been identified, which are also G-protein coupled
receptors.
[0007] It is well established that many medically significant
biological processes are mediated by proteins participating in
signal transduction pathways that involve G-proteins and/or second
messengers, e.g., cAMP (Lefkowitz, Nature 351:353-354 (1991)).
Herein these proteins are referred to as proteins participating in
pathways-with G-proteins or PPG proteins. Some examples of these
proteins include the GPC receptors, such as those for adrenergic
agents and dopamine (Kobilka, B. K., et al., PNAS 84:46-50 (1987);
Kobilka, B. K., et al., Science 238:650-656 (1987); Bunzow, J. R.,
et al., Nature 336:783-787 (1988)), G-proteins themselves, effector
proteins, e.g., phospholipase C, adenyl cyclase, and
phosphodiesterase, and actuator proteins, e.g., protein kinase A
and protein kinase C (Simon, M. I., et al., Science 252:802-8
(1991)).
[0008] For example, in one form of signal transduction, the effect
of hormone binding is activation of an enzyme, adenylate cyclase,
inside the cell. Enzyme activation by hormones is dependent on the
presence of the nucleotide GTP, and GTP also influences hormone
binding. G-protein connects the hormone receptors to adenylate
cyclase. G-protein was shown to exchange GTP for bound GDP when
activated by hormone receptors. The GTP-carrying form then binds to
an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed
by the G-protein itself, returns the G-protein to its basal,
inactive form. Thus, the G-protein serves a dual role, as an
intermediate that relays the signal from receptor to effector, and
as a clock that controls the duration of the signal.
[0009] The membrane protein gene superfamily of G-protein coupled
receptors has been characterized as having seven putative
transmembrane domains. The domains are believed to represent
transmembrane .alpha.-helices connected by extracellular or
cytoplasmic loops. A function G-protein is a trimer which consists
of a variable alpha subunit coupled to a much more
tightly-associated and constant beta and gamma subunits. A broad
range of ligands (more than twenty) have been identified which
function through GPCRs. In general, binding of an appropriate
ligand to a GPCR leads to the activation of the receptor. G-protein
coupled receptors include a wide range of biologically active
receptors, such as hormone, viral, growth factor and
neuroreceptors. Such an activated receptor initiates the regulatory
cycle of the G-protein. This cycle consists of GTP exchange for
GDP, dissociation of the alpha and beta/gamma subunits, activation
of the second messenger pathway by a complex of GTP and the alpha
subunit of the G-protein, and return to the resting state by GTP
hydrolysis via the innate GTP-ase activity of the G-protein alpha
subunit A
[0010] G-protein coupled receptors have been characterized as
including these seven conserved hydrophobic stretches of about 20
to 30 amino acids, connecting at least eight divergent hydrophilic
loops. The G-protein family of coupled receptors includes dopamine
receptors which bind to neuroleptic drugs used for treating
psychotic and neurological disorders. Other examples of members of
this family include calcitonin, adrenergic, endothelin, cAMP,
adenosine, muscarinic, acetylcholine, serotonin, histamine,
thrombin, kinin, follicle stimulating hormone, opsins and
rhodopsins, odorant, cytomegalovirus receptors, etc.
[0011] Most GPRs have single conserved cysteine residues in each of
the first two extracellular loops which form disulfide bonds that
are believed to stabilize functional protein structure. The 7
transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5,
TM6, and TM7. TM3 is also implicated in signal transduction.
[0012] Phosphorylation and lipidation (palmitylation or
farnesylation) of cysteine residues can influence signal
transduction of some GPRs. Most GPRs contain potential
phosphorylation sites within the third cytoplasmic loop and/or the
carboxy terminus. For several GPRs, such as the
.beta.-adrenoreceptor, phosphorylation by protein kinase A and/or
specific receptor kinases mediates receptor desensitization.
[0013] The ligand binding sites of GPRs are believed to comprise a
hydrophilic socket formed by several GPR transmembrane domains,
which socket is surrounded by hydrophobic residues of the GPRs. The
hydrophilic side of each GPR transmembrane helix is postulated to
face inward and form the polar ligand binding site. TM3 has been
implicated in several GPRs as having a ligand binding site, such as
including the TM3 aspartate residue. Additionally, TM5 serines, a
TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines-are also
implicated-in ligand binding.
[0014] GPRs can be intracellularly coupled by heterotrimeric
G-proteins to various intracellular enzymes, ion channels and
transporters (see, Johnson et al., Endoc. Rev. 10:317-331 (1989)).
Different G-protein .alpha.-subunits preferentially stimulate
particular effectors to modulate various biological functions in a
cell. Phosphorylation of cytoplasmic residues of GPRs has been
identified as an important mechanism for the regulation of
G-protein coupling of some GPRs.
[0015] G-protein coupled receptors are found in numerous sites
within a mammalian host. For example, dopamine is a critical
neurotransmitter in the central nervous system and is a G-protein
coupled receptor ligand.
SUMMARY OF THE INVENTION
[0016] In accordance with one aspect of the present invention,
there are provided novel polypeptides, as well as antisense analogs
thereof and biologically active and diagnostically or
therapeutically useful fragments and derivatives thereof. The
polypeptides of the present invention are of human origin.
[0017] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules, including
mRNAs, DNAs, cDNAS, genomic DNA as well as antisense analogs
thereof and biologically active and diagnostically or
therapeutically useful fragments thereof.
[0018] In accordance with a further aspect of the present
invention, there is provided a process for producing such
polypeptides by recombinant techniques which comprises culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
nucleic acid sequence encoding a polypeptide of the present
invention, under conditions promoting expression of said protein
and subsequent recovery of said protein.
[0019] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0020] In accordance with another embodiment, there is provided a
process for using one or more of the receptors according to the
invention to screen for receptor antagonists and/or agonists and/or
receptor ligands.
[0021] In accordance with still another embodiment of the present
invention there is provided a process of using such agonists to
activate the polypeptide of the present invention for the treatment
of conditions related to the underexpression of the polypeptide of
the present invention.
[0022] In accordance with another aspect of the present invention
there is provided a process of using such antagonists for
inhibiting the polypeptide of the present invention for treating
conditions associated with overexpression of the polypeptide of the
present invention.
[0023] In accordance with yet another aspect of the present
invention there is provided non-naturally occurring synthetic,
isolated and/or recombinant polypeptides which are fragments,
consensus fragments and/or sequences having conservative amino acid
substitutions, of at least one transmembrane domain, such that the
polypeptides of the present invention may bind ligands, or which
may also modulate, quantitatively or qualitatively, ligand binding
to the polypeptide of the present invention.
[0024] In accordance with still another aspect of the present
invention there are provided synthetic or recombinant polypeptides,
conservative substitution derivatives thereof, antibodies,
anti-idiotype antibodies, compositions and methods that can be
useful as potential modulators of G-protein coupled receptor
function, by binding to ligands or modulating ligand binding, due
to their expected biological properties, which may be used in
diagnostic, therapeutic and/or research applications.
[0025] In accordance with another object of the present invention,
there is provided synthetic, isolated or recombinant polypeptides
which are designed to inhibit or mimic various GPRs or fragments
thereof, as receptor types and subtypes.
[0026] In accordance with yet another object of the present
invention, there is provided a diagnostic assay for detecting a
disease or susceptibility to a disease related to a mutation in a
nucleic acid sequence encoding a polypeptide of the present
invention.
[0027] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE FIGURES
[0028] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0029] FIGS. 1A, 1B, and 1C show the cDNA sequence (SEQ ID NO:1)
and the corresponding deduced amino acid sequence (SEQ ID NO:2) of
the EBV-induced G-protein coupled receptor of the present
invention. The polynucleotide sequence contains a 2249 nucleotide
sequence which encodes a 342 amino acid ORF. In FIGS. 1A-1C, the
standard one-letter abbreviation for amino acids is used to
illustrate the deduced amino acid sequence. Sequencing was
performed using a 373 Automated DNA sequencer (Applied Biosystems,
Inc.). Sequencing accuracy is predicted to be greater than 97%
accurate.
[0030] FIG. 2 is an amino acid sequence comparison between the
EBV-induced (EBI-2) G-Protein Coupled Receptor (upper line, see SEQ
ID NO:2) and the human EBI-1 G-Protein Coupled Receptor (lower
line, SEQ ID NO: 17). The standard one letter abbreviations are
used to represent the amino acid residues of the amino acid
sequences illustrated. The EBI-2 polypeptide according to the
invention shows approximately 25% identity and 49% similarity to
the amino acid sequence of the EBI-1 gene over an approximately 350
amino acid stretch.
[0031] FIGS. 3A and 3B show the cDNA sequence (SEQ ID NO:3) and the
corresponding deduced-amino acid sequence (SEQ ID NO:4) of the
EDG-1-like G-protein coupled receptor of the present invention. The
polynucleotide sequence contains a 1637 nucleotide sequence which
encodes a 384 amino acid ORF. In FIGS. 3A and 3B, the standard
one-letter abbreviation for amino acids is used to illustrate the
deduced amino acid sequence. Sequencing was performed using a 373
Automated DNA sequencer (Applied Biosystems, Inc.). Sequencing
accuracy is predicted to be greater than 97% accurate.
[0032] FIG. 4 is an amino acid sequence comparison between the
EDG-1-like G-Protein Coupled Receptor (upper line, see SEQ ID NO:4)
and the human EDG-1 orphan G-Protein Coupled Receptor (lower line,
SEQ ID NO:18). The standard one-letter abbreviations are used to
represent the amino acid residues of the amino acid sequences
illustrated. The EDG-1-like polypeptide according to the invention
shows approximately 54% identity and 73% similarity to the amino
acid sequence of the human EDG-1 orphan G-protein Coupled Receptor
gene over two regions totaling approximately 120 amino acids.
DETAILED DESCRIPTION OF THE INVENTION
[0033] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encode
for the mature polypeptide having the deduced amino acid sequence
of FIGS. 1A-1C (SEQ ID NO: 2) or for the mature polypeptide encoded
by the cDNA of the clone deposited with the American Type Culture
Collection (ATCC), 10801 University Boulevard, Manassas, Va.
20110-2209, as ATCC Deposit No. 209003 on Apr. 28, 1997.
[0034] A polynucleotide encoding an EBI-2 polypeptide of the
present invention may be found in a cDNA library from umbilical
vein endothelial cells, neutrophil leukocyte cells, and corpus
colosum cells. The polynucleotide of this invention was discovered
in a cDNA library derived from umbilical vein endothelial cells. As
described above, it is structurally related to the G
protein-coupled receptor family. It contains an open reading frame
encoding a protein of 343 amino acid residues.
[0035] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIGS. 3A and 3B (SEQ ID NO:4) or for the mature polypeptide
encoded by the cDNA of the clone deposited as ATCC Deposit No.
209004 on Apr. 28, 1997.
[0036] A polynucleotide encoding an EDG-1-like G-protein coupled
receptor polypeptide of the present invention may be found in an
activated neutrophil cDNA library, cyclohexamine-treated Raji
cells, the RSR; 11 bone marrow cell line, activated T-cells,
tonsils, and CD34-positive cord blood cells. Northern blot analyses
indicate that the EDG-1-like receptor gene is expressed primarily
in leukocytes, but expression may also be observed in placenta,
spleen, thymus, lung and pancreas tissue. The polynucleotide of
this invention was discovered in a cDNA library derived from
activated neutrophils. As described above, it is structurally
related to the G protein-coupled receptor family. It contains an
open reading frame encoding a protein of 384 amino acid
residues.
[0037] As noted above, a great deal of the importance attributed to
GPCR molecules such as those of the presently claimed invention
lies in the diversity of biological functions in which they
participate. For example, it is thought that, upon release form the
alpha subunit, the beta/gamma subunit may also play a functional
role in the regulation of signal transduction by activating the
arachidonic acid signal transduction pathway via the activation of
phospholipase A.sub.2. In addition, GPCR molecules and their
associated G-proteins have been implicated in the coupling of
visual pigments to cGMP phosphodiesterase, phosphatidyl inositol
(PI) turnover, adenylyl cyclase signal channels and other integral
membrane enzymes to transporter proteins. As a result, it is
apparent that novel GPCR molecules may prove useful in a wide
variety of pharmaceutical applications including research and
development. For example, target based screens for small molecules
and other such pharmacologically valuable factors may be based on
activating a given GPCR. It has also been observed that short
peptides may function by mimicking the GPCR (termed
receptomimetics). Furthermore, monoclonal antibodies raised against
such factors may prove useful as therapeutics in a number of
capacities. Potential therapeutic and/or diagnostic applications
for such a factor may include such diverse clinical presentations
as heart disease, mental illness, cancer, atherosclerosis,
restenosis, Alzheimer's Disease, Parkinson's Disease, and a number
of others.
[0038] Accordingly, the polynucleotides of the present invention
may be in the form of RNA or in the form of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be
double-stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The coding
sequence which encodes the mature EBI-2 polypeptide may be
identical to the coding sequence shown in FIGS. 1A-1C (SEQ ID NO:1)
or that of the deposited clone or may be a different coding
sequence which coding sequence, as a result of the redundancy or
degeneracy of the genetic code, encodes the same mature polypeptide
as the DNA of FIGS. 1A-1C (SEQ ID NO:1) or the deposited cDNA.
Similarly, the coding sequence which encodes the mature EDG-1-like
G-protein coupled receptor polypeptide may be identical to the
coding sequence shown in FIGS. 3A and 3B (SEQ ID NO: 3) or that of
the deposited clone or may be a different coding sequence which
coding sequence, as a result of the redundancy or degeneracy of the
genetic code, encodes the same mature polypeptide as the DNA of
FIGS. 3A and 3B (SEQ ID NO:3) or the deposited cDNA.
[0039] The polynucleotides which encode either (a) the mature EBI-2
polypeptide of FIGS. 1A-1C (SEQ ID NO:2) or the mature EBI-2
polypeptide encoded by the deposited cDNA, or (b) the mature
EDG-1-like G-protein coupled receptor polypeptide of FIGS. 3A and
3B (SEQ ID NO:4) or the mature EDG-1-like G-protein coupled
receptor polypeptide encoded by the deposited cDNA may include:
only the coding sequence for the mature polypeptide; the coding
sequence for the mature polypeptide and additional coding sequence
such as a leader or secretory sequence or a proprotein sequence;
the coding sequence for the mature polypeptide (and optionally
additional coding sequence) and non-coding sequence, such as
introns or non-coding sequence 5' and/or 3' of the coding sequence
for the mature polypeptide.
[0040] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0041] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of (a) the polypeptide having the deduced
amino acid sequence of FIGS. 1A-1C (SEQ ID NO:2) or the polypeptide
encoded by the cDNA of the deposited clone, or (2) the polypeptide
having the deduced amino acid sequence of FIGS. 3A and 3B (SEQ ID
NO:4) or the polypeptide encoded by the cDNA of the deposited
clone. The variant of either of these two polynucleotides may be a
naturally occurring allelic variant of the polynucleotide or a
non-naturally occurring variant of the polynucleotide.
[0042] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 1A-1C (SEQ
ID NO:2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIGS. 1A-1C (SEQ ID NO:2) or the polypeptide encoded
by the cDNA of the deposited clone. Such nucleotide variants
include deletion variants, substitution variants and addition or
insertion variants.
[0043] Likewise, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 3A and 3B
(SEQ ID NO:4) or the same mature polypeptide encoded by the cDNA of
the deposited clone as well as variants of such polynucleotides
which variants encode for a fragment, derivative or analog of the
polypeptide of FIGS. 3A and 3B (SEQ ID NO:4) or the polypeptide
encoded by the cDNA of the deposited clone. Such nucleotide
variants include deletion variants, substitution variants and
addition or insertion variants.
[0044] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1A-1C (SEQ ID NO:1) or of the
coding sequence of the deposited clone. Also, as hereinabove
indicated, the polynucleotide may have a coding sequence which is a
naturally occurring allelic variant of the coding sequence shown in
FIGS. 3A and 3B (SEQ ID NO:3) or of the coding sequence of the
deposited clone. As known in the art, an allelic variant is an
alternate form of a polynucleotide sequence which may have a
substitution, deletion or addition of one or more nucleotides,
which does not substantially alter the function of the encoded
polypeptide.
[0045] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also code for a
proprotein which is the mature protein plus additional 51 amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains.
[0046] Thus, for example, the polynucleotide of the present
invention may encode a mature protein, or a protein having a
prosequence or for a protein having both a prosequence and a
presequence (leader sequence).
[0047] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell 37:767 (1984)).
[0048] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0049] Fragments of the full length gene of the present invention
may be used as hybridization probes for a cDNA or a genomic library
to isolate the full length DNA and to isolate other DNAs which have
a high sequence similarity to the gene or similar biological
activity. Probes of this type preferably have at least 10,
preferably at least 15, and even more preferably at least 30 bases
and may contain, for example, at least 50 or more bases. In fact,
probes of this type having at least up to 150 bases or greater may
be preferably utilized. The probe may also be used to identify a
DNA clone corresponding to a full length transcript and a genomic
clone or clones that contain the complete gene including regulatory
and promotor regions, exons and introns. An example of a screen
comprises isolating the coding region of the gene by using the
known DNA sequence to synthesize an oligonucleotide probe. Labeled
oligonucleotides having a sequence complementary or identical to
that of the gene or portion of the gene sequences of the present
invention are used to screen a library of genomic DNA to determine
which members of the library the probe hybridizes to.
[0050] It is also appreciated that such probes can be and are
preferably labeled with an analytically detectable reagent to
facilitate identification of the probe. Useful reagents include but
are not limited to radioactivity, fluorescent dyes, or enzymes
capable of catalyzing the formation of a detectable product. The
probes are thus useful to isolate complementary copies of DNA from
other sources or to screen such sources for related sequences.
[0051] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. (As indicated above, 70%
identity would include within such definition a 70 bps fragment
taken from a 100 bp polynucleotide, for example.) The present
invention particularly relates to polynucleotides which hybridize
under stringent conditions to the hereinabove-described
polynucleotides. As herein used, the term "stringent conditions"
means hybridization will occur only if there is at least 95% and
preferably at least 97% identity between the sequences. The
polynucleotides which hybridize to the hereinabove described
polynucleotides in a preferred embodiment encode enzymes which
either retain substantially the same biological function or
activity as the mature polypeptide encoded by the DNA of FIGS. 1
A-C, 3A and 3B (SEQ ID NOS:2 and 4, respectively). In referring to
identity in the case of hybridization, as known in the art, such
identity refers to complementarity of polynucleotide segments.
[0052] Alternatively, the polynucleotide may have at least 15
bases, preferably at least 30 bases, and more preferably at least
50 bases which hybridize to any part of a polynucleotide of the
present invention and which has an identity thereto, as hereinabove
described, and which may or may not retain activity. For example,
such polynucleotides may be employed as probes for the
polynucleotides of SEQ ID NOS:1 and 3, for example, for recovery of
the polynucleotide or as a diagnostic probe or as a PCR primer.
[0053] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% identity
and more preferably at least a 95% identity to a polynucleotide
which encodes either the polypeptide of SEQ ID NO:2, or the
polypeptide of SEQ ID NO:4, as well as fragments thereof, which
fragments have at least 15 bases, preferably at least 30 bases,
more preferably at least 50 bases and most preferably fragments
leaving up to at least 150 bases or greater, which fragments are at
least 90% identical, preferably at least 95% identical and most
preferably at least 97% identical to any portion of a
polynucleotide of the present invention.
[0054] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0055] The present invention further relates to polypeptides which
have the deduced amino acid sequences of FIGS. 1A-C, 3A; and 3B
(SEQ ID NOS:2 and 4, respectively) as well as fragments, analogs
and derivatives of such polypeptides.
[0056] The terms "fragment," "derivative," and "analog" when
referring to (a) the polypeptide of FIGS. 1A-1C (SEQ ID NO:2) or
that encoded by the deposited cDNA, or (b) the polypeptide of FIGS.
3A and 3B (SEQ ID NO:4), means a polypeptide which either retains
substantially the same biological function or activity as such
polypeptide, i.e., functions as a G-protein coupled receptor, or
retains the ability to bind the ligand or the receptor even though
the polypeptide does not function as a G-protein coupled receptor,
for example, a soluble form of the receptor.
[0057] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0058] The fragment, derivative or analog of either (a) the
polypeptide of FIGS. 1A-1C (SEQ ID NO:2) or that encoded by the
deposited cDNA, (b) the polypeptide of FIGS. 3A and 3B (SEQ ID
NO:4) may be (I) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved amino
acid residue (preferably a conserved amino acid residue) and such
substituted amino acid residue may or may not be one encoded by the
genetic code, or (ii) one in which one or more of the amino acid
residues includes a substituent group, or (iii) one in which the
mature polypeptide is fused with another compound, such as a
compound to increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are of used to the mature polypeptide, or (v) one in which a
fragment of the polypeptide is soluble, i.e., not membrane bound,
yet still binds ligands to the membrane bound receptor. Such
fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0059] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0060] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0061] The polypeptides of the present invention include the
polypeptides of SEQ ID NOS:2 and 4 (in particular the respective
mature polypeptides) as well as polypeptides which have at least
70% similarity (preferably at least a 70% identity) to either the
polypeptide of SEQ ID NO:2 or the polypeptide of SEQ ID NO:4 and
more preferably at least a 90% similarity (more preferably at least
a 90% identity) to the polypeptide of SEQ ID NO:2 or of SEQ ID NO:4
and still more preferably at least a 95% similarity (still more
preferably a 90% identity) to the polypeptide of SEQ ID NO:2 or of
SEQ ID NO:4 and also include portions of such polypeptides with
such portion of the polypeptide generally containing at least 30
amino acids and more preferably at least 50 amino acids.
[0062] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0063] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0064] The present invention also relates to a method for
identifying and/or isolating cells, tissues, or classes of cells or
tissues, by utilizing probes of the polynucleotides that encode the
EBI-2 G-protein coupled receptor polypeptide or by utilizing an
antibody specific for the EBI-2 G-protein coupled receptor, for
example. Since the EBI-2 G-protein coupled receptor polypeptides
according to the invention occur in vein endothelial cells,
neutrophil leukocyte cells, and corpus colosum cells, the above
probes or antibodies, for example, may be utilized to identify
and/or isolate such cells, tissues or classes of cells or
tissues.
[0065] The present invention further relates to a method for
identifying and/or isolating cells, tissues, or classes of cells or
tissues, by utilizing probes of the polynucleotides that encode the
EDG-1-like G-protein coupled receptor polypeptide or by utilizing
an antibody specific for the EDG-1-like G-protein coupled receptor
polypeptide, for example. Since the EDG-1-like G-protein coupled
receptor polypeptides according to the invention occur in
leukocyte, tonsil, placenta, thymus, lung, and pancreas tissue, the
above probes or antibodies, for example, may be utilized to
identify and/or isolate such cells, tissues or classes of cells or
tissues.
[0066] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0067] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
G-protein coupled receptor genes. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0068] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0069] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0070] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there-may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0071] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0072] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0073] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces, and
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
Cos or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0074] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10,
phagescript, .phi.X174, pbluescript SK, pbsks, pNH8A, pNH16a,
pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540,
pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVY3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0075] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0076] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation. (Davis, L., et al., Basic Methods in Molecular
Biology, (1986)).
[0077] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0078] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook et al., Molecular Cloning: A Laboratory A Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0079] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0080] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0081] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0082] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0083] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0084] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0085] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0086] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0087] The G-protein coupled receptor polypeptides can be recovered
and purified from recombinant cell cultures by methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0088] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0089] The G-protein coupled receptor of the present invention may
be employed in a process for screening for antagonists and/or
agonists for the receptor.
[0090] In general, such screening procedures involve providing
appropriate cells which express the receptor on the surface
thereof. In particular, a polynucleotide encoding the receptor of
the present invention is employed to transfect cells to thereby
express the G-protein coupled receptor. Such transfection may be
accomplished by procedures as hereinabove described.
[0091] One such screening procedure involves the use of the
melanophores which are transfected to express the G-protein coupled
receptor of the present invention. Such a screening technique is
described in PCT WO 92/01810 published Feb. 6, 1992.
[0092] Thus, for example, such assay may be employed for screening
for a receptor antagonist by contacting the melanophore cells which
encode the G-protein coupled receptor with both the receptor ligand
and a compound to be screened. Inhibition of the signal generated
by the ligand indicates that a compound is a potential antagonist
for the receptor, i.e., inhibits activation of the receptor.
[0093] The screen may be employed for determining an agonist by
contacting such cells with compounds to be screened and determining
whether such compound generates a signal, i.e., activates the
receptor.
[0094] Other screening techniques include the use of cells which
express the G-protein coupled receptor (for example, transfected
CHO cells) in a system which measures extracellular pH changes
caused by receptor activation, for example, as described in Parce
et al., Science 246:243-247 (1989). For example, potential agonists
or antagonists may be contacted with a cell which expresses the
G-protein coupled receptor and a second messenger response, e.g.,
signal transduction or pH changes, may be measured to determine
whether the potential agonist or antagonist is effective.
[0095] Another such screening technique involves introducing RNA
encoding the G-protein coupled receptor into Xenopus oocytes to
transiently express the receptor. The receptor oocyte may then be
contacted in the case of antagonist screening with the receptor
ligand and a compound to be screened, followed by detection of
inhibition of a calcium signal.
[0096] Another screening technique involves expressing the
G-protein coupled receptor in which the receptor is linked to a
phospholipase C or D. As representative examples of such cells,
there may be mentioned endothelial cells, smooth muscle cells,
embryonic kidney cells, etc. The screening for an antagonist or
agonist may be accomplished as hereinabove described by detecting
activation of the receptor or inhibition of activation of the
receptor from the phospholipase second signal.
[0097] Another method involves screening for antagonists by
determining inhibition of binding of labeled ligand to cells which
have the receptor on the surface thereof. Such a method involves
transfecting a eukaryotic cell with DNA encoding the G-protein
coupled receptor such that the cell expresses the receptor on its
surface and contacting the cell with a potential antagonist in the
presence of a labeled form of a known ligand. The ligand can be
labeled, e.g., by radioactivity. The amount of labeled ligand bound
to the receptors is measured, e.g., by measuring radioactivity of
the receptors. If the potential antagonist binds to the receptor as
determined by a reduction of labeled ligand which binds to the
receptors, the binding of labeled ligand to the receptor is
inhibited.
[0098] The present invention also provides a method for determining
whether a ligand not known to be capable of binding to a G-protein
coupled receptor can bind to such receptor which comprises
contacting a mammalian cell which expresses a G-protein coupled
receptor with the ligand under conditions permitting binding of
ligands to the G-protein coupled receptor, detecting the presence
of a ligand which binds to the receptor and thereby determining
whether the ligand binds to the G-protein coupled receptor. The
systems hereinabove described for determining agonists and/or
antagonists may also be employed for determining ligands which bind
to the receptor.
[0099] In general, antagonists for G-protein coupled receptors
which are determined by screening procedures may be employed for a
variety of therapeutic purposes. For example, such antagonists have
been employed for treatment of hypertension, angina pectoris,
myocardial infarction, ulcers, asthma, allergies, psychoses,
depression, migraine, vomiting, stroke, eating disorders, migraine
headaches, cancer and benign prostatic hypertrophy.
[0100] Agonists for G-protein coupled receptors are also useful for
therapeutic purposes, such as the treatment of asthma, Parkinson's
disease, acute heart failure, hypotension, urinary retention, and
osteoporosis.
[0101] Examples of G-protein coupled receptor antagonists include
an antibody, or in some cases an oligonucleotide, which binds to
the G-protein coupled receptor but does not elicit a second
messenger response such that the activity of the G-protein coupled
receptor is prevented. Antibodies include anti-idiotypic antibodies
which recognize unique determinants generally associated with the
antigen-binding site of an antibody. Potential antagonists also
include proteins which are closely related to the ligand of the
G-protein coupled receptor, i.e., a fragment of the ligand, which
has lost biological function and when binding to the G-protein
coupled receptor, elicit no response.
[0102] A potential antagonist also includes an antisense construct
prepared through the use of antisense technology. Antisense
technology can be used to control gene expression through
triple-helix formation or antisense DNA or RNA, both of which
methods are based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion of the polynucleotide sequence,
which encodes for the mature polypeptides of the present invention,
is used to design an antisense RNA oligonucleotide of from about 10
to 40 base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
(triple-helix see Lee et al., Nucl. Acids Res. 6:3073 (1979);
Cooney et al., Science 241:456 (1988); and Dervan et al., Science
251: 1360 (1991)), thereby preventing transcription and the
production of G-protein coupled receptor. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the G-protein coupled
receptor (antisense--Okano, J. Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of G-protein
coupled receptor.
[0103] Another potential antagonist is a small molecule which binds
to the G-protein coupled receptor, making it inaccessible to
ligands such that normal biological activity is prevented. Examples
of small molecules include but are not limited to small peptides or
peptide-like molecules.
[0104] Potential antagonists also include a soluble form of a
G-protein coupled receptor, e.g., a fragment of the receptor, which
binds to the ligand and prevents the ligand from interacting with
membrane bound G-protein coupled receptors.
[0105] The G-protein coupled receptor and antagonists or agonists
may be employed in combination with a suitable pharmaceutical
carrier. Such compositions comprise a therapeutically effective
amount of the polypeptide, and a pharmaceutically acceptable
carrier or excipient. Such a carrier includes but is not limited to
saline, buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The formulation should suit the mode of
administration.
[0106] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the pharmaceutical compositions
may be employed in conjunction with other therapeutic
compounds.
[0107] The pharmaceutical compositions may be administered in a
convenient manner such as by the topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, the
pharmaceutical compositions will be administered in an amount of at
least about 10 .mu.g/kg body weight and in most cases they will be
administered in an amount not in excess of about 8 mg/kg body
weight per day. In most cases, the dosage is from about 10 .mu.g/kg
to about 1 mg/kg body weight daily, taking into account the routes
of administration, symptoms, etc.
[0108] The G-protein coupled receptor polypeptides and antagonists
or agonists which are polypeptides, may be employed in accordance
with the present invention by expression of such polypeptides in
vivo, which is often referred to as "gene therapy."
[0109] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0110] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0111] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0112] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
BioTechniques 7:980-990 (1989), or any other promoter (e.g.,
cellular promoters such as eukaryotic cellular promoters including,
but not limited to, the histone, pol III, and .beta.-actin
promoters). Other viral promoters which may be employed include,
but are not limited to, adenovirus promoters, thymidine kinase (TK)
promoters, and B19 parvovirus promoters. The selection of a
suitable promoter will be apparent to those skilled in the art from
the teachings contained herein.
[0113] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or heterologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0114] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy 1:5-14 (1990),
which is-incorporated herein by reference in its entirety. The
vector may transduce the packaging cells through any means known in
the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0115] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0116] G-protein coupled receptors are ubiquitous in the mammalian
host and are responsible for many biological functions, including
many pathologies. Accordingly, it is desirous to find compounds
which stimulate a G-protein coupled receptor and compounds which
antagonize a G-protein coupled receptor.
[0117] This invention further provides a method of identifying
compounds which specifically interact with, and bind to, the human
G-protein coupled receptors on the surface of a cell which
comprises contacting a mammalian cell comprising an isolated DNA
molecule encoding the G-protein coupled receptor with a plurality
of compounds, determining those which bind to the mammalian cell,
and thereby identifying compounds which specifically interact with
and bind to a human G-protein coupled receptor of the present
invention.
[0118] This invention also provides a method of detecting
expression of the G-protein coupled receptor on the surface of a
cell by detecting the presence of mRNA coding for a G-protein
coupled receptor which comprises obtaining total mRNA from the cell
and contacting the mRNA so obtained with a nucleic acid probe
comprising a nucleic acid molecule of at least 15 nucleotides
capable of specifically hybridizing with a sequence included within
the sequence of a nucleic acid molecule encoding a human G-protein
coupled receptor under hybridizing conditions, detecting the
presence of mRNA hybridized to the probe, and thereby detecting the
expression of the G-protein coupled receptor by the cell.
[0119] This invention is also related to the use of the G-protein
coupled receptor gene as part of a diagnostic assay for detecting
diseases or susceptibility to diseases related to the presence of
mutated G-protein coupled receptor genes. Such diseases are related
to cell transformation, such as tumors and cancers.
[0120] Individuals carrying mutations in the human G-protein
coupled receptor gene may be detected at the DNA level by a variety
of techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, such as from blood, urine, saliva, tissue biopsy,
and autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR (Saiki et
al., Nature 324:163-166 (1986)) prior to analysis. RNA or cDNA may
also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid encoding the G-protein coupled
receptor protein can be used to identify and analyze G-protein
coupled receptor mutations. For example, deletions and insertions
can be detected by a change in size of the amplified product in
comparison to the normal genotype. Point mutations can be
identified by hybridizing amplified DNA to radiolabeled G-protein
coupled receptor RNA or alternatively, radiolabeled G-protein
coupled receptor antisense DNA sequences. Perfectly matched
sequences can be distinguished from mismatched duplexes by RNase A
digestion or by differences in melting temperatures.
[0121] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science 230:1242 (1985)).
[0122] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., Proc. Natl.
Acad. Sci. USA 85:4397-4401 (1985)).
[0123] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0124] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0125] The present invention also relates to a diagnostic assay for
detecting altered levels of soluble forms of the receptor
polypeptides of the present invention in various tissues. Assays
used to detect levels of the soluble receptor polypeptides in a
sample derived from a host are well known to those of skill in the
art and include radioimmunoassays, competitive-binding assays,
Western blot analysis and preferably as ELISA assay.
[0126] An ELISA assay initially comprises preparing an antibody
specific to antigens of the G-protein coupled receptor
polypeptides, preferably a monoclonal antibody. In addition a
reporter antibody is prepared against the monoclonal antibody. To
the reporter antibody is attached a detectable reagent such as
radioactivity, fluorescence or in this example a horseradish
peroxidase enzyme. A sample is now removed from a host and
incubated on a solid support, e.g., a polystyrene dish, that binds
the proteins in the sample. Any free protein binding sites on the
dish are then covered by incubating with a non-specific protein
such as bovine serum albumin. Next the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attach to any G-protein coupled receptor proteins attached to the
polystyrene dish. All unbound monoclonal antibody is washed out
with buffer. The reporter antibody linked to horseradish peroxidase
is now placed in the dish resulting in binding of the reporter
antibody to any monoclonal antibody bound to G-protein receptor
proteins. Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount of
color developed in a given time period is a measurement of the
amount of G-protein coupled receptor proteins present in a given
volume of patient sample when compared against a standard
curve.
[0127] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0128] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0129] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0130] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0131] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in McKusick, V., Mendelian Inheritance in Man (available
on line through Johns Hopkins University Welch Medical Library).
The relationship between genes and diseases that have been mapped
to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0132] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0133] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 (one) megabase
mapping resolution and one gene per 20 kb).
[0134] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0135] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0136] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, Nature 256:495-497 (1975)), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., Immunology Today
4:72 (1983)), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., in Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985)).
[0137] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0138] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0139] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0140] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0141] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0142] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res. 8:4057 (1980).
[0143] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0144] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments Sambrook
et al. ibid. Unless otherwise provided, ligation may be
accomplished using known buffers and conditions with 10 units to T4
DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0145] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology
52:456-457 (1973).
EXAMPLE 1
Bacterial Expression and Purification of EBI-2
[0146] The DNA sequence encoding EBI-2, ATCC #209003, is initially
amplified using PCR oligonucleotide primers corresponding to the 5'
sequences of the processed EBI-2 protein (minus the signal peptide
sequence) and the vector sequences 3' to the EBI-2 gene. Additional
nucleotides corresponding to EBI-2 were added to the 5' and 3'
sequences respectively. The 5' oligonucleotide primer has the
sequence 5' CCGAGGATCCATGCAAGCCGTCGACAAT 3' (SEQ ID NO:5) contains
a BamHI restriction enzyme site followed by 18 nucleotides of the
EBI-2 coding sequence starting from the presumed terminal amino
acid of the processed protein codon. The 3' sequence 5'
CCGAGGATCCTTACATTGGAGTCTCTTC 3' (SEQ ID NO:6) contains
complementary sequences to BamHI site and is followed by 18
nucleotides of EBI-2. The restriction enzyme sites correspond to
the restriction enzyme sites on the bacterial expression vector
pQE-60 (Qiagen, Inc., Chatsworth, Calif., 91311). pQE-60 encodes
antibiotic resistance (Amp.sup.r), a bacterial origin of
replication (ori), an IPTG-regulatable promoter operator (P/O), a
ribosome binding site (RBS), a 6-His tag and restriction enzyme
sites. pQE-60 was then digested with BamHI. The amplified sequences
were ligated into pQE-60 and were inserted in frame with the
sequence encoding for the histidine tag and the RBS. The ligation
mixture was then used to transform E. coli strain M15/rep 4
(Qiagen, Inc.) by the procedure described in Sambrook, J. et al.,
ibid. M15/rep4 contains multiple copies of the plasmid pREP4, which
expresses the lacI repressor and also confers kanamycin resistance
(Kan.sup.r). Transformants are identified by their ability to grow
on LB plates, and ampicillin/kanamycin resistant colonies were
selected. Plasmid DNA was isolated and confirmed by restriction
analysis. Clones containing the desired constructs were grown
overnight (O/N) in liquid culture in LB media supplemented with
both Amp (100 .mu.g/ml) and Kan (25 .mu.g/ml). The O/N culture is
used to inoculate a large culture at a ratio of 1:100 to 1:250. The
cells were grown to an optical density 600 (O.D..sub.600) of
between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalactopyranoside")
was then added to a final concentration of 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/O leading to
increased gene expression. Cells were grown an extra 3 to 4 hours.
Cells were then harvested by centrifugation. The cell pellet was
solubilized in the chaotropic agent 6 Molar Guanidine HCl. After
clarification, solubilized EBI-2 was purified from this solution by
chromatography on a Nickel-Chelate column under conditions that
allow for tight binding by proteins containing the 6-His tag
(Hochuli, E., et al., J. Chromatography 411:177-184 (1984)). EBI-2
(95%) pure was eluted from the column in 6 molar guanidine HCl pH
5.0 and for the purpose of renaturation adjusted to 3 molar
guanidine HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced)
and 2 mM glutathione (oxidized). After incubation in this solution
for 12 hours the protein was dialyzed to 10 mM sodium
phosphate.
EXAMPLE 2
Cloning and Expression of EBI-2 Using the Baculovirus Expression
System
[0147] The DNA sequence encoding the full length EBI-2 protein,
ATCC #209003, was amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0148] The 5' primer has the sequence 5' CCGAGGATCCGCC
ATCATGCAAGCCGTCGACAAT 3' (SEQ ID NO:7) and contains a BamHI
restriction enzyme site (in bold) followed by 6 nucleotides
resembling an efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987))
which is just behind the first 18 nucleotides of the EBI-2 gene
(the initiation codon for translation "ATG" is underlined).
[0149] The 3' primer has the sequence 5'
CCGAGGATCCTTACATTGGAGTCTCTTC 3' (SEQ ID NO: 8) and contains the
cleavage site for the restriction endonuclease BamHI and 18
nucleotides complementary to the 3' translated sequence of the
extracellular part of EBI-2. The amplified sequences were isolated
from a 1% agarose gel using a commercially available kit
("Geneclean," BIO 101 Inc., La Jolla, Calif.). The fragment was
then digested with the endonucleases BamHI, and purified again on a
1% agarose gel. This fragment is designated F2.
[0150] The vector pA2 (modification of pVL941 vector, discussed
below) is used for the expression of the EBI-2 protein using the
baculovirus expression system (for review see: Summers, M. D. and
Smith, G. E., A manual of methods for baculovirus vectors and
insect cell culture procedures, Texas Agricultural Experimental
Station Bulletin No. 1555 (1987)). This expression vector contains
the strong polyhedrin promoter of the Autographa californica
nuclear polyhedrosis virus (AcMNPV) followed by the recognition
sites for the restriction endonucleases BamHI. The polyadenylation
site of the simian virus SV40 is used for efficient
polyadenylation. For an easy selection of recombinant virus the
beta-galactosidase gene from E. coli is inserted in the same
orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pA2 such as pRG1 and pA2-GP in which case the 5' primer are changed
accordingly, and pAc373, pVL941 and pAcIM1 (Luckow, V. A. and
Summers, M. D., Virology 170:31-39).
[0151] The plasmid was digested with the restriction enzyme BamHI
and then dephosphorylated using calf intestinal phosphatase by
procedures known in the art. The DNA was then isolated from a 1%
agarose gel using the commercially available kit ("Geneclean" BIO
101 Inc., La Jolla, Calif.). This vector DNA is designated V2.
[0152] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBacEBI-2) with the
EBI-2 gene using the enzyme BamHI. The sequence of the cloned
fragment was confirmed by DNA sequencing.
[0153] 5 .mu.g of the plasmid pBacEBI-2 was co-transfected with 1.0
.mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al., Proc. Natl. Acad.
Sci. USA, 84:7413-7417 (1987)).
[0154] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBacEBI-2 were mixed in a sterile well of a microtiter
plate containing 50 .mu.l of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.L
Lipofectin plus 90 .mu.l Grace's medium were added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture was added drop-wise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate was rocked back and forth to mix the newly
added solution. The plate was then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution was removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum (FBS) was added. The plate was put back into
an incubator and cultivation continued at 27.degree. C. for four
days.
[0155] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Bluo-gal" (Life Technologies
Inc., Gaithersburg) was used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0156] Four days after the serial dilution, the virus was added to
the cells and blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus was used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0157] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-EBI-2 at a multiplicity of infection (MOI) of 2. Six
hours later the medium was removed and replaced with SF900 II
medium minus methionine and cysteine (Life Technologies Inc.
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) were added. The cells were
further incubated for 16 hours before they were harvested by
centrifugation and the labeled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
Expression of Recombinant EBI-2 in COS Cells
[0158] The expression of plasmid, EBI-2 HA is derived from a vector
pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication,
2) ampicillin resistance gene, 3) E. coli replication origin, 4)
CMV promoter followed by a polylinker region, an SV40 intron, and
polyadenylation site. A DNA fragment encoding the entire EBI-2
precursor and a HA tag fused in frame to its 3' end was cloned into
the polylinker region of the vector, therefore, the recombinant
protein expression is directed under the CMV promoter. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein as previously described (Wilson, I., et al., Cell 37:767
(1984)). The fusion of HA tag to the target protein allows easy
detection of the recombinant protein with an antibody that
recognizes the HA epitope.
[0159] The plasmid construction strategy is described as
follows:
[0160] The DNA sequence encoding EBI-2, ATCC #209003, was
constructed by PCR using two primers: the 5' primer 5'
CCGAGGATCCGCCATCATGCAAGCCGTCGACAAT 3' (SEQ ID NO:9) contains a
BamHI site followed by EBI-2 coding sequence starting from the
initiation codon; the 3' sequence 5'
CCGATCTAGATTAATCCCATACGACGTCCCAGACTACGCTCATTGGAGTCTCTTC 3' (SEQ ID
NO:10) contains complementary sequences to XbaI site, translation
stop codon, HA tag and EBI-2 coding sequence (not including the
stop codon). Therefore, the PCR product contains a BamHI site,
EBI-2 coding sequence followed by HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an XbaI
site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
were digested with BamHI and XbaI restriction enzyme and ligated.
The ligation mixture was transformed into E. coli strain SURE
(available from Stratagene Cloning Systems, 11099 North Torrey
Pines Road, La Jolla, Calif. 92037) the transformed culture was
plated on ampicillin media plates and resistant colonies were
selected. Plasmid DNA was isolated from transformants and examined
by restriction analysis for the presence of the correct fragment.
For expression of the recombinant EBI-2, COS cells were transfected
with the expression vector by DEAE-DEXTRAN method (Sambrook, J., et
al., ibid.). The expression of the EBI-2 HA protein was detected by
radiolabelling and immunoprecipitation method (Harlow, E., and
Lane, D., Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, (1988)). Cells were labelled for 8 hours with
.sup.35S-cysteine two days post transfection. Culture media was
then collected and cells were lysed with detergent (RIPA buffer
(150 mM NaCl, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5)
(Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and
culture media were precipitated with an HA specific monoclonal
antibody. Proteins precipitated were analyzed on 15% SDS-PAGE
gels.
EXAMPLE 4
Expression Via Gene Therapy
[0161] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added). This
is then incubated at 37.degree. C. for approximately one week. At
this time, fresh media is added and subsequently changed every
several days. After an additional two weeks in culture, a monolayer
of fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0162] pMV-7 (Kirschmeier, P. T., et al., DNA 7:219-225 (1988))
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0163] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0164] The amphotropic pA317 or GP+aml2 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0165] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0166] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
EXAMPLE 5
Bacterial Expression and Purification of EDG-1-Like Polypeptide
[0167] The DNA sequence encoding EDG-1-like polypeptide, ATCC
#209004, is initially amplified using PCR oligonucleotide primers
corresponding to the 5' sequences of the processed EDG-1-like
polypeptide protein (minus the signal peptide sequence) and the
vector sequences 3' to the EDG-1-like polypeptide gene. Additional
nucleotides corresponding to EDG-1-like sequence were added to the
5' and 3' sequences respectively. The 5' oligonucleotide primer has
the sequence 5' CCGAGGATCCATGAACGCCACGGGGACC 3' (SEQ ID NO:11)
contains a BamHI restriction enzyme site followed by 18 nucleotides
of the EDG-1-like polypeptide coding sequence starting from the
presumed terminal amino acid of the processed protein codon. The 3'
sequence 5' CCGAGGATCCTCAGATGCTCCGCACGCT 3' (SEQ ID NO:12) contains
complementary sequences to BamHI site and is followed by 18
nucleotides of EDG-1-like polypeptide. The restriction enzyme sites
correspond to the restriction enzyme sites on the bacterial
expression vector pQE-60 (Qiagen, Inc., Chatsworth, Calif., 91311).
pQE-60 encodes antibiotic resistance (Amp.sup.r), a bacterial
origin of replication (ori), an IPTG-regulatable promoter operator
(P/O), a ribosome binding site (RBS), a 6-His tag and restriction
enzyme sites. pQE-60 was then digested with BamHI. The amplified
sequences were ligated into pQE-60 and were inserted in frame with
the sequence encoding for the histidine tag and the RBS. The
ligation mixture was then used to transform E. coli strain M15/rep
4 (Qiagen, Inc.) by the procedure described in Sambrook, J., et
al., ibid. M15/rep4 contains multiple copies of the plasmid pREP4,
which expresses the lacI repressor and also confers kanamycin
resistance (Kan.sup.r). Transformants are identified by their
ability to grow on LB plates and ampicillin/kanamycin resistant
colonies were selected. Plasmid DNA was isolated and confirmed by
restriction analysis. Clones containing the desired constructs were
grown overnight (O/N) in liquid culture in LB media supplemented
with both Amp (100 .mu.g/ml) and Kan (25 .mu.g/ml). The O/N culture
is used to inoculate a large culture at a ratio of 1:100 to 1:250.
The cells were grown to an optical density 600 (O.D..sub.600) of
between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalactopyranoside")
was then added to a final concentration of 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/O leading to
increased gene expression. Cells were grown an extra 3 to 4 hours.
Cells were then harvested by centrifugation. The cell pellet was
solubilized in the chaotropic agent 6 Molar Guanidine HCl. After
clarification, solubilized EDG-1-like protein was purified from
this solution by chromatography on a Nickel-Chelate column under
conditions that allow for tight binding by proteins containing the
6-His tag (Hochuli, E., et al., J. Chromatography 411:177-184
(1984)). EDG-1-like protein (95% pure) was eluted from the column
in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation
adjusted- to 3 molar guanidine HCl, 100 mM sodium phosphate, 10 mM
glutathione (reduced) and 2 mM glutathione (oxidized). After
incubation in this solution for 12 hours the protein was dialyzed
to 10 mM sodium phosphate.
EXAMPLE 6
Cloning and Expression of EDG-1-like Poly-Peptide Using the
Baculovirus Expression System
[0168] The DNA sequence encoding the full length EDG-1-like
polypeptide protein, ATCC #209004, was amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene:
[0169] The 5' primer has the sequence 5'
GCGAGGATCCGCCATCATGAACGCCACGGGGACC 3' (SEQ ID NO:13) and contains a
BamHI restriction enzyme site (in bold) followed by 6 nucleotides
resembling an efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., J. Mol. Biol. 196:947-950 (1987))
which is just behind the first 18 nucleotides of the EDG-1-like
polypeptide gene (the initiation codon for translation "ATG" is
underlined).
[0170] The 3' primer has the sequence 5'
CCGAGGATCCTCAGATGCTCCGCACGCT 3' (SEQ ID NO:14) and contains the
cleavage site for the restriction endonuclease BamHI and 18
nucleotides complementary to the 3' translated sequence of the
extracellular part of EDG-1-like polypeptide. The amplified
sequences were isolated from a 1% agarose gel using a commercially
available kit ("Geneclean," BIO 101 Inc., La Jolla, Calif.). The
fragment was then digested with the endonucleases BamHI, and
purified again on a 1% agarose gel. This fragment is designated
F2.
[0171] The vector pA2 (modification of pVL941 vector, discussed
below) is used for the expression of the EDG-1-like polypeptide
protein using the baculovirus expression system (for review see:
Summers, M. D. and Smith, G. E., A manual of methods for
baculovirus vectors and insect cell culture procedures, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987)). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by the recognition sites for the restriction endonucleases BamHI.
The polyadenylation site of the simian virus SV40 is used for
efficient polyadenylation. For an easy selection of recombinant
virus the beta-galactosidase gene from E. coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pA2 such as pRG1 and pA2-GP in which case the 5' primer are changed
accordingly, and pAc373, pVL941 and pAcIM1 (Luckow, V. A. and
Summers, M. D., Virology 170:31-39).
[0172] The plasmid was digested with the restriction enzyme BamHI
and then dephosphorylated using calf intestinal phosphatase by
procedures known in the art. The DNA was then isolated from a 1%
agarose gel using the commercially available kit ("Geneclean" BIO
101 Inc., La Jolla, Calif.) This vector DNA is designated V2.
[0173] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBacEDG-1-like
polypeptide) with the EDG-1-like polypeptide gene using the enzyme
BamHI. The sequence of the cloned fragment was confirmed by DNA
sequencing.
[0174] 5 .mu.g of the plasmid pBacEDG-1-like polypeptide was
co-transfected with 1.0 .mu.g of a commercially available linearize
baculovirus ("BaculoGold.TM. baculovirus DNA", Pharmingen, San
Diego, Calif.) using the lipofection method (Felgner et al., Proc.
Natl. Acad. Sci. USA 84:7413-7417 (1987)).
[0175] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBacEDG-1-like polypeptide were mixed in a sterile well of
a microtiter plate containing 50 .mu.l of serum free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium were added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture was added drop-wise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate was rocked back and forth to mix the newly
added solution. The plate was then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution was removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum was added. The plate was put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
[0176] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Bluo-gal" (Life Technologies
Inc., Gaithersburg) was used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0177] Four days after the serial dilution, the virus was added to
the cells and blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus was used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0178] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-EDG-1-like polypeptide at a multiplicity of infection
(MOI) of 2. Six hours later the medium was removed and replaced
with SF900 II medium minus methionine and cysteine (Life
Technologies Inc., Gaithersburg). 42 hours later 5 .mu.Ci of
.sup.35S-methionine and 5 .mu.Ci .sup.35S cysteine (Amersham) were
added. The cells were further incubated for 16 hours before they
were harvested by centrifugation and the labelled proteins
visualized by SDS-PAGE and autoradiography.
EXAMPLE 7
Expression of Recombinant EDG-1-Like Polypeptide in COS Cells
[0179] The expression of plasmid, EDG-1-like polypeptide HA is
derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40
origin of replication, 2) ampicillin resistance gene, 3) E. coli
replication origin, 4) CMV promoter followed by a polylinker
region, an SV40 intron and polyadenylation site. A DNA fragment
encoding the entire EDG-1-like polypeptide precursor and a HA tag
fused in frame to its 3' end was cloned into the polylinker region
of the vector, therefore, the recombinant protein expression is
directed under the CMV promoter. The HA tag corresponds to an
epitope derived from the influenza hemagglutinin protein as
previously described. The fusion of HA tag to the target protein
allows easy detection of the recombinant protein with an antibody
that recognizes the HA epitope.
[0180] The plasmid construction strategy is described as
follows:
[0181] The DNA sequence encoding EDG-1-like polypeptide, ATCC
#209004, was constructed by PCR using two primers: the 5' primer 5'
CCGAGGATCCGCCATCATGAACGCCACGGGGACC 3' (SEQ ID NO: 15) contains a
BamHI site followed by EDG-1-like polypeptide coding sequence
starting from the initiation codon; the 3' sequence 5'
CCGATCTAGATCAATCCCATACGACGTCCCAGACTACGCTGATGCTCCGCACGCT 3' (SEQ ID
NO:16) contains complementary sequences to XbaI site, translation
stop codon, HA tag and EDG-1-like polypeptide coding sequence (not
including the stop codon). Therefore, the PCR product contains a
BamHI site, EDG-1-like polypeptide coding sequence followed by HA
tag fused in frame, a translation termination stop codon next to
the HA tag, and an XbaI site. The PCR amplified DNA fragment and
the vector, pcDNAI/Amp, were digested with BamHI and XbaI
restriction enzyme and ligated. The ligation mixture was
transformed into E. coli strain SURE (available from Stratagene
Cloning Systems, 11099 North Torrey Pines Road, La Jolla, Calif.
92037) the transformed culture was plated on ampicillin media
plates and resistant colonies were selected. Plasmid DNA was
isolated from transformants and examined by restriction analysis
for the presence of the correct fragment. For expression of the
recombinant EDG-1-like polypeptide COS cells were transfected with
the expression vector by DEAE-DEXTRAN method. The expression of the
EDG-1-like polypeptide HA protein was detected by radiolabelling
and immunoprecipitation method. Cells were labelled for 8 hours
with .sup.35S-cysteine two days post transfection. Culture media
was then collected and cells were lysed with detergent (RIPA
buffer). Both cell lysate and culture media were precipitated with
an HA specific monoclonal antibody. Proteins precipitated were
analyzed on 15% SDS-PAGE gels.
EXAMPLE 8
Expression Via Gene Therapy
[0182] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger-flasks.
[0183] pMV-7 flanked by the long terminal repeats of the Moloney
murine sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with calf intestinal phosphatase. The linear
vector is fractionated on agarose gel and purified, using glass
beads.
[0184] The cDNA encoding a polypeptide of the present invention is
amplified Using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0185] The amphotropic pA317 or GP+aml2 packaging cells are grown
in tissue culture to confluent density in DMEM with 10% calf serum
(CS), penicillin and streptomycin. The MSV vector containing the
gene is then added to the media and the packaging cells are
transduced with the vector. The packaging cells now produce
infectious viral particles containing the gene (the packaging cells
are now referred to as producer cells).
[0186] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0187] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0188] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
1812247DNAHomo sapiensCDS(226)..(1251) 1gcacgaggaa cagaacactt
tctcatgtcc agggtcagat tacaagagca ctcaagactt 60tactgacgaa aactcaggaa
atcctctatc acaaagaggt ttggcaacta aactaagaca 120ttaaaaggaa
aataccagat gccactctgc aggctgcaat aactactact tactggatac
180attcaaaccc tccagaatca acagttatca ggtaaccaac aagaa atg caa gcc
gtc 237 Met Gln Ala Valgac aat ctc acc tct gcg cct ggg aac acc agt
ctg tgc acc aga gac 285Asp Asn Leu Thr Ser Ala Pro Gly Asn Thr Ser
Leu Cys Thr Arg Asp 5 10 15 20tac aaa atc acc cag gtc ctc ttc cca
ctg ctc tac act gtc ctg ttt 333Tyr Lys Ile Thr Gln Val Leu Phe Pro
Leu Leu Tyr Thr Val Leu Phe 25 30 35ttt gtt gga ctt atc aca aat ggc
ctg gcg atg agg att ttc ttt caa 381Phe Val Gly Leu Ile Thr Asn Gly
Leu Ala Met Arg Ile Phe Phe Gln 40 45 50atc cgg agt aaa tca aac ttt
att att ttt ctt aag aac aca gtc att 429Ile Arg Ser Lys Ser Asn Phe
Ile Ile Phe Leu Lys Asn Thr Val Ile 55 60 65tct gat ctt ctc atg att
ctg act ttt cca ttc aaa att ctt agt gat 477Ser Asp Leu Leu Met Ile
Leu Thr Phe Pro Phe Lys Ile Leu Ser Asp 70 75 80gcc aaa ctg gga aca
gga cca ctg aga act ttt gtg tgt caa gtt acc 525Ala Lys Leu Gly Thr
Gly Pro Leu Arg Thr Phe Val Cys Gln Val Thr 85 90 95 100tcc gtc ata
ttt tat ttc aca atg tat atc agt att tca ttc ctg gga 573Ser Val Ile
Phe Tyr Phe Thr Met Tyr Ile Ser Ile Ser Phe Leu Gly 105 110 115ctg
ata act atc gat cgc tac cag aag acc acc agg cca ttt aaa aca 621Leu
Ile Thr Ile Asp Arg Tyr Gln Lys Thr Thr Arg Pro Phe Lys Thr 120 125
130tcc aac ccc aaa aat ctc ttg ggg gct aag att ctc tct gtt gtc atc
669Ser Asn Pro Lys Asn Leu Leu Gly Ala Lys Ile Leu Ser Val Val Ile
135 140 145tgg gca ttc atg ttc tta ctc tct ttg cct aac atg att ctg
acc aac 717Trp Ala Phe Met Phe Leu Leu Ser Leu Pro Asn Met Ile Leu
Thr Asn 150 155 160agg cag ccg aga gac aag aat gtg aag aaa tgc tct
ttc ctt aaa tca 765Arg Gln Pro Arg Asp Lys Asn Val Lys Lys Cys Ser
Phe Leu Lys Ser165 170 175 180gag ttc ggt cta gtc tgg cat gaa ata
gta aat tac atc tgt caa gtc 813Glu Phe Gly Leu Val Trp His Glu Ile
Val Asn Tyr Ile Cys Gln Val 185 190 195att ttc tgg att aat ttc tta
att gtt att gta tgt tat aca ctc att 861Ile Phe Trp Ile Asn Phe Leu
Ile Val Ile Val Cys Tyr Thr Leu Ile 200 205 210aca aaa gaa ctg tac
cgg tca tac gta aga acg agg ggt gta ggt aaa 909Thr Lys Glu Leu Tyr
Arg Ser Tyr Val Arg Thr Arg Gly Val Gly Lys 215 220 225gtc ccc agg
aaa aag gtg aac gtc aaa gtt ttc att atc att gct gta 957Val Pro Arg
Lys Lys Val Asn Val Lys Val Phe Ile Ile Ile Ala Val 230 235 240ttc
ttt att tgt ttt gtt cct ttc cat ttt gcc cga att cct tac acc 1005Phe
Phe Ile Cys Phe Val Pro Phe His Phe Ala Arg Ile Pro Tyr Thr245 250
255 260ctg agc caa acc cgg gat gtc ttt gac tgc act gct gaa aat act
ctg 1053Leu Ser Gln Thr Arg Asp Val Phe Asp Cys Thr Ala Glu Asn Thr
Leu 265 270 275ttc tat gtg aaa gag agc act ctg tgg tta act tcc tta
aat gca tgc 1101Phe Tyr Val Lys Glu Ser Thr Leu Trp Leu Thr Ser Leu
Asn Ala Cys 280 285 290ctg gat ccg ttc atc tat ttt ttc ctt tgc aag
tcc ttc aga aat tcc 1149Leu Asp Pro Phe Ile Tyr Phe Phe Leu Cys Lys
Ser Phe Arg Asn Ser 295 300 305ttg ata agt atg ctg aag tgc ccc aat
tct gca aca tct ctg tcc cag 1197Leu Ile Ser Met Leu Lys Cys Pro Asn
Ser Ala Thr Ser Leu Ser Gln 310 315 320gac aat agg aaa aaa gaa cag
gat ggt ggt gac cca aat gaa gag act 1245Asp Asn Arg Lys Lys Glu Gln
Asp Gly Gly Asp Pro Asn Glu Glu Thr325 330 335 340cca atg
taaacaaatt aactaaggaa atatttcaat ctctttgtgt tcagaactcg 1301Pro
Metttaaagcaaa gcgctaagta aaaatattaa ctgacgaaga agcaactaag
ttaataataa 1361tgactctaaa gaaacagaag attacaaaag caattttcat
ttacctttcc agtatgaaaa 1421gctatcttaa aatatagaaa actaatctaa
actgtagctg tattagcagc aaaacaaacg 1481acatccaatt gtcatgctgc
atgcaaaact acacagaatt catgttttgg cagagttttg 1541gcaaaatgag
taatcatata atatttactg taatttttaa aatacattat cgttcacaat
1601tttatttttt cataatcaac taaggaagaa cgatcaattg gatataatct
tcttaccaaa 1661aatgatagtt aaaatgtata tatatcctag tcccctaacc
aaatcctgac ctattgggat 1721acttataaaa atttaagtaa gtgggataca
caaagaataa taactattaa cttttcatta 1781ttagccaaaa acctaaggga
tttaaactaa ttgaaactgt atttgattgg acttaatttt 1841ttatgtttat
ttagaagata aagatttaag aagaccttta caataaagag aagaaatatc
1901gaagtcatta aaataaggag acttactttt atgacattct aatactaaaa
aatatagaaa 1961tatttcctta attctagaga aactagtttt actaattttt
tacaacttca ataataccat 2021cactgacact tacctttatt aattagcttc
tagaaaatag ctgctaatta ggttaatgaa 2081cattttacct tagtgaaaaa
aaattaatta aatatgatta caaagttgca cagcataact 2141actgagagga
aagtgattga tctgtttgta attacttgtt tgtattggtg tgtataaaat
2201acaaatttac attaaactct aaatcattaa aaaaaaaaaa aaaaaa
22472342PRTHomo sapiens 2Met Gln Ala Val Asp Asn Leu Thr Ser Ala
Pro Gly Asn Thr Ser Leu 1 5 10 15Cys Thr Arg Asp Tyr Lys Ile Thr
Gln Val Leu Phe Pro Leu Leu Tyr 20 25 30Thr Val Leu Phe Phe Val Gly
Leu Ile Thr Asn Gly Leu Ala Met Arg 35 40 45Ile Phe Phe Gln Ile Arg
Ser Lys Ser Asn Phe Ile Ile Phe Leu Lys 50 55 60Asn Thr Val Ile Ser
Asp Leu Leu Met Ile Leu Thr Phe Pro Phe Lys 65 70 75 80Ile Leu Ser
Asp Ala Lys Leu Gly Thr Gly Pro Leu Arg Thr Phe Val 85 90 95Cys Gln
Val Thr Ser Val Ile Phe Tyr Phe Thr Met Tyr Ile Ser Ile 100 105
110Ser Phe Leu Gly Leu Ile Thr Ile Asp Arg Tyr Gln Lys Thr Thr Arg
115 120 125Pro Phe Lys Thr Ser Asn Pro Lys Asn Leu Leu Gly Ala Lys
Ile Leu 130 135 140Ser Val Val Ile Trp Ala Phe Met Phe Leu Leu Ser
Leu Pro Asn Met145 150 155 160Ile Leu Thr Asn Arg Gln Pro Arg Asp
Lys Asn Val Lys Lys Cys Ser 165 170 175Phe Leu Lys Ser Glu Phe Gly
Leu Val Trp His Glu Ile Val Asn Tyr 180 185 190Ile Cys Gln Val Ile
Phe Trp Ile Asn Phe Leu Ile Val Ile Val Cys 195 200 205Tyr Thr Leu
Ile Thr Lys Glu Leu Tyr Arg Ser Tyr Val Arg Thr Arg 210 215 220Gly
Val Gly Lys Val Pro Arg Lys Lys Val Asn Val Lys Val Phe Ile225 230
235 240Ile Ile Ala Val Phe Phe Ile Cys Phe Val Pro Phe His Phe Ala
Arg 245 250 255Ile Pro Tyr Thr Leu Ser Gln Thr Arg Asp Val Phe Asp
Cys Thr Ala 260 265 270Glu Asn Thr Leu Phe Tyr Val Lys Glu Ser Thr
Leu Trp Leu Thr Ser 275 280 285Leu Asn Ala Cys Leu Asp Pro Phe Ile
Tyr Phe Phe Leu Cys Lys Ser 290 295 300Phe Arg Asn Ser Leu Ile Ser
Met Leu Lys Cys Pro Asn Ser Ala Thr305 310 315 320Ser Leu Ser Gln
Asp Asn Arg Lys Lys Glu Gln Asp Gly Gly Asp Pro 325 330 335Asn Glu
Glu Thr Pro Met 34031637DNAHomo sapiensCDS(50)..(1201) 3ggcacgagcc
caccctgcgt cgggcctcag tcagcccccg ggggaggcc atg aac gcc 58 Met Asn
Alaacg ggg acc ccg gtg gcc ccc gag tcc tgc caa cag ctg gcg gcc ggc
106Thr Gly Thr Pro Val Ala Pro Glu Ser Cys Gln Gln Leu Ala Ala Gly
5 10 15ggg cac agc cgg ctc att gtt ctg cac tac aac cac tcg ggc cgg
ctg 154Gly His Ser Arg Leu Ile Val Leu His Tyr Asn His Ser Gly Arg
Leu 20 25 30 35gcc ggg cgc ggg ggg ccg gag gat ggc ggc ctg ggg gcc
ctg cgg ggg 202Ala Gly Arg Gly Gly Pro Glu Asp Gly Gly Leu Gly Ala
Leu Arg Gly 40 45 50ctg tcg gtg gcc gcc agc tgc ctg gtg gtg ctg gag
aac ttg ctg gtg 250Leu Ser Val Ala Ala Ser Cys Leu Val Val Leu Glu
Asn Leu Leu Val 55 60 65ctg gcg gcc atc acc agc cac atg cgg tcg caa
cgc tgg gtc tac tat 298Leu Ala Ala Ile Thr Ser His Met Arg Ser Gln
Arg Trp Val Tyr Tyr 70 75 80tgc ctg gtg aac att acg atg agt gac ctg
ctc acg ggc gcg gcc tac 346Cys Leu Val Asn Ile Thr Met Ser Asp Leu
Leu Thr Gly Ala Ala Tyr 85 90 95ctg gcc aac gtg ctg ctg tcg ggg gcc
cgc acc ttc cgt ctg gcg ccc 394Leu Ala Asn Val Leu Leu Ser Gly Ala
Arg Thr Phe Arg Leu Ala Pro100 105 110 115gcc cag tgg ttc cta cgg
aag ggc ctg ctc ttc acc gcc ctg gcc gcc 442Ala Gln Trp Phe Leu Arg
Lys Gly Leu Leu Phe Thr Ala Leu Ala Ala 120 125 130tcc acc ttc agc
ctg ctc ttc act gca ggg ttg cgc ttt gcc acc atg 490Ser Thr Phe Ser
Leu Leu Phe Thr Ala Gly Leu Arg Phe Ala Thr Met 135 140 145gtg cgg
ccg gtg gcc gag agc ggg gcc acc aag acc agc cgc gtc tac 538Val Arg
Pro Val Ala Glu Ser Gly Ala Thr Lys Thr Ser Arg Val Tyr 150 155
160ggc ttc atc ggc ctc tgc tgg ctg ctg gcc gcg ctg ctg ggg atg ctg
586Gly Phe Ile Gly Leu Cys Trp Leu Leu Ala Ala Leu Leu Gly Met Leu
165 170 175cct ttg ctg ggc tgg aac tgc ctg tgc gcc ttt gac cgc tgc
tcc agc 634Pro Leu Leu Gly Trp Asn Cys Leu Cys Ala Phe Asp Arg Cys
Ser Ser180 185 190 195ctt ctg ccc ctc tac tcc aag cgc tac atc ctc
ttc tgc ctg gtg atc 682Leu Leu Pro Leu Tyr Ser Lys Arg Tyr Ile Leu
Phe Cys Leu Val Ile 200 205 210ttc gcc ggc gtc ctg gcc acc atc atg
ggc ctc tat ggg gcc atc ttc 730Phe Ala Gly Val Leu Ala Thr Ile Met
Gly Leu Tyr Gly Ala Ile Phe 215 220 225cgc ctg gtg cag gcc agc ggg
cag aag gcc cca cgc cca gcg gcc cgc 778Arg Leu Val Gln Ala Ser Gly
Gln Lys Ala Pro Arg Pro Ala Ala Arg 230 235 240cgc aag gcc cgc cgc
ctg ctg aag acg gtg ctg atg atc ctg ctg gcc 826Arg Lys Ala Arg Arg
Leu Leu Lys Thr Val Leu Met Ile Leu Leu Ala 245 250 255ttc ttg gtg
tgc tgg gga cca ctc ttc ggg ctg ctg ctg gcc gac gtc 874Phe Leu Val
Cys Trp Gly Pro Leu Phe Gly Leu Leu Leu Ala Asp Val260 265 270
275ttt ggc tcc aac ctc tgg gcc cag gag tac ctg cgg ggc atg gac tgg
922Phe Gly Ser Asn Leu Trp Ala Gln Glu Tyr Leu Arg Gly Met Asp Trp
280 285 290atc ctg gcc ctg gcc gtc ctc aac tcg gcg gtc aac ccc atc
atc tac 970Ile Leu Ala Leu Ala Val Leu Asn Ser Ala Val Asn Pro Ile
Ile Tyr 295 300 305tcc ttc cgc agc agg gag gtg tgc aga gcc gtg ctc
agc ttc ctc tgc 1018Ser Phe Arg Ser Arg Glu Val Cys Arg Ala Val Leu
Ser Phe Leu Cys 310 315 320tgc ggg tgt ctc cgg ctg ggc atg cga ggg
ccc ggg gac tgc ctg gcc 1066Cys Gly Cys Leu Arg Leu Gly Met Arg Gly
Pro Gly Asp Cys Leu Ala 325 330 335cgg gcc gtc gag gct cac tcc gga
gct tcc acc acc gac agc tct ctg 1114Arg Ala Val Glu Ala His Ser Gly
Ala Ser Thr Thr Asp Ser Ser Leu340 345 350 355agg cca agg gac agc
ttt cgc ggc tcc cgc tcg ctc agc ttt cgg atg 1162Arg Pro Arg Asp Ser
Phe Arg Gly Ser Arg Ser Leu Ser Phe Arg Met 360 365 370cgg gag ccc
ctg tcc agc atc tcc agc gtg cgg agc atc tgaagttgca 1211Arg Glu Pro
Leu Ser Ser Ile Ser Ser Val Arg Ser Ile 375 380gtcttgcgtg
tggatggtgc aaccaccggg tgcgtgccag gcaggccctc ctggggtaca
1271ggaagctgtg tgcacgcaac ctcgccctgt atggggagca gggaacggga
caggccccca 1331tggacttgcc cggtggcctc tcggggcttc tgacgccata
tggacttgcc cattgcctat 1391ggctcaccct ggacaaggag gcaaccaccc
cacctccccg taggagcaga gagcaccctg 1451gtgtgggggc gagtgggttc
cccacaaccc cgcttctgtg tgattctggg gaagtcccgg 1511cccctctctg
ggcctcagta gggctcccag gctgcaaggg gtggactgtg ggatgcatgc
1571cctggcaaca ttgaagttcg atcatggtaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 1631aaaaaa 16374384PRTHomo sapiens 4Met Asn Ala Thr Gly
Thr Pro Val Ala Pro Glu Ser Cys Gln Gln Leu 1 5 10 15Ala Ala Gly
Gly His Ser Arg Leu Ile Val Leu His Tyr Asn His Ser 20 25 30Gly Arg
Leu Ala Gly Arg Gly Gly Pro Glu Asp Gly Gly Leu Gly Ala 35 40 45Leu
Arg Gly Leu Ser Val Ala Ala Ser Cys Leu Val Val Leu Glu Asn 50 55
60Leu Leu Val Leu Ala Ala Ile Thr Ser His Met Arg Ser Gln Arg Trp
65 70 75 80Val Tyr Tyr Cys Leu Val Asn Ile Thr Met Ser Asp Leu Leu
Thr Gly 85 90 95Ala Ala Tyr Leu Ala Asn Val Leu Leu Ser Gly Ala Arg
Thr Phe Arg 100 105 110Leu Ala Pro Ala Gln Trp Phe Leu Arg Lys Gly
Leu Leu Phe Thr Ala 115 120 125Leu Ala Ala Ser Thr Phe Ser Leu Leu
Phe Thr Ala Gly Leu Arg Phe 130 135 140Ala Thr Met Val Arg Pro Val
Ala Glu Ser Gly Ala Thr Lys Thr Ser145 150 155 160Arg Val Tyr Gly
Phe Ile Gly Leu Cys Trp Leu Leu Ala Ala Leu Leu 165 170 175Gly Met
Leu Pro Leu Leu Gly Trp Asn Cys Leu Cys Ala Phe Asp Arg 180 185
190Cys Ser Ser Leu Leu Pro Leu Tyr Ser Lys Arg Tyr Ile Leu Phe Cys
195 200 205Leu Val Ile Phe Ala Gly Val Leu Ala Thr Ile Met Gly Leu
Tyr Gly 210 215 220Ala Ile Phe Arg Leu Val Gln Ala Ser Gly Gln Lys
Ala Pro Arg Pro225 230 235 240Ala Ala Arg Arg Lys Ala Arg Arg Leu
Leu Lys Thr Val Leu Met Ile 245 250 255Leu Leu Ala Phe Leu Val Cys
Trp Gly Pro Leu Phe Gly Leu Leu Leu 260 265 270Ala Asp Val Phe Gly
Ser Asn Leu Trp Ala Gln Glu Tyr Leu Arg Gly 275 280 285Met Asp Trp
Ile Leu Ala Leu Ala Val Leu Asn Ser Ala Val Asn Pro 290 295 300Ile
Ile Tyr Ser Phe Arg Ser Arg Glu Val Cys Arg Ala Val Leu Ser305 310
315 320Phe Leu Cys Cys Gly Cys Leu Arg Leu Gly Met Arg Gly Pro Gly
Asp 325 330 335Cys Leu Ala Arg Ala Val Glu Ala His Ser Gly Ala Ser
Thr Thr Asp 340 345 350Ser Ser Leu Arg Pro Arg Asp Ser Phe Arg Gly
Ser Arg Ser Leu Ser 355 360 365Phe Arg Met Arg Glu Pro Leu Ser Ser
Ile Ser Ser Val Arg Ser Ile 370 375 380528DNAHomo sapiens
5ccgaggatcc atgcaagccg tcgacaat 28628DNAHomo sapiens 6ccgaggatcc
ttacattgga gtctcttc 28734DNAHomo sapiens 7ccgaggatcc gccatcatgc
aagccgtcga caat 34828DNAHomo sapiens 8ccgaggatcc ttacattgga
gtctcttc 28934DNAHomo sapiens 9ccgaggatcc gccatcatgc aagccgtcga
caat 341055DNAHomo sapiens 10ccgatctaga ttaatcccat acgacgtccc
agactacgct cattggagtc tcttc 551128DNAHomo sapiens 11ccgaggatcc
atgaacgcca cggggacc 281228DNAHomo sapiens 12ccgaggatcc tcagatgctc
cgcacgct 281334DNAHomo sapiens 13gcgaggatcc gccatcatga acgccacggg
gacc 341428DNAHomo sapiens 14ccgaggatcc tcagatgctc cgcacgct
281534DNAHomo sapiens 15ccgaggatcc gccatcatga acgccacggg gacc
341655DNAHomo sapiens 16ccgatctaga tcaatcccat acgacgtccc agactacgct
gatgctccgc acgct 5517348PRTHomo sapiens 17Ile Gln Met Ala Asn Asn
Phe Thr Pro Pro Ser Ala Thr Pro Gln Asn 1 5 10 15Asp Cys Asp Leu
Tyr Ala His His Ser Thr Ala Arg Ile Val Met Pro 20 25 30Leu His Tyr
Ser Leu Val Phe Ile Ile Gly Leu Val Gly Asn Leu Leu 35 40 45Ala Leu
Val Val Ile Val Gln Asn Arg Lys Lys Ile Asn Ser Thr Thr 50 55 60Leu
Tyr Ser Thr Asn Leu Val Ile Ser Asp Ile Leu Phe Thr Thr Ala 65 70
75 80Leu Pro Thr Arg Ile Ala Tyr Tyr Ala Met Gly Phe Asp Trp Arg
Ile 85 90 95Gly Asp Ala Leu Cys Arg Ile Thr Ala Leu Val Phe Tyr Ile
Asn Thr 100 105
110Tyr Ala Gly Val Asn Phe Met Thr Cys Leu Ser Ile Asp Arg Phe Ile
115 120 125Ala Val Val His Pro Leu Arg Tyr Asn Lys Ile Lys Arg Ile
Glu His 130 135 140Ala Lys Gly Val Cys Ile Phe Val Trp Ile Leu Val
Phe Ala Gln Thr145 150 155 160Leu Pro Leu Leu Ile Asn Pro Met Ser
Lys Gln Glu Ala Glu Arg Ile 165 170 175Thr Cys Met Glu Tyr Pro Asn
Phe Glu Glu Thr Lys Ser Leu Pro Trp 180 185 190Ile Leu Leu Gly Ala
Cys Phe Ile Gly Tyr Val Leu Pro Leu Ile Ile 195 200 205Ile Lys Ile
Cys Tyr Ser Gln Ile Cys Cys Lys Leu Phe Arg Thr Ala 210 215 220Lys
Gln Asn Pro Leu Thr Glu Lys Ser Gly Val Asn Lys Lys Ala Leu225 230
235 240Asn Thr Ile Ile Leu Ile Ile Val Val Phe Val Leu Cys Phe Thr
Pro 245 250 255Tyr His Val Ala Ile Ile Gln His Met Ile Lys Lys Leu
Arg Phe Ser 260 265 270Asn Phe Leu Glu Cys Ser Gln Arg His Ser Phe
Gln Ile Ser Leu His 275 280 285Phe Thr Val Cys Leu Met Asn Phe Asn
Cys Cys Met Asp Pro Phe Ile 290 295 300Tyr Phe Phe Ala Cys Lys Gly
Tyr Lys Arg Lys Val Met Arg Met Leu305 310 315 320Lys Arg Gln Val
Ser Val Ser Ile Ser Ser Ala Val Lys Ser Ala Pro 325 330 335Glu Glu
Asn Ser Arg Glu Met Thr Glu Thr Gln Met 340 34518381PRTHomo sapiens
18Met Gly Pro Thr Ser Val Pro Leu Val Lys Ala His Arg Ser Ser Val 1
5 10 15Ser Asp Tyr Val Asn Tyr Asp Ile Ile Val Arg His Tyr Asn Tyr
Thr 20 25 30Gly Lys Leu Asn Ile Ser Ala Asp Lys Glu Asn Ser Ile Lys
Leu Thr 35 40 45Ser Val Val Phe Ile Leu Ile Cys Cys Phe Ile Ile Leu
Glu Asn Ile 50 55 60Phe Val Leu Leu Thr Ile Trp Lys Thr Lys Lys Phe
His Arg Pro Met 65 70 75 80Tyr Tyr Phe Ile Gly Asn Leu Ala Leu Ser
Asp Leu Leu Ala Gly Val 85 90 95Ala Tyr Thr Ala Asn Leu Leu Leu Ser
Gly Ala Thr Thr Tyr Lys Leu 100 105 110Thr Pro Ala Gln Trp Phe Leu
Arg Glu Gly Ser Met Phe Val Ala Leu 115 120 125Ser Ala Ser Val Phe
Ser Leu Leu Ala Ile Ala Ile Glu Arg Tyr Ile 130 135 140Thr Met Leu
Lys Met Lys Leu His Asn Gly Ser Asn Asn Phe Arg Leu145 150 155
160Phe Leu Leu Ile Ser Ala Cys Trp Val Ile Ser Leu Ile Leu Gly Gly
165 170 175Leu Pro Ile Met Gly Trp Asn Cys Ile Ser Ala Leu Ser Ser
Cys Ser 180 185 190Thr Val Leu Pro Leu Tyr His Lys His Tyr Ile Leu
Phe Cys Thr Thr 195 200 205Val Phe Thr Leu Leu Leu Leu Ser Ile Val
Ile Leu Tyr Cys Arg Ile 210 215 220Tyr Ser Leu Val Arg Thr Arg Ser
Arg Arg Leu Thr Phe Arg Lys Asn225 230 235 240Ile Ser Lys Ala Ser
Arg Ser Ser Glu Asn Val Ala Leu Leu Lys Thr 245 250 255Val Ile Ile
Val Leu Ser Val Phe Ile Ala Cys Trp Ala Pro Leu Phe 260 265 270Ile
Leu Leu Leu Leu Asp Val Gly Cys Lys Val Lys Thr Cys Asp Ile 275 280
285Leu Phe Arg Ala Glu Tyr Phe Leu Val Leu Ala Val Leu Asn Ser Gly
290 295 300Thr Asn Pro Ile Ile Tyr Thr Leu Thr Asn Lys Glu Met Arg
Arg Ala305 310 315 320Phe Ile Arg Ile Met Ser Cys Cys Lys Cys Pro
Ser Gly Asp Ser Ala 325 330 335Gly Lys Phe Lys Arg Pro Ile Ile Ala
Gly Met Glu Phe Ser Arg Ser 340 345 350Lys Ser Asp Asn Ser Ser His
Pro Gln Lys Asp Glu Gly Asp Asn Pro 355 360 365Glu Thr Ile Met Ser
Ser Gly Asn Val Asn Ser Ser Ser 370 375 380
* * * * *