U.S. patent application number 12/087799 was filed with the patent office on 2009-04-16 for compositions and methods for enhancing neuronal plasticity and regeneration.
This patent application is currently assigned to President and Fellows of Harvard College. Invention is credited to Carla Shatz, Joshua Syken.
Application Number | 20090098109 12/087799 |
Document ID | / |
Family ID | 38345620 |
Filed Date | 2009-04-16 |
United States Patent
Application |
20090098109 |
Kind Code |
A1 |
Shatz; Carla ; et
al. |
April 16, 2009 |
Compositions and Methods For Enhancing Neuronal Plasticity and
Regeneration
Abstract
The present invention relates PirB expression and function in
nervous tissue. PirB expressed in neurons acts to restrict
plasticity of neural circuits, and/or, restrict competition between
circuits with different activity patterns or levels, for cortical
representation. Thus, the present invention relates to methods of
increasing nervous system plasticity and associated disorders and
diseases in a subject comprising administering to the subject an
agent which modulates the activity, signal transduction or
expression of PirB in neurons of the subject.
Inventors: |
Shatz; Carla; (Palo Alto,
CA) ; Syken; Joshua; (Jamaica Plain, MA) |
Correspondence
Address: |
EDWARDS ANGELL PALMER & DODGE LLP
P.O. BOX 55874
BOSTON
MA
02205
US
|
Assignee: |
President and Fellows of Harvard
College
Cambridge
MA
|
Family ID: |
38345620 |
Appl. No.: |
12/087799 |
Filed: |
January 23, 2007 |
PCT Filed: |
January 23, 2007 |
PCT NO: |
PCT/US2007/002009 |
371 Date: |
December 10, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60761453 |
Jan 23, 2006 |
|
|
|
60838583 |
Aug 17, 2006 |
|
|
|
60859372 |
Nov 15, 2006 |
|
|
|
Current U.S.
Class: |
424/130.1 ;
436/501; 514/44R; 530/350; 530/387.1; 536/24.5 |
Current CPC
Class: |
A61P 9/00 20180101; A61P
25/04 20180101; C07K 14/705 20130101; C07K 2319/00 20130101; A61P
25/00 20180101; A61P 25/18 20180101; A61P 25/28 20180101; A61P
25/20 20180101; A61P 25/24 20180101 |
Class at
Publication: |
424/130.1 ;
514/44; 530/350; 536/24.5; 530/387.1; 436/501 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 31/7105 20060101 A61K031/7105; C07K 2/00 20060101
C07K002/00; C07H 21/02 20060101 C07H021/02; C07K 16/00 20060101
C07K016/00; G01N 33/566 20060101 G01N033/566; A61P 25/00 20060101
A61P025/00; A61P 25/28 20060101 A61P025/28 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0001] Funding for this invention was provided in part by the
Government of the United States of America National Institutes of
Health Grant NIH NEI EY 02858. The Government has certain rights in
this invention.
Claims
1. A method of increasing nervous system plasticity in a subject
comprising administering to the subject an effective amount of an
agent which modulates the activity of PirB in neurons of the
subject; a. wherein the agent acts as an antagonist to PirB
receptor; b. wherein the antagonist is small molecule; c. wherein
the antagonist is peptide mimetic; d. wherein the agent is an
antibodyPirB.
2. A method of increasing nervous system plasticity in a subject
comprising administering to the subject an effective amount of an
agent which modulates the signal transduction of PirB in neurons of
the subject; a. wherein the agents acts as to decrease the signal
transduction of PirB in neurons; b. wherein the antagonist is small
molecule; and c. wherein the antagonist is peptide mimetic.
3. A method of increasing nervous system plasticity in a subject
comprising administering to the subject an effective amount of an
agent which decreases the expression of PirB in neurons of the
subject wherein the agent is an one or more siRNA's.
4. A method of treating a CNS disease or disorder in a subject
comprising the administration of an effective amount of an agent
which decreases the activity, signal transduction or expression of
PirB in neurons of the subject.
5. A method of claim 4 wherein the CNS disease or disorder in a
subject is autism.
6. A method of claim 4 wherein the CNS disease or disorder in a
subject is dyslexia.
7. A method of claim 4 wherein the CNS disease or disorder in a
subject is cerebral palsy.
8. A method of claim 4 wherein the CNS disease or disorder in a
subject is traumatic brain injury.
9. A method of claim 4 wherein the CNS disease or disorder in a
subject is, spinal cord injury.
10. A method of claim 4 wherein the CNS disease or disorder in a
subject is stroke.
11. A method of claim 4 wherein the CNS disease or disorder in a
subject is Alzheimer's disease.
12. A method of claim 4 wherein the CNS disease or disorder in a
subject is memory disorders.
13. A method of treating epilepsy in a subject comprising the
administration of an agent which increases the activity, signal
transduction or expression of PirB in neurons of the subject.
14. A method of treating a visual system disorder or disease in a
subject comprising the administration of an agent which decreases
the activity, signal transduction or expression of PirB in neurons
of the subject.
15. A composition which modulates the activity of PirB in neurons
comprising a fusion protein.
16. The composition of claim 15 wherein the fusion protein is PirB
fusion protein.
17. A composition which increases nervous system plasticity
comprising a fusion protein.
18. The composition of claim 17 wherein the fusion protein is PirB
fusion protein.
19. A composition which modulates the activity of PirB in neurons
selected from the group consisting of a antagonist to the PirB
receptor, a small molecule antagonist of the PirB receptor, a
peptide mimetic antagonist of PirB, an antibody directed to a PirB
receptor and an antibody directed to a PirB specific ligand and a
siRNA molecule capable of interfering with PirB expression.
20. A method of increasing levels of Pir-A in a subject comprising
administering to the subject an agent which modulates the activity
of PirB wherein the agent is selected from the group consisting of
an antagonist to the PirB receptor, a small molecule antagonist of
PirB, a peptide mimetic antagonist of PirB, an antibody directed to
a PirB receptor and an antibody directed to a PirB specific ligand
and a siRNA molecule capable of interfering with PirB
expression.
21. A method of identifying a therapeutic agent in a binding assay
utilizing the PirB receptor where one or more of theagent's
molecules may be joined to a label, and the label can directly or
indirectly provide a detectable signal.
Description
FIELD OF THE INVENTION
[0002] The field of the invention relates to the role of the Major
Histocompatability Complex Class I molecules, in particular paired
immunoglobulin-like receptor-B, in non-immune system related
diseases/disorders not mediated by classical immunity and the
development of beneficial therapeutic/diagnostic utilities.
BACKGROUND OF THE INVENTION
[0003] Several publications and patent documents are cited
throughout the specification in order to describe the state of the
art to which this invention pertains. Full citations for those
references that are numbered can be found at the end of the
specification. Each citation is incorporated herein as though set
forth in full.
[0004] The MHC family is comprised of dozens of genes, some of
which are among the most polymorphic loci in the genome. The mouse
MHC may be divided into three broad categories: class I (HLA A, B,
and C in humans); class II, (HLA DP, DQ, and DR in humans); and
class III, which includes components of the compliment system.
While MHC class I is well known for its so-called "classical" class
I products, which are crucial for the adaptive immune response
mediated by T-cells, the majority of class I genes actually encode
"nonclassical" MHC class I products, many of which have no known
function in the immune system. Some nonclassical class I proteins
associate with the MHC class I light chain, .beta.2 microglobulin
(.beta.2m), bind and certain peptides, and have high sequence and
structural homology with members of the classical MHC class I,
although unlike the latter, they display more restricted expression
patterns and little or no polymorphism. Interestingly, a recent
study located one family of these "orphan" MHC class I's--whose
sequence was known, but whose products had not yet been
located--exclusively within the vomeronasal organ (VNO), a small
pit in the anterior nasal cavity of some mammals that is
specialized to detect pheromone.
[0005] Recent results suggest that normal, uninjured neurons
express both classical and nonclassical MHC class I in vivo. MHC
class I mRNA and/or protein has been detected in diverse neuronal
populations, including motor nuclei, substantia nigra pars
compacta, dorsal root ganglia neurons, dopaminergic nigral cells,
developing and adult hippocampal pyramidal cells, sensory neurons
of the vomeronasal organ, brainstem and spinal motoneurons, and
cortical pyramidal cells. In situ hybridization with probes
specific for individual classical and nonclassical MHC class I
genes reveals a complex pattern of MHC class I mRNA expression in
the healthy adult brain. Some of these studies also confirm that
MHC class I expression in neurons can be further increased by
treatments including axotomy, exposure to cytokines, and changes in
electrical activity.
[0006] MHC class I genes display overlapping but distinct neuronal
expression patterns, and these patterns are particularly dynamic
during normal development. Along with the fact that MHC class I
expression can be regulated by naturally occurring electrical
activity, these results suggest that the precise timing and level
of MHC class I expression is critical for its function in the
brain.
[0007] Pioneering studies into MHC class I function in the brain
have been initiated based on the identification of members of the
MHC class I family in genomic screens of specific neuronal
populations. The first hint of a non-immune function for MHC class
I in neurons came when it was identified in an unbiased functional
screen for genes involved in activity-dependent plasticity in the
developing visual system. MHC class I expression was found to
decrease after activity blockade with TTX, specifically during the
period when spontaneous retinal activity is needed for synaptic
refinement of overlapping eye-specific inputs to LGN neurons to
form a mature, segregated pattern of connections. Subsequent
examination revealed that MHC class I expression closely parallels
times and places of activity-dependent plasticity in the developing
and adult mammalian brain, including the early postnatal retina and
LGN, and adult cerebellum and hippocampus. Together, these
observations suggest that MHC class I might be involved in
activity-dependent structural and functional plasticity.
[0008] Plasticity of connections in the nervous system is thought
to be driven by cellular processes that strengthen or weaken
existing synapses in response to neuronal activity, followed by
long term changes that result in structural alterations to the
circuit. The cellular and molecular machinery responsible for
synaptic plasticity are well studied. However, the mechanisms and
molecular components that couple short term synaptic changes to
long term structural remodeling are less well known.
[0009] In the immune system, MHCI proteins function through
interactions with a variety of transmembrane receptors on immune
system cells (4-8). These cell-cell interactions are the means by
which normal cells are distinguished from abnormal or foreign
cells. In the nervous system, the mechanisms by which neuronal MHCI
modulates synaptic development are not understood. One hypothesis
that draws inspiration from many examples in the immune system
suggests that neuronal MHCI regulates neuronal function by engaging
transmembrane MHCI receptors expressed on other neurons. These
interactions could generate intracellular signals that ultimately
alter synaptic strength, neuronal morphology and circuit
properties. Thus, identifying neuronal MHCI receptors may be
crucial to understanding mechanisms underlying the neuronal
activities of these proteins and the neuronal plasticity that they
regulate.
[0010] An important early step in understanding the role of MHC
class I in the brain is to determine which of the many MHC class I
proteins are expressed in neurons, and to characterize the specific
expression profile of each MHC class I product in the developing
and adult brain. Furthermore, since members of the large MHC Class
I gene family are expressed on the surface of most nucleated cells,
it would be of major benefit if MHC Class I molecules involved in
normal development, disease or response to injury of all cell types
could be identified and used as tools for developing therapeutic
agents and diagnostic methods.
SUMMARY OF THE INVENTION
[0011] The present invention relates to the expression and function
of Paired immunoglobulin-like receptor-B (PirB) in nervous tissue.
PirB expressed in neurons acts to restrict regeneration and
plasticity of neural circuits, and/or, restrict competition between
circuits with different activity patterns or levels, for cortical
representation. In the immune system, PirB functions through Shp-1
and Shp-2 phosphatases to inhibit signals that could lead to
inappropriate and dangerous activation of immune cells toward
normal, healthy cells. PirB regulates cytoskeletal dynamics, cell
motility and adhesion, acting downstream of Src family kinases to
modulate integrin activity. In neurons, PirB may have analogous
activities in restricting the response of neurons to activity, only
allowing limited plasticity. In the absence of functional PirB,
rules regarding strengthening of synapses, or the formation of new
synapses, or even outgrowth of new neuritis, may be altered to
allow for exuberant and abnormal strengthening of those circuits
with an activity-dependent advantage in competition for synaptic
territory.
[0012] A preferred embodiment of the present invention relates to
methods of increasing nervous system plasticity in a subject
comprising administering to the subject an agent which modulates
the activity of Paired Immunoglobulin-like Receptor-B (PirB) in
neurons of the subject. In more preferred embodiments, the agent
acts as a receptor antagonist to PirB, wherein it can be a small
molecule or an inhibitory peptide mimetic.
[0013] Still another embodiment of the invention includes methods
of increasing nervous system plasticity in a subject comprising
administering to the subject an agent which modulates the activity
of, or signal transduction of PirB in neurons of the subject.
Again, preferred embodiments include agents that act to decrease
the activity or signal transduction of PirB and can be small
molecules.
[0014] One other embodiment of the present invention relates to
methods of increasing nervous system plasticity in a subject
comprising administering to the subject an agent which decreases
the expression of PirB in neurons of the subject, particularly
wherein the agent consists of one or more small interfering
ribonucleic acids (siRNA).
[0015] Methods of treating various disorders and/or diseases
associated with synaptic plasticity in a subject are also
embodiments of the present invention wherein the methods comprise
the administration of an agent which decreases the activity, signal
transduction or expression of PirB in neurons of the subject. These
disorders and diseases include but are not restricted to CNS
diseases, memory loss or lack of formation, such as Alzheimer's
disease; learning disorders; developmental disabilities, such as
autism, dyslexia or cerebral palsy; spinal cord injury; traumatic
brain injury; stroke; and disorders or diseases involving the
visual system.
[0016] Preferred therapeutic methods of the invention in general
comprise administering a therapeutically effective amount of one or
more of the above described compounds (including but not limited
to; small molecule, antibody, peptide mimetic, peptide fragment,
siRNA) to a subject (e.g., a mammal, particularly human), that is
suffering from or susceptible to a CNS disease.
[0017] The invention also includes pharmaceutical compositions that
comprise one or more of the above described compounds optionally
mixed with a pharmaceutically acceptable carrier and optionally
packaged together with instructions (e.g. written) for use of the
composition for a condition as disclosed herein.
[0018] In addition, the invention provides for methods for
identifying and designing drugs which inhibit, regulate or decrease
the activity, signal transduction and/or expression of PirB. This
is useful in determining the therapeutic value of drugs and/or
identification of novel candidate drug for neuronal treatment. For
example: drugs for treating neurological diseases and disorders
such as all agonists and antagonists that are known or designed to
interact with PirB present in neurons or the downstream signaling
pathways.
[0019] Furthermore, the invention relates to a method of increasing
levels of Pir-A in a subject comprising administering to the
subject an agent which modulates the activity of PirB wherein the
agent is selected from the group consisting of an antagonist to the
PirB receptor, a small molecule antagonist of PirB, a peptide
mimetic antagonist of PirB, an antibody directed to a PirB receptor
and an antibody directed to a PirB specific ligand and a siRNA
molecule capable of interfering with PirB expression.
[0020] Other and further aspects, features and advantages of the
present teachings will be apparent from the following description
of the various embodiments of the present teachings given for the
purpose of disclosure.
BRIEF DESCRIPTION OF THE FIGURES
[0021] FIG. 1. PirB mRNA is expressed in the mouse brain.
35S-labeled PirB-specific antisense or sense control probes
representing the 3' region of PirB mRNA were used to detect PirB
mRNA in sections from mouse brains of various ages. A. PO corona)
section. B. P7 sagittal section. C. P14 sagittal section. D. P29
sagittal section. E. P25 coronal section. F. Adult sagittal
section. Scale bars=1 mm. G. Corona) section of a P9 brain
immunostained with the anti-PirB antibody C19.
[0022] FIG. 2. PirB immunoreactivity on cultured cortical neurons.
A. Growth cone from a cortical neuron cultured three days and
immunostained with anti-PirB antibody 1477 (red), actin binding
protein phalloidin (blue) and synapsin (green). B. Cultured
cortical neuron nine days in vitro immunostained with anti PirB
antibody C19, anti-PSD-95 (green) and DAPI (blue). C. Cultured
cortical neuron nine days in vitro immunostained with anti PirB
antibody A20 (red), and anti-neurofilament (green). D. Growth cone
from a cortical neuron cultured three days and immunostained with
anti-PirB antibody C19 (red), axonal growth cone marker GAP-43
(blue), and actin stain phalloidin (green).
[0023] FIG. 3. PirB protein from the mouse balb. A. PirB was
immunoprecipitated from brain stem, thalamus and striatum,
cerebellum, and cortex, hippocampus or optic nerve derived from
equal total amounts of protein from P5 and P20 mouse brains (P14
for optic nerve) using the 6C 1 monoclonal antibody and detected by
Western Blot with the polyclonal C19 antibody. Control I.P. was
total rat ig G.I.P. from cerebellum lysate. B. PirB was
immunoprecipitated from total mouse brain at P7 and treated with
EndoH and PNGaseF glycosidases. C. Synaptosomal fractions were
prepared (see methods), and PirB was immunoprecipitated from
fractions. P100=light membranes. synaptosomes were subfractionated
into synaptic plasma membranes and synaptic v esicles by hypotontic
shock S100 rep resents so kb le fraction. Synapsin and
Synaptophysin, synaptic ve side proteins, were used as
fractionation controls.
[0024] FIG. 4. Solute PirBAP fusion protein binds to cultured
cortical neurons in an MHC [dependent manner. PirBAP binds to WT
mouse embyro fibroblasts (MEFs), and to culture cortical neurons.
This binding is dramatically reduced in B2M/Tap mutant mice, where
cell surface expression of MI-IC I molecules are abrogated (left).
Scatchard p lot analysis reveal saturable binding awe, and a
dissociation constant of approximately 1 .mu.M.
[0025] FIG. 5. PirB function is abrogated in PirBTM mice. (A)
Subcellular fractionation from wild-type and PirBTM mouse brains.
In WT mice, 130 kD mature PirB fractionates with heavy membranes
(P10) and light membranes (P100), and none is detected in soluble
5100 fraction. PirBTM is smaller, and exhibits increased
solubility, as a large proportion appears in the soluble (S100)
fraction. (B) Anti-phosphotyrosine immunoprecipitation followed by
anti-PirB Western blot reveals that PirB is phosphorylated. (C)
Anti-PirB I.P. followed by anti-PirB Western blot, which is then
stripped and probed for anti-phosphotyrosine. Only WT PirB is
phosphphorylated; no phosphorylated PirBTM is detected. (D)
Anti-Shp-1 immunoprecipitation, followed by Shp-1 and PirB Western
blots indicate a detectable interaction between Shp-1 and PirB in
mouse brain. E. Anti-Shp-2 immunoprecipiation demonstrates a robust
PirB/Shp-2 complex in the WT mouse brain, and no interaction in the
PirBTM brain (left panel). Shp-2 immunoprecipitation from PND5 and
PND20 brains also show this interaction. Controls were performed
using non-specific Ig control immunoprecipitation from WT brain to
demonstrate specificity of the Shp-2 antibody (right panel).
[0026] FIG. 6. PirB restricts ocular dominance plasticity in the
mouse visualcortex. (A) Average widths of ipsilateral Arc induction
zones in P19 end P34 WT end PirBTM mice (left panel), and widths
after monocular enucleation (ME) from P19-25, P22-31, and P31-36.
No difference is seen in normal development, but ME produces a
greater shift toward the non-deprived eye in PirBTM mice than in WT
mice n=6-9 mice per condition. (B.cndot.F) Cumulative histograms of
individual measurements at each age end under each condition. (G)
Examples of ipsilateral Arc patch (yellow arrows) at P34 after
refinement is complete in WT (top left) and PirBTM (bottom left),
and expended patches after P22-31 ME in the right panels. (H) Width
of 3H-proline a labeled ipsilateral patch is wider in PirBTM then
WT mice after ME from P25-P40.
[0027] FIG. 7. Plasticity in the segregated LG N of PirBTM mice.
Anterograde track 1 g Indicates that the area of the LGN occupied
by ipsiliateral axons is the same in WT and Pir3TM mice at P23.
After ME from P15 to P23, the ipsilateral area in the PirBTM mice
has expanded much more than WT.
[0028] FIG. 8. Schematic of targeting vector for PirBTM (see a
methods). A. Light blue boxes indicate exons. Exons 10, 11, 12, and
13, encoding PirB transmembrane domain end part of its
intracellular domain are deleted upon exposure to Cre recombines.
B. Schematic of hypothetical PirB and PirB TM mutant proteins.
Ig--Ig domain, ITIM=Immunoreceptortyrosine-based
inhibitorymotifs.
[0029] FIG. 9 illustrates that PirB mRNA and protein are expressed
in neurons wherein:
[0030] A-C: 35-S labeled PirB-specific probes representing the 3'
region of PirB mRNA were used to detect PirB mRNA in sections from
mouse brains of various ages. In situ hybridizations are shown in
darkfield optics (silver grains appear white);
[0031] A. P14 sagittal section;
[0032] B. P29 sagittal section;
[0033] C. Adult sagittal section (top) plus sense control
(bottom);
[0034] D-J: Immunohistochemistry using PirB-specific antibodies
[0035] D. P18 coronal section;
[0036] E, adult sagittal section stained with anti-PirB antibody
A20. Scale bars A-E 1 mm;
[0037] F. Growth cone of a cortical neuron 3 DIV immunostained with
anti-PirB 1477 (red) phalloidin (blue) and anti-synapsin
(green);
[0038] G. Cortical neuron 18 DIV stained with anti-PirB (red),
postsynaptic marker PSD-95 (green), and Hoechst (blue);
[0039] H. Cortical neuron 14 DIV stained with anti-PirB (red),
presynaptic protein synaptophysin (green), and Hoechst (blue);
[0040] I. Cortical neuron 14 DIV stained with anti-PirB (red),
presynaptic protein synapsin (green), and Hoechst (blue); and
[0041] J. Higher magnification of I. Scale bars F-J=10 um.
[0042] FIG. 10 illustrates that soluble PirB binds to neurons
wherein;
[0043] Soluble PirB-AP binds to mouse embryo fibroblasts (MEFs)
(A), and to cultured cortical neurons (B); binding is dependent on
surface expression of MHCI protein, as binding is reduced
significantly in cultures derived from .beta.2m-/-/Tap1-/- mice
(p<0.01 for MEFs and p=0.03 for neurons); (C) Binding of PirB-AP
to neurons is saturable (top); Scatchard analysis (bottom) predicts
a dissociation constant of 1.3 .mu.M. (D) PirB-AP binds to
pyramidal neurons in sections of cortex. Numbers indicate cortical
layers. Scale bars=250 um (left, middle panels) or 50 um (right
panel).
[0044] FIG. 11 illustrates that PirB protein is expressed
throughout the brain and forms complexes with Shp-1 and Shp-2;
[0045] A. PirB was immunoprecipitated using 6C1 monoclonal antibody
and detected by Western blot using C19 polyclonal antibody, from
whole brain at postnatal day 5, P12, P20, P28, or adult (Ad);
[0046] B. PirB protein immunoprecipitated from brain stem, thalamus
and striatum (thal. striat), cerebellum, and cortex/hippocampus
(ctx. hipp) derived from equal amounts of protein from P5 or P20
mouse brains. Control I.P. was non-specific rat IgG in lysate from
cerebellum;
[0047] C. PirB was immunoprecipitated from whole brain at P7 and
treated with EndoH or PNGaseF glycosidases;
[0048] D. PirB was immunoprecipitated from synaptosomal fractions
(see methods). PLT100=light membranes, SPM=synaptic plasma
membranes, VES=synaptic vesicle fraction, SUP100=soluble fraction.
Synapsin and Synaptophysin synaptic vesicle proteins were used as
fractionation markers;
[0049] E. Subcellular fractionation from WT and PirBTM mouse
brains. In WT, 130 kD mature PirB fractionates with heavy membranes
(P10 fraction) and light membranes (P100 fraction), but none is
detected in soluble S100 fraction. In contrast, mutant PirBTM is
smaller and exhibits increased solubility, as a large proportion
appears in the soluble (S100) fraction;
[0050] F. Anti-phosphotyrosine immunoprecipitation followed by
anti-PirB Western blot reveals that PirB is phosphorylated, and no
signal is detected in PirBTM mice;
[0051] G. Anti-PirB I.P. followed by anti-PirB Western blot, which
is then stripped and probed for anti-phosphotyrosine. Only WIT PirB
is phosphorylated; no phosphorylated PirBTM is detected;
[0052] H. Anti-Shp-1 I.P., followed by Shp-1 and PirB Western blots
demonstrates that PirB interacts with Shp-1 in brain;
[0053] I. Anti-Shp-2 I.P. followed by Shp-2 and PirB Western blots
from P5 or P12 brains demonstrate PirB/Shp-2 complex in the brain;
and
[0054] J. PirBTM/Shp-2 complex is absent in PirBTM brains.
[0055] FIG. 12 illustrates enhanced OD plasticity in visual cortex
of PirBTM mice; Arc mRNA induction (A-G), transneuronal
autoradiography (H-J);
[0056] A. Schematic of visual system showing connections from
retina to lateral geniculate nucleus (LGN) to visual cortex. Note
small binocular zone (BZ) that receives visual inputs via the LGN
from both eyes;
[0057] B-D: Developmental restriction of ipsilateral eye
representation proceeds normally in PirBTM mice;
[0058] B. Arc mRNA induced by visual stimulation of P34 mice,
detected by in situ hybridization in cortex ipsilateral to
stimulated eye. Yellow arrowheads delineate zone of Arc induction,
which corresponds to the binocular zone. In normally reared mice at
P19 or at P34, the width of Arc induction in WT or in PirBTM mice
appears indistinguishable;
[0059] C. Histograms represent average widths of Arc induction in
layer 4. P19: WT n=9, PirBTM n=7; P34: WT n=7, PirBTM n=7, 3-4
sections/animal;
[0060] D. Averaged line scans from all WT (blue) or PirBTM (red)
sections at P34. Scans were made blind to genotype and were aligned
at left border of BZ (black vertical line, left) Blue or red
vertical line indicates right border of Arc induction;
[0061] E-G: OD plasticity is enhanced in PirBTM mice;
[0062] E. OD plasticity following monocular enucleation (ME) from
P22-31 as assessed by Arc induction. Note expansion in width of in
situ hybridization pattern after ME in WT (compare E top with B
top). Zone of Arc induction after ME is even more extensive in
PirBTM mice (E bottom panel) than WT (top panel);
[0063] F. Consistently enhanced expansion in width of Arc induction
in PirBTM vs WT mice following periods of ME from P19-25, P22-31,
P31-36, or P100-110. Histograms represent average width of Arc
induction. ME from P19-25: WT n=5, PirBTM n=9; P21-32: WT n=6,
PirBTM n=6; P31-36 WT n=9, PirBTM n=9; P11-110: WT n=5, PirBTM n=5,
34 sections/animal;
[0064] G. Averaged line scans of layer 4 Arc signal in all WT
(blue) or PirBTM (red) sections following ME from P22-31. Scans
aligned at left border of BZ (vertical line, left). Blue or red
vertical lines indicate right border. Note larger width in PirBTM
mice;
[0065] H-J: Transneuronal autoradiography reveals an increase in
width of anatomical connections between LGN neurons representing
ipsilateral eye and layer 4 of cortex following ME (P25-40) in
PirBTM mice;
[0066] HL Darkfield autoradiographs showing increased width of
transneuronally transported radioactive label representing input
from the ipsilateral eye in layer 4 of cortex in PirBTM (bottom) vs
WT (top) mice;
[0067] I. Histograms are averages from all mice (WT n=7, PirBTM
n=6); and
[0068] J. Averaged line scans from all WT or PirBTM sections. Scans
were aligned at left border of BZ (black vertical line, left). Blue
or red vertical lines indicate width of thalamocortical projection
in WT or PirBTM. Error bars in C, F, I=1 S.E.M. asterisks: *
p<0.05; **=p<0.01.
[0069] FIG. 13 illustrates:
[0070] A. Schematic of targeting vector for PirBTM (see methods).
Light blue boxes indicate exons. Exons 10, 11, 12, and 13, encoding
PirB transmembrane domain and part of the intracellular domain are
deleted upon exposure to Cre recombinase; and
[0071] B. Schematic of hypothetical PirB and PirBTM mutant
proteins. Ig=Ig domain, ITIM=Immunoreceptor tyrosine-based
inhibitory motifs. Colored boxes indicate protein domain encoded by
separate exons. Exon indicated by numbers above box.
[0072] FIG. 14 illustrates:
[0073] A Sagittal sections (20 .mu.m) of P30 WT (top) and PirBTM
(bottom) mice stained with cresyl violet. Gross histological
organization of the brain is indistinguishable from normal in
PirBTM mice; Scale bar=1 mm; and
[0074] B. Anterograde tracing reveals normal patterns of
eye-specific segregation of retinogeniculate axons in LGN of PirBTM
mice. Pattern of retinogeniculate axons in three WT mice (left) and
three PirBTM mice (right) appear similar, Scale bar=100 um.
DETAILED DESCRIPTION OF THE INVENTION
[0075] It has long been known that there are critical periods
during brain development when experience can rapidly alter brain
circuits by changing synaptic connections, both by altering the
structure of connections and by changing their strength
functionally (39). These critical periods are defined by the
rapidity and ease with which neural connections can be changed by
experience, such as monocular visual deprivation or eye removal,
and such periods are thought to be terminated by progressive
developmental changes leading to the adult state in which
plasticity is far more limited if it occurs at all. It has
generally been thought that the critical period for the effects of
MD in visual cortex comes to a close due to the down regulation or
removal of factors that enable early synaptic plasticity. However,
the genetic loss of function experiments described here demonstrate
a role for PirB in limiting the extent of synaptic plasticity
present both in the thalamus and in the visual cortex, an effect
that is likely to be involved in other regions of the central
nervous system. In the absence of PirB function, plasticity in both
of these structures remains immature in the sense that it is rapid
and extensive even at older ages. This discovery is exciting
because it implies that there are not only positive, but also
negative regulators of synaptic plasticity and that by removing or
reducing activity or levels of a negative regulator-PirB- it is
possible to restore early, more robust forms of plasticity that may
have been present all along even in the adult brain.
[0076] The implications of this discovery are broad. PirB is
expressed throughout the brain and spinal cord, and thus may play a
role in restricting plasticity in many neural systems beyond the
visual system. For example, PirB is expressed in the hippocampus
and cerebral cortex, structures known to function in learning and
memory formation and consolidation by means of synaptic plasticity
and circuit refinement. Thus, PirB, and its human homologs the
LILRB/LIR/ILT family of proteins, represent prime candidate targets
for therapeutics for alleviating the memory loss due to aging and
Alzheimer's disease, and in cases for treatment of developmental
disability such as autism, dyslexia or cerebral palsy.
[0077] In the immune system, PirB regulates cytoskeletal dynamics
by inhibiting integrin signaling and chemokine signaling. Neuronal
PirB may function in a similar way, restricting synaptic plasticity
by limiting neuronal cytoskeletal activity, and thereby limiting
neurite outgrowth and synapse remodeling. Release of these
limitations through targeted inhibition of PirB or its downstream
effector molecules may significantly enhance regeneration of neural
circuits that have been lost due to spinal cord injury, head injury
or stroke. In addition, recovery from stroke may be enhanced by
coupling rehabilitation and retraining therapies with targeted
inhibition of PirB pharmacologically, with the idea that the
retraining of remaining, undamaged brain circuits can be
facilitated by allowing them access to earlier, more robust forms
of synaptic plasticity.
[0078] Conversely, the epileptic brain suffers from inappropriate
activity-induced neuronal sprouting and outgrowth. Epilepsy runs in
families, and thus has a genetic component. People suffering from
epilepsy may have reduced PirB/LILRD activity due to genetic
factors, or may benefit from limiting the extent of seizure-induced
plasticity by enhancing PirB function through therapeutic
intervention. The fundamental concept here is that a substrate for
the more robust forms of synaptic plasticity characteristic of the
developing brain are still present in the adult brain, but that
intact PirB functions in adulthood to put a brake on the extent of
neural plasticity. Thus, inhibitors of neural plasticity identified
and designed as function-blocking therapeutics for recovery from
injury and stroke, for enhancement of learning and memory, and as
function-enhancing therapeutics for preventing unwanted changes in
neural circuits that can occur with epilepsy or other forms of
abnormal brain activity.
[0079] Here we identify the Paired pmmunoglobulin-like receptor-B,
PirB, as a candidate neuronal receptor for MHCI. PirB is a
transmembrane MHCI receptor expressed on various types of
leukocytes (9-15), and has been shown to bind a broad array of MHCI
molecules, as well as to bind directly to the requisite MHCI
co-subunit .beta.2microglobulin (12, 13, 16). Our work demonstrates
that PirB is expressed in subsets of neurons throughout the mouse
brain at all ages tested. Cultured cortical and hippocampal neurons
exhibit PirB immunostaining along neuronal axons and growth cones.
Neuronal PirB protein is glycosylated, phosphorylated, and
fractionates in part with synaptosomes. As in the immune system
(17-21) neuronal PirB forms complexes with the phosphatases Shp-1
and Shp-2. Functional experiments in mutant mice reveal that ocular
dominance plasticity in the visual cortex is more robust, and that
segregated retinal ganglion axon are unusually plastic in the
absence of PirB signaling. These results demonstrate that a
neuronal-expressed MHCI receptor acts to limit visual system
plasticity.
DEFINITIONS
[0080] It is understood that this invention is not limited to the
particular materials and methods described herein. It is also to be
understood that the terminology used herein is for the purpose of
describing particular embodiments and is not intended to limit the
scope of the present invention which will be limited only by the
appended claims. As used herein, the singular forms "a", "an", and
"the" include plural reference unless the context clearly dictates
otherwise. For example, a reference to "leukocytes" includes a
plurality of cells known to those skilled in the art.
[0081] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs. All
publications mentioned herein are cited for the purpose of
describing and disclosing the models, protocols and reagents which
are reported in the publications and which might be used in
connection with the invention. Nothing herein is to be construed as
an admission that the invention is not entitled to antedate such
disclosure by virtue of prior invention.
[0082] As used herein, a "small molecule" is usually less than
about 25 K in molecular weight, preferably less than 10 K and may
possess a number of physicochemical and pharmacological properties
which enhance cell penetration, allow it to resist degradation and
prolong its physiological half-life. Preferably, small molecules
are not immunogenic. In addition, the small molecule should be
amenable to high throughput screening.
[0083] As used herein, "Expression" refers to the transcription
and/or translation of an endogenous gene (PirB), heterologous gene
or nucleic acid segment, or a transgene in cells. For example, in
the case of siRNA constructs, expression may refer to the
transcription of the siRNA only. In addition, expression refers to
the transcription and stable accumulation of sense (mRNA) or
functional RNA. Expression may also refer to the production of
protein.
[0084] As used herein, the term "administering a molecule to a
cell" (e.g., an expression vector, nucleic acid, cytokines,
angiogenic factors, a delivery vehicle, agent, and the like) refers
to transducing, transfecting, microinjecting, electroporating, or
shooting, the cell with the molecule. In some aspects, molecules
are introduced into a target cell by contacting the target cell
with a delivery cell (e.g., by cell fusion or by lysing the
delivery cell when it is in proximity to the target cell).
As used herein, "MHC Class I molecules" refers to classical (class
1a) MHC I molecules (HLA-A, -B, -C, -G and the like) and other
non-classical (class 1b) MHC Class I molecules. MHC Class I
molecules include human MHC Class I molecules (the human leukocyte
antigen (HLA) complex) and vertebrate equivalents thereof, such is
Class I antigens of the H-2 locus of mice, in particular H-2 D and
K. Human MHC Class I antigens include, for example, HLA-A, B, C, Qa
and T1. In addition, HLA-G encodes nonclassical MHC class I
products. There are also numerous MHC class I-like genes, many of
which are coded outside of the canonical MHC Class I region,
including HFE, MICA, MICB, CD1-a, -b, -c, -d, and members of the
ULPB family. Source for both human and mouse data:
[0085]
http://imgt.cines.fr/textes/IMGTrepertoireMHC/LocusGenes/nomenclatu-
res/mouse/MHC/Mu_MHCnom.html (hereby incorporated by reference in
its entirety
[0086] The PirB receptor has been identified recently in mice on
the basis of their homology with the human F=receptor (Fc.alpha.R).
PirB shares sequence similarity with a gene family that includes
human Fc.alpha.R and killer inhibitory receptors (KIR), mouse gp49,
bovine Fc receptor for IgG (Fc.gamma.R), and the recently
identified human Ig-like transcripts (ILT)/leukocyte Ig-like
receptors (LIR)/monocyte/macrophage Ig-like receptors (MIR). The
PirB gene is located on mouse chromosome 7 in a region syntenic
with the human chromosome 19q13 region that contains the
Fc.alpha.R, KIR, and ILT/LIR/MIR genes. DNA sequences for PirB
predict type I transmembrane proteins with similar ectodomains
(>92% homology) each containing six Ig-like domains. The PirB
protein, encoded by the Pirb gene, has a typical uncharged
transmembrane region and a long cytoplasmic tail with multiple
candidate immunoreceptor tyrosine-based inhibitory motifs (ITIMs).
Recent studies have demonstrated the inhibitory function of the two
most membrane-distal ITIM units in the PirB cytoplasmic region. The
PirB inhibitory function is mediated through ITIM recruitment of
the protein tyrosine phosphatase SHP-1.
[0087] It should be appreciated that the above PirB not only refers
to the polypeptide, but also the gene and all currently known
variants thereof, including the different mRNA transcripts to which
the gene and its variants can give rise, and any further gene
variants which may be elucidated. In general, however, such
variants will have significant homology (sequence identity) to a
sequence of a table above, e.g. a variant will have at least about
70 percent homology (sequence identity) to a sequence of the above
tables 1-5, more typically at least about 75, 80, 85, 90, 95, 97,
98 or 99 homology (sequence identity) to a sequence of the above
tables 1-5. Homology of a variant can be determined by any of a
number of standard techniques such as a BLAST program.
[0088] "Central nervous system diseases or disorders as used herein
refers to any neurological disorder whose disease course or
severity could be either prevented or treated by the teachings of
the current invention; that is, could be benefited by a therapeutic
enhancing neuronal plasticity or regeneration; including but not
limited to neurodegenerative disorders (Parkinson's; Alzheimer's)
or autoimmune disorders (multiple sclerosis) of the central nervous
system; memory loss; long term and short term memory disorders;
learning disorders; autism, depression, benign forgetfulness,
childhood learning disorders, close head injury, and attention
deficit disorder, autoimmune disorders of the brain, neuronal
reaction to viral infection; brain damage; depression; psychiatric
disorders such as bi-polarism, schizophrenia and the like;
narcolepsy/sleep disorders (including circadian rhythm disorders,
insomnia and narcolepsy); severance of nerves or nerve damage;
severance of the cerebrospinal nerve cord (CNS) and any damage to
brain or nerve cells; neurological deficits associated with AIDS;
tics (e.g. Giles de la Tourette's syndrome); Huntington's chorea,
schizophrenia, traumatic brain injury, tinnitus, neuralgia,
especially trigeminal neuralgia, neuropathic pain, inappropriate
neuronal activity resulting in neurodysthesias in diseases such as
diabetes, MS and motor neurone disease, ataxias, muscular rigidity
(spasticity) and temporomandibular joint dysfunction; Reward
Deficiency Syndrome (RDS) behaviors in a subject.
[0089] "Diagnostic" means identifying the presence or nature of a
pathologic condition. Diagnostic methods differ in their
sensitivity and specificity. The "sensitivity" of a diagnostic
assay is the percentage of diseased individuals who test positive
(percent of "true positives"). Diseased individuals not detected by
the assay are "false negatives." Subjects who are not diseased and
who test negative in the assay, are termed "true negatives." The
"specificity" of a diagnostic assay is 1 minus the false positive
rate, where the "false positive" rate is defined as the proportion
of those without the disease who test positive. While a particular
diagnostic method may not provide a definitive diagnosis of a
condition, it suffices if the method provides a positive indication
that aids in diagnosis.
[0090] As used herein, a "pharmaceutically acceptable" component is
one that is suitable for use with humans and/or animals without
undue adverse side effects (such as toxicity, irritation, and
allergic response) commensurate with a reasonable benefit/risk
ratio.
[0091] The terms "patient" or "individual" are used interchangeably
herein, and is meant a mammalian subject to be treated, with human
patients being preferred. In some cases, the methods of the
invention find use in experimental animals, in veterinary
application, and in the development of animal models for disease,
including, but not limited to, rodents including mice, rats, and
hamsters; and primates.
[0092] As used herein, "treatment" refers to a symptom which
approaches a normalized value, e.g., is less than 50% different
from a normalized value, preferably is less than about 25%
different from a normalized value, more preferably, is less than
10% different from a normalized value, and still more preferably,
is not significantly different from a normalized value as
determined using routine statistical tests. For example, treatment
of depression includes, for example, relief from the symptoms of
depression which include, but are not limited to changes in mood,
feelings of intense sadness and despair, mental slowing, loss of
concentration, pessimistic worry, agitation, and self-deprecation.
Physical changes may also be relieved, including insomnia, anorexia
and weight loss, decreased energy and libido, and the return of
normal hormonal circadian rhythms. Another example, when using the
terms "treating Parkinson's disease" or "ameliorating" as used
herein means relief from the symptoms of Parkinson's disease which
include, but are not limited to tremor, bradykinesia, rigidity, and
a disturbance of posture.
[0093] "Cells of the immune system" or "immune cells" as used
herein, is meant to include any cells of the immune system that may
be assayed, including, but not limited to, B lymphocytes, also
called B cells, T lymphocytes, also called T cells, natural killer
(NK) cells, lymphokine-activated killer (LAK) cells, monocytes,
macrophages, neutrophils, granulocytes, mast cells, platelets,
Langerhans cells, stem cells, dendritic cells, peripheral blood
mononuclear cells, tumor-infiltrating (TIL) cells, gene modified
immune cells including hybridomas, drug modified immune cells, and
derivatives, precursors or progenitors of the above cell types.
[0094] "Immune effector cells" refers to cells capable of binding
an antigen and which mediate an immune response. These cells
include, but are not limited to, T cells T lymphocytes), B cells
(13 lymphocytes), monocytes, macrophages, natural killer (NK) cells
and cytotoxic T lymphocytes (CTLs), for example CTL lines, CTL
clones, and CTLs from tumor, inflammatory, or other
infiltrates.
[0095] "T cells" or "T lymphocytes" are a subset of lymphocytes
originating in the thymus and having heterodimeric receptors
associated with proteins of the CD3 complex (e.g., a rearranged T
cell receptor, the heterodimeric protein on the T cell surfaces
responsible for antigen/MHC specificity of the cells). T cell
responses may be detected by assays for their effects on other
cells (e.g., target cell killing, macrophage, activation, B-cell
activation) or for the cytokines they produce.
[0096] "Activity", "activation" or "augmentation" is the ability of
"resting" immune cells to respond and exhibit, on a measurable
level, an immune function. Measuring the degree of activation
refers to a quantitative assessment of the capacity of immune cells
to express enhanced activity when further stimulated as a result of
prior activation. The enhanced capacity may result from biochemical
changes occurring during the activation process that allow the
immune cells to be stimulated to activity in response to low doses
of stimulants.
[0097] As used herein, the term "polypeptide" comprises amino acid
chains of any length, including full length proteins comprising the
sequences recited herein. A polypeptide comprising an epitope of a
protein comprising a sequence as described herein may consist
entirely of the epitope, or may contain additional sequences. The
additional sequences may be derived from the native protein or may
be heterologous, and such sequences may (but need not) possess
immunogenic or antigenic properties.
[0098] The terms "specific binding" or "specifically binding", as
used herein, in reference to the interaction of an antibody and a
protein or peptide, mean that the interaction is dependent upon the
presence of a particular structure (i.e., the antigenic determinant
or epitope) on the protein; in other words, the antibody is
recognizing and binding to a specific protein structure rather than
to proteins in general. For example, if an antibody is specific for
epitope "A", the presence of a protein comprising epitope A (or
free, unlabeled A) in a reaction comprising labeled "A" and the
antibody will reduce the amount of labeled A bound to the antibody.
"Specific binding" in general, refers to any MHC Class I molecule
binding to its ligand, such as for example the binding of a T cell
receptor expressed by a T lymphocyte, to an MHC molecule and
peptide on an antigen presenting cell.
[0099] As used herein, the term "antibody" refers to a polypeptide
or group of polypeptides which are comprised of at least one
binding domain, where an antibody binding domain is formed from the
folding of variable domains of an antibody molecule to form
three-dimensional binding spaces with an internal surface shape and
charge distribution complementary to the features of an antigenic
determinant of an antigen, which allows an immunological reaction
with the antigen. Antibodies include recombinant proteins
comprising the binding domains, as wells as fragments, including
Fab, Fab', F(ab).sub.2, and F(ab').sub.2 fragments. The term
"antibody," as used herein, also includes antibody fragments either
produced by the modification of whole antibodies or those
synthesized de novo using recombinant DNA methodologies. It also
includes polyclonal antibodies, monoclonal antibodies, chimeric
antibodies, humanized antibodies, or single chain antibodies. "Fc"
portion of an antibody refers to that portion of an immunoglobulin
heavy chain that comprises one or more heavy chain constant region
domains, CH.sub.1, CH.sub.2 and CH.sub.3, but does not include the
heavy chain variable region.
[0100] An "epitope", as used herein, is a portion of a polypeptide
that is recognized (i.e., specifically bound) by a B-cell and/or
T-cell surface antigen receptor. Epitopes may generally be
identified using well known techniques, such as those summarized in
Paul, Fundamental Immunology, 3rd ed., 243-247 (Raven Press, 1993)
and references cited therein. Such techniques include screening
polypeptides derived from the native polypeptide for the ability to
react with antigen-specific antisera and/or T-cell lines or clones.
An epitope of a polypeptide is a portion that reacts with such
antisera and/or T-cells at a level that is similar to the
reactivity of the full length polypeptide (e.g., in an ELISA and/or
T-cell reactivity assay). Such screens may generally be performed
using methods well known to those of ordinary skill in the art,
such as those described in Harlow and Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory, 1988. B-cell and
T-cell epitopes may also be predicted via computer analysis.
Polypeptides comprising an epitope of a polypeptide that is
preferentially expressed in a tumor tissue (with or without
additional amino acid sequence) are within the scope of the present
invention.
[0101] The terms "nucleic acid molecule" or "polynucleotide" will
be used interchangeably throughout the specification, unless
otherwise specified. As used herein, "nucleic acid molecule" refers
to the phosphate ester polymeric form of ribonucleosides
(adenosine, guanosine, uridine or cytidine; "RNA molecules") or
deoxyribonucleosides (deoxyadenosine, deoxyguanosine,
deoxythymidine, or deoxycytidine; "DNA molecules"), or any
phosphoester analogues thereof, such as phosphorothioates and
thioesters, in either single stranded form, or a double-stranded
helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are
possible. The term nucleic acid molecule, and in particular DNA or
RNA molecule, refers only to the primary and secondary structure of
the molecule, and does not limit it to any particular tertiary
forms. Thus, this term includes double-stranded DNA found, inter
alia, in linear or circular DNA molecules (e.g., restriction
fragments), plasmids, and chromosomes. In discussing the structure
of particular double-stranded DNA molecules, sequences may be
described herein according to the normal convention of giving only
the sequence in the 5' to 3' direction along the nontranscribed
strand of DNA (i.e., the strand having a sequence homologous to the
mRNA). A "recombinant DNA molecule" is a DNA molecule that has
undergone a molecular biological manipulation.
[0102] As used herein, the term "fragment or segment", as applied
to a nucleic acid sequence, gene or polypeptide, will ordinarily be
at least about 5 contiguous nucleic acid bases (for nucleic acid
sequence or gene) or amino acids (for polypeptides), typically at
least about 10 contiguous nucleic acid bases or amino acids, more
typically at least about 20 contiguous nucleic acid bases or amino
acids, usually at least about 30 contiguous nucleic acid bases or
amino acids, preferably at least about 40 contiguous nucleic acid
bases or amino acids, more preferably at least about 50 contiguous
nucleic acid bases or amino acids, and even more preferably at
least about 60 to 80 or more contiguous nucleic acid bases or amino
acids in length. "Overlapping fragments" as used herein, refer to
contiguous nucleic acid or peptide fragments which begin at the
amino terminal end of a nucleic acid or protein and end at the
carboxy terminal end of the nucleic acid or protein. Each nucleic
acid or peptide fragment has at least about one contiguous nucleic
acid or amino acid position in common with the next nucleic acid or
peptide fragment, more preferably at least about three contiguous
nucleic acid bases or amino acid positions in common, most
preferably at least about ten contiguous nucleic acid bases amino
acid positions in common.
[0103] A significant "fragment" in a nucleic acid context is a
contiguous segment of at least about 17 nucleotides, generally at
least 20 nucleotides, more generally at least 23 nucleotides,
ordinarily at least 26 nucleotides, more ordinarily at least 29
nucleotides, often at least 32 nucleotides, more often at least 35
nucleotides, typically at least 38 nucleotides, more typically at
least 41 nucleotides, usually at least 44 nucleotides, more usually
at least 47 nucleotides, preferably at least 50 nucleotides, more
preferably at least 53 nucleotides, and in particularly preferred
embodiments will be at least 56 or more nucleotides.
[0104] Further, an MHC Class I gene allelic variant may be isolated
from, for example, human nucleic acid, by performing PCR using the
pan specific probes as described in detail in the Examples section,
e.g. Pan PIRB probe. For example, the template for the reaction may
be cDNA obtained by reverse transcription of mRNA prepared from,
for example, human or non-human cell lines or tissue known or
suspected to express a PIR gene or allelic variant thereof.
Preferably, the allelic variant will be isolated from an individual
who has a PIR mediated neuronal disorder. This method is also used
to determine the absence of any MHC Class I expression.
[0105] In another aspect of the invention it is desirable to
correct abnormal MHC Class I levels of expression or abnormal
expression patterns. For example, MHC Class I and Class I-like gene
sequences or portions thereof can be used in gene replacement
therapy. Specifically, one or more copies of a normal class I MHC
gene or a portion of the class I MHC gene that directs the
production of a class I MHC gene product exhibiting normal class I
MHC gene function, may be inserted into the appropriate cells
within a patient, using vectors that include, but are not limited
to adenovirus, adeno-associated virus, and retrovirus vectors, in
addition to other particles that introduce DNA into cells, such as
liposomes. Preferably the vector is herpes simplex virus vector,
such as that described in U.S. Pat. Nos. 5,501,979 and 5,661,033,
which are herein incorporated by reference in their entirety.
[0106] Additional methods that may be utilized to increase,
decrease or modulate the overall level of PirB expression and/or
PirB gene product activity include the introduction of appropriate
PirB-expressing cells, preferably autologous cells, and/or stem
cells, and/or neural progenitor cells into a patient at positions
and in numbers that are sufficient to rectify the expression of
PirB receptors.
[0107] Such cell-based gene therapy techniques are well known to
those skilled in the art, see, e.g., Anderson, U.S. Pat. No.
5,399,349.
[0108] Additionally, compounds, such as those described, above and
below, that are capable of modulating PirB activity can be
administered using standard techniques that are well known to those
of skill in the art. In instances in which the compounds to be
administered are to involve an interaction with brain cells, the
administration techniques should include well known ones that allow
for a crossing of the blood-brain barrier.
[0109] Modulators of PirB include, but are not limited to: small
molecules, antibodies, peptides, nucleic acids, protein or nucleic
acid aptamers, antisense molecules, ribozymes, triple helix
molecules, carbohydrates, and the like. Preferred modulators
include those that up-regulate, such as for example, one involved
in neural plasticity or in other cases a down regulator, such as
for example a compound that inhibits (i.e., PirB) neuronal cell
plasticity.
[0110] Libraries of compounds may be screened to identify
modulators. There are a number of different libraries used for the
identification of small molecule modulators, including: (1)
chemical libraries, (2) natural product libraries, and (3)
combinatorial libraries comprised of random peptides,
oligonucleotides or organic molecules. Chemical libraries consist
of random chemical structures, some of which are analogs of known
compounds or analogs of compounds that have been identified as
"hits" or "leads" in other drug discovery screens, some of which
are derived from natural products, and some of which arise from
non-directed synthetic organic chemistry. Natural product libraries
are collections of microorganisms, animals, plants, or marine
organisms which are used to create mixtures for screening by: (1)
fermentation and extraction of broths from soil, plant or marine
microorganisms or (2) extraction of plants or marine organisms.
Natural product libraries include polyketides, non-ribosomal
peptides, and variants (non-naturally occurring) thereof. For a
review, see Science 282: 63-68 (1998). Combinatorial libraries are
composed of large numbers of peptides, oligonucleotides, or organic
compounds as a mixture. These libraries are relatively easy to
prepare by traditional automated synthesis methods, PCR, cloning,
or proprietary synthetic methods. Of particular interest are
non-peptide combinatorial libraries. Still other libraries of
interest include peptide, protein, peptidomimetic, multiparallel
synthetic collection, recombinatorial, and polypeptide libraries.
For a review of combinatorial chemistry and libraries created
therefrom, see Myers, Curr. Opin. Biotechnol. 8: 701-707 (1997).
Identification of modulators through use of the various libraries
described herein permits modification of the candidate "hit" (or
"lead") to optimize the capacity of the "hit" to modulate activity.
Compound libraries may be purchased commercially (e.g., such as
LeadQuest.TM.-libraries from Tripos (St. Louis, Mo.)) or may be
synthesized using methods well known in the art.
[0111] The methods of the invention can be used to screen for
antisense molecules that inhibit the functional expression of one
or more mRNA molecules that modulate MHC Class I molecule
expression. An antisense nucleic acid molecule may be constructed
in a number of different ways provided that it is capable of
interfering with the expression of a target protein. Typical
antisense oligonucleotides to be screened preferably are 30-100
nucleotides in length. The antisense nucleic acid molecule
generally will be substantially identical (although in antisense
orientation) to the target MHC Class I molecule sequence. The
minimal identity will typically be greater than about 80%, greater
than about 90%, greater than about 95% or about 100% identical.
[0112] Nucleic acid modulators also may include ribozymes. Thus,
the methods of the invention can be used to screen for ribozyme
molecules that inhibit the functional expression of one or more
mRNA molecules that encode one or more proteins that modulate MHC
Class I molecules. The design and use of target RNA-specific
ribozymes is described in Haseloff et al., Nature 334: 585, 1988;
see also U.S. Pat. No. 5,646,023, for example. Tablor, et al., Gene
108: 175, 1991, have greatly simplified the construction of
catalytic RNAs by combining the advantages of the anti-sense RNA
and the ribozyme technologies in a single construct. Smaller
regions of homology are required for ribozyme catalysis, therefore
this can promote the repression of different members of a large
gene family (e.g., Ig family) if the cleavage sites are
conserved.
[0113] In another preferred embodiment, siRNAs are used to
down-regulate, for example, MHC Class I molecules that have been
identified as playing a role in a neural disorder. Several methods
are available for the construction of siRNAs, including commercial
available sources. siRNAs can be constructed using T7 phage
polymerase. T7 polymerase is used to transcribe individual siRNA
sense and antisense strands, which are then annealed to produce a
siRNA. The T7 polymerase can also be used to transcribe siRNA
strands that are linked in cis, forming a hairpin structure. The
transcribed RNAs are comprised of 5' triphosphate termini or most
preferred for a mammalian cell, 5' monophosphates. Successful
siRNA-mediated knockdown of mammalian genes has been recently
reported.
[0114] Another technique for drug screening provides for high
throughput screening of compounds having suitable binding affinity
to the protein of interest (see, e.g., Geysen et al., 1984, PCT
application WO84/03564). In this method, large numbers of different
small test compounds are synthesized on a solid substrate. The test
compounds are reacted with MHC Class I molecules, or fragments
thereof, and washed. A bound MHC Class I molecule is then detected
by methods well known in the art. A purified NHC Class I molecule
can also be coated directly onto plates for use in the
aforementioned drug screening techniques. Alternatively,
non-neutralizing antibodies can be used to capture the peptide and
immobilize it on a solid support.
[0115] Diagnostic and research reagent kits are also provided which
include components to determine identity of the MHC Class I
molecule in a patient or other test subject. Thus, the kit may
contain a sample of the MHC Class I molecule, gene, an allele or
fragment thereof, or expression product of the MHC Class I
molecule, gene, an allele or fragment thereof. The kit also may
contain instructions (written) for conducting the diagnostic assay.
The kit also may contain an assay or test support, typically a
solid support, and other materials such as positive control
samples, negative control samples, cells, enzymes, detection
labels, buffers, etc.
Assays for Identifying Candidate Agents having PirB Antagonist
Activity:
[0116] The term "agent" or "compound" as used herein describes any
molecule, e.g. protein or pharmaceutical, with the capability of
antagonizing the biological activity of PirB. Generally a plurality
of assay mixtures can be run in parallel with different agent
concentrations to obtain a differential response to the various
concentrations. Typically, one of these concentrations serves as a
negative control i.e. at zero concentration or below the level of
detection.
[0117] Candidate agents (compounds) encompass numerous chemical
classes, though typically they are organic molecules, preferably
small organic compounds having a molecular weight of more than 50
and less than about 2,500 daltons. Candidate agents comprise
functional groups necessary for structural interaction with
proteins, particularly hydrogen bonding, and typically include at
least an amine, carbonyl, hydroxyl or carboxyl group, preferably at
least two of the functional chemical groups. The candidate agents
often comprise cyclical carbon or heterocyclic structures and/or
aromatic or polyaromatic structures substituted with one or more of
the above functional groups. Candidate agents are also found among
biomolecules including, but not limited to: peptides, saccharides,
fatty acids, steroids, purines, pyrimidines, derivatives,
structural analogs or combinations thereof.
[0118] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides and oligopeptides.
Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts are available or
readily produced. Additionally, natural or synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical and biochemical means, and may be used to
produce combinatorial libraries. Known pharmacological agents may
be subjected to directed or random chemical modifications, such as
acylation, alkylation, esterification, amidification, etc. to
produce structural analogs. Screening may be directed to known
pharmacologically active compounds and chemical analogs
thereof.
[0119] Where the screening assay is a binding assay utilizing the
PirB receptor, one or more of the molecules may be joined to a
label, where the label can directly or indirectly provide a
detectable signal. Various labels include radioisotopes,
fluorescers, chemiluminescers, enzymes, specific binding molecules,
particles, e.g. magnetic particles, and the like. Specific binding
molecules include pairs, such as biotin and streptavidin, digoxin
and antidigoxin etc. For the specific binding members, the
complementary member would normally be labeled with a molecule that
provides for detection, in accordance with known procedures.
[0120] A variety of other reagents may be included in the screening
assay. These include reagents like salts, neutral proteins, e.g.
albumin, detergents, etc that are used to facilitate optimal
protein-protein binding and/or reduce non-specific or background
interactions. Reagents that improve the efficiency of the assay,
such as protease inhibitors, nuclease inhibitors, anti-microbial
agents, etc. may be used. The mixture of components are added in
any order that provides for the requisite binding. Incubations are
performed at any suitable temperature, typically between 4 and
40.degree. C. Incubation periods are selected for optimum activity,
but may also be optimized to facilitate rapid high-throughput
screening.
[0121] In another embodiment, the invention provides a method for
identifying a composition which binds to PirB or blocks KSHV
env-mediated membrane fusion. The method includes incubating
components comprising the composition and PirB under conditions
sufficient to allow the components to interact and measuring the
binding of the composition to PirB. Compositions that bind to PirB
include peptides, peptidomimetics, polypeptides, chemical compounds
and biologic agents as described above.
[0122] Incubating includes conditions which allow contact between
the test composition and PirB. Binding can be measured indirectly
by biochemical alterations in the cell (e.g., calcium flux).
Contacting includes in solution and in solid phase. The test
ligand(s)/composition may optionally be a combinatorial library for
screening a plurality of compositions. Compositions identified in
the method of the invention can be further evaluated, detected,
cloned, sequenced, and the like, either in solution or after
binding to a solid support, by any method usually applied to the
detection of a specific DNA sequence such as PCR, oligomer
restriction (Saiki, et al., Bio/Technology, 3:1008-1012, 1985),
allele-specific oligonucleotide (ASO) probe analysis (Conner, et
al., Proc. Natl. Acad. Sci. USA, 80:278, 1983), oligonucleotide
ligation assays (OLAs) (Landegren, et al, Science, 241:1077, 1988),
and the like. Molecular techniques for DNA analysis have been
reviewed (Landegren, et al., Science, 242:229-237, 1988).
[0123] Any of a variety of procedures may be used to clone the
genes of the present invention when the test composition is in a
combinatorial library or is expressed as a gene product (as opposed
to a chemical composition). One such method entails analyzing a
shuttle vector library of DNA inserts (derived from a cell which
expresses the composition) for the presence of an insert which
contains the composition gene. Such an analysis may be conducted by
transfecting cells with the vector and then assaying for expression
of the composition binding activity. The preferred method for
cloning these genes entails determining the amino acid sequence of
the composition protein. Usually this task will be accomplished by
purifying the desired composition protein and analyzing it with
automated sequencers. Alternatively, each protein may be fragmented
as with cyanogen bromide, or with proteases such as papain,
chymotrypsin or trypsin (Oike, Y., et al., J. Biol. Chem.,
257:9751-9758 (1982); Liu, C., et al., Int. J. Pept. Protein Res.,
21:209-215 (1983)). Although it is possible to determine the entire
amino acid sequence of these proteins, it is preferable to
determine the sequence of peptide fragments of these molecules.
[0124] To determine if a composition can functionally complex with
the receptor protein, induction of the exogenous gene is monitored
by monitoring changes in the protein levels of the protein encoded
for by the exogenous gene, for example. When a composition(s) is
found that can induce transcription of the exogenous gene, it is
concluded that this composition(s) can bind to the receptor protein
coded for by the nucleic acid encoding the initial sample test
composition(s).
[0125] Expression of the exogenous gene can be monitored by a
functional assay or assay for a protein product, for example. The
exogenous gene is therefore a gene which will provide an
assayable/measurable expression product in order to allow detection
of expression of the exogenous gene. Such exogenous genes include,
but are not limited to, reporter genes such as chloramphenicol
acetyltransferase gene, an alkaline phosphatase gene,
beta-galactosidase, a luciferase gene, a green fluorescent protein
gene, guanine xanthine phosphoribosyltransferase, alkaline
phosphatase, and antibiotic resistance genes (e.g., neomycin
phosphotransferase).
[0126] Expression of the exogenous gene is indicative of
composition-receptor binding, thus, the binding or blocking
composition can be identified and isolated. The compositions of the
present invention can be extracted and purified from the culture
media or a cell by using known protein purification techniques
commonly employed, such as extraction, precipitation, ion exchange
chromatography, affinity chromatography, gel filtration and the
like. Compositions can be isolated by affinity chromatography using
the modified receptor protein extracellular domain bound to a
column matrix or by heparin chromatography.
PirB Antibodies
[0127] In another embodiment, the present invention provides for
antibodies against PirB that block PirB activation by binding to
the PirB receptor, itself, or a PirB soluble ligand. Such
antibodies are useful as research and diagnostic tools in the study
of PirB associated disorders or diseases and the development of
effective therapeutics. In addition, pharmaceutical compositions
comprising antibodies against PirB may represent effective
therapeutics.
[0128] Antibodies of the invention include polyclonal antibodies,
monoclonal antibodies, and fragments of polyclonal and monoclonal
antibodies.
[0129] The PirB polypeptides of the invention can also be used to
produce antibodies which are immunoreactive or bind to epitopes of
the PirB polypeptides. Antibody which consists essentially of
pooled monoclonal antibodies with different epitopic specificities,
as well as distinct monoclonal antibody preparations are provided.
Monoclonal antibodies are made from antigen containing fragments of
the protein by methods well known in the art (Kohler, et al.,
Nature, 256:495, 1975; Current Protocols in Molecular Biology,
Ausubel, et al., ed., 1989).
[0130] The term "antibody" as used in this invention includes
intact molecules as well as fragments thereof, such as Fab,
F(ab).sub.2, and Fv which are capable of binding the epitopic
determinant. These antibody fragments retain some ability to
selectively bind with its antigen or receptor and are defined as
follows:
[0131] (1) Fab, the fragment which contains a monovalent
antigen-binding fragment of an antibody molecule can be produced by
digestion of whole antibody with the enzyme papain to yield an
intact light chain and a portion of one heavy chain;
[0132] (2) Fab', the fragment of an antibody molecule can be
obtained by treating whole antibody with pepsin, followed by
reduction, to yield an intact light chain and a portion of the
heavy chain; two Fab' fragments are obtained per antibody
molecule;
[0133] (3) (Fab').sub.2, the fragment of the antibody that can be
obtained by treating whole antibody with the enzyme pepsin without
subsequent reduction; F(ab % is a dimer of two Fab' fragments held
together by two disulfide bonds;
[0134] (4) Fv, defined as a genetically engineered fragment
containing the variable region of the light chain and the variable
region of the heavy chain expressed as two chains; and
[0135] (5) Single chain antibody ("SCA"), defined as a genetically
engineered molecule containing the variable region of the light
chains the variable region of the heavy chain, linked by a suitable
polypeptide linker as a genetically fused single chain
molecule.
[0136] Methods of making these fragments are known in the art (See
for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory, New York (1988), incorporated herein by
reference).
[0137] As used in this invention, the term "epitope" means any
antigenic determinant on an antigen to which the paratope of an
antibody binds. Epitopic determinants usually consist of chemically
active surface groupings of molecules such as amino acids or sugar
side chains and usually have specific three dimensional structural
characteristics, as well as specific charge characteristics.
[0138] Antibodies which bind to the PirB polypeptide of the
invention can be prepared using an intact polypeptide or fragments
containing small peptides of interest as the immunizing antigen.
The polypeptide or a peptide used to immunize an animal can be
derived from translated cDNA or chemical synthesis which can be
conjugated to a carrier protein, if desired. Such commonly used
carriers which are chemically coupled to the peptide include
keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum
albumin (BSA), and tetanus toxoid. The coupled peptide is then used
to immunize the animal (e.g., a mouse, a rat, or a rabbit).
[0139] If desired, polyclonal or monoclonal antibodies can be
further purified, for example, by binding to and elution from a
matrix to which the polypeptide or a peptide to which the
antibodies were raised is bound. Those of skill in the art will
know of various techniques common in the immunology arts for
purification and/or concentration of polyclonal antibodies, as well
as monoclonal antibodies (See for example, Coligan, et al., Unit 9,
Current Protocols in Immunology, Wiley Interscience, 1994,
incorporated by reference).
[0140] It is also possible to use the anti-idiotype technology to
produce monoclonal antibodies which mimic an epitope. For example,
an anti-idiotypic monoclonal antibody made to a first monoclonal
antibody will have a binding domain in the hypervariable region
which is the "image" of the epitope bound by the first monoclonal
antibody.
[0141] The preparation of polyclonal antibodies is well-known to
those skilled in the art. See, for example, Green et al.,
Production of polyclonal Antisera, in IMMUNOCHEMICAL PROTOCOLS
(Manson, ed.), pages 1-5 (Humana Press 1992); Coligan et al.,
Production of Polyclonal Antisera in Rabbits, Rats, Mice and
Hamsters, in CURRENT PROTOCOLS IN IMMUNOLOGY, section 2.4.1 (1992),
which are hereby incorporated by reference.
[0142] The preparation of monoclonal antibodies likewise is
conventional. See, for example, Kohler & Milstein, Nature
256:495 (1975); Coligan et al., sections 2.5.1-2.6.7; and Harlow et
al., ANTIBODIES: A LABORATORY MANUAL, page 726 (Cold Spring Harbor
Pub. 1988), which are hereby incorporated by reference. Briefly,
monoclonal antibodies can be obtained by injecting mice with a
composition comprising an antigen, verifying the presence of
antibody production by removing a serum sample, removing the spleen
to obtain B lymphocytes, fusing the B lymphocytes with myeloma
cells to produce hybridomas, cloning the hybridomas, selecting
positive clones that produce antibodies to the antigen, and
isolating the antibodies from the hybridoma cultures. Monoclonal
antibodies can be isolated and purified from hybridoma cultures by
a variety of well-established techniques. Such isolation techniques
include affinity chromatography with Protein-A Sepharose,
size-exclusion chromatography, and ion-exchange chromatography.
See, e.g., Coligan et al., sections 2.7.1-2.7.12 and sections
2.9.1-2.9.3; Barnes et al., Purification of Immunoglobulin G (IgG),
in METHODS 1N MOLECULAR BIOLOGY, VOL. 10, pages 79-104 (Humana
Press 1992). Methods of in vitro and in vivo multiplication of
monoclonal antibodies is well-known to those skilled in the art.
Multiplication in vitro may be carried out in suitable culture
media such as Dulbecco's Modified Eagle Medium or RPMI 1640 medium,
optionally replenished by a mammalian serum such as fetal calf
serum or trace elements and growth-sustaining supplements such as
normal mouse peritoneal exudate cells, spleen cells, bone marrow
macrophages. Production in vitro provides relatively pure antibody
preparations and allows scale-up to yield large amounts of the
desired antibodies. Large scale hybridoma cultivation can be
carried out by homogenous suspension culture in an airlift reactor,
in a continuous stirrer reactor, or in immobilized or entrapped
cell culture. Multiplication in vivo may be carried out by
injecting cell clones into mammals histocompatible with the parent
cells, e.g., syngeneic mice, to cause growth of antibody-producing
tumors. Optionally, the animals are primed with a hydrocarbon,
especially oils such as pristane (tetramethylpentadecane) prior to
injection. After one to three weeks, the desired monoclonal
antibody is recovered from the body fluid of the animal.
[0143] Therapeutic applications are conceivable for the antibodies
of the present invention. For example, antibodies of the present
invention may also be derived from subhuman primate antibody.
General techniques for raising therapeutically useful antibodies in
baboons may be found, for example, in Goldenberg et al.,
International Patent Publication WO 91/11465 (1991) and Losman et
al., Int. J. Cancer 46:310 (1990), which are hereby incorporated by
reference.
[0144] Alternatively, a therapeutically useful anti-PirB antibody
may be derived from a "humanized" monoclonal antibody. Humanized
monoclonal antibodies are produced by transferring mouse
complementary determining regions from heavy and light variable
chains of the mouse immunoglobulin into a human variable domain,
and then substituting human residues in the framework regions of
the murine counterparts. The use of antibody components derived
from humanized monoclonal antibodies obviates potential problems
associated with the immunogenicity of murine constant regions.
General techniques for cloning murine immunoglobulin variable
domains are described, for example, by Orlandi et al., Proc. Nat'l
Acad. Sci. USA 86:3833 (1989), which is hereby incorporated in its
entirety by reference. Techniques for producing humanized
monoclonal antibodies are described, for example, by Jones et al.,
Nature 321: 522 (1986); Riechmann et al., Nature 332: 323 (1988);
Verhoeyen et alt, Science 239: 1534 (1988); Carter et al., Proc.
Nat'l Acad. Sci. USA 89: 4285 (1992); Sandhu, Crit. Rev. Biotech.
12: 437 (1992); and Singer et al., J. Immunol. 150: 2844 (1993),
which are hereby incorporated by reference
[0145] Antibodies of the invention also may be derived from human
antibody fragments isolated from a combinatorial immunoglobulin
library. See, for example, Barbas et al., METHODS: A COMPANION TO
METHODS IN ENZYMOLOGY, VOL. 2, page 119 (1991); Winter et al., Ann.
Rev. Immunol. 12: 433 (1994), which are hereby incorporated by
reference. Cloning and expression vectors that are useful for
producing a human immunoglobulin phage library can be obtained, for
example, from STRATAGENE Cloning Systems (La Jolla, Calif.).
[0146] In addition, antibodies of the present invention may be
derived from a human monoclonal antibody. Such antibodies are
obtained from transgenic mice that have been "engineered" to
produce specific human antibodies in response to antigenic
challenge. In this technique, elements of the human heavy and light
chain loci are introduced into strains of mice derived from
embryonic stem cell lines that contain targeted disruptions of the
endogenous heavy and light chain loci. The transgenic mice can
synthesize human antibodies specific for human antigens, and the
mice can be used to produce human antibody-secreting hybridomas.
Methods for obtaining human antibodies from transgenic mice are
described by Green et al., Nature Genet. 7:13 (1994); Lonberg et
al., Nature 368:856 (1994); and Taylor et al., Int. Immunol. 6:579
(1994), which are hereby incorporated by reference.
[0147] Antibody fragments of the present invention can be prepared
by proteolytic hydrolysis of the antibody or by expression in E.
Coli of DNA encoding the fragment. Antibody fragments can be
obtained by pepsin or papain digestion of whole antibodies by
conventional methods. For example, antibody fragments can be
produced by enzymatic cleavage of antibodies with pepsin to provide
a 5S fragment denoted F(ab').sub.2. This fragment can be further
cleaved using a thiol reducing agent, and optionally a blocking
group for the sulfhydryl groups resulting from cleavage of
disulfide linkages, to produce 3.5S Fab' monovalent fragments.
Alternatively, an enzymatic cleavage using papain produces two
monovalent Fab fragments and an Fc fragment directly. These methods
are described, for example, by Goldenberg, U.S. Pat. Nos. 4,036,945
and 4,331,647, and references contained therein. These patents are
hereby incorporated in their entireties by reference. See also
Nisonhoff et al., Arch. Biochem. Biophys. 89:230 (1960); Porter,
Biochem. J. 73:119 (1959); Edelman et al., METHODS IN ENZYMOLOGY,
VOL. 1, page 422 (Academic Press 1967); and Coligan et al. at
sections 2.8.1-2.8.10 and 2.10.1-2.10.4.
[0148] Other methods of cleaving antibodies, such as separation of
heavy chains to form monovalent light-heavy chain fragments,
further cleavage of fragments, or other enzymatic, chemical, or
genetic techniques may also be used, so long as the fragments bind
to the antigen that is recognized by the intact antibody.
[0149] For example, Fv fragments comprise an association of V.sub.H
and V.sub.L chains. This association may be noncovalent, as
described in Inbar et al., Proc. Nat'l Acad. Sci. USA 69:2659
(1972). Alternatively, the variable chains can be linked by an
intermolecular disulfide bond or cross-linked by chemicals such as
glutaraldehyde. See, e.g., Sandhu, supra. Preferably, the Fv
fragments comprise V and V.sub.L chains connected by a peptide
linker. These single-chain antigen binding proteins (sFv) are
prepared by constructing a structural gene comprising DNA sequences
encoding the V and V.sub.L domains connected by an oligonucleotide.
The structural gene is inserted into an expression vector, which is
subsequently introduced into a host cell such as E. coli. The
recombinant host cells synthesize a single polypeptide chain with a
linker peptide bridging the two V domains. Methods for producing
sFvs are described, for example, by Whitlow et al., METHODS: A
COMPANION TO METHODS IN ENZYMOLOGY, VOL. 2, page 97 (1991); Bird et
al., Science 242:423-426 (1988); Ladner et al., U.S. Pat. No.
4,946,778; Pack et al., Bio/Technology 11: 1271-77 (1993); and
Sandhu, supra.
[0150] Another form of an antibody fragment is a peptide coding for
a single complementarity-determining region (CDR). CDR peptides
("minimal recognition units") can be obtained by constructing genes
encoding the CDR of an antibody of interest. Such genes are
prepared, for example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-producing
cells. See, for example, Larrick et al., METHODS: A COMPANION TO
METHODS IN ENZYMOLOGY, VOL. 2, page 106 (1991).
Peptide Fragments of PirB:
[0151] In another embodiment, the present invention relates to
substantially purified peptide fragments of PirB that block
activation of PirB. Such peptide fragments could represent research
and diagnostic tools in the study of PirB associated therapeutics.
In addition, pharmaceutical compositions comprising isolated and
purified peptide fragments of PirB may represent effective
therapeutics.
[0152] The term "substantially purified" as used herein refers to a
molecule, such as a peptide that is substantially free of other
proteins, lipids, carbohydrates, nucleic acids, and other
biological materials with which it is naturally associated. For
example, a substantially pure molecule, such as a polypeptide, can
be at least 60%, by dry weight, the molecule of interest. One
skilled in the art can purify PIRB peptides using standard protein
purification methods and the purity of the polypeptides can be
determined using standard methods including, e.g., polyacrylamide
gel electrophoresis (e.g., SDS-PAGE), column chromatography (e.g.,
high performance liquid chromatography (HPLC)), and amino-terminal
amino acid sequence analysis.
[0153] The invention relates not only to fragments of
naturally-occurring PirB, but also to PirB mutants and chemically
synthesized derivatives of PirB that block the receptor's
activation.
[0154] For example, changes in the amino acid sequence of PirB are
contemplated in the present invention. PirB can be altered by
changing the DNA encoding the protein. Preferably, only
conservative amino acid alterations are undertaken, using amino
acids that have the same or similar properties. Illustrative amino
acid substitutions include the changes of: alanine to serine;
arginine to lysine; asparagine to glutamine or histidine; aspartate
to glutamate; cysteine to serine; glutamine to asparagine;
glutamate to aspartate; glycine to proline; histidine to asparagine
or glutamine; isoleucine to leucine or valine; leucine to valine or
isoleucine; lysine to arginine, glutamine, or glutamate; methionine
to leucine or isoleucine; phenylalanine to tyrosine, leucine or
methionine; serine to threonine; threonine to serine; tryptophan to
tyrosine; tyrosine to tryptophan or phenylalanine; valine to
isoleucine or leucine
[0155] Additionally, other variants and fragments of PIRB can be
used in the present invention. Variants include analogs, homologs,
derivatives, muteins and mimetics of PIRB that retain the ability
to block membrane fusion. Fragments of the PirB refer to portions
of the amino acid sequence of PirB that also retain this ability.
The variants and fragments can be generated directly from PirB
itself by chemical modification, by proteolytic enzyme digestion,
or by combinations thereof. Additionally, genetic engineering
techniques, as well as methods of synthesizing polypeptides
directly from amino acid residues, can be employed.
[0156] Non-peptide compounds that mimic the antagonistic binding of
PirB ("mimetics") can be produced by the approach outlined in
Saragovi et al., Science 253: 792-95 (1991). Mimetics are molecules
which mimic elements of protein secondary structure. See, for
example, Johnson et al., "Peptide Turn Mimetics," in BIOTECHNOLOGY
AND PHARMACY, Pezzuto et al., Eds., (Chapman and Hall, New York
1993). The underlying rationale behind the use of peptide mimetics
is that the peptide backbone of proteins exists chiefly to orient
amino acid side chains in such a way as to facilitate molecular
interactions. For the purposes of the present invention,
appropriate mimetics can be considered to be the equivalent of PirB
itself when administered to bind PirB ligands.
[0157] Variants and fragments also can be created by recombinant
techniques employing genomic or cDNA cloning methods. Site-specific
and region-directed mutagenesis techniques can be employed. See
CURRENT PROTOCOLS 1N MOLECULAR BIOLOGY vol. 1, ch. 8 (Ausubel et
al. eds., 3. Wiley & Sons 1989 & Supp. 1990-93); PROTEIN
ENGINEERING (Oxender & Fox eds., A. Liss, Inc. 1987). In
addition, linker-scanning and PCR-mediated techniques can be
employed for mutagenesis. See PCR TECHNOLOGY (Erlich ed., Stockton
Press 1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, vols. 1 &
2, supra. Protein sequencing, structure and modeling approaches for
use with any of the above techniques are disclosed in PROTEIN
ENGINEERING, loc. cit., and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY,
vols. 1 & 2, supra.
Inhibiting PirB Expression:
[0158] There are several methods which can be employed in the
inhibition or reduction of PirB Gene expression. these include:
[0159] "Gene silencing" refers to the suppression of gene
expression, e.g., transgene, heterologous gene and/or endogenous
gene expression. Gene silencing may be mediated through processes
that affect transcription and/or through processes that affect
post-transcriptional mechanisms. In some embodiments, gene
silencing occurs when siRNA initiates the degradation of the mRNA
of a gene of interest in a sequence-specific manner via RNA
interference. In some embodiments, gene silencing may be
allele-specific. "Allele-specific" gene silencing refers to the
specific silencing of one allele of a gene.
[0160] "Knock-down," "knock-down technology" refers to a technique
of gene silencing in which the expression of a target gene is
reduced as compared to the gene expression prior to the
introduction of the siRNA, which can lead to the inhibition of
production of the target gene product. The term "reduced" is used
herein to indicate that the target gene expression is lowered by
1-100%. For example, the expression may be reduced by 10, 20, 30,
40, 50, 60, 70, 80, 90, 95, or even 99%. Knock-down of gene
expression can be directed by the use of dsRNAs or siRNAs. For
example, "RNA interference (RNAi)," which can involve the use of
siRNA, has been successfully applied to knockdown the expression of
specific genes in plants, D. melanogaster, C. elegans,
trypanosomes, planaria, hydra, and several vertebrate species
including the mouse.
[0161] "RNA interference (RNAi)" is the process of
sequence-specific, post-transcriptional gene silencing initiated by
siRNA. RNAi is seen in a number of organisms such as Drosophila,
nematodes, fungi and plants, and is believed to be involved in
anti-viral defense, modulation of transposon activity, and
regulation of gene expression. During RNAi, siRNA induces
degradation of target mRNA with consequent sequence-specific
inhibition of gene expression.
[0162] A "small interfering" or "short interfering RNA" or siRNA is
a RNA duplex of nucleotides that is targeted to a gene interest. A
"RNA duplex" refers to the structure formed by the complementary
pairing between two regions of a RNA molecule. siRNA is "targeted"
to a gene in that the nucleotide sequence of the duplex portion of
the siRNA is complementary to a nucleotide sequence of the targeted
gene. In some embodiments, the length of the duplex of siRNAs is
less than 30 nucleotides. In some embodiments, the duplex can be
29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13,
12, 11 or 10 nucleotides in length. In some embodiments, the length
of the duplex is 19-25 nucleotides in length. The RNA duplex
portion of the siRNA can be part of a hairpin structure. In
addition to the duplex portion, the hairpin structure may contain a
loop portion positioned between the two sequences that form the
duplex. The loop can vary in length. In some embodiments the loop
is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length. The
hairpin structure can also contain 3' or 5' overhang portions. In
some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3,
4 or 5 nucleotides in length.
[0163] Furthermore, the term "short interfering RNA", "siRNA",
"short interfering nucleic acid molecule", "short interfering
oligonucleotide molecule", or "chemically-modified short
interfering nucleic acid molecule" as used herein refers to any
nucleic acid molecule capable of inhibiting or down regulating gene
expression or viral replication, for example by mediating RNA
interference "RNAi" or gene silencing in a sequence-specific
manner, see for example Zamore et al., 2000, Cell, 101, 25-33;
Bass, 2001, Nature, 411, 428-429; Elbashir et al., 2001, Nature,
411, 494-498; and Kreutzer et al., International PCT Publication
No. WO 00/44895; Zernicka-Goetz et al., International PCT
Publication No. WO 01/36646; Fire, International PCT Publication
No. WO 99/32619; Plaetinck et al., International PCT Publication
No. WO 00/01846; Mello and Fire, International PCT Publication No.
WO 01/29058; Deschamps-Depaillette, International PCT Publication
No. WO 99/07409; and Li et al., International PCT Publication No.
WO 00/44914; Allshire, 2002, Science, 297, 1818-1819; Volpe et al.,
2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297,
2215-2218; and Hall et al., 2002, Science, 297, 2232-2237;
Hutvagner and Zamore, 2002, Science, 297, 2056-60; McManus et al,
2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene & Dev., 16,
1616-1626; and Reinhart & Bartel, 2002, Science, 297, 1831).
Non limiting examples of siRNA molecules of the invention are shown
in FIGS. 18-20, and Table I herein. For example the siRNA can be a
double-stranded polynucleotide molecule comprising
self-complementary sense and antisense regions, wherein the
antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siRNA can be assembled from two
separate oligonucleotides, where one strand is the sense strand and
the other is the antisense strand, wherein the antisense and sense
strands are self-complementary (i.e. each strand comprises
nucleotide sequence that is complementary to nucleotide sequence in
the other strand; such as where the antisense strand and sense
strand form a duplex or double stranded structure, for example
wherein the double stranded region is about 19 base pairs); the
antisense strand comprises nucleotide sequence that is
complementary to nucleotide sequence in a target nucleic acid
molecule or a portion thereof and the sense strand comprises
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. Alternatively, the siRNA is
assembled from a single oligonucleotide, where the
self-complementary sense and antisense regions of the siRNA are
linked by means of a nucleic acid based or non-nucleic acid-based
linker(s). The siRNA can be a polynucleotide with a duplex,
asymmetric duplex, hairpin or asymmetric hairpin secondary
structure, having self-complementary sense and antisense regions,
wherein the antisense region comprises nucleotide sequence that is
complementary to nucleotide sequence in a separate target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof. The siRNA can be a circular
single-stranded polynucleotide having two or more loop structures
and a stem comprising self-complementary sense and antisense
regions, wherein the antisense region comprises nucleotide sequence
that is complementary to nucleotide sequence in a target nucleic
acid molecule or a portion thereof and the sense region having
nucleotide sequence corresponding to the target nucleic acid
sequence or a portion thereof, and wherein the circular
polynucleotide can be processed either in vivo or in vitro to
generate an active siRNA molecule capable of mediating RNAi. The
siRNA can also comprise a single stranded polynucleotide having
nucleotide sequence complementary to nucleotide sequence in a
target nucleic acid molecule or a portion thereof (for example,
where such siRNA molecule does not require the presence within the
siRNA molecule of nucleotide sequence corresponding to the target
nucleic acid sequence or a portion thereof), wherein the single
stranded polynucleotide can further comprise a terminal phosphate
group, such as a 5'-phosphate (see for example Martinez et al.,
2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell,
10, 537-568), or 5',3'-diphosphate. In certain embodiment, the
siRNA molecule of the invention comprises separate sense and
antisense sequences or regions, wherein the sense and antisense
regions are covalently linked by nucleotide or non-nucleotide
linkers molecules as is known in the art, or are alternately
non-covalently linked by ionic interactions, hydrogen bonding, van
der waals interactions, hydrophobic intercations, and/or stacking
interactions. In certain embodiments, the siRNA molecules of the
invention comprise nucleotide sequence that is complementary to
nucleotide sequence of a target gene. In another embodiment, the
siRNA molecule of the invention interacts with nucleotide sequence
of a target gene in a manner that causes inhibition of expression
of the target gene. As used herein, siRNA molecules need not be
limited to those molecules containing only RNA, but further
encompasses chemically-modified nucleotides and non-nucleotides. In
certain embodiments, the short interfering nucleic acid molecules
of the invention lack 2'-hydroxy (2'-OH) containing nucleotides.
Optionally, siRNA molecules can comprise ribonucleotides at about
5, 10, 20, 30, 40, or 50% of the nucleotide positions. The modified
short interfering nucleic acid molecules of the invention can also
be referred to as short interfering modified oligonucleotides
"siMON." As used herein, the term siRNA is meant to be equivalent
to other terms used to describe nucleic acid molecules that are
capable of mediating sequence specific RNAi, for example short
interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA
(miRNA), short hairpin RNA (shRNA), short interfering
oligonucleotide, short interfering nucleic acid, short interfering
modified oligonucleotide, chemically-modified siRNA,
post-transcriptional gene silencing RNA (ptgsRNA), and others. In
addition, as used herein, the term RNAi is meant to be equivalent
to other terms used to describe sequence specific RNA interference,
such as post transcriptional gene silencing, translational
inhibition, or epigenetics. For example, siRNA molecules of the
invention can be used to epigenetically silence genes at both the
post-transcriptional level or the pre-transcriptional level. In a
non-limiting example, epigenetic regulation of gene expression by
siRNA molecules of the invention can result from siRNA mediated
modification of chromatin structure to alter gene expression (see,
for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra
et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297,
1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein,
2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297,
2232-2237).
[0164] The siRNA can be encoded by a nucleic acid sequence, and the
nucleic acid sequence can also include a promoter. The nucleic acid
sequence can also include a polyadenylation signal. In some
embodiments, the polyadenylation signal is a synthetic minimal
polyadenylation signal.
Synthesis of siRNA Molecules of the Invention
[0165] The method of synthesis used for RNA including certain siRNA
molecules of the invention follows the procedure as described in
Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al.,
1990, Nucleic Acids Res., 18, 5433; and Wincott et al., 1995,
Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol.
Bio., 74, 59, and makes use of common nucleic acid protecting and
coupling groups, such as dimethoxytrityl at the 5'-end, and
phosphoramidites at the 3'-end. In a non-limiting example, small
scale syntheses are conducted on a 394 Applied Biosystems, Inc.
synthesizer using a 0.2 .mu.mol scale protocol with a 7.5 min
coupling step for alkylsilyl protected nucleotides and a 2.5 min
coupling step for 2'-O-methylated nucleotides. Alternatively,
syntheses at the 0.2 umol scale can be done on a 96-well plate
synthesizer, such as the instrument produced by Protogene (Palo
Alto, Calif.) with minimal modification to the cycle. A 33-fold
excess (60 uL of 0.11 M=6.6 umol) of 2'-O-methyl phosphoramidite
and a 75-fold excess of S-ethyl tetrazole (60 uL of 0.25 M=15 umol)
can be used in each coupling cycle of 2'-O-methyl residues relative
to polymer-bound 5'-hydroxyl. A 66-fold excess (120 uL of 0.11
M=13.2 umol) of alkylsilyl (ribo) protected phosphoramidite and a
150-fold excess of S-ethyl tetrazole (120 uL of 0.25 M=30 umol) can
be used in each coupling cycle of ribo residues relative to
polymer-bound 5'-hydroxyl. Average coupling yields on the 394
Applied Biosystems, Inc. synthesizer, determined by calorimetric
quantitation of the trityl fractions, are typically 97.5-99%. Other
oligonucleotide synthesis reagents for the 394 Applied Biosystems,
Inc. synthesizer include the following: detritylation solution is
3% TCA in methylene chloride (ABI); capping is performed with 16%
N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10%
2,6-lutidine in TBF (ABI); oxidation solution is 16.9 mM I.sub.2,
49 mM pyridine, 9% water in THF (PERSEPTIVE.TM.). Burdick &
Jackson Synthesis Grade acetonitrile is used directly from the
reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile)
is made up from the solid obtained from American International
Chemical, Inc. Alternately, for the introduction of
phosphorothioate linkages, Beaucage reagent
(3H-1,2-Benzodithiol-3-one 1,1-dioxide 0.05 M in acetonitrile) is
used.
[0166] Deprotection of the RNA is performed using either a two-pot
or one-pot protocol. For the two-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 40% aq. methylamine (1 mL)
at 65 degrees C. for 10 minutes. After cooling to -20 degrees C.,
the supernatant is removed from the polymer support. The support is
washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and
the supernatant is then added to the first supernatant. The
combined supernatants, containing the oligoribonucleotide, are
dried to a white powder. The base deprotected oligoribonucleotide
is resuspended in anhydrous TEA/HF/NMP solution (300 uL of a
solution of 1.5 mL-N-methylpyrrolidinone, 750 uL TEA and 1 mL
TEA.3HF to provide a 1.4 M HF concentration) and heated to 65
degrees C. After 1.5 h, the oligomer is quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0167] Alternatively, for the one-pot protocol, the polymer-bound
trityl-on oligoribonucleotide is transferred to a 4 mL glass screw
top vial and suspended in a solution of 33% ethanolic
methylamine/DMSO: 1/1 (0.8 mL) at 65 degrees C. for 15 minutes. The
vial is brought to room temperature TEA.3HF (0.1 mL) is added and
the vial is heated at 65 degrees C. for 15 minutes. The sample is
cooled at -20 degrees C. and then quenched with 1.5 M
NH.sub.4HCO.sub.3.
[0168] For purification of the trityl-on oligomers, the quenched
NH.sub.4HCO.sub.3. solution is loaded onto a C-18 containing
cartridge that had been prewashed with acetonitrile followed by 50
mM TEAA. After washing the loaded cartridge with water, the RNA is
detritylated with 0.5% TFA for 13 minutes. The cartridge is then
washed again with water, salt exchanged with 1 M NaCl and washed
with water again. The oligonucleotide is then eluted with 30%
acetonitrile.
[0169] The average stepwise coupling yields are typically >98%
(Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684). Those of
ordinary skill in the art will recognize that the scale of
synthesis can be adapted to be larger or smaller than the example
described above including but not limited to 96-well format.
[0170] Alternatively, the nucleic acid molecules of the present
invention can be synthesized separately and joined together
post-synthetically, for example, by ligation (Moore et al., 1992,
Science 256, 9923; Draper et al., International PCT publication No.
WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19,
4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951;
Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by
hybridization following synthesis and/or deprotection.
[0171] It will be apparent to one skilled in the art that the
inclusion of modified bases, as well as the naturally occurring
bases cytosine, uracil, adenosine and guanosine, may confer
advantageous properties on siRNA molecules containing said modified
bases. For example, modified bases may increase the stability of
the siRNA molecule thereby reducing the amount required to produce
a desired effect. The provision of modified bases may also provide
siRNA molecules which are more or less stable.
[0172] The term "modified nucleotide base" encompasses nucleotides
with a covalently modified base and/or sugar. For example, modified
nucleotides include nucleotides having sugars which are covalently
attached to low molecular weight organic groups other than a
hydroxyl group at the 3' position and other than a phosphate group
at the 5' position. Thus modified nucleotides may also include 2'
substituted sugars such as 2'-O-methyl-; 2-O-alkyl; 2-O-allyl;
2'-S-alkyl; 2'-S-allyl; 2'-fluoro-; 2'-halo or 2; azido-ribose,
carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such
as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars,
and sedoheptulose.
[0173] Modified nucleotides are known in the art and include by
example and not by way of limitation; alkylated purines and/or
pyrimidines; acylated purines and/or pyrimidines; or other
heterocycles. These classes of pyrimidines and purines are known in
the art and include, pseudoisocytosine; N4, N4-ethanocytosine;
8-hydroxy-N6-methyladenine; 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil;
5-carboxymethylaminomethyl-2-thiouracil; 5-carboxymethylaminomethyl
uracil; dihydrouracil; inosine; N6 isopentyl-adenine;
1-methyladenine; 1-methylpseudouracil; 1-methylguanine;
2,2-dimethylguanine; 2-methyladenine; 2-methylguanine;
3-methylcytosine; 5-methylcytosine; N6-methyladenine;
7-methylguanine; 5-methylaminomethyl uracil; 5-methoxy amino
methyl-2-thiouracil; beta-D-mannosylqueosine;
5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2
methylthio-N-6-isopentenyladenine; uracil-5-oxyacetic acid methyl
ester; psueouracil; 2-thiocytosine; 5-methyl-2 thiouracil,
2-thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic
acid methylester; uracil 5-oxyacetic acid; queosine;
2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil;
5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine;
and 2,6,-diaminopurine; methylpsuedouracil; 1-methylguanine;
1-methylcytosine.
[0174] The siRNA molecules of the invention can be synthesized
using conventional phosphodiester linked nucleotides and
synthesized using standard solid or solution phase synthesis
techniques which are known in the art. Linkages between nucleotides
may use alternative linking molecules. For example, linking groups
of the formula P(O)S, (thioate); P(S)S, (dithioate); P(O)NR12;
P(O)R'; P(O)OR6; CO; or CONR12 wherein R is H (or a salt) or alkyl
(1-12C) and R6 is alkyl (1-9C) is joined to adjacent nucleotides
through --O-- or --S--.
Administration of siRNA Moleclues of the Invention
[0175] A siRNA molecule of the invention can be adapted for use to
treat any PirB associated disease or disorder, and other
indications that can respond to the level of gene product in a cell
or tissue, alone or in combination with other therapies.
Non-limiting examples of such diseases and conditions include those
as defined under Nervous System defects, disorders and diseases
described above, and any other indications that can respond to the
level of an expressed gene product in a cell or organism (see for
example McSwiggen, International PCT Publication No. WO 03/74654).
For example, a siRNA molecule can comprise a delivery vehicle,
including liposomes, for administration to a subject, carriers and
diluents and their salts, and/or can be present in pharmaceutically
acceptable formulations. Methods for the delivery of nucleic acid
molecules are described in Akhtar et al., 1992, Trends Cell Bio.,
2, 139; Delivery Strategies for Antisense Oligonucleotide
Therapeutics, ed. Akhtar, 1995, Maurer et al., 1999, Mol. Membr.
Biol., 16, 129-140; Hofland and Huang, 1999, Handb. Exp.
Pharmacol., 137, 165-192; and Lee et al., 2000, ACS Symp. Ser.,
752, 184-192, all of which are incorporated herein by reference.
Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan et al., PCT
WO 94/02595 further describe the general methods for delivery of
nucleic acid molecules. These protocols can be utilized for the
delivery of virtually any nucleic acid molecule. Nucleic acid
molecules can be administered to cells by a variety of methods
known to those of skill in the art, including, but not restricted
to, encapsulation in liposomes, by iontophoresis, or by
incorporation into other vehicles, such as biodegradable polymers,
hydrogels, cyclodextrins (see for example Gonzalez et al., 1999,
Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT
publication Nos. WO 03/47518 and WO 03/46185),
poly(lactic-co-glycolic)ac-id (PLGA) and PLCA microspheres (see for
example U.S. Pat. No. 6,447,796 and US Patent Application
Publication No. US 2002130430), biodegradable nanocapsules, and
bioadhesive microspheres, or by proteinaceous vectors (O'Hare and
Normand, International PCT Publication No. WO 00/53722). In one
embodiment, nucleic acid molecules or the invention are
administered via biodegradable implant materials, such as elastic
shape memory polymers (see for example Lendelein and Langer, 2002,
Science, 296, 1673). In another embodiment, the nucleic acid
molecules of the invention can also be formulated or complexed with
polyethyleneimine and derivatives thereof, such as
polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine
(PEI-PEG-GAL) or
polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosamine
(PEI-PEG-triGAL) derivatives. Alternatively, the nucleic
acid/vehicle combination is locally delivered by direct injection
or by use of an infusion pump. Direct injection of the nucleic acid
molecules of the invention, whether subcutaneous, intramuscular, or
intradermal, can take place using standard needle and syringe
methodologies, or by needle-free technologies such as those
described in Conry et al., 1999, Clin. Cancer Res., 5, 2330-2337
and Barry et al., international PCT Publication No. WO 99/31262.
Many examples in the art describe CNS delivery methods of
oligonucleotides by osmotic pump, (see Chun et al., 1998,
Neuroscience Letters, 257, 135-138, D'Aldin et al., 1998, Mol.
Brain. Research, 55, 151-164, Dryden et al., 1998, J. Endocrinol.,
157, 169-175, Ghimikar et al., 1998, Neuroscience Letters, 247,
21-24) or direct infusion (Broaddus et al., 1997, Neurosurg. Focus,
3, article 4). Other routes of delivery include, but are not
limited to oral (tablet or pill form) and/or intrathecal delivery
(Gold, 1997, Neuroscience, 76, 1153-1158). More detailed
descriptions of nucleic acid delivery and administration are
provided in Sullivan et al., supra, Draper et al., PCT WO93/23569,
Beigelman et al., PCT WO99/05094, and Klimuk et al., PCT WO99/04819
all of which have been incorporated by reference herein. The
molecules of the instant invention can be used as pharmaceutical
agents. Pharmaceutical agents prevent, modulate the occurrence, or
treat (alleviate a symptom to some extent, preferably all of the
symptoms) of a disease state in a subject.
[0176] In one embodiment, a siRNA molecule of the invention is
complexed with membrane disruptive agents such as those described
in U.S. Patent Application Publication No. 20010007666,
incorporated by reference herein in its entirety including the
drawings. In another embodiment, the membrane disruptive agent or
agents and the siRNA molecule are also complexed with a cationic
lipid or helper lipid molecule, such as those lipids described in
U.S. Pat. No. 6,235,310, incorporated by reference herein in its
entirety including the drawings.
[0177] In one embodiment, siRNA molecules of the invention are
formulated or complexed with polyethylenimine (e.g., linear or
branched PEI) and/or polyethylenimine derivatives, including for
example grafted PEIs such as galactose PEI, cholesterol PEI,
antibody derivatized PEI and polyethylene glycol PEI (PEG-PEI)
derivatives thereof (see for example Ogris et al., 2001, AAPA
PharmiSci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14,
840847; Kunath et al., 2002, Pharmaceutical Research, 19, 810-817;
Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et
al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002,
Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of
Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999., PNAS USA,
96, 5177-5181; Godbey et al., 1999, Journal of Controlled Release,
60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry,
274, 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99,
14640-14645; and Sagara, U.S. Pat. No. 6,586,524, incorporated by
reference herein.
[0178] In one embodiment, a siRNA molecule of the invention
comprises a bioconjugate, for example a nucleic acid conjugate as
described in Vargeese et al., U.S. Ser. No. 10/427,160, filed Apr.
30, 2003; U.S. Pat. No. 6,528,631; U.S. Pat. No. 6,335,434; U.S.
Pat. No. 6,235,886; U.S. Pat. No. 6,153,737; U.S. Pat. No.
5,214,136; U.S. Pat. No. 5,138,045, all incorporated by reference
herein.
[0179] Thus, the invention features a pharmaceutical composition
comprising one or more nucleic acid(s) of the invention in an
acceptable carrier, such as a stabilizer, buffer, and the like. The
polynucleotides of the invention can be administered (e.g., RNA,
DNA or protein) and introduced into a subject by any standard
means, with or without stabilizers, buffers, and the like, to form
a pharmaceutical composition. When it is desired to use a liposome
delivery mechanism, standard protocols for formation of liposomes
can be followed. The compositions of the present invention can also
be formulated and used as tablets, capsules or elixirs for oral
administration; suppositories for rectal administration, sterile
solutions, suspensions for injectable administration, and the other
compositions known in the art.
[0180] The present invention also includes pharmaceutically
acceptable formulations of the compounds described. These
formulations include salts of the above compounds, e.g., acid
addition salts, for example, salts of hydrochloric, hydrobromic,
acetic acid, and benzene sulfonic acid.
[0181] A pharmacological composition or formulation refers to a
composition or formulation in a form suitable for administration,
e.g., systemic administration, into a cell or subject, including
for example a human. Suitable forms, in part, depend upon the use
or the route of entry, for example oral, transdermal, or by
injection. Such forms should not prevent the composition or
formulation from reaching a target cell (i.e., a cell to which the
negatively charged nucleic acid is desirable for delivery). For
example, pharmacological compositions injected into the blood
stream should be soluble. Other factors are known in the art, and
include considerations such as toxicity and forms that prevent the
composition or formulation from exerting its effect.
[0182] By "systemic administration" is meant in vivo systemic
absorption or accumulation of drugs in the blood stream followed by
distribution throughout the entire body. Administration routes that
lead to systemic absorption include, without limitation:
intravenous, subcutaneous, intraperitoneal, inhalation, oral,
intrapulmonary and intramuscular. Each of these administration
routes exposes the siRNA molecules of the invention to an
accessible diseased tissue. The rate of entry of a drug into the
circulation has been shown to be a function of molecular weight or
size. The use of a liposome or other drug carrier comprising the
compounds of the instant invention can potentially localize the
drug, for example, in certain tissue types, such as the tissues of
the reticular endothelial system (RES). A liposome formulation that
can facilitate the association of drug with the surface of cells,
such as, lymphocytes and macrophages is also useful. This approach
can provide enhanced delivery of the drug to target cells by taking
advantage of the specificity of macrophage and lymphocyte immune
recognition of abnormal cells, such as cancer cells.
[0183] By "pharmaceutically acceptable formulation" is meant a
composition or formulation that allows for the effective
distribution of the nucleic acid molecules of the instant invention
in the physical location most suitable for their desired activity.
Non-limiting examples of agents suitable for formulation with the
nucleic acid molecules of the instant invention include:
P-glycoprotein inhibitors (such as Pluronic P85), which can enhance
entry of drugs into the CNS (Jolliet-Riant and Tillement, 1999,
Fundam. Clin. Pharmacol., 13, 16-26); biodegradable polymers, such
as poly (DL-lactide-coglycolide) microspheres for sustained release
delivery after intracerebral implantation (Emerich, D F et al,
1999, Cell Transplant, 8, 47-58) (Alkermes, Inc. Cambridge, Mass.);
and loaded nanoparticles, such as those made of
polybutylcyanoacrylate, which can deliver drugs across the blood
brain barrier and can alter neuronal uptake mechanisms (Prog
Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999). Other
non-limiting examples of delivery strategies for the nucleic acid
molecules of the instant invention include material described in
Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tyler et al.,
1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA.,
92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107;
Aldrian-Herrada et al., 1998, Nucleic Acids Res., 26, 49104916; and
Tyler et al., 1999, PNAS USA, 96, 7053-7058.
[0184] The invention also features the use of the composition
comprising surface-modified liposomes containing poly (ethylene
glycol) lipids (PEG-modified, or long-circulating liposomes or
stealth liposomes). These formulations offer a method for
increasing the accumulation of drugs in target tissues. This class
of drug carriers resists opsonization and elimination by the
mononuclear phagocytic system (MPS or RES), thereby enabling longer
blood circulation times and enhanced tissue exposure for the
encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627;
Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such
liposomes have been shown to accumulate selectively in tumors,
presumably by extravasation and capture in the neovascularized
target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et
al., 1995, Biochim. Biophys. Acta, 1238, 86-90). The
long-circulating liposomes enhance the pharmacokinetics and
pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; Choi et al., International PCT Publication No. WO
96/10391; Ansell et al., International PCT Publication No. WO
96/10390; Holland et al., International PCT Publication No. WO
96/10392). Long-circulating liposomes are also likely to protect
drugs from nuclease degradation to a greater extent compared to
cationic liposomes, based on their ability to avoid accumulation in
metabolically aggressive MPS tissues such as the liver and
spleen.
[0185] The present invention also includes compositions prepared
for storage or administration that include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in Remington's Pharmaceutical Sciences,
Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated
by reference herein. For example, preservatives, stabilizers, dyes
and flavoring agents can be provided. These include sodium
benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In
addition, antioxidants and suspending agents can be used.
[0186] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective dose depends on the type of disease,
the composition used, the route of administration, the type of
mammal being treated, the physical characteristics of the specific
mammal under consideration, concurrent medication, and other
factors that those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body
weight/day of active ingredients is administered dependent upon
potency of the negatively charged polymer.
[0187] The nucleic acid molecules of the invention and formulations
thereof can be administered orally, topically, parenterally, by
inhalation or spray, or rectally in dosage unit formulations
containing conventional non-toxic pharmaceutically acceptable
carriers, adjuvants and/or vehicles. The term parenteral as used
herein includes percutaneous, subcutaneous, intravascular (e.g.,
intravenous), intramuscular, or intrathecal injection or infusion
techniques and the like. In addition, there is provided a
pharmaceutical formulation comprising a nucleic acid molecule of
the invention and a pharmaceutically acceptable carrier. One or
more nucleic acid molecules of the invention can be present in
association with one or more non-toxic pharmaceutically acceptable
carriers and/or diluents and/or adjuvants, and if desired other
active ingredients. The pharmaceutical compositions containing
nucleic acid molecules of the invention can be in a form suitable
for oral use, for example, as tablets, troches, lozenges, aqueous
or oily suspensions, dispersible powders or granules, emulsion,
hard or soft capsules, or syrups or elixirs.
[0188] Compositions intended for oral use can be prepared according
to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions can contain one
or more such sweetening agents, flavoring agents, coloring agents
or preservative agents in order to provide pharmaceutically elegant
and palatable preparations. Tablets contain the active ingredient
in admixture with non-toxic pharmaceutically acceptable excipients
that are suitable for the manufacture of tablets. These excipients
can be, for example, inert diluents; such as calcium carbonate,
sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating and disintegrating agents, for example, corn starch, or
alginic acid; binding agents, for example starch, gelatin or
acacia; and lubricating agents, for example magnesium stearate,
stearic acid or talc. The tablets can be uncoated or they can be
coated by known techniques. In some cases such coatings can be
prepared by known techniques to delay disintegration and absorption
in the gastrointestinal tract and thereby provide a sustained
action over a longer period. For example, a time delay material
such as glyceryl monosterate or glyceryl distearate can be
employed.
[0189] Formulations for oral use can also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an
inert solid diluent, for example, calcium carbonate, calcium
phosphate or kaolin, or as soft gelatin capsules wherein the active
ingredient is mixed with water or an oil medium, for example peanut
oil, liquid paraffin or olive oil.
[0190] Aqueous suspensions contain the active materials in a
mixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents, such as sucrose or saccharin.
[0191] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example beeswax, hard paraffin or cetyl alcohol. Sweetening agents
and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an anti-oxidant such as ascorbic acid
[0192] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Suitable dispersing
or wetting agents or suspending agents are exemplified by those
already mentioned above. Additional excipients, for example
sweetening, flavoring and coloring agents, can also be present.
[0193] Pharmaceutical compositions of the invention can also be in
the form of oil-in-water emulsions. The oily phase can be a
vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example gum
acacia or gum tragacanth, naturally-occurring phosphatides, for
example soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0194] Syrups and elixirs can be formulated with sweetening agents,
for example glycerol, propylene glycol, sorbitol, glucose or
sucrose. Such formulations can also contain a demulcent, a
preservative and flavoring and coloring agents. The pharmaceutical
compositions can be in the form of a sterile injectable aqueous or
oleaginous suspension. This suspension can be formulated according
to the known art using those suitable dispersing or wetting agents
and suspending agents that have been mentioned above. The sterile
injectable preparation can also be a sterile injectable solution or
suspension in a non-toxic parentally acceptable diluent or solvent,
for example as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water, Ringer's
solution and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil can be
employed including synthetic mono- or diglycerides. In addition,
fatty acids such as oleic acid find use in the preparation of
injectables.
[0195] The nucleic acid molecules of the invention can also be
administered in the form of suppositories, e.g., for rectal
administration of the drug. These compositions can be prepared by
mixing the drug with a suitable non-irritating excipient that is
solid at ordinary temperatures but liquid at the rectal temperature
and will therefore melt in the rectum to release the drug. Such
materials include cocoa butter and polyethylene glycols.
[0196] Nucleic acid molecules of the invention can be administered
parenterally in a sterile medium. The drug, depending on the
vehicle and concentration used, can either be suspended or
dissolved in the vehicle. Advantageously, adjuvants such as local
anesthetics, preservatives and buffering agents can be dissolved in
the vehicle.
[0197] Dosage levels of the order of from about 0.1 mg to about 140
mg per kilogram of body weight per day are useful in the treatment
of the above-indicated conditions (about 0.5 mg to about 7 g per
subject per day). The amount of active ingredient that can be
combined with the carrier materials to produce a single dosage form
varies depending upon the host treated and the particular mode of
administration. Dosage unit forms generally contain between from
about 1 mg to about 500 mg of an active ingredient.
[0198] It is understood that the specific dose level for any
particular subject depends upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, sex, diet, time of administration, route of
administration, and rate of excretion, drug combination and the
severity of the particular disease undergoing therapy.
[0199] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0200] The nucleic acid molecules of the present invention can also
be administered to a subject in combination with other therapeutic
compounds to increase the overall therapeutic effect. The use of
multiple compounds to treat an indication can increase the
beneficial effects while reducing the presence of side effects.
Kits
[0201] The present invention can be used alone or as a component of
a kit having at least one of the reagents necessary to carry out
the in vitro or in vivo introduction of RNA to test samples and/or
subjects. For example, preferred components of the kit include a
siRNA molecule of the invention and a vehicle that promotes
introduction of the siRNA into cells of interest as described
herein (e.g., using lipids and other methods of transfection known
in the art, see for example Beigelman et al, U.S. Pat. No.
6,395,713). The kit can be used for target validation, such as in
determining gene function and/or activity, or in drug optimization,
and in drug discovery (see for example Usman et al., U.S. Ser. No.
60/402,996). Such a kit can also include instructions to allow a
user of the kit to practice the invention.
Small Molecule and Peptide Mimetic Pharmaceutical Compositions:
[0202] The small molecule and peptide mimetics compounds which can
be identified as described above and act as PirB antagonist (also
referred to herein as "active compounds") of the invention can be
incorporated into pharmaceutical compositions suitable for
administration. Such compositions typically comprise the active
compounds and a pharmaceutically acceptable carrier. As used herein
the language "pharmaceutically acceptable carrier" is intended to
include any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like, compatible with pharmaceutical
administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. As
discussed above, supplementary active compounds can also be
incorporated into the compositions.
[0203] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include, but are not limited
to, parenteral, e.g., intravenous, intradermal, intramuscular,
intraosseous, subcutaneous, oral, intranasal, inhalation,
transdermal (topical), transmucosal, and rectal administration.
Solutions or suspensions used for parenteral, intradermal, or
subcutaneous application can include the following components: a
sterile diluent such as water for injection, saline solution, fixed
oils, polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating agents such as ethylenediaminetetraacetic
acid; buffers such as acetates, citrates or phosphates and agents
for the adjustment of tonicity such as sodium chloride or dextrose.
pH can be adjusted with acids or bases, such as hydrochloric acid
or sodium hydroxide. The parenteral preparation can be enclosed in
ampoules, disposable syringes or multiple dose vials made of glass
or plastic.
[0204] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM.. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). The composition preferably is
sterile and should be fluid to the extent that easy syringability
exists. The compositions suitably should be stable under the
conditions of manufacture and storage and preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0205] Sterile injectable solutions can be prepared by
incorporating the active compound (e.g.,
NeuAc.alpha.2-3(6-O-sulfo)Gal.beta.1-4(Fuc.alpha.1-3)GlcNAc.beta.-O--(CH.-
sub.2).sub.3--NH--CO(CH.sub.2).sub.5NH-M, where M is a hydrogen or
amide linkage) in a therapeutically effective or beneficial amount
in an appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle which contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, the preferred methods of preparation
are vacuum drying and freeze-drying which yields a powder of the
active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof.
[0206] Oral compositions generally include an inert diluent or an
edible carrier. Suitable oral compositions may be e.g. enclosed in
gelatin capsules or compressed into tablets. For the purpose of
oral therapeutic administration, the active compound can be
incorporated with excipients and used in the form of tablets,
troches, or capsules. Oral compositions can also be prepared using
a fluid carrier for use as a mouthwash, wherein the compound in the
fluid carrier is applied orally and swished and expectorated or
swallowed. Pharmaceutically compatible binding agents, and/or
adjuvant materials can be included as part of the composition. The
tablets, pills, capsules, troches and the like can contain any of
the following ingredients, or compounds of a similar nature: a
binder such as microcrystalline cellulose, gum tragacanth or
gelatin; an excipient such as starch or lactose, a disintegrating
agent such as alginic acid, Primogel, or corn starch; a lubricant
such as magnesium stearate or Sterotes; a glidant such as colloidal
silicon dioxide; a sweetening agent such as sucrose or saccharin;
or a flavoring agent such as peppermint, methyl salicylate, or
orange flavoring.
[0207] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as hydroxyfluoroalkane (HFA), or a nebulizer. Alternatively,
intranasal preparations may be comprised of dry powders with
suitable propellants such as HFA.
[0208] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0209] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0210] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially e.g. from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No.
4,522,811.
[0211] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0212] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD.sub.50 (the
dose lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds
which exhibit large therapeutic indices are preferred. While
compounds that exhibit toxic side effects may be used, care should
be taken to design a delivery system that targets such compounds to
the site of affected tissue in order to minimize potential damage
to uninfected cells and, thereby, reduce side effects.
[0213] Data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED50 with little or
no toxicity. The dosage may vary within-this range depending upon
the dosage form employed and the route of administration utilized.
For any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from cell
culture assays. A dose may be formulated in animal models to
achieve a circulating plasma concentration range that includes the
IC.sub.50 (i.e., the concentration of the test compound which
achieves a half-maximal inhibition of symptoms) as determined in
cell culture. Such information can be used to more accurately
determine useful doses in humans. Levels in plasma may be measured,
for example, by high performance liquid chromatography.
[0214] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions (e.g.
written) for administration, particularly such instructions for use
of the active agent to treat against a disorder or disease as
disclosed herein, including diseases or disorders associated with
Siglec-8 expressing cells.
EXEMPLIFICATION
[0215] This invention is further illustrated by the following
examples which are provided for the purpose of illustration only
and the invention should in no way be construed as being limited to
these examples but rather should be construed to encompass any and
all variations which become evident as a result of the teaching
provided herein. The contents of all references, patents, and
published patent applications cited throughout this application, as
well as the figures, are incorporated herein by reference. The
following non-limiting examples are illustrative of the
invention.
Methods and Materials
Generation of PirBTM Mice
[0216] Genomic PirB was amplified by PCR from C57/BL6 mice and
inserted into the pK-11 plasmid (40). All constructs were verified
by sequencing. A 3041 bp fragment including the exons 5, 6, 7, 8,
and 9 was amplified using primers tctgggcccgtcttctggtgaattgtatgg
and gtgtgaatgtcgtgctatgg. Fragments were digested with Apa1 and
cloned into the Apa1 site 5' to LoxP. A 1027 bp fragment including
exons 10, 11, 12, and 13 was amplified with primers
atatgtcgaccagcatgagcctgtcacac and atatgtcgacttggccctaaggtttagcac,
cut with Sal I and cloned into the Sal I site, just 3' to LoxP and
1' to Frt. A 1900 bp fragment including exons 14 and 15 was
amplified with primers
ataccgcggataacttcgtataatgtatgctatacgaagttatgggaccatgtttcttccag,
which includes a second LoxP site, and
tatccgcggttaattaattgaacttagtataacagtcc, cut with Sac II, and cloned
into the SacII site 3' to Frt, resulting in the construct shown in
Figure S1. The vector was electroporated into 129 J1 ES cells, and
positive clones were identified by PCR and by Southern
hybridization with two separate probes representing the 5' and 3'
ends of the construct.
[0217] Genomic DNA was extracted from founder mice and transgene
was confirmed by Southern hybridization and by PCR. Mice were
crossed with Cre expressing deleter strain
(B6.FVB-TgN(EIIa-cre)C5379Lmgd, Jackson), expressing Cre
recombinase, and mutant PirB gene with deletion of exons 10, 11,
12, and 13, was confirmed by PCR. Mutant protein was confirmed by
Western blotting. Siblings from 10-15 independent matings of
heterozygotes were taken to create WT and PirBTM colonies.
In Situ Hybridization
[0218] All animal procedures were performed according to
institutional guidelines and approved protocols at Harvard Medical
School. Mice were anaesthetized with Halothane (Halocarbon, River
Edge N.J.) and euthanized by injection of 0.1 ml of Euthasol
(Delmarva Laboratories). Brains were removed, placed in M1
embedding matrix (Shandon), and frozen in a dry ice/ethanol bath.
In situ hybridization was performed as described (41). Cryostat
sections (12 .mu.m) of brain were cut, air dried, fixed for 30 min
in sodium phosphate-buffered 4% paraformaldehyde, dehydrated with
ethanol, and stored at -80.degree. C. Sections were thawed,
permeabilized by proteinase K treatment, acetylated, dehydrated
with ethanol, and hybridized at 62.degree. C. for 12-18 hours with
a riboprobe labeled with [35S] UTP (1250 Ci/mmol). The sections
were then incubated with 50 .mu.g/ml RNase A for 30 min. at
37.degree. C. and washed with a series of SSC solutions, with a
high stringency wash of 0.1.times.SSC at 60.degree. C. for 30 min.
After exposure to Kodak XAR-5 film at room temperature, sections
were coated with NTB-2 emulsion and developed after 24 weeks. To
make the PirB probes, the 3' end of PirB mRNA was amplified by
RT-PCR using primer sequences tcggggaaaattcaggaa and
gagaaatctctagctttattt. The T7 binding sequence
taatacgactcactatagggac was added to the 3' primer in order to
transcribe antisense probe, or to the 5' primer to amplify sense
control probe using T7 RNA polymerase. Arc probe was transcribed
from a full length Arc sequence generated by PCR.
Antibodies
[0219] Goat anti-PirB antibodies C19 and A20 were purchased from
Santa Cruz Biotechnology. C19 and A20 are specific for the
cytoplasmic domain of PirB, a domain that is unique to PirB, and
carries little homology to any other known mouse protein. Rat 6C1
anti-PirA/B was purchased from Pharmingen, and is specific for the
extracellular domains of PirB and PirA proteins. 4G10 mouse
anti-phosphotyrosine was purchased from Upstate Biotechnology.
Synaptophysin monoclonal antibody SVP38 was purchased from Sigma
(St. Louis). Synapsin I monoclonal antibody clone 8 was purchased
from BD Transduction labs. The anti-PirB 1477 antibody was
generated by immunizing a rabbit with a peptide NTEYEQAEEGQGANNQ
which represents part of the PirB cytoplasmic domain. Rabbit
anti-Shp-2, and mouse anti-Shp-1 were purchased from Santa Cruz
Biotechnology.
Immunostaining
[0220] Mice were anaesthetized with isofluourane, fixed by
transcardial perfusion of phosphate buffered saline (PBS) followed
by 4% paraformaldehyde. Brains were removed and postfixed overnight
by immersion in 4% paraformaldehyde, followed by 24 hours immersion
in 30% sucrose/PBS for cryoprotection. Fifty-five .mu.m microtome
sections were taken, blocked in Tris buffered saline containing
0.1% Tween and 0.5% blocking reagent (Perkin Elmer, Boston) and
stained with C19 or A20 anti-PirB antibody, or control goat IgG, at
0.5 .mu.g/ml overnight at 4.degree. C. Signal was detected by
biotinylated secondary antibody, ABC and DAB (Vector Labs,
Burlingame Calif.). Cortical cultures were fixed for 10 minutes in
4% paraformaldehyde. Cultures were stained with 0.5-1.0 g/ml
antibody overnight at 4.degree. C. in Tris buffered saline
containing 0.1% Tween and 10% horse serum, followed by
fluorophore-conjugated secondary antibody, or unconjugated
secondary followed by fluorophore-conjugated tertiary antibody.
Actin was stained with fluorophore-conjugated phalloidin (Molecular
Probes) for 15 minutes. Stained cultures were imaged under a
60.times. oil immersion objective.
Soluble PirB Binding
[0221] To generate the PirB-alkaline phosphatase fusion protein
(PirB-AP) expression vector, the coding sequence of the
extracellular domain of PirB was amplified from Image clone 4488338
(Genbank EG247984) with primers
tatggcccagccggccgggtccctccctaagcctat and
tataagatctcttcaggtacatatgcagtcc and inserted into the SfiI and
BglII sites of the APtag-5 vector (GenHunter). As described by
Flanagan et al. (2000), the resulting construct, or the APtag-5
vector alone, was transfected into 293T cells with FuGENE 6
Transfection Reagent (Roche) and soluble, His- and myc-tagged
PirB-AP or AP containing conditioned media was collected
approximately 6 days post-transfection. PirB-AP or AP was purified
from conditioned media over a column of ProBond Resin (Invitrogen)
and eluted with 100 mM imidazole (Sigma). PirB-AP and AP containing
fractions were identified with the soluble AP substrate
p-nitro-phenyl phosphate (pNPP; Sigma), combined, and dialyzed
against Neurobasal media (Gibco).
[0222] For saturation analysis of PirB-AP binding to neurons,
dissociated cortical cultures were prepared from P0 CD-1 and C57BV6
mice and grown for 5-7 DIV. Cells were incubated with varying
concentrations of PirB-AP or AP (0.125-2 .mu.M) for 2 hours at
37.degree. C., washed to remove unbound AP-fusion protein, and
lysed with 1% Triton X-100. Lysates were collected and endogenous
AP was heat inactivated at 65.degree. C. AP activity was measured
using pNPP as substrate, reading at 405 nm (42) in a Bio-Rad Model
680 microplate reader using the Microplate Manager Software
(Version 5.2.1). Data represent background AP binding subtracted
from PirB-AP binding with 8-13 measurements at each concentration
from three independent experiments.
[0223] For investigation of PirB-AP binding to primary mouse
embryonic fibroblasts (MEFs), fibroblasts were isolated from WWW
and .beta.2m/Tap1 -/- embryos (3) at E13.5 by standard procedure
(43). For investigation of PIRB-AP binding of MHCI in neurons,
dissociated cortical neurons were prepared from P0 WWW and
.beta.2m/Tap1 -/- mice and grown for 5-6 DIV. Equal numbers of
cells from each genotype were incubated with 500 nM (MEFs) or 1
.mu.M (neurons) AP-proteins and bound PirB-AP/AP was measured as
described above using pNPP as substrate (42). Data represent
background AP binding subtracted from PirB-AP binding with 12
(MEFs) and 15 (neurons) measurements of each genotype from three
independent experiments.
[0224] To examine binding of PirB-AP to neurons in sections (42),
unfixed brains of adult WT mice were embedded in 3% UltraPure low
melting point agarose (Invitrogen) and 150-200 um sections were cut
with a vibratome. Sections were incubated in PirB-AP or AP (0.5-1
uM) for 16-18 hours at 4.degree. C., washed, and endogenous AP
activity was heat inactivated at 65.degree. C. PirB-AP binding was
visualized using the chromogenic AP substrates nitroblue
tetrazolium chloride (Roche) and
5-bromo-4-chloro-3-indolyl-phosphate (Roche).
Subcellular Fractionation
[0225] Mouse brains were dissected and homogenized ill 10 volumes
of ice cold buffer (0.32 M sucrose, 10 mM HEPES (pH. 7.5), 0.1 mM
EDTA) using 8-10 strokes in a teflon-glass homogenizer at
approximately 1000 rpm. Homogenate was centrifuged at 1000.times.g
for 10 minutes. Pellet containing unbroken cells and debris was
discarded. Supernatant was centrifuged at 10,000.times.g, and
pellet (P10) was collected. Supernatant was centrifuged at
100,000.times.g to produce pellet (P100) and 100,000.times.g
supernatant (S100), which were collected and analyzed by
immunoprecipitation/Western blot.
[0226] Synaptosomes were prepared as described by Nagy and
Delgado-Escueta (44). One P19 CD1 mouse brain was homogenized in 10
volumes of ice cold buffer containing 0.32 M sucrose, 10 mM HEPES
(pH. 7.5), 0.1 mM EDTA using 8-10 strokes in teflon-glass
homogenizer at approximately 1000 rpm. Homogenate was centrifuged
at 1000.times.g for 10 minutes to give pellet P1 and supernatant
S1. S1 was centrifuged at 12,000.times.g for 20 minutes to produce
pellet (P2) and supernatant (S2). S2 was spun at 100,000.times.g to
produce P100 (light membranes) and S100 (soluble fraction). P2 was
resuspended in 0.5 ml sucrose buffer and applied to Percoll step
gradient.
[0227] Percoll gradient was prepared by diluting SIP (9 parts
Percoll (Amersham) to 1 part 2.5 M sucrose), with Medium II (0.25 M
sucrose, 5 mM HEPES, pH 7.2, 0.1 mM EDTA) to produce the
appropriate concentrations of Percoll for the step gradient. Four
ml of 16% (vol/vol) Percoll were gently overlayed with 4 ml of 10%
Percoll and kept on ice. The resuspended P2 (0.5 ml) was then
diluted with 4 ml of 8.5% Percoll/sucrose (7.5% Percoll final),
layered onto the 10%16% Percoll gradient and centrifuged at
15,000.times.g for 20 minutes in a Sorvall SM-24 rotor.
Synaptosomes were collected from the 10%/16% Percoll interface.
Synaptosomes were centrifuged at 12,000.times.g for 10 min, then
briefly resuspended in 400 .mu.l water (to create an isotonic shock
and release synaptic vesicles) and buffered with 2 .mu.l of 1 M
HEPES pH 7.4. Synaptic vesicles were then pelleted at
25,000.times.g and plasma membranes remained in the supernatant.
Ten percent of the total protein of each fraction was removed for
analysis of marker proteins. The remaining protein in each fraction
was brought to a 1% NP-40 concentration and PirB was
immunoprecipitated overnight for subsequent SDS-PAGE/Western blot
analysis.
Immunoprecipitation/Western Blots
[0228] Mouse brains were dissected and homogenized in approximately
10 volumes of ice cold buffer containing 1% NP-40, 150 mM NaCl, 50
mM Tris (pH 7.4), 1 .mu.L/ml aprotinin, 1 .mu.g/ml leupeptin, 1 mM
phenylmethylsulfonyl fluoride, 1 mM sodium fluoride and 1 mM sodium
vanadate. Samples were centrifuged at 100,000.times.g for 15
minutes. Immunoprecipitation was performed overnight at 4.degree.
C., or for co-immunoprecipitation, for 2 hours at 4.degree. C.
Immunoprecipitates were collected on protein G agarose
(Invitrogen). Samples were separated by SDS-PAGE, transferred to
PVDF or nitrocellulose membranes, probed with the appropriate
antibody, and visualized with enhanced chemiluminescence (Pierce)
and Kodak XAR-5 film.
Eye Enucleation
[0229] All surgical procedures were performed according to the
approved animal use protocol on file at Harvard Medical School. For
monocular enucleation experiments, mice were anesthetized with
inhaled isofluorane. One eye was removed and eyelids were sutured
with 6-0 sterile surgical silk. Opthalmic ointment (Pharmaderm) was
used to prevent infection.
Arc Induction Experiments
[0230] To assess functionally the ocular dominance of cortical
neurons, the method of Arc mRNA induction according to Tagawa et
al. was used. One eye was removed (see above) under anaesthesia;
mice were revived and put in total darkness overnight. Mice were
returned to a lighted environment for 30 minutes to induce Arc mRNA
in the cortex driven by vision through the remaining eye. After
light exposure, mice were euthanized with Halothane (Halocarbon,
River Edge N.J.), brains were removed, flash-frozen in M-1 mounting
medium (ThermoShandon) and 16 .mu.m coronal sections were taken for
in situ hybridization for Arc mRNA (23).
Transneuronal Transport of [3H] Proline
[0231] To visualize the pattern of geniculocortical projections to
layer 4, mice (age P35) were anesthetized with isoflurane and 200
uCi of L-[2,3,4,5-3H]-Proline (Amersham) was injected into one eye
using a glass micropipette (23). After 7 days transport time,
animals were anaesthetized with Halothane (Halocarbon, River Edge
N.J.), then euthanized by injection of 0.1 ml of Euthasol (Delmarva
laboratories). Brains were removed, placed in M1 embedding matrix
(Shandon), and frozen in a dry ice/ethanol bath. Coronal cryostat
sections (20 .mu.m) of brain were cut, air dried, fixed for 30 min
in sodium phosphate-buffered 4% paraformaldehyde, dehydrated with
ethanol, coated with NTB-2 emulsion and developed after 3 months.
Images of visual cortex ipsilateral to the injected eye were
acquired in darkfield optics using a Nikon Eclipse microscope.
Widths of ipsilateral thalamocortical projections were measured
blind to genotype by scanning (see below).
Densitometric Scans of Arc Induction and Transneuronal Labeling in
Cortical Layer 4
[0232] Quantitative analysis of Arc expression was performed in
MATLAB (The Mathworks) by line scans in layer 4. A line along the
center of the layer 4 was generated by selecting 20-100 points and
then performing a cubic spline interpolation between these points.
At every pixel along this line, a perpendicular line through the
layer (15-30 pixels long; 1 pixel=3.5 um) was computed and the
average signal intensity of pixels along this line was measured.
The resulting intensity line scan was low pass filtered (8.sup.th,
order Butterworth), generating a curve of Arc signal intensity
versus distance along layer 4. Arc signal rose to a maximum within
the binocular zone. The width of the binocular zone was measured as
the region around the intensity maximum in which signal intensity
is greater than 2 standard deviations of the Arc background signal
intensity (determined as average intensity of 15 pixels outside the
binocular zone). Identical analysis techniques were used to
quantify the labeling intensity of transneuronally labeled
sections. The analyses were performed blind to genotype, age and
manipulation; slides from different animals and manipulations were
interleaved with each other and only reassembled once they were
decoded.
Anterograde Labeling of Retinal Ganglion Axons
[0233] Mice (P15) were anesthetized with isoflurane, and 1-2 .mu.l
of a 0.2% solution of cholera toxin B subunit (List Biological
Laboratories) conjugated to either rhodamine (product #107) or FITC
(product #106) was injected into each eye using a glass
micropipette (45). After 24 hours, animals were euthanized with
Euthasol (Delmarva laboratories). Brains were fixed by cardiac
perfusion with 0.9% saline and 4% paraformaldehyde. Brains were
removed and postfixed overnight in 4% paraformaldehyde at 4.degree.
C., then bathed in 30% sucrose overnight. Coronal sections (55
.mu.m) were cut through LGN on a freezing microtome, mounted on
glass slides using Vectashield (Vector Laboratories), and imaged on
a Nikon Eclipse fluorescence microscope. All images were acquired
such that peak intensity values were just saturating.
Example 1
PirB Expression in Nervous Tissue
[0234] To examine if PirB is expressed in the brain, we performed
in situ hybridization experiments using PirB-specific probes on
mouse brain tissue sections of various age from PO to adult.
Specific mRNA signal was detected throughout the brain at all ages
tested, with strong expression in cerebral cortex, hippocampus,
cerebellum and olfactory bulb (FIG. 1A-F). These brain regions are
also know to express MHCI mRNA and protein (1, 2).
[0235] Next, immunostaining for PirB protein was performed on brain
sections using two different antibodies specific for the
cytoplasmic domain of PirB (FIG. 1G). Specific expression was
detected at all ages tested, from PO to adult (Data not shown).
Protein is detected on a subset of neuronal cell bodies, and on
axon pathways and neuropil.
[0236] To determine if PirB is expressed in neurons, neocortex from
E17 or P0 was dissociated, cultured, and stained with three
different PirB-specific antibodies, in conjunction with
neuron-specific markers, including GAP-13, synapsin, PSD-95, and
neurofilament FIG. 2). In these cultures, a subset of neurons,
20-50% depending on the culture, were immunostained for PirB. PirB
staining is enriched in neuronal processes, where it appears as
puncta, and is also present in axonal growth cones, localized to
lamellipodia just behind the actin-rich leading edge (FIG. 2).
[0237] To characterize brain derived PirB protein expression
further, PirB protein was immunoprecipitated directly from the
brain. Immunoprecipitation and subsequent Western blots were
performed using different antibodies to ensure specificity. As in
the immune system (14, 15, 19, 20) brain-derived PirB exists
primarily as a 130 kD glycosylated protein (FIG. 3). PirB can be
detected in all brain regions at all ages tested, including the
optic nerve (FIG. 3A). PirB from the brain is glycosylated (FIG.
3B), as it is sensitive to deglycosylation by PNGaseF, which
removes N-linked oligosaccharides; PirB is insensitive to Endo H,
which cleaves a more restricted subset of oligosaccharides.
Preparation of synaptosomes from mouse brain tissue indicates that
a significant portion of PirB protein fractionates with
synaptosomal plasma membranes (FIG. 3C), suggesting that PirB may
function at or near synapses.
A soluble recombinant fusion protein consisting of the
extracellular domain of PirB fused to alkaline phosphatase (PirBAP)
was used to stain cultured cortical neurons from WT mice and from
mice with deleted .beta.2 microglobulin and Tap1 genes (2m/Tap).
These mutant mice have reduced cell surface expression of MHC Class
I protein (22, 23). We find that PirBAP binds specifically to WT
neurons, and that this binding severely reduced in 2m/Tap -/-
neurons (FIG. 4), indicating that soluble PirB binds to neurons in
an MHCI dependent manner.
Example 2
Signal Transduction of PirB in Nervous Tissue
[0238] The discovery of PirB expression in CNS neurons raises the
question of PirB neuronal function. Therefore, we created a mutant
mouse in which four exons encoding the transmembrane domain and
part of PirB intracellular domain are removed, rendering PirB
unable to convey signals across the plasma membrane (FIG. 8). The
resulting mutant mouse, which is completely viable, and mutant
protein, are thus called PirBTM. To determine the effects of
removing the protein's transmembrane domain and part of its
intracellular signaling structure, PirB protein expression in the
PirBTM mouse was examined. FIG. 5A shows subcellular fractionation
of wild-type and PirBTM brain, followed by immunoprecipitation of
PirB and the shorter PirBTM mutant proteins, respectively.
Wild-type PirB fractionates with both heavy and light membranes,
with no signal detected in the soluble fraction. The mutant PirBTM
protein can be detected in brain, but it is smaller and
fractionates with light membranes and cytosolic fractions. Thus,
loss of the transmembrane domain has altered the solubility of
PirB, as expected.
[0239] We next examined the ability of mutant PirBTM to transduce
signals in the brain. The cytoplasmic domain of PirB contains four
immunoreceptor tyrosine-based inhibitory motifs (ITIMs).
Phosphorylation of these sites recruits Shp-1 and Shp-2
phosphatases to PirB (17-21), and initiates a signal transduction
cascade that affects the activation state immune cells. Note the
PirBTM mutant lacks not only the transmembrane domain but also the
ITIM most proximal to the membrane (FIG. 8). When immunoprecipition
was performed with anti-phosphotyrosine antibodies from wild-type
and PirBTM brains, followed by anti-PirB Western blot analysis, we
found that PirB was phosphorylated only in wild-type brains; no
tyrosine phosphorylated PirBTM protein was detected FIG. 5B). This
result was expected, as PirBTM is not a transmembrane protein and
thus is unable to engage ligand, which normally leads to
phosphorylation (12, 13, 20). When PirB or PirBTM is
immunoprecipitated directly, followed by Western blot analysis for
PirB (FIG. 5C, top panel), and then followed by an
anti-phosphotyrosine Western blot (bottom panel), only wild-type
PirB is phosphorylated Together, these observations suggest that
PirBTM is unable to transduce signals via phosphorylation of its
remaining ITIM motifs, which is the primary means by which PirB and
other proteins of this class signal.
[0240] In immune cells, PirB associates with and signals primarily
through Shp-1 and Shp-2 phosphatases; neuronal PirB also associates
with these phosphatases (FIG. 5D,E). In contrast to the immune
system however, PirB appears to associate preferentially with
Shp-2, as indicated by the more robust co-immunoprecipitation of
PirB and Shp-2 directly from mouse brain FIG. 5D vs. SE). This
difference likely reflects the relative expression levels of Shp-1
and Shp-2 in the brain and the immune system; Shp-1 is highly
expressed in immune cells but Shp-2 is more prominent in neurons
(24, 25). As expected, mutant PirBTM does not co-I.P. with Shp-2
(FIG. 5E). Thus we conclude that signaling through PirB in the
brain of PirBTM mice is abrogated.
Example 3
Projection Pattern Development and PirB Expression
[0241] The search for neuronal MHCI receptors was inspired by the
discovery that mice defective for MHCI surface expression have
grossly normal brains but have abnormalities in the detailed
patterns of synaptic connections in the visual system, and defects
in synaptic plasticity (1). Initial observations of the PirBTM
mouse also revealed no obvious phenotype. Gross histology is
normal, as assessed by Niss1 staining. Because PirB is expressed on
neuronal processes and growth in cones, we examined axon tracts
that express PirB, such as the cortico-spinal tract and the
anterior portion of the anterior commissure. Retrograde and
anterograde tracing experiments indicate that, both tracts are
intact and appear to have developed normal projection patterns.
Example 4
PirB Function and Synaptic Plasticity
[0242] To examine whether PirB function is required for normal
synaptic plasticity in the visual system, we studied ocular
dominance development and plasticity in the primary visual cortex.
This choice was motivated by the fact that PirB protein is highly
expressed in cerebral cortex (FIG. 1). The adult mouse visual
cortex receives functional inputs from both eyes via the LGN. A
restricted binocular zone receives input from both ipsilateral and
contralateral eyes, whereas the rest of visual cortex consists of a
large monolcular zone where neurons are driven exclusively by the
contralateral eye (26, 27). In development, neurons across a wide
region of visual cortex receive functional input from the
ipsilateral eye, but by the fourth postnatal week, this region
becomes restricted, in an activity-dependent way, to the adult
binocular zone. The formation of the binocular zone and the
development of ocular dominance of visual cortical neurons is a
reliable model for studying developmental plasticity in the mouse
brain (28-32).
[0243] Ocular dominance was assessed in mouse visual cortex by
means of the activity-regulated immediate-early gene Arc. If one
eye is visually stimulated, Arc mRNA is rapidly induced in the
visual cortex, revealing the extent of cortex functionally
connected to the stimulated eye (32). This technique has provided
reliable, quantitative measurements of refinement and plasticity of
the ipsilateral eye representation in mouse visual cortex, and has
also been validated by demonstrating ocular dominance column
formation and plasticity in the cat (32). Accordingly, we examined
the representation of the ipsilateral eye within the binocular zone
in wild type and PirBTM mice by means of Arc induction.
[0244] In both WT and PirBTM mice at P34, stimulation of the
ipsilateral eye induces Arc mRNA expression in cortical layers 2-4
and 6 in the binocular zone of the hemisphere ipsilateral to the
stimulated eye (FIG. 6G). This is the adult pattern of ocular
dominance (32). The pattern of Arc induction in PirBTM mice at p34
appears indistinguishable from that of WT. To quantify these
observations, serial line scans were made along layer 4 of visual
cortex (blind to genotype) and the width of the binocular zone was
measured. The width of the binocular zones of WT and PirBTM mice at
P34 was identical. It is possible that the normally sized
representation of the ipsilateral eye at p34 in PirBTM mice arises
from an earlier widespread representation that is in fact different
from normal. However, the pattern of Arc induction at P19 is also
indistinguishable between PirBTM and WT (FIG. 6C). Note that the
width of Arc induction is larger at P19 than at P34 (FIG. 6B,CD),
indicating that PirB function is not needed for normal
developmental restriction of the ipsilateral projection.
Example 5
Ocular Dominance Plasticity and PirB
[0245] Activity-dependent refinement of visual system circuits
occurs during a critical period when altered sensory experience can
dramatically alter connectivity. Cortical ocular dominance can
readily be shifted by altering the relative amounts of activity
between the two eyes: this is referred to as ocular dominance
plasticity. OD plasticity is more limited after the critical period
(29, 32-38). Closing or removing one eye during the critical period
results in a dramatic shift in OD towards the remaining eye. This
shift can be visualized directly by means of Arc inductions in
cortex, ipsilateral to the remaining eye: the Arc mRNA signal
expands to occupy a wider than normal zone (FIG. 6E-H). Remarkably,
OD plasticity in PirBTM mice was not only present, but much more
robust than in WT mice at all ages tested during the critical
period; P19-25, which overlaps with the peak of normal ipsilateral
refinement and the peak of the critical period; P31-36, which is at
the end of the critical period, and from P22-31, which spans the
peak of OD plasticity. At these ages, the extent of Arc expression
in layer 4 of PirBTM mice has increased from XX % (P31-36) to as
much as 50% (P19-25) of WT (FIG. 6A, D, E, F, G).
[0246] The induction of Arc mRNA in the binocular zone of the
visual cortex is a functional measure of ocular dominance,
indicating the area in the cortex in which neurons are able to
respond to visual stimuli to the ipsilateral eye. The expansion of
the binocular zone in response to monocular enucleation may be due
to increased intracortical connectivity, increased spread of
thalamocortical axons, or both. To address this issue, we performed
ME on WT and PirBTM mice from age P2540, and visualized
thalamocortical input into the cortex by transneuronal transport of
3H-proline injected into one eye (FIG. 6H). These experiments
demonstrate that PirBTM mice undergo greater expansion of
thalamocortical axons in response to ME than in WT mice, indicating
that at least some of the enhanced plasticity observed by Arc
expression is likely to be due to expansion of the area innervated
by thalamocortical axons. Together, the observations of enhanced
plasticity at the structural level (thalamocortical axons) and
function level (Arc induction in cortical neurons) indicate that
PirB functions to regulate the extent of cortical OD plasticity
during the critical period.
[0247] Visual stimuli originate in the eye and pass to the cortex
via synaptic connections in the Lateral Geniculate Nucleus (LGN) of
the thalamus. In the mouse, retinal ganglion axons that innervate
the LGN undergo eye-specific segregation during the first postnatal
week. The fully segregated LGN is dominated by contralateral axons,
with a small region devoted to ipsilateral axons. These axons
connect to eye-specific neurons in the LGN, which then project to
visual cortex. Though the segregated LGN is not thought to be
susceptible to experience-ependent structural plasticity, it is
possible that the enhanced plasticity in the cortex of PirBTM mice
is due in part to an unusually plastic LGN. Thus, we performed
anterograde labeling experiments in WT and PirBTM mice to determine
if ME causes the mutant LGN ipsilateral representation to expand.
FIG. 7 shows that indeed, the ipsilateral region of the PirBTM mice
expands in response to ME, whereas in the wild-type mice, it does
not, indicating the PirBTM mice do indeed have abnormally plastic
LGN. These findings may account in part for the extra plasticity
observed in the cortex of these mice, or PirB function may be
required independently in many parts of the brain for normal
plasticity.
REFERENCES
[0248] 1. G. S. Huh et al., Science 290, 2155-9 (Dec. 15, 2000).
[0249] 2. R. A. Corriveau, G. S. Huh, C. J. Shatz, Neuron 21,
505-20 (September, 1998). [0250] 3. A. Barco et al., Neuron 48,
123-37 (Oct. 6, 2005). [0251] 4. E. O. Long, Annu Rev Immunol 17,
875-904 (1999). [0252] 5. L. L. Lanier, Annu Rev Immunol 16, 359-93
(1998). [0253] 6. L. L. Lanier, Cell 92, 705-7 (Mar. 20, 1998).
[0254] 7. A. Cerwenka, L. L. Lanier, Immunol Rev 181, 158-69 (June,
2001). [0255] 8. A. Moretta et al., Annu Rev Immunol 14, 61948
(1996). [0256] 9. T. Takai, Adv Immunol 88, 161-92 (2005). [0257]
10. T. Takai, Immunology 115, 43340 (August, 2005). [0258] 11. T.
Takai, M. Ono, Immunol Rev 181, 215-22 (June, 2001). [0259] 12. A.
Nakamura, E. Kobayashi, T. Takai, Nat Immunol 5, 623-9 (June,
2004). [0260] 13. S. Liang, B. Baibakov, A. Horuzsko, Eur J Immunol
32, 2418-26 (September, 2002). [0261] 14. B. Kubagawa, P. D.
Burrows, M. D. Cooper, Proc Natl Acad Sci USA 94, 5261-6 (May 13,
1997). [0262] 15. K. Hayami et al., J Biol Chem 272, 7320-7 (Mar.
14, 1997). [0263] 16. S. Kollnberger et al., J Immunol 173,
1699-710 (Aug. 1, 2004). [0264] 17. M. Blery et al., Proc Natl Acad
Sci USA 95, 2446-51 (Mar. 3, 1998). [0265] 18. A. Maeda et al.,
Oncogene 18, 2291-7 (Apr. 8, 1999). [0266] 19. J. F. Timms et al.,
Mol Cell Biol 18, 3838-50 (July, 1998). [0267] 20. L. H. Ho, T.
Uehara, C. C. Chen, H. Kubagawa, M. D. Cooper, Proc Natl Acad Sci
USA 96, 15086-90 (Dec. 21, 1999). [0268] 21. A. Maeda, M. Kurosaki,
M. Ono, T. Takai, T. Kurosaki, J Exp Med 187, 1355-60 (Apr. 20,
1998). [0269] 22. J. R. Dorfman, J. Zerrahn, M. C. Coles, D. H.
Raulet, J Immunol 159, 5219-25 (Dec. 1, 1997). [0270] 23. M.
Zijlstra et al., Nature 344, 742-6 (Apr. 19, 1990). [0271] 24. B.
G. Neel, H. Gu, L. Pao, Trends Biochem Sci 28, 284-93 (June, 2003).
[0272] 25. S. Paul, P. J. Lombroso, Cell Mol Life Sci 60, 2465-82
(November, 2003). [0273] 26. V. S. Caviness, Jr., J Comp Neurol
164, 247-63 (Nov. 15, 1975). [0274] 27. U. C. Drager, J Comp Neurol
160, 269-90 (Apr. 1, 1975). [0275] 28. T. K. Hensch, Neurosci Res
47, 17-22 (September, 2003). [0276] 29. N. B. Sawtell et al.,
Neuron 38, 977-85 (Jun. 19, 2003). [0277] 30. T. K. Hensch et al.,
Science 282, 1504-8 (Nov. 20, 1998). [0278] 31. J. A. Gordon, D.
Cioffi, A. J. Silva, M. P. Stryker, Neuron 17, 491-9 (September,
1996). [0279] 32. Y. Tagawa, P. O. Kanold, M. Majdan, C. J. Shatz,
Nat Neurosci 8, 380-8 (March, 2005). [0280] 33. M. Y. Frenkel, M.
F. Bear, Neuron 44, 917-23 (Dec. 16, 2004). [0281] 34. T. A. Pham
et al., Learn Mem 11, 738-47 (November-December, 2004). [0282] 35.
M. C. Crair, Curr Opin Neurobiol 9, 88-93 (February, 1999). [0283]
36. L. C. Katz, J. C. Crowley, Nat Rev Neurosci 3, 34-42 (January,
2002). [0284] 37. L. C. Katz, C. J. Shatz, Science 274, 1133-8
(Nov. 15, 1996). [0285] 38. D. H. Hubel, T. N. Wiesel, S. LeVay,
Philos Trans R Soc Lond B Biol Sci 278, 377-409 (Apr. 26, 1977).
[0286] 39. T. K. Hensch, Annu Rev Neurosci 27, 549-79 (2004).
[0287] 40. E. N. Meyers, M. Lewandoski, G. R Martin, Nat Genet. 18,
136-41 (Feburary, 1998). [0288] 41. D. M. Simmons, Arriza, J. L.
& Swanson, L. W., J. Histotechnol. 12, 169-181 (1989). [0289]
42. J. G. Flanagan, H. J. Cheng, Methods Enzymol 327, 198-210
(2000). [0290] 43. B. Hogan, Beddington, R., Costantini, F., Lacy,
E., Manipulating the mouse embryo: A laboratory manual, (Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., ed. 2,
1994). [0291] 44. A. Nagy, A. V. Delgado-Escueta, J Neurochem 43,
1114-23 (October, 1984). [0292] 45. C. L. Torborg, M. B. Feller, J
Neurosci Methods 135, 17-26 (May 30, 2004).
* * * * *
References