Systems for gene targeting and producing stable genomic transgene insertions

Abstract

The novel germ-line transformation systems disclosed in this patent application allow the physical deletion of transposon DNA following the transformation process, and the targeting of transgene integrations into predefined target sites. In this way, transposase-mediated mobilization of genes-of-interest is excluded mechanistically and random genomic integrations eliminated. In contrast to conventional germ-line transformation technology, our systems provide enhanced stability to the transgene insertion. Furthermore, DNA sequences required for the transgene modification (e.g. transformation marker genes, transposase or recombinase target sites), are largely removed from the genome after the final transgene insertion, thereby eliminating the possibility for instability generated by these processes. The RMCE technology, which is disclosed in this patent application for invertebrate organisms (exemplified in Drosophila melanogaster) represents an extremely versatile tool with application potential far beyond the goal of transgene immobilization. RMCE makes possible the targeted integration of DNA cassettes into a specific genomic loci that are pre-defined by the integration of the RMCE acceptor plasmid. The loci can be characterized prior to a targeting experiment allowing optimal integration sites to be pre-selected for specific applications, and allowing selection of host strains with optimal fitness. In addition, multiple cassette exchange reactions can be performed in a repetitive way where an acceptor cassette can be repetitively exchanged by multiple donor cassettes. In this way several different transgenes can be placed precisely at the same genomic locus, allowing, for the first time, the ability to eliminate genomic positional effects and to comparatively study the biological effects of different transgenes.

Description

FIELD OF THE INVENTION

[0001] The invention relates to novel methods and techniques to produce transgenic, or genetically modified, organisms (transgenesis). The focus of the innovation is on manipulation techniques that allow for the targeting and the stable anchoring of homologous or heterologous DNA-sequences (in the following description referred to as: "transgene" or "gene-of-interest") into the genome of a target species. To achieve this goal, we have developed three different systems of transformation vectors that are capable of integrating a transgene into invertebrate and vertebrate organisms via transposon- or recombinase-mediated transformation events. In addition, following the germline transformation procedure, both systems make possible the physical deletion of mobile DNA-sequences, brought in with the vector, from the target genome and therefore to stabilize the gene-of-interest. Stable (genomic) transgene insertions are regarded to be an essential pre-requisite for the safe production of genetically modified organisms at a large industrial scale.

DESCRIPTION OF THE RELATED ART

[0002] Current state-of-the-art technology to produce genetically modified insect organisms relies on transposon-mediated germ-line transformation. This transformational technique is based on mobilizable DNA, i.e. transformation vectors derived from Class II transposable elements having terminal inverted sequences, which transpose via a DNA-mediated process (see Finnegan, D. J., 1989. Eucaryotic transposable elements and genome evolution. Trends Genet. 5, 103-107, and Atkinson, P. W., Pinkerton, A. C., O'Brochta, D. A., 2001. Genetic transformation systems in insects. Annu. Rev. Entomol. 46, 317-346, the contents of which are incorporated herein by reference). The two ends of such a transposable element carrying within all functional parts necessary and sufficient for in vivo mobilization are termed TransposonL (5' end) and TransposonR (3' end) Several different germ-line transformation systems have in common that a gene-of-interest/transgene originally located within a transgene construct is transferred into genomic DNA of germ-line cells of the target species. The transformation process is catalyzed by the transposase enzyme provided by a helper plasmid. This enzyme recognizes DNA target sites flanking the gene-of-interest/transgene and mobilizes the transgene into the genome of germ-line cells of the insect species. In addition, transformed DNA contains a marker gene that allows detection of successful germ-line transformation events (by producing a dominantly visible phenotype).

[0003] Transposon-mediated germ-line transformation systems are currently available for a diverse spectrum of insect species. Systems based on the P-element revolutionized the genetics of the vinegar fly Drosophila melanogaster (see Engels, W. R. (1996). P elements in Drosophila. Curr. Top. Microbiol. Immunol. 204, 103-123, the contents of which are incorporated herein by reference), but they were not applicable to non-drosophilid insect species because of the dependence of P-elements on Drosophila-endogenous host factors (see Rio, D. C. & Rubin, G. M. (1988). Identification and purification of a Drosophila protein that binds to the terminal 31-base-pair inverted repeats of the P transposable element. Proc. Natl. Acad. Sci. USA 85, 8929-8933, the contents of which are incorporated herein by reference). Therefore, insect species of medical or economic importance have been transformed using host factor-independent "broad host range" transposable elements (see Atkinson, P. W. & James, A. A. (2002). Germline transformants spreading out to many insect species. Adv. Genet. 47, 49-86, the contents of which are incorporated herein by reference). Germline transformation systems based on the transposable elements piggyBac (see U.S. Pat. No. 6,218,185; WO 01/14537; and Handler, A. M., McCombs, S. D., Fraser, M. J., Saul, S. H. (1998). The lepidopteran transposon vector, piggyBac, mediates germline transformation in the Mediterranean fruitfly. Proc. Natl. Acad. Sci. USA 95, 7520-7525, the contents of which are incorporated by reference herein), Hermes (see U.S. Pat. No. 5,614,398, the contents of which are incorporated herein by reference), Minos (see European Patent No. EP 0 955 364 A36, the contents of which are incorporated herein by reference) and mariner (see WO 99/09817, the contents of which are incorporated herein by reference) are currently state-of-the-art technology to genetically modify important pest or useful insect species including, for example, malaria transmitting anopheline or culicine mosquitoes (Anopheles gambiae, Anopheles stephensi, Anopheles albimanus, Culex quinquefasciatus, Aedes aegypti; see Catteruccia, F., Nolan, T., Loukeris, T. G., Blass, C., Savakis, C., Kafatos, F. C. & Crisanti, A. (2000). Stable germline transformation of the malaria mosquito Anopheles stephensi. Nature 405, 959-962, and Allen, M. L., O'Brochta, D. A., Atkinson, P. W. & Levesque, C. S. (2001). Stable, germ-line transformation of Culex quinquefasciatus (Diptera: Culicidae). J. Med. Entomol. 38, 701-710, and Coates J. C., Jasinskiene, N., Miyashiro, L. & James, A. A. (1998). Mariner transposition and transformation of the yellow fever mosquito, Aedes aegypti. Proc. Natl. Acad. Sci. USA 95, 3748-3751, and Jasinskiene, N., Coates, C. J., Benedict, M. Q., Cornel, A. J., Rafferty, C. S., James, A. A. & Collins, F. H. (1998). Stable transformation of the yellow fever mosquito, Aedes aegypti, with the Hermes element from the housefly. Proc. Natl. Acad. Sci. USA 95, 3743-3747, and Perera, O. P., Harrell, R. A., Handler, A. M. (2002) Germ-line transformation of the South American malaria vector, Anopheles albimanus, with a piggyBac/EGFP transposon vector is routine and highly efficient. Insect Mol. Biol., 11, 291-297, the contents of which are incorporated herein by reference), the Mediterranean fruit fly, Ceratitis capitata (see Handler, A. M., McCombs, S. D., Fraser, M. J., Saul, S. H. (1998). The lepidopteran transposon vector, piggyBac, mediates germline transformation in the Mediterranean fruitfly. Proc. Natl. Acad. Sci. USA 95, 7520-7525 and Loukeris, G. T., Livadaras, I., Arca, B, Zabalou, S. & Savakis, C. (1995). Gene transfer into the Medfly, Ceratitis capitata, with a Drosophila hydei transposable element. Science 270, 2002-2005, the contents of which are incorporated herein by reference) and the silkworm, Bombyx mori (see Tamura, T. et al. (2000). Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposon-derived vector. Nat. Biotechnol. 18, 81-84, the contents of which are incorporated herein by reference). Moreover, the application potential of broad host range transposable elements is not restricted to insect species: mariner-derived transformation vectors have been shown to integrate stably into the germ-line of the nematode, Caenorhabditis elegans (see Bessereau, J.-L., Wright, A., Williams, D. C., Schuske, K., Davis, M. W. & Jorgensen, E. M. (2001). Mobilization of a Drosophila transposon in the Caenorhabditis elegans germ line. Nature 413, 70-74, the contents of which are incorporated herein by reference), the zebrafish, Danio rerio (see Fadool J. M., Hartl, D. L. & Dowling, J. E; (1998). Transposition of the mariner element from Drosophila mauritiana in Zebrafish. Proc. Natl. Acad. Sci. USA 95, 5182-5186, the contents of which are incorporated herein by reference) and chicken, Gallus spp. (see Sherman, A., Dawson, A., Mather, C., Gilhooley, H., Li, Y., Mitchell, R., Finnegan, D. & Sang, H. (1998). Transposition of the Drosophila element mariner into the chicken germ line. Nat. Biotechnol. 16, 1050-1053, the contents of which are incorporated herein by reference).

[0004] In order to follow germ-line transformation success, both species-specific and species-independent transformation markers have been established (see Horn, C., Schmid, B. G. M., Pogoda, F. S. & Wimmer, E. A. (2002). Fluorescent transformation markers for insect transgenesis. Insect Biochem. Mol. Biol. 32, 1221-1235, the contents of which are incorporated herein by reference). Species-independent markers consist of a combination of a promoter sequence which is phylogenetically conserved and a gene for a fluorescent protein placed under control of such a promoter (for example, GFP [green fluorescing protein] and derivatives thereof, or DsRed [Discosoma species red fluorescing protein] (see Chalfie, M. Tu, Y., Euskirchen, G., Ward, W., Prasher, D. C. (1994). Green fluorescent protein as a marker for gene expression. Science 263, 802-805, and Matz, M. V., Fradkov, A. F., Labas, Y. A., Savitsky, A. P., Zaraisky, A. G., Markelov, M. L., Lukyanov, S. A. (1999). Fluorescent proteins from nonbioluminescent Anthozoa species. Nat. Biotechnol. 17: 969-973, the contents of which are incorporated herein by reference). Species-independent markers are advantageous over species-specific markers because they are directly applicable to different insect species (and other organisms). The polyubiquitin-promoter (see Patent Cooperation Treaty PCT WO 01/14537 A1 and Handler, A. M. & Harrell, R. A. (1999). Germline transformation of Drosophila melanogaster with the piggyBac transposon vector. Insect Mol. Biol. 8, 449-457, the contents of which are incorporated herein by reference) as well as the "3.times.P3"-promoter (see Patent Cooperation Treaty PCT WO 01/12667 A1 and Berghammer, A. J., Klingler, M., & Wimmer, E. A. (1999). A universal marker for transgenic insects. Nature 402, 370-371, the contents of which are incorporated herein by reference) linked to genes for fluorescent proteins have been used most widely for this purpose.

[0005] A transposon-independent technology aiming at targeting a gene-of-interest/transgene into the genome of cells relies on the principle of site-specific recombination. This is possible by using a recombinase enzyme and corresponding DNA target sites that are heterospecific. The steps are: First, incorporating into the genome by transposon-mediated transformation, a DNA cassette that is flanked by heterospecific recombinase target sites and contains a marker system for positive-negative selection. Second, recombinase-mediated targeting into the marked genomic locus the gene-of-interest, which is located within a plasmid and is flanked by the same heterospecific recombinase target sites. This principle has been described as RMCE or recombinase-mediated cassette exchange (see European Patent No. EP 0 939 120 A1 and Baer, A. & Bode, J. (2001). Coping with kinetic and thermodynamic barriers: RMCE, an efficient strategy for the targeted integration of transgenes. Curr Opin Biotechnol. 12, 473-480 and Kolb, A. F. (2002). Genome engineering using site-specific recombinases. Cloning Stem Cells. 4, 65-80, the contents of which are incorporated herein by reference). The functionality of DNA cassette exchange systems has been demonstrated in different cell lines (comprising also murine embryonic stem cells) using the FLP-recombinase enzyme and heterospecific FRT target sites (see Schlake, T. & Bode, J. (1994). Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomal loci. Biochemistry 33, 12746-12751, and Seibler, J., Schubeler, D., Fiering, S, Groudine, M. & Bode, J. (1998). DNA cassette exchange in ES cells mediated by Flp recombinase: an efficient strategy for repeated modification of tagged loci by marker-free constructs. Biochemistry 37, 6229-6234, and European Patent No. EP 0 939 120 A1, the contents of which are incorporated herein by reference) as well as using the Cre-recombinase enzyme and heterospecific loxP target sites (see Kolb, A. F. (2001). Selection-marker-free modification of the murine beta-casein gene using a lox2272 [correction of lox2722] site. Anal Biochem. 290, 260-271.26), the contents of which are incorporated herein by reference). However, RMCE has not been applied to genetically modified invertebrate organisms thus far.

Limitations of Prior Art/Improvements Over Prior Art

[0006] Transposon-based plasmid vectors have proven to be efficient tools for producing genetically modified insects for research purposes, but so far only on a small laboratory scale. However, the mobile nature of DNA transposable elements will be disadvantageous when scaling up the production/rearing of genetically modified insects. Owing to potential re-mobilization, the stability of genomic transgene integrations cannot be assured and, connected to this issue, concerns relating to the safety of release of such genetically modified insects will be raised.

Stability of Genomic Transgene Integrations in Large Industrial Scale

[0007] The current state-of-the-art provides, typically, for random transposon vector integrations into the host genome. While this may be advantageous for functional genomics studies that use vector integrations to cause random mutations (e.g. for transposon-tagging and enhancer trapping), it is typically disadvantageous for the creation of transgenic strains for applied use where high fitness levels and optimal transgene expression are desired. This results from integrations that create mutations by insertion into genomic sites that eliminate or disrupt normal gene function that negatively effect viability, reproduction, or behavior. Genomic position effects also influence expression of transgenes, typically causing decreased expression and/or mis-expression of genes of interest and markers so that transformants may not be easily identified, and the desired transgene expression for application is not achieved. Thus, most transformation experiments require the screening of multiple transformant strains for optimal fitness and transgene expression, and often such strains cannot be identified. An important improvement over the current state-of-the-art would be an efficient and routine system to target transgene integrations to specific and defined genomic sites that are known not to disrupt normal gene function and whose position effects are limited or well characterized.

[0008] Transgene integrations that negatively effect host strain fitness and reproduction also confer a selective disadvantage to the transformed organism in a population relative to wild type organisms. Thus, a selective advantage is provided to non-transformed organisms or transformants that have lost or relocated the transgene due to a re-mobilization event. Re-mobilization requires the activity of a transposase enzyme corresponding to, and acting upon, the transposon sequences flanking the genomic transgene. Although the transposase used for germ-line transformation usually is not encoded by the host species' genome, transposase introduction by symbiotic or infectious agents is possible, and cross-reactivity to related transposase enzymes that are genomically encoded cannot be excluded. Such cross-reactivities have been reported between the transposable elements Hermes, from Musca domestica, and hobo, from Drosophila melanogaster, that caused significant instability of Hermes-flanked transgenes in hobo-containing Drosophila strains (see Sundararajan, P., Atkinson, P. W. & O'Brochta, D. A. (1999). Transposable element interactions in insects: crossmobilization of hobo and Hermes. Insect Mol. Biol. 8, 359-368, the contents of which are incorporated herein by reference). It should be noted that well-characterized families of transposable elements contain multiple members and the cross-reactivity of them is largely unknown to date (e.g. the mariner/Tc1 superfamily (see Hartl, D. L., Lohe, A. R. & Lozovskaya, E. R. (1997). Modern thoughts on an ancyent marinere: function, evolution, regulation. Annu. Rev. Genet. 31, 337-358, the contents of which are incorporated herein by reference)). For these reasons, a transformation technology that excludes the possibility of transgene re-mobilization events a priori will provide a higher standard of transgene stability and will be superior to currently available technology.

[0009] Transgene instability resulting from vector remobilization will have several negative consequences. The first is loss or change in desired transgene expression. Secondly, strain breakdown will result after relocated transgenes can segregate freely in meiosis and selection pressure acts against transgene-carrying chromosomes. Research results on the stability of transgene insertions in insects, reared at an industrial scale, have not been reported thus far. However, data for insect strains selected by classical Mendelian genetics and carrying translocations are available (see Franz, G., Gencheva, E. & Kerremans, Ph. (1994). Improved stability of genetic sex-separation strains for the Mediterranean fruit fly, Ceratitis capitata. Genome 37, 72-82, the contents of which are incorporated herein by reference). When reared at an industrial scale, such translocation strains, constructed for the Mediterranean fruit fly (see Franz, G., Gencheva, E. & Kerremans, Ph. (1994). Improved stability of genetic sex-separation strains for the Mediterranean fruit fly, Ceratitis capitata. Genome 37, 72-82, the contents of which are incorporated herein by reference) suffered from instability. Recombination events causing reversion of the selected recessive trait were observed at a frequency of 10.sup.-3-10.sup.-4 (see Franz, G. (2002). Recombination between homologous autosomes in medfly (Ceratitis capitata) males: type-1 recombination and the implications for the stability of genetic sexing strains. Genetica 116, 73-84, the contents of which are incorporated herein by reference). Because the recessive trait conferred a selective disadvantage to the individual insect, such reversion events caused strain breakdown rapidly. Most interestingly, these events were not observed at a small laboratory scale and therefore were not anticipated. As strain breakdown during a continuous industrial production of those insects is not acceptable, major research efforts have been made to improve the situation. Currently a laborious (and expensive) but efficient manual detection system for quality control has been implemented (see Fisher, K. & Caceres, C. (2000). A filter rearing system for mass reared medfly, S. 543-550 in Area-wide control of fruit flies and other insect pests, Ed.: Tan, K. H., Penerbit Universiti Sains Malaysia, Penang, Malaysia, the contents of which are incorporated herein by reference) and allows the successful production of this translocation strain at a scale of 10.sup.6-10.sup.7 individuals per week (see Franz, G. (2002). Recombination between homologous autosomes in medfly (Ceratitis capitata) males: type-1 recombination and the implications for the stability of genetic sexing strains. Genetica 116, 73-84, the contents of which are incorporated herein by reference).

Safety Aspects Concerning Release of Genetically Modified Insects

[0010] Another important concern for remobilization is the potential for lateral transmission of the transgene into unintended host strains or species. Many industrial applications of insect transgene technology will include the release of genetically modified insects into the environment (e.g. the Sterile Insect Technique). Therefore, aspects of biosafety and ecological risk assessment will be of fundamental importance. Biosafety includes minimizing the risk of unintended transgene transmission from the host to other procaryotic or eucaryotic species during rearing or after release into the field. Horizontal gene transfer cannot be excluded per se, because the mechanisms of nucleic acid exchange between species are not sufficiently investigated to date. While most transposon vectors have their transposase source eliminated and are not self-mobilizable, functional autonomous transposons can be transmitted among species horizontally, and transposase may be provided to the vector by associated organisms or by a related enzyme in the host species. Thus, the risk for transgene vector re-mobilization by a transposase-mediated event can be most definitively eliminated when transposon sequences, required for germ-line transformation, are removed from the genomic integration after the transformation process. Systems disclosed in this patent application contribute to risk minimization by introducing techniques for transposon sequence removal. It is probable that, in the future, procedures to remove such sequences, and therefore to assure a higher standard of biosafety, will become an obligate precondition for permission by regulatory organizations for release of transgenic organisms. In fact, there are sound prospects that such systems will set the safety standards and will become normative which in turn demonstrates the commercial potential of the invention.

BRIEF SUMMARY OF THE INVENTION

The Strategy

Post-Transformational Immobilization of Transgenes

[0011] Disadvantages stated in the previous section show the need for novel germ-line transformation systems that enable the stable integration of transgenes/genes-of-interest. The challenge is to develop a transformation method that prevents re-mobilization of transgenes which have been incorporated into the genome. The strategy disclosed in this patent application is to remove the intact transposon parts (containing transposase-recognition sites) following the transformation procedure (i.e. post-transformational). Three variants of this invention are disclosed as embodiments. These variants allow (i) modification of transgene DNA, (ii) post-transformational inactivation of at least one of the transposon parts and (iii) inactivation of at least one of the two transposon recognition sites required for re-mobilization by physical deletion from the genome.

[0012] The first embodiment disclosed has been termed "excision-competent stabilization vectors" (FIG. 1). This embodiment comprises a transformation vector that, in addition to currently applied vectors that contain solely a TransposonL1 half side and TransposonR1 half side (now referred to as TransposonL1 and R1), contains an additional internally-positioned TransposonL half side (referred to as TransposonL2 in FIG. 1) placed in-between the original Transposon L1 and R1 sides. L and R half sides are placed in the normal, or same, terminal inverted repeat orientation to one another as found in the original transposable element. Marker genes that can be distinguished from one another are placed in-between TransposonL1 and TransposonL2 and in-between TransposonL2 and TransposonR1. The steps of transformation are as follows. First, the transformation procedure is carried out according to the current state-of-the-art germ-line transformation technology that will result in individuals transformed by one of two possible events with this vector. One possible event is the integration of TransposonL1 and TransposonR1 and all intervening DNA including the two marker genes, TransposonL2, and other genes of interest. The second possible event is integration of TransposonL2 and TransposonR1 and all intervening DNA including the marker gene. For the purposes of this embodiment, only individuals transformed with TransposonL1 and TransposonR1, which are identified by expression of the two marker genes, are conserved for further experimentation. The internal vector containing TransposonL2 and TransposonR1, within TransposonL1 and TransposonR1, is then re-mobilized by introduction of a source of transposase derived from mating to a jumpstarter strain having a genomic transposase gene, or physical injection of the transposase DNA, RNA, or protein into embryos. Deletion by transposon excision of the TransposonL2 and TransposonR1 half sides is identified by loss of the intervening marker gene. The remaining TransposonL1 half-side, with the downstream marker gene and genes-of-interest, is identified by the single marker gene phenotype and verified by sequencing of amplified DNA. This remaining TransposonL1 half side, marker gene and genes-of-interest should be incapable of re-mobilization by transposase in the absence of the requisite TransposonR1 half side.

[0013] The second embodiment disclosed has been termed "conditional excision-competent transformation vectors" (FIG. 4). This embodiment comprises a modified excision-competent transformation vector that contains a transposonR2 half-side in an inverted orientation, relative to the R1 half side, with R2 also flanked by recombinase target sites in inverted orientation. In this configuration, only the TransposonL1 and R1 half-sides can integrate by transposition, and remobilization of the TransposonL1 and R2 half-sides can only occur after a recombinase-mediated inversion between the recombinase target sites. This modification will facilitate the stabilization process, by transposon L1 and R2 half-side deletion, for those excision-competent transformation vectors and/or host species where the primary transposition is highly favored or limited to the internal TransposonL1 and R2 half-sides if R2 was in a normal orientation.

[0014] A similar result is achieved by the third embodiment which has been termed "RMCE with subsequent transposon deletion" (FIG. 5). Completely new in this embodiment is a DNA targeting strategy. The ultimate germ-line transformation process is conducted as a recombinase-mediated process, instead of a transposase-mediated process, into an existing (and pre-defined) genomic target site. This involves the RMCE principle, i.e. a site-specific recombinase recognizes heterospecific DNA target sites and exchanges DNA-cassettes between a RMCE-acceptor and a RMCE-donor (step 1 in FIG. 5). The success of this cassette exchange is indicated by the exchange of the acceptor target marker gene (e.g. ECFP, see FIG. 7) by the donor vector marker gene (e.g. EYFP, see FIG. 7). It is important to stress that only the coding region of the transformation market genes is exchanged, not the promotor regions (which are not present in the RMCE-donor plasmid). The advantage of this promoter-free exchange is that side-reactions, which involve non-targeted integration of the donor into the genome, will not be recognized. Most important to this first step of cassette exchange, is a "homing DNA sequence" that is present in both the RMCE-acceptor and the RMCE-donor and is identical in both functional parts. The homing DNA sequence functions to significantly enhance the cassette exchange efficiency. The principle of stably integrating a gene-of-interest via a RMCE strategy into the genome of an invertebrate organism is completely novel and extends previously described RMCE-technology (see European Patent No. EP 0 939 120 and Schlake, T. & Bode, J. (1994). Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomal loci. Biochemistry 33, 12746-12751, and Seibler, J., Schubeler, D., Fiering, S, Groudine, M. & Bode, J. (1998). DNA cassette exchange in ES cells mediated by Flp recombinase: an efficient strategy for repeated modification of tagged loci by marker-free constructs. Biochemistry 37, 6229-6234, and European Patent No. EP 0 939 120, the contents of which are incorporated herein by reference) to invertebrate organisms. Because the RMCE-acceptor also carries a transposon half-side (Transposon R1 in FIG. 5), a fully remobilizable internal transposon is reconstituted after a successful RMCE reaction. This reconstituted transposon is subsequently physically deleted from the organism's genome by the action of a transposase (step 2 in FIG. 5 and FIG. 7), exactly as described for the first embodiment. In conclusion, the gene-of-interest is only flanked by one transposon half side end and hence is immobilized because it does not provide a complete substrate for transposase-mediated mobilization.

BRIEF DESCRIPTION OF THE FIGURES

[0015] For a fuller understanding of the nature and objects of the present invention, reference should be made by the following detailed description taken with the accompanying figures, in which:

[0016] FIG. 1 shows a protocol for integration and re-mobilization for stabilized vector creation;

[0017] FIG. 2 shows a diagram of stabilization vector pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1 };

[0018] FIG. 3 shows a PCR analysis and verification of pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} vector integration in line F34 and L2-3.times.P3-ECFP-R1 remobilization in line F34-1M;

[0019] FIG. 4 shows the principle of "conditional excision competent transformation vectors";

[0020] FIG. 5 shows the principle of "RMCE with subsequent transposon deletion";

[0021] FIG. 6 shows an embodiment of the principle as shown in FIG. 4

[0022] FIG. 7 shows an embodiment of the principle as shown in FIG. 5: Stabilized vector creation by RMCE;

[0023] FIG. 8 shows a diagram of RMCE acceptor vector;

[0024] FIG. 9 shows molecular analysis of RMCE acceptor and RMCE donor transgenic lines and PCR analysis of transgene mobilization;

[0025] FIG. 10 shows a diagram of a final RMCE donor vector for transgene stabilization;

[0026] FIG. 11 shows the approximate sequence of the vector shown in FIG. 2;

[0027] FIG. 12 shows the approximate sequence of the vector shown in FIG. 8; and

[0028] FIG. 13 shows the approximate sequence of the vector shown in FIG. 10.

DETAILED DESCRIPTION OF THE INVENTION

Embodiment 1

Excision-Competent Stabilization Vectors

[0029] The experimental steps for the method are described in FIG. 1, and the structure of the excision competent transformation vector, pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1 }, is described in FIG. 2. Integration and re-mobilization of the vector was verified by PCR and sequence analysis described in FIG. 3. pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} was constructed based on the transposable element "piggyBac" (see U.S. Pat. No. 6,218,185, the contents of which are incorporated herein by reference). Conventional piggyBac-based transformation vectors (see WO 01/14537 and WO 01/12667, the contents of which are incorporated herein by reference) typically contain piggyBac-half sides or parts thereof, including 5' piggyBac terminal sequences (referred to as piggyBacL) and 3' piggyBac terminal sequences (referred to as piggyBacR), which flank a transformation marker gene and a cloning site to insert the genes-of-interest. (see Handler, A. M., 2001. A current perspective on insect gene transfer. Insect Biochem. Mol. Biol., 31, 111-128, the contents of which are incorporated herein by reference.) For vectors that are not autonomously transpositionally active, the transposase gene is partially deleted or interrupted by marker genes or genes-of-interest, thereby mutating the transposase. Non-autonomous vectors require an independent source of functional transposase for mobilization resulting in transposition. In contrast to conventional vectors, pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} is provided with an additional piggyBacL half side (referred to as L2 half side) that is in the same orientation as the L1 half side, and positioned internal to the piggyBac L1 and R1 half sides. In this orientation, transposition can occur utilizing the L1 and R1 half sides, or the internal L2 and R1 half sides. In addition, pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} contains a unique KasI restriction endonuclease site in the piggyBacL1 region that can be used to insert genes of interest. In order to follow the primary transformation integration event of the L1 and R1 half-sides and to distinguish it from integration of L2 and R1 half-sides, independent transformation marker genes are placed in-between the two half-side pairs. In pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1 }, the PUbDsRed1 (see WO 01/14537, the contents of which are incorporated herein by reference) marker is placed in-between the L1 and L2 half sides, and the 3.times.P3-ECFP (see WO 01/12667, the contents of which are incorporated herein by reference) marker is placed in-between, the L2 and R1 half sides.

pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1}:

[0030] A 3.7-kb AflIII-AflII fragment from pB[PUbDsRed1], containing 0.7 kb of piggyBac L1 half-side DNA and adjacent 5' insertion site DNA and the polyubiquitin:DsRed1 DNA gene, was blunted by Klenow-mediated nucleotide fill-in reaction and isolated by agarose gel purification. The blunted fragment was ligated into the MscI site of pXL-BacII-3.times.P3-ECFP. Plasmids having the 3.times.P3-ECFP and polyubiquitin:DsRed1 reading frames in opposite orientation were selected.

phspBac Transposase Helper Plasmid:

[0031] For germline transformation experiments, the helper phspBac was (see PCT WO 01/14537, the contents of which are incorporated herein by reference).

[0032] Experimental Steps of the Transgene Immobilization Process:

a) Germ-Line Transformation with pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1 }

[0033] The pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} vector was integrated into the Drosophila genome of the white eye w[m] strain by coinjection with the phspBac helper plasmid into pre-blastoderm embryos. Using conventional piggyBac-mediated germ-line transformation methods (see U.S. Pat. No. 6,218,185 and WO 01/14537, the contents of which are incorporated herein by reference), seven putative G1 transformant lines expressing only the 3.times.P3-ECFP marker were observed and discarded. One G1 male fly exhibited both thoracic expression of DsRed and eye expression of ECFP, and it was backcrossed to w[m] females to create a line designated as F34. Transformation by an intact pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} vector by piggyBac-mediated transformation in F34 was confirmed by sequencing of internal PCR products and inverse PCR products, derived from F34 genomic DNA, which provided the insertion site DNA sequence (see below).

b) PiggyBac Transposase-Induced Excision of PiggyBacL2 and PiggyBacR1

[0034] Transformed individuals identified and confirmed to have the marker genes 3.times.P3-ECFP and PUbDsRed1 were backcrossed to w[m] flies for two generations. The presence of both markers solely in female progeny from F34 parental males indicated X-chromosome sex-linkage for the primary integration. F34 flies were mated as transgene heterozygotes to a piggyBac jumpstarter strain (w+/Y;pBac/pBac;+/+) having a homozygous P-element-mediated integration of an hsp70-regulated piggyBac transposase gene into chromosome 2 and marked with the wild type white+ allele. Larval and pupal offspring of these matings were heat shocked at 37.degree. C. for 60 minutes every second day until adult emergence to promote transposase gene expression. Male and female progeny of these matings were screened, with those carrying the transposase gene (red eye pigmentation) and expressing the fluorescent protein markers, PUb-DsRed1 and 3.times.P3-ECFP, being mated to w[m] individuals. Ten matings of 4 to 5 appropriately marked females to w[m] males and 18 matings of 2 to 3 marked males to w[m] females were set up. Progeny from these matings were screened for expression of PUb-DsRed1 and the absence of 3.times.P3-ECFP, which would indicate loss by remobilization of the piggyBacL2 and piggyBacR1 half sides with the intervening 3.times.P3-ECFP marker DNA. Progeny expressing only DsRed1 fluorescence were detected at an approximate frequency of 2% of all flies screened. A single white eye male (lacking the transposase gene) and expressing DsRed1, and not ECFP, was outcrossed to w[m] females with the resultant line designated as F34-1M.

c) Molecular Analysis of the Vector Integration Before and after Remobilization

[0035] The pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} integration into the F34 Drosophila genome was initially identified by phenotypic expression of the DsRed and ECFP marker genes and verified by PCR amplication of transformant DNA using primers internal to the vector sequence (see FIG. 3). Genomic insertion site DNA flanking the integration was obtained by inverse PCR of the piggyBacL1 5'-end half side using the 122R and 139F primers, in outward orientation, to F34 genomic DNA digested with MspI endonuclease and circularized by ligation. The 5' end insertion site sequence was compared by BLAST analysis to the Drosophila Genome Sequence Database, and consistent with segregation analysis, was found to be homologous to sequence found on the X-chromosome at locus 9B4. The database sequence was used to derive the piggyBacR1 3'-end insertion site, and the 197F and 196R PCR primers were created to genomic insertion site DNA at the 5' and 3'-end flanking sequences, respectively. The genomic primers were then used to amplify and sequence DNA that spans the pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} integration in F34, to further verify it as a primary intact piggyBac vector integration. The 197F and 196R primers were then used for PCR of F34-1M genomic DNA, which confirmed remobilization of the L2-PUbDsRed1-R1 internal vector DNA in F34. Further verification of the vector integration and subsequent re-mobilization was achieved by sequencing of PCR products obtained with primers 196 and 197 in combination with primers to internal vector DNA described in FIG. 3. In all cases, positive PCR results yielded sequences consistent with a primary integration of pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1} in F34, and remobilization of the L2-PUbDsRed1-R1 sequence in F34-1M flies. PCR products were not obtained in F34-1M flies using primers to the L2-PUbDsRed1-R1 sequence consistent with its deletion from the genomic DNA after re-mobilization.

Embodiment 2

Conditional Excision-Competent Transformation Vectors

[0036] The structure of the conditional excision-competent transformation vector, pBac_STBL, as well as the experimental steps are depicted schematically in FIGS. 4 and 6. pBac_STBL is based on the transposable element "piggybac" (see U.S. Pat. No. 6,218,185, the contents of which are incorporated herein by reference) and is a modified version of pBac{L1-PUbDsRed1-L2-3.times.P3-ECFP-R1 }. In pBac-STBL the internal transposon half-side (R2) is a duplication of the piggyBac 3'-end, and it is in reverse, or opposite, orientation to R1. In addition, it is flanked in upstream and downstream positions by FRT (FLP recombinase target) sites in opposite directions that create an inversion by recombination in the presence of FLP recombinase (see FIGS. 4 and 6). Therefore, in this vector, only the piggyBacL1 and R1 half sides and intervening DNA can integrate, but re-mobilization of piggyBacR2 together with piggyBacL1 or piggyBacR1 should not be possible. Mobilization of piggyBacR2 and L1 is only possible after FRT recombination.

[0037] In addition, pBac_STBL contains unique cloning sites for the rare octamer-specific restriction enzymes AscI and FseI. pBac_STBL is equipped with two separable transformation marker genes (see WO 01/12667, the contents of which are incorporated herein by reference), which are located upstream of the AscI/FseI cloning sites (3.times.P3-EYFP; FIG. 6) and downstream of the FRT-sites (3.times.P3-DsRed; FIG. 6), respectively. In the following, the details of pBac_STBL plasmid construction starting from plasmid vectors already published are disclosed:

pSL-3.times.P3-DsRedaf:

[0038] A 0.8 kb SalI-NotI fragment from pDsRed1-1 (Clontech, Palo Alto, Calif.) is cloned into the plasmid pSL-3.times.P3-EGFPaf (see WO 01/12667, the contents of which are incorporated herein by reference) previously digested with SalI-NotI. Thereby, the EGFP (0.7 kb) open reading frame was replaced by the DsRed (0.8 kb) open reading frame.

pSLfaFRTfa:

[0039] The FRT sequence (90 bp) is prepared by SalI-Asp718 restriction of PSL>AB> and cloned into the plasmid pSLfa1180fa previously digested with XhoI-Asp718. The FRT sequence corresponds to the substrate of the FLP recombinase:

TABLE-US-00001 TTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC AGAGCGCTTTTGAAGCT

pSL-3.times.P3-DsRed-FRT:

[0040] A 1.0 kb EcoRI-BsiWI fragment from pSL-3.times.P3-DsRedaf (containing the DsRed-ORF under 3.times.P3 promoter control) is cloned into pSLfaFRTfa previously digested with EcoRI-Asp718.

pSL-3.times.P3-DsRed-FRT-FRT:

[0041] The PCR amplification product of the FRT sequence (template: pSL>AB>; Primers: CH_FRT_F 5'-GAGCTTAAGGGTACCCGGGGATCTTG-3' and CH_FRT_R

[0042] 5'-GACTAGTCGATATCTAGGGCCGCCTAGCTTC-3') is digested with BfrI-SpeI and cloned into pSL-3.times.P3-DsRed-FRT previously digested with BfrI-SpeI. Both FRT sequences are oriented in opposite directions.

pSL-3.times.P3-DsRed-FRT-pBacR2-FRT:

[0043] The piggyBac 3' sequence (referred to as: piggyBacR2) is prepared as a 1.3 kb HpaI-EcoRV fragment from the plasmid p3E1.2 (see U.S. Pat. No. 6,218,185, the contents of which are incorporated herein by reference) and cloned into the plasmid pSL-3.times.P3-DsRed-FRT-FRT previously cut with EcoRV. The piggyBacR2 insertion with an orientation opposite to the DsRed-ORF is chosen (the EcoRV cloning site is restored at the 5' end of the insertion).

pBac_STBL:

[0044] A 2.7 kb EcoRI-BfrI fragment (both restriction sites filled in by Klenow reaction) from pSL-3.times.P3-DsRed-FRT-pBacR2-FRT is cloned into pBac-3.times.P3-EYFPaf (see WO 01/12667, the contents of which are incorporated herein by reference) previously cut with BglII (Klenow fill-in reaction). The insertion with an opposite orientation of the DsRed- and EYFP-ORFs is chosen. This final plasmid contains piggyBacR2 in opposite orientation to piggyBacR1 (FIG. 6).

phspBac Transposase Helper Plasmid:

[0045] For germline transformation experiments, the helper phspBac is used (see PCT WO 01/14537, the contents of which are incorporated herein by reference).

Experimental Steps of the Transgene Immobilization Process (FIG. 4 and FIG. 6)

[0046] a) Germline Transformation of pBac_STBL (Step 1 in FIG. 4 and FIG. 6)

[0047] DNA-sequences included in the plasmid pBac_STBL within the ends of piggyBacL1 and piggyBacR1 are integrated into the Drosophila genome by piggyBac-mediated germline transformation (see U.S. Pat. No. 6,218,185 and WO 01/14537, the contents of which are incorporated herein by reference). Similar constructs incorporating genes-of-interests inserted at the unique cloning sites would be treated in the same way.

[0048] b) FLP Recombinase Induced Inversion (Step 2 in FIG. 4 and FIG. 6)

[0049] Genomic integrations of the pBac_STBL transgene are identifiable by both EYFP and DsRed eye fluorescence (see WO 01/12667, the contents of which are incorporated herein by reference). Following the identification of transgenic founder individuals (and to establish Drosophila strains carrying the transgene in the homozygous state), the inversion of the piggyBacR2 sequence is carried out. This is performed by crossing in the strain beta2t-FLP that expresses FLP-recombinase during spermatogenesis. Alternatives of step 2 in FIG. 6 include crossing in hsp70-FLP and hsFLP-strains, respectively, or microinjection of a FLP-recombinase encoding plasmid, e.g. pKhsp82-FLP (into preblastoderm embryos of homozygous transgenic pBac_STBL lines). Though the inversion event cannot be detected by the marker genes included into pBac_STBL, a statistical equilibrium of original and inverted orientation of the piggyBacR1 sequence can be assumed. Thus, the inversion process is detected by testing several independent sublines by sequencing of vector PCR products to identify sublines having undergone piggyBacR1 inversion.

[0050] c) PiggyBac Transposase Induced Deletion (Step 3 in FIG. 4 and FIG. 6)

[0051] Strains with inverted piggyBacR2 sequence are crossed to piggyBac transposase expressing strains (referred to as jumpstarter). Different lines of the Drosophila strain Her{3.times.P3-ECFP, alphaltub-piggyBacK10} are available for this step. Progeny from this cross expressing both EYFP/DsReD (indicating the presence of pBac_STBL) and ECFP (indicating the presence of the jumpstarter) are crossed out in single male setups.

[0052] d) Identification of Immobilized Transgene DNA

[0053] ECFP.sup.- progeny (selection against the jumpstarter) of single male crossings are analyzed for both the presence of EYFP fluorescence and the absence of DsRed fluorescence. Individuals putatively containing a transposon deletion event should show EYFP but absence of DsRed fluorescence and can be analyzed further. By inverse PCR, the transposon deletion can be molecularly confirmed and stability of the potentially immobilized transgene insertion can be assessed by challenging the transgene insertion with piggyBac transposase.

Embodiment 3

RMCE with Subsequent Transposon Deletion

[0054] The RMCE-acceptor plasmid, pBac{3.times.P3-FRT-ECFP-linotte-FRT3} (FIG. 8), is a piggyBac-based transformation vector that was provided additionally with a DNA exchange cassette. This cassette consists of two heterospecific FRT sites (referred to as FRT and FRT3 equivalent to F and F3 (published in European Patent No. EP 0 939 120 A1, the contents of which are incorporated herein by reference)) in parallel orientation.

[0055] European Patent No. EP 0 939 120 A1 (see page 2, line 50 to page 3, line 6) teaches the technology of the RMCE reaction: [0056] "Recombinases such as FLP and Cre have emerged as powerful tools to manipulate the eucaryotic genome (Kilby, N. J., Snaith, M. R., Murray, J. A. H. (1993). Site-specific recombinases: tools for genome engineering. Trends Genet. 9, 413-421, and Sauer B. (1994). Site-specific recombination: developments and applications. Curr. Opin. Biotechnol. 5, 521-527, the contents of which are incorporated by reference herein). These enzymes mediate a recombination between two copies of their target sequence and have mainly been used for deletions. We show here that FLP-RMCE can be applied to introduce secondary mutations at a locus which has been previously tagged by a positive/negative selectable marker, and that these secondary mutations can be produced without depending on a selectable marker on the incoming DNA. FLP-RMCE utilizes a set of two 48 bp. FLP target sites, in this case wild type (F) and F3, a mutant that was derived from a systematic mutagenesis of the 8 bp spacer localized between the FLP binding elements (see Schlake, T., Bode, J. (1994). Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomal loci. Biochemistry 33, 12746-12751, the contents of which are incorporated by reference herein). FLP effects recombination between the F3/F3 couple which is as efficient as between the wild type sites (F/F) but it does not catalyze recombination between a F/F3 pair (Seibler J., Bode J. (1997). Double-reciprocal crossover mediated by FLP-recombinase: a concept and an assay. Biochemistry 36, 1740-1747, the contents of which are incorporated by reference herein). Thereby FLP-RMCE enables the specific exchange of an expression cassette in the genome which is flanked by a F3-site on one end and a F-site on the other for an analogous cassette comprising virtually any sequence which is provided on a plasmid in a single step without the need of introducing a positive selectable marker. Nothing else in the genome is altered and no plasmid sequences are inserted. In contrast to approaches using a single recombination site the targeting product is stable even under the permanent influence of the recombinase unless it is exposed to an exchange plasmid (Seibler J., Bode J. (1997). Double-reciprocal crossover mediated by FLP-recombinase: a concept and an assay. Biochemistry 36, 1740-1747, the contents of which are incorporated by reference herein). The system can be used to analyze the function of either a gene product or of regulatory sequences in ES-cells or of the derived transgenic mice." (citations added)

[0057] In the present invention, FRT and FRT3 flank the ECFP open reading frame and a "homing sequence". As a "homing sequence", the 1.6 kb HindIII fragment of the Drosophila linotte locus was chosen (see Taillebourg, E. & Dura, J. M. (1999). A novel mechanism for P element homing in Drosophila. Proc. Natl. Acad. Sci. USA 96, 6856-6861, the contents of which are incorporated herein by reference. This particular sequence has been described to act as "bait" for homing of identical/homologous DNA sequences by a process called "para-homologous pairing". We have shown previously that the positioning of the FRT site between the 3.times.P3 promoter and the start codon of the ECFP open reading frame does not interfere with expression of the 3.times.P3-ECFP gene (see PCT WO 01/12667, the contents of which are incorporated herein by reference). The RMCE donor plasmid, pSL-FRT-EYFP-pBacR2-3.times.P3-DsRed-linotte-FRT3 (FIG. 10), contains the DNA cassette to be recombined in. The donor cassette comprises the two heterospecific FRT sites (FRT and FRT3) flanking the EYFP open reading frame (promoter-free), a piggyBacR2 3'-half side sequence, the transformation marker gene 3.times.P3-DsRed and the homing sequence from the linotte locus (identical to the linotte sequence in the RMCE acceptor). The RMCE donor plasmid is a derivative of the plasmid pSLfa1180fa (see Patent Cooperation Treaty PCT WO 01/12667 A1), which does not contain any transposon sequences. AscI/FseI cloning sites have been incorporated to ease the insertion of gene(s)-of-interest upstream of the piggyBacR2 sequence.

[0058] In the following, the details of the RMCE plasmids construction starting from plasmid already published are disclosed:

Construction of the RMCE Acceptor Plasmid (FIG. 8):

[0059] pSL-3.times.P3-FRT-ECFPaf:

[0060] A 90 bp SalI-Asp718 fragment from the plasmid pSL>AB> containing the FRT sequence was cloned into the plasmid pSL-3.times.P3-ECFPaf (see Patent Cooperation Treaty PCT WO 01/12667, the contents of which are incorporated herein by reference) previously digested with SalI-Asp718. The FRT sequence corresponds to the substrate of the FLP recombinase:

TABLE-US-00002 TTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC AGAGCGCTTTTGAAGCT

pBac{3.times.P3-FRT-ECFPaf}:

[0061] A 1.3 kb EcoRI-(blunted by Klenow fill in reaction)-NruI fragment from the plasmid pSL-3.times.P3-FRT-ECFPaf was cloned into the plasmid p3E1.2 previously digested with HpaI.

pBac{3.times.P3-FRT-ECFP-linotte-FRT3}, Final RMCE Acceptor Plasmid:

[0062] The plasmid pBac{3.times.P3-FRT-ECFPaf} was digested with AscI-BglII, and the following sequences were cloned into the linearized vector:

[0063] i) the AscI-Asp718 cut PCR amplification product of the 1.6 kb HindIII genomic linotte fragment. As a template, genomic DNA of Drosophila melanogaster, strain OregonR, was chosen and as primers:

TABLE-US-00003 CH_lioFwd (5'-TTGGCGCGCCAAAAGCTTCTGTCTCTCTTTCTG-3') and CH_lioRev (5'-CGGGGTACCCCAAGCTTATTAGAGTAGTATTCTTC-3') and

[0064] ii.) the Asp718-BglII cut PCR amplification product of the FRT3 sequence (mutagenic PCR). As a template, the plasmid PSL>AB> was chosen and as primers:

[0065] CH_F3Fwd (5'-TTGGCGCGCCAAGGGGTACCCGGGGATCTTG-3') und

[0066] CH_F3Rev (5'-CGCTCGAGCGGAAGATCTGAAGTTCCTATACTATTTGAAGAATAG-3').

[0067] The FRT3 sequence corresponds to the F3 sequence (European Patent No. EP 0 939 120 A1):

TABLE-US-00004 TTGAAGTTCCTATTCCGAAGTTCCTATTCTtcAaAtAGTATAGGAACTTC AGAGCGC

[0068] The diagram of this final RMCE acceptor vector is shown in FIG. 8.

[0069] Construction of the RMCE Donor Plasmid (FIG. 10)

pSL-3.times.P3-FRT-EYFPaf:

[0070] Construction was analogous to pSL-3.times.P3-FRT-ECFPaf, but into the plasmid pSL-3.times.P3-EYFPaf (see WO 01/12667, the contents of which are incorporated herein by reference).

pSL-FRT-EYFPaf:

[0071] The 3.times.P3 promoter sequence was deleted from the plasmid pSL-3.times.P3-FRT-EYFPaf by digestion with EcoRI-BamHI, filling-in by Klenow enzyme reaction and finally religating the blunted plasmid.

pSL-FRT-EYFP-linotte-FRT3:

[0072] A 1.7 kb AscI-BglII (both sites blunted by Klenow fill-in reaction) fragment from pBac{3.times.P3-FRT-ECFP-linotte-FRT3} was cloned into the plasmid pSL-FRT-EYFPaf previously digested with NruI. The orientation with maximal distance of the FRT and FRT3 sites was chosen.

pBac{3.times.P3-DsRedaf}:

[0073] A 1.2 kb EcoRI (site blunted by Klenow fill-in reaction)-NruI fragment from the plasmid pSL-3.times.P3-DsRedaf was cloned into the plasmid p3E1.2 (see U.S. Pat. No. 6,218,185, the contents of which are herein incorporated by reference) previously digested with BglII-(site blunted by Klenow fill-in reaction)-HpaI.

pSL-FRT-EYFP-linotte-FRT3-3.times.P3-DsRed:

[0074] A 1.25 kb EcoRI-(site blunted by Klenow fill-in reaction)-NruI fragment from pSL-3.times.P3-DsRedaf was cloned into the plasmid pSL-FRT-EYFP-linotte-FRT3 previously digested with SpeI (site blunted by Klenow fill-in reaction).

pSL-FRT-EYFP-pBacR-3.times.P3-DsRed-linotte-FRT3, Final RMCE Donor Plasmid:

[0075] A 2.5 kb AscI-(site blunted by Klenow fill-in reaction)-EcoRV fragment from pBac{3.times.P3-DsRedaf} was cloned into the plasmid pSL-FRT-EYFP-linotte-FRT3 previously cut with EcoRI (site blunted by Klenow fill-in reaction).

[0076] The diagram of this final RMCE acceptor vector is shown in FIG. 10.

FLP Recombinase Plasmid Source: pKhsp82-FLP:

[0077] A 2.2 kb Asp718-XbaI (sites blunted by Klenow fill-in reaction) fragment from the plasmid pFL124 containing the FLP recombinase ORF and the 3' transcriptional terminator from the adh gene was cloned into the plasmid pKhsp82) previously cut with BamHI (site blunted by Klenow fill-in reaction).

phspBac Transposase Helper Plasmid:

[0078] For germ-line transformation experiments, the helper phspBac was used (see PCT WO 01/14537 A1).

DNA Cassette Exchange by RMCE is Highly Efficient in Drosophila melanogaster

[0079] Practical application of RMCE-based gene targeting and germline transformation (e.g. for the purpose of immobilizing transgenes) will depend strongly on the efficiency of the DNA cassette exchange. This efficiency should be in the range observed with conventional transposon-mediated germline transformation systems that allow the isolation of several transgenic founder individuals among 1,000-10,000 progeny screened. Previous experiments involving DNA cassette exchange have been performed only using cell culture and stringent selection conditions. Therefore the efficiency of such a system in an invertebrate organism such as Drosophila is hard to predict. Hence, a pilot experiment was performed. An intermediate of the RMCE donor plasmid, pSL-FRT-EYFP-linotte-FRT3 and the FLP recombinase expression vector pKhsp82-FLP were co-injected into pre-blastoderm embryos of a Drosophila melanogaster acceptor strain. These embryos carry the RMCE acceptor transgene vector (FIG. 8) integrated by piggyBac-mediated germ-line transformation, in a homozygous state. The final concentration of the plasmids in the injection mix was 500 ng/.mu.l (RMCE donor plasmid) and 300 ng/.mu.l (pKhsp82-FLP). Altogether, around 3,000 Drosophila embryos were injected, corresponding to ten times the number necessary for a conventional piggyBac-mediated germ-line transformation. Successful exchange of the acceptor by the donor cassette was indicated by the change in the eye fluorescence from ECFP to EYFP (in F1 individuals). Results documenting the frequency of such exchange events are given in Table 1:

TABLE-US-00005 TABLE 1 Results of the RMCE experiment in Drosophila with the donor plasmid pSL-FRT-EYFP-linotte-FRT3. Acceptor lines (II: second, III: third chromosomal homozygous, ECFP fluorescence) used for microinjection, number of injected embryos, male and fertile male injection survivors and the number of vials containing EYFP-positive progeny are given. Male Fertile Male Vials Acceptor Injected Injection with EYFP-pos. and Line Embryos Survivors Inj. Surv. ECFP-neg. progeny M4.II ECFP 750 121 70 22 M7.III ECFP 750 138 72 17 M8.II ECFP 600 68 54 12 M9.II ECFP 750 123 109 27

[0080] EYFP-positive founder males resulting from targeting events were bred to homozygosity and established as stocks (referred to as "M4.II EYFP", "M7.III EYFP", "M8.II EYFP" and "M9.II EYFP", respectively). Segregation analysis (genetic mapping of transgene integrations) indicated for all four lines that the chromosomal localization of the donor and acceptor transgene is identical.

[0081] We define the DNA cassette exchange frequency as a percentage of fertile F.sub.1 vials producing EYFP-positive progeny. With this definition, the frequency of RMCE events is 25% on average corresponding well to the germ-line transformation frequency usually observed with piggyBac, Hermes or Minos-based vectors in Drosophila). This experiment demonstrates that, with the particular design of RMCE-vectors, the process of cassette exchange is highly efficient in an invertebrate organism such as Drosophila.

Molecular Characterization of RMCE Events and Integration Site Analysis

[0082] a) Genomic Integration Site of Donor and Acceptor Transgenes

[0083] The exchange of eye fluorescence from ECFP to EYFP suggests that the donor cassette (carrying the promotor-free eyfp gene) integrated at the locus of the acceptor transgene (providing the 3.times.P3 promoter). Therefore, the genomic integration sites of the acceptor transgene in the acceptor line and of the donor transgene in the corresponding donor line should be identical. To identify genomic integration sites, inverse PCR experiments were carried out for acceptor and donor Drosophila lines. To recover DNA sequences flanking piggybac insertions, inverse PCR was performed. The purified fragments were directly sequenced for the 5' junction with primer CH_PLSeq 5'-CGGCGACTGAGATGTCC-3'. The obtained sequences were used in BLAST searches against the Drosophila Genome Sequence Database. For the 5' junction, genomic DNA sequence identity could be confirmed for three acceptor/donor pairs (Table 2).

TABLE-US-00006 TABLE 2 Genomic integration sites of the acceptor transgene pBac {3xP3-FRT-ECFP-linotte-FRT3} in four Drosophila lines used for RMCE targeting. Sequence numbers and nucleotide positions refer to the Release 3 sequence of the Drosophila Genome Sequence Database. Identical Location for corre- of insert sponding Acceptor Chromosome genomic donor line arm scaffold position line? M4.II ECFP 2L AE003662.3 204692 yes (M4.II EYFP) M7.III ECFP 3L AE003558.3 171057 yes (M7.III EYFP) M8.II ECFP 2L AE003618.2 15414 yes (M8.II EYFP) M9.II ECFP 2L AE003662.3 15805 nd.

For three corresponding RMCE donor lines, integration sites could be confirmed to be identical. nd.: not determined

[0084] Interestingly, the acceptor line M9.II ECFP was found to carry the acceptor transgene integrated at the Drosophila-endogenous linotte locus (integration position corresponds to bp 1185). This suggests that "para-homologous pairing" of the linotte sequences included in the acceptor plasmid to the homologous genomic sequence occurred, further verifying the homing phenomenon.

b) Southern Analysis

[0085] To further verify at the molecular level that the donor transgene targeted the acceptor locus via an RMCE mechanism, Southern analysis on genomic DNA of the four acceptor and the four donor lines was performed. PstI was chosen as an indicative restriction digest and a probe hybridizing to gfp-based transformation marker genes (hybridizing to both ECFP and EYFP) was selected (FIG. 9). Only one strong hybridization signal was present in all acceptor lines which is consistent with a single integration of the acceptor transgene. The expected pattern of DNA-DNA hybridization, 2.4 kb for the acceptor transgene and 1.6 kb for the donor transgene, was detected for all four lines for each transgene (FIG. 9). Additionally, a -6 kb hybridization signal was detected only in RMCE donor lines. As this signal might indicate the presence of the complete donor vector, further Southern experiments (using probes against the pUC plasmid backbone sequences) were carried out. The presence of pUC sequence in the donor lines could be confirmed (data not shown) pointing toward an integration of the entire donor vector in the four donor lines analyzed.

[0086] In summary, three lines of evidence let us infer that targeting of the RMCE acceptor locus by the RMCE donor vector took place: i) the exchange in eye color fluorescence from ECFP (acceptor) to EYFP (donor), ii) the identity of genomic DNA sequence flanking the piggyBac transgene integration in corresponding acceptor and donor lines, and iii) DNA hybridization signals in accordance with expectations for the exchange of the ecfp to the eyfp open reading frame.

Recombination Occurs by Cassette Exchange Via FRT and FRT3

[0087] The recombinase-mediated cassette exchange mechanism requires a double recombination event (see European Patent No. EP 0 939 120, the contents of which are incorporated herein by reference). Because the Southern analysis suggests that in the pilot RMCE experiments single recombination events caused integration of the entire donor plasmid, we analyzed in more detail whether the RMCE mechanism, which has not been established for an invertebrate organism, can occur in Drosophila. To this end, we modified the donor construct to include a 3.times.P3-DsRed marker gene downstream to the FRT3 sequence (pSL-FRT-EYFP-linotte-FRT3-3.times.P3-DsRed). This vector configuration allows the separation of RMCE events: [0088] 1) double cross-over via FRT and FRT3 sites resulting in ECFP to EYFP eye fluorescence exchange [0089] 2) single recombination events (via FRT site) resulting in ECFP to EYFP and DsRed eye fluorescence exchange [0090] 3) single recombination events (via FRT3 site) resulting in ECFP to DsRed (and ECFP) eye fluorescence exchange

[0091] For the targeting experiment, the acceptor line M4.II ECFP (Table 1) was selected for further testing. F1 individuals with ECFP to EYFP exchange indicating targeting were observed at a frequency of 13.1%:

TABLE-US-00007 Embryos injected: 750 single G0 male founders: 109 Fertile G0 male founders: 84 Setups producing EYFP-fluorescing F1 progeny: 11

[0092] The eleven setups yielding EYFP-fluorescing individuals were analyzed for the occurrence of double and single recombination events (Table 3).

TABLE-US-00008 TABLE 3 Phenotypic analysis of F1 progeny from G0 male founders of the acceptor line M4.II ECFP injected with the donor pSL-FRT-EYFP-linotte-FRT3-3xP3-DsRed. Double and single recombination events are indicated by differential analysis of eye fluorescence for ECFP, EYFP and DsRed. Phenotype of individual flies double recombination single FRT rec.single FRT3 rec. EYFP.sup.+ DsRed.sup.+DsRed.sup.+, Setup# (DsRed.sup.-, EYFP.sup.+, ECFP.sup.+ Stocks ECFP.sup.-) (ECFP.sup.-) (EYFP.sup.-) established 1 1 1 0 2 1 0 0 R1 3 2 6 0 4 4 0 0 R2 5 3 0 0 R3 6 3 0 0 R4 7 1 10 0 R5 (EYFP.sup.+, DsRed.sup.+) 8 13 26 0 R3 (EYFP.sup.+, DsRed.sup.+) 9 1 2 0 10 11 3 0 11 1 0 0

[0093] Five out of eleven setups produced progeny showing EYFP but lacking DsRed (and ECFP) fluorescence. This phenotype is consistent with targeting via double recombination with only sequences between FRT and FRT3 being exchanged. However, single recombination events via FRT were also observed, in contrast to no single recombinations via FRT3. The results indicate that recombinase mediated cassette exchange is mechanistically feasible in an invertebrate organism (the vinegar fly Drosophila melanogaster) and, by applying a simple eye fluorescence marker scheme, double recombination events can be selected for.

Experimental Steps of the Transgene Immobilization Process (FIG. 5 and FIG. 7)

[0094] The previous results demonstrate that recombinase mediated targeting of genomic DNA loci is possible in an invertebrate organism like Drosophila. As depicted in FIG. 5, the RMCE strategy can be further employed for the purpose of post-transformational transgene immobilization. The general procedure consists of two steps. In the first step, a transformation vector containing the gene of interest, a transposon half-side (TransposonR2 in FIG. 5) and an additional marker gene is used as the RMCE donor to target the RMCE acceptor line (i.e. RMCE acceptor vector (FIG. 8) genomically integrated). By a single or double recombination event, an `internal` piggyBac transposon comprising both half-sides (piggyBacL1 and piggyBacR2 in FIG. 5) is reconstituted. In a second step, transposase activity is introduced to remobilize the `internal` transposon by selecting for individuals lacking the additional marker gene as demonstrated in embodiment 1.

[0095] In the following section we provide data that prove this principle:

Step 1: Targeted DNA Cassette Exchange (RMCE, Step 1 in FIG. 5 and FIG. 7)

[0096] The final donor plasmid, pSL-FRT-EYFP-pBacR2-3.times.P3-DsRed-linotte-FRT3 (FIG. 10, in the following referred to as "final RMCE donor") contains, in-between the FRT and FRT3 sites, a cassette with: (i) a promotor-free eyfp ORF, (ii) the piggyBacR2 (3' end) transposon sequence, (iii) the transformation marker 3.times.P3-DsRed, and (iv) the homing sequence from the Drosophila linotte locus (see Taillebourg, E. & Dura, J. M. (1999). A novel mechanism for P element homing in Drosophila. Proc. Natl. Acad. Sci. USA 96, 6856-6861, the contents of which are incorporated herein by reference). Derivatives of the final RMCE donor vector carrying additional DNA sequences (genes-of-interest) can be constructed by insertion into the unique AscI and FseI cloning sites which are located upstream of the piggyBacR2 transposon sequence (FIG. 10).

[0097] Microinjection of the final RMCE donor was carried out using the Drosophila acceptor line M4.II ECFP (Table 2). This line carries the acceptor transgene pBac{3.times.P3-FRT-ECFP-linotte-FRT3} in the homozygous state. Embryos were injected under the conditions described previously. Single G0 founder males were crossed out and progeny (generation F1) were screened for the presence of both EYFP fluorescence and DsRed fluorescence (see FIG. 7). Targeting (i.e. individuals with ECFP to EYFP exchange) were observed at a frequency of 22.2%.

TABLE-US-00009 Embryos injected: 750 single G0 male founders: 178 Fertile G0 male founders: 158 Setups producing EYFP and DsRed fluorescing F1 progeny: 34

[0098] In total, 91 female and 62 male individuals were obtained which consistently showed an EYFP and DsRed eye fluorescence phenotype. Moreover, in these individuals ECFP fluorescence was absent as expected for recombination events. Though the exact mechanism (single versus double recombination) was not investigated for individuals from this targeting experiment, the previous pilot experiments suggest a significant fraction of double recombination events resulting from cassette exchange via FRT and FRT3 sites.

[0099] The results confirm a high efficiency of the gene targeting system disclosed in this embodiment, which is comparable to `conventional` transposon-mediated germ-line transformation, at least for the vinegar fly Drosophila. In particular, the efficiency did not decrease significantly due to the interruption of the linotte sequence in the final donor plasmid or the increased size (2.6 kb compared to previous "pilot" donor vector) of the final donor plasmid (FIG. 10). This suggests that recombinants can also be generated with derivatives of the final donor plasmid carrying additional gene(s)-of-interest.

Step 2: PiggyBac Transposase Induced Transposon Deletion of a Targeted Vector (Step 2 in FIG. 5 and FIG. 7).

[0100] Successful re-mobilization of the reconstituted piggyBac transposon is indicated by loss of DsRed fluorescence. Progeny lacking the sequence between piggyBacR2 and piggyBacL1 exclusively express EYFP fluorescence (see FIG. 7).

[0101] To examine whether the reconstituted internal piggyBac transposon vector can be re-mobilized by piggyBac transposase activity, individuals of generation F1 with EYFP and DsRed eye fluorescence were crossed to the following piggyBac-expressing jumpstarter lines: [0102] (1) line Her{3.times.P3-ECFP; .alpha.tub-piggyBac} M6.II, referred to as "HerM6" [0103] (2) line Her{3.times.P3-ECFP; .alpha.tub-piggyBac} M10.III, referred to as "HerM10" [0104] (3) line Mi{3.times.P3-DsRed; hsp70-piggyBac} M5.II, referred to as "MiM5"

[0105] Progeny (generation F2) carrying both the final RMCE donor and the jumpstarter transgenes were crossed individually to non-transgenic Drosophila and progeny from these crosses (generation F3) were analyzed for the presence of individuals carrying EYFP but lacking DsRed eye fluorescence (Table 4).

TABLE-US-00010 TABLE 4 Phenotypic analysis for piggyBac transposon remobilization events. Progeny from single crosses of males carrying both final RMCE donor and jumpstarter transgenes (Js) to non- transgenic Drosophila virgin females were analyzed for individuals showing EYFP eye fluorescence but lacking DsRed eye fluorescence. Js HerM6 HerM10 MiM5 Setup EYFP.sup.+ DsRed.sup.- EYFP.sup.+ DsRed.sup.- EYFP.sup.+ DsRed.sup.- 1 73 0 62 0 38 32 2 67 0 57 1 42 0 3 47 0 48 0 56 1 4 53 0 52 0 68 3 5 36 0 34 0 48 5 6 61 1 48 1 37 0 7 50 1 55 0 38 1 8 40 0 52 0 71 5 9 39 0 55 0 41 0 10 86 0 43 0 72 2 11 53 0 40 0 49 0 12 57 0 71 0 30 0 13 17 0 52 0 46 0 14 58 1 66 0 48 1 15 65 2 56 0 41 0 16 54 2 55 0 54 0 17 55 2 51 0 53 0 18 54 0 43 1 66 2 19 63 1 18 0 56 1 20 78 0 38 1 63 1 Sum: 1106 10 996 4 1017 25

Such a phenotype is consistent with a deletion of the internally reconstituted piggyBac transposon (FIG. 7).

[0106] Depending on the jumpstarter line employed, the frequency of remobilization ranged from 0.4% (HerM10) to 2.5% (MiM5). This indicates that the reconstituted internal piggyBac transposon vector can be remobilized efficiently, and the combination of different fluorescence markers allows the straightforward identification of remobilization events. Finally, the physical deletion of the reconstituted piggyBac transposon could be verified at a molecular level by PCR analysis (FIG. 9): Utilizing a primer pair binding to genomic region flanking to the RMCE acceptor transgenic line M4.II (primer M4.II Rev) and to piggyBacL1 sequences (primer pBL-R), the deletion of piggyBacL1 could be confirmed (compare PCR amplification products for acceptor line M4.II and immobilized lines #7 and #8 in FIG. 9). Moreover, utilizing a primer pair binding to genomic region flanking to the RMCE acceptor transgenic line M4.II (primer M4.II Rev) and to the linotte sequence (primer lioFwd) the truncation of the immobilized transgene could be confirmed (FIG. 9). The piggyBac remobilization event can be further confirmed by DNA sequencing over the genomic DNA to transgene DNA junction.

[0107] In conclusion, our data provide a proof-of-principle for the strategy of transgene immobilization by "RMCE with subsequent transposon deletion" in an invertebrate organism (Drosophila melanogaster).

ADVANTAGES OF THE INVENTION OVER THE PRIOR ART

[0108] The major advantage of the novel transformation systems disclosed in this patent application is the possibility to physically delete transposon DNA following the germ-line transformation process, in addition to targeting transgene integrations into predefined target sites. In this way, transposase-mediated mobilization or cross-mobilization of the genes-of-interest are excluded mechanistically and random genomic integrations are eliminated. In contrast to conventional germ-line transformation technology, our systems provide enhanced stability to the transgene insertion. Furthermore, DNA sequences required for the modification (e.g. transformation marker genes, transposase or recombinase target sites) are, to a large extent, removed from the genome after the final experimental step (step 2 in FIG. 1, step 3 in FIG. 4 and step 2 in FIG. 5). The final transgene insertion does not contain DNA sequences encoding complete target sites for the recombinases or transposases employed during the process, thereby eliminating the possibility for instability generated by these processes.

[0109] The RMCE technology, which is disclosed in this patent application for invertebrate organisms (exemplified in Drosophila melanogaster) represents an extremely versatile tool with application potential far beyond the goal of transgene immobilization. RMCE makes possible the targeted integration of DNA cassettes into a specific genomic DNA locus. This locus is pre-defined by the integration of the RMCE acceptor plasmid and can be characterized prior to a targeting experiment. In addition to the expected expression properties of the transgenes (including strength of expression, stage-specificity, tissue-specificity, and sex-specificity), the genomic environment of the transgene integration can have a significant effect on the level and tissue-specificity of expression. Therefore, suitable loci for integrations can be pre-selected before performing a gene targeting experiment according to the requirements specific for the experimental setup, and in addition, host strains with optimal fitness may be selected. Moreover, multiple cassette exchange reactions can be performed in a repetitive way, i.e. an acceptor cassette in a particular invertebrate strain with a specific genetic makeup can be repetitively exchanged by multiple donor cassettes. Furthermore, several different transgenes can be placed exactly at the same genomic locus. This allows for the first time the ability to eliminate genomic positional effects and to comparatively study the biological effects of different transgenes.

[0110] The particular embodiments of the invention are highly flexible. The functionality of systems disclosed is neither dependent on the particular transposable elements used in the embodiments, nor on the particular transformation marker genes used in the embodiments, nor on the particular site-specific recombination system used in the embodiments, nor on the particular homing sequence used in embodiment 3. Finally, all embodiments have broad general application potential in vertebrate and invertebrate organisms that are subject to transposon-mediated transformation or recombinase-mediated recombination, and fluorescent protein marking systems.

Sequence CWU 1

1

2419096DNAArtificial SequenceDescription of Artificial Sequence Synthetic vector sequence 1ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600taaaacgacg gccagtgagc gcgcctcgtt cattcacgtt tttgaacccg tggaggacgg 660gcagactcgc ggtgcaaatg tgttttacag cgtgatggag cagatgaaga tgctcgacac 720gctgcagaac acgcagctag attaacccta gaaagataat catattgtga cgtacgttaa 780agataatcat gcgtaaaatt gacgcatgtg ttttatcggt ctgtatatcg aggtttattt 840attaatttga atagatatta agttttatta tatttacact tacatactaa taataaattc 900aacaaacaat ttatttatgt ttatttattt attaaaaaaa aacaaaaact caaaatttct 960tctataaagt aacaaaactt ttatcgaatt cctgcagccc gggggatcca ctagttctag 1020tgttcccaca atggttaatt cgagctcgcc cggggatcta attcaattag agactaattc 1080aattagagct aattcaatta ggatccaagc ttatcgattt cgaaccctcg accgccggag 1140tataaataga ggcgcttcgt ctacggagcg acaattcaat tcaaacaagc aaagtgaaca 1200cgtcgctaag cgaaagctaa gcaaataaac aagcgcagct gaacaagcta aacaatcggg 1260gtaccgctag agtcgacggt acgatccacc ggtcgccacc atggtgagca agggcgagga 1320gctgttcacc ggggtggtgc ccatcctggt cgagctggac ggcgacgtaa acggccacaa 1380gttcagcgtg tccggcgagg gcgagggcga tgccacctac ggcaagctga ccctgaagtt 1440catctgcacc accggcaagc tgcccgtgcc ctggcccacc ctcgtgacca ccctgacctg 1500gggcgtgcag tgcttcagcc gctaccccga ccacatgaag cagcacgact tcttcaagtc 1560cgccatgccc gaaggctacg tccaggagcg caccatcttc ttcaaggacg acggcaacta 1620caagacccgc gccgaggtga agttcgaggg cgacaccctg gtgaaccgca tcgagctgaa 1680gggcatcgac ttcaaggagg acggcaacat cctggggcac aagctggagt acaactacat 1740cagccacaac gtctatatca ccgccgacaa gcagaagaac ggcatcaagg ccaacttcaa 1800gatccgccac aacatcgagg acggcagcgt gcagctcgcc gaccactacc agcagaacac 1860ccccatcggc gacggccccg tgctgctgcc cgacaaccac tacctgagca cccagtccgc 1920cctgagcaaa gaccccaacg agaagcgcga tcacatggtc ctgctggagt tcgtgaccgc 1980cgccgggatc actctcggca tggacgagct gtacaagtaa agcggccgcg actctagatc 2040ataatcagcc ataccacatt tgtagaggtt ttacttgctt taaaaaacct cccacacctc 2100cccctgaacc tgaaacataa aatgaatgca attgttgttg ttaacttgtt tattgcagct 2160tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 2220ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttaaagctt atcgatacgc 2280gtacggcgcg cctaggccgg ccgatactag agcggccgcc accgcggtgg agctccagct 2340tttgttccct ttagtgaggg ttaattagat cttaatacga ctcactatag ggcgaattgg 2400gtaccgggcc ccccctcgag gtcgacggta tcgataagct tgatatctat aacaagaaaa 2460tatatatata ataagttatc acgtaagtag aacatgaaat aacaatataa ttatcgtatg 2520agttaaatct taaaagtcac gtaaaagata atcatgcgtc attttgactc acgcggtcgt 2580tatagttcaa aatcagtgac acttaccgca ttgacaagca cgcctcacgg gagctccaag 2640cggcgactga gatgtcctaa atgcacagcg acggattcgc gctatttaga aagagagagc 2700aatatttcaa gaatgcatgc gtcaatttta cgcagactat ctttctaggg ttaatctagc 2760tgcatcagga tcatatcgtc gggtcttttt tccggctcag tcatcgccca agctggcgct 2820atctgggcat cggggaggaa gaagcccgtg ccttttcccg cgaggttgaa gcggcatgga 2880aagagtttgc cgaggatgac tgctgctgca ttgacgttga gcgaaaacgc acgtttacca 2940tgatgattcg ggaaggtgtg ggatacattg atgagtttgg acaaaccaca actagaatgc 3000agtgaaaaaa atgctttatt tgtgaaattt gtgatgctat tgctttattt gtaaccatta 3060taagctgcaa taaacaagtt aacaacaaca attgcattca ttttatgttt caggttcagg 3120gggaggtgtg ggaggttttt taaagcaagt aaaacctcta caaatgtggt atggctgatt 3180atgatctaga gtcgcggccg ctacaggaac aggtggtggc ggccctcggt gcgctcgtac 3240tgctccacga tggtgtagtc ctcgttgtgg gaggtgatgt ccagcttgga gtccacgtag 3300tagtagccgg gcagctgcac gggcttcttg gccatgtaga tggacttgaa ctccaccagg 3360tagtggccgc cgtccttcag cttcagggcc ttgtggatct cgcccttcag cacgccgtcg 3420cgggggtaca ggcgctcggt ggaggcctcc cagcccatgg tcttcttctg cattacgggg 3480ccgtcggagg ggaagttcac gccgatgaac ttcaccttgt agatgaagca gccgtcctgc 3540agggaggagt cttgggtcac ggtcaccacg ccgccgtcct cgaagttcat cacgcgctcc 3600cacttgaagc cctcggggaa ggacagcttc ttgtagtcgg ggatgtcggc ggggtgcttc 3660acgtacacct tggagccgta ctggaactgg ggggacagga tgtcccaggc gaagggcagg 3720gggccgccct tggtcacctt cagcttcacg gtgttgtggc cctcgtaggg gcggccctcg 3780ccctcgccct cgatctcgaa ctcgtggccg ttcacggtgc cctccatgcg caccttgaag 3840cgcatgaact ccttgatgac gttcttggag gagcgcacca tggtggcgac cggtggatcc 3900ccgatctgca ttttggatta ttctgcgggt caaaatagag atgtggaaaa ttagtacgaa 3960atcaaatgag tttcgttgaa attacaaaac tattgaaact aacttcctgg ctggggaata 4020aaaatgggaa acttatttat cgacgccaac tttgttgaga aacccctatt aaccctctac 4080gaatattgga acaaaggaaa gcgaagaaac aggaacaaag gtagttgaga aacctgttcc 4140gttgctcgtc atcgttttca taatgcgagt gtgtgcatgt atatatacac agctgaaacg 4200catgcataca cattattttg tgtgtatatg gtgacgtcac aactactaag caataagaaa 4260ttttccagac gtggctttcg tttcaagcaa cctactctat ttcagctaaa aataagtgga 4320tttcgttggt aaaatacttc aattaagcaa agaactaact aactaataac atgcacacaa 4380atgctcgagt gcgttcgtga tttctcgaat tttcaaatgc gtcactgcga atttcacaat 4440ttgccaataa atcttggcga aaatcaacac gcaagtttta tttatagatt tgtttgcgtt 4500ttgatgccaa ttgattggga aaacaagatg cgtggctgcc aatttcttat tttgtaatta 4560cgtagagcgt tgaataaaaa aaaaatggcc gaacaaagac cttgaaatgc agtttttctt 4620gaaattactc aacgtcttgt tgctcttatt actaattggt aacagcgagt taaaaactta 4680cgtttcttgt gactttcgag aatgttcttt taattgtact ttaatcacca acaattaagt 4740ataaattttt cgctgattgc gctttacttt ctgcttgtac ttgctgctgc aaatgtcaat 4800tggttttgaa ggcgaccgtt cgcgaacgct gtttatatac cttcggtgtc cgttgaaaat 4860cactaaaaaa taccgtagtg ttcgtaacac tttagtacag agaaaaaaaa ttgtgccgaa 4920atgtttttga tacgtacgaa taccttgtat taaaattttt tatgatttct gtgtatcact 4980ttttttttgt gtttttcgtt taaactcacc acagtacaaa acaataaaat atttttaaga 5040caatttcaaa ttgagacctt tctcgtactg acttgaccgg ctgaatgagg atttctacct 5100agacgaccta cttcttacca tgacattgaa tgcaatgcca cctttgatct aaacttacaa 5160aagtccaagg cttgttagga ttggtgttta tttagtttgc ttttgaaata gcactgtctt 5220ctctaccggc tataattttg aaactcgcag cttgactgga aatttaaaaa gtaattctgt 5280gtaggtaaag ggtgttttaa aagtgtgatg tgttgagcgt tgcggcaacg actgctattt 5340atgtatatat tttcaaaact tattgttttt gaagtgtttt aaatggagct atctggcaac 5400gctgcgcata atcttacaca agcttttctt aatccatttt taagtgaaat ttgtttttac 5460tctttcggca aataattgtt aaatcgcttt aagtgggctt acatctggat aagtaatgaa 5520aacctgcata ttataatatt aaaacatata atccactgtg ctttccccgt gtgtggccat 5580atacctaaaa aagtttattt tcgcagagcc ccgcacggtc acactacggt tcggcgattt 5640tcgattttgg acagtactga ttgcaagcgc accgaaagca aaatggagct ggagattttg 5700aacgcgaaga acagcaagcc gtacggcaag gtgaaggtgc cctccggcgc cacgcccatc 5760ggcgatctgc gcgccctaat tcacaagacc ctgaagcaga ccccacacgc gaatcgccag 5820tcgcttcgtc tggaactgaa gggcaaaagc ctgaaagata cggacacatt ggaatctctg 5880tcgctgcgtt ccggcgacaa gatcgggtac cgtcgactgc agaattcgaa gcttgagctc 5940gagatctgac aatgttcagt gcagagactc ggctacgcct cgtggacttt gaagttgacc 6000aacaatgttt attcttacct ctaatagtcc tctgtggcaa ggtcaagatt ctgttagaag 6060ccaatgaaga acctggttgt tcaataacat tttgttcgtc taatatttca ctaccgcttg 6120acgttggctg cacttcatgt acctcatcta taaacgcttc ttctgtatcg ctctggacgt 6180catcttcact tacgtgatct gatatttcac tgtcagaatc ctcaccaaca agctcgtcat 6240cgctttgcag aagagcagag aggatatgct catcgtctaa agaactaccc attttattat 6300atattagtca cgatatctat aacaagaaaa tatatatata ataagttatc acgtaagtag 6360aacatgaaat aacaatataa ttatcgtatg agttaaatct taaaagtcac gtaaaagata 6420atcatgcgtc attttgactc acgcggtcgt tatagttcaa aatcagtgac acttaccgca 6480ttgacaagca cgcctcacgg gagctccaag cggcgactga gatgtcctaa atgcacagcg 6540acggattcgc gctatttaga aagagagagc aatatttcaa gaatgcatgc gtcaatttta 6600cgcagactat ctttctaggg ttaaaaaaga tttgcgcttt actcgaccta aactttaaac 6660acgttaacca tgcacgcctt taacggtgaa ctgttcgttc aggccacctg ggataccagt 6720tcgtcgcggc ttttccggac acagttccgg atggtcagcc cgaagcgcat cagcaacccg 6780aacaataccg gcgacagccg gaactgccgt gccggtgtgc agattaatga cagcggtgcg 6840gcgctgggat attacgtcag cgaggacggg tatcctggct ggatgccgca gaaatggaca 6900tggatacccc gtgagttacc cggcgggcgc gcttggcgta atcatggtca tagctgtttc 6960ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt 7020gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc 7080ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg 7140ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct 7200cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca 7260cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga 7320accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc 7380acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg 7440cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat 7500acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt 7560atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc 7620agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg 7680acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg 7740gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg 7800gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 7860gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca 7920gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga 7980acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 8040tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 8100ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt 8160catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat 8220ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag 8280caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct 8340ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 8400tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 8460cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca 8520aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 8580tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 8640gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac 8700cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa 8760aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt 8820tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt 8880tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa 8940gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt 9000atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa 9060taggggttcc gcgcacattt ccccgaaaag tgccac 909628244DNAArtificial SequenceDescription of Artificial Sequence Synthetic vector sequence 2gagctcgccc ggggatctaa ttcaattaga gactaattca attagagcta attcaattag 60gatccaagct tatcgatttc gaaccctcga ccgccggagt ataaatagag gcgcttcgtc 120tacggagcga caattcaatt caaacaagca aagtgaacac gtcgctaagc gaaagctaag 180caaataaaca agcgcagctg aacaagctaa acaatcgggg tacccgggga tcttgaagtt 240cctattccga agttcctatt ctctagaaag tataggaact tcagagcgct tttgaagcta 300ggcggcccta gagtcgacgg tacgatccac cggtcgccac catggtgagc aagggcgagg 360agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 420agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 480tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 540ggggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 600ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 660acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 720agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 780tcagccacaa cgtctatatc accgccgaca agcagaagaa cggcatcaag gccaacttca 840agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 900cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 960ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 1020ccgccgggat cactctcggc atggacgagc tgtacaagta aagcggccgc gactctagat 1080cataatcagc cataccacat ttgtagaggt tttacttgct ttaaaaaacc tcccacacct 1140ccccctgaac ctgaaacata aaatgaatgc aattgttgtt gttaacttgt ttattgcagc 1200ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc 1260actgcattct agttgtggtt tgtccaaact catcaatgta tcttaaagct tatcgatacg 1320cgtacggcgc gccaaaagct tctgtctctc tttctgtaat aaactaacga tttataaagt 1380ataaaatgtc gtaatgttta tttttggcaa catgagttta attcgaaatt gaatcaaaca 1440caataaaaaa aagttaaaag gttaaaatca ttatattaca tcattaattc gaattcattt 1500gggaagtttg tgggtctatt ttttaaactt tatatgaatg tttgtttagt taatttaata 1560aaggatatcg aacagtatgc cagttttggt atttagccaa ttggagatgt tcgatgagat 1620gttcgaactg caaccgagtt cgaggttcca acacgactgt tatacgggtt ccagccttca 1680agttctacag aacaagtcca cgagcgccac acacagtcca cagtccacac tccactccgc 1740tcggcgtgga agccattcgc ttcgtggcga agtgtttgtt tatccagttg acagtttgtg 1800gaaaatcgtc acggtgagcg gatcaaacgc ggaaaacgaa cgcggacgaa cggcgagaaa 1860agcgaggaaa aacgggtgca gagacagaga ctgattggga aatatgtgcg cctgagtttt 1920cccggccaga aggcaaagtg ccaaatgctc tgacaaataa ttcctgtaat aatcagcgcg 1980attgaaatca acgcgacgct cgtaaaattg caaatgcagc gcaaaaagtg aacagcagtg 2040cagcggaaat taaatcgttt tagcgagtgc caaacgggaa atagaaaatc ggcagagtag 2100ccgaactgca gttaaaacta tctcttcctc ttattgcgac taaacaaccg gcggattaat 2160cgaatccgaa agatggcccc caacttgcta acaatcggat tacttttgac cctgatcgcc 2220agcggtcagg cccatctcaa tattttcctc aacttgcacg aggtgctgcg cctaatcggt 2280aagtaatcgt gttgattttc gcctgccttt tggcttttca attaactggg caattatttg 2340ccactttgtg tgcgttcgtt cgactttaaa tcaaatttga tttatgccaa gccgggattt 2400tgtctcctgg gcaaacgaat gcgacttgct gggattattt actctttttg cgtaaataat 2460atatgccttt taattgtttc tagcctcgga gctacatata aagtagtatt gtccctcctt 2520caattggcca gctcaccgag aaacaagaaa acattctatt tgtctagcat gatttcctgt 2580ttctttgatt taattgttcg ttagacttat ctagataaat agaaatgcta aagcgattta 2640aatttgtatt tctttgcgtt aaattaaatt cgattggcaa gtggattcat ctctagataa 2700gtaatccctc tataatcaaa gtttttattt aaaaaatcat attttttcat agtttatcca 2760atttaaaaca atacaaaaca attttagata tattttataa acgtcttcaa aagaaaataa 2820atagtaaaat catgtagtca aaaaatgaca ccaaaatgag tatttaaata tttagtttag 2880tttagtttat attatttatt tagcctaact attttccata gaagaatact actctaataa 2940gcttggggta cccggggatc ttgaagttcc tattccgaag ttcctattct tcaaatagta 3000taggaacttc agatctgaca atgttcagtg cagagactcg gctacgcctc gtggactttg 3060aagttgacca acaatgttta ttcttacctc taatagtcct ctgtggcaag gtcaagattc 3120tgttagaagc caatgaagaa cctggttgtt caataacatt ttgttcgtct aatatttcac 3180taccgcttga cgttggctgc acttcatgta cctcatctat aaacgcttct tctgtatcgc 3240tctggacgtc atcttcactt acgtgatctg atatttcact gtcagaatcc tcaccaacaa 3300gctcgtcatc gctttgcaga agagcagaga ggatatgctc atcgtctaaa gaactaccca 3360ttttattata tattagtcac gatatctata acaagaaaat atatatataa taagttatca 3420cgtaagtaga acatgaaata acaatataat tatcgtatga gttaaatctt aaaagtcacg 3480taaaagataa tcatgcgtca ttttgactca cgcggtcgtt atagttcaaa atcagtgaca 3540cttaccgcat tgacaagcac gcctcacggg agctccaagc ggcgactgag atgtcctaaa 3600tgcacagcga cggattcgcg ctatttagaa agagagagca atatttcaag aatgcatgcg 3660tcaattttac gcagactatc tttctagggt taaaaaagat ttgcgcttta ctcgacctaa 3720actttaaaca cgtcatagaa tcttcgtttg acaaaaacca cattgtggcc aagctgtgtg 3780acgcgacgcg cgctaaagaa tggcaaacca agtcgcgcga gcgtcgactc tagaggatcc 3840ccgggtaccg agctcgaatt cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta 3900tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc 3960ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg 4020aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg 4080tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 4140gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 4200cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 4260gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 4320aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 4380ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 4440cccttcggga agcgtggcgc tttctcaatg ctcacgctgt aggtatctca gttcggtgta 4500ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 4560cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 4620agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 4680gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 4740gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 4800tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 4860agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 4920agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 4980atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg 5040cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg 5100actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc 5160aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc 5220cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa 5280ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc 5340cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg 5400ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc 5460cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat 5520ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg 5580tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc 5640ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg 5700aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat 5760gtaacccact cgtgcaccca

actgatcttc agcatctttt actttcacca gcgtttctgg 5820gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg 5880ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct 5940catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac 6000atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga cattaaccta 6060taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg acggtgaaaa 6120cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg atgccgggag 6180cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct ggcttaacta 6240tgcggcatca gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag 6300atgcgtaagg agaaaatacc gcatcaggcg ccattcgcca ttcaggctgc gcaactgttg 6360ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaaag ggggatgtgc 6420tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac 6480ggccagtgcc aagctttgtt taaaatataa caaaattgtg atcccacaaa atgaagtggg 6540gcaaaatcaa ataattaata gtgtccgtaa acttgttggt cttcaacttt ttgaggaaca 6600cgttggacgg caaatccgtg actataacac aagttgattt aataatttta gccaacacgt 6660cgggctgcgt gttttttgcc gacgcgtctg tgtacacgtt gattaactgg tcgattaaac 6720tgttgaaata atttaatttt tggttcttct ttaaatctgt gatgaaattt tttaaaataa 6780ctttaaattc ttcattggta aaaaatgcca cgttttgcaa cttgtgaggg tctaatatga 6840ggtcaaactc agtaggagtt ttatccaaaa aagaaaacat gattacgtct gtacacgaac 6900gcgtattaac gcagagtgca aagtataaga gggttaaaaa atatatttta cgcaccatat 6960acgcatcggg ttgatatcgt taatatggat caatttgaac agttgattaa cgtgtctctg 7020ctcaagtctt tgatcaaaac gcaaatcgac gaaaatgtgt cggacaatat caagtcgatg 7080agcgaaaaac taaaaaggct agaatacgac aatctcacag acagcgttga gatatacggt 7140attcacgaca gcaggctgaa taataaaaaa attagaaact attatttaac cctagaaaga 7200taatcatatt gtgacgtacg ttaaagataa tcatgcgtaa aattgacgca tgtgttttat 7260cggtctgtat atcgaggttt atttattaat ttgaatagat attaagtttt attatattta 7320cacttacata ctaataataa attcaacaaa caatttattt atgtttattt atttattaaa 7380aaaaaacaaa aactcaaaat ttcttctata aagtaacaaa acttttaaac attctctctt 7440ttacaaaaat aaacttattt tgtactttaa aaacagtcat gttgtattat aaaataagta 7500attagcttaa cttatacata atagaaacaa attatactta ttagtcagtc agaaacaact 7560ttggcacata tcaatattat gctctcgaca aataactttt ttgcattttt tgcacgatgc 7620atttgccttt cgccttattt tagaggggca gtaagtacag taagtacgtt ttttcattac 7680tggctcttca gtactgtcat ctgatgtacc aggcacttca tttggcaaaa tattagagat 7740attatcgcgc aaatatctct tcaaagtagg agcttctaaa cgcttacgca taaacgatga 7800cgtcaggctc atgtaaaggt ttctcataaa ttttttgcga ctttggacct tttctccctt 7860gctactgaca ttatggctgt atataataaa agaatttatg caggcaatgt ttatcattcc 7920gtacaataat gccataggcc acctattcgt cttcctactg caggtcatca cagaacacat 7980ttggtctagc gtgtccactc cgcctttagt ttgattataa tacataacca tttgcggttt 8040accggtactt tcgttgatag aagcatcctc atcacaagat gataataagt ataccatctt 8100agctggcttc ggtttatatg agacgagagt aaggggtccg tcaaaacaaa acatcgatgt 8160tcccactggc ctggagcgac tgtttttcag tacttccggt atctcgcgtt tgtttgatcg 8220cacggttccc acaatggtta attc 824438638DNAArtificial SequenceDescription of Artificial Sequence Synthetic vector sequence 3cgtcgctaag cgaaagctaa gcaaataaac aagcgcagct gaacaagcta aacaatcggg 60gtacccgggg atcttgaagt tcctattccg aagttcctat tctctagaaa gtataggaac 120ttcagagcgc ttttgaagct aggcggccct agagtcgacg gtacgatcca ccggtcgcca 180ccatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg 240acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct 300acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca 360ccctcgtgac caccttcggc tacggcctgc agtgcttcgc ccgctacccc gaccacatga 420agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct 480tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc 540tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc 600acaagctgga gtacaactac aacagccaca acgtctatat catggccgac aagcagaaga 660acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg 720ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc 780actacctgag ctaccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg 840tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagt 900aaagcggccg cgactctaga tcataatcag ccataccaca tttgtagagg ttttacttgc 960tttaaaaaac ctcccacacc tccccctgaa cctgaaacat aaaatgaatg caattgttgt 1020tgttaacttg tttattgcag cttataatgg ttacaaataa agcaatagca tcacaaattt 1080cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt 1140atcaagctta tcgatacgcg tacggcgcgc ctaggccggc cgatctcgcg cgccaaaagc 1200ttctgtctct ctttctgtaa taaactaacg atttataaag tataaaatgt cgtaatgttt 1260atttttggca acatgagttt aattcgaaat tgaatcaaac acaataaaaa aaagttaaaa 1320ggttaaaatc attatattac atcattaatt cgaattatcg ttaatatgga tcaatttgaa 1380cagttgatta acgtgtctct gctcaagtct ttgatcaaaa cgcaaatcga cgaaaatgtg 1440tcggacaata tcaagtcgat gagcgaaaaa ctaaaaaggc tagaatacga caatctcaca 1500gacagcgttg agatatacgg tattcacgac agcaggctga ataataaaaa aattagaaac 1560tattatttaa ccctagaaag ataatcatat tgtgacgtac gttaaagata atcatgcgta 1620aaattgacgc atgtgtttta tcggtctgta tatcgaggtt tatttattaa tttgaataga 1680tattaagttt tattatattt acacttacat actaataata aattcaacaa acaatttatt 1740tatgtttatt tatttattaa aaaaaaacaa aaactcaaaa tttcttctat aaagtaacaa 1800aacttttaaa cattctctct tttacaaaaa taaacttatt ttgtacttta aaaacagtca 1860tgttgtatta taaaataagt aattagctta acttatacat aatagaaaca aattatactt 1920attagtcagt cagaaacaac tttggcacat atcaatatta tgctctcgac aaataacttt 1980tttgcatttt ttgcacgatg catttgcctt tcgccttatt ttagaggggc agtaagtaca 2040gtaagtacgt tttttcatta ctggctcttc agtactgtca tctgatgtac caggcacttc 2100atttggcaaa atattagaga tattatcgcg caaatatctc ttcaaagtag gagcttctaa 2160acgcttacgc ataaacgatg acgtcaggct catgtaaagg tttctcataa attttttgcg 2220actttggacc ttttctccct tgctactgac attatggctg tatataataa aagaatttat 2280gcaggcaatg tttatcattc cgtacaataa tgccataggc cacctattcg tcttcctact 2340gcaggtcatc acagaacaca tttggtctag cgtgtccact ccgcctttag tttgattata 2400atacataacc atttgcggtt taccggtact ttcgttgata gaagcatcct catcacaaga 2460tgataataag tataccatct tagctggctt cggtttatat gagacgagag taaggggtcc 2520gtcaaaacaa aacatcgatg ttcccactgg cctggagcga ctgtttttca gtacttccgg 2580tatctcgcgt ttgtttgatc gcacggttcc cacaatggta attcgagctc gcccggggat 2640ctaattcaat tagagactaa ttcaattaga gctaattcaa ttaggatcca agcttatcga 2700tttcgaaccc tcgaccgccg gagtataaat agaggcgctt cgtctacgga gcgacaattc 2760aattcaaaca agcaaagtga acacgtcgct aagcgaaagc taagcaaata aacaagcgca 2820gctgaacaag ctaaacaatc ggggtaccgc tagagtcgac ggtaccgcgg gcccgggatc 2880caccggtcgc caccatggtg cgctcctcca agaacgtcat caaggagttc atgcgcttca 2940aggtgcgcat ggagggcacc gtgaacggcc acgagttcga gatcgagggc gagggcgagg 3000gccgccccta cgagggccac aacaccgtga agctgaaggt gaccaagggc ggccccctgc 3060ccttcgcctg ggacatcctg tccccccagt tccagtacgg ctccaaggtg tacgtgaagc 3120accccgccga catccccgac tacaagaagc tgtccttccc cgagggcttc aagtgggagc 3180gcgtgatgaa cttcgaggac ggcggcgtgg tgaccgtgac ccaggactcc tccctgcagg 3240acggctgctt catctacaag gtgaagttca tcggcgtgaa cttcccctcc gacggccccg 3300taatgcagaa gaagaccatg ggctgggagg cctccaccga gcgcctgtac ccccgcgacg 3360gcgtgctgaa gggcgagatc cacaaggccc tgaagctgaa ggacggcggc cactacctgg 3420tggagttcaa gtccatctac atggccaaga agcccgtgca gctgcccggc tactactacg 3480tggactccaa gctggacatc acctcccaca acgaggacta caccatcgtg gagcagtacg 3540agcgcaccga gggccgccac cacctgttcc tgtagcggcc gcgactctag atcataatca 3600gccataccac atttgtagag gttttacttg ctttaaaaaa cctcccacac ctccccctga 3660acctgaaaca taaaatgaat gcaattgttg ttgttaactt gtttattgca gcttataatg 3720gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt 3780ctagttgtgg tttgtccaaa ctcatcaatg tatcaagctt atcgatacgc gtacggcgcg 3840aattcatttg ggaagtttgt gggtctattt tttaaacttt atatgaatgt ttgtttagtt 3900aatttaataa aggatatcga acagtatgcc agttttggta tttagccaat tggagatgtt 3960cgatgagatg ttcgaactgc aaccgagttc gaggttccaa cacgactgtt atacgggttc 4020cagccttcaa gttctacaga acaagtccac gagcgccaca cacagtccac agtccacact 4080ccactccgct cggcgtggaa gccattcgct tcgtggcgaa gtgtttgttt atccagttga 4140cagtttgtgg aaaatcgtca cggtgagcgg atcaaacgcg gaaaacgaac gcggacgaac 4200ggcgagaaaa gcgaggaaaa acgggtgcag agacagagac tgattgggaa atatgtgcgc 4260ctgagttttc ccggccagaa ggcaaagtgc caaatgctct gacaaataat tcctgtaata 4320atcagcgcga ttgaaatcaa cgcgacgctc gtaaaattgc aaatgcagcg caaaaagtga 4380acagcagtgc agcggaaatt aaatcgtttt agcgagtgcc aaacgggaaa tagaaaatcg 4440gcagagtagc cgaactgcag ttaaaactat ctcttcctct tattgcgact aaacaaccgg 4500cggattaatc gaatccgaaa gatggccccc aacttgctaa caatcggatt acttttgacc 4560ctgatcgcca gcggtcaggc ccatctcaat attttcctca acttgcacga ggtgctgcgc 4620ctaatcggta agtaatcgtg ttgattttcg cctgcctttt ggcttttcaa ttaactgggc 4680aattatttgc cactttgtgt gcgttcgttc gactttaaat caaatttgat ttatgccaag 4740ccgggatttt gtctcctggg caaacgaatg cgacttgctg ggattattta ctctttttgc 4800gtaaataata tatgcctttt aattgtttct agcctcggag ctacatataa agtagtattg 4860tccctccttc aattggccag ctcaccgaga aacaagaaaa cattctattt gtctagcatg 4920atttcctgtt tctttgattt aattgttcgt tagacttatc tagataaata gaaatgctaa 4980agcgatttaa atttgtattt ctttgcgtta aattaaattc gattggcaag tggattcatc 5040tctagataag taatccctct ataatcaaag tttttattta aaaaatcata ttttttcata 5100gtttatccaa tttaaaacaa tacaaaacaa ttttagatat attttataaa cgtcttcaaa 5160agaaaataaa tagtaaaatc atgtagtcaa aaaatgacac caaaatgagt atttaaatat 5220ttagtttagt ttagtttata ttatttattt agcctaacta ttttccatag aagaatacta 5280ctctaataag cttggggtac ccggggatct tgaagttcct attccgaagt tcctattctt 5340caaatagtat aggaacttca gatccgaccg cggacatgta cagagctcga gaagtactag 5400tggccacgtg ggccgtgcac cttaagcttg gcactggccg tcgttttaca acgtcgtgac 5460tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc 5520tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat 5580ggcgaatggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 5640atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 5700tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt 5760tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 5820tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 5880gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 5940agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct 6000cgggctattc ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg 6060agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 6120ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 6180caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6240ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6300cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6360tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 6420ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 6480aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 6540tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 6600atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 6660agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 6720tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 6780tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 6840atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 6900ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 6960tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 7020acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 7080ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 7140aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7200ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc 7260cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7320gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 7380actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 7440agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 7500cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 7560tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 7620agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 7680ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 7740acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 7800ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 7860gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 7920gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 7980gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 8040tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 8100caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 8160tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc 8220gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg 8280agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt 8340ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc 8400gcaacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta cactttatgc 8460ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca ggaaacagct 8520atgaccatga ttacgaattg atccaagctt atcgatttcg aaccctcgac cgccggagta 8580taaatagagg cgcttcgtct acggagcgac aattcaattc aaacaagcaa agtgaaca 8638467DNAArtificial SequenceDescription of Artificial Sequence Synthetic FRT sequence 4ttgaagttcc tattccgaag ttcctattct ctagaaagta taggaacttc agagcgcttt 60tgaagct 67526DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 5gagcttaagg gtacccgggg atcttg 26631DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 6gactagtcga tatctagggc cgcctagctt c 31733DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 7ttggcgcgcc aaaagcttct gtctctcttt ctg 33835DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 8cggggtaccc caagcttatt agagtagtat tcttc 35931DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 9ttggcgcgcc aaggggtacc cggggatctt g 311046DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 10ccgctcgagc ggaagatctg aagttcctat actatttgaa gaatag 461157DNAArtificial SequenceDescription of Artificial Sequence Synthetic FRT sequence 11ttgaagttcc tattccgaag ttcctattct tcaaatagta taggaacttc agagcgc 571217DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 12cggcgactga gatgtcc 171320DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 13ccctagaaag atagtctgcg 201425DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 14atcagtgaca cttaccgcat tgaca 251521DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 15ccagagcgat acagaagaag c 211620DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 16tgttcagtgc agagactcgg 201725DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 17tatgagttaa atcttaaaag tcacg 251827DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 18gttgaattta ttattagtat gtaagtg 271919DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 19agaagaacgg catcaaggc 192020DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 20actccaagct ggacatcacc 202122DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 21cgcagacgaa gaacaaacag ta 222223DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 22gctgtttgct ttgttgttgt cat 232319DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 23gggccacacg atttatggc 192421DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 24gtttattttt ggcaacatga g 21

Claims

1: A method for producing a heritable integration of a transgene within a genome of a somatic or germ line cell of an invertebrate organism, the method comprising: providing a first DNA cassette within said genome, wherein said first cassette comprises a first flanking transposon half side, a second flanking transposon half side, and an internal transposon half side, wherein said internal transposon half side and said first flanking transposon half side form a pair of excisable transposon half-sides, and wherein said first cassette further comprises said transgene in-between the internal transposon half side and said second flanking transposon half side; and mobilizing said excisable transposon half-sides.

2: The method of claim 1, wherein said internal transposon half side and said second flanking transposon half side are TransposonL half sides, and wherein said first flanking transposon half side is a TransposonR half side.

3: The method of claim 1, wherein said internal transposon half side and said second flanking transposon half side are TransposonR half sides, and wherein said first flanking transposon half side is a TransposonL half side.

4: The method of claim 1, wherein said excisable transposon half-sides and corresponding transposase enzyme are from a transposable element, wherein said transposable element has terminal inverted sequences, and wherein said transposable element transposes via a DNA-mediated process.

5: The method of claim 1, wherein said first DNA cassette further comprises a first selectable marker gene located between said internal transposon half side and said first flanking transposon half side, and a second selectable marker gene located between said internal transposon half side and said second flanking transposon half side, and wherein said first and second selectable marker genes are phenotypically distinguishable.

6: The method of claim 5, wherein said first and second marker genes are, in either order, any combination of marker genes producing distinguishable fluorescent or other visible dominant phenotypes.

7: The method of claim 5 wherein said first and second marker genes are, in either order, a combination of the transformation marker genes PUbDsRed1 and 3.times.P3-ECFP.

8: The method of claim 1, wherein said internal transposon half side is provided in reverse orientation, wherein said excisable transposon is formed by inversion of said internal transposon half side relative to said first flanking transposon half side, wherein said internal transposon half side further comprises flanking recombinase sites, and wherein said inversion is catalyzed by a site-specific recombinase.

9: The method of claim 8, wherein said recombinase sites are FRT sites in opposite or reverse orientation.

10: The method of claim 1, wherein said excisable transposon is mobilized by a source of transposase corresponding to said excisable transposon to render the remaining genomic DNA immobilizable.

11-22. (canceled)

23: An invertebrate organism comprising the heritable transgene produced according to claim 1.

24. (canceled)

25: A method for producing a heritable integration of a transgene within a genome of a somatic or germ line cell of an organism, the method comprising: providing a first DNA cassette within said genome, wherein said first cassette comprises a first flanking transposon half side, a second flanking transposon half side, and an internal transposon half side, wherein said internal transposon half side and said first flanking transposon half side form a pair of excisable transposon half-sides, and wherein said first cassette further comprises said transgene in-between the internal transposon half side and said second flanking transposon half side; and mobilizing said excisable transposon half-sides.

26: The method of claim 25, wherein said internal transposon half side and said second flanking transposon half side are TransposonL half sides, and wherein said first flanking transposon half side is a TransposonR half side.

27: The method of claim 25, wherein said internal transposon half side and said second flanking transposon half side are TransposonR half sides, and wherein said first flanking transposon half side is a TransposonL half side.

28: The method of claim 25, wherein said excisable transposon half-sides and corresponding transposase enzyme are from a transposable element, wherein said transposable element has terminal inverted sequences, and wherein said transposable element transposes via a DNA-mediated process.

29: The method of claim 25, wherein said first DNA cassette further comprises a first selectable marker gene located between said internal transposon half side and said first flanking transposon half side, and a second selectable marker gene located between said internal transposon half side and said second flanking transposon half side, and wherein said first and second selectable marker genes are phenotypically distinguishable.

30: The method of claim 29, wherein said first and second marker genes are, in either order, any combination of marker genes producing distinguishable fluorescent or other visible dominant phenotypes.

31: The method of claim 29, wherein said first and second marker genes are, in either order, a combination of the transformation marker genes PUbDsRed1 and 3.times.P3-ECFP.

32: The method of claim 25, wherein said internal transposon half side is provided in reverse orientation, wherein said excisable transposon is formed by inversion of said internal transposon half side relative to said first flanking transposon half side, wherein said internal transposon half side further comprises flanking recombinase sites, and wherein said inversion is catalyzed by a site-specific recombinase.

33: The method of claim 32, wherein said recombinase sites are FRT sites in opposite or reverse orientation.

34: The method of claim 25, wherein said excisable transposon is mobilized by a source of transposase corresponding to said excisable transposon to render the remaining genomic DNA immobilizable.

35-46. (canceled)

47: An organism comprising the heritable transgene produced according to claim 25.

48. (canceled)