U.S. patent application number 12/265499 was filed with the patent office on 2009-03-26 for compositions for enhancing transport of molecules into cells.
Invention is credited to Patrick L. Iversen, Andrew D. Kroeker, Hong M. Moulton, Michelle H. Nelson, David A. Stein.
Application Number | 20090082547 12/265499 |
Document ID | / |
Family ID | 33418412 |
Filed Date | 2009-03-26 |
United States Patent
Application |
20090082547 |
Kind Code |
A1 |
Iversen; Patrick L. ; et
al. |
March 26, 2009 |
COMPOSITIONS FOR ENHANCING TRANSPORT OF MOLECULES INTO CELLS
Abstract
Compositions and methods for enhancing delivery of molecules,
e.g. biological agents, into cells are described. The composition
is a conjugate of the biological agent, preferably a nucleic acid
analog having a substantially uncharged backbone, covalently linked
to a peptide transporter moiety as described. Conjugation of the
peptide transporter to a substantially uncharged nucleic acid
analog, such as a morpholino oligomer, is also shown to enhance
binding of the oligomer to its target sequence and enhance
antisense activity.
Inventors: |
Iversen; Patrick L.;
(Corvallis, OR) ; Moulton; Hong M.; (Corvallis,
OR) ; Nelson; Michelle H.; (Corvallis, OR) ;
Kroeker; Andrew D.; (Corvallis, OR) ; Stein; David
A.; (Corvallis, OR) |
Correspondence
Address: |
King & Spalding LLP
P.O. Box 889
Belmont
CA
94002-0889
US
|
Family ID: |
33418412 |
Appl. No.: |
12/265499 |
Filed: |
November 5, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10836804 |
Apr 29, 2004 |
7468418 |
|
|
12265499 |
|
|
|
|
60466703 |
Apr 29, 2003 |
|
|
|
Current U.S.
Class: |
530/322 |
Current CPC
Class: |
A61K 49/0056 20130101;
C12N 2310/3233 20130101; C12N 2310/314 20130101; C12N 2310/3513
20130101; A61K 47/64 20170801; C12N 2320/32 20130101; A61K 49/0054
20130101; C12N 2310/11 20130101; C12N 15/87 20130101; C12N 15/113
20130101; A61K 49/0043 20130101 |
Class at
Publication: |
530/322 |
International
Class: |
C07K 7/00 20060101
C07K007/00 |
Claims
1. A peptide-oligomer conjugate, comprising: a carrier peptide
attached to a nucleic acid analog having a substantially uncharged
backbone and a targeting base sequence, wherein the carrier peptide
has the formula (ArgYArg).sub.4 or (ArgArgY).sub.4, where each Y is
--C(O)--(CH.sub.2).sub.n--NH, where n is 2 to 7.
2. The conjugate of claim 1, wherein the carrier peptide has the
formula (ArgYArg).sub.4.
3. The conjugate of claim 2, wherein the nucleic acid analog is
attached to the peptide via a linker comprising a further Y
subunit.
4. The conjugate of claim 3, wherein the linker comprises a
.beta.-alamine or 6-aminohexanoic acid subunit.
5. The conjugate of claim 2, wherein the nucleic acid analog is
attached to the peptide via an Ahx-.beta.Ala (6-aminohexanoic
acid-.beta.-alamine) linker.
6. The conjugate of claim 1, wherein the nucleic acid analog is a
morpholino oligomer, comprising morpholino subunits linked by
phosphorus-containing linkages between the morpholino nitrogen of
one subunit and an exocyclic carbon at the morpholino 3-position of
an adjacent subunit.
7. The conjugate of claim 6, where the morpholino subunits are
joined by intersubunit linkages in accordance with the structure:
##STR00002## where Y.sub.1.dbd.O, Z=O, X is alkyl, alkoxy,
thioalkoxy, or --NR'.sub.2, wherein R' is independently H or lower
alkyl; and Pj is a purine or pyrimidine base-pairing moiety
effective to bind, by base-specific hydrogen bonding, to a base in
a polynucleotide.
8. The conjugate of claim 1, wherein the targeting base sequence of
the nucleic acid analog is targeted to an antisense target in a
polynucleotide, selected from a splice site in a pre-mRNA, a
translation start site in an mRNA, and a cis-acting element in a
viral genome.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 10/836,804 filed on Apr. 29, 2004 which claims
benefit of U.S. Provisional Patent Application No. 60/466,703 filed
on Apr. 29, 2003, both of which are incorporated in their entirety
herein by reference.
FIELD OF THE INVENTION
[0002] The invention relates to compositions and methods for
enhancing delivery of molecules, e.g. biological agents, into
cells, and in particular to intracellular delivery and enhanced
binding of substantially uncharged nucleic acid analogs,
particularly phosphorodiamidate-linked morpholino oligomers.
REFERENCES
[0003] Arora, V. and P. L. Iversen (2000). "Antisense
oligonucleotides targeted to the p53 gene modulate liver
regeneration in vivo." Drug Metab Dispos 28(2): 131-8. [0004]
Astriab-Fisher, A., D. Sergueev et al. (2002). "Conjugates of
antisense oligonucleotides with the Tat and antennapedia
cell-penetrating peptides:effects on cellular uptake, binding to
target sequences, and biologic actions." Pharm Res 19(6):744-54.
[0005] Astriab-Fisher, A., D. S. Sergueev et al. (2000). "Antisense
inhibition of P-glycoprotein expression using
peptide-oligonucleotide conjugates." Biochem Pharmacol 60(1):83-90.
[0006] Devi, G. R. (2002). "Prostate cancer:status of current
treatments and emerging antisense-based therapies." Curr Opin Mol
Ther 4(2):138-48. [0007] Devi, G. R., J. R. Oldenkamp et al.
(2002). "Inhibition of human chorionic gonadotropin beta-subunit
modulates the mitogenic effect of c-myc in human prostate cancer
cells." Prostate 53(3):200-10. [0008] Heasman, J., M. Kofron et al.
(2000). "Beta-catenin signaling activity dissected in the early
Xenopus embryo: a novel antisense approach." Dev Biol 222(1):
124-34. [0009] Hudziak, R. M., E. Barofsky et al. (1996).
"Resistance of morpholino phosphorodiamidate oligomers to enzymatic
degradation." Antisense Nucleic Acid Drug Dev 6(4):267-72. [0010]
Iversen, P. L. (2001). Phosphoramidite Morpholino Oligomers.
Antisense Drug Technology. S. T. Crooke. New York, Marcel Dekker,
Inc. [0011] Kang, S. H., M. J. Cho et al. (1998). "Up-regulation of
luciferase gene expression with antisense oligonucleotides:
implications and applications in functional assay development."
Biochemistry 37(18):6235-9. [0012] Khromykh, A. A., N. Kondratieva
et al. (2003). "Significance in replication of the terminal
nucleotides of the flavivirus genome." J Virol 77(19):10623-9.
[0013] Kipshidze, N., E. Keane et al. (2001). "Local delivery of
c-myc neutrally charged antisense oligonucleotides with transport
catheter inhibits myointimal hyperplasia and positively affects
vascular remodeling in the rabbit balloon injury model." Catheter
Cardiovasc Interv 54(2):247-56. [0014] Kipshidze, N. N., H. S. Kim
et al. (2002). "Intramural coronary delivery of advanced antisense
oligonucleotides reduces neointimal formation in the porcine stent
restenosis model." J Am Coll Cardiol 39(10):1686-91. [0015]
McCaffrey, A. P., L. Meuse et al. (2003). "A potent and specific
morpholino antisense inhibitor of hepatitis C translation in mice."
Hepatology 38(2):503-8. [0016] Moulton, H. M., M. C. Hase et al.
(2003). "HIV Tat peptide enhances cellular delivery of antisense
morpholino oligomers." Antisense Nucleic Acid Drug Dev 13(1):31-43.
[0017] Moulton, H. M., M. H. Nelson et al. (2004). "Cellular uptake
of antisense morpholino oligomers conjugated to arginine-rich
peptides." Bioconjug Chem 15(2):290-9. [0018] Nasevicius, A. and S.
C. Ekker (2000). "Effective targeted gene `knockdown` in
zebrafish." Nat Genet. 26(2):216-20. [0019] Qin, G., M. Taylor et
al. (2000). "In vivo evaluation of a morpholino antisense oligomer
directed against tumor necrosis factor-alpha." Antisense Nucleic
Acid Drug Dev 10(1):11-6. [0020] Richard, J. P., K. Melikov et al.
(2003). "Cell-penetrating peptides. A reevaluation of the mechanism
of cellular uptake." J Biol Chem 278(1):585-90. [0021] Ricker, J.
L., J. E. Mata et al. (2002). "c-myc Antisense oligonucleotide
treatment ameliorates murine ARPKD." Kidney Int 61 Suppl 1:
125-131. [0022] Rothbard, J. B., E. Kreider et al. (2002).
"Arginine-rich molecular transporters for drug delivery: role of
backbone spacing in cellular uptake." J Med Chem 45(17):3612-8.
[0023] Stein, D., E. Foster et al. (1997). "A specificity
comparison of four antisense types: morpholino, 2'-O-methyl RNA,
DNA, and phosphorothioate DNA." Antisense Nucleic Acid Drug Dev
7(3):151-7. [0024] Stein, D. A., D. E. Skilling et al. (2001).
"Inhibition of vesivirus infections in mammalian tissue culture
with antisense morpholino oligomers." Antisense Nucleic Acid Drug
Dev 11(5):317-25. [0025] Summerton, J. and D. Weller (1997).
"Morpholino antisense oligomers: design, preparation, and
properties." Antisense Nucleic Acid Drug Dev 7(3): 187-95. [0026]
Tisne, C., B. P. Roques et al. (2004). "The annealing mechanism of
HIV-1 reverse transcription primer onto the viral genome." J. Biol.
Chem. 279(5):3588-3595. [0027] Wender, P. A., D. J. Mitchell et al.
(2000). "The design, synthesis, and evaluation of molecules that
enable or enhance cellular uptake: peptoid molecular transporters."
Proc Natl Acad Sci USA 97(24):13003-8. [0028] Yoo, H., P. Sazani et
al. (1999). "PAMAM dendrimers as delivery agents for antisense
oligonucleotides." Pharm Res 16(12): 1799-804. [0029] Zuker, M.
(2003). "Mfold web server for nucleic acid folding and
hybridization prediction." Nucleic Acids Res 31(13):3406-15.
BACKGROUND OF THE INVENTION
[0030] The practical utility of many drugs having potentially
useful biological activity is often stymied by difficulty in
delivering such drugs to their targets. Compounds to be delivered
into cells must generally be delivered from a largely aqueous
extracellular environment and then penetrate a lipophilic cell
membrane to gain entry to the cell. Unless the substance is
actively transported by a specific transport mechanism, many
molecules, particularly large molecules, are either too lipophilic
for practical solubilization or are too hydrophilic to penetrate
the membrane.
[0031] A segment of the HIV Tat protein consisting of amino acid
residues 49-57 (Tat 49-57, having the sequence RKKRRQRRR) (SEQ ID
NO:11) has been used to deliver biologically active peptides and
proteins to cells (e.g. Barsoum et al., 1994, PCT Pubn. No. WO
94/04686). Tat (49-60) has been used to enhance delivery of
phosphorothioate oligonucleotides (Astriab-Fisher, Sergueev et al.
2000; Astriab-Fisher, Sergueev et al. 2002). Reverse Tat, or
rTat(57-49) (RRRQRRKKR) (SEQ ID NO.: 12), has been reported to
deliver fluorescein into cells with enhanced efficacy compared to
Tat (49-57) (Wender, Mitchell et al. 2000; Rothbard, Kreider et al.
2002). Rothbard and Wender have also disclosed other arginine-rich
transport polymers (PCT Pubn. No. WO 01/62297; U.S. Pat. No.
6,306,993; US Patent Appn. Pubn. No. 2003/0032593).
[0032] Oligonucleotides are one class of potentially useful drug
compounds whose delivery has often been an impediment to
therapeutic use. Phosphorodiamidate-linked morpholino oligomers
(PMOs; see e.g. Summerton and Weller, 1997) have been found more
promising in this regard than charged oligonucleotide analogs such
as phosphorothioates. The PMOs are water-soluble, uncharged or
substantially uncharged antisense molecules that inhibit gene
expression by preventing binding or progression of splicing or
translational machinery components. PMOs have also been to shown to
inhibit or block viral replication (Stein, Skilling et al. 2001;
McCaffrey, Meuse et al. 2003). They are highly resistant to
enzymatic digestion (Hudziak, Barofsky et al. 1996). PMOs have
demonstrated high antisense specificity and efficacy in vitro in
cell-free and cell culture models (Stein, Foster et al. 1997;
Summerton and Weller 1997), and in vivo in zebrafish, frog and sea
urchin embryos (Heasman, Kofron et al. 2000; Nasevicius and Ekker
2000), as well as in adult animal models, such as rats, mice,
rabbits, dogs, and pigs (see e.g. Arora and Iversen 2000; Qin,
Taylor et al. 2000; Iversen 2001; Kipshidze, Keane et al. 2001;
Devi 2002; Devi, Oldenkamp et al. 2002; Kipshidze, Kim et al. 2002;
Ricker, Mata et al. 2002).
[0033] Antisense PMO oligomers have been shown to be taken up into
cells and to be more consistently effective in vivo, with fewer
nonspecific effects, than other widely used antisense
oligonucleotides (see e.g. P. Iversen, "Phosphoramidite Morpholino
Oligomers", in Antisense Drug Technology, S. T. Crooke, ed., Marcel
Dekker, Inc., New York, 2001). However, further enhancement in
uptake and antisense efficacy is desirable in order to fully
explore their potential.
SUMMARY OF THE INVENTION
[0034] In one aspect, the invention provides a method for enhancing
the ability of an nucleic acid analog, having a substantially
uncharged backbone and a targeting base sequence, to bind to a
target sequence in a nucleic acid, the method comprising:
[0035] conjugating to the nucleic acid analog a peptide consisting
of 8 to 16 subunits selected from X subunits, Y subunits, and
optional Z subunits, including at least six, and preferably at
least eight, X subunits, at least two Y subunits, and at most three
Z subunits, where >50% of said subunits are X subunits, and
where
[0036] (a) each X subunit independently represents arginine or an
arginine analog, said analog being a cationic .alpha.-amino acid
comprising a side chain of the structure
R.sup.1N.dbd.C(NH.sub.2)R.sup.2, where R.sup.1 is H or R; R.sup.2
is R, NH.sub.2, NHR, or NR.sub.2, where R is lower alkyl or lower
alkenyl and may further include oxygen or nitrogen; R.sup.1 and
R.sup.2 may together form a ring; and the side chain is linked to
said amino acid via R.sup.1 or R.sup.2;
[0037] (b) each Y subunit independently represents a neutral amino
acid --C(O)--(CHR).sub.n--NH--, where (i) n is 2 to 7 and each R is
independently H or methyl, or (ii) n is 1 and R is a neutral side
chain selected from substituted or unsubstituted alkyl, alkenyl,
alkynyl, aryl, and aralkyl, wherein said neutral side chain, when
selected from substituted alkyl, alkenyl, and alkynyl, includes at
most one heteroatom for every two, preferably every four, and more
preferably every six carbon atoms; and
[0038] (c) each Z subunit independently represents an amino acid
selected from alanine, asparagine, cysteine, glutamine, glycine,
histidine, lysine, methionine, serine, and threonine.
[0039] Preferably, the above-described peptide, when conjugated to
an antisense oligomer having said substantially uncharged backbone
(i.e. the same type of backbone as the nucleic acid analog), is
effective to enhance the binding of the antisense oligomer to its
target sequence, relative to the antisense oligomer in unconjugated
form, as evidenced by:
[0040] (i) a decrease in expression of an encoded protein, relative
to that observed with unconjugated oligomer, when binding of the
antisense oligomer to its target sequence is effective to block a
translation start codon for the encoded protein, or
[0041] (ii) an increase in expression of an encoded protein,
relative to that observed with unconjugated oligomer, when binding
of the antisense oligomer to its target sequence is effective to
block an aberrant splice site in a pre-mRNA which encodes said
protein when correctly spliced.
[0042] Assays suitable for measurement of these effects are
described further below. In one embodiment, conjugation of the
peptide provides this activity in a cell-free translation assay, as
described herein. Preferably, activity is enhanced by a factor of
at least two, more preferably by a factor of at least five, and
most preferably by a factor of at least ten. In some embodiments,
activity may be enhanced by factors of 50, 100 or more.
[0043] Alternatively or in addition, the peptide is effective to
enhance the transport of the nucleic acid analog into a cell,
relative to the analog in unconjugated form. Preferably, transport
is enhanced by a factor of at least two, more preferably by a
factor of at least five, and most preferably by a factor of at
least ten. In some embodiments, uptake may be enhanced by factors
of 50, 100 or more.
[0044] In the conjugates, the nucleic acid analog may be conjugated
to the peptide via a Y subunit, a cysteine subunit, or an
uncharged, non-amino acid linker moiety, as described further
below.
[0045] The optional Z subunits, when present, are preferably
selected from alanine, glycine, methionine, serine, and threonine.
The peptide may include zero, one, two, or three Z subunits.
[0046] Preferably, for each X subunit, the side chain moiety is
independently selected from the group consisting of guanidyl
(HN.dbd.C(NH.sub.2)NH--), amidinyl (HN.dbd.C(NH.sub.2)C<),
2-amino dihydropyrimidyl, 2-aminotetrahydropyrimidyl,
2-aminopyridinyl, and 2-amino pyrimidonyl. More preferably, for
each X, the side chain moiety is guanidyl, such as in an arginine
subunit.
[0047] Preferably, when Y is defined as a neutral amino acid
subunit --C(O)--(CHR).sub.n--NH--, where n is 2 to 7, the subunit
is of the form --C(O)--(CH.sub.2).sub.n-1(CHR)--NH--, where R is H
or methyl, and is preferably H.
[0048] In other preferred embodiments, the at least two Y subunits
include
[0049] (i) two neutral, hydrophobic .alpha.-amino acid subunits
having side chains independently selected from substituted or
unsubstituted alkyl, alkenyl, alkynyl, aryl, and aralkyl, wherein
said side chain, when selected from substituted alkyl, alkenyl, and
alkynyl, includes at most one heteroatom for every six carbon
atoms, and wherein said subunits are contiguous or are flanking a
linker moiety, or
[0050] (ii) two neutral, hydrophobic amino acid subunits
--C(O)--(CH.sub.2).sub.n-1(CHR)--NH--, where n is 2 to 7 and R is H
or methyl and is preferably H.
[0051] In selected embodiments, the peptide has exactly two Y
subunits of type (i), which are contiguous or are flanking a
cysteine subunit, which acts as a linker. Preferably, the two Y
subunits are contiguous. In these embodiments, each Y preferably
represents a hydrophobic .alpha.-amino acid subunit having an aryl
or aralkyl side chain, such as, for example, phenylalanine,
tyrosine, tryptophan, leucine, isoleucine, or valine. In selected
embodiments of the peptide, each Y is independently selected from
phenylalanine and tyrosine. One such embodiment is a peptide having
the formula Arg.sub.9Phe.sub.2. Such a peptide may be linked to the
nucleic acid analog via a cysteine subunit attached to the terminal
Phe.
[0052] In other embodiments, each Y is a neutral, hydrophobic amino
acid subunit --CO--(CH.sub.2), CHR--NH--, where n is 2 to 7 and R
is H. For example, when n is 5 and R is H, Y is a 6-aminohexanoic
acid subunit, abbreviated herein as Ahx. In selected embodiments of
this group, each X comprises a guanidyl side chain moiety, as in an
arginine subunit. Preferred peptides of this type include those
comprising arginine dimers alternating with single Y subunits,
where Y is preferably Ahx. Examples include peptides having the
formula (RYR).sub.4 or the formula (RRY).sub.4, where Y is
preferably Ahx. In the latter case, the nucleic acid analog is
preferably linked to a terminal Y subunit.
[0053] The nucleic acid analog to which the peptide is conjugated,
having a substantially uncharged backbone, is preferably a
morpholino oligomer or a peptide nucleic acid. Preferably, the
oligomer backbone is fully uncharged. In preferred embodiments, the
nucleic acid analog is a morpholino oligomer, comprising morpholino
subunits linked by phosphorus-containing linkages, one to three
atoms long, between the morpholino nitrogen of one subunit and an
exocyclic carbon at the morpholino 3-position of an adjacent
subunit. The linkages are preferably two-atom uncharged
phosphorodiamidate linkages, in accordance with the structure:
##STR00001##
where Y.sub.1.dbd.O, Z=O, Pj is a purine or pyrimidine base-pairing
moiety effective to bind, by base-specific hydrogen bonding, to a
base in a polynucleotide, and X is alkyl, alkoxy, thioalkoxy, or
alkyl amino.
[0054] Conjugation of a peptide to a nucleic acid analog as
described above forms a peptide-oligomer conjugate which is more
effective than the unconjugated oligomer in various functions,
including: inhibiting expression of targeted mRNA in a protein
expression system; inhibiting splicing of targeted pre-mRNA; and
inhibiting replication of a virus, by targeting cis-acting elements
which control nucleic acid replication or mRNA transcription of the
virus.
[0055] In another aspect, the invention provides a peptide-nucleic
acid analog conjugate, comprising
[0056] a nucleic acid analog having a substantially uncharged
backbone and a targeting base sequence, and
[0057] covalently linked to the nucleic acid analog, a peptide
consisting of 8 to 16 subunits selected from X subunits, Y
subunits, and optional Z subunits, including at least eight X
subunits, at least two Y subunits, and at most three Z subunits,
wherein >50% of said subunits are X subunits, and where
[0058] (a) each X subunit independently represents arginine or an
arginine analog, said analog being a cationic .alpha.-amino acid
subunit comprising a side chain of the structure
R.sup.1N.dbd.C(NH.sub.2)R.sup.2, where R.sup.1 is H or R; R.sup.2
is R.sup.1, NH.sub.2, NHR, or NR.sub.2, where R is lower alkyl or
lower alkenyl and may further include oxygen or nitrogen; R.sup.1
and R.sup.2 may together form a ring; and the side chain is linked
to said amino acid subunit via R.sup.1 or R.sup.2;
[0059] (b) said at least two Y subunits include [0060] (i) two
neutral .alpha.-amino acid subunits having side chains
independently selected from substituted or unsubstituted alkyl,
alkenyl, alkynyl, aryl, and aralkyl, wherein said side chain, when
selected from substituted alkyl, alkenyl, and alkynyl, includes at
most one heteroatom for every two, preferably every four, and more
preferably every six carbon atoms, and wherein said subunits are
contiguous or are flanking a linker moiety, or [0061] (ii) two
neutral, hydrophobic amino acid subunits
--C(O)--(CH.sub.2).sub.n-1(CHR)--NH--, where n is 2 to 7 and R is H
or methyl; and
[0062] (c) Z represents an amino acid subunit selected from
alanine, asparagine, cysteine, glutamine, glycine, histidine,
lysine, methionine, serine, and threonine.
[0063] Preferably, the conjugate includes a peptide which, when
conjugated to an antisense oligomer having the same type of
substantially uncharged backbone as the nucleic acid analog, is
effective to enhance the binding of the antisense oligomer to its
target sequence, relative to the antisense oligomer in unconjugated
form, as evidenced by:
[0064] (i) a decrease in expression of an encoded protein, relative
to that observed with unconjugated oligomer, when binding of the
antisense oligomer to its target sequence is effective to block a
translation start codon for the encoded protein, or
[0065] (ii) an increase in expression of an encoded protein,
relative to that observed with unconjugated oligomer, when binding
of the antisense oligomer to its target sequence is effective to
block an aberrant splice site in a pre-mRNA which encodes said
protein when correctly spliced.
[0066] Assays suitable for measurement of these effects are
described further below. In one embodiment, conjugation of the
peptide provides this activity in a cell-free translation assay, as
described herein. Preferably, activity is enhanced by a factor of
at least two, more preferably by a factor of at least five, and
most preferably by a factor of at least ten. In some embodiments,
activity may be enhanced by factors of 50, 100 or more.
[0067] Alternatively or in addition, the peptide is effective to
enhance the transport of the nucleic acid analog into a cell,
relative to the analog in unconjugated form. Preferably, transport
is enhanced by a factor of at least two, more preferably by a
factor of at least five, and most preferably by a factor of at
least ten. In some embodiments, activity may be enhanced by factors
of 50, 100 or more.
[0068] In the conjugates of the invention, the nucleic acid analog
is preferably conjugated to the peptide via a linker moiety
selected from a Y subunit, a cysteine subunit, and an uncharged,
non-amino acid linker moiety.
[0069] Preferably, the side chain moieties of the X subunits are
independently selected from the group consisting of guanidyl
(HN.dbd.C(NH.sub.2)NH--), amidinyl (HN.dbd.C(NH.sub.2)C<),
2-aminodihydropyrimidyl, 2-aminotetrahydropyrimidyl,
2-aminopyridinyl, and 2-amino pyrimidonyl. More preferably, each
such side chain moiety is guanidyl; for example, each X can be an
arginine subunit.
[0070] The optional Z subunits, when present, are preferably
selected from alanine, glycine, methionine, serine, and threonine.
The peptide may include zero, one, two, or three Z subunits, and
preferably includes at most one Z subunit.
[0071] In selected embodiments, the peptide has exactly two Y
subunits of type (i), which are contiguous or are flanking a
cysteine subunit. Preferably, the two Y subunits are
contiguous.
[0072] In further preferred embodiments, each Y represents a
hydrophobic .alpha.-amino acid subunit having an aryl or aralkyl
side chain; for example, each Y may be independently selected from
the group consisting of phenylalanine, tyrosine, tryptophan,
leucine, isoleucine, and valine.
[0073] In selected embodiments, each Y is independently selected
from phenylalanine and tyrosine; in further embodiments, each Y is
phenylalanine. This includes, for example, conjugates which consist
of arginine subunits, phenylalanine subunits, a linker moiety, and
the nucleic acid analog. One such conjugate includes a peptide
having the formula Arg.sub.9Phe.sub.2.
[0074] The linker moiety may be, for example, a cysteine subunit
attached to the terminal Phe.
[0075] In other embodiments, each Y is a neutral, hydrophobic amino
acid subunit --C(O)--(CH.sub.2).sub.n-1(CHR)--NH--, where n is 2 to
7 and R is H. In one such embodiment, n is 5, such that Y is a
6-aminohexanoic acid subunit. In selected embodiments of this
class, each X has a guanidyl side chain, e.g. as in arginine
subunits. These include conjugates in which the peptide comprises
arginine dimers alternating with single Y subunits. Examples of
such peptides are the peptide having the formula (RYR).sub.4 and
the peptide having the formula (RRY).sub.4. In the latter case, the
nucleic acid analog is preferably linked to a terminal Y
subunit.
[0076] The nucleic acid analog to which the peptide is conjugated,
having a substantially uncharged backbone, is preferably a
morpholino oligomer, as described above, or a peptide nucleic
acid.
[0077] The peptide-oligomer conjugates of the invention are more
effective than the unconjugated oligomer in various functions,
including: inhibiting expression of targeted mRNA in a protein
expression system, including cell free translation systems;
inhibiting splicing of targeted pre-mRNA; and inhibiting
replication of a virus, by targeting cis-acting elements which
control nucleic acid replication or mRNA transcription of the
virus. Preferably, activity is enhanced by a factor of at least
two, more preferably by a factor of at least five, and most
preferably by a factor of at least ten.
[0078] Alternatively or in addition, the peptide is effective to
enhance the transport of the nucleic acid analog into a cell,
relative to the analog in unconjugated form. Preferably, transport
is enhanced by a factor of at least two, more preferably by a
factor of at least five, and most preferably by a factor of at
least ten.
[0079] In another aspect, the invention provides a conjugate
comprising a pharmacological agent covalently linked to a
peptide,
[0080] wherein the peptide consists of 8 to 16 subunits selected
from X subunits, Y subunits, and optional Z subunits, including at
least six, and preferably at least eight, X subunits, at least two
Y subunits, and at most three Z subunits, wherein >50% of said
subunits are X subunits, and where
[0081] (a) each X subunit independently represents arginine or an
arginine analog, said analog being a cationic .alpha.-amino acid
comprising a side chain of the structure
R.sup.1N.dbd.C(NH.sub.2)R.sup.2, where R.sup.1 is H or R; R.sup.2
is R, NH.sub.2, NHR, or NR.sub.2, where R is lower alkyl or lower
alkenyl and may further include oxygen or nitrogen; R.sup.1 and
R.sup.2 may together form a ring; and the side chain is linked to
said amino acid via R.sup.1 or R.sup.2;
[0082] (b) each Y subunit independently represents a neutral amino
acid --C(O)--(CHR)--NH--, where R is a neutral side chain selected
from substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl,
and aralkyl, wherein said neutral side chain, when selected from
substituted alkyl, alkenyl, and alkynyl, includes at most one
heteroatom for every two, preferably every four, and more
preferably every six carbon atoms; and
[0083] (c) each Z subunit independently represents an amino acid
selected from alanine, asparagine, cysteine, glutamine, glycine,
histidine, lysine, methionine, serine, and threonine.
[0084] The peptide is effective to enhance the transport of the
agent into a cell relative to the agent in unconjugated form. The
agent may be conjugated to the peptide via a Y subunit, a cysteine
subunit, or an uncharged, non-amino acid linker moiety.
[0085] The optional Z subunits, when present, are preferably
selected from alanine, glycine, methionine, serine, and threonine.
The peptide may include zero, one, two, or three Z subunits, and
preferably includes at most one Z subunit.
[0086] In selected embodiments of X, the side chain moiety is
independently selected from the group consisting of guanidyl
(HN.dbd.C(NH.sub.2)NH--), amidinyl (HN.dbd.C(NH.sub.2)C<),
2-amino dihydropyrimidyl, 2-aminotetrahydropyrimidyl,
2-aminopyridinyl, and 2-amino pyrimidonyl. Preferably, for each X,
the side chain moiety is guanidyl; more preferably, each X is an
arginine subunit.
[0087] In selected embodiments of Y, the at least two Y subunits
include two neutral, hydrophobic .alpha.-amino acid subunits having
side chains independently selected from substituted or
unsubstituted alkyl, alkenyl, alkynyl, aryl, and aralkyl, wherein
said side chain, when selected from substituted alkyl, alkenyl, and
alkynyl, includes at most one heteroatom for every six carbon
atoms, and wherein said subunits are contiguous or are flanking a
linker moiety. Preferably, the peptide has exactly two Y subunits
which are contiguous or are flanking a cysteine subunit, which acts
as a linker moiety; more preferably, the Y subunits are
contiguous.
[0088] In further preferred embodiments, each Y represents a
hydrophobic .alpha.-amino acid subunit having an aryl or aralkyl
side chain; for example, each Y may be independently selected from
the group consisting of phenylalanine, tyrosine, tryptophan,
leucine, isoleucine, and valine.
[0089] In selected embodiments, each Y is independently selected
from phenylalanine and tyrosine; in further embodiments, each Y is
phenylalanine. This includes, for example, conjugates which consist
of arginine subunits, phenylalanine subunits, a linker moiety, and
the nucleic acid analog. One such conjugate includes a peptide
having the formula Arg.sub.9Phe.sub.2.
[0090] The linker moiety may be, for example, a cysteine subunit
attached to the terminal Phe.
[0091] In a related aspect, the invention provides a method for
enhancing cell uptake of a pharmacological agent, the method
comprising conjugating the agent to a transport peptide as
described above; i.e. where the peptide consists of 8 to 16
subunits selected from X subunits, Y subunits, and optional Z
subunits, including at least six, and preferably at least eight, X
subunits, at least two Y subunits, and at most three Z subunits,
wherein >50% of said subunits are X subunits, and where
[0092] (a) each X subunit independently represents arginine or an
arginine analog, said analog being a cationic .alpha.-amino acid
comprising a side chain of the structure
R.sup.1N.dbd.C(NH.sub.2)R.sup.2, where R.sup.1 is H or R; R.sup.2
is R, NH.sub.2, NHR, or NR.sub.2, where R is lower alkyl or lower
alkenyl and may further include oxygen or nitrogen; R.sup.1 and
R.sup.2 may together form a ring; and the side chain is linked to
said amino acid via R.sup.1 or R.sup.2;
[0093] (b) each Y subunit independently represents a neutral amino
acid --C(O)--(CHR)--NH--, where R is a neutral side chain selected
from substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl,
and aralkyl, wherein said neutral side chain, when selected from
substituted alkyl, alkenyl, and alkynyl, includes at most one
heteroatom for every two, preferably every four, and more
preferably every six carbon atoms; and
[0094] (c) each Z subunit independently represents an amino acid
selected from alanine, asparagine, cysteine, glutamine, glycine,
histidine, lysine, methionine, serine, and threonine.
[0095] The invention also provides a composition useful for
intracellular delivery of an nucleic acid analog in vivo,
comprising a peptide-nucleic acid analog conjugate, as described
above, and a suspension of insoluble gas-containing microbubbles in
an aqueous vehicle comprising at least one filmogenic compound
selected from a protein, surfactant, lipid, polysaccharide, and
combinations thereof. Preferably, the microbubbles are suspended in
an aqueous vehicle comprising albumin, and the insoluble gas is
selected from the group consisting of perfluoromethane,
perfluoroethane, perfluoropropane, perfluorobutane, and
perfluoropentane.
[0096] In another aspect, the invention provides a modified nucleic
acid analog, comprising
[0097] (i) a plurality of subunits connected by intersubunit
linkages, and supporting a sequence of bases effective to hybridize
to a complementary-sequence target polynucleotide, to form a
target/antisense duplex; and
[0098] (ii) carried on at least six contiguous intersubunit
linkages, a charged moiety of the structure
R.sup.1N.dbd.C(NH.sub.2)R.sup.2, where R.sup.1 is H or R; R.sup.2
is R, NH.sub.2, NHR, or NR.sub.2, where R is lower alkyl or lower
alkenyl and may further include oxygen or nitrogen; R.sup.1 and
R.sup.2 may together form a ring; and the side chain moiety is
linked to said amino acid subunit via R.sup.1 or R.sup.2.
[0099] Preferably, the charged moiety is selected from the group
consisting of guanidyl (--N.dbd.C(NH.sub.2)NH--), amidinyl
(--C(.dbd.NH)(NH.sub.2)), 2-amino hexahydropyrimidyl
(.dbd.HN--H(NH.sub.2)NH--), 2-aminopyridinyl
(--C(.dbd.N)(NH.sub.2)), and 2-aminopyrimidonyl
(--N--NH.sub.2).dbd.N--). More preferably, the charged moiety is
guanidyl. In one embodiment, the subunits are morpholino subunits,
and the linkages are phosphorodiamidate linkages.
[0100] These and other objects and features of the invention will
become more fully apparent when the following detailed description
of the invention is read in conjunction with the accompanying
drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0101] FIGS. 1A-1D show several preferred morpholino-type subunits
having 5-atom (A), six-atom (B) and seven-atom (C-D) linking groups
suitable for forming polymers.
[0102] FIGS. 2A-D show the repeating subunit segment of exemplary
morpholino oligonucleotides, constructed using subunits A-D,
respectively, of FIG. 1.
[0103] FIGS. 3A-G show exemplary X side chain structures, for use
in various embodiments of the transporters of the invention.
[0104] FIGS. 4A-D show oligomer-transporter conjugates and methods
of their preparation, where FIG. 4C (SEQ ID NO:43) shows
preparation of an in vivo cleavable conjugate.
[0105] FIG. 5A shows adsorption of a fluorescein-labeled
peptide-PMO conjugate (R.sub.9F.sub.2C-705-FL) (SEQ ID NO:43) over
time, as measured in HeLa pLuc705 cells treated with 1 .mu.M of the
conjugate.
[0106] FIG. 5B shows absorption with increasing concentration,
measured at 37.degree. C. ( ) and 17.degree. C. (*), in HeLa
pLuc705 cells incubated with R.sub.9F.sub.2C-705-FL (SEQ ID NO.:43)
for 70 minutes.
[0107] FIG. 6 shows adsorption with increasing concentration in
HeLa pLuc705 cells incubated with R.sub.9F.sub.2C-705-FL (SEQ ID
NO.:43) and with (D)-R.sub.9F.sub.2C-705-FL (SEQ ID NO.:43),
without trypsin treatment (closed square and circle, respectively),
and with trypsin treatment (open square and circle,
respectively).
[0108] FIG. 7A shows internalization over time, as determined by
flow cytometry in cells incubated with 1 .mu.M fluorescein-labeled
peptide-PMO conjugate (R.sub.9F.sub.2C-705-FL) (SEQ ID NO.:43) and
then treated with trypsin.
[0109] FIG. 7B shows internalization with increasing concentration,
as determined by flow cytometry, in cells treated with
R.sub.9F.sub.2C-705-FL, at 37.degree. C. ( ) or 17.degree. C. (*)
for 70 minutes, and then treated with trypsin.
[0110] FIG. 8 shows the level of luciferase production observed
(expressed as RLU) in HeLa pLuc705 cells after 6 hrs incubation
with 25 .mu.M of each of the following: the PMO-transporter
conjugates R.sub.9F.sub.2C-PMO (SEQ ID NO.:43); RGC-PMO;
rTat(57-49)-C-PMO (SEQ ID NO.: 12); and rTat(57-49)-PMO (SEQ ID
NO.: 12); a mixture of R.sub.9F.sub.2C (SEQ ID NO.:43) and PMO;
R.sub.9F.sub.2C (SEQ ID NO.:43) alone; PMO alone; and PBS buffer.
The PMO used was the 705 sequence (SEQ ID NO: 1).
[0111] FIG. 9 shows viability of HeLa cells after 24 hrs incubation
with 25 .mu.M of the compositions listed for FIG. 8.
[0112] FIG. 10 shows the level of luciferase production normalized
to microgram of protein (RLU/.mu.g protein) observed in HeLa Luc705
cells after 24 hrs incubation with conjugates of PMO(705) with
R.sub.9F.sub.2 (SEQ ID NO.: 13), R.sub.9I.sub.2 (SEQ ID NO.:27),
R.sub.8F.sub.3 (SEQ ID NO.:28), and R.sub.9F.sub.4 (SEQ ID NO.:29),
respectively, where in each case the PMO was attached via a
cysteine residue at the C-terminus (right side) of the peptide
transporter as shown.
[0113] FIG. 11 shows (A) the level of luciferase production
(RLU/.mu.g protein), as in FIG. 10, and (B) fluorescence in HeLa
pLuc705 cells after 24 hrs incubation with conjugates of PMO(705)
with R.sub.9F.sub.2 (SEQ ID NO.:13), R.sub.6F.sub.2 (SEQ ID
NO.:31), and R.sub.5F.sub.2 (SEQ ID NO.:32) where in each case the
PMO was attached via a cysteine residue at the C-terminus of the
peptide transporter.
[0114] FIG. 12 shows the level of luciferase production (RLU/.mu.g
protein), as in FIG. 10, in HeLa pLuc705 cells after 24 hrs
incubation with conjugates of PMO with R.sub.9F.sub.2 (SEQ ID NO.:
13), R.sub.5F.sub.2R.sub.4 (SEQ ID NO.:20), and F.sub.2R.sub.9 (SEQ
ID NO.:25), respectively, where in each case the PMO was attached
via a cysteine residue at the C-terminus of the peptide
transporter.
[0115] FIG. 13 shows structures of bifunctional cross linkers that
may be used to link transport polymers to antisense oligomers.
[0116] FIG. 14 shows the level of luciferase production (RLU/.mu.g
protein), as in FIG. 10, in HeLa pLuc705 cells after 24 hrs
incubation with the conjugates R9F2-C-PMO (SEQ ID NO.:43) and
biotin-R9F2-C-PMO (SEQ ID NO.:43).
[0117] FIG. 15 shows the level of luciferase production (RLU/.mu.g
protein), as in FIG. 10, in HeLa pLuc705 cells after 24 hrs
incubation with various PMO(705)-transport peptide conjugates, as
shown in Table 1 herein, at a concentration of 25 .mu.M, where in
each case the PMO is linked to the C (cysteine) residue.
[0118] FIG. 16 shows luciferase production (RLU/.mu.g protein), in
HeLa pLuc705 cells treated with conjugates of antisense PMO (705)
with different-sequence transporter peptides, at a concentration of
1 .mu.M (dark bars) or 5 .mu.M (light bars) in serum-free medium
for 6 hours, where in each case the PMO is linked to the C
(cysteine) residue.
[0119] FIG. 17 shows luciferase production (RLU/.mu.g protein) in
HeLa pLuc705 cells treated with R9F2-C-PMO-705 (closed square) (SEQ
ID NO.:43) and the following control PMOs containing either two or
four mismatches, scrambled or irrelevant sequences:
R9F2-C-705.sub.2MM (closed circle) (SEQ ID NO.:43),
R.sub.9F.sub.2--C-705.sub.4MM ( ) (SEQ ID NO.:43),
R.sub.9F.sub.2--C-705.sub.SCR (.gradient.) (SEQ ID NO.:43) and
R.sub.9F.sub.2-C-cmyc (*) (SEQ ID NO.:43).
[0120] FIG. 18 shows luciferase production (RLU/.mu.g protein) in
HeLa pLuc705 cells treated with R.sub.9F.sub.2C-PMO-705 (SEQ ID
NO.:43), measured at several times points.
[0121] FIGS. 19A-G show examples of other uncharged antisense
oligomer types which may be modified to contain the transport
peptides as described herein.
[0122] FIG. 20 shows a method of preparing a PMO having a modified
intersubunit side chain containing cationic charge moieties.
[0123] FIGS. 21-23 represent the results of inhibition of cell-free
translation by peptide PMO conjugates directed to viral sequences
placed immediately upstream of the firefly luciferase reporter
gene. FIG. 23 represents results obtained with the pDCLD reporter
gene construct.
[0124] FIG. 24 shows the level of luciferase production observed
(RLU per microgram of protein) in HeLa pLuc/705 cells after 24
hours treatment with 10 .mu.M of each of the following: the PMO
(705-FL) conjugated to R.sub.9F.sub.2 (SEQ ID NO.: 13),
(RRAhx).sub.4 (SEQ ID NO.:33), (RAhxR).sub.4 (SEQ ID NO.:34),
(AhxRR).sub.4 (SEQ ID NO.:35), (RAhxR).sub.3 (SEQ ID NO.:37),
(RahxR).sub.2R (SEQ ID NO.:38), (RAhxR).sub.2 (SEQ ID NO.:39),
(RKAhx).sub.4 (SEQ ID NO.:40), or (RHAhx).sub.4 (SEQ ID
NO.:41).
[0125] FIGS. 25A-B and 26A-B show that a transport peptide
containing 6-aminohexanoic acid (Ahx), (RAhxR).sub.4 (SEQ ID
NO.:34), is resistant to proteinase K degradation and that a
transport peptide containing all natural amino acids,
R.sub.9F.sub.2 (SEQ ID NO.:13), was not resistant to proteinase K
degradation.
[0126] FIG. 27 shows the in vivo bioavailability and relative
intracellular delivery of unconjugated and peptide conjugated,
fluorescein-labeled PMO in mouse lymph node and spleen cells and
subpopulations of cells from those tissues.
[0127] FIG. 28 shows the results of inhibition of cell-free
translation by peptide-PMO conjugates targeted to a region of the
human c-myc gene that surrounds the translational start codon fused
to the firefly luciferase reporter gene.
[0128] FIG. 29 shows the computer-predicted RNA secondary structure
that surrounds the Dengue virus translational start codon and the
target of the DEN AUG antisense PMO (highlighted, nucleotides
87-106). The AUG start codon is at nucleotides 97-99.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0129] "Alkyl" refers to a fully saturated monovalent radical
containing carbon and hydrogen, which may be branched, linear, or
cyclic (cycloalkyl). Examples of alkyl groups are methyl, ethyl,
n-butyl, t-butyl, n-heptyl, isopropyl, cyclopropyl, cyclopentyl,
ethylcyclopentyl, and cyclohexyl. Generally preferred are alkyl
groups having one to six carbon atoms, referred to as "lower
alkyl", and exemplified by methyl, ethyl, n-butyl, i-butyl,
t-butyl, isoamyl, n-pentyl, and isopentyl. In one embodiment, lower
alkyl refers to C.sub.1 to C.sub.4 alkyl.
[0130] "Alkenyl" refers to an unsaturated monovalent radical
containing carbon and hydrogen, which may be branched, linear, or
cyclic. The alkenyl group may be monounsaturated or
polyunsaturated. Generally preferred are alkenyl groups having one
to six carbon atoms, referred to as "lower alkenyl". In one
embodiment, lower alkenyl refers to C.sub.2 to C.sub.4 alkenyl.
[0131] "Aryl" refers to a substituted or unsubstituted monovalent
aromatic radical, generally having a single ring (e.g., benzene) or
two condensed rings (e.g., naphthyl). Generally preferred are aryl
groups having a single ring. Preferably, the rings are hydrocarbon
rings.
[0132] "Aralkyl" refers to an alkyl, preferably lower
(C.sub.1-C.sub.4, more preferably C.sub.1-C.sub.2) alkyl,
substituent which is further substituted with an aryl group;
examples are benzyl (--CH.sub.2C.sub.6H.sub.5) and phenethyl
(--CH.sub.2CH.sub.2C.sub.6H.sub.5).
[0133] The term "substituted", with respect to an alkyl, alkenyl,
alkynyl, aryl, aralkyl, or alkaryl group in a neutral side chain,
refers to replacement of a hydrogen atom with a lower alkyl group
or a neutral heteroatom-containing substituent, such as, for
example, halogen, e.g. fluorine, chlorine, or bromine; hydroxy,
alkoxy, thiol, alkylthio, oxo (keto), nitro, cyano, or various
esters such as carboxylic, sulfonic, or phosphonic. Preferably,
such substituents are selected from hydroxy, lower alkoxy, thiol,
lower alkylthio, and oxo (keto).
[0134] A nucleic acid analog having a "substantially uncharged"
backbone (also referred to as a "substantially uncharged nucleic
acid analog") is one having at most one charged (at physiological
pH) intersubunit linkage for every four uncharged (at physiological
pH) linkages, preferably at most one for every eight, and more
preferably at most one for every sixteen uncharged linkages. In a
preferred embodiment, the nucleic acid analogs described herein are
fully uncharged.
[0135] In general, terms such as "charged", "uncharged", and
"neutral" used herein refer to the state of the group so described
at physiological pH, i.e. about 7.4.
[0136] The "backbone" of such an analog refers to the structure
supporting the base-pairing moieties; i.e., for a morpholino
oligomer, as described below, the "backbone" includes morpholino
ring structures connected by phosphorus-containing linkages.
[0137] A "target sequence" refers to a complementary or
near-complementary sequence to which an antisense oligomer is
targeted, by virtue of its base sequence, and is able to stably
bind under physiological conditions of temperature and pH.
[0138] The term "antisense activity", in reference to steric
blocking oligomers, refers to the ability of an antisense oligomer
to bind to its target sequence and inhibit the function of that
target sequence, or closely adjacent sequences, e.g., blocking
translation of an mRNA, blocking cis-acting elements in viral RNA
replication, or blocking the accurate splicing of pre-RNA.
I. Compound-Transporter Conjugates
[0139] A. Peptide Conjugates
[0140] In one aspect, the invention provides a peptide-nucleic acid
analog conjugate, comprising
[0141] a nucleic acid analog having a substantially uncharged
backbone and a targeting base sequence, and
[0142] covalently linked to the nucleic acid analog, a peptide
consisting of 8 to 16 subunits selected from X subunits, Y
subunits, and optional Z subunits, including at least eight X
subunits, at least two Y subunits, and at most three Z subunits,
where >50% of said subunits are X subunits, and where
[0143] (a) each X subunit independently represents arginine or an
arginine analog, said analog being a cationic .alpha.-amino acid
subunit comprising a side chain of the structure
R.sup.1N.dbd.C(NH.sub.2)R.sup.2 (see FIG. 3A), where R.sup.1 is H
or R; R.sup.2 is R, NH.sub.2, NHR, or NR.sub.2, where R is lower
alkyl or lower alkenyl and may further include oxygen or nitrogen;
R.sup.1 and R.sup.2 may together form a ring; and the side chain is
linked to said amino acid subunit via R.sup.1 or R.sup.2;
[0144] (b) said at least two Y subunits include [0145] (i) two
neutral .alpha.-amino acid subunits having side chains
independently selected from substituted or unsubstituted alkyl,
alkenyl, alkynyl, aryl, and aralkyl, wherein said side chain, when
selected from substituted alkyl, alkenyl, and alkynyl, includes at
most one heteroatom for every two, preferably every four, and more
preferably every six carbon atoms, and wherein said subunits are
contiguous or are flanking a linker moiety, or [0146] (ii) two
neutral, hydrophobic amino acid subunits
--C(O)--(CH.sub.2).sub.n-1(CHR)--NH--, where n is 2 to 7 and R is H
or methyl; and
[0147] (c) Z represents an amino acid subunit selected from
alanine, asparagine, cysteine, glutamine, glycine, histidine,
lysine, methionine, serine, and threonine.
[0148] Z may also include amino acids having side chains which are
one- or two-carbon homologs of naturally occurring side chains,
excluding side chains which are negatively charged at physiological
pH (e.g. carboxylate side chains). Preferably, the side chains are
neutral. More preferred side chains are side chains of naturally
occurring amino acids. The optional Z subunits are preferably
selected from alanine, glycine, methionine, serine, and threonine.
The peptide may include zero, one, two, or three Z subunits, and
preferably includes at most two Z subunits.
[0149] Preferably, the conjugate includes a peptide which, when
conjugated to an antisense oligomer having the same type of
substantially uncharged backbone as the nucleic acid analog, is
effective to enhance the binding of the antisense oligomer to its
target sequence, relative to the antisense oligomer in unconjugated
form, as evidenced by:
[0150] (i) a decrease in expression of an encoded protein, relative
to that provided by the unconjugated oligomer, when binding of the
antisense oligomer to its target sequence is effective to block a
translation start codon for the encoded protein, or
[0151] (ii) an increase in expression of an encoded protein,
relative to that provided by the unconjugated oligomer, when
binding of the antisense oligomer to its target sequence is
effective to block an aberrant splice site in a pre-mRNA which
encodes said protein when correctly spliced. Assays suitable for
measurement of these effects are described further below. In one
embodiment, conjugation of the peptide provides this activity in a
cell-free translation assay, as described herein. Preferably,
activity is enhanced by a factor of at least two, more preferably
by a factor of at least five, and most preferably by a factor of at
least ten.
[0152] Alternatively or in addition, the peptide is effective to
enhance the transport of the nucleic acid analog into a cell,
relative to the analog in unconjugated form. Preferably, transport
is enhanced by a factor of at least two, more preferably by a
factor of at least five, and most preferably by a factor of at
least ten.
[0153] In the conjugates of the invention, the nucleic acid analog
is preferably conjugated to the peptide via a linker moiety
selected from a Y subunit, a cysteine subunit, and an uncharged,
non-amino acid linker moiety.
[0154] Preferably, the side chain moieties of the X subunits are
independently selected from the group consisting of guanidyl
(HN.dbd.C(NH.sub.2)NH--), amidinyl (HN.dbd.C(NH.sub.2)C<),
2-aminodihydropyrimidyl, 2-aminotetrahydropyrimidyl,
2-aminopyridinyl, and 2-amino pyrimidonyl (FIGS. 3B-G,
respectively, with possible linkage sites indicated). Note that, in
structures 3D, 3E, and 3G, linking of the side chain to the amino
acid subunit could take place via any of the ring --NH-- groups as
well as via any of the carbon atoms indicated. In one embodiment,
the side chain moiety is guanidyl, as in the amino acid subunit
arginine (Arg).
[0155] In selected embodiments, the peptide has exactly two Y
subunits of type (i), which are contiguous or are flanking a
cysteine subunit. Preferably, the two Y subunits are contiguous.
Preferred side chains for Y subunits of type (i) include side
chains of naturally occurring amino acids and one- or two-carbon
homologs thereof, excluding side chains which are charged at
physiological pH. More preferred side chains are side chains of
naturally occurring amino acids. In further preferred embodiments,
the side chain is an aryl or aralkyl side chain; for example, each
Y may be independently selected from the group consisting of
phenylalanine, tyrosine, tryptophan, leucine, isoleucine, and
valine.
[0156] In selected embodiments, each Y is independently selected
from phenylalanine and tyrosine; in further embodiments, each Y is
phenylalanine. This includes, for example, conjugates which consist
of arginine subunits, phenylalanine subunits, a linker moiety, and
the nucleic acid analog. One such conjugate includes a peptide
having the formula Arg.sub.9Phe.sub.2.
[0157] The linker moiety may be, for example, a cysteine subunit
attached to the terminal Phe.
[0158] In other embodiments, each Y is a neutral, hydrophobic amino
acid subunit --C(O)--(CH.sub.2).sub.n-1(CHR)--NH--, where n is 2 to
7 and R is H. In one such embodiment, n is 5, such that Y is a
6-aminohexanoic acid subunit (Ahx). In selected embodiments of this
class, each X has a guanidyl side chain, e.g. as in arginine
subunits. These include conjugates in which the peptide comprises
arginine dimers alternating with single Y subunits, where Y is
preferably Ahx. Examples of such peptides are the peptide having
the formula (RYR).sub.4 and the peptide having the formula
(RRY).sub.4, where Y is preferably Ahx. In the latter case, the
nucleic acid analog is preferably linked to a terminal Y
subunit.
[0159] The nucleic acid analog to which the peptide is conjugated,
having a substantially uncharged backbone, is preferably a
morpholino oligomer, as described herein, or a peptide nucleic
acid.
[0160] The peptide-oligomer conjugates of the invention are more
effective than the unconjugated oligomer in various functions,
including: inhibiting expression of targeted mRNA in a protein
expression system, including cell free translation systems;
inhibiting splicing of targeted pre-mRNA; and inhibiting
replication of a virus, by targeting cis-acting elements which
control nucleic acid replication or mRNA transcription of the
virus. Preferably, activity is enhanced by a factor of at least
two, more preferably by a factor of at least five, and most
preferably by a factor of at least ten.
[0161] Alternatively or in addition, the peptide is effective to
enhance the transport of the nucleic acid analog into a cell,
relative to the analog in unconjugated form. Preferably, transport
is enhanced by a factor of at least two, more preferably by a
factor of at least five, and most preferably by a factor of at
least ten.
[0162] Also included are conjugates of other pharmacological
agents, not limited to nucleic acid analogs, linked to a peptide
transporter where the Y subunits are of type (i) above.
Specifically, the peptide consists of 8 to 16 subunits selected
from X subunits, Y subunits, and optional Z subunits, including at
least six, and preferably at least eight, X subunits, at least two
Y subunits, and at most three Z subunits, wherein >50% of said
subunits are X subunits. The X and Z subunits are as defined above,
and each Y subunit independently represents a neutral amino acid
--C(O)--(CHR)--NH--, where R is a neutral side chain selected from
substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl, and
aralkyl, wherein said neutral side chain, when selected from
substituted alkyl, alkenyl, and alkynyl, includes at most one
heteroatom for every two, preferably every four, and more
preferably every six carbon atoms. The agent may be conjugated to
the peptide via a Y subunit, a cysteine subunit, or an uncharged,
non-amino acid linker moiety.
[0163] The compound to be delivered is preferably a biologically
active agent, e.g. a therapeutic or diagnostic agent, although it
may be a compound employed for detection, such as a fluorescent
compound. Biologically active agents include drug substances
selected from biomolecules, e.g. peptides, proteins, saccharides,
or nucleic acids, particularly antisense oligonucleotides, or
"small molecule" organic or inorganic compounds. A "small molecule"
compound may be defined broadly as an organic, inorganic, or
organometallic compound which is not a biomolecule as described
above. Typically, such compounds have molecular weights of less
than 1000, or, in one embodiment, less than 500.
[0164] In one embodiment, the agent to be delivered does not
include single amino acids, dipeptides, or tripeptides. In another
embodiment, it does not include short oligopeptides; that is,
oligopeptides having fewer than six amino acid subunits. In a
further embodiment, it does not include longer oligopeptides; that
is, oligopeptides having between seven and 20 amino acid subunits.
In a still further embodiment, it does not include polypeptides,
having greater than 20 amino acid subunits, or proteins.
[0165] The transport peptide is effective to enhance the transport
of the agent into a cell relative to the agent in unconjugated
form, and relative to the agent conjugated to a corresponding
peptide lacking the Y subunits. Preferably, transport is enhanced
by a factor of at least two, more preferably by a factor of at
least five, and most preferably by a factor of at least ten.
[0166] B. Nucleic Acid Analogs
[0167] Nucleic acid analogs included in the conjugates of the
invention are substantially uncharged synthetic oligomers capable
of base-specific binding to a target sequence of a polynucleotide,
e.g. antisense oligonucleotide analogs. Such analogs include, for
example, methylphosphonates, peptide nucleic acids, substantially
uncharged N3'.fwdarw.P5' phosphoramidates, and morpholino
oligomers.
[0168] A nucleic acid analog having a "substantially uncharged"
backbone (also referred to as a "substantially uncharged nucleic
acid analog") is one having at most one charged (at physiological
pH) intersubunit linkage for every four uncharged (at physiological
pH) linkages, preferably at most one for every eight, and more
preferably at most one for every sixteen uncharged linkages. In a
preferred embodiment, the nucleic acid analogs described herein are
fully uncharged.
[0169] The base sequence of the nucleic acid analog, provided by
base pairing groups supported by the analog backbone, can be any
sequence, where the supported base pairing groups include standard
or modified A, T, C, G and U bases or the non-standard inosine (I)
and 7-deaza-G bases.
[0170] A preferred nucleic acid analog is a morpholino oligomer,
i.e. an oligonucleotide analog composed of morpholino subunit
structures of the form shown in FIG. 1, where (i) the structures
are linked together by phosphorus-containing linkages, one to three
atoms long, preferably two atoms long, and preferably uncharged,
joining the morpholino nitrogen of one subunit to the 5' exocyclic
carbon of an adjacent subunit, and (ii) P.sub.i and P.sub.j are
purine or pyrimidine base-pairing moieties effective to bind, by
base-specific hydrogen bonding, to a base in a polynucleotide. The
purine or pyrimidine base-pairing moiety is typically adenine,
cytosine, guanine, uracil or thymine. The synthesis, structures,
and binding characteristics of morpholino oligomers are detailed in
U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506,
5,166,315, 5,521,063, and 5,506,337, all of which are incorporated
herein by reference.
[0171] The subunit shown FIG. 1B, having a two-atom linkage, is
used for 6-atom repeating-unit backbones, as shown in FIG. 2B. In
these structures, the atom Y.sub.1 linking the 5' morpholino carbon
to the phosphorus group may be sulfur, nitrogen, carbon or,
preferably, oxygen. The X moiety pendant from the phosphorus is any
stable group which does not interfere with base-specific hydrogen
bonding. Preferred groups include alkyl, alkoxy, thioalkoxy, and
alkyl amino, including cyclic amines, all of which can be variously
substituted, as long as base-specific bonding is not disrupted.
Alkyl, alkoxy and thioalkoxy preferably include 1-6 carbon atoms.
Alkyl amino preferably refers to lower alkyl (C.sub.1 to C.sub.6)
substitution, and the cyclic amines are preferably 5- to 7-membered
nitrogen heterocycles optionally containing 1-2 additional
heteroatoms selected from oxygen, nitrogen, and sulfur. Z is sulfur
or oxygen, and is preferably oxygen.
[0172] A preferred morpholino oligomer is a
phosphorodiamidate-linked morpholino oligomer, referred to herein
as a PMO. Such oligomers are composed of morpholino subunit
structures of the form shown in FIG. 2B, where the structures are
linked together by phosphorodiamidate linkages, where
X.dbd.NH.sub.2, NHR, or NR.sub.2 (where R is lower alkyl,
preferably methyl), Y.dbd.O, and Z=O, joining the morpholino
nitrogen of one subunit to the 5' exocyclic carbon of an adjacent
subunit, P.sub.i and P.sub.j are purine or pyrimidine base-pairing
moieties effective to bind, by base-specific hydrogen bonding, to a
base in a polynucleotide. Also preferred are structures having an
alternate phosphorodiamidate linkage, where, in FIG. 2B, X=lower
alkoxy, such as methoxy or ethoxy, Y.dbd.NH or NR, where R is lower
alkyl, and Z=O.
[0173] Desirable chemical properties of the morpholino-based
oligomers include the ability to selectively hybridize with a
complementary-base target nucleic acid, including target RNA, with
high Tm, even with oligomers as short as 8-14 bases, the ability to
be actively transported into mammalian cells, and the ability of an
oligomer:RNA heteroduplex to resist RNAse degradation.
[0174] A "substantially uncharged" morpholino oligomer includes at
most one charged intersubunit linkage for every four, preferably
for every eight, and more preferably for every sixteen, uncharged
intersubunit linkages. Any charged linkages are preferably charged
phosphoramidate (or thiophosphoramidate) linkages, e.g. a linkage
as shown in FIG. 2B where X is O.sup.- or S.sup.-. Preferably, the
morpholino oligomers are fully uncharged.
[0175] In a preferred embodiment, the morpholino oligomer is about
8-40 subunits in length. More typically, the oligomer is about
8-20, about 8-16, about 10-30, or about 12-25 subunits in length.
For some applications, such as antibacterial, short oligomers, e.g.
from about 8-12 subunits in length, can be especially advantageous,
particularly when attached to a peptide transporter as disclosed
herein.
[0176] C. Linkers
[0177] The transport peptide can be linked to the agent to be
delivered by a variety of methods available to one of skill in the
art. Exemplary methods are provided in Examples 2-5 below and
illustrated in FIGS. 4A-D. In one embodiment, the transport peptide
contains a single cysteine residue whose side chain thiol is used
for linking, such as shown in FIGS. 4B and 4C, where the cysteine
is a terminal cysteine. The linker may also be provided by a
hydrophobic subunit such as those defined as Y, e.g. a
.beta.-alamine or longer non-.alpha. amino acid subunit, as shown,
for example, in FIG. 4D.
[0178] As discussed further below, the linkage point can be at
various locations along the transporter. In selected embodiments,
it is at a terminus of the transporter. Typically, it is adjacent
(or even between) the hydrophobic residues of the transporter.
Multiple transporters can be attached to a single compound if
desired; alternatively, multiple compounds can be conjugated to a
single transporter.
[0179] When the compound is a PMO, the transporter can be attached
at the 5' end of the PMO via an amine capping moiety, as described
in Examples 2-3 and illustrated in FIGS. 4A and 4D. Alternatively,
the transporter may be attached at the 3' end, e.g. via a
morpholino ring nitrogen, as described in Example 4 and shown in
FIG. 4B, or via the side chain of an intersubunit linkage, either
at a terminus or an internal linkage.
[0180] The linker between the transport peptide and the PMO may
also consist of natural or non-natural amino acids (e.g.,
6-aminohexanoic acid or .beta.-alamine) added to the peptide at the
C-terminal and as described in Example 2. The linker may also
comprise a direct bond between the carboxy terminus of a
transporter peptide and an amine or hydroxy group of the PMO,
formed by condensation promoted by e.g. carbodiimide.
[0181] In general, the linker may comprise any nonreactive moiety
which does not interfere with transport or function of the
conjugate. The linker preferably includes a chain of up to about
sixteen atoms, including lengths of up to 12 or up to 8 atoms,
comprising linkages selected from alkyl, ether (e.g. PEG linkages),
thioether, ester, amide, amino, carbamate, or combinations thereof.
More preferably, the linkages are selected from alkyl, ether, and
amide, when linkages which are stable (non-cleavable) in vivo are
desired.
[0182] Linkers can be selected from those which are non-cleavable
under normal conditions of use, e.g., containing an ether,
thioether, amide, or carbamate bond. In other embodiments, it may
be desirable to include a linkage between the transporter moiety
and compound which is cleavable in vivo. Bonds which are cleavable
in vivo are known in the art and include, for example, carboxylic
acid esters, which are hydrolyzed enzymatically, and disulfides,
which are cleaved in the presence of glutathione. It may also be
feasible to cleave a photolytically cleavable linkage, such as an
ortho-nitrophenyl ether, in vivo by application of radiation of the
appropriate wavelength.
[0183] For example, the preparation of a conjugate having a
disulfide linker, using the reagent N-succinimidyl
3-(2-pyridyldithio) propionate (SPDP) or succinimidyloxycarbonyl
.alpha.-methyl-.alpha.-(2-pyridyldithio) toluene (SMPT), is
described in Example 5 and illustrated in FIG. 4C. Exemplary
heterobifunctional linking agents which further contain a cleavable
disulfide group include N-hydroxysuccinimidyl
3-[(4-azidophenyl)dithio]propionate and others described in Vanin,
E. F. and Ji, T. H., Biochemistry 20:6754-6760 (1981).
[0184] D. Exemplary Peptides and Conjugates
[0185] A Table of sequences of exemplary transport peptides and
PMOs discussed in the following sections is provided below. In
general, the peptides include an N-terminal amino group and
C-terminal amide (e.g., NH.sub.2--CYGRKKRRQRRR--CONH.sub.2) or free
carboxyl group (e.g., NH.sub.2--CYGRKKRRQRRR--COOH), or they
include an N-terminal acetamide and C-terminal acid (e.g.,
Ac-NH(RAhxR).sub.4Ahx.beta.Ala-OH). The "Y" residues of peptides of
the invention designated by SEQ ID NOs: 13-32 are indicated in
boldface, and internal cysteine residues used for linkage to the
PMO are shown in italics. (When no cysteine linker is shown, the
peptide is typically linked via its C-terminus, i.e. at the right
side as shown.)
[0186] Exemplary peptides containing 6-aminohexanoic acid (Ahx)
subunits are shown in Table 1 as SEQ ID NOs: 33-41. The structure
of the (RAhxR).sub.4 transport peptide (SEQ ID NO:34) conjugated to
a PMO via an Ahx-.beta.Ala linker is shown in FIG. 4D.
TABLE-US-00001 TABLE 1 PMO Sequence (5.varies.0 to 3') SEQ ID NO:
705 5'- CCT CTT ACC TCA GTT ACA-acetyl-3' 1 705-FL 5'- CCT CTT ACC
TCA GTT ACA-fluorescein-3' 1 705.sub.2MM 5'- CCT CTT AAC TCC GTT
ACA-acetyl-3' 2 705.sub.4MM 5'- CCT ATT AAC TCC GTT CCA-acetyl-3' 3
705.sub.SCR 5'- CTC TCT CAC CAT TGA CAT-acetyl-3' 4 c-myc 5'- ACG
TTG AGG GGC ATC GTC GC-acetyl-3' 5 DEN5'CS 5'- CGT TTC AGC ATA TTG
AAA GG-3' 6 DEN3'CS 5'- CCC AGC GTC AAT ATG CTG-3' 7 DEN AUG 5'-
GGT TAT TCA TCA GAG ATC TG-3' 8 MHV lab 5'- GCC CAT CTT TGC CAT TAT
GC-3' 9 DSscr 5'- AGT CTC GAC TTG CTA CCT CA-3 10 Peptide Sequence
(N-terminal to C-terminal) SEQ ID NO: pTat CYGRKKRRQRRR 11 rTat
RRRQRRKKR 12 R.sub.9F.sub.2 RRRRRRRRRFF 13 2d-R.sub.9F.sub.2
.sub.DR.sub.DRRRRRRRRFF (mixed isomer) 14 D-R.sub.9F.sub.2
.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DF.su-
b.DF.sub.D (D-isomer) 15 R.sub.9CF.sub.2 RRRRRRRRRCFF 16
R.sub.8CF.sub.2R RRRRRRRRCFFR 17 R.sub.6CF.sub.2R.sub.3
RRRRRRCFFRRR 18 R.sub.5FCFR.sub.4 RRRRRFCFRRRR 19
R.sub.5F.sub.2R.sub.4 RRRRRFFRRRR 20 R.sub.4CF.sub.2R.sub.5
RRRRCFFRRRRR 21 R.sub.2CF.sub.2R.sub.7 RRCFFRRRRRRR 22
CF.sub.2R.sub.9 CFFRRRRRRRRR 23 CR.sub.9F.sub.2 CRRRRRRRRRFF 24
F.sub.2R.sub.9 FFRRRRRRRRR 25 R.sub.5F.sub.2CF.sub.2R.sub.4
RRRRRFFCFFRRRR 26 R.sub.9I.sub.2 RRRRRRRRRII 27 R.sub.8F.sub.3
RRRRRRRRFFF 28 R.sub.9F.sub.4 RRRRRRRRRFFFF 29 R.sub.8F.sub.2
RRRRRRRRFF 30 R.sub.6F.sub.2 RRRRRRFF 31 R.sub.5F.sub.2 RRRRRFF 32
(RRAhx).sub.4 RRAhxRRAhxRRAhxRRAhx 33 (RAhxR).sub.4
RAhxRRAhxRRAhxRRAhxR 34 (AhxRR).sub.4 AhxRRAhxRRAhxRRAhxRR 35
(RAhx).sub.6 RAhxRAhxRAhxRAhxRAhxRAhx 36 (RAhxR).sub.3
RAhxRRAhxRRAhxR 37 (RAhxR).sub.2R RAhxRRAhxRR 38 (RAhxR).sub.2
RAhxRRAhxR 39 (RKAhx).sub.4 RKAhxRKAhxRKAhxRKAhx 40 (RHAhx).sub.4
RHAhxRHAhxRHAhxRHAhx 41
II. Biological Activity of Transporter-PMO Conjugates
[0187] The peptide transporters described herein facilitate the
delivery of substantially uncharged oligomers into living
eukaryotic cells, as well as significantly enhancing antisense
activity, as demonstrated below for PMOs. In one embodiment, the
oligomer is a substantially uncharged morpholino oligomer as
described above.
[0188] Cellular delivery can involve both cytoplasmic and nuclear
compartments of the cell. Accordingly, in selected embodiments, the
antisense oligomer includes a base sequence effective to hybridize
to a target sequence which includes a splice site in a selected
preprocessed mRNA (pre-mRNA). The antisense oligomer may also
include a base sequence effective to hybridize to a target sequence
which includes a translation start site in a selected mRNA. The
antisense oligomer may also include a base specific sequence
effective to hybridize to a target sequence required for viral
replication. In another aspect, the antisense oligomer may be an
antibacterial agent, e.g. by targeting ribosomal RNA or other
bacterial nucleic acids, as described, for example, in co-owned PCT
Pubn. Nos. WO 01/49775 and WO 01/42457 (US Pubn. No. 2002/0082226),
which are incorporated herein by reference.
[0189] As demonstrated herein, the transport peptides as described
above greatly enhance cell entry of attached compounds, relative to
uptake of the compound in the absence of the attached peptide
transport moiety, and relative to uptake by an attached transport
moiety lacking the Y subunits. Such enhanced uptake is preferably
evidenced by at least a one-fold increase, and preferably a more
than two-fold increase, in the uptake of the compound into
mammalian cells, relative to uptake of the agent by an attached
transport moiety lacking the Y subunits. Uptake is preferably
enhanced at least twenty fold, and more preferably at least forty
fold, relative to the unconjugated compound.
[0190] Uptake is preferably measured in HeLa cells or in
mononuclear blood cells, particularly lymph or spleen derived
cells, such as lymphocytes or fibroblasts, by processes such as
described in Materials and Methods, below, for HeLa cells, under
the headings "Cell Culture" through "Flow Cytometry". See also
Example 6, Example 9, Section A below for evaluation of transport
only, and Section B below for evaluation of transport and antisense
activity.
[0191] A further benefit of the transport moiety is the enhancement
of binding of an attached nucleic acid analog to its target
sequence. The transport moieties of the invention are shown herein
to lower the concentration of an uncharged antisense oligomer
effective to achieve antisense activity, as measured in both tissue
culture and cell-free systems. Tissue culture experiments provide
indications of enhanced antisense activity, due to enhanced
intracellular delivery, enhanced antisense activity, e.g. binding
of the antisense oligomer to its target sequence, or a combination
of these phenomena.
[0192] Cell-free translation systems provide a means to assess,
independently of transport, the enhancing effect of the conjugated
peptide on the antisense oligomer's ability to bind to its target
and, through steric blocking, inhibit translation of downstream
sequences (or inhibit aberrant splicing, as in the assay of Example
6). Cell-free translation assays designed to test the antisense
effect of R.sub.9F.sub.2--PMO (SEQ ID NO.: 13) and
(RAhxR).sub.4--PMO (SEQ ID NO.:34) conjugates demonstrate between
10 fold and 500 fold improvement in antisense activity compared to
the unconjugated PMO (see, e.g., Example 8 and FIGS. 21-23 and 28).
The term "enhancing the translation inhibiting ability" or
"enhanced translation inhibiting ability" provided by the
conjugated peptide, as used herein, preferably refer to antisense
(translation inhibiting) activity as measured in such a cell free
system, such as described in Materials and Methods, below, under
the heading "Cell-free translations assays". See also Example 9 and
Section C below.
[0193] A. Transporter-Mediated Delivery of Morpholino Oligomers
into Cells
[0194] The cellular uptake of three test substances, including (1)
unconjugated PMO (SEQ ID NO: 1), also designated herein as "705" or
"PMO 705"), (2) a mixture of unconjugated PMO and the transport
peptide R.sub.9F.sub.2 (SEQ ID NO: 13)-C, and (3) a covalent
conjugate of the PMO and the transport peptide
(R.sub.9F.sub.2--C-705) (SEQ ID NO.:43), were determined by
fluorescent microscopy in four cell lines: HeLa pLuc705 derived
from HeLa S3, HeLa, NIH3T3, and Jurkat. HeLa pLuc/705 (Kang, Cho et
al. 1998) is a HeLa S3 cell line stably transfected with a plasmid
carrying the luciferase coding sequence interrupted by a mutated
human .beta.-globin intron 2 (Gene Tools, Philomath, Oreg.). Other
cell lines were obtained from ATCC (Manassas, Va.). The PMO's were
3'-labeled with fluorescein as described in Example 1. To avoid
artifacts, all fluorescent images were taken from live cells, and
no fixative agent or mounting media were used.
[0195] In all four cell lines, the fluorescent images of cells
treated with 705-FL (SEQ ID NO:2) alone, or with the mixture of
unconjugated 705-FL PMO and R.sub.9F.sub.2--C (SEQ ID NO:43), were
essentially devoid of fluorescence. In cells treated with
R.sub.9F.sub.2--C-PMO (SEQ ID NO.:43) conjugate, fluorescence was
observed in 100% of the cells, although patterns varied among the
different cell lines as follows. The NIH3T3 cells had very bright
and diffused cytosolic and nuclear fluorescence with fewer punctate
spots than other cell lines. The HeLa cells had mostly diffused
fluorescence with more distinct punctate spots than NIH3T3. The
HeLa S3 cells appeared to have less intense cytosolic diffuse
fluorescence but with a very bright fluorescent spot localized near
or in the nucleus. The Jurkat cells had the lowest level of
fluorescence among these cell lines.
[0196] The association of the conjugate with cells is a fairly
rapid process. As shown in FIG. 5A, fluorescence of cells incubated
with R.sub.9F.sub.2C-PMO (SEQ ID NO.:43) increased within minutes
and reached maximum intensity between 30-45 minutes over a 900
minute study period. The fluorescence of cells incubated at
37.degree. C. was similar to those incubated at 17.degree. C. over
a concentration range of 0.1 to 5 .mu.M (FIG. 5B). The adsorption
appeared to be saturable, with an increase in fluorescence observed
between 0.1-1 .mu.M, but not between 1-5 .mu.M.
[0197] As reported previously (Moulton, Hase et al. 2003), the
majority of Tat peptide that becomes associated with cell membranes
is not internalized. Because membrane-bound conjugate may
artificially enhance the appearance of cellular fluorescence,
trypsin treatment was used in the present case to reduce or
eliminate the contribution from membrane-bound conjugate (Moulton,
Hase et al. 2003; Richard, Melikov et al. 2003).
[0198] Thus, HeLa or NIH3T3 cells were incubated with conjugate,
then trypsinized, as described below in Materials and Methods,
washed, and replated. The trypsinized cells had much less
fluorescence than non-trypsinized cells (FIG. 6), though patterns
of fluorescence were similar.
[0199] As also shown in FIG. 6, both L-transporter and
D-transporter conjugates gave identical association and
internalization profiles; therefore, the decrease in fluorescence
upon trypsinization cannot be attributed solely to trypsin
digestion of R.sub.9F.sub.2C (SEQ ID NO.:43) peptide. This suggests
that the conjugate associates with membrane protein(s), which are
digested by trypsin.
[0200] Having shown that trypsin can effectively remove most
membrane-bound conjugate, factors affecting internalization of the
conjugate could be studied in trypsinized cells by flow cytometry.
As shown in FIG. 7A, gradual increases in fluorescence, due to
conjugate internalization, are observed up to 700 minutes from
incubation. Internalization is also seen to be temperature- and
concentration-dependent, as shown in FIG. 7B. The profile shown in
FIG. 7B is similar to that shown by the endocytosis marker FM4-64
(a fluorescent, lipophilic dye which labels the plasma membrane and
is then endocytosed in a time-, temperature-, and energy-dependent
manner). Internalization of conjugate was almost completely
inhibited in cells pre-incubated with the metabolic inhibitor,
NaN.sub.3, indicating that internalization of the peptide-PMO
conjugate is an energy dependent process.
[0201] B. Antisense Activity in Cell Culture
[0202] Various oligomer-transporter moiety conjugates in accordance
with the invention were tested for antisense activity in vitro
(Example 6). The data described below was obtained by targeting a
.beta.-globin splice correction sequence fused to luciferase.
Specifically, the assay uses HeLa cells stably transfected with
plasmid pLuc/705, which has a luciferase gene interrupted by a
human .beta.-globin intron mutated at nucleotide 705, thus causing
incorrect splicing. An antisense oligonucleotide targeting the 705
splice site, when delivered effectively, corrects splicing and
allows luciferase expression. For further description of the
plasmid and assay, see e.g. Kang, Cho et al. 1998; Yoo, Sazani et
al. 1999. Because the cell nucleus is the site of pre-mRNA
splicing, these data demonstrate delivery of the oligomer to the
cell nucleus.
[0203] A conjugate of an 18-mer antisense PMO (SEQ ID NO: 1) with
the oligopeptide rTat(57-49) (SEQ ID NO: 12) was previously shown
to inhibit aberrant splicing in this assay (Moulton, Hase et al.
2003). Comparative assays were carried out using rTat (57-49)
conjugates and conjugates containing transporter molecules of the
invention, as shown in FIG. 8.
[0204] As shown in the Figure, a conjugate consisting of the
antisense PMO linked, via a cysteine residue, to a peptide having
the sequence Arg.sub.9Phe.sub.2 (R.sub.9F.sub.2, SEQ ID NO:13) was
much more effective in suppressing aberrant splicing than
conjugates containing the peptides rTat(57-49) (RRRQRRKKR) (SEQ ID
NO.:12) and R.sub.9, also linked to the PMO via a cysteine
residue.
[0205] FIG. 9 gives the level of viable HeLa cells after 24 hrs
incubation with several of these conjugates at a concentration of
25 .mu.M, showing the low toxicity of the conjugates.
[0206] FIGS. 10-14 show the effect of various structural
modifications of the transporter on the antisense activity of the
PMO-transporter conjugates. In each Figure, results are expressed
in relative light units normalized to microgram of protein, based
on luciferase expression in the pLuc705 assay described above. In
the conjugates represented in these figures, the PMO is attached,
via a cysteine residue, at the C-terminus or right side of the
transporter sequence as written and to the 5'-terminus, or left
side as written, of the PMO.
[0207] FIG. 10 shows the effect of varying the nature or length of
the hydrophilic segment of the transporter. As shown, phenylalanine
(Phe or F)-containing transporters appeared to be more effective
than isoleucine (Ile or I)-containing transporters. Increasing the
length of the hydrophobic segment from 2 to 3 to 4 amino acid
subunits did not appear to increase effectiveness.
[0208] The total number of arginines in the transporter appears to
be significant, in view of the data shown in FIG. 11. As shown
therein, in oligopeptides of the series RnF2, oligopeptides where n
was 6 or less were much less effective than those where n was 8 or
9. See also Moulton, Nelson et al., 2004, which is incorporated
herein in its entirety by reference.
[0209] As shown in FIG. 12, the position of the hydrophobic segment
can be altered. In the data represented by F.sub.2R.sub.9 (SEQ ID
NO.:25), the R.sub.9 segment is at the C-terminus and is attached
to the PMO. Significantly, the data shows that the sequence of
cationic subunits can be non-contiguous (R.sub.5F.sub.2R.sub.4)
(SEQ ID NO.:20). Further examples are given in FIG. 15, below.
[0210] Table 2 below shows the level of luciferase production
(i.e., antisense activity) in HeLa pLuc705 cells after 24 hrs
incubation with R.sub.9F.sub.2--PMO (SEQ ID NO.: 13) conjugates,
linked by either a cleavable linker or a non-cleavable linker of
various lengths, where in each case the PMO was attached via a
cysteine residue at the C-terminus of the peptide transporter. The
structures of the bifunctional cross linkers used in this study are
shown in FIG. 13. As shown in the Table, the use of a cleavable
(disulfide) linker (see e.g. FIG. 4C) had no significant effect on
activity. See also Moulton, Nelson et al., 2004.
TABLE-US-00002 TABLE 2 Effect of linker on antisense activity of
R9F2C-PMO (705-FL) conjugates Linker length RLU/ug protein
Treatment Linker type {acute over (.ANG.)} range Vehicle control
(H.sub.20) N/A N/A 1 (0.1) R.sub.9F.sub.2C-705-FL (SEQ ID NO. 13)
thio-maleimide 6.8 102 (4.9) R.sub.9F.sub.2C-EMCS-705-FL (SEQ ID
NO. 13) thio-maleimide 9.4 141 (4.3) R.sub.9F.sub.2C-KMUS-705-FL
(SEQ ID NO. 13) thio-maleimide 15.7 171 (14.3)
R.sub.9F.sub.2C-SMPB-705-FL (SEQ ID NO. 13) thio-maleimide 11.6 123
(2.1) R.sub.9F.sub.2C-SMCC-705-F (SEQ ID NO. 13) thio-maleimide
11.6 86 (1.4) R.sub.9F.sub.2C-SBAP-705-F (SEQ ID NO. 13) thio-ether
6.2 98 (3.2) R.sub.9F.sub.2C-SPDP-705-FL (SEQ ID NO. 13) disulfide
6.8 109 (2.9) R.sub.9F.sub.2C-LCSPDP-705-FL (SEQ ID NO. 13)
disulfide 15.6 181 (7.8)
[0211] As shown in FIG. 14, attachment of biotin to the conjugate
(biotin-R.sub.9F.sub.2--PMO) appeared to increase activity at high
doses after 6 hours incubation (not shown), but little or no effect
was seen at 24 hours.
[0212] Further experiments were performed to evaluate the effect of
the position of both the hydrophobic segment and the PMO attachment
point within the transporter. FIGS. 15 and 16 show the results of
the pLuc/705 assay carried out with conjugates of PMO 705 (SEQ ID
NO.:1) linked to the transport peptides having SEQ ID NO: 13 and
16-26 as shown in Table 1. In each conjugate, the PMO is linked via
a C-terminal or internal cysteine (C) residue. As shown by the
data, transporters in which the Y subunits are internal (i.e.
flanked by X subunits) generally performed as well or better than
those in which the Y subunits are at a terminus. The linkage point
could be adjacent the Y subunits or remote from the Y subunits.
[0213] To determine whether the presence of the transporter
adversely affects the antisense specificity of the PMO, as has been
observed for Tat transporters (Moulton, Hase et al. 2003), the
assay was carried out with R.sub.9F.sub.2--C-PMO conjugates of
three mismatched-sequence control PMOs, designated 705.sub.2MM (two
mismatches, SEQ ID NO.:2), 705.sub.4MM (four mismatches, SEQ ID
NO.:3) and 705.sub.SCR (scrambled, SEQ ID NO.:4) (see Table 1 for
sequences). Up to the highest concentration tested, the three
control conjugates showed no antisense activity; that is, they did
not restore luciferase activity by correcting the 705 splice defect
(FIG. 17). Accordingly, there was no indication of adverse effects
on specificity by the transporter.
[0214] Fluorescence microscopy and the splice-correction assay were
also used to determine the time required for the conjugate to enter
the cytoplasm and nuclei of cells. HeLa, NIH3T3 or HeLa pLuc/705
cells were treated with the R.sub.9F.sub.2--C-PMO conjugate for 20
minutes and imaged. A nuclear stain, dihydroethidium (DHE,
Molecular Probes, Eugene, Oreg.), was used to locate the nucleus.
Diffuse green fluorescence was seen in both cytoplasm and nucleus,
and overlapped with the intense red of DHE in the nucleus.
[0215] In the splice-correction assay, the production of functional
luciferase was monitored over time, showing that luciferase was
produced after as little as 120 minutes of incubation time with the
R.sub.9F.sub.2C-705 PMO (FIG. 18).
[0216] C. Antisense Activity in Cell-Free Systems
[0217] To investigate antisense activity of the conjugates in a
manner independent of cellular transport, peptide-conjugated and
unconjugated PMOs were tested in a cell-free translation system for
their ability to sterically block translation of a downstream
reporter gene. The effects of various antisense PMOs on translation
of in vitro transcribed RNA from plasmids containing various viral
nucleotide sequences fused directly upstream of the coding region
for firefly luciferase (FLUC) were measured by in vitro translation
reactions in a commercially available rabbit reticulocyte lysate
(RRL) system, as described in Example 9. Specifically, three
different regions of the Dengue type 2 virus were fused to the FLUC
gene and a region surrounding the AUG start codon of the human
c-myc gene. Also targeted was a sequence of murine hepatitis virus
(MHV) that surrounds the start codon of the lab gene (Neuman, B. W.
et al., J. Virol. 2004, in press).
[0218] As shown in FIGS. 21-23 and 28, conjugation of the antisense
oligomers to peptide transporters of the invention was found to
increase effectiveness of the antisense PMOs by between 10-500
fold, as reflected by the concentration required to achieve 50%
inhibition of target expression (EC.sub.50). Conjugation to
R.sub.9F.sub.2 enhanced the antisense effectiveness of the PMO
compared to unconjugated PMO by as much as 500 fold (FIGS. 21-23).
As shown in FIG. 28, similar results were obtained using the
(RAhxR).sub.4 peptide (SEQ ID NO:34) conjugated to an anti-c-myc
PMO (SEQ ID NO:5).
[0219] Although the scope of the invention is not limited by
mechanism, the enhanced antisense activity observed with the
peptide conjugates of the invention in cell free translation
systems may be due to a localized disruption of RNA secondary
structure by the peptide. One construct used in the RRL assays,
pDCLD, contains the 5' most 204 bases of the Dengue virus genome,
which encodes the initial 35 amino acids of the polyprotein, placed
in frame with the FLUC gene. The computer-predicted RNA structure
for this region, shown in FIG. 29, which was generated using the
`mfold` RNA folding program (Zuker 2003), indicates extensive
secondary structure. The secondary structure shown in FIG. 29 also
agrees with that predicted by Khromykh et al. for the same region
of a distinct but related flavivirus, Kunjin virus (Khromykh,
Kondratieva et al., 2003).
[0220] The ability of unconjugated antisense PMOs to hybridize and
block translation can be inhibited by certain secondary structures,
as appears to be the case for this segment of RNA, as shown in FIG.
23. In this example, unconjugated PMO was unable to produce a 50%
reduction in translation despite increasing concentration. However,
R.sub.9F.sub.2 (SEQ ID NO.: 13) peptide conjugated PMO has greatly
enhanced antisense activity, producing nearly 100% suppression of
the reporter gene translation at the same concentration (FIG.
23).
[0221] D. Biodistribution In Vivo
[0222] Tissue culture experiments from a variety of experimental
systems clearly demonstrate that the transport peptides of the
invention enhance delivery to intracellular compartments, including
the cytoplasm and nucleus. To extend these observations to an in
vivo system, a comparative analysis of PMO and peptide conjugated
PMO uptake in spleen and lymph node cells was performed in mice. As
described in Example 10 and shown in FIG. 27, the
R.sub.5F.sub.2R.sub.4 transport peptide (SEQ ID NO:20) greatly
enhanced delivery to spleen and lymph node cells in total, and to
specific subpopulations of cells from these tissues, including CD4
and CD8 positive lymphocytes, monocytes, macrophages and B cells.
Furthermore, as described in Example 10, peptide conjugated PMO
were shown to have significant residence time in spleen and lymph
node-derived cells four days after a multidose PMO treatment
regimen in mice had ended.
III. Applications
[0223] The transporters and conjugates of the invention are
particularly useful for targeting a substantially uncharged
antisense oligomer, such as a PMO, to a cell nucleus, by exposing
the cell to a conjugate comprising the oligomer covalently linked
to a transport peptide as described above. The transporters are
effective to deliver the antisense oligomer across both the cell
and nuclear membranes, and to enhance the antisense activity of the
oligomer, as demonstrated above.
[0224] Nuclear delivery allows targeting of splice sites, which can
be implemented for generating dominant/negative proteins, which
preserve, for example, the feedback function of a protein, but not
its enzymatic activity. This is accomplished by selectively
inhibiting splice donor or acceptor sites in pre-mRNA that
eliminate from the mature spliced mRNA one or more exons encoding
unwanted functions. Useful gene targets for this approach include,
but are not limited to, CD86, c-FLIP, CTLA-4, TGF-b and c-myc.
[0225] The translation start site (i.e. the AUG start codon) is
another useful target for antisense therapy, as are cis-acting
elements required for viral replication or transcription. The
inhibition of viral replication can be accomplished either by
blocking translation of essential viral proteins or by targeting
regions of the viral genome required for either nucleic acid
replication or mRNA transcription. These cis-acting elements are
often located in untranslated regions (UTRs) of the viral genome
and typically found at either or both the 5' and 3' termini of the
genome. Examples of these elements include internal ribosome entry
sites (IRES) as found in hepatitis C virus (HCV), transcriptional
regulatory sequences (TRS) as found in the human coronavirus that
causes systemic acquired respiratory syndrome (SARS), cyclization
sequences (CS) as found in flaviviruses, and the tRNA primer
binding site (PBS) found in retroviruses such as human
immunodeficiency virus (HIV). Often, these elements have extensive
secondary structural characteristics and are recalcitrant to
binding of antisense oligomers. Conjugation of peptides as
disclosed herein to substantially uncharged antisense oligomers is
believed to allow disruption of such secondary structures and thus
enhanced binding of the oligomers to their targets. Therefore, the
methods and compositions of the invention described herein provide
the ability to more effectively target these regions of viral
genomes and inhibit viral replication.
[0226] PMO conjugates find use, in general, in any indication in
which delivery of an oligonucleotide to a cell is desired,
including antisense applications. Such indications include, but are
not limited to, proliferative disorders or ischemia, by targeting
p53; polycystic kidney disease, restenosis, and cancer, by
targeting c-myc; pulmonary inflammation or septic shock, by
targeting TNF-.alpha.; alteration of drug metabolism, by targeting
P450 enzymes; prostate cancer, by targeting .beta.-HCG or androgen
receptor; glioblastoma, by targeting integrin .alpha.V. Treatment
of stem cells with antisense oligonucleotides targeted to genes
preferentially expressed in such cells can also be used for cancer
treatment (e.g. co-owned and copending U.S. application Ser. No.
09/679,475; PCT Pubn. No. WO 01/25405). Treatment of infectious
diseases using antisense oligonucleotides targeted to either viral
genes or cis-acting sequences involved in replication or
transcription can be used as antiviral therapeutic treatments (e.g.
co-owned US applications: 10/272,865, pubn. no. US 2002/0171335,
issued as U.S. Pat. No. 6,828,105; copending application Ser. No.
10/422,671, pubn. no. US 2003/0224353; 60/493,990; 60/493,043;
60/514,064; and 60/532,701, expired). Treatment of certain
immunologic conditions can be facilitated using antisense
oligonucleotides conjugated to peptides that can provide
intracellular delivery specifically to naive or activated
lymphocytes (e.g. co-owned U.S. application 60/505,418,
expired).
[0227] The conjugates are particularly useful in treatment of
vascular proliferative disorders such as restenosis. Areas of
vessel injury include, for example, restenosis or renarrowing of
the vascular lumen following vascular intervention, such as
coronary artery balloon angioplasty, with or without stent
insertion. Restenosis is believed to occur in about 30% to 60% of
lesions treated by angioplasty and about 20% of lesions treated
with stents within 3 to 6 months following the procedure. (See,
e.g., Dev, N. B. et al., Cathet Cardiovasc Diagn 45(3):337-45,
1998). Stenosis can also occur after a coronary artery bypass
operation, wherein heart surgery is done to reroute, or "bypass,"
blood around clogged arteries and improve the supply of blood and
oxygen to the heart. In such cases, the stenosis may occur in the
transplanted blood vessel segments, and particularly at the
junction of replaced vessels. Stenosis can also occur at
anastomotic junctions created for dialysis.
[0228] In this aspect, a PMO conjugate, preferably targeting c-myc,
is employed in a coated stent, in a soaking solution for treatment
of saphenous veins, or otherwise delivered to the site of vascular
injury. Microbubble compositions, such as described below, have
been found particularly useful in delivery of attached molecules,
such as oligonucleotides, to areas of thrombosis or vessel injury,
e.g. damaged endothelium (see e.g. Kipshidze et al., 2001, 2002;
Kim et al., 2001; PCT Pubn. No. WO 2000/02588) as well as to
selected organs such as the liver and kidney. A preferred
antirestenotic composition is an anti-c-myc PMO (e.g. SEQ ID NO:5)
conjugated to an (RAhxR).sub.4 (SEQ ID NO:34) transport peptide
through an Ahx-.beta.Ala linker (as shown in FIG. 4D).
IV. Compositions Containing PMO-Transporter Conjugates and
Microbubble Carrier Suspensions
[0229] Aqueous suspensions of insoluble gas-containing microbubbles
have been shown to be effective vehicles for delivery of
oligonucleotides, including PMOs, as described, for example, in
co-owned U.S. Pat. Nos. 5,849,727 and 6,117,858 and pending U.S.
application Ser. No. 10/668,988. In general, the composition
comprises a liquid suspension, preferably an aqueous suspension, of
microbubbles containing a blood-insoluble gas. The microbubbles are
preferably about 0.1 to 10.mu. in diameter. Generally, any
blood-insoluble gas which is nontoxic and gaseous at body
temperature can be used. The insoluble gas should have a diffusion
coefficient and blood solubility lower than nitrogen or oxygen,
which diffuse in the internal atmosphere of the blood vessel.
Examples of useful gases are the noble gases, e.g. helium or argon,
as well as fluorocarbon gases and sulfur hexafluoride. Generally,
perfluorocarbon gases, such as perfluoromethane, perfluoroethane,
perfluoropropane, perfluorobutane, and perfluoropentane, are
preferred.
[0230] The gaseous microbubbles are stabilized by a fluid
filmogenic coating, to prevent coalescence and to provide an
interface for binding of molecules to the microbubbles. The fluid
is preferably an aqueous solution or suspension of one or more
components selected from proteins, surfactants, lipids, including
phospholipids, and polysaccharides. In preferred embodiments, the
components are selected from proteins, surfactant compounds, and
polysaccharides. Suitable proteins include, for example, albumin,
gamma globulin, apotransferrin, hemoglobin, collagen, and urease.
Human proteins, e.g. human serum albumin (HSA), are preferred.
[0231] Conventional surfactants include compounds such as alkyl
polyether alcohols, alkylphenol polyether alcohols, and alcohol
ethoxylates, having higher alkyl (e.g. 6-20 carbon atom) groups,
fatty acid alkanolamides or alkylene oxide adducts thereof, and
fatty acid glycerol monoesters. Surfactants particularly intended
for use in microbubble contrast agent compositions are disclosed,
for example, in Nycomed Imaging patents U.S. Pat. No. 6,274,120
(fatty acids, polyhydroxyalkyl esters such as esters of
pentaerythritol, ethylene glycol or glycerol, fatty alcohols and
amines, and esters or amides thereof, lipophilic aldehydes and
ketones; lipophilic derivatives of sugars, etc.), U.S. Pat. No.
5,990,263 (methoxy-terminated PEG acylated with e.g.
6-hexadecanoyloxyhexadecanoyl), and U.S. Pat. No. 5,919,434.
[0232] Other filmogenic synthetic polymers may also be used; see,
for example, U.S. Pat. Nos. 6,068,857 (Weitschies) and 6,143,276
(Unger), which describe microbubbles having a biodegradable polymer
shell, where the polymer is selected from e.g. polylactic acid, an
acrylate polymer, polyacrylamide, polycyanoacrylate, a polyester,
polyether, polyamide, polysiloxane, polycarbonate, or
polyphosphazene, and various combinations of copolymers thereof,
such as a lactic acid-glycolic acid copolymer.
[0233] Such compositions have been used as contrast agents for
diagnostic ultrasound, and have also been described for therapeutic
applications, such as enhancement of drug penetration (Tachibana et
al., U.S. Pat. No. 5,315,998), as thrombolytics (Porter, U.S. Pat.
No. 5,648,098), and for drug delivery (Unger, U.S. Pat. No.
6,143,276; Klaveness et al., U.S. Pat. No. 6,261,537; Porter et
al., U.S. Pat. No. 6,117,858).
[0234] In one embodiment, the carrier is a suspension of
perfluorocarbon-containing dextrose/albumin microbubbles known as
PESDA (perfluorocarbon-exposed sonicated dextrose/albumin). Human
serum albumin (HSA) is easily metabolized within the body and has
been widely used as a contrast agent. The composition may be
prepared as described in co-owned U.S. Pat. Nos. 5,849,727 and
6,117,858. Briefly, a dextrose/albumin solution is sonicated while
being perfused with the perfluorocarbon gas. The microbubbles are
preferably formed in an N.sub.2-depleted, preferably N.sub.2-free,
environment, typically by introducing an N.sub.2-depleted (in
comparison to room air) or N.sub.2.free gas into the interface
between the sonicating horn and the solution. Microbubbles formed
in this way are found to be significantly smaller and stabler than
those formed in the presence of room air. (See e.g. Porter et al.,
U.S. Pat. No. 6,245,747.)
[0235] The microbubbles are conjugated with a compound to be
delivered, such as a PMO-transporter conjugate, simply by
incubating the microbubble suspension, with agitation if necessary,
with a liquid formulation of the compound. The incubation may be
carried out at room temperature, or at moderately higher
temperatures, as long as the stability of the drug or the
microbubbles is not compromised. It is believed that compounds
incubated with such suspensions non-covalently bind at the
gas-fluid interface of the microbubbles, and that, upon
administration, the cell membrane fluidizing feature of the
insoluble (e.g. perfluorocarbon) gas enhances cell entry for the
compound.
V. Modified Antisense Oligonucleotides
[0236] In another aspect, the invention provides antisense
oligomers which are themselves modified with charged moieties of
the structure R.sup.1N.dbd.C(NH.sub.2)R.sup.2, where R.sup.1 is H
or R, and R.sup.2 is R, NH.sub.2, NHR, or NR.sub.2, where R is
lower alkyl or lower alkenyl and may further include oxygen or
nitrogen; R.sup.1 and R.sup.2 may together form a ring; and the
side chain moiety is linked to the amino acid subunit via R.sup.1
or R.sup.2. Specifically, the oligomer comprises a sequence of
subunits connected by intersubunit linkages, where the sequence of
subunits supports a sequence of bases effective to hybridize to a
complementary-sequence target polynucleotide, to form a
target/antisense duplex; and, carried on at least six contiguous
intersubunit linkages, a charged moiety as described above. In a
preferred embodiment, the charged moieties are independently
selected from the group consisting of guanidyl
(--HN.dbd.C(NH.sub.2)NH--), amidinyl (--C(.dbd.NH)(NH.sub.2)),
2-amino hexahydropyrimidyl (.dbd.HN--CH(NH.sub.2)NH--),
2-aminopyridinyl (--C(.dbd.N)(NH.sub.2)), and 2-aminopyrimidonyl
(--HN--C(NH.sub.2).dbd.N--) (see FIG. 3).
[0237] Preferably, the oligomer is an uncharged oligomer. Examples
of uncharged antisense oligomers are shown in FIGS. 19A-G. A small
number of charged linkages, e.g. phosphorothioate or, more
preferably, charged phosphoramidate, may also be incorporated into
the oligomers, preferably fewer than one charged linkage per four
uncharged linkages. The uncharged linkages shown in FIG. 19 include
carbonate (19A, R.dbd.O) and carbamate (19A, R.dbd.NH.sub.2)
linkages; alkyl phosphonate and phosphotriester linkages (19B,
R=alkyl or O-alkyl); amide linkages (19C); sulfones (19D, R.sub.1,
R.sub.2.dbd.CH.sub.2); sulfonamides (19D, R.sub.1.dbd.NH,
R.sub.2.dbd.CH.sub.2, or vice versa); sulfamates (19D, R.sub.1,
R.sub.2.dbd.NH); thioformacetyl (19E) and
3'-methylene-N-methylhydroxyamino (19F). Preferred uncharged
antisense oligomer types include alkyl phosphonate-,
phosphotriester-, and phosphoramidate- or phosphorodiamidate-linked
oligonucleotides. In FIGS. 19A-G, B represents a purine or
pyrimidine base-pairing moiety effective to bind, by base-specific
hydrogen bonding, to a base in a polynucleotide, preferably
selected from adenine, cytosine, guanine, thymine and uracil.
Although FIGS. 19A-F depict deoxyribose rings, subunits may also
comprise, for example, substituted ribose rings or morpholino
rings, as described above.
[0238] In a preferred embodiment, the oligomer comprises morpholino
subunits, e.g. as shown in FIG. 1, linked by phosphorodiamidate
linkages, as shown in FIG. 2B. In this case, the charged moiety is
preferably attached at the phosphorus atom of the linkage, via the
side group X, which is typically amino.
[0239] For example, FIG. 20 shows the preparation of a
phosphorodiamidate-linked morpholino oligomer having a modified
amino side chain. PMOs are conveniently synthesized via
5'-activated morpholino subunits having a protected morpholino
nitrogen, as shown, for example, in U.S. Pat. No. 5,185,444. Such
subunits having dialkylamino side chains can be stored at low
temperature for months prior to use (see e.g. Summerton and Weller,
Antisense & Nucleic Acid Drug Dev. 7:187-195, 1997). As
described, for example, in U.S. Pat. No. 5,378,841, which is
incorporated herein by reference, such a subunit having a dimethyl
amino side chain was prepared by reaction of the N-protected
5'-hydroxy morpholino subunit with dimethylamino dichlorophosphate
(POCl.sub.2N(CH.sub.3).sub.2). Such N-substituted phosphoramidic
dichlorides (POCl.sub.2NRR') can be prepared by reaction of the
desired amine; i.e. dimethylamine HCl in this case, with
phosphorous oxychloride.
EXAMPLES
[0240] The following examples are intended to illustrate but not to
limit the invention.
Materials and Methods
Peptide and Morpholino Synthesis
[0241] All peptides were custom synthesized by Global Peptide
Services (Ft. Collins, Colo.) or at AVI BioPharma (Corvallis,
Oreg.) and purified to >90% purity (see Example 2 below). PMOs
were synthesized at AVI BioPharma in accordance with known methods,
as described, for example, in Summerton and Weller, 1993, 1997, and
U.S. Pat. No. 5,185,444.
Cell Culture
[0242] HeLa pLuc/705 (Kang, Cho et al. 1998) is the HeLa S3 cell
line stably transfected with a plasmid carrying the luciferase
coding sequence interrupted by a mutated human .beta.-globin intron
2 (Gene Tools, Philomath, Oreg.). Other cell lines were obtained
from ATCC (Manassas, Va.). All cell lines were cultured in RPMI
1640 supplemented with 2 mM glutamine, 100 .mu.g/ml streptomycin,
100 U/ml penicillin (DME/F12) and 10% of fetal bovine serum (FBS)
(Hyclone, Ogden, Utah). All assays were carried out with
exponentially growing cells in culture media containing 10% fetal
bovine serum (FBS) unless otherwise specified.
Fluorescence Microscopy
[0243] Cells were plated onto a 48-well plate. The next day the
conditioned medium was removed and the test substances in fresh
medium were added to the wells. After incubation, the cells were
washed with phosphate-buffered saline (PBS) three times and
visualized directly in the culture medium with a Nikon Diaphot 300
inverted microscope. Images were captured with an Olympus digital
camera connected to a computer using MagnaFire software (Optronics,
Goleta, Calif.).
Fluorometry
[0244] HeLa pLuc/705 cells plated in a 48 well plate were treated
with medium containing test substance. After incubation, cells were
washed with PBS three times.
[0245] To measure the sum of membrane-bound and internalized
fluorescence, cells were lysed directly in the wells by addition of
100 .mu.l of cell lysis buffer (Promega, Madison, Wis.) to each
well. Cell lysates were collected. The total fluorescence was
determined by mixing 20 .mu.l of cell lysate and 80 .mu.l of 0.1 M
Na.sub.2CO.sub.3 (pH 11) and measuring with an Flx 800 microplate
fluorescence-luminescence reader with excitation at 485 nm and
emission at 524 nm.
[0246] To measure internalized conjugate, the membrane-bound
conjugate was removed by trypsinization, as follows. Trypsin (100
.mu.l, 10%, Hyclone, Logan, Utah) was added to each well and
incubated for 6 minutes at 37.degree. C., followed by addition of
300 .mu.l of culture media. The cells were spun down and washed
with PBS, then lysed with 100 .mu.l cell lysis buffer. The
fluorescence of the cell lysate was measured as described
above.
Flow Cytometry
[0247] To analyze the internalization of fluorescein-labeled
peptide-PMO conjugates by flow cytometry, HeLa pLuc/705 cells in a
48-well plate were treated with medium containing test substance.
After incubation, cells were washed with PBS three times, and 100
.mu.l of trypsin (see above) was added to each well, followed by
incubation for 6 minutes at 37.degree. C., then by addition of 300
.mu.l of culture media. The cells were spun down and washed once
with PBS, then suspended in 500 .mu.l of a buffer containing PBS
with 1% FBS and 0.2% NaN.sub.3. The flow data was collected using a
BD FACSCaliburf cytometer, and data was analyzed using FCS Express
2 (De Novo Software, Thornhill, Ontario, Canada).
Cell-Free Translation Assays
[0248] Plasmids. The coding sequence for firefly luciferase (FLUC)
was subcloned into the multiple cloning site of plasmid pCi-Neo
(Promega) at the Sal I and Not I sites and the resulting plasmid
named pCNlucr. Subsequently, two different nucleotide regions of
the Dengue type 2 virus (DEN2, Genbank accession number AY037116)
were subcloned into the Nhe I and Sal I sites of pCNlucr. This
placed the DEN2 sequences immediately upstream of the start codon
of the FLUC gene. Two different plasmids were constructed:
pCNDEN3'Cslucr, containing DEN2 nucleotides 10606 to 10646, and
pCNDEN5'Cslucr, containing DEN2 nucleotides 119 to 161. PMOs
targeting these regions (DEN3'CS and DEN5'CS) are listed in Table 1
as SEQ ID NOS: 7 and 6, respectively.
[0249] A similar construct using a portion of the murine hepatitis
virus (MHV) genome was constructed in the same vector (pCNlucr) by
inserting nucleotides 188 to 230 of MHV (Genbank accession number
AF029248) into the NheI and SalI sites of pCNlucr. This fragment of
MHV contains nucleotides -22 to +21 relative to the "A" of the AUG
of the MHV Orf 1a gene and generates a fusion protein with the
luciferase reporter gene. The PMO that targets this region is SEQ
ID NO: 9.
[0250] A fourth plasmid construct (pDCLD) was made using a
pUC-derived vector that placed a larger portion of the DEN2
sequence (GenBank accession number U87411, nucleotides 1 to
204),containing the 5' end of the DEN2 polyprotein coding sequence,
immediately upstream and in frame with the fLUC gene. A PMO that
targets this region (DEN AUG) is listed as SEQ ID NO: 8 in Table 1.
The DEN AUG PMO targets the DEN2 polyprotein start codon and its
target is highlighted in FIG. 29 (nucleotides 87-106).
[0251] A fifth plasmid construct was created with a 30 base pair
region surrounding the ATG start codon of human c-myc gene
(5'-AGCCTCCCGCGACGATGCCCCTCAACGTTA-3', SEQ ID NO: 42, Genbank
accession number V00568) subcloned into the Nhe I and Sal I sites
of pCNlucr and named pCNmycluc. This placed the c-myc coding
sequences in frame with the amino acid coding sequences of the fLUC
gene (c-myc:fLUC). A PMO targeting this region of c-myc, designated
AVI-4126, is listed as SEQ ID NO: 5.
[0252] Transcription and translation. All of the above-described
plasmids include the T7 RNA polymerase promoter upstream of the
viral:fLUC sequences and allow RNA to be produced from these
plasmids, after linearization with either NotI or SnaBI, using the
T7 polymerase-based Megascript kit and protocol (Ambion).
[0253] In vitro translations were carried out using transcribed
RNA, at a final concentration in each reaction of 1 nM, with 12
.mu.l nuclease-treated rabbit reticulocyte lysate (Promega) in
addition to PMO, R.sub.9F.sub.2--PMO, or water. Translation
reaction mixture (10 .mu.l) was then mixed with 50 .mu.l luciferase
assay reagent (Promega) according to manufacturer's instructions,
and light emission was read on a FLx800 microplate luminometer
(BIO-TEC Instruments). Reactions were assayed for relative light
units with the KC Junior program (BIO-TEC) using the luminescence
function and a sensitivity setting of 125. In the experiments
described herein, twelve reactions were assayed at one time,
including water-control reactions in the first and last well of
each row. The relative light units (RLU) produced by each reaction
was normalized to the mean of all control reactions and expressed
either as percent inhibition of luciferase expression or relative
light units as a function of PMO concentration, as described in
Example 8.
Protease Digestion of Peptide-PMO Conjugates
[0254] Experiments to measure the resistance of peptide-PMO
conjugates to protease digestion were performed as follows.
Proteinase K(10 units) was placed in 0.1 ml of 50 mM Tris-HCl (pH
7.2), 5 mM CaCl.sub.2 buffer and 40 .mu.g of peptide-PMO
(R.sub.9F.sub.2C-705) conjugate (SEQ ID NO:13-C-SEQ ID NO:1) was
added. After either 5 minutes or 2 hours at 37 degrees C., samples
were frozen on dry ice until analysis by MALDI TOF mass
spectroscopy.
Example 1
3'-Fluoresceination of a PMO
[0255] A protected and activated carboxyfluorescein, e.g.
6-carboxyfluorescein dipivalate N-hydroxysuccinimide ester,
commercially available from Berry & Associates, Inc. (Dexter,
Mich.), was dissolved in NMP (0.05M), and the solution was added to
a PMO synthesis column (see "Morpholino synthesis", above) in
sufficient volume to cover the resin. The mixture was incubated at
45.degree. C. for 20 minutes, then the column was drained and a
second similar portion of protected and activated
carboxyfluorescein was added to the column and incubated at
45.degree. C. for 60 minutes. The column was drained and washed
with NMP, and the oligomer was cleaved from the resin using 1 ml of
cleavage solution (0.1M dithiothreitol in NMP containing 10%
triethylamine). The resin was washed with 300 .mu.l of cleavage
solution three times, immediately followed by addition of 4 ml of
concentrated ammonia hydroxide and 16 hours incubation at
45.degree. C. to remove base protecting groups. The morpholino
oligomer was precipitated by adding 8 volumes of acetone, the
mixture was centrifuged, and the pellet was washed with 15 ml of
CH.sub.3CN. The washed pellet was re-dissolved in 4 ml of H.sub.2O
and lyophilized. The product was analyzed by time-of-flight MALDI
mass spectrometry (MALDI-TOF) and high pressure liquid
chromatography (HPLC).
Example 2
Peptide synthesis and Attachment of Transport Peptide
[0256] Peptides were synthesized by Fmoc Solid Phase Peptide
Synthesis, referred to herein as SPPS. A p-benzyloxybenzyl alcohol
resin was used for synthesis of peptides with a C-terminal acid,
while a Rink Amide MBHA resin was used for peptide amides. Both
resins are available from Novabiochem (San Diego, Calif.). A
typical synthesis cycle began with N-terminal deprotection via 20%
piperidine. Then, N-.alpha.-Fmoc-protected amino acids were coupled
to the growing peptide chain by activation with
2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium
hexafluorophosphate (HBTU) in the presence of N,N-diisopropyl
ethylamine (DIEA). Arginine side chains were protected with the
2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl (Pbf) protecting
group, cysteine with trityl, and lysine side chains with
t-butoxycarbonyl (Boc). The cycle was repeated until all of the
amino acids were added, in a carboxy-to-amino direction, in the
desired sequence. Cleavage from the synthesis resin and side chain
deprotection were carried out simultaneously by treating the
peptidyl-resin with a solution of 2.5% H.sub.2O, 2.5% triisopropyl
silane (TIS), and 95% trifluoroacetic acid (TFA). For peptides
containing a cysteine residue, 2.5% 1,2-ethanedithiol (EDT) was
added to the cleavage cocktail. Crude peptides were isolated by
precipitation using a tenfold excess of diethyl ether.
[0257] Strong cation exchange HPLC utilizing Source 15S resin
(Amersham Biosciences, Piscataway, N.J.) was used for purification,
followed by a reversed phase desalt employing Amberchrom 300M resin
(Tosoh Bioscience, Montgomeryville, Pa.). Desalted peptides were
lyophilized and analyzed for identity and purity by MALDI-TOF MS,
strong cation exchange (SCX) HPLC, and capillary electrophoresis
(CE).
[0258] Peptides containing various C-terminal hydrophobic linkages
were prepared as follows. Peptides were prepared for direct
condensation with an amine or hydroxy group of the PMO by including
combinations of natural and/or non-natural amino acids at the
C-terminal end of the peptide during SPPS. Specifically, the
linkages were comprised of the amino acids glycine, beta-alanine,
and/or 6-aminohexanoic acid, used in different combinations of one
or two residues. Peptide synthesis was otherwise identical to the
synthesis of other peptide acids.
[0259] Peptide sequences that contain amine side chains, such as
rTat and pTat (Table 1), were prepared using the
1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)ethyl (Dde) amine side
chain protecting group. Lysine Dde groups survived the resin
cleavage and deprotection of other amino acid side chain protecting
groups. The side chain amines remain masked by Dde through
conjugation with the PMO and are subsequently deprotected by
treatment with 2% hydrazine in DMF.
[0260] The 5' attachment of a transport peptide via an amide bond
was performed as follows. A C-terminally reactive
peptide-benzotriazolyl ester was prepared by dissolving the
peptide-acid (15 .mu.mol), HBTU (14.25 .mu.mol), and HOBt (15
.mu.mol) in 200 .mu.l NMP and adding DIEA (22.5 .mu.mol).
Immediately after addition of DIEA, the peptide solution was added
to 1 ml of a 12 mM solution of 5'-piperazine-functionalized,
3'-acetyl-PMO in DMSO. After 180 minutes at 30.degree. C., the
reaction was diluted with a four-fold excess of water. The crude
conjugate was purified first through a CM-Sepharose weak cation
exchange column (Sigma, St. Louis, Mo.), to remove unconjugated
PMO, and then through a reversed phase column (HLB column, Waters,
Milford, Mass.). The conjugate was lyophilized and analyzed by
MALDI-TOF MS, SCX HPLC, and CE.
Example 3
3'-Acetylation of PMO and 5' Attachment of Transport Peptide
[0261] Acetic anhydride (0.1 M), dissolved in
N-methyl-2-pyrrolidinone (NMP) containing 1% N-ethyl morpholine
(v/v), was added to a PMO synthesis product while the oligomer was
still attached to the synthesis resin. After 90 minutes at room
temperature, the oligomer was washed with NMP, cleaved from the
synthesis resin, and worked up as described above. The product was
analyzed by MALDI-TOF mass spectrometry (MALDI-TOF) and HPLC. The
desired product included a 3'-acetyl group and was capped at the
5'-end with piperazine, which was used for conjugation, as
described below and shown in FIG. 4A.
[0262] The linker reagent,
N-(.gamma.-maleimidobutyryloxy)succinimide ester (GMBS), was
dissolved in 50 .mu.l of DMSO, and the solution was added to the
oligomer (2-5 mM) in sodium phosphate buffer (50 mM, pH 7.2) at a
1:2 PMO/GMBS molar ratio. The mixture was stirred at room
temperature in the dark for 30 minutes, and the product was
precipitated using a 30-fold excess of acetone, then redissolved in
water. The PMO-GMBS adduct was lyophilized and analyzed by
MALDI-TOF and HPLC. The adduct was then dissolved in phosphate
buffer (50 mM, pH 6.5, 5 mM EDTA) containing 20% CH.sub.3CN, and
the transport peptide was added, at a 2:1 peptide to PMO molar
ratio (based on a PMO concentration as determined by its absorbance
at 260 nm). The reaction was stirred at room temperature in the
dark for 2 hours. The conjugate was purified first through a
CM-Sepharose (Sigma, St. Louis, Mo.) cationic exchange column, to
remove unconjugated PMO, then through a reverse phase column (HLB
column, Waters, Milford, Mass.). The conjugate was lyophilized and
analyzed by MALDI-TOF and capillary electrophoresis (CE). The final
product contained about 70% material corresponding to the full
length PMO conjugated to the transport peptide, with the balance
composed of shorter sequence conjugates, a small amount of
unconjugated PMO, both full length and fragments, and a very small
amount (about 2%) of unconjugated peptide. The concentration
determination used for all experiments was based on the total
absorbance at 260 nm, including all shorter PMO sequences in the
sample.
Example 4
3'-Attachment of Transport Peptide
[0263] A PMO having a free secondary amine (ring nitrogen of
morpholine) at the 3'-end (see FIG. 4B) was dissolved in 100 mM
sodium phosphate buffer, pH 7.2, to make a 2-5 mM solution. The
linking reagent, GMBS, was dissolved in 100 .mu.l of DMSO and added
to the PMO solution at a PMO/GMBS ratio of 1:2. The mixture was
stirred at room temperature in the dark for 30 min, then passed
through a P2 (Biorad) gel filtration column to remove the excess
GMBS and reaction by-products.
[0264] The GMBS-PMO adduct was lyophilized and re-dissolved in 50
mM phosphate buffer, pH 6.5, to make a 2-5 mM solution. A transport
peptide, represented by T-SH in FIG. 4B, was added to the GMBS-PMO
solution at a molar ratio of 2:1 peptide to PMO. (The thiol-SH is
the side chain of a single cysteine residue.) The reaction mixture
was stirred at room temperature for 2 hours or at 4.degree. C.
overnight. The conjugate was purified by passing through
Excellulose gel filtration column (Pierce Chemical) to remove
excess peptide, then through a cation exchange CM-Sepharose column
(Sigma) to remove unconjugated PMO, and finally through an
Amberchrom reverse phase column (Rohm and Haas) to remove salt. The
conjugate was lyophilized and characterized by MS and HPLC.
Example 5
Preparation of a PMO-Peptide Conjugate Having a Cleavable
Linker
[0265] The procedure of Example 3 or Example 4 is repeated,
employing N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) or
succinimidyloxycarbonyl .alpha.-methyl-.alpha.-(2-pyridyldithio)
toluene (SMPT) as linking reagent (see FIG. 4C), in place of
GMBS.
Example 6
Uptake of Labeled PMO-Peptide Conjugates
[0266] HeLa cells were stably transfected with plasmid pLuc/705,
which has a luciferase gene interrupted by a human .beta.-globin
intron mutated at nucleotide 705, thus causing incorrect splicing
(Kang et al., 1998; Kole et al., 2001; Yan et al., 2002). Because
the mis-spliced transcripts do not produce functional reporter
proteins, no reporter signals are observed unless wild-type
splicing is induced with a splice-correcting oligomer. An antisense
oligomer targeting the 705 splice site (having SEQ ID NO: 1, also
designated "PMO 705"), when delivered effectively, corrects
splicing and allows luciferase expression.
[0267] This assay measures the ability of steric blocking oligomers
to enter cells and nuclei, block incorrect splicing of pre-mRNA,
and thus cause expression of a reporter gene. It avoids the
confusion of cytotoxicity with activity that can affect
down-regulation assays, as cells must be able to carry out RNA
processing and translation to produce a signal. Because oligomers
must enter cells and cell nuclei to produce a signal in the assay,
it is very useful for measuring uptake and effectiveness of
delivery moieties. In addition, because no or very little signal is
present before splice correction, the assay has a favorable
signal-to-noise ratios. These unambiguously positive readouts allow
convenient quantitative comparisons between the effects of
different transporters on oligomer delivery (Moulton et al., 2003,
Astriab-Fisher et al., 2002).
[0268] The time course of the uptake of various
transporter-PMO-fluorescein conjugates, as described above, in HeLa
pLuc/705 cells was studied by fluorescence spectroscopy.
Experiments were generally run in triplicate. According to the
general procedure, culture medium containing the test substance at
a specified concentration was added to HeLa pLuc/705 cells plated
in a 48-well plate. After incubation, at each time point, the cells
were washed with PBS three times, and the cell lysate was collected
as described under "Fluorometry", above. The amount of functional
luciferase produced was determined by mixing 30 .mu.l of cell
lysate and 50 .mu.l of Luciferase Assay Reagent (LAR) (Promega,
Wis.) and measuring the light production using a Flx 800 microplate
fluorescence/luminescence reader (Bio-tek, Vermont). The relative
light units were normalized to .mu.g of protein determined by the
bicinchoninic acid (BCA) method, following the manufacturer's
procedure (Pierce, Ill.).
Example 7
Preparation of PMO Having Modified Intersubunit Linkages
[0269] A. Preparation of
Cl.sub.2P(O)NH--(CH.sub.2).sub.n--NH--C(.dbd.NH --NH.sub.2
[0270] A suspension containing 0.1 mole of RNH.sub.2.HCl, where
R.dbd.--(CH.sub.2).sub.n--NH--C(.dbd.NH)--NH.sub.2 (e.g.
2-aminoethylguanidine hydrochloride, where n=2), in 0.2 mol of
phosphorous oxychloride (POCl.sub.3) is refluxed for 12 hours and
then distilled under reduced pressure to give the N-substituted
dichlorophosphoramide.
[0271] B. Preparation of Activated Morpholino Subunit
[0272] One mmol of a 5'-hydroxyl subunit, base-protected and
tritylated on the morpholino nitrogen (Structure 1, FIG. 20),
prepared by standard methods (see e.g. U.S. Pat. No. 5,378,841) is
dissolved in 5 ml of dichloromethane. Six mmol of N-ethylmorpholine
and 2 mmol of
Cl.sub.2P(O)NH--(CH.sub.2).sub.n--NH--C(.dbd.NH)--NH.sub.2,
prepared as described above, are added, followed by 0.5 mmol
N-methylimidazole. When the reaction is complete as assessed by
thin layer chromatography, the reaction mixture is washed with
aqueous NaH.sub.2PO.sub.4 and concentrated. The residue is
fractionated on a silica gel column, eluting with 1:4
acetone/chloroform, to give the activated subunit (Structure 2,
FIG. 20).
[0273] C. Oligomerization
[0274] The activated monomer 2 is reacted with a 5'-O-support-bound
subunit to give the support-bound dimer 3. The dimer is
detritylated and reacted in a similar manner with further activated
subunits prepared in the manner described above.
Example 8
Peptide Conjugated PMOs Exhibit Enhanced Steric Blocking Properties
in Cell-free Translation Reactions Compared to Unconjugated PMO
[0275] To investigate antisense activity of conjugates in a manner
independent of cellular transport, peptide conjugated and
unconjugated PMO were tested in a cell free translation system for
their ability to sterically block translation of a downstream
reporter gene.
[0276] The effect of various antisense PMOs and PMO peptide
conjugates on cell free in vitro translation of RNA, transcribed in
vitro from plasmids containing various viral nucleotide sequences
fused directly upstream of the coding region for firefly luciferase
(fLUC), was measured in a rabbit reticulocyte lysate (RRL) system.
As shown in FIGS. 21-23, conjugation of R.sub.9F.sub.2 (SEQ ID NO:
13) to PMOs increased effectiveness of the antisense PMOs by
between 10-500 fold, based on the concentration required to achieve
50% inhibition of target expression. FIGS. 21-23 represent the
results of these analyses using three different regions of the
Dengue type 2 virus fused to the FLUC gene, as described above
under Materials and Methods. The region of Dengue viral RNA genome
used in the pDCLD construct is known to have a extensive secondary
structure (Khromykh, Kondratieva et al. 2003), as shown in FIG.
29.
[0277] A plasmid construct with a 30 base pair region surrounding
the ATG start codon of the human c-myc gene was placed in frame
with the amino acid coding sequences of the FLUC gene (c-myc:fLUC).
A PMO targeting this region of c-myc, AVI-4126, is listed as SEQ ID
NO: 5. FIG. 28 shows the enhanced antisense effect that conjugation
of the (RAhxR).sub.4 peptide conveys to the c-myc PMO in the in
vitro RRL translation system.
[0278] Results were also obtained targeting a sequence of MHV that
surrounds the start codon of the 1ab gene (Neuman, B. W. et al., J.
Virol. (2004), in press). In all the above described cases,
R.sub.9F.sub.2 conjugation enhanced the antisense effectiveness of
the PMO compared to unconjugated PMO by as much as 500 fold.
Example 9
Transport Peptides that Contain Non-natural Amino Acids Show
Enhanced Delivery into Cells, Enhanced Antisense Activity and
Resistance to Enzymatic Proteolysis
[0279] Cellular uptake and antisense activity was investigated,
using the 705 splice correction assay described in Example 6, for
several conjugates of the invention comprising PMOs conjugated to
peptides containing dimers of cationic amino acids alternating with
6-aminohexonic acid (Ahx). The data are shown in FIG. 24 for a
variety of such conjugates employing Ahx-containing transport
peptides (SEQ ID NOs: 33-35 and 37-41). FIG. 24 shows the level of
luciferase production in HeLa pLuc/705 cells after 24 hours
treatment with each of the following: the PMO (705-FL, SEQ ID NO:
1) conjugated to R.sub.9F.sub.2 (SEQ ID NO:13), (RRAhx).sub.4 (SEQ
ID NO:33), (RAhxR).sub.4 (SEQ ID NO:34), (AhxRR).sub.4 (SEQ ID
NO:35), (RAhxR).sub.3 (SEQ ID NO:37), (RahxR).sub.2R (SEQ ID
NO:38), (RAhxR).sub.2 (SEQ ID NO:39), (RKAhx).sub.4 (SEQ ID NO:40),
or (RHAhx).sub.4 (SEQ ID NO:41). It was observed that
Ahx-containing transport peptides having at least eight arginine
residues performed as well or better than R.sub.9F.sub.2 in this
assay.
[0280] The protease sensitivity of the transport peptides was also
investigated, as follows. Each of the peptide-PMO conjugates
R.sub.9F.sub.2-705-FL (SEQ ID NO: 13) and (RAhxR).sub.4-705-FL (SEQ
ID NO:34) was mixed with Proteinase K in 100 .mu.l of 50 mM Tris 5
mM CaCl.sub.2buffer. The sample was incubated at 37.degree. C. for
5 minutes or, in a separate analysis, 2 hours, then placed onto dry
ice until analysis by MALDI-TOF mass spectroscopy. The results are
shown in FIGS. 25 and 26, respectively.
[0281] FIG. 25 shows that the transport peptide containing all
natural amino acids, R.sub.9F.sub.2--C (SEQ ID NO.:43) (MW peak at
8331), was not resistant to proteinase K degradation, as it rapidly
converted to the peptide-free PMO (MW peak at 6632). The
R.sub.9F.sub.2--C-PMO (SEQ ID NO.:43) conjugate was also sensitive
to degradation by trypsin (data not shown). FIG. 26 shows that the
transport peptide containing Ahx, (RAhxR).sub.4 (SEQ ID NO.:43) (MW
peak at 8332), was resistant to proteinase K degradation.
Example 10
Distribution and Bioavailability In Vivo of Peptide Conjugated PMO
Compared to Unconjugated PMO
[0282] Tissue culture results from a variety of experimental
systems clearly demonstrate that the transport peptides described
in the present invention enhance delivery to intracellular
compartments including the cytoplasm and nucleus. To extend these
observations to an in vivo system, a comparative analysis of PMO
and peptide conjugated PMO uptake in spleen and lymph node cells
was performed in mice.
[0283] Nine month old female Y10A mice (F1 of B10.A and A.B1; two
mice per treatment) were injected intravenously (tail vein) with
0.5 ml of PBS containing 150 ug of a 3'-fluoresceinated PMO
(scrambled sequence DSscr, 5'-AGT CTC GAC TTG CTA CCT CA-3'-FL; SEQ
ID NO: 10) or the same PMO conjugated to R.sub.5F.sub.2R.sub.4 (SEQ
ID NO:20) through a cysteine linker at the 5' terminus
(R.sub.5F.sub.2R.sub.4--C-DSscr-FL). After 24 hours the mice were
sacrificed, the spleens and four lymph nodes from each mouse were
taken, and single cell suspensions were prepared and analyzed
unstained for fluorescence by flow cytometry. The cells were gated
for lymphocytes by forward/side scatter.
[0284] FIG. 27 shows that cells from both the spleens and lymph
nodes had substantially higher uptake of the peptide conjugated PMO
(R.sub.5F.sub.2R.sub.4--PMO-FL) as compared to unconjugated PMO
(PMO-FL). In addition, splenocytes were stained for different
subpopulations of lymphocytes by specific cell surface markers (CD4
and CD8 for lymphocytes, CD19 for B-cells and CD11b for
monocytes/macrophages). Flow cytometric analysis of the stained
lymphocytes for fluorescence of the fluorescein-labeled PMO was
performed. All these subpopulations demonstrated enhanced uptake of
the peptide conjugated PMO compared to unconjugated PMO, as shown
in FIG. 27.
[0285] The effect of multiple injections of peptide conjugated PMO
on the relative uptake and residence time in vivo was analyzed as
follows. Nine month old, female Y10A mice (n=3) were injected
intravenously (tail vein) with 150 .mu.g
R.sub.5F.sub.2R.sub.4--C-DSscr-FL on days 0, 3, 5, and 7. At 11
days post injection, mice were sacrificed and single cell
suspensions prepared from the spleens and four lymph nodes of each
mouse. Unstained flow cytometric analysis of both cell preparations
were performed as described above. A substantial percentage of both
splenocytes (6.6%.+-.2.6) and lymphocytes (4.3%+0.7) were positive
for R.sub.5F.sub.2R.sub.4--C-DSscr-FL uptake.
TABLE-US-00003 SEQUENCE LISTING TABLE Designation Sequence (5' to
3' or N-terminal to C-terminal) SEQ ID NO: 705 5'- CCT CTT ACC TCA
GTT ACA-acetyl-3' 1 705-FL 5'- CCT CTT ACC TCA GTT
ACA-fluorescein-3' 1 705.sub.2MM 5'- CCT CTT AAC TCC GTT
ACA-acetyl-3' 2 705.sub.4MM 5'- CCT ATT AAC TCC GTT CCA-acetyl-3' 3
705.sub.SCR 5'- CTC TCT CAC CAT TGA CAT-acetyl-3' 4 c-myc 5'- ACG
TTG AGG GGC ATC GTC GC-acetyl-3' 5 DENS'CS 5'- CGT TTC AGC ATA TTG
AAA GG-3' 6 DEN3'CS 5'- CCC AGC GTC AAT ATG CTG-3' 7 DEN AUG 5'-
GGT TAT TCA TCA GAG ATC TG-3' 8 MHV lab 5'- GCC CAT CTT TGC CAT TAT
GC-3' 9 DSscr 5'-AGT CTC GAC TTG CTA CCT CA-3' 10 pTat CYGRKKRRQRRR
11 rTat RRRQRRKKR 12 R.sub.9F.sub.2 RRRRRRRRRFF 13
2d-R.sub.9F.sub.2 .sub.DR.sub.DRRRRRRRRFF (mixed isomer) 14
D-R.sub.9F.sub.2
.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DR.sub.DF.su-
b.DF.sub.D (D-isomer) 15 R.sub.9CF.sub.2 RRRRRRRRRCFF 16
R.sub.8CF.sub.2R RRRRRRRRCFFR 17 R.sub.6CF.sub.2R.sub.3
RRRRRRCFFRRR 18 R.sub.5FCFR.sub.4 RRRRRFCFRRRR 19
R.sub.5F.sub.2R.sub.4 RRRRRFFRRRR 20 R.sub.4CF.sub.2R.sub.5
RRRRCFFRRRRR 21 R.sub.2CF.sub.2R.sub.7 RRCFFRRRRRRR 22
CF.sub.2R.sub.9 CFFRRRRRRRRR 23 CR.sub.9F.sub.2 CRRRRRRRRRFF 24
F.sub.2R.sub.9 FFRRRRRRRRR 25 R.sub.5F.sub.2CF.sub.2R.sub.4
RRRRRFFCFFRRRR 26 R.sub.9I.sub.2 RRRRRRRRRII 27 R.sub.8F.sub.3
RRRRRRRRFFF 28 R.sub.9F.sub.4 RRRRRRRRRFFFF 29 R.sub.8F.sub.2
RRRRRRRRFF 30 R.sub.6F.sub.2 RRRRRRFF 31 R.sub.5F.sub.2 RRRRRFF 32
(RRAhx).sub.4 RRAhxRRAhxRRAhxRRAhx 33 (RAhxR).sub.4
RAhxRRAhxRRAhxRRAhxR 34 (AhxRR).sub.4 AhxRRAhxRRAhxRRAhxRR 35
(RAhx).sub.6 RAhxRAhxRAhxRAhxRAhxRAhx 36 (RAhxR).sub.3
RAhxRRAhxRRAhxR 37 (RAhxR).sub.2R RAhxRRAhxRR 38 (RAhxR).sub.2
RAhxRRAhxR 39 (RKAhx).sub.4 RKAhxRKAhxRKAhxRKAhx 40 (RHAhx).sub.4
RHAhxRHAhxRHAhxRHAhx 41 human c-myc AGCCTCCCGCGACGATGCCCCTCAACGTTA
42 ATG region
Sequence CWU 1
1
44118DNAArtificialsynthetic oligomer 1cctcttacct cagttaca
18218DNAArtificialsynthetic oligomer 2cctcttaact ccgttaca
18318DNAArtificialsynthetic oligomer 3cctattaact ccgttcca
18418DNAArtificialsynthetic oligomer 4ctctctcacc attgacat
18520DNAArtificialsynthetic oligomer 5acgttgaggg gcatcgtcgc
20620DNAArtificialsynthetic oligomer 6cgtttcagca tattgaaagg
20718DNAArtificialsynthetic oligomer 7cccagcgtca atatgctg
18820DNAArtificialsynthetic oligomer 8ggttattcat cagagatctg
20920DNAArtificialsynthetic oligomer 9gcccatcttt gccattatgc
201020DNAArtificialsynthetic oligomer 10agtctcgact tgctacctca
201112PRTArtificialsynthetic tranport peptide 11Cys Tyr Gly Arg Lys
Lys Arg Arg Gln Arg Arg Arg1 5 10129PRTArtificialsynthetic
transport peptide 12Arg Arg Arg Gln Arg Arg Lys Lys Arg1
51311PRTArtificialsynthetic transport peptide 13Arg Arg Arg Arg Arg
Arg Arg Arg Arg Phe Phe1 5 101413PRTArtificialsynthetic transport
peptide 14Asp Arg Asp Arg Arg Arg Arg Arg Arg Arg Arg Phe Phe1 5
101523PRTArtificialsynthetic transport peptide 15Asp Arg Asp Arg
Asp Arg Asp Arg Asp Arg Asp Arg Asp Arg Asp Arg1 5 10 15Asp Arg Asp
Phe Asp Phe Asp 201612PRTArtificialsynthetic transport peptide
16Arg Arg Arg Arg Arg Arg Arg Arg Arg Cys Phe Phe1 5
101712PRTArtificialsynthetic transport peptide 17Arg Arg Arg Arg
Arg Arg Arg Arg Cys Phe Phe Arg1 5 101812PRTArtificialsynthetic
transport peptide 18Arg Arg Arg Arg Arg Arg Cys Phe Phe Arg Arg
Arg1 5 101912PRTArtificialsynthetic transport peptide 19Arg Arg Arg
Arg Arg Phe Cys Phe Arg Arg Arg Arg1 5 102011PRTArtificialsynthetic
transport peptide 20Arg Arg Arg Arg Arg Phe Phe Arg Arg Arg Arg1 5
102112PRTArtificialsynthetic transport peptide 21Arg Arg Arg Arg
Cys Phe Phe Arg Arg Arg Arg Arg1 5 102212PRTArtificialsynthetic
transport peptide 22Arg Arg Cys Phe Phe Arg Arg Arg Arg Arg Arg
Arg1 5 102312PRTArtificialsynthetic transport peptide 23Cys Phe Phe
Arg Arg Arg Arg Arg Arg Arg Arg Arg1 5 102412PRTArtificialsynthetic
transport peptide 24Cys Arg Arg Arg Arg Arg Arg Arg Arg Arg Phe
Phe1 5 102511PRTArtificialsynthetic transport peptide 25Phe Phe Arg
Arg Arg Arg Arg Arg Arg Arg Arg1 5 102614PRTArtificialsynthetic
transport peptide 26Arg Arg Arg Arg Arg Phe Phe Cys Phe Phe Arg Arg
Arg Arg1 5 102711PRTArtificialsynthetic transport peptide 27Arg Arg
Arg Arg Arg Arg Arg Arg Arg Ile Ile1 5 102811PRTArtificialsynthetic
transport peptide 28Arg Arg Arg Arg Arg Arg Arg Arg Phe Phe Phe1 5
102913PRTArtificialsynthetic transport peptide 29Arg Arg Arg Arg
Arg Arg Arg Arg Arg Phe Phe Phe Phe1 5 103010PRTArtificialsynthetic
transport peptide 30Arg Arg Arg Arg Arg Arg Arg Arg Phe Phe1 5
10318PRTArtificialsynthetic transport peptide 31Arg Arg Arg Arg Arg
Arg Phe Phe1 5327PRTArtificialsynthetic transport peptide 32Arg Arg
Arg Arg Arg Phe Phe1 53312PRTArtificialsynthetic transport peptide
33Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa1 5
103412PRTArtificialsynthetic transport peptide 34Arg Xaa Arg Arg
Xaa Arg Arg Xaa Arg Arg Xaa Arg1 5 103512PRTArtificialsynthetic
transport peptide 35Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg
Arg1 5 103612PRTArtificialsynthetic transport peptide 36Arg Xaa Arg
Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa1 5 10379PRTArtificialsynthetic
transport peptide 37Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg1
5387PRTArtificialsynthetic transport protein 38Arg Xaa Arg Arg Xaa
Arg Arg1 5396PRTArtificialsynthetic transport peptide 39Arg Xaa Arg
Arg Xaa Arg1 54012PRTArtificialsynthetic transport peptide 40Arg
Lys Xaa Arg Lys Xaa Arg Lys Xaa Arg Lys Xaa1 5
104112PRTArtificialsynthetic transport peptide 41Arg His Xaa Arg
His Xaa Arg His Xaa Arg His Xaa1 5 10429PRTArtificialsynthetic
transport peptide 42Arg Lys Lys Arg Arg Gln Arg Arg Arg1
54312PRTArtificialsynthetic transport peptide 43Arg Arg Arg Arg Arg
Arg Arg Arg Arg Phe Phe Cys1 5 104414PRTArtificialsynthetic
transport peptide 44Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg
Xaa Ala1 5 10
* * * * *