U.S. patent application number 11/859059 was filed with the patent office on 2009-03-26 for methods for using mutant rna polymerases wtih reduced discrimination between non-canonical nucleoside triphosphates.
This patent application is currently assigned to Wisconsin Alumni Research Foundation. Invention is credited to Jerome J. Jendrisak, Rui Sousa.
Application Number | 20090081736 11/859059 |
Document ID | / |
Family ID | 24865724 |
Filed Date | 2009-03-26 |
United States Patent
Application |
20090081736 |
Kind Code |
A1 |
Sousa; Rui ; et al. |
March 26, 2009 |
Methods For Using Mutant RNA Polymerases Wtih Reduced
Discrimination Between Non-Canonical Nucleoside Triphosphates
Abstract
A method for synthesizing a nucleic acid molecule comprising at
least one non-canonical nucleoside triphosphate using a mutant
polymerase having a reduced discrimination between canonical and
non-canonical substrates is disclosed. The method comprises
incubating a template nucleic acid in a reaction mixture comprising
the mutant nucleic acid polymerase and the appropriate canonical
and non-canonical nucleoside triphosphates which are desired
substrates for the mutant nucleic acid polymerase. The present
invention is also a method of determining the sequence of a nucleic
acid molecule using the mutant polymerase to create a nucleic acid
molecule comprising at least one non-canonical nucleoside
triphosphate.
Inventors: |
Sousa; Rui; (San Antonia,
TX) ; Jendrisak; Jerome J.; (Madison, WI) |
Correspondence
Address: |
QUARLES & BRADY LLP
411 E. WISCONSIN AVENUE, SUITE 2040
MILWAUKEE
WI
53202-4497
US
|
Assignee: |
Wisconsin Alumni Research
Foundation
Madison
WI
|
Family ID: |
24865724 |
Appl. No.: |
11/859059 |
Filed: |
September 21, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10404726 |
Apr 1, 2003 |
7291487 |
|
|
11859059 |
|
|
|
|
Current U.S.
Class: |
435/91.1 |
Current CPC
Class: |
C12Q 2531/143 20130101;
C12Q 2521/119 20130101; C12Q 2525/121 20130101; C12Q 2525/121
20130101; C12Q 2525/121 20130101; C12Q 1/6869 20130101; C12Q 1/6869
20130101; C12Q 1/6806 20130101; C12P 19/34 20130101; C12N 9/1247
20130101; C12Q 1/6869 20130101; C12Q 1/6865 20130101; C12Q 1/6806
20130101; C12Q 1/6869 20130101; C12Q 1/6865 20130101; C12Q 2531/143
20130101; C12Q 1/6869 20130101; C12Q 2531/143 20130101; C12Q
2521/119 20130101; C12Q 2521/119 20130101; C12Q 2521/119 20130101;
C12Q 2531/143 20130101; C12Q 2521/119 20130101; C12Q 2531/143
20130101 |
Class at
Publication: |
435/91.1 |
International
Class: |
C12P 19/34 20060101
C12P019/34 |
Claims
1. A method for synthesizing a nucleic acid molecule comprising at
least one non-canonical nucleotide, comprising the steps of: a)
incubating a template nucleic acid in a reaction mixture under
nucleic acid synthesis conditions containing (i) a mutant RNA
polymerase exhibiting an amino acid selected from the group
consisting of phenylalanine, methionine and leucine in place of
tyrosine (Y) in the conserved wild-type motif having a consensus
sequence consisting of . . . K-(7 amino acids)-YG . . . wherein the
mutant RNA polymerase has a reduced discrimination between
canonical and non-canonical nucleoside triphosphates, and (ii) at
least one non-canonical nucleoside triphosphate, and b) obtaining
the synthesis of a nucleic acid molecule comprising at least one
non-canonical nucleotide.
2. The method of claim 1 wherein the template nucleic acid is
DNA.
3. The method of claim 1 wherein the template nucleic acid is
RNA.
4. The method of claim 1 wherein the nucleic acid molecule
comprising the at least one non-canonical nucleotide is synthesized
by extension of a primer molecule, at least part of which is
sufficiently complementary to a portion of the template to
hybridize therewith.
5. The method of claim 1 wherein the nucleic acid molecule
comprising the at least one non-canonical nucleotide is synthesized
de novo without using a primer molecule.
6. The method of claim 1 wherein the at least one non-canonical
nucleoside triphosphate is selected from the group consisting of a
2'-deoxy nucleoside triphosphate, a 2',3'-dideoxy nucleoside
triphosphate and a nucleoside triphosphate that has a fluorine or
an amino group on the 2'-position of the sugar.
7. The method of claim 1 wherein the synthesized nucleic acid
molecule is selected from the group consisting of a ribozyme, a
nucleic acid molecule for gene therapy, a nucleic acid molecule for
use in a vaccine, a nucleic acid molecule for use as an antiviral,
a nucleic acid molecule for use as an antimicrobial, a nucleic acid
molecule for use as an antisense composition for regulating gene
expression, a nucleic acid molecule for use in a composition for
hybridization to a complementary nucleic acid and a nucleic acid
molecule for use as primer or a probe for detection of a
complementary nucleic acid.
8. The method of claim 1 wherein the synthesized nucleic acid
molecule is single-stranded.
9. The method of claim 1 wherein the method is part of an
amplification reaction selected from the group consisting of NASBA,
3SR and TMA.
10. A kit for performing the method of claim 1 comprising: (i) the
mutant RNA polymerase exhibiting an amino acid selected from the
group consisting of phenylalanine, methionine, and leucine in place
of tyrosine (Y) in the conserved wild-type motif having a consensus
sequence consisting of . . . K-(7 amino acids)-YG . . . wherein the
mutant RNA polymerase has a reduced discrimination between
canonical and non-canonical nucleoside triphosphate substrates; and
(ii) data or information describing conditions under which the
method of claim 1 may be performed.
11-40. (canceled)
Description
FIELD OF INVENTION
[0001] The field of the present invention is methods for producing
nucleic acid molecules containing at least one non-canonical
nucleotide and for characterizing nucleic acid molecules by
synthesizing nucleic acid molecules containing at least one
non-canonical nucleotide in vitro using mutant nucleic acid
polymerases having at least a 10-fold reduced discrimination
between 2'-deoxyribonucleoside-5'-triphosphates and
ribonucleoside-5'-triphosphates as substrates compared to the
corresponding wild-type enzymes.
BACKGROUND
[0002] There are a number of procedures commonly used in the art
for in vitro synthesis of nucleic acid molecules, including both
DNA and RNA. For example, one may use an in vitro transcription
reaction to synthesize RNA from a DNA template present in the
reaction. T7-type RNA polymerases, such as T7 RNA polymerase, T3
RNA polymerase or SP6 RNA polymerase, are commonly used in such
reactions, although many other RNA polymerases may also be used.
Usually, but not always, synthesis of RNA is de novo (i.e.,
unprimed), and usually, but not always, transcription is initiated
at a sequence in the template that is specifically recognized by
the RNA polymerase, termed a "promoter" or a "promoter sequence". A
method for in vitro transcription is presented herein.
[0003] Procedures for in vitro nucleic acid synthesis are also
commonly used in the art to amplify nucleic acid molecules,
including both DNA and RNA. For example, transcriptions using RNA
polymerases are an integral part of "nucleic acid sequence-based
amplification" (NASBA), "self-sustained sequence replication"
(3SR), and "transcription-mediated amplification" (TMA) Hill, C.
S., 1996, three similar methods for amplifying nucleic acid
molecules in vitro.
[0004] By way of example, all or a specific portion of an RNA
molecule may be amplified using NASBA (Compton, et al., 1991) or
3SR (Fahy, et al., 1991) by isothermal incubation of a sample RNA
in a buffer containing two primers (a first primer complementary to
the RNA molecule and encoding a promoter sequence for an RNA
polymerase and a second primer complementary to the 3'-end of the
first cDNA strand resulting from reverse transcription of the RNA
molecule), an RNA- and DNA-dependent DNA polymerase which also has
RNase H activity (or a separate RNase H enzyme), all four canonical
2'-deoxynucleoside-5'-triphosphates (dATP, dCTP, dGTP and dTTP), an
RNA polymerase that recognizes the promoter sequence of the first
primer, and all four canonical ribonucleoside-5'-triphosphates
(rATP, rCTP, rGTP and rUTP).
[0005] A first cDNA strand is synthesized by extension of the first
primer by reverse transcription. Then, the RNase H digests the RNA
of the resulting DNA:RNA hybrid, and the second primer primes
synthesis of the second cDNA strand. The RNA polymerase then
transcribes the resultant double-stranded DNA (ds-DNA) molecule
from the RNA polymerase promoter sequence, making many more copies
of RNA, which in turn, are reversed transcribed into cDNA and the
process begins all over again. This series of reactions, from
ds-DNA through RNA intermediates to more ds-DNA, continues in a
self-sustained way until reaction components are exhausted or the
enzymes are inactivated. DNA samples can also be amplified by other
variations of NASBA or 3SR or TMA.
[0006] Another nucleic acid amplification method involving DNA
synthesis is the polymerase chain reaction (PCR).
[0007] By way of example, a specific portion of a DNA molecule may
be amplified using PCR by temperature cycling of a sample DNA in a
buffer containing two primers (one primer complementary to each of
the DNA strands and which, together, flank the DNA sequence of
interest), a thermostable DNA polymerase, and all four canonical
2'-deoxynucleoside-5'-triphosphates (dATP, dCTP, dGTP and dTTP).
The specific nucleic acid sequence is geometrically amplified
during each of about 30 cycles of denaturation (e.g., at 95.degree.
C.), annealing of the two primers (e.g., at 55.degree. C.), and
extension of the primers by the DNA polymerase (e.g., at 70.degree.
C.), so that up to about a billion copies of the nucleic acid
sequence are obtained. RNA may be similarly amplified using one of
several protocols for (reverse transcription-PCR) RT-PCR, such as,
for example, by carrying out the reaction using a thermostable DNA
polymerase which also has reverse transcriptase activity (Myers and
Gelfand, 1991).
[0008] The polymerase chain reaction, discussed above, is the
subject of numerous publications and patents, including, for
example: Mullis, K. B., et al., U.S. Pat. No. 4,683,202 and U.S.
Pat. No. 4,965,188.
[0009] A variety of procedures for using in vitro nucleic acid
synthesis for characterizing nucleic acid molecules, including both
DNA and RNA, also are known in the art.
[0010] There are many reasons for characterizing nucleic acid
molecules. For example, genes are rapidly being identified and
characterized which are causative or related to many human, animal
and plant diseases. Even within any particular gene, numerous
mutations are being identified that are responsible for particular
pathological conditions. Thus, although many methods for detection
of both known and unknown mutations have been developed (e.g., see
Cotton, 1993), our growing knowledge of human and other genomes
makes it increasingly important to develop new, better, and faster
methods for characterizing nucleic acids. Besides diagnostic uses,
improved methods for rapidly characterizing nucleic acids will also
be useful in many other areas, including human forensics, paternity
testing, animal and plant breeding, tissue typing, screening for
smuggling of endangered species, and biological research.
[0011] One of the most informative ways to characterize a DNA
molecule is to determine its nucleotide sequence. The most commonly
used method for sequencing DNA at this time (Sanger, et al., 1977)
uses a DNA polymerase to produce differently sized fragments
depending on the positions (sequence) of the four bases (A=Adenine;
C=Cytidine; G=Guanine; and T=Thymine) within the DNA to be
sequenced. In this method, the DNA to be sequenced is used as a
template for in vitro DNA synthesis. RNA may also be used as a
template if a polymerase with RNA-directed DNA polymerase (i.e.,
reverse transcriptase) activity is used. In addition to all four of
the deoxynucleotides (dATP, dCTP, dGTP and dTTP), a
2',3'-dideoxynucleotide is also included in each in vitro DNA
synthesis reaction at a concentration that will result in random
substitution of a small percentage of a normal nucleotide by the
corresponding dideoxynucleotide. Thus, each DNA synthesis reaction
yields a mixture of DNA fragments of different lengths
corresponding to chain termination wherever the dideoxynucleotide
was incorporated in place of the normal deoxynucleotide.
[0012] The DNA fragments are labelled, either radioactively or
non-radioactively, by one of several methods known in the art and
the label(s) may be incorporated into the DNA by extension of a
labelled primer, or by incorporation of a labelled deoxy- or
dideoxy-nucleotide. By carrying out DNA synthesis reactions for
each of the four dideoxynucleotides (ddATP, ddCTP, ddGTP or ddTTP),
then separating the products of each reaction in adjacent lanes of
a denaturing polyacrylamide gel or in the same lane of a gel if
different distinguishable labels are used for each reaction, and
detecting those products by one of several methods, the sequence of
the DNA template can be read directly. Radioactively-labelled
products may be read by analyzing an exposed X-ray film.
Alternatively, other methods commonly known in the art for
detecting DNA molecules labelled with fluorescent, chemiluminescent
or other non-radioactive moieties may be used.
[0013] Because 2',3'-dideoxynucleotides (ddNTPs), including even
ddNTPs with modified nucleic acid bases, can be used as substrates
for many DNA polymerases, Sanger's dideoxy-sequencing method is
widely used. Recently, Tabor and Richardson (EP application
942034331, 1994) reported that mutations at specific sites in many
DNA polymerases improved the ability of these mutant enzymes to
accept ddNTPs as substrates, thereby leading to improved DNA
polymerases for DNA sequencing using the Sanger method.
[0014] Nucleic acid sequencing provides the highest degree of
certainty as to the identity of a particular nucleic acid. Also,
nucleic acid sequencing permits one to detect mutations in a gene
even if the site of the mutation is unknown. Sequencing data may
even provide enough information to permit an estimation of the
clinical significance of a particular mutation or of a variation in
the sequence.
[0015] Cycle sequencing is a variation of Sanger sequencing that
achieves a linear amplification of the sequencing signal by using a
thermostable DNA polymerase and repeating chain terminating DNA
synthesis during each of multiple rounds of denaturation of a
template DNA (e.g., at 95.degree. C.), annealing of a single primer
oligonucleotide (e.g., at 55.degree. C.), and extension of the
primer (e.g., at 70.degree. C.).
[0016] Other methods for sequencing nucleic acids are also known
besides the Sanger method. For example, Barnes described a method
for sequencing DNA by partial ribo-substitution (Barnes, W. M.,
1977). In this method, a pre-labelled primer was extended in vitro
on a template DNA to be sequenced in each of four reactions
containing a wild-type DNA polymerase in the presence of Mn2+, all
four canonical 2'-deoxyribonucleoside triphosphates, and one of
four ribonucleoside triphosphates under deoxy-/ribonucleotide
ratios and conditions that result in about 2% ribonucleotide
substitution at each position. After alkali treatment to cleave the
synthetic DNA at the positions of partial ribosubstitution, the
sequence was determined by analyzing the fragments resulting from
each reaction following electrophoresis on a denaturing
polyacrylamide gel.
[0017] Although most methods for sequencing nucleic acids employ
DNA polymerases, some work has also been reported on the use of T7
RNAP and SP6 RNAP for transcription sequencing of DNA templates
beginning at the respective T7 or SP6 promoter sequence using
3'-deoxyribonucleoside-5'-triphosphates (Axelrod, V. D., and
Kramer, F. R., 1985), and Q-Beta replicase for sequencing
single-stranded RNA templates (Kramer, F. R., and Mills, D. R.,
1978). Also, 3'-O-methyl-ribonucleoside-5'-triphosphates have been
used for sequencing DNA templates with E. coli RNA polymerase
((Axelrod, V. D., et al., 1978). None of these techniques is
commonly used at present, perhaps in part, due to the difficulty to
obtain the 3'-deoxy- and 3'-O-methyl-nucleoside triphosphate
substrates, while 2',3'-dideoxyribonucleoside-5'-triphosphates that
are commercially available have not been found to be substrates for
wild-type (w.t.) RNA polymerases.
[0018] In view of the numerous applications involving in vitro
nucleic acid synthesis known in the art, it is useful to consider
the properties of the key nucleic acid polymerase reagents which
make these procedures possible, and which, if modified in their
essential properties, might improve these procedures.
[0019] One classification of nucleic acid polymerases relies on
their different template specificities (RNA or DNA), substrate
specificities (rNTPs or dNTPs), and mode of initiation (de novo or
primed). These designations usually refer to the template and
substrate specificities displayed in vivo during the fulfillment of
a polymerase's biological function.
[0020] In vitro, polymerases can display novel activities, albeit
with reduced efficiency and/or under non-physiological conditions.
E. coli DNA-directed DNA polymerase I, for example, can use RNA as
a template, although there is a concomitant .sup..about.100-fold
increase in dNTP K.sub.m (Ricchetti and Buc, 1993). T7 DNA-directed
RNA polymerase can also use RNA as a template (Konarska and Sharp,
1989). These are not exceptional observations because it is a
general property of polymerases that they display relaxed template
specificity, at least in vitro.
[0021] While template specificity may be relaxed, polymerase
substrate specificity is normally extremely stringent. T7 DNAP, for
example, displays at least 2,000-fold selectivity for dNTPs over
rNTPs, even in Mn.sup.++ buffer which relaxes the ability of the
polymerase to discriminate between dNTPs and ddNTPs (Tabor and
Richardson, 1989).
[0022] It has been reported that transcripts synthesized by a T7
RNAP Y639F mutant in vivo yielded 1/2-1/3 of the protein per
transcript compared to transcripts synthesized by the wild-type
enzyme (Makarova, et al., 1995). The latter phenotype was unique to
the Y639F mutant amongst a number of other active site mutants
examined for in vivo expression, and indicated that Y639F
transcripts contained a defect that led to their being
inefficiently translated.
[0023] A polymerase with an altered substrate specificity would be
useful in many molecular biological applications, such as creating
a nucleic acid molecule comprising at least one non-canonical
nucleotide.
SUMMARY OF THE INVENTION
[0024] We disclose herein the identification of mutant polymerases,
such as T7-type RNAPs, that display the ability to use dNTPs. The
mutations occur in tyrosine 639 within motif B (Delarue, et al.,
1990) of T7 RNAP.
[0025] We have characterized the ability of the Y639 mutants, as
well as a large number of other active site mutants, to use dNTPs
in both Mg.sup.++ and Mn.sup.++ buffers. Our results point to a
specialized role for tyrosine 639 in T7 RNAP--and the corresponding
amino acid in other polymerases--in insuring that substrates to be
added to the crowing nucleic acid have the correct structure. The
results reveal that both transcript and substrate structure affect
the efficiency with which the transcript is extended and show that
the restriction of unprimed initiation to RNA polymerases is not
due to an intrinsic property of ribo- vs. deoxynucleotides, but
simply to the selectivity of the polymerase active site. The
present invention provides researchers with novel polymerase
reagents and improved methods that expand the structural range of
nucleic acids that can be enzymatically synthesized in vitro.
[0026] The present invention requires a polymerase with a reduced
discrimination between canonical and non-canonical nucleoside
triphosphates. In a preferred embodiment of the present invention,
the polymerase has a reduced discrimination between rNTPs and
dNTPs. In an especially preferred embodiment, the reduced
discrimination is at least 10-fold compared to wild-type
enzymes.
[0027] In one embodiment, the present invention is a method for
synthesizing a nucleic acid molecule that comprises at least one
non-canonical nucleotide. This method comprises the steps of
incubating a template nucleic acid in a reaction mixture suitable
for nucleic acid polymerization containing a mutant nucleic acid
polymerase and the appropriate canonical and non-canonical
nucleoside triphosphates which are substrates for a mutant nucleic
acid polymerase and which are desired to be incorporated into the
synthesized nucleic acid molecule.
[0028] In an especially preferred form of this method, the
synthesized nucleic acid molecule has an altered susceptibility to
a nuclease compared to a nucleic acid which could be synthesized
using the corresponding non-mutant nucleic acid polymerase with
canonical nucleoside triphosphates.
[0029] The present invention is also a method for determining the
sequence of a nucleic acid molecule using a mutant RNA
polymerase.
[0030] The method comprises synthesizing a nucleic acid molecule,
either de novo from a promoter, or by extending a primer annealed
to the template molecule in four separate reactions. The four
separate reactions each have all 4 rNTPs and a portion of a ddNTP,
or have all 4 dNTPs and a portion of a ddNTP, or have 4
2'-fluorine-substituted NTPs and a portion of a ddNTP. Chain
termination will occur and the products may be evaluated so that
the sequence of the template molecule may be deduced. In one
embodiment of this method, the reactions which include a ddNTP
occur in the same reaction mixture and are linked to a method for
nucleic acid amplification, including, but not limited to, NASBA,
3SR, TMA, or other similar methods.
[0031] The present invention is also a partial ribo-substitution
method for determining the sequence of a nucleic acid molecule.
This method comprises synthesizing a nucleic acid molecule, either
de novo from a promoter or by extending a primer annealed to the
template molecule in four separate reactions. The reactions each
have, either four dNTPs and a portion of an rNTP or four 2'-F-NTPs
and a portion of an rNTP, or four different non-canonical
nucleoside triphosphates, wherein these nucleoside triphosphates
have substituents different than a hydroxyl group at the 2'
position of the ribose and which the mutant polymerase can use as
substrates for synthesis in nucleic acids, and a portion of an
rNTP. The reaction products are then cleaved at sites containing an
incorporated rNTP by using an alkaline solution or an RNase, and
the cleaved nucleic acid fragments are separated according to size
so that the sequence of the template molecule may be
determined.
[0032] The present invention is also embodiments of a partial
ribo-substitution method wherein the nucleic acid synthesis
reactions of said method occur in the same reaction mixture and are
also part of or linked to a method for nucleic acid amplification,
including, but not limited to, NASBA, 3SR, TMA, or other similar
methods.
[0033] In still other embodiments of the present invention, the
products of either 1, 2, 3, or 4 of the dideoxy-sequencing
reactions or of the partial ribo-substitution sequencing reactions
are performed or analyzed to determine the presence or absence of a
particular nucleic acid, or its relatedness to another nucleic
acid, or whether it contains a mutation compared to another nucleic
acid.
[0034] The present invention is also a kit for performing any of
the above-identified methods.
[0035] It is an object of the present invention to provide a mutant
polymerase capable of altered discrimination between canonical and
non-canonical nucleoside triphosphates.
[0036] It is an object of the present invention to provide an
improved DNA sequencing method.
[0037] It is an object of the present invention to provide a method
to detect the presence of a nucleic acid.
[0038] It is an object of the present invention to provide a method
to detect the identity of a nucleic acid.
[0039] It is an object of the present invention to provide a method
to detect mutations in a nucleic acid.
[0040] It is an object of the present invention to minimize the
steps involved in amplifying and sequencing, detecting, identifying
and detecting mutations in nucleic acids.
[0041] It is another object of the present invention to provide a
method for synthesizing nucleic acid molecules with altered
nuclease susceptibility.
[0042] It is another object of the present invention to provide a
method for synthesizing nucleic acid molecules comprising at least
one non-canonical nucleoside triphosphate.
[0043] Other objects, features and advantages of the present
invention will become apparent after examination of the
specification, claims and drawings.
DESCRIPTION OF THE DRAWINGS
[0044] FIG. 1 diagrams the transcription products produced by Y639F
and w.t. T7 RNAP in the presence of various combinations of rNTPs
and dNTPs.
[0045] FIG. 2 shows the effect of dGTP substitution on
transcription by the w.t. and Y639F polymerase.
[0046] FIG. 3 shows the effects of single-strandedness and sequence
in the initially transcribed region on the activity of Y639F in
reactions with 4 rNTPs or 4 dNTPs.
[0047] FIG. 4 shows transcription by Y639F and w.t. polymerase with
dGTP or rGTP on poly(dI).cndot.poly(dC).
[0048] FIG. 5 shows primed synthesis of DNA and RNA with Y639F and
the w.t. polymerase.
[0049] FIG. 6 shows relative elongation rates of Y639F in "4 rNTP"
and "3 rNTP+1 dNTP" reactions.
[0050] FIG. 7 is a diagram of the mutagenesis strategy involved in
creating a mutant SP6 RNA polymerase.
DESCRIPTION OF THE INVENTION
Definitions
[0051] By "mutant polymerase" is meant a nucleic acid polymerase
which has at least one altered amino acid compared to the
corresponding wild-type polymerase, wherein said mutation or
alteration results in the mutant polymerase having a reduced
discrimination between non-canonical and canonical nucleoside
triphosphates as substrates.
[0052] By "template" we mean a macromolecular pattern or mold for
the synthesis of another macromolecule, composed of a sequence of
nucleotides, either rNTPs or dNTPs, that serves to specify the
nucleotide sequence of another structure.
[0053] "Nucleotide" refers to a base-sugar-phosphate compound.
Nucleotides are the monomeric subunits of both types of nucleic
acid polymers, RNA and DNA. "Nucleotide" refers to ribonucleoside
triphosphates, rATP, rGTP, rUTP and rCTP, and deoxyribonucleoside
triphosphates, such as dATP, dGTP, dTTP, dCTP.
[0054] As used herein, "nucleoside" refers to a base-sugar
combination without a phosphate group. "Base" refers to the
nitrogen-containing base, for example adenine (A), cytidine (C),
guanine (G) and thymine (T) and uracil (U).
[0055] "Incorporation" refers to becoming a part of a nucleic acid
polymer. There is a known flexibility in the terminology about
incorporation of nucleic acid precursors. For example, the
nucleotide dGTP is a deoxyribonucleoside triphosphate. Upon
incorporation into DNA, it becomes a dGMP, or deoxyguanosine
monophosphate moiety. Although there is no dGTP molecule in DNA,
one may say that one incorporates dGTP into DNA.
[0056] As defined herein, a "canonical" nucleoside triphosphate for
an RNA polymerase ("RNAP") consists of any
ribonucleoside-5'-triphosphate ("rNTP" or "NTP") which has an
hydroxyl group at the 2'-position of the sugar, including, but not
limited to, the four common ribose-containing substrates for an RNA
polymerase--ATP, CTP, GTP and UTP. A
2'-deoxyribonucleoside-5'-triphosphate ("dNTP") which has hydrogen
at the 2'-position of the sugar, including, but not limited to, the
four common deoxyribose-containing substrates (dATP, dCTP, dGTP and
dTTP, also known as "TTP") for a DNA polymerase ("DNAP") is defined
herein as a "non-canonical" nucleoside-5'-triphosphate or a
"non-canonical NTP" or a "non-canonical nucleotide" or a
"non-canonical deoxynucleotide" or a "non-canonical triphosphate"
or a "non-canonical substrate" for an RNA polymerase. On the other
hand, a "canonical" nucleoside triphosphate for a DNAP consists of
any dNTP which has a hydrogen at the 2'-position of the sugar,
while an rNTP is defined as a "non-canonical NTP" or a
"non-canonical nucleotide" or a "non-canonical substrate" for a
DNAP. The terms "canonical" and "non-canonical" are meant to be
used herein only with reference to the 2' position of the sugar.
Thus, as defined herein, 2',3'-dideoxynucleoside-5'-triphosphates
("2',3'-ddNTPs" or "ddNTPs") are "non-canonical" substrates for an
RNAP, but are defined as "canonical" for a DNAP. Further, any other
substituent than an hydroxyl group at the 2'-position of ribose or
a hydrogen at the 2-position of deoxyribose, including, but not
limited to, a fluorine ("F" or "fluoro" group) or an amino group,
would be defined as "non-canonical" for both RNAPs and DNAPs
herein. The terms "canonical" or "non-canonical" also are not meant
to refer to the nucleic acid bases attached to the sugar moieties.
Thus, for example, other natural or modified nucleic acid bases
attached to the 1'-position of ribose-5'-triphosphate would still
be defined as "canonical" herein.
[0057] By "a (mutant) nucleic acid polymerase (enzyme) with reduced
discrimination between canonical and non-canonical nucleoside
triphosphate substrates", we have a specific quantitative
definition calculated as follows: [0058] 1. One first determines
the K.sub.m and the k.sub.cat for each enzyme (mutant and
wild-type) using the non-canonical nucleotide as a substrate and
using the canonical nucleotide as a substrate, as was described
previously (Patra, et al., 1992). The value "K.sub.m" expresses how
readily the enzyme will bind the substrate (a larger K.sub.m
implies weaker binding) and "k.sub.cat" expresses the rapidity with
which the substrate, once bound by the enzyme, is reacted upon.
[0059] 2. One next calculates the numerical value for
k.sub.cat/K.sub.m for each enzyme and for each substrate. By broad
scientific consensus, the specificity of an enzyme for a substrate
is felt to be most suitably expressed by this ratio. [0060] 3. For
each enzyme, one then calculates the numerical value obtained by
using the value of k.sub.cat/K.sub.m for the canonical substrate in
the numerator and k.sub.cat/K.sub.m for the non-canonical substrate
in the denominator. This number indicates how much a given enzyme
discriminates between the two substrates. For example, if this
value equals 1, then the enzyme uses both the canonical and the
non-canonical substrates equally well; it does not discriminate
between the two substrates. If this value is greater than 1, then
the enzyme discriminates by that factor between the two substrates;
for example, if the value is 100, then the enzyme discriminates by
a factor of 100 in favor of the canonical substrate compared to the
non-canonical substrate. Similarly, a value less than 1 means that
the enzyme discriminates in favor of the non-canonical substrate
over the canonical substrate. [0061] 4. Finally, one compares the
numerical value calculated in step 3 above for the wild-type (w.t.)
enzyme with the value calculated in step 3 for the mutant enzyme.
If the value calculated for the mutant enzyme is less than the
value calculated for the wild-type enzyme, then the mutant enzyme
"has a reduced discrimination for the non-canonical substrate
compared to the wild-type enzyme." For example, if the values
calculated in step 3 are 100 for the wild-type enzyme and 10 for
the mutant enzyme, then the discrimination of the mutant enzyme in
favor of the canonical substrate (or against the non-canonical
substrate) is reduced 10-fold compared to the discriminator of the
wild-type enzyme.
[0062] We have found that for wild-type T7 RNAP, the average of the
k.sub.cat/K.sub.m values for the four common rNTPs (ATP, CTP, GTP
& UTP) is about 120-fold larger than the average
k.sub.cat/K.sub.m values for the four common dNTPs (dATP, dCTP,
dGTP and dTTP); i.e., the wild-type enzyme discriminates by a
factor of 120 for rNTPs vs. dNTPs. For the Y639F mutant enzyme, the
average of the k.sub.cat/K.sub.m values for the four common rNTPs
is only about 6-fold larger than the average k.sub.cat/K.sub.m
values for the four common dNTPs. Thus, using the average
k.sub.cat/K.sub.m values for these substrates, the Y639F mutant T7
RNAP enzyme has about a 20-fold reduced discrimination between
dNTPs and rNTPs. However, it is recognized that the difference in
discrimination between wild-type and mutant enzymes will vary
depending on the non-canonical substrates and the mutant enzymes
used. Therefore, for the purposes of this invention, we herein
define "a (mutant) nucleic acid polymerase (enzyme) with reduced
discrimination between canonical and non-canonical nucleoside
triphosphate substrates" as "a polymerase which has at least a
10-fold reduced discrimination compared to the corresponding
wild-type enzyme for non-canonical nucleotides compared to
canonical nucleotides, wherein the respective values for
discrimination between canonical and non-canonical substrates is
calculated using the average of the k.sub.cat/K.sub.m values for
all four rNTPs and all four dNTPs."
[0063] By "T7-type RNA polymerases" we mean T7, T3, .phi.I,
.phi.IIH, W31, ghl, Y, A1122, SP6 and mitochondrial RNAPs.
In General
[0064] There are many reasons to synthesize nucleic acid molecules
containing at least one non-canonical nucleotide. For example,
incorporation of a non-canonical nucleotide may make the synthetic
nucleic acid more resistant and therefore, more stable, to a
nuclease, such as a ribonuclease. Also, one may wish to incorporate
one or more non-canonical nucleotides which, for example, change
the nuclease digestion pattern so that the product nucleic acid is
easier to detect or characterize. For example, because RNase A
cleaves RNA only after C or U, replacement of one or both of these
rNMPs by a dNMP or other non-canonical nucleotide that is resistant
to cleavage by RNase A would alter the digestion pattern of the
nucleic acid.
[0065] There are many uses for nucleic acids which have one or more
of these properties, such as nuclease resistance. For example,
nucleic acids containing at least one non-canonical nucleotide may
have advantages for use as ribozymes, or as nucleic acid molecules
used for gene therapy, in a vaccine, in an antiviral composition,
in an antimicrobial composition, in an anti-sense composition for
regulating gene expression, in a composition for hybridization to a
complementary nucleic acid, including as a primer, or as a probe
for detection of a complementary nucleic acid for a variety of
purposes.
[0066] Some nucleic acid molecules, such as those of mixed
dNMP/rNMP composition, are highly useful for certain applications,
but are presently difficult or impossible to produce on a practical
scale. Thus, improved methods for synthesizing such nucleic acid
molecules in vitro would be highly desirable. For example, probes
of mixed DNA-RNA-DNA composition for the Cycling Probe Assay (Duck,
P. G., et al., 1990) are currently made using difficult chemical
methods.
[0067] We describe herein previously-unknown properties of T7-type
RNA polymerases having a non-wild-type amino acid at specific
positions within the polypeptides. We found that altering the amino
acid at these specific positions results in mutant polymerases
having at least a 10-fold reduced discrimination between
2'-deoxyribonucleoside-5'-triphosphates (dNTPs) and
ribonucleoside-5'-triphosphates (rNTPs) as substrates in in vitro
nucleic acid synthesis reactions compared to the corresponding
wild-type enzymes. We found that these mutant polymerases also have
reduced discrimination for other non-canonical nucleoside
triphosphate (NTP) substrates, including
2',3'-dideoxyribonucleoside-5'-triphosphates (ddNTPs) and
2'-fluoro-nucleoside-5'-triphosphates (2'-F-NTPs). Based on
knowledge of these novel properties, we have disclosed methods for
using these mutant polymerases for producing nucleic acid molecules
containing at least one non-canonical nucleotide for characterizing
nucleic acid molecules by synthesizing nucleic acid molecules
containing at least one non-canonical nucleotide in vitro.
[0068] In one preferred embodiment, the invention uses mutant RNA
polymerases that efficiently utilize deoxynucleoside triphosphates
as substrates. In vitro, this mutant will synthesize RNA, DNA, or
`transcripts` of mixed dNMP/rNMP composition from a template
molecule depending on the mix of NTPs or dNTPs present in the
synthesis reaction.
Mutant Polymerases of the Present Invention
[0069] In a preferred embodiment, the polymerase mutation is
conservative, for example, changing tyrosine 639 (of T7 polymerase)
within the active site to phenylalanine, and does not substantially
affect promoter specificity or overall activity. Non-conservative
mutations of this tyrosine also reduce discrimination between
deoxy- and ribonucleoside triphosphates, but these mutations also
typically cause large activity reductions. Among the most active of
the non-conservative mutations, enzymes with methionine or leucine
in place of the wild-type tyrosine at the 639 position of T7 RNAP
had about half the enzymatic activity of the wild-type enzyme.
[0070] Of 26 other mutations of other amino acid positions examined
in and around the active site of T7 RNAP, none showed marked
effects on rNTP/dNTP discrimination.
[0071] T7 RNA polymerase can use RNA templates as well as DNA
templates and is capable of both primer extension and de novo
initiation. The Y639F mutant, described below in the Examples,
retains the ability to use RNA or DNA templates. Thus, this mutant
can display de novo initiated or primed DNA directed DNA
polymerase, reverse transcriptase, RNA directed RNA polymerase, or
DNA directed RNA polymerase activities depending on the templates
and substrates presented to it in the synthesis reaction.
[0072] A major theme of research on nucleic acid polymerases over
the past several years has been the discovery of extensive
structural similarity between the majority of these enzymes, even
those from functionally different classes (Sousa, et al., 1993;
Pelletier, et al., 1994; Jacob-Molina, et al., 1993; Kohlstaedt, et
al., 1992; Sawaya, et al., 1994; Steitz, et al., 1994). One part of
this work has been the identification of well-conserved residues.
Five amino acids have been identified as invariant in a large
number of DNA-directed RNA polymerases (Delarue, et al., 1990). In
T7 RNAP these are D537, K631, Y639, G640A and D812. A specific,
conserved function has been revealed for the two invariant
aspartates in coordinating the catalytic Mg.sup.++ ion (Sousa, et
al., 1993; Pelletier, et al., 1994; Jacob-Molina, et al., 1993;
Kohlstaedt, et al., 1993; Sawaya, et al., 1994; Steitz, et al.,
1994). Our observations imply a similarly specific and conserved
function for Y639 as a sensor of inappropriate geometry or
structure in the template-NTP-primer/RNA complex.
[0073] The present invention encompasses methods for synthesis of
nucleic acids containing at least one non-canonical nucleotide
using mutant nucleic acid polymerases which have reduced
discrimination for non-canonical nucleoside triphosphate
substrates. The examples below demonstrate the reduced dNTP/rNTP
discrimination of mutants of T7 RNA polymerase and SP6 RNA
polymerase. Genes for other polymerases may be modified or mutated
to obtain mutant enzymes which have similar reduced discrimination
for non-canonical substrates. If one wished to mutate an RNA
polymerase to have the properties described herein, one would first
locate the amino acid corresponding to the T7 polymerase Y639 in
other RNA polymerases. Identification of the corresponding mutation
site in other polymerases can be done by the well-established
procedure of sequence alignment, which involves aligning the amino
acid sequences of two proteins, introducing gaps and insertions,
and shifting the sequences with respect to each other while
maintaining their original linearity. Such alignment procedures are
often performed with the aid of one or more computer programs into
which the amino acid sequences that one wishes to compare have been
entered. When the sequence identity of two proteins is high enough
(greater than or equal to 30%) over a sufficient length of amino
acids (greater than or equal to 50), this procedure is very
reliable in identifying amino acids that occupy corresponding
structural and functional positions in the two proteins. Such
conditions are met for the T7-type group of RNAPs, which include
T7, T3, .phi.I, .phi.IIH, W31, ghl, Y, A1122, SP6 and mitochondrial
RNAPs, and allow identification of the mutation site corresponding
to Y639 in T7 RNAP.
[0074] Using this method, we predicted that the amino acid in w.t.
SP6 RNAP that corresponded to the Y639 site in T7 RNAP was Y631,
and as described herein, mutagenesis of this site resulted in a
Y631F mutant SP6 RNAP which has a similar reduced discrimination
for dNTPs compared to rNTPs like the Y639F mutant T7 RNAP.
[0075] From alignment studies, it is known that there is a
conserved motif present in T7-like RNAPs and class I DNAPs with the
following consensus sequences:
. . . K - - - - - - - Y G . . .
[0076] where Y is the tyrosine at amino acid number 639 in the T7
RNA polymerase protein. The same consensus sequence is observed in
the SP6 RNA polymerase and T3 RNA polymerase proteins where a K
(K=lysine) is succeeded by 7 amino acids and a Y G (G=glycine). In
SP6 RNA polymerase the Y is at amino acid number 631 in the
polypeptide chain, and in T3 RNA polymerase it is at amino acid
number 573. By mutating the codon for Y631 in SP6 RNA polymerase
such that a phenylalanine is at this position, the expected
phenotypic change was realized.
[0077] In summary, one may locate the corresponding mutation site
in other RNAPs by aligning the amino acid sequence of a T7-like
RNAP, chosen from among T7, T3, .phi.I, .phi.IIH, W31, ghl, Y,
A1122, SP6 and mitochondrial RNAPs, against the conserved motif
given above and identifying which position corresponds to the Y639
position in T7 RNAP.
[0078] As stated above, the conserved motif is also present in
class I DNAPs. While a structure of T7 RNAP complexed with NTP is
not available, the structure of the homologous Klenow fragment of
DNAP I with dNTP has been obtained (Beese, et al., 1993). This
structure demonstrated that the amino acids encompassed within the
above-mentioned conserved motif (i.e., amino acid residues 758 to
767 of E. coli DNAP I) are in proximity to the deoxyribose sugar of
the dNTP, so that it is reasonable that mutations within this motif
might affect the ability of a DNAP to discriminate between dNTPs
and rNTPs. However, one of the present inventors found that when a
mutation was made which changed the amino acid at the position in a
class I DNAP corresponding to the Y639 mutation in T7 RNAP, the
mutant DNAP retained enzymatic activity, but did not have a reduced
discrimination for rNTPs compared to dNTPs. Thus, it is not obvious
what mutations, if any, would result in a class I DNAP having
reduced discrimination for rNTPs vs. dNTPs, even if it is
reasonable to assume that such a mutation would occur within the
above-mentioned conserved motif (residues 758 to 767 of E. coli
DNAP I) which the structure shows to be in proximity to the
dNTP.
[0079] Because the structure of the Klenow fragment of DNAP I
complexed with dNTP was determined (Beese, et al., 1993),
researchers have believed that the homologous conserved motif of T7
RNAP (i.e., amino acid residues 631-640) is likely to be in
proximity to the ribose moiety of an NTP, as the case for the DNAP
I. Nevertheless, prior to the work of the present invention, it was
not possible to know which mutation, if any, might result in a
reduced discrimination for dNTPs vs. rNTPs. Since the Y639 mutation
of T7 RNAP was identified, as presented herein, one of the present
inventors has modeled NTP in T7 RNAP (Huang, et al., submitted for
publication) based on the structures of the homologous Klenow
fragment of DNAP I complexed with dNTP (Beese, et al., 1993) and of
RT complexed with primer-template (Jacabo-Molina, et al., 1993).
Models based on either structure agree in placing the ribose close
to Y639, and in revealing no other side chain capable of
discriminating the hydrogen bonding character of the 2'-substituent
within 5 angstroms of the 2'-group of the NTP. Thus, the model is
consistent with our results related to a reduced discrimination of
Y639 RNAP mutants for dNTPs vs. rNTPs, even though additional
studies (Huang, et al., submitted for publication) have determined
that the hydrogen bonding character is not the only factor involved
in dNTP/rNTP discrimination.
[0080] Less is known about non-T7-type RNAPs. For many, the amino
acid sequences are not known. Non-phage-encoded host bacterial RNA
polymerases are complex multi-subunit proteins. A nucleotide
polymerization site has been localized in the .beta. subunit of E.
coli RNA polymerase although participation of other subunits is not
ruled out. In order to determine the site in a non-T7-like RNAP
which would result in a reduced dNTP/rNTP discrimination, one would
first use the above-described procedure of alignment to determine
if the
. . . K - - - - - - Y G . . . motif was present. If so, it may be
possible to obtain the desired mutation in the same manner as for
T7-like RNAPs. However, if the conserved motif is not present, one
may obtain the desired mutation with greater difficulty by random
mutagenesis and enzyme assay screening in order to find a change or
changes that result in reduced dNTP/rNTP discrimination.
[0081] Once one has determined where the corresponding Y639 site is
in the polymerase one wishes to mutate, one would use standard
methods in the art of molecular biology to create an amino acid
substitution. As disclosed above, a conservative substitution is
preferable. For example, a substitution of a phenylalanine for a
tyrosine is most preferable. The Examples below disclose a method
for creating a mutant polymerase, but one of skill in the art will
realize that there are many substitute methods of equal
effectiveness.
Methods of the Present Invention
[0082] In one embodiment, the present invention is a method for
using a mutant polymerase for synthesizing in vitro a nucleic acid
molecule which comprises at least one non-canonical nucleotide in
place of at least a portion of the canonical nucleotides. The
method comprises the steps of incubating a template nucleic acid in
a reaction mixture containing a mutant nucleic acid polymerase
which has reduced discrimination between canonical and
non-canonical nucleoside triphosphates, including between dNTPs and
rNTPs, and the appropriate canonical or non-canonical nucleoside
triphosphates which are substrates for the nucleic acid polymerase.
One then follows standard polymerase reaction protocols and creates
the synthesized nucleic acid molecule.
[0083] Preferably, the reactions also contain inorganic
pyrophosphatase, which is known to increase the yields in in vitro
transcription reactions (Cunningham, P. R. and Ofengand, J., 1990)
and to reduce pyrophosphorolysis in in vitro DNA synthesis
reactions (Tabor, S., and Richardson, C. C., 1990), as well as
buffers and other components which are known to those of skill in
the art to be optimal for the particular w.t. polymerase used.
Cunningham and Ofengand (1990) provide an example of conditions
which may be used for unprimed synthesis with T7 RNA polymerase or
mutant T7 RNAPs, although one of skill in the art will recognize,
with respect to reactions with these enzymes or other enzymes, the
need to optimize the concentrations and ratios of canonical and
non-canonical NTP substrates according to the respective K.sub.m
and application and to modify reaction conditions, such as
temperature, amount of enzyme, salt concentration, or divalent
cation (e.g., Mg2+ or Mn2+) concentration, in order to produce
improved results such as higher yield or a greater percentage of
full-length products.
[0084] In a preferred form of this method, the resulting
synthesized nucleic acid molecule has a different susceptibility to
a nuclease compared to a nucleic acid synthesized by the
corresponding non-mutant nucleic acid polymerase under identical
reaction conditions with canonical substrates. By "different
susceptibility" we mean to include reduced, increased, or, in the
case of synthetic nucleic acids containing both canonical and
non-canonical nucleotides, altered susceptibility to a nuclease,
which may be either a DNAse or RNAse. The nature of the reduced,
increased or altered susceptibility to a nuclease is also related
to the properties of the nuclease. For example, a nucleic acid
resistant to RNase A, which cleaves RNA only after C or U, may be
synthesized using fewer non-canonical nucleotides (e.g., dNTPs or
2'-F-NTPs) than a nucleic acid which is resistant to RNase I, which
cleaves after every base.
[0085] In a preferred form of the present invention, the resulting
synthesized nucleic acid is a ribozyme or a nucleic acid molecule
used for gene therapy, in a vaccine as an antiviral composition, in
an antimicrobial composition, as an antisense composition for
regulating gene expression, in a composition for hybridization to a
complementary nucleic acid, such as for a primer, or as a probe for
detection of a complementary nucleic acid.
[0086] The resulting synthesized nucleic acid may be either single-
or double-stranded.
[0087] The present invention is also a kit for performing the
method of synthesizing a nucleic acid containing at least one
non-canonical nucleotide. Typically, the kit contains a mutant
nucleic acid polymerase with a reduced discrimination for
non-canonical compared to canonical substrates and data or
information describing conditions under which the method may be
performed.
[0088] The present invention is also improved methods for
sequencing nucleic acids using a mutant nucleic acid polymerase of
the present invention.
[0089] Because 2',3'-dideoxynucleotides are not substrates for
wild-type RNA polymerase, it previously has not been possible to
use the Sanger method for determining the sequence of a nucleic
acid with an RNA polymerase, although 3'-deoxy- or 3'-hydroxymethyl
analogs have been used as terminators for Sanger-like sequencing
with RNA polymerases.
[0090] However, 2',3'-ddNTPs are substrates for the mutant nucleic
acid polymerases of this invention which can also utilize both
rNTPs and dNTPs as substrates, and the present invention is also a
method for sequencing nucleic acid molecules (DNA or RNA) using a
mutant nucleic acid polymerase and 2',3'-ddNTPs as terminators.
[0091] In one embodiment of this method, the nucleic acid to be
sequenced, whether DNA or RNA, is used as a template for in vitro
nucleic acid synthesis from a primer (i.e., primed synthesis) using
a mutant RNA polymerase which has a reduced discrimination for
dNTPs compared to rNTPs. Each of four different reactions also
contains an amount of at least one nucleoside triphosphate
corresponding to each nucleic acid base represented in either DNA
or RNA, chosen from among the 2'-deoxynucleotides dATP, dCTP, dGTP
and dTTP or dUTP, or the four common ribonucleotides ATP, CTP, GTP
and UTP, or the 2'-fluorine-substituted nucleotides 2'-F-ATP,
2'-F-CTP, 2'-F-GTP and 2'-F-UTP or 2'-F-TTP. A
2',3'-dideoxynucleotide is also included in each in vitro nucleic
acid synthesis reaction in an amount that will result in random
substitution by the dideoxynucleotide of a small percentage of the
corresponding rNTP, dNTP or 2'-F-NTP that is present in the
reaction and that would be incorporated into the synthetic nucleic
acid in a template-dependent fashion.
[0092] Thus, each DNA synthesis reaction yields a mixture of DNA
fragments of different lengths corresponding to chain termination
wherever the dideoxynucleotide was incorporated in place of the
ribo-, 2'-deoxy- or 2'-fluoro-nucleotide. The DNA fragments are
labelled, either radioactively or non-radioactively, by one of
several methods known in the art and the label(s) may be
incorporated into the DNA by extension of a labelled primer, or by
incorporation of a labelled ribo-, deoxy-, 2'-fluoro- or
2',3'-dideoxynucleotide.
[0093] By carrying out DNA synthesis reactions for each of the
dideoxynucleotides (ddATP, ddCTP, ddGTP and ddTTP or ddUTP), then
separating the products of each reaction in adjacent lanes of a
denaturing polyacrylamide gel or in the same lane of the gel if
different distinguishable labels are used for each separate
reaction, and then detecting those products by one of several
radioactive or non-radioactive methods known in the art, the
sequence of the DNA template can be read directly. Also, other
matrices than polyacrylamide which separate the fragments based on
size may be used. Those with skill in the art will also recognize
that other nucleotide analogs generally used for reducing
sequencing compressions, such as ribo-, deoxy- or
2'-fluoro-nucleoside triphosphates containing 7-deaza-guanine or
inosine, may also be used in place of the ribo-, deoxy- or
2'-fluoro-nucleotide for which the respective analog is used.
[0094] The present invention also comprises another embodiment of
this method for sequencing using 2',3'-ddNTPs and a mutant RNA
polymerase which has a reduced discrimination for dNTPs compared to
rNTPs. In this embodiment of the method, the nucleic acid to be
sequenced, whether DNA or RNA, is used as a template for de novo
(i.e., unprimed) in vitro nucleic acid synthesis beginning at an
RNA polymerase promoter. In this embodiment, a primer is omitted
from the reactions and depending on the promoter sequence, in
addition to the other components used in the first embodiment, an
amount of a dinucleoside tetraphosphate or a trinucleoside
penta-phosphate may be added as an initiating nucleotide (Moroney
and Piccirilli, 1991) so that the majority of nucleic acid
synthesis is initiated from a single site. Because no primer is
used, the labelling of the sequencing products must be carried out
by one of the other methods envisioned and discussed with respect
to the first embodiment of the method or by incorporating a label
into or on an initiating dinucleotide or trinucleotide. In other
respects, the second embodiment of this sequencing method of the
invention is similar to the first embodiment of the method.
[0095] The present invention also comprises methods of sequencing
nucleic acids by partial ribo-substitution using mutant nucleic
acid polymerase which have a reduced discrimination between
non-canonical and canonical nucleotides. These methods have
advantages over the partial ribo-substitution sequencing method
described by Barnes (1977), which relied on the use of a
Mn2+-containing reaction buffer to relax the ability of a wild-type
DNA polymerase to discriminate between dNTPs and rNTPs. Further,
only DNA was used as a template for this method and de novo (i.e.,
unprimed) nucleic acid synthesis was not envisioned. In contrast,
the ribo-substitution sequencing method of the present invention
uses a mutant nucleic acid polymerase which has an inherent reduced
discrimination between dNTPs and rNTPs and, although it may be
included, Mn2+ is not required in the sequencing reactions. In
still another embodiment, 2'-fluorine-substituted NTPs are used in
place of dNTPs in the ribo-substitution reaction. Embodiments of
the method of the present invention also include sequencing using
either DNA or RNA as templates and sequencing using either nucleic
acid primers or de novo nucleic acid synthesis from an RNA
polymerase promoter sequence.
[0096] Since incorporation of the sequence-delimiting
ribonucleotide does not terminate nucleic acid synthesis during
partial ribo-substitution sequencing, all of the radioactive or
non-radioactive label must be incorporated into the sequencing
reaction products prior to incorporation of the first
ribonucleotide in order to avoid multiple labeled produced from
each nucleic acid molecule synthesized. Multiple labeled products,
starting from different positions on the template, would make it
difficult or impossible to interpret sequence results. Thus,
labeling of nucleic acid products for partial ribo-substitution
sequencing must be accomplished by means such as incorporating the
label into a primer, when used, or into an initiating di- or
tri-nucleotide, or by prelabelling in the presence of an amount of
a labeled nucleotide which will be used up or destroyed and/or
limiting 2'-deoxy- or 2'-fluoro-nucleotides prior to addition of
the sequence-delimiting rNTPs.
[0097] We envision sequencing reactions wherein all of the
distinguishable non-radioactive labels in, or attached to, or
connected with, the products from more than one of the reactions,
up to and including all four of the sequencing reactions for a
template, or even reactions from multiple templates if
distinguishable non-radioactive labels are present, are detected in
or from a single lane of a sequencing gel or a single capillary
electrophoresis tube or a single matrix or means of any kind using
an automated sequencer or other detection device.
EXAMPLES
Example 1
Creation and Characterization of a Mutant T7 RNA Polymerase
A. Materials and Methods
[0098] Nucleic acids and NTPs: Nucleotides were from Pharmacia or
USB/Amersham. Polynucleotides were from Pharmacia and the Midland
Certified Reagent Company. Synthetic DNAs were prepared at the
UTHSCSA DNA synthesis facility on an Applied Biosystems DNA
synthesizer and purified by HPLC. A synthetic RNA 12mer was from
the Midland Certified Reagent Company. Plasmids pT75 (Tabor and
Richardson, 1985) and pBS (Stratagene Inc.) were purified from E.
coli by alkaline-lysis and cesium chloride gradient centrifugation
(Sambrook, et al., 1989). Radioactive nucleotides were from NEN
Dupont or ICN.
[0099] Preparation and purification of mutant polymerases:
Construction, expression, and purification of the T7 RNAP mutants
was described previously (Bonner, et al., 1992).
[0100] Transcription reactions: Transcription reactions were
carried out in 40 mM Tris-Cl pH 8.0, 15 mM MgCl.sub.2, and 5 mM DTT
or 20 mM Manganese Citrate pH p 8.0, 5 mM DTT at 37.degree. C.
Template, polymerase, and NTP concentrations were as indicated in
the legends to the figures and tables. Relative activity
determinations were made by taking 4 .mu.l aliquots of reactions at
5, 10, and 20 minute time points and spotting on to DE81 filter
paper. Unincorporated nucleotides were separated from incorporated
nucleotides by washing the filter paper with 0.5 M KH.sub.2PO.sub.4
pH 7.0 and retained radioactive nucleotide was quantitated with a
Molecular Dynamics phosphorimager. Radioactive NTPs used were as
indicated in figure and table legends. To evaluate rNTP/dNTP
selectivity, reactions were run with 4 rNTPs and pT75 as template
and .alpha.-P.sup.32 rNTPs or .alpha.-P.sup.32 dNTPs were used to
label the transcripts. The relative rate of incorporation of an
rNTP vs. its cognate dNTP was determined from the relative
percentages of labeled dNTP vs. dNTP incorporated into DE81
retainable RNA at 5, 10, and 20 minute time points. Apparent
miscoding frequencies were determined similarly, though in this
instance the template was a single-stranded homopolymer and the
reaction contained the complementary unlabeled rNTP, and
complementary .alpha.-P.sup.32 rNTP or one of the 3
non-complementary .alpha.-P.sup.32 rNTPs. The relative percentages
of labeled complementary vs. non-complementary rNTPs incorporated
at 5, 10 and 20 minute time points gave an apparent miscoding rate.
The rNTP/dNTP selectivity assay was used to test the following T7
RNAP mutants for effects on substrate discrimination: D537S, D537E,
S539A, R551S, D552S, R627S, K631S, L637A, Y639S, Y639F, Y639A,
G640A, F644A, G645A, Q649S, !810S, H811S, H811A, D812A, D812E,
D812S, D812N, D879E+.DELTA.F882+.DELTA.A883,
D879E+A881T+.DELTA.A883, D879E+F884+A885, D879E+F882Y,
D879E+.DELTA.A883, D879E+F882W, D879E.
[0101] Elongation rate determinations were carried out as described
(Golomb & Chamberlin, 1974) with some variations (Bonner, et
al., 1994).
[0102] Determination of NTP K.sub.m and k.sub.cat was as described
previously (Patra, et al., 1992).
B. Results
[0103] Structure of the transcripts synthesized by Y639F and the
w.t. enzyme with rNTPs and dNTPS: FIG. 1 diagrams the structure of
transcription products produced by Y639F and w.t. T7 RNAP in the
presence of various combinations of rNTPs and dNTPs. The template
was pT75 (Tabor and Richardson, 1985) cut with HindIII so that
transcription from its T7 promoter generates a 59-base run-off
transcript. Electrophoresis was on a 20% polyacrylamide 6M urea
gel. Plasmid and polymerases were at concentrations of 10.sup.-7 M,
and NTP concentrations were 0.5 mM (all rNTPs and dTTP), 1 mM
(dATP, dGTP), or 5 mM (dCTP). .gamma.-P.sup.32-GTP was added to
radiolabel the transcription products Wild-type (WT) or Y639F
mutant (Mu) polymerases and NTPs used are as indicated. Poly-rG
products of various sizes are labeled in lane A ("2G", "3G", etc. .
. . ) and heterogeneous sequence abortive transcripts of different
lengths are indicated by "4H", "5H", etc. . . . in lane c. Lanes
q-t are a 10-fold longer exposure of lanes m-p.
[0104] FIG. 1 shows transcription reactions carried out with the
w.t. enzyme or the Y639F mutant polymerase and a T7 .phi.-10
promoter template. Transcription by T7 RNA polymerase, like other
RNA polymerases, is characterized by an initial, poorly processive
`abortive` phase of transcription during which the short, nascent
transcript frequently dissociates from the ternary complex. When
the transcript reaches a length of .sup..about.9 bases
transcription becomes highly processive and the transcript becomes
stably associated with the elongation complex. On this promoter,
which initiates with GGGAGACCGGAAU (SEQ ID NO:1), T7 RNAP can also
synthesize long poly-G ladders (labeled "2G", 3G", etc. in lanes a
and b) when rGTP is the sole NTP present (Martin, et al., 1988).
Lanes c and d of the electrophoretic gel display the transcription
products typical of runoff reactions counting all 4 rNTPs: there
are abortive transcripts ranging up to 8 bases in length and a
59-base runoff product. The 4mer length the sequences of the poly-G
transcripts and the abortive transcripts made in the presence of
all 4 rNTPs (labeled "4H", "5H", etc.) diverge and no longer
co-migrate with the poly-G transcripts of equivalent size.
[0105] When rATP is omitted from the transcription reactions (lanes
e and f) normal elongation of the initially synthesized GGG trimer
cannot occur. There are no heterogenous sequence abortive
transcripts or 59 base runoff products made and instead long poly-G
transcript s, as in lane a, are made. Adding dATP to reactions
lacking rATP does not change the transcripts produced by the w.t.
enzyme (lane g). However, with the mutant enzyme we observed that
addition of dATP (lane h) allows synthesis a long runoff transcript
as well as synthesis of heterogenous sequence abortive transcripts
that do not co-migrate with the poly-G transcripts. Observation of
an abortive transcript in lane h running near the position of the
"4H" band in lane d confirms extension of the GGG trimer with an A
but note that the major 4mer transcript in lane h migrates close
to, but not precisely with, the major 4mer in lane d or in adjacent
lane i. This is consistent with the expectation that these 4mers
will have identical sequence and length but different structure
(i.e., rGrGrGrA in lanes d or i; rGrGrGdA in lane h). It should
also be noted that some poly-G transcript synthesis is observed in
lane h. For example, in lane h we observe both a heterogeneous
sequence 4mer migrating near the "4H" position and a smaller amount
of 4mer band migrating at the "4G" position. When 4 rNTPs are
present (lanes c or d) the synthesis of poly-G transcripts is more
completely suppressed. This indicates that dATP is utilized by
Y639F, but not as efficiently as rATP.
[0106] When rCTP is omitted from the reaction, transcripts
terminate predominately at the 6mer length because rCMP is normally
first incorporated at position 7 (lanes i, j). Addition of dCTP
does not allow extension of the 6mer in reactions with the w.t.
enzyme (lane k). However, addition of dCTP to reactions with Y639F
allows extension beyond the 6mer length and synthesis of the runoff
transcript (lane l). Again, the following should be noted: 1. The
transcripts larger than 6 bases do not co-migrate with their
counterparts in lanes c or d consistent with the expected
structural difference despite length and sequence identity, 2.
there is more termination at the 6- and 7mer points in lane l than
in lanes c or d, indicating that Y639F uses dCTP well, but not as
efficiently as it utilizes rCTP.
[0107] In lanes m and n UTP was omitted from the reactions. Lanes
q-t show a 10-fold longer exposure of lanes m-p. Within the set of
4 NTPs, UTP is unique on this template since it first becomes
incorporated into the transcript at the 13 base position. This
corresponds to a transcript length subsequent to the transition
form abortive to processive transcription. As a consequence of this
transition, the ternary complex becomes more stable (Martin, et
al., 1988). Therefore, when transcript extension is blocked during
the processive phase of transcription, the stalled ternary complex
does not rapidly dissociate (Shi, et al., 1988). Instead it remains
stalled on the template, near the promoter, and blocks
reinitiation. For this reason we observe a large decrease in the
overall amount of transcription when UTP is omitted from the
reaction in lanes m and n.
[0108] A longer exposure of lanes m and n (lanes q, r) does,
however, reveal transcription products of the expected structure.
When TTP is added to these reactions (lanes o, p, s, t) synthesis
of the 59 base runoff transcript is observed with both the w.t. and
Y639F mutant.
[0109] The ability of the w.t. enzyme to extend transcripts with
TTP when it is unable to extend transcripts with the other dNTPs is
also likely to be related to unique position at which UTP/TTP first
becomes incorporated into the transcript. The amount of transcript
termination or extension that occurs with a particular dNTP depends
simply on the relative rates of ternary complex dissociation or
dNMP incorporation (McClure and Chow, 1980). During abortive
transcription complex, dissociation must be more rapid than the
rate at which the w.t. enzyme incorporates dNMPs into its
transcripts. During processive transcription even the expected slow
rate of dNMP incorporation by the w.t. enzyme must be competitive
with the slow rate of dissociation of the stable elongation
complex, and an ability of the w.t. enzyme to incorporate dNMPs
becomes manifest. Because elongation during the processive phase of
transcription is fast (.sup..about.230 bases/sec, Golomb and
Chamberlin, 1974), while initiation and progression through
abortive transcription is slow (Martin and Coleman, 1987; Martin,
et al., 1988), elongation of the transcript from 11 to 59 bases is
expected to contribute less than 10% to the time required for
transcript synthesis. As a consequence the phase of transcription
during which TTP is incorporated may not be the rate limiting step
in synthesis of the runoff transcript even for the w.t. enzyme.
These considerations imply that one need not expect to see marked
differences in synthesis of a relatively short runoff transcript by
Y639F or the w.t. enzyme when TTP is substituted for UTP.
[0110] Lanes u and v show reactions in which two rNTPs have been
substituted with dNTPs (dATP and dCTP), and lanes w and x show
reactions in which three rNTPs have been substituted with dNTPs
(dATP, dCTP, and TTP). Synthesis of the 59 base runoff transcript
is observed with the mutant polymerase (lanes v and x) indicating
that Y639F can carry out synthesis even when 3 rNTPs are
substituted with dNTPs.
[0111] While the abortive transcript patterns in lanes v and x may
largely be described as a combination of the patterns observed in
lanes h and l there are some important distinctions. The transcript
patterns in lanes v and x reveal that the structure of the
transcript, as well as the structure of the NTP, affect the rate at
which NMPs are added to the transcript. For example, in lanes v and
x there is an increase in termination at the 6mer length relative
to lane l (the 6mer in lanes v or x runs slightly slower than the
poly-G 5mer in the adjacent lane). In lanes l, v and x synthesis of
the 7mer involves incorporation of dCMP but in lanes v and x the
6mer contains a dAMP at its 3' end and in lane l it contains an
rAMP.
[0112] The increase in termination at the 6mer point in lanes v or
x indicates that the presence of a dNMP on the 3' end of the
transcript reduces the ability of the polymerase to further
incorporate NMPs. The high level of termination after synthesis of
the rGrGrGdA 4mer in lane h relative to the observed termination
after synthesis of the rGrGrGrA 4mer in lanes c or d similarly
indicates that the presence of deoxynucleotides in the transcript,
at least at the 3'-end, influences subsequent extension of the
transcript.
[0113] FIG. 2 shows the effect of dGTP substitution on
transcription by the w.t. and Y639F polymerase. Polymerases,
template (supercoiled (Sc) or HindIII linearized (Li) pT75), and
NTPs were as indicated. Polymerase and template concentrations and
electrophoresis conditions as in FIG. 1. Left panel: Labeling was
with .alpha.-P.sup.32 rGTP (a, d, g, j) or .alpha.-P.sup.32 dGTP
(all other lanes). The runoff transcript from the HindIII-cut
template is indicated in lane f. Right panel: Labeling was with
.alpha.-P.sup.32-rGTP (a, b, f, g) or .alpha.-P.sup.32-dGTP (all
other lanes). Poly-rG and poly-dG products of various sizes are
indicated in lanes a, c, d. Alignment of these transcript patterns
with those in lanes b, c, h, and i in the left panel reveals that
the added complexity of the transcript pattern in the latter set of
lanes is due to the presence of a mixture of heterogeneous sequence
and poly-G transcripts. Heterogenous sequence abortive transcripts
are indicated in lane c of the left panel ("4H", "5H").
[0114] FIG. 2 reveals the effects of substituting dGTP for rGTP in
transcription reactions with the w.t. or Y639F polymerase. In
reactions containing only dGTP and HindIII-cut pT75 as the
template, the mutant polymerase synthesizes poly-dG transcripts up
to 4 bases in length (lane c, right panel). Note that--consistent
with the assumed structural differences--the poly-dG transcripts
("2dG", "3dG", etc.) in lane c do no co-migrate with the poly-rG
transcripts ("2rG", "3rG", etc.) in lane a despite length and
sequence identity. When a supercoiled template is used, poly-dG
transcripts up to 5 bases in length are obtained (lane d, right
panel). In lane e rGMP is added to reactions which contain only
dGTP. Ribo-GMP can serve as the initiating, but not elongating
nucleotide during transcription (Martin and Coleman, 1989). With
rGMP we therefore ask whether either polymerase can elongate with
dGTP if an rNMP is provided for initiation. Addition of rGMP to
reactions with dGTP further extends the lengths of the transcripts
obtained with the mutant polymerase (lane e, right panel). With the
w.t. enzyme very little synthesis is observed in reactions with
dGTP (lanes h-j, right panel), though the normal pattern of poly-rG
synthesis is observed in the rGTP reactions (lanes f, g, right
panel).
[0115] When reactions contained three rNTPs and dGTP synthesis of
runoff transcript from the HindIII-cut template is reduced much
more than in reactions in which rGTP is present but other
ribonucleotides are substituted with deoxynucleotides. For example,
there is very little runoff transcript in lane h of the left panel
of FIG. 2. Addition of rGMP increases the amount of runoff
transcript made by the mutant enzyme in a reaction containing dGTP
(lane i) but the amount of runoff transcript is still much less
than in reactions with rGTP. On a supercoiled template (lanes a-c,
left panel) high levels of long transcripts are obtained with the
mutant enzyme in the reactions with dGTP. The w.t. enzyme shows no
transcript synthesis in any of the reactions with dGTP irrespective
of whether supercoiled templates or rGMP is used.
[0116] Examination of FIG. 2 shows that the marked reduction in
runoff transcript synthesis by the mutant enzyme in reactions with
dGTP is not due to a deficit in initiation. In fact, in all of the
reactions with dGTP we observe abundant synthesis of
2-.sup..about.6 base transcripts with the mutant enzyme. The low
level of runoff transcript synthesis means that these short
transcripts are being inefficiently extended to greater lengths. It
should also be noted that the abortive transcript pattern seen in
lanes b, c, h, and i of the left h panel in FIG. 2 is too complex
to be accounted for by presuming one product of each base length.
Aligning the transcripts produced in the presence of dGTP only with
those produced with dGTP, rUTP, rCTP, and rATP allows us to
identify the predominant abortive transcripts in lanes c, d, h, and
i of the left panel as poly-dG products. In lane c of the left
panel we indicate the major non poly-dG abortives by "4H" and "5H".
In lanes b, c, h, and i of the left panel of FIG. 2 we therefore
see a pattern similar to that of lane h in FIG. 1. The presence of
a mixture of normally extended heterogenous sequence and poly-G
abortive transcripts indicates that `normal` transcript extension
is inefficient.
[0117] It has been shown that mutations in T7 RNAP that reduce
phosphodiester bond formation rates cause poly-rG transcript
synthesis even when 4 rNTPs are present (Bonner, et al., 1994). It
can be seen that the ratio of poly-G to heterogenous sequence
transcripts in lanes b, c, h, i of the left panel of FIG. 2 is
greater than in lane h of FIG. 1, indicating a greater deficiency
in normal transcript extension when dGTP is substituted for rGTP
than when dATP is substituted for dGTP. Note that this occurs even
though normal extension of the dGdGdG trimer in lane i of the left
panel of FIG. 2 (for example) would involve addition of a ribo-AMP
while extension of the rGrGrG trimer in lane h of FIG. 1 would
involve addition of a deoxy-AMP, clearly highlighting the role of
transcript structure, as well as substrate structure, in
determining the efficiency of transcript extension. These results
show that Y639F can initiate and elongate transcripts with dGTP
substituted for rGTP but normal extension of the transcripts in the
2-8 base range is impaired leading to a large increase in the
proportion of poly-dG and short transcripts synthesized. Addition
of rGMP to serve as the initiating nucleotide and the use of a
supercoiled template both enhance the ability of the mutant to
extend the short transcripts during the initial stages of
transcription.
[0118] Barriers to initiation and extension of the initial
transcript with dNTPs: FIG. 2 reveals that Y639F can efficiently
transcribe with dGTP the initial G segment of a promoter that
initiates "GGGA" but is severely blocked in extending the dG trimer
with the A. This implies that the sequence of the initially
transcribed region may influence the efficiency with which Y639F
can extend the transcript when using dNTPs. FIG. 2 also shows that
supercoiling, which presumably facilitates unwinding of the
template, enhances the activity of Y639F when using dNTPs. To
evaluate the effects of sequence and single-strandedness in the
initially transcribed region on the activity of Y639F when using
dNTPs, we examined transcription from a set of synthetic promoters
which differed in the sequence of their initially transcribed
regions and in being fully double-stranded or single-stranded in
their initially transcribed regions (FIG. 3).
[0119] FIG. 3 shows the effects of single-strandedness and sequence
in the initially transcribed region on the activity of Y639F in
reactions with 4 rNTPs or 4 dNTPs. Poly-rG transcripts of various
sizes are indicated in lane a. Reactions contained the indicated
NTPs and polymerases. Polymerase and promoter concentrations were
10.sup.-6 M and 10.sup.-5 M, respectively. NTP concentrations and
electrophoresis as in FIG. 1. Indicated in some of the lanes are
the sequences of different transcripts as deduced from alignment
with poly-rG or poly-dG ladders synthesized in the presence of rGTP
or dGTP only. The synthetic promoter templates used are
double-stranded and have the sequence--CGAAATTAATACGACTCACTATA (SEQ
ID NO:2)--in their -23 to -1 regions. The promoters differ in their
initially transcribed regions as follows: b-e, t, u: GGACT; f-j, v,
w: GAGACCGG; a, j-m, x, y: GGGAGACC; n, o, z: GGAAAATT; p-s:
GGGGGGGGGGGACT (SEQ ID NO:3). The promoters also differ in being
double-stranded (b, d, f, h, j, l, p, r) or single-stranded (other
lanes) in their transcribed regions.
[0120] For most of the promoters tested, transcription with rNTPs
was not markedly affected by having the initially transcribed
region be single-stranded. However, when transcribing with 4 dNTPs,
Y639F was more active on the partially single-stranded promoters.
For example, in lane e (partially single-stranded promoter) of FIG.
3 transcription products are both more abundant and extend to
greater lengths than in lane d, where the promoter is fully
double-stranded. A similar comparison may be made between lanes m
and 1 or s and r. Regarding sequence we found that a promoter which
initiated with 3 G's was superior to a promoter which initiated
with two, which was in turn superior to a promoter which initiated
with just one G. Thus Y639F activity when using dNTPs was greatest
on a promoter which initiates "GGGAGACC" (lanes l and m). The
initially transcribed region of this promoter corresponds to the
consensus sequence for T7 promoters in the +1 to +6 segment. This
was the only promoter which, when fully double-stranded, gave rise
to high levels of transcript synthesis with Y639F in reactions
(containing only dNTPs (lane l).
[0121] Promoters which initiated with 2 G's (lanes d, e, o) gave
lower levels of transcript synthesis in the 4 dNTP reactions, and a
promoter which initiated with 1 G (lanes h, i) was not utilized by
Y639F in reactions with 4 dNTPs. Within the initially transcribed
region, elements other than the number of G's appear to be
important. For example, we have found that the w.t. or Y639F
polymerases are less efficient in initial transcription extension
on the T7 promoter found in the pBS plasmid which initiates GGGC,
than on the .phi.10 promoter found in pT75 which initiates with the
consensus GGGAGA (data not shown).
[0122] Another example is evident in lanes n and o which show the
transcripts obtained on a partially single-stranded promoter that
initiates GGAAAAUU. Like the promoter used in lanes c and e, this
promoter initiates with 2 G's but normal transcript extension on
this promoter is less efficient than on the promoter that initiates
GGACU. In the 4 rNTP reactions (lanes c, n), the proportion of
short transcripts (dimers, trimers) is greater in lane n and we
observe significant amounts of poly-rG transcripts beyond the dimer
length in lane n but not in lane c. In the 4 dNTP reactions almost
all of the transcripts in lane o terminate at the trimer or
tetramer length. Because increasing the number of Gs from 1 to 3
enhanced Y639F activity when using dNTPs, we tested a promoter
which initiated with a run of 11 G's (lanes p-s). A potential
drawback to such a promoter is that such a long run of G's could
inhibit the ability of the polymerase to unwind the template. Since
T7 promoters with more than 3 consecutive G's in the initial region
do not occur naturally, it may be that for other reasons such
sequences do not favor initial transcript extension. In fact, we
find that this promoter is a poor template. When it is fully
double-stranded, initiation and extension of the transcript is
inefficient with either rNTPs (lane p) or dNTPs (lane r),
consistent with the expectation that a promoter with this sequence
would be difficult to melt. Initiation and transcript extension is
enhanced when this promoter is partially single-stranded (lanes q
and s), but while poly-G transcripts from 2 to 7 or more bases in
length are abundant, runoff transcripts of the expected length are
not predominant products. In reactions with 4 rNTPs the transcript
patterns of the w.t. and Y639F polymerases are virtually identical
so we do not repeat the 4 rNTP reactions with the w.t. enzyme in
FIG. 3. Lanes t-z show that the w.t. enzyme is virtually inactive
in reactions with 4 dNTPs and the same set of promoter used in
lanes b-s.
[0123] Relative selectivity of the mutant and w.t. polymerases for
dNTPs and rNTPs: FIGS. 1-3 present a qualitative analysis of the
structure of the transcripts produced by the w.t. and Y639F
polymerases with various combinations of NTPs. They show that Y639F
can use dNTPs with high efficiency and that both transcript and
substrate structure play a role in determining the efficiency of
transcript extension. To obtain a quantitative measure of the
relative selectivity of the w.t. and mutant polymerases for dNTPs
vs. rNTPs under conditions where transcript structure was not a
complicating factor, we carried out reactions in which all 4 rNTPs
were present but rNTPs or dNTPs were used to radiolabel the
transcripts (Table 1, see Appendix 1). Under these conditions the
unlabeled rNTPs were present in vast excess relative to the
labeling NTPs so labeling dNTPs are almost always incorporated
adjacent to rNTPs and into transcripts of nearly uniform rNMP
structure. On average the mutant enzyme is .sup..about.20-fold less
selective for rNTPs over dNTPs than the w.t. enzyme. We used this
assay to screen our collection of T7 RNAP active site mutants for
increased dNTP utilization. In this screen we looked for increased
dATP incorporation in transcription reactions with all of these
mutants using supercoiled pT75 as the template, 4 cold rNTPs, and
P.sup.32-rATP or P.sup.32-DATP to label. Since these results were
negative with the exception of the tyrosine 639 mutants, we do not
present them here, but the mutants tested in this way are listed in
"Materials and Methods". It has been reported that use of Mn.sup.++
instead of Mg.sup.++ decreases substrate discrimination and
increases miscoding for a number of polymerases (Tabor and
Richardson, 1989; Nivogi and Feldman, 1981). We, therefore,
examined the rNTP/dNTP selectivity of the mutant and w.t. enzymes
in Mn.sup.++-citrate buffer (Tabor and Richardson, 1989). With
Mn.sup.++ the preference of both the w.t. and Y639F polymerases for
rNTPs over dNTPs was markedly reduced.
[0124] Relative activity of the w.t. and Y639F polymerases with
different NTP combinations: The relative activities of the Y639F
and w.t. polymerases with supercoiled pT75 as a template and
various combinations of rNTPs/dNTPs were measured in both Mg.sup.++
and Mn.sup.++ buffers (Table II, see Appendix 1). In Mg.sup.++
buffer, substitution of a single rNTP with a dNTP reduces w.t.
activity by 20 to >400-fold, but only modestly reduces the
activity of Y639F. The rank order of the effect of a particular
dNTP substitution on w.t. enzyme
activity--dGTP>dATP>dCTP>dTTP=dUTP--matches the order of
their addition to the transcript. With the "2 dNTP" reactions the
w.t. enzyme was most active when rCTP and rUTP were substituted
with dNTPs, corresponding to the 2 nucleotides added latest to the
transcript. The w.t. enzyme was inactive with all other "2 dNTP" or
"3 dNTP". In the "2 dNTP" reactions Y639F was least active in the
dGTP, dATP reaction, corresponding to the 2 nucleotides
incorporated first during transcription. In the "3 dNTP" reactions
Y639F was least active in the dGTP, dATP, dCTP reaction,
corresponding to the 3 nucleotides incorporated first during
transcription.
[0125] In Mn.sup.++ buffer both the w.t. enzyme and Y639F show a
reduction in their sensitivity to substitution of dNTPs for rNTPs,
consistent with an expectation of reduced substrate discrimination
in Mn.sup.++ buffer. There was, however, also a sharp reduction in
overall activity with Mn.sup.++. We varied Mn.sup.++ concentrations
over a wide range (from 20 mM to 150 .mu.M in 2-fold dilutions) to
determine if an optimal Mn.sup.++ concentration that would result
in high activity could be identified, but we found similar activity
at all Mn.sup.++ concentrations tested (data not shown). Thus,
while discrimination between rNTPs and dNTPs was less in Mn.sup.++
buffer, Y639F is more active in Mg.sup.-+ buffer than in Mn.sup.++
buffer with all NTP combinations examined. Similarly, the w.t.
enzyme exhibits greatly reduced discrimination between rNTPs and
dNTPs in Mn.sup.++ buffer, but is modestly more active in Mn.sup.++
buffer than in Mg.sup.++ buffer only for certain combinations of
dNTPs and rNTPs.
[0126] DNA and RNA synthesis on homopolymeric templates: T7 RNAP
will synthesize poly(rG) RNAs on poly(dC) templates (Bonner, et
al., 1994; Ikeda and Richardson 1987). We measured the activity of
the w.t. and mutant polymerases on poly(dI).cndot.poly(dC) with
rGTP, dGTP, dGTP+rGMP (Table III, see Appendix 1). The activity of
T7 RNAP on poly(dI).cndot.poly(dC) and poly(dC) is especially
robust. Mutant polymerases that have greatly reduced activity on
normal promoter templates still display high activity on poly(dC)
templates (Bonner, et al., 1994). We, therefore, characterized two
poorly active non-conservative tyrosine mutations on this template
(Y639A and Y639S). In Table III we also present results obtained
with mutant G640A. Presentation of data for the latter mutant was
selected because it is more comparable in activity to the Y639A/S
mutants and because it is representative of a mutation which has
marked effects on the kinetics of transcription but does not affect
substrate discrimination, even though it is directly adjacent to
Y639. We find that all of the Y639 mutants exhibit reduced
substrate discrimination as demonstrated by the fact that their
differential activity in reactions containing dGTP or dGTP+rGMP vs.
rGTP is less than for the w.t. enzyme or the G640A mutant. In fact
Y639F displays similar activity with rGTP, dGTP, or dGTP+rGMP.
[0127] Since the nucleic acid synthesized by Y639F on
poly(dI).cndot.poly(dC) using dGTP is presumably composed solely of
dNMPs it is expected to be resistant to alkaline hydrolysis
(Schmidt and Tannhauser, 1945). FIG. 4 shows transcription by Y639F
and w.t. polymerase with dGTP or rGTP on poly(dI).cndot.poly(dC).
Transcription reactions were carried out with
poly(dI).cndot.poly(dC) at 0.2 mg/ml and the indicated NTPs and
polymerases. Reaction products were left untreated (-) or treated
with 1 M NaOH for 5 hours at 37.degree. C. (+). Polymerase and NTP
concentrations and electrophoresis as in FIG. 1. Labeling was with
.alpha.-P.sup.32 rGTP (a, d, g, j) or .alpha.-P.sup.32 dGTP (other
lanes). FIG. 4 shows the transcription products obtained with the
w.t. or Y639F polymerases on poly(dI).cndot.poly(dC) before and
after treatment with alkali. With dGTP or dGTP+rGMP the w.t. enzyme
is poorly active in the synthesis of long transcripts, however we
can observe smears of heterogeneously sized, short transcripts in
the reactions with the w.t. enzyme and the dGTP substrates (lanes e
and f) while Y639F synthesizes higher levels of long transcripts
which are retained near the top of these gels (lanes b and c). The
presence of these short transcripts indicates that Y639F and the
w.t. enzyme differ only in the degree to which they can utilize
dNTPs. The w.t. can also initiate and extend transcripts with dGTP,
but it is much less processive when using dNTPs than Y639F so its
transcripts are much shorter. When these reactions are treated with
base, degradation of the long transcripts made in the reactions
with rGTP is observed and the amounts of short RNAs (presumably
hydrolysis products) increase (lanes g and j). In the reactions in
which dGTP or dGTP+rGMP were used as substrates no degradation of
the transcripts by base treatment is observed, confirming that
these transcripts are composed of dNMPs.
[0128] T7 RNAP as a reverse transcriptase or RNA replicase which
initiates de novo: It has been reported that T7 RNAP can use both
RNA and DNA templates (Konarska and Sharp, 1989). We, therefore,
determined if the Y639F mutant would use dNTPs when transcribing an
RNA template (poly(rC), Table IV). Overall the activity of the w.t.
and Y639F polymerases on poly(rC) with rGTP was 10-20-fold less
than on poly(dC) (not shown), but this reduction did not preclude
synthesis of high levels of RNA on poly(rc) by using higher
polymerase concentrations than were used in the
poly(dI).cndot.poly(dC) reactions. When dGTP or dGTP+rGMP was used
the w.t. enzyme was not measurably active on poly(rC), while the
activity of Y639F was reduced by only .sup..about.4-fold with
dGTP+rGMP) or .sup..about.8-fold (with dGTP). Thus, both the w.t.
and Y639F polymerases are capable of unprimed RNA-directed RNA
polymerization while Y639F is also capable of unprimed reverse
transcription.
[0129] DNA- and RNA-primed synthesis of DNA and RNA: In the assays
described so far we have examined de novo initiated synthesis. T7
RNAP can also extend RNA primers. We, therefore, examined the
abilities of both polymerase to carry out DNA or RNA primed
synthesis of DNA and RNA (FIG. 5).
[0130] FIG. 5 shows primed synthesis of DNA and RNA with Y639F and
the w.t. polymerase. Transcription reactions contained end-labeled
12 base DNA or RNA primers of identical sequence (GGACACGGCGAA, SEQ
ID NO: 4) hybridized to a DNA template
(CCCGGGATGGAATGGAGTATTCGCCGTGTCCATGGCTGTAAGTATCC, SEQ ID NO: 5).
Primer-template concentrator was 10.sup.-5 M. Reactions contained
the indicated polymerases (10.sup.-7 M) and NTPs. NTP
concentrations and electrophoresis as in FIG. 1.
[0131] We found that both the w.t. and Y639F polymerases can extend
DNA and RNA primers with rNTPs, but extension of DNA primers was
2-3-fold less efficient than extension of RNA primers. Y639F also
extended DNA and RNA primers with dNTPs but .sup..about.4-fold less
efficiently than with rNTPs.
[0132] The Y639F mutant does not exhibit greatly increased
miscoding: We examined the miscoding properties of the w.t. and
mutant T7 RNAPs by measuring the relative incorporation of labeled
rGTP, rUTP, rATP, and rCTP on poly(dC) or poly(dT) templates in the
presence of excess unlabeled rGTP or rATP, respectively (Table V,
see Appendix 1). An increase in miscoding would be reflected in an
increase in the rate of incorporation of the non-complementary NTP
into RNA.
[0133] On poly(dC), the w.t., Y639F, and G640A polymerases
incorporate rGTP into RNA at greater than 1300-2000-fold the rate
of rUTP incorporation. Ribo-GTP is incorporated some 400-600-fold
better than rCTP, and 200-400-fold better than rATP. Because of
their lower activity we can say only that the relative rate of
incorporation of rGTP on poly(dC) is 184-fold greater than the rate
of incorporation of non-complementary rNTPs for Y639A, and 50-fold
greater for Y639S. The use of Mn.sup.++ instead of Mg.sup.++ has
been reported to increase miscoding for a number of polymerases
(Tabor and Richardson, 1989; Nivogi and Feldman, 1981) so we
examined the effects of Mn.sup.++ on miscoding by w.t. and Y639F
polymerases. In Mn.sup.++ buffer the G640A, Y639A, and Y639S
mutants were insufficiently active to allow accurate measures of
miscoding. With the w.t. and Y639F polymerases the use of Mn.sup.++
increases miscoding by 20-40-fold. However, the apparent rate of
miscoding by Y639F remains similar to the w.t enzyme.
[0134] On poly(dT), high levels of activity allowing an accurate
measure of miscoding frequencies could only be observed for Y639F
and the w.t. polymerase in both Mg.sup.++ and Mn.sup.++ buffers. In
Mg.sup.++ buffer apparent miscoding rates on poly(dT) were higher
than on poly(dC), but were similar for Y639F and the w.t. enzyme.
In Mn.sup.++ buffer miscoding rates were increased by
.sup..about.5-fold, on average, but again rates were similar for
w.t. and Y639F. However, on poly(dT) Y639F did show a reproducible
.sup..about.2-fold increase, relative to the w.t. enzyme, in the
ratio of the rates of rGTP to rATP incorporation.
[0135] Homopolymer assays have been used previously to measure
miscoding by RNAPs (Nivogi and Feldman, 1981; Glazer, 1978; Blank,
et al., 1986) but it should be remarked that they can produce only
upper bounds for miscoding frequencies. Measured miscoding rates
could reflect contamination of the homopolymeric templates. It is
also possible that the transcripts themselves could serve as
templates and support incorporation of rNMPs non-complementary to
the original template (i.e., the poly(rG) or poly(rA) transcripts
made on poly(dC) or poly(dT) could subsequently support synthesis
of poly(rC) or poly(rU) transcripts). Such caveats are less
relevant to the miscoding observed in Mn.sup.++ buffer since the
change in divalent cation increases miscoding but cannot affect
template composition. However, in Mg.sup.++ buffer we should
consider the measured miscoding frequencies to be upper bounds for
the true rates of miscoding. Nevertheless, the results presented in
table V indicate that Y639F does not exhibit a gross increase in
miscoding which would manifest itself as a clear increase in the
incorporation of non-complementary rNMPs on homopolymeric
templates.
[0136] The increased utilization of dNTPs by Y639F is due to both a
decreased K.sub.m and an increased k.sub.cat for dNTPs: The K.sub.m
and k.sub.cat of the w.t. and Y639F polymerases with rATP, rITP and
5 different dNTPs were measured (Table VI, see Appendix 1). The
K.sub.m of the w.t. enzyme for dNTPs was much higher than
previously reported values for the corresponding rNTPs and varied
considerably for different dNTPs (Ikeda and Richardson, 1987;
Patra, et al., 1992). Notably the w.t. enzyme K.sub.m values
correlate with the rNTP/dNTP selectivity values presented in Table
I. The selectivity of the w.t. enzyme with ribo- vs.
deoxy-nucleotides was greatest for CTP, followed by ATP, and was
the least for UTP, implying that an important component of the
selectivity of the w.t. enzyme for rNTPs over dNTPs is a much
higher K.sub.m for dNTPs. For Y639F, the K.sub.m values for these
dNTPs are from .sup..about.3 to .sup..about.11-fold less, but the
rank order of these K.sub.m values (dCTP K.sub.m>dATP
K.sub.m>dGTP K.sub.m>dTTP K.sub.m) is the same as for the
w.t. enzyme. For Y639F, k.sub.cat values for reactions with
different dNTPs were only 2-4 fold less than for rNTPs, while the
w.t. enzyme displayed k.sub.cat values with dNTPs that were from
.sup..about.6 to .sup..about.30-fold less than for rNTPs.
[0137] Elongation rates of Y639F in reactions containing a single
dNTP: Elongation rates for Y639F in reactions with 4 rNTPs or 1
dNTP and 3 rNTPs were determined by analyzing aliquots, taken at 10
second intervals, from transcription reactions initiated on
supercoiled PT75 by adding NTPs to otherwise complete reaction
mixes (FIG. 6).
[0138] FIG. 6 shows relative elongation rates of Y639F in "4 rNTP"
and "3 rNTP+1 dNTP" reactions. The template was supercoiled pT75 at
5.times.10.sup.-7 M. Y639F polymerase was used at a concentration
of 10.sup.-6 M. Reactions contained the indicated NTPs. Labeling
was with .alpha.-P.sup.32-rATP (lane e) or .alpha.-P.sup.32-rGTP
(other lanes). After initiation of the reactions aliquots were
taken at 10 second intervals and analyzed on 1% agarose
denaturing-formaldehyde gels. The figure shows the 20 second time
point. The bars indicate the positions of .lamda. DNA markers.
[0139] When analyzed on denaturing agarose gels (FIG. 6) the
heterogeneously sized transcripts from these reactions are resolved
as a smear with the trailing edge of the smear corresponding to
transcripts initiated at t=0 and from which the maximal transcript
elongation rate can be determined (Golomb and Chamberlin, 1974;
Bonner, et al., 1994). The following elongation rate reductions
(relative to a `4 rNTP` reaction) were obtained for reactions
containing a 3 rNTPS and 1 dNTP:dATP, 3-fold; dUTP,
.sup..about.2-fold; dGTP .sup..about.1.5-fold; dCTP, 1-1.5-fold.
Because of its poor activity in reactions with dNTPs we could not
determine the corresponding elongation rate reductions for the w.t.
enzyme.
[0140] Other non-canonical nucleoside triphosphate substrates for
mutant polymerases: Although wild-type T7 RNAP can not efficiently
utilize dideoxy-NTPs as substrates, we have found that Y639 mutants
of this enzyme can also use dideoxy-NTPs as substrates (Table VII).
We have also found that Y639 mutants can use other non-canonical
nucleoside triphosphates as substrates (Table VIII). Nucleic acids
synthesized by incorporation of some non-canonical nucleotides,
such as 2'-F-NTPs, may offer advantages in being more resistant to
digestion by nucleases such as ribonucleases. Other uses and
advantages of various non-canonical nucleotide substrates in
methods of the present invention using the mutant polymerases will
be apparent after examination of the specification, claims and
drawings.
[0141] Other mutations: It is conceivable that, in the absence of a
bound rNTP, a hydrogen bond forms between Y639 and some other
active site side chain. The possibility of an interaction between
M635 and Y639 was tested since M635 and Y639 are close and M635
approaches the ribose in our models of NTP in T7 RNAP (Huang, et
al., submitted for publication). This position is methionine in the
T7 RNAP class of RNAPs (McAllister, W. T., 1993), but is either
tyrosine or phenylalanine in the homologous DNAPs, and in the DNAP
mutants at this site (i.e., positions homologous to position 762 in
E. coli DNAP I) that affect dNTP/ddNTP discrimination (Tabor. S.,
and Richardson, C. C., European patent application, 1994). While
M635A, M635F or M635Y mutants had effects on NTP K.sub.m, they did
not affect 2'-group discrimination with respect to dNTPs and rNTPs
in either wild-type or the Y639F T7 RNAP background. Additional
studies will reveal whether these M635 mutations have other
effects, such as effects on discrimination at the 3'-position of
the sugar, or effects on discrimination with respect to NTPs with
other substituents, such as fluorine at the 2' position of the
sugar. Also, studies on similar double mutations at the homologous
sites in the homologous class I DNAPs will reveal the effects of
such double mutations on discrimination at the 2'- and 3'-positions
of the sugar; specifically, these studies will reveal whether class
I DNAPs having a phenylalanine at the position homologous to amino
acid position 766 in E. coli DNAP I have reduced discrimination for
rNTPs if the amino acid is methionine or tyrosine at the position
homologous to amino acid position 762 in E. coli DNAP I.
[0142] Provided that class I DNAP mutants which have a reduced
discrimination for rNTPs compared to dNTPs can be obtained, it will
be possible to use such DNAP mutants to carry out the methods of
the present invention that comprise nucleic acid synthesis from a
nucleic acid primer, at least part of which is sufficiently
complementary to a template nucleic acid to hybridize therewith and
to be extended by the polymerase. An especially preferable use for
such mutant DNA polymerases would be to carry out Partial
Ribo-substitution sequencing reactions from primers, whether
labelled by any of the methods known in the art, or unlabelled.
Since the sequence-delimiting rNTP nucleotides for the Partial
Ribo-substitution Reaction do not terminate the growing
phosphodiester chain when they are incorporated during nucleic acid
synthesis, the DNA synthesis for Partial Ribo-substitution can
occur simultaneous with and be identical to nucleic acid synthesis
for another procedure, such as NASBA, 3SR, TMA or another similar
method, provided that the mutant DNAP with reduced discrimination
for rNTP compared to dNTPs is thermostable, or the PCR strand
displacement amplification or other methods for nucleic acid
amplification involving nucleic acid synthesis from a primer. The
nucleic acid products containing the sequence-delimiting rNMPs can
then be cleaved by treatment with a chemical base or a
ribonuclease, and analyzed by methods known in the art to obtain
the nucleotide-specific pattern of bands or, provided that a
Partial Ribo-substitution Reaction is carried out for each of the
four nucleotides, the complete sequence of the nucleic acid. Also,
provided that primers with distinguishable non-radioactive labels
are used, multiple Partial Ribo-substitution sequencing reactions
may be carried out simultaneously in the same reaction mixture and
run and read in the same lane of a polyacrylamide gel or capillary
tube or other matrix for separating the fragments based on size, as
is the case for all of the methods of the present invention
described herein.
C. Discussion
[0143] Our results reveal that mutations of tyrosine 639 in T7 RNAP
reduce the ability of the polymerase to discriminate between rNTPs
and dNTPs. A conservative mutation which removes the tyrosine
hydroxyl but retains the phenolic ring (Y639F) exhibits w.t.
activity but an average reduction of .sup..about.20-fold in the
selectivity for dNTPs over rNTPs (Table I). Non-conservative
mutations of this tyrosine (Y639A/S) also display decreased
rNTP/dNTP discrimination (Table III), but are less active than the
w.t. enzyme. Replacement of an rNTP by a dNTP typically reduces
Y639F transcript elongation rates by only a factor of two. Tyrosine
639 is conserved in a large number of DNA-directed RNA and DNA
polymerases (Delarue, et al., 1990). In DNAP I, mutations of the
Y766 to serine and phenylalanine have been characterized (Polesky,
et al., 1989; Carrol, et al., 1991). The Y766S mutation was alone
amongst a number of active site mutations characterized in
decreasing DNAP I fidelity (increasing miscoding). The Y766F
mutation displayed w.t. fidelity and activity. Similarly, the T7
RNAP Y639F mutant displays w.t. kinetics (Bonner, et al., 1992,
1994; Woody, et al., 1994), and the only effect we can identify for
this mutation in T7 RNAP is the reduced substrate discrimination
reported here. Thus, while T7 RNAP Y639F showed decreased dNTP/rNTP
selectivity, it did not exhibit increased miscoding as assessed by
incorporation of non-complementary NTPs on homopolymeric
templates.
[0144] The Y639 T7 RNAP mutations present us with, in one sense,
the functional unification of polymerases to go along with their
structural unification. The active site of w.t. T7 RNAP is
forgiving with regards to template structure (RNA or DNA) or mode
of initiation (primed or de novo). A mutation which relaxes the
substrate selectivity of this polymerase further expands the range
of activities which it can display in vitro. Depending on the
substrates and templates presented to it, the Y639F T7 RNAP can act
as an RNA- or DNA-directed RNA or DNA polymerase in primed or de
novo initiated reactions. Thus it can display a variety of
activities normally associated with distinct polymerases, including
some entirely novel activities such as de novo initiated reverse
transcription or mixed dNMP/rNMP polymer synthesis.
Example 2
A mutant SP6 RNA Polymerase as a DNA Polymerase
[0145] After the observations made above with T7 RNAP, we decided
to examine bacteriophage SP6 RNA polymerase to determine whether
the DNA synthesis properties observed for the mutant T7 RNAP could,
as expected, be extended to other mutant polymerases. Bacteriophage
SP6 is a lytic phage which infects the bacterial species Salmonella
tryphimurium (Butler and Chamberlin, 1982). SP6 phage resembles E.
coli phage T7 and their genomes are comparable in size, gene
organization and pattern of gene expression (Kassavetis, et al.,
1982).
[0146] The phage encoded RNA polymerases are very similar in size
(Butler and Chamberlin, 1982) and amino acid sequence (Katani, et
al., 1987).
[0147] The homologous tyrosine at position 639 in T7 RNA polymerase
is readily identified at position 631 in SP6 RNA polymerase (FIG.
7). Substitution of tyrosine 631 with phenylalanine in the SP6 RNA
polymerase was expected to confer the same phenotypic changes in
catalytic properties in this enzyme as were demonstrated for
Y639FT7 RNA polymerase (Example 1).
[0148] Localized Mutagenesis. Refer to FIG. 7 for a summary of the
amino acid and nucleotide sequence surrounding TYR631 in the SP6
RNA polymerase gene. Mutagenesis of the Y631 residue may be
accomplished by the method of Kunkel, et al. (1991). Alternatively,
one of the many other methods for mutagenesis known to those of
skill in the art may be used. The amino acid and nucleotide
sequences of the resulting TYR631PHE mutant SP6 RNA polymerase are
also given in FIG. 7. As shown, the A residue at position 2 in
codon 631 of the SP6 RNA polymerase gene was changed to a T. This
results in the loss of the single NdeI restriction enzyme site
which is present in the wild-type gene, permitting identification
of mutant clones.
Preparation and Purification of Mutant RNA Polymerase
[0149] A single clone was selected in which the NdeI site was
missing and which expressed SP6 RNA polymerase activity. Several
liters of LB+Amp were grown from a pUC18 Y631F SP6 RNA polymerase
clone overnight at 37.degree. C. Cells were harvested, lysed and
Y631F mutant SP6 RNA polymerase was purified approximately
according to standard methods (Butler and Chamberlin, 1983).
Transcription Reactions
[0150] To verify that Y631F SP6 RNAP had the desired phenotype, in
vitro transcription reactions were done where one of the four rNTPs
was substituted by the corresponding dNTP (Sousa and Padilla,
1995). As expected, the Y631F SP6 RNAP mutant displayed reduced
dNTP/rNTP discrimination compared with wild-type SP6 RNAP, similar
to that observed for the Y639 mutant of T7 RNAP.
[0151] In a standard in vitro transcription reaction using the four
ribonucleoside triphosphates (rATP, rGTP, rCTP, and rUTP), both
enzymes, the wild-type SP6 RNA polymerase as well as the Y631F
mutant, synthesized the correct 1.4 kb transcript and in the
expected amounts as visualized on gels. However, if one of the four
ribonucleoside triphosphates, rGTP for example, is completely
substituted by dGTP and in vitro transcription reactions are done
with the wild-type and mutant enzymes, no transcript is made by the
wild-type enzymes. However, the mutant enzyme makes the expected
full length transcript in good yield as observed on agarose
gels.
APPENDIX 1
TABLE-US-00001 [0152] TABLE I Relative Selectivity of Y639F and
W.T. Polymerase for rNTPs vs. dNTPs rATP/dATP rUTP/dTTP rCTP/dCTP
rGTP/dGTP Y639F 8.5-10 (Mg)* 1.7-1.9 2.4-2.5 .93-1.6 .9-1.0 (Mn)*
.48-.76 .55-.80 .98-.99 W.T. 72-83 (Mg)* 22-25 110-150 51-67 6-14
(Mn)* 2.3-2.8 4.3-5.1 4.4-6.3 *For each rNTP/dNTP and polymerase
the upper numbers are those obtained in Mg.sup.++ buffer, the lower
numbers are from Mn.sup.++ buffer. Polymerases at 10.sup.-8 M.
Template was supercoiled pT75 at 10.sup.-7 M.
[0153] Reactions were carried out with all 4 rNTPs (0.5 mM) in
great excess over radioactive rNTPs or dNTPs. Relative selectivity
was determined from the relative percentages of radioactive rNTP
vs. dNTP incorporated into RNA. Maximal incorporation was less than
.sup..about.30% of total input radioactivity with all data points
used so as to limit effects due to changing NTP concentrations
during the experimental time course. The numbers shown give the
range for 2 experiments.
TABLE-US-00002 TABLE II Relative Activity of Y639F and W.T.
Polymerase with Different rNTP/dNTP Mixes W.T. Y639F W.T. Y639F
(Mg.sup.++) (Mg.sup.++) (Mn.sup.++) (Mn.sup.++) 4 rNTPs 200.sup.
200 21-23 9 3 rNTPs, dTTP 11-13 90-96 7-8 4 3 rNTPs, dUTP 9-11
82-91 10-11 7-8 3 rNTPs, dATP 1-2 73 1-2 2-3 3 rNTPs, dCTP 4-9 86
15 7-11 3 rNTPs, dGTP, rGMP <.5 95-109 1-3 1.4-2.5 3 rNTPs, dGTP
<.5 43-63 .5-2 3 2 rNTPs, dCTP, dUTP 2-6 27-29 3 4-7 2 rNTPs,
dCTP, dTTP 2.sup. 30 5-7 5 2 rNTPs, dCTP, dATP <.5 20-29 .5-.9
4-7 2 rNTPs, dTTP, dGTP, rGMP <.5 13-15 <.5 3-6 2 rNTPs,
dATP, dTTP <.5 11-14 <.5 3-4 2 rNTPs, dCTP, dGTP, rGMP <.5
11-14 <.5 2-5 2 rNTPs, dATP, dGTP, rGMP <.5 5-6 <.5 1-1.5
1 rNTP, dCTP, dATP, dTTP <.5 12-14 <.5 .7-2 1 rNTP, dCTP,
dATP, dUTP <.5 10-11 <.5 2-3 1 rNTP, dTTP, dCTP, dGTP* <.5
10-13 <.5 2-4 1 rNTP, dTTP, dATP, dGTP* <.5 11 <.5 1.5-2 1
rNTP, dCTP, dATP, dGTP* <.5 3-5 <.5 1-2 4 dNTPs, rGMP <.5
<5 <.5 .5 *These reactions also contain rGMP. Numbers give
ranges from 2 experiments. Template was supercoiled pT75 (10.sup.-7
M), polymerases at 10.sup.-8 M (in Mg.sup.++buffer) or 10.sup.-7 M
(in Mn.sup.++ buffer). rNTPs, rGMP, dTTP were at .5 mM; dATP, dGTP
were at 1 mM; dUTP was at 2.5 mM, dCTP was at 5 mM. From top to
bottom the labeling NTPs were: .alpha.-P.sup.32 rGTP,
.alpha.-P.sup.32 rCTP, .alpha.-P.sup.32 rCTP, .alpha.-P.sup.32
dATP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32 dGTP,
.alpha.-P.sup.32 dGTP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32
dTTP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32 dTTP,
.alpha.-P.sup.32 dTTP, .alpha.-P.sup.32 dCTP, .alpha.-P.sup.32
dATP, .alpha.-P.sup.32 dTTP, .alpha.-P.sup.32 dCTP,
.alpha.-P.sup.32 dTTP, .alpha.-P.sup.32 dTTP, .alpha.-P.sup.32
rCTP, .alpha.-P.sup.32 dCTP.
TABLE-US-00003 TABLE III Relative activity on poly(dI) poly(dC)
W.T. Y639F G640A Y639A Y639S rGTP 1000 1000 240 (200-270) 145
(142-151) 48 (47-50) dGTP 7.4 (5.4-12.5) 964 (684-1257) <5 5.3
(4.8-5.5) .6 dGTP + rGMP 25 (20-27) 1070 (816-1457) <5 25
(17-30) 4.4
[0154] Numbers give mean and range from 3 experiments. Templates
were at 0.2 mg/ml, polymerases at 10.sup.-8 M. Labeling NTPs were
.alpha.-P32 rGTP, .alpha.-P32 dGTP, .alpha.-P32 rATP, .alpha.-P32
dATP, as appropriate. rNTPs or rNMPs at 0.5 mM; dNTPs at 1 mM.
TABLE-US-00004 TABLE IV W.T. and Y639F activity on an RNA
(poly(rC)) template .5 mM GTP 1 mM dGTP 1 mM dGTP + .5 mM GMP w.t.
1000 <.5 <.5 Y639F 505 (358-733) 62 (48-80) 116 (90-148)
[0155] Numbers give mean and range from 3 experiments. Template was
at 0.2 mg/ml, polymerases at 10.sup.-6 M. Labeling NTPs were
.alpha.-P32 rGTP, .alpha.-P32 dGTP.
TABLE-US-00005 TABLE V Relative rates of incorporation of
complementary and non-complementary rNTPs on homopolymeric
templates by w.t. and mutant polymerases W.T. Y639F G640A Y639A
Y639S I. Template: poly(dC) GTP/UTP >2000 (Mg.sup.++*) >1760
>1320 >184 >50 53 (Mn.sup.++)* 55 n.d. n.d. n.d. GTP/CTP
400 550 508 >184 >50 32 40 n.d. n.d. n.d. GTP/ATP 233 338 388
>184 >50 9.3 8 n.d. n.d. n.d. II. Template: poly(dT) ATP/GTP
170 94 n.d. n.d. n.d. 50 27 n.d. n.d. n.d. ATP/UTP 121 94 n.d. n.d.
n.d. 21 20 n.d. n.d. n.d. ATP/CTP >340 >94 n.d. n.d. n.d. 77
60 n.d. n.d. n.d. *The upper number refers to results obtained in
Mg.sup.++ buffer, the lower number to results in Mn.sup.++ buffer.
n.d.: G640A, Y639A, Y639S were poorly active in Mn.sup.++ buffer,
or on poly(dT) under all conditions.
[0156] Numbers are averages from 2 experiments and reflect the
ratio of the percentages of labeled rNTPs incorporated into RNA in
reactions in which unlabeled complementary rNTPs were in great
excess (0.5 mM) to labeled complementary or non-complementary
rNTPs. Templates were at 0.1 mg/ml. Polymerases were at 10.sup.-8 M
in Mg.sup.++ buffer and 10.sup.-7 M in Mn.sup.++ buffer.
TABLE-US-00006 TABLE VI Kinetic Constants for Y639F and the W.T.
polymerase with rNTPs or dNTPs rATP rITP dTTP dUTP dCTP dGTP dATP
Y639F: K.sub.m .063-.125 .034-.094 .038-.059 .052-.092 .92-1.6
.185-.264 .20-.35 k.sub.cat 150-210 s.sup.-1 180-200 s.sup.-1
70-110 s.sup.-1 70-130 s.sup.-1 50-90 s.sup.-1 30-60 s.sup.-1 50-70
s.sup.-1 W.T.: K.sub.m .034-.068 .029-.059 .209-.262 4.4-9.0
4.3-13.5 .602-.701 2.0-5.0 k.sub.cat 190-220 s.sup.-1 170-230
s.sup.-1 26-29 s.sup.-1 25-39 s.sup.-1 9-14 s.sup.-1 5-9 s.sup.-1
6-9 s.sup.-1 Numbers give ranges from 3 experiments. The template
was supercoiled pT75 at 10.sup.-7 M, and polymerases were at
10.sup.-8 M.
TABLE-US-00007 TABLE VII 2',3'-dideoxy NTP preferences of the Y639F
mutant ATP/ddATP TTP/ddUTP CTP/ddCTP GTP/ddGTP 9.0 7.0 10. 0
5.0
[0157] Numbers reflect the relative specificity (k.sub.cat/K.sub.m)
for an NTP vs. the corresponding ddNTP. Relative specificities
could not be evaluated for the wild-type T7 RNAP because the ddNTPs
are such poor substrates, but these relative specificities appear
to be at least 150-fold.
TABLE-US-00008 TABLE VIII Activity of W.T. and Y639 mutants with
NTPs containing different 2'-substituents NTP W.T. Y639F Y639M UTP
100 95 .+-. 6.7 50 .+-. 1.2 2'-NH2-UTP 5.9 .+-. .27 12 .+-. .41 3.6
.+-. .19 2'-F-UTP 3.1 .+-. .14 73 .+-. 2.6 23 .+-. .72 2'-dUTP 2.4
.+-. .11 46 .+-. 2.4 11 .+-. .46 CTP 100 103 .+-. 2.3 54 .+-. 3.9
2'-NH2-CTP 34 .+-. .86 60 .+-. 2.5 21 .+-. .38 2'-F-CTP 3.4 .+-.
.22 63 .+-. 3.1 47 .+-. .70 2'-dCTP 1.6 .+-. .16 57 .+-. 1.7 32
.+-. 1.1 ATP 100 96 .+-. 3.0 51 .+-. 1.3 2'-NH2-ATP 18 .+-. .39 21
.+-. .75 .92 .+-. .035 2'-F-ATP 6.6 .+-. .12 50 .+-. 1.4 9.7 .+-.
.20 2'-dATP 2.7 .+-. .28 40 .+-. 1.3 3.2 .+-. .11
[0158] Activity was determined with pT75 as template but with one
of the rNTPs replaced with a dNTP or a 2'-modified NTP. The
labeling NTP was UTP (in reactions with 2'-modified CTPs or ATPs)
or CTP (in reactions with 2'-modified UTPs). Y639F and Y639M
represent enzymes with substitutions of the wild-type (W.T.)
tyrosine at position 639 by phenyalanine (F) or methionine (M),
respectively.
APPENDIX 2
References
U.S. Patents
[0159] U.S. Pat. No. 4,683,202 [0160] U.S. Pat. No. 4,965,188
International Patents
[0160] [0161] Tabor, S and Richardson, C. C. (Filed 24.11.94)
European Patent Application Number 94203433.1; Publication Number 0
655 506 A1.
Publications
[0161] [0162] Astatke, M., Grindley, N. D. F., and Joyce, C. M.
(1995) J. Biol. Chem. 270, 1945-1954. [0163] Axelrod, V. D,
Vartikyan, R. M., Aivazashvilli, V. A., and Bebelashvilly, R. S.
(1978) Nucleic Acids Res. 5, 3549-3563. [0164] Axelrod, V. D, and
Kramer, P. R. (1985) Biochemistry 24, 5716-5723. [0165] Barnes, W.
M. (1978) J. Mol. Biol. 119, 83-99. [0166] Beese, L. S., Friedman,
J. M., and Steitz, T. A. (1993) Biochemistry 31, 9636. [0167]
Blank, A., Gallant, J. A., Burgess, R. R., Loeb, L. A. (1986)
Biochemistry 25, 5920-5928. [0168] Bonner, G., Patra, D., Lafer, E.
M., and Sousa, R. (1992) EMBO J. 11, 3767-3775. [0169] Bonner, G.,
Lafer, E. M., and Sousa, R. (1994) J. Biol. Chem. 42, 25120-25128.
[0170] Butler, E. T. and Chamberlin, M. J. (1982) J. Biol. Chem.
257, 5772-5778. [0171] Carroll, S. S., Cowart, M., and Benkovic, S.
J. (1991) Biochemistry 30, 804-13. [0172] Cazenave, C., and
Uhlenbeck, O. C. (1994) Proc. Natl. Acad. Sci. USA 91, 6972-6976.
[0173] Chapman, K. A., and Burgess, R. R. (1987) Nucl. Acids Res.
15, 5413-5426. [0174] Chapman, K. A., Gunderson, S. I., Arnello,
M., Wells, R. D., and Burgess, R. R. (1988) Nucl. Acids Res. 16,
4511-4530. [0175] Compton, J. (1991) Nature 350:91-92. [0176]
Cotton (1993) Mutation Res. 285:125-144. [0177] Cunningham, P. R.,
and Ofengand, J. (1990) BioTechniques 9(6), 713-714. [0178] Duck,
P. G., Alvarado-Urbina, B., Burdick, B., and Collier, B. (1990)
BioTechniques 9, 142-148. [0179] Fahy, et al. (1991) PCR Methods
& Applications 1, 25-33. [0180] Glazer, R. I. (1978) Nucleic
Acids Res. 5, 2607-2616. [0181] Golomb and Chamberlin, (1974) J.
Biol. Chem. 249, 2858-2863. [0182] DeLarue, M., Poch, O., Tordo,
N., Moras, D., and Argos, P. (1990) J. Protein Engineering 10,
461-467. [0183] Hill, C. S. (1996) "Gen-Probe
Transcription-mediated Amplification System Principles," Tech.
Bulletin No: L137/01/96, of Gen-Probe, Inc. [0184] Ikeda, R. A.,
Richardson, C. C. (1987) J. Biol. Chem. 262, 2800-3808. [0185]
Jacobo-Molina, A, Ding., J., Nanni, R. G., Clark, A. D., Lu, X.,
Tantillo, C., Williams, R. L., Kramer, G., Ferris, A. L., Clark,
P., Hizi, A., Hughes, S. H. & Arnold, E. (1993) Proc. Natl.
Acad. Sci. (USA) 90, C6320. [0186] Kassayetis, G. A., Butler, E.
T., Roulland, D., and Chamberlin, M. J. (1982) J. Biol. Chem. 257,
5779-5788. [0187] Katani, H., Ishizaki, Y., Hiraoka, N., and
Obayashi, A. (1987) Nucleic Acids Res. 15, 2653-2664. [0188]
Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and
Steitz, T. A. (1992) Science 256, 1783-1790. [0189] Konarska, M.
M., and Sharp, P. A. (1989) Cell 57, 423-431. [0190] Kramer, F. R.,
and Mills, D. R., (1978) Proc. Natl. Acad. Sci. (USA) 75,
5334-5338. [0191] Kuchta, R. D., Mizrahi, V., Benkovic, P. A.,
Johnson, K. A., and Benkovic, S. J. (1987) Biochemistry 26,
8410-8417. [0192] Kunkel, T. A., Bebenek, K., and McClary, J.
(1991) Methods in Enzymology 204, 125. [0193] Makarova, O. V.,
Makarov, E. M., Sousa R., Dreyfus, M. (1995) Proc. Natl. Acad. Sci.
USA. (submitted). [0194] Martin, C. T., Coleman, J. E. (1987)
Biochemistry 26, 2690-2696. [0195] Martin, C. T., Muller, D. K.,
Coleman, J. E. (1988) Biochemistry 27, 3966-3974. [0196] Martin, C.
T., and Coleman, J. E. (1989) Biochemistry 28, 2760-2762. [0197]
McAllister, W. T. (1993) Cellular & Molecular Biol. Res. 39,
385. [0198] McClure, W. R., and Chow, Y. (1980) Methods of
Enzymology 64, 277-297. [0199] Milligan, J. F., Groebe, D. R.,
Witherwell, G. W., and Uhlenbeck, O. C. (1987) Nucl. Acids. Res.
15, 8783-8798. [0200] Mizrahi, V., Henrie, R. N., Marlier, J. F.,
Johnson, K. A., and Benkovic, S. J. (1985) Biochemistry 24,
4010-4018. [0201] Moroney, S. E., and Picirrilli, J. A. (1991)
Biochemistry 30, 10343-10349. [0202] Niyogi, S. K., Feldman, R. P.
(1981) Nucleic Acids Res. 9, 2615-2627. [0203] Myers and Gelfand,
D. (1991) Biochemistry 30, 7661-7666. [0204] Patra, D., Sousa, R.,
and Lafer, E. M. (1992) J. Mol. Biol. 224, 307-318. [0205]
Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., and Kraut,
J. (1994) Science 264, 891. [0206] Polesky, A. H., Steitz, T. A.,
Grindley, N. D., and Joyce, C. M. (1989) J. Biol. Chem. 265,
14579-14591. [0207] Ricchetti, M. and Buc, H. (1993) EMBO J. 12,
387-396. [0208] Sambrook, J., Fritsch, E. F., Maniatis, T., (1989)
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0209] Sanger, et al. (1977) Proc. Natl. Acad. Sci. (USA) 74,
5463-5468. [0210] Schmidt, G. and Tannhauser, S. J. (1945) J. Biol.
Chem. 159, 83-89. [0211] Shi, Y., Gamper, H., Hearst, J. E. (1988)
J. Biol. Chem. 263, 527-534. [0212] Sawaya, M. R., Pelletier, H.,
Kumar, A., Wilson, S. H., and Kraut, J. (1994) Science 264, 1930.
[0213] Sousa, R., and Padilla, R. (1995) EMBO J. 14, 4609-4621.
(Incorporated by reference as if set forth herein.) [0214] Sousa,
R., Lafer, E. M., and Wang, B.-C. (1991) J. Crystal Growth 110,
237-246. [0215] Sousa, R., Chung, Y. J., Rose, J. R., and Wang, B.
C. (1993) Nature 364, 593-599. [0216] Steitz, T. A., Smerdon, S.
J., Jager, J., and Joyce, C. M. (1994) Science 266, 2022-2025.
[0217] Tabor, S., and Richardson, C. C. (1990) J. Biol. Chem. 265:
8322. [0218] Tantillo, C., Jianoing, D., Jacobo-Molina, A., Nanni,
R. G., Boyer, P. L., Hughes, S. H., Pauwels, R., Andiries, K.,
Janssen, P. A. J., and Arnold, E. (1994) J. Mol. Biol. 243,
369-387. [0219] Tabor, S., and Richardson, C. C. (1989) Proc. Natl.
Acad. Sci. USA 82, 1074-1078. [0220] Tabor, S., and Richardson, C.
C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1078. [0221]
Osumi-Davis, P. A., Sreerama N., Volkin, D. B., Middaugh, C. R.,
Woody, R. W., Woody, A. Y. (1994) J. Mol. Biol. 237, 5-19.
Sequence CWU 1
1
5113RNAArtificial SequenceDescription of Artificial Sequence Region
of T7 promoter 1gggagaccgg aau 13223DNAArtificial
SequenceDescription of Artificial Sequence Portion of synthetic
promoter template 2cgaaattaat acgactcact ata 23314DNAArtificial
SequenceDescription of Artificial Sequence Portion of synthetic
promoter template 3gggggggggg gact 14412DNAArtificial
SequenceDescription of Artificial Sequence Oligonucleotide primer
4ggacacggcg aa 12547DNAArtificial SequenceDescription of Artificial
Sequence Oligonucleotide primer 5cccgggatgg aatggagtat tcgccgtgtc
catggctgta agtatcc 47
* * * * *