U.S. patent application number 12/020205 was filed with the patent office on 2009-03-26 for cd33-like protein.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Reiner L. Gentz, Jian Ni, Craig A. Rosen.
Application Number | 20090081727 12/020205 |
Document ID | / |
Family ID | 26695974 |
Filed Date | 2009-03-26 |
United States Patent
Application |
20090081727 |
Kind Code |
A1 |
Ni; Jian ; et al. |
March 26, 2009 |
CD33-Like Protein
Abstract
The present invention concerns a novel CD33-like protein. In
particular, isolated nucleic acid molecules are provided encoding
the CD33-like protein. Recombinant CD33-like polypeptides are also
provided as are recombinant vectors and host cells. The invention
further provides methods useful during tumor or inflammatory
disease diagnosis or prognosis and therapeutic treatments targeting
cells expressing CD33-like polypeptides.
Inventors: |
Ni; Jian; (Germantown,
MD) ; Gentz; Reiner L.; (Belo Horizonte, BR) ;
Rosen; Craig A.; (Laytonsville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
26695974 |
Appl. No.: |
12/020205 |
Filed: |
January 25, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10413518 |
Apr 15, 2003 |
7374764 |
|
|
12020205 |
|
|
|
|
08896537 |
Jul 18, 1997 |
6590088 |
|
|
10413518 |
|
|
|
|
60022481 |
Jul 19, 1996 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 435/455; 530/387.9; 536/23.5; 536/24.5 |
Current CPC
Class: |
C07K 14/70596
20130101 |
Class at
Publication: |
435/69.1 ;
536/23.5; 536/24.5; 435/320.1; 435/455; 435/325; 530/387.9 |
International
Class: |
C12P 21/02 20060101
C12P021/02; C07H 21/00 20060101 C07H021/00; C12N 15/63 20060101
C12N015/63; C07K 16/28 20060101 C07K016/28; C12N 15/87 20060101
C12N015/87; C12N 5/10 20060101 C12N005/10 |
Claims
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding a polypeptide comprising amino acids from about -15 to
about 536 in SEQ ID NO:2; (b) a nucleotide sequence encoding a
polypeptide comprising amino acids from about -14 to about 536 in
SEQ ID NO:2; (c) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 1 to about 536 in SEQ ID NO:2;
(d) a nucleotide sequence encoding a polypeptide having the amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit
No. 97521; (e) a nucleotide sequence encoding the mature CD33-like
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97521; (f) a nucleotide
sequence encoding the CD33-like polypeptide extracellular domain;
(g) a nucleotide sequence encoding the CD33-like polypeptide
transmembrane domain; (h) a nucleotide sequence encoding the
CD33-like polypeptide intracellular domain; (i) a nucleotide
sequence encoding the CD33-like polypeptide receptor extracellular
and intracellular domains with all or part of the transmembrane
domain deleted; and (j) a nucleotide sequence complementary to any
of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g),
(h), or (i).
2. An isolated nucleic acid molecule comprising a polynucleotide
which hybridizes under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence identical to a
nucleotide sequence in (a), (b), (c), (d), (e), (f), (g), (h), (i),
or (j) of claim 1 wherein said polynucleotide which hybridizes does
not hybridize under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence consisting of only A
residues or of only T residues.
3. An isolated nucleic acid fragment of the polynucleotide of claim
1, wherein said fragment is at least 15 nucleotides in length.
4. A method for making a recombinant vector comprising inserting an
isolated nucleic acid molecule of claim 1 into a vector.
5. A recombinant vector produced by the method of claim 4.
6. A method of making a recombinant host cell comprising
introducing the recombinant vector of claim 5 into a host cell.
7. A recombinant host cell produced by the method of claim 6.
8. A recombinant method for producing a CD33-like polypeptide,
comprising culturing the recombinant host cell of claim 7 under
conditions such that said polypeptide is expressed and recovering
said polypeptide.
9. An isolated CD33-like polypeptide having an amino acid sequence
at least 95% identical to a sequence selected from the group
consisting of: (a) amino acids from about -15 to about 536 in SEQ
ID NO:2; (b) amino acids from about -14 to about 536 in SEQ ID
NO:2; (c) amino acids from about 1 to about 536 in SEQ ID NO:2; (d)
the amino acid sequence of the CD33-like polypeptide having the
amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. 97521; (e) the amino acid sequence of the mature
CD33-like polypeptide having the amino acid sequence encoded by the
cDNA clone contained in ATCC Deposit No. 97521; (f) the amino acid
sequence of the CD33-like polypeptide extracellular domain; (g) the
amino acid sequence of the CD33-like polypeptide transmembrane
domain; (h) the amino acid sequence of the CD33-like polypeptide
intracellular domain; (i) the amino acid sequence of the CD33-like
polypeptide extracellular and intracellular domains with all or
part of the transmembrane domain deleted; and (j) the amino acid
sequence of an epitope-bearing portion of any one of the
polypeptides of (a), (b), (c), (d), (e), (f), (g), (h), or (i).
10. An isolated antibody that binds specifically to a CD33-like
polypeptide of claim 9.
11. An isolated nucleic acid molecule comprising a polynucleotide
encoding a CD33-like polypeptide wherein, except for at least one
conservative amino acid substitution, said polypeptide has a
sequence selected from the group consisting of: (a) a nucleotide
sequence encoding a polypeptide comprising amino acids from about
-15 to about 536 in SEQ ID NO:2; (b) a nucleotide sequence encoding
a polypeptide comprising amino acids from about -14 to about 536 in
SEQ ID NO:2; (c) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 1 to about 536 in SEQ ID NO:2;
(d) a nucleotide sequence encoding a polypeptide having the amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit
No. 97521; (e) a nucleotide sequence encoding the mature CD33-like
polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC Deposit No. 97521; (f) a nucleotide
sequence encoding the CD33-like polypeptide extracellular domain;
(g) a nucleotide sequence encoding the CD33-like polypeptide
transmembrane domain; (h) a nucleotide sequence encoding the
CD33-like polypeptide intracellular domain; (i) a nucleotide
sequence encoding the CD33-like polypeptide receptor extracellular
and intracellular domains with all or part of the transmembrane
domain deleted; and (j) a nucleotide sequence complementary to any
of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g),
(h), or (i).
12. An isolated CD33-like polypeptide wherein, except for at least
one conservative amino acid substitution, said polypeptide has a
sequence selected from the group consisting of: (a) amino acids
from about -15 to about 536 in SEQ ID NO:2; (b) amino acids from
about -14 to about 536 in SEQ ID NO:2; (c) amino acids from about 1
to about 536 in SEQ ID NO:2; (d) the amino acid sequence of the
CD33-like polypeptide having the amino acid sequence encoded by the
cDNA clone contained in ATCC Deposit No. 97521; (e) the amino acid
sequence of the mature CD33-like polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
97521; (f) the amino acid sequence of the CD33-like polypeptide
extracellular domain; (g) the amino acid sequence of the CD33-like
polypeptide transmembrane domain; (h) the amino acid sequence of
the CD33-like polypeptide intracellular domain; (i) the amino acid
sequence of the CD33-like polypeptide extracellular and
intracellular domains with all or part of the transmembrane domain
deleted; and (j) the amino acid sequence of an epitope-bearing
portion of any one of the polypeptides of (a), (b), (c), (d), (e),
(f), (g), (h), or (i).
13. An isolated nucleic acid molecule comprising a polynucleotide
having a sequence at least 95% identical to a sequence selected
from the group consisting of: (a) the nucleotide sequence of clone
HTOBA14R (SEQ ID NO:11); and (b) the nucleotide sequence of a
portion of the sequence shown in SEQ ID NO:1 wherein said portion
comprises at least 50 contiguous nucleotides from nucleotide 1 to
nucleotide 1898; and (c) a nucleotide sequence complementary to any
of the nucleotide sequences in (a) or (b) above.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/413,518, filed on Apr. 15, 2003, which is a divisional of
U.S. application Ser. No. 08/896,537, filed on Jul. 18, 1997, now
U.S. Pat. No. 6,590,088, which claims the benefit of the filing
date of provisional application 60/022,481, filed on Jul. 19, 1996,
each of which is herein incorporated by reference.
STATEMENT UNDER 37 C.F.R. .sctn. 1.77(b)(5)
[0002] This application refers to a "Sequence Listing" listed
below, which is provided as a text document. The document is
entitled "PF285D2_SeqList.txt" (21,890 bytes, created Jan. 17,
2008), and is hereby incorporated by reference in its entirety
herein.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates to a novel CD33-like protein.
In particular, isolated nucleic acid molecules are provided
encoding the CD33-like protein. Recombinant CD33-like polypeptides
are also provided as are recombinant vectors and host cells. The
invention further provides methods useful during tumor or
inflammatory disease diagnosis or prognosis and therapeutic
treatments targeting cells expressing CD33-like polypeptides.
[0005] 2. Background Information
[0006] CD33 was originally defined on human myeloid cells by a
panel of monoclonal antibodies (MoAbs) that recognize a
glycoprotein of 67 kD that is restricted in its expression to cells
of the hematopoietic system (Peiper S. C. et al., in Knapp W,
Dorken B, Gilks W R, Rieber E P, Schmidt R E, Stein H, von dem
Borne A E G (eds): Leucocyte Typing IV. White Cell Differentiation
Antigens. Oxford, UK, Oxford University 1989, p 814; but is first
detected on a subpopulation of mixed colony-forming cells (Pierelli
L. et al., Br J Haematol 84:24 (1993); Griffin J. D. et al., Leuk
Res 8:521 (1984)). Expression then continues along the
myelomonocytic pathway until it is downregulated on granulocytes
but retained by monocytes and tissue macrophages. (Pierelli L. et
al., Br J Haematol 84:24 (1993); Bernstein I. D. et al., J Clin
Invest 79:1153 (1987)). The expression pattern of CD33 within the
hematopoietic system indicates a potential role in the regulation
of myeloid cell differentiation. However, despite its initial
identification over 10 years ago (Andrews R. G. et al., Blood
62:124 (1983)), the functions and binding properties of CD33 have
remained obscure.
[0007] CD33 MoAbs are of great importance in the immunodiagnosis of
acute leukemias, allowing distinction between myeloid leukemic
cells (acute myeloid leukemia (AML) French-American-British
classification MI-7) and the usually CD33-negative cells of
lymphoid origin. (Griffin J. D. et al., Leuk Res 8:521 (1984);
Matutes E. et al., Haematol Oncol 3:179 (1985); Bain B. J.:
Immunological cytogenetics and other markers, in Bain B J (ed):
Leukaemia Diagnosis: A Guide to FAB Classification. London, UK,
Gower Medical, 1990, p 61). This is especially valuable for the
more immature forms of AML, where morphologic criteria are
insufficient yet correct categorization is essential for prognostic
predictions and the choice of therapy. CD33 MoAbs have also been
used in preliminary therapeutic trials, principally for purging of
the bone marrow of AML patients, either before transplantation or
in case of diseases that are resistant to chemotherapy. (Robertson
M. J. et al., Blood 79:2229 (1992); Applebaum F. R. et al.,
Transplantation 54: 829 (1992); Caron P. C. et al., Cancer 73:1049
(1994)). Thus, due to the importance of CD33, there is a clear need
to identify and isolate nucleic acid molecules encoding additional
polypeptides having CD33-like protein activity.
SUMMARY OF THE INVENTION
[0008] The present invention provides isolated nucleic acid
molecules comprising a nucleic acid sequence encoding a CD33-like
protein whose amino acid sequence is shown in FIGS. 1A-1C (SEQ ID
NO:2) or a fragment of the polypeptide. The CD33-like protein gene
contains an open reading frame encoding a protein of about 551
amino acid residues whose initiation codon is at position 37-39 of
the nucleotide sequence shown in FIGS. 1A-1C (SEQ ID NO:1), with a
leader sequence of about 15 amino acid residues, and a deduced
molecular weight of about 60 kDa. The amino acid sequence of the
mature CD33-like protein is shown in FIGS. 1A-1C (amino acid
residues from about 1 to about 536 in SEQ ID NO:2).
[0009] Thus, one aspect of the invention provides an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence selected from the group consisting of: (a) a
nucleotide sequence encoding the CD33-like protein having the
complete amino acid sequence in SEQ ID NO:2; (b) a nucleotide
sequence encoding the CD33-like protein having the complete amino
acid sequence in SEQ ID NO:2 but minus the N-terminal methionine
residue; (c) a nucleotide sequence encoding the mature CD33-like
protein having the amino acid sequence at positions from about 1 to
about 536 in SEQ ID NO:2; (d) a nucleotide sequence encoding the
CD33-like protein having the complete amino acid sequence encoded
by the cDNA clone contained in ATCC Deposit No. 97521; (e) a
nucleotide sequence encoding the mature CD33-like protein having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. 97521; (f) a nucleotide sequence encoding the CD33-like
protein extracellular domain; (g) a nucleotide sequence encoding
the CD33-like protein transmembrane domain; (h) a nucleotide
sequence encoding the CD33-like protein intracellular domain; (i) a
nucleotide sequence encoding the CD33-like protein intracellular
and extracellular domains with all or part of the transmembrane
domain deleted; and (j) a nucleotide sequence complementary to any
of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g),
(h), or (i) above.
[0010] Further embodiments of the invention include isolated
nucleic acid molecules that comprise a polynucleotide having a
nucleotide sequence at least 95% identical, and more preferably at
least 96%, 97%, 98% or 99% identical, to any of the nucleotide
sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), or (j)
above, or a polynucleotide which hybridizes under stringent
hybridization conditions to a polynucleotide in (a), (b), (c), (d),
(e), (f), (g), (h), (i), or (j) above. This polynucleotide which
hybridizes does not hybridize under stringent hybridization
conditions to a polynucleotide having a nucleotide sequence
consisting of only A residues or of only T residues. An additional
nucleic acid embodiment of the invention relates to an isolated
nucleic acid molecule comprising a polynucleotide which encodes the
amino acid sequence of an epitope-bearing portion of a CD33-like
protein having an amino acid sequence in (a), (b), (c), (d), (e),
(f), (g), (h), or (i) above.
[0011] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, and
the production of CD33-like polypeptides or fragments thereof by
recombinant techniques.
[0012] The polypeptides of the present invention include the
polypeptide encoded by the deposited cDNA, the polypeptide of SEQ
ID NO:2 (in particular the mature polypeptide), as well as
polypeptides having an amino acid sequence at least 95% identical,
more preferably, at least 96% or 99% identical, to the amino acid
sequence of the polypeptide encoded by the deposited cDNA or the
polypeptide of SEQ ID NO:2.
[0013] The invention further provides an isolated CD33-like protein
having an amino acid sequence selected from the group consisting
of: (a) the amino acid sequence of the CD33-like protein having the
complete 551 amino acid sequence, including the leader sequence
shown in SEQ ID NO:2; (b) the amino acid sequence of the CD33-like
protein having the complete 551 amino acid sequence, including the
leader sequence shown in SEQ ID NO:2 but minus the N-terminal
methionine residue; (c) the amino acid sequence of the mature
CD33-like protein (without the leader) having the amino acid
sequence at positions from about 1 to about 536 in SEQ ID NO:2; (d)
the amino acid sequence of the CD33-like protein having the
complete amino acid sequence, including the leader, encoded by the
cDNA clone contained in ATCC Deposit No. 97521; (e) the amino acid
sequence of the mature CD33-like protein having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
97521; (f) the amino acid sequence of the CD33-like protein
extracellular domain; (g) the amino acid sequence of the CD33-like
protein transmembrane domain; (h) the amino acid sequence of the
CD33-like protein intracellular domain; and (i) the amino acid
sequence of the CD33-like protein intracellular and extracellular
domains with all or part of the transmembrane domain deleted.
[0014] An additional embodiment of this aspect of the invention
relates to a peptide or polypeptide which has the amino acid
sequence of an epitope-bearing portion of a CD33-like polypeptide
having an amino acid sequence described in (a), (b), (c), (d), (e),
(f), (g), (h), or (i) above. Peptides or polypeptides having the
amino acid sequence of an epitope-bearing portion of a CD33-like
polypeptide of the invention include portions of such polypeptides
with at least six or seven, preferably at least nine, and more
preferably at least about 30 amino acids to about 50 amino acids,
although epitope-bearing polypeptides of any length up to and
including the entire amino acid sequence of a polypeptide of the
invention described above also are included in the invention. In
another embodiment, the invention provides an isolated antibody
that binds specifically to a CD33-like polypeptide having an amino
acid sequence described in (a), (b), (c), (d), (e), (f), (g), (h),
or (i) above. Such antibodies are useful diagnostically or
therapeutically as described below.
[0015] The invention further provides a method useful during tumor
or inflammatory disease diagnosis, which involves assaying the
expression level of the gene encoding the CD33-like protein or the
gene copy number in mammalian cells or body fluid and comparing the
gene expression level or gene copy number with a standard CD33-like
protein gene expression level or gene copy number, whereby an
increase in the gene expression level or gene copy number over the
standard is indicative of certain tumors or inflammatory disease.
By the invention, the above-described method is further useful as a
prognostic indicator.
[0016] In another embodiment, an in vitro method is provided for
purging leukemic hematopoietic cells from the autografts of
patients with leukemia. The method involves removing CD33-like
antigen-containing hematopoietic cells from bone marrow obtained
from the patient with an anti-CD33-like protein monoclonal antibody
(MoAb) and complement.
[0017] In a further embodiment, the invention provides an in vivo
method for selectively killing or inhibiting growth of tumor cells
expressing the CD33-like antigen of the present invention, which
involves administering to a patient an effective amount of an
antagonist to inhibit the CD33-like protein receptor signaling
pathway. By the invention, administering such antagonists of the
CD33-like protein to a patient is also useful for treating
inflammatory disease.
[0018] In a still further embodiment, immunotoxins specific for
cells expressing the CD33-like protein are provided for selective
killing of tumor cells. The immunotoxins of the present invention
are further useful according to the method described above for
purging leukemic hematopoietic CD33.sup.+ cells in vitro.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIGS. 1A-1C shows the nucleotide (SEQ ID NO:1) and deduced
amino acid (SEQ ID NO:2) sequences of the CD33-like protein. Amino
acids from about 1 to about 15 represent the signal peptide (first
underlined sequence), amino acids from about 16 to about 422 the
extracellular domain (sequence between the first and second
underlined sequences) (amino acids from about 1 to about 407 in SEQ
ID NO:2), amino acids from about 423 to about 464 the transmembrane
domain (second underlined sequence) (amino acids from about 408 to
about 449 in SEQ ID NO:2), and amino acids from about 465 to about
551 the intracellular domain (the remaining sequence) (amino acids
from about 450 to about 536 in SEQ ID NO:2).
[0020] FIG. 2 is an amino acid sequence comparison showing the
regions of similarity between the amino acid sequences of the
CD33-like protein of the present invention (SEQ ID NO:2) and the
human differentiation antigen CD33 (SEQ ID NO:3).
[0021] FIG. 3 is a Northern blot showing the tissue distribution of
human CD33-like protein mRNA expression. Expression was measured in
the following tissues: pancreas (lane 1), kidney (lane 2), skeletal
muscle (lane 3), liver (lane 4), lung (lane 5), placenta (lane 6),
brain (lane 7), heart (lane 8), fetal liver (lane 9), bone marrow
(lane 10), peripheral blood leucocytes (lane 11), appendix (lane
12), thymus (lane 13), lymph node (lane 14), and spleen (lane
15).
DETAILED DESCRIPTION
[0022] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding a CD33-like protein
having an amino acid sequence shown in FIGS. 1A-1C (SEQ ID NO:2),
which was determined by sequencing a cloned cDNA. The CD33-like
protein of the present invention shares sequence homology with the
human differentiation antigen (CD33) (FIG. 2 (SEQ ID NO:3)). The
nucleotide sequence shown in FIGS. 1A-1C (SEQ ID NO:1) was obtained
by sequencing the HMQCD14 clone, which was deposited on Apr. 25,
1996 at the American Type Culture Collection, 10801 University
Blvd., Manassas, Va. 20110-2209, USA, and given accession number
97521.
Nucleic Acid Molecules
[0023] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 373 from
Applied Biosystems, Inc.), and all amino acid sequences of
polypeptides encoded by DNA molecules determined herein were
predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined
by this automated approach, any nucleotide sequence determined
herein may contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more
typically at least about 95% to at least about 99.9% identical to
the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other
approaches including manual DNA sequencing methods well known in
the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual
sequence will cause a frame shift in translation of the nucleotide
sequence such that the predicted amino acid sequence encoded by a
determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or
deletion.
[0024] Unless otherwise indicated, each "nucleotide sequence" set
forth herein is presented as a sequence of deoxyribonucleotides
(abbreviated A, G, C and T). However, by "nucleotide sequence" of a
nucleic acid molecule or polynucleotide is intended, for a DNA
molecule or polynucleotide, a sequence of deoxyribonucleotides, and
for an RNA molecule or polynucleotide, the corresponding sequence
of ribonucleotides (A, G, C and U) where each thymidine
deoxynucleotide (T) in the specified deoxynucleotide sequence is
replaced by the ribonucleotide uridine (U). For instance, reference
to an RNA molecule having the sequence of SEQ ID NO:1 set forth
using deoxyribonucleotide abbreviations is intended to indicate an
RNA molecule having a sequence in which each deoxynucleotide A, G,
or C of SEQ ID NO:1 has been replaced by the corresponding
ribonucleotide A, G, or C, and each deoxynucleotide T has been
replaced by a ribonucleotide U.
[0025] Thus, in one aspect, isolated nucleic acid molecules are
provided which encode the CD33-like protein. By "isolated" nucleic
acid molecule(s) is intended a nucleic acid molecule, DNA or RNA,
which has been removed from its native environment. For example,
recombinant DNA molecules contained in a vector are considered
isolated for the purposes of the present invention. Further
examples of isolated DNA molecules include recombinant DNA
molecules maintained in heterologous host cells or purified
(partially or substantially) DNA molecules in solution. Isolated
RNA molecules include in vitro RNA transcripts of the DNA molecules
of the present invention. Isolated nucleic acid molecules according
to the present invention further include such molecules produced
synthetically.
[0026] Using the information provided herein, such as the
nucleotide sequence set out in FIGS. 1A-1C (SEQ ID NO:1), a nucleic
acid molecule of the present invention encoding a CD33-like protein
may be obtained using standard cloning and screening procedures,
such as those for cloning cDNAs using mRNA as starting material.
Illustrative of the invention, the nucleic acid molecule described
in FIGS. 1A-1C (SEQ ID NO:1) was discovered in a cDNA library
derived from human activated monocytes. Further, the gene was also
found in cDNA libraries derived from the following types of human
cells: human eosinophils, spleen, chronic lymphocytic leukemia,
human activated neutrophils, and human tonsils.
[0027] The CD33-like protein gene contains an open reading frame
encoding a full-length protein of about 551 amino acid residues
whose initiation codon is at position 37-39 of the nucleotide
sequence shown in FIGS. 1A-1C (SEQ ID NO:1), and a predicted leader
sequence of about 15 amino acid residues, and a deduced molecular
weight of about 60 kDa. The amino acid sequence of the predicted
mature CD33-like protein is shown in FIGS. 1A-1C from amino acid
residue 16 to residue 551 (amino acids from about 1 to about 536 in
SEQ ID NO:2). The mature CD33-like protein has three main
structural domains. These include the extracellular domain, which
includes the ligand binding domain, and is predicted to correspond
to amino acid residues from about 16 to about 422 in FIGS. 1A-1C
(amino acids from about 1 to about 407 in SEQ ID NO:2). The mature
extracellular domain is predicted to be about 407 amino acids in
length with a molecular weight of about 45 kDa. Another domain is
the transmembrane domain, which has been predicted to correspond to
about residues 423 to about 464 in FIGS. 1A-1C (amino acids from
about 408 to about 449 in SEQ ID NO:2). Another domain is the
intracellular domain, which has been predicted to correspond to
amino acid residue 465 to about 551 in FIGS. 1A-1C (amino acids
from about 450 to about 536 in SEQ ID NO:2). The CD33-like protein
shown in FIGS. 1A-1C (SEQ ID NO:2) is about 53% identical and about
64% similar to the human differentiation antigen CD33, which can be
accessed on GenBank as Accession No. M23197. As one of ordinary
skill would appreciate, due to the possibilities of sequencing
errors discussed above, as well as the variability of cleavage
sites for leaders in different known proteins, the actual
full-length CD33-like protein (including the leader) encoded by the
deposited cDNA comprises about 551 amino acids, but may be anywhere
in the range of about 545-560 amino acids; and the actual leader
sequence of this protein is about 15 amino acids, but may be
anywhere in the range of about 12 to about 18 amino acids. It will
also be appreciated that reasonable persons of skill in the art may
disagree, depending on the criteria used, concerning the exact
`address` of the above described CD33-like protein domains. Thus,
for example, the exact location of the CD33-like protein
extracellular, intracellular and transmembrane domains in FIGS.
1A-1C (SEQ ID NO:2) may vary slightly (e.g., the exact `address`
may differ by about 1 to about 5 residues compared to that shown in
FIGS. 1A-1C (SEQ ID NO:2)) depending on the criteria used to define
the domain.
[0028] The present invention also provides the mature form(s) of
the CD33-like protein of the present invention. According to the
signal hypothesis, proteins secreted by mammalian cells have a
signal or secretory leader sequence which is cleaved from the
mature protein once export of the growing protein chain across the
rough endoplasmic reticulum has been initiated. Most mammalian
cells and even insect cells cleave secreted proteins with the same
specificity. However, in some cases, cleavage of a secreted protein
is not entirely uniform, which results in two or more mature
species on the protein. Further, it has long been known that the
cleavage specificity of a secreted protein is ultimately determined
by the primary structure of the complete protein, that is, it is
inherent in the amino acid sequence of the polypeptide. Therefore,
the present invention provides a nucleotide sequence encoding the
mature CD33-like proteins having the amino acid sequence encoded by
the cDNA clone contained in the host identified as ATCC Deposit No.
97521 and as shown in SEQ ID NO:2. By the mature CD33-like protein
having the amino acid sequence encoded by the cDNA clone contained
in the host identified as ATCC Deposit 97521 is meant the mature
form(s) of the CD33-like protein produced by expression in a
mammalian cell (e.g., COS cells, as described below) of the
complete open reading frame encoded by the human DNA sequence of
the clone contained in the vector in the deposited host. As
indicated below, the mature CD33-like protein having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
97521 may or may not differ from the predicted "mature" CD33-like
protein shown in SEQ ID NO:2 (amino acids from about 1 to about
536) depending on the accuracy of the predicted cleavage site based
on computer analysis.
[0029] Methods for predicting whether a protein has a secretory
leader as well as the cleavage point for that leader sequence are
available. For instance, the methods of McGeoch, Virus Res.
3:271-286 (1985) and von Heinje, Nucleic Acids Res. 14:4683-4690
(1986) can be used. The accuracy of predicting the cleavage points
of known mammalian secretory proteins for each of these methods is
in the range of 75-80%. von Heinje, supra. However, the two methods
do not always produce the same predicted cleavage point(s) for a
given protein.
[0030] In the present case, the predicted amino acid sequence of
the complete CD33-like polypeptide of the present invention was
analyzed by a computer program (PSORT) (Nakai, K. and Kanehisa, M.
Genomics 14:897-911 (1992)), which is an expert system for
predicting the cellular location of a protein based on the amino
acid sequence. As part of this computational prediction of
localization, the methods of McGeoch and von Heinje are
incorporated. The analysis by the PSORT program predicted the
cleavage site between amino acids -1 and 1 in SEQ ID NO:2.
Thereafter, the complete amino acid sequences were further analyzed
by visual inspection, applying a simple form of the (-1, -3) rule
of von Heinje. von Heinje, supra. Thus, the leader sequence for the
CD33-like protein is predicted to consist of amino acid residues
from about -15 to about -1 in SEQ ID NO:2, while the mature
CD33-like protein is predicted to consist of residues from about 1
to about 536.
[0031] As indicated, nucleic acid molecules of the present
invention may be in the form of RNA, such as mRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA may be double-stranded
or single-stranded. Single-stranded DNA may be the coding strand,
also known as the sense strand, or it may be the non-coding strand,
also referred to as the anti-sense strand.
[0032] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) whose
initiation codon is at position 37-39 of the nucleotide sequence
shown in FIGS. 1A-1C (SEQ ID NO:1) and further include DNA
molecules which comprise a sequence substantially different than
all or part of the ORF whose initiation codon is at position 37-39
of the nucleotide sequence shown in FIGS. 1A-1C (SEQ ID NO:1) but
which, due to the degeneracy of the genetic code, still encode the
CD33-like protein or a fragment thereof. Of course, the genetic
code is well known in the art. Thus, it would be routine for one
skilled in the art to generate the degenerate variants described
above.
[0033] In addition, the invention provides a nucleic acid molecule
having a nucleotide sequence related to an extensive portion of SEQ
ID NO:1. This cDNA clone is designated HTOBA14R (SEQ ID NO:11).
[0034] The sequence of a public EST, having GenBank Accession No.
H71235, related to a portion of SEQ ID NO:1 is shown in SEQ ID
NO:12. This public EST is 433 nucleotides in length and contains a
region of 111 nucleotides having a sequence identical to
nucleotides 1899 to 2009 of the sequence shown in SEQ ID NO:1 with
the exception of two undisclosed nucleotides at positions 12 and 22
in SEQ ID NO:12. These undisclosed nucleotides are represented by
the letter "N".
[0035] In another aspect, the invention provides isolated nucleic
acid molecules encoding the CD33-like polypeptide having an amino
acid sequence encoded by the cDNA of the clone deposited as ATCC
Deposit No. 97521 on Apr. 25, 1996. Preferably, the nucleic acid
molecule will encode the mature polypeptide encoded by the
above-described deposited cDNA.
[0036] The invention further provides an isolated nucleic acid
molecule having the nucleotide sequence shown in FIGS. 1A-1C (SEQ
ID NO:1) or the nucleotide sequence of the CD33-like protein gene
contained in the above-described deposited cDNA, or a nucleic acid
molecule having a sequence complementary to one of the above
sequences. In a further embodiment, isolated nucleic acid molecules
are provided encoding the full-length CD33-like protein lacking the
N-terminal methionine. Such isolated molecules, particularly DNA
molecules, are useful as probes for gene mapping by in situ
hybridization with chromosomes and for detecting expression of the
CD33-like protein gene in human tissue by Northern blot analysis.
As described in detail below, detecting enhanced CD33-like protein
gene expression in certain tissues is indicative of neoplasia.
[0037] The present invention is further directed to fragments of
the isolated nucleic acid molecules described herein. By a fragment
of an isolated nucleic acid molecule having the nucleotide sequence
of the deposited cDNA or the nucleotide sequence shown in FIGS.
1A-1C (SEQ ID NO:1) is intended fragments at least about 15 nt, and
more preferably at least about 20 nt, still more preferably at
least about 30 nt, and even more preferably, at least about 40 nt
in length which are useful as diagnostic probes and primers as
discussed herein. Of course larger DNA fragments 50, 100, 150, 200,
250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850,
900, 100, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450,
1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000,
or 2010 nt in length are also useful according to the present
invention as are fragments corresponding to most, if not all, of
the nucleotide sequence of the deposited cDNA or as shown in FIGS.
1A-1C (SEQ ID NO:1). By a fragment at least 20 nt in length, for
example, is intended fragments which include 20 or more contiguous
bases from the nucleotide sequence of the deposited cDNA or the
nucleotide sequence as shown in FIGS. 1A-1C (SEQ ID NO:1). Since
the gene has been deposited and the nucleotide sequence shown in
FIGS. 1A-1C (SEQ ID NO:1) is provided, generating such DNA
fragments would be routine to the skilled artisan. For example,
restriction endonuclease cleavage or shearing by sonication could
easily be used to generate fragments of various sizes.
Alternatively, such fragments could be generated synthetically.
[0038] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding: a polypeptide comprising
the CD33-like protein extracellular domain (amino acid residues
from about 16 to about 422 in FIGS. 1A-1C (amino acids from about 1
to about 407 in SEQ ID NO:2)); a polypeptide comprising the
CD33-like protein transmembrane domain (amino acid residues from
about 423 to about 464 in FIGS. 1A-1C (amino acids from about 408
to about 449 in SEQ ID NO:2)); a polypeptide comprising the
CD33-like protein intracellular domain (amino acid residues from
about 465 to about 551 in FIGS. 1A-1C (amino acids from about 450
to about 536 in SEQ ID NO:2)); a polypeptide comprising the
CD33-like protein extracellular and intracellular domain having all
or part of the transmembrane region deleted.
[0039] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the cDNA clone contained in ATCC
Deposit 97521. By "stringent hybridization conditions" is intended
overnight incubation at 42.degree. C. in a solution comprising: 50%
formamide, 5.times.SSC (750 mM NaCl, 75 mM tridosium citrate), 50
mM sodium phosphate (pH7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm
DNA, followed by washing the filters in 0.1.times.SSC at about
65.degree. C. By a polynucleotide which hybridizes to a "portion"
of a polynucleotide is intended a polynucleotide (either DNA or
RNA) hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below.
[0040] Of course, polynucleotides hybridizing to a larger portion
of the reference polynucleotide (e.g., the deposited cDNA clone),
for instance, a portion 50-750 nt in length, or even to the entire
length of the reference polynucleotide, are also useful as probes
according to the present invention, as are polynucleotides
corresponding to most, if not all, of the nucleotide sequence of
the deposited cDNA or the nucleotide sequence as shown in FIGS.
1A-1C (SEQ ID NO:1). By a portion of a polynucleotide of "at least
20 nt in length," for example, is intended 20 or more contiguous
nucleotides from the nucleotide sequence of the reference
polynucleotide (e.g., the deposited cDNA or the nucleotide sequence
as shown in FIGS. 1A-1C (SEQ ID NO:1)). As indicated, such portions
are useful diagnostically either as a probe according to
conventional DNA hybridization techniques or as primers for
amplification of a target sequence by the polymerase chain reaction
(PCR), as described, for instance, in Molecular Cloning, A
Laboratory Manual, 2nd. edition, edited by Sambrook, J., Fritsch,
E. F. and Maniatis, T., (1989), Cold Spring Harbor Laboratory
Press, the entire disclosure of which is hereby incorporated herein
by reference.
[0041] Of course, a polynucleotide which hybridizes only to a poly
A sequence (such as the 3' terminal poly(A) tract of the CD33-like
cDNA shown in FIGS. 1A-1C (SEQ ID NO:1)), or to a complementary
stretch of T (or U) resides, would not be included in a
polynucleotide of the invention used to hybridize to a portion of a
nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule containing a poly (A)
stretch or the complement thereof (e.g., practically any
double-stranded cDNA clone).
[0042] As indicated, nucleic acid molecules of the present
invention which encode the CD33-like polypeptide may include, but
are not limited to the coding sequence for the mature polypeptide,
by itself; the coding sequence for the mature polypeptide and
additional sequences, such as those encoding the about 15 amino
acid leader or secretory sequence, such as a pre-, or pro- or
prepro-protein sequence; the coding sequence of the mature
polypeptide, with or without the aforementioned additional coding
sequences, together with additional, non-coding sequences,
including for example, but not limited to introns and non-coding 5'
and 3' sequences, such as the transcribed, non-translated sequences
that play a role in transcription, mRNA processing--including
splicing and polyadenylation signals, for example--ribosome binding
and stability of mRNA; additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, for instance, the sequence encoding the
polypeptide may be fused to a marker sequence, such as a sequence
encoding a peptide, which facilitates purification of the fused
polypeptide. In certain preferred embodiments of this aspect of the
invention, the marker sequence is a hexa-histidine peptide, such as
the tag provided in a pQE vector (Qiagen, Inc.), among others, many
of which are commercially available. As described in Gentz et al.,
Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance,
hexa-histidine provides for convenient purification of the fusion
protein. The HA tag is another peptide useful for purification
which corresponds to an epitope derived of influenza hemagglutinin
protein, which has been described by Wilson et al., Cell 37:767
(1984), for instance. As discussed below, other such fusion
proteins include the CD33-like protein fused to Fc at the N- or
C-terminus.
[0043] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
fragments, analogs or derivatives of the CD33-like protein.
Variants may occur naturally, such as an allelic variant. By an
"allelic variant" is intended one of several alternate forms of a
gene occupying a given locus on a chromosome of an organism. Lewin,
B., ed., Genes II, John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0044] Such variants include those produced by nucleotide
substitutions, deletions or additions. The substitutions, deletions
or additions may involve one or more nucleotides. The variants may
be altered in coding or non-coding regions or both. Alterations in
the coding regions may produce conservative or non-conservative
amino acid substitutions, deletions or additions.
[0045] Especially preferred among these are silent substitutions,
additions and deletions, which do not alter the properties and
activities of the CD33-like protein or portions thereof. Also
especially preferred in this regard are conservative
substitutions.
[0046] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 95% identical, and more preferably at
least 96%, 97%, 98% or 99% identical to: (a) a nucleotide sequence
encoding the full-length CD33-like protein having the complete
amino acid sequence (including the predicted leader sequence) shown
in FIGS. 1A-1C (SEQ ID NO:2) or as encoded by the cDNA clone
contained in ATCC Deposit No. 97521; (b) a nucleotide sequence
encoding the protein having the amino acid sequence in FIGS. 1A-1C
(SEQ ID NO:2), but lacking the N-terminal methionine; (c) a
nucleotide sequence encoding the mature CD33 protein (the
full-length polypeptide with the leader removed) having an amino
acid sequence shown in FIGS. 1A-1C (SEQ ID NO:2) or as encoded by
the cDNA clone contained in ATCC Deposit No. 97521; (d) a
nucleotide sequence encoding the CD33-like protein extracellular
domain having an amino acid sequence shown in FIGS. 1A-1C (amino
acids from about 1 to about 407 in SEQ ID NO:2) or as encoded by
the cDNA clone contained in ATCC Deposit No. 97521; (e) a
nucleotide sequence encoding the CD33-like protein intracellular
domain having an amino acid sequence shown in FIGS. 1A-1C (amino
acids from about 450 to about 536 in SEQ ID NO:2) or as encoded by
the cDNA clone contained in ATCC Deposit No. 97521; (f) a
nucleotide sequence encoding the CD33-like protein transmembrane
domain having an amino acid sequence shown in FIGS. 1A-1C (amino
acids from about 408 to about 449 in SEQ ID NO:2) or as encoded by
the cDNA clone contained in ATCC Deposit No. 97521; (g) a
nucleotide sequence encoding the CD33-like protein extracellular
domain and intracellular domain (with all or part of the
transmembrane domain deleted) having an amino acid sequence shown
in FIGS. 1A-1C (SEQ ID NO:2) or as encoded by the cDNA clone
contained in ATCC Deposit No. 97521; or (h) a nucleotide sequence
complementary to any of the nucleotide sequences of (a)-(g).
[0047] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a CD33-like protein is intended that the nucleotide
sequence of the polynucleotide is identical to the reference
sequence except that the polynucleotide sequence may include up to
five point mutations per each 100 nucleotides of the reference
nucleotide sequence encoding the CD33-like polypeptide. In other
words, to obtain a polynucleotide having a nucleotide sequence at
least 95% identical to a reference nucleotide sequence, up to 5% of
the nucleotides in the reference sequence may be deleted or
substituted with another nucleotide, or a number of nucleotides up
to 5% of the total nucleotides in the reference sequence may be
inserted into the reference sequence. These mutations of the
reference sequence may occur at the 5' or 3' terminal positions of
the reference nucleotide sequence or anywhere between those
terminal positions, interspersed either individually among
nucleotides in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0048] As a practical matter, whether any particular nucleic acid
molecule has a nucleotide sequence at least 95%, 97%, 98% or 99%
identical to, for instance, the nucleotide sequence shown in FIGS.
1A-1C (SEQ ID NO:1) or to the nucleotide sequence of the deposited
cDNA clone can be determined conventionally using known computer
programs such as the Bestfit.RTM. program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711).
Bestfit.RTM. uses the local homology algorithm of Smith and
Waterman (Advances in Applied Mathematics 2:482-489, 1981) to find
the best segment of homology between two sequences. When using
Bestfit.RTM. or any other sequence alignment program to determine
whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity
is calculated over the full length of the reference nucleotide
sequence and that gaps in homology of up to 5% of the total number
of nucleotides in the reference sequence are allowed.
[0049] The present application is directed to such nucleic acid
molecules which are at least 95%, 97%, 98% or 99% identical to a
nucleic acid sequence described above irrespective of whether they
encode a polypeptide having CD33-like protein activity. This is
because, even where a particular nucleic acid molecule does not
encode a polypeptide having CD33-like protein activity, one of
skill would still know how to use the nucleic acid molecule, for
instance, as a hybridization probe or a polymerase chain reaction
(PCR) primer. Uses of the nucleic acid molecules of the present
invention that do not encode a polypeptide having CD33-like protein
activity include, inter alia, (1) isolating the gene encoding the
CD33-like protein, or allelic variants thereof from a cDNA library;
(2) in situ hybridization (FISH) to metaphase chromosomal spreads
to provide precise chromosomal location of the CD33-like gene as
described in Verma et al., Human Chromosomes: a Manual of Basic
Techniques, Pergamon Press, New York (1988); and (3) Northern blot
analysis for detecting expression of CD33-like mRNA in specific
tissues.
[0050] Preferred, however, are nucleic acid molecules which are at
least 95%, 97%, 98% or 99% identical to a nucleic acid sequence
described above which do, in fact, encode a polypeptide having
CD33-like protein activity. By "a polypeptide having CD33-like
protein activity" is intended polypeptides exhibiting activity
similar, but not necessarily identical, to an activity of the
CD33-like polypeptide of the invention as measured in a particular
biological assay.
[0051] For example, in a solid-phase binding assay, the CD33-like
protein of the present invention can mediate sialic acid-dependent
adhesion to red blood cells (RBC) in a manner similar to CD33 and
sialoadhesin. (This assay is described in detail in Freeman, S. D.,
et al., Blood 85 (8):2005-2012 (1995), the contents of which are
incorporated herein by reference). In particular, human red blood
cells (RBC) can be modified enzymatically to carry sialic acids in
unique linkages (Paulson J C., et al., Methods Enzymol. 138:162
(1987)). This provides a useful experimental approach to
characterize the specificity of sialic acid-dependent adhesion
molecules. Briefly, the assay involves generating Fc-CD33-like
protein by polymerase chain reaction amplification of the
extracellular portion of the CD33-like protein cDNA described above
and cloning into the Fc expression vector, pIG, (Simmons D L:
Cloning cell surface molecules by transient expression in mammalian
cells, in Hartley D A (ed): Cellular Interactions in Development-A
Practical Approach. Oxford, UK, IRL, 1993, p 93.) followed by
expression in COS-1 cells as described in Freeman, S. D., et al.,
85 (8):2005-2012 (1995)). The COS cell supernatants are harvested
at about 6 days posttransfection, and the Fc-CD33-like protein
purified on protein A Sepharose.RTM. as described in Simmons D L,
supra.
[0052] The solid-phase binding assay involves coating enzyme-linked
immunosorbent assay plates the with Fc-CD-33 like protein as
described in Kelm, S. et al., Curr Biol 4:965 (1994) and adding
radiolabeled RBC bearing sialic acid residues in one or of more the
structures described in Freeman, S. D. et al., Blood 85
(8):2005-2012 (1995) at an appropriate concentration (such as, for
example, 4.times.10.sup.6 cell/mL). After 30 minutes, nonadherent
and loosely adherent cells are removed by washing. The percentage
of cells binding in each well is determined as follows: (cpm
bound/cpm input) X 100. The CD33-like polypeptide of the present
invention will bind RBC in a sialic acid-dependent manner.
[0053] Thus, by the invention, a "polypeptide having CD33-like
protein activity" includes polypeptides that also bind RBC in the
above-described assay in a sialic acid-dependent manner. In other
words, in a side-by-side comparison, the percentage of RBC binding
as described above using the CD33-like protein will be similar
(i.e., not more than a 50% difference, and preferably, not more
than a 25% difference) to that occurring using a candidate
"polypeptide having CD33-like protein activity."
[0054] In another embodiment, the above-described binding assay is
useful for screening potential antagonist and agonist of CD33-like
protein activity. The method involves determining whether a
candidate agonist or antagonist (such as an anti-CD33-like protein
antibody) enhances or inhibits sialic acid-dependent binding of the
CD33-like protein to RBC relative to a standard binding level,
i.e., the degree of CD33-like protein binding to RBC in the absence
of the candidate agonist or antagonist.
[0055] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that large
number of the nucleic acid molecules having a nucleotide sequence
at least 95%, 97%, 98% or 99% identical to a nucleic acid sequence
described above will encode a polypeptide "having CD33-like protein
activity." In fact, since degenerate variants all encode the same
polypeptide, this will be clear to the skilled artisan even without
performing the above-described comparison assay. It will be further
recognized in the art that, for such nucleic acid molecules that
are not degenerate variants, a reasonable number will also encode a
polypeptide having CD33-like protein activity. This is because the
skilled artisan is fully aware of amino acid substitutions that are
either less likely or not likely to significantly effect protein
function (e.g., replacing one aliphatic amino acid with a second
aliphatic amino acid).
[0056] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie, J. U., et
al., "Deciphering the Message in Protein Sequences: Tolerance to
Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein
the authors indicate that there are two main approaches for
studying the tolerance of an amino acid sequence to change. The
first method relies on the process of evolution, in which mutations
are either accepted or rejected by natural selection. The second
approach uses genetic engineering to introduce amino acid changes
at specific positions of a cloned gene and selects or screens to
identify sequences that maintain functionality. As the authors
state, these studies have revealed that proteins are surprisingly
tolerant of amino acid substitutions. The authors further indicate
which amino acid changes are likely to be permissive at a certain
position of the protein. For example, most buried amino acid
residues require nonpolar side chains, whereas few features of
surface side chains are generally conserved. Other such
phenotypically silent substitutions are described in Bowie, J. U.
et al., supra, and the references cited therein.
Vectors and Host Cells
[0057] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, and
the production of CD33-like polypeptides or fragments thereof by
recombinant techniques.
[0058] Recombinant constructs may be introduced into host cells
using well known techniques such as infection, transduction,
transfection, transvection and transformation. The vector may be,
for example, a plasmid, viral or retroviral vector. Retroviral
vectors may be replication competent or replication defective. In
the latter case, retroviral propagation generally will occur only
in complementing host cells.
[0059] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transfected into host cells.
[0060] Preferred are vectors comprising cis-acting control regions
to the polynucleotide of interest. Appropriate trans-acting factors
either are supplied by the host, supplied by a complementing vector
or supplied by the vector itself upon introduction into the
host.
[0061] In certain preferred embodiments in this regard, the vectors
provide for specific expression, which be inducible and/or cell
type-specific. Particularly preferred among inducible vectors are
vectors that can be induced for expression by environmental factors
that are easy to manipulate, such as temperature and nutrient
additives.
[0062] Expression vectors useful in the present invention include
chromosomal-, episomal- and virus-derived vectors e.g., vectors
derived from bacterial plasmids, bacteriophage, yeast episomes,
yeast chromosomal elements, viruses such as baculoviruses, papova
viruses, vaccinia viruses, adenoviruses, fowl pox viruses,
pseudorabies viruses and retroviruses, and vectors derived from
combinations thereof, such as those derived from plasmid and
bacteriophage genetic elements, such as cosmids and phagemids.
[0063] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp and tac promoters, the SV40 early and late promoters
and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be known to the skilled artisan. The expression
constructs will contain sites for transcription initiation,
termination, and, in the transcribed region, a ribosome binding
site for translation. The coding portion of the mature transcripts
expressed by the constructs will include a translation initiating
AUG at the beginning and a termination codon appropriately
positioned at the end of the polypeptide to be translated.
[0064] As indicated, the expression vectors will preferably contain
selectable markers. Such markers include dihydrofolate reductase or
neomycin resistance for eukaryotic cell culture and tetracycline or
ampicillin resistance for culturing in E. coli and other bacteria.
Representative examples of appropriate hosts include bacterial
cells, such as E. coli, Streptomyces and Salmonella typhimurium,
fungal cells, such as yeast; insect cells such as Drosophila S2 and
Spodoptera Sf9; animal cells such as CHO, COS and Bowes melanoma;
and plant cells. Appropriate culture mediums and conditions for the
above-described host cells are known in the art.
[0065] Among vectors preferred for use in bacteria are pQE70, pQE60
and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors,
Bluescript.RTM. vectors, pNH8A, pNH16a, pNH18A, pNH46A, available
from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
available from Pharmacia. Among preferred eukaryotic vectors are
pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and
pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable
vectors will be readily apparent to the skilled artisan.
[0066] Among known bacterial promoters for use in the present
invention include E. coli lacI and lacZ promoters, the T3 and T7
promoters, the gpt promoter, the lambda PR, PL promoters and the
trp promoter. Suitable eukaryotic promoters include the CMV
immediate early promoter, the HSV thymidine kinase promoter, the
early and late SV40 promoters, the promoters of retroviral LTRs,
such as those of the Rous sarcoma virus ("RSV"), and
metallothionein promoters, such as the mouse metallothionein-I
promoter.
[0067] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods in Molecular Biology (1986).
[0068] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes may be increased by
inserting an enhancer sequence into the vector. Enhancers are
cis-acting elements of DNA, usually about from 10 to 300 bp that
act to increase transcriptional activity of a promoter in a given
host cell-type. Examples of enhancers include the SV40 enhancer,
which is located on the late side of the replication origin at bp
100 to 270, the cytomegalovirus early promoter enhancer, the
polyoma enhancer on the late side of the replication origin, and
adenovirus enhancers.
[0069] For secretion of the translated protein into the lumen of
the endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, appropriate secretion signals may be
incorporated into the expressed polypeptide. The signals may be
endogenous to the polypeptide or they may be heterologous
signals.
[0070] The polypeptide may be expressed in a modified form, such as
a fusion protein, and may include not only secretion signals but
also additional heterologous functional regions. Thus, for
instance, a region of additional amino acids, particularly charged
amino acids, may be added to the N-terminus of the polypeptide to
improve stability and persistence in the host cell, during
purification or during subsequent handling and storage. Also,
peptide moieties may be added to the polypeptide to facilitate
purification. Such regions may be removed prior to final
preparation of the polypeptide. The addition of peptide moieties to
polypeptides to engender secretion or excretion, to improve
stability and to facilitate purification, among others, are
familiar and routine techniques in the art. A preferred fusion
protein comprises a heterologous region from immunoglobulin that is
useful to solubilize proteins. For example, EPA 0 464 533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with
another human protein or part thereof. In many cases, the Fc part
in a fusion protein is thoroughly advantageous for use in therapy
and diagnosis and thus results, for example, in improved
pharmacokinetic properties (EPA 0 232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part
after the fusion protein has been expressed, detected and purified
in the advantageous manner described. This is the case when the Fc
portion proves to be a hindrance to use in therapy and diagnosis,
for example when the fusion protein is to be used as an antigen for
immunizations. In drug discovery, for example, human proteins, such
as the hIL5-receptor, have been fused with Fc portions for the
purpose of high-throughput screening assays to identify antagonists
of hIL-5. See, D. Bennett et al., J. of Molec. Recognition 8:52-58
(1995) and K. Johanson et al., J. Biol. Chem. 270:9459-9471
(1995).
[0071] The CD33-like protein can be recovered and purified from
recombinant cell cultures by well-known methods including ammonium
sulfate or ethanol precipitation, acid extraction, anion or cation
exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification.
[0072] Polypeptides of the present invention include naturally
purified products, products of chemical synthetic procedures, and
products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed
in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or may be non-glycosylated.
In addition, polypeptides of the invention may also include an
initial modified methionine residue, in some cases as a result of
host-mediated processes.
CD33-Like Polypeptides and Fragments
[0073] The invention further provides an isolated CD33-like
polypeptide having the amino acid sequence encoded by the deposited
cDNA, or the amino acid sequence as shown in FIGS. 1A-1C (SEQ ID
NO:2), or a peptide or polypeptide comprising a portion of the
above polypeptides. The terms "peptide" and "oligopeptide" are
considered synonymous (as is commonly recognized) and each term can
be used interchangeably as the context requires to indicate a chain
of at least two amino acids coupled by peptidyl linkages. The word
"polypeptide" is used herein for chains containing more than ten
amino acid residues. All oligopeptide and polypeptide formulas or
sequences herein are written from left to right and in the
direction from amino terminus to carboxy terminus.
[0074] It will be recognized in the art that some amino acid
sequences of the CD33-like polypeptide can be varied without
significant effect on the structure or function of the protein. If
such differences in sequence are contemplated, it should be
remembered that there will be critical areas on the protein which
determine activity.
[0075] Thus, the invention further includes variations of the
CD33-like polypeptide which show substantial CD33-like polypeptide
activity or which include regions of CD33-like protein such as the
protein portions discussed below. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions. As
indicated above, guidance concerning which amino acid changes are
likely to be phenotypically silent can be found in Bowie, J. U., et
al., "Deciphering the Message in Protein Sequences: Tolerance to
Amino Acid Substitutions," Science 247:1306-1310 (1990).
[0076] Thus, the fragment, derivative or analog of the polypeptide
of SEQ ID NO:2, or that encoded by the deposited cDNA, may be (i)
one in which one or more of the amino acid residues are substituted
with a conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is
fused with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene glycol), or
(iv) one in which the additional amino acids are fused to the
mature polypeptide, such as an IgG Fc fusion region peptide or
leader or secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein sequence.
Such fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0077] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the
CD33-like protein. The prevention of aggregation is highly
desirable. Aggregation of proteins not only results in a loss of
activity but can also be problematic when preparing pharmaceutical
formulations, because they can be immunogenic. (Pinckard et al.,
Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes
36:838-845 (1987); Cleland et al. Crit. Rev. Therapeutic Drug
Carrier Systems 10:307-377 (1993)).
[0078] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 1).
TABLE-US-00001 TABLE 1 Conservative Amino Acid Substitutions.
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
[0079] Amino acids in the CD33-like protein of the present
invention that are essential for function can be identified by
methods known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. Sites that are
critical for ligand binding can also be determined by structural
analysis such as crystallization, nuclear magnetic resonance or
photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904
(1992) and de Vos et al., Science 255:306-312 (1992)).
[0080] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and/or contained within a recombinant host
cell is considered isolated for purposes of the present invention.
Also intended as an "isolated polypeptide" are polypeptides that
have been purified, partially or substantially, from a recombinant
host cell. For example, a recombinantly produced version of the
CD33-like protein polypeptide can be substantially purified by the
one-step method described in Smith and Johnson, Gene 67:31-40
(1988).
[0081] The polypeptides of the present invention include the
polypeptide encoded by the deposited cDNA including the leader; the
mature polypeptide encoded by the deposited cDNA minus the leader
(i.e., the mature protein); a polypeptide comprising amino acids
about -15 to about 536 in SEQ ID NO:2; a polypeptide comprising
amino acids about -14 to about 536 in SEQ ID NO:2; a polypeptide
comprising amino acids about 1 to about 536 in SEQ ID NO:2; a
polypeptide comprising amino acids about 1 to about 407 in SEQ ID
NO:2; a polypeptide comprising amino acids about 408 to about 449
in SEQ ID NO:2; a polypeptide comprising amino acids about 450 to
about 536 in SEQ ID NO:2; a polypeptide comprising the CD33-like
polypeptide extracellular and intracellular domains with all or
part of the transmembrane domain deleted; as well as polypeptides
which are at least 95% identical, more preferably at least 96%,
97%, 98% or 99% identical to the polypeptide encoded by the
deposited cDNA, to the polypeptide of SEQ ID NO:2, and also include
portions of such polypeptides with at least 30 amino acids and more
preferably at least 50 amino acids.
[0082] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
CD33-like polypeptide is intended that the amino acid sequence of
the polypeptide is identical to the reference sequence except that
the polypeptide sequence may include up to five amino acid
alterations per each 100 amino acids of the reference amino acid of
the CD33-like polypeptide. In other words, to obtain a polypeptide
having an amino acid sequence at least 95% identical to a reference
amino acid sequence, up to 5% of the amino acid residues in the
reference sequence may be deleted or substituted with another amino
acid, or a number of amino acids up to 5% of the total amino acid
residues in the reference sequence may be inserted into the
reference sequence. These alterations of the reference sequence may
occur at the amino or carboxy terminal positions of the reference
amino acid sequence or anywhere between those terminal positions,
interspersed either individually among residues in the reference
sequence or in one or more contiguous groups within the reference
sequence.
[0083] As a practical matter, whether any particular polypeptide is
at least 95%, 97%, 98% or 99% identical to, for instance, the amino
acid sequence shown in FIGS. 1A-1C (SEQ ID NO:2) or to the amino
acid sequence encoded by deposited cDNA clone or a portion thereof
can be determined conventionally using known computer programs such
the Bestfit.RTM. program (Wisconsin Sequence Analysis Package,
Version 8 for Unix, Genetics Computer Group, University Research
Park, 575 Science Drive, Madison, Wis. 53711). When using
Bestfit.RTM. or any other sequence alignment program to determine
whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity
is calculated over the full length of the reference amino acid
sequence and that gaps in homology of up to 5% of the total number
of amino acid residues in the reference sequence are allowed.
[0084] The polypeptide of the present invention are useful as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0085] In another aspect, the invention provides a peptide or
polypeptide comprising an epitope-bearing portion of a polypeptide
of the invention. The epitope of this polypeptide portion is an
immunogenic or antigenic epitope of a polypeptide of the invention.
An "immunogenic epitope" is defined as a part of a protein that
elicits an antibody response when the whole protein is the
immunogen. These immunogenic epitopes are believed to be confined
to a few loci on the molecule. On the other hand, a region of a
protein molecule to which an antibody can bind is defined as an
"antigenic epitope." The number of immunogenic epitopes of a
protein generally is less than the number of antigenic epitopes.
See, for instance, Geysen, H. M. et al., Proc. Natl. Acad. Sci. USA
81:3998-4002 (1984).
[0086] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
Sutcliffe, J. G. et al., Science 219:660-666 (1984). Peptides
capable of eliciting protein-reactive sera are frequently
represented in the primary sequence of a protein, can be
characterized by a set of simple chemical rules, and are confined
neither to immunodominant regions of intact proteins (i.e.,
immunogenic epitopes) nor to the amino or carboxyl terminals.
Peptides that are extremely hydrophobic and those of six or fewer
residues generally are ineffective at inducing antibodies that bind
to the mimicked protein; longer, soluble peptides, especially those
containing proline residues, usually are effective. Sutcliffe et
al., supra, at 661. For instance, 18 of 20 peptides designed
according to these guidelines, containing 8-39 residues covering
75% of the sequence of the influenza virus hemagglutinin HA1
polypeptide chain, induced antibodies that reacted with the HA1
protein or intact virus; and 12/12 peptides from the MuLV
polymerase and 18/18 from the rabies glycoprotein induced
antibodies that precipitated the respective proteins.
[0087] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to a polypeptide of
the invention. Thus, a high proportion of hybridomas obtained by
fusion of spleen cells from donors immunized with an antigen
epitope-bearing peptide generally secrete antibody reactive with
the native protein. Sutcliffe et al., supra, at 663. The antibodies
raised by antigenic epitope-bearing peptides or polypeptides are
useful to detect the mimicked protein, and antibodies to different
peptides may be used for tracking the fate of various regions of a
protein precursor which undergoes posttranslation processing. The
peptides and anti-peptide antibodies may be used in a variety of
qualitative or quantitative assays for the mimicked protein, for
instance in competition assays since it has been shown that even
short peptides (e.g., about 9 amino acids) can bind and displace
the larger peptides in immunoprecipitation assays. See, for
instance, Wilson, I. A. et al., Cell 37:767-778 at 777 (1984). The
anti-peptide antibodies of the invention also are useful for
purification of the mimicked protein, for instance, by adsorption
chromatography using methods well known in the art.
[0088] Antigenic epitope-bearing peptides and polypeptides of the
invention designed according to the above guidelines preferably
contain a sequence of at least seven, more preferably at least nine
and most preferably between about 15 to about 30 amino acids
contained within the amino acid sequence of a polypeptide of the
invention. However, peptides or polypeptides comprising a larger
portion of an amino acid sequence of a polypeptide of the
invention, containing about 30 to about 50 amino acids, or any
length up to and including the entire amino acid sequence of a
polypeptide of the invention, also are considered epitope-bearing
peptides or polypeptides of the invention and also are useful for
inducing antibodies that react with the mimicked protein.
Preferably, the amino acid sequence of the epitope-bearing peptide
is selected to provide substantial solubility in aqueous solvents
(i.e., the sequence includes relatively hydrophilic residues and
highly hydrophobic sequences are preferably avoided); and sequences
containing proline residues are particularly preferred.
[0089] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means for making
peptides or polypeptides including recombinant means using nucleic
acid molecules of the invention. For instance, a short
epitope-bearing amino acid sequence may be fused to a larger
polypeptide which acts as a carrier during recombinant production
and purification, as well as during immunization to produce
anti-peptide antibodies. Epitope-bearing peptides also may be
synthesized using known methods of chemical synthesis. For
instance, Houghten has described a simple method for synthesis of
large numbers of peptides, such as 10-20 mg of 248 different 13
residue peptides representing single amino acid variants of a
segment of the HA1 polypeptide which were prepared and
characterized (by ELISA-type binding studies) in less than four
weeks. Houghten, R. A., Proc. Natl. Acad. Sci. USA 82:5131-5135
(1985). This "Simultaneous Multiple Peptide Synthesis (SMPS)"
process is further described in U.S. Pat. No. 4,631,211 to Houghten
et al. (1986). In this procedure the individual resins for the
solid-phase synthesis of various peptides are contained in separate
solvent-permeable packets, enabling the optimal use of the many
identical repetitive steps involved in solid-phase methods. A
completely manual procedure allows 500-1000 or more syntheses to be
conducted simultaneously. Houghten et al., supra, at 5134.
[0090] Epitope-bearing peptides and polypeptides of the invention
are used to induce antibodies according to methods well known in
the art. See, for instance, Sutcliffe et al., supra; Wilson et al.,
supra; Chow, M. et al., Proc. Natl. Acad. Sci. USA 82:910-914; and
Bittle, F. J. et al., J. Gen. Virol. 66:2347-2354 (1985).
Generally, animals may be immunized with free peptide; however,
anti-peptide antibody titer may be boosted by coupling of the
peptide to a macromolecular carrier, such as keyhole limpet
hemacyanin (KLH) or tetanus toxoid. For instance, peptides
containing cysteine may be coupled to carrier using a linker such
as m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carrier using a more general linking
agent such as glutaraldehyde. Animals such as rabbits, rats and
mice are immunized with either free or carrier-coupled peptides,
for instance, by intraperitoneal and/or intradermal injection of
emulsions containing about 100 .mu.g peptide or carrier protein and
Freund's adjuvant. Several booster injections may be needed, for
instance, at intervals of about two weeks, to provide a useful
titer of anti-peptide antibody which can be detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The
titer of anti-peptide antibodies in serum from an immunized animal
may be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and
elution of the selected antibodies according to methods well known
in the art.
[0091] Immunogenic epitope-bearing peptides of the invention, i.e.,
those parts of a protein that elicit an antibody response when the
whole protein is the immunogen, are identified according to methods
known in the art. For instance, Geysen et al., 1984, supra,
discloses a procedure for rapid concurrent synthesis on solid
supports of hundreds of peptides of sufficient purity to react in
an enzyme-linked immunosorbent assay. Interaction of synthesized
peptides with antibodies is then easily detected without removing
them from the support. In this manner a peptide bearing an
immunogenic epitope of a desired protein may be identified
routinely by one of ordinary skill in the art. For instance, the
immunologically important epitope in the coat protein of
foot-and-mouth disease virus was located by Geysen et al. with a
resolution of seven amino acids by synthesis of an overlapping set
of all 208 possible hexapeptides covering the entire 213 amino acid
sequence of the protein. Then, a complete replacement set of
peptides in which all 20 amino acids were substituted in turn at
every position within the epitope were synthesized, and the
particular amino acids conferring specificity for the reaction with
antibody were determined. Thus, peptide analogs of the
epitope-bearing peptides of the invention can be made routinely by
this method. U.S. Pat. No. 4,708,781 to Geysen (1987) further
describes this method of identifying a peptide bearing an
immunogenic epitope of a desired protein.
[0092] Further still, U.S. Pat. No. 5,194,392 to Geysen (1990)
describes a general method of detecting or determining the sequence
of monomers (amino acids or other compounds) which is a topological
equivalent of the epitope (i.e., a "mimotope") which is
complementary to a particular paratope (antigen binding site) of an
antibody of interest. More generally, U.S. Pat. No. 4,433,092 to
Geysen (1989) describes a method of detecting or determining a
sequence of monomers which is a topographical equivalent of a
ligand which is complementary to the ligand binding site of a
particular receptor of interest. Similarly, U.S. Pat. No. 5,480,971
to Houghten, R. A. et al. (1996) on Peralkylated Oligopeptide
Mixtures discloses linear C.sub.1-C.sub.7-alkyl peralkylated
oligopeptides and sets and libraries of such peptides, as well as
methods for using such oligopeptide sets and libraries for
determining the sequence of a peralkylated oligopeptide that
preferentially binds to an acceptor molecule of interest. Thus,
non-peptide analogs of the epitope-bearing peptides of the
invention also can be made routinely by these methods.
[0093] The present inventors have discovered that the CD33-like
protein is a 551 residue protein exhibiting three main structural
domains. First, the extracellular domain (which includes the ligand
binding domain) was identified within residues from about 16 to
about 422 in FIGS. 1A-1C (amino acids from about 1 to about 407 in
SEQ ID NO:2). The mature extracellular domain has been predicted by
the inventors as being about 407 amino acids in length with a
molecular weight of about 45 kDa. Second, the transmembrane domain
was identified within residues from about 423 to about 464 in FIGS.
1A-1C (amino acids from about 408 to about 449 in SEQ ID NO:2).
Third, the intracellular domain was identified within residues from
about 465 to about 551 in FIGS. 1A-1C (amino acids from about 450
to about 536 in SEQ ID NO:2). Thus, the invention further provides
preferred CD33-like protein fragments comprising a polypeptide
selected from: the mature CD33-like protein; the CD33-like protein
extracellular domain; the CD33-like protein transmembrane domain;
the CD33-like protein intracellular domain; or the CD33-like
protein extracellular domain and intracellular domain with part or
all of the transmembrane domain deleted. Methods for producing such
CD33-like protein fragments are described above.
[0094] The extracellular domains of receptors can be combined with
parts of the constant domain of immunoglobulins (IgG), resulting in
chimeric polypeptides. These fusion proteins often show an
increased half-life time in vivo. This has been shown, e.g., for
chimeric proteins consisting of the first two domains of the human
CD4 polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins (European Patent
Application Publication No. 394 827; Traunecker et al., Nature 331:
84-86 (1988)). Fusion proteins that have disulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding
and neutralizing the ligands than the monomeric extracellular
domains alone (Fountoulakis et al., J. Biochem. 270: 3958-3964
(1995)).
[0095] As described in detail below, the polypeptides of the
present invention and fragments thereof can be used to raise
polyclonal and monoclonal antibodies, which are useful in
diagnostic assays for detecting CD33-like protein expression as
described below or as agonists and antagonists capable of enhancing
or inhibiting CD33-like protein function. Further, such
polypeptides can be used in the yeast two-hybrid system to
"capture" CD33-like protein binding proteins which are also
candidate agonist and antagonist according to the present
invention. The yeast two hybrid system is described in Fields and
Song, Nature 340:245-246 (1989).
[0096] The entire disclosure of each document cited in this section
on "CD33-Like Polypeptides and Fragments" is hereby incorporated
herein by reference.
Cancer and Inflammatory Disease Diagnosis and Prognosis
[0097] It is believed that certain tissues in mammals with cancer
or inflammatory disease contain significantly greater CD33-like
protein gene copy number and express significantly enhanced levels
of the CD33-like protein and mRNA encoding the CD33-like protein
when compared to a corresponding "standard" mammal, i.e., a mammal
of the same species not having the cancer or inflammatory disease.
Enhanced levels of the CD33-like protein will be detected in
certain body fluids (e.g., sera, plasma, urine, synovial and spinal
fluid) from mammals with cancer or inflammatory disease when
compared to sera from mammals of the same species not having the
cancer or inflammatory disease. Thus, the invention provides a
method useful during tumor or inflammatory disease diagnosis, which
involves assaying the expression level of the gene encoding the
CD33-like protein or the gene copy number in mammalian cells or
body fluid and comparing the gene expression level or gene copy
number with a standard CD33-like protein gene expression level or
gene copy number, whereby an increase in the gene expression level
or gene copy number over the standard is indicative of certain
tumors or inflammatory disease.
[0098] Where a tumor or inflammatory disease diagnosis has already
been made according to conventional methods, the present invention
is useful as a prognostic indicator. For example, samples of bone
marrow or peripheral blood can be obtained from patients diagnosed
previously with leukemia to obtain leukemic blasts for examination
of the CD33-like protein expression using anti-CD33-like protein
monoclonal antibodies. Because the level of differentiation of
normal myeloid cells is believed to be reflected by the
concentration of the CD33-like protein antigen expressed, samples
can be categorized as CD33-bright (immature) versus CD33-dull
(mature). Patients whose leukemic blasts display the CD33-like
protein antigen in an amount associated with immature myeloid cells
will experience a worse clinical outcome than patients with
leukemic blasts expressing a phenotype associated with more mature
cells (i.e., a relatively lower CD33-like protein expression
level).
[0099] By "assaying the expression level of the gene encoding the
CD33-like protein" is intended qualitatively or quantitatively
measuring or estimating the level of the CD33-like protein or the
level of the mRNA encoding the CD33-like protein in a first
biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the CD33-like protein level or mRNA level in
a second biological sample). By "assaying the copy number of the
gene encoding the CD33-like protein" is intended qualitatively or
quantitatively measuring or estimating the gene copy number in a
first biological sample either directly (e.g., by determining or
estimating absolute gene copy number) or relatively (e.g., by
comparing to the CD33-like protein gene copy number in a second
biological sample).
[0100] Preferably, the CD33-like protein level, mRNA level, or gene
copy number in the first biological sample is measured or estimated
and compared to a standard CD33-like protein level, mRNA level, or
gene copy number, the standard being taken from a second biological
sample obtained from an individual not having the cancer or
inflammatory disease. Alternatively, where the method is used as a
prognostic indicator, both the first and second biological samples
can be taken from individuals having the cancer or inflammatory
disease and the relative expression levels or copy number will be
measured to determine prognosis. As will be appreciated in the art,
once a standard CD33-like protein level, mRNA level, or gene copy
number is known, it can be used repeatedly as a standard for
comparison.
[0101] By "biological sample" is intended any biological sample
obtained from an individual, cell line, tissue culture, or other
source which contains CD33-like protein or mRNA. Biological samples
include mammalian body fluids (such as sera, plasma, urine,
synovial fluid and spinal fluid) which contain secreted mature
CD33-like protein or its soluble extracellular domain, and
eosinophils, spleen tissue, monocytes, neutrophils, tonsils, and
bone marrow. Methods for obtaining tissue biopsies and body fluids
from mammals are well known in the art. Where the biological sample
is to include mRNA, a tissue biopsy is the preferred source.
[0102] The present invention is useful for detecting cancer and
inflammatory disease in mammals. In particular the invention is
useful during diagnosis or prognosis of the following types of
cancers and inflammatory diseases in mammals: metastatic tumors,
leukemias, lymphomas, arthritis, and allergical diseases. Preferred
mammals include monkeys, apes, cats, dogs, cows, pigs, horses,
rabbits and humans. Particularly preferred are humans.
[0103] Total cellular RNA can be isolated from a biological sample
using any suitable technique such as the single-step
guanidinium-thiocyanate-phenol-chloroform method described in
Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels
of mRNA encoding the CD33-like protein are then assayed using any
appropriate method. These include Northern blot analysis, S1
nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in combination with the ligase
chain reaction (RT-LCR).
[0104] Northern blot analysis can be performed as described in
Harada et al., Cell 63:303-312 (1990). Briefly, total RNA is
prepared from a biological sample as described above. For the
Northern blot, the RNA is denatured in an appropriate buffer (such
as glyoxal/dimethyl sulfoxide/sodium phosphate buffer), subjected
to agarose gel electrophoresis, and transferred onto a
nitrocellulose filter. After the RNAs have been linked to the
filter by a UV linker, the filter is prehybridized in a solution
containing formamide, SSC, Denhardt's solution, denatured salmon
sperm, SDS, and sodium phosphate buffer. CD33-like protein cDNA
labeled according to any appropriate method (such as the
.sup.32P-multiprimed DNA labeling system (Amersham)) is used as
probe. After hybridization overnight, the filter is washed and
exposed to x-ray film. cDNA for use as probe according to the
present invention is described in the sections above and will
preferably be at least 15 bp in length.
[0105] S1 mapping can be performed as described in Fujita et al.,
Cell 49:357-367 (1987). To prepare probe DNA for use in S1 mapping,
the sense strand of above-described cDNA is used as a template to
synthesize labeled antisense DNA. The antisense DNA can then be
digested using an appropriate restriction endonuclease to generate
further DNA probes of a desired length. Such antisense probes are
useful for visualizing protected bands corresponding to the target
mRNA (i.e., mRNA encoding the CD33-like protein). Northern blot
analysis can be performed as described above.
[0106] Preferably, levels of mRNA encoding the CD33-like protein
are assayed using the RT-PCR method described in Makino et al.,
Technique 2:295-301 (1990). By this method, the radioactivities of
the "amplicons" in the polyacrylamide gel bands are linearly
related to the initial concentration of the target mRNA. Briefly,
this method involves adding total RNA isolated from a biological
sample in a reaction mixture containing a RT primer and appropriate
buffer. After incubating for primer annealing, the mixture can be
supplemented with a RT buffer, dNTPs, DTT, RNase inhibitor and
reverse transcriptase. After incubation to achieve reverse
transcription of the RNA, the RT products are then subject to PCR
using labeled primers. Alternatively, rather than labeling the
primers, a labeled dNTP can be included in the PCR reaction
mixture. PCR amplification can be performed in a DNA thermal cycler
according to conventional techniques. After a suitable number of
rounds to achieve amplification, the PCR reaction mixture is
electrophoresed on a polyacrylamide gel. After drying the gel, the
radioactivity of the appropriate bands (corresponding to the mRNA
encoding the CD33-like protein)) is quantified using an imaging
analyzer. RT and PCR reaction ingredients and conditions, reagent
and gel concentrations, and labeling methods are well known in the
art. Variations on the RT-PCR method will be apparent to the
skilled artisan.
[0107] Any set of oligonucleotide primers which will amplify
reverse transcribed target mRNA can be used and can be designed as
described in the sections above.
[0108] Assaying CD33-like protein gene copy number can occur
according to any known technique, such as for example, in situ
hybridization of tissue samples with a cDNA probe described
above.
[0109] Assaying CD33-like protein levels in a biological sample can
occur using any art-known method. Preferred for assaying CD33-like
protein levels in a biological sample are antibody-based
techniques. For example, CD33-like protein expression in tissues
can be studied with classical immunohistological methods. In these,
the specific recognition is provided by the primary antibody
(polyclonal or monoclonal) but the secondary detection system can
utilize fluorescent, enzyme, or other conjugated secondary
antibodies. As a result, an immunohistological staining of tissue
section for pathological examination is obtained. Tissues can also
be extracted, e.g., with urea and neutral detergent, for the
liberation of CD33-like protein for Western-blot or dot/slot assay
(Jalkanen, M., et al., J. Cell. Biol. 101:976-985 (1985));
Jalkanen, M., et al., J. Cell. Biol. 105:3087-3096 (1987)). In this
technique, which is based on the use of cationic solid phases,
quantitation of CD33-like protein can be accomplished using
isolated CD33-like protein as a standard. This technique can also
be applied to body fluids. With these samples, a molar
concentration of CD33-like protein will aid to set standard values
of CD33-like protein content for different body fluids, like serum,
plasma, urine, spinal fluid, etc. The normal appearance of
CD33-like protein amounts can then be set using values from healthy
individuals, which can be compared to those obtained from a test
subject.
[0110] Other antibody-based methods useful for detecting CD33-like
protein gene expression include immunoassays, such as the enzyme
linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
For example, a CD33-like protein-specific monoclonal antibody can
be used both as an immunoabsorbent and as an enzyme-labeled probe
to detect and quantify the CD33-like protein. The amount of
CD33-like protein present in the sample can be calculated by
reference to the amount present in a standard preparation using a
linear regression computer algorithm. Such an ELISA for detecting a
tumor antigen is described in Iacobelli et al., Breast Cancer
Research and Treatment 11:19-30 (1988). In another ELISA assay, two
distinct specific monoclonal antibodies can be used to detect
CD33-like protein in a body fluid. In this assay, one of the
antibodies is used as the immunoabsorbent and the other as the
enzyme-labeled probe.
[0111] The above techniques may be conducted essentially as a
"one-step" or "two-step" assay. The "one-step" assay involves
contacting CD33-like protein with immobilized antibody and, without
washing, contacting the mixture with the labeled antibody. The
"two-step" assay involves washing before contacting the mixture
with the labeled antibody. Other conventional methods may also be
employed as suitable. It is usually desirable to immobilize one
component of the assay system on a support, thereby allowing other
components of the system to be brought into contact with the
component and readily removed from the sample.
[0112] Suitable enzyme labels include, for example, those from the
oxidase group, which catalyze the production of hydrogen peroxide
by reacting with substrate. Glucose oxidase is particularly
preferred as it has good stability and its substrate (glucose) is
readily available. Activity of an oxidase label may be assayed by
measuring the concentration of hydrogen peroxide formed by the
enzyme-labeled antibody/substrate reaction. Besides enzymes, other
suitable labels include radioisotopes, such as iodine (.sup.125I,
.sup.121I), carbon (.sup.14C), sulphur (.sup.35S), tritium
(.sup.3H, indium (.sup.112In), and technetium (.sup.99mTc), and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0113] In addition to assaying CD33-like protein levels in a
biological sample obtained from an individual, CD33-like protein
can also be detected in vivo by imaging. Antibody labels or markers
for in vivo imaging of CD33-like protein include those detectable
by X-radiography, NMR or ESR. For X-radiography, suitable labels
include radioisotopes such as barium or caesium, which emit
detectable radiation but are not overtly harmful to the subject.
Suitable markers for NMR and ESR include those with a detectable
characteristic spin, such as deuterium, which may be incorporated
into the antibody by labeling of nutrients for the relevant
hybridoma.
[0114] A CD33-like protein-specific antibody or antibody fragment
which has been labeled with an appropriate detectable imaging
moiety, such as a radioisotope (for example, .sup.131I, .sup.112In,
.sup.99mTc), a radio-opaque substance, or a material detectable by
nuclear magnetic resonance, is introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the mammal
to be examined for cancer. It will be understood in the art that
the size of the subject and the imaging system used will determine
the quantity of imaging moiety needed to produce diagnostic images.
In the case of a radioisotope moiety, for a human subject, the
quantity of radioactivity injected will normally range from about 5
to 20 millicuries of .sup.99mTc. The labeled antibody or antibody
fragment will then preferentially accumulate at the location of
cells which contain CD33-like protein. In vivo tumor imaging is
described in S. W. Burchiel et al., "Immunopharmacokinetics of
Radiolabelled Antibodies and Their Fragments" (Chapter 13 in Tumor
Imaging: The Radiochemical Detection of Cancer, eds., S. W.
Burchiel and B. A. Rhodes, Masson Publishing Inc. (1982)).
[0115] CD33-like-protein specific antibodies for use in the present
invention can be raised against the intact CD33-like protein or an
antigenic polypeptide fragment thereof, which may presented
together with a carrier protein, such as an albumin, to an animal
system (such as rabbit or mouse) or, if it is long enough (at least
about 25 amino acids), without a carrier.
[0116] As used herein, the term "antibody" (Ab) or "monoclonal
antibody" (MoAb) is meant to include intact molecules as well as
antibody fragments (such as, for example, Fab and F(ab').sub.2
fragments) which are capable of specifically binding to CD33-like
protein. Fab and F(ab').sub.2 fragments lack the Fc fragment of
intact antibody, clear more rapidly from the circulation, and may
have less non-specific tissue binding of an intact antibody (Wahl
et al., J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are
preferred.
[0117] The antibodies of the present invention may be prepared by
any of a variety of methods. For example, cells expressing the
CD33-like protein or an antigenic fragment thereof can be
administered to an animal in order to induce the production of sera
containing polyclonal antibodies. In a preferred method, a
preparation of CD33-like protein is prepared and purified to render
it substantially free of natural contaminants. Such a preparation
is then introduced into an animal in order to produce polyclonal
antisera of greater specific activity.
[0118] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or CD33-like protein binding
fragments thereof). Such monoclonal antibodies can be prepared
using hybridoma technology (Kohler et al., Nature 256:495 (1975);
Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur.
J. Immunol. 6:292 (1976); Hammerling et al., In: Monoclonal
Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681
(1981)). In general, such procedures involve immunizing an animal
(preferably a mouse) with a CD33-like protein antigen or, more
preferably, with a CD33-like protein-expressing cell. Suitable
cells can be recognized by their capacity to bind anti-CD33-like
protein antibody. Such cells may be cultured in any suitable tissue
culture medium; however, it is preferable to culture cells in
Earle's modified Eagle's medium supplemented with 10% fetal bovine
serum (inactivated at about 56.degree. C.), and supplemented with
about 10 .mu.g/l of nonessential amino acids, about 1,000 U/ml of
penicillin, and about 100 .mu.g/ml of streptomycin. The splenocytes
of such mice are extracted and fused with a suitable myeloma cell
line. Any suitable myeloma cell line may be employed in accordance
with the present invention; however, it is preferable to employ the
parent myeloma cell line (SP.sub.2O), available from the American
Type Culture Collection, Manassas, Va. After fusion, the resulting
hybridoma cells are selectively maintained in HAT medium, and then
cloned by limiting dilution as described by Wands et al.
(Gastioenterology 80:225-232 (1981)). The hybridoma cells obtained
through such a selection are then assayed to identify clones which
secrete antibodies capable of binding the CD33-like protein
antigen.
[0119] Alternatively, additional antibodies capable of binding to
the CD33-like protein antigen may be produced in a two-step
procedure through the use of anti-idiotypic antibodies. Such a
method makes use of the fact that antibodies are themselves
antigens, and that, therefore, it is possible to obtain an antibody
which binds to a second antibody. In accordance with this method,
CD33-like-protein specific antibodies are used to immunize an
animal, preferably a mouse. The splenocytes of such an animal are
then used to produce hybridoma cells, and the hybridoma cells are
screened to identify clones which produce an antibody whose ability
to bind to the CD33-like protein-specific antibody can be blocked
by the CD33-like protein antigen. Such antibodies comprise
anti-idiotypic antibodies to the CD33-like protein-specific
antibody and can be used to immunize an animal to induce formation
of further CD33-like protein-specific antibodies.
[0120] It will be appreciated that Fab and F(ab').sub.2 and other
fragments of the antibodies of the present invention may be used
according to the methods disclosed herein. Such fragments are
typically produced by proteolytic cleavage, using enzymes such as
papain (to produce Fab fragments) or pepsin (to produce
F(ab').sub.2 fragments). Alternatively, CD33-like protein-binding
fragments can be produced through the application of recombinant
DNA technology or through synthetic chemistry.
[0121] Where in vivo imaging is used to detect enhanced levels of
CD33-like protein for tumor diagnosis in humans, it may be
preferable to use "humanized" chimeric monoclonal antibodies. Such
antibodies can be produced using genetic constructs derived from
hybridoma cells producing the monoclonal antibodies described
above. Methods for producing chimeric antibodies are known in the
art. See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).
[0122] Further suitable labels for the CD33-like protein-specific
antibodies of the present invention are provided below. Examples of
suitable enzyme labels include malate dehydrogenase, staphylococcal
nuclease, delta-5-steroid isomerase, yeast-alcohol dehydrogenase,
alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase,
peroxidase, alkaline phosphatase, asparaginase, glucose oxidase,
beta-galactosidase, ribonuclease, urease, catalase,
glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholine
esterase.
[0123] Examples of suitable radioisotopic labels include .sup.3H,
.sup.111In, .sup.125I, .sup.131I, .sup.32P, .sup.35S, .sup.14C,
.sup.51Cr, .sup.57To, .sup.58Co, .sup.59Fe, .sup.75Se, .sup.152Eu,
.sup.90Y, .sup.67Cu, .sup.217Ci, .sup.211At, .sup.212Pb, .sup.47Sc,
.sup.109Pd, etc. .sup.111In is a preferred isotope where in vivo
imaging is used since its avoids the problem of dehalogenation of
the .sup.121I or .sup.131I-labeled monoclonal antibody by the
liver. In addition, this radionucleotide has a more favorable gamma
emission energy for imaging (Perkins et al., Eur. J. Nucl. Med.
10:296-301 (1985); Carasquillo et al., J. Nucl. Med. 28:281-287
(1987)). For example, .sup.111In coupled to monoclonal antibodies
with 1-(P-isothiocyanatobenzyl)-DPTA has shown little uptake in
non-tumorous tissues, particularly the liver, and therefore
enhances specificity of tumor localization (Esteban et al., J.
Nucl. Med. 28:861-870 (1987)).
[0124] Examples of suitable non-radioactive isotopic labels include
.sup.157Gd, .sup.55Mn, .sup.162Dy, .sup.52Tr, and .sup.56Fe.
[0125] Examples of suitable fluorescent labels include an
.sup.152Eu label, a fluorescein label, an isothiocyanate label, a
rhodamine label, a phycoerythrin label, a phycocyanin label, an
allophycocyanin label, an o-phthaldehyde label, and a fluorescamine
label.
[0126] Examples of suitable toxin labels include diphtheria toxin,
ricin, and cholera toxin.
[0127] Examples of chemiluminescent labels include a luminal label,
an isoluminol label, an aromatic acridinium ester label, an
imidazole label, an acridinium salt label, an oxalate ester label,
a luciferin label, a luciferase label, and an aequorin label.
[0128] Examples of nuclear magnetic resonance contrasting agents
include heavy metal nuclei such as Gd, Mn, and iron.
[0129] Typical techniques for binding the above-described labels to
antibodies are provided by Kennedy et al. (Clin. Chim. Acta 70:1-31
(1976)), and Schurs et al. (Clin. Chim. Acta 81:1-40 (1977)).
Coupling techniques mentioned in the latter are the glutaraldehyde
method, the periodate method, the dimaleimide method, the
m-maleimido-benzyl-N-hydroxy-succinimide ester method, all of which
methods are incorporated by reference herein.
Therapeutics
[0130] CD33 is expressed by clonogenic leukemic cells from about
90% of patients with acute myeloid leukemia (AML). While about
60-70% of adults suffering from AML experience complete remission
after chemotherapy, most of these patients will ultimately die of
relapsed leukemia (Robertson et al., Blood 79:2229-2236 (1992)). It
is believed that, like CD33, the CD33-like protein of the present
invention is also expressed by clonogenic leukemic cells from the
vast majority of patients with AML.
[0131] Postremission therapy is more successful when patients are
treated with an allogeneic bone marrow transplant. However, this
mode of therapy is often unavailable to an individual because of
their age or because of the lack of an appropriate donor. An
alternative treatment utilizes autologous bone marrow harvested
while the patient was in remission. However, if residual leukemia
cells exist, such an allograft could result in relapse for the
patient. Consequently, a need exists for methods of purging
leukemic cells from the autografts of patients with advanced AML.
Such a method would ideally involve the use of a cytotoxic agent
capable of selectively eliminating or removing tumor cells while
sparing the hematopoietic stem cells necessary for engraftment.
Studies have shown that the majority of leukemia cells are
incapable of sustained replication; these cells are, however,
produced by a small number of leukemic "stem cells" which appear to
have a different surface antigen phenotype from the other cells,
i.e., they are believed to lack the CD33-like protein antigen of
the present invention.
[0132] By the invention, a method is provided for purging leukemic
hematopoietic cells from the autografts of patients with AML. The
method involves obtaining bone marrow (BM) from an AML patient by,
for example, percutaneous aspirations from the posterior iliac
crest, isolating BM mononuclear by Ficoll-hypaque density gradient
centrifugation, and incubating with an anti-CD33-like protein
monoclonal antibody (MoAb), for example, 3-5 times for 15-30
minutes at 4-6.degree. C., followed by incubation with rabbit
complement at about 37.degree. C. for 30 minutes. (Rabbit
complement tested for optimal specific cytotoxicity can be obtained
as described in Roy et al., Leuk Res 14:407 (1990)). The patient is
then subject to myeloablative chemotherapy as described in
Robertson et al., Blood 79 (9):2229 (1992), followed by reinfusion
of the treated autologous BM according to standard technique. By
the invention, clonogenic tumor cells are depleted from the marrow
while sparing hematopoietic cells necessary for engraftment.
[0133] In a further embodiment, the invention provides an in vivo
method for selectively killing or inhibiting growth of tumor cells
expressing the CD33-like protein antigen of the present invention.
Such tumor cells include metastatic tumors, leukemias and
lymphomas. The method involves administering to a patient an
effective amount of an antagonist to inhibit the CD33-like protein
receptor signaling pathway. By the invention, administering such
antagonist of the CD33-like protein to a patient is also useful for
treating inflammatory diseases including arthritis and colitis.
[0134] Antagonists for use in the present invention include
polyclonal and monoclonal antibodies raised against the CD33-like
polypeptides or a fragment thereof. Such antagonist antibodies
raised against CD33-like polypeptides can be generated as described
in Caron et al., Cancer Research 52:6761 (1992); Juric et al.,
Cancer Research (Suppl.) 55:5908s-5910s (1995); and Robertson et
al., Blood 79:2229-2236 (1992).
[0135] Other potential antagonists include antisense molecules.
Antisense technology can be used to control gene expression through
antisense DNA or RNA or through triple-helix formation. Antisense
techniques are discussed, for example, in Okano, J., Neurochem.
56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix
formation is discussed in, for instance Lee et al., Nucleic Acids
Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and
Dervan et al., Science 251:1360 (1991). The methods are based on
binding of a polynucleotide to a complementary DNA or RNA. For
example, the 5' coding portion of a polynucleotide that encodes the
mature polypeptide of the present invention may be used to design
an antisense RNA oligonucleotide of from about 10 to 40 base pairs
in length. A DNA oligonucleotide is designed to be complementary to
a region of the gene involved in transcription thereby preventing
transcription and the production of the receptor. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into receptor polypeptide. The
oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of the receptor.
[0136] Further antagonist according to the present invention
include soluble forms of CD33-like protein, i.e., CD33-like protein
fragments that include the extracellular region from the full
length receptor. Such soluble forms of the receptor, which may be
naturally occurring or synthetic, antagonize CD33-like protein
mediated signaling by competing with the cell surface CD33-like
protein for binding to CD33 receptor ligands.
[0137] As indicated polyclonal and monoclonal antibody antagonists
according to the present invention can be raised according to the
methods disclosed in WO 93/20848 and U.S. Pat. No. 5,239,062. The
term "antibody" (Ab) or "monoclonal antibody" (MoAb) as used herein
is meant to include intact molecules as well as fragments thereof
(such as, for example, Fab and F(ab').sub.2 fragments) which are
capable of binding an antigen. Fab and F(ab').sub.2 fragments lack
the Fc fragment of intact antibody, clear more rapidly from the
circulation, and may have less non-specific tissue binding of an
intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)).
[0138] Antibodies according to the present invention may be
prepared by any of a variety of methods using CD33-like protein
immunogens of the present invention. As indicated, such CD33-like
protein immunogens include the full length CD33-like protein
polypeptide (which may or may not include the leader sequence) and
CD33-like protein polypeptide fragments such as the extracellular
domain, the transmembrane domain, and the intracellular domain.
[0139] In a preferred method, antibodies according to the present
invention are MoAbs. Such MoAbs can be prepared using hybridoma
technology as described above (Kohler and Millstein, Nature
256:495-497 (1975) and U.S. Pat. No. 4,376,110; Harlow et al.,
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1988; Monoclonal Antibodies and
Hybridomas: A New Dimension in Biological Analyses, Plenum Press,
New York, N.Y., 1980; Campbell, "Monoclonal Antibody Technology,"
In: Laboratory Techniques in Biochemistry and Molecular Biology,
Volume 13 (Burdon et al., eds.), Elsevier, Amsterdam (1984)).
[0140] Also intended within the scope of the present invention are
humanized chimeric antibodies, produced using genetic constructs
derived from hybridoma cells producing the MoAbs described above.
Methods for production of chimeric antibodies are known in the art.
See, for review: Morrison, Science, 229:1202-1207 (1985); Oi et
al., BioTechniques 4:214 (1986); see, also: Cabilly et al., U.S.
Pat. No. 4,816,567 (Mar. 28, 1989); Taniguchi et al., EPO Patent
Public. EP171496 (Feb. 19, 1986); Morrison et al., EPO Patent Pub.
EP173494 (Mar. 5, 1986); Neuberger et al., PCT Pub. WO8601533 (Mar.
13, 1986); Robinson et al., PCT Pub. WO 8702671 (May 7, 1987);
Boulianne et al., Nature 312:643-646 (1984); Neuberger et al.,
Nature 314:268-270 (1985).
[0141] A particularly preferred method for generating an
anti-CD33-like protein humanized MoAb is described in Caron et al.,
Cancer Res 52:6761 (1992).
[0142] Proteins and other compounds which bind the CD33-like
protein domains are also candidate antagonist according to the
present invention. Such binding compounds can be "captured" using
the yeast two-hybrid system (Fields and Song, Nature 340:245-246
(1989)). A modified version of the yeast two-hybrid system has been
described by Roger Brent and his colleagues (Gyuris, J. et al.,
Cell 75:791-803 (1993); Zervos, A. S. et al., Cell 72:223-232
(1993)). Briefly, a domain of the CD33-like polypeptide is used as
bait for binding compounds. Positives are then selected by their
ability to grow on plates lacking leucine, and then further tested
for their ability to turn blue on plates with X-gal, as previously
described in great detail (Gyuris, J. et al., Cell 75:791-803
(1993)). Preferably, the yeast two-hybrid system is used according
to the present invention to capture compounds which bind to either
the CD33-like extracellular ligand binding domain or to the
CD33-like protein intracellular domain. Such compounds are good
candidate antagonists of the present invention. This system has
been used previously to isolate proteins which bind to the
intracellular domain of the p55 and p75 TNF receptors (WO
95/31544).
[0143] The invention further provides methods for using the
CD33-like protein binding compounds described above as vehicles for
selective killing of tumor cells.
[0144] The specificity of the binding compounds to the CD33-like
protein can be determined by their affinity. Such specificity
exists if the dissociation constant (K.sub.D=1/K, where K is the
affinity constant) of the moiety is <1 .mu.M, preferably <100
nM, and most preferably <1 nM. Antibody molecules will typically
have a K.sub.D in the lower ranges. K.sub.D=[R-L]/[R] [L] where
[R], [L], and [R-L] are the concentrations at equilibrium of the
receptor or CD33-like protein (R), ligand, antibody, or peptide (L)
and receptor-ligand complex (R-L), respectively. Typically, the
binding interactions between ligand or peptide and receptor or
antigen include reversible noncovalent associations such as
electrostatic attraction, Van der Waals forces, and hydrogen
bonds.
[0145] Other assay formats may involve the detection of the
presence or absence of various physiological or chemical changes
that result from the interaction, such as down modulation,
internalization, or an increase in phosphorylation, as described in
Receptor-Effector Coupling--A Practical Approach, ed. Hulme, IRL
Press, Oxford (1990).
[0146] Gelonin is a glycoprotein (m.w. approximately 29-30,000 Kd)
purified from the seeds of Gelonium multiforum. Gelonin belongs to
a class of potent ribosomal-inactivating plant toxins. Other
members of this class of ribosomal inactivating plant toxins are
the chains of abrin, ricin and modeccin. Gelonin, like abrin and
ricin, inhibits protein synthesis by damaging the 60S sub-unit of
mammalian ribosomes. Gelonin appears to be stable to chemical and
physical treatment. Furthermore, gelonin itself does not bind to
cells and, therefore, is non-toxic (except in high concentrations)
and is safe to manipulate in the laboratory. The inactivation of
ribosomes is irreversible, does not appear to involve co-factors
and occurs with an efficiency which suggests that gelonin acts
enzymatically.
[0147] Gelonin and ricin are among the most active toxins which
inhibit protein synthesis on a protein weight basis. Gelonin is 10
to 1000 times more active in inhibiting protein synthesis than
ricin A chain. Peptides like ricin and abrin are composed of two
chains, an A chain which is the toxic unit and a B chain which acts
by binding to cells. Unlike ricin and abrin, gelonin is composed of
a single chain, and because it lacks a B chain for binding to
cells, it is itself relatively non-toxic to intact cells.
[0148] Mammalian cells apparently lack the ability to bind and/or
to internalize the native gelonin molecule. Conjugates of gelonin
with a CD33-like protein binding compound of the present invention
provide both a specific method for binding the gelonin to the cell
and a route for internalization of the gelonin-binding compound
complex.
[0149] Where the CD33-like protein binding compound is a MoAb, the
cytotoxic moiety of the immunotoxin may be a cytotoxic drug or an
enzymatically active toxin of bacterial or plant origin, or an
enzymatically active fragment ("A chain") of such a toxin.
Enzymatically active toxins and fragments thereof are preferred and
are exemplified by gelonin, diphtheria A chain, nonbinding active
fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas
aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha
sarcin, Aleurites fordii proteins, dianthin proteins, Phytoiacca
americana proteins (PAPI, PAPII, and PAP-S), momordica charantia
inhibitor, curcin, crotin, saponaria officinalis inhibitor,
mitogellin, restrictocin, phenomycin, and enomycin. Most preferred
is the conjugation with gelonin.
[0150] Biological response modifiers which may be coupled to the
anti-CD33-like protein MoAb to form an immunotoxin include, but are
not limited to, lymphokines and cytokines such as IL-1, IL-2,
interferons (alpha, beta or gamma), TNF, LT, TGF-beta and IL-6.
These biological response modifiers have a variety of effects on
tumor cells. Among these are increased tumor cell killing by direct
action as well as increased tumor cell killing by increased host
defense mediated processes. Conjugation of an MoAb to these
biological response modifiers will allow selective localization
within tumors and, hence, improved anti-proliferative effects while
suppressing non-specific effects leading to toxicity of non-target
cells.
[0151] Cytotoxic drugs (and derivatives thereof) which are useful
in the present invention include, but are not limited to,
adriamycin, cis-platinum complex, bleomycin and methotrexate. These
cytotoxic drugs are useful for clinical management of recurrent
tumors, but their use is complicated by severe side effects and
damage caused to non-target cells. The MoAb serves as a useful
carrier of such drugs providing an efficient means of both delivery
to the tumor and enhanced entry into the tumor cells themselves. In
addition, specified antibody delivery of cytotoxic drugs to tumors
will provide protection of sensitive sites such as the liver that
do not express CD33-like protein and bone marrow stem cells from
the deleterious action of the chemotherapeutic agents. Use of drugs
conjugated to the carrier antibody as a delivery system allows
lower dosage of the drug itself, since all drug moieties are
conjugated to antibodies which concentrate within the tumor or
leukemia.
[0152] Conjugates of the monoclonal antibody may be made using a
variety of bifunctional protein coupling agents. Examples of such
reagents are SPDP, iminothiolante (IT), bifunctional derivatives of
imidoesters such as dimethyl adipimidate, HCl, active esters such
as disuccinimidyl suberate, aldehydes such as glutaraldehyde,
bis-azido compounds such as bib(p-azidobenzoyl) hexanediamine,
bis-diazonium derivatives such as
bi-(p-diazoniumbenzoyl)ethylenediamine, diisocyanates such as
tolyene 2,6-diisocyanate, and bis-active fluorine compounds such as
a 1,5-difluoro-2,4-dinitrobenzene.
[0153] When used in vivo for therapy, the immunotoxins are
administered to the human or animal patient in therapeutically
effective amounts, i.e., amounts that eliminate or reduce the tumor
burden or in amounts to eliminate residual disease after an earlier
treatment with chemotherapy or radiation therapy. They will
normally be administered parenterally, preferably intravenously.
The dose and dosage regimen will depend upon the nature of the
leukemia and its population, the characteristics of the particular
immunotoxin, e.g., its therapeutic index, the patient, and the
patient's history. The amount of immunotoxin administered will
typically be in the range of about 0.01 to about 1.0 mg/kg of
patient weight.
[0154] For parenteral administration the immunotoxins will be
formulated in a unit dosage injectable form (solution, suspension,
emulsion) in association with a pharmaceutically acceptable
parenteral vehicle. Such vehicles are inherently non-toxic and
non-therapeutic. Examples of such vehicles are water, saline,
Ringer's solution, dextrose solution, and 5% human serum albumin.
Nonaqueous vehicles such as fixed oils and ethyl oleate may also be
used. Liposomes may be used as carriers. The vehicle may contain
minor amounts of additives such as substances that enhance
isotoxicity and chemical stability, e.g., buffers and
preservatives. The immunotoxin will typically be formulated in such
vehicles at concentrations of about 0.1 mg/ml to 10 mg/ml.
[0155] The immunotoxins of the present invention may also be used
in a method of killing tumor cells in bone marrow. In this method,
the bone marrow is first removed from an individual having a
neoplastic disease such as leukemia. Subsequently, the bone marrow
is treated with a cytocidally effective dose of an immunotoxin of
the present invention.
[0156] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1
Expression in E. coli
[0157] The DNA sequence encoding the CD33-like protein in the
deposited polynucleotide is amplified using PCR oligonucleotide
primers specific to the amino acid carboxyl terminal sequence of
the CD33-like protein and to vector sequences 3' to the gene.
Additional nucleotides containing restriction sites to facilitate
cloning are added to the 5' and 3' sequences respectively.
[0158] The 5' oligonucleotide primer has the sequence:
5'CGCCCATGGAGAAGCCAGTGTACGAG 3' (SEQ ID NO:4) containing the
underlined NcoI restriction site, which encodes a start AUG within
the NcoI site, followed by 17 nucleotides of the CD33-like protein
cDNA having the nucleotide sequence shown at nucleotide position
85-102 in FIGS. 1A-1C (SEQ ID-NO:1).
[0159] The 3' primer has the sequence:
5'CGCAAGCTTTCAAGAGCCGCTCTGGGACCC 3' (SEQ ID NO:5) containing the
underlined HindIII restriction site and 18 nucleotides of the
CD33-like protein cDNA having a nucleotide sequence complementary
to the nucleotide sequence shown at nucleotide position 1285-1302
in FIGS. 1A-1C (SEQ ID NO:1).
[0160] The restrictions sites are convenient to restriction enzyme
sites in the bacterial expression vector pQE-60, which is used for
bacterial expression in these examples. (Qiagen, Inc. 9259 Eton
Avenue, Chatsworth, Calif., 91311). pQE60 encodes ampicillin
antibiotic resistance ("Ampr") and contains a bacterial origin of
replication ("ori"), an IPTG inducible promoter, a ribosome binding
site ("RBS"), a 6-His tag and restriction enzyme sites.
[0161] The amplified DNA and the vector pQE60 both are digested
with NcoI and HindIII and then ligated together. Inserting
amplified cDNA encoding the CD33-like protein into pQE60 places the
coding region downstream of and operably linked to the vector's
IPTG-inducible promoter, and in-frame with an initiating AUG
appropriately positioned for translation of the CD33-like
protein.
[0162] The ligation mixture is transformed into competent E. coli
cells using standard procedures. Such procedures are described in
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed.;
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989). E. coli strain M15/rep4, containing multiple copies of the
plasmid pREP4, which expresses lac repressor and confers kanamycin
resistance ("Kanr"), is used in carrying out the illustrative
example described here. This strain, which is only one of many that
are suitable for expressing the CD33-like protein, is available
commercially from Qiagen.
[0163] Transformants are identified by their ability to grow on LB
plates in the presence of ampicillin. Plasmid DNA is isolated from
resistant colonies and the identity of the cloned DNA is confirmed
by restriction analysis.
[0164] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 ug/ml) and kanamycin (25 ug/ml).
[0165] The O/N culture is used to inoculate a large culture, at a
dilution of approximately 1:100 to 1:250. The cells are grown to an
optical density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from lac
repressor sensitive promoters, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
are then harvested by centrifugation and disrupted, by standard
methods. Inclusion bodies are purified from the disrupted cells
using routine collection techniques, and protein is solubilized
from the inclusion bodies into 8M urea. The 8M urea solution
containing the solubilized protein is passed over a PD-10 column in
2.times. phosphate buffered saline ("PBS"), thereby removing the
urea, exchanging the buffer and refolding the protein. Expressed
protein is purified by a further step of chromatography to remove
endotoxin. Then, it is sterile filtered. The sterile filtered
protein preparation is stored in 2.times.PBS at a concentration of
95 micrograms per ml.
Example 2
Expression in Mammalian Cells CHO, COS and Others
[0166] Most of the vectors used for the transient expression of the
cDNA encoding the CD33-like protein in mammalian cells should carry
the SV40 origin of replication. This allows the replication of the
vector to high copy numbers in cells (e.g. COS cells) which express
the T antigen required for the initiation of viral DNA synthesis.
Any other mammalian cell line can also be utilized for this
purpose.
[0167] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from retroviruses, e.g. RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, also cellular
signals can be used (e.g. human actin, promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as pSVL and pMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and
pBC12MI (ATCC 67109). Mammalian host cells that could be used
include, human HeLa, 283, H9 and Jurkart cells, mouse NIH3T3 and
C127 cells, Cos 1, Cos 7 and CV1 African green monkey cells, quail
QC1-3 cells, mouse L cells and Chinese hamster ovary cells.
[0168] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome. The
co-transfection with a selectable marker such as dhfr, gpt,
neomycin, hygromycin allows the identification and isolation of the
transfected cells.
[0169] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
is a useful marker to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al. Biochem J. 227:277-275 (1991), Bebbington et al.,
Bio/Technology 10:163-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) cells are often used for the production of
proteins.
[0170] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology, 438-4470 (March 1985)) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521-530 (1985). Multiple
cloning sites, e.g. with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
Example 2A
Expression of Extracellular Soluble Domain of CD33-Like Protein in
COS Cells
[0171] The expression plasmid is made by cloning a cDNA encoding
CD33-like protein into the expression vector pcDNAI/Amp (which can
be obtained from Invitrogen, Inc.). The expression vector
pcDNAI/amp contains: (1) an E. coli origin of replication effective
for propagation in E. coli and other prokaryotic cell; (2) an
ampicillin resistance gene for selection of plasmid-containing
prokaryotic cells; (3) an SV40 origin of replication for
propagation in eukaryotic cells; (4) a CMV promoter, a polylinker,
an SV40 intron, and a polyadenylation signal arranged so that a
cDNA conveniently can be placed under expression control of the CMV
promoter and operably linked to the SV40 intron and the
polyadenylation signal by means of restriction sites in the
polylinker.
[0172] A DNA fragment encoding the CD33-like protein extracellular
soluble domain and a HA tag fused in frame to its 3' end are cloned
into the polylinker region of the vector so that recombinant
protein expression is directed by the CMV promoter. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein described by Wilson et al., Cell 37: 767 (1984). The fusion
of the HA tag to the target protein allows easy detection of the
recombinant protein with an antibody that recognizes the HA
epitope.
[0173] The plasmid construction strategy is as follows. The
CD33-like protein cDNA of the deposit clone is amplified using
primers that contain convenient restriction sites, much as
described above for the expression of CD33-like protein in E. coli.
To facilitate detection, purification and characterization of the
expressed CD33-like protein, one of the primers contains a
hemagglutinin tag ("HA tag") as described above.
[0174] Suitable primers include the following, which are used in
this example: the 5' primer CGC GGA TCC GCC ATC ATG CTG CCC CTG CTG
CTG 3' (SEQ ID NO:6) contains the underlined BamHI site and the
first 18 nucleotides in the coding region of the CD33-like protein
cDNA having the nucleotide sequence shown at nucleotide position
37-54 in FIGS. 1A-1C (SEQ ID NO:1).
[0175] The 3' primer, containing the underlined XbaI site, stop
codon, hemagglutinin tag and being complementary to the nucleotide
sequence of the last 18 bp preceding the transmembrane domain (bps
1285-1302) shown in FIG. 1 (SEQ ID NO:1), has the following
sequence: 5'CGC TCT AGA TCA AGC GTA GTC TGG GAC GTC GTA TGG GTA AGA
GCC GCT CTG GGA CCC 3' (SEQ ID NO:7).
[0176] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with BamHI and XbaI and then ligated. The ligation
mixture is transformed into E. coli strain SURE (available from
Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, Calif. 92037), and the transformed culture is plated on
ampicillin media plates which then are incubated to allow growth of
ampicillin resistant colonies. Plasmid DNA is isolated from
resistant colonies and examined by restriction analysis and gel
sizing for the presence of the CD33-like protein-encoding
fragment.
[0177] For expression of recombinant CD33-like protein, COS cells
are transfected with an expression vector, as described above,
using DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of CD33-like protein by the vector.
Expression of the CD33-like protein/HA fusion protein is detected
by radiolabelling and immunoprecipitation, using methods described
in, for example Harlow et al., Antibodies: A Laboratory Manual, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing .sup.35S-cysteine for 8
hours. The cells and the media are collected, and the cells are
washed and the lysed with detergent-containing RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5,
as described by Wilson et al. cited above. Proteins are
precipitated from the cell lysate and from the culture media using
an HA-specific monoclonal antibody. The precipitated proteins then
are analyzed by SDS-PAGE gels and autoradiography. An expression
product of the expected size is seen in the cell lysate, which is
not seen in negative controls.
Example 2B
Expression and Purification of Human CD33-Like Protein Using the
CHO Expression System
[0178] The DNA sequence encoding CD33-like protein in the deposited
polynucleotide is amplified using PCR oligonucleotide primers
specific to the carboxyl terminal sequence of the CD33-like protein
and to vector sequences 3' to the gene. Additional nucleotides
containing restriction sites to facilitate cloning are added to the
5' and 3' sequences respectively.
[0179] For both the full length gene and the nucleotide sequence
encoding the extracellular soluble domain, the 5' primer has the
sequence: 5'CGC GGA TCC GCC ATC ATG CTG CCC CTG CTG CTG 3' (SEQ ID
NO:9) containing the underlined BamHI restriction site and the
first 18 nucleotides in the coding region of the CD33-like protein
cDNA having the nucleotide sequence shown at nucleotide position
37-54 in FIGS. 1A-1C (SEQ ID NO:1). For the full length gene, the
3' primer has the sequence: 5'CGC GGT ACC TCA GTG GCT CCT CCA GCC
AGG 3' (SEQ ID NO:8), containing the underlined Asp718 restriction
site and nucleotides of the CD33-like protein cDNA having a
sequence complementary to the nucleotide sequence shown at
nucleotide position 1713-1730 in FIGS. 1A-1C (SEQ ID NO:1). For the
extracellular domain, the 3' primer has the sequence: 5'CGC GGT ACC
TCA AGA GCC GCT CTG GGA CCC 3' (SEQ ID NO:10), containing the
underlined Asp718 restriction site and 18 nucleotides of the
CD33-like protein cDNA having a nucleotide sequence complementary
to the nucleotide sequence shown at nucleotide position 1285-1302
in FIGS. 1A-1C (SEQ ID NO:1). The restrictions sites are convenient
to restriction enzyme sites in the CHO expression vectors PC4.
[0180] The amplified CD33-like protein DNA and the vector PC4 both
are digested with BamHI and the digested DNAs then ligated
together. Insertion of the CD33-like protein DNA into the BamHI
restricted vector placed the CD33-like protein coding region
downstream of and operably linked to the vector's promoter. The
ligation mixture is transformed into competent E. coli cells using
standard procedures. Such procedures are described in Sambrook et
al., Molecular Cloning: A Laboratory Manual, 2nd Ed.; Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
Example 3
Cloning and Expression of the CD33-Like Protein in a Baculovirus
Expression System
[0181] The cDNA sequences encoding either the soluble extracellular
domain or the full length CD33-like protein receptor in the
deposited clone is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0182] The 5' primer for expression of either the extracellular
domain or the full length protein has the sequence: 5'CGC GGA TCC
GCC ATC ATG CTG CCC CTG CTG CTG 3' (SEQ ID NO:9) containing the
underlined BamHI restriction site and the first 18 nucleotides in
the coding region of the CD33-like protein cDNA having the
nucleotide sequence shown at nucleotide position 37-54 in FIGS.
1A-1C (SEQ ID NO:1). Inserted into an expression vector, as
described below, the 5' end of the amplified fragment encoding
CD33-like protein provides an efficient signal peptide. An
efficient signal for initiation of translation in eukaryotic cells,
as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987) is
appropriately located in the vector portion of the construct.
[0183] For the full length gene the 3' primer has the full length
sequence: 5'CGC GGT ACC TCA GTG GCT CCT CCA GCC AGG 3' (SEQ ID
NO:8), containing the underlined Asp718 restriction site and
nucleotides of the CD33-like protein cDNA having a sequence
complementary to the nucleotide sequence shown at nucleotide
position 1713-1730 in FIGS. 1A-1C (SEQ ID NO:1). For the
extracellular domain, the 3' primer has the sequence: 5'CGC GGT ACC
TCA AGA GCC GCT CTG GGA CCC 3' (SEQ ID NO:10), containing the
underlined Asp718 restriction site and 18 nucleotides of the
CD33-like protein cDNA having a nucleotide sequence complementary
to the nucleotide sequence shown at nucleotide position 1285-1302
in FIGS. 1A-1C (SEQ ID NO:1).
[0184] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean.RTM.," BIO 101 Inc.,
La Jolla, Calif.). The fragment then is digested with BamHI and
Asp718 and again is purified on a 1% agarose gel. This fragment is
designated herein F2.
[0185] The vector pA2 is used to express the CD33-like protein in
the baculovirus expression system, using standard methods, such as
those described in Summers et al, A Manual of Methods for
Baculovirus Vectors and Insect Cell Culture Procedures, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by convenient restriction sites. For an easy selection of
recombinant virus the beta-galactosidase gene from E. coli is
inserted in the same orientation as the polyhedrin promoter and is
followed by the polyadenylation signal of the polyhedrin gene. The
polyhedrin sequences are flanked at both sides by viral sequences
for cell-mediated homologous recombination with wild-type viral DNA
to generate viable virus that express the cloned
polynucleotide.
[0186] Many other baculovirus vectors could be used in place of
pA2, such as pAc373, pVL941 and pAcIM1 provided, as those of skill
readily will appreciate, that construction provides appropriately
located signals for transcription, translation, trafficking and the
like, such as an in-frame AUG and a signal peptide, as required.
Such vectors are described in Luckow et al., Virology 170:31-39,
among others.
[0187] The plasmid is digested with the restriction enzymes BamHI
and Asp718 and then is dephosphorylated using calf intestinal
phosphatase, using routine procedures known in the art. The DNA is
then isolated from a 1% agarose gel using a commercially available
kit ("Geneclean.RTM." BIO 101 Inc., La Jolla, Calif.). This vector
DNA is designated herein "V2".
[0188] Fragment F2 and the dephosphorylated plasmid V2 are ligated
together with T4 DNA ligase. E. coli HB101 cells are transformed
with ligation mix and spread on culture plates. Bacteria are
identified that contain the plasmid with the human CD33-like
protein gene by digesting DNA from individual colonies using BamHI
and Asp718 and then analyzing the digestion product by gel
electrophoresis. The sequence of the cloned fragment is confirmed
by DNA sequencing. This plasmid is designated herein pBac/CD33-like
protein.
[0189] Five .mu.g of the plasmid pBac/CD33-like protein is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus DNA ("BaculoGold.RTM. baculovirus DNA",
Pharmingen, San Diego, Calif.), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci. USA
84:7413-7417 (1987). 1 .mu.g of BaculoGold.RTM. virus DNA and 5
.mu.g of the plasmid pBac/CD33-like protein are mixed in a sterile
well of a microtiter plate containing 50 .mu.l of serum-free
Grace's medium (Life Technologies Inc., Gaithersburg, Md.).
Afterwards 10 .mu.l Lipofectin plus 90 .mu.l Grace's medium are
added, mixed and incubated for 15 minutes at room temperature. Then
the transfection mixture is added drop-wise to Sf9 insect cells
(ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml
Grace's medium without serum. The plate is rocked back and forth to
mix the newly added solution. The plate is then incubated for 5
hours at 27.degree. C. After 5 hours the transfection solution is
removed from the plate and 1 ml of Grace's insect medium
supplemented with 10% fetal calf serum is added. The plate is put
back into an incubator and cultivation is continued at 27.degree.
C. for four days.
[0190] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, cited above.
An agarose gel with "Blue Gal" (Life Technologies Inc.,
Gaithersburg, Md.) is used to allow easy identification and
isolation of gal-expressing clones, which produce blue-stained
plaques. (A detailed description of a "plaque assay" of this type
can also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
Md., page 9-10).
[0191] Four days after serial dilution, the virus is added to the
cells. After appropriate incubation, blue stained plaques are
picked with the tip of an Eppendorf pipette. The agar containing
the recombinant viruses is then resuspended in an Eppendorf tube
containing 200 .mu.l of Grace's medium. The agar is removed by a
brief centrifugation and the supernatant containing the recombinant
baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
Four days later the supernatants of these culture dishes are
harvested and then they are stored at 4.degree. C. A clone
containing properly inserted CD33-like protein receptor is
identified by DNA analysis including restriction mapping and
sequencing. This is designated herein as V-CD33-like protein.
[0192] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-CD33-like protein at a multiplicity of infection
("MOI") of about 2 (about 1 to about 3). Six hours later the medium
is removed and is replaced with SF900 II medium minus methionine
and cysteine (available from Life Technologies Inc., Gaithersburg,
Md.). Forty-two hours later, 5 .mu.Ci of 35S-methionine and 5
.mu.Ci 35S cysteine (available from Amersham) are added. The cells
are further incubated for 16 hours and then they are harvested by
centrifugation, lysed and the labeled proteins are visualized by
SDS-PAGE and autoradiography.
Example 4
Tissue Distribution of CD33-Like Protein mRNA Expression
[0193] Northern blot analysis was carried out to examine the levels
of expression of the gene encoding the CD33-like protein in human
tissues, using methods described by, among others, Sambrook et al.,
cited above. A cDNA probe containing the entire nucleotide sequence
of the CD33-like protein of the present invention (SEQ ID NO:1) was
labeled with .sup.32P using the rediprime DNA labeling system
(Amersham Life Science), according to manufacturer's instructions.
After labeling, the probe was purified using a CHROMA SPIN-100
column (Clontech Laboratories, Inc.), according to manufacturer's
protocol number PT1200-1. The purified labeled probe was then used
to examine various human tissues for the expression of the gene
encoding the CD33-like protein.
[0194] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) were obtained
from Clontech and were examined with labeled probe using ExpressHyb
Hybridization Solution (Clontech) according to manufacturer's
protocol number PT1190-1. Following hybridization and washing, the
blots were mounted and exposed to film at -70.degree. C. overnight,
and films developed according to standard procedures.
[0195] As shown in FIG. 3, expression of the gene encoding the
CD33-like protein of the present invention was highest in
hemopoietic tissues including bone marrow, peripheral blood
leucocytes and spleen (FIG. 3, lanes 10, 11, 15, respectively), but
can also be detected in other tissue such as the lymph node,
appendix, lung and placenta (FIG. 3, lanes 14, 12, 5 and 6,
respectively).
[0196] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples.
[0197] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the appended claims.
[0198] The disclosures of all patents, patent applications, and
publications referred to herein are hereby incorporated by
reference.
Sequence CWU 1
1
1212027DNAHomo
sapiensCDS(37)..(1689)sig_peptide(37)..(81)mat_peptide(82)..()
1ggcacgagct gggctggggc cctggcggat ggagac atg ctg ccc ctg ctg ctg
54Met Leu Pro Leu Leu Leu-15 -10ctg ccc ctg ctg tgg ggg ggg tcc ctg
cag gag aag cca gtg tac gag 102Leu Pro Leu Leu Trp Gly Gly Ser Leu
Gln Glu Lys Pro Val Tyr Glu-5 -1 1 5ctg caa gtg cag aag tcg gtg acg
gtg cag gag ggc ctg tgc gtc ctt 150Leu Gln Val Gln Lys Ser Val Thr
Val Gln Glu Gly Leu Cys Val Leu10 15 20gtg ccc tgc tcc ttc tct tac
ccc tgg aga tcc tgg tat tcc tct ccc 198Val Pro Cys Ser Phe Ser Tyr
Pro Trp Arg Ser Trp Tyr Ser Ser Pro25 30 35cca ctc tac gtc tac tgg
ttc cgg gac ggg gag atc cca tac tac gct 246Pro Leu Tyr Val Tyr Trp
Phe Arg Asp Gly Glu Ile Pro Tyr Tyr Ala40 45 50 55gag gtt gtg gcc
aca aac aac cca gac aga aga gtg aag cca gag acc 294Glu Val Val Ala
Thr Asn Asn Pro Asp Arg Arg Val Lys Pro Glu Thr60 65 70cag ggc cga
ttc cgc ctc ctt ggg gat gtc cag aag aag aac tgc tcc 342Gln Gly Arg
Phe Arg Leu Leu Gly Asp Val Gln Lys Lys Asn Cys Ser75 80 85ctg agc
atc gga gat gcc aga atg gag gac acg gga agc tat ttc ttc 390Leu Ser
Ile Gly Asp Ala Arg Met Glu Asp Thr Gly Ser Tyr Phe Phe90 95 100cgc
gtg gag aga gga agg gat gta aaa tat agc tac caa cag aat aag 438Arg
Val Glu Arg Gly Arg Asp Val Lys Tyr Ser Tyr Gln Gln Asn Lys105 110
115ctg aac ttg gag gtg aca gcc ctg ata gag aaa ccc gac atc cac ttt
486Leu Asn Leu Glu Val Thr Ala Leu Ile Glu Lys Pro Asp Ile His
Phe120 125 130 135ctg gag cct ctg gag tcc ggc cgc ccc aca agg ctg
agc tgc agc ctt 534Leu Glu Pro Leu Glu Ser Gly Arg Pro Thr Arg Leu
Ser Cys Ser Leu140 145 150cca gga tcc tgt gaa gcg gga cca cct ctc
aca ttc tcc tgg acg ggg 582Pro Gly Ser Cys Glu Ala Gly Pro Pro Leu
Thr Phe Ser Trp Thr Gly155 160 165aat gcc ctc agc ccc ctg gac ccc
gag acc acc cgc tcc tca gag ctc 630Asn Ala Leu Ser Pro Leu Asp Pro
Glu Thr Thr Arg Ser Ser Glu Leu170 175 180acc ctc acc ccc agg ccc
gag gac cat ggc acc aac ctc acc tgt cag 678Thr Leu Thr Pro Arg Pro
Glu Asp His Gly Thr Asn Leu Thr Cys Gln185 190 195atg aaa cgc caa
gga gct cag gtg acc acg gag aga act gtc cag ctc 726Met Lys Arg Gln
Gly Ala Gln Val Thr Thr Glu Arg Thr Val Gln Leu200 205 210 215aat
gtc tcc tat gct cca cag acc atc acc atc ttc agg aac ggc ata 774Asn
Val Ser Tyr Ala Pro Gln Thr Ile Thr Ile Phe Arg Asn Gly Ile220 225
230gcc cta gag atc ctg caa aac acc tca tac ctt ccg gtc ctg gag ggc
822Ala Leu Glu Ile Leu Gln Asn Thr Ser Tyr Leu Pro Val Leu Glu
Gly235 240 245cag gct ctg cgg ctg ctc tgt gat gct ccc agc aac ccc
cct gca cac 870Gln Ala Leu Arg Leu Leu Cys Asp Ala Pro Ser Asn Pro
Pro Ala His250 255 260ctg agc tgg ttc cag ggc tcc cct gcc ctg aac
gcc acc ccc atc tcc 918Leu Ser Trp Phe Gln Gly Ser Pro Ala Leu Asn
Ala Thr Pro Ile Ser265 270 275aat acc ggg atc ttg gag ctt cgt cga
gta agg tct gca gaa aaa gga 966Asn Thr Gly Ile Leu Glu Leu Arg Arg
Val Arg Ser Ala Glu Lys Gly280 285 290 295ggc ttc acc tgc cgc gct
cag cac ccg ctg ggc ttc ctg caa att ttt 1014Gly Phe Thr Cys Arg Ala
Gln His Pro Leu Gly Phe Leu Gln Ile Phe300 305 310ctg aat ctc tca
gtt tac tcc ctc cca cag ttg ctg ggc ccc tcc tgc 1062Leu Asn Leu Ser
Val Tyr Ser Leu Pro Gln Leu Leu Gly Pro Ser Cys315 320 325tcc tgg
gag gct gag ggt ctg cac tgc aga tgc tcc ttt cga gcc tgg 1110Ser Trp
Glu Ala Glu Gly Leu His Cys Arg Cys Ser Phe Arg Ala Trp330 335
340ccg gcc ccc tcc ctg tgc tgg cgg ctt gag gag aag ccg ctg gag ggg
1158Pro Ala Pro Ser Leu Cys Trp Arg Leu Glu Glu Lys Pro Leu Glu
Gly345 350 355aac agc agc cag ggc tca ttc aag gtc aac tcc agc tca
cct ggt ccc 1206Asn Ser Ser Gln Gly Ser Phe Lys Val Asn Ser Ser Ser
Pro Gly Pro360 365 370 375tgg gcc aac agc tcc ctg atc ctc cac ggg
ggg ctc aat tcc gac ctc 1254Trp Ala Asn Ser Ser Leu Ile Leu His Gly
Gly Leu Asn Ser Asp Leu380 385 390aaa gtc agc tgc aag gcc tgg aac
atc tat ggg tcc cag agc ggc tct 1302Lys Val Ser Cys Lys Ala Trp Asn
Ile Tyr Gly Ser Gln Ser Gly Ser395 400 405gtc ctg ctg ctg caa ggg
aga tcg aac ctc ggg aca gga gtg gtt cct 1350Val Leu Leu Leu Gln Gly
Arg Ser Asn Leu Gly Thr Gly Val Val Pro410 415 420gca gcc ctt ggt
ggt gct ggt gtc atg gcc ctg ctc tgt atc tgt ctg 1398Ala Ala Leu Gly
Gly Ala Gly Val Met Ala Leu Leu Cys Ile Cys Leu425 430 435tgc ctc
atc ttc ttt tta ata gtg aaa gcc cgc agg aag caa gca gct 1446Cys Leu
Ile Phe Phe Leu Ile Val Lys Ala Arg Arg Lys Gln Ala Ala440 445 450
455ggg aga cca gag aaa atg gat gat gaa gac ccc att atg ggt acc atc
1494Gly Arg Pro Glu Lys Met Asp Asp Glu Asp Pro Ile Met Gly Thr
Ile460 465 470acc tcg ggt tcc agg aag aag ccc tgg cca gac agc ccc
gga gat caa 1542Thr Ser Gly Ser Arg Lys Lys Pro Trp Pro Asp Ser Pro
Gly Asp Gln475 480 485gca tct cct cct ggg gat gcc cct ccc ttg gaa
gaa caa aag gag ctc 1590Ala Ser Pro Pro Gly Asp Ala Pro Pro Leu Glu
Glu Gln Lys Glu Leu490 495 500cat tat gcc tcc ctt agt ttt tct gag
atg aag tcg agg gag cct aag 1638His Tyr Ala Ser Leu Ser Phe Ser Glu
Met Lys Ser Arg Glu Pro Lys505 510 515gac cag gag gcc cca agc acc
acg gag tac tcg gag atc aag aca agc 1686Asp Gln Glu Ala Pro Ser Thr
Thr Glu Tyr Ser Glu Ile Lys Thr Ser520 525 530 535aag tgaggatttg
cccagagttc agtcctggct ggaggagcca cagcctgtct 1739Lysgggggaaagg
acaagtcagg gaccacttgc tgaagcacga agagcccttg tggcaatgtt
1799aacattaact gatgtttaag tgctccaagc agagcagaaa gaaaacagat
gatggaatta 1859gagaggtggg ctcaaatcta ggccctggca ctgtcatcaa
gcaattcact gcatccctct 1919gtgcctcagt ttcccattct gtaaatcaga
gatcatgcat gctacctcaa aggttgttgt 1979gaacattaaa gaaatcaaca
catggaaatc aaaaaaaaaa aaaaaaaa 20272551PRTHomo sapiens 2Met Leu Pro
Leu Leu Leu Leu Pro Leu Leu Trp Gly Gly Ser Leu Gln-15 -10 -5 -1
1Glu Lys Pro Val Tyr Glu Leu Gln Val Gln Lys Ser Val Thr Val Gln5
10 15Glu Gly Leu Cys Val Leu Val Pro Cys Ser Phe Ser Tyr Pro Trp
Arg20 25 30Ser Trp Tyr Ser Ser Pro Pro Leu Tyr Val Tyr Trp Phe Arg
Asp Gly35 40 45Glu Ile Pro Tyr Tyr Ala Glu Val Val Ala Thr Asn Asn
Pro Asp Arg50 55 60 65Arg Val Lys Pro Glu Thr Gln Gly Arg Phe Arg
Leu Leu Gly Asp Val70 75 80Gln Lys Lys Asn Cys Ser Leu Ser Ile Gly
Asp Ala Arg Met Glu Asp85 90 95Thr Gly Ser Tyr Phe Phe Arg Val Glu
Arg Gly Arg Asp Val Lys Tyr100 105 110Ser Tyr Gln Gln Asn Lys Leu
Asn Leu Glu Val Thr Ala Leu Ile Glu115 120 125Lys Pro Asp Ile His
Phe Leu Glu Pro Leu Glu Ser Gly Arg Pro Thr130 135 140 145Arg Leu
Ser Cys Ser Leu Pro Gly Ser Cys Glu Ala Gly Pro Pro Leu150 155
160Thr Phe Ser Trp Thr Gly Asn Ala Leu Ser Pro Leu Asp Pro Glu
Thr165 170 175Thr Arg Ser Ser Glu Leu Thr Leu Thr Pro Arg Pro Glu
Asp His Gly180 185 190Thr Asn Leu Thr Cys Gln Met Lys Arg Gln Gly
Ala Gln Val Thr Thr195 200 205Glu Arg Thr Val Gln Leu Asn Val Ser
Tyr Ala Pro Gln Thr Ile Thr210 215 220 225Ile Phe Arg Asn Gly Ile
Ala Leu Glu Ile Leu Gln Asn Thr Ser Tyr230 235 240Leu Pro Val Leu
Glu Gly Gln Ala Leu Arg Leu Leu Cys Asp Ala Pro245 250 255Ser Asn
Pro Pro Ala His Leu Ser Trp Phe Gln Gly Ser Pro Ala Leu260 265
270Asn Ala Thr Pro Ile Ser Asn Thr Gly Ile Leu Glu Leu Arg Arg
Val275 280 285Arg Ser Ala Glu Lys Gly Gly Phe Thr Cys Arg Ala Gln
His Pro Leu290 295 300 305Gly Phe Leu Gln Ile Phe Leu Asn Leu Ser
Val Tyr Ser Leu Pro Gln310 315 320Leu Leu Gly Pro Ser Cys Ser Trp
Glu Ala Glu Gly Leu His Cys Arg325 330 335Cys Ser Phe Arg Ala Trp
Pro Ala Pro Ser Leu Cys Trp Arg Leu Glu340 345 350Glu Lys Pro Leu
Glu Gly Asn Ser Ser Gln Gly Ser Phe Lys Val Asn355 360 365Ser Ser
Ser Pro Gly Pro Trp Ala Asn Ser Ser Leu Ile Leu His Gly370 375 380
385Gly Leu Asn Ser Asp Leu Lys Val Ser Cys Lys Ala Trp Asn Ile
Tyr390 395 400Gly Ser Gln Ser Gly Ser Val Leu Leu Leu Gln Gly Arg
Ser Asn Leu405 410 415Gly Thr Gly Val Val Pro Ala Ala Leu Gly Gly
Ala Gly Val Met Ala420 425 430Leu Leu Cys Ile Cys Leu Cys Leu Ile
Phe Phe Leu Ile Val Lys Ala435 440 445Arg Arg Lys Gln Ala Ala Gly
Arg Pro Glu Lys Met Asp Asp Glu Asp450 455 460 465Pro Ile Met Gly
Thr Ile Thr Ser Gly Ser Arg Lys Lys Pro Trp Pro470 475 480Asp Ser
Pro Gly Asp Gln Ala Ser Pro Pro Gly Asp Ala Pro Pro Leu485 490
495Glu Glu Gln Lys Glu Leu His Tyr Ala Ser Leu Ser Phe Ser Glu
Met500 505 510Lys Ser Arg Glu Pro Lys Asp Gln Glu Ala Pro Ser Thr
Thr Glu Tyr515 520 525Ser Glu Ile Lys Thr Ser Lys530 5353364PRTHomo
sapiens 3Met Pro Leu Leu Leu Leu Leu Pro Leu Leu Trp Ala Gly Ala
Leu Ala1 5 10 15Met Asp Pro Asn Phe Trp Leu Gln Val Gln Glu Ser Val
Thr Val Gln20 25 30Glu Gly Leu Cys Val Leu Val Pro Cys Thr Phe Phe
His Pro Ile Pro35 40 45Tyr Tyr Asp Lys Asn Ser Pro Val His Gly Tyr
Trp Phe Arg Glu Gly50 55 60Ala Ile Ile Ser Gly Asp Ser Pro Val Ala
Thr Asn Lys Leu Asp Gln65 70 75 80Glu Val Gln Glu Glu Thr Gln Gly
Arg Phe Arg Leu Leu Gly Asp Pro85 90 95Ser Arg Asn Asn Cys Ser Leu
Ser Ile Val Asp Ala Arg Arg Arg Asp100 105 110Asn Gly Ser Tyr Phe
Phe Arg Met Glu Arg Gly Ser Thr Lys Tyr Ser115 120 125Tyr Lys Ser
Pro Gln Leu Ser Val His Val Thr Asp Leu Thr His Arg130 135 140Pro
Lys Ile Leu Ile Pro Gly Thr Leu Glu Pro Gly His Ser Lys Asn145 150
155 160Leu Thr Cys Ser Val Ser Trp Ala Cys Glu Gln Gly Thr Pro Pro
Ile165 170 175Phe Ser Trp Leu Ser Ala Ala Pro Thr Ser Leu Gly Pro
Arg Thr Thr180 185 190His Ser Ser Val Leu Ile Ile Thr Pro Arg Pro
Gln Asp His Gly Thr195 200 205Asn Leu Thr Cys Gln Val Lys Phe Ala
Gly Ala Gly Val Thr Thr Glu210 215 220Arg Thr Ile Gln Leu Asn Val
Thr Tyr Val Pro Gln Asn Pro Thr Thr225 230 235 240Gly Ile Phe Pro
Gly Asp Gly Ser Gly Lys Gln Glu Thr Arg Ala Gly245 250 255Leu Val
His Gly Ala Ile Gly Gly Ala Gly Val Thr Ala Leu Leu Ala260 265
270Leu Cys Leu Cys Leu Ile Phe Phe Ile Val Lys Thr His Arg Arg
Lys275 280 285Ala Ala Arg Thr Ala Val Gly Ser Asn Asp Thr His Pro
Thr Thr Gly290 295 300Ser Ala Ser Pro Lys His Gln Lys Asn Ser Lys
Leu His Gly Pro Thr305 310 315 320Glu Thr Ser Ser Cys Ser Gly Ala
Ala Pro Thr Val Glu Met Asp Glu325 330 335Glu Leu His Tyr Ala Ser
Leu Asn Phe His Gly Met Asn Pro Ser Lys340 345 350Asp Thr Ser Thr
Glu Tyr Ser Glu Val Arg Thr Gln355 360426DNAHomo sapiens
4cgcccatgga gaagccagtg tacgag 26530DNAHomo sapiens 5cgcaagcttt
caagagccgc tctgggaccc 30633DNAHomo sapiens 6cgcggatccg ccatcatgct
gcccctgctg ctg 33757DNAHomo sapiens 7cgctctagat caagcgtagt
ctgggacgtc gtatgggtaa gagccgctct gggaccc 57830DNAHomo sapiens
8cgcggtacct cagtggctcc tccagccagg 30933DNAHomo sapiens 9cgcggatccg
ccatcatgct gcccctgctg ctg 331030DNAHomo sapiens 10cgcggtacct
caagagccgc tctgggaccc 3011459DNAHomo
sapiensmisc_feature(10)..(10)May be any nucleotide 11aattcggcan
aggttccggg acgggnagat cccatactac gctgaggttg tggccacaaa 60caacccagac
agaagagtga agccagagac ccagggccga ttccgcctcc ttggggatgt
120ccagaagaag aactgctccc tgagcatcgg agatccagaa ntggaggaca
cgggaagcta 180tttcttccgc gtggagagag gaagggatgt aaaaatatag
ctaccaacag aataagctga 240acttggaggt gacagccctg atagagaaac
ccgacatcca ctttttggag cctttggagt 300tccggtccgn cccaaaaggt
tgagntgnag nctttccagn ntcctgttna agggggaccc 360acttttaaaa
ttttcntgga ggggattncc tnannccntg gncccggnna nnacnnttnt
420nggggttnnn nttnancnna gnncngggnn ctgggaaan 45912433DNAHomo
sapiensmisc_feature(12)..(12)May be any nucleotide 12agcaattcac
tncatccctc tntgcctcag tttcccattc tgtaaatcag agatcatgca 60tgctacctca
aaggttgttg tgaacattaa agaaatcaac acatggaaat caaccaacat
120gggtcctgga acaggcgttg tgctcagtgc tttctggtct ctcttccttg
aatagaaagg 180tcctgctggc aagttctctc aaggctgggg atgaccaggc
acaaaaaaca gggcagcaat 240atgttggtgt cactcccctt cccaaaactc
ttcgaagact ccctagggaa agaccagccc 300ctcagcctgg gcacttggtt
catgatgtgg gatcttatat ccttgccaga gtcatatctt 360ttgcccactt
ttacctgcaa tccttgcatt catattcctt gggttccagt cnttcattta
420tgagacccta ggg 433
* * * * *