U.S. patent application number 12/106048 was filed with the patent office on 2009-03-26 for corn plants and seed enhanced for asparagine and protein.
This patent application is currently assigned to Monsanto Technology LLC. Invention is credited to Scott Andersen, James Crowley, Stephen M. Duff, Bradon J. Fabbri, Qungang Qi, Bo-Xing Qiu, Steven Screen.
Application Number | 20090081353 12/106048 |
Document ID | / |
Family ID | 39876167 |
Filed Date | 2009-03-26 |
United States Patent
Application |
20090081353 |
Kind Code |
A1 |
Andersen; Scott ; et
al. |
March 26, 2009 |
CORN PLANTS AND SEED ENHANCED FOR ASPARAGINE AND PROTEIN
Abstract
The present invention relates to a corn plant and seed with
enhanced levels of protein and amino acids. The invention also
relates to DNA constructs that provide expression in transgenic
corn cells of an asparagine synthetase enzyme. The DNA constructs
are used in a method to produce transgenic corn plants and seeds
and to select for plants and seeds with enhanced levels of protein
and amino acids.
Inventors: |
Andersen; Scott;
(Manchester, MO) ; Crowley; James; (Manchester,
MO) ; Duff; Stephen M.; (St. Louis, MO) ;
Fabbri; Bradon J.; (Chesterfield, MO) ; Qi;
Qungang; (Ballwin, MO) ; Qiu; Bo-Xing;
(Chesterfield, MO) ; Screen; Steven; (St. Louis,
MO) |
Correspondence
Address: |
SONNENSCHEIN NATH & ROSENTHAL LLP
P.O. BOX 061080, SOUTH WACKER DRIVE STATION, SEARS TOWER
CHICAGO
IL
60606
US
|
Assignee: |
Monsanto Technology LLC
|
Family ID: |
39876167 |
Appl. No.: |
12/106048 |
Filed: |
April 18, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60912909 |
Apr 19, 2007 |
|
|
|
Current U.S.
Class: |
426/622 ;
435/320.1; 435/419; 536/23.1; 800/278; 800/320.1 |
Current CPC
Class: |
C12N 15/8251 20130101;
C12N 9/93 20130101 |
Class at
Publication: |
426/622 ;
536/23.1; 435/320.1; 435/419; 800/320.1; 800/278 |
International
Class: |
A23L 1/10 20060101
A23L001/10; C12N 15/11 20060101 C12N015/11; C12N 15/82 20060101
C12N015/82; A23K 1/16 20060101 A23K001/16; C12N 5/10 20060101
C12N005/10; A01H 5/00 20060101 A01H005/00 |
Claims
1. An isolated nucleic acid sequence selected from the group
consisting of: (a) a nucleic acid sequence comprising the sequence
of SEQ ID NO:50; (b) a nucleic acid sequence with at least about
90% sequence identity to the sequence of SEQ ID NO:50, wherein the
nucleic acid sequence encodes a polypeptide with asparagine
synthetase activity; (c) a nucleic acid sequence that encodes the
polypeptide sequence of SEQ ID NO:51; (d) a nucleic acid sequence
that encodes a polypeptide with at least about 90% sequence
identity to the polypeptide sequence of SEQ ID NO:51, wherein the
polypeptide has asparagine synthetase activity; and (e) a nucleic
acid sequence that hybridizes to a sequence of (a)-(d) under high
stringency conditions of about 0.2.times.SSC and 65.degree. C.,
wherein the nucleic acid sequence encodes a polypeptide comprising
asparagine synthetase activity.
2. The isolated nucleic acid sequence of claim 1, further defined
as operably linked to a heterologous regulatory element.
3. The isolated nucleic acid sequence of claim 1, further defined
as operably linked to a heterologous promoter functional in
plants.
4. A transgenic plant cell transformed with the isolated nucleic
acid sequence of claim 1.
5. A transgenic plant transformed with the isolated nucleic acid
sequence of claim 1, or a part thereof.
6. The transgenic plant of claim 5, further defined as a corn
plant.
7. A transgenic seed comprising the isolated nucleic acid sequence
of claim 1.
8. A transgenic corn seed with an increased asparagine and/or
protein content comprising in its genome a DNA construct comprising
a polynucleotide encoding an AsnS4 asparagine synthetase
polypeptide operably linked to a heterologous promoter, wherein
said seed has an increased asparagine and/or protein content
relative to the protein level of a seed of the same variety as the
transgenic corn seed but not containing said DNA construct in its
genome.
9. The transgenic corn seed of claim 8, wherein the polynucleotide
encoding an asparagine synthetase polypeptide comprises the
isolated nucleic acid sequence of claim 1.
10. The transgenic corn seed of claim 8, wherein said asparagine
synthetase polypeptide comprises SEQ ID NO:51.
11. The transgenic corn seed of claim 8, wherein said
polynucleotide comprises the nucleic acid sequence of SEQ ID
NO:50.
12. The transgenic corn seed of claim 8, wherein said promoter is a
rice actin 1 promoter.
13. A method of producing a transgenic corn plant with increased
asparagine comprising a) introducing into a corn plant a
heterologous DNA construct comprising a promoter molecule
functional in a corn cell operably linked to a DNA molecule
encoding an asparagine synthetase polypeptide; b) growing the plant
to maturity; and c) harvesting seed from the plant.
14. The method of claim 13, wherein said polynucleotide encoding a
heterologous asparagine synthetase comprises the isolated nucleic
acid sequence of claim 1.
15. The method of claim 13, wherein said asparagine synthetase
polypeptide comprises the amino acid sequence of SEQ ID NO:51.
16. The method of claim 13, wherein said DNA molecule comprises the
nucleic acid sequence of SEQ ID NO:50.
17. The method of claim 13, further comprising the step of: f)
selecting a seed with increased protein.
18. Corn meal produced from the plant of claim 6, wherein the corn
meal comprises the isolated nucleic acid sequence of claim 1.
19. The corn meal of claim 18, wherein said nucleic acid sequence
comprises the sequence of SEQ ID NO:50.
20. The corn meal of claim 18, wherein said nucleic acid sequence
encodes a polypeptide of SEQ ID NO:51.
21. A method of producing food or feed comprising obtaining the
transgenic plant of claim 5 and producing food or feed from the
plant or a part thereof.
22. Food or feed produced by the method of claim 21, wherein the
food or feed comprises the isolated nucleic acid sequence of claim
1.
Description
[0001] This application claims the priority of U.S. Provisional
application Ser. No. 60/912,909, filed Apr. 19, 2007, the entire
disclosure of which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the field of
plant biotechnology and more specifically to enhancing asparagine
and protein in plants and seeds.
[0004] 2. Description of Related Art
[0005] Farmers and consumers desire crop plants with improved
agronomic traits such as increased yield, increased seed protein
production, and improved nutritional composition. Desirable
nutritional components of crop plants include, among others, fiber,
antioxidants such as Vitamin E, selenium, iron, magnesium, zinc, B
vitamins, lignans, phenolic acids, essential amino acids, and
phytoestrogens. Although considerable efforts in plant breeding
have provided some gains in these desired traits, the ability to
introduce specific non-host DNA into a plant genome provides
further opportunities for generation of plants with these traits.
In particular, while the yield of conventional corn has steadily
increased over the years, there has not been a similar increase in
the capacity of corn plants to assimilate nitrogen more efficiently
or to increase seed protein content.
[0006] Availability of nitrogen has a significant positive impact
on plant productivity, biomass, and crop yield including the
production of seed protein. In plants, inorganic nitrogen is
assimilated from the soil, reduced to ammonia, and incorporated
into organic nitrogen in the form of the nitrogen-transporting
amino acids asparagine, glutamine, aspartic acid and glutamic acid.
Asparagine (Asn) is the preferred amide transport molecule because
of its high nitrogen to carbon ratio (2N:4C versus 2N:5C) and
because it is relatively inert. Asn and other amino acids are also
used as building blocks for protein synthesis.
[0007] In plants, Asn is synthesized from glutamine, aspartate and
ATP, in a reaction catalyzed by the enzyme asparagine synthetase
(AsnS). Glutamate, AMP and pyrophosphate are formed as by-products.
Two forms of AsnS have been described: a glutamine-dependent form
and an ammonia-dependent form. The glutamine-dependent AsnS can
catalyze both the glutamine-dependent and ammonia-dependent
reactions although glutamine is the preferred nitrogen source.
[0008] High concentration of protein is considered an important
quality trait for most major crops, including soybean, corn, and
wheat. Varieties of high protein corn, wheat, and soybeans, for
example, have been identified through traditional breeding.
However, most of the high protein lines developed this way have
yield drag or other agronomic disadvantages. It would be desirable
if the protein content of crops, especially corn, could be
increased above the presently available levels, both for human
consumption and for use of the product in animal feeds. This would
offer the benefit of greatly enhanced nutrient value when the crop
is used as food and feed for humans and animals.
SUMMARY OF THE INVENTION
[0009] The invention provides methods and compositions for
development of crops and plant products to increase the protein and
amino acid content. The methods and compositions increase the level
of free amino acids and protein in plant tissues, particularly in
seeds. More specifically, transgenic plants and seeds are provided
that contain heterologous DNA compositions that expresses a gene
product involved in increased asparagine and increased protein
biosynthesis. The expression of the product enhances the
nutritional value of food corn and feed corn sources and processed
products derived from the transgenic corn seed or parts
thereof.
[0010] In one aspect, the invention provides methods for increasing
protein content in a corn plant. DNA constructs comprising a
polynucleotide sequence encoding polypeptides with asparagine
synthetase activity are also provided.
[0011] In another embodiment, the present invention comprises a
corn plant cell transformed with the heterologous DNA composition
encoding an asparagine synthetase identified herein. In specific
embodiments, the heterologous expression of a corn AsnS4
(asparagine synthetase isozyme 4) polynucleotide molecule is
provided, for example, to result in elevated asparagine and/or
protein in a transgenic plant, including in the seeds, relative to
a plant of the same variety not expressing the heterologous corn
AsnS2 polynucleotide molecule.
[0012] In particular embodiments, a nucleic acid sequence is
provided, as well as methods of use thereof, wherein the sequence
is selected from the group consisting of: (a) a nucleic acid
sequence comprising the sequence of SEQ ID NO:50; (b) a nucleic
acid sequence with at least about 90% identity to the sequence of
SEQ ID NO:50, wherein the nucleic acid sequence encodes a
polypeptide comprising asparagine synthetase activity; (c) a
nucleic acid sequence that encodes the polypeptide sequence of SEQ
ID NO:51; (d) a nucleic acid sequence that encodes a polypeptide
sequence with at least about 90% identity to the sequence of SEQ ID
NO:51, wherein the polypeptide comprises asparagine synthetase
activity; and (e) a nucleic acid sequence that hybridizes to a
sequence of (a)-(d) under high stringency conditions of about
0.2.times.SSC and 65.degree. C., wherein the nucleic acid sequence
encodes a polypeptide comprising asparagine synthetase activity. In
particular emnbodiments, nucleic acids are provided having at least
90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity with the
sequence of SEQ ID NO:50. In further embodiments, nucleic acids are
provided encoding a polypeptide sequence having at least 90%, 93%,
95%, 96%, 97%, 98% or 99% sequence identity with the sequence of
SEQ ID NO:51. The invention also provides isolated polypeptide
sequences comprising SEQ ID NO:51, as well as sequences having at
least 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity
thereto.
[0013] The present invention also relates to food or animal feed
prepared from a seed provided by the invention with increased
protein and/or amino acid content, or a processed product of such
seed, for example, a meal. Accordingly, the present invention also
encompasses a corn seed containing an asparagine synthetase enzyme
produced by expression of a heterologous DNA construct comprising a
DNA molecule encoding a corn asparagine synthetase enzyme. One
embodiment of such a seed is harvested grain, the present invention
also encompasses meal, gluten and other corn products made from
such grain.
[0014] The present invention includes isolated nucleic acid primer
sequences comprising one or more of SEQ ID NOs:52-59, or the
complement thereof. The present invention includes a method to
detect or identify, in the genome of a transformed plant or progeny
thereof, a heterologous polynucleotide molecule encoding a plant
AsnS polypeptide, or a plant polypeptide having AsnS activity of
the present invention, comprising a polynucleotide molecule
selected from the group consisting of SEQ ID NOs:52-59, wherein
said polynucleotide molecule is used as a DNA primer in a DNA
amplification method.
BRIEF DESCRIPTION OF THE FIGURES
[0015] FIG. 1 illustrates the plasmid map of pMON79706.
[0016] FIG. 2 illustrates the plasmid map of pMON66229.
[0017] FIG. 3 illustrates the plasmid map of pMON66230.
[0018] FIG. 4 illustrates the plasmid map of pMON66231.
[0019] FIG. 5 illustrates the plasmid map of pMON66239.
[0020] FIG. 6 Transgene expression in pMON79706 events. Error bars
represent 95% confidence interval, with n=5 for transgenic events
and n=10 for inbred control.
[0021] FIG. 7 Transgene expression in pMON92870 events. Error bars
represent 95% confidence interval, with n>3 plants for
transgenic events and n=8 plants for inbred control.
DESCRIPTION OF THE NUCLEIC ACID AND POLYPEPTIDE SEQUENCES
[0022] SEQ ID NO: 1 is a polynucleotide sequence encoding a Zea
mays AsnS1.
[0023] SEQ ID NO: 2 is a Zea mays AsnS1 polypeptide.
[0024] SEQ ID NO: 3 is a polynucleotide sequence encoding a Zea
mays AsnS2.
[0025] SEQ ID NO: 4 is a Zea mays AsnS2 polypeptide.
[0026] SEQ ID NO: 5 is a polynucleotide sequence encoding a Zea
mays AsnS3.
[0027] SEQ ID NO: 6 is a Zea mays AsnS3 polypeptide.
[0028] SEQ ID NO: 7 is a polynucleotide sequence encoding a Glycine
max AsnS.
[0029] SEQ ID NO: 8 is a Glycine max AsnS polypeptide.
[0030] SEQ ID NO: 9 is a polynucleotide sequence encoding a Xylella
fastidiosa AsnS.
[0031] SEQ ID NO: 10 is a polynucleotide sequence encoding a
Xanthomonas campestris AsnS.
[0032] SEQ ID NO: 11 is a polynucleotide sequence encoding a
Bacillus halodurans AsnS.
[0033] SEQ ID NO: 12 is a polynucleotide sequence encoding an Oryza
sativa AsnS.
[0034] SEQ ID NO: 13 is a polynucleotide sequence encoding a
Galdieria sulphuraria AsnS.
[0035] SEQ ID NO: 14 is a polynucleotide sequence encoding a
Galdieria sulphuraria AsnS.
[0036] SEQ ID NO: 15 is a polynucleotide sequence encoding a
Galdieria sulphuraria AsnS.
[0037] SEQ ID NO: 16 is a polynucleotide sequence encoding a
Galdieria sulphuraria AsnS.
[0038] SEQ ID NO: 17 is a polynucleotide sequence encoding a
Saccharomyces cerevisiae CGPG3913 AsnS.
[0039] SEQ ID NO: 18 is a forward (f) AsnS PCR primer sequence.
[0040] SEQ ID NO: 19 is a forward (f) AsnS PCR primer sequence.
[0041] SEQ ID NOs 20-43, are primary and secondary forward (f) and
reverse (r) AsnS PCR primer sequences used in a Gateway cloning
procedure.
[0042] SEQ ID NO: 44, a forward (f) AsnS PCR primer sequence.
[0043] SEQ ID NO: 45, a forward (f) AsnS PCR primer sequence.
[0044] SEQ ID NO:46 ZmASsense primer
[0045] SEQ ID NO:47 ZmASantisense primer
[0046] SEQ ID NO: 48 corn AsnS3 forward primer
[0047] SEQ ID NO: 49 corn AsnS3 reverse primer
[0048] SEQ ID NO: 50 is a polynucleotide sequence encoding a Zea
mays AsnS4.
[0049] SEQ ID NO: 51 is a Zea mays AsnS4 polypeptide.
[0050] SEQ ID NO: 52 is a forward PCR primer, Zm-AsnS1_for1.
[0051] SEQ ID NO: 53 is a reverse PCR primer, Zm-AsnS1_rev1.
[0052] SEQ ID NO: 54 is a forward PCR primer, Zm-AsnS3_for 2.
[0053] SEQ ID NO: 55 is a reverse PCR primer, Zm-AsnS3_rev2.
[0054] SEQ ID NO: 56 is a forward PCR primer, Zm-AsnS4_for 3.
[0055] SEQ ID NO: 57 is a reverse PCR primer, Zm-AsnS4_rev3.
[0056] SEQ ID NO: 58 is a forward PCR primer, Zm-AsnS2_for 4.
[0057] SEQ ID NO: 59 is a reverse PCR primer, Zm-AsnS2_rev4.
DETAILED DESCRIPTION OF THE INVENTION
[0058] The following is a detailed description of the invention
provided to aid those skilled in the art in practicing the present
invention. Unless otherwise defined herein, terms are to be
understood according to conventional usage by those of ordinary
skill in the relevant art. Definitions of common terms in molecular
biology may also be found in Rieger et al., 1991; and Lewin, 1994.
The nomenclature for DNA bases as set forth at 37 CFR .sctn. 1.822
is used. The standard one- and three-letter nomenclature for amino
acid residues is used. Modifications and variations in the
embodiments described herein may be made by those of ordinary skill
in the art without departing from the spirit or scope of the
present invention.
[0059] The present invention provides a method to increase protein
content in a corn plant by introducing into the genome of a corn
plant cell a heterologous polynucleotide that expresses an AsnS
polypeptide in the transgenic plant cell. The present invention
provides DNA constructs that comprise (comprise means "including
but not limited to") polynucleotide molecules, or segments of a
polynucleotide molecule that encode an AsnS polypeptide, optionally
operably linked to a chloroplast transit peptide.
[0060] Polynucleotide molecules encoding a AsnS polypeptide or
analog or allele thereof, or polynucleotide molecules encoding a
transit peptide or marker/reporter gene are "isolated" in that they
have been at least partially prepared in vitro, e.g., isolated from
its native state, from a cell, purified, and amplified, e.g., they
are in combination with genetic elements heterologous to those
found normally associated with them in their native state. As used
herein, a heterologous DNA construct comprising an AsnS encoding
polynucleotide molecule that has been introduced into a host cell,
is preferably not identical to any polynucleotide molecule present
in the cell in its native, untransformed state and is isolated with
respect of other DNA molecules that occur in the genome of the host
cell.
[0061] As used herein, "altered or increased" levels of asparagine
in a transformed plant, plant tissue, or plant cell are levels
which are greater than the levels found in the corresponding plant,
plant tissue, or plant cells not containing the DNA constructs of
the present invention.
[0062] The agents of the present invention may also be recombinant.
As used herein, the term recombinant means any agent (e.g., DNA,
peptide, etc.), that is, or results, however indirectly, from human
manipulation of a polynucleotide molecule.
[0063] As used herein in a preferred aspect, an increase in the
nutritional quality of a seed, for example, increased seed protein
content, is determined by the ability of a plant to produce a seed
having a higher yield of protein or a nutritional component than a
seed without such increase in protein or nutritional quality. In a
particularly preferred aspect of the present invention, the
increase in nutritional quality is measured relative to a plant
with a similar genetic background to the nutritionally enhanced
plant except that the plant of the present invention expresses or
over expresses a protein or fragment thereof described in the
heterologous DNA constructs herein.
Polynucleotide Molecules
[0064] The present invention includes and provides transgenic corn
plants and seed that comprise in their genome a transgene
comprising a heterologous DNA molecule encoding a corn asparagine
synthetase (Zm.AsnS4) enzyme, the DNA molecule, for example,
comprising SEQ ID NO:50 and sequences having at least 90%, 95%, or
99% identity to such sequences with asparagine synthetase
activity.
[0065] A further aspect of the invention is a method for increasing
protein in a corn plant by introducing into a corn cell a DNA
construct that provides a heterologous polynucleotide molecules,
for example, SEQ ID NOs:1, 3, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16,
17 and 50 that encode an asparagine synthetase enzyme. The
polynucleotide can differ from any of these examples without
altering the polypeptide for which it encodes. For example, it is
understood that codons capable of coding for such conservative
amino acid substitutions are known in the art. Additionally, the
invention contemplates that polypeptides in which one or more amino
acid have been deleted, substituted, or added without altering the
asparagine synthetase function can be used in the invention
[0066] In one aspect of the present invention the polynucleotide of
the present invention are said to be introduced polynucleotide
molecules. A polynucleotide molecule is said to be "introduced" if
it is inserted into a cell or organism as a result of human
manipulation, no matter how indirect. Examples of introduced
polynucleotide molecules include, without limitation,
polynucleotides that have been introduced into cells via
transformation, transfection, injection, and projection, and those
that have been introduced into an organism via conjugation,
endocytosis, phagocytosis, etc. Preferably, the polynucleotide is
inserted into the genome of the cell.
[0067] One subset of the polynucleotide molecules of the present
invention is fragment polynucleotide molecules. Fragment
polynucleotide molecules may consist of significant portion(s) of,
or indeed most of, the polynucleotide molecules of the present
invention, such as those specifically disclosed. Alternatively, the
fragments may comprise smaller oligonucleotides (having from about
15 to about 400 nucleotide residues and more preferably, about 15
to about 30 nucleotide residues, or about 50 to about 100
nucleotide residues, or about 100 to about 200 nucleotide residues,
or about 200 to about 400 nucleotide residues, or about 275 to
about 350 nucleotide residues). A fragment of one or more of the
polynucleotide molecules of the present invention may be a probe
and specifically a PCR primer molecule. A PCR primer is a
polynucleotide molecule capable of initiating a polymerase activity
while in a double-stranded structure with another polynucleotide.
Various methods for determining the structure of PCR probes and PCR
techniques exist in the art.
[0068] As used herein, two polynucleotide molecules are said to be
capable of specifically hybridizing to one another if the two
molecules are capable of forming an anti-parallel, double-stranded
polynucleotide structure.
[0069] A polynucleotide molecule is said to be the "complement" of
another polynucleotide molecule if they exhibit complete
complementarity. As used herein, molecules are said to exhibit
"complete complementarity" when every nucleotide of one of the
molecules is complementary to a nucleotide of the other. Two
molecules are said to be "minimally complementary" if they can
hybridize to one another with sufficient stability to permit them
to remain annealed to one another under at least conventional
"low-stringency" conditions. Similarly, the molecules are said to
be "complementary" if they can hybridize to one another with
sufficient stability to permit them to remain annealed to one
another under conventional "high-stringency" conditions.
Conventional stringency conditions are described by Sambrook et
al., (2001), and by Haymes et al., (1985). Departures from complete
complementarity are therefore permissible, as long as such
departures do not completely preclude the capacity of the molecules
to form a double-stranded structure. Thus, in order for a
polynucleotide molecule to serve as a primer or probe it need only
be sufficiently complementary in sequence to be able to form a
stable double-stranded structure under the particular solvent and
salt concentrations employed.
[0070] Appropriate stringency conditions which promote DNA
hybridization are, for example, 6.0.times. sodium chloride/sodium
citrate (SSC) at about 45.degree. C., followed by a wash of
2.0.times.SSC at 20-25.degree. C., are known to those skilled in
the art or can be found in Ausubel, et al., eds. (1989), section
6.3.1-6.3.6. For example, the salt concentration in the wash step
can be selected from a low stringency of about 2.0.times.SSC at
50.degree. C. to a high stringency of about 0.2.times.SSC at
65.degree. C. In addition, the temperature in the wash step can be
increased from low stringency conditions at room temperature, about
22.degree. C., to high stringency conditions at about 65.degree. C.
Both temperature and salt may be varied, or either the temperature
or the salt concentration may be held constant such that a nucleic
acid will specifically hybridize to one or more of the
polynucleotide molecules provided herein, for example, as set forth
in: SEQ ID NOs 1, 3, 5, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18-45
and 50, and complements thereof, under moderately stringent
conditions, for example at about 2.0.times.SSC and about 65.degree.
C.
[0071] In one embodiment of a method of the present invention, any
of the polynucleotide sequences or polypeptide sequences, or
fragments of either, of the present invention can be used to search
for related sequences. As used herein, "search for related
sequences" means any method of determining relatedness between two
sequences, including, but not limited to, searches that compare
sequence homology: for example, a PBLAST search of a database for
relatedness to a single polypeptide sequence. Other searches may be
conducted using profile based methods, such as the HMM (Hidden
Markov model) META-MEME, which is maintained by South Dakota State
University, SD, and PSI-BLAST, which is maintained by the National
Center for Biotechnology Information, National Library of Medicine,
National Institutes of Health (NCBI).
[0072] A polynucleotide molecule can encode for a substantially
identical or substantially homologous polypeptide molecule. The
degree of identity or homology can be determined by use of computer
software such as the WISCONSIN PACKAGE Gap Program. The Gap program
in the WISCONSIN PACKAGE version 10.0-UNIX from Genetics Computer
Group, Inc. is based on the method of Needleman and Wunsch, 1970.
Using the TBLASTN program in the BLAST 2.2.1 software suite
(Altschul et al., (1997, or using BLOSUM62 matrix (Henikoff and
Henikoff, 1992). A polynucleotide molecule of the present invention
can also encode a homolog polypeptide. As used herein, a homolog
polypeptide molecule or fragment thereof is a counterpart protein
molecule or fragment thereof in a second species (e.g., corn
rubisco small subunit is a homolog of Arabidopsis rubisco small
subunit). A homolog can also be generated by molecular evolution or
DNA shuffling techniques, so that the molecule retains at least one
functional or structure characteristic of the original polypeptide
(see, for example, U.S. Pat. No. 5,811,238).
[0073] In a preferred embodiment, any of the polynucleotide
molecules of the present invention can be operably linked to a
promoter region that functions in a plant cell to cause the
production of an mRNA molecule, where the polynucleotide molecule
that is linked to the promoter is heterologous with respect to that
promoter. As used herein, "heterologous" DNA is any DNA sequence
which is not naturally found next to the adjacent DNA. "Native"
refers to a naturally occurring nucleic acid sequence.
"Heterologous" sequence often originates from a foreign source or
species or, if from the same source, is modified from its original
form and/or location in the genome.
[0074] As used herein, the terms "protein," "peptide molecule," or
"polypeptide" includes any molecule that comprises five or more
amino acids. It is well known in the art that protein, peptide, or
polypeptide molecules may undergo modification, including
post-translational modifications, such as, but not limited to,
disulfide bond formation, glycosylation, phosphorylation, or
oligomerization. Thus, as used herein, the terms "protein,"
"peptide molecule," or "polypeptide" includes any protein that is
modified by any biological or non-biological process. The terms
"amino acid" and "amino acids" refer to all naturally occurring
L-amino acids. This definition is meant to include norleucine,
norvaline, ornithine, homocysteine, and homoserine.
[0075] A "protein fragment" is a peptide or polypeptide molecule
whose amino acid sequence comprises a subset of the amino acid
sequence of that protein. A protein or fragment thereof that
comprises one or more additional peptide regions not derived from
that protein is a "fusion" protein. Such molecules may be
derivatized to contain carbohydrate or other moieties (such as
keyhole limpet hemocyanin). Fusion protein or peptide molecules of
the present invention are preferably produced via recombinant
means.
Plant Constructs and Plant Transformants
[0076] One or more of the DNA constructs of the present invention
that encode for an asparagine synthetase may be used in plant
transformation or transfection. Exogenous genetic material may be
transferred into a plant cell and the plant cell regenerated into a
whole, fertile, or sterile plant. Exogenous genetic material is any
genetic material, whether naturally occurring or otherwise, from
any source that is capable of being inserted into any organism.
[0077] In a further aspect of the present invention, polynucleotide
sequences of the present invention also encode peptides involved in
intracellular localization, export, or post-translational
modification, for example chloroplast transit peptides.
[0078] As used herein, the term "gene" includes a nucleic acid
molecule that provides regulation of transcription that includes a
promoter that functions in plants, 5' untranslated molecules, e.g.,
introns and leader sequences, a transcribed nucleic acid molecule
and a 3' transcriptional termination molecule.
[0079] The polynucleic acid molecules encoding a polypeptide of the
present invention may be combined with other non-native, or
heterologous sequences in a variety of ways. By "heterologous"
sequences it is meant any sequence that is not naturally found
joined to the nucleotide sequence encoding polypeptide of the
present invention, including, for example, combinations of
nucleotide sequences from the same plant that are not naturally
found joined together, or the two sequences originate from two
different species. The term "operably linked", as used in reference
to the physical and function arrangement of regulatory and
structural polynucleotide molecules that causes regulated
expression of an operably linked structural polynucleotide
molecule.
[0080] The expression of a DNA construct or transgene means the
transcription and stable accumulation of sense or antisense RNA or
protein derived from the polynucleotide molecule of the present
invention or translation thereof. "Sense" RNA means RNA transcript
that includes the mRNA and so can be translated into polypeptide or
protein by the cell. "Antisense RNA" means a RNA transcript that is
complementary to all or part of a target primary transcript or mRNA
and that blocks the expression of a target gene (U.S. Pat. No.
5,107,065, incorporated herein by reference). The complementarity
of an antisense RNA may be with any part of the specific gene
transcript, i.e., at the 5' non-coding sequence, 3' non-translated
sequence, introns, or the coding sequence. "RNA transcript" means
the product resulting from RNA polymerase-catalyzed transcription
of a DNA sequence. When the RNA transcript is a perfect
complementary copy of the DNA sequence, it is referred to as the
primary transcript or it may be a RNA sequence derived from
post-transcriptional processing of the primary transcript and is
referred to as the mature RNA.
[0081] As used herein, the term plant expression cassette refers to
a construct comprising the necessary DNA regulatory molecules
operably linked to the target molecule to provide expression in a
plant cell.
[0082] The DNA construct of the present invention can, in one
embodiment, contain a promoter that causes the over expression of
the polypeptide of the present invention, where "overexpression"
means the expression of a polypeptide either not normally present
in the host cell, or present in said host cell at a higher level
than that normally expressed from the endogenous gene encoding said
polypeptide. Promoters, which can cause the overexpression of the
polypeptide of the present invention, are generally known in the
art, examples of such that provide constitutive expression pattern
include cauliflower mosaic virus 19S promoter and cauliflower
mosaic virus 35S promoter (U.S. Pat. No. 5,352,605), figwort mosaic
virus 35S promoter (U.S. Pat. No. 6,051,753), sugarcane bacilliform
virus promoter (U.S. Pat. No. 5,994,123), commelina yellow mottle
virus promoter (Medberry et al., 1992), small subunit of
ribulose-1,5-bisphosphate carboxylase promoter, rice cytosolic
triosephosphate isomerase promoter, adenine
phosphoribosyltransferase promoter, rice actin 1 promoter (U.S.
Pat. No. 5,641,876), maize ubiquitin promoter, mannopine synthase
promoter and octopine synthase promoter.
[0083] Such genetic constructs may be transferred into either
monocotyledonous or dicotyledonous plants including, but not
limited to alfalfa, apple, Arabidopsis, banana, Brassica
campestris, canola, castor bean, coffee, corn, cotton, cottonseed,
chrysanthemum, crambe, cucumber, Dendrobium spp., Dioscorea spp.,
eucalyptus, fescue, flax, gladiolus, liliacea, linseed, millet,
muskmelon, mustard, oat, oil palms, oilseed rape, peanut, perennial
ryegrass, Phaseolus, rapeseed, rice, sorghum, soybean, rye,
tritordeum, turfgrass, wheat, safflower, sesame, sugarbeet,
sugarcane, cranberry, papaya, safflower, and sunflower (Christou,
1996). In a preferred embodiment, the genetic material is
transferred into a corn cell.
[0084] Transfer of a polynucleotide molecule that encodes a protein
can result in expression or overexpression of that polypeptide in a
transformed cell or transgenic plant. One or more of the proteins
or fragments thereof encoded by polynucleotide molecules of the
present invention may be overexpressed in a transformed cell or
transformed plant.
[0085] In one embodiment, DNA constructs of the present invention
comprise a polynucleotide molecule encoding a polypeptide sequence
selected from the group consisting of SEQ ID NOs 1, 3, 5, 7, 9, 10,
11, 12, 13, 14, 15, 16, 17 and 50. The invention provides
transformed corn cells wherein, relative to an untransformed corn
plant without such a DNA construct, the cell has an enhanced
asparagine level.
[0086] In another embodiment, DNA constructs of the present
invention comprise a heterologous DNA molecule operably linked to a
corn asparagine synthetase coding sequence, for example, SEQ ID NOs
1, 3, 5 or 50, and the DNA construct is transformed corn cell In a
one embodiment, DNA constructs of the present invention comprising
SEQ ID NO:50 or related sequences described herein are provided in
a transformed corn cell, and expression of the DNA construct
provides a corn plant tissue with increased asparagine or a corn
plant seed with increased protein relative to a corn plant not
transformed with the DNA construct.
[0087] In some embodiments, the levels of one or more products of
the AsnS may be increased throughout a plant or localized in one or
more specific organs or tissues of the plant. Without limiting the
scope of the present invention, several promoter sequences are
useful for expressing the gene of the above enzyme. For example,
maize C4 type PPDK promoter (Glackin et al., 1990), maize C4 type
PEPC promoter (Hudspeth and Grula, 1989), rice Rubisco small
subunit promoter (Kyozuka et al., 1993), and light-harvesting
chlorophyll a/b binding protein promoter (Sakamoto et al., 1991),
the P-FDA promoter (US20040216189A1, the polynucleotide sequence of
which is herein incorporated by reference) and P-RTBV promoter
(U.S. Pat. No. 5,824,857, the polynucleotide sequence of which is
herein incorporated by reference). For example the levels of
asparagine or protein may be increased in one or more of the
tissues and organs of a plant including without limitation: roots,
tubers, stems, leaves, stalks, fruit, berries, nuts, bark, pods,
seeds, and flowers. A preferred organ is a seed.
[0088] For the purpose of expression in source tissues of the
plant, such as the leaf, seed, root, or stem, it is preferred that
the promoters utilized have relatively high expression in these
specific tissues. Tissue-specific expression of a protein of the
present invention is a particularly preferred embodiment.
[0089] DNA constructs or vectors may also include, with the coding
region of interest, a polynucleotide sequence that acts, in whole
or in part, to terminate transcription of that region. A number of
such sequences have been isolated, including the T-NOS 3' region
(Ingelbrecht et al., 1989; Bevan et al., 1983). Regulatory
transcript termination regions can be provided in plant expression
constructs of this present invention as well. Transcript
termination regions can be provided by the DNA sequence encoding
the gene of interest or a convenient transcription termination
region derived from a different gene source, for example, the
transcript termination region that is naturally associated with the
transcript initiation region. The skilled artisan will recognize
that any convenient transcript termination region that is capable
of terminating transcription in a plant cell can be employed in the
constructs of the present invention.
[0090] A vector or construct may also include regulatory elements,
such as introns. Examples of such include, the Adh intron 1 (Callis
et al., 1987), the sucrose synthase intron (Vasil et al., 1989),
hsp70 intron (U.S. Pat. No. 5,859,347), and the TMV omega element
(Gallie et al., 1989). These and other regulatory elements may be
included when appropriate.
[0091] A vector or construct may also include a selectable marker.
Selectable markers may also be used to select for plants or plant
cells that contain the exogenous genetic material. Examples of such
include, but are not limited to: a neo gene (Potrykus et al.,
1985), which codes for kanamycin resistance and can be selected for
using kanamycin, nptII, G418, hpt, etc.; a bar gene, which codes
for bialaphos resistance; a mutant EPSP synthase gene (Hinchee et
al., 1988; Reynaerts et al., 1988; Jones et al., 1987), which
encodes glyphosate resistance; a nitrilase gene which confers
resistance to bromoxynil (Stalker et al., 1988); a mutant
acetolactate synthase gene (ALS) which confers imidazolinone or
sulphonylurea resistance (U.S. Pat. No. 4,761,373); D'Halluin et
al., 1992); and a methotrexate resistant DHFR gene (Thillet et al.,
1988).
Plant Transformation
[0092] The most commonly used methods for transformation of plant
cells are the Agrobacterium-mediated DNA transfer process and the
biolistics or microprojectile bombardment mediated process (i.e.,
the gene gun). Typically, nuclear transformation is desired but if
it is desirable to specifically transform plastids, such as
chloroplasts or amyloplasts, plant plastids may be transformed
utilizing a microprojectile-mediated delivery of the desired
polynucleotide.
[0093] The methods for introducing transgenes into plants by
Agrobacterium-mediated transformation utilize a T-DNA (transfer
DNA) that incorporates the genetic elements of the transgene and
transfers those genetic elements into the genome of a plant.
Generally, the transgene(s) bordered by a right border DNA molecule
(RB) and a left border DNA molecule (LB) is (are) transferred into
the plant genome at a single locus. The "T-DNA molecule" refers to
a DNA molecule that integrates into a plant genome via an
Agrobacterium mediated transformation method. The ends of the T-DNA
molecule are defined in the present invention as being flanked by
the border regions of the T-DNA from Agrobacterium Ti plasmids.
These border regions are generally referred to as the Right border
(RB) and Left border (LB) regions and exist as variations in
nucleotide sequence and length depending on whether they are
derived from nopaline or octopine producing strains of
Agrobacterium. The border regions commonly used in DNA constructs
designed for transferring transgenes into plants are often several
hundred polynucleotides in length and comprise a nick site where an
endonuclease digests the DNA to provide a site for insertion into
the genome of a plant. T-DNA molecules generally contain one or
more plant expression cassettes.
[0094] With respect to microprojectile bombardment (U.S. Pat. Nos.
5,550,318; 5,538,880; and 5,610,042; each of which is specifically
incorporated herein by reference in its entirety), particles are
coated with polynucleotides and delivered into cells by a
propelling force. Exemplary particles include those comprised of
tungsten, platinum, and preferably, gold. A useful method for
delivering DNA into plant cells by particle acceleration is the
Biolistics Particle Delivery System (BioRad, Hercules, Calif.),
which can be used to propel particles coated with DNA or cells
through a screen, such as a stainless steel or Nytex screen, onto a
filter surface covered with monocot plant cells cultured in
suspension. Microprojectile bombardment techniques are widely
applicable, and may be used to transform virtually any plant
species. Examples of species that have been transformed by
microprojectile bombardment include monocot species such as corn
(PCT Publication WO 95/06128), barley, wheat (U.S. Pat. No.
5,563,055, incorporated herein by reference in its entirety), rice,
oat, rye, sugarcane, and sorghum; as well as a number of dicots
including tobacco, soybean (U.S. Pat. No. 5,322,783, incorporated
herein by reference in its entirety), sunflower, peanut, cotton,
tomato, and legumes in general (U.S. Pat. No. 5,563,055,
incorporated herein by reference in its entirety).
[0095] To select or score for transformed plant cells regardless of
transformation methodology, the DNA introduced into the cell
contains a gene that functions in a regenerable plant tissue to
produce a compound that confers upon the plant tissue resistance to
an otherwise toxic compound. Genes of interest for use as a
selectable, screenable, or scorable marker would include but are
not limited to GUS, green fluorescent protein (GFP), luciferase
(LUX), and antibiotic or herbicide tolerance genes. Examples of
antibiotic resistance genes include those conferring resistance to
kanamycin (and neomycin, G418), and bleomycin.
[0096] The regeneration, development, and cultivation of plants
from various transformed explants are well documented in the art.
This regeneration and growth process typically includes the steps
of selecting transformed cells and culturing those individualized
cells through the usual stages of embryonic development through the
rooted plantlet stage. Transgenic embryos and seeds are similarly
regenerated. The resulting transgenic rooted shoots are thereafter
planted in an appropriate plant growth medium such as soil. Cells
that survive the exposure to the selective agent, or cells that
have been scored positive in a screening assay, may be cultured in
media that supports regeneration of plants. Developing plantlets
are transferred to soil-less plant growth mix, and hardened off,
prior to transfer to a greenhouse or growth chamber for
maturation.
[0097] The present invention can be used with any transformable
cell or tissue. By transformable as used herein is meant a cell or
tissue that is capable of further propagation to give rise to a
plant. Those of skill in the art recognize that a number of plant
cells or tissues are transformable in which after insertion of
exogenous DNA and appropriate culture conditions the plant cells or
tissues can form into a differentiated plant. Tissue suitable for
these purposes can include but is not limited to immature embryos,
scutellar tissue, suspension cell cultures, immature inflorescence,
shoot meristem, nodal explants, callus tissue, hypocotyl tissue,
cotyledons, roots, and leaves.
[0098] Any suitable plant culture medium can be used. Examples of
suitable media would include but are not limited to MS-based media
(Murashige and Skoog, 1962) or N6-based media (Chu et al., 18: 659,
1975) supplemented with additional plant growth regulators
including but not limited to auxins, cytokinins, ABA, and
gibberellins. Those of skill in the art are familiar with the
variety of tissue culture media, which when supplemented
appropriately, support plant tissue growth and development and are
suitable for plant transformation and regeneration. These tissue
culture media can either be purchased as a commercial preparation,
or custom prepared and modified. Those of skill in the art are
aware that media and media supplements such as nutrients and growth
regulators for use in transformation and regeneration and other
culture conditions such as light intensity during incubation, pH,
and incubation temperatures that can be optimized for the
particular variety of interest.
[0099] Any of the polynucleotide molecules of the present invention
may be introduced into a plant cell in a permanent or transient
manner in combination with other genetic elements such as vectors,
promoters, enhancers, etc. Further, any of the polynucleotide
molecules of the present invention may be introduced into a plant
cell in a manner that allows for expression or overexpression of
the protein or fragment thereof encoded by the polynucleotide
molecule.
[0100] The present invention also provides for parts of the plants,
particularly reproductive or storage parts, of the present
invention. Plant parts, without limitation, include seed,
endosperm, ovule, pollen, or tubers. In a particularly preferred
embodiment of the present invention, the plant part is a corn seed.
In one embodiment the corn seed (or grain) is a constituent of
animal feed.
[0101] In a preferred embodiment the corn feed or corn meal or
protein from the corn seed is designed for livestock animals or
humans, or both. Methods to produce feed, meal, and protein, are
known in the art. See, for example, U.S. Pat. Nos. 4,957,748;
5,100,679; 5,219,596; 5,936,069; 6,005,076; 6,146,669; and
6,156,227. In a preferred embodiment, the protein preparation is a
high protein preparation. Such a high protein preparation
preferably has a protein content of greater than about 5% (w/v),
more preferably 10% (w/v), and even more preferably 15% (w/v).
[0102] Descriptions of breeding methods that are commonly used for
different traits and crops can be found in one of several reference
books (e.g., Hayward, 1993; Richards, 1997; Allard, 1999).
Other Organisms
[0103] A polynucleotide of the present invention may be introduced
into any cell or organism such as a mammalian cell, mammal, fish
cell, fish, bird cell, bird, algae cell, algae, fungal cell, fungi,
or bacterial cell. A protein of the present invention may be
produced in an appropriate cell or organism. Preferred host and
transformants include: fungal cells such as Aspergillus, yeasts,
mammals, particularly bovine and porcine, insects, bacteria, and
algae. Particularly preferred bacteria are Agrobacterium
tumefaciens and E. coli.
[0104] In an aspect of the present invention, one or more of the
nucleic acid molecules of the present invention are used to
determine the level of expression (i.e., the concentration of mRNA
in a sample, etc.) in a plant (preferably canola, corn, Brassica
campestris, oilseed rape, rapeseed, soybean, crambe, mustard,
castor bean, peanut, sesame, cottonseed, linseed, safflower, oil
palm, flax or sunflower) or pattern (i.e., the kinetics of
expression, rate of decomposition, stability profile, etc.) of the
expression of a protein encoded in part or whole by one or more of
the polynucleotide molecule of the present invention. A number of
methods can be used to compare the expression between two or more
samples of cells or tissue. These methods include hybridization
assays, such as northerns, RNAase protection assays, and in situ
hybridization. Alternatively, the methods include PCR-type assays.
In a preferred method, expression is assessed by hybridizing
polynucleotides from the two or more samples to an array of
polynucleotides. The array contains a plurality of suspected
sequences known or suspected of being present in the cells or
tissue of the samples.
[0105] The following examples are included to demonstrate aspects
of the invention, those of skill in the art should, in light of the
present disclosure, appreciate that many changes can be made in the
specific aspects which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
EXAMPLES
[0106] Those of skill in the art will appreciate the many
advantages of the methods and compositions provided by the present
invention. The following examples are included to demonstrate the
preferred embodiments of the invention. It should be appreciated by
those of skill in the art that the techniques disclosed in the
examples that follow represent techniques discovered by the
inventors to function well in the practice of the invention, and
thus can be considered to constitute preferred modes for its
practice. However, those of skill in the art should, in light of
the present disclosure, appreciate that many changes can be made in
the specific embodiments that are disclosed and still obtain a like
or similar result without departing from the spirit and scope of
the invention. All references cited herein are incorporated herein
by reference to the extent that they supplement, explain, provide a
background for, or teach methodology, techniques, or compositions
employed herein.
Example 1
Construction of Corn and Soy Plant cDNA and Genomic Libraries
[0107] This example describes the production of cDNA libraries made
from corn and soy plant tissues from which the corn AsnS and soy
polynucleotide sequences of the present invention were isolated.
cDNA Libraries were generated from Zea mays and Glycine max tissue
using techniques known in the art, for example, Alba, 2004. Corn
cDNA libraries were made from two different tissues. A library was
made from incipient kernels harvested at the dilatory phase from
inbred line 90DDD5. A second corn cDNA library was made from silk
tissue at the silking growth stage from corn inbred line H99 and
germinating pollen from corn inbred line MO17. For construction of
a cDNA library from soybean (Glycine max), meristematic tissue and
part of the hypocotyl were excised from rehydrated dry soybean
seeds of variety A3237 (Asgrow). Explants were prepared by first
germinating surface sterilized seeds on solid tissue culture media
for 6 days at 28.degree. C. at 18 hours of light/day, and then
transferring germinated seeds to 4.degree. C. for at least 24
hours. For the tissue used in library preparation the cotyledons
were removed to enrich for the specific tissue of interest. 0.5 to
2 grams of tissue were used for preparation of total RNA and poly
A+ RNA. For all cDNA libraries, plant tissues were harvested and
immediately frozen in liquid nitrogen. The harvested tissue was
stored at -80.degree. C. until preparation of total RNA. The total
RNA was purified using Trizol reagent from Invitrogen Corporation
(Invitrogen Corporation, Carlsbad, Calif., U.S.A.), essentially as
recommended by the manufacturer. Poly A+ RNA (mRNA) was purified
using magnetic oligo dT beads essentially as recommended by the
manufacturer (Dynabeads.RTM., Dynal Biotech, Oslo, Norway).
[0108] Construction of plant cDNA libraries is well known in the
art and a number of cloning strategies exist. A number of cDNA
library construction kits are commercially available. cDNA
libraries were prepared using the Superscript.TM. Plasmid System
for cDNA synthesis and Plasmid Cloning (Invitrogen Corporation), as
described in the Superscript II cDNA library synthesis protocol.
The cDNA libraries were checked to confirm an appropriate
insert:vector ratio.
[0109] A genomic DNA library was constructed using genomic DNA
isolated from Zea mays using a modified genomic DNA isolation
protocol described below (Dellaporta et al., 1983). Corn seedlings
were grown in soil or in Petri plates, were harvested, and kept
frozen in liquid nitrogen until extraction. The tissue was ground
to a fine powder using a mortar and pestle while keeping the tissue
frozen with liquid nitrogen. The powdered tissue was transferred to
a Warning blender containing 200 mL of cold (0.degree. C.) DNA
extraction buffer (350 mM sorbitol; 100 mM Tris; 5 mM EDTA; pH to
7.5 with HCl; sodium bisulfite, 3.8 mg/mL) that was added just
before use, and homogenized at high speed for 30-60 seconds. The
homogenate was filtered through a layer of cheesecloth and
collected in a centrifuge bottle. The samples were then centrifuged
at 2500.times.g for 20 minutes, and the supernatant and any loose
green material were discarded. The pellet was then resuspended in
1.25 mL of DNA extraction buffer and transferred to a 50 mL
polypropylene tube. Nuclei lysis buffer (1.75 mL containing 200 mM
Tris; 50 mM EDTA; 2 M NaCl; 2.0% (w/v) CTAB; pH adjusted to 7.5
with HCl) was then added, followed by addition of 0.6 mL of 5%
(w/v) sarkosyl. The tubes were mixed gently, and the samples were
incubated at 65.degree. C. for 20 minutes. An equal volume of
chloroform:isoamyl alcohol (24:1) was added and the tubes were
again mixed gently. The tubes were then centrifuged at 2500.times.g
for 15 minutes, and the resulting supernatant was transferred to a
clean tube. An equal volume of ice-cold isopropanol was poured onto
the sample, and the sample was inverted several times until a
precipitate formed. The precipitate was removed from the solution
using a glass pipette and residual alcohol removed by allowing the
precipitate to air dry for 2-5 minutes. The precipitate was
resuspended in 400 .mu.L TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH
adjusted to 8.0).
Example 2
Isolation of AsnS Polynucleotide Sequences by Ligation Independent
and Gateway.RTM. Cloning Methods and Corn Transformation
[0110] This example illustrates the isolation of polynucleotide
molecules encoding AsnS using ligation independent and Gateway.RTM.
cloning methods and the construction of DNA constructs of the
present invention that comprise the polynucleotide molecules that
encode AsnS polypeptides isolated from various plant and
microorganisms sources as described in Table 1. The promoter
molecules used to drive the expression of the linked AsnS-encoding
polynucleotide molecules are the rice actin 1 promoter, P-Os.Act1
(U.S. Pat. No. 5,641,876, herein incorporated by reference); the
Zea mays PPDK (Matsuoka et al., 1993), P-RTBV-1 (U.S. Pat. No.
5,824,857, herein incorporated by reference), and the P-Zm.NAS
(promoter molecule of the genomic region coding for a nicotianamine
synthase 2 polypeptide from corn).
TABLE-US-00001 TABLE 1 AsnS coding sequence source, promoter and
DNA constructs SEQ ID Exemplary DNA NO: Coding sequence source
Promoter construct 3 Zea mays AsnS2 P-Os.cndot.Act1 pMON79706 5 Zea
mays AsnS3 P-Os.cndot.Act1 pMON92870 7 Glycine max P-Os.cndot.Act1
pMON79700 17 Saccharomyces cerevisiae P-Os.cndot.Act1 PMON79653
[0111] Ligation independent cloning was developed to clone PCR
products and is based on the annealing of non-palindromic
single-stranded ends. LIC is an efficient cloning method, which is
not limited by restriction sites or the need for restriction enzyme
digestion or ligation reactions and leaves seamless junctions
(Aslanidis and de Jong, 1990).
[0112] Terminal, single-stranded DNA segments are produced in the
vector through the use of a "nicking endonuclease" and restriction
endonuclease. A nicking endonuclease is an endonuclease that nicks
one strand of the polynucleotide duplex to create single stranded
tails on the cloning vector. The vector is first linearized with a
standard restriction endonuclease. This is then followed by
digestion with a nicking endonuclease. After heat treatment,
terminal, single-stranded DNA segments are produced in the vector.
A GC content of roughly 55% is recommended for downstream PCR
amplification and efficient annealing. The promoter, tag, or other
sequence element can be added to the 5' and 3' ends of the
PCR-amplified product to create a linear construct that can be used
in downstream applications.
[0113] The DNA construct pMON92870 was assembled from the base
vector, pMON82060, and a corn AsnS3 polynucleotide molecule
encoding an AsnS polypeptide provided as SEQ ID NO 5. The plasmid
backbone pMON82060 was linearized using the restriction
endonuclease, HpaI. The plasmid backbone was then treated with the
nicking endonuclease, N.BbvC IA (New England Biolabs, Beverly,
Mass.). After digestion, the reaction was heated to 65.degree. C.
This causes the nicked strands of DNA to disassociate from their
complementary DNA strands. The resulting linearized plasmid
backbone was left with two terminal, single-stranded DNA segments
available for assembly.
[0114] The polymerase chain reaction was employed to produce the
terminal single-stranded DNA segments in the DNA molecule encoding
AsnS. The corn AsnS3 polynucleotide sequence (SEQ ID NO: 5)
encoding the AsnS polypeptide was used for the design of the
forward PCR primer (SEQ ID NO: 48) and the reverse PCR primer (SEQ
ID NO: 49):
TABLE-US-00002 SEQ ID NO:48: GCAGTCGCTGTCGTTACCCGGCATCATGTGTGGCATC
SEQ ID NO:49: GCGAGTACCGCTGGGTTCTAACGTACTCTCGTCAGACCGCG
Polymerase chain reaction amplification was performed using the
high fidelity thermal polymerase, KOD hot start DNA polymerase
(Novagen, Madison, Wis.). The polymerase chain reaction was
performed in a 25 .mu.L volume containing, 1.times.KOD hot start
DNA polymerase buffer, 1M betaine (Sigma, St. Louis, Mo.), 1 mM
MgSO4, 250 .mu.M dNTPs, 5 pmols of each primer and 1 unit of KOD
hot start DNA polymerase. The polymerase chain reaction was
performed in a PTC-225 DNA Engine Tetrad.TM. thermal cycler (MJ
Research Inc., Waltham, Mass.) using the following cycler
parameters:
TABLE-US-00003 1. 94.degree. C. for 2 minutes 2. 94.degree. C. for
15 seconds 3. 70.degree. C. for 30 seconds (-1.degree. C. per
cycle) 4. 72.degree. C. for 5 minutes 5. Go to step 2, 9 times 6.
94.degree. C. for 15 seconds 7. 60.degree. C. for 30 seconds 8.
72.degree. C. for 5 minutes 9. Go to step 6, 24 times 10.
72.degree. C. for 10 minutes 11. 10.degree. C. hold 12. end
[0115] A second round of polymerase chain reaction was performed to
introduce uridine residues in the region in which the terminal,
single-stranded DNA segments were produced. Many DNA polymerases
are unable to read uridine residues in the template strand of DNA
or are unable to polymerize strands using uridine residues.
Polymerase chain reaction was therefore performed using an enzyme
capable of incorporating and reading uridines (Expand High
Fidelity.TM. plus PCR System; Roche, Indianapolis, Ind.).
Modification of this method and use of other methods that provide
the expected result are known by those skilled in the art.
[0116] The assembled DNA construct was transformed into
ElectroMAX.TM. DH10B E. coli competent cells (Invitrogen, Carlsbad,
Calif.). A 0.5 .mu.L (microliter) aliquot from the assembly
reaction was mixed with 20 .mu.L of ElectroMAX.TM. DH10B competent
cells on ice and loaded into a MicroPulser 0.2 mm electroporation
cuvette (Bio-Rad Laboratories Inc., Hercules Calif.) for
electroporation. Cells were subjected to electroporation at 1.8 kV
using a 165-2100 MicroPulser Electroporator (Bio-Rad Laboratories
Inc.). Electroporated cells were incubated in 180 .mu.L of SOC
medium (Invitrogen Inc.) at 37.degree. C. for 1 hour. Cells were
then plated onto LB agar plates containing spectinomycin (75 mg/L)
and grown overnight at 37.degree. C. Colonies were selected and
grown in LB media overnight at 37.degree. C. The plasmid DNA
construct was isolated using the QIAprep.RTM. Spin Miniprep Kit
(QIAgen Sciences, Valencia, Calif.). DNA sequencing was performed
on an ABI 3730x1 DNA Analyzer, using BigDye.RTM. terminator
(Applied Biosystems, Foster City, Calif.).
[0117] The cloning of corn AsnS2, soy AsnS, and yeast AsnS1
AsnS-encoding polynucleotide sequences was accomplished using the
Gateway.RTM. cloning method as described by the manufacturer
(Invitrogen Corp.). The goal of the Gateway.RTM. cloning method is
to make an expression clone. This two-step process involves first,
the cloning of the gene of interest into an entry vector, followed
by subcloning of the gene of interest from the entry vector into a
destination vector to produce an expression vector. The cloning
technology is based on the site-specific recombination system used
by phage lambda to integrate its DNA into the E. coli
chromosome.
[0118] DNA constructs for use in subsequent recombination cloning,
two attB or attR recombination sequences were cloned into a
recombinant vector flanking a Spectinomycin/Streptomycin resistance
gene (SPC/STR) and an AsnS-encoding polynucleotide sequence. The
AsnS-encoding polynucleotide sequences were isolated from cDNA or
genomic libraries made from their respective species using the
primary and secondary primer sequences (SEQ ID NOs 20-43). The
contiguous attB1/R1, SPC/STR gene, AsnS gene, and attB2/R2
sequences were moved as a single polynucleotide molecule into a
recombinant construct for expression in plant cells, the
double-stranded DNA plasmids designated pMON79706 (Zea mays AsnS2),
pMON79700 (Glycine max AsnS) or pMON79653 (Saccharomyces cerevisiae
AsnS). These DNA constructs comprise the Agrobacterium right border
(O-OTH.-RB) regions and left border (LB) regions, and others
disclosed by Herrera-Estrella et al., 1983; Bevan, 1984; Klee et
al., 1985, the e35S promoter (P-CAMV.35S, tandemly duplicated
enhancer U.S. Pat. No. 5,322,938), the attB1/R1 genetic element
(O-Lam.attB1/R1), the SPC/STR gene, the respective AsnS-coding
region (CR), the attB2/R2 genetic element (O-Lam.attB2/R2), the
potato protease inhibitor II terminator (St.Pis), the Agrobacterium
NOS promoter (P-AGRtu.nos, Fraley et al., 1983), the Agrobacterium
left border (O-OTH.-LB), the kanamycin resistance gene
(CR-OTH.-Kan, U.S. Pat. No. 6,255,560), and the E. coli origin of
replication (Ec.ori.ColE).
[0119] The DNA constructs were amplified in Library Efficiency.RTM.
DB3.1.TM. cells (Invitrogen Corporation) under chloramphenicol
selection (25 .mu.g/mL) and kanamycin selection (50 .mu.g/mL) for
pMON79706, pMON79700 or pMON79653. Vector DNA was purified from
bacterial cultures using a QIAGEN Plasmid Kit (QIAGEN Inc.).
[0120] DNA for pMON79700, pMON79706, and pMON79653 was introduced
into the corn embryos as described in U.S. Pat. No. 5,015,580,
using the electric discharge particle acceleration gene delivery
device. For microprojectile bombardment of LH59 pre-cultured
immature embryos, 35% to 45% of maximum voltage was preferably
used. Following microprojectile bombardment, the corn tissue was
cultured in the dark at 27 .quadrature.C. Transformation methods
and materials for making transgenic plants of this invention, for
example, various media and recipient target cells, transformation
of immature embryos and subsequent regeneration of fertile
transgenic plants are disclosed in U.S. Pat. Nos. 6,194,636 and
6,232,526 and U.S. Patent Application Publication 20040216189,
which are incorporated herein by reference.
[0121] Fertile transgenic corn plants were produced from
transformed corn cells by growing transformed callus on the
appropriate regeneration media to initiate shoot development and
plantlet formation. Plantlets were transferred to soil when they
were about 3 inches tall and possessed roots (about four to 6 weeks
after transfer to medium). Plants were maintained for two weeks in
a growth chamber at 26.degree. C., followed by two weeks on a mist
bench in a greenhouse. The plants were subsequently transplanted
into 5-gallon pots and grown to maturity in the greenhouse.
Reciprocal pollinations were made with the corn LH59 inbred line.
Seed was collected from corn plants and used for analysis of
protein and further breeding activities.
Example 3
Vector Construction and Transformation of Corn with AsnS
Polynucleotide Sequences
[0122] The corn AsnS2 (SEQ ID NO: 3, pMON79706, FIG. 1) was
amplified by use of PCR (polymerase chain reaction). The reaction
conditions for the PCR reaction followed the manufacturer's
protocol (PE Applied Biosystems, Foster City, Calif.).
Approximately 100 ng of corn DNA, prepared as described above, was
amplified using 30 nmole each of forward (f) primer (SEQ ID NO: 32)
and reverse (r) primer (SEQ ID NO: 33) and 10 micromoles each of
dATP, dCTP, dGTP and TTP, 2.5 units of TaKaRaLA Taq in 1.times.LA
PCR Buffer II (Takara Bio INC, Shiga, Japan). After initial
incubation at 94.degree. C. for 1 minute, 35 cycles of PCR were
performed at 94.degree. C. for 45 seconds, followed by annealing at
60.degree. C. for 45 seconds, 72.degree. C. for 1 minute 15
seconds, followed, by 1 cycle of 72.degree. C. for 7 minutes.
[0123] Five AsnS2 DNA constructs were made. The first corn AsnS2
construct was made by isolating an 1821 base pair AsnS2 fragment
from pMON79706 by PCR, as described above, followed by restriction
digestion with XbaI and EcoRI restriction enzymes. The resulting
AsnS2 gene was ligated into pMON61560, which had also been digested
with XbaI and EcoRI. The resulting shuttle vector (pMON66246) was
digested with NotI and the insert containing the AsnS2 gene, in
operable linkage with the PPDK promoter and RGLUT1 terminator, was
ligated into pMON30167, which had also been digested with NotI. The
pMON30167 plasmid, which contains the EPSPS gene, provides for
selection with glyphosate. The resulting final plasmid was
designated pMON66230 (FIG. 3).
[0124] A second AsnS2 construct was made using the aforementioned
AsnS2 (pMON79706) gene. The construct was made by insertion of the
XbaI/EcoRI digested AsnS2 gene into pMON61562, which had also been
digested with XbaI and EcoRI, resulting in the AsnS2 gene being in
operable linkage with the NAS promoter and RGLUT1 terminator. The
resulting plasmid was digested with NotI and ligated into the NotI
digested pMON30167. The resulting plasmid was designated pMON66229
(FIG. 2).
[0125] A third AsnS2 construct was made using the aforementioned
AsnS2 gene (pMON79706). The P-FDA promoter used in this construct
was isolated from pMON78810 by digestion with NotI and XbaI
restriction enzymes. The P-FDA promoter was then ligated into
pMON66246, which was previously digested with NotI and XbaI to
remove its PPDK promoter. The resulting plasmid was digested with
NotI and ligated into the NotI digested pMON30167. The resulting
plasmid was designated pMON66231 (FIG. 4).
[0126] A fourth AsnS2 construct was made using the aforementioned
AsnS2 gene (pMON79706). The P-RTBV promoter to be used in this
construct was generated by PCR from pMON74576. The 721 bp fragment
was digested with NotI and XbaI and ligated into pMON66246, which
was previously digested with NotI and XbaI. The resulting plasmid,
containing the AsnS2 gene in operable linkage with the P-RTBV
promoter and RGLUT1 terminator was digested with NotI and ligated
into the NotI digested pMON30167. The resulting plasmid was
designated pMON66239 (FIG. 5).
[0127] A fifth AsnS2 construct was made using the aforementioned
AsnS2 gene (pMON79706). A primer pair of ZmASsense,
TABLE-US-00004 5'TCCTAGACATGTCCGGCATACTTGCTG3', (SEQ ID NO:46)
and ZmASantisense,
TABLE-US-00005 [0128] 5'TGCAGAATTCTATCCCTCGATGG;, (SEQ ID
NO:47)
was used to amplify corn AsnS2 from pMON66240. PCR set up was as
follows: in a total volume of 50 .mu.l PCR reaction, 1 .mu.l of 10
mM each primer of ZmASsense and ZmASantisense, 0.2 to 0.5 .mu.g (1
.mu.l) of plasmid DNA of pMON66240, 5 .mu.l of 10.times.
AccuPrime.TM. Pfx Reaction Mix, 1 .mu.l of ACCuPrime.TM. Pfx DNA
Polymerase (Invitrogen), and 41 .mu.l of distilled water. The PCR
reaction was carried out with the following cycle parameters:
94.degree. C. for 1 min., followed by 30 cycles of 94.degree. C.
for 15 seconds for denaturing; 58.degree. C. for 15 sec of
annealing, and 68.degree. C. for 4 min.; followed by 10 min. of
extension at 68.degree. C. The PCR product was purified using a PCR
purification kit from QIAGEN (QIAGEN Inc.). An aliquot of the PCR
corn AsnS2 product was digested with NcoI and EcoRI restriction
enzyme and another aliquot of the PCR product was digested with
AflIII and NcoI. The NcoI and EcoRI fragment was then cloned into
NcoI and EcoRI sites of pMON94901. The AflIII and NcoI 5' end
fragment of corn AsnS2 was cloned into the NcoI and EcoRI of the
corn AsnS2 fragment at NcoI site. The resulting plasmid
(pMON74940), containing corn AsnS2 in operable linkage with the
e35S promoter and the Hsp 17 terminator, was digested with NotI and
ligated into NotI digested pMON53616 to construct pMON74946.
[0129] Each construct described above contained an expression
cassette for expression of a glyphosate insensitive Type II EPSPS
as a means for selecting transgenic events (U.S. Pat. No.
5,633,435). The nucleic acid sequence of each construct was
determined using standard methodology as set forth by PE Applied
Biosystems BigDye terminator v.3.0 (PE Applied Biosystems, Foster
City, Calif.) and the integrity of the cloning junctions confirmed.
The pMON66229, pMON66230, pMON66231, pMON66239, and pMON74946
vectors were used in the subsequent transformation of corn cells
and regeneration of these cells into intact corn plants. Constructs
of interest were introduced to immature embryos from corn line
LH244 by an Agrobacterium-mediated transformation method, for
instance as described in U.S. Published Patent Application
20050048624.
Example 4
Protein and Amino Acid Analysis of Corn Seed Samples
[0130] This example sets forth a method of protein and amino acid
analysis to select seed of the present invention with increased
asparagine and protein using HPLC and near infrared measurements.
For seed protein analysis, small bulk samples consisting of 50-100
seeds for each treatment were measured using near infrared
transmittance spectroscopy (Infratec model 1221, Tecator, Hoganas
Sweden). This procedure was based upon the observation that a
linear relation exists between the absorption of near infrared
radiation and the quantity of chemical constituents comprised in a
typical seed sample. Prior to analyzing unknown samples, spectral
data was collected with calibration samples that were subsequently
analyzed using a primary analysis technique. The primary technique
used was nitrogen combustion (Murray and Williams, 1987). A
multivariate model was developed using the spectral data from the
spectrometer and the primary data. In the present case, a PLS-1
(Partial Least Squares Regression Type I) multivariate model was
constructed using 152 calibration samples. Each unknown sample was
scanned on the spectrometer at least five times and its protein
content predicted with each scan. Each time the sample was scanned,
it was added back to the sample cuvette to provide an accurate
representation of the sample tested. The predicted protein values
were averaged for the multiple scans and then reported for each
sample.
[0131] Free amino acid analysis was performed on corn tissues by
HPLC. For each sample, 20-50 mg lyophilized tissue were extracted
with 1.5 mL of 10% trichloroacetic acid in 2-mL microfuge tubes.
Samples were extracted at room temperature overnight with gentle
shaking. Extracted samples were cleared by centrifugation and the
supernatant was removed for further analysis. Free amino acid
analysis was performed by HPLC on an Agilent Series 1100 HPLC with
a fluorescence detector and 96-well plate autosampler equipped with
a Zorbax Eclipse AAA C18 column (4.6.times.75 mm, 3.5 micron,
Agilent Technologies, Palo Alto, Calif.) and Zorbax Eclipse AAA
analytical guard column (4.6.times.12.5 mm, 5 micron). Samples were
pre-derivatized with o-pthalaldehyde immediately prior to
separation. Free amino acids were resolved with a 40 mM phosphate
buffer, pH 7.6/Methanol/Acetonitrile gradient followed by
fluorescence detection at 340 nm/450 nm (excitation/emission). Free
amino acids were quantified based on external amino acid standards
and peaks were integrated with ChemStation software (Agilent).
Relative standard deviations were typically less than 8%.
Example 5
Field Evaluation of Asparagine Levels and Grain Protein Content in
Transgenic Corn Plants
[0132] This example sets forth the results of a field evaluation of
the effects of the corn AsnS constructs (pMON79706 and pMON92870)
on asparagine and protein levels in transformed corn plants and
seed; and the effects of the corn AsnS constructs (pMON79700 and
pMON79653) on grain protein content. The relative concentration of
free asparagine in corn tissues was obtained from inbred lines
derived from R.sub.0 corn plants transformed with pMON79706 or
pMON92870. For pMON79706, R.sub.0 transformants were backcrossed to
the parent inbred, LH59, to create BC.sub.1 seed. The BC.sub.1
seed, which segregates with the transgene, was planted in a field
nursery and individual plants were scored for the presence of the
NPTII marker gene. Leaf tissue was collected for free amino acid
analysis from transgene-positive and transgene-negative plants for
each transgenic event for free amino acid analysis. Leaf free amino
acids of pMON79706 transgenic plants were compared to negative
isoline plants within each event and analyzed statistically by
Student's T test with JMP 5.1 software (SAS Institute, Cary, N.C.).
For pMON92870, R.sub.0 transformants were backcrossed to the parent
inbred, LH244, to create BC.sub.1 seed. The BC1 seed was planted in
a field nursery and self-pollinated to create the BC.sub.1S.sub.1
seed, which subsequently was planted in a second inbred nursery.
Transgene-positive plants were identified for each transgenic event
following scoring for the presence of the NPTII marker gene. Leaf
tissue was collected from transgene-positive BC.sub.1S.sub.1 plants
and parental inbred plots planted at regular intervals in the
nursery. Leaf free amino acids for pMON92870 were analyzed
statistically by performing analysis of variance and comparing
transgenic entries to the parental control by conducting Student's
T test using SAS 9.1 software. For free amino acid analyses for
both constructs, leaf tissue was collected by removal of an upper
fully expanded leaf at anthesis followed by freezing on dry ice.
Leaf samples were ground frozen, lyophilized, and measured for free
amino acid content by HPLC.
[0133] Multiple transgenic events of pMON79706 and pMON92870 were
observed to show substantial increases in leaf asparagine content
(Table 2). Four of seven events of pMON79706 tested showed
significant increases in the concentration of leaf asparagine, as
indicated by a p value of 0.05 or less. In transgenic events of
pMON92870, expressing a second maize asparagine synthetase gene,
four of five events showed significant increases in leaf asparagine
levels (Table 2). These data show that transgenic expression of
maize AsnS2 and maize AsnS3 under the rice actin promoter in
pMON79706 and pMON92870, respectively, can result in a specific
increase in free asparagine, which is consistent with the
overexpression of active asparagine synthetase.
[0134] The relative concentration of protein in corn seed was
obtained from inbred lines derived from R.sub.0 corn plants
transformed with pMON79706 or pMON92870. BC.sub.1 transgenic plants
of pMON79706 (described above) were self-pollinated and the
resulting BC.sub.1S.sub.1 grain was grown to maturity and measured
for protein content by single ears. Protein was measured as a
percentage of dry weight at 0% moisture. Grain protein for
pMON79706 transgenic plants were compared to negative isoline
plants within each event and analyzed statistically by Student's T
test with SAS 9.1 software. For pMON98270, BC.sub.1S.sub.1 plants
were self-pollinated and grown to maturity and measured for protein
content by single ears. Grain protein for pMON92870 was analyzed
statistically with a custom developed spatial method by conducting
a by-location analysis. The by-location analysis is a two-step
process. The first step in the analysis involved estimating the
spatial autocorrelation in the field by fitting an anisotropic
spherical semi-variogram model using all spatial check plots that
were placed systematically in the field (every 6th plot). The
second stage of analysis involved adjusting the values of the
transgenic entries for the spatial variability using the spatial
autocorrelation structure estimated in the first stage of the
analysis. Following the adjustment for spatial autocorrelation,
mean comparison was carried out where the mean value of a
transgenic entry was compared to the parental control to test the
statistical significance of the difference between a transgene and
the control mean.
[0135] Multiple events of both pMON79706 and pMON92870 showed
significant increases in inbred grain protein content (Table 3).
Three of five events of pMON79706 that were analyzed statistically
showed significant increases in grain protein content (p<0.05)
and two other events showed trends toward significant increases
(p<0.15). Two events did not return sufficient numbers of ears
for a statistical analysis. Three of four transgenic events of
pMON92870 showed significant increases in grain protein content
(p<0.1), with one event untested due to insufficient numbers of
ears for analysis. These data confirm that pMON79706 and pMON92870
produce transgenic events that increase grain protein content in
maize in addition to increasing leaf asparagine content.
TABLE-US-00006 TABLE 2 Relative leaf asparagine concentrations in
inbred maize transformed with corn AsnS2 gene (pMON79706) or corn
AsnS3 gene (pMON92870). Mean of Mean of Transgene- Transgene- p
Construct.sup.a Event Generation positive Plants.sup.b negative
Plants Difference value pMON79706 ZM_M50965 BC.sub.1 16.3 10.7 5.6
0.319 ZM_M50973 BC.sub.1 32.0 7.3 24.3 0.025 ZM_M50974 BC.sub.1
25.0 5.3 19.8 0.014 ZM_M50980 BC.sub.1 18.0 5.3 12.5 0.001
ZM_M50984 BC.sub.1 29.3 10.3 19.1 0.002 ZM_M50985 BC.sub.1 15.7 6.3
9.5 0.278 ZM_M51011 BC.sub.1 15.0 7.3 7.7 0.191 pMON92870
ZM_M102252 BC.sub.1S.sub.1 22.5 0.0 22.5 <0.001 ZM_M103304
BC.sub.1S.sub.1 18.8 0.0 18.8 <0.001 ZM_M103315 BC.sub.1S.sub.1
30.6 0.0 30.6 <0.001 ZM_M103316 BC.sub.1S.sub.1 2.6 0.0 2.6 0.55
ZM_M103320 BC.sub.1S.sub.1 30.0 0.0 30.0 <0.001 .sup.aLeaf
asparagine was determined in two separate experiments for pMON79706
and pMON92870. .sup.bRelative free asparagine measured as a
percentage of total free amino acids in leaf tissue
TABLE-US-00007 TABLE 3 Grain protein content in inbred maize
transformed with maize AsnS2 gene (pMON79706) or maize AsnS3 gene
(pMON92870). Mean of Mean of Transgene- Transgene- p
Construct.sup.a Event Generation positive Plants.sup.a negative
Plants Difference value pMON79706 ZM_M50965 BC.sub.1 nd.sup.c nd nd
nd ZM_M50973 BC.sub.1 15.1 11.6 3.5 0.024 ZM_M50974 BC.sub.1 nd nd
nd nd ZM_M50980 BC.sub.1 13.8 12.0 1.8 0.118 ZM_M50984 BC.sub.1
15.1 11.4 3.7 0.002 ZM_M50985 BC.sub.1 13.9 10.8 3.1 0.003
ZM_M51011 BC.sub.1 13.5 11.4 2.2 0.08 pMON92870 ZM_M102252
BC.sub.1S.sub.1 13.3 11.9 1.4 0.096 ZM_M103304 BC.sub.1S.sub.1 13.7
11.9 1.8 0.042 ZM_M103315 BC.sub.1S.sub.1 nd 11.9 nd nd ZM_M103316
BC.sub.1S.sub.1 11.2 11.9 -0.7 0.373 ZM_M103320 BC.sub.1S.sub.1
14.2 11.9 2.3 0.003 .sup.aGrain protein was determined in two
separate experiments for pMON79706 and pMON92870. .sup.bGrain
protein measured as a percentage of total grain composition on a 0%
moisture basis. .sup.cnd; not determined.
[0136] The high asparagine and grain protein phenotype pMON79706
was confirmed in multiple tissues in a second trial. After the
BC.sub.1 generation, five events of pMON79706 were self-pollinated
in two following nurseries to generate BC.sub.1S.sub.3 seed that
was homozygous for the transgene. The relative concentration of
asparagine resulting from expression of the pMON79706 construct was
determined in a study at the corn V8 growth stage by comparing
homozygous BC.sub.1S.sub.3 plants and a LH59 corn variety control
(Table 4). Transgenic entries and controls were planted in a
randomized complete block design with 5 replicated blocks in a
field plot. The upper fully expanded leaves and stem sections of
two plants were sampled and pooled, placed on dry ice, ground,
lyophilized, and measured for free amino acid content by HPLC.
Values followed by "*" indicate a significant difference from the
LH59 control (Dunnett's one-tail test; (SAS 9.1, Cary, N.C.).
Asparagine measurements taken at both the V8 growth stage and the
R.sub.1 generation showed that plants from five pMON79706 events
had significant increases in free asparagine. Relative free
asparagine levels in V8 leaf tissue were increased up to 13.9% as
compared to 3.4% in the LH59 variety control, and stem asparagine
was increased up to 39% as compared to 9.6 in the control (Table
4). For grain protein analysis, 10 ears were sampled per plot,
shelled, and analyzed for grain protein concentration. Grain
protein was also increased significantly in the five events of
pMON79706 (Table 4). The results show that, as a general trend,
events producing a significant increase in asparagine also produced
as significant increase in kernel protein (Tables 2-4).
TABLE-US-00008 TABLE 4 Relative asparagine concentrations at V8
growth stage and grain protein concentration at maturity in
BC.sub.1S.sub.3 corn plants transformed with the corn AsnS2 gene
(pMON79706). Leaf Stem Grain Asn % Asn (ppm) Asn % Asn (ppm)
Protein % Event Mean Mean Mean Mean Mean LH59 control 3.54 389 9.6
2254 12.3 ZM_M50974 12.31* 1312* 32.20* 9179* 14.8* ZM_M50980
10.20* 1058* 38.68* 12844* 15.2* ZM_M50984 9.18* 997* 28.20* 8062*
14.4* ZM_M50985 5.86* 697 15.12* 3404 14.5* ZM_M51011 13.89* 1740*
37.05* 11820* 15.0* *Significant at p < 0.05
[0137] Significant increases in hybrid grain protein were observed
for three different constructs expressing asparagine synthetase
genes under the rice actin promoter. Homozygous inbred corn lines
were produced from R.sub.0 transgenic events of pMON79706 (corn
AsnS2), pMON79700 (soy AsnS), and pMON79653 (yeast AsnS1) by first
backcrossing R.sub.0 events to the recurrent parent, LH59, followed
by self-pollinations of transgene-positive selections in two
subsequent inbred nurseries using the NPTII selectable marker to
score for zygosity. The homozygous events for each construct were
then used as a male pollen donor in a cross with a female inbred
line to create the F.sub.1 hybrid. The F.sub.1 hybrid seed was
planted in a multiple-location trial and transgenic events for each
construct were analyzed for final grain protein and compared to the
recurrent parent hybrid control following a spatial correction
analysis based on grain protein in control hybrids that were
planted at regular intervals throughout the field. Grain was
harvested from each plot, shelled, and analyzed for protein
content. Data were analyzed using a custom developed spatial method
by conducting a by-location and an across location analysis. The
by-location analysis is a two-step process. The first step in the
analysis involved estimating the spatial autocorrelation in the
field by fitting an anisotropic spherical semi-variogram model
using all spatial check plots that were placed systematically in
the field (every 3rd plot). The second stage of analysis involved
adjusting the values of the transgenic entries for the spatial
variability using the spatial autocorrelation structure estimated
in the first stage of the analysis. Following the adjustment for
spatial autocorrelation in each location separately, an
across-location analysis was conducted where the mean value of a
transgenic entry was compared to the parental control to test the
statistical significance (P=0.20) of the difference between a
transgene and the control mean. All five events of pMON79706 showed
significant increases in grain protein in the hybrid trial,
consistent with the observation that grain protein was increased in
the inbred lines of transgenic events of this construct (Table 5).
Two other asparagine synthetase constructs, pMON79700 (soy AsnS)
and pMON79653 (yeast AsnS), also showed significant increases in
grain protein levels in two of five events and two of two events,
respectively.
TABLE-US-00009 TABLE 5 Grain protein content in hybrid maize
transformed with genes for asparagine synthetase from maize (Zea
mays), soy (Glycine max), and yeast (Saccharomyces
cerevisiae).sup.a. Protein Protein Transgenic Control Protein
Construct Gene Event Mean Mean Delta p value pMON79706 Maize AsnS2
ZM_M50974 11.12 8.65 2.48 0.000 ZM_M50980 9.17 8.65 0.53 0.003
ZM_M50984 9.56 8.65 0.91 0.000 ZM_M50985 9.71 8.65 1.07 0.000
ZM_M51011 9.45 8.65 0.81 0.000 pMON79700 Soy AsnS ZM_M49436 8.52
8.65 -0.13 0.469 ZM_M61615 11.25 8.65 2.61 0.000 ZM_M62422 13.30
8.65 4.65 0.000 ZM_M62428 8.61 8.65 -0.04 0.826 ZM_M64520 8.76 8.65
0.11 0.570 pMON79653 Yeast AsnS1 ZM_M49883 9.12 8.65 0.48 0.007
ZM_M65281 9.43 8.65 0.79 0.000 .sup.aGrain protein measured as a
percentage of total grain composition on a 0% moisture basis.
Example 6
Field Evaluation of the Transgene Expression and Asparagine
Synthetase Enzyme Activity Due to pMON79706 and pMON92870
[0138] Transgene expression was confirmed in transgenic events of
pMON79706 and pMON92870. For pMON79706, tissue used for the
determination of leaf asparagine content in the field trial with
BC.sub.1S.sub.3 homozygous inbred lines was also used for
determination of transgene expression based on measurement of the
expression from the 3'-terminator sequence (St.Pis4) from pMON79706
at anthesis. Two leaf samples were harvested and pooled from each
of 5 replicate plots (10 for inbred control) and frozen on dry ice.
Leaf samples were then ground frozen for expression analysis. For
RNA extraction, 50 mg of frozen tissue were aliquoted into 96-well
plates. Each sample was extracted with 500 .mu.l of lysis buffer
containing a 1:1 solution of ABI nucleic acid lysis solution
(Applied Biosystems, Foster City, Calif.) to 1.times.PBS pH 7.4
(without MgCl or CaCl). RNA was extracted from fresh-frozen tissue
samples using filter-plates to capture nucleic acids from crude
lysates, and 50 .mu.l of ABI elution buffer was used to elute bound
RNA. Quantitative PCR was performed using a 5 .mu.l RNA template
with 5 .mu.l ABI one-step RT-PCR reagent. The reactions were
carried out for 40 PCR cycles on an ABI Taqman 7900 PCR instrument,
with cycling parameters of 48.degree. C. for 30 min., 95.degree. C.
for 10 min., 95.degree. C. for 10 sec., 60.degree. C. for 1 min.
Fluorescent measurements were taken from each well at each of the
40 cycles for both the terminator sequence derived from the potato
protease inhibitor II (St.Pis4) and the endogenous control
(ubiquitin). A subset of samples was run without reverse
transcriptase to monitor DNA contamination. Samples were scored for
relative expression by subtracting the cycle threshold values for
St.Pis4 from the cycle threshold value of the endogenous control.
The cycle threshold (Ct) was determined, and the delta Ct was
calculated from the St.Pis4 minus endogenous control value. An in
situ wild-type was created by calculating the average endogenous
control signals and setting the St.Pis4 signal value at 40. The
delta Ct of the unknown samples was subtracted from the delta Ct of
the in situ wild-type. Final data was reported as pinII (St.Pis4)
expression relative to wild type. Quantitative RT-PCR analysis
confirmed overexpression of the transgene from six of six events of
pMON79706 (FIG. 6).
[0139] Transgene expression was also confirmed in inbred events
comprising pMON92870. RNA expression was determined from leaf
tissue at anthesis of inbred plants grown in a field nursery by
first harvesting an upper expanded leaf from each plant (4-8 plants
per event) and freezing on dry ice. Transgene-positive plants were
previously identified based on presence of the NPTII marker gene.
Leaf tissue was ground while frozen, and analyzed for expression
from the 3'-terminator sequence (St.Pis4) of pMON92870.
Quantitative RT-PCR analysis showed that five of six events
comprising pMON92870 showed increased transgene expression as
compared to an inbred control (FIG. 7). The low RNA expression in
pMON92870 event ZM_M103316 is consistent with the low leaf
asparagine content and grain protein content in this event.
[0140] The effect of expression of asparagine synthetase genes on
asparagine synthetase activity was measured in transgenic events of
pMON79706 and pMON92870. Frozen, ground leaf tissue was aliquoted
(200-400 mg) into wells from a precooled 96 deep-well plate.
Protein was extracted in Buffer A (100 mM Hepes-OH, pH 8.0, 0.1 mM
EDTA, 10 mM MgCl.sub.2, 2 mM aspartate, 0.5 mM DTT, 67 mM
mercaptoethanol, 20% (v/v) glycerol, 0.1 mM ATP, 1% (v/v) P9599
(Sigma Company), 25 mM KCl). A small amount of sand was added to
each well. Buffer A was then added to the leaf tissue in the wells
at a ratio of 4:1 (buffer:tissue). The plates were then agitated in
a paint shaker for 2 min. to mix the sample and then centrifuged at
5000.times.g for 10 minutes. The supernatant (100-200 .mu.L) was
desalted in a 96-well macro spin plate (SNS S025L, The Nest Group
Inc., Southboro, Mass.) equilibrated in buffer A. The supernatant
was then either assayed immediately or frozen in liquid nitrogen
and maintained at -80.degree. C. until used. To assay asparagine
synthetase activity, desalted protein extracts (10-50 .mu.L) were
added to wells containing 100 .mu.L assay solution (100 mM Hepes,
pH 8.0, 10 mM MgCl.sub.2, 2 mM aspartate, 5 mM DTT, 10 mM ATP, 1 mM
amino(oxy)acetic acid (aspartate amino transferase inhibitor), 1 mM
aspartic semialdehyde (asparaginase inhibitor). To start the
reaction, glutamine (final concentration of 2 mM for standard
assay) was added to the solution, which was then mixed. The assay
mixture was then incubated for 1 to 2 hours. The reaction was then
stopped by the addition of an equal volume of 20% (w/v)
trichloroacetic acid. The mixture was then filtered to remove
precipitate and asparagine was measured by HPLC. Sample size was
increased from 0.5 .mu.L to 2.5 .mu.L for HPLC, excitation
wavelength was reduced from 340 nm to 235 nm, and fluorimeter gain
was increased from 10 to 13. This results in a sensitivity of
detection of 0.5 to 100 .mu.M asparagine and allows the measurement
of levels of activity in the 100s of microunits.
[0141] For pMON79706, tissue used for the determination of leaf
asparagine synthetase enzyme activity was from a field trial with
BC.sub.1S.sub.3 homozygous inbred lines harvested at the V7 growth
stage. Events of pMON79706 were shown to display increased leaf
asparagine synthetase activity (Table 6). Asparagine synthetase
activity was increased up to 5-fold over the inbred variety
control. Asparagine synthetase enzyme activity was also determined
for transgenic events of pMON92870 in an inbred field nursery at
the time of anthesis. Four of five pMON92870 events also showed
increased enzyme activity (Table 6). The increased asparagine
synthetase enzyme activity in corn plants expressing the corn AsnS2
(pMON79706) or corn AsnS3 (pMON92870) under the rice actin promoter
is consistent with the increase in gene expression and leaf
asparagine increases observed with these constructs.
TABLE-US-00010 TABLE 6 Asparagine synthetase activity in inbred
lines of transgenic events of pMON79706 and pMON92870.sup.a.
Construct Event AsnS Activity (.mu.units/mg protein) Control LH59
276 pMON79706 ZM_M50973 519 ZM_M50974 1179 ZM_M50984 1592 ZM_M50985
450 ZM_M51011 1031 Control LH244 98 pMON92870 ZM_M102252 160
ZM_M103304 209 ZM_M103315 243 ZM_M103316 11 ZM_M103319 192
ZM_M103320 240 .sup.aEnzyme activities for pMON79706 and pMON92870
were determined from two different field experiments.
Example 7
Field Evaluation of the Effects of pMON66231, pMON66239, and
pMON74946 on Asparagine and Grain Protein Content
[0142] The relative content of free asparagine in corn tissues was
obtained from hybrid lines derived from R.sub.0 corn plants (LH244
background) transformed with pMON66231 (FIG. 4), where corn AsnS2
is under the control of the corn FDA promoter. Hybrids were made by
crossing the R.sub.0 plants to the male inbred line LH59, which
creates a segregating (1:1) F.sub.1 population. The resulting
F.sub.1 seed was planted in three midwest location with two
replications at each location. Plots were sprayed with glyphosate
at V3 growth stage to eliminate null sergeants. A hybrid control
was planted in the perimeter and comparisons were made to the
hybrid control. Upper leaves were collected and pooled from three
plants within each plot at the time of anthesis, two hours after
sunset, at all three locations. Leaves were placed immediately on
dry ice and then stored at -80.degree. C. until processing. Leaves
were ground frozen, and a portion was lyophilized for free amino
acid analysis by HPLC. Data were first screened for outliers with
the two-pass method for deleted studentized residuals using
Bonferroni-adjusted p-values. Outliers were identified and removed
from the data set before analysis of variance calculations were
initiated. The data were analyzed according to an across-locations
randomized complete block design. Construct-event combinations were
modeled with fixed effects, and locations and reps within locations
were modeled with random effects. Treatment comparisons were made
by performing contrasts of the least-squares means of the
construct-event combinations. Relative leaf asparagine was
increased significantly in 11 of 12 events of pMON66231, with
asparagine levels as high as 16% as compared to 3% in the control
(Table 7). Mature grain protein was also measured following harvest
of 10 ears per plot followed by shelling and pooling of seed for
each plot, which was then measured for grain protein content. Nine
of 12 events were found to significantly increase protein content
in the mature grain over the LH244/LH59 hybrid control.
TABLE-US-00011 TABLE 7 Relative leaf asparagine and mature grain
protein content in pMON66231 transgenic events. Leaf Asn %.sup.a
Grain Protein % Event Mean p value.sup.b Mean p value.sup.b
LH244/LH59 2.73 8.68 ZM_S120303 11.41 <.001 8.57 0.774
ZM_S120316 8.92 0.007 9.90 0.002 ZM_S122246 8.69 0.01 10.22
<.001 ZM_S122249 9.85 0.002 10.83 <.001 ZM_S122257 9.57 0.003
12.48 <.001 ZM_S122262 10.10 0.001 9.70 0.011 ZM_S122267 9.33
0.004 9.23 0.162 ZM_S122279 12.67 <.001 11.13 <.001
ZM_S122280 12.54 <.001 10.90 <.001 ZM_S122281 9.47 0.003
10.53 <.001 ZM_S122291 16.25 <.001 9.83 0.004 ZM_S122303 6.44
0.126 8.53 0.71 .sup.aRelative free asparagine measured as a
percentage of total free amino acids in leaf tissue .sup.bCompared
to hybrid control.
[0143] The relative content of free asparagine in corn tissues was
obtained from hybrid lines derived from R.sub.0 corn plants (LH244
background) transformed with pMON66239 and pMON74946, where corn
AsnS2 is under the control of the RTBV or e35S promoter,
respectively. Hybrids were made by crossing the R.sub.0 plants to
the male inbred line, LH59, which creates a segregating (1:1)
F.sub.1 population. The resulting F.sub.1 seed was planted in one
location in Hawaii with three replications for each transgenic
event. Plots were sprayed with glyphosate at V3 growth stage to
eliminate null sergeants. A hybrid control lacking the corn AsnS2
gene was included for comparison. Upper leaves were collected and
pooled from three plants within each plot at the time of anthesis,
two hours after sunset. Leaves were placed immediately on dry ice
and then stored at -80.degree. C. until processing. Leaves were
ground frozen, and a portion was lyophilized for free amino acid
analysis by HPLC. Data were first screened for outliers with the
two-pass method for deleted studentized residuals using
Bonferroni-adjusted p-values. Outliers were identified and removed
from the data set before analysis of variance calculations were
initiated. The data were analyzed according to a randomized
complete block design. Construct-event combinations were modeled
with fixed effects, and reps were modeled with random effects.
Treatment comparisons were made by performing contrasts of the
least-squares means of the construct-event combinations. Relative
leaf asparagine was increased significantly in 10 of 13 events of
pMON74946, with asparagine levels as high as 16% as compared to 2%
in the control (Table 8). Mature grain protein was also measured
following harvest of all ears per plot followed by shelling and
pooling of seed for each plot, which was then measured for grain
protein content and analyzed statistically as for the leaf
asparagine trait. Ten of thirteen events were found to possess
significantly increased protein content in the mature grain as
compared to the hybrid control, and the same 10 events with
increased leaf asparagine also showed increased protein in the
hybrid trial. For transgenic events of pMON66239, 11 of 15 events
showed increases in leaf asparagine content, and 3 of 15 events
showed significant increases in grain protein at the 0.05 alpha
level, although an additional five transgenic events showed
increased protein at p<0.15, indicating that expression of corn
AsnS2 under the RTBV promoter (pMON66239) can increase leaf
asparagine content and kernel protein content, but to a lesser
extent than under the e35s promoter (pMON74946) (Table 8).
TABLE-US-00012 TABLE 8 Relative leaf asparagine and mature grain
protein content in pMON74946 and pMON66239 transgenic events. Leaf
Asn %.sup.a Grain Protein % Construct Event Mean p value.sup.b Mean
p value.sup.b Control Hybrid control 1.47 7.98 pMON74946 ZM_S156600
10.37 <.0001 8.67 0.0398 ZM_S156602 1.23 0.7315 8.43 0.1728
ZM_S156606 0.39 0.1214 7.43 0.0995 ZM_S156613 0.71 0.2786 7.70
0.3959 ZM_S156634 14.79 <.0001 9.37 <.0001 ZM_S156636 12.28
<.0001 9.23 0.0002 ZM_S160005 15.57 <.0001 9.50 <.0001
ZM_S160015 15.85 <.0001 13.10 <.0001 ZM_S160025 13.41
<.0001 9.13 0.0007 ZM_S160026 11.94 <.0001 9.17 0.0005
ZM_S160034 11.00 <.0001 9.60 <.0001 ZM_S160037 15.79
<.0001 9.10 0.001 ZM_S160042 14.73 <.0001 9.17 0.0005
pMON66239 ZM_S140597 8.84 <.0001 11.03 <.0001 ZM_S140601 2.14
0.3419 8.20 0.5078 ZM_S140609 10.08 <.0001 8.50 0.1182
ZM_S140613 2.67 0.0881 8.50 0.1182 ZM_S140615 1.23 0.7333 8.20
0.5078 ZM_S140617 6.68 <.0001 8.50 0.1182 ZM_S140618 3.93 0.0005
8.73 0.0244 ZM_S140633 5.96 <.0001 8.63 0.0503 ZM_S140635 3.69
0.0017 8.37 0.2445 ZM_S140645 5.88 <.0001 8.37 0.2445 ZM_S140647
3.66 0.0019 8.30 0.3353 ZM_S140651 4.66 <.0001 8.57 0.0784
ZM_S140661 4.13 0.0002 8.03 0.8741 ZM_S140663 2.07 0.61 9.03 0.0018
ZM_S140665 7.33 <.0001 8.27 0.388 .sup.aRelative free asparagine
measured as a percentage of total free amino acids in leaf tissue
.sup.bCompared to hybrid control.
Example 8
Bacterial Expression Vectors, Purification, and Kinetics of AsnS1,
AsnS2, AsnS3 and AsnS4 Isoforms
[0144] This example describes the cloning of the nucleotide
sequence for AsnS1 (SEQ ID NO: 1), AsnS2 (SEQ ID NO: 3), AsnS3 (SEQ
ID NO: 5) and AsnS4 (SEQ ID NO: 50) into E. coli expression
vectors, as well as the expression, purification and kinetics of
the recombinant forms of the four AsnS isoforms.
[0145] Bioinformatic searches using a published maize AsnS gene
sequence (Chevalier et al., 1996; gi984262) resulted in the
identification of four full-length cDNA sequences in proprietary
in-house cDNA collections which were identified as sharing
significant sequence similarity to the published maize AsnS gene.
Two of the full-length cDNAs that share sequence identity with the
public AsnS sequence were named Zm-AsnS1 and Zm-AsnS3. The other
two genes were named Zm-AsnS2 and Zm-AsnS4 (SEQ ID NO:50)
respectively. Cloning of Zm-AsnS1, Zm-AsnS2, and Zm-AsnS3 sequences
into plant expression vectors is described in Examples 2 and 3
above. These three genes as well as Zm-AsnS4 were cloned into
bacterial expression vectors as follows:
[0146] The full-length coding sequences of Zm-AsnS1, Zm-AsnS3 and
AsnS4 were amplified by polymerase chain reaction (PCR) from cDNA
clones 700151670_FLI, LIB5399-001-A2, and LibLIB3732-039-F9_FLI
respectively in the proprietary in-house cDNA collections.
Sequences of the forward and reverse primers for PCR-amplified
fragments encoding the Zm-AsnS1 were:
TABLE-US-00013 Zm-AsnS1_for1 (SEQ ID NO: 52)
5'-ggaattccatATGTGTGGCATCTTAGC-3' and Zm-AsnS 1_rev1 (SEQ ID NO:
53) 5'-ataagaatgcggccgcGACCGCGATCGCGACTGCGACA-3'
[0147] Sequences of the forward and reverse primers used for the
Zm-AsnS3 PCR amplification were:
TABLE-US-00014 Zm-AsnS3_for2 (SEQ ID NO: 54)
5'-ctagctagctagATGTGCGGCATCCTC-3' and Zm-AsnS3_rev2 (SEQ ID NO: 55)
5'-ccgctcgagGACAGCTGTGGCTGAAGCAACG-3'
[0148] A PCR-amplified fragment encoding the full length of AsnS4
(SEQ ID NO: 50) was obtained with the following primer pair:
TABLE-US-00015 Zm-AsnS4=HD --for3 (SEQ ID NO: 56)
5'-gggaattccatATGTGTGGCATCTTAGC-3' and Zm-AsnS4_rev3 (SEQ ID NO:
57) 5'-ataagaatgcggccgcCACCGCGATCGCGACAGCGA-3'
[0149] The full-length coding sequence of Zm-AsnS2 was amplified by
polymerase chain reaction (PCR) from pMON79706 (FIG. 1; SEQ ID NO:
3). Sequences of primers for PCR amplification of Zm-AsnS2
were:
TABLE-US-00016 Zm-AsnS2_for4 (SEQ ID NO: 58)
5'-tatgtgcggcatacttgctgtgctcgggt -3' and Zm-AsnS2_rev4 (SEQ ID NO:
59) 5'-gctatccctcgatggcaacgccagat-3'
[0150] PCR was carried out in a total volume of 50 .mu.L using the
Expand.TM. High Fidelity PCR kit (Boehringer Mannheim, Germany).
The reaction was carried out in a PTC-200 Peltier thermal cycler
(MJ Research Inc., Watertown, Mass.) under the following
conditions:
[0151] Initial incubation: [0152] 5 min at 95.degree. C.
[0153] 27 cycles of: [0154] 1 min at 95.degree. C. [0155] 1 min
annealing at 56.degree. C.
[0156] followed by: [0157] 2 min extension at 72.degree. C. [0158]
10 min incubation at 72.degree. C.
[0159] The resulting PCR fragments were subcloned into one of the
expression plasmids pET30a(+) or pET21d(+) (Novagen, San Diego,
Calif.), yielding plasmids pET30a-Zm-AsnS1, pET30a-ZmAsnS2,
pET30a-Zm-AsnS,3 and pET21d-Zm-AsnS4. The plasmid sequences were
confirmed by DNA sequence analysis. These vectors are expected to
produce recombinant proteins with C-terminal histidine tags.
[0160] The E. coli expression vectors described in the previous
paragraph were used to transform Rosetta DE5.TM. E. coli cells
(Novagen). Transformed cells were transferred from solid LB media
plates and grown in liquid LB media containing standard
concentrations of kanomycin (50 .mu.M) and chloramphenicol (25
.mu.M) at 37.degree. C. An overnight culture was used to inoculate
a 25 mL culture, which was grown at 37.degree. C. until mid log
phase (OD.sub.600=0.4-0.6). Cells were then transferred to
20.degree. C. for 30 min after which IPTG was added to a final
concentration of 0.5 mM. The cells were then grown at 20.degree. C.
for 12 hours and cell pellets were harvested by centrifugation.
[0161] The protein was recovered from the insoluble fraction while
bound to a nickel column. Buffers used for the purification of
recombinant AsnS were:
[0162] Buffer A: 100 mM Hepes-OH, pH=7.6, 0.1 mM EDTA, 10 mM
MgCl.sub.2, 2 mM aspartate, 0.5 mM DTT, 20% (v/v) glycerol, 0.1 mM
ATP, 1% (v/v) protease inhibitor cocktail (Sigma Product No.
P9599), 25 mM KCl
[0163] Buffer B: (Buffer A+6 M Guanidine-HCl)
[0164] Buffer C: (Buffer A+6 M Urea)
[0165] Buffer D: (Buffer A+4 M Urea)
[0166] Buffer E: (Buffer A+2 M Urea)
[0167] Buffer F: (Buffer A+1 M Urea)
[0168] Buffer G: (Buffer A+500 mM imidazole)
[0169] All purification procedures were performed at 4.degree. C.
unless otherwise stated. E. coli pellets were solubilized in Buffer
A and passed through a French Press three times at 16,000 PSI. The
sample was then centrifuged at 75,000.times.g for at least one
hour. The pellet (inclusion body) was frozen in liquid N.sub.2 and
then stored at -80.degree. C. until used.
[0170] All routine kinetic measurements of plant AsnS enzymes were
performed on his-tagged plant AsnS forms which had been refolded on
the nickel column during purification. An E. coli pellet resulting
from bacteria expressing one of the AsnS forms in 200 mL of LB
media as described above was used as the starting material.
Inclusion bodies were isolated using the method described in the
Pierce Pro-Matrix.TM. Protein Refolding Guide (Thermo Fisher
Scientific, Rockford, Ill., product No. 89867; Appendix A) and then
solubilized using the protocol Pierce Pro-Matrix Protein Refolding
Guide (product No. 89867; Appendix B) except that Buffer B was used
in place of the 6-8M GdnHCl, 50 mM Tris. The solubilized sample was
then applied at a flow rate of 1 mL/min to a 3-5 mL Nickel NTA
agarose (Qiagen) column previously equilibrated in Buffer B. The
column was then successively washed at 1 mL/min with at least two
column bed volumes of Buffers B, C, D and E and F. The column was
then washed with Buffer A until the OD.sub.280 of the column eluent
was less than 0.05. The entire wash process was completed within
1-2 hours. The protein was then eluted with Buffer G at 1 mL/min. 2
mL fractions were taken and the three fractions with the highest
protein amounts were pooled, frozen in liquid N.sub.2 and stored at
-80.degree. C. until assayed as described in Example 6. Levels of
each substrate (ATP, glutamine, NH.sub.4.sup.+ and aspartate) were
titrated to determine the individual K.sub.m and V.sub.max values.
Kinetic parameters measured were K.sub.m (Asp), K.sub.m (Gln),
K.sub.m (NH.sub.4.sup.+) and V.sub.max, for each substrate, and for
some enzymes. Results are reported in Table 9.
[0171] All four genes encode sequences which give rise to
polypeptides with AsnS activity. AsnS1, AsnS2 and AsnS3 appear to
be kinetically distinct since K.sub.m (Gln) for AsnS2 is several
fold lower than the other enzymes; and the V.sub.max of AsnS1 is
several fold lower than the other enzymes.
TABLE-US-00017 TABLE 9 Kinetic comparison of maize asparagine
synthetases V.sub.max K.sub.m(Gln) K.sub.m(ASP) K.sub.m(ATP)
K.sub.m(NH.sub.4.sup.+) .mu.u/mg .mu.M .mu.M .mu.M .mu.M Zm AsnS1
170 543 980 110 9900 Zm AsnS2 850 110 910 125 750 Zm AsnS3 350 423
1200 97 8400 Zm AsnS4 310 233 930 128 9000
[0172] All publications, patents and patent applications are herein
incorporated by reference to the same extent as if each individual
publication or patent application was specifically and individually
indicated to be incorporated by reference.
REFERENCES
[0173] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference:
[0174] U.S. Pat. No. 4,761,373 [0175] U.S. Pat. No. 4,957,748
[0176] U.S. Pat. No. 5,100,679 [0177] U.S. Pat. No. 5,219,596
[0178] U.S. Pat. No. 5,322,783 [0179] U.S. Pat. No. 5,322,938
[0180] U.S. Pat. No. 5,538,880 [0181] U.S. Pat. No. 5,550,318
[0182] U.S. Pat. No. 5,563,055 [0183] U.S. Pat. No. 5,610,042
[0184] U.S. Pat. No. 5,633,435 [0185] U.S. Pat. No. 5,936,069
[0186] U.S. Pat. No. 6,005,076 [0187] U.S. Pat. No. 6,146,669
[0188] U.S. Pat. No. 6,156,227 [0189] U.S. Pat. No. 6,194,636
[0190] U.S. Pat. No. 6,232,526 [0191] U.S. Patent Application
Publication 20040216189A1 [0192] U.S. Patent Application
Publication 20050048624A1 [0193] Alba, Plant J., 39(5): 681-808,
2004. [0194] Allard, In: Principles of Plant Breeding, 2.sup.nd
Ed., John Wiley & Sons, ISBN: 0471023094, 1999. [0195] Altschul
et al., Nucleic Acids Res., 25:3389-3402, 1997. [0196] Aslanidis
and de Jong, Nucleic Acids Res., 18(20):6069-6074, 1990. [0197]
Ausubel et al., eds. Current Protocols in Molecular Biology, John
Wiley & Sons, New York, 1989. [0198] Bevan, Nucleic Acids Res.,
12:8711-8721, 1984. [0199] Chu et al., Scientia Sinica, 18:659,
1975. [0200] Dellaporta et al., Plant Molecular Biology Reporter,
1:19-21, 1983. [0201] D'Halluin et al., Bio/Technology, 10:
309-314, 1992. [0202] Fraley et al., Proc. Natl. Acad. Sci. USA,
80:4803-4807, 1983. [0203] Haymes et al., Nucleic Acid
Hybridization, A Practical Approach, IRL Press, Washington, D.C.,
1985. [0204] Hayward, In: Plant Breeding: Principles and Prospects,
Vol. 1, Chapman & Hall, ISBN: 0412433907, 1993. [0205] Henikoff
and Henikoff, Proc. Natl. Acad. Sci. USA, 89:10915-10919, 1992.
[0206] Herrera-Estrella et al., Nature, 303:209, 1983. [0207]
Hinchee et al., Bio/Technology, 6: 915-922, 1988. [0208] Jones and
Shenk, Cell, 13:181-188, 1978. [0209] Jones et al., Mol. Gen.
Genet., 210(1):1-4, 1987. [0210] Klee et al., Bio-Technology,
3(7):637-642, 1985. [0211] Lewin, In: Genes V, Oxford University
Press, NY, 1994. [0212] Matsuoka et al, Proc. Natl. Acad. Sci. USA,
90:9586-9590, 1993. [0213] Murashige and Skoog, Physiol. Plant,
15:473-497, 1962. [0214] Murray and Williams, In: Chemical
Principles of Near-Infrared Technology, Near-Infrared Technology in
the Agricultural and Food Industries, Williams and K. Norris
(Eds.), 1987. [0215] PCT Appln. WO 95/06128 [0216] Reynaerts et
al., In: Selectable and Screenable Markers, Gelvin and Schilperoort
(Eds.), Plant Molecular Biology Manual, Kluwer, Dordrecht, 1988.
[0217] Richards, In: Plant Breeding Systems, Stanley Thornes Pub
Ltd; 2.sup.nd Ed., ISBN: 0412574500, 1997. [0218] Rieger et al.,
Glossary of Genetics: Classical and Molecular, 5th edition,
Springer-Verlag: New York, 1991. [0219] Sambrook et al., Molecular
Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Press,
Cold Spring Harbor, N.Y., 2001. [0220] Stalker et al., J. Biol.
Chem., 263:6310-6314, 1988. [0221] Thillet et al., J. Biol. Chem.,
263:12500-12508, 1988.
Sequence CWU 1
1
5911869DNAZea mays 1atgatttgtg acaaatgcag cctcgtgcgg agcttttttg
taggtagacc gcgggatatc 60acaagtttgt acaaaaaagc aggctcctgc aggaccatgt
gcggcatcct cgctgtcctc 120ggcgtcgctg aggtctccct cgccaagcgc
tcccgcatca ttgagctctc gcgcaggtta 180cggcaccgag ggcctgattg
gagtggtttg cactgtcatg aggattgtta ccttgcacac 240cagcggttgg
ctattatcga tcctacatct ggagaccagc ctttgtacaa tgaggataaa
300acagttgttg taacggtgaa cggagagatc tataaccatg aagaattgaa
agctaagttg 360aaaactcatg agttccaaac tggcagtgat tgtgaagtta
tagcccatct ttacgaagaa 420tatggcgaag aatttgtgga tatgttggat
ggaatgttct cctttgttct tcttgataca 480cgtgataaaa gcttcatcgc
agctcgtgat gctattggca tctgcccttt atacatggga 540tggggtcttg
atggatcagt ctggttttct tcagagatga aggcattgag tgatgattgt
600gaacgcttca taacatttcc cccagggcat ctctactcca gcaagacagg
tggtctaagg 660agatggtaca acccaccatg gttttcagag acggtccctt
caacccctta caatgctctc 720ttcctccggg agatgtttga gaaggctgtt
attaagaggc tgatgactga tgtgccattt 780ggtgtgcttt tatctggtgg
actcgactct tctttggttg catctgttgc ttcgcggcac 840ttaaacgaaa
caaaggttga caggcagtgg ggaaataaat tgcatacttt ctgtataggc
900ttgaagggtt ctcctgatct taaagctgct agagaagttg ctgattacct
cagcactgta 960catcatgagt tccacttcac agtgcaggag ggcattgatg
ccttggaaga agtcatctac 1020catattgaga catatgatgt tacaacaatc
agagcaagta ccccaatgtt tttgatgtca 1080cgcaaaatca aatctttggg
tgtgaagatg gttatttctg gcgaaggttc agatgaaatt 1140tttggtggtt
acctttattt tcacaaggca ccaaacaaga aagaattcca tgaggaaaca
1200tgtcggaaga taaaagcact acatctgtat gactgcttga gagctaacaa
agcaacttct 1260gcctggggtg ttgaggctcg tgttccattc cttgacaaaa
gtttcatcag tgtagcaatg 1320gacattgatc ctgaatggaa gatgataaaa
cgtgacctcg gtcgaattga gaaatgggtt 1380atccgtaatg catttgatga
tgatgagagg ccctatttac ctaagcacat tctctacagg 1440caaaaggaac
agttcagtga tggtgttggg tatagttgga tcgatggatt gaaggaccat
1500gccagccaac atgtctccga ttccatgatg atgaatgctg gctttgttta
cccagagaac 1560acacccacaa caaaagaagg gtactactac agaatgatat
tcgagaaatt ctttcccaag 1620cctgcagcaa ggtcaactgt tcctggaggt
cctagtgtgg cctgcagcac tgccaaagct 1680gttgaatggg acgcatcctg
gtccaagaac cttgatcctt ctggccgtgc tgctttgggt 1740gttcacgatg
ctgcgtatga agacactgca gggaaaactc ctgcctctgc tgatcctgtc
1800tcagacaagg gccttcgtcc agctattggc gaaagcctag ggacacccgt
tgcttcagcc 1860acagctgtc 18692623PRTZea mays 2Met Ile Cys Asp Lys
Cys Ser Leu Val Arg Ser Phe Phe Val Gly Arg1 5 10 15Pro Arg Asp Ile
Thr Ser Leu Tyr Lys Lys Ala Gly Ser Cys Arg Thr20 25 30Met Cys Gly
Ile Leu Ala Val Leu Gly Val Ala Glu Val Ser Leu Ala35 40 45Lys Arg
Ser Arg Ile Ile Glu Leu Ser Arg Arg Leu Arg His Arg Gly50 55 60Pro
Asp Trp Ser Gly Leu His Cys His Glu Asp Cys Tyr Leu Ala His65 70 75
80Gln Arg Leu Ala Ile Ile Asp Pro Thr Ser Gly Asp Gln Pro Leu Tyr85
90 95Asn Glu Asp Lys Thr Val Val Val Thr Val Asn Gly Glu Ile Tyr
Asn100 105 110His Glu Glu Leu Lys Ala Lys Leu Lys Thr His Glu Phe
Gln Thr Gly115 120 125Ser Asp Cys Glu Val Ile Ala His Leu Tyr Glu
Glu Tyr Gly Glu Glu130 135 140Phe Val Asp Met Leu Asp Gly Met Phe
Ser Phe Val Leu Leu Asp Thr145 150 155 160Arg Asp Lys Ser Phe Ile
Ala Ala Arg Asp Ala Ile Gly Ile Cys Pro165 170 175Leu Tyr Met Gly
Trp Gly Leu Asp Gly Ser Val Trp Phe Ser Ser Glu180 185 190Met Lys
Ala Leu Ser Asp Asp Cys Glu Arg Phe Ile Thr Phe Pro Pro195 200
205Gly His Leu Tyr Ser Ser Lys Thr Gly Gly Leu Arg Arg Trp Tyr
Asn210 215 220Pro Pro Trp Phe Ser Glu Thr Val Pro Ser Thr Pro Tyr
Asn Ala Leu225 230 235 240Phe Leu Arg Glu Met Phe Glu Lys Ala Val
Ile Lys Arg Leu Met Thr245 250 255Asp Val Pro Phe Gly Val Leu Leu
Ser Gly Gly Leu Asp Ser Ser Leu260 265 270Val Ala Ser Val Ala Ser
Arg His Leu Asn Glu Thr Lys Val Asp Arg275 280 285Gln Trp Gly Asn
Lys Leu His Thr Phe Cys Ile Gly Leu Lys Gly Ser290 295 300Pro Asp
Leu Lys Ala Ala Arg Glu Val Ala Asp Tyr Leu Ser Thr Val305 310 315
320His His Glu Phe His Phe Thr Val Gln Glu Gly Ile Asp Ala Leu
Glu325 330 335Glu Val Ile Tyr His Ile Glu Thr Tyr Asp Val Thr Thr
Ile Arg Ala340 345 350Ser Thr Pro Met Phe Leu Met Ser Arg Lys Ile
Lys Ser Leu Gly Val355 360 365Lys Met Val Ile Ser Gly Glu Gly Ser
Asp Glu Ile Phe Gly Gly Tyr370 375 380Leu Tyr Phe His Lys Ala Pro
Asn Lys Lys Glu Phe His Glu Glu Thr385 390 395 400Cys Arg Lys Ile
Lys Ala Leu His Leu Tyr Asp Cys Leu Arg Ala Asn405 410 415Lys Ala
Thr Ser Ala Trp Gly Val Glu Ala Arg Val Pro Phe Leu Asp420 425
430Lys Ser Phe Ile Ser Val Ala Met Asp Ile Asp Pro Glu Trp Lys
Met435 440 445Ile Lys Arg Asp Leu Gly Arg Ile Glu Lys Trp Val Ile
Arg Asn Ala450 455 460Phe Asp Asp Asp Glu Arg Pro Tyr Leu Pro Lys
His Ile Leu Tyr Arg465 470 475 480Gln Lys Glu Gln Phe Ser Asp Gly
Val Gly Tyr Ser Trp Ile Asp Gly485 490 495Leu Lys Asp His Ala Ser
Gln His Val Ser Asp Ser Met Met Met Asn500 505 510Ala Gly Phe Val
Tyr Pro Glu Asn Thr Pro Thr Thr Lys Glu Gly Tyr515 520 525Tyr Tyr
Arg Met Ile Phe Glu Lys Phe Phe Pro Lys Pro Ala Ala Arg530 535
540Ser Thr Val Pro Gly Gly Pro Ser Val Ala Cys Ser Thr Ala Lys
Ala545 550 555 560Val Glu Trp Asp Ala Ser Trp Ser Lys Asn Leu Asp
Pro Ser Gly Arg565 570 575Ala Ala Leu Gly Val His Asp Ala Ala Tyr
Glu Asp Thr Ala Gly Lys580 585 590Thr Pro Ala Ser Ala Asp Pro Val
Ser Asp Lys Gly Leu Arg Pro Ala595 600 605Ile Gly Glu Ser Leu Gly
Thr Pro Val Ala Ser Ala Thr Ala Val610 615 62031818DNAZea mays
3atgtgcggca tacttgctgt gctcgggtgc gccgacgagg ccaagggcag cagcaagagg
60tcccgggtgc tggagctgtc gcggcggctg aagcaccggg gccccgactg gagcggcctc
120cggcaggtgg gcgactgcta cctctctcac cagcgcctcg ccatcatcga
cccggcctct 180ggcgaccagc ccctctacaa cgaggaccag tcggtggtcg
tcgccgtcaa cggcgagatc 240tacaaccacc tggacctcag gagccgcctc
gccggcgcag gccacagctt caggaccggc 300agcgactgcg aggtcatcgc
gcacctgtac gaggagcatg gagaagagtt cgtggacatg 360ctggacggcg
tcttctcctt cgtgctgctg gacactcgcc atggcgaccg cgcgggcagc
420agcttcttca tggctgctcg cgacgccatc ggtgtgacgc ccctctacat
cggatgggga 480gtcgatgggt cggtgtggat ttcgtcggag atgaaggccc
tgcacgacga gtgtgagcac 540ttcgagatct tccctccggg gcatctctac
tccagcaaca ccggcggatt cagcaggtgg 600tacaaccctc cttggtacga
cgacgacgac gacgaggagg ccgtcgtcac cccctccgtc 660ccctacgacc
cgctggcgct aaggaaggcg ttcgagaagg ccgtggtgaa gcggctgatg
720acagacgtcc cgttcggcgt cctgctctcc ggcgggctgg actcgtcgct
ggtggcgacc 780gtcgccgtgc gccacctcgc ccggacagag gccgccaggc
gctggggcac caagctccac 840tccttctgcg tgggcctgga ggggtcccct
gacctcaagg cggccaggga ggtggcggag 900tacctgggca ccctgcacca
tgagttccac ttcactgttc aggacggcat cgacgccatc 960gaggacgtga
tctaccacac ggagacgtac gacgtcacca cgatcagggc gagcacgccc
1020atgttcctca tgtcgcgcaa gatcaagtcg ctcggggtca agatggtcat
ctccggcgag 1080ggctccgacg agctcttcgg aggctacctc tacttccaca
aggcgcccaa caaggaggag 1140ttgcaccgag agacgtgtag gaaggttaag
gctctgcatc agtacgactg cctgagagcc 1200aacaaggcga catcagcttg
gggcctggag gctcgcgtcc cgttcctgga caaggagttc 1260atcaatgcgg
ccatgagcat cgatcctgag tggaagatgg tccagcctga tcttggaagg
1320attgagaagt gggtgctgag gaaggcattc gacgacgagg agcagccatt
cctgcccaag 1380catatcctct acagacagaa ggagcagttc agtgacggcg
ttgggtacag ctggatcgat 1440ggcctgaagg ctcatgcaac atcaaatgtg
actgacaaga tgctgtcaaa tgcaaagttc 1500atcttcccac acaacactcc
gaccaccaag gaggcctact actacaggat ggtcttcgag 1560aggttcttcc
cacagaaatc tgctatcctg acggtacctg gtgggccaag tgtggcgtgc
1620agcacagcca aagccatcga gtgggacgca caatggtcag gaaatctgga
cccctcggga 1680agggcggcac tgggcgtcca tctcgccgcc tacgaacacc
aacatgatcc cgagcatgtc 1740ccggcggcca ttgcagcagg aagcggcaag
aagccaagga cgattagggt ggcaccgcct 1800ggcgttgcca tcgaggga
18184606PRTZea mays 4Met Cys Gly Ile Leu Ala Val Leu Gly Cys Ala
Asp Glu Ala Lys Gly1 5 10 15Ser Ser Lys Arg Ser Arg Val Leu Glu Leu
Ser Arg Arg Leu Lys His20 25 30Arg Gly Pro Asp Trp Ser Gly Leu Arg
Gln Val Gly Asp Cys Tyr Leu35 40 45Ser His Gln Arg Leu Ala Ile Ile
Asp Pro Ala Ser Gly Asp Gln Pro50 55 60Leu Tyr Asn Glu Asp Gln Ser
Val Val Val Ala Val Asn Gly Glu Ile65 70 75 80Tyr Asn His Leu Asp
Leu Arg Ser Arg Leu Ala Gly Ala Gly His Ser85 90 95Phe Arg Thr Gly
Ser Asp Cys Glu Val Ile Ala His Leu Tyr Glu Glu100 105 110His Gly
Glu Glu Phe Val Asp Met Leu Asp Gly Val Phe Ser Phe Val115 120
125Leu Leu Asp Thr Arg His Gly Asp Arg Ala Gly Ser Ser Phe Phe
Met130 135 140Ala Ala Arg Asp Ala Ile Gly Val Thr Pro Leu Tyr Ile
Gly Trp Gly145 150 155 160Val Asp Gly Ser Val Trp Ile Ser Ser Glu
Met Lys Ala Leu His Asp165 170 175Glu Cys Glu His Phe Glu Ile Phe
Pro Pro Gly His Leu Tyr Ser Ser180 185 190Asn Thr Gly Gly Phe Ser
Arg Trp Tyr Asn Pro Pro Trp Tyr Asp Asp195 200 205Asp Asp Asp Glu
Glu Ala Val Val Thr Pro Ser Val Pro Tyr Asp Pro210 215 220Leu Ala
Leu Arg Lys Ala Phe Glu Lys Ala Val Val Lys Arg Leu Met225 230 235
240Thr Asp Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser
Ser245 250 255Leu Val Ala Thr Val Ala Val Arg His Leu Ala Arg Thr
Glu Ala Ala260 265 270Arg Arg Trp Gly Thr Lys Leu His Ser Phe Cys
Val Gly Leu Glu Gly275 280 285Ser Pro Asp Leu Lys Ala Ala Arg Glu
Val Ala Glu Tyr Leu Gly Thr290 295 300Leu His His Glu Phe His Phe
Thr Val Gln Asp Gly Ile Asp Ala Ile305 310 315 320Glu Asp Val Ile
Tyr His Thr Glu Thr Tyr Asp Val Thr Thr Ile Arg325 330 335Ala Ser
Thr Pro Met Phe Leu Met Ser Arg Lys Ile Lys Ser Leu Gly340 345
350Val Lys Met Val Ile Ser Gly Glu Gly Ser Asp Glu Leu Phe Gly
Gly355 360 365Tyr Leu Tyr Phe His Lys Ala Pro Asn Lys Glu Glu Leu
His Arg Glu370 375 380Thr Cys Arg Lys Val Lys Ala Leu His Gln Tyr
Asp Cys Leu Arg Ala385 390 395 400Asn Lys Ala Thr Ser Ala Trp Gly
Leu Glu Ala Arg Val Pro Phe Leu405 410 415Asp Lys Glu Phe Ile Asn
Ala Ala Met Ser Ile Asp Pro Glu Trp Lys420 425 430Met Val Gln Pro
Asp Leu Gly Arg Ile Glu Lys Trp Val Leu Arg Lys435 440 445Ala Phe
Asp Asp Glu Glu Gln Pro Phe Leu Pro Lys His Ile Leu Tyr450 455
460Arg Gln Lys Glu Gln Phe Ser Asp Gly Val Gly Tyr Ser Trp Ile
Asp465 470 475 480Gly Leu Lys Ala His Ala Thr Ser Asn Val Thr Asp
Lys Met Leu Ser485 490 495Asn Ala Lys Phe Ile Phe Pro His Asn Thr
Pro Thr Thr Lys Glu Ala500 505 510Tyr Tyr Tyr Arg Met Val Phe Glu
Arg Phe Phe Pro Gln Lys Ser Ala515 520 525Ile Leu Thr Val Pro Gly
Gly Pro Ser Val Ala Cys Ser Thr Ala Lys530 535 540Ala Ile Glu Trp
Asp Ala Gln Trp Ser Gly Asn Leu Asp Pro Ser Gly545 550 555 560Arg
Ala Ala Leu Gly Val His Leu Ala Ala Tyr Glu His Gln His Asp565 570
575Pro Glu His Val Pro Ala Ala Ile Ala Ala Gly Ser Gly Lys Lys
Pro580 585 590Arg Thr Ile Arg Val Ala Pro Pro Gly Val Ala Ile Glu
Gly595 600 60551764DNAZea mays 5atgtgtggca tcttagccgt gctcggttgc
tccgactggt ctcaggcaaa gagggctcgc 60atcctcgcct gctccagaag gttgaagcac
aggggccccg actggtcggg cctttaccag 120cacgagggca acttcctggc
gcagcagcgg ctcgccgtcg tctccccgct gtccggcgac 180cagccgctgt
tcaacgagga ccgcaccgtc gtggtggtgg ccaatggaga gatctacaac
240cacaagaacg tccggaagca gttcaccggc acacacaact tcagcacggg
cagtgactgc 300gaggtcatca tgcccctgta cgagaagtac ggcgagaact
tcgtggacat gctggacggg 360gtgttcgcgt tcgtgctcta cgacacccgc
gacaggacct acgtggcggc gcgcgacgcc 420atcggcgtca acccgctcta
catcggctgg ggcagtgacg gttccgtctg gatcgcgtcc 480gagatgaagg
cgctgaacga ggactgcgtg cgcttcgaga tcttcccgcc gggccacctc
540tactccagcg ccggcggcgg gttccggcgg tggtacaccc cgcactggtt
ccaggagcag 600gtgccccgga cgccgtacca gccgctcgtc ctcagagagg
ccttcgagaa ggcggtcatc 660aagaggctca tgactgacgt cccgttcggg
gtcctcctct ccggcggcct cgactcctcg 720ctagtcgcct ccgtcaccaa
gcgccacctc gtcgagaccg aggccgccga gaagttcggc 780accgagctcc
actcctttgt cgtcggcctc gagggctccc ctgacctgaa ggccgcacga
840gaggtcgctg actacctcgg aaccatccat cacgagttcc acttcaccgt
acaggacggc 900atcgacgcga tcgaggaggt gatctaccac gacgagacgt
acgacgtgac gacgatccgg 960gccagcacgc ccatgttcct gatggctcgc
aagatcaagt cgctgggcgt gaagatggtg 1020ctgtccgggg agggctccga
cgagctcctg ggcggctacc tctacttcca cttcgccccc 1080aacaaggagg
agttccacag ggagacctgc cgcaaggtga aagccctgca ccagtacgac
1140tgcctgcgcg ccaacaaggc cacgtcggcg tggggcctgg aggtccgcgt
gccgttcctc 1200gacaaggagt tcatcaacgt cgccatgggc atggaccccg
aatggaaaat gtacgacaag 1260aacctgggcc gcatcgagaa gtgggtcatg
aggaaggcgt tcgacgacga cgagcaccct 1320tacctgccca agcatattct
ctaccggcag aaagaacagt tcagtgacgg cgttggctac 1380aactggatcg
atggccttaa atccttcact gaacagcagg tgacggatga gatgatgaac
1440aacgccgccc agatgttccc ctacaacacg cccgtcaaca aggaggccta
ctactaccgg 1500atgatattcg agaggctctt ccctcaggac tcggcgaggg
agacggtgcc gtggggcccg 1560agcatcgcct gcagcacgcc cgcggccatc
gagtgggtgg agcagtggaa ggcctccaac 1620gacccctccg gccgcttcat
ctcctcccac gactccgccg ccaccgacca caccggcggt 1680aagccggcgg
tggccaacgg cggcggccac ggcgcggcga acggcacggt caacggcaag
1740gacgtcgcag tcgcgatcgc ggtc 17646588PRTZea mays 6Met Cys Gly Ile
Leu Ala Val Leu Gly Cys Ser Asp Trp Ser Gln Ala1 5 10 15Lys Arg Ala
Arg Ile Leu Ala Cys Ser Arg Arg Leu Lys His Arg Gly20 25 30Pro Asp
Trp Ser Gly Leu Tyr Gln His Glu Gly Asn Phe Leu Ala Gln35 40 45Gln
Arg Leu Ala Val Val Ser Pro Leu Ser Gly Asp Gln Pro Leu Phe50 55
60Asn Glu Asp Arg Thr Val Val Val Val Ala Asn Gly Glu Ile Tyr Asn65
70 75 80His Lys Asn Val Arg Lys Gln Phe Thr Gly Thr His Asn Phe Ser
Thr85 90 95Gly Ser Asp Cys Glu Val Ile Met Pro Leu Tyr Glu Lys Tyr
Gly Glu100 105 110Asn Phe Val Asp Met Leu Asp Gly Val Phe Ala Phe
Val Leu Tyr Asp115 120 125Thr Arg Asp Arg Thr Tyr Val Ala Ala Arg
Asp Ala Ile Gly Val Asn130 135 140Pro Leu Tyr Ile Gly Trp Gly Ser
Asp Gly Ser Val Trp Ile Ala Ser145 150 155 160Glu Met Lys Ala Leu
Asn Glu Asp Cys Val Arg Phe Glu Ile Phe Pro165 170 175Pro Gly His
Leu Tyr Ser Ser Ala Gly Gly Gly Phe Arg Arg Trp Tyr180 185 190Thr
Pro His Trp Phe Gln Glu Gln Val Pro Arg Thr Pro Tyr Gln Pro195 200
205Leu Val Leu Arg Glu Ala Phe Glu Lys Ala Val Ile Lys Arg Leu
Met210 215 220Thr Asp Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu
Asp Ser Ser225 230 235 240Leu Val Ala Ser Val Thr Lys Arg His Leu
Val Glu Thr Glu Ala Ala245 250 255Glu Lys Phe Gly Thr Glu Leu His
Ser Phe Val Val Gly Leu Glu Gly260 265 270Ser Pro Asp Leu Lys Ala
Ala Arg Glu Val Ala Asp Tyr Leu Gly Thr275 280 285Ile His His Glu
Phe His Phe Thr Val Gln Asp Gly Ile Asp Ala Ile290 295 300Glu Glu
Val Ile Tyr His Asp Glu Thr Tyr Asp Val Thr Thr Ile Arg305 310 315
320Ala Ser Thr Pro Met Phe Leu Met Ala Arg Lys Ile Lys Ser Leu
Gly325 330 335Val Lys Met Val Leu Ser Gly Glu Gly Ser Asp Glu Leu
Leu Gly Gly340 345 350Tyr Leu Tyr Phe His Phe Ala Pro Asn Lys Glu
Glu Phe His Arg Glu355 360 365Thr Cys Arg Lys Val Lys Ala Leu His
Gln Tyr Asp Cys Leu Arg Ala370 375 380Asn Lys Ala Thr Ser Ala Trp
Gly Leu Glu Val Arg Val Pro Phe Leu385 390 395 400Asp Lys Glu Phe
Ile Asn Val Ala Met Gly Met Asp Pro Glu Trp Lys405 410 415Met Tyr
Asp Lys Asn Leu Gly Arg Ile Glu Lys Trp Val Met Arg Lys420 425
430Ala Phe Asp Asp Asp Glu His Pro Tyr Leu Pro Lys His Ile Leu
Tyr435 440 445Arg Gln Lys Glu Gln Phe Ser Asp Gly Val Gly Tyr Asn
Trp Ile Asp450 455 460Gly Leu Lys Ser Phe Thr Glu Gln Gln Val Thr
Asp Glu Met Met Asn465 470 475 480Asn Ala Ala Gln Met Phe Pro Tyr
Asn Thr Pro Val Asn Lys Glu Ala485 490 495Tyr Tyr Tyr Arg Met Ile
Phe Glu Arg Leu Phe Pro Gln Asp Ser Ala500 505 510Arg Glu Thr Val
Pro Trp Gly Pro Ser Ile Ala Cys Ser Thr Pro Ala515 520 525Ala Ile
Glu Trp Val Glu Gln Trp Lys Ala Ser Asn Asp Pro Ser Gly530 535
540Arg Phe Ile Ser Ser His Asp Ser Ala Ala Thr Asp His Thr Gly
Gly545 550 555 560Lys Pro Ala Val Ala Asn Gly Gly Gly His Gly Ala
Ala Asn Gly Thr565 570 575Val Asn Gly Lys Asp Val Ala Val Ala Ile
Ala Val580 58571743DNAGlycine max 7atgtgtggta ttcttgctgt tcttggttgt
tctgatgact ctcgagccaa aagggtccgc 60gtgcttgagc tctctcgcag attgaagcac
cgtggccctg actggagtgg gctccatcaa 120catggtgact gctttttggc
acatcaacgg ttagccatag ttgatcctgc ttctggggat 180caacctctct
ttaacgagga caaatccgtc attgttacgg taaatggaga gatttacaac
240catgaagagc tcaggaaaca gctgcctaat cacaacttcc gaactggaag
tgattgtgat 300gttattgcac acctgtacga ggaacatgga gaagactttg
tggacatgct ggatggtatc 360ttctcatttg ttctactgga cacccgtgac
aacagtttta tagtggctcg ggatgctatt 420ggggtcactt ccttgtacat
tggatggggg ttagatggct ctgtttggat ttcatcagaa 480atgaaaggcc
tgaatgatga ttgtgaacac tttgagtgtt ttccacctgg tcacttgtac
540tctagcaaag aaagagggtt ccgcagatgg tacaatcctc cttggttctc
tgaggctatt 600ccatctgccc cttatgatcc tcttgtttta agacacgcct
ttgagcaggc agtcataaaa 660aggttgatga ctgatgtgcc ttttggtgtt
ctactctctg gaggtttgga ctcttctttg 720gttgcatcca tcacttctcg
ttacttggcc aacacaaagg ctgctgagca gtggggatca 780aagttacatt
cattctgtgt aggccttgag ggctcaccag atttgaaggc tgcaaaagag
840gttgctgact atctaggcac tgtccaccat gagtttacct tcactgttca
ggatggaata 900gatgccattg aagatgttat ctaccatatt gaaacatatg
atgtgactac aattagagca 960agcacaccta tgtttctcat gtctcggaag
attaaatcac ttggtgtcaa atgggttatc 1020tcaggagaag gatctgatga
gatctttgga gggtatttgt acttccacaa ggcacccaac 1080aaggaggagt
tccacagaga aacatgccgc aagatcaaag cacttcacca atatgattgc
1140ttgcgagcca ataaatcaac atttgcttgg ggtctagaag cccgtgtacc
atttttggac 1200aaggcgttta tcaatgctgc aatgagtatt gaccctgagt
ggaagatgat aaaaagagat 1260gaaggacgaa ttgagaagtg gattctgagg
agagcctttg atgatgaaga gcatccttat 1320ctgccaaagc acattttata
caggcagaaa gaacaattca gtgatggagt tggctatagt 1380tggattgatg
gccttaaggc ccatgctgca aaacatgtga ctgaaaaaat gatgcttaat
1440gctggtaaca tttaccccca caacacccca aaaaccaagg aagcatatta
ctacagaatg 1500atctttgaga ggttcttccc tcagaactca gctaggctca
ctgttcctgg aggagcaagt 1560gttgcatgta gcacagccaa agctgttgag
tgggatgctg cttggtctaa caaccttgat 1620ccctctggta gagcagcact
tggagtgcac atttcagcct atgaaaacca gaacaacaag 1680ggtgtagaaa
ttgagaagat aatacctatg gatgctgctc cccttggtgt tgccatccag 1740ggc
17438581PRTGlycine max 8Met Cys Gly Ile Leu Ala Val Leu Gly Cys Ser
Asp Asp Ser Arg Ala1 5 10 15Lys Arg Val Arg Val Leu Glu Leu Ser Arg
Arg Leu Lys His Arg Gly20 25 30Pro Asp Trp Ser Gly Leu His Gln His
Gly Asp Cys Phe Leu Ala His35 40 45Gln Arg Leu Ala Ile Val Asp Pro
Ala Ser Gly Asp Gln Pro Leu Phe50 55 60Asn Glu Asp Lys Ser Val Ile
Val Thr Val Asn Gly Glu Ile Tyr Asn65 70 75 80His Glu Glu Leu Arg
Lys Gln Leu Pro Asn His Asn Phe Arg Thr Gly85 90 95Ser Asp Cys Asp
Val Ile Ala His Leu Tyr Glu Glu His Gly Glu Asp100 105 110Phe Val
Asp Met Leu Asp Gly Ile Phe Ser Phe Val Leu Leu Asp Thr115 120
125Arg Asp Asn Ser Phe Ile Val Ala Arg Asp Ala Ile Gly Val Thr
Ser130 135 140Leu Tyr Ile Gly Trp Gly Leu Asp Gly Ser Val Trp Ile
Ser Ser Glu145 150 155 160Met Lys Gly Leu Asn Asp Asp Cys Glu His
Phe Glu Cys Phe Pro Pro165 170 175Gly His Leu Tyr Ser Ser Lys Glu
Arg Gly Phe Arg Arg Trp Tyr Asn180 185 190Pro Pro Trp Phe Ser Glu
Ala Ile Pro Ser Ala Pro Tyr Asp Pro Leu195 200 205Val Leu Arg His
Ala Phe Glu Gln Ala Val Ile Lys Arg Leu Met Thr210 215 220Asp Val
Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser Ser Leu225 230 235
240Val Ala Ser Ile Thr Ser Arg Tyr Leu Ala Asn Thr Lys Ala Ala
Glu245 250 255Gln Trp Gly Ser Lys Leu His Ser Phe Cys Val Gly Leu
Glu Gly Ser260 265 270Pro Asp Leu Lys Ala Ala Lys Glu Val Ala Asp
Tyr Leu Gly Thr Val275 280 285His His Glu Phe Thr Phe Thr Val Gln
Asp Gly Ile Asp Ala Ile Glu290 295 300Asp Val Ile Tyr His Ile Glu
Thr Tyr Asp Val Thr Thr Ile Arg Ala305 310 315 320Ser Thr Pro Met
Phe Leu Met Ser Arg Lys Ile Lys Ser Leu Gly Val325 330 335Lys Trp
Val Ile Ser Gly Glu Gly Ser Asp Glu Ile Phe Gly Gly Tyr340 345
350Leu Tyr Phe His Lys Ala Pro Asn Lys Glu Glu Phe His Arg Glu
Thr355 360 365Cys Arg Lys Ile Lys Ala Leu His Gln Tyr Asp Cys Leu
Arg Ala Asn370 375 380Lys Ser Thr Phe Ala Trp Gly Leu Glu Ala Arg
Val Pro Phe Leu Asp385 390 395 400Lys Ala Phe Ile Asn Ala Ala Met
Ser Ile Asp Pro Glu Trp Lys Met405 410 415Ile Lys Arg Asp Glu Gly
Arg Ile Glu Lys Trp Ile Leu Arg Arg Ala420 425 430Phe Asp Asp Glu
Glu His Pro Tyr Leu Pro Lys His Ile Leu Tyr Arg435 440 445Gln Lys
Glu Gln Phe Ser Asp Gly Val Gly Tyr Ser Trp Ile Asp Gly450 455
460Leu Lys Ala His Ala Ala Lys His Val Thr Glu Lys Met Met Leu
Asn465 470 475 480Ala Gly Asn Ile Tyr Pro His Asn Thr Pro Lys Thr
Lys Glu Ala Tyr485 490 495Tyr Tyr Arg Met Ile Phe Glu Arg Phe Phe
Pro Gln Asn Ser Ala Arg500 505 510Leu Thr Val Pro Gly Gly Ala Ser
Val Ala Cys Ser Thr Ala Lys Ala515 520 525Val Glu Trp Asp Ala Ala
Trp Ser Asn Asn Leu Asp Pro Ser Gly Arg530 535 540Ala Ala Leu Gly
Val His Ile Ser Ala Tyr Glu Asn Gln Asn Asn Lys545 550 555 560Gly
Val Glu Ile Glu Lys Ile Ile Pro Met Asp Ala Ala Pro Leu Gly565 570
575Val Ala Ile Gln Gly58091785DNAXylella fastidiosa 9atgatttgtg
acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcgggatatc 60acaagtttgt
acaaaaaagc aggctcctgc aggaccatgt gttccatttt tggaatcttc
120aacctgcaac ccagtgacaa cctacagata ctgcgtcacc aagcattgga
gtgctcgcaa 180cggcaacggc atcgcggacc cgattggagc ggcgtttacg
ttgatgtggg tgcgattctg 240gtgcacgaac gtcttgctat cgttgatcca
gctggcggtg cccagccact gctctccgag 300gatggcaccc tggcgttggc
ggtcaacggc gaaatctata accacgctgt actcaaagga 360acattgcagc
agccctatgc gttccaaact cattctgatt gcgaagtgat taatgcgctt
420taccgcgaag aaactccaac ctcgtttctg aatcgcttaa atgggatttt
tgcattcgta 480ttatgggaca agactaccgg acgtggcctc atcgcacgcg
atccaatggg tgtggtgccg 540ctgtactggg ggcacgatca ggacggtcgc
ttacgtgtcg cgtcagagat gaaagcattg 600gttgagcatt gctccgacgt
tgcacaattc ccacccggcc attggtacga caccacaacg 660ggcacgctgg
tgaagtatta cgaacgcccc tggaaaaact attctgcagt ggaaggagtg
720caggtctcac tacaggaact gcgtgaagcg ttcgagcggg ccgtccatcg
tcaactcatg 780acagatgttc catacggtgt actgctttct ggtggattgg
attcttccct ggtggctgcg 840gtggccgcac gctacgcacg ccatcgcatc
gaaaccaatg atcagagcga agcatggtgg 900ccacgtctgc actcatttgc
gattggactg aaagactcgc cagatttgag tgcggcgaac 960gtggctgctg
aggcgttgaa taccgtccac catcgtttcg agtacacctt ccaggagggg
1020ctggatgttc tacctgaagt gattcgtcac attgaaactt acgatgtcac
gacgattcgc 1080gcatctacac caatgttcct gctggcacgt cgcattaagg
cgatgggagt gaagatggtc 1140ttgtcaggtg aaggtagcga tgaaattttt
ggcggttacc tgtacttcca caaagcgccg 1200aacgcacgcg agttccacga
agaattggtc cgtaagctca acgccctgta ttactacgac 1260tgcttgcgcg
ccaacaaagc gatgatggcg tggggtgtcg agccgcgcgt gccgtttttg
1320gaccgtgaat ttctcgatgt ggctatgcgg atggatgctc agcataagat
ggtcgacaag 1380accagcaacg gcccacaacg gatggagaaa ggcatcctgc
gtgcagcgtt tgacggctat 1440ttgccgccat caatcctgtg gcgacagaag
gagcagttca gtgatggtgt tggctacggt 1500tggatcgacg gactgaaagc
acacgctgaa acgcaagtgt ctgaccatgc gctggcaact 1560gccgagacac
gtttccaggt gaatcctccc cagaccaaag aagcctatta ctaccgcagc
1620atatttgagc gcttcttccc aagcccggcg gcggctgaga cggtaccggg
cggtaaatca 1680attgcctgtt cctcaccggc ggcgattgcc tgggatgcca
gcttcgccac aatggctgac 1740ccatccggtc gtgcagtcag cggggttcat
caacaagcac tgctg 1785101779DNAXanthomonas campestris 10atgatttgtg
acaaatgcag cctcgtgcgg agcttttttg taggtagacc gcggaccggt 60cgcgcctcag
cagtcgctgt cgttaccatg tgttccatct tcggtatctt cggcctgcaa
120cccggcgacg acctgcaggc cctgcgccgg caggccctgg aatgttcgca
gcggcaacgc 180catcgcgggc cggactggag cggcgtgtac gtcgatgccg
gtgccatcct ggtgcacgag 240cgcctggcca tcgtcgaccc ggcgggcggt
tcgcagccgc tgttgtcgga ggacggcagc 300ctggcgttgg cagtcaacgg
cgagatctat aaccatcgcg aactcaaggc cgagctactg 360cagccgtacg
cttttcagac cggctcggac tgcgaagtga tcaacgcgct gtaccgcgaa
420gatgcgccgg cctcctatct caaccgcctc aatggcatct tcgcctttgc
gttgtgggac 480aaggccgcgg ggcgggtgat catcgcgcgc gacccgattg
gcgtggtgcc gttgtactgg 540ggacacgacc gcgaaggccg tctgcgcgtg
gcgtccgaac tcaagtcgct ggtggacgat 600tgcgccgatg ctgcgcagtt
tccgcctggt cattggtacg acagcgccac cggcgcattg 660agccgctact
acgagcgctc gtggcgcgaa tacagcgaag tggaaaatgt gcaggtgccg
720ctgcaggaac tgcgcgaggc gttcgagcgc gcggtgcatc gccagctgat
gaccgacgtg 780ccctacggtg tgctgctgtc cggtggcctg gattcgtcgt
tggtggcggc agtggccgcg 840cgctacgcgc ggcatcgtat cgaagagaac
gacaccaccg aagcctggtg gccgcgcctg 900cattccttcg caatcggcct
gaccggctcg ccggatctgg ccgctgccga agtggccgcc 960gccgcgctcg
gtaccgtgca ccacggcttc gaatacagct ttgaagaagg cctggatgca
1020ttgccggaag tgatccgcca catcgaaacc tacgacgtca ccacgattcg
tgcgtccacg 1080ccgatgttcc tgctggcgcg gcgcatcaag gcgatgggcg
tcaagatggt gctgtccggc 1140gaaggcagcg acgagatctt cggtggctac
ctgtacttcc acaaggcacc gaacgcccgc 1200gaattccacg aagaactggt
gcgcaagctc gatgcgctca acaactacga ttgcctgcgc 1260gccaacaagt
cgatgatggc ctggggcgtg gaaccgcgcg tgccgttcct ggatcgcgaa
1320ttcctggacg tggcgatgcg catggacgcg cgcttcaaga tgatcgacaa
gaccagcacc 1380ggtgccaccc gcatcgagaa gggcatcttg cgcgaggcat
ttgccggcta tctgccggaa 1440tcgatcctgt ggcggcagaa ggagcaattc
agcgatggcg ttggttatgg ctggatcgac 1500ggcctcaagg cacatgccgc
cgcgcacgtg agcgaccgcg aactcgcagc ggccgaccgg 1560cgcttcccgg
tgaacccgcc gcagaccaag gaagcctatt tctaccgcag tctgttcgag
1620cagttcttcc ccagccaggc cgctgcggag acggtgccgg gtggtaaatc
catcgcgtgt 1680tcgtcgccga cggccattgc ctgggacgcg agctttgcgg
cgatggccga tccgtcgggc 1740cgtgcgattg ccggcgtgca cgcgcaggcg
ttggcgtcc 1779111941DNABacillus halodurans 11atgatttgtg acaaatgcag
cctcgtgcgg agcttttttg taggtagacc gcgggatatc 60acaagtttgt acaaaaaagc
aggctcctgc aggaccatgt gtggaattac aggctgggta 120gattggcgac
gcaacttgca aaatgagacg gaaacgatca aacagatggc ggaaacgcaa
180acacatcgag ggcccgatga tttgaacgtt tggacagaga agcatgctgc
cttaggccac 240tcgcggctca ttgtcgttga tccggaaggc ggttgtcagc
cgatgatgag ggagaggaat 300ggcaaacgct atacgatcgt gtataacggc
gaattataca atacagaaga tttacggaaa 360gagcttatag taaaaggtta
ccaatttcaa ggccattcgg atacggaagt attactcgtg 420tcttatatcg
aatggggtta ccaatgtgtg gagaagttca atggcatttt tgcgtttgcg
480atttggaatg ataaagatca gagcttgttt atggcccgcg accgattagg
ggtaaagccg 540ctattttata ctgttcgcca tggattttta ctttttgcaa
ctgagataaa agcgctgctt 600gctcatcctg aaatcgagcc ggttcttacc
gaagaagggc tatcggaagt gctcgggctt 660gggccatcac gttcaccggg
taatggcgtt tttgatgata ttcaagagtt gcgaccagct 720catcttttga
catacgatcg caatggggca aaagtgagcc gttattggag attaaaatca
780atggctcatt ctgaagatgc gatggaaacg gccgcccatc ttcgcgactt
attagaagat 840actgtcgaac gtcagctatt tgcagatgtt ccagttggaa
tgtttctttc gggtggagtc 900gattcgagtg ctttaacggc aattgcggcg
ctgatttacg agcgagaagg gaagggcctg 960attcggacgt actcgattga
ttatgacgaa aatgataagt attttaaagc gaatgacttt 1020caaccgaatg
ccgatggacc ttgggttgaa aaagtttcaa ctacttttcg aacgaaccac
1080cacaatgctg tcatctcgat cgaggagttg gctaatcaat taaagcgagc
ggtagagctt 1140cgtgacttac ctggaatggc cgatgtagac tcttcattgt
attggttttg taagcaaatc 1200aaaaaagatg ttaccgttgg cttatcgggt
gaatgtgctg acgaaatttt tggtgggtat 1260ccttggttcc ataagccaga
ggtcatgaat tttaatgggt ttccttggat gagatcagcg 1320gatgaacgtc
aggagcttct tcatgaacga tggcgccaaa agttaaattt gcccaaatac
1380gttcatgatc gttataaaga aacgattgcc gaaacgcctc gcttcgaaga
ggacacaccg 1440gaagaagcgc gacgcaggga aatttcgtat ttgaacatgg
tctggtttat gacaacgctt 1500cttgatcgga aggatcgaat gagcatggga
gcgagcttag aagtgcgagt tccattttct 1560gaccaccgaa ttgtagaata
cgcttggaac attccgtggg aaattaaaca attcggaggg 1620agagagaagg
gcattttacg aaaagcgttg gaaggcatcc tcccagatga agtgttatac
1680cggaaaaaaa gtccttatcc gaaaacgcac catccaaaat acacgaaaat
ggtccagcaa 1740gagatggaac gaattctcgg tcaaagcgat agccccctct
ttgatgtagt gaaccggaaa 1800aagttaaaag agttaaccga aactggtggc
aaggcattaa cgacacctta ttttgggcag 1860cttatgacag gcccgcagct
ccttgcccac ttcatccaaa tggagcattg gcttaagcat 1920tacaatatca
aattaattgg t 1941121869DNAOryza sativa 12atgatttgtg acaaatgcag
cctcgtgcgg agcttttttg taggtagacc gcgggatatc 60acaagtttgt acaaaaaagc
aggctcctgc aggaccatgt gtggcatcct cgccgtgctc 120ggcgtcgcag
acgtctccct cgtcaagcgc tcccgcatca tcgagctatc ccgccggtta
180cgtcatagag gccctgattg gagtggtata cactgctatc aggattgcta
tcttgcacac 240cagcggttgg ctattgttga tcccacatcc ggagaccagc
cgttgtacaa tgaggacaaa 300tctgttgttg tgacggtgaa tggagagatc
tataaccatg aagaattgaa agctaacctg 360aaatctcata aattccaaac
tgctagcgat tgtgaagtta ttgctcatct gtatgaggaa 420tatggggagg
aatttgtgga tatgttggat gggatgttcg cttttgttct tcttgacaca
480cgtgataaaa gcttcattgc agcccgtgat gctattggca tttgtccttt
atacatgggc 540tggggtcttg atggttcggt ttggttttcg tcagagatga
aggcattaag tgatgattgc 600gagcgattca tatccttccc ccctgggcac
ttgtactcca gcaaaacagg tggcctaagg 660agatggtaca acccaccatg
gttttctgaa agcattccct ccaccccgta caatcctctt 720cttctccgac
agagctttga gaaggctatt attaagaggc taatgacaga tgtgccattt
780ggtgttctct tgtctggtgg actggactct tctttggttg catctgttgt
ttcgcggcac 840ttggcagagg caaaagttgc cgcacagtgg ggaaacaaac
tgcatacatt ttgcattggt 900ttgaaaggtt ctcctgatct tagagctgct
aaggaagttg cagactacct tggtactgtt 960catcacgaac tccacttcac
agtgcaggaa ggcattgatg cactggagga agtcatttac 1020catgttgaga
catatgatgt aacgacaatt agagcaagca ccccaatgtt cttgatgtca
1080cgtaaaatta aatctttggg ggtgaagatg gttctttcgg gagaaggttc
tgatgaaata 1140tttggcggtt acctttattt tcacaaggca ccaaacaaga
aggaattcca tgaggaaaca 1200tgtcggaaga taaaagccct tcatttatat
gattgcttga gagcgaacaa atcaacttct 1260gcatggggtg ttgaggcccg
tgttccgttc cttgacaaaa acttcatcaa tgtagctatg 1320gacattgatc
ctgaatggaa aatgataaaa cgtgatcttg gccgtattga gaaatgggtt
1380ctccggaatg catttgatga tgaggagaag ccctatttac ctaagcacat
tctatacagg 1440caaaaggagc aattcagtga tggtgttggg tacagttgga
ttgatggatt gaaggatcat 1500gcaaatgaac atgtatcaga ttccatgatg
atgaacgcta gctttgttta cccagaaaac 1560actccagtta caaaagaagc
gtactattat aggacaatat tcgagaaatt ctttcccaag 1620aatgctgcta
ggttgacagt acctggaggt cctagcgtcg cgtgcagcac tgctaaagct
1680gttgaatggg acgcagcctg gtccaaaaac cttgatccat ctggtcgtgc
tgctcttggt 1740gttcatgatg ctgcatatga agatactcta caaaaatctc
ctgcctctgc caatcctgtc 1800ttggataacg gctttggtcc agcccttggg
gaaagcatgg tcaaaaccgt tgcttcagcc 1860actgccgtt
1869131764DNAGaldieria sulphuraria 13atgatttgtg acaaatgcag
cctcgtgcgg agcttttttg taggtagacc gcggaccggt 60cgcgcctcag cagtcgctgt
cgttaccatg tgtgggattc ttgcggtgtt gggctcgtcg 120ttaccggtcg
aagagcttag agagttggtt aaaagctgca ccaaaaaact atatcacaga
180ggtccagatg aagaacaata tttcattagt gaagatgggt ggtgtggttt
aggctttgcc 240aggttgaaga ttgttgatcc tgagcacggt gtccagccta
tgttcaacga ccaacggaca 300gtttggagtg tcactaatgg cgagctttac
aaccatgaag agatccgaaa aacggaattg 360aacaatatga cactccattc
tcattctgac tgcgaaataa tgataccttt gtatgagaaa 420tatgtttcta
gtcagcgtta tgatcatgac attcaatatg tttataatct tctccgtgga
480gtctttgctt cttgcctggt tgatttgaaa cgtggttttt tcatggctgg
aagagatcct 540atcggggtcc gagctctttt ttatgggaca agtaaagatg
gtgctgtttg gtttgcttca 600gaggcaaaag caattgtgga tgtttgtgat
tatgtgacag cattcatacc aggtaccttt 660gtgaaaggat acagaggccg
cgaacaagca ttttctttta cgagatatta cgaaccagtg 720tactggcatg
atcactggat gccggtttct ccagttgact atcaactttt acatgacacc
780tttgtgttgt cttgtaagcg tcgtttaatg tccgacgtgc ctattggagt
atttatctct 840ggtggtttgg gttcttctct tgtggcctcc gtcgccaaac
gcttactgga tcccaactat 900gattttcatt cttttgcttg tggtcttgaa
ggagcaccag atgttgctgc agcgcaaaga 960gttgccgatt tcttaggaac
aaagcaccac gtattaacat ttactgtgga ggagggtatc 1020caagcactag
accaagtaat atatcacttg gaaacgtacg atgttaccac agttagagca
1080tcgacgccga tgtatttgtt atcaggtttg tgcaaaaagt atgtcaaagt
agtgttatca 1140ggtgaaggag cagatgaaat cttcggtgga tatctctatt
tccacaatgc accaaatgag 1200attgcatttc atcaagaagt tgttcgccga
gtgaaacttt tatacacagc cgacgtattg 1260cgtggagata gagcaacggc
agcacaaagt ttagaacttc gagttccgtt tcttgataga 1320gactttctgg
atgttgcaat gagtattcat ccgcgtgaaa aggttacttc taagcataga
1380atcgagaaat atatcattcg ctatgccttt
tccaaggagt tttgtggtga agagtatctt 1440cctgacgata ttctttggag
acaaaaagaa cagttttcgg atggcgtggg ctatagctgg 1500atcgatggtt
taaaggcgta ttgtgaaaag gccgtttccg atgcagactt gcaaaatgcc
1560gctcagcgtt ttccgcacga tactccaaca accaaagagg catatgttta
ccgagctata 1620ttcgaaaaac attttgggaa ttgcaaggca gtacaaggtc
ttcgtgaatc agttgcaaga 1680tgggtaccta tgtggagtga cagcacggat
cctagcggtc gtgcacaaaa agttcatgtg 1740gctgcatatt caaatggagg agac
1764141905DNAGaldieria sulphuraria 14atgtgttgct ctccttacct
cctgatggta tctagtatct accaactgac actatattgc 60ttctctttac atacgtatct
tgctcgatgc cttctcccta gtgttgacca gtgttactca 120catagtcttt
gctcatttca ttgtaatgca gataccaagc ggggtaccag atctgagctc
180ccgcgggata tcacaagttt gtacaaaaaa gcaggctcct gcaggaccat
gtgtgggatt 240cttgcggtgt tgggctcgtc gttaccggtc gaagagctta
gagagttggt taaaagctgc 300accaaaaaac tatatcacag aggtccagat
gaagaacaat atttcattag tgaagatggg 360tggtgtggtt taggctttgc
caggttgaag attgttgatc ctgagcacgg tgtccagcct 420atgttcaacg
accaacggac agtttggagt gtcactaatg gcgagcttta caaccatgaa
480gagatccgaa aaacggaatt gaacaatatg acactccatt ctcattctga
ctgcgaaata 540atgatacctt tgtatgagaa atatgtttct agtcagcgtt
atgatcatga cattcaatat 600gtttataatc ttctccgtgg agtctttgct
tcttgcctgg ttgatttgaa acgtggtttt 660ttcatggctg gaagagatcc
tatcggggtc cgagctcttt tttatgggac aagtaaagat 720ggtgctgttt
ggtttgcttc agaggcaaaa gcaattgtgg atgtttgtga ttatgtgaca
780gcattcatac caggtacctt tgtgaaagga tacagaggcc gcgaacaagc
attttctttt 840acgagatatt acgaaccagt gtactggcat gatcactgga
tgccggtttc tccagttgac 900tatcaacttt tacatgacac ctttgtgttg
tcttgtaagc gtcgtttaat gtccgacgtg 960cctattggag tatttatctc
tggtggtttg ggttcttctc ttgtggcctc cgtcgccaaa 1020cgcttactgg
atcccaacta tgattttcat tcttttgctt gtggtcttga aggagcacca
1080gatgttgctg cagcgcaaag agttgccgat ttcttaggaa caaagcacca
cgtattaaca 1140tttactgtgg aggagggtat ccaagcacta gaccaagtaa
tatatcactt ggaaacgtac 1200gatgttacca cagttagagc atcgacgccg
atgtatttgt tatcaggttt gtgcaaaaag 1260tatgtcaaag tagtgttatc
aggtgaagga gcagatgaaa tcttcggtgg atatctctat 1320ttccacaatg
caccaaatga gattgcattt catcaagaag ttgttcgccg agtgaaactt
1380ttatacacag ccgacgtatt gcgtggagat agagcaacgg cagcacaaag
tttagaactt 1440cgagttccgt ttcttgatag agactttctg gatgttgcaa
tgagtattca tccgcgtgaa 1500aaggttactt ctaagcatag aatcgagaaa
tatatcattc gctatgcctt ttccaaggag 1560ttttgtggtg aagagtatct
tcctgacgat attctttgga gacaaaaaga acagttttcg 1620gatggcgtgg
gctatagctg gatcgatggt ttaaaggcgt attgtgaaaa ggccgtttcc
1680gatgcagact tgcaaaatgc cgctcagcgt tttccgcacg atactccaac
aaccaaagag 1740gcatatgttt accgagctat attcgaaaaa cattttggga
attgcaaggc agtacaaggt 1800cttcgtgaat cagttgcaag atgggtacct
atgtggagtg acagcacgga tcctagcggt 1860cgtgcacaaa aagttcatgt
ggctgcatat tcaaatggag gagac 1905151851DNAGaldieria sulphuraria
15atggtatcta gtatctacca actgacacta tattgcttct ctttacatac gtatcttgct
60cgatgccttc tccctagtgt tgaccagtgt tactcacata gtctttgctc atttcattgt
120aatgcagata ccaagcggga gctcgacgtc cctcagcagt cgctgtgcga
taccatgtgt 180gggattcttg cggtgttggg ctcgtcgtta ccggtcgaag
agcttagaga gttggttaaa 240agctgcacca aaaaactata tcacagaggt
ccagatgaag aacaatattt cattagtgaa 300gatgggtggt gtggtttagg
ctttgccagg ttgaagattg ttgatcctga gcacggtgtc 360cagcctatgt
tcaacgacca acggacagtt tggagtgtca ctaatggcga gctttacaac
420catgaagaga tccgaaaaac ggaattgaac aatatgacac tccattctca
ttctgactgc 480gaaataatga tacctttgta tgagaaatat gtttctagtc
agcgttatga tcatgacatt 540caatatgttt ataatcttct ccgtggagtc
tttgcttctt gcctggttga tttgaaacgt 600ggttttttca tggctggaag
agatcctatc ggggtccgag ctctttttta tgggacaagt 660aaagatggtg
ctgtttggtt tgcttcagag gcaaaagcaa ttgtggatgt ttgtgattat
720gtgacagcat tcataccagg tacctttgtg aaaggataca gaggccgcga
acaagcattt 780tcttttacga gatattacga accagtgtac tggcatgatc
actggatgcc ggtttctcca 840gttgactatc aacttttaca tgacaccttt
gtgttgtctt gtaagcgtcg tttaatgtcc 900gacgtgccta ttggagtatt
tatctctggt ggtttgggtt cttctcttgt ggcctccgtc 960gccaaacgct
tactggatcc caactatgat tttcattctt ttgcttgtgg tcttgaagga
1020gcaccagatg ttgctgcagc gcaaagagtt gccgatttct taggaacaaa
gcaccacgta 1080ttaacattta ctgtggagga gggtatccaa gcactagacc
aagtaatata tcacttggaa 1140acgtacgatg ttaccacagt tagagcatcg
acgccgatgt atttgttatc aggtttgtgc 1200aaaaagtatg tcaaagtagt
gttatcaggt gaaggagcag atgaaatctt cggtggatat 1260ctctatttcc
acaatgcacc aaatgagatt gcatttcatc aagaagttgt tcgccgagtg
1320aaacttttat acacagccga cgtattgcgt ggagatagag caacggcagc
acaaagttta 1380gaacttcgag ttccgtttct tgatagagac tttctggatg
ttgcaatgag tattcatccg 1440cgtgaaaagg ttacttctaa gcatagaatc
gagaaatata tcattcgcta tgccttttcc 1500aaggagtttt gtggtgaaga
gtatcttcct gacgatattc tttggagaca aaaagaacag 1560ttttcggatg
gcgtgggcta tagctggatc gatggtttaa aggcgtattg tgaaaaggcc
1620gtttccgatg cagacttgca aaatgccgct cagcgttttc cgcacgatac
tccaacaacc 1680aaagaggcat atgtttaccg agctatattc gaaaaacatt
ttgggaattg caaggcagta 1740caaggtcttc gtgaatcagt tgcaagatgg
gtacctatgt ggagtgacag cacggatcct 1800agcggtcgtg cacaaaaagt
tcatgtggct gcatattcaa atggaggaga c 1851161851DNAGaldieria
sulphuraria 16atggtatcta gtatctacca actgacacta tattgcttct
ctttacatac gtatcttgct 60cgatgccttc tccctagtgt tgaccagtgt tactcacata
gtctttgctc atttcattgt 120aatgcagata ccaagcggga gctcgacgtc
cctcagcagt cgctgtgcga taccatgtgt 180gggattcttg cggtgttggg
ctcgtcgtta ccggtcgaag agcttagaga gttggttaaa 240agctgcacca
aaaaactata tcacagaggt ccagatgaag aacaatattt cattagtgaa
300gatgggtggt gtggtttagg ctttgccagg ttgaagattg ttgatcctga
gcacggtgtc 360cagcctatgt tcaacgacca acggacagtt tggagtgtca
ctaatggcga gctttacaac 420catgaagaga tccgaaaaac ggaattgaac
aatatgacac tccattctca ttctgactgc 480gaaataatga tacctttgta
tgagaaatat gtttctagtc agcgttatga tcatgacatt 540caatatgttt
ataatcttct ccgtggagtc tttgcttctt gcctggttga tttgaaacgt
600ggttttttca tggctggaag agatcctatc ggggtccgag ctctttttta
tgggacaagt 660aaagatggtg ctgtttggtt tgcttcagag gcaaaagcaa
ttgtggatgt ttgtgattat 720gtgacagcat tcataccagg tacctttgtg
aaaggataca gaggccgcga acaagcattt 780tcttttacga gatattacga
accagtgtac tggcatgatc actggatgcc ggtttctcca 840gttgactatc
aacttttaca tgacaccttt gtgttgtctt gtaagcgtcg tttaatgtcc
900gacgtgccta ttggagtatt tatctctggt ggtttgggtt cttctcttgt
ggcctccgtc 960gccaaacgct tactggatcc caactatgat tttcattctt
ttgcttgtgg tcttgaagga 1020gcaccagatg ttgctgcagc gcaaagagtt
gccgatttct taggaacaaa gcaccacgta 1080ttaacattta ctgtggagga
gggtatccaa gcactagacc aagtaatata tcacttggaa 1140acgtacgatg
ttaccacagt tagagcatcg acgccgatgt atttgttatc aggtttgtgc
1200aaaaagtatg tcaaagtagt gttatcaggt gaaggagcag atgaaatctt
cggtggatat 1260ctctatttcc acaatgcacc aaatgagatt gcatttcatc
aagaagttgt tcgccgagtg 1320aaacttttat acacagccga cgtattgcgt
ggagatagag caacggcagc acaaagttta 1380gaacttcgag ttccgtttct
tgatagagac tttctggatg ttgcaatgag tattcatccg 1440cgtgaaaagg
ttacttctaa gcatagaatc gagaaatata tcattcgcta tgccttttcc
1500aaggagtttt gtggtgaaga gtatcttcct gacgatattc tttggagaca
aaaagaacag 1560ttttcggatg gcgtgggcta tagctggatc gatggtttaa
aggcgtattg tgaaaaggcc 1620gtttccgatg cagacttgca aaatgccgct
cagcgttttc cgcacgatac tccaacaacc 1680aaagaggcat atgtttaccg
agctatattc gaaaaacatt ttgggaattg caaggcagta 1740caaggtcttc
gtgaatcagt tgcaagatgg gtacctatgt ggagtgacag cacggatcct
1800agcggtcgtg cacaaaaagt tcatgtggct gcatattcaa atggaggaga c
1851171803DNASaccharomyces cerevisiae 17atgatttgtg acaaatgcag
cctcgtgcgg agcttttttg taggtagacc gcggaccggt 60cgcgcctcag cagtcgctgt
cgttaccatg tgtggtatct ttgcagcctt caagcatgaa 120gatattcaca
acttcaaacc aaaagctcta caactatcta aaaaaatcag acaccgtggc
180ccagattggt caggaaatgc cgttatgaat tccaccattt tcgttcacga
gaggttggct 240attgttggtt tagactccgg tgcccagcca atcacttcag
ctgatggcga atatatgctt 300ggcgttaatg gtgagatcta caaccacatc
caactaaggg agatgtgctc tgattacaag 360tttcaaactt tcagtgactg
tgaacccatc ataccgttat atttggaaca tgatatcgat 420gctccaaaat
atctggacgg tatgttcgca ttttgtctgt atgattccaa gaaagaccgt
480attgtcgctg caagagaccc tatcggtgtt gtcactttat acatggggcg
ttcttctcag 540tctccagaga ccgtttattt tgcctccgaa ttaaaatgtc
taactgacgt ttgtgacagt 600atcatttcgt tccctcctgg tcatgtctac
gattctgaaa cggacaagat tactcgttac 660tttaccccag actggttgga
tgaaaagcgt atcccatcca ccccagttga ctaccatgct 720atcagacaca
gtttagaaaa ggccgttaga aagaggctaa tggctgaagt tccatacggt
780gttcttctat ccggtgggct ggactcttct ttgattgctg cgattgctgc
tcgtgaaacg 840gaaaaagcta atgctgatgc taacgaagac aacaatgttg
acgagaagca acttgcaggt 900atcgatgacc aaggccatct acacacatcc
ggttggtctc gtttgcattc gtttgcgatt 960ggtctaccaa atgcacctga
tttacaagcg gctagaaaag tcgccaaatt cattggttct 1020atccaccatg
aacacacttt tacattacaa gaaggtttgg atgctttgga cgacgtgatc
1080taccatttgg aaacttacga cgttaccact atcagagctt ctacaccaat
gttcttacta 1140tctagaaaga ttaaggccca aggtgtcaaa atggttcttt
ctggtgaagg ctcggacgaa 1200atattcggtg gctatctata tttcgcacaa
gcaccttctg ctgcagaatt tcacaccgaa 1260tctgtgcaac gtgtcaagaa
cttgcatttg gcagattgtt tgagagctaa taagtccacg 1320atggcttggg
gtctagaagc tcgtgttccc ttcttagaca aagacttttt gcagctatgt
1380atgaacattg atccaaatga aaagatgatc aagccaaagg aaggacgtat
cgaaaaatac 1440attttaagaa aggcattcga cactacagat gaaccagatg
ttaagccata cctacctgaa 1500gaaatcttat ggagacaaaa ggaacaattt
tccgatggtg ttggctactc atggattgac 1560ggcctaagag acactgctga
aagggccatt tctgacgcca tgtttgccaa tccaaaggct 1620gattggggcg
acgatattcc aaccaccaaa gaagcttact ggtacaggct gaagtttgat
1680gcttggtttc ctcaaaagac tgcggcagac actgtcatga gatggattcc
aaaggccgat 1740tggggttgtg ccgaagatcc ttcaggtaga tacgccaaaa
tacacgaaaa gcacgtcagt 1800gct 18031821DNAArtificial
Sequencesynthetic primer sequence 18gcagucgctg ucgtuaccat g
211920DNAArtificial Sequencesynthetic primer sequence 19gcgaguaccg
cugggtucta 202039DNAArtificial Sequencesynthetic primer sequence
20gctcctgcag gaccatgtgt tccatttttg gaatcttca 392137DNAArtificial
Sequencesynthetic primer sequence 21ctgggtctcg agctacagca
gtgcttgttg atgaacc 372253DNAArtificial Sequencesynthetic primer
sequence 22ccccttttat aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc
atg 532348DNAArtificial Sequencesynthetic primer sequence
23ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta
482436DNAArtificial Sequencesynthetic primer sequence 24gctcctgcag
gaccatgtgt ggaattacag gctggg 362547DNAArtificial Sequencesynthetic
primer sequence 25ctgggtctcg agctaaccaa ttaatttgat attgtaatgc
ttaagcc 472653DNAArtificial Sequencesynthetic primer sequence
26ccccttttat aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc atg
532748DNAArtificial Sequencesynthetic primer sequence 27ggggtcttat
aatgccaact ttgtacaaga aagctgggtc tcgagcta 482831DNAArtificial
Sequencesynthetic primer sequence 28gctcctgcag gaccatgtgc
ggcatcctcg c 312936DNAArtificial Sequencesynthetic primer sequence
29ctgggtctcg agctagacag ctgtggctga agcaac 363053DNAArtificial
Sequencesynthetic primer sequence 30ccccttttat aatgccaact
ttgtacaaaa aagcaggctc ctgcaggacc atg 533148DNAArtificial
Sequencesynthetic primer sequence 31ggggtcttat aatgccaact
ttgtacaaga aagctgggtc tcgagcta 483235DNAArtificial
Sequencesynthetic primer sequence 32gctcctgcag gaccatgtgc
ggcatacttg ctgtg 353332DNAArtificial Sequencesynthetic primer
sequence 33ctgggtctcg agctatccct cgatggcaac gc 323453DNAArtificial
Sequencesynthetic primer sequence 34ccccttttat aatgccaact
ttgtacaaaa aagcaggctc ctgcaggacc atg 533548DNAArtificial
Sequencesynthetic primer sequence 35ggggtcttat aatgccaact
ttgtacaaga aagctgggtc tcgagcta 483634DNAArtificial
Sequencesynthetic primer sequence 36gctcctgcag gaccatgtgt
ggcatcctcg ccgt 343734DNAArtificial Sequencesynthetic primer
sequence 37ctgggtctcg agctaaacgg cagtggctga agca
343853DNAArtificial Sequencesynthetic primer sequence 38ccccttttat
aatgccaact ttgtacaaaa aagcaggctc ctgcaggacc atg 533948DNAArtificial
Sequencesynthetic primer sequence 39ggggtcttat aatgccaact
ttgtacaaga aagctgggtc tcgagcta 484040DNAArtificial
Sequencesynthetic primer sequence 40gctcctgcag gaccatgtgt
ggtattcttg ctgttcttgg 404133DNAArtificial Sequencesynthetic primer
sequence 41ctgggtctcg agctagccct ggatggcaac acc 334233DNAArtificial
Sequencesynthetic primer sequence 42ctgggtctcg agctagccct
ggatggcaac acc 334348DNAArtificial Sequencesynthetic primer
sequence 43ggggtcttat aatgccaact ttgtacaaga aagctgggtc tcgagcta
484426DNAArtificial Sequencesynthetic primer sequence 44cctctagatg
tgcggcatac ttgctg 264525DNAArtificial Sequencesynthetic primer
sequence 45cgaattctat ccctcgatgg caacg 254627DNAArtificial
Sequencesynthetic primer sequence 46tcctagacat gtccggcata cttgctg
274723DNAArtificial Sequencesynthetic primer sequence 47tgcagaattc
tatccctcga tgg 234837DNAArtificial Sequencesynthetic primer
sequence 48gcagtcgctg tcgttacccg gcatcatgtg tggcatc
374941DNAArtificial Sequencesynthetic primer sequence 49gcgagtaccg
ctgggttcta acgtactctc gtcagaccgc g 41501767DNAZea mays 50atgtgtggca
tcttagccgt gctcggatgc tccgactgct cccaggccag gagggctcgc 60atcctcgcct
gctccagaag gctgaagcac aggggccccg actggtcggg cctctaccag
120cacgagggca acttcctggc gcagcagcgg ctcgccatcg tctccccgct
gtccggcgac 180cagccgctgt tcaacgagga ccgcaccgtc gtggtggtgg
ccaatggaga gatctacaac 240cacaagaacg tccggaagca gttcaccggc
gcgcacagct tcagcaccgg aagtgactgc 300gaggtcatca tccccctgta
cgagaagtac ggcgagaact tcgtggacat gctggacgga 360gtcttcgcgt
tcgtgctcta cgacacgcga gacaggacct acgtggcggc acgcgacgcc
420atcggcgtca acccgctcta catcggctgg ggcagcgacg gttccgtctg
gatgtcatcc 480gagatgaagg cgctgaacga ggactgcgtg cgcttcgaga
tcttcccgcc gggccacctc 540tactccagcg ccggcggcgg gttccgccgg
tggtacaccc cgcactggtt ccaggagcag 600gtgccccgga cgccgtacca
gtcgctcgtc cttagagagg ccttcgagaa ggcggttatc 660aagaggctca
tgaccgacgt cccgttcggg gtcctcctct ccggcggcct cgactcctcc
720ctcgtcgcct ccgtcaccaa gcgccacctc gtcgagaccg acgccgccga
aaagttcggc 780acagagctcc actccttcgt cgtcggcctc gagggctccc
ctgacctgaa ggccgcacga 840gaggtcgctg actacctcgg aaccacccat
cacgagttcc atttcaccgt acaggacggc 900atcgacgcga tcgaggaggt
gatctaccac gacgagacgt acgacgtgac gacgatccgg 960gccagcacgc
ccatgttcct gatggctcgc aagatcaagt cgctgggcgt gaagatggtg
1020ctgtccgggg agggctccga cgagctcctg ggcggctacc tctacttcca
cttcgccccc 1080aacagggagg agctccacag ggagacctgc cgcaaggtga
aggccctgca ccagtacgac 1140tgcctgcgcg ccaacaaggc gacgtcggcg
tggggcctgg aggtccgcgt gccgttcctc 1200gacaaggagt tcgtcgacgt
cgcgatgggc atggaccccg aatggaaaat gtacgacaag 1260aacctgggtc
gcatcgagaa gtgggtcctg aggaaggcgt tcgacgacga ggagcaccct
1320tacctgcccg agcatattct gtacaggcag aaagaacagt tcagtgacgg
agtgggctac 1380aactggatcg atggactcaa atccttcacc gaacagcagg
tgacggatga gatgatgaac 1440agcgccgccc agatgttccc gtacaacacg
cccgtcaaca aggaggccta ctactaccgg 1500atgatattcg agaggctctt
ccctcaggac tcggcgaggg agacggtgcc gtggggcccg 1560agcatcgcct
gcagcacgcc cgcggccatc gagtgggtgg agcagtggaa ggcctccaac
1620gacccctccg gccgcttcat ctcctcccac gactccgccg ccaccgaccg
caccggcgac 1680aagctggcgg tggccaacgg cggcgggcac ggcgcggcga
acggcacggt caacggcaac 1740gacgtcgctg tcgcgatcgc ggtgtaa
176751588PRTZea mays 51Met Cys Gly Ile Leu Ala Val Leu Gly Cys Ser
Asp Cys Ser Gln Ala1 5 10 15Arg Arg Ala Arg Ile Leu Ala Cys Ser Arg
Arg Leu Lys His Arg Gly20 25 30Pro Asp Trp Ser Gly Leu Tyr Gln His
Glu Gly Asn Phe Leu Ala Gln35 40 45Gln Arg Leu Ala Ile Val Ser Pro
Leu Ser Gly Asp Gln Pro Leu Phe50 55 60Asn Glu Asp Arg Thr Val Val
Val Val Ala Asn Gly Glu Ile Tyr Asn65 70 75 80His Lys Asn Val Arg
Lys Gln Phe Thr Gly Ala His Ser Phe Ser Thr85 90 95Gly Ser Asp Cys
Glu Val Ile Ile Pro Leu Tyr Glu Lys Tyr Gly Glu100 105 110Asn Phe
Val Asp Met Leu Asp Gly Val Phe Ala Phe Val Leu Tyr Asp115 120
125Thr Arg Asp Arg Thr Tyr Val Ala Ala Arg Asp Ala Ile Gly Val
Asn130 135 140Pro Leu Tyr Ile Gly Trp Gly Ser Asp Gly Ser Val Trp
Met Ser Ser145 150 155 160Glu Met Lys Ala Leu Asn Glu Asp Cys Val
Arg Phe Glu Ile Phe Pro165 170 175Pro Gly His Leu Tyr Ser Ser Ala
Gly Gly Gly Phe Arg Arg Trp Tyr180 185 190Thr Pro His Trp Phe Gln
Glu Gln Val Pro Arg Thr Pro Tyr Gln Ser195 200 205Leu Val Leu Arg
Glu Ala Phe Glu Lys Ala Val Ile Lys Arg Leu Met210 215 220Thr Asp
Val Pro Phe Gly Val Leu Leu Ser Gly Gly Leu Asp Ser Ser225 230 235
240Leu Val Ala Ser Val Thr Lys Arg His Leu Val Glu Thr Asp Ala
Ala245
250 255Glu Lys Phe Gly Thr Glu Leu His Ser Phe Val Val Gly Leu Glu
Gly260 265 270Ser Pro Asp Leu Lys Ala Ala Arg Glu Val Ala Asp Tyr
Leu Gly Thr275 280 285Thr His His Glu Phe His Phe Thr Val Gln Asp
Gly Ile Asp Ala Ile290 295 300Glu Glu Val Ile Tyr His Asp Glu Thr
Tyr Asp Val Thr Thr Ile Arg305 310 315 320Ala Ser Thr Pro Met Phe
Leu Met Ala Arg Lys Ile Lys Ser Leu Gly325 330 335Val Lys Met Val
Leu Ser Gly Glu Gly Ser Asp Glu Leu Leu Gly Gly340 345 350Tyr Leu
Tyr Phe His Phe Ala Pro Asn Arg Glu Glu Leu His Arg Glu355 360
365Thr Cys Arg Lys Val Lys Ala Leu His Gln Tyr Asp Cys Leu Arg
Ala370 375 380Asn Lys Ala Thr Ser Ala Trp Gly Leu Glu Val Arg Val
Pro Phe Leu385 390 395 400Asp Lys Glu Phe Val Asp Val Ala Met Gly
Met Asp Pro Glu Trp Lys405 410 415Met Tyr Asp Lys Asn Leu Gly Arg
Ile Glu Lys Trp Val Leu Arg Lys420 425 430Ala Phe Asp Asp Glu Glu
His Pro Tyr Leu Pro Glu His Ile Leu Tyr435 440 445Arg Gln Lys Glu
Gln Phe Ser Asp Gly Val Gly Tyr Asn Trp Ile Asp450 455 460Gly Leu
Lys Ser Phe Thr Glu Gln Gln Val Thr Asp Glu Met Met Asn465 470 475
480Ser Ala Ala Gln Met Phe Pro Tyr Asn Thr Pro Val Asn Lys Glu
Ala485 490 495Tyr Tyr Tyr Arg Met Ile Phe Glu Arg Leu Phe Pro Gln
Asp Ser Ala500 505 510Arg Glu Thr Val Pro Trp Gly Pro Ser Ile Ala
Cys Ser Thr Pro Ala515 520 525Ala Ile Glu Trp Val Glu Gln Trp Lys
Ala Ser Asn Asp Pro Ser Gly530 535 540Arg Phe Ile Ser Ser His Asp
Ser Ala Ala Thr Asp Arg Thr Gly Asp545 550 555 560Lys Leu Ala Val
Ala Asn Gly Gly Gly His Gly Ala Ala Asn Gly Thr565 570 575Val Asn
Gly Asn Asp Val Ala Val Ala Ile Ala Val580 5855227DNAArtificial
Sequencesynthetic primer sequence 52ggaattccat atgtgtggca tcttagc
275338DNAArtificial Sequencesynthetic primer sequence 53ataagaatgc
ggccgcgacc gcgatcgcga ctgcgaca 385427DNAArtificial
Sequencesynthetic primer sequence 54ctagctagct agatgtgcgg catcctc
275531DNAArtificial Sequencesynthetic primer sequence 55ccgctcgagg
acagctgtgg ctgaagcaac g 315628DNAArtificial Sequencesynthetic
primer sequence 56gggaattcca tatgtgtggc atcttagc
285736DNAArtificial Sequencesynthetic primer sequence 57ataagaatgc
ggccgccacc gcgatcgcga cagcga 365829DNAArtificial Sequencesynthetic
primer sequence 58tatgtgcggc atacttgctg tgctcgggt
295926DNAArtificial Sequencesynthetic primer sequence 59gctatccctc
gatggcaacg ccagat 26
* * * * *