U.S. patent application number 12/262093 was filed with the patent office on 2009-03-26 for bicyclic heteroaryl derivatives.
This patent application is currently assigned to Genelabs Technologies, Inc.. Invention is credited to Janos Botyanszki, Mikail Hakan Gezginci, Joshua Michael Gralapp, Ronald Conrad Griffith, Sebastian Johannes Reinhard Liehr, Christopher Don Roberts, Franz Ulrich Schmitz, Dong-Fang Shi.
Application Number | 20090081165 12/262093 |
Document ID | / |
Family ID | 34115596 |
Filed Date | 2009-03-26 |
United States Patent
Application |
20090081165 |
Kind Code |
A1 |
Schmitz; Franz Ulrich ; et
al. |
March 26, 2009 |
BICYCLIC HETEROARYL DERIVATIVES
Abstract
Disclosed are compounds, compositions and methods for treating
Flaviviridae family virus infections.
Inventors: |
Schmitz; Franz Ulrich; (Mill
Valley, CA) ; Roberts; Christopher Don; (Belmont,
CA) ; Griffith; Ronald Conrad; (Escondido, CA)
; Botyanszki; Janos; (Fremont, CA) ; Gezginci;
Mikail Hakan; (Foster City, CA) ; Gralapp; Joshua
Michael; (Sunnyvale, CA) ; Shi; Dong-Fang;
(Fremont, CA) ; Liehr; Sebastian Johannes Reinhard;
(Palo Alto, CA) |
Correspondence
Address: |
Genelabs Technologies, Inc.;c/o Foley & Lardner LLP
975 Page Mill Road
Palo Alto
CA
94304-1013
US
|
Assignee: |
Genelabs Technologies, Inc.
|
Family ID: |
34115596 |
Appl. No.: |
12/262093 |
Filed: |
October 30, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10909758 |
Jul 30, 2004 |
|
|
|
12262093 |
|
|
|
|
60492108 |
Aug 1, 2003 |
|
|
|
Current U.S.
Class: |
424/85.7 ;
514/314; 514/43 |
Current CPC
Class: |
C07D 487/04 20130101;
C07D 471/04 20130101; C07D 401/04 20130101; A61P 31/12 20180101;
C07D 403/14 20130101; C07D 417/04 20130101; C07D 409/14 20130101;
C07D 405/04 20130101; C07D 401/14 20130101; C07D 403/04 20130101;
C07D 417/14 20130101; C07D 405/14 20130101; C07D 413/14 20130101;
A61P 31/14 20180101 |
Class at
Publication: |
424/85.7 ;
514/314; 514/43 |
International
Class: |
A61K 38/21 20060101
A61K038/21; A61K 31/4709 20060101 A61K031/4709; A61P 31/12 20060101
A61P031/12; A61K 31/70 20060101 A61K031/70 |
Claims
1-107. (canceled)
108. A method for treating a viral infection in a mammal mediated
at least in part by a virus in the flaviviridae family of viruses
which method comprises administering to a mammal, that has been
diagnosed with said viral infection or is at risk of developing
said viral infection, a pharmaceutical composition comprising a
compound according to formula II ##STR00428## wherein: W is CH; Z'
is selected from the group consisting of carboxy and carboxy ester,
R.sup.17 is selected from the group consisting of cycloalkyl and
cycloalkyl substituted with 1 to 3 alkyl groups; X and X' are
independently selected from the group consisting of alkyl,
substituted alkyl, alkoxy, substituted alkoxy, halo, hydroxy, and
nitro; Ar.sup.1 is selected from the group consisting of aryl, and
substituted aryl; and Ar.sup.2 is selected from the group
consisting of aryl, substituted aryl, cycloalkyl, substituted
cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic and
substituted heterocyclic; t is an integer equal to 0, 1 or 2; and
t' is an integer equal to 0 or 1; and pharmaceutically acceptable
salts thereof.
109. The method according to claim 108, wherein R.sup.17 is
cycloalkyl.
110. The method according to claim 109, wherein R.sup.17 is
cyclohexyl.
111. The method according to claim 108, wherein
--Ar.sup.1--Ar.sup.2 are selected from the group consisting of
aryl-aryl, -aryl-substituted aryl, -substituted aryl-aryl, and
-substituted aryl-substituted aryl.
112. The method according to claim 111, wherein
--Ar.sup.1--Ar.sup.2 are selected from the group consisting of
biphen-2-yl, biphen-4-yl, 4-amino-4'-chlorobiphen-2-yl,
4'-aminomethyl-4-methoxybiphen-2-yl,
4-carbamoyl-4'-methoxybiphen-2-yl,
4-carbamoyl-4'-fluorobiphen-2-yl,
4-carbamoyl-4'-methoxybiphen-2-yl, 4-carbamoyl-4'-nitrobiphen-2-yl,
4-(carbamoylmethyl-carbamoyl)biphen-2-yl,
4-(carbamoylmethylcarbamoyl)-4'-chlorobiphen-2-yl,
4-carboxy-4'-chlorobiphen-2-yl, 3-carboxy-4'-methoxybiphen-2-yl,
4-carboxy-4'-methoxybiphen-2-yl,
4'-carboxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4-carboxymethoxybiphen-2-yl, 4-carboxymethoxy-4'-chlorobiphen-2-yl,
4'-chlorobiphen-2-yl, 4'-chloro-4-chlorobiphen-2-yl,
4'-chloro-4-(dimethylaminoethylcarbamoylbiphen-2-yl,
4'-chloro-4-(2-ethoxyethoxy)biphen-2-yl,
3'-chloro-4'-fluoro-4-methoxybiphen-2-yl,
4'-chloro-4-fluorobiphen-2-yl, 4'-chloro-4-hydroxybiphen-2-yl,
3'-chloro-4-methoxybiphen-2-yl,
4'-chloro-4-methylcarbamoylbiphen-2-yl,
4'-chloro-4-methoxybiphen-2-yl,
4'-chloro-4-(2-methoxyethoxy)biphen-2-yl,
4'-chloro-4-nitrobiphen-2-yl,
4'-chloro-4-(2-oxo-2-pyrrolidin-1-ylethoxy)biphen-2-yl,
4'-chloro-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4'-chloro-4-(3-pyrrolidin-1-ylpropoxy)biphen-2-yl,
4'-cyano-4-methoxybiphen-2-yl, 3',4_dichloro-4-methoxybiphen-2-yl,
4,4'-dimethoxybiphen-2-yl,
3',4'-dimethoxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4'-dimethylamino-4-methoxybiphen-2-yl,
4-(2-dimethylaminoethylcarbamoyl)biphen-2-yl,
4'-ethoxy-4-methoxybiphen-2-yl, 4'-fluoro-4-methoxybiphen-2-yl,
4-hydroxybiphenyl, 4-methoxybiphenyl,
4-methoxy-4'-hydroxybiphen-2-yl, 4-(2-methoxyethoxy)biphen-2-yl,
4-methoxy-4'-methylbiphen-2-yl, 4-methoxy-3'-nitrobiphen-2-yl,
4-methoxy-4'-nitrobiphen-2-yl, 4-methylcarbamoylbiphen-2-yl,
3'-methyl-4-methoxybiphen-2-yl,
4'-nitro-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4-(2-oxo-2-pyrrolidin-1-ylethoxy)biphen-2-yl,
4-(3-pyrrolidin-1-ylpropoxy)biphen-2-yl, and
4'-trifluoromethyl-4-methoxybiphen-2-yl.
113. The method according to claim 108, wherein
--Ar.sup.1--Ar.sup.2 are selected from the group consisting of
-aryl-heteroaryl, -aryl-substituted heteroaryl, -substituted
aryl-heteroaryl, and -substituted aryl-substituted heteroaryl.
114. The method according to claim 113, wherein
--Ar.sup.1--Ar.sup.2 are selected from the group consisting of
2-furan-2-yl-5-methoxyphenyl, 4-(imidazol-1-yl)phenyl,
5-methoxy-2-thiophen-2-ylphenyl,
2-(2,4-dimethoxypyrimidin-5-yl)-4-methoxyphenyl, and
2-(pyrid-4-yl)phenyl.
115. The method according to claim 108, wherein
--Ar.sup.1--Ar.sup.2 are selected from the group consisting of
-aryl-cycloalkyl, -aryl-substituted cycloalkyl, -substituted
aryl-cycloalkyl, -substituted aryl-substituted cycloalkyl,
-aryl-heterocyclic, aryl-substituted heterocyclic, substituted
aryl-heterocyclic, and substituted aryl-substituted
heterocyclic.
116. The method according to claim 115, wherein
--Ar.sup.1--Ar.sup.2 are selected from the group consisting of
(4-piperazin-1-yl)phenyl, 2-cyclohexyl-5-methoxyphenyl, and
4-morpholinophenyl.
117. The method according to claim 108, wherein the compound
selected from the group consisting of
2-{2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl}-1--
cyclohexyl-1H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid;
1-cyclohexyl-2-{2-[4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl]-quinol-
in-6-yl}-1H-benzoimidazole-5-carboxylic acid;
2-{2-[4-(carbamoylmethyl-carbamoyl)-4'-chloro-biphen-2-yl]-quinolin-6-yl}-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-methylcarbamoyl-biphen-2-yl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid;
2-[2-(4'-cyano-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid;
2-[2-(3'-chloro-4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-methoxy-3'-methyl-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(2-pyridin-4-yl-phenyl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid;
2-[2-(4-carboxymethoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoi-
midazole-5-carboxylic acid;
2-{2-[4'-chloro-4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl]-quinolin--
6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid;
2-{2-[4-(carbamoylmethyl-carbamoyl)-biphen-2-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methylcarbamoyl-biphen-2-yl)-quinolin-6-yl]-1-cyclohexy-
l-1H-benzoimidazole-5-carboxylic acid;
2-(2-biphen-2-yl-8-methyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-
-carboxylic acid;
2-[2-(4'-carbamoyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H--
benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-methoxy-4'-nitro-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid;
2-[2-(4'-aminomethyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1-
H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazol-
e-5-carboxylic acid;
2-(2-biphen-2-yl-7-fluoro-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-
-carboxylic acid;
2-(2-biphenyl-4-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbox-
ylic acid;
2-(2-biphen-2-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole--
5-carboxylic acid;
1-cyclohexyl-2-[2-(4'-dimethylamino-4-methoxy-biphen-2-yl)-quinolin-6-yl]-
-H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(3',4'-dichloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-H-
-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid;
2-[2-(4-carboxy-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-biphen-2-yl)-8-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid;
1-cyclohexyl-2-{2-[3',4'-dimethoxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]-
quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-methoxy-3'-nitro-biphen-2-yl)-quinolin-6-yl]1H-benzo-
imidazole-5-carboxylic acid;
2-[2-(4'-carboxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-be-
nzoimidazole-5-carboxylic acid;
2-[2-(3'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-morpholin-4-yl-phenyl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid;
1-cyclohexyl-2-{2-[4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl]-quinolin-6--
yl}-1H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-{2-[4'-nitro-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinoli-
n-6-yl}-1H-benzimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-methoxy-4'-trifluoromethyl-biphen-2-yl)-quinolin-6-y-
l]-H-benzoimidazole-5-carboxylic acid;
2-[2-(3'-carboxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-be-
nzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-methoxy-4'-methyl-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-nitro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid;
2-[2-(4'-chloro-biphen-2-yl)-3-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid;
2-{2-[4'-chloro-4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl]-quinolin-6-yl}-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid;
2-{2-[4'-carboxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinolin-6-yl}-1-c-
yclohexyl-1H-benzimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(2-furan-2-yl-5-methoxy-phenyl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4'-ethoxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid;
1-cyclohexyl-2-{2-[4-(2-methoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1H-be-
nzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4,4'-dimethoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4'-hydroxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-be-
nzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(5-methoxy-2-thiophen-2-yl-phenyl)-quinolin-6-yl]-1H-be-
nzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-imidazol-1-yl-phenyl)-quinolin-6-yl]-1H-benzoimidazo-
le-5-carboxylic acid;
2-{2-[4'-chloro-4-(2-methoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1-cycloh-
exyl-1H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-biphenyl-3-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidaz-
ole-5-carboxylic acid;
1-cyclohexyl-2-{2-[2-(2,4-dimethoxy-pyrimidin-5-yl)-5-methoxy-phenyl]-qui-
nolin-6-yl}-1H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-biphen-2-yl)-4-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-hydroxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-piperazin-1-yl-phenyl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid;
2-{2-[4'-chloro-4-(2-dimethylamino-ethylcarbamoyl)-biphen-2-yl]-quinolin--
6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid;
2-[2-(4'-chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid;
1-cyclohexyl-2-{2-[4-(2-dimethylamino-ethylcarbamoyl)-biphen-2-yl]-quinol-
in-6-yl}-1H-benzoimidazole-5-carboxylic acid;
2-{2-[4'-chloro-4-(2-ethoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(4-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(2'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(2-cyclohexyl-5-methoxy-phenyl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(4-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid;
2-(2-biphenyl-4-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbox-
ylic acid;
1-cyclohexyl-2-{2-[4'-fluoro-4-(pyrrolidine-1-carbonyl)biphen-2-
-yl]quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4,2'-dimethoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid; Ethyl
1-cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(3,3,5-trimethyl--
cyclohexyl)-1H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(2-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4'-ethyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(3',4'-difluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-H-
-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-{2-[4'-methoxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quino-
lin-6-yl}-1H-benzimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(3',5'-dichloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-fluoro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid;
2-{2-[8-(4-chloro-phenyl)-3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-yl]-quin-
olin-6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-[2-(4,4'-dichloro-biphen-2-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid;
1-bicyclo[2.2.1]hept-2-yl-2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-
-6-yl]1H-benzoimidazole-5-carboxylic acid;
2-[2-(4-amino-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopropyl-1H-be-
nzoimidazole-5-carboxylic acid;
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopentyl-1H-be-
nzoimidazole-5-carboxylic acid;
1-cyclohexyl-2-(2-(4-methoxy-2'-methylbiphenyl-2-yl)quinolin-6-yl)-1H-ben-
zoimidazole-5-carboxylic acid; and
2-[2-(4-carbamoyl-5-hydroxy-4'-nitro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid; and
pharmaceutically acceptable tautomers or salts thereof.
118. The method according to claim 108, wherein said virus is
hepatitis C virus.
119. The method according to claim 118 in combination with the
administration of a therapeutically effective amount of one or more
agents active against hepatitis C virus.
120. The method according to claim 119 wherein said active agent
against is ribavirin, levovirin, thymosin alpha-1, an inhibitor of
NS3 serine protease, and inhibitor of inosine monophosphate
dehydrogenase, interferon-alpha, pegylated interferon-alpha, alone
or in combination with ribavirin or levovirin.
121. The method according to claim 120 wherein said agent active
against HCV is interferon-alpha or pegylated interferon-alpha alone
or in combination with ribavirin or levovirin.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. .sctn.
119(e) of U.S. Provisional Application Ser. No. 60/492,108 which
application is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The invention relates to the field of pharmaceutical
chemistry, in particular to compounds, compositions and methods for
treating viral infections in mammals mediated, at least in part, by
a virus in the Flaviviridae family of viruses.
REFERENCES
[0004] The following publications are cited in this application as
superscript numbers: [0005] 1. Giangaspero, et al., Arch. Virol.
Suppl., 7: 53-62 (1993); [0006] 2. Giangaspero, et al., Int. J.
STD. AIDS, 4(5): 300-302 (1993); [0007] 3. Yolken, et al., Lancet,
1(8637): 517-20 (1989); [0008] 4. Wilks, et al., Lancet, 1(8629):
107 (1989); [0009] 5. Giangaspero, et al., Lancet, 2: 110 (1988);
[0010] 6. Potts, et al., Lancet, 1(8539): 972-973 (1987); [0011] 7.
Cornberg, et al., "Hepatitis C: therapeutic perspectives." Forum
(Genova), 11(2):154-62 (2001); [0012] 8. Dymock, et al., Antivir.
Chem. Chemother. 11(2):79-96 (2000); [0013] 9. Devos, et al.,
International Patent Application Publication No. WO 02/18404 A2,
published 7 Mar. 2002; [0014] 10. Sommadossi, et al., International
Patent Application Publication No. WO 01/90121, published 23 May,
2001; [0015] 11. Carroll, S. S., et al., International Patent
Application Publication No. WO 02057287, published 25 Jul. 2002;
[0016] 12. Carroll, S. S., et al., International Patent Application
Publication No. WO 02057425, published 25 Jul. 2002; [0017] 13.
Herr, J. R., Bioorg. Med. Chem., 10: 3379-3393 (2002); [0018] 14.
Andersen, K. E. et al., Eur. J. Med. Chem., 31: 417-425 (1996);
[0019] 15. Thornber, C. W. Chem. Soc. Rev. 8: 563-580 (1979);
[0020] 16. Lipinski, C. A. Annual Reports in Med. Chem. 21: 283-297
(1986); [0021] 17. Wissner, A. et al., J. Med. Chem. 23: 715-717
(1980); [0022] 18. Patani, G. A. et al., Chem. Rev. 96: 3147-3176
(1996).
[0023] All of the above publications applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication was specifically and individually
indicated to be incorporated by reference in its entirety.
[0024] 2. State of the Art
[0025] The Flaviviridae family of viruses is composed of three
genera: pestivirus, flavivirus and hepacivirus (hepatitis C virus).
Of these genera, flaviviruses and hepaciviruses represent important
pathogens of man and are prevalent throughout the world. There are
38 flaviviruses associated with human disease, including the dengue
fever viruses, yellow fever virus and Japanese encephalitis virus.
Flaviviruses cause a range of acute febrile illnesses and
encephalitic and hemorrhagic diseases. Hepaciviruses currently
infect approximately 2 to 3% of the world population and cause
persistent infections leading to chronic liver disease, cirrhosis,
hepatocellular carcinoma and liver failure. Human pestiviruses have
not been as extensively characterized as the animal pestiviruses.
However, serological surveys indicate considerable pestivirus
exposure in humans. Pestivirus infections in man have been
implicated in several diseases including, but not likely limited
to, congenital brain injury, infantile gastroenteritis and chronic
diarrhea in human immunodeficiency virus (HIV) positive
patients..sup.1-6
[0026] Currently, there are no antiviral pharmaceutical drugs to
prevent or treat pestivirus or flavivirus infections. For
hepacivirus, i.e., hepatitis C virus (HCV) infections, interferon
alpha (IFN) is currently the only approved drug in the United
States. HCV is a major causative agent for post-transfusion and for
sporadic non-A, non-B hepatitis. Infection by HCV is insidious in a
high proportion of chronically infected (and infectious) carriers
who may not experience clinical symptoms for many years.
[0027] At present, the only acceptable treatment for chronic HCV is
interferon (IFN-alpha) and this requires at least six (6) months of
treatment and/or ribavirin, which can inhibit viral replication in
infected cells and also improve liver function in some people.
[0028] IFN-alpha belongs to a family of naturally occurring small
proteins with characteristic biological effects such as antiviral,
immunoregulatory and antitumoral activities that are produced and
secreted by most animal nucleated cells in response to several
diseases, in particular viral infections. IFN-alpha is an important
regulator of growth and differentiation affecting cellular
communication and immunological control. Treatment of HCV with
interferon, however, has limited long term efficacy with a response
rate about 25%. In addition, treatment of HCV with interferon has
frequently been associated with adverse side effects such as
fatigue, fever, chills, headache, myalgias, arthralgias, mild
alopecia, psychiatric effects and associated disorders, autoimmune
phenomena and associated disorders and thyroid dysfunction.
[0029] Ribavirin
(1-.beta.3-D-ribofuranosyl-1H-1,2,4-triazole-3-carboxamide), an
inhibitor of inosine 5'-monophosphate dehydrogenase (IMPDH),
enhances the efficacy of IFN-alpha in the treatment of HCV. Despite
the introduction of ribavirin, more than 50% of the patients do not
eliminate the virus with the current standard therapy of
interferon-alpha (IFN) and ribavirin. By now, standard therapy of
chronic hepatitis C has been changed to the combination of PEG-IFN
plus ribavirin. However, a number of patients still have
significant side effects, primarily related to ribaviran. Ribavirin
causes significant hemolysis in 10-20% of patients treated at
currently recommended doses, and the drug is both teratogenic and
embryotoxic.
[0030] Other approaches are being taken to combat the virus. They
include, for example, application of antisense oligonucleotides or
ribozymes for inhibiting HCV replication. Furthermore,
low-molecular weight compounds that directly inhibit HCV proteins
and interfere with viral replication are considered as attractive
strategies to control HCV infection. NS3/4A serine protease,
ribonucleic acid (RNA) helicase, RNA-dependent RNA polymerase are
considered as potential targets for new drugs..sup.7,8
[0031] Devos, et al..sup.9 describes purine and pyrimidine
nucleoside derivatives and their use as inhibitors of HCV RNA
replication. Sommadossi, et al..sup.10 describes 1',2' or
3'-modified nucleosides and their use for treating a host infected
with HCV. Carroll, et al..sup.11,12, describes nucleosides as
inhibitors of RNA-dependent RNA viral polymerase. Given the fact of
the worldwide epidemic level of HCV and other members of the
Flaviviridae family of viruses, there is a strong need for new
effective drugs for treatment of Flaviviridae family viruses. The
present invention provides compounds for treating such
infections.
SUMMARY OF THE INVENTION
[0032] This invention is directed to novel compounds that are
useful in the treatment of viral infections in mammals mediated at
least in part by a member of the Flaviviridae family viruses such
as HCV. Specifically, the compounds of this invention are
represented by formula I:
##STR00001##
wherein:
[0033] W is CH or N;
[0034] R is selected from the group consisting of hydrogen,
(C.sub.1-C.sub.10)alkyl, substituted (C.sub.1-C.sub.10)alkyl,
(C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, and --NR.sup.12R.sup.13, where each of R.sup.12 and
R.sup.13 is independently selected from the group consisting of
(C.sub.1-C.sub.10)alkyl, substituted (C.sub.1-C.sub.10)alkyl,
(C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl; or R.sup.12 and R.sup.13 may optionally be joined
together with the nitrogen atom bound thereto to form a
heterocyclic, substituted heterocyclic, heteroaryl or substituted
heteroaryl;
[0035] Z is selected from the group consisting of
[0036] a) --C(.dbd.O)OR.sup.7, wherein R.sup.7 is selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic
and substituted heterocyclic;
[0037] b) --C(.dbd.O)NR.sup.8R.sup.9, wherein R.sup.8 and R.sup.9
are independently selected from the group consisting of hydrogen,
alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, aryl, substituted aryl, heteroaryl,
substituted heteroaryl, heterocyclic and substituted heterocycle
or, alternatively, R.sup.8 and R.sup.9 together with the nitrogen
atom pendent thereto, form a heterocyclic, a substituted
heterocyclic, a heteroaryl or a substituted heteroaryl ring
group;
[0038] c) tetrazolyl or --C(O)NHS(O).sub.2R.sup.4, wherein R.sup.4
is selected from the group consisting of alkyl, substituted alkyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl,
heterocyclic and substituted heterocyclic;
[0039] d) --C(X)--N(R.sup.3)CR.sup.2R.sup.2'C(.dbd.O)R.sup.1,
wherein X is selected from the group consisting of .dbd.O, .dbd.S,
and .dbd.NR.sup.11, where R.sup.11 is hydrogen or alkyl, R.sup.1 is
selected from the group consisting of --OR.sup.7 and
--NR.sup.8R.sup.9;
[0040] wherein R.sup.7, R.sup.8 and R.sup.9 are as defined
above;
[0041] each R.sup.2 and R.sup.2' is independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclic, and substituted heterocyclic,
or, alternatively, R.sup.2 and R.sup.2' as defined are taken
together with the carbon atom pendent thereto to form a cycloalkyl,
substituted cycloalkyl, heterocyclic or substituted heterocyclic
group,
[0042] or, still further alternatively, one or R.sup.2 or R.sup.2'
is hydrogen, alkyl or substituted alkyl, and the other is joined,
together with the carbon atom pendent thereto, with either the
R.sup.7 and the oxygen atom pendent thereto or R.sup.8 and the
nitrogen atom pendent thereto to form a heterocyclic or substituted
heterocyclic group;
[0043] R.sup.3 is selected from the group consisting of hydrogen
and alkyl or, when R.sup.2 and R.sup.2' are not taken together to
form a ring and when R.sup.2/R.sup.2' and R.sup.7 or R.sup.8 are
not joined to form a heterocyclic or substituted heterocyclic
group, then R.sup.3, together with the nitrogen atom pendent
thereto, may be taken together with one of R.sup.2 or R.sup.2' to
form a heterocyclic or substituted heterocyclic ring group;
[0044] HET is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, cycloalkyl,
cycloalkenyl, heterocyclic, or heteroaryl rings that are optionally
substituted with (Y).sub.q; with the proviso that at least one
6-membered ring in the bicycle is heterocyclic or heteroaryl or the
bicycle is naphthyl;
[0045] each Y is independently selected from the group consisting
of halo, cyano, nitro, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, acyl, acyloxy, guanidino, substituted
guanidino, oxycarbonylamino, aminocarbonyloxy, aminocarbonylamino,
oxycarbonyloxy, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, --CO.sub.2R.sup.7, --NR.sup.14R.sup.15,
--NHNR.sup.14R.sup.15, --C(X)NR.sup.14R.sup.15, --OR.sup.14,
SR.sup.14, --S(O)R.sup.14, --S(O).sub.2R.sup.14, and
--S(O).sub.2NR.sup.14R.sup.15; where X is as defined above;
[0046] where R.sup.7 is as defined above and each of R.sup.14 and
R.sup.15 is independently selected from the group consisting of
hydrogen, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, (C.sub.3-C.sub.10)cyclo-alkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl; or R.sup.14 and R.sup.15 may optionally be joined
together with the nitrogen atom bound thereto to form a
heterocyclic, substituted heterocyclic, heteroaryl or substituted
heteroaryl;
[0047] n is an integer equal to 0, 1 or 2;
[0048] q is an integer equal to 1, 2 or 3;
[0049] and pharmaceutically acceptable salts or tautomers
thereof.
[0050] In one preferred embodiment, n is zero (i.e.,
Z=hydrogen).
[0051] In another preferred embodiment, n is one or two; more
preferably, n is one.
[0052] When n is not zero, preferred Z groups fall into several
embodiments. For example, in one preferred embodiment, Z is
1H-tetrazol-5-yl or --COOR.sup.7 where R.sup.7 is as defined above.
In a particularly preferred aspect of this embodiment, Z is
selected from the group consisting of 1H-tetrazol-5-yl,
--C(.dbd.O)OH, and --C(.dbd.O)OR'' where R'' is
(C.sub.1-C.sub.6)alkyl and especially (C.sub.1-C.sub.2)alkyl.
Further with regard to this embodiment, Z is most preferably
--C(.dbd.O)OH.
[0053] In another preferred embodiment, Z is
--C(.dbd.O)NR.sup.8R.sup.9 where R.sup.8 and R.sup.9 are as defined
above. In one particularly preferred aspect of this embodiment,
R.sup.8 is hydrogen and R.sup.9 is as defined above. Even more
preferably, in this aspect, R.sup.9 is selected from the group
consisting of alkyl, substituted alkyl, aryl, substituted aryl,
heteroaryl, substituted heteroaryl, heterocyclic and substituted
heterocyclic.
[0054] Preferred R.sup.9 substituted alkyl groups comprise 1 to 2
substituents selected from the group consisting of sulfonic acid,
carboxy and carboxy ester. Particularly preferred R.sup.9
substituted alkyl groups include, by way of example,
--CH.sub.2CH.sub.2SO.sub.3H and --CH.sub.2CH.sub.2COOH.
[0055] Preferred R.sup.9 aryl and substituted aryl groups include,
for example, 7-hydroxynaphth-1-yl, 6-hydroxynaphth-1-yl,
5-hydroxynaphth-1-yl, 4-methyl-2-oxo-2H-chromen-7-yl,
6-carboxynaphth-2-yl, (4-HOOCCH.sub.2-)phenyl,
(3,4-dicarboxy)phenyl, 3-carboxyphenyl, 3-carboxy-4-hydroxyphenyl,
2-carboxy-naphthen-6-yl, (4-carboxymethyl)phenyl,
(3,4-dicarboxy)phenyl, 4-hydroxy-3-carboxyphenyl and
3-carboxyphenyl.
[0056] Preferred R.sup.9 heteroaryl and substituted heteroaryl
groups include, for example, 1-phenyl-4-carboxy-1H-pyrazol-5-yl,
5-carboxypyrid-2-yl, 2-carboxypyrazin-3-yl, and
3-carboxythien-2-yl.
[0057] In Another preferred embodiment, R.sup.9 is heterocyclic,
more preferably, N-morpholino.
[0058] In another particularly preferred aspect of this embodiment,
R.sup.8 and R.sup.9, together with the nitrogen atom pendent
thereto, form a heterocyclic or substituted heterocyclic ring.
Preferred heterocyclic and substituted heterocyclic rings include 4
to 8 membered rings containing 1 to 3 heteroatoms and particularly
1 to 2 nitrogen atoms including, for example, piperidine,
substituted piperidine, piperazine, substituted piperazine,
morpholino, substituted morpholino, thiomorpholino and substituted
thiomorpholino wherein the sulfur atom of the thiomorpholino or
substituted thiomorpholino ring is optionally oxidized to provide
for sulfoxide and sulfones. Particularly preferred heterocyclic and
substituted heterocyclic groups include, by way of example,
4-hydroxypiperidin-1-yl,
1,2,3,4-tetrahydro-3-carboxy-isoquinolin-2-yl,
4-methylpiperazin-1-yl, morpholin-4-yl, and thiomorpholin-4-yl.
[0059] In still another preferred embodiment, Z is
--C(X)--N(R.sup.3)--CR.sup.2R.sup.2'--C(.dbd.O)R.sup.1.
[0060] In one aspect of this embodiment, Z is
--C(O)NHCHR.sup.2C(.dbd.O)R.sup.1. In this aspect, preferred
R.sup.2 groups include hydrogen, alkyl, substituted alkyl,
cycloalkyl, substituted cycloalkyl, aryl, substituted aryl,
heteroaryl and substituted heteroaryl. Particularly preferred
R.sup.2 groups include hydrogen, alkyl, substituted alkyl, and
cycloalkyl including, for example, hydrogen, methyl,
1-methylprop-1-yl, sec-butyl, hydroxymethyl, 1-hydroxyeth-1-yl,
4-amino-n-butyl, 2-carboxyeth-1-yl, carboxymethyl, benzyl,
(1H-imidazol-4-yl)methyl, (4-phenyl)benzyl,
(4-phenylcarbonyl)benzyl, cyclohexylmethyl, cyclohexyl,
5-hydroxy-1H-indol-3-yl, 2-methylthioeth-1-yl, iso-propyl,
carbamoylmethyl, 2-carbamoyleth-1-yl, (4-hydroxy)benzyl and
3-guanidino-n-propyl.
[0061] In this aspect, preferred R.sup.1 groups include, for
example, hydroxy, amino, and amino(N-morpholino).
[0062] In another aspect of the above embodiment, Z is
--C(O)N(R.sup.3)CHR.sup.2C(.dbd.O)R.sup.1 where R.sup.2 and
R.sup.3, together with the carbon atom and nitrogen atom bound
thereto respectively, are joined to form a heterocyclic or
substituted heterocyclic group. In this aspect, preferred
heterocyclic and substituted heterocyclic groups include, by way of
example, pyrrolidinyl, 2-carboxypyrrolidinyl,
2-carboxy-4-hydroxypyrrolidinyl, and
3-carboxy-1,2,3,4-tetrahydroisoquinolin-3-yl.
[0063] In still another preferred embodiment, Z is
--C(O)NHS(O).sub.2R.sup.4. In this preferred aspect, R.sup.4 is
preferably alkyl, substituted alkyl, aryl and substituted aryl.
More preferably, R.sup.4 is exemplified by methyl, trifluoromethyl,
phenyl, 4-bromophenyl, 4-nitrophenyl or 4-methylphenyl.
[0064] In another preferred embodiment, Z is a carboxylic acid
isostere such as those recited in references 13 to 18 as listed:
Herr, J. R., Bioorg. Med. Chem., 10: 3379-3393 (2002).sup.13;
Andersen, K. E. et al., Eur. J. Med. Chem., 31: 417-425 (1996);
Thomber, C. W. Chem. Soc. Rev. 8: 563-580 (1979).sup.15; Lipinski,
C. A. Annual Reports in Med. Chem. 21: 283-297 (1986).sup.16;
Wissner, A. et al., J. Med. Chem. 23: 715-717 (1980).sup.17; and,
Patani, G. A. et al., Chem. Rev. 96: 3147-3176 (1996).sup.18.
[0065] In another preferred embodiment, R is selected from the
group consisting of hydrogen, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, (C.sub.3-C.sub.10)cycloalkyl, -substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10) alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl.
[0066] Particularly preferred R groups include hydrogen, alkyl,
substituted alkyl, cycloalkyl and substituted cycloalkyl which are
exemplified by, for example, hydrogen, ethyl, iso-propyl,
sec-butyl, 3-methyl-n-butyl, cyclopropyl, cyclopentyl, cyclohexyl,
cyclopropylmethyl, 2-(N,N-dimethylamino)eth-1-yl. Most preferably,
R is cyclohexyl.
[0067] In one embodiment, W is N. Preferably, however, W is CH.
[0068] In one preferred embodiment, the HET group is a fused
bicyclic nitrogen-containing heterocyclic or heteroaryl ring. More
preferably, the HET group contains a total of 1 to 4 nitrogen ring
atoms in one or both ring groups and optionally 1 to 2 hetero ring
atoms selected from the group consisting of --O--, --S--, --S(O)--
and --S(O).sub.2-- again, in one or both ring groups. Preferably,
there are no more than 3 nitrogen ring atoms in any one of the
fused rings and, even more preferably, there are no more than 2
nitrogen ring atoms in any one of the fused rings.
[0069] In a particularly preferred aspect of this embodiment, the
HET group is selected from the group consisting of quinolinyl,
isoquinolinyl, quinoxalinyl, quinazolinyl, pteridinyl, cinnolinyl,
[1,8]naphthyridinyl, [1,5]naphthyridinyl,
1,2,3,4-tetrahydroquinolinyl, 1,2,3,4-tetrahydroisoquinolinyl,
1,4-dioxo-1,4-dihydrophthalazinyl, 4-oxo-1,4-dihydroquinolinyl,
4-oxo-1,4-dihydroquinazolinyl,
1,1-dioxo-1,4-dihydro-1.lamda.6-benzo[1,2,4]thiadiazinyl, and
1,4-dihydroisoquinolinyl which groups are exemplified by, for
example, quinolin-6-yl, isoquinolin-6-yl, quinolin-7-yl,
quinoxalin-6-yl, quinazolin-7-yl, pteridin-6-yl, cinnolin-3-yl,
[1,8]naphthyridin-3-yl, [1,5]naphthyridin-2-yl,
1,2,3,4-tetrahydroquinolin-6-yl,
1,4-dioxo-1,4-dihydrophthalazin-6-yl,
4-oxo-1,4-dihydroquinolin-6-yl, 4-oxo-1,4-dihydroquinazolin-6-yl,
1,1-dioxo-1,4-dihydro-1.lamda.6-benzo[1,2,4]thiadiazin-7-yl, and
1,4-dihydroisoquinolin-6-yl.
[0070] In another preferred embodiment, the heterocyclic or
heteroaryl ring of the HET group is an oxygen-containing
heterocyclic or heteroaryl ring. Preferably, the HET group contains
1 to 2 oxygen ring atoms and optionally 1 to 2 hetero ring atoms
selected from the group consisting of --S--, --S(O)-- and
--S(O).sub.2--.
[0071] In a particularly preferred aspect of this embodiment, the
HET group is selected from the group consisting of
2-oxo-2H-chromenyl, 4-oxo-2H-chromenyl, and 4-oxo-4H-chromen-6-yl
which groups are exemplified, for example, by
2-oxo-2H-chromen-7-yl, 4-oxo-2H-chromen-6-yl,
4-oxo-2H-chromen-7-yl, and 4-oxo-4H-chromen-6-yl.
[0072] In another particularly preferred embodiment, the HET group
is naphthyl.
[0073] Preferably, Y is selected from the group consisting of
(C.sub.1-C.sub.10)alkyl, substituted (C.sub.1-C.sub.10)alkyl,
amino, substituted amino, aryl, substituted aryl, cycloalkyl,
substituted cycloalkyl, halo, heteroaryl, substituted heteroaryl,
substituted heterocyclic, --C(O)NR.sup.14R.sup.15, --OR.sup.14, and
--SR.sup.14
[0074] One set of preferred Y groups, for example, amino
substituted amino (hydrazine) and mono- and disubstituted amino
groups. Mono-substituted amino groups include alkylamino,
substituted alkylamino, arylamino, substituted arylamino.
Disubstituted amino groups include substituents independently
selected from alkyl, substituted alkyl, aryl and substituted aryl
groups. Examples of preferred amino Y groups include, for instance,
amino, phenylamino, [2-(t-butoxycarbonylaminoethyl]amino,
N-(4-chlorophenyl)amino, N,N-dimethylamino, 4-hydroxybutylamino,
3-imidazol-1-yl-propylamino, and hydrazino.
[0075] Another set of preferred Y groups include (C.sub.1-C.sub.10)
alkyl, substituted (C.sub.1-C.sub.10) alkyl, cycloalkyl, and
substituted cycloalkyl. Preferred substituents for substituted
(C.sub.1-C.sub.10) alkyl Y groups include, for example, hydroxy,
amino, substituted amino, aryl, substituted aryl, heteroaryl and
substituted heteroaryl. Preferred substituents for substituted
cycloalkyl include, for example, carboxymethyl and methyl. Examples
of preferred alkyl, substituted alkyl and substituted cycloalkyl Y
groups include, for instance, methyl, 3-hydroxypropyl,
(N,N-di-n-propyl)aminomethyl, diphenylmethyl(benzhydryl), and
2-(pyrazol-1-yl)eth-1-yl and
3-carboxymethyl-2,2-dimethylcyclobutyl.
[0076] Another set of preferred Y groups include carboxy, carboxy
esters, halo (particularly fluoro), cyano, and nitro.
[0077] Another set of preferred Y groups include
--C(O)NR.sup.14R.sup.15 where each of R.sup.14 and R.sup.15 is
independently selected from the group consisting of hydrogen,
alkyl, substituted alkyl, aryl and substituted aryl or where
R.sup.14 and R.sup.15, together with the nitrogen atom pendent
thereto, form a heterocyclic and substituted heterocyclic group.
Preferred substituents on the substituted alkyl and substituted
aryl include, for example, halo, hydroxy, carbamoyl, and the like.
These preferred Y groups are exemplified by, for instance,
1-carbamoylethyl-carbamoyl,
1-carbamoyl-2-(1H-imidazol-2-yl)ethylcarbamoyl,
1-carbamoyl-2-hydroxyethylcarbamoyl,
1-carbamoyl-2-methylpropylcarbamoyl, 4-chlorophenylcarbamoyl, and
pyrrolidin-1-ylcarbonyl.
[0078] Another set of preferred Y groups include aryl groups which
are exemplified by, for instance, phenyl, naphthalen-1-yl, and
5,6,7,8-tetrahydronaphthalen-2-yl.
[0079] Another set of preferred Y groups include substituted aryl.
In one embodiment, the substituted aryls are substituted with
non-aryl groups. In another embodiment, the substituted aryl is
substituted with an aryl or substituted aryl to form, e.g., a
biphenyl group.
[0080] Preferred substituents for substituted aryl Y groups
include, for example, acylamino, amino, substituted amino, alkyl,
substituted alkyl, alkoxy, substituted alkoxy, aryl, substituted
aryl, aryloxy, substituted aryloxy, cycloalkyl, substituted
cycloalkyl, halo, heterocyclic, substituted heterocyclic,
heteroaryl, substituted heteroaryl, hydroxy, nitro and
--C(O)NR.sup.14R.sup.15 where each of R.sup.14 and R.sup.15 is
independently selected from the group consisting of hydrogen,
alkyl, substituted alkyl, aryl and substituted aryl or where
R.sup.14 and R.sup.15, together with the nitrogen atom pendent
thereto, form a heterocyclic and substituted heterocyclic
group.
[0081] Substituted aryl Y groups which are not substituted by an
aryl or substituted aryl group are, for example,
4-acetylaminophenyl, 4-aminophenyl, 4-amino-3-bromophenyl,
4-amino-3,5-dichlorophenyl, 4-benzyloxy-2-hydroxy-3-methylphenyl,
2-bromophenyl, 3-bromophenyl, 4-bromophenyl,
5-bromo-2-hydroxyphenyl, 3-carbamoyl-4-hydroxyphenyl,
3-carboxymethoxyphenyl, 2-cyclohexyl-5-methoxyphenyl,
3,4-dichlorophenyl, 2,4-dihydroxyphenyl, 3,5-dihydroxyphenyl,
4-(N,N-dimethylamino)phenyl, 4-fluorophenyl,
2-furan-2-yl-5-methoxyphenyl, 3-hydroxyphenyl,
2-hydroxy-4-,6-dimethoxyphenyl, 2-hydroxynaphthalen-1-yl,
2-hydroxy-6-methoxyphenyl, 2-hydroxy-5-methyl-3-nitrophenyl,
4-(imidazol-1-yl)phenyl, 3-(2-methoxyethoxy)phenyl,
2-methoxy-5-nitrophenyl, 3-methoxyphenyl, 4-methoxyphenyl,
5-methoxy-2-thiophen-2-ylphenyl, 4-methylphenyl,
4-morpholinophenyl, 6-methylnaphthalen-2-yl, 2-nitrophenyl,
3-(2-oxo-2-pyrrolidin-1-ylethoxy)phenyl, 4-phenoxyphenyl,
(4-piperazin-1-yl)phenyl, 3-[pyrrolidin-1-ylcarbonyl]-phenyl,
3-[3-(pyrrolidin-1-ylpropoxy)]phenyl,
2-(2,4-dimethoxypyrimidin-5-yl)-4-methoxyphenyl, and
2-(pyrid-4-yl)phenyl.
[0082] Substituted aryl Y groups which are substituted by an aryl
or substituted aryl group are exemplified, for example, by
biphen-2-yl, biphen-4-yl, 4-amino-4'-chlorobiphen-2-yl,
4'-aminomethyl-4-methoxybiphen-2-yl,
4-carbamoyl-4'-methoxybiphen-2-yl,
4-carbamoyl-4'-fluorobiphen-2-yl,
4-carbamoyl-4'-methoxybiphen-2-yl, 4-carbamoyl-4'-nitrobiphen-2-yl,
4-(carbamoylmethylcarbamoyl)biphen-2-yl,
4-(carbamoylmethylcarbamoyl)-4'-chlorobiphen-2-yl,
4-carboxy-4'-chlorobiphen-2-yl, 3-carboxy-4'-methoxybiphen-2-yl,
4-carboxy-4'-methoxybiphen-2-yl,
4'-carboxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4-carboxymethoxybiphen-2-yl, 4-carboxymethoxy-4'-chlorobiphen-2-yl,
4'-chlorobiphen-2-yl, 4'-chloro-4-chlorobiphen-2-yl,
4'-chloro-4-(dimethylaminoethylcarbamoylbiphen-2-yl,
4'-chloro-4-(2-ethoxyethoxy)biphen-2-yl,
3'-chloro-4'-fluoro-4-methoxybiphen-2-yl,
4'-chloro-4-fluorobiphen-2-yl, 4'-chloro-4-hydroxybiphen-2-yl,
3'-chloro-4-methoxybiphen-2-yl,
4'-chloro-4-methylcarbamoylbiphen-2-yl,
4'-chloro-4-methoxybiphen-2-yl,
4'-chloro-4-(2-methoxyethoxy)biphen-2-yl,
4'-chloro-4-nitrobiphen-2-yl,
4'-chloro-4-(2-oxo-2-pyrrolidin-1-ylethoxy)biphen-2-yl,
4'-chloro-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4'-chloro-4-(3-pyrrolidin-1-ylpropoxy)biphen-2-yl,
4'-cyano-4-methoxybiphen-2-yl, 3',4'-dichloro-4-methoxybiphen-2-yl,
4,4'-dimethoxybiphen-2-yl,
3',4'-dimethoxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4'-dimethylamino-4-methoxybiphen-2-yl,
4-(2-dimethylaminoethylcarbamoyl)biphen-2-yl,
4'-ethoxy-4-methoxybiphen-2-yl, 4'-fluoro-4-methoxybiphen-2-yl,
4-hydroxybiphenyl, 4-methoxybiphenyl,
4-methoxy-4'-hydroxybiphen-2-yl, 4-(2-methoxyethoxy)biphen-2-yl,
4-methoxy-4'-methylbiphen-2-yl, 4-methoxy-3'-nitrobiphen-2-yl,
4-methoxy-4'-nitrobiphen-2-yl, 4-methylcarbamoylbiphen-2-yl,
3'-methyl-4-methoxybiphen-2-yl,
4'-nitro-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4-(2-oxo-2-pyrrolidin-1-ylethoxy)biphen-2-yl,
4-(3-pyrrolidin-1-ylpropoxy)biphen-2-yl, and
4'-trifluoromethyl-4-methoxybiphen-2-yl.
[0083] Another set of preferred Y groups include heteroaryl groups
which are exemplified by, for instance, benzo[1,3]dioxol-5-yl,
benzofuran-2-yl, 2,3-dihydrobenzofuran-5-yl, pyrazin-2-yl,
pyrid-2-yl, pyrid-3-yl, pyrid-4-yl, 1H-pyrrol-2-yl, 1H-pyrrol-3-yl,
quinolin-4-yl, 3-oxo-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl, and
thien-2-yl.
[0084] Another set of preferred Y groups include substituted
heteroaryl. Preferred substituents on the substituted heteroaryl Y
groups include amino, substituted amino, alkyl, substituted alkyl,
aryl, substituted aryl, alkoxy, substituted alkoxy, halo,
heteroaryl, substituted heteroaryl, hydroxy, nitro and cyano. Such
groups are exemplified by, for example,
2-amino-4-methylthiazol-5-yl, 3-amino-5-phenylthiophen-2-yl,
5-benzyloxy-2-methylbenzofuran-3-yl,
7-bromo-5-methoxybenzofuran-2-yl,
6-chloro-9-methyl-9H-carbazol-3-yl,
5-(4-chlorophenyl)-2-methylfuran-2-yl,
3-(4-chlorophenyl)-5-methylisoxazol-4-yl,
2-(4-chlorophenyl)-4-methylthiazol-5-yl,
1-(2-chloropyrid-3-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl,
3-(3,4-dichlorophenyl)isoxazol-5-yl, 7-hydroxybenzofuran-2-yl,
5-methoxybenzofuran-3-yl, 3,5-dimethyl-1-phenyl-1H-pyrazol-4-yl,
2,4-dimethylthiazol-5-yl, 5-methyl-2-phenyl-thiophen-3-yl, and
1-phenyl-1H-pyrazol-4-yl.
[0085] Another set of preferred Y groups include alkoxy, thioalkyl,
substituted alkoxy, substituted thioalkyl, aryloxy and substituted
aryloxy group. Such groups are exemplified by, for example,
2-chloro-4-(4-chlorophenyl)phenoxy, ethoxy,
7-hydroxynaphthalen-2-oxy, phenoxy, and phenylsulfanyl.
[0086] A particularly preferred class of compounds of this
invention are set forth in formula II below:
##STR00002##
[0087] wherein:
[0088] W is CH or N;
[0089] Z' is selected from the group consisting of carboxy, carboxy
ester, and tetrazolyl,
[0090] R.sup.17 is selected from the group consisting of
cycloalkyl, cycloalkyl substituted with 1 to 3 alkyl groups,
heterocyclic and heterocyclic substituted with 1 to 3 alkyl
groups;
[0091] X and X' are independently selected from the group
consisting of alkyl, substituted alkyl, alkoxy, substituted alkoxy,
halo, hydroxy, and nitro;
[0092] Ar.sup.1 and Ar.sup.2 are independently selected from the
group consisting of aryl, substituted aryl, cycloalkyl, substituted
cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic and
substituted heterocyclic;
[0093] t is an integer equal to 0, 1 or 2;
[0094] t' is an integer equal to 0 or 1;
[0095] and pharmaceutically acceptable salts thereof.
[0096] Preferably, W is CH.
[0097] Preferably, R.sup.17 is cycloalkyl and, more preferably, is
cyclohexyl.
[0098] In one preferred embodiment, --Ar.sup.1--Ar.sup.2-- are
selected from the group consisting of aryl-aryl, -aryl-substituted
aryl, -substituted aryl-aryl, and -substituted aryl-substituted
aryl. Examples of such preferred embodiments include, for instance,
biphen-2-yl, biphen-4-yl, 4-amino-4'-chlorobiphen-2-yl,
4'-aminomethyl-4-methoxybiphen-2-yl,
4-carbamoyl-4'-methoxybiphen-2-yl,
4-carbamoyl-4'-fluorobiphen-2-yl,
4-carbamoyl-4'-methoxybiphen-2-yl, 4-carbamoyl-4'-nitrobiphen-2-yl,
4-(carbamoylmethylcarbamoyl)-biphen-2-yl,
4-(carbamoylmethylcarbamoyl)-4'-chlorobiphen-2-yl,
4-carboxy-4'-chlorobiphen-2-yl, 3-carboxy-4'-methoxybiphen-2-yl,
4-carboxy-4'-methoxybiphen-2-yl,
4'-carboxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4-carboxymethoxybiphen-2-yl, 4-carboxymethoxy-4'-chlorobiphen-2-yl,
4'-chlorobiphen-2-yl, 4'-chloro-4-chlorobiphen-2-yl,
4'-chloro-4-(dimethylaminoethylcarbamoylbiphen-2-yl,
4'-chloro-4-(2-ethoxyethoxy)biphen-2-yl,
3'-chloro-4'-fluoro-4-methoxybiphen-2-yl,
4'-chloro-4-fluorobiphen-2-yl, 4'-chloro-4-hydroxybiphen-2-yl,
3'-chloro-4-methoxybiphen-2-yl,
4'-chloro-4-methylcarbamoylbiphen-2-yl,
4'-chloro-4-methoxybiphen-2-yl,
4'-chloro-4-(2-methoxyethoxy)biphen-2-yl,
4'-chloro-4-nitrobiphen-2-yl,
4'-chloro-4-(2-oxo-2-pyrrolidin-1-ylethoxy)biphen-2-yl,
4'-chloro-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4'-chloro-4-(3-pyrrolidin-1-ylpropoxy)biphen-2-yl,
4'-cyano-4-methoxybiphen-2-yl, 3',4'-dichloro-4-methoxybiphen-2-yl,
4,4'-dimethoxybiphen-2-yl,
3',4'-dimethoxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4'-dimethylamino-4-methoxybiphen-2-yl,
4-(2-dimethylaminoethylcarbamoyl)biphen-2-yl,
4'-ethoxy-4-methoxybiphen-2-yl, 4'-fluoro-4-methoxybiphen-2-yl,
4-hydroxybiphenyl, 4-methoxybiphenyl,
4-methoxy-4'-hydroxybiphen-2-yl, 4-(2-methoxyethoxy)biphen-2-yl,
4-methoxy-4'-methylbiphen-2-yl, 4-methoxy-3'-nitrobiphen-2-yl,
4-methoxy-4'-nitrobiphen-2-yl, 4-methylcarbamoylbiphen-2-yl,
3'-methyl-4-methoxybiphen-2-yl,
4'-nitro-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl,
4-(2-oxo-2-pyrrolidin-1-ylethoxy)biphen-2-yl,
4-(3-pyrrolidin-1-ylpropoxy)biphen-2-yl, and
4'-trifluoromethyl-4-methoxybiphen-2-yl.
[0099] In another preferred embodiment, --Ar.sup.1--Ar.sup.2-- are
selected from the group consisting of -aryl-heteroaryl,
-aryl-substituted heteroaryl, -substituted aryl-heteroaryl,
-substituted aryl-substituted heteroaryl, heteroaryl-aryl,
heteroaryl-substituted aryl, substituted heteroaryl-aryl, and
substituted heteroaryl-substituted aryl. Examples of such preferred
embodiments include, for instance, 2-furan-2-yl-5-methoxyphenyl,
4-(imidazol-1-yl)phenyl, 5-methoxy-2-thiophen-2-ylphenyl,
2-(2,4-dimethoxypyrimidin-5-yl)-4-methoxyphenyl,
2-(pyrid-4-yl)phenyl, 3-amino-5-phenylthiophen-2-yl,
5-(4-chlorophenyl)-2-methylfuran-2-yl,
3-(4-chlorophenyl)-5-methylisoxazol-4-yl,
2-(4-chlorophenyl)-4-methylthiazol-5-yl,
3-(3,4-dichloro-phenyl)isoxazol-5-yl,
3,5-dimethyl-1-phenyl-1H-pyrazol-4-yl,
5-methyl-2-phenylthiophen-3-yl, and 1-phenyl-1H-pyrazol-4-yl.
[0100] In another preferred embodiment, --Ar.sup.1--Ar.sup.2-- are
selected from the group consisting of -aryl-cycloalkyl,
-aryl-substituted cycloalkyl, -substituted aryl-cycloalkyl,
-substituted aryl-substituted cycloalkyl, -aryl-heterocyclic,
aryl-substituted heterocyclic, substituted aryl-heterocyclic, and
substituted aryl-substituted heterocyclic. Examples of such
preferred embodiments include, (4-piperazin-1-yl)phenyl,
2-cyclohexyl-5-methoxyphenyl, and 4-morpholinophenyl.
[0101] In another embodiment of the invention, the compounds are
represented by formula III:
##STR00003##
[0102] wherein:
[0103] q is an integer equal to 1, 2 or 3;
[0104] R.sup.7 is selected from the group consisting of hydrogen,
alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, aryl, substituted aryl, heteroaryl,
substituted heteroaryl, heterocyclic and substituted
heterocyclic;
[0105] HET is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, cycloalkyl,
cycloalkenyl, heterocyclic, or heteroaryl rings that are optionally
substituted with (Y).sub.q; with the proviso that at least one
6-membered ring in the bicycle is heterocyclic or heteroaryl or the
bicycle is naphthyl;
[0106] each Y is independently selected from the group consisting
of halo, cyano, nitro, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, acyl, acyloxy, guanidino, substituted
guanidino, oxycarbonylamino, aminocarbonyloxy, aminocarbonylamino,
oxycarbonyloxy, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, --CO.sub.2R.sup.7, --NR.sup.14R.sup.15,
--NHNR.sup.14R.sup.15, --C(X)NR.sup.14R.sup.15, --OR.sup.14,
--SR.sup.14, --S(O)R.sup.14, --S(O).sub.2R.sup.14, and
--S(O).sub.2NR.sup.14R.sup.15; where X is as defined above;
[0107] where R.sup.7 is as defined above and each of R.sup.14 and
R.sup.15 is independently selected from the group consisting of
hydrogen, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, (C.sub.3-C.sub.10)cyclo-alkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl; or R.sup.14 and R.sup.15 may optionally be joined
together with the nitrogen atom bound thereto to form a
heterocyclic, substituted heterocyclic, heteroaryl or substituted
heteroaryl;
[0108] and pharmaceutically acceptable salts and/or tautomers
thereof.
[0109] Preferred R.sup.7, HET and Y groups are as defined
above.
[0110] In another embodiment of the invention, the compounds are
represented by formula IV:
##STR00004##
[0111] wherein:
[0112] R.sup.7 is selected from the group consisting of hydrogen,
alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, aryl, substituted aryl, heteroaryl,
substituted heteroaryl, heterocyclic and substituted
heterocyclic;
[0113] HET' is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, substituted aryl,
heterocyclic, substituted heterocyclic, heteroaryl, or substituted
heteroaryl rings that are optionally substituted with Y; with the
proviso that at least one 6-membered ring in the bicycle is
aromatic;
[0114] Y' is independently selected from the group consisting of
alkyl, aryl, heteroaryl, substituted aryl, and substituted
heteroaryl; and
[0115] pharmaceutically acceptable salts and/or tautomers
thereof.
[0116] In another embodiment of the invention, the compounds are
represented by formula V:
##STR00005##
[0117] wherein:
[0118] R.sup.8 and R.sup.9 are independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic
and substituted heterocycle or, alternatively, R.sup.8 and R.sup.9
together with the nitrogen atom pendent thereto, form a
heterocyclic, a substituted heterocyclic, a heteroaryl or a
substituted heteroaryl ring group;
[0119] HET is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, cycloalkyl,
cycloalkenyl, heterocyclic, or heteroaryl rings that are optionally
substituted with (Y).sub.q; with the proviso that at least one
6-membered ring in the bicycle is heterocyclic or heteroaryl or the
bicycle is naphthyl;
[0120] each Y is independently selected from the group consisting
of halo, cyano, nitro, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, acyl, acyloxy, guanidino,
oxycarbonylamino, aminocarbonyloxy, aminocarbonylamino,
oxycarbonyloxy, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, --CO.sub.2R.sup.7, --NR.sup.14R.sup.15,
--NHNR.sup.14R.sup.15, --C(X)NR.sup.14R.sup.15, --OR.sup.14,
SR.sup.14, --S(O)R.sup.14, --S(O).sub.2R.sup.14, and
--S(O).sub.2NR.sup.14R.sup.15; where X is as defined above;
[0121] where R.sup.7 is as defined above and each of R.sup.14 and
R.sup.15 is independently selected from the group consisting of
hydrogen, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl; or R.sup.14 and R.sup.15 may optionally be joined
together with the nitrogen atom bound thereto to form a
heterocyclic, substituted heterocyclic, heteroaryl or substituted
heteroaryl;
[0122] q is an integer equal to 1, 2 or 3; and
[0123] pharmaceutically acceptable salts or tautomers thereof.
[0124] In yet another embodiment, the compounds are represented by
the formula VI:
##STR00006##
[0125] wherein:
[0126] R.sup.8 and R.sup.9 are independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic
and substituted heterocycle or, alternatively, R.sup.8 and R.sup.9
together with the nitrogen atom pendent thereto, form a
heterocyclic, a substituted heterocyclic, a heteroaryl or a
substituted heteroaryl ring group;
[0127] HET' is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, substituted aryl,
heterocyclic, substituted heterocyclic, heteroaryl, or substituted
heteroaryl rings that are optionally substituted with Y; with the
proviso that at least one 6-membered ring in the bicycle is
aromatic;
[0128] Y' is independently selected from the group consisting of
alkyl, aryl, heteroaryl, substituted aryl, and substituted
heteroaryl; and pharmaceutically acceptable salts and/or tautomers
thereof.
[0129] In yet another embodiment, the compounds are represented by
the formula VII:
##STR00007##
[0130] wherein:
[0131] HET is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, cycloalkyl,
cycloalkenyl, heterocyclic, or heteroaryl rings that are optionally
substituted with (Y).sub.q; with the proviso that at least one
6-membered ring in the bicycle is heterocyclic or heteroaryl or the
bicycle is naphthyl;
[0132] each Y is independently selected from the group consisting
of halo, cyano, nitro, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, acyl, acyloxy, guanidino, substituted
guanidino, oxycarbonylamino, aminocarbonyloxy, aminocarbonylamino,
oxycarbonyloxy, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, --CO.sub.2R.sup.7, --NR.sup.14R.sup.15,
--NHNR.sup.14R.sup.15, --C(X)NR.sup.14R.sup.15, --OR.sup.14,
SR.sup.14, --S(O)R.sup.14, --S(O).sub.2R.sup.14, and
--S(O).sub.2NR.sup.14R.sup.15; where X is as defined above;
[0133] where R.sup.7 is as defined above and each of R.sup.14 and
R.sup.15 is independently selected from the group consisting of
hydrogen, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl; or R.sup.14 and R.sup.15 may optionally be joined
together with the nitrogen atom bound thereto to form a
heterocyclic, substituted heterocyclic, heteroaryl or substituted
heteroaryl;
[0134] q is an integer equal to 1, 2 or 3; and
[0135] pharmaceutically acceptable salts or tautomers thereof.
[0136] In yet another embodiment, the compounds are represented by
the formula VIII:
##STR00008##
[0137] wherein:
[0138] HET' is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, substituted aryl,
heterocyclic, substituted heterocyclic, heteroaryl, or substituted
heteroaryl rings that are optionally substituted with Y; with the
proviso that at least one 6-membered ring in the bicycle is
aromatic;
[0139] Y' is independently selected from the group consisting of
alkyl, aryl, heteroaryl, substituted aryl, and substituted
heteroaryl; and
[0140] pharmaceutically acceptable salts and/or tautomers
thereof.
[0141] In yet another embodiment, the compounds are represented by
the formula IX:
##STR00009##
[0142] wherein:
[0143] R.sup.4 is selected from the group consisting of alkyl,
substituted alkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, heterocyclic and substituted heterocyclic;
[0144] HET is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, cycloalkyl,
cycloalkenyl, heterocyclic, or heteroaryl rings that are optionally
substituted with (Y).sub.q; with the proviso that at least one
6-membered ring in the bicycle is heterocyclic or heteroaryl or the
bicycle is naphthyl;
[0145] each Y is independently selected from the group consisting
of halo, cyano, nitro, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, acyl, acyloxy, guanidino, substituted
guanidino, oxycarbonylamino, aminocarbonyloxy, aminocarbonylamino,
oxycarbonyloxy, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, --CO.sub.2R.sup.7, --NR.sup.14R.sup.15,
--NHNR.sup.14R.sup.15, --C(X)NR.sup.14R.sup.15, --OR.sup.14,
SR.sup.14, --S(O)R.sup.14, --S(O).sub.2R.sup.14, and
--S(O).sub.2NR.sup.14R.sup.15; where X is as defined above;
[0146] where R.sup.7 is as defined above and each of R.sup.14 and
R.sup.15 is independently selected from the group consisting of
hydrogen, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, (C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl; or R.sup.14 and R.sup.15 may optionally be joined
together with the nitrogen atom bound thereto to form a
heterocyclic, substituted heterocyclic, heteroaryl or substituted
heteroaryl;
[0147] q is an integer equal to 1, 2 or 3; and
[0148] pharmaceutically acceptable salts or tautomers thereof
[0149] In yet another embodiment, the compounds are represented by
the formula X:
##STR00010##
[0150] wherein:
[0151] R.sup.4 is selected from the group consisting of alkyl,
substituted alkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, heterocyclic and substituted heterocyclic;
[0152] HET' is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, substituted aryl,
heterocyclic, substituted heterocyclic, heteroaryl, or substituted
heteroaryl rings that are optionally substituted with Y; with the
proviso that at least one 6-membered ring in the bicycle is
aromatic;
[0153] Y' is independently selected from the group consisting of
alkyl, aryl, heteroaryl, substituted aryl, and substituted
heteroaryl; and
[0154] pharmaceutically acceptable salts and/or tautomers
thereof.
[0155] In yet another embodiment, the compounds are represented by
the formula XI:
##STR00011##
[0156] wherein X is selected from the group consisting of .dbd.O,
.dbd.S, and .dbd.NR.sup.11, where R.sup.11 is hydrogen or alkyl,
R.sup.1 is selected from the group consisting of --OR.sup.7 and
--NR.sup.8R.sup.9 where R.sup.7 is selected from the group
consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic
and substituted heterocyclic; R.sup.8 and R.sup.9 are independently
selected from the group consisting of hydrogen, alkyl, substituted
alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl,
heterocyclic and substituted heterocycle or, alternatively, R.sup.8
and R.sup.9 together with the nitrogen atom pendent thereto, form a
heterocyclic, a substituted heterocyclic, a heteroaryl or a
substituted heteroaryl ring group;
[0157] each R.sup.2 and R.sup.2' is independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclic, and substituted heterocyclic,
or, alternatively, R.sup.2 and R.sup.2' as defined are taken
together with the carbon atom pendent thereto to form a cycloalkyl,
substituted cycloalkyl, heterocyclic or substituted heterocyclic
group,
[0158] or, still further alternatively, one or R.sup.2 or R.sup.2'
is hydrogen, alkyl or substituted alkyl, and the other is joined,
together with the carbon atom pendent thereto, with either the
R.sup.7 and the oxygen atom pendent thereto or R.sup.9 and the
nitrogen atom pendent thereto to form a heterocyclic or substituted
heterocyclic group;
[0159] R.sup.3 is selected from the group consisting of hydrogen
and alkyl or, when R.sup.2 and R.sup.2' are not taken together to
form a ring and when R.sup.2/R.sup.2' and R.sup.7 or R.sup.8 are
not joined to form a heterocyclic or substituted heterocyclic
group, then R.sup.3, together with the nitrogen atom pendent
thereto, may be taken together with one of R.sup.2 and R.sup.2' to
form a heterocyclic or substituted heterocyclic ring group;
[0160] HET is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, cycloalkyl,
cycloalkenyl, heterocyclic, or heteroaryl rings that are optionally
substituted with (Y).sub.q; with the proviso that at least one
6-membered ring in the bicycle is heterocyclic or heteroaryl or the
bicycle is naphthyl;
[0161] each Y is independently selected from the group consisting
of halo, cyano, nitro, (C.sub.1-C.sub.10)alkyl, substituted
(C.sub.1-C.sub.10)alkyl, acyl, acyloxy, guanidino, substituted
guanidino, oxycarbonylamino, aminocarbonyloxy, aminocarbonylamino,
oxycarbonyloxy, (C.sub.3-C.sub.10) cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, --CO.sub.2R.sup.7, --NR.sup.14R.sup.15,
--NHNR.sup.14R.sup.15, --C(X)NR.sup.14R.sup.15, --OR.sup.14,
SR.sup.14, --S(O)R.sup.14, --S(O).sub.2R.sup.14, and
--S(O).sub.2NR.sup.14R.sup.15; where X is as defined above;
[0162] where R.sup.7 is selected from the group consisting of
hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl,
alkynyl, substituted alkynyl, aryl, substituted aryl, heteroaryl,
substituted heteroaryl, heterocyclic and substituted heterocyclic;
s as defined above and each of R.sup.14 and R.sup.15 is
independently selected from the group consisting of hydrogen,
(C.sub.1-C.sub.10)alkyl, substituted (C.sub.1-C.sub.10)alkyl,
(C.sub.3-C.sub.10)cycloalkyl, substituted
(C.sub.3-C.sub.10)cycloalkyl, (C.sub.2-C.sub.10)alkenyl,
substituted (C.sub.2-C.sub.10)alkenyl, (C.sub.2-C.sub.10)alkynyl,
substituted (C.sub.2-C.sub.10)alkynyl, heterocyclic, substituted
heterocyclic, aryl, substituted aryl, heteroaryl, and substituted
heteroaryl; or R.sup.14 and R.sup.15 may optionally be joined
together with the nitrogen atom bound thereto to form a
heterocyclic, substituted heterocyclic, heteroaryl or substituted
heteroaryl; [0163] q is an integer equal to 1, 2 or 3; and
[0164] pharmaceutically acceptable salts or tautomers thereof.
[0165] In yet another embodiment, the compounds are represented by
the formula XII:
##STR00012##
[0166] wherein X is selected from the group consisting of .dbd.O,
.dbd.S, and .dbd.NR.sup.11, where R.sup.11 is hydrogen or alkyl,
R.sup.1 is selected from the group consisting of --OR.sup.7 and
--NR.sup.8R.sup.9 where R.sup.7 is selected from the group
consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic
and substituted heterocyclic; R.sup.8 and R.sup.9 are independently
selected from the group consisting of hydrogen, alkyl, substituted
alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl,
heterocyclic and substituted heterocycle or, alternatively, R.sup.8
and R.sup.9 together with the nitrogen atom pendent thereto, form a
heterocyclic, a substituted heterocyclic, a heteroaryl or a
substituted heteroaryl ring group;
[0167] each R.sup.2 and R.sup.2' is independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic,
and substituted heterocyclic, or, alternatively, R.sup.2 and
R.sup.2' as defined are taken together with the carbon atom pendent
thereto to form a ring group, R.sup.3 is selected from the group
consisting of hydrogen and alkyl or, when R.sup.2 and R.sup.2' are
not taken together to form a ring then R.sup.3 may be taken
together with one of R.sup.2 and R.sup.2' to form a heterocyclic or
substituted heterocyclic ring group;
[0168] HET' is a fused 6,6-bicycle provided by the fused linkage of
any two 6-membered rings selected from aryl, substituted aryl,
heterocyclic, substituted heterocyclic, heteroaryl, or substituted
heteroaryl rings that are optionally substituted with Y; with the
proviso that at least one 6-membered ring in the bicycle is
aromatic;
[0169] Y' is independently selected from the group consisting of
alkyl, aryl, heteroaryl, substituted aryl, and substituted
heteroaryl; and
[0170] pharmaceutically acceptable salts and/or tautomers
thereof.
[0171] Compounds within the scope of this invention include those
of Formula I as set forth in Tables I-VIII as follows:
TABLE-US-00001 TABLE I ##STR00013## Cmpd # Structure q Y Het Name
201 ##STR00014## 1 phenyl quinolin-6-yl
1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carboxylic-ac-
id 203 ##STR00015## 1 phenyl quinoxalin-6-yl
1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid 204 ##STR00016## 1
4'-chloro-4-(pyrrolidinyl-1-carbonyl)-biphen-2-yl quinolin-6-yl
2-{2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl}-1--
cyclohexyl-1H-benzoimidazole-5-carboxylic acid 205 ##STR00017## 1
phenyl quinoxalin-6-yl
1-cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid 206 ##STR00018## 1 phenyl quinolin-6-yl
1-cyclohexyl-2-(3-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carboxylic
acid 207 ##STR00019## 1 phenyl pteridin-6-yl
1-cyclohexyl-2-(2-phenyl-pteridin-6-yl)-1H-benzoimidazole-5-carboxylic
acid 208 ##STR00020## 1 methyl pteridin-6-yl
1-cyclohexyl-2-(2-methyl-pteridin-6-yl)-1H-benzoimidazole-5-carboxylic
acid 209 ##STR00021## 1 Phenyl cinnolin-3-yl
1-cyclohexyl-2-(7-phenyl-cinnolin-3-yl)-1H-benzoimidazole-5-carboxylic
acid 210 ##STR00022## 1 Methyl cinnolin-3-yl
1-cyclohexyl-2-(7-methyl-cinnolin-3-yl)-1H-benzoimidazole-5-carboxylic
acid 211 ##STR00023## 1 Phenyl [1,8]naphthyridin-3-yl
1-cyclohexyl-2-(7-phenyl[1,8]naphthyridin-3-yl)-1H-benzoimidazole-5-carbo-
xylic acid 212 ##STR00024## 1 Methyl [1,8]naphthyridin-3-yl
1-cyclohexyl-2-(7-methyl-[1,8]naphthyridin-3-yl)-1H-benzoimidazole-5-carb-
oxylic acid 213 ##STR00025## 1 Phenyl [1,8]naphthyridin-3-yl
1-cyclohexyl-2-(6-phenyl-[1,8]naphthyridin-3-yl)-1H-benzoimidazole-5-carb-
oxylic acid 214 ##STR00026## 1 Methyl [1,8]naphthyridin-3-yl
1-cyclohexyl-2-(6-methyl-[1,8]naphthyridin-3-yl)-1H-benzoimidazole-5-carb-
oxylic acid 215 ##STR00027## 1 Phenyl
1,2,3,4-tetrahydro-quinolin-6-yl
1-cyclohexyl-2-(2-phenyl-1,2,3,4-tetrahydro-quinolin-6-yl)-1H-benzoimidaz-
ole-5-carboxylic acid 216 ##STR00028## 1 Methyl
1,2,3,4-tetrahydro-quinolin-6-yl
1-cyclohexyl-2-(2-methyl-1,2,3,4-tetrahydroquinolin-6-yl)-1H-benzoimidazo-
le-5-carboxylic acid 217 ##STR00029## 1 Methyl
4-oxo-2H-chromen-6-yl
1-cyclohexyl-2-(3-methyl-4-oxo-chromen-6-yl)-1H-benzoimidazole-5-carboxyl-
ic acid 218 ##STR00030## 1 Methyl 4-oxo-2H-chromen-7-yl
1-cyclohexyl-2-(3-methyl-4-oxo-chromen-7-yl)-1H-benzoimidazole-5-carboxyl-
ic acid 219 ##STR00031## 1 Methyl
1,4-dioxo-1,2,3,4-tetrahydro-phthalazin-6-yl
1-cyclohexyl-2-(2-methyl-1,4-dioxo-1,2,3,4-tetrahydro-phthalazin-6-yl)-1H-
-benzoimidazole-5-carboxylic acid 220 ##STR00032## 1 Methyl
1,1-dioxo-1,4-dihydro-1.lamda.16-benzo-[1,2,4]thiadiazin-7-yl
1-cyclohexyl-2-(3-methyl-1,1-dioxo-1,4-dihydro-1.lamda.6-benzo[1,2,4]thia-
diazin-7-yl)-1H-benzoimidazole-5-carboxylic acid 221 ##STR00033## 0
4-oxo-1,4-dihydro-quinazolin-6-yl
1-cyclohexyl-2-(4-oxo-1,4-dihydro-quinazolin-6-yl)-1H-benzoimidazole-5-ca-
rboxylic acid 222 ##STR00034## 1 Methyl Isoquinolin-6-yl
1-cyclohexyl-2-(3-methyl-isoquinolin-6-yl)-1H-benzoimidazole-5-carboxylic
acid 223 ##STR00035## 1 Methyl 1,4-dihydro-isoquinolin-6-yl
1-cyclohexyl-2-(3-methyl-1,4-dihydro-isoquinolin-6-yl)-1H-benzoimidazole--
5-carboxylic acid 224 ##STR00036## 1 Methyl quinazolin-7-yl
1-cyclohexyl-2-(2-methyl-quinazolin-7-yl)-1H-benzoimidazole-5-carboxylic
acid 225 ##STR00037## 1 Methyl quinoxalin-6-yl
1-cycohexyl-2-(2-methyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid 226 ##STR00038## 1 Methyl [1,5]naphthyridin-2-yl
1-cyclohexyl-2-(6-methyl-[1,5]naphthyridin-2-yl)-1H-benzoimidazole-5-carb-
oxylic acid 227 ##STR00039## 1 Methyl
4-oxo-1,4-dihydro-quinolin-6-yl
1-cyclohexyl-2-(2-methyl-4-oxo-1,4-dihydro-quinolin-6-yl)-1H-benzoimidazo-
le-5-carboxylic acid 228 ##STR00040## 1 Methyl
4-oxo-1,4-dihydro-quinazolin-6-yl
1-cyclohexyl-2-(2-methyl-4-oxo-1,4-dihydro-quinazolin-6-yl)-1H-benzoimida-
zole-5-carboxylic acid 351 ##STR00041## 1 Phenyl quinolin-7-yl
1-cyclohexyl-2-(3-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carboxylic
acid 352 ##STR00042## 1 2-bromo-phenyl quinolin-6-yl
2-[2-(2-bromo-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-5-car-
boxylic acid 353 ##STR00043## 1 4'-chloro-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazole-5-carboxyli-
c acid 354 ##STR00044## 1 5-bromo-2-hydroxy-phenyl quinolin-6-yl
2-[2-(5-bromo-2-hydroxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimida-
zole-5-carboxylic acid 355 ##STR00045## 1 pyridin-3-yl
quinolin-6-yl
1-cyclohexyl-2-(2-pyridin-3-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid 356 ##STR00046## 1 4'-chloro-4-methoxy-biphen-2-yl
quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid 357 ##STR00047## 1 naphthalen-1-yl-
quinolin-6-yl
1-cyclohexyl-2-(2-naphthalen-1-yl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid 358 ##STR00048## 1 4-amino-phenyl quinolin-6-yl
2-[2-(4-amino-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-5-car-
boxylic acid 359 ##STR00049## 1 3-carboxy-methoxy-phenyl
quinolin-6-yl
2-[2-(3-carboxymethyl-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazo-
le-5-carboxylic acid 360 ##STR00050## 1
4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-{2-[4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl]-quinol-
in-6-yl}-1H-benzoimidazole-5-carboxylic acid 361 ##STR00051## 1
4-(carbamoylmethyl-4'-chloro-biphen-2-yl quinolin-6-yl
2-{2-[4-(carbamoylmethyl-carbamoyl)-4'-chloro-biphen-2-yl]-quinolin-6-yl}-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid 362 ##STR00052##
1 4-methyl-carbamoyl-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4-methylcarbamoyl-biphen-2-yl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid 363 ##STR00053## 1
4-amino-3,5-dichloro-phenyl quinolin-6-yl
2-[2-(4-amino-3,5-dichloro-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoim-
idazole-5-carboxylic acid 364 ##STR00054## 1 2,4-dihydroxy-phenyl
quinolin-6-yl
1-cyclohexyl-2-[2-(2,4-dihydroxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-
-5-carboxylic acid 365 ##STR00055## 1
4'-cyano-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-cyano-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid 366 ##STR00056## 1
3'-chloro-4'-fluoro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(3'-chloro-4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid 367 ##STR00057## 1
4-methoxy-3'-methyl-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4-methoxy-3'-methyl-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid 368 ##STR00058## 1
1-carbamoyl-2-(1H-imidazol-2-yl)ethyl-carbamoyl quinolin-6-yl
2-{2-[1-carbamoyl-2-(1H-imidazol-2-yl)ethylcarbamoyl]quinolin-6-yl}-1-cyc-
lohexyl-1H-benzimidazole-5-carboxylic acid 369 ##STR00059## 1
2-pyridin-4-yl-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(2-pyridin-4-yl-phenyl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid 370 ##STR00060## 1
3-(pyrrolidinyl-1-carbonyl)-phenyl quinolin-6-yl
1-cyclohexyl-2-{2-[3-(pyrrolidinyl-1-carbonyl)-phenyl]-quinolin-6-yl}-1H--
benzoimidazole-5-carboxylic acid 371 ##STR00061## 2
4-bromo-phenylAND4-bromo-phenyl quinoxalin-6-yl
2-[2,3-bis(4-bromophenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazole-5-
-carboxylic acid 372 ##STR00062## 1 4-amino-3-bromo-phenyl
quinolin-6-yl
2-[2-(4-amino-3-bromo-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazo-
le-5-carboxylic acid 373 ##STR00063## 1 Phenyl
4-oxo-1,4-dihydro-quinolin-6-yl
1-cyclohexyl-2-(4-oxo-2-phenyl-1,4-dihydro-quinolin-6-yl)-1H-benzoimidazo-
le-5-carboxylic acid 374 ##STR00064## 1
3-carbamoyl-4-hydroxy-phenyl quinolin-6-yl
2-[2-(3-carbamoyl-4-hydroxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoi-
midazole-5-carboxylic acid 375 ##STR00065## 1
4-carboxy-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4-carboxymethoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoi-
midazole-5-carboxylic acid 376 ##STR00066## 1
4'-chloro-4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl
quinolin-6-yl
2-{2-[4'-chloro-4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl]-quinolin--
6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid 377
##STR00067## 1 4-(carbamoylmethyl-carbamoyl)-biphen-2-yl
2-[4-(carbamoyl-methyl-carbamoyl)-biphen-2-yl]-quinolin-6-yl
2-{2-[4-(carbamoylmethyl-carbamoyl)-biphen-2-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid 378 ##STR00068## 1
4'-chloro-4-methyl-carbamoyl-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methylcarbamoyl-biphen-2-yl)-quinolin-6-yl]-1-cyclohexy-
l-1H-benzoimidazole-5-carboxylic acid 379 ##STR00069## 2
biphen-2-ylANDmethyl quinolin-6-yl
2-(2-biphen-2-yl-8-methyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-
-carboxylic acid 380 ##STR00070## 2
(4-chloro-phenyl)-aminoANDphenyl quinolin-6-yl
2-[4-(4-chloro-phenylamino)-2-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid 381 ##STR00071## 1 3,5-dihydroxy-phenyl
quinolin-6-yl
1-cyclohexyl-2-[2-(3,5-dihydroxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-
-5-carboxylic acid 382 ##STR00072## 1
4'-carbamoyl-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-carbamoyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H--
benzoimidazole-5-carboxylic acid
383 ##STR00073## 1 4-methoxy-4'-nitro-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4-methoxy-4'-nitro-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid 384 ##STR00074## 1
4'-amino-methyl-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-aminomethyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1-
H-benzoimidazole-5-carboxylic acid 385 ##STR00075## 1
1-carbamoyl-2-hydroxy-ethyl-carbamoyl quinolin-6-yl
2-[2-(1-carbamoyl-2-hydroxyethylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H--
benzimidazole-5-carboxylic acid 386 ##STR00076## 2 PhenylANDphenyl
quinolin-6-yl
1-cyclohexyl-2-(2,3-diphenyl-quinolin-6-yl)-1H-benzoimidazole-5-carboxyli-
c acid 387 ##STR00077## 1 4'-chloro-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazol-
e-5-carboxylic acid 388 ##STR00078## 2 biphenyl-2-ylANDfluoro
quinolin-6-yl
2-(2-biphen-2-yl-7-fluoro-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-
-carboxylic acid 389 ##STR00079## 2 p-tolylANDp-tolyl
quinoxalin-6-yl
1-cyclohexyl-2-(2,3-di-p-tolylquinoxalin-6-yl)-1H-benzimidazole-5-carboxy-
lic acid 390 ##STR00080## 1 biphen-4-yl- quinolin-6-yl
2-(2-biphen-4-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carboxyl-
ic acid 391 ##STR00081## 1 2-amino-4-methyl-thiazol-5-yl
quinolin-6-yl
2-[2-(2-amino-4-methyl-thiazol-5-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid 392 ##STR00082## 1 3-hydroxy-propyl
quinolin-6-yl
1-cyclohexyl-2-[2-(3-hydroxy-propyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid 393 ##STR00083## 1
4-carboxy-methoxy-4'-chloro-biphen-2-yl quinolin-6-yl
2-[2-(4-carboxymethoxy-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-
-1H-benzoimidazole-5-carboxylic acid 394 ##STR00084## 1
7-bromo-5-methoxy-benzofuran-2-yl quinolin-6-yl
2-[2-(7-bromo-5-methoxy-benzofuran-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-b-
enzoimidazol-5-carboxylic acid 395 ##STR00085## 1 biphen-2-yl
quinolin-6-yl
2-(2-biphen-2-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carboxyl-
ic acid 396 ##STR00086## 1
3-(4-chloro-phenyl)-5-methyl-isoxazol-4-yl quinolin-6-yl
2-{2-[3-(4-chloro-phenyl)-5-methyl-isoxazol-4-yl]-quinolin-6-yl}-1-cycloh-
exyl-1H-benzoimidazole-5-carboxylic acid 397 ##STR00087## 2
MethylANDphenyl quinolin-6-yl)-
1-cyclohexyl-2-(8-methyl-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid 398 ##STR00088## 2 4-hydroxy-butylaminoANDphenyl
quinolin-6-yl
1-cyclohexyl-2-[4-(4-hydroxy-butylamino)-2-phenyl-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid 399 ##STR00089## 2
2-tert-butoxy-carbonyl-aminoethyl-aminoANDphenyl quinolin-6-yl
2-[4-(2-tert-butoxycarbonylamino-ethylamino)-2-phenyl-quinolin-6-yl]-1-cy-
clohexyl-1H-benzoimidazole-5-carboxylic acid 400 ##STR00090## 1
5-(pyrrolidinyl-1-carbonyl)-2-thiophen-2-yl quinolin-6-yl
1-cyclohexyl-2-{2-[5-(pyrrolidinyl-1-carbonyl)-2-thiophen-2-yl]quinoline--
6-yl}-1H-benzimidazole-5-carboxylic acid 401 ##STR00091## 1
4'-dimethyl-amino-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4'-dimethylamino-4-methoxy-biphen-2-yl)-quinolin-6-yl]-
-1H-benzoimidazole-5-carboxylic acid 402 ##STR00092## 1 carboxyl
quinolin-6-yl
6-(5-carboxy-1-cyclohexyl-1H-benzimidazol-2-yl)quinoline-2-carboxylic
acid 403 ##STR00093## 1 3',4'-dichloro-4-methoxy-biphen-2-yl
quinolin-6-yl
1-cyclohexyl-2-[2-(3',4'-dichloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid 404 ##STR00094## 1
2-ethoxy-5-nitrophenyl quinolin-6-yl
1-cyclohexyl-2-[2-(2-ethoxy-5-nitro-phenyl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid 405 ##STR00095## 1 Phenyl quinolin-7-yl
1-cyclohexyl-2-(2-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carboxylic
acid 406 ##STR00096## 2 PhenylANDphenyl quinoxalin-6-yl
cyclohexyl-2-(2,3-diphenylquinoxalin-6-yl)-1H-benzimidazole-5-carboxylic
acid 407 ##STR00097## 1 Phenyl 4-oxo-4H-chromen-6-yl
cyclohexyl-2-(4-oxo-2-phenyl-4H-chromen-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid 408 ##STR00098## 2 4'-chloro-biphen-2-ylANDfluoro
quinolin-6-yl
2-[2-(4'-chloro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid 409 ##STR00099## 2
4-fluoro-phenylAND4-fluoro-phenyl quinoxalin-6-yl
2-[2,3-bis-(4-fluorophenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazole-
-5-carboxylic acid 410 ##STR00100## 2 biphen-2-ylANDfluoro
quinolin-6-yl
2-(2-biphen-2-yl-7-fluoro-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazol-5--
yl]-(4-hydroxy-piperidin-1-yl)-methanone 411 ##STR00101## 1
7-hydroxy-benzofuran-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(7-hydroxy-benzofuran-2-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid 412 ##STR00102## 1 benzo[1,3]dioxol-5-yl
quinolin-6-yl
2-(2-benzo[1,3]dioxol-5-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole--
5-carboxylic acid 413 ##STR00103## 1 benzofuran-2-yl quinolin-6-yl
2-(2-benzofuran-2-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid 414 ##STR00104## 1 3-(3-pyrrolidin-1-yl-prop-oxy)phenyl
quinolin-6-yl
1-cyclohexyl-2-{2-[3-(3-pyrrolidin-1-yl-propoxy)-phenyl]-quinolin-6-yl}-1-
H-benzoimidazole-5-carboxylic acid 415 ##STR00105## 1
4-carboxy-4'-chloro-biphen-2-yl quinolin-6-yl
2-[2-(4-carboxy-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid 416 ##STR00106## 1
2-(4-chloro-phenyl)-4-methyl-thiazol-5-yl quinolin-6-yl
2-{2-[2-(4-chloro-phenyl)-4-methyl-thiazol-5-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid 417 ##STR00107## 2
4'-chloro-biphen-2-ylANDmethyl quinolin-6-yl
2-[2-(4'-chloro-biphen-2-yl)-8-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid 418 ##STR00108## 1
2-hydroxy-5-methyl-3-nitrophenyl quinolin-6-yl
1-cyclohexyl-2-[2-(2-hydroxy-5-methyl-3-nitro-phenyl)-quinolin-6-yl]-1H-b-
enzoimidazole-5-carboxylic acid 419 ##STR00109## 1
3',4'-dimethoxy-4-(pyrrolidinyl-1-carbonyl)-biphen-2-yl
quinolin-6-yl
1-cyclohexyl-2-{2-[3',4'-dimethoxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]-
quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid 420 ##STR00110##
1 4-methoxy-3'-nitro-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4-methoxy-3'-nitro-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid 421 ##STR00111## 1
4'-carboxy-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-carboxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-be-
nzoimidazole-5-carboxylic acid 422 ##STR00112## 1
3'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(3'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid 423 ##STR00113## 1 quinolin-4-yl
quinolin-6-yl
2-[2,4']biquinolinyl-6-yl-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid 424 ##STR00114## 2 2-bromo-phenylANDphenyl quinolin-6-yl
2-[2-(2-bromo-phenyl)-3-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidaz-
ole-5-carboxylic acid 425 ##STR00115## 2
3-methoxy-phenylAND3-methoxy-phenyl quinoxalin-6-yl
2-[2,3-bis-(3-methoxyphenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazol-
e-5-carboxylic acid 426 ##STR00116## 1 2,4-dimethyl-thiazol-5-yl
quinolin-6-yl
1-cyclohexyl-2-[2-(2,4-dimethyl-thiazol-5-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid 427 ##STR00117## 1 pyridin-2-yl
quinolin-6-yl
1-cyclohexyl-2-(2-pyridin-2-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid 428 ##STR00118## 1 4-phenoxy-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(4-phenoxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid 429 ##STR00119## 1 4-morpholin-4-yl-phenyl
quinolin-6-yl
1-cyclohexyl-2-[2-(4-morpholin-4-yl-phenyl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid 430 ##STR00120## 1
4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-{2-[4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl]-quinolin-6--
yl}-1H-benzoimidazole-5-carboxylic acid 431 ##STR00121## 1
1-(2-chloro-pyridin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydro-pyrimidin-5-yl
quinolin-6-yl
2-{2-[1-(2-chloro-pyridin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydro-pyrimidin-5--
yl]-quinolin-6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid
432 ##STR00122## 1 1H-pyrrol-3-yl quinolin-6-yl
1-cyclohexyl-2-[2-(1H-pyrrol-3-yl)-quinolin-6-yl]-1H-benzoimidazole-5-car-
boxylic acid 433 ##STR00123## 2 PhenylANDPhenyl-amino quinolin-6-yl
1-cyclohexyl-2-(2-phenyl-4-phenylamino-quinolin-6-yl)-1H-benzoimidazole-5-
-carboxylic acid 434 ##STR00124## 1 2-hydroxy-6-methoxy-phenyl
quinolin-6-yl
1-cyclohexyl-2-[2-(2-hydroxy-6-methoxy-phenyl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid 435 ##STR00125## 1
2-[4'-nitro-4-(pyrrolidinyl-1-carbonyl)-biphen-2-yl] quinolin-6-yl
1-cyclohexyl-2-{2-[4'-nitro-4-(pyrrolidinyl-1-carbonyl)biphen-2-yl]quinol-
in-6-yl}-1H-benzimidazole-5-carboxylic acid 436 ##STR00126## 1
4-methoxy-4'-trifluoro-methyl-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4-methoxy-4'-trifluoromethyl-biphen-2-yl)-quinolin-6-y-
l]-1H-benzoimidazole-5-carboxylic acid 437 ##STR00127## 1
3'-carboxy-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(3'-carbonyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-b-
enzoimidazole-5-carboxylic acid 438 ##STR00128## 1
4-methoxy-4'-methyl-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4-methoxy-4'-methyl-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid 439 ##STR00129## 1
4'-chloro-4-nitrobiphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-nitro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid 440 ##STR00130## 2
4'-chloro-biphen-2-ylANDphenyl quinolin-6-yl
2-[2-(4'-chloro-biphen-2-yl)-3-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid 441 ##STR00131## 2
4-methoxy-phenylAND4-methoxy-phenyl quinoxalin-6-yl
2-[2,3-bis-(4-methoxyphenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazol-
e-5-carboxylic acid 442 ##STR00132## 1 pyrazin-2-yl quinolin-6-yl
1-cyclohexyl-2-(2-pyrazin-2-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid
443 ##STR00133## 1 pyridin-4-yl quinolin-6-yl
1-cyclohexyl-2-(2-pyridin-4-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid 444 ##STR00134## 1 6-methyl-naphthalen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(6-methyl-naphthalen-2-yl)-quinolin-6-yl]-1H-benzoimida-
zole-5-carboxylic acid 445 ##STR00135## 1
3-(2-methoxy-ethoxy)-phenyl quinolin-6-yl
1-cyclohexyl-2-{2-[3-(2-methoxy-ethoxy)-phenyl]-quinolin-6-yl}-1H-benzoim-
idazole-5-carboxylic acid 446 ##STR00136## 1 2-nitro-phenyl
quinolin-6-yl
2-[6-(2-nitrophenyl)-quinolin-6-yl]-1H-benzoimidazole-5-carboxylic
acid 447 ##STR00137## 1
4'-chloro-4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl quinolin-6-yl
2-{2-[4'-chloro-4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl]-quinolin-6-yl}-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid 448 ##STR00138##
1 5-benzyl-oxy-2-methyl-benzofuran-3-yl quinolin-6-yl
2-[2-(5-benzyloxy-2-methyl-benzofuran-3-yl)-quinolin-6-yl]-1-cyclohexyl-1-
H-benzoimidazole-5-carboxylic acid 449 ##STR00139## 1
1-phenyl-1H-pyrazol-4-yl quinolin-6-yl
1-cyclohexyl-2-[2-(1-phenyl-1H-pyrazol-4-yl)-quinolin-6-yl]-1H-benzoimida-
zole-5-carboxylic acid 450 ##STR00140## 1 1H-pyrrol-2-yl
quinolin-6-yl
1-cyclohexyl-2-[2-(1H-pyrrol-2-yl)-quinolin-6-yl]-1H-benzoimidazole-5-car-
boxylic acid 451 ##STR00141## 1
(3-imidazol-1-yl-propyl-amino)-2-phenyl quinolin-6-yl
1-cyclohexyl-2-[4-(3-imidazol-1-yl-propylamino)-2-phenyl-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid 452 ##STR00142## 1
2-hydroxy-4,6-dimethoxy-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(2-hydroxy-4,6-dimethoxy-phenyl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid 453 ##STR00143## 1
4'-carboxy-4-(pyrrolidine-1-carbonyl)-biphen-2-yl quinolin-6-yl
2-{2-[4'-carboxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinolin-6-yl}-1-c-
yclohexyl-1H-benzoimidazole-5-carboxylic acid 454 ##STR00144## 1
2-furan-2-yl-5-methoxy-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(2-furan-2-yl-5-methoxy-phenyl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid 455 ##STR00145## 1
4'-fluoro-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid 456 ##STR00146## 1
4'-ethoxy-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[4'-ethoxy-4-methoxybiphen-2yl]-1H-benzoimidazole-5-carbox-
ylic acid 457 ##STR00147## 1 Diphenyl-methyl quinolin-6-yl
2-(2-dimethylphenylquinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbox-
ylic acid 458 ##STR00148## 2
4-dimethyl-amino-phenylAND4-dimethyl-amino-phenyl quinoxalin-6-yl
2-[2,3-bis-(4-dimethyl-aminophenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzi-
midazole-5-carboxylic acid 459 ##STR00149## 1
5,6,7,8-tetrahydro-naphthalen-2-yl quinolin-6-yl
1-cyclohexyl-2-[5,6,7,8-tetrahydronaphthalen-2-yl]-1H-benzoimidazole-5-ca-
rboxylic acid 460 ##STR00150## 1 2-hydroxy-naphthalen-1-yl
quinolin-6-yl
1-cyclohexyl-2-[2-(2-hydroxy-naphthalen-1-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid 461 ##STR00151## 1
4-(2-methoxy-ethoxy)-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-{2-[4-(2-methoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1H-be-
nzoimidazole-5-carboxylic acid 462 ##STR00152## 1
2-(4-benzyloxy-2-hydroxy-3-methyl-phenyl)- quinolin-6-yl
2-[2-(4-benzyloxy-2-hydroxy-3-methyl-phenyl)-quinolin-6-yl]-1-cyclohexyl--
1H-benzoimidazole-5-carboxylic acid 463 ##STR00153## 1
6-chloro-9-methyl-9H-carbazol-3-yl quinolin-6-yl
2-[2-(6-chloro-9-methyl-9H-carbazol-3-yl)-quinolin-6-yl]-1-cyclohexyl-1H--
benzoimidazole-5-carboxylic acid 464 ##STR00154## 1
3,5-dimethyl-1-phenyl-1H-pyrazol-4-yl quinolin-6-yl
1-cyclohexyl-2-[2-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-yl)-quinolin-6-yl]--
1H-benzoimidazole-5-carboxylic acid 465 ##STR00155## 1
3-oxo-3,4-dihydro-2H-benzo[1,4]-oxazin-6-yl quinolin-6-yl
1-cyclohexyl-2-[2-(3-oxo-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl)-quinolin-6-
-yl]-1H-benzoimidazole-5-carboxylic acid 466 ##STR00156## 2
hydrazinoANDphenyl quinolin-6-yl
1-cyclohexyl-2-(4-hydrazino-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-c-
arboxylic acid 467 ##STR00157## 2 phenylANDPhenyl-sulfanyl
quinolin-6-yl
1-cyclohexyl-2-(2-phenyl-4-phenylsulfanyl-quinolin-6-yl)-1H-benzoimidazol-
e-5-carboxylic acid 468 ##STR00158## 1 4,4'-dimethoxy-biphen-2-yl
quinolin-6-yl
1-cyclohexyl-2-[2-(4,4'-dimethoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid 469 ##STR00159## 1
4'-hydroxy-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4'-hydroxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-be-
nzoimidazole-5-carboxylic acid 470 ##STR00160## 1
5-methoxy-2-thiophen-2-yl-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(5-methoxy-2-thiophen-2-yl-phenyl)-quinolin-6-yl]-1H-be-
nzoimidazole-5-carboxylic acid 471 ##STR00161## 2
2-bromo-phenylANDmethyl quinolin-6-yl
2-[2-(2-bromo-phenyl)-4-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidaz-
ole-5-carboxylic acid 472 ##STR00162## 1
5-methyl-2-phenyl-thiophen-3-yl quinolin-6-yl
1-cyclohexyl-2-[2-(5-methyl-2-phenyl-thiophen-3-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid 473 ##STR00163## 1
4-imidazol-1-yl-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(4-imidazol-1-yl-phenyl)-quinolin-6-yl]-1H-benzoimidazo-
le-5-carboxylic acid 474 ##STR00164## 1 3-hydroxy-phenyl
quinolin-6-yl
1-cyclohexyl-2-[2-(3-hydroxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid 475 ##STR00165## 1
4'-chloro-4-(2-methoxy-ethoxy)-biphen-2-yl quinolin-6-yl
2-{2-[4'-chloro-4-(2-methoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1-cycloh-
exyl-1H-benzoimidazole-5-carboxylic acid 476 ##STR00166## 1
2-pyrazol-1-yl-eth-1-yl quinolin-6-yl
1-cyclohexyl-2-[2-(2-pyrazol-1-yl-eth-1-yl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid 477 ##STR00167## 1 2-bromo-phenyl
quinolin-6-yl
2-[2-(2-bromo-phenyl)-quinolin-6-yl]-3-cyclohexyl-3H-imidazo[4,5-b]pyridi-
ne-6-carboxylic 478 ##STR00168## 1 2,3-dihydro-benzofuran-5-yl
quinolin-6-yl
1-cyclohexyl-2-[2-(2,3-dihydro-benzofuran-5-yl)-quinolin-6-yl]-1H-benzoim-
idazole-5-carboxylic acid 479 ##STR00169## 1
3-(3,4-dichloro-phenyl)-isoxazol-5-yl quinolin-6-yl
1-cyclohexyl-2-{2-[3-(3,4-dichloro-phenyl)-isoxazol-5-yl]-quinolin-6-yl}--
1H-benzoimidazole-5-carboxylic acid 480 ##STR00170## 1
3-amino-5-phenyl-thiophen-2-yl quinolin-6-yl
2-[2-(3-amino-5-phenyl-thiophen-2-yl)-quinolin-6-yl]-1H-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid 481 ##STR00171## 2
Dimethyl-aminoANDphenyl quinolin-6-yl
1-cyclohexyl-2-(4-dimethylamino-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-
-5-carboxylic acid 482 ##STR00172## 1 3-bromo-phenyl quinolin-6-yl
2-[2-(3-bromo-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-5-car-
boxylic acid 483 ##STR00173## 1 4'-chloro-biphenyl-3-yl
quinolin-6-yl
2-[2-(4'-chloro-biphen-3-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazol-
e-5-carboxylic acid 484 ##STR00174## 1
2-(2,4-dimethoxy-pyrimidin-5-yl)-5-methoxy-phenyl quinolin-6-yl
1-cyclohexyl-2-{2-[2-(2,4-dimethoxy-pyrimidin-5-yl)-5-methoxy-phenyl]-qui-
nolin-6}-1H-benzoimidazole-5-carboxylic acid 485 ##STR00175## 2
2-(4'-chloro-biphen-2-yl)ANDmethyl quinolin-6-yl
2-[2-(4'-chloro-biphen-2-yl)-4-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid 486 ##STR00176## 1 3-methoxy-phenyl
quinolin-6-yl
1-cyclohexyl-2-[2-(3-methoxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid 487 ##STR00177## 1 4-hydroxy-biphen-2-yl
quinolin-6-yl
1-cyclohexyl-2-[2-(4-hydroxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid 488 ##STR00178## 1 4-piperazin-1-yl-phenyl
quinolin-6-yl
1-cyclohexyl-2-[2-(4-piperazin-1-yl-phenyl)-quinolin-6-yl]-1H-1H-benzoimi-
dazole-5-carboxylic acid 489 ##STR00179## 1 Dipropyl-amino-methyl
quinolin-6-yl
1-cyclohexyl-2-(2-dipropylaminomethyl-quinolin-6-yl)-1H-benzoimidazole-5--
carboxylic acid 490 ##STR00180## 1 4'-chloro-biphen-2-yl
quinolin-6-yl
2-[2-(4'-chlorobiphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imidazo[4,5-b]-
pyridine-6-carboxylic acid 491 ##STR00181## 1
4'-chloro-4-(2-dimethyl-aminoethyl-carbamoyl)-biphen-2-yl
quinolin-6-yl
2-{2-[4'-chloro-4-(2-dimethylamino-ethylcarbamoyl)-biphen-2-yl]-quinolin--
6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid 492
##STR00182## 1 2-chloro-4-(4-chloro-phenoxy)-phenyl quinolin-6-yl
2-{2-[2-chloro-4-(4-chloro-phenoxy)-phenyl]-quinolin-6-yl}-1-cyclohexyl-1-
H-benzoimidazole-5-carboxylic acid 493 ##STR00183## 1
5-methoxy-benzofuran-3-yl quinolin-6-yl
1-cyclohexyl-2-[2-(5-methoxy-benzofuran-3-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid 494 ##STR00184## 2 ethoxyANDphenyl
quinolin-6-yl
1-cyclohexyl-2-(4-ethoxy-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid 495 ##STR00185## 1 3,5-dimethoxy-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(3,5-dimethoxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-
-5-carboxylic acid 496 ##STR00186## 2 phenoxyANDphenyl
quinolin-6-yl
1-cyclohexyl-2-(4-phenoxy-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-car-
boxylic acid 497 ##STR00187## 1 1-carbamoyl-ethyl-carbamoyl
quinolin-6-yl
2-[2-(1-carbamoylethyl-carbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-benzimida-
zole-5-carboxylic acid 498 ##STR00188## 2 methylANDphenyl
quinolin-6-yl
1-cyclohexyl-2-(4-methyl-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid 499 ##STR00189## 1 4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid 500 ##STR00190## 1
4'-chloro-4-hydroxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid 501 ##STR00191## 1
4-acetylaminophenyl quinolin-6-yl
2-[2-(4-acetylamino-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-
-5-carboxylic acid 502 ##STR00192## 1
3-carboxy-methyl-2,2-dimethyl-cyclobutyl quinolin-6-yl
2-[2-(3-carboxymethyl-2,2-dimethyl-cyclobutyl)-quinolin-6-yl]-1-cyclohexy-
l-1H-benzoimidazole-5-carboxylic acid 503 ##STR00193## 1
3-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-phenyl quinolin-6-yl
1-cyclohexyl-2-{2-[3-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-phenyl]-quinolin-6--
yl}-1H-benzoimidazole-5-carboxylic acid 504 ##STR00194## 1
4-(2-dimethyl-aminoethyl-carbamoyl)-biphen-2-yl]- quinolin-6-yl
1-cyclohexyl-2-{2-[4-(2-dimethylamino-ethylcarbamoyl)-biphen-2-yl]-quinol-
in-6-yl}-1H-benzoimidazole-5-carboxylic acid 505 ##STR00195## 1
5-(4-chloro-phenyl)-2-methyl-furan-3-yl quinolin-6-yl
2-{2-[5-(4-chloro-phenyl)-2-methyl-furan-3-yl]-quinolin-6-yl}-1-cyclohexy-
l-1H-benzoimidazole-5-carboxylic acid 507 ##STR00196## 1
4'-chloro-4-(2-ethoxy-ethoxy)-biphen-2-yl quinolin-6-yl
2-{2-[4'-chloro-4-(2-ethoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid 508 ##STR00197## 1
3,4-dichloro-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(3,4-dichloro-phenyl)-quinolin-6-yl]-1H-benzoimidazole--
5-carboxylic acid 509 ##STR00198## 2
7-hydroxy-naphthalen-2-oxyANDphenyl quinolin-6-yl
1-cyclohexyl-2-[4-(7-hydroxy-naphthalen-2-yloxy)-2-phenyl-quinolin-6-yl]--
1H-benzoimidazole-5-carboxylic acid 510 ##STR00199## 1
4-chloro-phenyl-carbamoyl quinolin-6-yl
2-[2-(4-chlorophenylcarbamoyl)yl)quinolin-6-yl]-1-cyclohexyl-1H-benzimida-
zole-5-carboxylic acid 511 ##STR00200## 1
1-carbamoyl-2-methyl-propyl-carbamoyl quinolin-6-yl
2-[2-(1-carbamoyl-2-methylpropyl-carbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-
-benzimidazole-5-carboxylic acid 542 ##STR00201## 1
1-carbamoyl-2-phenyl-ethyl-carbamoyl quinolin-6-yl
2-[2-(1-carbamoyl-2-phenylethylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-b-
enzimidazole-5-carboxylic acid 543 ##STR00202## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(4-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid 544 ##STR00203## 1
2'-fluoro-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(2'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid 545 ##STR00204## 1
2-cyclohexyl-5-methoxy-phenyl quinolin-6-yl
1-cyclohexyl-2-[2-(2-cyclohexyl-5-methoxy-phenyl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid 546 ##STR00205## 1
(4-chloro-phenyl)methylcarbamoyl quinolin-6-yl
2-{2-[(4-chlorophenyl)methylcarbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benz-
imidazole-5-carboxylic acid 547 ##STR00206## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(4-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid 548 ##STR00207## 1
biphen-4-yl quinolin-6-yl
2-(2-biphen-4-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carboxyl-
ic acid 549 ##STR00208## 1
4'-fluoro-4-(pyrrolidin-1-ylcarbonyl)-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-{2-[4'-fluoro-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinol-
in-6-yl}-1H-benzimidazole-5-carboxylic acid 550 ##STR00209## 1
(4-chloro-phenyl)isopropylcarbamoyl quinolin-6-yl
2-{2-[(4-chlorophenyl)isopropylcarbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-b-
enzimidazole-5-carboxylic acid 551 ##STR00210## 1
(4-chloro-phenyl)cyclohexylcarbamoyl quinolin-6-yl
2-{2-[(4-chlorophenyl)cyclohexylcarbamoyl]quinolin-6-yl}-1-cyclohexyl-1H--
benzimidazole-5-carboxylic acid 552 ##STR00211## 1
4,2'-dimethoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4,2'-dimethoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid 554 ##STR00212## 1
4'-fluoro-4-methoxy-biphen-2-yl quinolin-6-yl Ethyl
1-cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid 555 ##STR00213## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxybiphen-2-yl)-quinolin-6-yl]-1-(3,3,5-trimethyl-c-
yclohexyl)-1H-benzoimidazole-5-carboxylic acid 556 ##STR00214## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(2-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid 557 ##STR00215## 1
4'-ethyl-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4'-ethyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid 558 ##STR00216## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-piperidin-4-yl-1H-
-benzoimidazole-5-carboxylic acid 559 ##STR00217## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
1-benzyl-2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoim-
idazole-5-carboxylic acid 560 ##STR00218## 1
3',4'-difluoro-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(3',4'-difluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid 561 ##STR00219## 1
4'-methoxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-{2-[4'-methoxy-4-(pyrrolidin-1-ylcarbonyl)biphen-2-yl]quin-
olin-6-yl}-1H-benzimidazole-5-carboxylic acid 562 ##STR00220## 1
3',5'-dichloro-4-methoxy-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(3',5'-dichloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid 563 ##STR00221## 1
4'-chloro-4-fluoro-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-fluoro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid 564 ##STR00222## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(1-ethyl-propyl)--
1H-benzoimidazole-5-carboxylic acid 565 ##STR00223## 1
8-(4-chloro-phenyl)-3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-yl
quinolin-6-yl
2-{2-[8-(4-chloro-phenyl)-3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-yl]-quin-
olin-6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid 566
##STR00224## 1 4'-chloro-4-methoxy-biphen-2-yl) quinolin-6-yl
2[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(tetrahydrofuran-2-
-yl-methyl)-1H-benzoimidazole-5-carboxylic acid 567 ##STR00225## 1
4,4'-dichloro-biphen-2-yl quinolin-6-yl
1-cyclohexyl-2-[2-(4,4'-dichloro-biphen-2-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid 568 ##STR00226## 1
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
1-bicyclo[2.2.1]hept-2-yl-2-]2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-
-6-yl]1H-benzoimidazole-5-carboxylic acid 569 ##STR00227## 1
4-amino-4'-chloro-biphen-2-yl quinolin-6-yl
2-[2-(4-amino-4'-chlorobiphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoi-
midazole-5-carboxylic acid ##STR00228## 2
fluoroAND4-carbamoyl-5-hydroxy-4'-nitrobiphen-2-yl quinolin-6-yl
2-[2-(4-carbamoyl-5-hydroxy-4'-nitro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid 573 ##STR00229##
1 methyl quinolin-6-yl
1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carboxylic
acid
TABLE-US-00002 TABLE II ##STR00230## Cmpd # Structure R.sup.8
R.sup.9 Y Het Name 229 ##STR00231## H
3-(5-hydroxy-1H-indol-3-yl)-propionic acid phenyl Quino-lin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid 230 ##STR00232##
H 3-(5-hydroxy-1H-indol-3-yl)-propionic acid methyl
Quino-lin-6-yl)-
2-{[1-cyclohexyl-2-(2-methyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid 231 ##STR00233##
H 3-hydroxy-propionic acid phenyl Quino-lin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-hydroxy-propionicacid 232 ##STR00234## H 6-amino-hexanoic
acid phenyl Quino-lin-6-yl
6-amino-2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-c-
arbonyl]-amino}-hexanoic acid 233 ##STR00235##
pyrrolidine-2-carboxylic acid phenyl Quino-lin-6-yl
1-[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]--
pyrrolidine-2-carboxylic acid 234 ##STR00236## H
3-(5-hydroxy-1H-indol-3-yl)-propionic acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(5-hydroxy-1H-indol-3-yl)propionic acid 235
##STR00237## H 3-(5-hydroxy-1H-indol-3-yl)-propionic acid
4'-chloro-4-(pyrr-olidine-1-car-bonyl)-biphen-2-yl Quin-olin-6-yl
2-[(2-{2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl-
}-1-cyclohexyl-1H-benzoimidazole-5-carbonyl)-amino]-3-(5-hydroxy-1H-indol--
3-yl)-propionic acid 236 ##STR00238## H
3-(5-hydroxy-1H-indol-3-yl)-propionic acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid 237
##STR00239## H pentanedioicacid phenyl Quin-olin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-pentanedioic acid 238 ##STR00240## H
3-(5-hydroxy-1H-indol-3-yl)-propionic acid phenyl Quin-olin-6-yl
2-{[1-cyclohexyl-2-(3-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)propionic acid 239 ##STR00241##
H propionic acid phenyl Quin-oxalin-6-yl
3-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-propionic acid 240 ##STR00242## H
3-biphenyl-4-ylpropionic acid phenyl Quin-oxalin-6-yl
3-biphenyl-4-yl-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimi-
dazole-5-carbonyl]-amino}-propionic acid 241 ##STR00243## H
3-(4-benzoyl-phenyl)-propionic acid phenyl Quin-oxalin-6-yl
3-(4-benzoyl-phenyl)-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-ben-
zoimidazole-5-carbonyl]-amino}-propionic acid 242 ##STR00244## H
3-cyclohexyl-propionic acid phenyl Quin-oxalin-6-yl
3-cyclohexyl-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidaz-
ole-5-carbonyl]-amino}-propionic acid 243 ##STR00245## H
cyclohexyl-acetic acid phenyl Quin-oxalin-6-yl
cyclohexyl-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole--
5-carbonyl]-amino}-acetic acid 244 ##STR00246## H succinic acid
phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-succinic acid 245 ##STR00247## H pentanedioicacid phenyl
Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-pentanedioic acid 246 ##STR00248## H 3-phenyl-propionic
acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l-amino}-3-phenyl-propionicacid 247 ##STR00249## H
3-(1H-imidazol-4-yl)-propionic acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(1H-imidazol-4-yl)-propionic acid 248 ##STR00250##
-pyrrolidine-2-carboxylic acid phenyl Quin-oxalin-6-yl
1-[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl-
]-4-hydroxy-pyrrolidine-2-carboxylic acid 249 ##STR00251## H
3-methyl-pentanoic acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-methyl-pentanoicacid 512 ##STR00252## H
3-hydroxy-butyric acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonl-
y]-amino}-3-hydroxy-butyricacid 513 ##STR00253## H
4-methyl-pentanoic acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-4-methyl-pentanoicacid 514 ##STR00254##
4-hydroxy-piperidin-1-y 2-(4'-chloro-biphen-2-yl)-7-fluoro-
Quin-olin-6-yl
{2-[2-(4'-chloro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazol-5-yl}-(4-hydroxy-piperidin-1-yl)-methanone 515
##STR00255## H 4-methylsulfanyl-butyric acid 2-phenyl
Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-4-methylsulfanyl-butyric acid 516 ##STR00256## H
3-(5-hydroxy-1H-indol-3-yl)-propionic acid 3-phenyl Quin-olin-7-yl
2-{[1-cyclohexyl-2-(3-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid 517 ##STR00257##
H 3-methyl-butyric acid 2-phenyl- Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-methyl-butyricacid 518 ##STR00258## H succinamicacid
2-phenyl- Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-succinamic acid 519 ##STR00259## H
3-(4-hydroxy-phenyl)-propionic acid 2-phenyl- Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(4-hydroxy-phenyl)-propionic acid 520 ##STR00260##
1,2,3,4-tetrahydro-isoquinoline-3-carboxylic acid 2-phenyl-
Quin-oxalin-6-yl
2-[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl-
]-1,2,3,4-tetrahydro-isoquinoline-3-carboxylicacid 521 ##STR00261##
4-methyl-piperazin-1-yl 4'-chloro-biphen-2-yl)-fluoro
Quin-olin-6-yl
{2-[2-(4'-chloro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazol-5-yl}-(4-methyl-piperazin-1-yl)-methanone 522
##STR00262## 4-methyl-piperazin-1-yl biphen-2-yl-fluoro
Quin-olin-6-yl
[2-(2-biphen-2-yl-7-fluoro-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazol-5-
-yl]-(4-methyl-piperazin-1-yl)-methanone 523 ##STR00263## H
5-guanidino-pentanoic acid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-5-guanidino-pentanoic acid 524 ##STR00264## H
ethanesulfonicacid phenyl Quin-oxalin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-ethanesulfonic acid 541 ##STR00265## H butyric acid
phenyl Quin-oxalin-6-yl
4-carbamoyl-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazo-
le-5-carbonyl]-amino}-butyric acid 250 ##STR00266## H
3-(5-Hydroxy-1H-indol-3-yl)-2-propionicacid phenyl Quin-olin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid 251 ##STR00267##
H 7-hydroxy-naphthalen-1-yl phenyl Quin-olin-6-yl
1-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-7-hydroxy-naphthalene 252 ##STR00268## H
5-hydroxy-naphthalen-1-yl phenyl Quin-olin-6-yl
1-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-5-hydroxy-naphthalene 253 ##STR00269## H
4-methyl-2-oxo-chromen-7-yl phenyl Quin-olin-6-yl
7-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-4-methyl-2-oxo-chromene 254 ##STR00270## H morpholin-4-yl
phenyl Quin-olin-6-yl
{2-[2-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazol-5-yl}-(morpholi-
n-4-yl)-methanone 255 ##STR00271## H Ethanesulfonicacid-1-yl phenyl
Quin-olin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-ethanesulfonic acid 570 ##STR00272## H H
4'-fluoro-4-methoxy-biphen-2-yl Quin-olin-6-yl
1-cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylicacid amide 574 ##STR00273## H
morpholin-4-yl phenyl Quin-oxalin-6-yl
1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylica-
cid morpholin-4-ylamide 575 ##STR00274## H
7-hydroxy-naphthalen-1-yl phenyl Quin-oxalin-6-yl
1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylica-
cid (7-hydroxy-naphthalen-1-yl)-amide 576 ##STR00275## H
5-hydroxy-naphthalen-1-yl phenyl Quin-oxalin-6-yl
1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylica-
cid (5-hydroxy-naphthalen-1-yl)-amide 577 ##STR00276## H
4-methyl-2-oxo-2H-chromen-7-yl phenyl Quin-oxalin-6-yl
1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylica-
cid (4-methyl-2-oxo-2H-chromen-7-yl)-amide
TABLE-US-00003 TABLE III ##STR00277## Cmpd # Structure Y Het Name
256 ##STR00278## phenyl quinolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-phenylquinol-
ine 257 ##STR00279## methyl quinolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methylquinol-
ine 258 ##STR00280## phenyl quinoxalin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-phenylquinox-
aline 259 ##STR00281##
4'-chloro-4-(pyrrolidin-1-ylcarbonyl)-biphen-2-yl quinoxalin-6-yl
(4'-chloro-2-{6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]--
quinolin-2-yl}-biphen-4-yl)-pyrrolidin-1-yl-methanone 260
##STR00282## phenyl quinoxalin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-3-phenylquinox-
aline 261 ##STR00283## phenyl pteridin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-phenylpterid-
ine 262 ##STR00284## methyl pteridin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methylpterid-
ine 263 ##STR00285## phenyl cinnolin-3-yl
3-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-7-phenylcinnol-
ine 264 ##STR00286## methyl cinnolin-3-yl
3-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-7-methylcinnol-
ine 265 ##STR00287## phenyl [1,8]naph-thyridin-3-yl
3-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-7-phenyl[1,8]n-
aphthyridine 266 ##STR00288## methyl [1,8]naph-thyridin-3-yl
3-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-7-methyl[1,8]n-
aphthyridine 267 ##STR00289## phenyl [1,8]naph-thyridin-3-yl
3-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-6-phenyl[1,8]n-
aphthyridine 268 ##STR00290## methyl [1,8]naph-thyridin-3-yl
3-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-6-methyl[1,8]n-
aphthyridine 269 ##STR00291## phenyl
1,2,3,4-tetrahydro-quinolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-phenyl-1,2,3-
,4-tetrahydroquinoline 270 ##STR00292## methyl
1,2,3,4-tetrahydro-quinolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methyl-1,2,3-
,4-tetrahydroquinoline 271 ##STR00293## methyl
4-oxo-2H-chromen-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-3-methyl-4-oxo-
-2H-chromene 272 ##STR00294## methyl 2-oxo-2H-chromen-7-yl
7-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-3-methyl-2-oxo-
-2H-chromene 273 ##STR00295## methyl
1,4-dioxo-1,2,3,4-tetrahydro-phthalazin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methyl-1,4-d-
ioxo-1,2,3,4-tetrahydro-phthalazine 274 ##STR00296## methyl
1,1-dioxo-1,4-dihydro-1.lamda.6-benzo-[1,2,4]thia-diazin-7-yl
7-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-3-methyl-1,1-d-
ioxo-1,4-dihydro-1.lamda.6-benzo[1,2,4]thiadiazine 275 ##STR00297##
4-oxo-1,4-dihydro-quinazolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-4-oxo-1,4-dihy-
dro-quinazoline 276 ##STR00298## methyl Isoquinolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-3-methyl-isoqu-
inoline 277 ##STR00299## methyl 1,4-dihydro-isoquinolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-3-methyl-1,4-d-
ihydro-isoquinoline 278 ##STR00300## methyl quinazolin-7-yl
7-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methyl-quina-
zoline 279 ##STR00301## methyl quinoxalin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methyl-quino-
xaline 280 ##STR00302## methyl [1,5]naph-thyridin-2-yl
2-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-6-methyl-[1,5]-
naphthyridine 281 ##STR00303## methyl
4-oxo-1,4-dihydro-quinolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methyl-4-oxo-
-1,4-dihydro-quinoline 282 ##STR00304## methyl
4-oxo-1,4-dihydro-quinazolin-6-yl
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-methyl-4-oxo-
-1,4-dihydro-quinazloine 525 ##STR00305##
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-(4'-chloro-4-methoxy-biphen-2-yl)-6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)--
1H-benzoimidazol-2-yl]-quinoline
TABLE-US-00004 TABLE IV ##STR00306## Cmpd # Structure R.sup.4 Y Het
Name 283 ##STR00307## methyl Phenyl quinolin-6-yl
N-[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazol-5-ylcarbonyl]-
-N-(methylsulfonyl)amine 284 ##STR00308## phenyl Methyl
quinolin-6-yl
N-[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazol-5-ylcarbonyl]-
-N-(phenylsulfonyl)amine 285 ##STR00309## methyl Phenyl
Quin-oxalin-6-yl
N-[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazol-5-ylcarbony-
l]-N-(methylsulfonyl)amine 286 ##STR00310## phenyl
4'-chloro-4-(pyrrol-idine-1-carbonyl)-biphen-2-yl quinolin-6-yl
N-[1-cyclohexyl-2-(2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-q-
uinoxalin-6-yl)-1H-benzoimidazol-5-ylcarbonyl]-N-(phenylsulfonyl)amine
287 ##STR00311## methyl phenyl Quin-oxalin-6-yl
N-[1-cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazol-5-ylcarbony-
l]-N-(methylsulfonyl)amine 288 ##STR00312## phenyl phenyl
pteridin-6-yl
N-[1-cyclohexyl-2-(2-phenyl-pteridin-6-yl)-1H-benzoimidazol-5-ylcarbonyl]-
-N-(phenylsulfonyl)amine 289 ##STR00313## methyl methyl
pteridin-6-yl
N-[1-cyclohexyl-2-(2-methyl-pteridin-6-yl)-1H-benzoimidazol-5-ylcarbonyl]-
-N-(methylsulfonyl)amine 290 ##STR00314## phenyl phenyl
cinnolin-3-yl
N-[1-cyclohexyl-2-(7-phenyl-cinnolin-3-yl)-1H-benzoimidazol-5-ylcarbonyl]-
-N-(phenylsulfonyl)amine 291 ##STR00315## methyl methyl
cinnolin-3-yl
N-[1-cyclohexyl-2-(7-methyl-cinnolin-3-yl)-1H-benzoimidazol-5-ylcarbonyl]-
-5-(methylsulfonyl)amine 292 ##STR00316## phenyl phenyl
[1,8]naph-thyridin-3-yl
N-[1-cyclohexyl-2-(7-phenyl-[1,8]naphthyridin-3-yl)-1H-benzoimidazol-5-yl-
carbonyl]-N-(phenylsulfonyl)amine 293 ##STR00317## methyl methyl
[1,8]naph-thyridin-3-yl
N-[1-cyclohexyl-2-(7-methyl-[1,8]naphthyridin-3-yl)-1H-benzoimidazol-5-yl-
carbonyl]-N-(methylsulfonyl)amine 294 ##STR00318## phenyl phenyl
[1,8]naph-thyridin-3-yl
N-[1-cyclohexyl-2-(6-phenyl-[1,8]naphthyridin-3-yl)-1H-benzoimidazol-5-yl-
carbonyl]-N-(phenylsulfonyl)amine 295 ##STR00319## methyl methyl
[1,8]naph-thyridin-3-yl
N-[1-cyclohexyl-2-(6-methyl-[1,8]naphthyridin-3-yl)-1H-benzoimidazol-5-yl-
carbonyl]-N-(methylsulfonyl)amine 296 ##STR00320## phenyl phenyl
1,2,3,4-tetra-hydro-quinolin-6-yl
N-[1-cyclohexyl-2-(2-phenyl-1,2,3,4-tetrahydroquinolin-6-yl)-1H-benzoimid-
azol-5-ylcarbonyl]-N-(phenylsulfonyl)amine 297 ##STR00321## methyl
methyl 1,2,3,4-tetra-hydro-quinolin-6-yl
N-[1-cyclohexyl-2-(2-methyl-1,2,3,4-tetrahydroquinolin-6-yl)-1H-benzoimid-
azol-5-ylcarbonyl]-N-(methylsulfonyl)amine 298 ##STR00322## phenyl
methyl 4-oxo-2H-chromen-6-yl
N-[1-cyclohexyl-2-(3-methyl-4-oxo-2H-chromen-6-yl)-1H-benzoimidazol-5-ylc-
arbonyl]-N-(phenylsulfonyl)amine 299 ##STR00323## methyl methyl
2-oxo-2H-chromen-7-yl
N-[1-cyclohexyl-2-(3-methyl-2-oxo-2H-chromen-7-yl)-1H-benzoimidazol-5-ylc-
arboynl]-N-(methylsulfonyl)amine 300 ##STR00324## phenyl methyl
1,4-dioxo-1,2,3,4-tetra-hydro-phthal-azin-6-yl
N-[1-cyclohexyl-2-(2-methyl-1,4-dioxo-1,2,3,4-tetrahydro-phthalazin-6-yl)-
-1H-benzoimidazol-5-ylcarbonyl]-N-(phenylsulfonyl)amine 301
##STR00325## methyl methyl
1m1-dioxo-1,4-dihydro-1.lamda.6-benzo-[1,2,4]-thiadi-azin-7-yl
N-[1-cyclohexyl-2-(3-methyl-1,1-dioxo-1,4-dihydro-1.lamda.6-benzo[1,2,4]t-
hiadiazin-7-yl)-1H-benzoimidazol-5-ylcarbonyl]-N-(methylsulfonyl)amine
302 ##STR00326## phenyl 4-oxo-1,4-dihydro-quinazolin-6-yl
N-[1-cyclohexyl-2-(4-oxo-1,4-dihydro-quinazolin-6-yl)-1H-benzoimidazol-5--
ylcarbonyl]-N-(phenylsulfonyl)amine 303 ##STR00327## methyl methyl
isoquino-lin-6-yl
N-[1-cyclohexyl-2-(3-methyl-isoquinolin-6-yl)-1H-benzoimidazol-5-ylcarbon-
yl]-N-(methylsulfonyl)amine 304 ##STR00328## phenyl methyl
1,4-dihydro-isoquin-olin-6-yl
N-[1-cyclohexyl-2-(3-methyl-1,4-dihydro-isoquinolin-6-yl)-1H-benzoimidazo-
l-5-ylcarbonyl]-N-(phenylsulfonyl)amine 305 ##STR00329## methyl
methyl Quin-azolin-7-yl
N-[1-cyclohexyl-2-(2-methyl-quinazolin7-yl)-1H-benzoimidazol-5-ylcarbonyl-
]-N-(methylsulfonyl)amine 306 ##STR00330## phenyl methyl
Quin-oxalin-6-yl
N-[1-cyclohexyl-2-(2-methyl-quinoxalin-6-yl)-1H-benzoimidazol-5-ylcarbony-
l]-N-(phenylsulfonyl)amine 307 ##STR00331## methyl methyl
[1,5]naph-thyridin-2-yl
N-[1-cyclohexyl-2-(6-methyl-[1,5]naphthyridin-2-yl)-1H-benzoimidazol-5-yl-
carbonyl]-N-(methylsulfonyl)amine 308 ##STR00332## phenyl methyl
4-oxo-1,4-dihydro-quinolin-6-yl
N-[1-cyclohexyl-2-(2-methyl-4-oxo-1,4-dihydro-quinolin-6-yl)-1H-benzoimid-
azol-5-ylcarbonyl]-N-(phenylsulfonyl)amine 309 ##STR00333## methyl
methyl 4-oxo-1,4-dihydro-quinazolin-6-yl
N-[1-cyclohexyl-2-(2-methyl-4-oxo-1,4-dihydro-quinazolin-6-yl)-1H-benzoim-
idazol-5-ylcarbonyl]-N-(methylsulfonyl)amine
TABLE-US-00005 TABLE V ##STR00334## Cmpd # Structure R.sup.2
R.sup.2' Y Het-Y Name 310 ##STR00335## methyl H phenyl
quinoxalin-6-yl
2-[(2-(2-phenyl-quinoxalin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbony-
l)-amino]-propionic acid 311 ##STR00336## H H phenyl
quinoxalin-6-yl
{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-aceticacid 312 ##STR00337## methyl H methyl quinoxalin-6-yl
2-[(2-(2-methyl-quinoxalin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbony-
l)-amino]-propionic acid 313 ##STR00338## H H methyl
quinoxalin-6-yl
{[1-cyclohexyl-2-(2-methyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-aceticacid 314 ##STR00339## methyl H methyl quinolin-6-yl
2-[(2-(2-methyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbonyl)-
-amino]-propionic acid 315 ##STR00340## H H methyl quinolin-6-yl
{[1-cyclohexyl-2-(2-methyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-a-
mino}-aceticacid 316 ##STR00341## methyl H phenyl quinoxalin-6-yl
2-[(2-(3-phenyl-quinoxalin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbony-
l)-amino]-propionic acid 317 ##STR00342## H H phenyl
quinoxalin-6-yl
{[1-cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-aceticacid 318 ##STR00343## methyl H
4'-chloro-4-(pyrro-lidin-1-ylcar-bonyl)-biphen-2-yl quinolin-6-yl
2-[(2-{2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl-
}-1-cyclohexyl-1H-benzoimidazole-5-carbonyl)-amino]-propionic acid
319 ##STR00344## H H
4'-chloro-4-(pyrro-lidin-1-ylcar-bonyl)-biphen-2-yl quinolin-6-yl
2-[(2-{2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl-
}-1-cyclohexyl-1H-benzoimidazole-5-carbonyl)-amino]-aceticacid
TABLE-US-00006 TABLE VI ##STR00345## Cmpd # R.sup.6-COOH Y Het Name
320 ##STR00346## 1-phenyl-1H-pyrazole-4-carboxylic acid-5-yl phenyl
quinolin-6-yl
5-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-1-phenyl-1H-pyrazole-4-carboxylicacid 321 ##STR00347##
nicotinic acid-6-yl phenyl quinolin-6-yl
5-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-nicotinicacid 322 ##STR00348## naphthalene-2-carboxylic
acid-6-yl phenyl quinolin-6-yl
6-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-naphthalene-2-carboxylicacid 323 ##STR00349## phenylacetic
acid-4-yl phenyl quinolin-6-yl
4-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-phenylacetic acid 324 ##STR00350## phthalic acid-4-yl
phenyl quinolin-6-yl
4-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-phthalicacid 325 ##STR00351## pyrazine-2-carboxylic
acid-3-yl phenyl quinolin-6-yl
3-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-pyrazine-2-carboxylic acid 326 ##STR00352##
2-hydroxy-benzoicacid-5-yl phenyl quinolin-6-yl
5-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-2-hydroxy-benzoic acid 327 ##STR00353## benzoic acid-5-yl
phenyl quinolin-6-yl
5-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-benzoicacid 328 ##STR00354## thiophene-3-carboxylic
acid-2-yl phhenyl quinolin-6-yl
2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-thiophene-3-carboxylic acid 526 ##STR00355##
naphthalene-2-carboxylic acid phenyl Quin-oxalin-6-yl
6-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-naphthalene-2-carboxylicacid
TABLE-US-00007 TABLE VII ##STR00356## Cmpd # Structure W R.sup.7 R
Y Het Name 527 ##STR00357## CH H isopropyl
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-isopropyl-1H-benz-
oimidazole-5-carboxylic acid 528 ##STR00358## CH H Cyclo-propyl
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopropyl-1H-be-
nzoimidazole-5-carboxylic acid 529 ##STR00359## CH H Cyclo-pentyl
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopentyl-1H-be-
nzoimidazole-5-carboxylic acid 530 ##STR00360## CH H isobutyl
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-isobutyl-1H-benzo-
imidazole-5-carboxylic acid 531 ##STR00361## CH H
Cyclo-propyl-methyl 4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopropylmethyl-
-1H-benzimidazole-5-carboxylic acid 532 ##STR00362## CH H
2-methyl-butyl 4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(3-methyl-butyl)--
1H-benzoimidazole-5-carboxylic acid 533 ##STR00363## CH H
2-(N,N-di-methyl)-ethyl 4'-chloro-4-methoxy-biphen-2-yl
quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(2-dimethylamino--
ethyl)-1H-benzoimidazole-5-carboxylic acid 534 ##STR00364## CH H
ethyl 4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxybiphen-2-yl)-quinolin-6-yl]-1-ethyl-1H-benzoimid-
azole-5-carboxylic acid 535 ##STR00365## N H Cyclo-hexyl
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imi-
dazo[4,5-b]pyrridin-6-carboxylic acid 536 ##STR00366## CH H
Cyclo-hexyl 4'-chloro-4-methoxy-biphhen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-1H-ind-
ole-6-carboxylic acid 537 ##STR00367## N H Cyclo-hexyl
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imi-
dazo[4,5-b]pyridine-6-carboxcylic acid 538 ##STR00368## N ethyl
Cyclo-hexyl 4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-[2-(4'-chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imi-
dazo[4,5-b]pyridine-6-carboxylic acid ethyl ester 539 ##STR00369##
N H Cyclo-hexyl 4'-chloro-4-(pyrrolidin-1-ylcarbonyl)-biphen-2-yl
quinolin-6-yl
2-{2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl}-3--
cyclohexyl-3H-imidazo[4,5-b]pyridine-6-carboxylic acid 571
##STR00370## CH H Cyclo-hexyl 4'-chloro-4-methoxy-biphen-2-yl
quinolin-6-yl
2-[2-(4'-chloro-4-methoxybiphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-benz-
oimidazole-5-carboxylic acid 572 ##STR00371## CH H Cyclo-hexyl
4'-chloro-4-methoxy-biphen-2-yl quinolin-6-yl
2-(4'-chloro-4-methoxybiphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-benzoim-
idazole-4-carboxylic acid 402a ##STR00372## CH Et Cyclo-hexyl
carboxylicacid quinolin-6-yl
6-(1-cyclohexyl-5-ethoxycarbonyl-1H-benzimidazol-2-yl)quinoline-2-carboxy-
licacid 578 ##STR00373## CH H trans-2-hydroxy-cyclo-hexyl phenyl
Quin-oxalin-6-yl
1-(trans-2-hydroxy-cyclohexyl)-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimida-
zole-5-carboxylic acid 579 ##STR00374## CH H
trans-4-hydroxy-cyclo-hexyl phenyl Quin-oxalin-6-yl
1-(trans-4-hydroxy-cyclohexyl)-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimida-
zole-5-carboxylic acid
TABLE-US-00008 TABLE VIII Cmpd # Structure W R.sup.7 R Y Het Name
540 ##STR00375## CH H cyclo-hexyl
4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl quinolin-6-yl
{4'-chloro-2-[6-(1-cyclohexyl-1H-benzoimidazol-2-yl)-quinolin-2-yl]-biphe-
n-4-yl}-pyrrolidin-1-yl-methanone
[0172] In still another embodiment the present invention is
contemplated to include the following compounds [0173]
N-[1-cyclohexyl-2-(4-oxo-1,4-dihydro-quinazolin-6-yl)-1H-benzoimidazol-5--
ylcarbonyl]-N-(phenylsulfonyl)amine; [0174]
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-4-oxo-1,4-dihy-
dro-quinazoline; [0175]
1-cyclohexyl-2-(4-oxo-1,4-dihydro-quinazolin-6-yl)-1H-benzoimidazole-5-ca-
rboxylic acid; and
[0176] pharmaceutically acceptable tautomers and salts thereof.
[0177] This invention is also directed to pharmaceutical
compositions comprising a pharmaceutically acceptable diluent and a
therapeutically effective amount of one of the compounds described
herein or mixtures of one or more of such compounds.
[0178] This invention is still further directed to methods for
treating a viral infection mediated at least in part by a virus in
the flaviviridae family of viruses, such as HCV, in mammals which
methods comprise administering to a mammal, that has been diagnosed
with said viral infection or is at risk of developing said viral
infection, a pharmaceutical composition comprising a
pharmaceutically acceptable diluent and a therapeutically effective
amount of one of the compounds described herein or mixtures of one
or more of such compounds.
[0179] In yet another embodiment of the invention, methods of
treating or preventing viral infections in mammals are provided
where in the compounds of this invention are administered in
combination with the administration of a therapeutically effective
amount of one or more agents active against HCV. Active agents
against HCV include ribavirin, levovirin, thymosin alpha-1, an
inhibitor of NS3 serine protease, and inhibitor of inosine
monophosphate dehydrogenase, interferon-alpha, pegylated
interferon-alpha, alone or in combination with ribavirin or
levovirin. Preferably the additional agent active against HCV is
interferon-alpha or pegylated interferon-alpha alone or in
combination with ribavirin or levovirin.
DETAILED DESCRIPTION OF THE INVENTION
[0180] The invention is directed to compounds, compositions and
methods for treating Flaviviridae family viral infections. However,
prior to describing this invention in detail, the following terms
will first be defined.
DEFINITIONS
[0181] Before the present invention is described in detail, it is
to be understood that, unless otherwise indicated, this invention
is not limited to any particular composition or pharmaceutical
carrier, as such may vary. It is also to be understood that the
terminology used herein is for the purpose of describing particular
embodiments only and is not intended to limit the scope of the
present invention.
[0182] It must be noted that as used herein and in the claims, the
singular forms "a," "and" and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "pharmaceutically acceptable diluent" in a composition
includes two or more pharmaceutically acceptable diluents, and so
forth.
[0183] In this specification and in the claims that follow,
reference will be made to a number of terms that shall be defined
to have the following meanings:
[0184] As used herein, "alkyl" refers to monovalent alkyl groups
having from 1 to 10 carbon atoms, preferably from 1 to 5 carbon
atoms and more preferably 1 to 3 carbon atoms. This term is
exemplified by groups such as methyl, ethyl, n-propyl, iso-propyl,
n-butyl, t-butyl, n-pentyl and the like.
[0185] "Substituted alkyl" refers to an alkyl group having from 1
to 3, and preferably 1 to 2, substituents selected from the group
consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy,
amino, substituted amino, aminoacyl, aryl, substituted aryl,
aryloxy, substituted aryloxy, cyano, halogen, hydroxy, nitro,
carboxy, carboxy ester, cycloalkyl, substituted cycloalkyl,
heteroaryl, substituted heteroaryl, heterocyclic, and substituted
heterocyclic.
[0186] As used herein, "alkylene" refers to straight chain and
branched divalent alkyl groups having from 1 to 10 carbon atoms,
preferably from 1 to 5 carbon atoms and more preferably 1 to 3
carbon atoms. This term is exemplified by groups such as methylene,
ethylene, propylene, butylene, and the like.
[0187] "Substituted alkylene" refers to an alkylene group having
from 1 to 3, and preferably 1 to 2, substituents selected from the
group consisting of alkoxy, substituted alkoxy, acyl, acylamino,
acyloxy, amino, substituted amino, aminoacyl, aryl, substituted
aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxy, nitro,
carboxy, carboxy ester, cycloalkyl, substituted cycloalkyl,
heteroaryl, substituted heteroaryl, heterocyclic, and substituted
heterocyclic.
[0188] "Alkoxy" refers to the group "alkyl-O--" which includes, by
way of example, methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy,
t-butoxy, sec-butoxy, n-pentoxy and the like.
[0189] "Substituted alkoxy" refers to the group "substituted
alkyl-O--".
[0190] "Acyl" refers to the groups H--C(O)--, alkyl-C(O)--,
substituted alkyl-C(O)--, alkenyl-C(O)--, substituted
alkenyl-C(O)--, alkynyl-C(O)--, substituted
alkynyl-C(O)-cycloalkyl-C(O)--, substituted cycloalkyl-C(O)--,
aryl-C(O)--, substituted aryl-C(O)--, heteroaryl-C(O)--,
substituted heteroaryl-C(O), heterocyclic-C(O)--, and substituted
heterocyclic-C(O)--.
[0191] "Acylamino" refers to the group --C(O)NR.sup.20R.sup.21
where R.sup.20 and R.sup.21 is independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclic, substituted heterocyclic and
where R.sup.20 and R.sup.21 are joined to form together with the
nitrogen atom a heterocyclic or substituted heterocyclic ring.
[0192] "Acyloxy" refers to the groups alkyl-C(O)O--, substituted
alkyl-C(O)O--, alkenyl-C(O)O--, substituted alkenyl-C(O)O--,
alkynyl-C(O)O--, substituted alkynyl-C(O)O--, aryl-C(O)O--,
substituted aryl-C(O)O--, cycloalkyl-C(O)O--, substituted
cycloalkyl-C(O)O--, heteroaryl-C(O)O--, substituted
heteroaryl-C(O)O--, heterocyclic-C(O)O--, and substituted
heterocyclic-C(O)O--.
[0193] "Alkenyl" refers to alkenyl group having from 2 to 10 carbon
atoms, preferably having from 2 to 6 carbon atoms, and more
preferably 2 to 4 carbon atoms and having at least 1 and preferably
from 1-2 sites of alkenyl unsaturation.
[0194] "Substituted alkenyl" refers to alkenyl groups having from 1
to 3 substituents, and preferably 1 to 2 substituents, selected
from the group consisting of alkoxy, substituted alkoxy, acyl,
acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl,
substituted aryl, aryloxy, substituted aryloxy, cyano, halogen,
hydroxy, nitro, carboxy, carboxy ester, cycloalkyl, substituted
cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and
substituted heterocyclic.
[0195] "Alkynyl" refers to alkynyl group having from 2 to 10 carbon
atoms, preferably having from 2 to 6 carbon atoms, and more
preferably 2 to 3 carbon atoms and having at least 1 and preferably
from 1-2 sites of alkynyl unsaturation.
[0196] "Substituted alkynyl" refers to alkynyl groups having from 1
to 3 substituents, and preferably 1 to 2 substituents, selected
from the group consisting of alkoxy, substituted alkoxy, acyl,
acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl,
substituted aryl, aryloxy, substituted aryloxy, cyano, halogen,
hydroxy, nitro, carboxy, carboxy ester, cycloalkyl, substituted
cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and
substituted heterocyclic.
[0197] "Amino" refers to the group --NH.sub.2.
[0198] "Substituted amino" refers to the group --NR.sup.22R.sup.23
where R.sup.22 and R.sup.23 are independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclic, substituted heterocyclic and
where R.sup.22 and R.sup.23 are joined, together with the nitrogen
bound thereto to form a heterocyclic or substituted heterocyclic
group provided that R.sup.22 and R.sup.23 are both not hydrogen.
When R.sup.22 is hydrogen and R.sup.23 is alkyl, the substituted
amino group is sometimes referred to herein as alkylamino. When
R.sup.22 and R.sup.23 are alkyl, the substituted amino group is
sometimes referred to herein as dialkylamino.
[0199] "Aminoacyl" refers to the groups --NR.sup.24C(O)alkyl,
--NR.sup.24C(O)substituted alkyl, --NR.sup.24C(O)-cycloalkyl,
--NR.sup.24C(O)substituted cycloalkyl, --NR.sup.24C(O)alkenyl,
--NR.sup.24C(O)substituted alkenyl, --NR.sup.24C(O)alkynyl,
--NR.sup.24C(O)substituted alkynyl, --NR.sup.24C(O)aryl,
--NR.sup.24C(O)substituted aryl, --NR.sup.24C(O)heteroaryl,
--NR.sup.24C(O)substituted heteroaryl, --NR.sup.24C(O)heterocyclic,
and --NR.sup.24C(O)substituted heterocyclic where R.sup.24 is
hydrogen or alkyl.
[0200] The term "aminocarbonylamino" refers to the group
--NR.sup.25C(O)NR.sup.26R.sup.27 where R.sup.25 is hydrogen or
alkyl and R.sup.26 and R.sup.27 are independently selected from the
group consisting of hydrogen, alkyl, substituted alkyl, alkenyl,
substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclic, substituted heterocyclic and
where R.sup.26 and R.sup.27 are joined, together with the nitrogen
bound thereto to form a heterocyclic or substituted heterocyclic
group.
[0201] The term "aminocarbonyloxy" refers to the group
--NR.sup.28C(O)OR.sup.29 where R.sup.28 is hydrogen or alkyl and
R.sup.29 is selected from the group consisting of alkyl,
substituted alkyl, alkenyl, substituted alkenyl, alkynyl,
substituted alkynyl, aryl, substituted aryl, cycloalkyl,
substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl,
heteroaryl, substituted heteroaryl, heterocyclic and substituted
heterocyclic.
[0202] "Aryl" or "Ar" refers to a monovalent aromatic carbocyclic
group of from 6 to 14 carbon atoms having a single ring (e.g.,
phenyl) or multiple condensed rings (e.g., naphthyl or anthryl)
which condensed rings may or may not be aromatic (e.g.,
2-benzoxazolinone, 2H-1,4-benzoxazin-3(4H)-one-7-yl, and the like)
provided that the point of attachment is to an aromatic ring atom.
Preferred aryls include phenyl and naphthyl.
[0203] "Substituted aryl" refers to aryl groups which are
substituted with from 1 to 3 substituents, and preferably 1 to 2
substituents, selected from the group consisting of hydroxy, acyl,
acylamino, acyloxy, alkyl, substituted alkyl, alkoxy, substituted
alkoxy, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl,
amino, substituted amino, aminoacyl, aryl, substituted aryl,
aryloxy, substituted aryloxy, cycloalkoxy, substituted cycloalkoxy,
carboxy, carboxy esters, cyano, thiol, cycloalkyl, substituted
cycloalkyl, halo, nitro, heteroaryl, substituted heteroaryl,
heterocyclic, substituted heterocyclic, heteroaryloxy, substituted
heteroaryloxy, heterocyclyloxy, and substituted
heterocyclyloxy.
[0204] "Aryloxy" refers to the group aryl-O-- that includes, by way
of example, phenoxy, naphthoxy, and the like.
[0205] "Substituted aryloxy" refers to substituted aryl-O--
groups.
[0206] "Carboxy" refers to --COOH or salts thereof.
[0207] "Carboxy esters" refers to the groups --C(O)O-alkyl,
--C(O)O-substituted alkyl, --C(O)O-alkenyl, --C(O)O-substituted
alkenyl, --C(O)O-alkynyl, --C(O)O-substituted alkynyl,
--C(O)O-aryl, --C(O)O-substituted aryl, --C(O)O-heteroaryl,
--C(O)O-substituted heteroaryl, --C(O)O-heterocyclic, and
--C(O)O-substituted heterocyclic. Preferred carboxy esters are
--C(O)O-alkyl, --C(O)O-substituted alkyl, --C(O)O-aryl, and
--C(O)O-substituted aryl.
[0208] "Cycloalkyl" refers to cyclic alkyl groups of from 3 to 10
carbon atoms having single or multiple cyclic rings optionally
comprising 1 to 3 exo carbonyl or thiocarbonyl groups. Suitable
cycloalkyl groups include, by way of example, adamantyl,
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclooctyl,
3-oxocyclohexyl, and the like. In multiple condensed rings, one or
more of the rings may be other than cycloalkyl (e.g., aryl,
heteroaryl or heterocyclic) provided that the point of attachment
is to a carbon ring atom of the cycloalkyl group. In one
embodiment, the cycloalkyl group does not comprise 1 to 3 exo
carbonyl or thiocarbonyl groups. In another embodiment, the
cycloalkyl group does comprise 1 to 3 exo carbonyl or thiocarbonyl
groups. It is understood, that the term "exo" refers to the
attachment of a carbonyl or thiocarbonyl to a carbon ring atom of
the cycloalkyl group.
[0209] In a preferred embodiment, cycloalkyl includes alkyl groups
of from 3 to 10 carbon atoms having single or multiple cyclic rings
including, by way of example, adamantyl, cyclopropyl, cyclobutyl,
cyclopentyl, cyclooctyl, and the like.
[0210] "Cycloalkenyl" refers to cyclic alkenyl groups of from 4 to
10 carbon atoms having single or multiple cyclic rings and further
having at least 1 and preferably from 1 to 2 internal sites of
ethylenic (>C.dbd.C<) unsaturation optionally comprising 1 to
3 exo carbonyl or thiocarbonyl groups. Suitable cycloalkenyl groups
include, by way of example, cyclopentenyl, cyclohexenyl,
cyclooctenyl, 3-oxocyclohex-1,2-enyl, and the like. In one
embodiment, the cycloalkenyl group does not comprise 1 to 3 exo
carbonyl or thiocarbonyl groups. In a preferred embodiment, the
cycloalkenyl group does comprise 1 to 3 exo carbonyl or
thiocarbonyl groups. It is understood, that the term "exo" refers
to the attachment of a carbonyl or thiocarbonyl to a carbon ring
atom of the cycloalkenyl group.
[0211] "Substituted cycloalkyl" and "substituted cycloalkenyl"
refers to an cycloalkyl or cycloalkenyl group, having from 1 to 5
substituents selected from the group consisting of alkyl,
substituted alkyl, alkoxy, substituted alkoxy, acyl, acylamino,
acyloxy, amino, substituted amino, aminoacyl, aryl, substituted
aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxy, nitro,
carboxy, carboxy esters, cycloalkyl, substituted cycloalkyl,
heteroaryl, substituted heteroaryl, heterocyclic, and substituted
heterocyclic. Preferred substituted cycloalkyl and substituted
cycloalkenyl include cycloalkyl or cycloalkenyl group, having from
1 to 5 substituents selected from the group consisting of alkoxy,
substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted
amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted
aryloxy, cyano, halogen, hydroxy, nitro, carboxy, carboxy esters,
cycloalkyl, substituted cycloalkyl, heteroaryl, substituted
heteroaryl, heterocyclic, and substituted heterocyclic.
[0212] "Cycloalkoxy" refers to --O-cycloalkyl groups.
[0213] "Substituted cycloalkoxy" refers to --O-substituted
cycloalkyl groups.
[0214] The term "guanidino" refers to the group
--NHC(.dbd.NH)NH.sub.2 and the term substituted "guanidino" refers
to --NR.sup.3C(.dbd.NR.sup.30)N(R.sup.30).sub.2 where each R.sup.30
is independently hydrogen or alkyl.
[0215] "Halo" or "halogen" refers to fluoro, chloro, bromo and iodo
and preferably is fluoro or chloro.
[0216] "Haloalkyl" refers to an alkyl group substituted with at
least one halogen such that a monohaloalkyl, a polyhaloalkyl or a
perhaloalkyl are encompassed by the term haloalkyl.
[0217] "Heteroaryl" refers to an aromatic group of from 1 to 15
carbon atoms, preferably from 1 to 10 carbon atoms, and 1 to 4
heteroatoms selected from the group consisting of oxygen, nitrogen,
sulfur, --S(O)--, and --S(O).sub.2-- within the ring. Preferably,
such heteroaryl groups are aromatic groups of from 1 to 15 carbon
atoms, preferably from 1 to 10 carbon atoms, and 1 to 4 heteroatoms
selected from the group consisting of oxygen, nitrogen, and sulfur
within the ring. Such heteroaryl groups can have a single ring
(e.g., pyridyl or furyl) or multiple condensed rings (e.g.,
indolizinyl or benzothienyl).
[0218] "Substituted heteroaryl" refers to heteroaryl groups that
are substituted with from 1 to 3 substituents selected from the
same group of substituents defined for substituted aryl.
[0219] "Heteroaryloxy" refers to the group --O-heteroaryl and
"substituted heteroaryloxy" refers to the group --O-substituted
heteroaryl.
[0220] "Heterocycle" or "heterocyclic" refers to a saturated or
unsaturated group having a single ring or multiple condensed rings,
from 1 to 10 carbon atoms and from 1 to 4 hetero atoms selected
from the group consisting of nitrogen, sulfur, --S(O)--,
--S(O).sub.2-- or oxygen within the ring which ring may optionally
comprise 1 to 3 exo carbonyl or thiocarbonyl groups. Preferably,
such heterocyclic groups are saturated or unsaturated group having
a single ring or multiple condensed rings, from 1 to 10 carbon
atoms and from 1 to 4 hetero atoms selected from the group
consisting of nitrogen, sulfur, or oxygen within the ring.
[0221] In multiple condensed rings, one or more of the rings may be
other than heterocyclic (e.g., aryl, heteroaryl or cycloalkyl)
provided that the point of attachment is to a heterocyclic ring
atom. In one embodiment, the heterocyclic group does not comprise 1
to 3 exo carbonyl or thiocarbonyl groups. In a preferred
embodiment, the heterocyclic group does comprise 1 to 3 exo
carbonyl or thiocarbonyl groups. It is understood, that the term
"exo" refers to the attachment of a carbonyl or thiocarbonyl to a
carbon ring atom of the heterocyclic group.
[0222] "Substituted heterocyclic" refers to heterocycle groups that
are substituted with from 1 to 3 of the same substituents as
defined for substituted cycloalkyl. Preferred substituents for
substituted heterocyclic groups include heterocyclic groups having
from 1 to 5 having substituents selected from the group consisting
of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino,
substituted amino, aminoacyl, aryl, substituted aryl, aryloxy,
substituted aryloxy, cyano, halogen, hydroxy, nitro, carboxy,
carboxy esters, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclic, and substituted
heterocyclic.
[0223] Examples of heterocycles and heteroaryls include, but are
not limited to, azetidine, pyrrole, imidazole, pyrazole, pyridine,
pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole,
dihydroindole, indazole, purine, quinolizine, isoquinoline,
quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline,
cinnoline, carbazole, carboline, phenanthridine, acridine,
phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine,
phenothiazine, imidazolidine, imidazoline, piperidine, piperazine,
indoline, phthalimide, 1,2,3,4-tetrahydro-isoquinoline,
4,5,6,7-tetrahydrobenzo[b]thiophene, thiazole, thiazolidine,
thiophene, benzo[b]thiophene, morpholinyl, thiomorpholinyl (also
referred to as thiamorpholinyl), piperidinyl, pyrrolidine,
tetrahydrofuranyl, and the like.
[0224] "Heterocyclyloxy" refers to the group --O-heterocyclic and
"substituted heterocyclyloxy" refers to the group --O-substituted
heterocyclic.
[0225] The term "oxycarbonylamino" refers to the group
--O(CO)NR31R32 where R31 and R32 are independently selected from
the group consisting of hydrogen, alkyl, substituted alkyl,
alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl,
substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl,
substituted heteroaryl, heterocyclic, substituted heterocyclic and
where R.sup.31 and R.sup.32 are joined, together with the nitrogen
bound thereto to form a heterocyclic or substituted heterocyclic
group.
[0226] The term "oxycarbonyloxy" refers to the group
--OC(O)OR.sup.33 where R.sup.33 is selected from the group
consisting of alkyl, substituted alkyl, alkenyl, substituted
alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl,
cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted
cycloalkenyl, heteroaryl, substituted heteroaryl, heterocyclic and
substituted heterocyclic.
[0227] The term "thiol" refers to the group --SH.
[0228] The term "thioalkyl" refers to the group --S-alkyl and the
term "substituted thioalkyl" refers to the group --S-substituted
alkyl.
[0229] The term "amino acid" refers to .beta.-amino acids or to
.beta.-amino acids of the formula HR.sup.34NCH(R.sup.2)COOH where
R.sup.2 is as defined above and R.sup.34 is hydrogen, alkyl,
substituted alkyl or aryl, Preferably, the .alpha.-amino acid is
one of the twenty naturally occurring L amino acids.
[0230] "Pharmaceutically acceptable salt" refers to
pharmaceutically acceptable salts of a compound, which salts are
derived from a variety of organic and inorganic counter ions well
known in the art and include, by way of example only, sodium,
potassium, calcium, magnesium, ammonium, tetraalkylammonium, and
the like; and when the molecule contains a basic functionality,
salts of organic or inorganic acids, such as hydrochloride,
hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the
like.
[0231] It is understood that in all substituted groups defined
above, polymers arrived at by defining substituents with further
substituents to themselves (e.g., substituted aryl having a
substituted aryl group as a substituent which is itself substituted
with a substituted aryl group, etc.) are not intended for inclusion
herein. In such cases, the maximum number of such substituents is
three. That is to say that each of the above definitions is
constrained by a limitation that, for example, substituted aryl
groups are limited to -substituted aryl-(substituted
aryl)-substituted aryl.
[0232] Similarly, it is understood that the above definitions are
not intended to include impermissible substitution patterns (e.g.,
methyl substituted with 5 fluoro groups or a hydroxy group alpha to
ethenylic or acetylenic unsaturation). Such impermissible
substitution patterns are well known to the skilled artisan.
General Synthetic Methods
[0233] The compounds of this invention can be prepared from readily
available starting materials using the following general methods
and procedures. It will be appreciated that where typical or
preferred process conditions (i.e., reaction temperatures, times,
mole ratios of reactants, solvents, pressures, etc.) are given,
other process conditions can also be used unless otherwise stated.
Optimum reaction conditions may vary with the particular reactants
or solvent used, but such conditions can be determined by one
skilled in the art by routine optimization procedures.
[0234] Additionally, as will be apparent to those skilled in the
art, conventional protecting groups may be necessary to prevent
certain functional groups from undergoing undesired reactions.
Suitable protecting groups for various functional groups as well as
suitable conditions for protecting and deprotecting particular
functional groups are well known in the art. For example, numerous
protecting groups are described in T. W. Greene and P. G. M. Wuts,
Protecting Groups in Organic Synthesis, Third Edition, Wiley, New
York, 1999, and references cited therein.
[0235] If the compounds of this invention contain one or more
chiral centers, such compounds can be prepared or isolated as pure
stereoisomers, i.e., as individual enantiomers or diastereomers, or
as stereoisomer-enriched mixtures. All such stereoisomers (and
enriched mixtures) are included within the scope of this invention,
unless otherwise indicated. Pure stereoisomers (or enriched
mixtures) may be prepared using, for example, optically active
starting materials or stereoselective reagents well-known in the
art. Alternatively, racemic mixtures of such compounds can be
separated using, for example, chiral column chromatography, chiral
resolving agents and the like.
[0236] The following synthetic protocols illustrate the general
manner for preparing the compounds described herein.
##STR00376##
[0237] Scheme I illustrates the conventional preparation of
4-amino-3-formyl-benzoic acid methyl ester, compound 7, which is a
starting material in the preparation of quinoline or substituted
quinoline groups, i.e., Het-Y. Specifically, in Scheme I,
commercially available 3-methyl-4-nitrobenzoic acid methyl ester,
compound 1, is contacted with at least a stoichiometric equivalent
of commercially available dimethoxymethyl-dimethyl-amine, also
known as N,N-dimethylformamide dimethylacetal, compound 2, under
conditions to form 3-(2-dimethylamino-vinyl)-4-nitro-benzoic acid
methyl ester, compound 3. The reaction is preferably conducted in
an inert diluent such as N,N-dimethylformamide at an elevated
temperature of from about 100 to 160.degree. C. for a period of
time to effect substantial completion of the reaction which
typically occurs within 12 to 48 hours. After reaction completion,
the resulting product, compound 3, can be isolated by conventional
techniques such as extraction, filtration, chromatography, and the
like; or, alternatively, used in the next step without purification
and/or isolation.
[0238] 3-(2-dimethylamino-vinyl)-4-nitro-benzoic acid methyl ester,
3, is subsequently converted to the formaldehyde by contact with at
least a stoichiometric amount of oxidant, under conditions
appropriate, to form 3-formyl-4-nitro-benzoic acid methyl ester 4.
The reaction is conducted in a suitable solvent, such as THF, in
the presence of water. Preferably, the reaction is conducted at a
temperature of from room temperature to 50.degree. C. The reaction
is continued until it is substantially complete which typically
occurs within about 0.5 to 2 hours. Suitable oxidants are well
known in the art and include, for example, sodium periodate,
NaIO.sub.4. While Compound 4 may be prepared in this manner, the
compound is also commercially available.
[0239] The formyl group of 3-formyl-4-nitro-benzoic acid methyl
ester 4 is protected with a suitable protecting group, for example,
as the acetal to form 3-dimethoxymethyl-4-nitro-benzoic acid methyl
ester 5. Other protecting groups are well known in the art and may
also be used. In the acetal reaction, compound 4 is contacted with
an acidic solution in methanol, under conditions appropriate to
form compound 5. The reaction is preferably conducted at an
elevated temperature of from 80 to 100.degree. C. The reaction is
continued until it is substantially complete which typically occurs
within about 10 to 30 minutes. Upon reaction completion, the
3-dimethoxymethyl-4-nitro-benzoic acid methyl ester, compound 5,
can be recovered by conventional techniques such as extraction,
precipitation, chromatography, filtration and the like; or,
alternatively, used in the next step without purification and/or
isolation.
[0240] The nitro group of 3-dimethoxymethyl-4-nitro-benzoic acid
methyl ester, compound 5 is then converted to the primary amine by
conventional reducing procedures to provide
4-amino-3-dimethoxymethyl-benzoic acid methyl ester, compound 6.
Conventional reducing procedures include, but are not limited to,
hydrogenation utilizing Pd/C. The reaction is preferably conducted
in a suitable vessel such as a Parr apparatus, at room temperature
for a time sufficient to provide substantial reaction completion,
which typically occurs in from 15 minutes to 1.5 hours. Compound 6
can be recovered by conventional techniques such as extraction,
precipitation, chromatography, filtration and the like; or,
alternatively, used in the next step without purification and/or
isolation.
[0241] 4-Amino-3-formyl-benzoic acid methyl ester, compound 7, is
obtained by conventional deprotection of the protecting group.
Preferably, the acetal of compound 6 is hydrolyzed under standard
reaction conditions. Acetal hydrolysis conditions are well known in
the art and may be achieved by treating compound 6 with, for
example, an acidic aqueous solution. The reaction is preferably
conducted at room temperature and continued until it is
substantially complete which typically occurs within about 15 to 30
minutes. Upon reaction completion, the product
4-amino-3-formyl-benzoic acid methyl ester, compound 7, can be
recovered by conventional techniques such as extraction,
precipitation, chromatography, filtration and the like.
[0242] Alternatively, Compound 7 may be prepared directly from
Compound 4 by reduction with iron sulfate and ammonium
hydroxide.
##STR00377##
[0243] Scheme II illustrates the general synthesis of
3-amino-4-cyclohexylamino-benzoic acid ethyl ester, compound 11,
which is used as a starting material in the preparation of 2-Het-Y
substituted 1-cyclohexyl-1H-benzoimidazole-5-carboxylic acids. It
is understood that the cyclohexyl group in Scheme II is only for
illustrative purposes and that other R groups can be prepared using
the protocols described herein merely by replacing the
cyclohexylamine with other suitable amines.
[0244] Specifically, in Scheme II, commercially available
4-chloro-3-nitro-benzoic acid, compound 8, is converted to the
corresponding ethyl ester using conventional alkylation protocols.
In one preferred method, compound 8 is contacted with a molar
excess of the appropriate alcohol (ethanol) in the presence of an
acid at an elevated temperature. The reaction is maintained at an
elevated temperature, preferably at the reflux temperature of the
alcohol solvent/reactant, until reaction completion, which is
typically achieved in about 10 to 24 hours. Upon reaction
completion, the resulting 4-chloro-3-nitro-benzoic acid ethyl
ester, compound 9, can be recovered by conventional techniques such
as extraction, precipitation, chromatography, filtration and the
like; or, alternatively, used in the next step without purification
and/or isolation.
[0245] 4-chloro-3-nitro-benzoic acid ethyl ester, compound 9 is
then aminated to provide 4-cyclohexylamino-3-nitro-benzoic acid
ethyl ester, compound 10. In this reaction, compound 9 is treated
with cyclohexylamine in the presence of TEA. The reaction is
preferably conducted in an inert diluent such as acetonitrile, at
an elevated temperature, preferably at the reflux temperature of
the solvent, for a period of time to effect substantial completion
of the reaction which typically occurs within 10 to 48 hours. After
reaction completion, the resulting product, compound 10, can be
isolated by conventional techniques such as extraction, filtration,
chromatography, and the like; or, alternatively, used in the next
step without purification and/or isolation.
[0246] 3-Amino-4-cyclohexylamino-benzoic acid ethyl ester, compound
11, is provided by reducing the nitro functionality of compound 10.
Reduction protocols are well known in the art and include, for
example, hydrogenation with Pd/C. The reaction is preferably
conducted at room temperature in a suitable inert solvent such as
ethyl acetate and is continued until a substantial amount of
product is obtained, which typically occurs in about 2 to 8 hours.
The resulting 3-amino-4-cyclohexylamino-benzoic acid ethyl ester,
compound 11, can be recovered by conventional techniques such as
extraction, precipitation, chromatography, filtration and the
like.
[0247] Tetrazolyl-substituted compounds are similarly obtained
using 4-chloro-3-nitro-benzonitrile, as shown in Scheme IIa
below.
##STR00378##
[0248] Initially, commercially available
2-chloro-5-cyano-nitrobenzene, compound 125, is aminated as
described above with cyclohexylamine, compound 126 to provide for
compound 127. As before, cyclohexylamine is representative of
suitable amines which can be used in this protocol. Conversion of
the cyano group of the 2-cyclohexylamino-5-cyano-nitrobenzene,
compound 127, to the corresponding tetrazolyl derivative, compound
128, proceeds via conventional conditions such as contacting
compound 127 with trimethyltin azide in the presence of refluxing
toluene. An aqueous acid is then added and acidic hydrolysis
proceeds for several hours at room temperature to provide for
compound 128 which can be recovered by conventional techniques such
as extraction, precipitation, chromatography, filtration and the
like; or, alternatively, used in the next step without purification
and/or isolation.
[0249] The nitro group of compound 128 is then converted to the
primary amine by conventional reducing procedures to provide for
compound 129. Conventional reducing procedures include, but are not
limited to, hydrogenation utilizing Pd/C. The reaction is
preferably conducted in a suitable vessel such as a Parr apparatus,
at room temperature for a time sufficient to provide substantial
reaction completion, which typically occurs in from 15 minutes to
1.5 hours. Compound 129 can be recovered by conventional techniques
such as extraction, precipitation, chromatography, filtration and
the like; or, alternatively, used in the next step without
purification and/or isolation.
[0250] Subsequent conventional coupling of compound 129 with
2-phenyl-6-carboxyquinoxaline, compound 130, provides for compound
131.
##STR00379##
[0251] Compound 7 as prepared above is combined with a suitable
ketone, such as acetophenone (where Y=phenyl or substituted
phenyl), in a basic alcohol solvent system such as KOH/EtOH to
provide the aromatized product, 2-Y-quinoline-6-carboxylic acid,
compound 13. Y may be an aryl group such as phenyl, substituted
phenyl or an alkyl group such as methyl or other suitable
functionality such as those particularly disclosed herein.
Preferably, the reaction is allowed to proceed at an elevated
temperature, preferably at the solvent reflux temperature, for a
time sufficient to effect substantial completion of the reaction
which typically occurs within 10 to 48 hours. After reaction
completion, the resulting 2-Y-quinoline-6-carboxylic acid, compound
13, can be isolated by conventional techniques such as extraction,
filtration, chromatography, and the like; or, alternatively, used
in the next step without purification and/or isolation.
[0252] The carboxylic acid moiety of compound 13 is then converted
to an acyl chloride by treating 13 with a suitable chlorinating
agent. Chlorinating agents are well known in the art, and
preferable chlorinating agents include thionyl chloride, oxalyl
chloride, phosphorus trichloride, and the like. The reaction is
subjected to conventional reaction conditions. Preferably, compound
13 is treated with thionyl chloride and the reaction is run neat,
in the absence of other solvents, until substantial reaction
completion. Typically, the reaction requires elevated temperatures
such as the reflux temperature of thionyl chloride, for a time
sufficient to produce substantial product, usually about 1 to 2
hours. After reaction completion, the resulting acyl chloride,
compound 14, can be isolated by conventional techniques such as
extraction, filtration, chromatography, and the like; or,
alternatively, used in the next step without purification and/or
isolation.
[0253] 2-Y-quinoline-6-carbonyl chloride, compound 14 undergoes
aminolysis with compound 11, as provided above, to produce the
intermediate
4-cyclohexylamino-3-[(2-Y-quinoline-6-carbonyl)-amino]-benzoic acid
ethyl ester, compound 15. The aminolysis reaction is preferably
conducted in the presence of an inert solvent such as DMF and
requires at least a stoichiometric amount of compound 11. The
reaction is preferably conducted for a time sufficient for
substantial reaction completion. Compound 15 can be isolated by
conventional techniques such as extraction, filtration,
chromatography, and the like and is used in the subsequent step
without further purification.
[0254] Compound 15 is then treated with acetic acid to affect
cyclization and provide
1-cyclohexyl-2-(2-Y-quinolin-6-yl)-1H-benzoimidazole-5-carboxylic
acid ethyl ester (not shown). Cyclization is preferably performed
at elevated temperatures, typically reflux temperatures of the
solvent which usually occurs between 130 to 145.degree. C., for a
time sufficient to provide substantial reaction completion, which
typically occurs in 2 to 5 hours. Upon reaction completion, the
resulting compound can be recovered by conventional techniques such
as neutralization, extraction, precipitation, chromatography,
filtration and the like; or, alternatively, may be used in the next
step without purification and/or isolation. An alternate
cyclization protocol involves treating 15 with 10% TFA in
1,2-dichloroethane at the reflux temperature of the solution for a
time sufficient to affect substantial reaction completion, which
typically occurs between 3 to 10 hours. Upon reaction completion,
the resulting compound can be recovered by conventional techniques
such as neutralization, extraction, precipitation, chromatography,
filtration and the like; or, alternatively, may be used in the next
step without purification and/or isolation. The ethyl ester is
subsequently deprotected under basic reaction conditions in an
appropriate aqueous alcoholic solvent such as ethanol. Preferably,
the ethyl ester is treated with a base such as aqueous NaOH at an
elevated temperature, such as the reflux temperature of the
solvent. The reaction is allowed to continue for a time sufficient
to effect substantial reaction completion, typically from 1 to 3
hours to provide compound 16. Upon reaction completion, the
resulting compound can be recovered by conventional techniques such
as neutralization, extraction, precipitation, chromatography,
filtration and the like; or additionally, purified 16 may be
converted to the acid salt by treatment with HCl or other acid salt
in an appropriate solvent, such as dioxane and ether, for a time
sufficient to provide substantial salt formation, followed by
conventional recovery techniques.
##STR00380##
[0255] Compound 16 is further derivatized with a suitable moiety,
Q. Preferred Q groups include those which give rise to Z groups as
recited for the compounds of Formula I when Z is as defined in
Formula I subset (b), (c --C(O)NHSO.sub.2R.sup.4) or (d).
Preferably, compound 16 is coupled with Q wherein Q is a heteroatom
containing group, preferably an amino or substituted amino group
including, for example, substituted amino acids such as
L-5-hydroxytryptophane. Suitable amino groups are well known in the
art and include a variety of commercially available primary or
secondary amines, and preferably, an amino acid or substituted
amino acid derived from an L isomer of an amino acid. Compound 16
is activated by conventional means, such as treatment with HBTU and
DIEA at room temperature for a time sufficient to promote
activation, typically from 5 to 20 minutes. Activated 16 is then
treated with Q, for example, a nitrogen containing group, in an
inert diluent such as N,N-dimethylformamide at room temperature for
a period of time to effect substantial completion of the reaction
which typically occurs within 30 minutes to 1 hour. After reaction
completion, the resulting product, compound 17, can be isolated by
conventional techniques such as extraction, filtration,
chromatography, and the like. The purified product may also be
converted to the acid salt by treatment of 17 with an appropriate
acid salt, such as TFA, for a time sufficient for substantial
reaction completion.
##STR00381## ##STR00382## ##STR00383##
[0256] Scheme V illustrates the general synthetic scheme for the
synthesis of
2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl
derivatives of the title compounds. Specifically, the carboxylic
acid moiety of commercially available 3-acetyl-4-hydroxy-benzoic
acid is converted to an amide by coupling with pyrrolidine. Other
basic nitrogen containing compounds may be used in this reaction if
other primary or secondary amide moieties are desired. The reaction
is preferably conducted in the presence of an inert solvent such as
DMF, and is performed at room temperature for a time sufficient to
provide substantial conversion to the product,
1-[2-hydroxy-5-(pyrrolidine-1-carbonyl)-phenyl]ethanone 18 which
typically occurs in from 30 minutes to 2 hours. After reaction
completion, the resulting product can be isolated by conventional
techniques such as extraction, filtration, chromatography, and the
like; or, alternatively, may be used in subsequent reaction without
further purification.
[0257] Compound 18 is treated with compound 7, which is produced as
shown above, in an alcohol solvent. Treatment of the mixture with a
base under inert atmosphere provides conditions appropriate for
cyclization and affords compound 19. Cyclization is preferably
performed at elevated temperatures for a time sufficient to provide
substantial reaction completion, which typically occurs in 10 to 48
hours. A suitable base/solvent can be, for example, KOH/ethanol,
although other bases and solvents may also be used. Upon reaction
completion, the resulting compound 19 can be recovered by
conventional techniques such as neutralization, extraction,
precipitation, chromatography, filtration and the like; or,
alternative, may be used in subsequent synthetic steps without
purification and/or isolation.
[0258] The carboxylic acid of compound 19 is protected as a methyl
ester by treatment of 19 with acidic methanol under conventional
reaction conditions. Preferably, the reaction is performed at
elevated temperature, from 50 to 80.degree. C. for a time such that
substantial conversion of starting material to the methyl ester has
occurred, which typically is 12 to 24 hours. The corresponding
methyl ester, 20, once obtained, can be recovered by conventional
techniques such as neutralization, extraction, precipitation,
chromatography, filtration and the like; or, alternatively, may be
used in subsequent synthetic steps without purification and/or
isolation.
[0259] The phenol of 20 is subsequently converted to the
corresponding triflate or other good leaving group by treatment of
20 with, for example, triflic anhydride. The reaction is preferably
conducted in an inert solvent, such as DCM in the presence of base,
such as DMAP or pyridine. The reaction is typically conducted at
room temperature for a time sufficient to provide substantial
reaction completion, which typically occurs in about 10 to 48
hours. Compound 21 can be recovered by conventional techniques such
as neutralization, extraction, precipitation, chromatography,
filtration and the like; or, alternative, may be used in subsequent
synthetic steps without purification and/or isolation.
[0260] Compound 21 is coupled with a suitable boronic acid, such as
para-chlorophenylboronic acid 22 to provide the biphenyl
derivative, 23. Other boronic acids may be used if other
substituents or substitution patterns are desired. The reaction is
conducted under conventional coupling reaction conditions, such as
in the presence of a lithium salt and palladium catalyst in dioxane
under an inert atmosphere. The reaction is preferably conducted at
elevated temperatures, such as the reflux temperature of the
solvent, for a time sufficient to allow substantial completion of
the reaction, which typically occurs in 10 to 48 hours. Compound 23
can be recovered by conventional techniques such as neutralization,
extraction, precipitation, chromatography, filtration and the like;
or, alternatively, may be used in subsequent synthetic steps
without purification and/or isolation.
[0261] The methyl ester of compound 23 is then removed under basic
conditions to provide compound 24, which may be used in a
subsequent synthetic step without purification and/or isolation.
Deprotection protocols are well known in the art and preferably,
the reaction involves treating 23 with a suitable base, such as
aqueous sodium hydroxide, in an alcohol solvent at reflux
temperature for about 1 to 3 hours to provide the quinolin
carboxylic acid 24.
[0262] The carboxylic acid of 24 is subsequently treated with
compound 11, which is prepared above, under conditions suitable to
effect an amide linkage. Preferably, compound 24 is activated with,
for example, HATU and DIEA at room temperature for a time of from
10 to 30 minutes and is then treated with compound 11 at room
temperature for a time sufficient to effect substantial reaction
completion, typically between 10 to 48 hours. The resulting amide
25 may be recovered by conventional techniques such as
neutralization, extraction, precipitation, chromatography,
filtration and the like; or, alternatively, may be used in
subsequent synthetic steps without purification and/or
isolation.
[0263] Compound 25 is then treated with acetic acid to affect
cyclization and provide the benzoimidazole-5-carboxylic acid ethyl
ester (not shown). Cyclization is preferably performed at elevated
temperatures, typically reflux temperature of the solution which
usually occurs between 130 to 145.degree. C., for a time sufficient
to provide substantial reaction completion, which typically occurs
in 2 to 5 hours. Upon reaction completion, the resulting compound
can be recovered by conventional techniques such as neutralization,
extraction, precipitation, chromatography, filtration and the like;
or, alternatively, may be used in the next step without
purification and/or isolation. The ethyl ester is subsequently
deprotected under basic reaction conditions in an appropriate
alcoholic solvent such as ethanol. Preferably, the ethyl ester is
treated with a base such as aqueous NaOH at an elevated
temperature, such as the reflux temperature of the solvent. The
reaction is allowed to continue for a time sufficient to effect
substantial reaction completion, typically from 1 to 3 hours to
provide compound 26. Upon reaction completion, the resulting
compound can be recovered by conventional techniques such as
neutralization, extraction, precipitation, chromatography,
filtration and the like; or additionally, purified compound 26 may
be converted to the acid salt by treatment with HCl or other acid
salt in an appropriate solvent, such as dioxane and ether, for a
time sufficient to provide substantial salt formation, followed by
conventional recovery techniques.
[0264] Compound 26 is further derivatized with any suitable Q
moiety as recited above. Preferably, compound 26 is coupled with a
substituted amino group, preferably a substituted amino acid such
as L-5-hydroxytryptophane. Suitable amino groups are well known in
the art and include a variety of commercially available primary or
secondary amines, and preferably, an amino acid or substituted
amino acid derived from an L isomer of an amino acid. Compound 26
is activated by conventional means, such as treatment with HBTU and
DIEA at room temperature for a time sufficient to promote
activation, typically from 5 to 20 minutes. Activated compound 26
is then coupled with Q, such as, for example, an amino group, in an
inert diluent such as N,N-dimethylformamide at room temperature for
a period of time to effect substantial completion of the reaction
which typically occurs within 30 minutes to 1 hour. After reaction
completion, the resulting product, compound 27, can be isolated by
conventional techniques such as extraction, filtration,
chromatography, and the like. The purified product may also be
converted to the acid salt by treatment of compound 27 with an
appropriate acid salt, such as HCl, for a time sufficient for
substantial reaction completion.
[0265] Compound 26 is shown in the tables as Compound 204.
##STR00384##
[0266] Scheme VI illustrates a synthetic scheme for producing
methyl substituted quinoline derivatives of the title compounds
utilizing the protocols provided in Schemes III and IV above.
##STR00385## ##STR00386##
[0267] Scheme VII illustrates the conventional preparation of
substituted quinoxaline derivates of the title compounds.
Specifically, in Scheme VII, commercially available
3,4-diaminobenzoic acid is treated with a readily available dione,
such as phenyl glyoxal (where Y=phenyl) under reaction conditions
appropriate to effect cyclization to the quinoxaline. Preferably,
the reaction is conducted under inert atmosphere under acidic
reaction conditions, such as in acetic acid. The reaction is
allowed to proceed at an elevated temperature, typically the reflux
temperature of the solution, for a time sufficient to effect
substantial cyclization, which typically occurs in about 1 to 4
hours. The resulting quinoxaline isomers, 36a and 36b can be
separated by conventional techniques such as by chromatography.
Alternatively, the major isomer, compound 36a, may be prepared
using an alcoholic solvent such as ethanol at reduced temperatures
such as 0.degree. C. for a time sufficient to effect substantial
cyclization, typically 10 to 48 hours. The major isomer is then
obtained by conventional separation techniques, such as, for
example, filtration.
[0268] Compound 36a is subsequently coupled with compound 11 as
formed above to provide the intermediate amide product, compound
37. Preferably, the reaction is conducted in an inert solvent, such
as DMF, and compound 36a is activated, for example, by treatment
with HATU and DIEA for a time such that activation occurs,
typically 5 to 30 minutes. Preferably, compound 11 is added to the
reaction mixture under conditions appropriate to afford the amide
product. Preferably, the reaction is conducted at around room
temperature for a time sufficient to establish substantial product,
compound 37, which typically occurs in about 10 to 24 hours. Upon
reaction completion, the resulting amide can be isolated by
conventional techniques such as extraction, filtration,
chromatography, and the like; or, alternatively, used in the next
step without purification and/or isolation.
[0269] The amide, compound 37, is subsequently cyclized by
treatment with acid at elevated reaction temperatures. Preferably,
the reaction is conducted at, for example, reflux temperature of
the solution, for a time sufficient to promote substantial
cyclization, which typically occurs in from 2 to 6 hours.
Preferably, the reaction is run neat in glacial acetic acid. The
resulting product, compound 38, may be isolated by conventional
techniques such as extraction, filtration, chromatography, and the
like; or, alternatively, used in the next step without purification
and/or isolation.
[0270] The ethyl ester of compound 38 is subsequently removed by
treatment with an aqueous base in an appropriate alcoholic solvent.
Preferably, the reaction is conducted at elevated temperatures in
the presence of a base such as NaOH for a time sufficient to afford
substantial deprotection and production of the corresponding
carboxylic acid, compound 39. The resulting product, compound 39,
may be isolated by conventional techniques such as extraction,
filtration, chromatography, and the like; or, alternatively, used
in the next step without purification and/or isolation.
[0271] Compound 39 is optionally derivatized with any suitable
amino or substituted amino moiety shown as "Q". Amino groups are
well known in the art and it is apparent that readily available
amines may be used in this reaction. Preferably, compound 39 is
treated with a substituted amino acid such as
L-5-hydroxytryptophane. The reaction is preferably conducted in an
inert diluent such as DMF at room temperature for a portion of time
to effect substantial completion of the reaction which typically
occurs within 30 minutes to 1 hour. After reaction completion, the
resulting product, 40 can be isolated by conventional techniques
such as extraction, filtration, chromatography, and the like; or,
alternatively, used in the next step without purification and/or
isolation.
##STR00387##
[0272] Scheme VIIa illustrates the conventional preparation of
3-substituted quinoxaline derivates of the title compounds. More
specifically, the phenyl-substituted derivative is exemplified
above, although this group is readily substituted with, for
example, a methyl group as has been shown with the previous
examples. Compound 37 as obtained above, is aminated with compound
11 under conventional protocols, such as those described above, to
afford the quinoxaline derivative 41. Similarly to the above
synthetic schemes, compound 41 may undergo cyclization under acidic
reaction conditions to afford the cyclized product 42. Hydrolysis
of the ethyl ester protecting group, as in the above Schemes,
provides compound 43. Optional derivatization with an amino group,
represented by "Q" affords product 44. The synthetic protocols in
this Scheme may be inferred from the examples depicted in the
Schemes above.
[0273] In addition to the foregoing Schemes, the following examples
illustrate Het-Y groups that are within the scope of the present
invention. Specifically, illustrative compounds I-A to I-W below
optionally may be further derivatized with functional groups, for
example, with amino, substituted alkyl, heteroaryl, sulfonamido, or
other suitable functional groups. It is recognized throughout that
further derivatization may require the use of protecting groups and
protecting group strategies such that selective reactions may be
pursued. Accompanying the illustrative examples below are preferred
synthetic protocols which are useful in obtaining the compounds of
formula I-A to I-W. In the illustrations below, R.sup.50, which is
selected from hydrogen, Y or X', denotes an optional substituent on
HET (when R.sup.50 is not hydrogen) where X' and Y are as defined
above.
3-Substituted Quinoline Het-Y
##STR00388##
[0275] I-A may be obtained by the protocols above using the
intermediate 46 the synthesis is as described below. The preferred
intermediate 46 is to be synthesized as described for 19 except 18
is replaced with the analogues alkyl-aryl-ketone, 45, whose
synthesis is described in R. P. Thummel, S. Chirayl, C. Hery, J-L.
Lim, T-L Wang, J. Org. Chem., 1993, 58, 1666-1671.
##STR00389##
4-Substituted Quinoline Het-Y
##STR00390##
[0277] I-B may be optionally further modified as per the above
Schemes to afford title compounds with a 4-substituted quinolin
Het-Y moiety. I-B may be obtained as shown above, using compound 49
as an intermediate the synthesis of which is described below. The
preferred compound 49 is to be synthesized as described for
compound 19 except compound 7 is replaced with alkyl-aryl-ketone,
compound 47, whose synthesis is described in R. P. Thummel, S.
Chirayl, C. Hery, J-L. Lim, T-L Wang, J. Org. Chem., 1993, 58,
1666-1671.
##STR00391##
5 or 7 or 8-Substituted Quinoline Het-Y
##STR00392##
[0279] In formula I-C, R.sup.51 is selected from hydrogen, X and Y
where X and Y are as defined above. I-C may be optionally further
modified as per the above Schemes to afford the title compounds
with a 5 or 7 or 8-substituted quinoline Het-Y moiety. I-C may be
obtained from the intermediate 51 the synthesis of which is
described below. The preferred intermediate is to be synthesized as
described for 19 except 7 is replaced with the analogues
alkyl-substituted amino-aldehyde, 50, synthesized as described in
R. P. Thummel, S. Chirayl, C. Hery, J-L. Lim, T-L Wang, J. Org.
Chem., 1993, 58, 1666-1671.
##STR00393##
3,7-Quinoline Het-Y
##STR00394##
[0281] I-D may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,7-quinoline Het-Y
moiety. I-D may be obtained from the intermediate 54 the synthesis
of which is described below. The preferred intermediate is to be
synthesized as described for 19 except 7 and 18 are replaced with
53 and 52, respectively, synthesized as described in R. P. Thummel,
S. Chirayl, C. Hery, J-L. Lim, T-L Wang, J. Org. Chem., 1993, 58,
1666-1671.
##STR00395##
3,7-Isoquinoline Het-Y
##STR00396##
[0283] I-E may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,7-isoquinoline Het-Y
moiety. I-E may be obtained from the intermediate 60 the synthesis
of which is described below. The preferred 3,7-isoquinoline
intermediate 60 is synthesized by a modification of the
Pomeranz-Fritsch reaction described in Gensler, W. J., Organic
Reactions, 1951, 6, 191 and Kucznierz, R. et al., Synth. Commun.,
1999, 29, 1617 and shown directly below with numerical indicators
55 to 60.
##STR00397##
[0284] Alternatively, another preferred protocol is utilized to
synthesize the key 3,7-isoquinoline intermediate by modification of
the procedure described in Numata, A., et al., Synthesis, 1999,
306, followed by reduction of the isoquinoline N-oxide with
triphenylphospine as described in Katrizky, A. R., Lam, J. N.,
Heterocycles, 1992, 33, 1011, as shown directly below with the
compounds numbered 61 to 65. Note that the alternative procedure
provides the same preferred intermediate above, with the numerical
indicator 65 illustrating the second reaction protocol. Thus, 60 is
the same intermediate as 65.
##STR00398##
Quinazoline Het-Y
##STR00399##
[0286] I-F may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,7-isoquinoline Het-Y
moiety. I-F may be obtained from the intermediate 69 the synthesis
of which is provided as shown below.
##STR00400##
[0287] To form the preferred intermediate, 67 is first acylated
with 66 using a standard coupling reagent (e.g. HATU). The
resulting amide, 68 is to be heated with alcoholic ammonia as
described by A. Biscler et al., Berichte, 1895, 28 to afford the
intermediate 69.
Reverse 2,6-Quinoline linker Het-Y
##STR00401##
[0289] I-G may be optionally further modified as per the above
Schemes to afford the title compounds with a 2,6-quinoline Het-Y
moiety. I-G may be obtained from the intermediate 72 which is
provided as shown below.
##STR00402##
[0290] The preferred intermediate is to be synthesized as described
for 19 except 7 and 18 are replaced with ethyl-pyruvate, 70, and
71, respectively as described in R. P. Thummel, S. Chirayl, C.
Hery, J-L. Lim, T-L Wang, J. Org. Chem., 1993, 58, 1666-1671. 72
may be further derivatized with the substituted aryl moiety by
using standard coupling procedures, such as Suzuki conditions using
the appropriately substituted aryl boronic acid to provide for
intermediate 72a.
3,7-Isoquinoline Het-Y
##STR00403##
[0292] I-H may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,7-isoquinoline Het-Y
moiety. I-H may be obtained from the intermediate 78 which is
provided as shown below.
##STR00404##
[0293] The preferred "reversed" 3,7-isoquinoline intermediate is
synthesized by reaction of commercial 5-bromosalicylaldehyde 73
with the appropriate aryl boronic acid under Suzuki conditions. The
product, 74, is then converted to the triflate, 75, using standard
conditions (triflic anhydride, 2,6-lutidine in dichloromethane).
This intermediate and commercial ethyl propynoate, 76, are then
used to synthesize the desired isoquinoline by modification of the
procedure described in Numata, A., et al., Synthesis, 1999, 306,
followed by reduction of the isoquinoline N-oxide with
triphenylphospine as described in Katrizky, A. R., Lam, J. N.,
Heterocycles, 1992, 33, 1011 to afford the intermediate 78.
Reverse 3,7-Quinoline Linker
##STR00405##
[0295] I-I may be optionally further modified as per the above
Schemes to afford the title compounds with a reverse 3,7-quinoline
Het-Y moiety. I-I may be obtained from the intermediate 81 which is
provided as shown below.
##STR00406##
[0296] The preferred intermediate, 81, is to be synthesized as
described for 19 except 7 and 18 are replaced with 79 and 80,
respectively, as described in R. P. Thummel, S. Chirayl, C. Hery,
J-L. Lim, T-L Wang, J. Org. Chem., 1993, 58, 1666-1671 which is
then coupled using Suzuki conditions to the appropriately
substituted aryl boronic acid to provide the aryl substituted
product 81a.
Reverse Quinoxaline Het-Y
##STR00407##
[0298] I-J may be optionally further modified as per the above
Schemes to afford the title compounds with a reverse quinoxaline
Het-Y moiety. I-J may be obtained from the intermediate 85 which is
provided as shown below.
##STR00408##
[0299] The preferred intermediate is to be synthesized as described
for 36 and 37 except 3,4-diaminobenzoic acid, 34, and
phenylglyoxal, 35, are replaced with 82 and 83, respectively as
described in F. Roubinek, V. Bydzovsky and Z. Budesinsky, Coll.
Czech. Chem. Commun., 49, 285, 1984. The resulting isomers,
compounds 84 and 85 are then resolved and then coupled using Suzuki
conditions to the appropriate substituted aryl boronic acid to
provide the aryl substituted reverse quinoxaline, compounds 84a and
85a.
[1,5]-Naphthyridine Het-Y
##STR00409##
[0301] I-K may be optionally further modified as per the above
Schemes to afford the title compounds with a [1,5]-Naphthyridine
Het-Y moiety. I-K may be obtained from the intermediate 88 which is
provided as shown below:
##STR00410##
[0302] The preferred intermediate, compound 88, is to be
synthesized using the procedure described by X. Li, Z. Xu, E. F.
Erin, M. C. Kozlowski, Tetrahedron Lett., 43(20), 3747 (2002)
utilizing 87 (synthesis described in V. S. Binz, Chem. Ber., 68,
1935; 315; 321) and 86. This is then coupled using Suzuki
conditions to the appropriate substituted aryl boronic acid to
provide the aryl substituted [1,5]-naphthyridine product, compound
88a.
3,7-Substituted [1,8]-Naphthyridine Het-Y
##STR00411##
[0304] I-L may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,7-substituted
[1,8]-naphthyridine Het-Y moiety. I-L may be obtained from the
intermediate 91 which is provided as shown below:
##STR00412##
[0305] The preferred intermediate, compound 91, is synthesized
using the procedure described by H. Bock, T. T. H. Van, H.
Schoedel, Monatsh. Chem., 127; 4; 1996; 391-396 utilizing 89
(described in Coleman, Glattfeld, J. Am. Chem. Soc., 66, 1944;
1183; 1186) and 90. The bromo-substituted product is then coupled
using Suzuki conditions to the appropriate substituted aryl boronic
acid to afford the aryl substituted 3,7-substituted
[1,8]-naphthyridine product compound 91a.
3,6-Substituted [1,8]-Naphthyridine Het-Y
##STR00413##
[0307] I-M may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,6-Substituted
[1,8]-Naphthyridine Het-Y moiety. I-M may be obtained from the
intermediate 94 which is provided as shown below:
##STR00414##
[0308] The preferred intermediate, 94, is synthesized using the
procedure described by H. Bock, T. T. H. Van, H. Schoedel, Monatsh.
Chem., 127; 4; 1996; 391-396 utilizing 93 (whose synthesis is
described in Coleman, Glattfeld, J. Am. Chem. Soc., 66, 1944; 1183;
1186) and 92. This is then coupled using Suzuki conditions to the
appropriate substituted aryl boronic acid to provide the aryl
substituted 3,6-Substituted [1,8]-naphthyridine product, 94a.
3,7-Cinnoline Het-Y
##STR00415##
[0310] I-N may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,7-Cinnoline Het-Y
moiety. I-N may be obtained from the intermediate 102 which is
provided as shown below:
##STR00416##
[0311] The preferred 3,7-cinnoline intermediate, 102, is
synthesized by conversion of commercial anisidine 95 to its diazo
form 96 (synthesis described in Hanson, P. et al., J. Chem. Soc.
Perkin Trans. 2, 2002, 6, 1135.) and then coupled with ethyl
(E)-3-piperidinoacrylate 100 to yield the
3-carboxyethyl-7-methoxy-cinnoline 97 as described in Kanner, C.
B., Pandit, U. K., Tetrahedron, 1982, 38, 3597. The methoxy group
is deprotected to the phenol 101 using standard BBr.sub.3
conditions. Intermediate 101 is then converted to the triflate (not
shown) using standard conditions (triflic anhydride, 2,6-lutidine
in dichloromethane) and finally converted to the preferred
intermediate 102 via a Suzuki reaction with the appropriately
substituted aryl boronic acid.
2, 6-1H-Quinolin-4-one Het-Y
##STR00417##
[0313] I-O may be optionally further modified as per the above
Schemes to afford the title compounds with a 2, 6-1H-Quinolin-4-one
Het-Y moiety. I-O may be obtained from the intermediate 107 which
is provided as shown below:
##STR00418##
[0314] The key intermediate 108 is synthesized by a variation of
the Conrad-Limpach-Knorr synthesis. Commercial starting material
103 is reacted with the appropriate aromatic Grignard-reagent,
Compound 104, (or other appropriate organometallic) to yield
compound 105 as described in J. Chem. Soc. Perkin Trans. 110, 1995;
1209-1214. Subsequent nucleophilic attack of amine 106 yields
compound 107 as described in Synthesis 1987, 5, 482-483. 107 is
then heated in Dowtherm A at 240.degree. C. to yield compound 108
as described in J. Med. Chem. 38; 22; 1995; 4439-4445 or Eur. J.
Med. Chem. Chim. Ther. 32; 7-8; 1997; 547-570.
2,6-Chromen-4-one Het-Y
##STR00419##
[0316] I-P may be optionally further modified as per the above
Schemes to afford the title compounds with a 2,6-chromen-4-one
Het-Y moiety. I-P may be obtained from the intermediate 112 which
is provided as shown below.
##STR00420##
[0317] The preferred intermediate is synthesized by an aldol
condensation performed on starting material 109 with the
appropriate substituted aldehyde 110 with sodium hydroxide in
ethanol, as described in Eur. J. Med. Chem. Chim. Ther. 31; 11;
1996; 861-874 or J. Med. Chem. 23; 3; 1980; 335-338. Subsequent
cyclization to 113 is accomplished using selenium dioxide in amyl
alcohol at 150.degree. C. or DDQ as described in JACS 77; 1955;
2223 or Eur. J. Med. Chem. Chim. Ther. 13; 1978; 33-39.
Alternatively the double-bond of enone 111 is brominated to give
112, which in turn is cyclized to give 113, using aqueous potassium
hydroxide as catalyst, as described in J. Med. Chem. 23; 3; 1980;
335-338.
3,7-Isochromen-1-one Het-Y
##STR00421##
[0319] I-Q may be optionally further modified as per the above
Schemes to afford the title compounds with a 3,7-isochromen-1-one
Het-Y moiety. I-Q may be obtained from the intermediate 119 which
is provided as shown below.
##STR00422##
[0320] The preferred intermediate 119 is synthesized via a
modification of Izumi, et al., Heterocycl. Chem. 31; 1; 1994;
145-152. Starting material 114 (described in J. Heterocycl. Chem.
31; 1; 1994; 145-152) is coupled via standard Heck reaction
conditions to the appropriate styrene 115 to give 116. Hydrolysis
of the methyl esters of 116 with sodium hydroxide gives the free
acid 117, which is then oxidatively cyclized using selenium reagent
118 to give intermediate 119.
2,6-(2,3-Dihydrophthalazine-1,4-dione) Het-Y
##STR00423##
[0322] I-R may be optionally further modified as per the above
Schemes to afford the title compounds with a
2,6-(2,3-Dihydrophthalazine-1,4-dione) Het-Y moiety. I-R may be
obtained from the intermediate 124 which is provided as shown
below:
2,7-(2,3-Dihydrophthalazine-1,4-dione) Het-Y
##STR00424##
[0324] I-S may be optionally further modified as per the above
Schemes to afford the title compounds with a
2,7-(2,3-Dihydrophthalazine-1,4-dione) Het-Y moiety. I-S may be
obtained from the intermediate 124 which is provided as shown
below.
##STR00425##
[0325] The preferred intermediates are synthesized via a
modification of the procedure described by Watanabe, N., et al., J.
Med. Chem. 1998, 41, 3367-3372. Amine 120 is converted to 121 by
formation and subsequent nucleophilic displacement with cyanide of
the diazonium salt. 121 is then reacted with the appropriate
substituted hydrazine 122 to give a mixture of 123 and 124. This
mixture is then resolved via chromatography or crystallization into
its pure forms. Intermediate 123 is then utilized to synthesize I-R
and intermediate 124 is used to synthesize I-S.
3,7-tetrahydroquinoline (I-T) and reversed 3,7-tetrahydroquinoline
(I-T) Het-Y
##STR00426##
[0327] I-T and I-U may be optionally further modified as per the
above Schemes to afford the title compounds with a
3,7-tetrahydroquinoline (I-T) and reversed 3,7-tetrahydroquinoline
(I-T) Het-Y moiety. I-T and I-U may be obtained from by selective
catalytic reduction of the aromatic Het-Y molecule with PtO.sub.2
utilizing a modification of the procedure described in Maillard, M.
C., et al., J. Med. Chem., 1998, 41, 3048.
3,7-tetrahydroisoquinoline and reversed 3,7-tetrahydroisoquinoline
Het-Y
##STR00427##
[0329] I-V and I-W may be used in the above Schemes to afford the
title compounds with a 3,7-tetrahydroisoquinoline (I-V) and
reversed 3,7-tetrahydroisoquinoline (I-W) Het-Y moiety. I-V and I-W
may be obtained from selective catalytic reduction of the aromatic
Het-Y molecule with PtO.sub.2 utilizing a modification of the
procedure described in Maillard, M. C., et al., J. Med. Chem.,
1998, 41, 3048.
Utility
[0330] The present invention provides novel compounds possessing
antiviral activity, including Flaviviridae family viruses such as
hepatitis C virus. The compounds of this invention inhibit viral
replication by inhibiting the enzymes involved in replication,
including RNA dependent RNA polymerase. They may also inhibit other
enzymes utilized in the activity or proliferation of Flaviviridae
viruses.
[0331] Compounds of this invention maybe used alone or in
combination with other compounds to treat viruses.
Administration and Pharmaceutical Composition
[0332] In general, the compounds of this invention will be
administered in a therapeutically effective amount by any of the
accepted modes of administration for agents that serve similar
utilities. The actual amount of the compound of this invention,
i.e., the active ingredient, will depend upon numerous factors such
as the severity of the disease to be treated, the age and relative
health of the subject, the potency of the compound used, the route
and form of administration, and other factors. The drug can be
administered more than once a day, preferably once or twice a
day.
[0333] Therapeutically effective amounts of compounds of Formula I
may range from approximately 0.1 to 20 mg per kilogram body weight
of the recipient per day, more preferably from about 0.1 to 10
mg/kg/day.
[0334] In general, compounds of this invention will be administered
as pharmaceutical compositions by any one of the following routes:
oral, systemic (e.g., transdermal, intranasal or by suppository),
or parenteral (e.g., intramuscular, intravenous or subcutaneous)
administration. The preferred manner of administration is oral
using a convenient daily dosage regimen that can be adjusted
according to the degree of affliction. Compositions can take the
form of tablets, pills, capsules, semisolids, powders, sustained
release formulations, solutions, suspensions, elixirs, aerosols, or
any other appropriate compositions. Another preferred manner for
administering compounds of this invention is inhalation. This is an
effective method for delivering a therapeutic agent directly to the
respiratory tract, in particular for the treatment of diseases such
as asthma and similar or related respiratory tract disorders (see
U.S. Pat. No. 5,607,915).
[0335] The choice of formulation depends on various factors such as
the mode of drug administration and bioavailability of the drug
substance. For delivery via inhalation the compound can be
formulated as liquid solution, suspensions, aerosol propellants or
dry powder and loaded into a suitable dispenser for administration.
There are several types of pharmaceutical inhalation
devices-nebulizer inhalers, metered dose inhalers (MDI) and dry
powder inhalers (DPI). Nebulizer devices produce a stream of high
velocity air that causes the therapeutic agents (which are
formulated in a liquid form) to spray as a mist that is carried
into the patient's respiratory tract. MDI's typically are
formulation packaged with a compressed gas. Upon actuation, the
device discharges a measured amount of therapeutic agent by
compressed gas, thus affording a reliable method of administering a
set amount of agent. DPI dispenses therapeutic agents in the form
of a free flowing powder that can be dispersed in the patient's
inspiratory air-stream during breathing by the device. In order to
achieve a free flowing powder, the therapeutic agent is formulated
with an excipient such as lactose. A measured amount of the
therapeutic agent is stored in a capsule form and is dispensed with
each actuation.
[0336] Recently, pharmaceutical formulations have been developed
especially for drugs that show poor bioavailability based upon the
principle that bioavailability can be increased by increasing the
surface area i.e., decreasing particle size. For example, U.S. Pat.
No. 4,107,288 describes a pharmaceutical formulation having
particles in the size range from 10 to 1,000 nm in which the active
material is supported on a cross-linked matrix of macromolecules.
U.S. Pat. No. 5,145,684 describes the production of a
pharmaceutical formulation in which the drug substance is
pulverized to nanoparticles (average particle size of 400 nm) in
the presence of a surface modifier and then dispersed in a liquid
medium to give a pharmaceutical formulation that exhibits
remarkably high bioavailability.
[0337] The compositions are comprised of in general, a compound of
formula I in combination with at least one pharmaceutically
acceptable excipient. Acceptable excipients are non-toxic, aid
administration, and do not adversely affect the therapeutic benefit
of the compound of formula I. Such excipient may be any solid,
liquid, semi-solid or, in the case of an aerosol composition,
gaseous excipient that is generally available to one of skill in
the art.
[0338] Solid pharmaceutical excipients include starch, cellulose,
talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, magnesium stearate, sodium stearate, glycerol
monostearate, sodium chloride, dried skim milk and the like. Liquid
and semisolid excipients may be selected from glycerol, propylene
glycol, water, ethanol and various oils, including those of
petroleum, animal, vegetable or synthetic origin, e.g., peanut oil,
soybean oil, mineral oil, sesame oil, etc. Preferred liquid
carriers, particularly for injectable solutions, include water,
saline, aqueous dextrose, and glycols.
[0339] Compressed gases may be used to disperse a compound of this
invention in aerosol form. Inert gases suitable for this purpose
are nitrogen, carbon dioxide, etc.
[0340] Other suitable pharmaceutical excipients and their
formulations are described in Remington's Pharmaceutical Sciences,
edited by E. W. Martin (Mack Publishing Company, 18th ed.,
1990).
[0341] The amount of the compound in a formulation can vary within
the full range employed by those skilled in the art. Typically, the
formulation will contain, on a weight percent (wt %) basis, from
about 0.01-99.99 wt % of a compound of formula I, Ia, Ib, II, or
III based on the total formulation, with the balance being one or
more suitable pharmaceutical excipients. Preferably, the compound
is present at a level of about I-80 wt %. Representative
pharmaceutical formulations containing a compound of formula I, Ia,
Ib, II, or III are described below.
EXAMPLES
[0342] In the examples below and the synthetic schemes above, the
following abbreviations have the following meanings. If an
abbreviation is not defined, it has its generally accepted
meaning.
TABLE-US-00009 .mu.L microliters .mu.M = micromolar .mu.g =
micrograms NMR = nuclear magnetic resonance AcOH = acetic acid aq.
= aqueous boc = t-butoxycarbonyl br = broad peak cm = centimeters
CSA = camphorsulfonic acid d = doublet .delta. = chemical shift DCM
= dichloromethane dd = doublet of doublets DIEA =
diisopropylethylamine DMAP = 4-N,N-dimethylaminopyridine DMEM =
Dulbeco's Modified Eagle's Medium DMF = N,N-dimethylformamide DMSO
= dimethylsulfoxide dppp = 1,3-bis(diphenylphosphino)propane DTT =
dithiothreotol EDTA = ethylenediaminetetraacetic acid eq. =
equivalents ESI = electrospray ionization EtOAc = ethyl acetate
EtOH = ethanol Fmoc = 9-fluorenylmethoxycarbonyl g = gram h = hours
HATU = O-(7-Azabenzotriazol-1-yl)-N,N,N',N'- tetramethyluronium
hexafluorophosphate HBTU = O-Benzotriazol-1-yl-N,N,N',N'-
tetramethyluronium hexafluorophosphate HCV = hepatitus C virus HPLC
= high performance liquid chromatography Hz = hertz IPTG =
isopropyl-.beta.-D-thiogalactopyranoside IU = International Units
IC.sub.50 = inhibitory concentration at 50% inhibition J = coupling
constant L = liters m = multiplet M = molar M+ H.sup.+ = parent
mass spectrum peak plus H.sup.+ M- H.sup.+ = parent mass spectrum
peak minus H.sup.+ MeOH = methanol MeCN = methylcyanide mg =
milligram min. = minutes mL = milliliter mM = millimolar mmol =
millimole MS = mass spectrum N = normal nm = nanometer nM =
nanomolar ng = nanogram NMP = 1-methyl-2-pyrrolidinone NTA =
nitrilotriacetic acid NTP = nucleoside triphosphate PCR =
Polymerase chain reaction Pfp = pentafluorophenyl radical Ph or o =
phenyl ppm = parts per million psi = pounds per square inch PyBroP
= Bromotris(pyrrolidine)phosphonium hexafluorophosphate q = quartet
Rp-HPLC = reversed phase high performance liquid chromatography s =
singlet t = triplet dt = Doublet of triplets t-Bu = tertiary-butyl
protecting group TBTU = O-(Benzotriazol-1-yl)-N,N,N',N'-
tetramethyluronium tetrafluoroborate TC.sub.50 = Toxic
concentration at 50% cell toxicity TEA = triethylamine tetrakis or
= tetrakis(triphenylphosphine)palladium(0) tetrakis palladium
Tf.sub.2O = Trifluorosulfonic anhydride TFMSA =
Trifluoromethanesulfonic acid TFA = trifluoroacetic acid THF =
tetrahydrofuran TLC = Thin layer chromatography Tris =
Tris(hydroxymenthyl)aminomethane UTP = uridine triphosphate v/v =
Volume to volume ratio w/v = Weight to volume ratio
[0343] Set forth in the examples below are compounds and
intermediates useful for making compounds of the present invention.
An overview of the synthetic protocols employed to prepare these
compounds is set forth above.
[0344] Unless indicated otherwise the HPLC methods referred to in
the Examples correspond to the following procedures.
TABLE-US-00010 HPLC Buffer A consists of 0.1% TFA in purified water
Procedure A Buffer B consists of 0.1% TFA in acetonitrile Vydac C18
Protein and Peptide column (250 .times. 4.6 mm) The column uses a
flow rate of 1 mL per minute with a gradient of 20% B to 99% B over
20 minutes. (c18 column) HPLC Buffer A consists of 0.1% TFA in
purified water Procedure B Buffer B consists of 0.1% TFA in
acetonitrile Vydac C18 Protein and Peptide column (250 .times. 4.6
mm) The column uses a flow rate of 2 mL per minute with a gradient
of 20% B to 99% B over 10 minutes. (C18 column) HPLC Buffer A
consists of 0.1% TFA in purified water Procedure C Buffer B
consists of 0.1% TFA in acetonitrile Merck KGaA Chromolith
Performance RP-18e column (100 .times. 4.6 mm) The column uses a
flow rate of 4 mL per minute with a gradient of 20% B to 99% B over
5 minutes. (Monolithic column)
Example 1
Preparation of
1-Cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carboxylic-ac-
id (Compound 201)
Step 1: trans-3-(2-Dimethylamino-vinyl)-4-nitro-benzoic acid methyl
ester (Compound 3)
[0345] A 100 mL flask fitted with a 15 cm Vigreux head was charged
with 10 g (49.7 mmol) of 3-methyl-4-nitro-benzoic acid methyl
ester, 12.5 mL of DMF and 14.8 g (124.2 mmol) of
N,N-dimethylformamide dimethylacetal. The reaction vessel was
immersed in a 140.degree. C. oil bath for 18 h under argon while
the forming methanol distilled away. Upon cooling to room
temperature the dark red content of the flask solidified. The solid
was transferred to a 250 mL flask using DMF which was removed by
evaporation. The residue was triturated with petroleum ether to
give 11.81 g of enamine as dark red solid.
[0346] MS: 251.10 (M+H.sup.+); H.sup.1-NMR (CDCl.sub.3):
.delta.(ppm) 8.11 (d, 1H, Ar--H.sup.2), 7.80 (d, 1H, Ar--H.sup.5),
7.53-7.50 (dd, 1H, Ar--H.sup.6), 7.06 (d, 1H, CH.dbd.), 5.76 (d,
1H, CH.dbd.), 3.93 (s, 3H, OCH.sub.3), 2.93 (s, 6H,
(CH.sub.3).sub.2N).
Step 2: 3-Formyl-4-nitro-benzoic acid methyl ester (Compound 4)
[0347] Compound 3 (11.81 g 47.2 mmol) and NaIO.sub.4 (30.3 g 141.6
mmol) was dissolved in 250 mL THF/H.sub.2O 1:1 at room temperature.
The dark red solution was warmed to about 40.degree. C. while heavy
precipitation occurred and the color changed to light brown. After
1 h the precipitate was removed by filtration and washed with 200
mL ethyl acetate. The organic layer was washed three times with
saturated NaHCO.sub.3, once with brine and dried with
Na.sub.2SO.sub.4. The solution was evaporated to dryness and the
resulting oil was purified on a silicagel pad eluting with
DCM-hexane gradient (30% to 60% DCM) to yield after evaporation
yellow Compound 4.
[0348] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 10.39 (s, 1H, CHO),
8.57 (d, 1H, J=2.1 Hz, Ar--H.sup.2) 8.40-8.36 (dd, 1H, J=2.1 Hz and
8.4 Hz, Ar--H.sup.6), 8.14 (d, 1H, J=8.4 Hz, Ar--H.sup.5), 4.00 (s,
3H, OCH.sub.3).
Step 3: 3-Dimethoxymethyl-4-nitro-benzoic acid methyl ester
(Compound 5)
[0349] To a solution of Compound 4 (1 g, 4.78 mmol) in 20 mL
methanol, 0.5 mL 4N HCL/dioxane was added and the mixture was kept
at 90.degree. C. for 10 minutes. The reaction mixture was then
evaporated to dryness. The white solid material was dissolved in 20
mL methanol and was treated with 0.5 mL 4N HCl again in the same
way. The solid was dried under high vacuum overnight to give
compound 5 in quantitative yield.
[0350] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 8.40 (d, 1H, J=1.8
Hz, Ar--H.sup.2), 8.14-8.10 (dd, 1H, J=8.1 Hz and 1.8 Hz,
Ar--H.sup.6), 7.81 (d, 1H, J=8.1 Hz, Ar--H.sup.5), 5.89 (s, 1H,
Ar--CH), 3.96 (s, 3H, ester CH.sub.3), 3.40 (s, 6H, acetal
CH.sub.3);
Step 4: 4-Amino-3-dimethoxymethyl-benzoic acid methyl ester
(Compound 6)
[0351] 100 mg 10% Pd/C and 1 g Mg.sub.2SO.sub.4 were suspended in
20 mL methanol and were hydrogenated in a Parr apparatus at 30 psi
for 15 minutes. The apparatus was opened, and 1.22 g (4.78 mmol) of
Compound 5 dissolved in 40 mL methanol was added, followed by 2 mL
TEA. The mixture was hydrogenated at 30 psi for 30 minutes, the
catalyst was removed by means of filtration and the solution was
evaporated to dryness. The solid material was dried over
P.sub.2O.sub.5/H.sub.3PO.sub.4 overnight to give Compound 6.
[0352] H.sup.1-NMR (DMSO): .delta.(ppm) 7.80 (d, 1H, J=2.1 Hz,
Ar--H.sup.2), 7.62-7.58 (dd, 1H, J=8.4 Hz and 2.1 Hz, Ar--H.sup.6),
6.64 (d, 1H, J=8.4 Hz, Ar--H.sup.5), 5.84 (s, 2H, NH2), 5.32 (s,
1H, Ar--CH), 3.72 (s, 3H, ester CH.sub.3), 3.20 (s, 6H, acetal
CH.sub.3).
Step 5: 4-Amino-3-formyl-benzoic acid methyl ester (Compound 7)
[0353] Compound 6 (0.95 g, 4.2 mmol) was dissolved at room
temperature in 15 mL of a solvent mixture composed of EtOH-acetic
acid-water 2:2:1. The strongly colored yellow solution became pale
yellow in 5 minutes. The mixture was let stand for an additional 15
minutes before it was evaporated to dryness and further dried in
high vacuum overnight to get Compound 7 as a yellow powder.
[0354] MS: 180.05 (M+H.sup.+); H.sup.1-NMR (CDCl.sub.3):
.delta.(ppm) 9.88 (s, 1H, CHO), 8.23 (d, 1H, J=2.1 Hz,
Ar--H.sup.2), 7.96-7.91 (dd, 1H, J=8.7 Hz and 2.1 Hz, Ar--H.sup.6),
6.64 (d, 1H, J=8.4 Hz, Ar--H.sup.5), 3.88 (s, 1H, CH.sub.3).
Step 6: 4-Chloro-3-nitro-benzoic acid ethyl ester (Compound 9)
[0355] 4-chloro-3-nitrobenzoic acid (100 g) was dissolved in 500 mL
anhydrous ethanol and 35 mL concentrated sulfuric acid was added
dropwise over a period of 5 minutes. The mixture was refluxed
overnight then poured on 1 L ice. The precipitate was separated by
filtration, washed four times with water and was then air dried.
Recrystallization from 275 mL ethanol afforded a pale yellow
product.
[0356] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 8.49 (d, 1H, J=2.1
Hz, Ar--H.sup.2), 8.17-8.13 (dd, 1H, J=8.8 and 2.1 Hz),
Ar--H.sup.6), 7.63 (d, 1H, J=8.1 Hz, Ar--H.sup.5), 4.42 (q, 2H,
J=7.5 Hz, CH.sub.2), 1.42 (t, 3H, J=7.5 Hz, CH.sub.3);
Step 7: 4-Cyclohexylamino-3-nitro-benzoic acid ethyl ester
(Compound 10)
[0357] A solution of Compound 9 (22.96 g, 100 mmol),
cyclohexylamine (15.31 g, 154 mmol) and TEA (13.57 g, 134 mmol) in
100 mL acetonitrile was refluxed overnight. The reaction mixture
was poured into icy water and the precipitated crystals were
collected by means of filtration, washed three times with water
then was dried over phosphorous pentoxide in high vacuum to yield
Compound 10.
[0358] MS: 293.16 (M+H.sup.+); H.sup.1-NMR (CDCl.sub.3):
.delta.(ppm) 8.85 (d, 1H, J=2.1 Hz, Ar--H.sup.2), 8.40 (d, br, 1H,
J=6.9 Hz, NH), 8.01-7.97 (dd, 1H, J=9.0 and 2.1 Hz), Ar--H.sup.6),
6.86 (d, 1H, J=9.0 Hz, Ar--H.sup.5), 4.34 (q, 2H, J=7.5 Hz,
CH.sub.2), 3.56 (m, 1H, --CH.dbd.), 2.05 (m, 2H), 1.81 (m, 2H),
1.65 (m, 2H), 1.44 (m, 4H), 1.38 (t, 3H, J=7.5 Hz, CH.sub.3);
Step 8: 3-Amino-4-cyclohexylamino-benzoic acid ethyl ester
(Compound 11)
[0359] To a solution of 5.84 g (20 mmol) of Compound 10 in 50 mL
ethyl acetate and 30 mL methanol, 100 mg of 10% Pd/C was added, and
the mixture was hydrogenated at 30 psi for 6 h. The catalyst was
removed by filtration through a pad of Celite, the solvent was
evaporated to dryness resulting in a dark purple solid which was
recrystallized from ether-hexane. The mother liquid was evaporated,
and the resulting solid was suspended in hexane and filtered to
give additional yield of Compound 11
[0360] MS: 263.18 (M+H.sup.+); H.sup.1-NMR (CDCl.sub.3):
.delta.(ppm) 7.57-7.54 (dd, 1H, J=8.7 and 2.1 Hz, Ar--H.sup.6),
7.39 (d, 1H, J=2.1 Hz, Ar--H.sup.2), 6.57 (d, 1H, J=9.0 Hz,
Ar--H.sup.5), 4.29 (q, 2H, J=7.2 Hz, CH.sub.2), 3.32 (m, 1H,
--CH.dbd.), 2.05 (m, 2H), 1.77 (m, 2H), 1.66 (m, 2H), 1.42-1.20 (m,
7H);
Step 9: 2-Phenyl-quinoline-6-carboxylic acid (Compound 13,
Y=phenyl)
[0361] To a solution of 100 mg (0.56 mmol) of Compound 7 and 67 mg
(0.56 mmol) of acetophenone in 7 mL ethanol, 420 .mu.L of a 10%
KOH/ethanol (0.75 mmol) solution was added and the mixture was
refluxed under argon overnight. The product partially precipitated
as bright yellow crystals which were not filtered off. The whole
mixture was evaporated to dryness, the residue was triturated with
ether to give the product as potassium salt. The acid was liberated
by dissolving in 10 mL water and acidification to pH 4 (about 500
.mu.L 1M HCl). The precipitate was collected by filtration, washed
twice with water and dried over phosphorous pentoxide in high
vacuum to yield Compound 13.
[0362] MS: 250.10 (M+H.sup.+); H.sup.1-NMR (DMSO): .delta.(ppm)
8.51-8.48 (m, 2H), 8.22-8.08 (m, 4H), 7.96 (d, 1H, J=8.4 Hz),
7.50-7.40 (m, 3H);
Step 10: 2-Phenyl-quinoline-6-carbonyl chloride (Compound 14,
Y=phenyl)
[0363] Compound 13 (100 mg, 0.4 mmol) was suspended in 15 mL of
thionyl chloride and refluxed for 1 hr. The mixture was evaporated
to dryness and the residue co-evaporated twice with toluene to give
Compound 14 as a yellow solid in quantitative yield which was used
immediately without further purification.
Step 11:
1-Cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbo-
xylic-acid (Compound 201 or Compound 16, Y=phenyl))
[0364] Compound 14, prepared from 100 mg (0.4 mmol) of Compound 13,
was dissolved in 4 mL of DMF. Then 105.2 mg (0.4 mmol) Compound 11
was added as a solid, followed by 69 .mu.L (0.4 mmol) of DIEA. The
mixture was then evaporated to dryness and the residue dissolved in
30 mL of glacial acetic acid. The solution was refluxed for 3 h and
evaporated to dryness. The yellow solid was dissolved again in 15
mL methanol, and 4 mL 1N NaOH was added with stirring at 80.degree.
C. for 1 h. The reaction mixture was cooled in an ice bath,
acidified with 4 mL 1N HCl and evaporated to dryness to give an oil
which was dissolved in 20 mL DMF-water 1:1 containing 0.1% TFA. The
solution was applied on a RP-HPLC column to give the pure Compound
201.
[0365] Conversion to HCl salt: The purified title compound was
dissolved in 4 mL methanol, 500 .mu.L 4M HCl in dioxane was added
followed by 40 mL ether. The white precipitate was separated by
filtration and dried in high vacuum overnight.
[0366] MS: 448.20 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.70 (m, 1H), 8.47 (s, 1H), 8.33 (m, 5H), 8.22 (m,
1H), 8.09 (m, 1H), 8.00 (m, 2H), 7.58 (m, 3H), 4.44 (m, 1H), 4.23
(br, 4H), 2.33 (m, 2H), 2.10 (m, 2H), 1.85 (m, 2H), 1.61 (m, 1H),
1.36 (m, 3H);
Example 2
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid (Compound
229)
[0367] To a solution of 45 mg (0.1 mmol) Compound 201 in 500 .mu.L
DMF 22.8 .mu.L (0.13 mmol) TFA-OPfp and 23 .mu.L (0.13 mmol) DIEA
was added. The mixture was stirred at room temperature for 30
minutes. 29.1 mg (0.13 mmol) L-5-hydroxytryptophane dissolved in
500 .mu.L DMF was added to the activated ester solution followed by
40 .mu.L DIEA. The reaction was complete in 1 h. The DMF was
evaporated and the residual oil which was dissolved in 20 mL
DMF-water 1:1 containing 0.1% TFA. The solution was applied on a
R.sup.P-HPLC column to give the pure Compound 229 as TFA salt.
[0368] Conversion to HCl salt: The purified Compound 229 was
dissolved in 4 mL methanol, 1 mL 4M HCl in dioxane was added
followed by 40 mL ether. The off-white precipitate was separated by
filtration and dried in high vacuum overnight.
[0369] MS: 650.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.52 (d, 1H), 8.93 (d, 1H), 8.71 (d, 1H), 8.49 (d,
1H), 8.35-8.24 (m, 5H), 8.23 (d, 1H), 8.09 (dd, 1H), 7.97 (dd, 1H),
7.63-7.54 (m, 3H), 7.12-7.08 (m, 2H), 6.90 (d, 1H), 6.57 (dd, 1H),
4.46 (m, 1H), 4.44 (m, 1H), 3.32 (m, 2H), 2.33 (m, 2H), 2.10 (m,
2H), 1.85 (m, 2H), 1.60 (m, 1H), 1.32 (m, 3H);
Example 3
Preparation of
1-(trans-4-Hydroxy-cyclohexyl)-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimida-
zole-5-carboxylic acid (Compound 579)
Step 1: 3-Nitro-4-(trans-4-hydroxy-cyclohexylamino)-benzoic acid
ethyl ester (Compound 579a)
[0370] Compound 9 (689 mg, 3 mmol) was suspended in acetonitrile (5
mL) and then triethylamine was added (1.3 mL, 9 mmol).
trans-4-aminocyclohexanol hydrochloride (682 mg, 4.5 mmol) was then
added and the reaction refluxed for 12 hours, 2 mL methanol was
then added and the reaction further refluxed for another 24 hours.
Water (100 mL) was added and the resulting precipitate filtered,
washed 3 times with water and air-dried. The product was used
without further characterization in the next step MS: 309.3
(M+H.sup.+)
Step 2: 3-Amino-4-(trans-4-hydroxy-cyclohexylamino)-benzoic acid
ethyl ester (Compound 579b)
[0371] The product from the previous step (3 mmol) was dissolved in
ethyl acetate (60 mL) and methanol (40 mL) and 10% Pd/C (100 mg)
was added. The reaction was hydrogenated on a Parr-shaker at 35 psi
for 61/2 hours at ambient temperature. The Pd/C was filtered and
the filtrate concentrated. Chromatography (SiO.sub.2,
methanol/dichloromethane 3:97 v/v) to yield the title intermediate
(265 mg, 0.95 mmol) MS: 279.2 (M+H.sup.+)
Step 3:
1-(trans-4-Hydroxy-cyclohexyl)-2-(2-phenyl-quinoxalin-6-yl)-1H-ben-
zoimidazole-5-carboxylic acid (Compound 579)
[0372] Compound 36A Y=Phenyl, (200 mg, 0.8 mmol) was activated in 8
mL DMF with TBTU (282 mg, 0.88 mmol) and DIEA (0.285 mL, 1.6 mmol)
for 30 minutes at room temperature. This solution was then added to
Compound 579b (265 mg, 0.95 mmol) and stirred at ambient
temperature for 20 hours. The reaction was concentrated to a
residue in-vacuo and then dissolved in acetic acid (20 mL) and
refluxed overnight. In the morning, the acetic acid was removed
in-vacuo and the crude residue dissolved in a mixture of THF (20
mL), methanol (16 mL) and 2 M NaOH (4 mL) and the solution heated
at 60 C overnight. The solution was then concentrated in-vacuo to
an aqueous solution and concentrated HCl added until the pH was 5.
The resulting precipitate was filtered, washed with water and
purified using RP-HPLC column to give the pure title compound.
[0373] Conversion to HCl salt: The HPLC purified product was
dissolved in 4 mL methanol, 500 .mu.L 4M HCl in dioxane was added
followed by 40 mL ether. The resulting precipitate was separated by
filtration and dried in high vacuum overnight. Yield: 15.7 mg.
[0374] MS: 465.21 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 9.72 (s, 1H), 8.45 (s, 1H), 8.41-8.32 (m, 5H),
8.19-8.12 (m, 2H), 7.98 (d, 1H, 8.4 Hz), 7.62 (m, 3H), 4.27 (t, 1H,
12 Hz), 2.53-2.36 (m, 3H), 2.06-1.93 (m, 4H), 1.29-1.22 (m,
2H).
Example 4
Preparation of
2-{[1-Cyclohexyl-2-(2-methyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid (Compound
230)
Step 1: 2-Methyl-quinoline-6-carboxylic acid (Compound 28)
[0375] Compound 28 was synthesized as described for Compound 13,
using acetone in place of acetophenone.
[0376] MS: 188.06 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.88 (d, 1H, J=8.4 Hz), 8.78 (s, 1H), 8.37-8.26 (m,
2H), 7.83-7.80 (m, 1H), 2.88 (s, 3H).
Step 2:
4-Cyclohexylamino-3-[(2-methyl-quinoline-6-carbonyl)-amino]-benzoi-
c acid ethyl ester (Compound 29)
[0377] Compound 29 was synthesized from Compound 28 as described
for Compound 25 with quantitative yield.
Step 3:
1-Cyclohexyl-2-(2-methyl-quinolin-6-yl)-1H-benzoimidazole-5-carbox-
ylic acid ethyl ester (Compound 30)
[0378] Compound 30 was synthesized from Compound 29 as described
for Compound 23 with quantitative yield. MS: 414.24
(M+H.sup.+).
Step 4:
1-Cyclohexyl-2-(2-methyl-quinolin-6-yl)-1H-benzoimidazole-5-carbox-
ylic acid (Compound 31)
[0379] Compound 31 was synthesized from Compound 30 as described
for Compound 204. Yield: 77%.
[0380] MS: 386.21 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.99 (d, 1H, J=8.7 Hz), 8.57 (d, 1H, J=1.8 Hz), 8.52
(d, 1H, J=8.7 Hz), 8.27-8.23 (m, 2H), 8.085 (d, 1H, J=9.0 Hz),
7.92-7.88 (m, 2H), 4.28 (m, 1H), 2.94 (s, 3H), 2.30-2.18 (m, 2H),
1.99 (m, 2H), 1.78 (m, 2H), 1.56 (m, 1H), 1.36-1.20 (m, 3H).
Step 4:
2-{[1-Cyclohexyl-2-(2-methyl-quinolin-6-yl)-1H-benzoimidazole-5-ca-
rbonyl]-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid (Compound
230)
[0381] Compound 230 was synthesized from Compound 31 as described
for Compound 235 Yield: 32%.
[0382] MS: 588.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.47 (s, 1H), 8.92 (d, 1H, J=9.0 Hz), 8.79 (d, 1H,
J=7.5 Hz) 8.56 (s, 1H), 8.41 (d, 1H, J=8.7 Hz), 8.28-8.21 (m, 2H),
8.10 (d, 1H, J=8.7 Hz), 7.88 (d, 2H, J=8.7 Hz), 7.08-7.04 (m, 2H),
6.86 (d, 1H, J=1.8 Hz), 6.55-6.51 (dd, 1H, J=2.1 Hz, 8.7 Hz), 4.61
(m, 1H), 4.31 (m, 1H), 2.91 (s, 3H), 2.28-2.24 (m, 2H), 2.01 (m,
2H), 1.80 (m, 2H), 1.56 (m, 1H), 1.32-1.19 (m, 3H).
Example 5
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-hydroxy-propionic acid (Compound 231)
[0383] Compound 231 was synthesized from Compound 201 as described
for Compound 235, except L-serine was used instead of
L-5-hydroxytryptophane. Yield: 36%.
[0384] MS: 535.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.93 (d, 1H, J=7.2 Hz), 8.73 (d, 1H, J=8.4 Hz), 8.54
(d, 1H, J=2.1 Hz), 8.46 (s, 1H), 8.38-8.29 (m, 5H), 8.15-8.11 (m,
2H), 7.73-7.55 (m, 3H), 4.50 (m, 2H), 3.85 (d, 1H, J=5.4 Hz),
2.37-2.32 (m, 2H), 2.15 (m, 2H), 1.86 (m, 2H), 1.61 (m, 1H),
1.39-1.30 (m, 3H).
Example 6
Preparation of
6-Amino-2-{[1-cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-c-
arbonyl]-amino}-hexanoic acid (Compound 232)
[0385] Compound 232 was synthesized from Compound 201 as described
for Compound 235, except H-Lys(Boc)-OtBu was used instead of
L-5-hydroxytryptophane. In the 3rd step the protected intermediate
was treated with a mixture of TFA-anisol 8:2 for 2 hours then the
product was precipitated with ether and purified on RP-HPLC. Yield
15%.
[0386] MS: 576.33 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.90 (d, 1H, J=7.8 Hz), 8.71 (d, 1H, J=8.7 Hz), 8.48
(d, 1H, J=1.8 Hz), 8.41 (d, 1H), 8.35-8.32 (m, 4H), 8.22 (d, 1H,
J=9.6 Hz), 8.12-8.08 (dd, 1H, J=1.8 Hz, 8.7 Hz), 8.02 (d, 1H, J=8.7
Hz), 7.86 (br, 3H), 7.60-7.54 (m, 3H), 4.42 (m, 2H), 2.78 (m, 2H),
2.36-2.27 (m, 2H), 2.11 (m, 2H), 1.90-1.83 (m, 4H), 1.62 (m, 3H),
1.53-1.25 (m, 6H).
Example 7
Preparation of
1-[1-Cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]--
pyrrolidine-2-carboxylic acid (Compound 233)
[0387] Compound 233 was synthesized from Compound 201 as described
for Compound 235, except L-proline was used instead of
L-5-hydroxytryptophane. Yield: 15%.
[0388] MS: 545.28 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.71 (d, 1H), J=9.0 Hz), 8.49 (d, 1H), 8.36-8.32 (m,
4H, 8.26 (d, 1H, J=8.7 Hz), 8.12-8.08 (dd, 1H, J=1.5 Hz, 8.7 Hz),
7.95 (m, 1H), 7.65-7.53 (m, 2H), 4.44 (m, 1H), 3.56 (m, 1H), 2.30
(m, 3H), 2.11 (m, 2H), 1.92-1.83 (m, 6H), 1.65 (m, 1H), 1.37-1.32
(m, 4H).
Example 8
Preparation of
1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid (Compound 203 or Compound 39, Y=phenyl)
Step 1: 2-Phenyl-quinoxaline-6-carboxylic acid (compound 36A,
Y=phenyl) and 3-Phenyl-quinoxaline-6-carboxylic acid (compound 36B,
Y=phenyl)
[0389] To a solution of Compound 34 (850.75 mg, 5 mmol) and
3,4-diaminobenzoic acid in 50 mL of acetic acid, Compound 35 (670.7
mg, 5 mmol) phenylglyoxal was added and was refluxed under argon
for 2.5 h. The reaction mixture was evaporated to dryness. The
resulting grey solid containing the two isomers in about 2:1 ration
was separated by HPLC resulting in 230 mg (19%) Compound 36A and
140 mg (12%) Compound 36B.
[0390] The major component (Compound 36A) was also prepared in an
alternate manner. Ethanol was used as a solvent in place of acetic
acid and the reaction mixture was stirred overnight at 0.degree. C.
The precipitate formed during the reaction was filtered off, washed
with cold ethanol and dried to provide Compound 36A. Yield
(78%).
[0391] Compound 36A: MS: 251.10 (M+H.sup.+); H.sup.1-NMR (DMSO):
.delta. (ppm) 13.5 (s, 1H), 9.67 (s, 1H,), 8.60 (d, 1H, J=1.5 Hz),
8.38-8.34 (m, 2H), 8.31-8.27 (dd, 1H, J=8.7 Hz and 2.1 Hz), 8.20
(d, 1H, J=9 Hz), 7.65-7.59 (m, 3H);
[0392] Compound 36B: MS: 251.10 (M+H.sup.+); H.sup.1-NMR (DMSO):
.delta.(ppm) 13.5 (s, 1H), 9.63 (s, 1H,), 8.30 (d, 1H, J=1.2 Hz),
8.38-8.34 (m, 2H), 8.28-8.24 (dd, 1H, J=8.7 Hz and 1.8 Hz), 8.18
(d, 1H, J=8.7 Hz), 7.63-7.57 (m, 3H);
Step 2:
4-Cyclohexylamino-3-[(2-phenyl-quinoxaline-6-carbonyl)-amino]-benz-
oic acid ethyl ester (compound 37, Y=phenyl)
[0393] The suspension of 250 mg (1 mmol) of Compound 36 in 4 mL of
DMF was activated by treatment with 418 mg (1.1 mmol) of HATU and
383 .mu.L (2.2 mmol) of DIEA for 10 minutes at room temperature
during which time it remains a suspension. Compound 11 (289 mg, 1.1
mmol) was added and the mixture was stirred at room temperature
overnight, becoming a clear solution. The DMF was evaporated and
the resulting oil was triturated with water. The solidified
material was filtered, washed with water (3.times.) and dried to
give Compound 37 as a yellow solid which was used without further
purification. MS: 495.27 (M+H.sup.+);
Step 3:
1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester (Compound 38, Y=phenyl)
[0394] Compound 37 (1 mmol) from the previous step was dissolved in
80 mL glacial acetic acid and was refluxed for 4 h. The acetic acid
was evaporated and the resulting oil was dried overnight under high
vacuum to give Compound 38 as a semisolid which was used without
further purification. MS: 477.25 (M+H.sup.+);
Step 4:
1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid (Compound 203)
[0395] To the solution of 1 mmol of Compound 38 in 40 mL ethanol,
10 mL of 1 M NaOH was added and the mixture was refluxed for 1 h.
The reaction mixture was then cooled and evaporated to dryness. The
residue was dissolved in 50 mL of water and acidified with 1 M HCl
to pH 4. The precipitate was filtered off, washed with water
(4.times.) and dried to give the title compound.
[0396] MS: 449.23 (M+H.sup.+); H.sup.1-NMR (DMSO): .delta.(ppm)
9.73 (s, 1H), 8.51 (d, 1H, J=1.5 Hz), 8.42-8.35 (m, 4H), 8.24-8.16
(m, 2H), 8.03-7.99 (dd, 1H, J=9 Hz and 1.5 Hz), 7.65-7.61 (m, 3H),
4.41 (m, 1H), 4.5-3.9 (br, 2H), 2.31 (m, 2H), 2.10 (m, 2H), 1.85
(m, 2H), 1.61 (m, 1H), 1.40-1.20 (m, 3H);
Example 9
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid (Compound
234)
[0397] Compound 203 (100 mg, 0.22 mmol) was activated in 2 mL DMF
with 92 mg (0.24 mmol) HBTU and 85 .mu.L DIEA for 10 minutes at
room temperature. 56 mg 5-hydroxy-L-tryptophane, dissolved in 1 mL
DMF was added followed by 44 .mu.L DIEA. The mixture was stirred at
room temperature for 1 h, then evaporated to dryness. The oil was
purified using RP-HPLC column to give Compound 234.
[0398] Conversion to HCl salt: The purified Compound 234 was
dissolved in 4 mL methanol, 500 .mu.L of 4M HCl in dioxane was
added followed by 40 mL of ether. The yellow precipitate was
separated by filtration and dried in high vacuum overnight. Yield:
76 mg (58%) off yellow solid.
[0399] MS: 651.28 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.49 (d, 1H), 9.71 (s, 1H), 8.73 (d, 1H), 8.41-8.31
(m, 5H), 8.18-8.14 (dd, 1H, J=8.4 Hz and 1.8 Hz), 8.05 (d, 1H, J=9
Hz), 7.85 (dd, 1H, J=9 Hz and 1.8 Hz), 7.67-7.61 (m, 3H), 7.13-7.08
(m, 2H), 6.90 (d, 1H, J=2.1 Hz), 6.59-6.55 (dd, 1HH, J=8.7 Hz and
2.4 Hz), 4.65 (m, 1H), 4.41 (m, 1H), 3.20 (m, 2H), 2.32 (m, 2H),
2.04 (m, 2H), 1.85 (m, 2H), 1.61 (m, 1H), 1.44-1.22 (m, 3H).
Example 10
Preparation of
2-{2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl}-1--
cyclohexyl-1H-benzoimidazole-5-carboxylic acid (Compound 204)
Step 1: 1-[2-Hydroxy-5-(pyrrolidine-1-carbonyl)-phenyl]-ethanone
(Compound 18)
[0400] To a solution of 500 mg (2.8 mmol) of
3-acetyl-4-hydroxy-benzoic acid in 5 mL of DMF, 721.6 .mu.L (4.2
mmol) of TFA-OPfp and 731.5 .mu.L (4.2 mmol) of DIEA were added.
The clear solution was stirred at room temperature for 15 minutes,
then 467.5 .mu.L (5.6 mmol) of pyrrolidine was added. The mixture
was stirred for another hour and was then evaporated to dryness.
The oily residue was taken up in 50 mL water-50 mL ethyl acetate
mixture, the EtOAc phase was separated, washed twice with 1M HCl,
water, saturated NaHCO.sub.3, brine and was dried with
Na.sub.2SO.sub.4. The EtOAc was evaporated; the oil was purified on
an open silica gel column using a toluene/ethyl acetate gradient
containing 5% acetic acid to yield 410 mg (51%) Compound 18.
[0401] MS: 232.12 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 12.02 (s, 1H), 7.99 (d, 1H, J=2.1 Hz), 7.69-7.65 (dd,
1H, J=2.1 Hz, 8.7 Hz), 6.97 (d, 1H, J=8.7 Hz), 3.47-3.32 (m, 4H),
2.65 (s, 3H), 1.90-1.83 (br, 4H).
Step 2:
2-[2-Hydroxy-5-(pyrrolidine-1-carbonyl)-phenyl]-quinoline-6-carbox-
ylic acid (Compound 19)
[0402] Compound 18 (410 mg, 1.75 mmol) and Compound 7 (315 mg, 1.75
mmol) were dissolved in 30 mL of ethanol, 2.45 mL of a 10%
KOH/ethanol solution was added and the mixture was refluxed
overnight under argon. The ethanol was evaporated, the residue
dissolved in water, and acidified with 3 mL of 1M HCl. The formed
gel was solidified by addition of 30 mL of ethyl acetate and 30 mL
of a saturated NaCl solution. The solid was filtered, a washed with
water, and dried. Yield 302 mg (48%) Compound 19.
[0403] MS: 363.15 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 13.28 (br, 1H), 8.72 (m, 2H), 8.50 (m, 1H), 8.37 (s,
1H), 8.25 (m, 1H), 8.14 (d, 1H, J=8.7 Hz), 7.58 (m, 1H), 7.02 (d,
1H, J=8.7 Hz), 3.51 (m, 4H), 1.85 (m, 4H).
Step 3:
2-[2-Hydroxy-5-(pyrrolidine-1-carbonyl)-phenyl]-quinoline-6-carbox-
ylic acid methyl ester (Compound 20)
[0404] To the solution of 295 mg (0.81 mmol) of Compound 19 in 3 mL
of methanol, 1 mL of 4M HCl/dioxane was added, and the mixture was
heated at 60.degree. C. overnight. The reaction mixture was then
evaporated to dryness to give Compound 20 in quantitative yield.
MS: 377.18 (M+H.sup.+).
Step 4:
2-[5-(Pyrrolidine-1-carbonyl)-2-trifluoromethanesulfonyloxy-phenyl-
]-quinoline-6-carboxylic acid methyl ester (Compound 21)
[0405] Compound 20 described in the previous step (0.81 mmol) and
10 mg of DMAP were dissolved in 10 mL of DCM. Then 1 mL of pyridine
was added, followed by 450 .mu.L (2.67 mmol) of triflic anhydride
(drop-wise), and the mixture was stirred overnight. The reaction
mixture was evaporated and purified on silicagel using
toluene-ethyl acetate (10-50%) gradient. Yield: 320 mg (77%)
Compound 21.
[0406] MS: 509.11 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.78-8.74 (m, 2H), 8.29-8.25 (dd, 1H, J=2.1 Hz, 9.0
Hz), 8.18 (d, 1H, J=8.7 Hz), 8.1 (d, 1H, J=2.1 Hz), 8.03 (d, 1H,
J=8.7 Hz), 7.85-7.81 (dd, 1H, J=2.1 Hz, J=2.1 Hz, 8.4 Hz), 7.67 (d,
1H, J=8.4 Hz), 3.94 (s, 3H), 3.51-3.41 (m, 4H), 1.9-1.82 (m, 4H);
F.sup.19-NMR: .delta.-74.58.
Step 5:
2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinoline-6-c-
arboxylic acid methyl ester (Compound 23)
[0407] Compound 21 (320 mg, 0.63 mmol), 4-chloro-phenylboronic acid
(Compound 22, 148 mg, 0.94 mmol), 500 mg (2.35 mmol) of
K.sub.3PO.sub.4, 27 mg (0.63 mmol) of LiCl and 36.5 mg (0.031 mmol)
of Pd(PPh.sub.3).sub.4 were dissolved in 30 mL dioxane (degassed).
The mixture was refluxed under argon overnight. The black solution
was filtered through a Celite pad, and evaporated to dryness to
give Compound 23 as yellow oil which was used without further
purification. MS: 471.16 (M+H.sup.+).
Step 6:
2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinoline-6-c-
arboxylic acid (Compound 24)
[0408] Compound 23 from the previous step (0.63 mmol) was dissolved
in 15 mL methanol, and 5 mL of 1M NaOH were added. The solution was
refluxed for 2 hours, then evaporated. The residue was then
dissolved in water, acidified with 5 mL of 1M HCl, and the
precipitate was filtered off, washed three times with water and
dried to yield 276 mg (96%) of Compound 24.
[0409] MS: 455.12 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 13.1 (br, 1H), 8.59 (d, 1H, J=1.8 Hz), 8.33 (d, 1H,
J=8.4 Hz), 8.20-8.17 (dd, 1H, J=2.1 Hz, 9.0 Hz), 8.04 (d, 1H, J=8.7
Hz), 7.87 (d, 1H, J=1.8 Hz), 7.74-7.71 (dd, 1H, J=1.8 Hz, 8.1 Hz),
7.55-7.51 (d, 1H, J=8.4 Hz), 7.32-7.3 (m, 2H), 7.17-7.13 (m, 3H),
3.51-3.47 (m, 4H), 1.88-1.83 (m, 4H).
Step 7:
3-({2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinoline-
-6-carbonyl}-amino)-4-cyclohexylamino-benzoic acid ethyl ester
(Compound 25)
[0410] Compound 24 (270 mg, 0.59 mmol) in 4 mL of DMF was activated
with 246.6 mg (0.65 mmol) of HATU and 226 .mu.L (1.30 mmol) of DIEA
at room temperature for 15 minutes. Compound 11 (170 mg, 0.65 mmol)
was added as solid and the mixture was stirred overnight. The DMF
was evaporated; the remaining oil was solidified by trituration
with water. The solid Compound 25 was filtered off, dried and used
without further purification. MS: 701.34 (M+H.sup.+).
Step 8:
2-{2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-
-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid ethyl ester
(Compound 27 Q=ethyl)
[0411] The compound from the previous step (0.59 mmol) was
dissolved in 80 mL acetic acid and refluxed for 2.5 hours. The
acetic acid was evaporated, the residue was dried to give Compound
204 in quantitative yield. MS: 683.33 (M+H.sup.+).
Step 9:
2-{2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-
-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid (Compound
204)
[0412] Compound 27 Q=ethyl (0.59 mmol), from the previous step, was
dissolved in a mixture of 25 mL of ethanol and 5 mL of 1 M NaOH and
was refluxed for 2 hours. The reaction mixture was then evaporated
to dryness. The residue was dissolved in 30 mL water, acidified
with 1M HCl to pH 4. The precipitate that formed was filtered off,
washed four times with water and dried. Yield 315 mg (73%). The
title compound maybe further purified using RP-HPLC.
[0413] Conversion to HCl salt: The purified Compound 204 was
dissolved in 4 mL methanol, 1 mL 4M HCl in dioxane was added
followed by 40 mL ether. The off-white precipitate was separated by
filtration and dried in high vacuum overnight. Yield: 28.3 mg
solid.
[0414] MS: 655.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.41-8.38 (m, 2H), 8.32 (d, 1H, J=1.5 Hz), 8.27-8.19
(m, 2H), 8.10-8.06 (dd, 1H, J=1.8 Hz, 8.7 Hz), 8.02-7.98 (dd, 1H,
J=1.5 Hz, 8.7 Hz), 7.92 (d, 1H, J=1.8 Hz), 7.77-7.74 (dd, 1H, J=2.1
Hz, 8.1 Hz), 7.58 (d, 1H, J-7.8 Hz), 7.36-7.33 (m, 2H), 7.25-7.19
(m, 3H), 4.43 (m, 1H), 3.51 (m, 4H), 3.33 (m, 2H), 2.08 (m, 2H),
1.87 (m, 6H), 1.61 (m, 1H), 1.32 (m, 3H).
Example 11
Preparation of
1-Cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid (Compound 205)
Step 1:
4-Cyclohexylamino-3-[(3-phenyl-quinoxaline-6-carbonyl)-amino]-benz-
oic acid ethyl ester (Compound 41)
[0415] The solution of 238 mg (0.95 mmol) Compound 37 in 5 mL DMF
was activated by treatment with 398 mg (1.05 mmol) HATU and 365
.mu.L (2.1 mmol) DIEA for 10 minutes at room temperature. Compound
11 (275 mg, 1.1 mmol) was added and the mixture was stirred at room
temperature overnight. The DMF was evaporated, the resulting oil
was triturated with water, the solidified material filtered off,
washed with water (3.times.) and dried to give Compound 41 as a 92%
pure yellow solid which was used without further purification. MS:
495.26 (M+H.sup.+);
Step 2:
1-Cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester (Compound 42)
[0416] Compound 41 (0.95 mmol) from the previous step was refluxed
in 80 mL acetic acid for 3.5 h. The mixture was then evaporated to
dryness and dried overnight under high vacuum to yield Compound 42
in quantitative yield. It was not further purified before
saponification.
Step 3:
1-Cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid (Compound 205)
[0417] To the solution of Compound 42 (0.95 mmol) in 25 mL ethanol
5 mL, 1 M NaOH was added and the mixture was refluxed for 1 h. It
was then cooled and evaporated to dryness. The residue was
dissolved in 50 mL water, acidified with 1M HCl to pH 4. The
precipitate was filtered off, washed with water (4.times.) and
dried to give 345 mg (81%) of the title compound which maybe
further purified by RP-HPLC.
[0418] MS: 448.19 (M-H.sup.+); H.sup.1-NMR (DMSO--): .delta.(ppm)
9.72 (s, 1H), 8.48 (d, 1H, J=1.8 Hz), 8.39-8.34 (m, 4H), 8.20-8.11
(m, 2H), 8.01-7.97 (dd, 1H, J=8.7 Hz and 1.5 Hz), 7.63-7.60 (m,
3H), 4.41 (m, 1H), 4.5-3.9 (br, 2H), 2.31 (m, 2H), 2.10 (m, 2H),
1.85 (m, 2H), 1.60 (m, 1H), 1.40-1.20 (m, 3H);
Example 12
Preparation of
2-[(2-{2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl-
}-1-cyclohexyl-1H-benzoimidazole-5-carbonyl)-amino]-3-(5-hydroxy-1H-indol--
3-yl)-propionic acid (Compound 235)
[0419] Compound 204 (100 mg, 0.15 mmol) in 2 mL DMF was activated
with 64 mg (0.17 mmol) HBTU and 58 .mu.L (0.33 mmol) DIEA at room
temperature for 10 minutes. Then 40 mg (0.18 mmol)
5-hydroxytryptophane and 32 .mu.L (0.25 mmol) DIEA, dissolved in 1
mL DMF, was added and the mixture was stirred for 1 h. The DMF was
evaporated; the residue was purified with RP-HPLC.
[0420] Conversion to HCl salt: The purified Compound 235 was
dissolved in 4 mL methanol, 1 mL 4M HCl in dioxane was added
followed by 40 mL ether. The off-white precipitate was separated by
filtration and dried in high vacuum overnight. Yield: 44.1 mg
(32%).
[0421] MS: 856.23 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.51 (d, 1H, J=1.8 Hz), 8.89 (d, 1H, J=4.8 Hz),
8.41-8.38 (m, 2H), 8.33 (d, 1H, J=1.5 Hz), 8.28-8.19 (m, 2H),
8.10-8.07 (dd, 1H, J=1.5 Hz, 8.1 Hz), 7.96-7.91 (m, 2H), 7.78-7.74
(dd, 1H, J=1.8 Hz, 8.1 Hz), 7.58 (d, 1H, J=7.8 Hz), 7.37-7.34 (m,
2H), 7.26-7.19 (m, 3H), 7.10 (m, 2H), 6.89 (d, 1H, J=1.8 Hz),
6.58-6.55 (dd, 1H, J=2.1 Hz, 8.7 Hz), 4.65 (m. 1H), 4.43 (m, 1H),
3.51 (m, 4H), 2.33 (m, 2H), 2.08 (m, 2H), 1.87 (m, 6H), 1.61 (m,
1H), 1.32 (m, 3H).
Example 13
Preparation of
2-{[1-Cyclohexyl-2-(3-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid (Compound
236)
[0422] Compound 205 (100 mg, 0.22 mmol) was activated in 2 mL of
DMF with 92 mg (0.24 mmol) of HBTU and 85 .mu.L of DIEA for 10
minutes at room temperature. 5-hydroxy-L-tryptophane (56 mg)
dissolved in 1 mL DMF was added, followed by 44 .mu.L of DIEA. The
mixture was stirred at room temperature for 1 h, then was
evaporated to dryness. The oil was purified using RP-HPLC column to
give the pure Compound 236.
[0423] Conversion to HCl salt: The purified Compound 236 was
dissolved in 4 mL methanol, 500 .mu.L 4M HCl in dioxane was added
followed by 40 mL ether. The dark gray precipitate was separated by
filtration and dried in high vacuum overnight. Yield: 87 mg (55%)
of grayish brown solid.
[0424] MS: 649.22 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.54 (d, 1H, J-2.1 HZ), 9.75 (s, 1H), 8.99 (d, 1H,
J=7.5 Hz), 8.58 (d, 1H, J=1.8 Hz), 8.41-8.36 (m, 4H), 8.28-8.25 (d,
1H, J=9.0 Hz), 8.18-8.14 (dd, 1H, J=1.8 Hz, 8.7 Hz), 8.02-7.99 (dd,
1H, 1.8 Hz, 8.7 Hz), 7.65-7.60 (m, 3H), 7.12-7.08 (m, 2H), 6.90 (m,
1H), 6.59-6.55 (dd, 1H, J=2.4 Hz, 8.7 Hz), 4.67 (m, 1H), 4.44 (m,
1H), 3.22 (m, 2H), 2.30 (m, 2H), 2.12 (m, 2H), 1.85 (m, 2H), 1.58
(m, 1H), 1.36-1.25 (m, 3H);
Example 14
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-pentanedioic acid (Compound 237)
[0425] Compound 237 was synthesized from Compound 201 as described
for Compound 235, using L-glutamic acid dimethylester in place of
L-5-hydroxytryptophane. In the 3rd step the protected intermediate
was treated with aqueous sodium hydroxide for a 15% yield of the
title compound
[0426] MS: 577.17 (M+H.sup.+); H.sup.1-NMR (DMSO d.sub.6):
.delta.(ppm) 8.72-8.64 (m, 2H), 8.38-8.25 (m, 6H), 8.06-8.02 (m,
2H), 7.89-7.86 (dd, 1H, J=1.5 Hz, 8.7 Hz), 7.60-7.53 (m, 3H)
4.48-4.38 (m, 2H), 2.42-2.28 (m, 4H), 2.16-1.96 (m, 4H), 1.88-1.83
(m, 2H), 1.62 (m, 1H), 1.4-1.22 (m, 3H).
Example 15
Preparation of
1-Cyclohexyl-2-(3-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carboxylic
acid (Compound 206)
Step 1: 3-Phenyl-quinoline-6-carboxylic acid (Compound 206a)
[0427] The title intermediate was synthesized as described for
Compound 13, using phenylacet-aldehyde instead of acetophenone.
Yield: 68%.
[0428] MS: 248.09 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 9.20 (s, 1H), 8.79 (d, 2H), 8.20-8.00 (m, 2H),
7.95-7.00 (m, 5H).
Step 2:
4-Cyclohexylamino-3-[(3-phenyl-quinoline-6-carbonyl)-amino]-benzoi-
c acid ethyl ester (Compound 206b)
[0429] The title intermediate was synthesized from the product of
the previous step as described for Compound 25 with quantitative
yield.
Step 3:
1-Cyclohexyl-2-(3-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbox-
ylic acid ethyl ester (Compound 206c)
[0430] The title intermediate was synthesized from the product of
the previous step as described for compound 27 Q=ethyl with
quantitative yield. MS: 476.26 (M+H.sup.+).
Step 4:
1-Cyclohexyl-2-(3-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbox-
ylic acid
[0431] The title compound was synthesized from the product of the
previous step as described for Compound 204. Yield: 91%.
[0432] MS: 448.22 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 9.50 (d, 1H, J=2.4 Hz), 9.05 (d, 1H, J=1.8 Hz), 8.55
(d, 1H, J=1.5 Hz), 8.39-8.34 (m, 2H), 8.24-8.21 (d, 1H, J=8.7 Hz),
8.16-8.12 (dd, 1H, J=9.0 Hz, 1.5 Hz), 8.03-7.94 (m, 3H), 7.61-7.47
(m, 3H), 4.44 (m, 1H), 2.35-2.26 (m, 2H), 2.16-2.08 (m, 2H),
1.86-1.82 (m, 2H), 1.60 (m, 1H), 1.43-1.25 (m, 3H).
Example 16
Preparation of
2-{[1-Cyclohexyl-2-(3-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid (Compound
238)
[0433] The title compound was synthesized from Compound 206 as
described for Compound 235 Yield: 19%.
[0434] MS: 650-31 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.52 (s, 1H), 9.49 (d, 1H, J=1.8 Hz), 9.01 (s, 1H),
8.95-8.92 (d, 1H, J=7.5 Hz), 8.56 (s, 1H), 8.39-8.33 (m, 2H),
8.25-8.22 (d, 1H, J=9.0 Hz), 8.15-8.12 (d, 1H, J=8.7 Hz), 7.99-7.94
(m, 3H), 7.61-7.47 (m, 3H), 7.11-7.03 (m, 2H), 6.89 (m, 1H),
6.58-6.55 (m, 1H), 4.70-4.62 (m, 1H), 4.44 (m, 2H), 3.21 (m, 1H),
2.34-2.31 (m, 2H), 2.10 (m, 2H), 1.86-1.82 (m, 2H), 1.59 (m, 1H),
1.45-1.30 (m, 3H).
Example 17
Preparation of
2-[(2-(2-phenyl-quinoxalin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbony-
l)-amino]-propionic acid (Compound 310)
[0435] The general procedure described for Compound 242 was used
with Fmoc-Ala Wang resin (167 mg, 0.6 mmol/g), producing 10.2 mg of
the title compound. (10% yield). MS: 520.26 (M+H.sup.+) HPLC
Procedure A, retention time=12.52 min.
Example 18
Preparation of
3-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-propionic acid (Compound 239)
[0436] The general procedure described for Compound 242 was used
with Fmoc-.beta.-Ala Wang resin (167 mg, 0.6 mmol/g), producing 21
mg of the title compound (39% yield).
[0437] MS: 520.26 (M+H.sup.+) HPLC Procedure A, retention
time=12.25 min.
Example 19
Preparation of
3-Biphenyl-4-yl-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimi-
dazole-5-carbonyl]-amino}-propionic acid (Compound 240)
[0438] The general procedure described for Compound 242 was used
with Fmoc-Bip Wang resin (125 mg, 0.8 mmol/g), producing 33 mg of
the title compound (51% yield).
[0439] MS: 672.33 (M+H.sup.+) HPLC Procedure A, retention
time=16.33 min.
Example 20
Preparation of
3-(4-Benzoyl-phenyl)-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-ben-
zoimidazole-5-carbonyl]-amino}-propionic acid (Compound 241)
[0440] The general procedure described for Compound 242 was used
with Fmoc-Bpa Wang resin (125 mg, 0.8 mmol/g), producing 37 mg of
the title compound (50% yield).
[0441] MS: 700.32 (M+H.sup.+) HPLC Procedure A, retention
time=15.46 min.
Example 21
Preparation of
3-Cyclohexyl-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidaz-
ole-5-carbonyl]-amino}-propionic acid (Compound 242)
[0442] Fmoc protected amino acids on Wang resins (0.1 mmol) were
added to a reaction vessel. The resin was then stirred for 1 hour
with a 20% solution of piperidine in DMF. The resins were rinsed 6
times with DMF. A solution of Compound 203 (0.5 mmol in 6 mL DMF),
preactivated with HATU (0.496 mmol) and DIEA (1.0 mmol), was added
to the resin and mixed for 16 hours. The resins were then washed
with DMF (5 mL 3 times), dichloromethane (5 mL 3 times), and
diethylether (5 mL 3 times). The desired compound was cleaved from
the resin with 2% water in TFA and converted to the HCl salt by
dissolving in 0.8 mL methanol and adding 1 mL 4M HCl in dioxane
followed by 40 mL ether. The compound was centrifuged down, the
solvent decanted off, and the solid dried to yield the final
compound.
[0443] This general procedure was followed with Fmoc-Cys Wang resin
(167 mg, 0.6 mmol/g), producing 25 mg of the title compound (46%
yield). MS: 600.29 (M-H.sup.+) HPLC Procedure A, retention
time=15.76 min.
Example 22
Preparation of
Cyclohexyl-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole--
5-carbonyl]-amino}-acetic acid (Compound 243)
[0444] The general procedure described for Compound 242 was used
with Fmoc-Cha Wang resin (250 mg, 0.4 mmol/g), producing 29 mg of
the title compound (48% yield). MS: 586.27 (M-H.sup.+) HPLC
Procedure A, retention time=14.94 min.
Example 23
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-succinic acid (Compound 244)
[0445] The general procedure described for Compound 242 was used
with Fmoc-Asp Wang resin (125 mg, 0.8 mmol/g), producing 28 mg of
the title compound (50% yield). MS: 562.20 (M-H.sup.+) HPLC
Procedure A, retention time=12.08 min.
Example 24
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-pentanedioic acid (Compound 245)
[0446] The general procedure described for Compound 242 was used
with Fmoc-Glu Wang resin (111 mg, 0.9 mmol/g), producing 25 mg of
the title compound (44% yield). MS: 576.22 (M-H.sup.+) HPLC
Procedure A, retention time=12.14 min.
Example 25
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-phenyl-propionic acid (Compound 246)
[0447] The general procedure described for Compound 242 was used
with Fmoc-Phe Wang resin (167 mg, 0.6 mmol/g), producing 26 mg of
the title compound (44% yield). MS: 594.24 (M-H.sup.+) HPLC
Procedure A, retention time=14.58 min.
Example 26
Preparation of
{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-acetic acid (Compound 311)
[0448] The general procedure described for Compound 242 was used
with Fmoc-Gly Wang resin (125 mg, 0.8 mmol/g), producing 30 mg of
the title compound (55% yield). MS: 504.21 (M-H.sup.+) HPLC
Procedure A, retention time=12.32 min.
Example 27
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(1H-imidazol-4-yl)-propionic acid (Compound 247)
[0449] The general procedure described for Compound 242 was used
with Fmoc-His Wang resin (250 mg, 0.4 mmol/g), producing 30 mg of
the title compound (51% yield). MS: 584.24 (M-H.sup.+) HPLC
Procedure A, retention time=11.16 min.
Example 28
Preparation of
1-[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl-
]-4-hydroxy-pyrrolidine-2-carboxylic acid (Compound 248)
[0450] The general procedure described for Compound 242 was used
with Fmoc-Hyp Wang resin (143 mg, 0.7 mmol/g), producing 23 mg of
the title compound (50% yield). MS: 560.23 (M-H.sup.+) HPLC
Procedure A, retention time=11.58 min.
Example 29
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-methyl-pentanoic acid (Compound 249)
[0451] The general procedure described for Compound 242 was used
with Fmoc-Ile Wang resin (250 mg, 0.4 mmol/g), producing 23 mg of
the title compound (54% yield). MS: 560.26 (M-H.sup.+) HPLC
Procedure A, retention time=14.34 min.
Example 30
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-4-methyl-pentanoic acid (Compound 513)
[0452] The general procedure described for Compound 242 was used
with Fmoc-Leu Wang resin (111 mg, 0.9 mmol/g), producing 8.1 mg of
the title compound (14% yield). MS: 560.25 (M-H.sup.+) HPLC
Procedure A, retention time=17.17 min.
Example 31
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-4-methylsulfanyl-butyric acid (Compound 515)
[0453] The general procedure described for Compound 242 was used
with Fmoc-Met Wang resin (111 mg, 0.9 mmol/g), producing 21 mg of
the title compound (36% yield). MS: 578.21 (M-H.sup.+) HPLC
Procedure A, retention time=15.08 min.
Example 32
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-succinamic acid (Compound 518)
[0454] The general procedure described for Compound 242 was used
with Fmoc-Asn Wang resin (167 mg, 0.6 mmol/g), producing 22 mg of
the title compound (36% yield). MS: 561.21 (M-H.sup.+) HPLC
Procedure A, retention time=15.04 min.
Example 33
Preparation of
4-Carbamoyl-2-{[1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazo-
le-5-carbonyl]-amino}-butyric acid (Compound 541)
[0455] The general procedure described for Compound 242 was used
with Fmoc-Gln Wang resin (167 mg, 0.6 mmol/g), producing 27 mg of
the title compound (47% yield). MS: 575.22 (M-H.sup.+) HPLC
Procedure A, retention time=15.02 min.
Example 34
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-5-guanidino-pentanoic acid (Compound 523)
[0456] The general procedure described for Compound 242 was used
with Fmoc-Arg Wang resin (200 mg, 0.5 mmol/g), producing 53 mg of
the title compound (87% yield). MS: 605.35 (M+H.sup.+) HPLC
Procedure A, retention time=14.84 min.
Example 35
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-hydroxy-butyric acid (Compound 512)
[0457] The general procedure described for Compound 242 was used
with Fmoc-Thr Wang resin (200 mg, 0.5 mmol/g), producing 26 mg of
the title compound (47% yield). MS: 548.22 (M-H.sup.+) HPLC
Procedure A, retention time=15.45 min.
Example 36
Preparation of
2-[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbonyl-
]-1,2,3,4-tetrahydro-isoquinoline-3-carboxylic acid (Compound
520)
[0458] The general procedure described for Compound 242 was used
with Fmoc-Tic Wang resin (143 mg, 0.7 mmol/g), producing 25 mg of
the title compound (41% yield). MS: 606.22 (M-H.sup.+) HPLC
Procedure A, retention time=17.18 min.
Example 37
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-methyl-butyric acid (Compound 517)
[0459] The general procedure described for Compound 242 was used
with Fmoc-Val Wang resin (250 mg, 0.4 mmol/g), producing 16 mg of
the title compound (29% yield). MS: 546.23 (M-H.sup.+) HPLC
Procedure A, retention time=16.59 min.
Example 38
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-3-(4-hydroxy-phenyl)-propionic acid (Compound 519)
[0460] The general procedure described for Compound 242 was used
with Fmoc-Tyr Wang resin (125 mg, 0.8 mmol/g), producing 22 mg of
the title compound (36% yield). MS: 610.22 (M-H.sup.+) HPLC
Procedure A, retention time=16.14 min.
Example 39
Preparation of
2-[2-(4'-Chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazol-
e-5-carboxylic acid (Compound 387)
[0461] Compound 352 (150 mg, 0.28 mmol), 4-chlorophenyl boronic
acid (134 mg, 0.86 mmol), potassium phosphate (452 mg, 2.14 mmol),
lithium chloride (12.1 mg, 0.28 mmol) and
tetrakis(triphenylphosphine) palladium(0) (34 mg, 0.028 mmol) were
combined in 15 mL degassed dioxane and the mixture was refluxed
under argon overnight. The dark mixture was filtered through a
Celite pad, was evaporated and purified using RP-HPLC to give 31 mg
(17%) of the title compound.
[0462] MS: 558.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.49-8.40 (m, 3H), 8.34-8.30 (m, 2H), 8.17-8.14 (dd,
1H, J=8.4 Hz &1.5 Hz), 8.10-8.07 (dd, 1H, J=8.4 Hz & 1.2
Hz), 7.87-7.84 (m, 1H), 7.68-7.56 (m, 3H), 7.39-7.36 (m, 2H),
7.30-7.27 (d, 1H, J=8.4 Hz), 7.24-7.21 (m, 2H), 4.50 (m, 1H), 2.35
(m, 2H), 2.15 (m, 2H), 1.90 (m, 2H), 1.65 (m, 1H), 1.49-1.26 (m,
3H).
Example 40
Preparation of
1-Cyclohexyl-2-[2-(2-pyrid-4-yl-phenyl)-quinolin-6-yl]-1H-benzoimidazole--
5-carboxylic acid (Compound 369)
[0463] The title compound was synthesized as described for Compound
387 except pyridine-4-boronic acid was used instead of
4-chlorophenyl-boronic acid.
[0464] MS: 525.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.75 (m, 2H), 8.61-8.58 (d, 1H, J=8.4 Hz), 8.41 (d,
1H, 1.5 Hz), 8.32 (d, 1H, 1.5 Hz), 8.13-8.10 (d, 1H, J=8.4 Hz),
8.05-7.90 (m, 4H), 7.82-7.71 (m, 6H), 4.42 (m, 1H), 2.35 (m, 2H),
2.08 (m, 2H), 1.90 (m, 2H), 1.65 (m, 1H), 1.40-1.26 (m, 3H).
Example 41
Preparation of
1-Cyclohexyl-2-{2-[3-(pyrrolidine-1-carbonyl)-phenyl]-quinolin-6-yl}-1H-b-
enzoimidazole-5-carboxylic acid (Compound 370)
Step 1: 1-[3-(Pyrrolidine-1-carbonyl)-phenyl]-ethanone (Compound
370a)
[0465] The title intermediate was synthesized as described for
Compound 18 except 3-acetylbenzoic acid was used instead of
3-acetyl-4-hydroxy benzoic acid.
[0466] H.sup.1-NMR (DMSO-d.sub.6): .delta.(ppm) 8.06-8.02 (m, 2H),
7.80-7.77 (m, 1H), 7.63-7.58 (m, 1H), 3.51 (t, 2H, J=6.6 Hz), 3.40
(t, 2H, J=6.3 Hz), 2.65 (s, 3H), 1.94-1.83 (m, 4H).
Step 2:
1-Cyclohexyl-2-{2-[3-(pyrrolidine-1-carbonyl)-phenyl]-quinolin-6-y-
l}-1H-benzoimidazole-5-carboxylic acid (Compound 370)
[0467] The title compound was synthesized in four steps as
described for Compound 13, Compound 25, Compound 27 Q=ethyl and
Compound 204, respectively, except the product of the previous step
was used in the first step, instead of acetophenone.
[0468] MS: 545.28 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.78-8.75 (d, 1H, J=8.4 Hz), 8.55 (d, 1H, J=1.5 Hz),
8.50 (s, 1H), 8.47-8.38 (m, 4H), 8.33-8.30 (d, 1H), J=9.0 Hz),
8.17-8.14 (dd, 1H, J=8.7 Hz & 1.5 Hz), 8.10-8.06 (dd, 1H, J=8.7
Hz & 1.8 Hz), 7.74-7.66 (m, 2H), 4.50 (m, 1H), 2.36 (m, 2H),
2.15 (m, 2H), 1.90 (m, 6H), 1.65 (m, 1H), 1.44-1.20 (m, 3H).
Example 42
Preparation of
2-[2-(2-Bromo-phenyl)-4-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 471)
Step 1: 4-{[1-(2-Bromo-phenyl)-meth-(E)-ylidene]-amino}-benzoic
acid methyl ester (Compound 471a)
[0469] 4-aminobenzoic acid methyl ester (1.51 g, 10 mmol) and
2-bromobenzaldehyde (1.45 mL, 12.5 mmol) were dissolved in 15 mL of
methanol. The mixture was let stand overnight. A white precipitate
formed and the crystals were filtered off, washed with cold
methanol (2.times.) and dried.
[0470] MS: 318.03 & 320.03 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.81 (s, 1H), 8.22-8.19 (dd, 1H, J=7.8
&1.8 Hz), 8.09-8.05 (m, 2H), 7.63-7.60 (dd, 1H, J=7.8&1.2
Hz), 7.43-7.30 (m, 2H), 7.24-7.2 (m, 2H), 3.92 (s, 3H), 1.62 (s,
1H).
Step 2: 2-(2-Bromo-phenyl)-4-methyl-quinoline-6-carboxylic acid
methyl ester (Compound 471b)
[0471] A suspension of 1.97 g (6.1 mmol) of the product of the
previous step in 20 mL acetonitrile and a solution of 385 mg (0.61
mmol) of ytterbium-triflate in 20 mL acetonitrile were combined and
stirred at room temperature for 10 minutes. Then 1.46 mL (15.3
mmol) of 2-methoxy-propene were added in one portion. The
suspension immediately cleared. The mixture was stirred at room
temperature overnight. The next day the reaction was quenched by
the addition of 20 mL of 2.5 M HCl. The resulting mixture was
evaporated and the product purified on a silica pad using
hexane-ethyl acetate 10%-30% step gradient to yield 500 mg (23%)
(See also, Y. Makioka, T. Shindo, Y. Taniguchi, K Takaki, Y.
Fujiwara, Synthesis, 1995.) MS: 356.05 & 358.05 (M+H.sup.+)
Step 3: 2-(2-Bromo-phenyl)-4-methyl-quinoline-6-carboxylic acid
(Compound 471c)
[0472] Compound 471b (500 mg, 1.4 mmol) was refluxed in a mixture
of 15 mL dioxane and 15 mL 1M aqueous NaOH for 1 h then it was
evaporated to dryness, the residue dissolved in 50 mL water and
acidified with 1M HCl solution to pH 4. The precipitate was
filtered off, washed four times with water and dried. Yield: 361 mg
(75%).
[0473] MS: 344.02 & 342.03 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 7.65-7.62 (dd, 1H, J=8.1 & 0.9
Hz), 7.60-7.51 (m, 4H), 7.46-41 (m, 1H), 7.27-7.25 (m, 2H), 1.98
(s, 3H).
Step 4:
2-[2-(2-Bromo-phenyl)-4-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 471)
[0474] The title compound was synthesized in a one-pot reaction
sequence of three steps starting with the product of the previous
step as described for Compound 25, Compound 27 Q=ethyl and Compound
204, respectively. Yield: 91%.
[0475] MS: 540.13 & 542.14 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.639 (s, 1H), 8.4-8.34 (m, 2H),
8.3-8.27 (d, 1H, J=8.7 Hz), 8.21-8.13 (d, 1H, J=8.7 Hz), 8.08-8.05
(d, 1H, J=9.0 Hz), 7.88-7.83 (m, 2H), 7.7-7.67 (dd, 1H, J=7.2 &
1.5 Hz), 7.64-7.59 (m, 1H), 7.54-7.48 (m, 1H), 4.57 (m, 1H), 2.89
(s, 1H), 2.39 (m, 2H), 2.15 (m, 2H), 1.90 (m, 2H), 1.67 (m, 1H),
1.44 (m, 3H).
Example 43
Preparation of
2-[2-(4'-Chloro-biphen-2-yl)-4-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 485) and
1-Cyclohexyl-2-(4-methyl-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid (Compound 498)
[0476] Compound 471 was treated as described for Compound 23. The
reaction resulted in two products that were separated using
preparative RP-HPLC.
[0477] Compound 485: MS: 572.21 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.38 (s, 1H), 8.3 (d, 1H, J=1.2 Hz),
8.17-8.05 (m, 3H), 7.96-7.92 (dd, 1H, J=9.0 & 1.5 Hz),
7.78-7.74 (m, 1H), 7.63-7.51 (m, 3H), 7.34-7.31 (m, 2H), 7.21-7.18
(m, 3H), 4.46 (m, 1H), 2.59 (s, 3H), 2.33 (m, 2H), 2.05 (m, 2H),
1.85 (m, 2H), 1.62 (m, 1H), 1.34 (3H).
[0478] Compound 498: MS: 462.22 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.49 (m, 1H), 8.35-8.30 (m, 4H), 8.23
(s, 1H), 8.19-8.16 (d, 1H, J=8.7 Hz), 8.13-8.09 (dd, 1H, J=8.7
& 1.8 Hz), 8.00-7.97 (dd, 1H, J=8.7 Hz), 7.63-7.55 (m, 3H),
4.48 (m, 1H), 2.86 (s, 1H), 2.34 (m, 2H), 2.10 (m, 2H), 1.86 (m,
2H), 1.62 (m, 1H), 1.35 (m, 3H).
Example 44
Preparation of
2-[2-(4'-Chloro-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazole-5-carboxyli-
c acid (Compound 353)
Step 1: 2-(2-Bromo-phenyl)-quinoline-6-carboxylic acid (Compound
353a)
[0479] The title intermediate was synthesized as described for
Compound 13, Y=phenyl except 2' bromoacetophenone was used instead
of acetophenone.
[0480] MS: 326.00 & 328.00 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.72 (d, 1H, J=1.2 Hz), 8.65-8.62 (d,
1H, J=8.4 Hz), 8.25-8.21 (dd, 1H, J=9.0 Hz & 1.8 Hz), 8.11-8.09
(d, 1H, J=8.7 Hz), 7.83-7.77 (m, 2H), 7.64-7.61 (m, 1H), 7.56-7.51
(m, 1H), 7.46-7.40 (m, 1H).
Step 2: 2-(4'-Chloro-biphen-2-yl)-quinoline-6-carboxylic acid
(Compound 353b)
[0481] The title intermediate was synthesized from the product of
the previous step, compound 353a, as described for compound
387.
[0482] MS: 358.09 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.62 (d, 1H, J=1.2 Hz), 8.36-8.33 (d, 1H, J=8.4 Hz),
8.24-8.21 (dd, 1H, J=9.0 Hz & 1.8 Hz), 8.08-8.05 (d, 1H, J=9
Hz), 7.81-7.78 (dd, 1H, J=6.3 hz & 2.1 Hz), 7.14-7.12 (d, 1H,
J=8.7 Hz), 7.64-7.52 (m, 3H), 7.34-7.31 (m, 2H), 7.18-7.15 (m,
2H).
Step 3:
2-[2-(4'-Chloro-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazole-5-ca-
rboxylic acid (Compound 353)
[0483] The title compound was synthesized from Compound 353b in two
steps as described for Compound 25 and 27 Q=ethyl,
respectively.
[0484] MS: 476.11 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 9.03 (m, 1H), 8.71-8.69 (dd, 1H, J=7. Hz), 8.43-8.29
(m, 3H), 8.1-8.07 (dd, 1H, J=7.5 Hz), 7.93-7.84 (m, 2H), 7.68-7.57
(m, 3H), 7.38-7.2 (m, 5H).
Example 45
Preparation of
2-[2-(4'-Chloro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 408)
[0485] The title compound was synthesized using the procedures
described in Examples 42 to 43 except in step 1 of Example 42
4-aminobenzoic acid methyl ester was replaced by
4-amino-2-fluorobenzoic acid methyl ester and in the second step
methyl-vinyl ether was used.
[0486] MS: 576.19 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.42-8.40 (d, 1H, J=7.8 Hz), 8.34-8.31 (m, 2H),
8.13-8.3 (m, 2H), 7.97-7.94 (dd, 1H, J=8.4 & 1.5 Hz), 7.81-7.78
(m, 1H), 7.63-7.51 (m, 3H), 7.35-7.32 (m, 2H), 7.19-7.12 (m, 3H),
4.14 (m, 1H), 2.26 (m, 2H), 1.95 (m, 2H), 1.82 (m, 2H), 1.60 (m,
1H), 1.33 (m, 3H). F.sup.19-NMR (DMSO-d.sub.6): .delta.(ppm)-112.33
(t).
Example 46
Preparation of
2-(2-Biphen-2-yl-7-fluoro-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-
-carboxylic acid (Compound 388)
[0487] The title compound was collected as a side product of the
synthesis of Compound 408.
[0488] MS: 541.22 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.39-8.36 (d, 1H, J=7.5 Hz), 8.30 (d, 1H, J=1.5 Hz),
8.26-8.23 (d, 1H, J=8.7 Hz), 8.10-8.04 (m, 2H), 7.96-7.78 (m, 1H),
7.65-7.51 (m, 3H), 7.30-7.26 (m, 3H), 7.18-7.15 (m, 2H), 7.08-7.05
(d, 1H, J=8.7 Hz), 4.14 (m, 1H), 2.26 (m, 2H), 1.95 (m, 2H), 1.82
(m, 2H), 1.60 (m, 1H), 1.32 (m, 3H). F.sup.19-NMR (DMSO-d.sub.6):
.delta.(ppm)-112.51 (t).
Example 47
Preparation of
2-[2-(4'-Chloro-biphen-2-yl)-8-methyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 417)
[0489] The title compound was synthesized using the procedures
described in Examples 42 to Example 43 except in step 1 of Example
42 4-aminobenzoic acid methyl ester was replaced by
4-amino-3-methylbenzoic acid methyl ester and in the second step
methyl-vinyl ether was used.
[0490] MS: 572.21 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.43 (d, 1H, J=8.4 Hz), 8.30 (d, 1H, J=1.5 Hz),
8.20-8.17 (m, 2H), 7.99 (dd, 1H, J=8.7 and 1.2 Hz), 7.88-7.83 (m,
2H), 7.62-7.59 (m, 2H), 7.53-7.50 (m, 1H0, 7.46 (d, 1H, J=8.7 Hz),
7.33-7.30 (m, 2H), 7.17-7.14 (m, 2H), 4.46 (m, 1H), 2.51 (s, 3H),
2.35-1.28 (m 10H).
Example 48
Preparation of
2-(2-Biphen-2-yl-8-methyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-
-carboxylic acid (Compound 379)
[0491] The title compound was collected as a side product of the
synthesis of Compound 417.
[0492] MS: 538.27 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.33-8.27 (m, 2H), 8.12-8.10 (m, 2H), 7.95 (dd, 1H,
J=8.7 Hz), 7.86-7.83 (m, 2H), 7.60-7.50 (m, 3H), 7.34 (d, 1H, J=8.7
Hz), 7.26-7.13 (m, 5H), 4.44 (m, 1H), 2.62 (s, 3H), 2.35-1.23 (m
10H).
Example 49
Preparation of
1-Cyclohexyl-2-(8-methyl-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid (Compound 397)
[0493] The title compound was collected as a side product of the
synthesis of Compound 417.
[0494] MS: 462.22 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.64 (d, 1H, J=8.7 Hz), 8.38-8.36 (m, 2H), 8.32-8.29
(m, 2H), 8.21 (m, 1H), 8.13 (d, 1H, J=8.1 Hz), 7.97-7.94 (m, 2H),
7.62-7.53 (m, 3H), 4.45 (m, 1H), 2.92 (s, 3H), 2.35-1.23 (m
10H);
Example 50
Preparation of
{2-[2-(4'-Chloro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazol-5-yl}-(4-methyl-piperazin-1-yl)-methanone (Compound
521)
[0495] The title compound was synthesized from Compound 408 and
N-methyl-piperazine using standard HBTU activation.
[0496] MS: 329.63 (M+2H.sup.+)/2; H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.95 (s, 1H), 8.34-8.28 (m, 2H), 8.06-8.00 (m, 2H),
7.85 (d, 1H, J=1.8 Hz), 7.80-7.77 (m, 1H), 7.62-7.50 (m, 3H),
7.43-7.39 (dd, 1H, J=8.1 Hz & 1.5 Hz), 7.35-7.32 (m, 2H),
7.20-7.10 (m, 3H), 4.09 (, 1H), 3.38 (m, 5H), 3.12 (m, 3H), 2.78
(d, 3H, J=4.2 Hz), 2.28 (m, 2H), 1.93-1.80 (m, 4H), 1.59 (m, 1H),
1.33 (m, 3H); F.sup.19-NMR (DMSO-d.sub.6): .delta.(ppm)-112.71
(t).
Example 51
Preparation of
{2-[2-(4'-Chloro-biphen-2-yl)-7-fluoro-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazol-5-yl}-(4-hydroxy-piperidin-1-yl)-methanone (Compound
514)
[0497] The title compound was synthesized from Compound 408 and
4-hydroxypiperidine using standard HBTU activation.
[0498] MS: 659.31 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.44-8.36 (m, 2H), 8.11-8.08 (m, 2H), 7.89-7.86 (m,
1H), 7.80 (d, 1H, J-1.2 Hz), 7.70-7.67 (m, 2H), 7.62-7.59 (m, 1H),
7.43-7.41 (m, 3H), 7.24-7.18 (, 3H), 4.17 (m, 1H), 3.83 (m, 1H),
3.3 (m, 1H), 2.37 (, 2H), 2.37-1.41 (m, 15H); F.sup.19-NMR
(DMSO-d.sub.6): .delta.(ppm)-112.67 (t).
Example 52
Preparation of
[2-(2-Biphen-2-yl-7-fluoro-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazol-5-
-yl]-(4-methyl-piperazin-1-yl)-methanone (Compound 522)
[0499] The title compound was isolated as a side product of
Compound 521 synthesis.
[0500] MS: 312.65 (M+2H.sup.+)/2; H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.76 (s, 1H), 8.30 (d, 1H, J=7.8 Hz), 8.22 (d, 1H),
J=8.7 Hz), 8.05-8.01 (m, 2H), 7.84 (d, 1H, J=1.2 Hz), 7.80-7.77 (m,
2H), 7.61-7.50 (m, 3H), 7.42-7.39 (dd, 1H), J=6.9 Hz & 1.2 Hz),
7.28-7.25 (m, 3H), 7.18-7.14 (m. 2H), 7.05 (d, 1H, J=8.7 Hz), 4.1
(m, 1H), 3.38 (m, 2H), 3.12 (m, 3H), 2.79 (d, 3H, J=4.2 Hz),
2.28-1.22 (m, 13H); F.sup.19-NMR (DMSO-d.sub.6):
.delta.(ppm)-112.77 (t).
Example 53
Preparation of
2-(2-Biphen-2-yl-7-fluoro-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazol-5--
yl]-(4-hydroxy-piperidin-1-yl)-methanone (Compound 410)
[0501] The title compound was isolated as a side product of
Compound 514 synthesis.
[0502] MS: 625.34 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.32 (d, 1H0, J=8.4 Hz), 8.21 (d, 1H, J=8.4 Hz),
8.04-8.97 (m, 2H), 7.79 (m, 1H0, 7.71 (d, 1H, J=1.2 Hz), 7.63-7.50
(m, 3H), 7.32 (dd, 1H0, J=8.4 Hz & 1.5 Hz), 7.28-7.14 (m, 2H),
7.03 (d, 1H, J=8.7 Hz), 4.09 (m, 1H), 3.73 (m, 1H), 3.20 (m, 2H),
2.25-1.33 (m, 16H). F.sup.19-NMR (DMSO-d.sub.6): .delta.
(ppm)-112.81 (t).
Example 54
Preparation of
2-[2-(5-Bromo-2-hydroxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimida-
zole-5-carboxylic acid (Compound 354)
Step 1: 3-Dimethoxymethyl-4-nitro-benzoic acid (Compound 354a)
[0503] To a solution of 5.49 g (21.5 mmol) of Compound 5 in 200 mL
of methanol, 50 mL of 1M NaOH were added and the mixture was
stirred at room temperature for 2 h. The reaction mixture was then
evaporated to dryness, the residue was dissolved in 100 mL water,
acidified with 1M HCl to pH 3-4. The precipitate was then filtered
off, washed with water (4.times.), and dried. Yield: 4.96 g
(95%).
[0504] MS: 240.08 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.49 (d, 1H, J=1.8 Hz), 8.21-8.18 (dd, 1H, J=8.4 &
1.8 Hz), 7.85-7.82 (d, 1H, J=8.4 Hz), 5.90 (s, 1H), 3.41 (s,
6H).
Step 2:
4-Cyclohexylamino-3-(3-dimethoxymethyl-4-nitro-benzoylamino)-benzo-
ic acid ethyl ester (Compound 354b)
[0505] The title intermediate was synthesized from the product of
the previous step as described for Compound 25.
[0506] MS: 486.23 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.93 (s, 1H), 8.23-8.15 (m, 2H), 8.05-8.02 (d, 1H,
J=8.1 Hz), 7.70-7.67 (m, 2H), 6.78-6.75 (d, 1H, J=8.4 Hz), 5.83 (s,
1H), 5.54-5.51 (d, 1H, J=7.5 Hz), 4.22 (q, 2H, J=7.2 Hz), 3.39-3.34
(m, 7H), 1.92 (m, 2H), 1.73-1.58 (m, 3H), 1.38-1.12 (m, 8H).
Step 3:
1-Cyclohexyl-2-(3-dimethoxymethyl-4-nitro-phenyl)-1H-benzoimidazol-
e-5-carboxylic acid ethyl ester (Compound 354c)
[0507] To a solution of 1.53 g (3.15 mol) the product of the
previous step in 75 mL acetic acid 1.5 g 4 A molecular sieves was
added and the mixture was refluxed for 2 h. TLC indicated a
complete and clean reaction. The mixture was evaporated to dryness,
dried under high vacuum and was used without further
purification.
Step 4:
2-(4-Amino-3-dimethoxymethyl-phenyl)-1-cyclohexyl-1H-benzoimidazol-
e-5-carboxylic acid ethyl ester (Compound 354d)
[0508] In 20 mL methanol 100 mg of 10% Pd--C was pre-hydrogenated
in the presence of 1 g MgSO.sub.4 at 30 psi for 15 minutes.
Compound 354c (100 mg) dissolved in a solution of 20 mL of methanol
containing 2 mL triethylamine, was added to the catalyst and the
hydrogenation was continued for 30 minutes. The catalyst and the
magnesium sulfate were filtered using Celite. The solution was
evaporated to dryness and the oily residue was used immediately in
the following step.
Step 5:
2-(4-Amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carbo-
xylic acid ethyl ester (Compound 354e)
[0509] The oily product of the previous step was dissolved in 25 mL
ethanol-acetic acid-water 2:2:1 mixture and was let stand for 15
minutes at room temperature. It was evaporated to dryness to get
the solid title intermediate, which was pure enough to use in the
next step without further purification. MS: 392.25 (M+H.sup.+)
Step 6:
2-[2-(5-Bromo-2-hydroxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid (Compound 354)
[0510] The title compound was synthesized from the product of the
previous step as described for Compound 19, followed by
purification on RP-HPLC.
[0511] MS: 542.15 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 12.81 (s, 1H), 8.77-8.74 (d, 1H, J=8.7 Hz), 8.56-8.53
(d, 1H, J=9.0 Hz), 8.41 (m, 2H), 8.30-8.27 (m, 2H), 8.10-8.07 (dd,
1H, J=8.7 & 2.1 Hz), 8.03-8.00 (d, 1H, J=8.7 Hz), 7.90-7.87
(dd, 2H, J=8.7 & 1.5 Hz), 7.57-7.53 (dd, 1H, J=9.0 & 2.4
Hz), 7.02-6.99 (d, 1H, J=9.0 Hz), 4.39 (m, 1H), 2.33 (m, 2H), 2.02
(m, 2H), 1.85 (m, 2H), 1.61 (m, 1H), 1.32 (m, 3H).
Example 55
Preparation of
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid (Compound 356)
[0512] The title compound was synthesized in seven steps as
described for Compound 204 except 2-hydroxy-5-methoxy acetophenone
was used instead of Compound 18.
[0513] MS: 588.23 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.38-8.35 (m, 2H), 8.30 (d, 1H, J=1.5 Hz), 8.23 (d,
1H, J=8.7 Hz), 8.15 (d, 1H, J=8.7 Hz), 8.05 (dd, 1H, J=8.7 Hz &
1.5 Hz), 7.97 (dd, 1H, J=9 Hz & 1.5 Hz), 7.45 (d, 1H, J=8.4
Hz), 7.31-7.27 (m, 3H), 7.21-7.17 (m, 2H), 7.13-7.10 (m, 2H), 4.41
(m, 1H), 3.87 (s, 3H), 2.34-1.28 (m, 10H);
Example 56
Preparation of
1-Cyclohexyl-2-[2-(4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid (Compound 499)
[0514] The title compound was isolated as side product of the
synthesis of Compound 356.
[0515] MS: 554.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.34-8.24 (m, 4H), 8.13 (d, 1H, J=8.4 Hz), 8.05 (dd,
1H, J=9 Hz), 7.95 (dd, 1H, J=8.4 Hz & 1.2 Hz), 7.46 (d, 1H,
J=8.4 Hz), 7.33 (d, 1H, J=2.4 Hz), 7.24-7.10 (m, 7H), 4.42 (m, 1H),
3.88 (s, 3H), 2.34-1.28 (m, 10H).
Example 57
Preparation of
1-Cyclohexyl-2-[2-(3-methoxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid (Compound 486)
[0516] The title compound was isolated as side product of the
synthesis of Compound 356.
[0517] MS: 478.22 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.68 (d, 1H, J=8.7 Hz), 8.43 (d, 1H, J=1.8 Hz),
8.33-8.29 (m, 3H), 8.15 (d, 1H, J=9 Hz), 8.06 (dd, 1H, J=8.7 Hz
&1.5 Hz), 7.97 (dd, 1H, J=8.7 Hz & 1.5 Hz), 7.91-7.87 (m,
2H), 7.53-7.48 (m, 1H), 7.12 (dd, 1H, J=8.4 Hz, 2.4 Hz), 4.43 (m,
1H), 3.89 (s, 3H), 2.35-1.28 (m, 10H).
Example 58
Preparation of
2-[2-(4'-Chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid (Compound 500) and
1-Cyclohexyl-2-[2-(3-hydroxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid (Compound 474) and
1-Cyclohexyl-2-[2-(4-hydroxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimidazol-
e-5-carboxylic acid (Compound 487)
[0518] To a cold solution of 2.3 g (3.7 mmol) of Compound 500a in
90 mL DCM, 37.2 mL (37.2 mmol) of a solution of 1M PBr.sub.3 in DCM
was added. The mixture was stirred overnight then was quenched by
addition of 110 mL of methanol. The reaction mixture was evaporated
to dryness and triturated with water to give the title compound
which was purified by RP-HPLC. After trituration, Compound 500 was
sufficient to use in subsequent reactions without further
purification. Two side-products (Compound 487) and (Compound 474)
were also separated and identified from the reaction mixture.
[0519] (Compound 500): MS: 574.21 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.38-8.31 (m, 3H), 8.25 (d, 1H, J=8.7
Hz), 8.18 (d, 1H, J=8.7 Hz), 8.08 (dd, 1H, J=8.7 & 2.1 Hz),
7.99 (dd, 1H, J=8.4 & 1.5 Hz), 7.35 (d, 1H, J=8.7 Hz), 7.28 (m,
2H), 7.21 (d, 1H, J=2.7 Hz), 7.16 (d, 1H, J=8.7 Hz), 7.10 (m. 2H),
7.01 (dd, 1H, J=8.4 & 2.1 Hz), 4.44 (m, 1H), 2.35-1.03 (m,
10H);
[0520] (Compound 474): MS: 464.21 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.68 (d, 1H, J=8.7 Hz), 8.47 (d, 1H,
J=1.8 Hz), 8.34-8.22 (m, 4H), 8.10 (dd, 1H, J=8.7 & 1.8 Hz),
8.03 (dd, 1H, J=8.7 & 1.5 Hz), 7.76-7.70 (m, 2H), 7.41-7.35 (m,
1H), 6.97-6.94 (m, 1H), 4.44 (m, 1H), 2.35-1.23 (m, 10H);
[0521] (Compound 487): MS: 540.25 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): .delta.(ppm) 8.34-8.24 (m, 4H), 8.15 (d, 1H), 8.05
(dd, 1H), 7.98 (dd, 1H), 7.34 (d, 1H, J=8.7 Hz), 7.21 (m, 4H),
7.11-7.08 (m, 3H), 7.01 (dd, 1H, J=8.1 & 2.7 Hz), 5.43 (m, 1H),
2.35-1.33 (m, 10H);
Example 59
Preparation of
2-{2-[4'-Chloro-4-(2-methoxy-ethoxy)-biphen-2-yl}-quinolin-6-yl]-1-cycloh-
exyl-1H-benzoimidazole-5-carboxylic acid (Compound 475)
Step 1:
2-[2-(4'-Chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-
-1H-benzoimidazole-5-carboxylic acid methyl ester (Compound
475a)
[0522] To a solution of 2.15 g (3.745 mmol) of Compound 500 in 100
mL methanol, 25 mL of 4M HCl in dioxane were added and the mixture
was heated at 55 C..degree. for 3 hours. The reaction mixture was
then evaporated to dryness and the residual oil triturated with
water and dried to yield 1.97 g (89%) of the title intermediate,
which was used without further purification.
Step 2:
2-{2-[4'-Chloro-4-(2-methoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1-
-cyclohexyl-1H-benzoimidazole-5-carboxylic acid (Compound 475)
[0523] Compound 475a (100 mg, 0.162 mmol) was dissolved in 2 mL of
DMF and treated with 16.8 mg (0.7 mmol) of NaH for 30 min.
1-bromo-2-methoxy ethane (30.5 .mu.L) was added and the mixture was
agitated overnight. The next day the reaction mixture was
evaporated to dryness, the oily residue dissolved in 3 mL methanol
followed by the addition of 1 mL 1M NaOH. The mixture was refluxed
for 2 h before it was evaporated to dryness. The product was
purified by RP-HPLC for a yield of 19.3 mg of the title
compound.
[0524] MS: 632.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.40-8.34 (m, 2H), 8.32 (d, 1H, J=1.2 Hz), 8.23 (d,
1H, J=8.7 Hz), 8.15 (d, 1H, J=9.0 Hz), 8.07 (dd, 1H, J=9.0 and 1.8
Hz), 7.48 (dd, 1H, J=8.4 and 1.2 Hz), 7.45 (d, 1H, J=8.4 Hz),
7.33-7.29 (m, 3H), 7.23-7.14 (m, 2H), 7.14-7.11 (m, 2H), 4.43 (m,
1H), 4.24 (m, 3H), 3.71 (m, 2H), 3.37 (m, 3H), 2.35-1.30 (m.
10H);
Example 60
Preparation of
1-Cyclohexyl-2-{2-[4-(2-methoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1H-be-
nzoimidazole-5-carboxylic acid (Compound 461)
[0525] The title compound was isolated as a side product of the
synthesis of Compound 475.
[0526] MS: 598.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.33-8.28 (m, 3H), 8.23 (d, 1H, J=9.0 Hz), 8.13-8.03
(m, 2H), 7.95 (dd, 1H, J=8.7 Hz, 1.2 Hz), 7.45 (d, 1H, J=8.4 Hz),
7.34 (d, 1H, J=2.7 Hz), 7.24-7.18 (m, 4H), 7.14-7.10 (m, 3H), 4.41
(m, 1H), 4.22 (m, 2H), 3.5-3.3 (m, 5H offset by water), 2.34-1.23
(m, 10H);
Example 61
Preparation of
1-Cyclohexyl-2-{2-[3-(2-methoxy-ethoxy)-phenyl]-quinolin-6-yl}-1H-benzoim-
idazole-5-carboxylic acid (Compound 445)
[0527] The title compound was isolated as a side product of the
synthesis of Compound 475.
[0528] MS: 522.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.69 (d, 1H, J=8.7 Hz), 8.44 (d, 1H, J=1.8 Hz),
8.35-8.29 (m, 3H), 8.17 (d, 1H, J=8.7 Hz), 8.08 (dd, 1H, J=8.7 and
1.8 Hz), 8.98 (dd, 1H, J=9.0 and 1.8 Hz), 7.92-7.89 (m, 2H),
7.52-7.47 (m, 1H), 7.15-7.12 (m, 1H), 4.43 (m, 1H), 4.24 (m, 2H),
3.73 (m, 2H), 3.41-3.34 (m, 3H), 2.36-1.2 (m, 10H);
Example 62
Preparation of
2-{2-[4'-Chloro-4-(2-ethoxy-ethoxy)-biphen-2-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid (Compound 507)
[0529] The title compound was synthesized as described for Compound
475, except 1-bromo-2-ethoxy ethane was used for alkylation instead
of 1-bromo-2-methoxy ethane.
[0530] MS: 646.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.34-8.22 (m, 3H), 8.18 (d, 1H, J=9.0 Hz), 8.08 (d,
1H, J=8.4 Hz), 8.01 (dd, 1H, J=8.4 and 1.5 Hz), 7.91 (dd, 1H, 8.4
and 1.2 Hz), 7.40 (m, 1H), 7.29-7.07 (m, 7H), 4.37 (m, 1H), 4.18
(m, 2H), 3.70 (m, 2H), 3.50 (q, 2H, J=1.2 Hz), 2.30-1.24 (m, 10H),
1.10 (t, 3H, J=1.2 Hz);
Example 63
Preparation of
2-[2-(4-Carboxymethoxy-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-
-1H-benzoimidazole-5-carboxylic acid (Compound 393)
[0531] The title compound was synthesized as described for Compound
475, except tert-butyl bromoacetate was used for alkylation instead
of 1-bromo-2-methoxy ethane. The tert-butyl group was removed in a
separate step before saponification by a 1 h treatment with
TFA.
[0532] MS: 630.16 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.41-8.38 (m, 2H), 8.32 (d, 1H, J=1.5 Hz), 8.25-8.18
(m, 2H), 8.09 (dd, 1H, J=8.4 and 1.8 Hz), 8.00 (dd, 1H, J=8.7 and
1.5 hz), 7.47 (d, 1H, J=8.4 Hz), 7.32-7.29 (m, 3H), 7.23-7.11 (m,
4H), 4.83 (s, 2H), 4.44 (m, 1H), 2.35-1.3 (m, 10H);
Example 64
Preparation of
2-[2-(4-Carboxymethoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoi-
midazole-5-carboxylic acid (Compound 375)
[0533] The title compound was isolated as a side product of the
synthesis of Compound 393.
[0534] MS: 596.20 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.35-8.29 (m, 3H), 8.25 (d, 1H, J=8.7 Hz), 8.15 (dd,
1H, J=9.0 Hz), 8.07 (dd, 1H, J=9.0 Hz), 7.97 (dd, 1H, 7.2 and 1.8
Hz), 7.46 (d, 1H, J=8.4 Hz), 7.31 (d, 1H, J=2.7 Hz), 7.25-7.11 (m,
8H), 4.82 (s, 2H), 4.42 (m, 1H), 2.43-1.30 (m, 10H);
Example 65
Preparation of
2-[2-(3-Carboxymethoxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 359)
[0535] The title compound was isolated as a side product of the
synthesis of Compound 393.
[0536] MS: 520.17 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.70 (d, 1H, J=8.7 Hz), 8.45 (d, 1H), 8.32 (m, 3H),
8.19 (d, 1H, J=9.0 Hz), 8.09 (dd, 1H), 8.00-7.87 (m, 3H), 7.50 (m,
1H), 7.11 (m, 1H), 4.83 (s, 2H), 4.44 (m, 1H), 2.35-1.30 (m,
10H);
Example 66
Preparation of
2-{2-[4'-Chloro-4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl]-quinolin-6-yl}-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid (Compound
447)
[0537] The title compound was synthesized as described for Compound
475, except 1,3-dibromopropane was used for alkylation instead of
1-bromo-2-methoxy ethane. The resulting 3-bromopropyl derivative
was treated in situ with an excess of pyrrolidine to give the final
product.
[0538] MS: 685.34 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.74 (m, 1H), 8.39-8.36 (m, 2H), 8.32 (d, 1H, J=1.5
Hz), 8.25 (d, 1H, J=8.7 Hz), 8.18 (d, 1H, J=8.7 Hz), 8.07 (dd, 1H,
J=8.4 and 1.8 Hz), 8.98 (dd, 1H, J=9.0 and 1.6 Hz), 7.47 (d, 1H,
J=8.7 Hz), 7.35-7.29 (m, 3H), 7.23-7.18 (m 2H), 7.14-7.11 (m, 2H),
4.42 (m, 1H), 4.21 (m, 2H), 3.56 (m, 2H), 3.33 (m, 2H), 3.02 (m,
2H), 2.35-1.28 (m, 16H);
Example 67
Preparation of
1-Cyclohexyl-2-{2-[4-(3-pyrrolidin-1-yl-propoxy)-biphen-2-yl]-quinolin-6--
yl}-1H-benzoimidazole-5-carboxylic acid (Compound 430)
[0539] The title compound was isolated as a side product of the
synthesis of Compound 447.
[0540] MS: 651.36 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.70 (m, 1H), 8.34-8.23 (m, 4H), 8.13 (d, 1H, J=8.4
Hz), 8.06 (dd, 1H, J=8.7 and 1.8 Hz), 7.96 (dd, 1H, J=8.7 and 1.5
Hz), 7.47 (d, 1H, J=8.7 Hz), 7.35 (d, 1H, J=2.7 Hz), 7.26-7.18 (m,
4H), 7.14-7.09 (m, 3H), 4.41 (m, 1H), 4.21 (m, 2H), 3.58 (m, 2H),
3.34 (m, 2H), 3.02 (m, 2H), 2.35-1.23 (m, 16H);
Example 68
Preparation of
1-Cyclohexyl-2-{2-[3-(3-pyrrolidin-1-yl-propoxy)-phenyl]-quinolin-6-yl}-1-
H-benzoimidazole-5-carboxylic acid (Compound 414)
[0541] The title compound was isolated as a side product of the
synthesis of Compound 447.
[0542] MS: 575.32 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.70 (m, 1H), 8.68 (d, 1H, J=8.7 Hz), 8.42 (d, 1H),
8.30 (m, 3H), 8.14 (d, 1H, J=8.4 Hz), 8.07 (dd, 1H, J=8.4 Hz),
7.97-7.90 (m, 3H), 7.71 (m, 1H), 7.13 (m, 1H), 4.41 (m, 1H), 4.22
(m, 2H), 3.59 (m, 2H), 3.36 (m, 2H), 3.042 (m, 2H), 2.43-1.23 (m,
16H);
Example 69
Preparation of
2-{2-[4'-Chloro-4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl]-quinolin--
6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid (Compound
376)
[0543] The title compound was synthesized as described for Compound
475, except 2-bromo-1-pyrrolidin-1-yl-ethanone was used for
alkylation instead of 1-bromo-2-methoxy ethane.
[0544] MS: 685.34 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.37-8.34 (m, 3H), 8.20 (d, 1H, J=8.4 Hz), 8.12-8.03
(m, 2H), 7.94 (dd, 1H, J=8.7 and 1.2 Hz), 7.43 (d, 1H, J=8.7 Hz),
7.31-7.28 (m, 3H), 7.20-7.11 (m, 4H), 4.87 (s, 2H), 4.41 (m, 1H),
3.49 (m, 2H), 3.33 (m, 2H), 2.35-1.23 (m, 14H);
Example 70
Preparation of
1-cyclohexyl-2-{2-[4-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-biphen-2-yl]-quinol-
in-6-yl}-1H-benzoimidazole-5-carboxylic acid (Compound 360)
[0545] The title compound was isolated as a side product of the
synthesis of Compound 376.
[0546] MS: 651.34 (M+H.sup.+); H1-NMR (DMSO-d.sub.6): .delta. (ppm)
8.30-8.25 (m, 3H), 8.20 (d, 1H, J=8.4 Hz), 8.05 (m, 2H), 7.192 (dd,
1H, J=8.4 and 1.5 Hz), 7.43 (d, 1H, J=8.4 Hz), 7.30 (d, 1H, J=2.7
Hz), 7.24-7.08 (m, 8H), 4.87 (s, 2H), 4.40 (m, 1H), 3.49 (m, 2H),
3.34 (m, 2H), 2.34-1.23 (m, 14H);
Example 71
Preparation of
1-cyclohexyl-2-{2-[3-(2-oxo-2-pyrrolidin-1-yl-ethoxy)-phenyl]-quinolin-6--
yl}-1H-benzoimidazole-5-carboxylic acid (Compound 503)
[0547] The title compound was isolated as a side product of the
synthesis of Compound 376.
[0548] MS: 575.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.66 (d, 1H, J=8.7 hz), 8.41 (d, 1H, J=1.8 Hz),
8.30-8.26 (m, 3H), 8.12-8.04 (m, 2H), 7.96-7.87 (m, 3H), 7.49 (m,
1H), 7.10 (dd, 1H, J=7.8 and 2.1 Hz), 4.87 (s, 2H), 4.42 (m, 1H),
3.41 (m, 2H), 3.35 (m, 2H), 2.35-1.23 (m, 14H);
Example 72
Preparation of
2-[2-(4-Carboxy-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid (Compound 415)
Step 1:
2-[2-(4'-Chloro-4-trifluoromethanesulfonyloxy-biphen-2-yl)-quinoli-
n-6-yl]-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid methyl
ester (Compound 415a)
[0549] To a solution of 1 g (1.7 mmol) of Compound 475a in 20 mL of
DCM, 550 .mu.L (6.8 mmol) of pyridine, and 21 mg (0.17 mmol) of
DMAP were added and the entire mixture was cooled to 0.degree. C.
Dropwise, 860 .mu.L of Tf.sub.2O was added. The reaction was then
stirred at room temperature for 1 h. Finally the reaction mixture
was evaporated, and the product dissolved in ethyl acetate, washed
with cold water (2.times.), brine (2.times.), dried with
Na.sub.2SO.sub.4 and evaporated again to give the title
intermediate as a white solid foam in quantitative yield.
Step 2:
2-[2-(4-Carboxy-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-
-1H-benzoimidazole-5-carboxylic acid methyl ester (Compound
415b)
[0550] A mixture of 1.334 g (1.85 mmol) of the product from the
previous step, 350 .mu.L of acetic anhydride, 288 mg (5.55 mmol) of
LiO(O)CH, 235 mg (5.55 mmol) of LiCl, 644 .mu.L (3.7 mmol) of DIEA
and 54 mg (92.5 .mu.mol) of Pd Cl.sub.2(dppp) in DMF was heated
under Ar at 80.degree. C. overnight. The solvent was evaporated and
the residue triturated with water to give 1 g of the crude title
intermediate, which was not isolated and was used as is in the
following steps.
Step 3:
2-[2-(4-Carboxy-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-
-1H-benzoimidazole-5-carboxylic acid (Compound 415)
[0551] The crude product from the previous step (250 mg) was
saponified with 5 eq. of aq. 1M NaOH in methanol for 1 h at
55.degree. C. The reaction mixture was evaporated and the product
purified with RP-HPLC to give the title compound as a yellow
solid.
[0552] MS: 600.14 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.41-8.38 (m, 2H), 8.34-8.28 (m, 3H), 8.23 (d, 1H,
J=8.4 Hz), 8.14 (dd, 1H, J=8.1 and 1.8 Hz), 8.09 (dd, 1H, J=8.4 and
1.8 Hz), 8.00 (dd, 1H, J=7.2 Hz), 7.67 (d, 1H, J=7.8 Hz), 7.37 (m,
2H), 7.26-7.20 (m, 3H), 4.43 (m 1H), 2.31-1.32 (m, 10H).
Example 73
Preparation of
2-{2-[4'-Chloro-4-(2-dimethylamino-ethylcarbamoyl)-biphen-2-yl]-quinolin--
6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid (Compound
491)
[0553] Crude Compound 415b (250 mg, 0.4 mmol) in 2 mL DMF was
pre-activated with 193 mg (0.5 mmol) of HATU and 174 .mu.L (1 mmol)
of DIEA for 15 min at room temperature.
N.sup.1,N.sup.1-dimethyl-ethane-1,2-diamine (100 .mu.L, 0.9 mmol)
was added and stirred overnight. The next day the reaction mixture
was evaporated to dryness and triturated with water. The wet solid
was dissolved in 5 mL methanol and was saponified as described for
Compound 415 to give, after RP-HPLC purification, 8.5 mg of the
title compound.
[0554] MS: 672.28 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.10 (m, 1H), 9.04 (m, 1H), 8.40-8.36 (m, 2H),
8.31-8.29 (m, 2H), 8.23 (d, 1H, J=8.7 Hz), 8.16-8.04 (m, 3H), 7.94
(dd, 1H, J=8.7 and 1.2 Hz), 7.65 (d, 1H, J=7.8 Hz), 7.36 (m, 2H),
7.22 (m, 3H), 4.41 (m, 1H), 3.69 (m, 2H), 3.31 (m, 2H), 2.84 (s,
6H), 2.36-1.23 (m, 10H).
Example 74
Preparation of
1-Cyclohexyl-2-{2-[4-(2-dimethylamino-ethylcarbamoyl)-biphen-2-yl]-quinol-
in-6-yl}-1H-benzoimidazole-5-carboxylic acid (Compound 504)
[0555] The title compound was isolated as a side product of the
synthesis of Compound 491.
[0556] MS: 638.31 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 9.99 (m, 1H), 9.00 (m, 1H), 8.33-8.28 (m, 4H), 8.25
(d, 1H, J=8.7 Hz), 8.14-8.04 (m, 3H), 7.94 (dd, 1H, J=9.0 Hz), 7.66
(d, 1H, J=8.1 Hz), 7.30-7.27 (m, 3H), 7.21-1.13 (m, 3H), 4.41 (m,
1H), 3.68 (m, 2H), 3.31 (m, 2H), 2.83 (s, 6H), 2.35-1.23 (m,
10H).
Example 75
Preparation of
2-{2-[4-(Carbamoylmethyl-carbamoyl)-4'-chloro-biphen-2-yl]-quinolin-6-yl}-
-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid (Compound
361)
[0557] The title compound was synthesized as described for Compound
491, except glycine-amide was used instead of
N.sup.1,N.sup.1-dimethyl-ethane-1,2-diamine.
[0558] MS: 658.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.92 (m, 1H), 8.41-8.23 (m, 5H), 8.14-8.04 (m, 3H),
7.95 (dd, 1H, J=8.4 and 1.5 Hz), 7.65 (d, 1H, J=8.4 Hz), 7.43-7.35
(m, 3H), 7.26-7.20 (m, 3H), 7.06 (m, 1H), 4.42 (m, 1H), 3.86 (m,
2H), 2.35-1.23 (m, 10H).
Example 76
Preparation of
2-{2-[4-(Carbamoylmethyl-carbamoyl)-biphen-2-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid (Compound 377)
[0559] The title compound was isolated as a side product of the
synthesis of Compound 361.
[0560] MS: 624.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.90 (m, 1H), 8.33-8.25 (m, 4H), 8.12-8.04 (m, 3H),
7.95 (d, 1H, J=9.0 Hz), 7.64 (d, 1H, J=8.1 Hz), 7.42 (m, 1H), 7.28
(m, 2H), 7.22-7.06 (m, 3H), 4.42 (m, 1H), 3.87 (m, 2H), 2.35-1.23
(m, 10H).
Example 77
Preparation of
2-[2-(4'-chloro-4-methylcarbamoyl-biphen-2-yl)-quinolin-6-yl]-1-cyclohexy-
l-1H-benzoimidazole-5-carboxylic acid (Compound 378)
[0561] The title compound was synthesized as described for Compound
491, except methyl amine was used instead of
N.sup.1,N.sup.1-dimethyl-ethane-1,2-diamine.
[0562] MS: 615.25 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.70 (d, 1H, J=9.3 Hz), 8.46 (d, 1H, J=1.5 Hz), 8.39
(m, 1H), 8.34-8.31 (m, 3H), 8.27-8.19 (m, 2H), 8.10-7.99 (m, 3H),
7.64-7.55 (m, 3H), 7.35 (d, 1H, J=8.4 Hz), 7.27-7.19 (m, 1H), 4.44
(m, 1H), 2.83 (d, 3H), 2.35-1.23 (m, 10H).
Example 78
Preparation of
1-cyclohexyl-2-[2-(4-methylcarbamoyl-biphen-2-yl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid (Compound 362)
[0563] The title compound was isolated as a side product of the
synthesis of Compound 378.
[0564] MS: 581.28 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.65 (m, 1H), 8.36-8.25 (m, 5H), 8.15 (d, 1H, J=9.0
Hz), 8.08-8.04 (m, 2H0, 7.97 (dd, 1H, J=8.7 and 1.8 Hz), 7.62 (d,
1H, J=7.8 Hz), 7.30-7.15 (m, 6H), 4.43 (m, 1H), 2.84 (d, 3H),
2.35-1.23 (m, 10H).
Example 79
Preparation of
2-(2-biphen-2-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carboxyl-
ic acid (Compound 395)
[0565] The title compound was isolated as a side product of the
synthesis of Compound 378.
[0566] MS: 524.22 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.40 (d, 1H, J=1.8 Hz), 8.34-8.28 (m, 3H), 8.23 (d,
1H, J=8.7 Hz), 8.10 (dd, 1H, J=8.4 and 1.7 Hz), 8.02 (dd, 1H, J=8.7
and 1.2 Hz), 7.81 (dd, 1H, J=7.8 and 1.5 Hz), 7.63-7.52 (m, 3H),
7.28-7.14 (m, 6H), 4.44 (m, 1H), 2.35-1.29 (m, 10H).
Example 80
Preparation of
Cyclohexyl-2-(2,3-diphenylquinoxalin-6-yl)-1H-benzimidazole-5-carboxylic
acid (Compound 406)
Step 1: 3,4-Bis-tert-butoxycarbonylaminobenzoic acid (Compound
406a)
[0567] A solution of 2 g (13.15 mmol) of 3,4-diaminobenzoic acid,
8.61 g (39.45 mmol) of (BOC).sub.2O, and 2.04 g (15.78 mmol) of
DIEA in 15 mL anhydrous DMF was stirred at room temperature
overnight and then poured into 150 mL H.sub.2O. The pH of the
mixture was adjusted to pH 5 or 6 followed by extraction with
3.times.100 mL EtOAc. The organic layer was washed with 300 mL
H.sub.2O, dried (Na.sub.2SO.sub.4) and the solvent was evaporated.
The residue was purified on silica gel using hexane and EtOAc to
yield 3 g white solid. MS: 351.17 (M-H.sup.+).
Step 2:
1-Cyclohexyl-2-(3,4-diaminophenyl)-1H-benzimidazole-5-carboxylic
acid (Compound 406b)
[0568] A solution of 1 g (2.84 mmol) of the product of the previous
step, 0.91 g (2.84 mmol) of TBTU and 0.73 g (5.68 mmol) of DIEA in
10 mL anhydrous DMF was allowed to stand at room temperature for 15
min. To this solution was added 0.90 g (3.41 mmol) of Compound 11,
and the solution was allowed to stand at room temperature
overnight. The solution was then poured into 100 mL H.sub.2O,
stirred for 30 min, filtered and dried. The solution of the solids
thus obtained, in 50 mL 1M HCl and 25 mL EtOH, was refluxed at
110.degree. C. overnight. The solvents were removed and the residue
was treated with 14 mL 2 M NaOH in 70 mL of MeOH at 60.degree. C.
overnight. The MeOH was evaporated, the residue was diluted with 70
mL H.sub.2O and acidified to pH 6. The precipitate was filtered,
washed with H.sub.2O and dried yielding 0.95 g brown solid. MS:
351.20 (M+H.sup.+).
Step 3:
1-Cyclohexyl-2-(2,3-diphenylquinoxalin-6-yl)-1H-benzimidazole-5-ca-
rboxylic acid (Compound 406)
[0569] A solution of 100 mg (0.29 mmol) of Compound 406b and 74 mg
(0.35 mmol) of benzil was stirred at room temperature overnight.
The solvent was evaporated and the residue was purified on
preparative HPLC yielding 10 mg.
[0570] MS: 523.25 (M-H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.44-8.32 (m, 3H), 8.18-8.12 (m, 2H), 7.97-7.90 (m,
2H), 7.79 (t, 1H, J=7.5 Hz), 7.77-7.60 (m, 1H), 7.53-7.50 (m, 3H),
7.44-7.35 (m, 4H), 4.42 (m, 1H), 2.40-2.20 (m, 2H), 2.09-2.06 (m,
2H), 1.86 (m, 2H), 1.62 (m, 2H), 1.39-1.23 (m, 3H).
Example 81
Preparation of
2-[2,3-Bis-(4-bromophenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazole--
5-carboxylic acid (Compound 371)
[0571] Prepared as described for Compound 406 using
4,4'-dibromobenzil in place of benzil.
[0572] MS: 683.04 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.42-8.30 (m, 3H), 7.88-7.81 (m, 3H), 7.65-7.60 (m,
4H), 7.49-7.44 (m, 4H), 4.38 (m, 1H), 2.34-2.27 (m, 2H), 2.08-2.04
(m, 2H), 1.91-1.83 (m, 2H), 1.61 (m, 1H), 1.42-1.23 (m, 3H).
Example 82
Preparation of
1-Cyclohexyl-2-(2,3-di-p-tolylquinoxalin-6-yl)-1H-benzimidazole-5-carboxy-
lic acid (Compound 389)
[0573] Prepared as described for Compound 406 using
4,4'-dimethylbenzil in place of benzil.
[0574] MS: 553.26 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.38-8.31 (m, 3H), 8.10 (t, 2H, J=10.5 Hz), 7.93 (d,
1H, J=8.4 Hz), 7.42 (dd, 4H, J=2.7 Hz and 7.8 Hz), 7.19 (d, 4H,
J=7.8 Hz) 4.40 (m, 1H), 2.41-2.31 (m, 8H), 2.07 (m, 2H), 1.83 (m,
2H), 1.61 (m, 1H), 1.23 (m, 3H).
Example 83
Preparation of
2-[2,3-Bis-(4-fluorophenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazole-
-5-carboxylic acid (Compound 409)
[0575] Prepared as described for Compound 406 using
4,4'-difluorobenzil in place of benzil.
[0576] MS: 561.19 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.44 (s, 1H), 8.35 (t, 2H, J=9 Hz), 8.15 (m, 2H),
7.59-7.54 (m, 4H), 7.28-7.22 (m, 4H), 4.40 (m, 1H), 2.30 (m, 2H),
2.07 (m, 2H), 1.85 (m, 2H), 1.62 (m, 1H), 1.43-1.23 (m, 3H).
Example 84
Preparation of
2-[2,3-Bis-(3-methoxyphenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazol-
e-5-carboxylic acid (Compound 425)
[0577] Prepared as described for Compound 406 using
3,3'-dimethoxybenzil in place of benzil.
[0578] MS: 585.25 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.40-8.31 (m, 4H), 8.15 (d, 1H, J=8.4 Hz), 8.06 (d,
1H, J=4.2 Hz), 7.92 (d, 1H, J=8.4 Hz), 7.30 (t, 2H, J=8.1 Hz), 7.07
(m, 3H), 6.99 (d, 2H, J=8.1 Hz), 4.39 (m, 1H), 3.67 (s, 3H), 3.66
(s, 3H), 2.35-2.26 (m, 2H), 2.08-2.04 (m, 2H), 1.87-1.84 (m, 2H),
1.62 (m, 1H), 1.34-1.23 (m, 3H).
Example 85
Preparation of
2-[2,3-Bis-(4-methoxyphenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzimidazol-
e-5-carboxylic acid (Compound 441)
[0579] Prepared as described for Compound 406 using
4,4'-dimethoxybenzil in place of benzil.
[0580] MS: 585.25 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.39 (s, 1H), 8.32 (d, 2H, J=9H), 8.13 (m, 2H), 7.96
(m, 1H), 7.84 (dd, 1H, J=0.9 Hz and 9 Hz), 7.51 (m, 4H), 6.96 (dd,
4H, J=3 Hz, 9 Hz), 4.42 (m, 1H), 3.80 (s, 3H), 3.79 (s, 3H),
2.35-2.27 (m, 2H), 2.09-2.06 (m, 2H), 1.87-1.83 (m, 2H), 1.65-1.61
(m, 1H), 1.38-1.23 (m, 3H).
Example 86
Preparation of
2-[2,3-Bis-(4-dimethylaminophenyl)quinoxalin-6-yl]-1-cyclohexyl-1H-benzim-
idazole-5-carboxylic acid (Compound 458)
[0581] Prepared as described for Compound 406 using
4,4'-dimethylaminobenzil in place of benzil.
[0582] MS: 306.17 (M/2+H); .sup.1H-NMR (DMSOd.sub.6): .delta.(ppm)
8.32 (m, 2H), 8.22-8.15 (m, 3H), 8.02-7.96 (m, 3H), 7.49-7.44 (m,
4H), 6.73 (d, 4H, J=9 Hz), 4.43 (m, 1H), 2.97 (s, 6H), 2.96 (s,
6H), 2.35-2.27 (m, 2H), 2.09-2.06 (m, 2H), 1.91-1.83 (m, 2H), 1.61
(m, 1H), 1.38-1.23 (m, 3H).
Example 87
Preparation of
1-Cyclohexyl-2-{2-[3',4'-dimethoxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]-
quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound
419)
Step 1: 3-Acetyl-4-iodobenzoic acid methyl ester (Compound
419a)
[0583] A suspension of 1.45 g (7.56 mmol) of
3-acetyl-4-aminobenzoic acid methyl ester in 15 mL of 6N HCl and 3
mL MeOH was stirred and cooled to 0.degree. C. (See Padwa, A.; et
al. J. Org Chem. 1997, 62, 4088-4096). A solution of 0.63 g (9.07
mmol) of NaNO.sub.2 in 5 mL H.sub.2O was added dropwise to the
suspension while stirring. The resulting solution was stirred at
0.degree. C. for 15 min. A solution of 3.77 g of KI in 25 mL
H.sub.2O was added dropwise to this solution. The flask was removed
from the cooling bath and stirred overnight. The mixture was
extracted with 3.times.50 mL EtOAc. The organic layer was washed
with 10% Na.sub.2S.sub.2O.sub.3 solution until all I.sub.2 was
removed. A pale yellow solution was obtained which was dried
(Na.sub.2SO.sub.4) and concentrated. The residue was purified on
silica gel using hexane and EtOAc as eluent yielding 2 g yellow
solid.
Step 2: 3-Acetyl-4-iodobenzoic acid (Compound 419b)
[0584] A solution of 2 g of the product from the previous step
(6.58 mmol) in a mixture of 66 mL MeOH and 33 mL 2 N aqueous NaOH
was heated at 60.degree. C. overnight. The MeOH was evaporated and
the residue was acidified by the addition of 70 mL of 1 N aqueous
HCl. The resulting emulsion was extracted with 3.times.50 mL EtOAc,
the organic layer was washed with 50 mL of H.sub.2O, dried
(Na.sub.2SO.sub.4) and the solvent was evaporated to yield 1.92 g
of a yellow solid.
Step 3: 1-[2-Iodo-5-(pyrrolidine-1-carbonyl)phenyl]ethanone
(Compound 419c)
[0585] A solution of 1.92 g (6.62 mmol) of the product from the
previous step, 1.61 g (15.88 mmol) of Et.sub.3N and 3.01 g (7.94
mmol) of HBTU in 10 mL anhydrous DMF was allowed to stand at room
temperature for 15 min. Pyrrolidine (2 mL) was added and the
solution was allowed to stand at room temperature overnight. The
volatiles were removed and the residue was purified on silica gel
using hexane and EtOAc as eluent yielding 1.6 g yellow oil. MS:
343.99 (M+H.sup.+)
Step 4:
1-Cyclohexyl-2-{2-[iodo-5-(pyrrolidine-1-carbonyl)phenyl]quinolin--
6-yl}-1H-benzimidazole-5-carboxylic acid ethyl ester (Compound
419d)
[0586] A mixture of 1.03 g (3 mmol) compound 419c 1.41 g (3.6 mmol)
Compound 354e and 5.1 mL 10% KOH in EtOH in 50 mL anhydrous EtOH
was heated at 55.degree. C. for 30 min. The solvent was evaporated,
the residue was dissolved in 50 mL H.sub.2O and the solution was
extracted with 3.times.50 mL EtOAc. The organic layers were washed
with 50 mL H.sub.2O, dried over Na.sub.2SO.sub.4 and the solvent
was evaporated. The residue was purified on silica gel using first
hexane/EtOAc and then CH.sub.2Cl.sub.2/MeOH as the eluent to yield
1.09 g yellow solid. MS: 699.22 (M+H.sup.+).
Step 5:
1-Cyclohexyl-2-{2-[3',4'-dimethoxy-4-(pyrrolidine-1-carbonyl)biphe-
n-2-yl]quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound
419)
[0587] A mixture of 50 mg (0.07 mmol)) of the product from the
previous step, 20 mg (0.11 mmol) of 3,4-dimethoxyphenylboronic
acid, 8 mg (0.007 mmol) of Pd(PPh.sub.3).sub.4 and 1.25 mL of
saturated aqueous NaHCO.sub.3 in 2.5 mL degassed toluene was
stirred at 80.degree. C., under Ar, overnight. The mixture was
filtered through Celite, the solvents were evaporated and the
residue was hydrolyzed in 2.5 mL MeOH and 0.35 mL 2 N aqueous NaOH
at 65.degree. C. for 2.5 h. The mixture was acidified with 1 mL 4 N
HCl in dioxane and the solvents were removed. The residue was
purified by HPLC yielding 10 mg.
[0588] MS: 681.31 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.47-8.30 (m, 4H), 8.16-8.08 (m, 2H), 7.91 (d, 1H,
J=1.5 Hz), 7.75 (m, 1H), 7.63 (d, 1H, J=8.1 Hz), 7.24 (d, 1H, J=8.7
Hz), 6.87-6.80 (m, 3H), 6.68 (m, 1H), 4.40 (m, 1H), 3.56 (s, 3H),
3.55 (m, 4H), 3.54 (s, 3H), 2.30 (m, 2H), 2.17 (m, 2H), 1.88 (m,
4H), 1.59 (s, 1H), 1.25 (m, 3H).
Example 88
Preparation of
1-cyclohexyl-2-{2-[4'-nitro-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinoli-
n-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound 435)
[0589] The title compound (5.2 mg yield) was prepared as described
for Compound 419 using 4-nitrophenylboronic acid in place of
3,4-dimethoxyphenylboronic acid.
[0590] MS: 666.27 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.46 (m, 3H), 8.35 (d, 1H, J=1.2 Hz), 8.26 (d, 1H),
8.20-7.98 (m, 5H), 7.81 (m, 1H), 7.48 (d, 2H, J=9 Hz), 7.40 (d, 1H,
J=8.7 Hz), 3.55 (m, 4H), 2.38 (m, 2H), 2.15 (m, 2H), 1.89 (m, 4H),
1.63 (m, 1H), 1.30 (m, 3H).
Example 89
Preparation of
6-(5-carboxy-1-cyclohexyl-1H-benzimidazol-2-yl)quinoline-2-carboxylic
acid (Compound 402)
Step 1:
6-(1-Cyclohexyl-5-ethoxycarbonyl-1H-benzimidazol-2-yl)quinoline-2--
carboxylic acid (Compound 402a)
[0591] A solution of 500 mg (1.28 mmol) of Compound 354e, 255 mg
(2.56 mmol) of pyruvic acid and 436 mg (5.16 mmol) of piperidine in
25 mL anhydrous MeOH was heated at 55.degree. C. overnight. The
solvent was evaporated, the residue was dissolved in H.sub.2O and
neutralized. The precipitate was filtered, washed with H.sub.2O and
dried yielding 600 mg white solid.
[0592] MS: 442.18 (M-H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.76 (d, 1H, J=8.4 Hz), 8.50 (d, 1H, J=1.5 Hz),
8.38-8.32 (m, 2H), 8.22 (d, 1H, J=8.4 Hz), 8.16-8.13 (m, 2H), 7.95
(dd, 1H, J=1.8 Hz and 9 hz), 4.36 (q, 2H, J=7.2 Hz), 2.31 (m, 2H),
2.07 (m, 2H), 1.84 (m, 2H), 1.61 (m, 1H), 1.37 (t, 3H, J=6.9 Hz),
1.32 (m, 3H).
Step 2:
6-(5-Carboxy-1-cyclohexyl-1H-benzimidazol-2-yl)quinoline-2-carboxy-
lic acid (Compound 402)
[0593] A solution of 90 mg (0.2 mmol) of Compound 402a and 1 mL 2 N
aq. NaOH in 4 mL MeOH was heated overnight at 55.degree. C. The
solvent was evaporated, the residue was dissolved in H.sub.2O and
neutralized. The precipitate was filtered, washed with H.sub.2O and
dried. The product was purified by HPLC to yield 34 mg.
[0594] MS: 416.17 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 9.23 (s, 1H), 8.76 (d, 1H, J=8.7 Hz), 8.48 (s, 1H),
8.36 (d, 1H, J=8.7 Hz), 8.30-8.21 (m, 2H), 8.12 (t, 2H, J=8.4 Hz),
8.95 (d, 1H, J=8.7 Hz), 4.32 (m, 1H), 2.30 (m, 2H), 2.06 (m, 2H),
1.85 (m, 2H), 1.63 (m, 1H), 1.35 (m, 3H).
Example 90
Preparation of
2-[2-(1-Carbamoylethylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-benzimidaz-
ole-5-carboxylic acid (Compound 497)
Step 1:
2-[2-(1-Carbamoylethylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-ben-
zimidazole-5-carboxylic acid ethyl ester (Compound 497a)
[0595] A solution of 100 mg (0.23 mmol) of Compound 402a, 86 mg
(0.69 mmol) of L-alaninamide, 322 mg (0.69 mmol) of PyBroP, 84 mg
(0.69 mmol) DMAP and 89 mg (0.69 mmol) DIEA in 5 mL anhydrous
CH.sub.2Cl.sub.2 was stirred at room temperature for 24 h. To this
solution was added 214 mg (0.92 mmol) of CSA. The solution was
stirred for another 24 h, diluted with 10 mL CH.sub.2Cl.sub.2 and
washed with 10 mL H.sub.2O. The solvent was dried and evaporated.
The residue was chromatographed on silica gel using first
hexane/EtOAc then CH.sub.2Cl.sub.2/MeOH as eluent yielding 50 mg
yellow oil. MS: 514.28 (M+H.sup.+).
Step 2:
2-[2-(1-Carbamoylethylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-ben-
zimidazole-5-carboxylic acid (Compound 497)
[0596] A solution of 50 mg (0.1 mmol) of the product from the
previous step in 2.5 mL THF, 2 mL MeOH and 0.5 mL 2 N aq. NaOH was
allowed to stand at room temperature overnight. The solvents were
removed, the residue was dissolved in 1 mL H.sub.2O, and the
solution was neutralized with 1 M aq. HCl. The precipitate was
purified by HPLC to yield 7 mg of the title compound.
[0597] MS: 486.24 (M+H.sup.+); .sup.1H-NMR (CD.sub.3OD):
.delta.(ppm) 8.76 (d, 1H, J=8.4 Hz), 8.61-8.51 (m, 3H), 8.40-8.32
(m, 3H), 8.20 (d, 1H, J=8.4 Hz), 4.70 (m, 2H), 2.47 (m, 2H), 2.67
(m, 2H), 2.00 (m, 2H), 1.75 (m, 1H), 1.60 (d, 3H, J=6.9 Hz), 1.45
(m, 3H).
Example 91
Preparation of
2-[2-(1-Carbamoyl-2-methylpropylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H--
benzimidazole-5-carboxylic acid (Compound 511)
[0598] The title compound (5 mg yield) was prepared as described
for Compound 497a using L-valinamide in place of L-alaninamide, and
hydrolyzed as described for Compound 497.
[0599] MS: 514.28 (M+H.sup.+); .sup.1H-NMR (CD.sub.3OD):
.delta.(ppm) 8.72 (d, 1H, J=9 Hz), 8.52-8.47 (m, 3H), 8.40-8.36 (m,
1H), 8.19-8.14 (m, 2H), 7.99 (d, 1H, J=8.4 Hz), 4.58 (m, 2H), 2.44
(m, 2H), 2.29 (m, 1H), 2.19 (m, 2H), 2.02 (m, 3H), 1.74 (m, 1H),
1.44 (m, 3H), 1.10 (m, 6H).
Example 92
Preparation of
2-{2-[1-Carbamoyl-2-(1H-imidazol-2-yl)ethylcarbamoyl]quinolin-6-yl}-1-cyc-
lohexyl-1H-benzimidazole-5-carboxylic acid (Compound 368)
[0600] The title compound (8 mg yield) was prepared as described
for Compound 497a using L-histidinamide in place of L-alaninamide
and hydrolyzed as described for Compound 497.
[0601] MS: 552.25 (M+H.sup.+); .sup.1H-NMR (CD.sub.3OD):
.delta.(ppm) 8.80 (d, 1H, J=1.5 Hz), 8.71 (d, 1H, J=8.7 Hz),
8.49-8.45 (m, 3H), 8.32 (d, 1H, J=8.7 Hz), 8.21 (m, 2H), 8.15 (dd,
1H, J=1.8 Hz and 8.7 Hz), 7.97 (s, 1H), 7.40 (d, 1H, J=1.2 Hz),
5.05-5.01 (m, 1H), 4.53 (m, 1H), 3.54 (dd, 1H, J=5.4 Hz and 15.3
Hz), 3.52 (t, 1H, J=8.4 Hz), 2.46 (m, 2H), 2.17 (m, 2H), 1.98 (m,
2H), 1.74 (m, 1H), 1.45-1.36 (m, 3H).
Example 93
Preparation of
2-[2-(1-Carbamoyl-2-hydroxyethylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H--
benzimidazole-5-carboxylic acid (Compound 385)
[0602] The title compound (5 mg yield) was prepared as described
for Compound 497a using L-serinamide in place of L-alaninamide and
hydrolyzed as described for Compound 497.
[0603] MS: 502.23 (M+H.sup.+); .sup.1H-NMR (CD.sub.3OD):
.delta.(ppm) 8.73 (d, 1H, J=8.4 Hz), 8.51 (m, 2H,), 8.40 (d, 1H,
J=8.7 Hz), 8.26 (s, 2H), 8.17 (d, 1H, J=9.3), 7.97 (s, 1H), 4.72
(t, 1H, J=4.5 Hz), 4.59 (m, 1H), 4.02 (m, 2H), 3.00 (s, 1H), 2.86
(s, 1H), 2.46 (m, 2H), 2.20 (m, 2H), 1.98 (m, 2H), 1.75 (m, 1H),
1.43 (m, 3H).
Example 94
Preparation of
2-[2-(1-Carbamoyl-2-phenylethylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-b-
enzimidazole-5-carboxylic acid (Compound 542)
[0604] The title compound (5 mg yield) was prepared as described
for Compound 497a using L-phenylalaninamide in place of
L-alaninamide and hydrolyzed as described for Compound 497.
[0605] MS: 562.27 (M+H.sup.+); .sup.1H-NMR (CD.sub.3OD):
.delta.(ppm) 9.06 (d, 1H, J=8.1 Hz), 8.72 (d, 1H, J=8.4 Hz), 8.50
(m, 2H), 8.32 (m, 2H), 8.17 (dd, 1H, J=1.8 Hz and 8.7 Hz),
7.34-7.19 (m, 5H), 4.61 (m, 1H), 3.34 (d, 2H, obscured by residual
solvent), 3.22 (m, 1H), 2.46 (m, 2H), 2.25 (m, 2H), 2.00 (m, 2H),
1.77 (m, 1H), 1.44 (m, 3H).
Example 95
Preparation of
2-[2-(4-Chlorophenylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-benzimidazol-
e-5-carboxylic acid (Compound 510)
Step 1:
2-[2-(4-Chlorophenylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-benzi-
midazole-5-carboxylic acid ethyl ester (Compound 510a)
[0606] The title compound was prepared as described for Compound
497a using 4-chloroaniline in place of L-alaninamide yielding 91 mg
yellow solid. MS: 553.23 (M+H.sup.+).
Step 2:
2-[2-(4-Chlorophenylcarbamoyl)quinolin-6-yl]-1-cyclohexyl-1H-benzi-
midazole-5-carboxylic acid (Compound 510)
[0607] The 91 mg of the product from the previous step was
hydrolyzed as described for Compound 497 yielding 16 mg of the
title compound.
[0608] MS: 525.18 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 10.97 (s, 1H), 8.83 (d, 1H, J=8.7), 8.46 (m, 2H), 8.32
(m, 2H), 8.19 (dd, 1H, J=1.8 Hz and 8.7 Hz), 8.10 (d, 1H, J=8.7
Hz), 8.02 (m, 2H), 7.94 (dd, 1H, J=1.5 Hz and 8.4 Hz), 7.48 (m,
1H), 4.41 (m, 1H), 2.32 (m, 2H), 2.06 (m, 2H), 1.85 (m, 2H), 1.62
(m, 1H), 1.36 (m, 3H).
Example 96
Preparation of
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-1H-ind-
ole-6-carboxylic acid (Compound 536)
Step 1: 2-Amino-5-bromo-benzaldehyde (Compound 536a)
[0609] The title intermediate was synthesized as described for
Compound 7 in five steps starting from 5-bromo-2-nitrotoluene
instead of 3-methyl-4-nitrobenzoic acid methyl ester.
[0610] MS: 199.97 & 201.97 (M+H.sup.+); H.sup.1-NMR
(CDCl.sub.3): .delta.(ppm) 9.75 (s, 1H), 7.71 (s, 1H), 7.39 (d, 1H,
J=9.3 Hz), 7.22 (s, 2H), 6.72 (d, 1H, J=9.3 Hz);
Step 2: 6-Bromo-2-(4'-chloro-4-methoxy-biphen-2-yl)-quinoline
(Compound 536c)
[0611] The title intermediate was synthesized from the product of
the previous reaction and Compound 525a using the procedure
described for Compound 13 (y=phenyl) in 44% yield.
[0612] MS: 424.03 & 426.03 (M+H.sup.+); H.sup.1-NMR
(CDCl.sub.3): .delta.(ppm) 8.20 (d, 1H, J=2.1 Hz), 8.10 (d, 1H,
J=9.0 Hz), 7.93-7.83 (m, 2H), 7.40 (d, 1H, J=8.4 Hz), 7.26-7.23 (m,
3H0, 7.16-7.03 (m, 4H), 3.85 (s, 3H);
Step 3: 2-Boronic acid derivative of
3-Cyclohexyl-1H-indole-6-carboxylic acid methyl ester (Compound
536e)
[0613] Compound 536d (1 g, 3 mmol) (See International Patent
Application Publication Number WO 03/010141), 890 mg (9 mmol) of
potassium acetate, 105 mg (0.15 mmol) of
dichloro[1,1'-bis(diphenylphosphino)ferrocene]palladium (II)
dichloromethane adduct and 6.7 g (30 mmol) of bis(neopentyl
glycolato)diboron were dissolved in 20 mL of DMSO and the mixture
was heated overnight at 95.degree. C. The crude product was
precipitated by addition of 30 mL water. It was purified on a
silicagel pad using toluene-ethyl acetate solvent gradient elution
to yield 391 mg (43%) of the title compound.
[0614] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 11.06 (s, 1H), 8.01
(d, 1H, J=1.5 Hz), 7.78 (d, 1H, J=8.4 Hz), 7.47 (dd, 1H, J=8.4 and
1.8 Hz), 3.81 (s, 3H), 1.98-1.33 (m, 11H).
Step 4:
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-
-1H-indole-6-carboxylic acid (Compound 536)
[0615] A mixture of 106 g (0.25 mmol) of Compound 536c, 180 mg (0.6
mmol) of Compound 536e, 58 mg (0.05 mmol) of
tetrakis-(triphenylphosphino) palladium, 6 mL of toluene, 1.5 mL of
methanol and 600 .mu.L of saturated sodium bicarbonate was heated
under Ar overnight at 80.degree. C. The reaction mixture was then
evaporated to dryness, the semi-solid dissolved in 5 mL ethanol, 3
mL 1M NaOH was added and was heated at 85.degree. C. for 30
minutes. The reaction mixture was then evaporated to dryness. The
pure title compound was isolated using RP-HPLC to yield 27.5 mg
(19%) yellow solid.
[0616] MS: 587.23 (M+H.sup.+); H.sup.1-NMR (CDCl.sub.3):
.delta.(ppm) 11.66 (s, 1H), 8.39 (d, 1H, J=8.4 Hz), 8.20 (d, 1H,
J=8.7 Hz), 8.12 (d, 1H, J=1.5 Hz), 8.00-7.95 (m, 2H), 7.86 (d, 1H,
J=8.4 Hz), 7.59 (, dd, 1H, J=8.7 and 1.5 Hz), 4.47 (d, 1H, J=8.7
Hz), 7.34-7.28 (m, 3H), 7.22-7.18 (m, 2H), 7.14-7.11 (m, 2H), 3.88
(s, 3H), 2.96 (m, 1H), 2.05-1.22 (m, 10H).
Example 97
Preparation of
1-Cyclohexyl-2-(2-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carboxylic
acid (Compound 405)
Step 1: 4-methyl-3-nitro-benzoic acid methyl ester (Compound
405a)
[0617] 4-Methyl-3-nitro benzoic acid (12.5 g, 69 mmol) was
dissolved in anhydrous methanol (500 mL) in a 1 L flask. HCl gas
was then bubbled through the solution until saturation (3 h). The
HCl source was then removed, and the reaction was stirred at room
temperature overnight. The reaction was then concentrated to
dryness and dried over phosphorus pentoxide overnight to yield
13.34 g (99%) of product which was 99% pure by QC HPLC.
[0618] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 8.59 (d, 1H,
Ar--H.sup.2), 8.13 (dd, 1H, Ar--H.sup.6), 7.43 (d, 1H,
Ar--H.sup.5), 3.96 (s, 3H, OCH.sub.3), 2.67 (s, 3H, CH.sub.3)
Step 2: trans-4-(2-Dimethylamino-vinyl)-3-nitro-benzoic acid methyl
ester (Compound 405b)
[0619] A 100 mL flask fitted with a 15 cm Vigreux head was charged
with 10 g (49.7 mmol) of the product from the previous step, 16.9
mL of DMF, and 21.2 g (196.0 mmol) of N,N-dimethylformamide
dimethylacetal. The reaction vessel was immersed in a 140
C..degree. oil bath for 18 h under Ar while the forming methanol
was distilled away. Upon cooling to room temperature the dark red
content of the flask solidified. The solid was transferred to a 250
mL flask using DMF, which was subsequently removed by evaporation.
The residue was triturated with petroleum ether to give 16.16 g
(95%) enamine as dark red solid which was 98.4% pure based on QC
HPLC.
[0620] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 8.48 (d, 1H,
Ar--H.sup.2), 7.88 (dd, 1H, Ar--H.sup.6), 7.45 (d, 1H,
Ar--H.sup.5), 7.15 (d, 1H, CH.dbd.), 5.91 (d, 1H, CH.dbd.), 3.90
(s, 3H, OCH.sub.3), 2.95 (s, 6H, (CH.sub.3).sub.2N)
Step 3: 4-Formyl-3-nitro-benzoic acid methyl ester (Compound
405c)
[0621] The product from the previous step (16.10 g, 64.3 mmol) and
NaIO.sub.4 (41 g, 191.7 mmol) was dissolved in 250 mL of 1:1
THF/H.sub.2O at room temperature. The dark red solution was warmed
to about 40.degree. C. while heavy precipitation occurred and the
solution color changed to light brown. After 1 h, the precipitate
was removed by filtration and was washed with 400 mL ethyl acetate.
The organic layer was washed three times with saturated
NaHCO.sub.3, once with brine and dried with Na.sub.2SO.sub.4. The
solution was evaporated to dryness and the resulting oil was
purified on a silicagel pad eluting with ethyl acetate-hexane
gradient (30% to 40% ethyl acetate) to yield 11.07 g (83%) of the
title intermediate as a yellow solid after evaporation.
[0622] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 10.45 (s, 1H, CHO),
8.75 (d, 1H, Ar--H.sup.2) 8.41 (dd, 1H, Ar--H.sup.6), 8.01 (d, 1H,
Ar--H.sup.5), 4.02 (s, 3H, OCH.sub.3)
Step 4: 4-Dimethoxymethyl-3-nitro-benzoic acid methyl ester
(Compound 405d)
[0623] To a solution of 11 g (52.6 mmol) of the product from the
previous step in 220 mL methanol 5.5 mL 4N HCL/dioxane was added.
The mixture was kept at 90.degree. C. for 10 minutes before it was
evaporated to dryness. The white solid material was dissolved in 20
mL methanol again and was treated with 5.5 mL 4N HCl in the same
way 2 more times. The solid was dried in high vacuum overnight to
give 12.46 g (93%) reddish oil of the title intermediate (76%).
[0624] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 8.43 (d, 1H,
Ar--H.sup.2), 8.23 (dd, 1H, Ar--H.sup.6), 7.87 (d, 1H,
Ar--H.sup.5), 5.93 (s, 1H, Ar--CH), 3.97 (s, 3H, ester CH.sub.3),
3.41 (s, 6H, acetal CH.sub.3)
Step 5: 3-Amino-4-dimethoxymethyl-benzoic acid methyl ester
(Compound 405e)
[0625] Mg.sub.2SO.sub.4 (1 g) and 100 mg of 10% Pd/C were suspended
in 20 mL methanol and were hydrogenated in a Parr apparatus at 30
psi for 20 minutes. The apparatus was opened and 1.22 g (4.78 mmol)
of the product from the previous step dissolved in 20 mL methanol
was added followed by 2 mL TEA. The mixture was hydrogenated at 30
psi for 45 minutes, the catalyst was removed by filtration and the
solution was evaporated to dryness. The solid material was dried
over P.sub.2O.sub.5 overnight to give 84 mg (95.4%) of the title
intermediate.
[0626] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 7.37 (d, 2H,
Ar--H.sup.5+6), 7.31 (d, 1H, Ar--H.sup.2), 5.34 (s, 1H, Ar--CH),
4.36 (s, 2H, NH2), 3.88 (s, 3H, ester CH.sub.3), 3.33 (s, 6H,
acetal CH.sub.3)
Step 6: 3-Amino-4-formyl-benzoic acid methyl ester (Compound
53)
[0627] The product from the previous step (100 mg, 0.44 mmol) was
dissolved at room temperature in a 15 mL solvent mixture composed
of 2:2:1 EtOH-acetic acid-water. The strong yellow solution became
pale yellow in 5 minutes. The mixture was let stand for an
additional 15 minutes then was evaporated to dryness and was
further dried in high vacuum overnight to get 75 mg (94%) of the
title intermediate as a yellow powder.
[0628] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 9.92 (s, 1H, CHO),
7.55 (d, 1H, Ar--H.sup.2), 7.34 (m, 2H, Ar--H.sup.5+6), 3.91 (s,
1H, CH.sub.3)
Step 7: 2-Phenyl-quinoline-7-carboxylic acid (Compound 405f)
[0629] To a solution of 500 mg (2.8 mmol) of the product from the
previous step, 340 mg (2.8 mmol) of acetophenone in 20 mL ethanol,
2.1 mL of a 10% KOH/ethanol solution was added and the mixture was
refluxed under argon overnight. The product partially precipitated
as dull tan crystals which were not filtered off. The whole mixture
was evaporated to dryness; the residue was triturated with ether to
give the product as a potassium salt. The acid was obtained by
dissolving the potassium salt in 25 mL water and acidifying to pH
4. The precipitate was collected by filtration, washed twice with
water and dried over phosphorous pentoxide in high vacuum to yield
261 mg (54%) the title intermediate MS: 250.32 (M+H.sup.+)
Step 8:
4-Cyclohexylamino-3-[(2-phenyl-quinoline-7-carbonyl)-amino]-benzoi-
c acid ethyl ester (Compound 405g)
[0630] To a solution of 250 mg (1.0 mmol) of the product from the
previous step and 418 mg HATU (1.1 mmol) in DMF (5 mL), 0.383 mL
(2.2 mmol) of DIEA was added. The reaction was stirred at room
temperature for 15 minutes before 289 mg (1.1 mol) of Compound 11
was added. The reaction was complete after stirring at room
temperature for 1 hour. After being evaporated to dryness, the
reaction mixture was dissolved in ethyl acetate, and washed with
water (2.times.100 mL), brine (1.times.100 mL), dried over sodium
sulfate, and evaporated to an oil residue which was then dried over
phosphorus pentoxide overnight to produce 200 mg (46% yield) of the
title intermediate.
Step 9:
1-Cyclohexyl-2-(2-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carbox-
ylic acid (Compound 405)
[0631] The product from the previous step (200 mg, 0.4 mmol) was
dissolved in 30 mL of glacial acetic acid. The solution was
refluxed for 4 h, then evaporated to dryness. The yellow solid was
dissolved again in 20 mL ethanol, and 4 mL 1N NaOH was added with
stirring at 80.degree. C. for 1 h. The reaction mixture was then
evaporated to dryness. The solid was dissolved in 20 mL water,
cooled in an ice bath, acidified with 4 mL 1N HCl after which the
precipitate was filtered and washed with water. The solid was dried
over phosphorus pentoxide overnight to yield 25 mg of the title
compound.
[0632] MS: 448.27 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.64 (d, 1H), 8.44 (s, 1H), 8.30 (m, 5H), 8.18 (d,
1H), 7.95 (dd, 1H), 7.90 (dd, 1H), 7.55 (m, 3H), 3.40 (m, 4H), 2.32
(dd, 2H), 2.08 (d, 2H), 1.85 (d, 2H), 1.62 (d, 1H)
Example 98
Preparation of
1-cyclohexyl-2-(3-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carboxylic
acid (Compound 351)
Step 1: 3-Phenyl-quinoline-7-carboxylic acid (Compound 351a)
[0633] Following the same reaction procedure and workup for
Compound 405f, 500 mg (2.8 mmol) of Compound 53 was reacted with
340 mg (2.8 mmol) phenylacetaldehyde to produce 603 mg (87% yield)
of the title intermediate.
[0634] MS: 250.17 (M+H.sup.+); H.sup.1-NMR (DMSO): .delta.(ppm)
9.35 (d, 1H), 8.72 (s, 1H), 8.58 (s, 1H), 8.12 (m, 2H); 7.90 (d,
2H), 7.55 (m, 3H);
Step 2:
4-Cyclohexylamino-3-[(3-phenyl-quinoline-7-carbonyl)-amino]-benzoi-
c acid ethyl ester (Compound 351b)
[0635] Following the same reaction procedure and workup as for
Compound 405g, 250 mg (1 mmol) of the product from the previous
step was reacted with 289 mg (1.1 .mu.mol) of Compound 11, using
418 mg (1.1 mmol) of HATU and 0.383 mL of DIEA to produce 448 mg
(91% yield) of the title intermediate. MS: 494.29 (M+H.sup.+)
Step 3:
1-Cyclohexyl-2-(3-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carbox-
ylic acid (Compound 351)
[0636] Following the same reaction procedure and workup as for
Compound 405, 450 mg (0.9 mmol) of the product from the previous
step was cyclized with 40 mL acetic acid and saponified with 35 mL
EtOH and 7 mL 1M NaOH to produce 70 mg (17% yield) of the title
compound.
[0637] MS: 448.23 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 9.49 (d, 1H), 9.0 (d, 1H), 8.56 (s, 1H), 8.39 (m, 2H),
8.26 (d, 1H), 8.05 (m, 5H), 7.55 (m, 3H), 2.30 (m, 3H), 2.12 (d,
3H), 1.86 (d, 3H), 1.62 (d, 2H), 1.34 (m, 5H)
Example 99
Preparation of
2-{[1-cyclohexyl-2-(3-phenyl-quinolin-7-yl)-1H-benzoimidazole-5-carbonyl]-
-amino}-3-(5-hydroxy-1H-indol-3-yl)-propionic acid (Compound
516)
[0638] To a solution of 50 mg (0.11 mmol) of Compound 351 in 2 mL
DMF, 46 mg (0.12 mmol) of HATU and 40 .mu.L (0.24 mmol) of DIEA
were added. The mixture was stirred at room temperature for 30
minutes and 27 mg (0.12 mmol) of L-5-hydroxytryptophane was added
to the activated ester solution. The reaction was complete in 1 h.
The DMF was evaporated and the residual oil which was dissolved in
20 mL 1:1 DMF-water containing 0.1% TFA. The solution was applied
on a RP-HPLC column to give the pure title compound as TFA
salt.
[0639] Conversion to HCl salt: The purified Compound 516 was
dissolved in 0.8 mL methanol, 1 mL 4M HCl in dioxane was added
followed by 40 mL ether. The off-white precipitate was centrifuged
down and the ether was decanted off. Yield: 15 mg (25%) beige
solid.
[0640] MS: 648.24 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 10.50 (d, 1H), 9.45 (s, 1H), 8.92 (s, 1H), 8.52 (s,
1H), 8.39-8.30 (m, 3H), 8.23 (m, 1H), 7.98 (m, 4H), 7.54 (m, 3H),
7.08 (m, 3H), 6.87 (m, 3H), 6.56 (d, 1H), 4.65 (m, 1H), 4.36 (m,
1H), 2.32 (m, 2H), 2.10 (m, 2H), 1.84 (d, 2H), 1.95 (m, 1H), 1.29
(m, 4H);
Example 100
Preparation of
1-cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid morpholin-4-ylamide (Compound 574)
[0641] A solution of Compound 203 (0.25 mmol) in 3 mL DMF was
preactivated with HATU (0.246 mmol) and DIEA (0.5 mmol). To the
solution, the desired amine was added (0.1 mmol) and the reaction
was stirred for 16 hours. The completed reaction was then purified
via RP-HPLC, and converted to the HCl salt by evaporating to
dryness, dissolving in 0.8 mL methanol and adding 1 mL 4M HCl in
dioxane followed by 40 mL ether. The compound was centrifuged down,
the solvent decanted off, and the solid dried to yield the final
compound.
[0642] Using this general procedure with morpholin-4-ylamine (9.8
ul), produced 15 mg of the title compound (58% yield). MS: 533.32
(M+H.sup.+) HPLC Procedure A, retention time=12.87 min.
Example 101
Preparation of
2-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-ethanesulfonic acid (Compound 524)
[0643] The general procedure described for Compound 574 was used
with 2-amino-ethanesulfonic acid (12.5 mg), producing 28 mg of the
title compound (98% yield). MS: 556.28 (M+H.sup.+) HPLC Procedure
A, retention time=11.36 min.
Example 102
Preparation of
1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid (7-hydroxy-naphthalen-1-yl)-amide (Compound 575)
[0644] The general procedure described for Compound 574 was used
with 8-amino-naphthalen-2-ol (15.9 mg), producing 5 mg of the title
compound (20% yield). MS: 590.25 (M+H.sup.+) HPLC Procedure A,
retention time=15.31 min.
Example 103
Preparation of
1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid (5-hydroxy-naphthalen-1-yl)-amide (Compound 576)
[0645] The general procedure described for Compound 574 was used
with 5-amino-naphthalen-1-ol (15.9 mg), producing 7 mg of the title
compound (25% yield). MS: 590.24 (M+H.sup.+) HPLC Procedure A,
retention time=15.26 min.
Example 104
Preparation of
6-{[1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carbony-
l]-amino}-naphthalene-2-carboxylic acid (Compound 526)
[0646] The general procedure described for Compound 574 was used
with 6-amino-naphthalene-2-carboxylic acid (18.7 mg), producing 15
mg of the title compound (53% yield). MS: 618.30 (M+H.sup.+) HPLC
Procedure A, retention time=16.24 min.
Example 105
Preparation of
1-Cyclohexyl-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimidazole-5-carboxylic
acid (4-methyl-2-oxo-2H-chromen-7-yl)-amide (Compound 577)
[0647] The general procedure described for Compound 574 was used
with 7-Amino-4-methyl-chromen-2-one (17.5 mg), producing 8 mg of
the title compound (27% yield). MS: 606.29 (M+H.sup.+) HPLC
Procedure A, retention time=19.22 min.
Example 106
Preparation of
1-Cyclohexyl-2-(2-phenyl-1,2,3,4-tetrahydro-quinolin-6-yl)-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 215)
[0648] A solution of Compound 203 (100 mg, 0.23 mmol) and platinum
oxide (12 mg, 0.048 mmol) in methanol (5 mL) was hydrogenated at 40
psi for 3 h. The reaction was evaporated to dryness, and purified
via HPLC. The resulting compound was then converted to the HCl salt
using the standard method, yielding 40 mg (37% yield) of the title
compound.
[0649] MS: 452.25 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.31 (d, 1H, J=9), 8.22 (d, 1H, J=1.5), 8.044 (dd, 1H,
J=9.1, 1.5), 7.36 (m, 7H), 6.865 (d, 1H, J=9), 4.58 (m, 2H), 2.86
(m, 1H), 2.66 (m, 1H), 2.33 (m, 2H), 2.07 (m, 3H), 1.90 (m, 3H),
1.66 (m, 1H), 1.41 (m, 3H).
Example 107
Preparation of
2-[2-(2-Bromo-phenyl)-3-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 424)
Step 1: 1-(2-Bromo-phenyl)-2-phenyl-ethanol (Compound 424a)
[0650] A mixture of 2-bromobenzaldehyde (1 mL, 5.4 mmol) in
diethylether (2 mL) was added to a flame dried flask, and flushed
with argon. The temperature was reduced to -10.degree. C. and
benzylmagnesium chloride was slowly added to the flask via syringe.
The reaction was stirred at -10.degree. C. for 1 hour and then
stirred at room temperature for 16 hours. The reaction was the
poured over ice and acidified to pH 3. It was then extracted with
ether (3.times.40 mL). The organic layers were combined,
evaporated, and the resulting residue was purified via silica gel
chromatography to produce 520 mg (33% yield) of the title
intermediate.
[0651] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 7.54 (dd, 2H), 7.33
(m, 1H), 7.25 (m, 3H), 7.12 (m, 2H), 5.22 (m, 1H), 3.18 (dd, 3.18,
J=2.7, 13.8), 2.715 (dd, 1H, J=13.8, 9)
Step 2: 1-(2-Bromo-phenyl)-2-phenyl-ethanone (Compound 424b)
[0652] To a flame dried flask, Dess-Martin periodinane (1.23 g, 2.9
mmol) and dichloromethane (30 mL) were added. The mixture was
cooled to 0.degree. C., and the product of the previous reaction
(520 mg, 1.8 mmol) was added and stirred for 1 hour at the reduced
temperature before being stirred for 48 hours at room temperature.
The reaction was then evaporated to an oil, and purified on silica
gel to produce the title intermediate (385 mg, 78% yield).
[0653] H.sup.1-NMR (CDCl.sub.3): .delta.(ppm) 7.58 (m, 1H), 7.26
(m, 8H), 4.23 (s, 2H)
Step 3: 3-(2-Bromo-phenyl)-2-phenyl-quinoline-6-carboxylic acid
(Compound 424c)
[0654] Following the same reaction procedure and workup as for
Compound 405f (235 mg, 1.31 mmol) of Compound 53 was reacted with
the product of the previous reaction, Compound 424b (360 mg, 1.31
mmol), in ethanol (12 mL) using 10% w/v KOH in ethanol (1.1 mL) to
produce the title compound (210 mg, 40% yield).
[0655] MS: 403.22 (M-H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.69 (s, 1H), 8.28 (d, 1H, J=8.7), 8.04 (s, 1H,
J=8.7), 7.93 (s, 1H); 7.542 (d, 1H, J=7.2), 7.40 (m, 3H), 7.25 (m,
4H)
Step 4:
3-{[2-(2-Bromo-phenyl)-3-phenyl-quinoline-6-carbonyl]-amino}-4-cyc-
lohexylamino-benzoic acid ethyl ester (Compound 424d)
[0656] Using the same reaction procedure and workup as for Compound
405g, the product of the previous reaction, Compound 424c (200 mg,
0.495 mmol), HATU (207 mg, 0.545 mmol), DIEA (141 mg, 1.09 mmol),
Compound 11 (143 mg, 0.545 mmol) and DMF (4 mL) were used to
produce of the title intermediate (250 mg, 78% yield). MS 649.57
(M+H.sup.+)
Step 5:
2-[2-(2-Bromo-phenyl)-3-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 424)
[0657] Using the same reaction procedure and workup as for Compound
405, the product of the previous reaction (250 mg, 0.39 mmol) was
reacted with acetic acid (30 mL), and 1M NaOH (4 mL) to produce the
title compound (60 mg, 25% yield).
[0658] MS 602.15; H.sup.1-NMR (DMSO-d.sub.6): .delta.(ppm) 8.71 (s,
1H), 8.53 (s, 1H), 8.31 (m, 2H), 8.13 (m, 2H), 7.98 (dd, 1H, J=1.5,
8.4), 7.585 (d, 1H, J=7.8), 7.46 (m, 2H), 7.3 (m, 6H), 4.47 (m,
1H), 2.35 (m, 3H), 2.09 (m, 2H), 1.86 (m, 2H), 1.63 (m, 1H), 1.37
(m, 3H)
Example 108
Preparation of
2-[2-(4'-Chloro-biphen-2-yl)-3-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 440)
[0659] Compound 424 (50 mg, 0.083 mmol), 4-chlorophenylboronic acid
(20 mg, 0.125 mmol), and CsF (143 mg, 0.94 mmol) were added to
degassed dioxane (6 mL). A solution of
2-(dicyclohexylphosphino)biphenyl (5 mg, 0.0125 mmol) and palladium
acetate (2 mg, 0.0083 mmol) in degassed dioxane (3 mL) was added to
the reaction solution. The reaction was then refluxed under argon
for 3 hours. The reaction was then evaporated to dryness and
purified via HPLC resulting in the title compound (4 mg, 10%
yield).
[0660] MS 634.18; H.sup.1-NMR (DMSO-d.sub.6): .delta.(ppm) 8.40 (d,
2H, J=4.8), 8.30 (d, 2H, J=8.7), 8.09 (m, 2H), 7.9 (d, 1H, J=8.7),
7.3 (d, 1H, J=7.2), 7.54 (m, 2H), 7.20 (m, 2H), 7.08 (dd, 4H,
J=13.8, 7.8), 6.61 (d, 2H, J=6.9), 6.47 (d, 2H, J=8.4), 2.34 (m,
2H), 2.05 (m, 2H), 1.85 (m, 2H), 1.62 (m, 1H), 1.38 (m, 3H)
Example 109
Preparation of
2-(2-biphenyl-4-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carbox-
ylic acid (Compound 390)
[0661] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-biphenyl-4-yl-ethanone (51 mg, 0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (15 mg, 10% yield).
[0662] MS: 524.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.71 (d, 1H, J=9), 8.39 (m, 6H), 8.2 (d, 1H, J=8.7),
8.19 (d, 1H, J=9), 8.0 (d, 1H, J=9), 7.9 (d, 2H, J=8.1), 7.79 (d,
2H, J=7.5), 7.52 (m, 2H), 7.42 (m, 1H), 3.56 (s, 1H), 2.45 (m, 2H),
2.10 (m, 2H), 1.86 (m, 2H), 1.62 (s, 1H), 1.34 (m, 3H)
Example 110
Preparation of
1-cyclohexyl-2-[2-(2,4-dimethyl-thiazol-5-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid (Compound 426)
[0663] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2,4-dimethyl-thiazol-5-yl)-ethanone (40 mg, 0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (14 mg, 12% yield).
[0664] MS: 483.19 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.61 (m,
1H), 8.37 (m, 1H), 8.26 (m, 1H), 8.0 (m, 5H), 4.38 (s, 1H), 2.72
(s, 3H), 2.66 (s, 3H), 2.28 (m, 2H), 2.02 (m, 2H), 1.82 (m, 2H),
1.62 (m, 1H), 1.30 (m, 3H)
Example 111
Preparation of
1-cyclohexyl-2-(2-pyrazin-2-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid (Compound 442)
[0665] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-pyrazin-2-yl-ethanone (32 mg, 0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (15 mg, 10% yield).
[0666] MS: 450.20 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 9.79 (d,
1H, J=1.5), 8.84 (m, 3H), 8.62 (d, 1H, J=8.7), 8.53 (d, 1H, J=1.5),
8.40 (d, 1H, J=8.4), 8.34 (d, 1H, J=1.5), 8.22 (d, 1H, J=8.7), 8.15
(dd, 1H, J=9, 2.1), 8.01 (dd, 1H, J=8.4, 1.2), 2.33 (m, 2H), 2.10
(m, 2H), 1.85 (m, 2H), 1.61 (m, 1H), 1.35 (m, 3H)
Example 112
Preparation of
1-cyclohexyl-2-[2-(5-methyl-2-phenyl-thiophen-3-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid (Compound 472)
[0667] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(5-methyl-2-phenyl-thiophen-3-yl)-ethanone (56 mg, 0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (8 mg, 6% yield). MS: 544.27
(M+H.sup.+) HPLC Procedure A, retention time=17.05 min.
Example 113
Preparation of
1-cyclohexyl-2-(2-pyridin-3-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid (Compound 355)
[0668] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-pyridin-3-yl-ethanone (0.256 mmol) in ethanol (2 mL) using 10%
w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (19 mg, 17% yield). MS: 449.21 (M+H.sup.+) HPLC Procedure
A, retention time=7.96 min.
Example 114
Preparation of
2-[2-(4-amino-3-bromo-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazo-
le-5-carboxylic acid (Compound 372)
[0669] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
N-(4-acetyl-2-bromo-phenyl)-acetamide (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (16 mg, 15% yield).
[0670] MS: 541.15 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.80 (d,
1H, J=9), 8.53 (m, 3H), 8.35 (m, 2H), 8.28 (d, 1H, J=9), 8.17 (m,
2H), 8.04 (dd, 1H, J=8.7, 1.2), 6.98 (d, 1H, J=8.7), 4.44 (m, 1H),
2.30 (m, 2H), 2.12 (m, 2H), 1.85 (m, 2H), 1.62 (m, 1H), 1.35 (m,
3H)
Example 115
Preparation of
2-[2-(2-amino-4-methyl-thiazol-5-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid (Compound 391)
[0671] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2-amino-4-methyl-thiazol-5-yl)-ethanone (0.256 mmol) in ethanol
(2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to
produce the title compound (8 mg, 9% yield). MS: 484.19
(M+H.sup.+); HPLC Procedure A, retention time=8.57 min.
Example 116
Preparation of
1-cyclohexyl-2-[2-(7-hydroxy-benzofuran-2-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid (Compound 411)
[0672] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(7-hydroxy-benzofuran-2-yl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (19 mg, 20% yield). MS: 504.22 (M+H.sup.+); HPLC
Procedure A, retention time=12.20 min.
Example 117
Preparation of
1-cyclohexyl-2-(2-pyridin-2-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid (Compound 427)
[0673] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-pyridin-2-yl-ethanone (0.256 mmol) in ethanol (2 mL) using 10%
w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (66 mg, 61% yield). MS: 449.19 (M+H); HPLC Procedure A,
retention time=9.85 min.
Example 118
Preparation of
1-cyclohexyl-2-(2-pyridin-4-yl-quinolin-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid (Compound 443)
[0674] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-pyridin-4-yl-ethanone (0.256 mmol) in ethanol (2 mL) using 10%
w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (68 mg, 62% yield). MS: 449.19 (M+H.sup.+); HPLC Procedure
A, retention time=7.98 min.
Example 119
Preparation of
1-cyclohexyl-2-[2-(5,6,7,8-tetrahydro-naphthalen-2-yl)-quinolin-6-yl]-1H--
benzoimidazole-5-carboxylic acid (Compound 459)
[0675] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(5,6,7,8-tetrahydro-naphthalen-2-yl)-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in Ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (65 mg, 60% yield).
[0676] MS: 502.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.76 (m,
1H), 8.54 (s, 1H), 8.39 (m, 4H), 8.10 (m, 4H), 7.36 (m, 1H), 4.45
(m, 1H), 2.84 (m, 4H), 2.35 (m, 2H), 2.14 (m, 2H), 1.80 (m, 6H),
1.62 (m, 1H), 1.34 (m, 3H)
Example 120
Preparation of
1-cyclohexyl-2-[2-(4-imidazol-1-yl-phenyl)-quinolin-6-yl]-1H-benzoimidazo-
le-5-carboxylic acid (Compound 473)
[0677] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(4-imidazol-1-yl-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (75 mg, 59% yield). MS: 514.23 (M+H.sup.+); HPLC
Procedure A, retention time=8.40 min.
Example 121
Preparation of
2-(2-benzo[1,3]dioxol-5-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole--
5-carboxylic acid (Compound 412)
[0678] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-benzo[1,3]dioxol-5-yl-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (30 mg, 24% yield).
[0679] MS: 492.21 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.68 (m,
1H), 8.42 (s, 1H), 8.28 (m, 4H), 8.05 (m, 2H), 7.92 (m, 2H), 7.13
(m, 1H), 6.15 (s, 2H), 2.33 (m, 2H), 2.10 (m, 2H), 1.85 (m, 2H),
1.62 (m, 1H), 1.35 (m, 3H)
Example 122
Preparation of
1-cyclohexyl-2-[2-(4-phenoxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid (Compound 428)
[0680] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(4-phenoxy-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in Ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (42 mg, 31% yield).
[0681] MS: 540.25 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.68 (d,
1H), 8.46 (d, 1H), 8.30 (m, 6H), 8.04 (dd, 2H), 7.44 (m, 2H), 7.16
(m, 5H), 4.45 (m, 1H), 2.32 (m, 2H), 2.10 (m, 2H), 1.85 (m, 2H),
1.65 (m, 1H), 1.35 (m, 3H)
Example 123
Preparation of
1-cyclohexyl-2-[2-(6-methyl-naphthalen-2-yl)-quinolin-6-yl]-1H-benzoimida-
zole-5-carboxylic acid (Compound 444)
[0682] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(6-methyl-naphthalen-2-yl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (23 mg, 18% yield).
[0683] MS: 512.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.85 (s,
1H), 8.73 (d, 1H), 8.46 (d, 3H), 8.34 (m, 2H), 8.20 (d, 1H), 8.10
(dd, 1H), 8.02 (m, 3H), 7.57 (s, 1H), 7.44 (1H), 2.32 (m, 2H), 2.08
(m, 2H), 1.85 (m, 2H), 1.64 (m, 1H), 1.36 (m, 3H)
Example 124
Preparation of
1-cyclohexyl-2-[2-(2-hydroxy-naphthalen-1-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid (Compound 460)
[0684] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2-hydroxy-naphthalen-1-yl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (7 mg, 6% yield). MS: 514.23 (M+H.sup.+); HPLC
Procedure A, retention time=12.20 min.
Example 125
Preparation of
1-cyclohexyl-2-(2-naphthalen-1-yl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid (Compound 357)
[0685] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
I-naphthalen-1-yl-ethanone (0.256 mmol) in ethanol (2 mL) using 10%
w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (4 mg, 4% yield).
[0686] MS: 498.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.82 (d,
1H), 8.59 (d, 1H), 8.36 (m, 2H), 8.24 (d, 1H), 8.10 (m, 6H), 7.81
(d, 1H), 7.70 (m, 1H), 7.57 (m, 2H), 4.49 (m, 1H), 3.55 (s, 1H),
2.31 (m, 2H), 2.10 (m, 2H), 1.82 (m, 2H), 1.62 (m, 1H), 1.36 (m,
3H)
Example 126
Preparation of
1-cyclohexyl-2-[2-(4-piperazin-1-yl-phenyl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 488)
[0687] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(4-piperazin-1-yl-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (120 mg, 91% yield). MS: 532.21 (M+H.sup.+); HPLC
Procedure A, retention time=7.78 min.
Example 127
Preparation of
2-[2-(4-acetylamino-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-
-5-carboxylic acid (Compound 501)
[0688] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
N-(4-acetyl-phenyl)-acetamide (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (19 mg, 15% yield). MS: 505.26 (M+H.sup.+); HPLC Procedure
A, retention time=9.94 min.
Example 128
Preparation of
2-[2-(4-amino-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-5-car-
boxylic acid (Compound 358)
[0689] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(4-amino-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (14 mg, 10% yield). MS: 463.23 (M+H.sup.+); HPLC Procedure
A, retention time=8.62 min.
Example 129
Preparation of
2-[2-(3-carbamoyl-4-hydroxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoi-
midazole-5-carboxylic acid (Compound 374)
[0690] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
5-acetyl-2-hydroxy-benzamide (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in Ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (13 mg, 10% yield). MS: 507.24 (M+H.sup.+); HPLC Procedure
A, retention time=10.36 min.
Example 130
Preparation of
1-Cyclohexyl-2-[2-(3-hydroxy-propyl)-quinolin-6-yl]-1H-benzoimidazole-5-c-
arboxylic acid (Compound 392)
[0691] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
5-hydroxy-pentan-2-one (0.256 mmol) in ethanol (2 mL) using 10% w/v
KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title compound
(96 mg, 90% yield). MS: 430.23 (M+H.sup.+); HPLC Procedure A,
retention time=6.84 min, 82.48% purity.
Example 131
Preparation of
2-(2-benzofuran-2-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid (Compound 413)
[0692] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-benzofuran-2-yl-ethanone (0.256 mmol) in ethanol (2 mL) using 10%
w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (75 mg, 62% yield). MS: 488.22 (M+H.sup.+); HPLC Procedure
A, retention time=14.35 min.
Example 132
Preparation of
1-cyclohexyl-2-[2-(4-morpholin-4-yl-phenyl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 429)
[0693] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(4-morpholin-4-yl-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (37 mg, 30% yield). MS: 533.28 (M+H.sup.+); HPLC
Procedure A, retention time=10.39 min.
Example 133
Preparation of
2-[6-(2-Nitro-phenyl)-quinolin-6-yl]-1H-benzoimidazole-5-carboxylic
acid (Compound 446)
[0694] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2-nitro-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (11 mg, 10% yield). MS: 493.21 (M+H.sup.+); HPLC Procedure
A, retention time=12.72 min.
Example 134
Preparation of
2-[2-(4-benzyloxy-2-hydroxy-3-methyl-phenyl)-quinolin-6-yl]-1-cyclohexyl--
1H-benzoimidazole-5-carboxylic acid (Compound 462)
[0695] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(4-benzyloxy-2-hydroxy-3-methyl-phenyl)-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (73 mg, 10% yield). MS: 584.29
(M+H.sup.+); HPLC Procedure A, retention time=18.27 min.
Example 135
Preparation of
1-cyclohexyl-2-[2-(2-pyrazol-1-yl-ethyl)-quinolin-6-yl]-1H-benzoimidazole-
-5-carboxylic acid (Compound 476)
[0696] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
4-pyrazol-1-yl-butan-2-one (0.256 mmol) in ethanol (2 mL) using 10%
w/v KOH in Ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (14 mg, 50% yield). MS: 466.27 (M+H.sup.+); HPLC Procedure
A, retention time=8.41 min.
Example 136
Preparation of
1-cyclohexyl-2-(2-dipropylaminomethyl-quinolin-6-yl)-1H-benzoimidazole-5--
carboxylic acid (Compound 489)
[0697] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-dipropylamino-propan-2-one (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (70 mg, 58% yield). MS: 485.34 (M+H.sup.+); HPLC Procedure
A, retention time=9.20 min.
[0698] H.sup.1-NMR (DMSO-d.sub.6): 8.70 (d, 1H), 8.44 (d, 1H), 8.25
(m, 2H), 8.10 (m, 2H), 7.92 (dd, 1H), 7.95 (d, 1H), 4.8 (m, 2H),
3.4 (m, 4H), 3.25 (m, 2H), 2.30 (m, 1H), 2.00 (m, 1H), 1.85 (m,
5H), 1.6 (m, 1H), 1.35 (m, 3H), 0.89 (m, 6H)
Example 137
Preparation of
2-[2-(3-carboxymethyl-2,2-dimethyl-cyclobutyl)-quinolin-6-yl]-1-cyclohexy-
l-1H-benzoimidazole-5-carboxylic acid (Compound 502)
[0699] Following the procedure and workup for Compound 354,
Compound 354e 100 mg, 0.256 mmol) was reacted with
(3-acetyl-2,2-dimethyl-cyclobutyl)-acetic acid (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (21 mg, 16% yield). MS: 512.31
(M+H.sup.+); HPLC Procedure A, retention time=9.07 min.
Example 138
Preparation of
2-[2-(7-bromo-5-methoxy-benzofuran-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-b-
enzoimidazole-5-carboxylic acid (Compound 394)
[0700] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(7-bromo-5-methoxy-benzofuran-2-yl)-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound, 17% yield).
[0701] MS: 596.12 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.75 (d,
1H), 8.51 (d, 1H), 8.34 (m, 2H), 8.3 (m, 2H), 8.13 (dd, 1H), 8.05
(dd, 1H), 7.96 (s, 1H), 7.31 (m, 2H), 4.40 (m, 1H), 3.83 (s, 1H),
2.30 (m, 2H), 2.15 (m, 2H), 1.85 (m, 2H), 1.62 (m, 1H), 1.35 (m,
3H)
Example 139
Preparation of
2-{2-[1-(2-chloro-pyridin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydro-pyrimidin-5--
yl]-quinolin-6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid
(Compound 431)
[0702] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
5-acetyl-1-(2-chloro-pyridin-3-yl)-1H-pyrimidine-2,4-dione (0.256
mmol) in ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L,
0.64 mmol) to produce the title compound 45 mg, 31% yield). MS:
593.17 (M+H.sup.+); HPLC Procedure A, retention time=10.02 min.
Example 140
Preparation of
2-[2-(5-benzyloxy-2-methyl-benzofuran-3-yl)-quinolin-6-yl]-1-cyclohexyl-1-
H-benzoimidazole-5-carboxylic acid (Compound 448)
[0703] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(5-benzyloxy-2-methyl-benzofuran-3-yl)-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (75 mg, 49% yield). MS: 608.25
(M+H.sup.+); HPLC Procedure A, retention time=17.24 min.
Example 141
Preparation of
2-[2-(6-chloro-9-methyl-9H-carbazol-3-yl)-quinolin-6-yl]-1-cyclohexyl-1H--
benzoimidazole-5-carboxylic acid (Compound 463)
[0704] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(6-chloro-9-methyl-9H-carbazol-3-yl)-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (18 mg, 12% yield). MS: 585.21
(M+H.sup.+); HPLC Procedure A, retention time=16.25 min.
Example 142
Preparation of
1-cyclohexyl-2-[2-(2,3-dihydro-benzofuran-5-yl)-quinolin-6-yl]-1H-benzoim-
idazole-5-carboxylic acid (Compound 478)
[0705] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2,3-dihydro-benzofuran-5-yl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in Ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (34 mg, 28% yield). MS: 490.19 (M+H.sup.+); HPLC
Procedure A, retention time=11.50 min.
Example 143
Preparation of
1-cyclohexyl-2-[2-(1-phenyl-1H-pyrazol-4-yl)-quinolin-6-yl]-1H-benzoimida-
zole-5-carboxylic acid (Compound 449)
[0706] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(1-phenyl-1H-pyrazol-4-yl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (69 mg, 51% yield). MS: 514.23 (M+H.sup.+); HPLC
Procedure B, retention time=6.36 min.
Example 144
Preparation of
1-cyclohexyl-2-[2-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-yl)-quinolin-6-yl]--
1H-benzoimidazole-5-carboxylic acid (Compound 464)
[0707] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-yl)-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (47 mg, 37% yield).
[0708] MS: 542.27 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.73 (d,
1H), 8.49 (d, 1H), 8.32 (m, 2H), 8.23 (d, 1H), 8.12 (dd, 1H), 8.02
(dd, 1H), 7.93 (d, 1H), 7.57 (m, 4H), 7.47 (m, 1H), 4.45 (m, 1H),
2.58 (s, 3H), 2.34 (m, 2H), 2.32 (s, 3H), 2.10 (m, 2H), 1.85 (m,
2H), 1.62 (m, 1H), 1.36 (m, 3H)
Example 145
Preparation of
1-cyclohexyl-2-{2-[3-(3,4-dichloro-phenyl)-isoxazol-5-yl]-quinolin-6-yl}--
1H-benzoimidazole-5-carboxylic acid (Compound 479)
[0709] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-[3-(3,4-dichloro-phenyl)-isoxazol-5-yl]-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (21 mg, 15% yield). MS: 583.16
(M+H.sup.+); HPLC Procedure B, retention time=8.77 min.
Example 146
Preparation of
2-{2-[2-chloro-4-(4-chloro-phenoxy)-phenyl]-quinolin-6-yl}-1-cyclohexyl-1-
H-benzoimidazole-5-carboxylic acid (Compound 492)
[0710] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-[2-chloro-4-(4-chloro-phenoxy)-phenyl]-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (75 mg, 49% yield). MS: 608.17
(M+H.sup.+); HPLC Procedure B, retention time=8.44 min.
Example 147
Preparation of
2-{2-[5-(4-chloro-phenyl)-2-methyl-furan-3-yl]-quinolin-6-yl}-1-cyclohexy-
l-1H-benzoimidazole-5-carboxylic acid (Compound 505)
[0711] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-[5-(4-chloro-phenyl)-2-methyl-furan-3-yl]-ethanone (0.256 mmol)
in ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64
mmol) to produce the title compound (83 mg, 59% yield). MS: 562.21
(M+H.sup.+); HPLC Procedure B, retention time=8.99 min.
Example 148
Preparation of
2-{2-[3-(4-chloro-phenyl)-5-methyl-isoxazol-4-yl]-quinolin-6-yl}-1-cycloh-
exyl-1H-benzoimidazole-5-carboxylic acid (Compound 396)
[0712] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-[3-(4-chloro-phenyl)-5-methyl-isoxazol-4-yl]-ethanone (0.256
mmol) in ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L,
0.64 mmol) to produce the title compound (16 mg, 12% yield).
[0713] MS: 563.20 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.59 (d,
1H), 8.46 (d, 1H), 8.35 (d, 1H), 8.24 (m, 2H), 8.06 (m, 2H), 7.53
(s, 4H), 7.46 (d, 1H), 4.48 (m, 1H), 3.55 (s, 1H), 2.72 (s, 3H),
2.30 (m, 2H), 2.10 (m, 2H), 1.83 (m, 2H), 1.62 (m, 1H), 1.34 (m,
3H)
Example 149
Preparation of
2-{2-[2-(4-chloro-phenyl)-4-methyl-thiazol-5-yl]-quinolin-6-yl}-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid (Compound 416)
[0714] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-[2-(4-chloro-phenyl)-4-methyl-thiazol-5-yl]-ethanone (0.256 mmol)
in ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64
mmol) to produce the title compound (27 mg, 19% yield). MS: 580.19
(M+H.sup.+); HPLC Procedure B, retention time=9.18 min.
Example 150
Preparation of
1-cyclohexyl-2-[2-(1H-pyrrol-3-yl)-quinolin-6-yl]-1H-benzoimidazole-5-car-
boxylic acid (Compound 432)
[0715] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(1H-pyrrol-3-yl)-ethanone (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (10 mg, 8% yield).
[0716] MS: 437.20 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 12.22
(s, 1H), 8.95 (d, 1H), 8.89 (d, 1H), 8.55 (m 2H), 8.42 (d, 1H),
8.31 (m, 2H), 8.15 (d, 1H), 7.90 (d, 1H), 7.49 (s, 1H), 7.15 (s,
1H), 4.39 (m, 1H), 3.55 (s, 1H), 2.32 (m, 2H), 2.05 (m, 2H), 1.85
(m, 2H), 1.66 (m, 1H), 1.35 (m, 3H)
Example 151
Preparation of
1-Cyclohexyl-2-[2-(1H-pyrrol-2-yl)-quinolin-6-yl]-1H-benzoimidazole-5-car-
boxylic acid (Compound 450)
[0717] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(1H-pyrrol-2-yl)-ethanone (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (11 mg, 9% yield).
[0718] MS: 437.16 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 12.12
(s, 1H), 8.80 (d, 1H), 8.49 (m, 2H), 8.31 (m, 2H), 8.18 (m, 2H),
7.95 (d, 1H), 7.63 (m, 1H), 7.43 (s, 1H), 6.45 (m, 1H), 4.40 (m,
1H), 3.51 (s, 1H), 2.30 (m, 2H), 2.08 (m, 2H), 1.85 (m, 2H), 1.65
(m, 1H), 1.35 (m, 3H)
Example 152
Preparation of
1-cyclohexyl-2-[2-(3-oxo-3,4-dihydro-2H-benzo[1,4]oxazin-6-yl)-quinolin-6-
-yl]-1H-benzoimidazole-5-carboxylic acid (Compound 465)
[0719] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
6-acetyl-4H-benzo[1,4]oxazin-3-one (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (11 mg, 8% yield).
[0720] MS: 519.21 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 10.95
(s, 1H), 8.67 (d, 1H), 8.49 (s, 1H), 8.25 (m, 4H), 8.05 (m, 2H),
7.95 (d, 1H), 7.85 (m, 1H), 7.12 (d, 1H), 4.68 (s, 2H), 4.45 (m,
1H), 2.31 (m, 2H), 2.11 (m, 2H), 1.83 (m, 2H), 1.60 (m, 1H), 1.31
(m, 3H)
Example 153
Preparation of
2-[2-(3-amino-5-phenyl-thiophen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 480)
[0721] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(3-amino-5-phenyl-thiophen-2-yl)-ethanone (0.256 mmol) in ethanol
(2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to
produce the title compound (19 mg, 14% yield). MS: 545.24
(M+H.sup.+); HPLC Procedure B, retention time=8.25 min.
Example 154
Preparation of
1-cyclohexyl-2-[2-(5-methoxy-benzofuran-3-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid (Compound 493)
[0722] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(5-methoxy-benzofuran-3-yl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (10 mg, 8% yield). MS: 518.24 (M+H.sup.+); HPLC
Procedure B, retention time=7.60 min.
Example 155
Preparation
1-(trans-2-Hydroxy-cyclohexyl)-2-(2-phenyl-quinoxalin-6-yl)-1H-benzoimida-
zole-5-carboxylic acid (Compound 578)
Step 1: 3-Nitro-4-(trans-2-hydroxy-cyclohexylamino)-benzoic acid
ethyl ester (Compound 578a)
[0723] Compound 9 (689 mg, 3 mmol) was suspended in acetonitrile (5
mL) and then triethylamine was added (1.3 mL, 9 mmol).
trans-2-aminocyclohexanol hydrochloride (682 mg, 4.5 mmol) was then
added and the reaction refluxed for 12 hours, 2 mL methanol was
then added and the reaction further refluxed for another 24 hours.
Water (100 mL) was added and the resulting precipitate filtered,
washed 3 times with water and air-dried. The product was used
without further characterization in the next step. MS: 309.3
(M+H.sup.+)
Step 2: 3-Amino-4-(trans-2-hydroxy-cyclohexylamino)-benzoic acid
ethyl ester (Compound 578b)
[0724] The product from the previous step (3 mmol) was dissolved in
ethyl acetate (60 mL) and methanol (40 mL) and 10% Pd/C (100 mg)
was added. The reaction was hydrogenated on a Parr-shaker at 35 psi
for 61/2 hours at ambient temperature. The Pd/C was filtered and
the filtrate concentrated. Chromatography (SiO.sub.2, ethyl
acetate/toluene 6:4 v/v) to yield the title intermediate (230 mg,
0.83 mmol) MS: 279.2 (M+H.sup.+)
Step 3:
1-(trans-2-Hydroxy-cyclohexyl)-2-(2-phenyl-quinoxalin-6-yl)-1H-ben-
zoimidazole-5-carboxylic acid (Compound 578)
[0725] Compound 36A Y=Phenyl, (200 mg, 0.8 mmol) was activated in 8
mL DMF with TBTU (282 mg, 0.88 mmol) and DIEA (0.285 mL, 1.6 mmol)
for 30 minutes at room temperature. This solution was then added to
Compound 578b (230 mg, 0.83 mmol) and stirred at ambient
temperature for 20 hours. The reaction was concentrated to a
residue in-vacuo and then dissolved in acetic acid (20 mL) and
refluxed overnight. In the morning, the acetic acid was removed
in-vacuo and the crude residue dissolved in a mixture of THF (20
mL), methanol (16 mL) and 2 M NaOH (4 mL) and the solution heated
at 60 C overnight. The solution was then concentrated in-vacuo to
an aqueous solution and concentrated HCl added until the pH was 5.
The resulting precipitate was filtered, washed with water and
purified using RP-HPLC column to give the pure title compound.
[0726] Conversion to HCl salt: The HPLC purified product was
dissolved in 4 mL methanol, 500 .mu.L 4M HCl in dioxane was added
followed by 40 mL ether. The resulting precipitate was separated by
filtration and dried in high vacuum overnight. Yield: 18.3 mg.
[0727] MS: 465.21 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 9.71 (s, 1H), 8.68 (s, 1H), 8.41-8.32 (m, 5H), 8.2 (d,
1H, J=8.7 Hz), 7.98 (d, 1H, 8.7 Hz), 7.62 (m, 3H), 4.33 (m, 2H),
2.36 (m, 1H), 2.06 (m, 2H), 1.77-1.55 (m, 2H), 1.29-1.22 (m,
2H).
Example 156
Preparation of
2-[2-(4-amino-3,5-dichloro-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoim-
idazole-5-carboxylic acid (Compound 363)
[0728] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(4-amino-3,5-dichloro-phenyl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (31 mg, 25% yield).
[0729] MS: 531.15 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.68 (d,
1H), 8.49 (d, 1H), 8.34 (m, 6H), 8.09 (m, 2H), 4.48 (m, 1H), 3.55
(s, 1H), 2.30 (m, 2H), 2.12 (m, 2H), 1.82 (m, 2H), 1.60 (m, 1H),
1.30 (m, 3H)
Example 157
Preparation of
2-[2-(3-bromo-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-5-car-
boxylic acid (Compound 482)
[0730] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(3-bromo-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL) using
10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the title
compound (15 mg, 12% yield).
[0731] MS: 526.12 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.72 (d,
1H), 8.53 (m, 1H), 8.48 (d, 1H), 8.35 (m, 4H), 8.23 (d, 1H), 8.10
(dd, 1H), 8.01 (dd, 1H), 7.74 (m, 1H), 7.55 (m, 1H), 4.45 (m, 1H),
3.51 (s, 1H), 2.30 (m, 2H), 2.10 (m, 2H), 1.83 (m, 2H), 1.64 (m,
1H), 1.33 (m, 3H)
Example 158
Preparation of
1-cyclohexyl-2-[2-(3,5-dimethoxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-
-5-carboxylic acid (Compound 495)
[0732] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(3,5-dimethoxy-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (44 mg, 35% yield).
[0733] MS: 508.23 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.74 (d,
1H), 8.55 (d, 1H), 8.37 (m, 4H), 8.10 (m, 2H), 7.47 (d, 2H), 6.70
(m, 1H), 4.43 (m, 1H), 3.85 (s, 6H), 3.51 (s, 1H), 2.30 (m, 2H),
2.13 (m, 2H), 1.82 (m, 2H), 1.60 (m, 1H), 1.32 (m, 3H)
Example 159
Preparation of
1-cyclohexyl-2-[2-(3,4-dichloro-phenyl)-quinolin-6-yl]-1H-benzoimidazole--
5-carboxylic acid (Compound 508)
[0734] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(3,4-dichloro-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (12 mg, 10% yield).
[0735] MS: 516.14 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.74 (d,
1H), 8.58 (d, 1H), 8.49 (d, 1H), 8.40 (d, 1H), 8.34 (m, 3H), 8.25
(d, 1H), 8.11 (dd, 1H), 8.03 (dd, 1H), 7.85 (d, 1H), 4.45 (m, 1H),
3.51 (s, 1H), 2.32 (m, 2H), 2.10 (m, 2H), 1.84 (m, 2H), 1.62 (m,
1H), 1.33 (m, 3H)
Example 160
Preparation of
1-cyclohexyl-2-[2-(2,4-dihydroxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-
-5-carboxylic acid (Compound 364)
[0736] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2,4-dihydroxy-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (9.5 mg, 8% yield).
[0737] MS: 480.21 (M+H.sup.+); H1-NMR (DMSO-d6): 8.72 (d, 1H), 8.46
(d, 1H), 8.35 (m, 2H), 8.26 (dd, 2H), 8.15 (dd, 1H), 8.03 (d, 2H),
6.47 (dd, 1H), 6.42 (d, 1H), 4.44 (m, 1H), 3.51 (s, 1H), 2.30 (m,
2H), 2.10 (m, 2H), 1.84 (m, 2H), 1.64 (m, 1H), 1.35 (m, 3H)
Example 161
Preparation of
1-cyclohexyl-2-[2-(3,5-dihydroxy-phenyl)-quinolin-6-yl]-1H-benzoimidazole-
-5-carboxylic acid (Compound 381)
[0738] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(3,5-dihydroxy-phenyl)-ethanone (0.256 mmol) in ethanol (2 mL)
using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce the
title compound (22 mg, 18% yield).
[0739] MS: 480.21 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.66 (d,
1H), 8.46 (d, 1H), 8.32 (m, 1H), 8.25 (m, 2H), 8.11 (m, 2H), 8.01
(m, 1H), 7.15 (d, 2H), 6.41 (m, 1H), 4.46 (m, 1H), 3.51 (s, 1H),
2.32 (m, 2H), 2.15 (m, 2H), 1.84 (m, 2H), 1.62 (m, 1H), 1.32 (m,
3H)
Example 162
Preparation of
1-cyclohexyl-2-[2-(2-hydroxy-5-methyl-3-nitro-phenyl)-quinolin-6-yl]-1H-b-
enzoimidazole-5-carboxylic acid (Compound 418)
[0740] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2-hydroxy-5-methyl-3-nitro-phenyl)-ethanone (0.256 mmol) in
ethanol (2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (40 mg, 31% yield).
[0741] MS: 523.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.870
(d, 1H, J=9.3), 8.61 (d, 1H, J=9.3), 8.49 (s, 2H), 8.41 (d, 1H,
J=8.7), 8.30 (s, 1H), 8.15 (d, 2H, J=7.8), 7.97 (d, 1H, J=9.3),
7.89 (s, 1H), 4.20 (m, 1H), 3.55 (s, 1H), 2.42 (s, 3H), 2.32 (m,
2H), 2.08 (m, 2H), 1.84 (m, 2H), 1.62 (m, 1H), 1.37 (m, 3H)
Example 163
Preparation of
1-cyclohexyl-2-[2-(2-hydroxy-6-methoxy-phenyl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid (Compound 434)
[0742] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
1-(2-hydroxy-6-methoxy-phenyl)-ethanone (0.256 mmol) in ethanol (2
mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to produce
the title compound (75 mg, 69% yield).
[0743] MS: 494.24 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 9.03 (d,
1H, J=9.3), 8.63 (s, 1H), 8.42 (d, 1H, J=8.1), 8.26 (m, 3H), 8.15
(d, 1H, J=8.4), 7.97 (d, 1H, J=9), 7.40 (m, 1H), 6.74 (m, 2H), 4.42
(m, 1H), 3.81 (s, 3H), 3.55 (s, 1H), 2.32 (m, 2H), 2.07 (m, 2H),
1.86 (m, 2H), 1.61 (m, 1H), 1.36 (m, 3H)
Example 164
Preparation of
1-cyclohexyl-2-[2-(2-hydroxy-4,6-dimethoxy-phenyl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid (Compound 452)
[0744] Following the procedure and workup for Compound 354,
Compound 354e (100 mg, 0.256 mmol) was reacted with
-(2-hydroxy-4,6-dimethoxy-phenyl)-ethanone (0.256 mmol) in ethanol
(2 mL) using 10% w/v KOH in ethanol (506 .mu.L, 0.64 mmol) to
produce the title compound (85 mg, 65% yield).
[0745] MS: 524.25 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.98 (d,
1H, J=8.1), 8.59 (s, 1H), 8.40 (d, 1H, J=8.7), 8.33 (m, 2H), 8.24
(d, 1H, J=9), 8.15 (d, 1H, J=8.7), 7.97 (d, 1H, J=8.7), 6.31 (m,
2H), 4.40 (m, 1H), 3.86 (s, 3H), 3.84 (s, 3H), 3.55 (s, 1H), 2.32
(m, 2H), 2.08 (m, 2H), 1.83 (m, 2H), 1.62 (m, 1H), 1.37 (m, 3H)
Example 165
Preparation of
2-[2-(4'-chloro-biphenyl-3-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 483)
[0746] In dried vial with a Teflon lined screw cap, a solution of
Compound 482 (156 mg, 0.31 mmol), 4-chlorophenylboronic acid (73
mg, 0.465 mmol), and Palladium Tetrakis (37 mg, 0.031 mmol) in
toluene (9 mL), methanol (2 mL), and saturated sodium bicarbonate
in water (900 .mu.L) was degassed, flushed with argon, and sealed.
The reaction was stirred for 16 h at 90.degree. C. The completed
reaction was then evaporated to dryness, purified via HPLC, and
converted to the HCl salt using the standard procedure (as
described in Compound 516) to produce the title compound (73 mg,
42% yield).
[0747] MS: 559.23 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.76 (d,
1H, J=9), 8.53 (m, 3H), 8.34 (m, 4H), 8.13 (dd, 1H, J=8.7, 1.8),
8.05 (dd, 1H, J=8.7, 1.5), 7.86 (m, 3H), 7.70 (t, 1H, J=7.8), 7.57
(m, 2H), 4.47 (m, 1H), 3.55 (s, 1H), 2.33 (m, 2H), 2.13 (m, 2H),
1.85 (m, 2H), 1.61 (m, 1H), 1.36 (m, 3H)
Example 166
Preparation of
2-[2-(4'-cyano-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 365)
Step 1:
2-[2-(2-Bromo-5-methoxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid (Compound 365a)
[0748] Following the procedure and workup for Compound 354,
Compound 354e (2.28 g, 5.83 mmol) was reacted with
1-(2-bromo-5-methoxy-phenyl)-ethanone (1.335 g, 5.83 mmol) (the
ethanone was prepared by reacting 1-(2-bromo-5-methoxy)benzoic acid
with thionyl chloride to give 1-(2-bromo-5-methoxy)benzoyl chloride
which is further reacted with dimethyl zinc to give the ethanone)
in ethanol (45 mL) using 10% w/v KOH in ethanol (11.57 m, 17.5
mmol) to the title intermediate (2.80 g, 86% yield).
[0749] MS: 557.14 (M+H.sup.+); HPLC Procedure C, retention
time=2.82 min.
Step 2:
2-[2-(2-Bromo-5-methoxy-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid methyl ester (Compound 365b)
[0750] In a flame dried flask with stir bar, the product of the
previous reaction (1.35 g, 2.43 mmol) was dissolved in anhydrous
methanol (70 mL) and 4N HCl in dioxane (10 mL) was added. The
reaction was refluxed at 60.degree. C. overnight. The completed
reaction was then evaporated to an oil, coevaporated 3 times with
50 mL anhydrous methanol, and foamed from acetonitrile to produce
the title intermediate (1.38 g, 99% yield).
[0751] MS: 573.12 (M+H.sup.+); HPLC Procedure C, retention
time=3.25 min.
Step 3:
2-[2-(4'-Cyano-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl--
1H-benzoimidazole-5-carboxylic acid (Compound 365)
[0752] In a flame dried vial with a Teflon lined screw cap, a
solution of the product of the previous reaction (100 mg, 0.175
mmol), 4-cyanophenylboronic acid (31 mg, 0.2625 mmol), and
Palladium Tetrakis (20 mg, 0.0175 mmol) in toluene (6.5 mL),
methanol (1.6 mL), and saturated sodium bicarbonate in water (800
ul) was degassed, flushed with argon, and sealed. The reaction was
stirred for 16 hours at 90.degree. C. The vial was then cooled to
room temperature and 10% w/v KOH in methanol (2 mL, 3.5 mmol) was
added. The reaction was resealed and stirred at 70.degree. C. for 1
hour. The completed reaction was then evaporated to dryness,
purified via HPLC, and converted to the HCl salt using the standard
procedure (as described for Compound 516) to produce the title
compound.
[0753] MS: 579.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.44-8.41 (m, 2H), 8.33 (s, 1H), 8.24-8.18 (m, 2H),
8.09-8.00 (m, 2H), 7.7-7.68 (m, 2H), 7.50 (d, 1H, J=8.7 Hz),
7.35-7.21 (m, 5H), 4.42 (m, 1H), 3.89 (s, 3H), 2.33-1.28 (m
10H)
Example 167
Preparation of
2-[2-(4'-carbamoyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H--
benzoimidazole-5-carboxylic acid (Compound 382)
[0754] In a flame dried vial with a Teflon lined screw cap, a
solution of Compound 365b (100 mg, 0.175 mmol),
4-amidophenylboronic acid (31 mg, 0.2625 mmol), and Palladium
Tetrakis (20 mg, 0.0175 mmol) in toluene (6.5 mL), methanol (1.6
mL), and saturated sodium bicarbonate in water (800 ul) was
degassed, flushed with argon, and sealed. The reaction was stirred
for 16 hours at 90.degree. C. The vial was then cooled to room
temperature and 10% w/v KOH in methanol (2 mL, 3.5 mmol) was added.
The reaction was resealed and stirred at 70.degree. C. for 1 hour.
The completed reaction was then evaporated to dryness, purified via
HPLC, and converted to the HCl salt using the standard procedure
(as described for Compound 516) to produce the title compound.
[0755] MS: 597.30 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.39-8.19 (m, 5H), 8.09 (d, 1H, J=9.3 Hz), 7.99 (d,
1H, J=8.4 Hz), 7.91 (m, 1H), 7.74-7.71 (m, 2H), 7.50 (d, 1H, J=8.1
Hz), 7.33-7.31 (m, 2H), 7.23-7.17 (4H), 4.43 (m, 1H), 3.88 (s, 3H),
2.33-1.33 (m 10H)
Example 168
Preparation of
2-[2-(3'-chloro-4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohe-
xyl-1H-benzoimidazole-5-carboxylic acid (Compound 366)
[0756] In dried vial with a Teflon lined screw cap, a solution of
Compound 365b (100 mg, 0.175 mmol), 4-fluoro-3-chlorophenylboronic
acid (61 mg, 0.2625 mmol), and Palladium Tetrakis (20 mg, 0.0175
mmol) in toluene (6.5 mL), methanol (1.6 mL), and saturated sodium
bicarbonate in water (800 ul) was degassed, flushed with argon, and
sealed. The reaction was stirred for 16 hours at 90.degree. C. The
vial was then cooled to room temperature and 10% w/v KOH in
methanol (2 mL, 3.5 mmol) was added. The reaction was resealed and
stirred at 70.degree. C. for 1 hour. The completed reaction was
then evaporated to dryness, purified via HPLC, and converted to the
HCl salt using the standard procedure (as described for Compound
516) to produce the title compound (7 mg, 7% yield).
[0757] MS: 606.20 (M); H.sup.1-NMR (DMSO-d.sub.6): 8.40 (m, 2H),
8.31 (s, 1H), 8.19 (m, 2H), 8.05 (d, 1H, J=9), 7.96 (d, 1H, J=8.1),
7.49 (d, 1H, J=8.4), 7.37 (m, 1H), 7.30 (m, 2H), 7.20 (m, 2H), 6.98
(s, 1H), 4.40 (m, 1H), 3.75 (s, 3H), 3.55 (s, 1H), 2.30 (m, 2H),
2.05 (m, 2H), 1.85 (m, 2H), 1.63 (m, 1H), 1.30 (m, 3H)
Example 169
Preparation of
1-cyclohexyl-2-[2-(4-methoxy-4'-nitro-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid (Compound 383)
[0758] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-nitrophenylboronic acid (62 mg, 0.2625 mmol) to produce the title
compound (15 mg, 14% yield).
[0759] MS: 599.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.40 (m,
2H), 8.29 (s, 1H), 8.10 (m, 5H), 7.97 (m, 1H), 7.53 (d, 1H, J=8.4),
7.36 (m, 4H), 7.24 (m, 1H), 4.40 (s, 1H), 3.90 (s, 3H), 3.55 (s,
1H), 2.30 (m, 2H), 2.06 (m, 2H), 1.84 (m, 2H), 1.62 (s, 1H), 1.32
(m, 3H)
Example 170
Preparation of
1-cyclohexyl-2-[2-(4'-dimethylamino-4-methoxy-biphen-2-yl)-quinolin-6-yl]-
-1H-benzoimidazole-5-carboxylic acid (Compound 401)
[0760] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-dimethylaminophenylboronic acid (44 mg, 0.2625 mmol) to produce
the title compound (27 mg, 26% yield).
[0761] MS: 597.32 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.34 (m,
4H), 8.16 (d, 1H, J=9.6), 8.06 (d, 1H, J=9.3), 7.96 (m, 1H), 7.42
(d, 1H, J=9), 7.30 (s, 1H), 7.17 (m, 3H), 7.07 (m, 3H), 4.40 (m,
1H), 3.87 (s, 3H), 2.92 (s, 6H), 2.31 (m, 2H), 2.08 (m, 2H), 1.82
(m, 2H), 1.16 (m, 1H), 1.36 (m, 3H)
Example 171
Preparation of
1-cyclohexyl-2-[2-(4-methoxy-3'-nitro-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid (Compound 420)
[0762] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
3-nitrophenylboronic acid (44 mg, 0.2625 mmol) to produce the title
compound (7 mg, 7% yield).
[0763] MS: 599.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.36 (m,
3H), 8.13 (d, 2H, J=9), 8.02 (m, 4H), 7.58 (d, 1H, J=9), 7.50 (m,
2H), 7.37 (m, 2H), 7.24 (m, 1H), 4.37 (m, 1H), 3.90 (s, 3H), 3.55
(s, 1H), 2.28 (m, 2H), 2.06 (m, 2H), 1.85 (m, 2H), 1.61 (m, 1H),
1.34 (m, 3H)
Example 172
Preparation of
1-cyclohexyl-2-[2-(4-methoxy-4'-trifluoromethyl-biphen-2-yl)-quinolin-6-y-
l]-1H-benzoimidazole-5-carboxylic acid (Compound 436)
[0764] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-trifluoromethylphenylboronic acid (50 mg, 0.2625 mmol) to produce
the title compound (14 mg, 12% yield).
[0765] MS: 622.27 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.40 (m,
2H), 8.32 (s, 1H), 8.21 (d, 2H, J=8.4), 8.06 (dd, 1H, J=8.7, 1.5),
8.00 (d, 1H, J=8.7), 7.58 (d, 2H, J=8.7), 7.51 (d, 1H, J=8.4), 7.32
(m, 4H), 7.22 (m, 2H), 4.45 (m, 1H), 3.89 (s, 3H), 3.55 (s, 1H),
2.32 (m, 2H), 2.07 (m, 2H), 1.84 (m, 2H), 1.06 (m, 1H), 1.35 (m,
3H)
Example 173
Preparation of
1-cyclohexyl-2-[2-(2-furan-2-yl-5-methoxy-phenyl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid (Compound 454)
[0766] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with 2-furanboronic
acid (30 mg, 0.2625 mmol) to produce the title compound (5 mg, 5%
yield).
[0767] MS: 544.25 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.51 (d,
1H, J=8.4), 8.42 (s, 1H), 8.28 (m, 2H), 8.09 (m, 2H), 7.92 (m, 2H),
7.68 (d, 1H, J=7.8), 7.48 (s, 1H), 7.40 (d, 1H, J=8.4), 7.17 (m,
1H), 6.40 (s, 1H), 6.06 (m, 1H), 4.45 (m, 1H), 3.86 (s, 3H), 2.34
(m, 2H), 2.08 (m, 2H), 1.85 (m, 2H), 1.62 (m, 1H), 1.34 (m, 3H)
Example 174
Preparation of
1-cyclohexyl-2-[2-(4,4'-dimethoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid (Compound 468)
[0768] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-methoxyphenylboronic acid (40 mg, 0.2625 mmol) to produce the
title compound (15 mg, 15% yield).
[0769] MS: 584.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.37 (m,
4H), 8.20 (d, 1H, J=9.6), 8.10 (d, 1H, J=8.1), 8.00 (d, 1H, J=9),
7.42 (d, 1H, J=8.4), 7.30 (d, 1H, J=1.5), 7.17 (m, 2H), 7.03 (d,
2H, J=8.1), 6.81 (d, 2H, J=8.7), 4.43 (m, 1H), 3.88 (s, 3H), 3.68
(s, 3H), 3.55 (s, 1H), 2.32 (m, 2H), 2.08 (m, 2H), 1.84 (m, 2H),
1.61 (m, 1H), 1.34 (m, 3H)
Example 175
Preparation of
2-[2-(4'-carboxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-be-
nzoimidazole-5-carboxylic acid (Compound 421)
[0770] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with methyl
4-boronic acid benzoate (47 mg, 0.2625 mmol) to produce the title
compound (22 mg, 21% yield).
[0771] MS: 598.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.32 (m,
2H), 8.21 (d, 1H, J=8.7), 8.13 (d, 1H, J=8.7), 8.03 (m, 2H), 7.95
(m, 1H), 7.84 (d, 1H, J=8.7), 7.76 (d, 2H, J=8.4), 7.50 (d, 1H,
J=8.4), 7.33 (d, 1H, J=2.4), 7.21 (m, 3H), 4.41 (m, 1H), 3.89 (s,
3H), 3.55 (s, 1H), 2.29 (m, 2H), 2.05 (m, 2H), 1.83 (m, 2H), 1.61
(m, 1H), 1.32 (m, 3H)
Example 176
Preparation of
2-[2-(3'-carboxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-be-
nzoimidazole-5-carboxylic acid (Compound 437
[0772] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with ethyl 3-boronic
acid benzoate (51 mg, 0.2625 mmol) to produce the title compound
(26 mg, 23% yield).
[0773] MS: 598.27 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.31 (m,
2H), 8.20 (d, 1H, J=8.7), 8.11 (d, 1H, J=9), 8.03 (m, 1H), 7.93 (m,
1H), 7.74 (m, 2H), 7.49 (d, 1H, J=8.7), 7.31 (m, 3H), 7.19 (m, 3H),
4.40 (m, 1H), 3.89 (s, 3H), 3.55 (s, 1H), 2.29 (m, 2H), 2.04 (m,
2H), 1.84 (m, 2H), 1.61 (m, 1H), 1.31 (m, 3H)
Example 177
Preparation of
1-Cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid (Compound 455) and
Ethyl
1-Cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid (Compound 554)
[0774] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-fluorophenylboronic acid (37 mg, 0.2625 mmol) to produce both the
title compound (9 mg, 8% yield), as well as the ester of the same,
Compound 554.
[0775] Compound 516: MS: 572.27 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): 8.36 (m, 2H), 8.30 (d, 1H, J=1.8), 8.24 (d, 1H,
J=8.7), 8.17 (d, 1H, J=9), 8.07 (dd, 1H, J=8.7, 1.8), 7.98 (dd, 1H,
J=8.7, 1.5), 7.45 (d, 1H, J=8.7), 7.31 (d, 1H, J=2.7), 7.13 (m,
6H), 4.41 (m, 1H), 3.87 (s, 3H), 3.55 (s, 1H), 2.33 (m, 2H), 2.06
(m, 2H), 1.84 (m, 2H), 1.62 (m, 1H), 1.32 (m, 3H)
[0776] Compound 554: MS: 586.30 (M+H.sup.+); H.sup.1-NMR
(DMSO-d.sub.6): 8.35 (m, 3H), 8.25 (d, 1H, J=8.7), 8.16 (d, 1H,
J=8.7), 8.06 (dd, 1H, J=8.7, 1.8), 7.97 (dd, 1H, J=8.4, 1.5), 7.45
(d, 1H, J=8.7), 7.31 (d, 1H, J=3), 7.14 (m, 6H), 4.41 (m, 1H), 3.90
(s, 3H), 3.87 (s, 3H), 3.55 (s, 1H), 2.29 (m, 2H), 2.05 (m, 2H),
1.84 (m, 2H), 1.61 (m, 1H), 1.34 (m, 3H)
Example 178
Preparation of
1-cyclohexyl-2-[2-(4'-hydroxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-be-
nzoimidazole-5-carboxylic acid (Compound 469)
[0777] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with 4-phenolboronic
acid (36 mg, 0.2625 mmol) to produce the title compound (10 mg, 8%
yield).
[0778] MS: 570.27 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.36 (m,
3H), 8.21 (d, 1H, J=9), 8.10 (dd, 1H, J=8.4, 1.2), 8.00 (dd, 1H,
J=8.7, 1.5), 7.56 (m, 1H), 7.40 (d, 1H, J=8.7), 7.31 (d, 1H,
J=2.7), 7.15 (m, 2H), 6.90 (d, 2H, J=8.7), 6.62 (d, 2H, J=8.4),
4.45 (m, 1H), 3.86 (s, 3H), 3.54 (s, 1H), 2.31 (m, 2H), 2.08 (m,
2H), 1.84 (m, 2H), 1.60 (m, 1H), 1.35 (m, 3H)
Example 179
Preparation of
1-cyclohexyl-2-[2-(3',4'-dichloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid (Compound 403)
[0779] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
3,4-dichlorophenylboronic acid (50 mg, 0.2625 mmol) to produce the
title compound (5 mg, 4% yield).
[0780] MS: 622.20 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.40 (d,
1H, J=9), 8.34 (m, 1H), 8.27 (m, 1H), 8.17 (d, 1H, J=8.4), 8.06 (m,
2H), 7.93 (m, 1H), 7.50 (d, 1H, J=8.4), 7.42 (m, 2H), 7.31 (m, 2H),
7.19 (dd, 1H, J=9, 2.7), 6.96 (dd, 1H, J=8.1, 1.2), 4.45 (m, 1H),
3.88 (s, 3H), 2.29 (m, 2H), 2.05 (m, 2H), 1.84 (m, 2H), 1.61 (m,
1H), 1.31 (m, 3H)
Example 180
Preparation of
2-[2-(3'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-ben-
zoimidazole-5-carboxylic acid (Compound 422)
[0781] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
3-chlorophenylboronic acid (41 mg, 0.2625 mmol) to produce the
title compound (20 mg, 17% yield).
[0782] MS: 588.23 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.39 (m,
2H), 8.30 (d, 1H, J=1.8), 8.20 (m, 2H), 8.06 (dd, 1H, J=8.7, 1.8),
7.98 (dd, 1H, J=8.4, 1.5), 7.49 (d, 1H, J=7.5), 7.31 (d, 1H,
J=2.7), 7.24 (m, 6H), 6.99 (m, 1H), 4.41 (m, 1H), 3.88 (s, 3H),
3.55 (s, 1H), 2.31 (m, 2H), 2.06 (m, 2H), 1.84 (m, 2H), 1.60 (m,
1H), 1.31 (m, 3H)
Example 181
Preparation of
1-cyclohexyl-2-[2-(4-methoxy-4'-methyl-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid (Compound 438)
[0783] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with p-tolylboronic
acid (36 mg, 0.2625 mmol) to produce the title compound (12 mg, 12%
yield).
[0784] MS: 568.30 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.32 (m,
4H), 7.16 (d, 1H, J=9), 8.07 (dd, 1H, J=8.7, 2.1), 7.97 (dd, 1H,
J=8.7, 1.8), 7.42 (d, 1H, J=8.7), 7.30 (d, 1H, J=2.7), 7.15 (m,
2H), 7.02 (m, 4H), 4.42 (m, 1H), 3.87 (s, 3H), 3.54 (s, 1H), 2.30
(m, 2H), 2.24 (s, 3H), 2.06 (m, 2H), 1.84 (m, 2H), 1.63 (m, 1H),
1.32 (m, 3H)
Example 182
Preparation of
1-cyclohexyl-2-[2-(4-methoxy-3'-methyl-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid (Compound 367)
[0785] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with m-tolylboronic
acid (36 mg, 0.2625 mmol) to produce the title compound (27 mg, 27%
yield).
[0786] MS: 568.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.30 (m,
4H), 8.16 (d, 1H, J=8.7), 8.07 (dd, 1H, J=8.4, 1.8), 7.97 (dd, 1H,
J=9, 1.8), 7.44 (d, 1H, J=8.4), 7.32 (d, 1H, J=2.7), 7.16 (m, 2H),
7.04 (m, 3H), 6.78 (d, 1H, J=7.2), 4.41 (m, 1H), 3.87 (s, 3H), 3.55
(s, 1H), 2.29 (m, 2H), 2.20 (s, 3H), 2.06 (m, 2H), 1.84 (m, 2H),
1.61 (m, 1H), 1.31 (m, 3H)
Example 183
Preparation of
2-[2-(4'-aminomethyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1-
H-benzoimidazole-5-carboxylic acid (Compound 384)
[0787] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-aminomethylphenylboronic acid (49 mg, 0.2625 mmol) to produce the
title compound (48 mg, 46% yield).
[0788] MS: 583.31 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.31 (m,
3H), 8.14 (d, 1H, J=8.7), 8.05 (dd, 1H, J=8.4, 1.8), 7.95 (dd, 1H,
J=8.4, 1.2), 7.70 (m, 1H), 7.58 (m, 1H), 7.43 (d, 1H, J=8.4), 7.45
(d, 2H, J=8.4), 7.28 (d, 1H, J=2.4), 7.17 (m, 4H), 4.40 (m, 1H),
3.87 (s, 3H), 3.55 (s, 1H), 2.30 (m, 2H), 2.05 (m, 2H), 1.83 (m,
2H), 1.64 (m 1H), 1.33 (m, 3H)
Example 184
Preparation of
1-cyclohexyl-2-[2-(4'-ethoxy-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid (Compound 456)
[0789] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-ethoxyphenylboronic acid (44 mg, 0.2625 mmol) to produce the
title compound (17 mg, 16% yield).
[0790] MS: 598.32 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.35 (m,
4H), 8.23 (d, 1H, J=8.4), 8.12 (d, 1H, J=9), 8.02 (d, 1H, J=8.7),
7.42 (d, 1H, J=8.7), 7.32 (m, 1H), 7.16 (m, 2H), 7.02 (d, 2H,
J=8.7), 6.78 (m, 2H), 4.43 (m, 1H), 3.94 (m, 2H), 3.86 (s, 3H),
3.54 (s, 1H), 2.32 (m, 2H), 2.08 (m, 2H), 1.84 (m, 2H), 1.61 (m,
1H), 1.34 (m, 3H), 1.27 (m, 3H)
Example 185
Preparation of
1-cyclohexyl-2-[2-(5-methoxy-2-thiophen-2-yl-phenyl)-quinolin-6-yl]-1H-be-
nzoimidazole-5-carboxylic acid (Compound 470)
[0791] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
2-thiopheneboronic acid (34 mg, 0.2625 mmol) to produce the title
compound (26 mg, 27% yield).
[0792] MS: 598.32 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.48 (m,
2H), 8.34 (m, 2H), 8.27 (d, 1H, J=8.7), 8.12 (d, 1H, J=8.7), 8.04
(d, 1H, J=9), 7.56 (d, 1H, J=8.4), 7.40 (m, 2H), 7.30 (d, 1H,
J=2.7), 7.17 (dd, 1H, J=8.4, 2.7), 6.91 (m, 1H), 6.77 (d, 1H, 2.7),
4.46 (m, 1H), 3.86 (s, 3H), 3.55 (s, 1H), 2.31 (m, 2H), 2.11 (m,
2H), 1.84 (m, 2H), 1.61 (m, 1H), 1.33 (m, 3H)
Example 186
Preparation of
1-cyclohexyl-2-{2-[2-(2,4-dimethoxy-pyrimidin-5-yl)-5-methoxy-phenyl]-qui-
nolin-6-yl}-1H-benzoimidazole-5-carboxylic acid (Compound 484)
[0793] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
2,4-dimethoxypyrimidine-5-boronic acid (34 mg, 0.2625 mmol) to
produce the title compound (8 mg, 7% yield).
[0794] MS: 616.30 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.55 (d,
1H, J=9), 8.43 (s, 1H), 8.32 (d, 1H, J=0.9), 8.21 (d, 1H, J=8.7),
8.16 (s, 1H), 8.09 (m, 2H), 8.00 (m, 1H), 7.56 (d, 1H, J=8.7), 7.39
(m, 2H), 7.18 (dd, 1H, J=8.7, 2.7), 4.40 (m, 1H), 3.87 (m, 6H),
3.55 (s, 1H), 3.84 (s, 3H), 2.30 (m, 2H), 2.10 (m, 2H), 1.84 (m,
2H), 1.60 (m, 1H), 1.32 (m, 3H)
Example 187
Preparation of
2-[2-(2-bromo-phenyl)-quinolin-6-yl]-3-cyclohexyl-3H-imidazo[4,5-b]pyridi-
ne-6-carboxylic acid (Compound 477)
Step 1: 6-Hydroxy-5-nitronicotinic acid (Compound 477a)
[0795] A solution of 6-hydroxynicotinic acid (10 g, 71.89 mmol) in
fuming nitric acid (100 mL) was stirred at 50.degree. C. for 4 h.
After evaporation of extra nitric acid, the solid was obtained and
it was directly used in the next step reaction. MS: 185.02
(M+H.sup.+).
Step 2: Ethyl 6-chloro-5-nitronicotinic ester (Compound 477b)
[0796] A mixture of 6-hydroxy-5-nitronicotinic acid (Compound 477a)
(1.5 g, 8.15 mmol), phosphorus pentachloride (3 g) and phosphoryl
chloride (5 mL) was stirred at 100.degree. C. for 2 h. Excess of
phosphoryl chloride was removed under reduced pressure and to the
residue was added anhydrous EtOH (2 mL) at 0.degree. C. Water (50
mL) was added. The mixture was extracted with EtOAc. The combined
organic phase was washed with water, dried over anhydrous
Na.sub.2SO.sub.4 and evaporated to give the title intermediate
(1.24 g, 66%).
[0797] MS: 230.03 (M+H.sup.+).
Step 3: 6-Cyclohexylamino-5-nitro-nicotinic acid ethyl ester
(Compound 477c)
[0798] A mixture of ethyl 6-chloro-5-nitronicotinic ester (Compound
477b)(0.83 g, 3.60 mmol), DIEA (0.32 mL, 18.0 mmol) and
cyclohexylamine (1.25 mL, 10.93 mmol) in MeCN (15 mL) was stirred
at reflux under Ar overnight. After removal of solvent, the residue
was purified by chromatography using CHCl.sub.3-hexane (2:1) as the
eluent to give the title intermediate (1.0 g, 95%). MS: 294.13
(M+H.sup.+).
Step 4:
2-[2-(2-Bromo-phenyl)-quinolin-6-yl]-3-cyclohexyl-3H-imidazo[4,5-b-
]pyridine-6-carboxylic acid ethyl ester (Compound 477d)
[0799] (1) A mixture of Compound 477c (0.18 g, 0.614 mmol) and 5%
Pd/C (20 mg) in MeOH was shaken under 40 psi of H.sub.2 for 30 min.
The mixture was filtered through Celite and washed with MeOH and
DMF. The combined filtrate was evaporated to dryness to give the
amine.
[0800] (2) A mixture of Compound 353a (0.217 g, 0.661 mmol), HBTU
(0.26 g, 0.686 mmol) and DIEA (0.267 mL, 1.53 mmol) in DMF (10 mL)
was stirred at room temperature for 30 min and then transferred to
above amine. The resulting reaction mixture was stirred at room
temperature for 6 h and evaporated to dryness.
[0801] (3) To this residue was added AcOH (8 mL) and the solution
was stirred at reflux for 2 h. After removal of solvent by
evaporation, the residue was purified by chromatography using
CHCl.sub.3-hexane (10:1) and CHCl.sub.3-MeOH (100:1) as the eluents
to give the title intermediate. Total yield was 69%. MS: 557.17
(M+H.sup.+).
Step 5:
2-[2-(2-Bromo-phenyl)-quinolin-6-yl]-3-cyclohexyl-3H-imidazo[4,5-b-
]pyridine-6-carboxylic acid (Compound 477)
[0802] Compound 477d (0.139 g, 0.25 mmol) was dissolved in MeOH (3
mL) and 2 N aqueous NaOH (1.5 mL) was added. The mixture was
stirred at 55.degree. C. for 2 h and then neutralized with 5 N HCl
to pH 3 at 0.degree. C. The precipitates formed was collected by
filtration and purified by RP HPLC (15% of buffer B to 95% of
buffer B) to give the title compound. Yield 96%.
[0803] MS: 527.17, 529.17 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.97 (d, 1H, J=2.1 Hz), 8.67 (d, 1H, J=8.1 Hz), 8.55
(d, 1H, J=1.5 Hz), 8.46 (d, 1H, J=1.5 Hz), 8.26 (d, 1H, J=8.7 Hz),
8.10 (dd, 1H, J=1.8, 8.7 Hz), 7.87 (d, 1H, J=8.4 Hz), 7.81 (dd, 1H,
J=1.2, 8.1 Hz), 7.66 (d, 1H, J=2.1, 7.5 Hz), 7.57 (dt, 1H, J=1.2,
7.5 Hz), 7.45 (dt, 1H, J=1.2, 7.7 Hz), 4.42 (m, 1H), 2.72-2.68 (m,
2H), 2.07-2.00 (m, 2H), 1.83 (m, 5H), 1.65 (m, 1H), 1.30 (m,
4H).
Example 188
Preparation of
2-[2-(4'-chloro-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imidazo[4,5-b-
]pyridine-6-carboxylic acid (Compound 490)
[0804] A mixture of Compound 477d (0.139 g, 0.25 mmol),
4-chlorobenzeneboronic acid (78 mg, 0.50 mmol) and
Pd(PPh.sub.3).sub.4 (20 mg) in toluene (8 mL), MeOH (2 mL) and
saturated NaHCO.sub.3 (0.8 mL) was stirred under Ar at 70.degree.
C. for 16 h. After evaporation of solvent, the residue was
dissolved in CHCl.sub.3 (30 mL) and filtered. The filtrate was
evaporated to dryness. MS: 587.25 (M+H.sup.+).
[0805] The residue was hydrolyzed with 2 N aqueous NaOH in MeOH
according to procedure described in Compound 477. Purification was
achieved by RP HPLC (15% of buffer B to 95% of buffer B) to give
the title compound (0.116 g, 83%).
[0806] MS: 559.22 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.97 (d, 1H, J=1.8 Hz), 8.54 (d, 1H, J=2.1 Hz), 8.43
(d, 1H, J=8.4 Hz), 8.39 (d, 1H, J=1.8 Hz), 8.25 (d, 1H, J=8.7 Hz),
8.11 (dd, 1H, J=1.8, 9.0 Hz), 7.81 (dd, 1H, J=2.1, 6.9 Hz),
7.65-7.60 (m, 2H), 7.54 (dd, 1H, J=2.4, 6.6 Hz), 7.33 (d, 2H, J=8.4
Hz), 7.24 (d, 1H, J=8.4 Hz), 7.19 (d, 2H, J=8.4 Hz), 4.40 (m, 1H),
2.72-2.67 (m, 2H), 2.03-1.99 (m, 2H), 1.83 (m, 5H), 1.65 (m, 1H),
1.29 (m, 4H).
Example 189
Preparation of
(4'-chloro-2-{6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzoimidazol-2-yl]-
-quinolin-2-yl}-biphenyl-4-yl)-pyrrolidin-1-yl-methanone (Compound
259)
Step 1:
1-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-ethanone
(Compound 259a)
[0807] A mixture of Compound 419c (0.29 g, 0.845 mmol),
4-chlorobenzeneboronic acid (0.159 g, 1.02 mmol)) and
Pd(PPh.sub.3).sub.4 (97 mg) in toluene (25 mL), MeOH (6 mL) and
saturated NaHCO.sub.3 (2.5 mL) was stirred under Ar at 70.degree.
C. for 16 h. After evaporation of solvent, the residue was
dissolved in CHCl.sub.3 (30 mL) and filtered. The filtrate was
evaporated to dryness. The residue was purified by chromatography
using CHCl.sub.3-MeOH (80:1 to 30:1) as the eluent to give an oil
(0.266 g, 96%). MS: 328.08 (M+H.sup.+).
Step 2:
2-[4'-Chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinoline-6-c-
arboxylic acid (Compound 259e)
[0808] To a mixture of Compound 259a (0.388 g, 1.184 mmol) and
Compound 7 (0.223 g, 1.243 mmol) was added a solution of KOH (0.234
g, 3.55 mmol) in EtOH (18 mL). The reaction mixture was stirred
under Ar at 75.degree. C. for 16 h. EtOH (10 mL) was added to make
a clean solution, which was neutralized by adding 4 N HCl in
dioxane (about 1 mL) to pH 3. After evaporation of solvent,
H.sub.2O (15 mL) was added and the precipitates were collected by
filtration, washed with water and dried. Yield 0.125 g, 89%.
[0809] MS: 457.12, 458.13 (M+H.sup.+).
Step 3:
(4'-Chloro-2-{6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzoimidazo-
l-2-yl]-quinolin-2-yl}-biphenyl-4-yl)-pyrrolidin-1-yl-methanone
(Compound 259)
[0810] Compound 128 (91 mg, 0.316 mmol) was reduced to the
corresponding amine by hydrogenation according to procedures used
in the preparation of Compound 477d.
[0811] The amine was reacted with Compound 259e (0.125 g, 0.274
mmol) in the presence of HBTU (0.114 g, 0.30 mmol), followed
cyclization in AcOH according to procedures described for the
preparation of Compound 477d. Separation by RP HPLC (from 10% of
buffer B to 85% of buffer B) gave the title compound (42 mg,
23%).
[0812] MS: 679.30 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.45 (d, 1H, J=1.2 Hz), 8.40-8.37 (m, 2H), 8.29 (d,
1H, J=8.7 Hz), 8.24 (d, 1H, J=9.0 Hz), 8.10-8.06 (m, 2H), 7.92 (d,
1H, J=1.8 Hz), 7.76 (dd, 1H, J=1.8, 8.1 Hz), 7.59 (d, 1H, J=7.8
Hz), 7.35 (d, 2H, J=8.4 Hz), 7.24-7.20 (m, 3H), 4.44 (m, 1H),
3.55-3.49 (m, 4H), 2.43-2.2.28 (m, 2H), 2.09-2.06 (m, 2H),
1.92-1.85 (m, 5H), 1.68-1.62 (m, 1H), 1.45-1.29 (m, 4H).
Example 190
Preparation of
2-{2-[4'-chloro-4-(pyrrolidine-1-carbonyl)-biphen-2-yl]-quinolin-6-yl}-3--
cyclohexyl-3H-imidazo[4,5-b]pyridine-6-carboxylic acid (Compound
539)
[0813] Compound 477c (0.104 g, 0.355 mmol) was hydrogenated over 5%
Pd/C (11 mg) according to procedure (1) in the preparation of
Compound 477d.
[0814] The amine was then reacted with Compound 259e (0.13 g, 0.284
mmol) in the presence of HBTU (0.135 g, 0.356 mmol), followed
cyclization in AcOH and purification according to procedure (2) and
(3) in the preparation of Compound 477d, resulting in the precursor
ester of Compound 539.
[0815] Hydrolysis of the ester with 2N aqueous NaOH/MeOH to the
acid and purification by HPLC to give the title compound (23 mg,
13%).
[0816] MS: 656.30 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.96 (d, 1H, J=1.8 Hz), 8.53 (d, 1H, J=2.1 Hz),
8.37-8.34 (m, including d, 2H, J=8.1 Hz), 8.20 (d, 1H, J=8.7 Hz),
8.06 (dd, 1H, J=1.8, 8.4 Hz), 7.90 (d, 1H, J=1.8 Hz), 7.75 (dd, 1H,
J=1.8, 7.8 Hz), 7.58 (d, 1H, J=7.5 Hz), 7.36 (d, 2H, J=8.4 Hz),
7.22-7.18 (m, 3H), 4.40 (m, 1H), 3.51-3.41 (m, 4H), 2.72-2.68 (m,
2H), 2.02-1.98 (m, 2H), 1.87 (m, 5H), 1.65 (m, 1H), 1.29-1.23 (m,
4H).
Example 191
Preparation of
{4'-chloro-2-[6-(1-cyclohexyl-1H-benzoimidazol-2-yl)-quinolin-2-yl]-biphe-
nyl-4-yl}-pyrrolidin-1-yl-methanone (Compound 540)
[0817] Compound 259e (50 mg, 0.109 mmol) was reacted with HBTU (62
mg, 0.163 mmol) in DMF (1.5 mL) in the presence of DIEA (38 .mu.L,
0.219 mmol) at room temperature for 30 min.
N-cyclohexyl-benzene-1,2-diamine (31.2 mg, 0.164 mmol), (prepared
in the manner described for Compound 11 starting with
2-chloro-nitrobenzene instead of 4-chloro-3 nitro benzoic acid) was
added and the mixture was stirred at room temperature for 16 h.
After evaporation of solvent, to the residue was added AcOH (5 mL)
and the mixture was stirred at reflux for 2 h. The solvent was
evaporated and the residue was separated by RP HPLC (from 10% of
buffer B to 85% of buffer B) to give the title compound (26 mg,
39%).
[0818] MS: 611.28 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.47 (s, 1H), 8.40 (d, 1H, J=8.7 Hz), 8.31-8.28 (m,
including d, 2H, J=8.7 Hz), 8.12 (d, 1H, J=8.4 Hz), 7.92-7.89 (m,
2H), 7.77 (dd, 1H, J=1.5, 8.1 Hz), 7.65-7.58 (m, 3H), 7.36 (d, 2H,
J=8.1 Hz), 7.27 (d, 1H, J=8.1 Hz), 7.21 (d, 2H, J=8.7 Hz), 4.47 (m,
1H), 3.55-3.49 (m, 4H), 2.37-2.29 (m, 2H), 2.15-2.12 (m, 2H),
1.92-1.83 (m, 5H), 1.68-1.61 (m, 1H), 1.46-1.23 (m, 4H).
Example 192
Preparation of
2-(4'-chloro-4-methoxy-biphen-2-yl)-6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)--
1H-benzoimidazol-2-yl]-quinoline (Compound 525)
Step 1: 1-(4'-Chloro-4-methoxy-biphen-2-yl)-ethanone (Compound
525a)
[0819] 1-(2-Bromo-5-methoxyphenyl)ethanone (prepared as described
in Step 1 of Example 166) (12 g, 52.39 mmol) was reacted with
4-chlorobenzeneboronic acid (9.02, 57.68 mmol) and the catalyst
Pd(PPh.sub.3).sub.4 (0.605 g) as described for Compound 477e.
Purification by chromatography using CHCl.sub.3-MeOH (80:1) as the
eluent gave the title intermediate (12.67 g, 93%). MS: 261.08
(M+H.sup.+), 283.07 (M+Na.sup.+).
Step 2: 2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinoline-6-carboxylic
acid (Compound 525c)
[0820] Compound 7 (3.06 g. 11.72 mmol) was reacted with compound
525a (2.1 g, 11.72 mmol) and KOH (2.32 g, 35.16 mmol) in EtOH (150
mL) according to the procedure in the preparation of Compound 259e.
Purification by chromatography using CHCl.sub.3-MeOH (7:1) as the
eluent gave the title intermediate (3.1 g, 91%). MS: 388.07
(M+H.sup.+).
Step 3: Preparation of
2-(4'-Chloro-4-methoxy-biphen-2-yl)-6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)--
1H-benzoimidazol-2-yl]-quinoline (Compound 525)
[0821] Compound 128 (98 mg, 0.34 mmol) was reduced to the
corresponding amine by hydrogenation according to procedure (1) in
the preparation of Compound 477d.
[0822] The amine was reacted with compound 525c (0.11 g, 0.34 mmol)
in the presence of HBTU (0.135 g, 0.356 mmol), followed by
cyclization in AcOH according to procedure (2) in the preparation
of Compound 477d. Separation by RP HPLC (from 20% of buffer B to
99% of buffer B) gave the title compound (51 mg, 25%).
[0823] MS: 612.26 (M+H). .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.54 (d, 1H, J=1.6 Hz), 8.44-8.37 (m, 3H), 8.29 (d, 1H, J=8.7 Hz),
8.19 (d, 1H, J=9.0 Hz), 8.12 (d, 1H, J=8.7 Hz), 7.48-7.42 (m, 2H),
7.33-7.19 (m, 5H), 7.12 (d, 1H, J=8.4 Hz), 4.46 (m, 1H), 3.88 (s,
1H), 2.38-2.34 (m, 2H), 2.13-2.09 (m, 2H), 1.88-1.84 (m, 2H), 1.62
(m, 1H), 1.47-1.30 (m, 3H).
Example 193
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imi-
dazo[4,5-b]pyridine-6-carboxylic acid (Compound 537)
Step 1:
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-
-3H-imidazo[4,5-b]pyridine-6-carboxylic acid ethyl ester (Compound
537a)
[0824] Compound 477c (0.225 g, 0.767 mmol) was reduced to the
corresponding amine by hydrogenation according to procedure (1) in
the preparation of Compound 477d.
[0825] The amine was reacted with Compound 525c (0.314 g, 0.805
mmol) in the presence of HBTU (0.32 g, 0.844 mmol) and DIEA (0.47
mL, 2.68 mmol) in DMF (10 mL), followed cyclization in AcOH (10 mL)
according to procedure (2) and (3) in the preparation of Compound
477d. Separation by RP HPLC (from 20% of buffer B to 99% of buffer
B) gave the title intermediate (0.19 g, 40%).
Step 2:
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-
-3H-imidazo[4,5-b]pyridine-6-carboxylic acid (Compound 537)
[0826] Hydrolysis of the product from the previous reaction (63 mg,
0.102 mmol) with 2N aqueous NaOH/MeOH and purification by HPLC was
accomplished using the procedures described for Compound 477 giving
the title compound (31 mg, 52%).
[0827] MS: 589.24 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.96 (d, 1H, J=1.8 Hz), 8.53 (d, 1H, J=2.1 Hz), 8.36-8.33 (m, 2H),
8.20 (d, 1H, J=8.4 Hz), 8.06 (dd, 1H, J=1.8, 9.0 Hz), 7.45 (d, 1H,
J=8.4 Hz), 7.31-7.28 (m, 3H), 7.20-7.11 (m, 4H), 4.44-4.36 (m, 1H),
3.88 (s, 3H), 2.72-2.67 (m, 2H), 2.01-1.97 (m, 2H), 1.82 (m, 2H),
1.65 (m, 1H), 1.29-1.22 (m, 3H).
Example 194
Preparation of
2-[2-(4'-chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imi-
dazo[4,5-b]pyridine-6-carboxylic acid (Compound 535) and
2-[2-(4'-chloro-4-hydroxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-imi-
dazo[4,5-b]pyridine-6-carboxylic acid ethyl ester (Compound
538)
[0828] Compound 537a (71.8 mg) was dissolved in anhydrous
CH.sub.2Cl.sub.2 (8 mL) and 1.0 M BBr.sub.3 in CH.sub.2Cl.sub.2 (4
mL) was added dropwise at -70.degree. C. The mixture was stirred at
-70.degree. C. for 1 h and at room temperature overnight. The
mixture was cooled down to -70.degree. C. again and MeOH (2 mL) was
added dropwise. To the mixture was added 2 N aqueous NaOH (1 mL) at
room temperature and neutralized with 5 N HCl to pH 3. After
evaporation of solvent, the dry residue was dissolved in MeOH (10
mL) and filtered off insoluble precipitates. The filtrate was
evaporated to dryness. Separation by RP HPLC (form 20% buffer B to
99% buffer B) gave the title compounds.
[0829] Compound 535: (25.8 mg)MS: 575.22 (M+H.sup.+); .sup.1H NMR
(DMSO-d.sub.6) .delta.(ppm) 9.88 (br s, 1H), 8.96 (d, 1H, J=1.8
Hz), 8.53 (d, 1H, J=1.8 Hz), 8.33-8.30 (m, 2H), 8.20 (d, 1H, J=9.0
Hz), 8.06 (dd, 1H, J=2.1, 9.0 Hz), 7.33 (d, 1H, J=8.1 Hz),
7.29-7.25 (m, 2H), 7.19 (d, 1H, J=2.4 Hz), 7.13-7.08 (m, 3H), 6.99
(dd, 1H, J=2.7, 8.4 Hz), 4.41 (m, 1H), 3.88 (s, 3H), 2.72-2.68 (m,
2H), 2.01-1.98 (m, 2H), 1.83 (m, 2H), 1.66 (m, 1H), 1.30 (m,
3H).
[0830] Compound 538: (10.6 mg): MS: 603.25 (M+H.sup.+); .sup.1H NMR
(DMSO-d.sub.6) .delta.(ppm) 8.98 (d, 1H, J=1.8 Hz), 8.55 (d, 1H,
J=2.1 Hz), 8.33-8.30 (m, 2H), 8.20 (d, 1H, J=8.7 Hz), 8.06 (dd, 1H,
J=1.8, 8.7 Hz), 7.32 (d, 1H, J=8.1 Hz), 7.30-7.25 (m, 3H), 7.19 (d,
1H, J=2.4 Hz), 7.13-7.08 (m, 3H), 6.99 (dd, 1H, J=2.4, 8.4 Hz),
4.42-4.34 (m, 3H), 2.72-2.67 (m, 2H), 2.02-1.98 (m, 2H), 1.83 (m,
2H), 1.67 (m, 1H), 1.37 (t, 3H, J=7.2 Hz), 1.29-1.23 (m, 3H).
Example 195
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-ben-
zoimidazole-5-carboxylic acid (Compound 571)
Step 1: 3-Cyclohexylamino-4-nitro-benzoic acid (Compound 571a)
[0831] A mixture of 3-fluoro-4-nitrobenzoic acid (0.35 g, 1.891
mmol) and cyclohexylamine (2.17 mL, 18.91 mmol) in NMP (10 mL) was
stirred under Ar at 85.degree. C. for 6 h. The solvent was
evaporated under high vacuum. The residue was purified by
chromatography using CH.sub.3Cl-MeOH (10:1) as the eluent to give
the title intermediate in a quantitative yield. MS: 263.11
(M-H.sup.+)
Step 2: 3-Cyclohexylamino-4-nitro-benzoic acid ethyl ester
(Compound 571b)
[0832] A solution of the product of the previous step (0.4 g) in
anhydrous EtOH (50 mL) was gently bubbled with anhydrous HCl gas
for 4 h and the solution was left at room temperature for 16 h. The
solvent was evaporated to dryness to give the title intermediate in
a quantitative yield. MS: 293.14 (M+H.sup.+)
Step 3:
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-
-3H-benzoimidazole-5-carboxylic acid (Compound 571)
[0833] The product from the previous step (0.14 g, 0.479 mmol) was
reduced to the corresponding amine by hydrogenation according to
the preparation of Compound 477d.
[0834] The amine was reacted with Compound 525c (0.215 g, 0.552
mmol) in the presence of HBTU (0.22 g, 0.58 mmol) and DIEA (0.17
mL, 0.976 mmol) in DMF (10 mL), followed cyclization in AcOH (10
mL) according to procedure (2) and (3) in the preparation of
Compound 477d.
[0835] Hydrolysis of above ester with 2 N aqueous NaOH/MeOH and
purification by HPLC was accomplished as described for Compound 477
to give the title compound (43.2 mg, 15%).
[0836] MS: 588.24 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.48 (s, 1H), 8.42-8.38 (m, 2H), 8.27 (d, 1H, J=9.0
Hz), 8.10 (dd, 1H, J=1.8, 9.0 Hz), 8.03 (dd, 1H, J=1.5, 8.7 Hz),
7.89 (d, 1H, J=8.7 Hz), 7.46 (d, 1H, J=8.7 Hz), 7.32 (d, 1H, J=2.7
Hz), 7.29 (d, 2H, J=8.7 Hz), 7.25-7.19 (m, 2H), 7.13 (d, 2H, J=8.7
Hz), 4.52-4.45 (m, 1H), 3.87 (s, 3H), 2.27-2.12 (m, 4H), 1.86 (br
s, 2H), 1.67 (br s, 1H), 1.34 (br, 3H).
Example 196
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-ethyl-1H-benzoimi-
dazole-5-carboxylic acid (Compound 534)
Step 1: Loading the Resin with 4-Chloro-3-Nitrobenzoic Acid (Resin
534a)
[0837] To a solution of 4-chloro-3-nitrobenzoic acid (0.605 g, 3
mmol) in ethanol (15 mL) and water (5 mL) was added dropwise 10%
aqueous Cs.sub.2CO.sub.3 to adjust the solution to pH 7. The
resulting mixture was evaporated to dryness and co-evaporated with
toluene (20 mL) four times. The residue was then dried over
P.sub.2O.sub.5 under high vacuum.
[0838] A mixture in anhydrous DMF (8 mL) of Merrifield resin HL
(Nova Biochem, 100-200 mesh, loading: 1.34 mmol/g, 1.04 g) and the
dry Cs-salt prepared above was gently agitated at 50.degree. C.
overnight. The solution was drained and the resin was washed with
DMF (5 mL.times.5), DMF/H.sub.2O (9:1 v/v, 5 mL.times.5), DMF (5
mL.times.5), and MeOH (5 mL.times.5). The resin was dried under
high vacuum. Based on the increase of the resin weight, the loading
of substitution was calculated to be 1.30 mmol/g.
Step 2: Amine Addition
[0839] A mixture of Resin 534a (0.308 g, 0.40 mmol), a 2.0 M
solution of ethylamine in MeOH (3.9 mL, 7.8 mmol), and DIEA (0.82
mL, 4.68 mmol) in NMP (10 mL) was shaken for 16 h at room
temperature. The solution was drained and the resin was washed with
DMF (5 mL.times.5), MeOH (5 mL.times.5), and CH.sub.2Cl.sub.2 (5
mL.times.5). The resins was dried under high vacuum.
Step 3: Reduction of the Nitro Group
[0840] The resin was then suspended in DMF (10 mL) and
SnCl.sub.2.2H.sub.2O (5.42 g, 24 mmol) was added. The mixture was
shaken under Ar at room temperature for 32 h. The solution was
drained and the resin was washed with DMF (5 mL.times.5), MeOH (5
mL.times.5), and CH.sub.2Cl.sub.2 (5 mL.times.5). The resin was
dried under high vacuum.
Step 4: Formation of the Benzimidazole Ring
[0841] Compound 525c (0.38 g, 0.97 mmol) was reacted with HBTU
(0.444 g, 1.2 mmol) in anhydrous DMF (5 mL) in the presence of DIEA
(0.41 mL, 2.35 mmol) for 30 min. The mixture was then transferred
to a suspension of amine-resin in DMF (5 mL). The reaction mixture
was shaken at room temperature overnight. The solution was drained
and the resin was washed with DMF (5 mL.times.5), MeOH (5
mL.times.5), and CH.sub.2Cl.sub.2 (5 mL.times.5). The resin was
dried under high vacuum.
Step 5: Cleavage of the Resin
[0842] To the resin was added AcOH (10 mL) and the mixture was
refluxed for 3 h. After evaporation of AcOH, TFA (3 mL) and TFMSA
(0.3 mL) were added to the dry resin. The mixture was left at room
temperature for 2 h. The resin was filtered off and washed with TFA
(3 mL.times.3) and MeOH (3 mL.times.2). The filtrate was evaporated
and the residue was neutralized with ammonium solution. The product
was purified by reverse phase HPLC from 20% of Buffer B to 99% of
Buffer A.
[0843] MS: 534.16 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.50 (s, 1H), 8.42-8.34 (m, including d, 2H, J=8.4 Hz), 8.29-8.20
(m, including d, 2H, J=8.4 Hz), 8.08 (d, 1H, J=8.4 Hz), 8.02 (d,
1H, J=9.0 Hz), 7.46 (d, 1H, J=8.0 Hz), 7.33-7.07 (m, 7H), 4.53 (q,
2H, J=6.9 Hz), 3.88 (s, 3H), 1.45 (t, 3H, J=5.7 Hz).
Example 197
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopropyl-1H-be-
nzoimidazole-5-carboxylic acid (Compound 528)
[0844] The title compound was prepared from Resin 534a and
cyclopropylamine according to the procedure described in the
preparation of Compound 534.
[0845] MS: 546.16 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.70 (s, 1H), 8.46-8.39 (m, 2H), 8.31 (s, 1H), 8.23 (d, 1H, J=9.0
Hz), 8.05 (d, 1H, J=8.4 Hz), 7.90 (d, 1H, J=2.1, 8.7 Hz), 7.48-7.42
(m, 2H), 7.35-7.28 (m, 2H), 7.25-7.07 (m, 4H), 4.12 (m, 1H), 3.88
(s, 3H), 1.19 (d, 2H, J=6.6 Hz), 0.76 (br s, 2H).
Example 198
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-isopropyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 527)
[0846] The title compound was prepared from Resin 534a and
isopropylamine according to the procedure described in the
preparation of Compound 534.
[0847] MS: 548.19 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.38 (s, 1H), 8.36 (d, 1H, J=7.0 Hz), 8.32 (d, 1H, J=1.5 Hz), 8.24
(d, 1H, J=8.7 Hz), 8.14 (d, 1H, J=9.0 Hz), 8.09 (dd, 1H, J=2.1, 8.7
Hz), 7.99 (dd, 1H, J=1.5, 8.7 Hz), 7.46 (d, 1H, J=8.7 Hz),
7.32-7.27 (m, 3H), 7.22-7.18 (m, 2H), 7.14-7.11 (m, 2H), 4.89 (t,
1H, J=7.2 Hz), 3.88 (s, 3H), 1.69 (d, 6H, J=7.2 Hz).
Example 199
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(2-dimethylamino--
ethyl)-1H-benzoimidazole-5-carboxylic acid (Compound 533)
[0848] The title compound was prepared from Resin 534a and
N,N-dimethylethyleneamine according to the procedure described in
the preparation of Compound 534.
[0849] MS: 577.22 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 10.77 (br s, 1H), 8.47 (s, 1H), 8.42 (d, 1H, J=8.7
Hz), 8.32 (d, 1H, J=0.9 Hz), 8.26-8.21 (m, 2H), 8.00 (s, 2H), 7.45
(d, 2H, J=8.4 Hz), 7.32-7.26 (m, 2H), 7.22-7.17 (m, 2H), 7.14-7.11
(m, 2H), 4.88 (t, 2H, J=7.8 Hz), 3.88 (s, 3H), 3.83 (s, 6H), 3.61
(m, 2H).
Example 200
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopentyl-1H-be-
nzoimidazole-5-carboxylic acid (Compound 529)
[0850] The title compound was prepared from Resin 534a and
cyclopentylamine according to the procedure described in the
preparation of Compound 534.
[0851] MS: 574.21 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.39 (d, 1H, J=8.7 Hz), 8.38 (s, 1H), 8.32 (d, 1H, J=1.5 Hz), 8.24
(d, 1H, J=8.7 Hz), 8.10 (dd, 1H, J=2.1, 8.8 Hz), 8.00 (dd, 1H,
J=1.5, 8.7 Hz), 7.90 (d, 1H, J=8.4 Hz), 7.45 (d, 1H, J=8.4 Hz),
7.31-7.28 (m, 3H), 7.23-7.18 (m, 2H), 7.15-7.11 (m, 2H), 5.03 (q,
1H, J=9.3 Hz), 3.88 (s, 3H), 2.23 (m, 4H), 2.02 (m, 2H), 1.72-1.69
(m, 2H).
Example 201
Preparation of
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-isobutyl-1H-benzo-
imidazole-5-carboxylic acid (Compound 530)
[0852] The title compound was prepared from Resin 534a and
isobutylamine according to the procedure described in the
preparation of Compound 534.
[0853] MS: 562.22 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.51 (s, 1H), 8.35 (d, 1H, J=9.0 Hz), 8.32 (s, 1H), 8.22 (br s,
2H), 8.03-7.95 (m, 2H), 7.45 (d, 1H, J=8.4 Hz), 7.34 (d, 1H, J=2.7
Hz), 7.29 (d, 2H, J=8.7 Hz), 7.20 (d, 1H, J=8.4 Hz), 7.18 (d, 1H,
J=8.4 Hz), 7.12 (d, 2H, J=8.7 Hz), 4.41 (d, 2H, J=7.8 Hz), 3.88 (s,
3H), 1.98-1.93 (m, 1H), 0.68 (d, 6H, J=6.9 Hz).
Example 202
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(3-methyl-butyl)--
1H-benzoimidazole-5-carboxylic acid (Compound 532)
[0854] The title compound was prepared from Resin 534a and
isoamylamine according to the procedure described in the
preparation Compound 534.
[0855] MS: 576.24 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.49 (s, 1H), 8.37 (d, 1H, J=8.7 Hz), 8.32 (d, 1H, J=1.2 Hz),
8.25-8.17 (m, 2H), 8.03 (dd, 1H, J=1.3, 8.4 Hz), 7.94 (d, 1H, J=8.7
Hz), 7.46 (d, 1H, J=8.7 Hz), 7.33 (d, 1H, J=2.7 Hz), 7.28-7.18 (m,
including d, 4H, J=8.4 Hz), 7.10 (d, 2H, J=8.4 Hz), 4.49 (t, 2H,
J=7.2 Hz), 3.88 (s, 3H), 1.71-1.64 (m, 2H), 1.55-1.46 (m, 1H), 0.78
(d, 6H, J=6.6 Hz).
Example 203
Preparation of
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(1-ethyl-propyl-1-
H-benzoimidazole-5-carboxylic acid (Compound 564)
[0856] The title compound was prepared from Resin 534a and
1-ethylpropylamine according to the procedure described in the
preparation of Compound 534.
[0857] MS: 576.25 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.39 (d, 1H, J=8.4 Hz), 8.35-8.32 (m, 2H), 8.27 (d,
1H, J=8.7 Hz), 8.09-8.02 (m, 2H), 7.98 (d, 1H, J=9.0 Hz), 7.46 (d,
1H, J=8.7 Hz), 7.33 (d, 1H, J=3.0 Hz), 7.30 (d, 2H, J=8.4 Hz),
7.22-7.18 (m, including d, 2H, J=8.7 Hz), 7.13 (d, 2H, J=8.4 Hz),
4.35-4.30 (m, 1H), 3.88 (s, 3H), 2.25-2.15 (m, 2H), 2.05-1.96 (m,
2H), 0.70 (t, 6H, J=7.2 Hz).
Example 204
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-cyclopropylmethyl-
-1H-benzoimidazole-5-carboxylic acid (Compound 531)
[0858] The title compound was prepared from Resin 534a and
cyclopropylmethylamine according to the procedure described in the
preparation of Compound 534.
[0859] MS: 560.21 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.29 (s, 1H), 8.13 (d, 1H, J=8.4 Hz), 8.11 (d, 1H, J=1.2 Hz), 8.01
(m, 2H), 7.81-7.73 (m, 2H), 7.25 (d, 1H, J=8.4 Hz), 7.46 (d, 1H,
J=8.7 Hz), 7.33 (d, 1H, J=2.7 Hz), 7.09 (d, 2H, J=8.7 Hz), 7.00 (d,
1H, J=8.4 Hz), 6.98 (d, 1H, J=8.4 Hz), 6.92 (d, 2H, J=8.7 Hz), 4.23
(d, 2H, J=6.9 Hz), 3.88 (s, 3H), 0.89 (m, 1H), 0.23-0.169 (m, 2H),
0.03-0.02 (m, 2H).
Example 205
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(tetrahydrofuran--
2-yl-methyl)-1H-benzoimidazole-5-carboxylic acid (Compound 566)
[0860] The title compound was prepared from Resin 534a and
tetrahydrofurfurylamine according to the procedure described in the
preparation of Compound 534.
[0861] MS: 590.22 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.49 (s, 1H), 8.31 (d, 1H, J=9.0 Hz), 8.29 (s, 1H), 8.22-8.15 (m,
2H), 7.97-7.89 (m, 2H), 7.45 (d, 1H, J=8.4 Hz), 7.31 (d, 1H, J=2.4
Hz), 7.28 (d, 2H, J=8.4 Hz), 7.19 (d, 1H, J=8.4 Hz), 7.17 (d, 1H,
J=8.4 Hz), 7.11 (d, 2H, J=8.4 Hz), 4.61-4.42 (m, 2H), 4.22-4.18 (m,
1H), 3.88 (s, 3H), 1.99-1.90 (m, 2H), 1.77-1.1.67 (m, 2H),
1.58-1.49 (m, 2H).
Example 206
Preparation of
1-bicyclo[2.2.1]hept-2-yl-2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-
-6-yl]1H-benzoimidazole-5-carboxylic acid (Compound 568)
[0862] The title compound was prepared from Resin 534a and
2-aminonorbornane according to the procedure described in the
preparation of Compound 534.
[0863] MS: 600.22 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.39 (d, 1H, J=1.8 Hz), 8.34 (d, 1H, J=8.7 Hz), 8.29
(s, 1H), 8.20 (d, 1H, J=8.7 Hz), 8.12 (dd, 1H, J=1.8, 8.7 Hz), 8.00
(br s, 2H), 7.46 (d, 1H, J=8.4 Hz), 7.33 (d, 1H, J=2.7 Hz), 7.29
(d, 2H, J=8.7 Hz), 7.22-7.18 (m, 2H), 7.15-7.11 (m, 2H), 4.98-4.93
(m, 1H), 3.88 (s, 3H), 3.73-3.65 (m, 2H), 3.49-3.45 (m, 1H), 2.31
(br s, 1H), 2.04-1.93 (m, 1H), 1.86-1.77 (m, 1H), 1.56-1.45 (m,
3H), 1.33-1.30 (m, 1H).
Example 207
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(4-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid (Compound 543) (Cis or
Trans)
[0864] The title compound was prepared from Resin 534a and a
mixture of cis and trans 4-methylcyclohexyl-amine according to the
procedure described in the preparation of Compound 534.
[0865] MS: 602.25 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6) .delta.
(ppm) 8.36-8.32 (m, 2H), 8.29 (d, 1H, J=1.5 Hz), 8.19 (d, 1H, J=8.7
Hz), 8.04 (dd, 1H, J=1.8, 8.7 Hz), 7.98 (dd, 1H, J=1.5, 8.7 Hz),
7.91 (d, 1H, J=8.4 Hz), 7.45 (d, 1H, J=8.4 Hz), 7.31-7.27 (m,
including d, 3H, J=8.4 Hz), 7.20-7.17 (m, 2H), 7.12 (d, 2H, J=8.4
Hz), 4.42-4.33 (m, 1H), 3.88 (s, 3H), 2.44-2.34 (m, 2H), 1.97-1.94
(m, 1H), 1.86-1.83 (m, 2H), 1.62 (m, 4H), 1.13 (d, 3H, J=7.2
Hz).
Example 208
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(4-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid (Compound 547) (Trans or
Cis)
[0866] The title compound was prepared from Resin 534a and a
mixture of cis and trans 4-methylcyclohexyl-amine according to the
procedure described in the preparation of Compound 534.
[0867] MS: 602.25 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.36-8.32 (m, 2H), 8.27 (d, 1H, J=1.5 Hz), 8.19 (d, 1H, J=8.7 Hz),
8.07-8.01 (m, 2H), 7.92 (dd, 1H, J=1.5, 8.7 Hz), 7.45 (d, 1H, J=8.4
Hz), 7.31-7.27 (m, including d, 3H, J=9.0 Hz), 7.20-7.17 (m, 2H),
7.12 (d, 2H, J=8.7 Hz), 4.42-4.33 (m, 1H), 3.88 (s, 3H), 2.44-2.36
(m, 2H), 2.03-1.99 (m, 2H), 1.82-1.78 (m, 2H), 1.62 (m, 2H),
1.06-1.02 (m, 1H), 0.89 (d, 3H, J=6.6 Hz).
Example 209
Preparation of
2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(3,3,5-trimethyl--
cyclohexyl)-1H-benzoimidazole-5-carboxylic acid (Compound 555)
[0868] The title compound was prepared from Resin 534a and
3,3,5-trimethylcyclohexylamine according to the procedure described
in the preparation of Compound 534.
[0869] MS: 630.28 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.35-8.32 (m, 2H), 8.29 (d, 1H, J=1.2 Hz), 8.19 (d, 1H, J=8.7 Hz),
8.10 (d, 1H, J=9.0 Hz), 8.05 (dd, 1H, J=1.5, 8.7 Hz), 7.93 (dd, 1H,
J=1.5, 8.7 Hz), 7.45 (d, 1H, J=8.4 Hz), 7.32 (d, 1H, J=2.7 Hz),
7.27 (d, 2H, J=8.7 Hz), 7.23-7.17 (m, 2H), 7.09 (d, 2H, J=8.4 Hz),
4.71-4.62 (m, 1H), 3.88 (s, 3H), 2.25-2.15 (m, 1H), 1.94-1.87 (m,
2H), 1.63 (br s, 1H), 1.36-1.32 (m, 1H), 1.23-1.08 (m, 2H), 1.03
(s, 3H), 0.89 (d, 3H, J=7.2 Hz), 0.87 (s, 3H).
Example 210
Preparation of
cyclohexyl-2-(4-oxo-2-phenyl-4H-chromen-6-yl)-1H-benzoimidazole-5-carboxy-
lic acid (Compound 407)
Step 1: 4-Hydroxy-3-(3-phenyl-acryloyl)-benzoic acid (Compound
407a)
[0870] 3-Acetyl-4-hydroxy-benzoic acid was prepared as described in
J. Pfister et al. in J. Med. Chem. (1980), 23, 335-338. To an ice
cooled solution of 3-acetyl-4-hydroxy-benzoic acid (4 g, 22.2 mmol)
and benzaldehyde (2.44 mL, 24 mmol, 1.08 eq.) in 60 mL ethanol was
added 20 mL of an 40% KOH solution. The resulting dark red solution
was stirred under argon at ambient temperature until the reaction
was complete as judged by TLC (2 days). Thereafter, the mixture was
slowly poured into excess 6N HCl, and the resulting yellow
precipitate was filtered off, washed with water and dried. The
crude materials were recrystallized from THF-EtOH to yield 2.43 g
of a yellow/brown solid (88% yield).
[0871] MS: 267.10 (M-H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
12.88 (br s, 1H), 12.46 (s, 1H), 8.50 (d, 1H, J=2.1 Hz), 8.03 (dd,
1H, J=2.1 HZ, J=8.8 Hz), 7.85-7.93 (m, 3H), 7.77 (d, 1H, J=15.5
Hz), 7.44-7.48 (m, 3H), 7.08 (d, 1H, J=8.8 Hz)
Step 2: 4-Oxo-2-phenyl-4H-chromene-6-carboxylic acid (Compound
407b)
[0872] Bromine (216 .mu.L, 1.13 eq.) was added to
4-hydroxy-3-(3-phenyl-acryloyl)-benzoic acid (1 g, 3.72 mmol) in
acetic acid (37.5 mL). After the solution was stirred at ambient
temperature for 1 day, 10% aqueous NaHSO.sub.3 (62.5 mL) was added
slowly. The resulting precipitate was filtered off, washed with
water and suspended in ethanol (25 mL). MS: 426.93 (M+H.sup.+).
[0873] Potassium hydroxide (861 mg, 3.5 eq., 13.05 mmol) dissolved
in water (12.5 mL) was added and stirring was continued for 4 h.
The reaction mixture was acidified with 2N HCL, and the precipitate
formed was filtered off, washed with water, died and recrystallized
to give 621 mg (62%) of product.
[0874] MS: 265.08 (M-H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
8.57 (d, 1H, J=2.1 Hz), 8.30 (dd, 1H, J=2.1 Hz, J=8.5 Hz),
8.11-8.14 (m, 2H), 7.87 (d, 1H, 8.7 Hz), 7.58-7.89 (m, 3H), 7.12
(s, 1H).
Step 3:
1-Cyclohexyl-2-(4-oxo-2-phenyl-4H-chromen-6-yl)-1H-benzoimidazole--
5-carboxylic acid (Compound 407)
[0875] 4-Oxo-2-phenyl-4H-chromene-6-carboxylic acid (280 mg, 1.05
mmol) was dissolved in DMF (5 mL), and HATU (418 mg, 1.1 eq.) and
diisopropyl ethylamine (402 .mu.L) were added. After stirring at
room temperature for 15 minutes, 3-amino-4-cyclohexylamino-benzoic
acid ethyl ester (303 mg, 1.1 eq.) dissolved in 2 mL DMF was added.
After stirring overnight, the reaction was evaporated, dissolved in
ethyl acetate and washed with water and brine, dried with sodium
sulfate, evaporated and dried overnight. The product was then
refluxed in acetic acid for 4 h, evaporated to dryness, and
coevaporated 2 more times with toluene. Saponification proceeds by
dissolving the residue in ethanol (10 mL), adding 10 eq. of 1N NaOH
solution and stirring at 40.degree. C. for 4 hr. The ethanol was
evaporated, water was added and acidified. The resulting
precipitate was purified via reverse-phase HPLC. Yield: 58 mg
[0876] MS: 465.20 (M+H.sup.+); H.sup.1-NMR (MeOD): .delta.(ppm)
8.64 (d, 1H, J=2.3 Hz), 8.49 (s, 1H), 8.30-8.38 (m, 2H), 8.24 (dd,
1H, J=2.3 Hz, J=8.8 Hz), 8.12-8.17 (m, 3H), 7.59-7.66 (m, 3H), 7.10
(s, 1H), 4.55-4.63 (m, 1H), 2.42-2.50 (m, 2H), 2.20-2.24 (m, 2H),
2.00-2.03 (m, 2H), 1.77-1.81 (m, 1H), 1.42-1.49 (m, 3H).
Example 211
Preparation of
1-cyclohexyl-2-(4-oxo-2-phenyl-1,4-dihydro-quinolin-6-yl)-1H-benzoimidazo-
le-5-carboxylic acid (Compound 373)
[0877] 4-Oxo-2-phenyl-1,4-dihydro-quinoline-6-carboxylic acid
(298.5 mg, 1.05 mmol), (Compound 481c), was dissolved in DMF (5
mL), and HATU (440 mg, 1.1 eq.) and diisopropyl ethylamine (402
.mu.L) were added. After stirring at room temperature for 15
minutes, 3-amino-4-cyclohexylamino-benzoic acid ethyl ester (303
mg, 1.1 eq.) dissolved in 2 mL DMF was added. After stirring
overnight, the reaction was evaporated, dissolved in ethyl acetate
and washed with water and brine, dried with sodium sulfate,
evaporated and dried overnight. The product was then refluxed in
acetic acid for 4 hr, evaporated to dryness, and coevaporated 2
more times with toluene. Saponification proceeded by dissolving the
residue in ethanol (10 mL), adding 10 eq. of 1N NaOH solution and
stirring at 40.degree. C. for 4 hr. The ethanol was evaporated, and
water was added and acidified. The resulting precipitate is
purified via reverse-phase HPLC. Yield: 47 mg
[0878] MS: 464.19 (M+H.sup.+); H.sup.1-NMR (MeOD): .delta.(ppm)
8.71 (s, 1H), 8.44 (s, 1H), 8.22-8.25 (m, 2H), 8.15 (s, 1H),
7.86-7.89 (m, 2H), 7.61-7.64 (m, 2H), 6.79 (s, 1H), 4.55-4.64 (m,
1H), 2.45-2.53 (m, 2H), 2.19-2.23 (m, 2H), 1.99-2.02 (m, 2H),
1.76-1.80 (m, 2H), 1.41-1.48 (m, 3H).
Example 212
Preparation of
1-cyclohexyl-2-(4-dimethylamino-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-
-5-carboxylic acid (Compound 481)
Step 1: 4-Oxo-2-phenyl-1,4-dihydro-quinoline-6-carboxylic acid
ethyl ester (Compound 481b)
[0879] 4-Amino-benzoic acid ethyl ester (66 g, 0.4 mol) and
3-oxo-3-phenyl-propionic acid ethyl ester (0.4 mol, 1 eq.) were
dissolved in 500 mL cyclohexane and refluxed for 2 days using a
Dean-Stark trap. The solution was filtered, the solvent evaporated
and the residue recrystallized to give
4-(2-ethoxycarbonyl-1-phenyl-ethylideneamino)-benzoic acid ethyl
ester (Compound 481a) MS: 340.18 (M+H.sup.+).
4-(2-Ethoxycarbonyl-1-phenyl-ethylideneamino)-benzoic acid ethyl
ester was dissolved in diphenyl-methanone (250 mL) and heated to
250.degree. C. for 4 hr. The resulting solution was diluted with
diethyl ether and filtered to give 48.6 g of the title intermediate
as a white crystalline solid.
[0880] MS: 294.13 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
11.98 (brs, 1H), 8.69 (d, 1H, J=1.1 Hz), 8.16 (dd, 1H, J=2.0 Hz,
J=8.5 Hz), 7.82-7.86 (m, 3H), 7.56-7.61 (m, 3H), 6.42 (s, 1H), 4.35
(q, 2H, J=7.0 Hz), 1.36 (t, 3H, J=7.0 Hz)
Step 2: 4-Oxo-2-phenyl-1,4-dihydro-quinoline-6-carboxylic acid
(Compound 481c)
[0881] Saponification proceeded with dissolving 26.5 g (0.1 mol)
4-oxo-2-phenyl-1,4-dihydro-quinoline-6-carboxylic acid ethyl ester
in ethanol (100 mL), adding 10 eq. of 1N NaOH solution and stirring
at 40.degree. C. for 4 hr. The ethanol was evaporated, water was
added and acidified, and the precipitate filtered. The white
product was dried over P.sub.2O.sub.5 to give quantitative amounts
of 4-oxo-2-phenyl-1,4-dihydro-quinoline-6-carboxylic acid.
[0882] MS: 266.10 (M+H.sup.+); H.sup.1-NMR (d.sub.6-DMSO):
.delta.(ppm) 12.29 (s, 1H), 8.14 (dd, 1H, J-2.0 Hz, J=8.8 Hz), 7.94
(d, 1H, J-8.8 Hz), 7.84-7.89 (m, 2H), 7.55-7.59 (m, 3H), 6.46 (s,
1H).
Step 3:
1-Cyclohexyl-2-(4-oxo-2-phenyl-1,4-dihydro-quinolin-6-yl)-1H-benzo-
imidazole-5-carboxylic acid ethyl ester acid (Compound 481d)
[0883] 4-Oxo-2-phenyl-1,4-dihydro-quinoline-6-carboxylic acid (2.78
g, 1.05 mmol) was dissolved in DMF (50 mL), and HATU (1.1 eq.) and
diisopropyl ethylamine (2.2 eq, 402 .mu.L) were added. After
stirring at room temperature for 15 minutes,
3-amino-4-cyclohexylamino-benzoic acid ethyl ester (2.89 g, 1.1
eq.) dissolved in 20 mL DMF was added. After stirring overnight,
the reaction was evaporated, dissolved in ethyl acetate and washed
with water and brine, dried with sodium sulfate, evaporated and
dried overnight. The product was then refluxed in acetic acid for 4
hr, evaporated to dryness, and coevaporated 2 more times with
toluene. The product was recrystallized from methanol to give 4.13
g of product.
[0884] MS: 492.25 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
11.98 (s, 1H), 8.35 (d, 1H, J=1.5 Hz), 8.27 (d, 1H, 1.7 Hz),
7.95-8.02 (m, 3H), 7.82-7.88 (m, 3H), 7.57-7.69 (m, 3H), 6.43 (s,
1H), 4.29-4.38 (m, 3H), 2.26-2.37 (m, 2H), 1.95-1.99 (m, 2H),
1.84-1.89 (m, 2H), 1.62-1.66 (m, 1H), 1.24-1.42 (m, 6H).
Step 4:
2-(4-Chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-
-5-carboxylic acid ethyl ester (Compound 481e)
[0885]
1-Cyclohexyl-2-(4-oxo-2-phenyl-1,4-dihydro-quinolin-6-yl)-1H-benzoi-
midazole-5-carboxylic acid ethyl ester acid (4 g, 8.14 mmol) was
dissolved in phosphorous oxy chloride and heated at 100.degree. C.
overnight. After evaporation of the solvent the product was
recrystallized from methanol/water to give 3.96 g of crude product.
Silica gel purification of the title compound proved to be
unsatisfactory due to degradation of the product on the column. MS:
510.22 (M+H.sup.+).
Step 5: Preparation of
1-Cyclohexyl-2-(4-dimethylamino-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-
-5-carboxylic acid (Compound 481)
[0886]
2-(4-Chloro-2-phenyl-quinolin-6-yl)-1-(1-cyclohexyl)-1H-benzoimidaz-
ole-5-carboxylic acid ethyl ester was dissolved in 5 mL NMP and 1.1
eq of nucleophile is added. The reaction mixture was heated to
80.degree. C. overnight, and subsequently evaporated.
Saponification proceeded with dissolving the residue in ethanol (10
mL), adding 10 eq. of 1N NaOH solution and stirring at 40.degree.
C. for 4 hr. The ethanol was evaporated, and the residue purified
via reverse-phase HPLC.
[0887] In the synthesis of the title compound 51 mg (0.1 mmol) of
crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used. The nucleophile used was neat
DMF. No NMP was used in this reaction. Yield: 11 mg
[0888] MS: 491.26 (M+H.sup.+); H.sup.1-NMR (MeOD): .delta.(ppm)
8.69 (s, 1H), 8.41 (s, 1H), 8.12-8.30 (m, 2H), 7.87-8.08 (m, 4H),
7.62-7.74 (m, 3H), 7.20 (s, 1H), 4.40-4.48 (m, 1H), 3.67 (s, 6H),
2.44-2.48 (m, 2H), 1.96-1.99 (m, 2H), 1.75-1.79 (m, 1H), 1.30-1.42
(m, 3H).
Example 213
Preparation of
1-cyclohexyl-2-(4-ethoxy-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-carb-
oxylic acid (Compound 494)
[0889] The title compound was isolated as a side product from the
reaction sequence used for the preparation of Compound 481. Yield:
4 mg
[0890] MS: 492.22 (M+H.sup.+), H.sup.1-NMR (MeOD): .delta.(ppm)
8.80 (s, 1H), 8.36-8.46 (m, 3H), 8.12-8.17 (m, 4H), 7.71-97 (m,
4H), 4.75 (q, 1H, J=7.0 Hz), 4.46-4.57 (m, 1H), 2.42-2.55 (m 2H),
2.13-2.17 (m, 2H), 1.94-1.99 (m, 2H), 1.71-1.76 (m, 1H), 1.69 (t,
3H, J=7.0 Hz), 1.38-1.45 (m, 3H)
Example 214
Preparation of
2-[4-(4-chloro-phenylamino)-2-phenyl-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid (Compound 380)
[0891] The title compound was prepared using the method described
for Compound 481. In this reaction 102 mg (0.2 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used. The nucleophile used was
p-chlorophenylamine. Yield: 89 mg
[0892] MS: 573.22 (M+H.sup.+), H.sup.1-NMR (MeOD): .delta.(ppm)
8.98 (d, 1H, J=1.4 Hz), 8.27-8.38 (m, 3H), 8.08-8.16 (m, 2H),
7.86-7.96 (m, 2H), 7.54-7.72 (m, 7H), 7.13 (s, 1H), 4.45 (t t, 1H,
J=8.0 Hz, J=4.3 Hz), 2.37-2.48 (m, 2H), 2.13-2.17 (m, 2H),
1.94-1.99 (m, 2H), 1.74-1.78 (m, 1H), 1.37-1.49 (m, 3H)
Example 215
Preparation of
1-cyclohexyl-2-[4-(4-hydroxy-butylamino)-2-phenyl-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid (Compound 398)
[0893] In this reaction 102 mg (0.2 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used in the same reaction sequence as
that used for Compound 481. The nucleophile used was
4-amino-butan-1-ol. Yield: 59 mg
[0894] MS: 535.28 (M+H.sup.+); H.sup.1-NMR (MeOD): .delta.(ppm)
8.75 (s, 1H), 8.43 (s, 1H), 8.15-8.24 (m, 2H), 8.07-8.10 (dd, 1H,
J=0.9 Hz, J=8.8 Hz), 7.98-8.03 (m, 3H), 7.67-7.73 (m, 3H), 7.15 (s,
1H), 4.34 (m, 1H), 3.75 (tr, 2H, 7.0 Hz), 3.67 (tr, 2H, J=5.9 Hz),
2.37-2.45 (m, 2H), 2.07-2.11 (m, 2H), 1.90-1.97 (m, 4H), 1.70-1.79
(m, 3H), 1.28-1.45 (m, 3H)
Example 216
Preparation of
1-cyclohexyl-2-(2-phenyl-4-phenylamino-quinolin-6-yl)-1H-benzoimidazole-5-
-carboxylic acid (Compound 433)
[0895] In this reaction 102 mg (0.2 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used in the same reaction sequence as
that used for Compound 481. The nucleophile used was aniline.
Yield: 143 mg.
[0896] MS: 571.30 (M+H.sup.+), 539.26; H.sup.1-NMR (d6-DMSO):
.delta.(ppm) 11.10 (bs, 1H), 9.11 (s, 1H), 8.25-8.36 (m, 3H), 8.05
(d, 1H, 8.8 Hz), 7.88-7.93 (m, 3H), 7.57-7.67 (m, 7H), 7.39-7.45
(m, 1H), 7.03 (s, 1H), 4.24-4.29 (m, 1H), 2.31-2.37 (m, 2H),
2.02-2.04 (m, 2H), 1.84-1.88 (m, 2H), 1.62-1.66 (m, 1H), 1.21-1.43
(m, 3H)
Example 217
Preparation of
1-cyclohexyl-2-[4-(3-imidazol-1-yl-propylamino)-2-phenyl-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid (Compound 451)
[0897] In this reaction 102 mg (0.2 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used in the same reaction sequence as
that used for Compound 481. The nucleophile used was
3-imidazol-1-yl-propylamine. Yield: 31 mg.
[0898] MS: 571.30 (M+H.sup.+), 286.12 ((M+2H.sup.+)/2); H.sup.1-NMR
(MeOD): .delta.(ppm) 9.03 (s, 1H), 8.91 (s, 1H), 8.46 (s, 1H),
8.09-8.30 (m, 5H), 8.01-8.04 (m, 2H), 7.68-7.74 (m, 4H), 7.56-7.58
(m, 1H), 7.17 (s, 1H), 4.49 (tr, 2H, J=7.0 Hz), 4.37-4.47 (m, 1H),
3.83 (tr, 2H, J=6.7 Hz), 2.42-2.51 (m, 2H), 2.12-2.16 (2H, m, 2H),
1.95-1.99 (m, 2H), 1.74-1.78 m, 1H), 1.35-1.42 (m, 3H)
Example 218
Preparation of
1-cyclohexyl-2-(4-phenoxy-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-car-
boxylic acid (Compound 496)
[0899] In this reaction 51 mg (0.1 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used in the same reaction sequence as
that used for Compound 481. The nucleophile used was phenol. Yield:
19 mg.
[0900] MS: 540.25 (M+H.sup.+); H.sup.1-NMR (MeOD): .delta.(ppm)
8.97 (s, 1H), 8.45-8.50 (m, 2H), 8.32 (d, 1H, J=8.5 Hz), 8.18 (s,
2H), 7.91-7.94 (m, 2H), 7.54-7.65 (m, 5H), 7.41-7.49 (m, 3H), 7.19
(s, 1H), 4.58-4.66 (m, 1H), 2.42-2.49 (m, 2H), 2.17-2.21 (m, 2H),
1.95-2.01 (m, 2H), 1.72-1.84 (m, 1H), 1.41-1.52 (m, 3H).
Example 219
Preparation of
1-cyclohexyl-2-[4-(7-hydroxy-naphthalen-2-yloxy)-2-phenyl-quinolin-6-yl]--
1H-benzoimidazole-5-carboxylic acid (Compound 509)
[0901] In this reaction 51 mg (0.1 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used in the same reaction sequence as
that used for Compound 481. The nucleophile used was
naphthalene-2,7-diol. Yield: 6.2 mg.
[0902] MS: 606.28 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
8.66 (s, 1H), 8.29-8.34 (m, 2H), 8.15-8.18 (m, 1H), 8.03-8.11 (m,
3H), 7.91-7.97 (m, 2H), 7.83 (d, 1H, J=8.8 Hz), 7.65 (bs, 1H),
7.47-7.49 (m, 3H), 7.34 (s, 1H), 7.27-7.31 (m, 1H), 7.14 (bs, 1H),
7.07-7.11 (m, 1H), 4.47-4.49 (m, 2H, OH and CH), 2.32 (q, 2H,
J=12.6 Hz), 2.01-2.04 (m, 2H), 1.81-1.84 (m, 2H), 1.58-1.62 (m,
1H), 1.22-1.41 (m, 3H).
Example 220
Preparation of
1-Cyclohexyl-2-(2-phenyl-4-phenylsulfanyl-quinolin-6-yl)-1H-benzoimidazol-
e-5-carboxylic acid (Compound 467)
[0903] In this reaction 51 mg (0.1 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used in the same reaction sequence as
that used for Compound 481. The nucleophile used was benzenethiol.
Yield: 36 mg.
[0904] MS: 556.21 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
8.48 (s, 1H), 8.28-8.31 (m, 2H), 8.16 (d, 1H, J=8.8 Hz), 8.05 (d,
1H, J=8.8 Hz), 7.89-7.97 (m, 3H), 7.66-7.70 (m, 2H), 7.55-7.57 (m,
3H), 7.48-7.53 (m, 4H), 4.43-4.49 (m, 1H), 2.30-2.40 (m, 2H),
2.00-2.04 (m, 2H), 1.85-1.88 (m, 2H), 1.62-1.66 (m, 1H), 1.22-1.37
(m, 3H).
Example 221
Preparation of
1-cyclohexyl-2-[2-(2-ethoxy-5-nitro-phenyl)-quinolin-6-yl]-1H-benzoimidaz-
ole-5-carboxylic acid (Compound 404)
[0905] 1-(2-Bromo-5-nitro-phenyl)-ethanone (61 mg, 0.25 mmol)
prepared similarly to the procedure described in Meisenheimer, J.,
Zimmermann P., and v. Kummer, U. Ann. der. Chem. 446, pp. 205-228)
and
2-(4-amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid ethyl ester (98 mg, 0.25 mmol) were dissolved in 500 .mu.L
ethanol and 500 .mu.L 10% ethanolic KOH were added. The reaction
was stirred at 75.degree. C. overnight. The reaction was acidified
with 4N hydrochloric acid, extracted three times with ethyl
acetate, the organic extracts were dried with sodium sulfate and
then evaporated. Purification via reverse-phase HPLC gave 16 mg
(97.33% pure) of product.
[0906] MS: 537.23 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
8.71 (d, 1H, J=2.9 Hz), 8.62 (d, 1H, J=8.8 Hz), 8.41 (d, 1H, J=2.7
Hz), 8.37 (dd, 1H, J=3.0 Hz, J=9.0 Hz), 8.29-8.33 (m, 2 Hz), 8.18
(d, 1H, J=8.5 Hz), 8.04-8.08 (m, 2H), 7.92 (1H, dd, J=1.8 Hz, J=8.5
Hz), 7.44 (d, 1H, 8.4 Hz), 4.31-4.44 (m, 3H), 2.26-2.34 (m, 2H),
2.02-2.05 (m, 2H), 1.83-1.86 (m, 2H), 1.61-1.65 (m, 1H), 1.28-1.43
(m, 6H).
Example 222
Preparation of
2-[2,4']biquinolinyl-6-yl-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid (Compound 423)
[0907] Methylmagnesium bromide in diethyl ether (2.4 mL of 3.0M
solution) was dropped onto solid quinoline-4-carboxylic acid (250
mg). After stirring for an additional 15 min. the reaction was
quenched by addition of methanol. The solution was separated
between ethyl acetate and water, the water extracted two more times
with ethyl acetate, the organic phases were dried with sodium
sulfate and then evaporated. The crude product
(1-quinolin-4-yl-ethanone was used without further purification in
the next step.
[0908] MS: 172.07 (M+H.sup.+); H.sup.1-NMR (CDCl.sub.3):
.delta.(ppm) 9.01 (d, 1H, J=4.5 Hz), 8.42 (d, 1H, J=9 Hz), 8.14 (d,
1H, J=9 Hz), 7.72-7.78 (m, 1H), 7.59-7.64 (m, 2H), 2.75 (s,
3H))
[0909] (1-Quinolin-4-yl-ethanone (43 mg, 0.25 mmol) and
2-(4-amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid ethyl ester (98 mg, 0.25 mmol) were dissolved in 500 .mu.L
ethanol and 500 .mu.L 10% ethanolic KOH were then added. The
reaction was stirred at 75.degree. C. overnight. The reaction was
acidified with 4N hydrochloric acid, extracted three times with
ethyl acetate, and the organic extracts were dried with sodium
sulfate and then evaporated. Purification via reverse-phase HPLC
gave 24 mg product.
[0910] MS: 499.23 (M+H.sup.+); H.sup.1-NMR (MeOD): .delta.(ppm)
9.33 (d, 1H, J=5.5 Hz), 8.87 (d, 1H, J=8.5 Hz), 8.65 (d, 1H, J=1.8
Hz), 8.55 (d, 1H, 8.8 Hz), 8.48-8.52 (m, 2H), 8.37 (d, 1H, 8.5 Hz),
8.30 (d, 5.5 Hz), 8.16-8.27 (m, 5H), 7.94-7.99 (m, 1H), 4.62 (t, t,
1H, J=8.5 Hz, J=3.9 Hz), 2.43-2.54 (m (like br q), 2H), 2.22-2.26
(m, 2H), 1.99-2.03 (m, 2H), 1.76-1.80 (m, 1H), 1.40-1.53 (m,
3H).
Example 223
Preparation of
2-[2-(4'-chloro-4-nitro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid (Compound 439)
[0911] 1-(2-Bromo-5-nitro-phenyl)-ethanone (1 g, 4 mmol; prepared
similarly to the procedure described in Meisenheimer, J.,
Zimmermann P., and v. Kummer, U. Ann. der. Chem. 446, pp. 205-228),
p-Chlorophenylboronic acid (768 mg, 1.2 eq.), and
tetrakis(triphenylphosphine)-palladium(0) (473 mg, 0.1 eq.), were
dissolved in 25 mL toluene, 6 mL methanol and 2.5 mL sat. sodium
bicarbonate solution. After degassing/sonicating the solution, the
sealed reaction vessel was heated to 80.degree. C. overnight. The
cooled solution was separated between ethyl acetate and water; the
aqueous phase extracted two more times with ethyl acetate, and the
organic fractions were combined, dried with sodium sulfate and
evaporated. Silica gel chromatography (4:1 hexanes/ethyl acetate)
gave 1-(4'-chloro-4-nitro-biphen-2-yl)-ethanone (962 mg).
[0912] 1-(4'-Chloro-4-nitro-biphen-2-yl)-ethanone (69 mg, 0.25
mmol) and
2-(4-amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid ethyl ester (98 mg, 0.25 mmol) were dissolved in 500 .mu.L
ethanol and 500 .mu.L 10% ethanolic KOH were added. The reaction
was stirred at 75.degree. C. overnight. The reaction was acidified
with 4N hydrochloric acid, extracted three times with ethyl
acetate, the organic extracts were dried with sodium sulfate and
then evaporated. Purification via reverse-phase HPLC gave 34 mg
product MS: 603.20 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
8.57 (d, 1H, J=2.3 Hz), 8.38-8.45 (m, 2H), 8.34 (d, 1H, J=1.8 Hz),
8.24-8.28 (m, 2H), 8.05-8.08 (m, (like d), 2H), 7.91 (dd, 1H,
J=1.5, J=8.8 Hz), 7.82 (d, 1H, J=8.5 Hz), 7.38-7.43 (m, 2 Hz),
7.20-7.27 (m, 3H), 4.34-4.43 (m, 1H), 2.26-2.34 (m, 2H), 2.01-2.05
(m, 2H), 1.83-1.87 (m, 2H), 1.62-1.75 (m, 2H), 1.32-1.43 (m,
3H).
Example 224
Preparation of
6-[1-cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-phenylquinox-
aline (Compound 258)
Step 1: 4-Cyclohexylamino-3-nitrobenzonitrile (Compound 127)
[0913] A solution of 1 g (5.48 mmol) 4-chloro-3-nitrobenzonitrile,
Compound 126, and 1.14 g (11.51 mmol) of cyclohexylamine were
heated overnight in 5 mL anhydrous DMF. After cooling to room
temperature, the solution was added dropwise into 100 mL H.sub.2O
stirring vigorously. The solids were collected by filtration and
dried under vacuum yielding 1.34 g (100%) bright yellow solids
which were used as such without analysis in the next step.
Step 2: Cyclohexyl-[2-nitro-4-(1H-tetrazol-5-yl)-phenyl]amine
(Compound 128)
[0914] A solution of 1.10 g (4.49 mmol) of
4-cyclohexylamino-3-nitrobenzonitrile, Compound 127, and 1.11 g
(5.39 mmol) of Me.sub.3SnN.sub.3 in 50 mL toluene was refluxed
overnight. The crystals were collected by filtration, washed with
toluene, dried, and treated with 50 mL 4M HCl in dioxane for 4 h.
The solids were collected by filtration, washed with dioxane, and
dried yielding 1.14 g (88%) red solids. MS: 289.15 (M+H.sup.+).
Step 3: N-1-Cyclohexyl-4-(1H-tetrazol-5-yl)-benzene-1,2-diamine
(Compound 129)
[0915] The title intermediate was prepared from 1.20 g (4.16
mmol)
[0916] Compound 128 as described for Compound 11 to yield 0.9 g
(83%). MS: 259.18 (M+H.sup.+).
Step 4:
6-[1-Cyclohexyl-5-(1H-tetrazol-5-yl)-1H-benzimidazol-2-yl]-2-pheny-
lquinoxaline (Compound 258)
[0917] The title compound was prepared from 100 mg (0.39 mmol) of
Compound 129 and Compound 36A Y=phenyl as described for compound 38
Y=phenyl to yield 21 mg.
[0918] MS: 473.25 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 9.73 (s, 1H), 8.46 (d, 2H, J=1.2 Hz), 8.42-8.36 (m,
4H), 8.29 (d, 1H, J=5.6 Hz), 8.19 (dd, 1H, J=1.2 Hz and 5.6 Hz),
8.09 (dd, 1H, J=1 Hz and 5.8 Hz), 7.63 (m, 5H), 4.45 (m, 1H),
2.44-2.35 (m, 2H), 2.12-2.08 (m, 2H), 1.90-1.85 (m, 2H), 1.62 (m,
1H), 1.50-1.29 (m, 3H).
Example 225
Preparation of
1-cyclohexyl-2-(2,3-diphenyl-quinolin-6-yl)-1H-benzoimidazole-5-carboxyli-
c acid (Compound 386)
[0919] The title compound was synthesized in four steps as
described for Compound 13, Compound 25, Compound 27 Q=ethyl and
Compound 204, respectively, except deoxybenzoin was used in the
first step instead of acetophenone.
[0920] MS: 524.29 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.73 (s, 1H), 8.57 (s, 1H), 8.40-8.37 (m, 2H),
8.31-8.28 (d, 1H, J=8.4 Hz), 8.17-8.14 (d, 1H, J=8.4 Hz), 8.07-8.04
(d, 1H, J=8.4 Hz), 7.45-7.29 (m, 10H), 4.46 (m, 1H), 2.34-2.26 (m,
2H), 2.14-2.10 (m, 2H), 1.86-1.82 (m, 2H), 1.60 (m, 1H), 1.43-1.21
(m, 3H).
Example 226
Preparation of
2-(2-benzhydryl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carboxyli-
c acid (Compound 457)
[0921] The title compound was synthesized in four steps as
described for Compound 13, Compound 25, Compound 27, Q=ethyl and
Compound 204, respectively, except 1,1-diphenylacetone was used in
the first step, instead of acetophenone.
[0922] MS: 538.30 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.63-8.60 (d, 1H, J=9.0 Hz), 8.47 (d, 1H, J=1.5 Hz),
8.34 (d, 1H, J=1.2 Hz), 8.29-8.24 (m, 2H), 8.10-8.02 (m, 2H),
7.66-7.63 (d, 1H), J=8.7 Hz), 7.36-7.20 (m, 10H), 6.05 (s, 1H),
4.45-4.41 (m, 1H), 2.33-2.28 (m, 2H), 2.1-2.06 (m, 2H), 1.84-1.79
(m 2H), 1.58 (m, 1H), 1.38-1.20 (m, 3H).
Example 227
Preparation of
2-[2-(2-bromo-phenyl)-quinolin-6-yl]-1-cyclohexyl-1H-benzoimidazole-5-car-
boxylic acid (Compound 352)
[0923] The title compound was synthesized in four steps as
described for Compound 13, Compound 25, Compound 27 Q=ethyl and
Compound 204, respectively, except 2'-bromoacetophenon was used in
the first step instead of acetophenone.
[0924] MS: 526.14 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.75-8.72 (d, 1H, J=8.7 Hz), 8.55 (d, 1H, J=1.5 Hz),
8.38 (d, 1H, J=1.2 Hz), 8.36-8.33 (d, 1H, J=8.7 Hz), 8.26-8.8.22
(d, 1H, J=8.7 Hz), 8.17-8.13 (dd, 1H, J=8.7 Hz and 1.8 Hz),
8.06-8.02 (dd, 1H, J=8.4 Hz and 1.5 Hz), 7.96-7.93 (d, 1H, J=8.4
Hz), 7.87-7.84 (dd, 1H, J=7.8 Hz and 0.9 Hz), 7.73-7.69 (dd, 1H,
J=7.5 Hz and 1.8 Hz), 7.64-7.59 (m, 1H), 7.53-7.47 (m 1H), 4.49 (m,
1H), 2.40-2.32 (m, 2H), 2.15-2.11 (m, 2H), 1.91-1.87 (m, 2H), 1.66
(m, 1H), 1.42-1.34 (m, 3H).
Example 228
Preparation of 2-{2-[(4-Chlorophenyl)methyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid (Compound 546)
Step 1: (4-Chlorophenyl)isopropylamine (Compound 546a)
[0925] A mixture of 1 g (7.84 mmol) of 4-chloroaniline, 0.91 g
(15.68 mmol) of acetone, 0.99 g (15.68 mmol) of NaCNBH.sub.3, 4 g
of MgSO.sub.4 in 99 mL anhydrous EtOH and 1 mL AcOH was stirred at
room temperature overnight, filtered and the solvent was removed.
The residue was dissolved in 50 mL EtOAc, washed with 50 mL
H.sub.2O, dried (Na.sub.2SO.sub.4) and evaporated. The residue was
purified on silica gel using hexane/EtOAc as eluent to yield 0.86 g
colorless oil. MS: 170.08 (M+H.sup.+).
Step 2: (4-Chlorophenyl)cyclohexylamine (Compound 546b)
[0926] Prepared as described above using cyclohexanone in place of
acetone to yield 1.11 g colorless crystals. MS: 210.12
(M+H.sup.+).
Step 3: 2-{2-[(4-Chlorophenyl)methyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid ethyl ester (Compound 546c)
[0927] A solution of 100 mg (0.23 mmol) Compound 402a in 1 mL
SOCl.sub.2 was allowed to stand at room temperature for 10 min and
SOCl.sub.2 was removed. The residue was dissolved in 5 mL anhydrous
CH.sub.2Cl.sub.2; 89 mg (0.69 mmol) DIEA, 84 mg (0.69 mmol) DMAP,
98 mg (0.69 mmol) 4-chloro-N-methylaniline were added; and the
solution was vortexed and allowed to stand at room temperature
overnight. The solvent was removed and the residue was
chromatographed on silica gel using hexane/EtOAc as the eluent to
yield 63 mg of yellow oil. MS: 576.24 (M+H.sup.+).
Step 4: 2-{2-[(4-Chlorophenyl)methyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid (Compound 546)
[0928] A solution of 63 mg (0.11 mmol) of Compound 546c in 0.55 mL
THF, 0.44 mL of EtOH and 0.11 mL of 2 N aq. NaOH was allowed to
stand at room temperature overnight. The reaction was quenched with
0.22 mL 1 M aq. HCl. The solvents were removed and the residue was
purified by HPLC to yield 6 mg of the title compound.
[0929] MS: 539.21 (M+H.sup.+); .sup.1H-NMR (CD.sub.3OD):
.delta.(ppm) 8.47 (m, 3H), 8.31 (m, 2H), 8.10 (m, 2H), 7.84 (m,
1H), 7.23 (m, 4H), 4.58 (m, 1H), 3.58 (s, 3H), 2.45 (m, 2H), 2.19
(m, 2H), 1.98 (m, 2H), 1.74 (m, 1H), 1.46-1.30 (m, 3H).
Example 229
Preparation of 2-{2-[(4-Chlorophenyl) isopropyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid (Compound 550)
Step 1: 2-{2-[(4-Chlorophenyl) isopropyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid ethyl ester (Compound 550a)
[0930] The title compound was prepared as described for Compound
546c using Compound 546a in place of 4-chloro-N-methylaniline. MS:
595.27 (M+H.sup.+).
Step 2: 2-{2-[(4-Chlorophenyl) isopropyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid (Compound 550)
[0931] The title compound was prepared as described for Compound
546 heating the solution at 50.degree. C. for 4 h instead of
standing overnight.
[0932] MS: 567.25 (M+H.sup.+); .sup.1H-NMR (CD.sub.3OD):
.delta.(ppm) 8.45 (m, 2H), 8.36 (s, 1H), 8.24 (m, 2H), 8.15 (d, 1H,
J=9 Hz), 8.04 (d, 1H, J=8.4 Hz), 7.71 (d, 1H, J=8.4 Hz), 7.24 (dd,
4H, J=8.4 Hz and 18.3 Hz), 5.12 (m, 1H), 4.53 (m, 1H), 2.41 (m,
2H), 2.15 (m, 2H), 1.95 (m, 2H), 1.73 (m, 1H) 1.41 (m, 3H), 1.31
(d, 6H, J=6.6 Hz).
Example 230
Preparation of 2-{2-[(4-Chlorophenyl)cyclohexyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid (Compound 551)
Step 1: 2-{2-[(4-Chlorophenyl)cyclohexyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid ethyl ester (Compound 551a)
[0933] The title compound was prepared as described for Compound
546c using Compound 546b in place of 4-chloro-N-methylaniline. MS:
635.31 (M+H.sup.+).
Step 2: 2-{2-[(4-Chlorophenyl)cyclohexyl
carbamoyl]quinolin-6-yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic
acid (Compound 551)
[0934] The title compound was prepared as described for Compound
550 using 5 eq. of 2 N aq NaOH in place of 1 eq. MS: 607.28
(M+H.sup.+); .sup.1H-NMR (DMSO-d.sub.6): .delta.(ppm) 8.46 (d, 1H,
J=8.4 Hz), 8.25 (s, 2H), 7.96 (m, 3H), 7.68 (d, 1H, J=8.4 Hz), 7.26
(s, 4H), 4.61 (m, 1H), 4.34 (m, 1H), 2.29-0.96 (m, 10H).
Example 231
Preparation of
1-Cyclohexyl-2-[2-(4'-ethyl-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benz-
oimidazole-5-carboxylic acid (Compound 557)
[0935] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
4-ethylphenylboronic acid (39 mg, 0.2625 mmol) to produce the title
compound (48 mg, 48% yield).
[0936] MS: 582.32 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.38 (d,
1H, J=1.5), 8.31 (m, 3H), 8.17 (d, 1H, J=8.7), 8.07 (dd, 1H, J=8.7,
1.8), 7.98 (dd, 1H, J=8.4, 1.2), 7.43 (d, 1H, J=8.7), 7.31 (d, 1H,
J=2.7), 7.17 (m, 2H), 7.05 (m, 4H0, 4.42 (m, 1H), 3.87 (s, 3H),
2.53 (m, 2H), 2.31 (m, 2H), 2.07 (m, 2H), 1.84 (m, 2H), 1.61 (m,
1H), 1.32 (m, 3H), 1.12 (m, 3H)
Example 232
Preparation of
1-Cyclohexyl-2-[2-(3',4'-difluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid (Compound 560)
[0937] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
3,4-difluorophenylboronic acid (42 mg, 0.2625 mmol) to produce the
title compound (26 mg, 25% yield).
[0938] MS: 590.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.46 (m,
2H), 8.36 (s, 1H), 8.29 (d, 2H, J=9), 8.11 (dd, 1H, J=8.7, 1.8),
8.05 (dd, 1H, J=9, 1.5), 7.49 (d, 1H, J=8.4), 7.27 (m, 5H), 6.84
(m, 1H), 4.44 (m, 1H), 3.88 (s, 3H), 3.54 (s, 1H), 2.30 (m, 2H),
2.11 (m, 2H), 1.84 (m, 2H), 1.61 (m, 1H), 1.35 (m, 3H)
Example 233
Preparation of
1-Cyclohexyl-2-[2-(3',5'-dichloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid (Compound 562)
[0939] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
3,5-dichlorophenylboronic acid (50 mg, 0.2625 mmol) to produce the
title compound (17 mg, 15% yield).
[0940] MS: 622.20 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.48 (d,
1H, J=8.4), 8.44 (s, 1H), 8.32 (s, 1H), 8.22 (m, 2H), 8.05 (m, 2H),
7.53 (d, 1H, J=8.4), 7.42 (m, 2H), 7.33 (d, 1H, J=2.7), 7.20 (dd,
1H, H=8.7, 2.7), 7.11 (m, 2H), 4.40 (m, 1H), 3.89 (s, 3H), 2.30 (m,
2H), 2.08 (m, 2H), 1.84 (m, 2H), 1.60 (m, 1H), 1.32 (m, 3H)
Example 234
Preparation of
1-Cyclohexyl-2-[2-(4'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid amide (Compound 570)
[0941] Compound 455 (50 mg, 0.087 mmol) was dissolved in ammonia
saturated methanol (50 mL) and placed in a 100 mL glass bomb. The
reaction was argon flushed, sealed, and stirred at 70.degree. C.
for 8 days. The reaction was then evaporated to dryness and
purified via HPLC to produce the title compound (9 mg, 18%
yield).
[0942] MS: 571.27 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.37 (m,
3H), 8.29 (m, 2H), 8.09 (m, 2H), 7.55 (s, 1H), 7.46 (2, 1H, J=8.4),
7.32 (d, 1H, J=2.7), 7.20 (m, 2H), 7.12 (m, 4H), 4.44 (s, 1H), 3.88
(s, 3H), 3.55 (s, 1H), 2.34 (m, 2H), 2.10 (m, 2H), 1.84 (m, 2H),
1.60 (m, 1H), 1.35 (m, 3H)
Example 235
Preparation of
1-Cyclohexyl-2-[2-(2'-fluoro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-ben-
zoimidazole-5-carboxylic acid (Compound 544)
[0943] Following the full procedure and workup for Compound 366,
Compound 365b (100 mg, 0.175 mmol) was reacted with
2-fluorophenylboronic acid (37 mg, 0.2625 mmol) to produce the
title compound (9 mg, 25% yield).
[0944] MS: 572.26 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6): 8.40 (m,
2H), 8.34 (m, 1H), 8.24 (d, 1H, J=8.7), 8.17 (d, 1H, J=9), 8.04 (m,
2H), 7.41 (m, 2H), 7.29 (m, 3H), 7.20 (m, 2H), 7.03 (m, 1H), 4.43
(m, 1H), 3.90 (s, 3H), 3.55 (s, 1H), 2.30 (m, 2H), 2.10 (m, 2H),
1.84 (m, 2H), 1.61 (m, 1H), 1.35 (m, 3H)
Example 236
Preparation of
2-(2-Biphenylyl-4-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid (Compound 548)
Step 1: 1-(4-Methoxy-2'-methyl-biphen-2-yl)-ethanone (Compound
548a)
[0945] Following the procedure and workup (without the potassium
hydroxide addition) for Compound 366, 2-bromo,
5-methoxyacetophenone (80 mg, 0.35 mmol) was reacted with
o-tolylboronic acid (71 mg, 0.525 mmol) to produce the title
intermediate (42 mg, 50% yield). HPLC Procedure C, retention
time=2.84 min.
Step 2:
2-(2-Biphenyl-4-yl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-
-carboxylic acid (Compound 562)
[0946] Following the procedure and workup for Compound 354 (68 mg,
0.17 mmol) was reacted with Compound 548a (42 mg, 0.17 mmol) in
ethanol (3 mL) using 10% w/v KOH in Ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound 29 mg, 28% yield).
[0947] MS: 568.28 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.43 (d, 1H, J=1.8), 8.34 (m, 4H), 8.09 (m, 2H), 7.43
(d, 1H, J=2.4), 7.32 (d, 1H, J=8.4), 7.14 (m, 6H), 4.45 (m, 1H),
3.90 (s, 3H), 3.55 (s, 1H), 2.30 (m, 2H), 2.11 (m, 2H), 1.96 (s,
3H), 1.83 (m, 2H), 1.60 (m, 1H), 1.30 (m, 3H)
Example 237
Preparation of
1-Cyclohexyl-2-[2-(4,2'-dimethoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoimi-
dazole-5-carboxylic acid (Compound 552)
Step 1: 1-(4,2'-Dimethoxy-biphen-2-yl)-ethanone (Compound 552a)
[0948] Following the procedure and workup (without the potassium
hydroxide addition) for Compound 366, 2-bromo,
5-methoxyacetophenone (80 mg, 0.35 mmol) was reacted with
2-methoxyphenylboronic acid (80 mg, 0.525 mmol) to produce Compound
552a (40 mg, 48% yield). HPLC Procedure C, retention time=2.37
min.
Step 2:
1-Cyclohexyl-2-[2-(4,2'-dimethoxy-biphen-2-yl)-quinolin-6-yl]-1H-b-
enzoimidazole-5-carboxylic acid (Compound 552)
[0949] Following the procedure and workup for Compound 354 (68 mg,
0.17 mmol) was reacted with Compound 552a (40 mg, 0.17 mmol) in
ethanol (3 mL) using 10% w/v KOH in Ethanol (506 .mu.L, 0.64 mmol)
to produce the title compound (12 mg, 10% yield).
[0950] MS: 584.28 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.50 (m, 2H), 8.37 (m, 2H), 8.27 (d, 1H, J=9), 8.17
(m, 1H), 8.04 (m, 1H), 7.40 (m, 2H), 7.24 (m, 4H), 6.94 (m, 1H),
6.82 (d, 1H, J=8.4), 4.41 (m, 1H), 3.90 (s, 3H), 3.55 (s, 1H), 3.23
(s, 3H), 2.29 (m, 2H), 2.10 (m, 2H), 1.84 (m, 2H), 1.60 (m, 1H),
1.32 (m, 3H)
Example 238
Preparation of
1-Cyclohexyl-2-[2-(2-cyclohexyl-5-methoxy-phenyl)-quinolin-6-yl]-1H-benzo-
imidazole-5-carboxylic acid (Compound 545)
Step 1: 1-(2-Cyclohexyl-5-methoxy-phenyl)-ethanone (Compound
545a)
[0951] 2-bromo-5-methoxyacetophenone (500 mg, 2.185 mmol),
Pd(P(t-Bu).sub.3).sub.2 (100 mg, 0.219 mmol), and NMP (15 mL) were
added to a 25 mL, flame dried, Argon filled flask. The flask was
sealed and, while stirring, cyclohexyl zinc bromide (5.5 mL, 0.5M
in THF) was added dropwise. The reaction was stirred at 90.degree.
C. for 20 h. The reaction was then evaporated to dryness and
purified via RP-HPLC to produce the title intermediate (50 mg, 10%
yield). HPLC Procedure C, retention time=3.12 min.
Step 2:
1-Cyclohexyl-2-[2-(2-cyclohexyl-5-methoxy-phenyl)-quinolin-6-yl]-1-
H-benzoimidazole-5-carboxylic acid (Compound 545)
[0952] Following the procedure and workup for Compound 354,
Compound 354e (86 mg, 0.22 mmol) was reacted with Compound 545a (50
mg, 0.22 mmol) in ethanol (3 mL) using 10% w/v KOH in Ethanol (436
.mu.L, 0.66 mmol) to produce the title compound (26 mg, 21%
yield).
[0953] MS: 560.30 (M+H.sup.+); H.sup.1-NMR (DMSO-d.sub.6):
.delta.(ppm) 8.78 (d, 1H, J=8.7), 8.59 (s, 1H), 8.31 (m, 3H), 8.17
(m, 1H), 8.04 (d, 1H, J=8.7), 7.85 (d, 1H, J=8.7), 7.41 (d, 1H,
J=8.7), 7.06 (m, 2H), 4.48 (m, 1H), 3.78 (s, 3H), 3.55 (m, 2H), 2.7
(m, 1H), 2.34 (m, 2H), 2.12 (m, 2H), 1.87-1.04 (m, 14H)
Example 239
Preparation of
1-Cyclohexyl-2-{2-[4'-fluoro-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinol-
in-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound 549)
Step 1:
1-Cyclohexyl-2-{2-[4'-fluoro-4-(pyrrolidine-1-carbonyl)biphen-2-yl-
]quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid ethyl ester
(Compound 549a)
[0954] A mixture of 200 mg (0.29 mmol) Compound 419d 62 mg (0.44
mmol) 4-fluorophenyl-boronic acid, 32 mg (0.029 mmol)
Pd(PPh.sub.3).sub.4 and 2 mL sat. NaHCO.sub.3 in 16 mL degassed
MeOH was heated at 90.degree. C. under Ar overnight. The mixture
was evaporated to dryness, the residue was taken up in
CH.sub.2Cl.sub.2 and purified on silica gel using
CH.sub.2Cl.sub.2/MeOH as eluent to yield 197 mg orange solid.
Step 2:
1-Cyclohexyl-2-{2-[4'-fluoro-4-(pyrrolidine-1-carbonyl)biphen-2-yl-
]quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound
549)
[0955] A solution of 197 mg (0.30 mmol) Compound 549a in 3.75 mL
THF, 3 mL MeOH and 0.75 mL 2 N NaOH was stirred at room temperature
overnight and then heated at 50.degree. C. for 1.5 h. After the
addition of 1.5 mL 1 M HCl, the solution was evaporated to dryness
and the residue was purified on HPLC to yield 66 mg yellow
solid.
[0956] MS: 639.40 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm) 8.43-8.35 (m, 2H), 8.31-8.25 (m, 2H), 8.11 (dd, 1H,
J=9 Hz and 1.8 Hz), 8.04 (dd, 1H, J=8.7 Hz and 1.5 Hz), 7.93 (d,
1H, J=1.5 Hz), 7.76 (dd, 1H, J=8.1 Hz and 1.8 Hz), 7.61-7.55 (m,
4H), 7.24 (m, 2H), 7.14 (m, 2H), 4.45 (m, 1H), 3.52 (m, 4H), 2.31
(m, 2H), 2.12 (m, 2H), 1.88 (m, 6H), 1.62 (m, 1H), 1.33 (m,
3H).
Example 240
Preparation of
1-Cyclohexyl-2-{2-[4'-methoxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quino-
lin-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound 561)
Step 1:
1-Cyclohexyl-2-{2-[4'-methoxy-4-(pyrrolidine-1-carbonyl)biphen-2-y-
l]quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid ethyl ester
(Compound 561a)
[0957] Prepared as described for Compound 549a using
4-methoxyphenylboronic acid instead of 4-fluorophenylboronic
acid.
Step 2:
1-Cyclohexyl-2-{2-[4'-methoxy-4-(pyrrolidine-1-carbonyl)biphen-2-y-
l]quinolin-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound
561)
[0958] Prepared as described for Compound 549 using Compound 561a
instead Compound 549a.
[0959] MS: 651.32 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm): 8.35-8.27 (m, 3H), 8.15-8.05 (m, 2H), 7.96 (d, 1H,
J=8.7 Hz), 8.90 (d, 1H, J=1.2 Hz), 7.73 (dd, 1H, J=7.8 Hz and 1.2
Hz), 7.55 (d, 2H, J=8.1 Hz), 7.15-7.11 (m, 3H), 6.86 (d, 2H, J=8.4
Hz), 4.43 (m, 1H), 3.72 (s, 3H), 3.52 (m, 4H), 2.31 (m, 2H), 2.07
(m, 2H), 1.87 (m, 6H), 1.62 (m, 1H), 1.33 (m, 3H).
Example 241
Preparation of
2-[2-(4'-Chloro-4-fluoro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benz-
oimidazole-5-carboxylic acid (Compound 563)
[0960] 1-(2-Bromo-5-fluoro-phenyl)-ethanone (868 mg, 4 mmol),
p-chlorophenylboronic acid (768 mg, 1.2 eq.), and
tetrakis(triphenylphosphine)palladium(0) (473 mg, 0.1 eq.), were
dissolved in 25 mL toluene, 6 mL methanol and 2.5 mL sat. sodium
bicarbonate solution. After degassing/sonicating the solution, the
sealed reaction vessel was heated to 80.degree. C. overnight. The
cooled solution was separated between ethyl acetate and water; the
aqueous phase extracted two more times with ethyl acetate, and the
organic fractions were combined, dried with sodium sulfate and
evaporated. Silica gel chromatography (5:1 hexanes/ethyl acetate)
gave 1-(4'-chloro-4-fluoro-biphen-2-yl)-ethanone (821 mg).
[0961] 1-(4'-Chloro-4-fluoro-biphen-2-yl)-ethanone (62 mg, 0.25
mmol) and
2-(4-amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid ethyl ester (98 mg, 0.25 mmol) were dissolved in 500 .mu.L
ethanol and 500 .mu.L 10% ethanolic KOH were added. The reaction
was stirred at 75.degree. C. overnight. The reaction was acidified
with 4N hydrochloric acid, extracted three times with ethyl
acetate, the organic extracts were dried with sodium sulfate and
then evaporated. Purification via reverse-phase HPLC gave 84 mg
product.
[0962] MS: 576.20 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
8.27-8.35 (m, 3H), 8.18 (8d, 1H, J=8.8 Hz), 8.07 (d, 1H, J=8.5 Hz),
8.01 (dd, 1H, J=2.1 Hz, 8.8 Hz), 8.92 (dd, 1H, J=1.4 Hz, 8.5 Hz),
7.84 (dd, 1H, J=5.9 Hz, 8.5 Hz), 7.38-7.47 (m, 2H), 7.31-7.36 (m,
2H), 7.18-7.22 (m, 2H), 7.15 (d, 1H, 8.5 Hz) 4.36-4.45 (m, 1H),
2.26-2.35 (m, 2H), 2.01-2.05 (m, 2H), 1.83-1.87 (m, 2H), 1.62-1.75
(m, 1H), 1.28-1.43 (m, 3H)
Example 242
Preparation of
2-[2-(4-amino-4'-chloro-biphen-2-yl)-quinolin-6-yl]-1-cyclohexyl-1H-benzo-
imidazole-5-carboxylic acid (Compound 569)
[0963] 1-(4'-Chloro-4-nitro-biphen-2-yl)-ethanone (69 mg, 0.25
mmol) and
2-(4-amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid ethyl ester (98 mg, 0.25 mmol) were dissolved in 500 .mu.L
ethanol and 500 .mu.L 10% ethanolic KOH were added. The reaction
was stirred at 75.degree. C. for 3 days. The reaction was acidified
with 4N hydrochloric acid, extracted three times with ethyl
acetate, the organic extracts were dried with sodium sulfate and
then evaporated. Purification via reverse-phase HPLC gave 18 mg
product.
[0964] MS: 563.22 (M+H.sup.+); H.sup.1-NMR (d.sub.6-acetone):
.delta.(ppm) 8.51-8.59 (m, 2H), 8.12-8.34 (m, 5H), 7.90-7.99 (m,
1H), 7.73 (d, 1H, 8.5 Hz), 7.61-7.68 (m, 1H), 7.15-7.36 (m, 5H),
4.70-4.75 (m, 1H), 2.46-2.58 (m, 2H), 2.22-2.30 (m, 2H), 1.92-2.00
(m, 2H), 1.72-1.75 (m, 1H), 1.46-1.55 (m, 3H)
Example 243
Preparation of
1-cyclohexyl-2-[2-(4,4'-dichloro-biphen-2-yl)-quinolin-6-yl]-1H-benzoimid-
azole-5-carboxylic acid (Compound 567)
Step 1: 1-(4'-chloro-4-chloro-biphen-2-yl)-ethanone (Compound
567a)
[0965] 1-(2-Bromo-5-chloro-phenyl)-ethanone (467 mg, 2 mmol;
synthesized similarly as described in Example 166 from
2-Bromo-5-chloro-benzoic acid), p-chlorophenylboronic acid (384 mg,
1.2 eq.), and tetrakis(triphenylphosphine)palladium(0) (237 mg, 0.1
eq.), were dissolved in 12.5 mL toluene, 3 mL methanol and 1.3 mL
sat. sodium bicarbonate solution. After degassing/sonicating the
solution, the sealed reaction vessel was heated to 80.degree. C.
overnight. The cooled solution was separated between ethyl acetate
and water; the aqueous phase extracted two more times with ethyl
acetate, and the organic fractions were combined, dried with sodium
sulfate and evaporated. Silica gel:chromatography (5:1
hexanes/ethyl acetate) gave the title intermediate (438 mg).
Step 2: The Title Compound
[0966] 1-(4'-Chloro-4-chloro-biphen-2-yl)-ethanone (132 mg, 0.5
mmol) and
2-(4-amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid ethyl ester (98 mg, 0.25 mmol) were dissolved in 500 .mu.L
ethanol and 500 .mu.L 10% ethanolic KOH were added. The reaction
was stirred at 75.degree. C. overnight. The reaction was acidified
with 4N hydrochloric acid, extracted three times with ethyl
acetate, the organic extracts were dried with sodium sulfate and
then evaporated. Purification via reverse-phase HPLC gave 132 mg
product.
[0967] MS: 592.17 (M+H.sup.+); H.sup.1-NMR (d.sub.6-acetone):
.delta.(ppm) 8.54-8.55 (m, 2H), 8.19-8.32 (m, 4H), 8.10 (dd, 1H,
J=1.0 Hz, 8.5 Hz), 7.88 (d, 1H, 2.0 Hz), 7.62 (dd, 1H, J=2.3 Hz,
8.3 Hz), 7.55 (d, 1H, 8.2 Hz), 7.22-7.33 (m, 5H), 4.73-4.82 (m,
1H), 2.46-2.54 (m, 2H), 2.28-2.32 (m, 2H), 1.94-1.97 (m, 2H),
1.71-1.75 (m, 1H), 1.46-1.55 (m, 3H)
Example 244
Preparation of
2-{2-[8-(4-chloro-phenyl)-3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-yl]-quin-
olin-6-yl}-1-cyclohexyl-1H-benzoimidazole-5-carboxylic acid
(Compound 565)
Step 1:
1-[8-(4-Chloro-phenyl)-3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-yl]--
ethanone (Compound 565a)
[0968] 1-(8-Bromo-3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-yl)-(1.08
g, 4 mmol), p chlorophenylboronic acid (768 mg, 1.2 eq.), and
tetrakis (triphenylphosphine)palladium(0) (473 mg, 0.1 eq.), were
dissolved in 25 mL toluene, 6 mL methanol and 2.5 mL of saturated
sodium bicarbonate solution. After degassing/sonicating the
solution, the sealed reaction vessel was heated to 80 C overnight.
The cooled solution was separated between ethyl acetate and water;
the aqueous phase extracted two more times with ethyl acetate, and
the organic fractions were combined, dried with sodium sulfate and
evaporated. Silica gel chromatography (5:1 hexanes/ethyl acetate)
was used for purification
Step 2: The Title Compound
[0969]
1-[8-(4-Chloro-phenyl)-3,4-dihydro-2H-benzo[b][1,4]dioxepin-7-yl]-e-
thanone (76 mg, 0.25 mmol) and
2-(4-amino-3-formyl-phenyl)-1-cyclohexyl-1H-benzoimidazole-5-carboxylic
acid ethyl ester (98 mg, 0.25 mmol) were dissolved in 500 .mu.L
ethanol and 500 .mu.L 10% ethanolic KOH were added. The reaction
was stirred at 75.degree. C. overnight. The reaction was acidified
with 4N hydrochloric acid, extracted three times with ethyl
acetate, the organic extracts were dried with sodium sulfate and
then evaporated. Purification via reverse-phase HPLC gave 132 mg of
the title compound.
[0970] MS: 630.23 (M+H.sup.+); H.sup.1-NMR (d6-DMSO): .delta.(ppm)
8.27-8.32 (m, 3H), 8.17 (d, 1H, J=8.8 Hz), 8.07 (d, 1H, 8.5 Hz),
8.02 (dd, 1H, 1.8 Hz, 9.1 Hz), 7.41 (s, 1H), 7.29-7.32 (m, 2H),
7.09-7.15 (m, 4H), 4.36-4.45 (m, 1H), 4.22-4.30 (m, 2H), 2.26-2.34
(m, 2H), 2.17-2.21 (m, 2H), 2.01-2.05 (m, 2H), 1.83-1.86 (m, 2H),
1.62-1.75 (m, 1H), 1.28-1.35 (m, 3H)
Example 245
Preparation of
2-[4-(2-tert-butoxycarbonylamino-ethylamino)-2-phenyl-quinolin-6-yl]-1-cy-
clohexyl-1H-benzoimidazole-5-carboxylic acid (Compound 399)
[0971] In this reaction 51 mg (0.1 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester were used. The nucleophile used was
(2-amino-ethyl)-carbamic acid tert-butyl ester. Yield: 21 mg
[0972] MS: 606.32 (M+H.sup.+); H.sup.1-NMR (CD.sub.3OD):
.delta.(ppm) 8.72 (s, 1H), 8.45 (s, 1H), 8.04-8.27 (m, 6H),
7.68-7.76 (m, 4H), 7.33 (s, 1H), 4.36-4.45 (m, 1H), 3.81 (tr, 2H,
5.6 Hz), 3.49 (tr, 2H, 5.6 Hz), 2.42-2.48 (m, 2H), 2.14-2.16 (m,
2H), 1.96-2.99 (m, 2H), 1.74-1.80 (m, 1H), 1.35-1.45 (m, 3H), 1.25
(s, 9H)
Example 246
Preparation of
1-Cyclohexyl-2-(4-hydrazino-2-phenyl-quinolin-6-yl)-1H-benzoimidazole-5-c-
arboxylic acid (Compound 466)
[0973] In this reaction 102 mg (0.2 mmol) of crude
2-(4-chloro-2-phenyl-quinolin-6-yl)-1-cyclohexyl-1H-benzoimidazole-5-carb-
oxylic acid ethyl ester was reacted with hydrazine as the
nucleophile as described for the preparation of Compound 481.
Yield: 3.7 mg
[0974] MS: 478.20 (M+H.sup.+); H.sup.1-NMR (CD.sub.3OD):
.delta.(ppm) 8.74 (s, 1H), 8.38-8.44 (m, 2H), 8.28-8.31 (m, 1H),
8.05-8.18 (m, 4H), 7.71-7.77 (m, 4H), 4.36-4.45 (m, 1H), 2.44-2.48
(m, 2H), 2.10-2.14 (m, 2H), 1.97-2.01 (m, 2H), 1.83-1.86 (m, 2H),
1.75-1.80 (m, 1H), 1.35-1.42 (m, 3H)
Example 247
Preparation of
1-Benzyl-2-[2-(4'-chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1H-benzoim-
idazole-5-carboxylic acid (Compound 559)
[0975] The title compound was prepared from resin 534a and
benzylamine according to the procedure described in the preparation
of Compound 534.
[0976] MS (ESI) 596.19 (M+H.sup.+); .sup.1H NMR (DMSO-d.sub.6)
.delta.(ppm) 8.45 (s, 1H), 8.35 (s, 1H), 8.26 (d, 1H, J=8.7 Hz),
8.17 (s, 2H), 7.95 (dd, 1H, J=1.5, 8.4 Hz), 7.72 (d, 1H, J=8.7 Hz),
7.45 (d, 1H, J=7.5 Hz), 7.32-7.26 (m, 6H), 7.18 (d, 2H, J=8.4 Hz),
7.10 (d, 2H, J=8.4 Hz), 7.04 (d, 2H, J=8.41 Hz), 5.81 (s, 2H), 3.87
(s, 3H).
Example 248
Preparation of
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-3H-ben-
zoimidazole-4-carboxylic acid (Compound 572)
Step 1. 2-Cyclohexylamino-3-nitro-benzoic acid ethyl ester
[0977] To a solution of 2-chloro-3-nitrobenzoic acid (0.85 g, 4.22
mmol) in anhydrous EtOH (50 mL) was bubbled with dry hydrogen
chloride for 2 h at room temperature and the mixture was then
stirred at room temperate overnight. After evaporation of solvent,
water (100 mL) was added and the precipitates were collected by
filtration and dried to give 2-chloro-3-nitro-benzoic acid ethyl
ester.
[0978] The crude 2-chloro-3-nitro-benzoic acid ethyl ester was
dissolved in acetonitrile (100 mL) and cyclohexylamine (2.5 mL,
21.83 mmol) was added. The mixture was stirred at reflux overnight.
After evaporation of solvent, water (100 mL) was added and the
precipitates were collected by filtration and dried to give
2-cyclohexylamino-3-nitro-benzoic acid ethyl ester (1.168 g, 95%).
MS: 293.16 (M+H.sup.+).
Step 2.
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-3-cyclohexyl-
-3H-benzoimidazole-4-carboxylic acid Compound 572)
[0979] 2-Cyclohexylamino-3-nitro-benzoic acid ethyl ester (0.165 g,
0.564 mmol) by hydrogenation according to procedure (1) in the
preparation of Compound 477d.
[0980] The amine was reacted with Compound 525c (0.23 g, 0.592
mmol) in the presence of HBTU (0.135 g, 0.356 mmol), followed
cyclization in AcOH according to procedure (2) in the preparation
of Compound 477d. Separation by RP HPLC (from 20% of buffer B to
99% of buffer B) gave the title compound (36 mg, 11%).
[0981] MS: 588.23 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.38 (d, 1H, J=1.5 Hz), 8.35 (d, 1H, J=9.0 Hz), 8.21 (d, 1H, J=8.7
Hz), 8.08 (dd, 1H, J=1.5, 8.5 Hz), 7.95 (dd, 1H, J=1.1, 8.0 Hz),
7.77 (d, 1H, J=7.5 Hz), 7.53 (d, 1H, J=7.5 Hz), 7.46 (d, 1H, J=8.7
Hz), 7.36 (d, 1H, J=2.4 Hz), 7.29-7.25 (m, 2H), 7.22-7.19 (m, 2H),
7.10 (d, 2H, J=8.1 Hz), 4.74-4.65 (m, 1H), 3.88 (s, 3H), 2.11-2.08
(m, 2H), 1.70-1.66 (m, 2H), 1.55-1.48 (m, 2H), 1.23-1.16 (m, 2H),
0.82-0.73-1.23 (m, 2H).
Example 249
Preparation of
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-(2-methyl-cyclohe-
xyl)-1H-benzoimidazole-5-carboxylic acid (Compound 556)
[0982] The title compound was prepared from resin 534a and
2-methylcyclopropylamine (a mixture of cis and trans) according to
the procedure described in the preparation of Compound 534. This
product is a mixture of cis and trans isomers.
[0983] MS: 602.24 (M+H.sup.+).
Example 250
Preparation of
2-[2-(4'-Chloro-4-methoxy-biphen-2-yl)-quinolin-6-yl]-1-piperidin-4-yl-1H-
-benzoimidazole-5-carboxylic acid (Compound 558)
[0984] The title compound was prepared from resin 534a and
4-amino-cyclohexanecarboxylic acid tert-butyl ester according to
the procedure described in the preparation of Compound 534.
[0985] MS: 589.22 (M+H); .sup.1H NMR (DMSO-d.sub.6) .delta.(ppm)
8.36 (d, 1H, J=8.7 Hz), 8.33-8.29 (m, 3H), 8.20 (d, 1H, J=8.7 Hz),
8.08 (dd, 2H, J=2.1, 8.7 Hz), 7.95 (dd, 1H, J=1.2, 8.4 Hz), 7.46
(d, 1H, J=8.4 Hz), 7.32-7.28 (m, 3H), 7.22-7.12 (m, 4H), 4.85 (m,
1H), 3.88 (s, 3H), 3.16-3.03 (m, 3H), 2.92-2.82 (m, 3H), 2.24-2.20
(m, 2H).
Example 251
Preparation of
1-Cyclohexyl-2-{2-[5-(pyrrolidine-1-carbonyl)-2-thiophen-2-yl]quinoline-6-
-yl}-1H-benzimidazole-5-carboxylic acid (Compound 400)
Step 1:
1-Cyclohexyl-2-{2-[5-(pyrrolidine-1-carbonyl)-2-thiophen-2-yl]quin-
oline-6-yl}-1H-benzimidazole-5-carboxylic acid ethyl ester
(Compound 400a)
[0986] Prepared as described for Compound 402a using
4-tiopheneboronic acid instead of 4-fluorophenylboronic acid.
Step 2:
1-Cyclohexyl-2-{2-[5-(pyrrolidine-1-carbonyl)-2-thiophen-2-yl]quin-
oline-6-yl}-1H-benzimidazole-5-carboxylic acid (Compound 400)
[0987] Prepared as described for Compound 402 using Compound 400a
instead of Compound 402a.
[0988] MS: 627.25 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm): 8.52-8.49 (m, 2H), 8.38-8.29 (m, 3H), 8.16-8.04 (m,
2H), 7.81-7.69 (m, 3H), 7.54-7.44 (m, 2H), 7.00-6.93 (m, 2H), 4.40
(m, 1H), 3.51 (m, 4H), 2.30 (m, 2H), 2.15 (m, 2H), 1.87 (m, 6H),
1.62 (m, 1H), 1.38 (m, 3H).
Example 252
Preparation of
2-{2-[4'-Carboxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinolin-6-yl}-1-c-
yclohexyl-1H-benzimidazole-5-carboxylic acid (Compound 453)
Step 1:
2-{2-[4'-Carboxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinolin-6--
yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic acid ethyl ester
(Compound 453a)
[0989] Prepared as described for Compound 549a using
4-carboxyphenylboronic acid instead of 4-fluorophenylboronic
acid.
Step 2:
2-{2-[4'-Carboxy-4-(pyrrolidine-1-carbonyl)biphen-2-yl]quinolin-6--
yl}-1-cyclohexyl-1H-benzimidazole-5-carboxylic acid (Compound
453)
[0990] Prepared as described for Compound 549 using Compound 453a
instead of Compound 549a.
[0991] MS: 665.26 (M+H.sup.+); .sup.1H-NMR (DMSOd.sub.6):
.delta.(ppm): 8.47-8.28 (m, 6H), 8.14-8.06 (m, 2H), 7.97 (d, J=1.8
Hz), 7.85-7.78 (m, 2H), 7.68-7.62 (m, 2H), 7.34-7.26 (m, 2H), 4.47
(m, 1H), 3.39 (m, 4H), 2.47 (m, 2H), 2.12 (m, 2H), 1.88 (m, 6H),
1.62 (m, 1H), 1.34 (m, 3H).
BIOLOGICAL EXAMPLES
Example A
Anti-Hepatitis C Activity
[0992] Compounds can exhibit anti-hepatitis C activity by
inhibiting HCV polymerase, by inhibiting other enzymes needed in
the replication cycle, or by other pathways. A number of assays
have been published to assess these activities. A general method
that assesses the gross increase of HCV virus in culture is
disclosed in U.S. Pat. No. 5,738,985 to Miles et al. In vitro
assays have been reported in Ferrari et al. Jnl. of Vir.,
73:1649-1654, 1999; Ishii et al., Hepatology, 29:1227-1235, 1999;
Lohmann et al., Jnl of Bio. Chem., 274:10807-10815, 1999; and
Yamashita et al., Jnl. of Bio. Chem., 273:15479-15486, 1998.
[0993] WO 97/12033, filed on Sep. 27, 1996, by Emory University,
listing C. Hagedom and A. Reinoldus as inventors, which claims
priority to U.S. Ser. No. 60/004,383, filed on September 1995,
describes an HCV polymerase assay that can be used to evaluate the
activity of the of the compounds described herein. Another HCV
polymerase assay has been reported by Bartholomeusz, et. al.,
Hepatitis C Virus (HCV) RNA polymerase assay using cloned HCV
non-structural proteins; Antiviral Therapy 1996:1 (Supp 4)
18-24.
[0994] Screens that measure reductions in kinase activity from HCV
drugs are disclosed in U.S. Pat. No. 6,030,785, to Katze et al.,
U.S. Pat. No. Delvecchio et al., and U.S. Pat. No. 5,759,795 to
Jubin et al. Screens that measure the protease inhibiting activity
of proposed HCV drugs are disclosed in U.S. Pat. No. 5,861,267 to
Su et al., U.S. Pat. No. 5,739,002 to De Francesco et al., and U.S.
Pat. No. 5,597,691 to Houghton et al.
Example B
Replicon Assay
[0995] A cell line, ET (Huh-lucubineo-ET) was used for screening of
compounds of the present invention for HCV replication. The ET cell
line was stably transfected with RNA transcripts harboring a
I.sub.389luc-ubi-neo/NS3-3'/ET replicon with firefly
luciferase-ubiquitin-neomycin phosphotransferase fusion protein and
EMCV-IRES driven NS3-5B polyprotein containing the cell culture
adaptive mutations (E1202G; T1280I; K1846T) (Krieger at al, 2001
and unpublished). The ET cells were grown in DMEM, supplemented
with 10% fetal calf serum, 2 mM Glutamine, Penicillin (100
IU/mL)/Streptomycin (100 .mu.g/mL), 1.times. nonessential amino
acids, and 250 .mu.g/mL G418 ("Geneticin"). They are all available
through Life Technologies (Bethesda, Md.). The cells were plated at
0.5-1.0.times.10.sup.4 cells/well in the 96 well plates and
incubated for 24 h before adding test compounds. Then the compounds
each at 5 and 50 .mu.M were added to the cells. Luciferase activity
was measured 48-72 hours later by adding a lysis buffer and the
substrate (Catalog number Glo-lysis buffer E2661 and Bright-Glo
leuciferase system E2620 Promega, Madison, Wis.). Cells should not
be too confluent during the assay. Percent inhibition of
replication was plotted relative to no compound control. Under the
same condition, cytotoxicity of the compounds was determined using
cell proliferation reagent, WST-1 (Roche, Germany). The compounds
showing antiviral activities, but no significant cytotoxicities
were chosen to determine IC.sub.50 and TC.sub.50.
Example C
Cloning and Expression of Recombinant HCV-NS5b
[0996] The coding sequence of NS5b protein was cloned by PCR from
pFKI.sub.389luc/NS3-3'/ET as described by Lohmann, V., et al.
(1999) Science 285, 110-113 using the following primers:
TABLE-US-00011 (SEQ. ID. NO. 1) aggacatggatccgcggggtcgggcacgagacag
(SEQ. ID. NO. 2) aaggctggcatgcactcaatgtcctacacatggac
[0997] The cloned fragment was missing the C terminus 21 amino acid
residues. The cloned fragment was inserted into an IPTG-inducible
expression plasmid that provided an epitope tag (His)6 at the
carboxy terminus of the protein.
[0998] The recombinant enzyme was expressed in XL-1 cells and after
induction of expression, the protein was purified using affinity
chromatography on a nickel-NTA column. Storage condition was 10 mM
Tris-HCl pH 7.5, 50 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 20% glycerol at
-20.degree. C.
Example D
HCV-NS5b Enzyme Assay
[0999] The polymerase activity was assayed by measuring
incorporation of radiolabeled UTP into a RNA product using a
biotinylated, heteropolymeric template, which included a portion of
the HCV genome. Typically, the assay mixture (50 .mu.L) contained
10 mM Tris-HCl (pH 7.5), 5 mM MgCl.sub.2, 0.2 mM EDTA, 10 mM KCl, 1
unit/.mu.L RNAsin, 1 mM DTT, 10 .mu.M each of NTP, including
[.sup.3H]-UTP, and 10 ng/.mu.L heteropolymeric template. Test
compounds were initially dissolved in 100% DMSO and further diluted
in aqueous buffer containing 5% DMSO. Typically, compounds were
tested at concentrations between 1 nM and 100 .mu.M. Reactions were
started with addition of enzyme and allowed to continue at
37.degree. C. for 2 hours. Reactions were quenched with 8 .mu.L of
100 mM EDTA and reaction mixtures (30 .mu.L) were transferred to
streptavidin-coated scintillation proximity microtiter plates
(FlashPlates) and incubated at 4.degree. C. overnight.
Incorporation of radioactivity was determined by scintillation
counting.
[1000] Shown in Table IX below are the values for enzyme inhibition
measured at compound concentrations of 100 and 33 uM, (% inh@199
and % inh@33, respectively). The percent inhibition values are
calculated from the differential incorporation of radioactivity
compared to a control reaction without compound:
%
inhibition=100-[(Counts.sub.INH-Counts.sub.BKG)/Counts.sub.CTRL-Counts-
.sub.BKG).times.100
where Counts.sub.INH is the signal of the testwell with inhibitor,
Counts.sub.BKG is the background signal and Counts.sub.CTRL is the
signal of a testwell without inhibitor.
TABLE-US-00012 TABLE IX Percent Inhibition Data Cmpd # % inh@100 %
inh@33 203 97.54 74.98 204 100.95 99.68 205 98.95 84.42 206 96.87
94.16 215 100.88 99.25 230 98.22 92.74 231 97.54 66.96 232 80.22
60.45 233 88.16 49.99 234 100.11 98.59 235 99.50 99.07 236 99.25
99.19 237 95.62 79.74 238 98.40 97.60 239 70.15 49.12 240 96.08
95.74 241 98.41 98.00 242 97.00 97.40 243 98.12 95.99 244 97.02
75.71 245 97.38 73.22 246 96.40 95.92 247 94.24 66.78 248 86.78
47.36 249 97.15 94.51 258 97.99 97.03 259 99.36 99.71 310 98.33
83.24 311 93.27 83.02 351 98.13 94.87 352 98.82 94.18 353 67.52
67.33 354 100.55 97.99 355 89.31 72.35 356 100.47 101.08 357 100.55
98.79 358 95.33 85.08 359 99.60 97.29 360 97.86 97.56 361 98.71
100.00 362 98.43 100.52 363 100.53 98.36 364 100.54 98.60 365
102.60 102.25 366 99.38 97.62 367 100.85 102.67 368 79.47 51.25 369
98.80 96.18 370 99.67 97.76 372 98.17 98.12 373 83.79 39.89 374
98.32 97.62 376 97.19 97.42 377 99.42 99.20 378 100.93 100.39 379
97.78 93.32 380 101.16 97.59 381 98.05 94.33 382 100.73 101.35 384
99.26 95.54 385 76.24 42.63 386 99.90 100.34 387 98.68 99.05 388
98.58 98.73 389 99.55 99.92 390 92.52 79.87 391 97.45 94.13 392
93.53 83.75 393 96.94 97.56 394 100.04 98.90 395 101.21 100.10 396
100.24 100.13 397 99.28 95.57 398 92.05 59.65 399 101.52 95.64 401
101.01 100.40 403 99.93 99.42 404 101.17 102.42 405 98.89 90.50 406
98.06 97.29 408 98.86 99.29 409 99.86 97.88 410 88.64 84.34 411
91.45 78.12 412 100.15 98.44 413 100.19 95.50 414 96.83 93.43 415
101.59 101.27 416 102.51 100.70 417 97.98 97.75 418 102.87 103.58
419 101.14 100.67 420 98.26 98.26 421 100.12 100.02 422 99.18 98.76
423 101.62 102.46 424 99.09 98.70 425 98.18 96.17 426 101.61 96.59
427 98.37 93.85 428 99.57 98.85 429 100.88 96.25 430 96.65 98.02
431 96.38 95.34 432 96.37 88.94 433 100.50 92.47 434 102.40 104.83
435 101.42 102.36 436 99.29 98.82 437 100.51 100.29 438 99.60 98.71
439 97.03 99.19 440 97.75 99.15 441 98.75 97.35 442 98.23 92.50 443
98.70 87.01 444 100.55 99.55 445 99.64 96.88 446 100.99 96.61 447
94.86 97.83 448 96.03 94.57 449 101.33 99.77 450 99.70 96.48 451
95.64 76.27 452 102.35 102.39 454 100.56 98.26 455 99.79 100.03 456
99.69 100.26 457 98.33 98.21 458 103.55 100.15 459 99.82 99.54 460
101.72 100.53 461 96.65 97.89 462 101.29 98.24 463 97.17 95.99 464
100.35 99.74 465 100.83 98.78 466 100.12 92.92 467 100.48 96.33 468
99.12 99.33 469 98.24 94.22 470 99.37 100.78 471 99.81 97.79 472
98.07 97.10 473 97.41 99.22 474 100.57 96.95 475 95.91 97.50 476
97.06 97.35 477 95.91 92.43 478 97.15 95.80 479 102.24 99.64 480
103.84 101.37 481 96.74 76.46 482 100.85 100.12 483 99.39 101.50
484 98.30 99.62 485 99.54 98.59 486 97.89 93.46 487 101.00 101.69
488 97.17 91.81 489 96.01 87.01 490 94.33 95.94 491 99.95 98.35 492
100.37 99.19 493 99.96 101.32 494 99.18 94.82 495 100.98 99.76 496
101.35 101.25 497 88.47 65.45 498 100.08 98.48 499 99.74 100.97 500
100.96 101.33 501 96.82 90.61 502 100.17 99.04 503 96.99 95.76 504
99.97 98.26 505 101.67 99.73 506 99.12 98.92 507 100.68 100.80 508
98.89 98.94 509 100.70 100.44 510 100.14 99.45 511 94.96 78.44 512
97.87 78.89 513 95.91 93.18 514 91.87 89.64 515 88.31 81.94 516
100.07 99.30 517 97.78 81.02 518 97.84 75.95 519 99.11 96.88 520
98.89 94.81 521 91.41 84.85 522 74.23 76.67 523 94.97 87.14 524
93.58 74.09 525 100.63 100.83 526 98.99 96.84 527 100.64 99.42 528
101.32 100.28 529 99.75 99.20 530 98.15 98.17 531 99.26 99.98 532
98.77 99.64 533 89.85 56.75 534 101.02 90.07 535 100.49 100.97 536
98.87 97.55 537 99.76 100.24 538 72.78 56.60 539 102.41 104.03 540
95.05 91.13 541 98.14 76.08 542 98.58 81.13 543 101.90 102.06 544
100.09 101.67 545 101.02 99.18 546 101.72 95.35 547 101.82 102.71
548 100.68 102.77 549 102.09 100.38 550 101.72 99.13 551 95.68
87.53 552 100.63 101.29 554 82.03 64.68 555 100.85 101.06 556
102.27 102.72 557 101.41 102.52 558 77.35 32.53 559 101.13 101.11
560 100.73 101.03 562 101.41 101.94 563 100.87 100.69 564 101.39
102.31 565 100.47 102.26 566 100.49 99.17 567 97.65 100.79 568
100.49 100.99 569 100.78 100.86
Formulation Examples
[1001] The following are representative pharmaceutical formulations
containing a compound of formula I.
Formulation Example 1
Tablet Formulation
[1002] The following ingredients are mixed intimately and pressed
into single scored tablets.
TABLE-US-00013 Quantity per Ingredient tablet, mg compound of this
invention 400 cornstarch 50 croscarmellose sodium 25 lactose 120
magnesium stearate 5
Formulation Example 2
Capsule Formulation
[1003] The following ingredients are mixed intimately and loaded
into a hard-shell gelatin capsule.
TABLE-US-00014 Quantity per Ingredient capsule, mg compound of this
invention 200 lactose, spray-dried 148 magnesium stearate 2
Formulation Example 3
Suspension Formulation
[1004] The following ingredients are mixed to form a suspension for
oral administration.
TABLE-US-00015 Ingredient Amount compound of this invention 1.0 g
fumaric acid 0.5 g sodium chloride 2.0 g methyl paraben 0.15 g
propyl paraben 0.05 g granulated sugar 25.0 g sorbitol (70%
solution) 13.00 g Veegum K (Vanderbilt Co.) 1.0 g flavoring 0.035
mL colorings 0.5 mg distilled water q.s. to 100 mL
Formulation Example 4
Injectable Formulation
[1005] The following ingredients are mixed to form an injectable
formulation.
TABLE-US-00016 Ingredient Amount compound of this invention 0.2
mg-20 mg sodium acetate buffer solution, 0.4 M 2.0 mL HCl (1N) or
NaOH (1N) q.s. to suitable pH water (distilled, sterile) q.s. to 20
mL
Formulation Example 5
Suppository Formulation
[1006] A suppository of total weight 2.5 g is prepared by mixing
the compound of the invention with Witepsol.RTM. H-15
(triglycerides of saturated vegetable fatty acid; Riches-Nelson,
Inc., New York), and has the following composition:
TABLE-US-00017 Ingredient Amount Compound of the invention 500 mg
Witepsol .RTM. H-15 balance
* * * * *