U.S. patent application number 12/143320 was filed with the patent office on 2009-03-19 for promoterless cassettes for expression of alphavirus structural proteins.
This patent application is currently assigned to AlphaVax, Inc.. Invention is credited to Kurt I. Kamrud, Maureen Maughan, Jonathan F. Smith.
Application Number | 20090075384 12/143320 |
Document ID | / |
Family ID | 40156867 |
Filed Date | 2009-03-19 |
United States Patent
Application |
20090075384 |
Kind Code |
A1 |
Kamrud; Kurt I. ; et
al. |
March 19, 2009 |
PROMOTERLESS CASSETTES FOR EXPRESSION OF ALPHAVIRUS STRUCTURAL
PROTEINS
Abstract
The present invention provides an isolated RNA molecule
comprising: a) an alphavirus 5' replication recognition sequence,
wherein at least one initiation codon has been removed from the 5'
replication recognition sequence; b) a nucleotide sequence encoding
an alphavirus structural protein; and c) an alphavirus 3'
replication recognition sequence, with the proviso that the RNA
molecule does not contain a promoter that directs transcription of
the nucleotide sequence of (b), and wherein the alphavirus 5' and
3' replication recognition sequences of (a) and (c) direct
replication of the RNA molecule in the presence of alphavirus
nonstructural proteins.
Inventors: |
Kamrud; Kurt I.; (Apex,
NC) ; Smith; Jonathan F.; (Cary, NC) ;
Maughan; Maureen; (Durham, NC) |
Correspondence
Address: |
MYERS BIGEL SIBLEY & SAJOVEC
PO BOX 37428
RALEIGH
NC
27627
US
|
Assignee: |
AlphaVax, Inc.
|
Family ID: |
40156867 |
Appl. No.: |
12/143320 |
Filed: |
June 20, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60936637 |
Jun 21, 2007 |
|
|
|
Current U.S.
Class: |
435/465 ;
424/204.1; 424/93.2; 435/235.1; 435/320.1; 435/325; 435/455;
536/23.1; 536/23.72 |
Current CPC
Class: |
A61P 31/00 20180101;
A61P 31/14 20180101; C12N 15/86 20130101; A61K 39/12 20130101; A61K
2039/5256 20130101; A61P 35/00 20180101; C12N 2770/36143 20130101;
C12N 2710/24134 20130101; A61P 37/04 20180101; C12N 2770/36134
20130101; A61P 31/12 20180101; A61K 39/285 20130101 |
Class at
Publication: |
435/465 ;
536/23.72; 435/455; 435/235.1; 424/93.2; 424/204.1; 435/325;
435/320.1; 536/23.1 |
International
Class: |
C12N 15/09 20060101
C12N015/09; C07H 21/02 20060101 C07H021/02; A61K 35/76 20060101
A61K035/76; A61K 39/12 20060101 A61K039/12; C12N 5/10 20060101
C12N005/10; C12N 15/63 20060101 C12N015/63 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] Aspects of this invention were supported by funding under
Grant No. 5 UO1 A1057286-03 from the National Institutes of Health.
The U.S. Government has certain rights in this invention.
Claims
1. An isolated RNA molecule comprising: a) an alphavirus 5'
replication recognition sequence, wherein at least one initiation
codon has been removed from the 5' replication recognition
sequence; b) a nucleotide sequence encoding an alphavirus
structural protein; and c) an alphavirus 3' replication recognition
sequence, with the proviso that the RNA molecule does not contain a
promoter that directs transcription of the nucleotide sequence of
(b), and wherein the alphavirus 5' and 3' replication recognition
sequences of (a) and (c) direct replication of the entire RNA
molecule in the presence of alphavirus nonstructural proteins.
2. The RNA molecule of claim 1, wherein the nucleotide sequence
encoding the alphavirus structural protein is selected from the
group consisting of a nucleotide sequence encoding 1) an alphavirus
capsid protein, 2) alphavirus E1 and E2 proteins in any order, 3)
alphavirus capsid protein and alphavirus E1 protein in any order,
5) alphavirus capsid protein and alphavirus E2 protein in any
order, 6) alphavirus E2 protein, and 7) alphavirus E1 protein.
3. The RNA molecule of claim 1, wherein the alphavirus 5'
replication recognition sequence is the 5' replication recognition
sequence of Venezuelan equine encephalitis virus.
4. The RNA molecule of claim 3, wherein the 5' replication
recognition sequence is between 70 and 524 nucleotides in
length.
5. The RNA molecule of claim 1, wherein the alphavirus 3'
replication recognition sequence is the 3' replication recognition
sequence of Venezuelan equine encephalitis virus.
6. The RNA molecule of claim 3, wherein the alphavirus 3'
replication recognition sequence is the 3' replication recognition
sequence of Venezuelan equine encephalitis virus.
7. The RNA molecule of claim 1, wherein the 3' replication
recognition sequence is 19 to 325 nucleotides in length.
8. The RNA molecule of claim 1, wherein the at least one initiation
codon is the initiation codon for nonstructural protein 1
(nsp1).
9. The RNA molecule of claim 1, wherein all initiation codons have
been removed from the 5' replication recognition sequence.
10. The RNA molecule of claim 1, wherein the RNA is capped at the
5' terminus
11. A method of making an alphavirus replicon particle, comprising
introducing one or more of the RNA molecules of claim 1 into a
cell, whereby the combination of RNA molecules encodes all
alphavirus structural proteins necessary for production of an
alphavirus replicon particle, along with an alphavirus replicon
RNA, under conditions whereby alphavirus replicon particles are
produced.
12. The method of claim 11, wherein two RNA molecules are
introduced into the cell, wherein a first RNA molecule of the two
RNA molecules encodes one or more alphavirus structural proteins
and a second RNA molecule of the two RNA molecules encodes one or
more alphavirus structural proteins, at least one of which is
different from the alphavirus structural proteins encoded by the
first RNA molecule.
13. The method of claim 11, wherein three RNA molecules are
introduced into the cell, wherein a first RNA molecule of the three
RNA molecules encodes one or more alphavirus structural proteins
and a second RNA molecule of the three RNA molecules encodes one or
more alphavirus structural proteins, at least one of which is
different from the alphavirus structural proteins encoded by the
first RNA molecule and a third RNA molecule encodes one or more
alphavirus structural proteins, at least one of which is different
from the alphavirus structural proteins encoded by the first RNA
molecule and the second RNA molecule.
14. The method of claim 11, wherein at least one of the one or more
RNA molecules is capped at the 5' terminus.
15. A method of making an alphavirus replicon particle, comprising
introducing into a cell: a) an alphavirus replicon RNA; b) one or
more of the RNA molecules of claim 1; and c) one or more
promoter-assisted alphavirus helper constructs, whereby the
combination of RNA molecules of (b) and helper constructs of (c)
encodes all alphavirus structural proteins necessary for production
of an alphavirus replicon particle, under conditions whereby an
alphavirus replicon particle is produced.
16. The method of claim 15, wherein at least one of the one or more
RNA molecules is capped at the 5' terminus.
17. A population of alphavirus replicon particles, comprising a
subset of particles comprising the RNA molecule of claim 1, wherein
the population contains no detectable replication-competent
alphavirus virus particles per 108 alphavirus replicon particles,
as determined by passage on permissive cells in culture.
18. A population of alphavirus replicon particles, comprising a
subset of particles comprising the RNA molecule of claim 1, wherein
the population contains no detectable replication-competent
alphavirus particles per 108 alphavirus replicon particles, as
determined by passage on permissive cells in culture, wherein the
alphavirus replicon particles comprise one or more attenuating
mutations in either an alphavirus structural protein or an
alphavirus nonstructural protein or both an alphavirus structural
protein and an alphavirus nonstructural protein.
19. A composition comprising the population of claim 17 in a
pharmaceutically acceptable carrier.
20. A composition comprising the population of claim 18 in a
pharmaceutically acceptable carrier.
21. A method of inducing an immune response in a subject,
comprising administering an effective amount of the population of
claim 17 to the subject.
22. A method of inducing an immune response in a subject,
comprising administering an effective amount of the population of
claim 18 to the subject.
23. A cell comprising the RNA molecule of claim 1.
24. A vector comprising the RNA molecule of claim 1.
25. A nucleic acid construct comprising the RNA molecule of claim
1.
26. A cell comprising the vector of claim 24.
27. A cell comprising the nucleic acid construct of claim 25.
Description
STATEMENT OF PRIORITY
[0001] The present invention claims the benefit, under 35 U.S.C.
.sctn. 119(e), of U.S. Provisional Application No. 60/936,637,
filed Jun. 21, 2007, the entire contents of which are incorporated
by reference herein.
FIELD OF THE INVENTION
[0003] The present invention relates to improved constructs for and
methods of making recombinant alphavirus particles.
BACKGROUND OF THE INVENTION
[0004] Alphaviruses are currently being used as vector platforms to
develop vaccines for infectious diseases and cancer (e.g., see U.S.
Pat. Nos. 5,792,462; 6,156,558; 5,811,407; 6,531,135; 6,541,010;
6,783,939; 6,844,188; 6,982,087; 7,045,335; 5,789,245; 6,015,694;
5,739,026; Pushko et al., Virology 239(2):389-401 (1997), Frolov et
al., J. Virol. 71(1):248-258 (1997); Smerdou and Liljestrom, J.
Virol. 73(2):1092-1098 (1999)). Alphaviruses comprise a genus in
the Togaviridae family, and members of the genus are found
throughout the world, in both vertebrate and invertebrate hosts.
Among the most studied alphaviruses for vector platforms are
Venezuelan Equine Encephalitis (VEE) Virus, Semliki Forest Virus
(SFV), and Sindbis Virus (SV), the prototype member of the
genus.
[0005] One such vector platform is the alphavirus replicon system,
described in U.S. Pat. No. 6,190,666 to Garoff et al., U.S. Pat.
Nos. 5,792,462 and 6,156,558 to Johnston et al., U.S. Pat. Nos.
5,814,482, 5,843,723, 5,789,245, 6,015,694, 6,105,686 and 6,376,236
to Dubensky et al; U.S. Published Application No. 2002-0015945 A1
(Polo et al.), U.S. Published Application No. 2001-0016199
(Johnston et al.), Frolov et al. (1996) Proc. Natl. Acad. Sci. USA
93:11371-11377 and Pushko et al. (1997) Virology 239:389-401. An
alphavirus replicon vector is engineered to contain and express one
or more nucleic acids of interest, where the nucleic acid of
interest can encode, for example, an antigen, a cytokine, a
ribozyme, or an enzyme. The alphavirus replicon vector can be
derived from any alphavirus, such as Venezuelan Equine Encephalitis
(VEE) virus, Sindbis virus, e.g., strain TR339, South African
Aibovirus No. 86, and Semliki Forest virus, among others. The
vector is then introduced into cells in culture that allow
replication of alphaviruses and in which the structural proteins of
the alphavirus are also expressed, so that the vector is packaged
by the alphavirus structural proteins into alphavirus replicon
particles (ARPs). ARPs are then harvested from the culture and
delivered into subjects for a variety of therapeutic purposes.
[0006] Various constructs have been developed to enhance
immunogenicity and effectiveness of the ARP system in vaccine
applications. Many of these constructs have also been designed to
decrease the likelihood of formation of replication-competent
alphavirus through recombination of genome fragments. Johnston et
al. (U.S. Pat. Nos. 5,792,462 and 6,156,558) recognized the
potential for recombination from a single helper system (in which
the complete set of structural protein genes of an alphavirus are
on one RNA molecule and the nonstructural protein genes and
heterologous nucleic acid of interest are on a separate replicon
RNA), and thus designed "double-helper" systems that utilized two
helper RNAs to encode the structural proteins. Dubensky et al.
(U.S. Pat. No. 5,789,245) and Polo et al. (U.S. Pat. No. 6,242,259)
describe the use of two DNA alphavirus structural protein
expression cassettes, stably transformed into a packaging cell
line, to package alphavirus vectors by production of RNAs
expressing those structural proteins upon introduction of a
replicating alphavirus vector into cultures of the packaging cell.
Liljestrom and colleagues have presented data confirming that a
"single helper system" will generate wild-type alphavirus particles
(Berglund, et al. Biotechnology 11(8): 916-920 (1993)). Smith et al
have described other novel RNA helpers that direct expression of
the structural proteins (WO 2004/085660).
[0007] By distributing the viral coding sequences among three
nucleic acids, two of which comprise the helper system, as
described above, the theoretical frequency of recombination that
would create a replication-competent virus ("RCV") is reduced
significantly relative to single helper systems. These systems
include the use of the alphaviral subgenomic promoter, often
referred to as the 26S promoter or the viral junction region
promoter, to provide a construct which functions as an independent
transcriptional unit and the use of the alphavirus RNA polymerase
recognition signals, so that the helper systems can take advantage
of the presence of the alphavirus replication machinery for
amplification and efficient expression of helper functions.
[0008] In existing systems, known packaging signals are typically
included in replicon RNAs and excluded from helper constructs.
However, helper RNAs are nonetheless packaged or copackaged at a
lower frequency (Lu and Silver. J. Virol Methods, 91(1):59-65
(2001)), and helper constructs with terminal recognition signals
will be amplified and expressed in the presence of a replicon,
potentially yielding recombination events with other helper
molecules or the replicon RNA.
[0009] Animal studies with alphavirus replicon particles have
employed doses ranging from 10.sup.5 to 10.sup.8, with 10.sup.7,
5.times.10.sup.7 and 10.sup.8 having been effectively employed in
non-human primates, which are also the doses being used in human
clinical trials. In addition, higher doses such as
2.times.10.sup.8, 5.times.10.sup.8 and 10.sup.9 are also useful in
applications for humans. Such dosages require large scale
manufacturing procedures, and at such scale, it is statistically
possible that replication-competent alphavirus may be generated
with existing RNA helper systems.
[0010] Thus, there remains a need in the art to provide improved
systems for manufacturing alphavirus replicon particles to further
reduce the predicted frequency for formation of
replication-competent alphavirus, and to optimize manufacturing
strategies and costs.
[0011] The present invention provides alphavirus RNA helper
molecules encoding alphavirus structural proteins that lack a
promoter sequence, thereby significantly decreasing the theoretical
number of functional recombination events that might occur between
the helper molecules and the replicon vector, resulting in a
decrease in the theoretical prediction for the rate of formation of
replication-competent alphavirus during the production of
recombinant alphavirus particles.
SUMMARY OF THE INVENTION
[0012] The present invention provides an isolated RNA molecule
comprising: a) an alphavirus 5' replication recognition sequence,
wherein an initiation codon has been removed from the 5'
replication recognition sequence; b) a nucleotide sequence encoding
an alphavirus structural protein; and c) an alphavirus 3'
replication recognition sequence, with the proviso that the RNA
molecule does not contain a promoter that directs transcription of
the nucleotide sequence of (b), and wherein the alphavirus 5' and
3' replication recognition sequences direct replication of the
entire RNA molecule in the presence of alphavirus nonstructural
proteins.
[0013] Additionally provided herein is a method of making an
alphavirus replicon particle, comprising introducing one or more of
the RNA molecules of this invention into a cell, whereby the
combination of RNA molecules encodes all alphavirus structural
proteins necessary for production of an alphavirus replicon
particle, along with an alphavirus replicon RNA, under conditions
whereby alphavirus replicon particles are produced.
[0014] Further provided is a method of making an alphavirus
replicon particle, comprising introducing into a cell: a) an
alphavirus replicon RNA; b) one or more of the RNA molecules of
this invention; and c) one or more promoter-assisted alphavirus
helper constructs, whereby the combination of RNA molecules of (b)
and helper constructs of (c) encodes all alphavirus structural
proteins necessary for production of an alphavirus replicon
particle, under conditions whereby an alphavirus replicon particle
is produced.
[0015] In additional embodiments, the present invention provides a
population of alphavirus replicon particles, wherein the population
contains no detectable replication-competent virus particles, as
determined by passage on permissive cells in culture.
[0016] Also provided herein is a population of alphavirus replicon
particles, wherein the population contains no detectable
replication-competent virus particles, as determined by passage on
permissive cells in culture, wherein the alphavirus replicon
particles comprise one or more attenuating mutations in either an
alphavirus structural protein or an alphavirus nonstructural
protein or both an alphavirus structural protein and an alphavirus
nonstructural protein.
[0017] Furthermore, the present invention provides a method of
inducing an immune response in a subject, comprising administering
an effective amount of the population of alphavirus replicon
particles of this invention to the subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 shows the structure of the 5' replication recognition
sequence (RRS) of a full length (FL) promoterless helper molecule.
The location of start codons upstream of the capsid or glycoprotein
(GP) initiation codons within the 5' replication recognition
sequence are indicated with outlined lines and black lines.
Outlined lines indicate start codons that are in-frame with the
coding sequence for capsid or GP. Black lines indicate start codons
that are out-of-reading frame with the coding sequence for capsid
or GP. Numbers under the vertical lines indicate the first
nucleotide positions for the putative start codons in the 5'
replication recognition sequence, numbered from the 5' terminus of
the molecule.
[0019] FIG. 2 shows the structure of 5' replication recognition
sequence deletions in a promoterless helper molecule. The outlined
boxes indicate the 5' replication recognition sequence remaining in
each construct and the number inside the box is the nucleotide
length of the sequence. Thin black lines indicate the 5'
replication recognition sequence that has been deleted from each
construct. Boxes with diagonal stripes represent the location of
the coding sequence for either capsid or GP.
[0020] FIG. 3 is a Northern blot analysis. Total cellular RNA was
extracted from Vero cells electroporated with 30 .mu.g of
pERK/342/MS/BoNT A replicon mRNA and either 30 .mu.g of dHE1-6M1 (a
promoterless E1 helper) or 30 .mu.g of a GP helper RNA containing a
26S promoter (13.4.6). RNA for each sample (5 .mu.g) was run on a
1% glyoxal gel and transferred to a BrightStar.RTM. membrane
(Ambion; Austin, Tex.). A probe specific for the genomic sense
alphavirus RNA 3' end was used to detect replication of the
helpers. Lane 1: RNA molecular weight marker, lane 2: dHE1-6M1
helper+BoNT A replicon, lane 3: promoter-assisted GP helper+BoNT A
replicon.
[0021] FIG. 4 is a diagram showing the C-terminal amino acid and
nucleotide sequence of the ubiquitin monomer and N-terminal
residues of alphavirus capsid and glycoprotein coding sequences for
ubiquitinated (dHcapU and dHgpU) or standard (dHcap and dHgp)
constructs. The "Met Phe," "Pro Met Phe," "Pro Thr Met Ser," and
"Thr Met Ser" at the right end of these sequences represent amino
acids found at the N-terminus of the capsid and GP proteins. The
ubiquitinated constructs have additional N-terminal residues not
found in the 13.2.2 and 13.4.6 helpers. The right-most box
indicates the 3' RsrII restriction site and amino acids coded as a
result of the primary nucleotide sequence. The left-most box
represents critical residues for cleavage of ubiquitin from VEE
structural proteins.
[0022] FIG. 5 shows Western blot analyses (one using
capsid-specific antibody and the other using glycoprotein
(GP)-specific antibody) of cell lysates generated from cells
electroporated to produce VRP in a packaging study (Table 10). Two
RNA helpers, in addition to a replicon, were electroporated into
the cells as follows: Lane 1, dHcap6-mut1 and 13.4.6 (GP); Lane 2,
Hcap4 and dHgp6-mut1; Lane 3, dHcapU and dHgpU; Lane 4, dHcap(FL)
and dHgp(FL); Lane 5, Hcap4 and dHgpU; Lane 6, Hcap4 and dHgp(FL);
Lane 7, dHcapU and 13.4.6; Lane 8, dHcap(FL) and 13.4.6; Lane 9,
Hcap4 and 13.4.6; Lane 10, molecular weight markers.
[0023] FIG. 6 shows a Northern blot analysis of capsid helper RNAs
produced in Vero cells into which two RNA helpers, in addition to a
replicon, were electroporated into the cells as follows: Lane 1,
dHcap6-mut1 and 13.4.6 (GP); Lane 2, Hcap4 and dHgp6-mut1; Lane 3,
dHcapU and dHgpU; Lane 4, dHcap(FL) and dHgp(FL); Lane 5, Hcap4 and
dHgpU; Lane 6, Hcap4 and dHgp(FL); Lane 7, dHcapU and 13.4.6; Lane
8, dHcap(FL) and 13.4.6. The translatable capsid RNA molecule in
each lane is marked with an asterisk.
[0024] FIG. 7 shows a Northern blot analysis of glycoprotein (GP)
helper RNAs produced in Vero cells into which two RNA helpers, in
addition to a replicon, were electroporated into the cells as
follows: Lane 1, dHcap6-mut1 and 13.4.6 (GP); Lane 2, Hcap4 and
dHgp6-mut1; Lane 3, dHcapU and dHgpU; Lane 4, dHcap(FL) and
dHgp(FL); Lane 5, Hcap4 and dHgpU; Lane 6, Hcap4 and dHgp(FL); Lane
7, dHcapU and 13.4.6; Lane 8, dHcap(FL) and 13.4.6. The
translatable glycoprotein RNA molecule in each lane is marked with
an asterisk.
DETAILED DESCRIPTION OF THE INVENTION
[0025] As used herein, "a," "an" and "the" can mean one or more
than one, depending on the context in which it is used. For
example, "a" cell can mean one cell or multiple cells.
[0026] Also as used herein, "and/or" refers to and encompasses any
and all possible combinations of one or more of the associated
listed items, as well as the lack of combinations when interpreted
in the alternative ("or").
[0027] Furthermore, the term "about," as used herein when referring
to a measurable value such as an amount of a compound or agent of
this invention, dose, time, temperature, and the like, is meant to
encompass variations of .+-.20%, .+-.10%, .+-.5%, .+-.1%, .+-.0.5%,
or even .+-.0.1% of the specified amount.
[0028] The terms "5' alphavirus replication recognition sequence,"
"3' alphavirus replication recognition sequence," "5' replication
recognition sequence," and "3' replication recognition sequence
refer to the RNA sequences found in alphaviruses, sequences derived
therefrom, or synthetic sequences based on conserved sequences
among various alphaviruses, that are recognized by the
nonstructural alphavirus replicase proteins and lead to replication
of viral RNA. In some embodiments, these sequences can be in the
form of DNA to facilitate the preparation, mutation and/or
manipulation of the constructs, plasmids and nucleic acids of this
invention to produce VRPs. These sequences are also referred to as
the "5' and 3' ends," 5' and 3' viral sequences required for
nonstructural protein-mediated amplification, 5' and 3' sequences
required for nonstructural protein-mediated amplification, 5' or 3'
conserved sequence element (CSE), 5' or 3' non-coding regions, 5'
or 3' noncoding region sequences, 5' or 3' viral sequences required
in cis for replication, 5' or 3' sequence that initiates
transcription of an alphavirus, and/or alphavirus 5' and 3'
sequences, with the 5' and 3' designations referring to their
location in the alphavirus genome. In the nucleic acid molecules of
this invention, the use of these 5' and 3' ends will result in
replication and/or transcription of the RNA sequence encoded
between the two ends. These sequences can be modified by standard
molecular biological techniques (e.g., truncated at either end
and/or modified to remove initiation (i.e., start) codons or to
enhance translatability) to further minimize the potential for
recombination and/or to introduce cloning sites, etc., with the
proviso that they must still be recognized by the alphavirus
replication machinery.
[0029] As used herein, the terms "initiation codon" or "start
codon" refer to a codon that is AUG in RNA and ATG in DNA that may
or may not be used in the translation of a functional protein.
[0030] The term "alphavirus structural protein/protein(s)" refers
to one or a combination of the structural proteins encoded by
alphaviruses. These are produced by the wild type virus as a
polyprotein and are described generally in the literature as
C-E3-E2-6k-E1. E3 and 6k serve as membrane translocation/transport
signals for the two glycoproteins, E2 and E1. Thus, use of the term
E1 herein can refer to E1, E3-E1, 6k-E1, or E3-6k-E1, and use of
the term E2 herein can refer to E2, E3-E2, 6k-E2, PE2, p62 or
E3-6k-E2. The term "glycoprotein helper" or "GP helper" typically
refers herein to a helper molecule that encodes both E2 and E1
glycoproteins; in certain embodiments of this invention, E1 and E2
are encoded on separate helper molecules.
[0031] The terms "helper(s)" and "helper molecules" are used
interchangeably and refer to a nucleic acid molecule that expresses
nucleic acid encoding one or more alphavirus structural
proteins.
[0032] The terms "helper cell" and "packaging cell" are used
interchangeably herein and refer to a cell in which alphavirus
replicon particles are produced. The helper cell comprises a set of
helper molecules and/or helper constructs as described herein that
encode one or more alphavirus structural proteins. The helpers can
be RNA or DNA or both. The helper cell or packaging cell can be any
cell that is alphavirus-permissive, i.e., that can produce
alphavirus particles upon introduction of a replicon RNA.
Alphavirus-permissive cells include, but are not limited to, Vero,
baby hamster kidney (BHK), 293, 293T/17 (ATCC accession number
CRL-11268), chicken embryo fibroblast (CEF), UMNSAH/DF-1 (ATCC
accession number CRL-12203) and Chinese hamster ovary (CHO)
cells.
[0033] A "promoter" as used herein is a nucleic acid sequence that
directs transcription of an RNA molecule.
[0034] An "isolated cell" as used herein is a cell or population of
cells that have been removed from the environment in which the cell
occurs naturally and/or altered or modified from the state in which
the cell occurs in its natural environment. An isolated cell of
this invention can be a cell, for example, in a cell culture. An
isolated cell of this invention can also be a cell that can be in
an animal and/or introduced into an animal and wherein the cell has
been altered or modified, e.g., by the introduction into the cell
of an alphavirus particle of this invention.
[0035] As used herein, an "alphavirus subgenomic promoter" or "26S
promoter" is a promoter as originally defined in a wild type
alphavirus genome that directs transcription of a subgenomic
messenger RNA as part of the alphavirus replication process.
[0036] The heterologous nucleic acid (e.g., a gene of interest or
"GOI" or nucleic acid of interest or "NOI") used in some
embodiments of this invention is a nucleic acid that is not present
in the genome of a wild type alphavirus and/or is not present in
the genome of a wild type alphavirus in the same order as it exists
in a recombinant nucleic acid of this invention. For example, in
certain embodiments, the NOT can encode one or more alphavirus
structural proteins (e.g., C, PE2/E2, E1, E3, 6K) when they are
used as helper nucleic acids in the assembly of infectious,
defective alphavirus particles (e.g., alphavirus replicon
particles) or as immunogens for vaccines against diseases caused by
certain alphaviruses.
[0037] The present invention is based on the surprising and
unexpected discovery that RNA molecules comprising a nucleotide
sequence encoding alphavirus structural protein(s) and alphavirus
5' and 3' sequences, wherein an initiation codon has been removed
from the 5' replication recognition sequence, but lacking a
promoter sequence (e.g., a subgenomic alphavirus promoter sequence,
sometimes referred to as a 26S, or viral junction region, promoter)
can be replicated such that the full-length positive strand RNA can
be translated efficiently and produce sufficient amounts of
alphavirus structural proteins in trans for the production of
alphavirus replicon particles in cultured cell lines. These
"promoterless" RNA molecules, sometimes referred to herein as
".DELTA.26S helpers," increase the theoretical safety margin in a
population of alphavirus replicon particles (e.g., produced for use
as a vaccine or adjuvant) by decreasing the predicted theoretical
frequency of generation of functional recombination events that
occur between the helper molecules and the replicon vector.
[0038] Any split helper system requires a minimum of two
independent recombination events to generate replication-competent
alphavirus (RCV). For alphaviruses, recombination is thought to be
predominantly the result of random strand switching by the RNA
replication complex (Weiss et al 1991), although homologous
recombination has also been reported. For the first recombination
event, the replication complex could, for example, begin at the 3'
end of an RNA helper molecule in the split helper/replicon
packaging systems disclosed in the literature (e.g., Johnston et
al. U.S. Pat. No. 5,792,462). If the complex continued replication
of this helper RNA through the 26S or viral junction region and
then switched to the foreign nucleotide sequence in the replicon
RNA as a template and completed replication through the replicon 5'
end, the resulting "recombinant replicon intermediate" would
contain sequence encoding all the non-structural proteins, some or
all of the transcriptional unit containing the foreign nucleic acid
of interest (NOI) coding region, and the new inserted
transcriptional unit expressing one of the alphaviral structural
proteins. In order for an RCV to be created, a subsequent, second
recombination event must occur by a strand-switching event into the
3' replication recognition sequence of the recombinant replicon
intermediate (described above), since this is the only location
that would result in retention of functional transcriptional units
for all of the nonstructural and structural protein coding
sequences without insertional mutagenesis. Because the helper RNA
molecules contain 26S promoters, two such recombination events
could create, theoretically, an RCV. The precise recombination
points would not be critical because each of the recombination
inserts would be an independent transcriptional unit.
[0039] Generation of RCV using promoterless helper molecules of
this invention would also require a minimum of two independent
recombination events, but the constraints for obtaining a
functional recombinant are much higher than for the RNA helper
molecules known in the literature and thus the theoretical
frequency for generating RCV is much lower. This is because, in the
absence of the 26S promoter, most recombination events would not
result in the generation of a functional transcriptional unit that
could express an alphavirus structural protein. Thus, the
generation of RCV using promoterless helper molecules will require
the regeneration of a structural polyprotein open reading frame
(i.e., substantively similar to the structure found in the
wild-type virus from which these helpers are derived), and this in
turn requires that the two required recombination events occur in a
specific order and in very specific nucleotide locations. The
initial recombination event must involve the capsid helper coding
sequence, since it must be located in a proper (i.e., 5') position
relative to the glycoproteins in order to cleave itself and
generate a functional capsid protein. The capsid helper must be
recombined with the replicon vector via a nucleotide- or
near-nucleotide-perfect recombination event to achieve a
recombinant in which there would be expression of the capsid
protein from the replicon 26S promoter. That is, only
recombinations that 1) are directly downstream of the replicon 26S
promoter, 2) are in frame with any remnants of the heterologous
GOI, and 3) do not result in the generation of a GOI/alphavirus
capsid fusion protein (thereby generating an inactive alphavirus
capsid), would be functional. The second recombination event,
involving the alphavirus glycoprotein helper, is under the same
constraints as the first, in addition to being limited to occurring
in the 3' replication recognition sequence. Thus, methods of this
invention for producing the particles using the promoterless helper
molecules will theoretically generate RCV at a much lower frequency
than the helper molecules known in the literature, a frequency so
low that no such RCV have been detected with the methods of this
invention.
[0040] The surprising nature of this invention lies in the fact
that previous efforts to produce helper/replicon systems for
assembling alphavirus particles have relied on the use of a strong
promoter, most often the alphavirus 26S subgenomic promoter, to
provide sufficient RNA molecules from which to translate structural
proteins for assembly. In stark contrast to the existing
literature, the inventors discovered that they can utilize novel
RNA helper molecules that can be translated directly as full length
molecules without transcription of smaller messenger RNAs from the
26S promoter and the messenger amplification that normally
accompanies this process in wild-type alphavirus propagation and
helper RNA systems known in the literature. Direct translation of
the helper RNAs of this invention is then accomplished through the
recognition of the cap at the 5' end of the full-length RNA by
cellular ribosomal machinery. Within a eukaryotic cell, the
initiation of translation from an mRNA involves a series of tightly
regulated events that allow the recruitment of ribosomal subunits
to the mRNA. In the case of cap-dependent translation, the
methyl-7-G(5')pppN structure present at the 5' end of the mRNA,
known as "cap," is recognized by the cellular initiation factor
eIF4F, which is composed of eIF4E, eIF4G and eIF4A. (reviewed in
Hershey & Merrick. Translational Control of Gene Expression,
pp. 33-88. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory
Press. 2000.)
[0041] Alphaviruses are positive strand RNA viruses; when the viral
RNA enters the cell, translation of the nonstructural alphavirus
proteins (nsP1, nsP2, nsP3 and nsP4) occurs from this RNA, and
these proteins generate a full-length negative strand RNA template,
respectively. The negative strand RNA is then replicated to produce
a full-length ("genomic") positive strand RNA and a smaller
("subgenomic") positive strand that is initiated at the 26S
promoter. When the positive strands are produced, the nonstructural
proteins of the alphavirus also cap the RNA, making it available in
the cytoplasm for translation by ribosomes. The "cap" refers to a
methylated residue added to the 5' end of the RNA. In specific
embodiments of this invention, the helper RNA molecules that are
produced in vitro (which are positive strand RNAs) are not capped.
When the positive strand helper RNAs are introduced into a
eukaryotic cell also containing a replicon RNA, largely negative
strand synthesis occurs initially. In the presence of the
alphavirus replicon RNA, from which the non-structural proteins are
synthesized, the negative strand templates (both helper and
replicon) will be replicated into positive strand RNAs that are
then capped. In other embodiments of this invention, the helper
RNAs can be capped in vitro, using reagents well known to the art
and commercially available, for example, from Promega (Madison,
Wis.) and Ambion (Austin, Tex.). Caps can include G cap, C cap, A
cap, methylated G (m.sup.7G(5'ppp(5')pppG(5)A); unmethylated
G(G(5'ppp(5')A); ARCA (anti-reverse cap analog,
3-O-Me-m.sup.7G(5')pppG(5)); trimethylated
(m.sup.2,.sup.2,7G(5'ppp(5')pppG), 2-way cap
(m.sup.7G(5'ppp(5')m.sup.7G), for example. In some embodiments, for
maximal yield of ARP, all helpers of this invention used to produce
ARP are either capped or uncapped. Highest yields have been
recorded with capped helper RNAs, but, in certain embodiments,
uncapped helper RNAs can generate sufficiently high yields such
that the added cost of capping may be avoided. It is also possible
to cap only one of the helper RNAs, although this also may
sometimes limit ARP yields. In general, the inventors have shown
that ARP yield can be optimized by routine experimentation looking
at several variables, such as varying the use of capping, the ratio
of cap analog to NTPs in the transcription mixture, and the ratio
of RNAs used to generate the ARPs.
[0042] Thus, in particular embodiments, the present invention
provides an isolated RNA molecule comprising, consisting
essentially of and/or consisting of: a) an alphavirus 5'
replication recognition sequence wherein at least one initiation
codon has been removed; b) a nucleotide sequence encoding an
alphavirus structural protein; and c) an alphavirus 3' replication
recognition sequence, with the proviso that the RNA molecule does
not contain a promoter that directs transcription of the nucleotide
sequence of (b), and wherein the alphavirus 5' and 3' replication
recognition sequences direct replication of the entire RNA molecule
in the presence of alphavirus nonstructural proteins.
[0043] A wide variety of nucleic acid sequences can satisfy the
function of the 5' and 3' ends in the nucleic acid constructs of
this invention. For example, the sequence can include the
alphavirus 5' replication recognition sequence and other adjacent
sequences, as exemplified above, for the VEE alphavirus.
Additionally, deletions can be made in the native 5' alphavirus end
to remove certain secondary structural elements, for example
stem-loop structures. In certain embodiments, one or more of these
stem-loop structures may be removed from the helper constructs of
this invention. Alternatively, non-alphavirus or other sequences
can be employed as this element, while maintaining similar
functional capacity, for example, in the case of Sindbis virus,
nucleotides 10-75 for tRNA asparagine (Schlesinger et al. U.S. Pat.
No. 5,091,309).
[0044] In some embodiments, the 3' alphavirus replication
recognition sequence can be approximately 300 nucleotides in
length, which contains essentially the native alphavirus 3'
replication recognition sequence. The minimal 3' replication
recognition sequence, conserved among alphaviruses, is a 19
nucleotide sequence (Hill et al., Journal of Virology, 2693-2704
(1997)). In addition, for Sindbis virus, it has been shown that the
poly(A) tail immediately following the 3' replication recognition
sequence must be at least 11-12 residues in length and that the 3'
13 nt of the 3' replication recognition sequence are critical for
efficient minus strand RNA synthesis (Hardy and Rice, Journal of
Virology, 79:4630-4639 (2005)). Therefore, sequence for the 3' end
can include a complete alphavirus 3' replication recognition
sequence, or a truncated region of the 3' replication recognition
sequence, which still maintains function as a recognition sequence,
or a 3' end that is between 25 and 325 nucleotides in length and
contains a poly(A) run immediately following the 3' replication
recognition sequence with a minimum length of 11-12 nt. Other
examples of sequences that can be used in this context include, but
are not limited to, non-alphavirus or other sequences that maintain
a similar functional capacity to permit initiation of negative
strand RNA synthesis (e.g., sequences described in George et al. J.
Virol. 74: 9776-9785 (2000)).
[0045] The 5' and 3' replication recognition sequences used in the
RNA molecules of this invention can be derived from the same or
different alphaviruses in any combination, and they can be used in
any combination with replicon vectors which are derived from the
same or different alphaviruses.
[0046] In certain embodiments of this invention, the 5' and 3'
sequences of the helper RNA molecules are chosen to both maximize
the performance of the helpers in generating VRPs and minimize the
theoretical potential for generating RCV. Specific embodiments may
include modifications of the 5' and 3' sequences as well as
deletions of parts of the original 5' and 3' sequences from the
alphavirus, examples of which are described herein. There are
numerous combinations of 5' and 3' sequences described in this
invention, and different combinations can be used for each helper
molecule. It is within one of skill in the art to test various
combinations of the modifications and deletions taught herein to
determine their performance in the generation of VRPs.
[0047] The RNA helper molecules of this invention rely on ribosomes
scanning from the 5' cap structure through the 5' replication
recognition sequence to initiate translation of the alphavirus
structural proteins at their native methionine start codon. The
presence of additional initiation codons in these regions reduces
the effectiveness of these helpers by allowing translation to
initiate at a site other than the native start codon for the
structural proteins, thereby generating either fusion proteins as
the ribosomes move along the mRNA into the alphavirus structural
protein coding region or short non-functional peptides when the
ribosomes subsequently reach a stop codon in the 5' replication
recognition sequence. Therefore, the use of the intact 5'
alphavirus non-coding region in these helpers (i.e., the entire
sequence from the 5' terminus of the wild-type alphavirus up to the
first codon of the 26S subgenomic promoter) is not optimal, due to
the presence of numerous start and stop codons in this region.
Thus, in particular embodiments, the RNA molecules of this
invention can have one or more initiation codons removed from the
5' replication recognition sequence. By one or more is meant that
two, three, four, five, six, seven, eight, nine, ten, 11, 12 or
more initiation codons (i.e., start codons) have been removed or
inactivated according to methods standard in the art.
[0048] Thus, the present invention provides an RNA molecule of this
invention wherein one or more initiation codons have been removed,
e.g., by mutation from AUG to GUG, from the 5' replication
recognition sequence. In a specific embodiment, an RNA molecule is
provided wherein all initiation codons have been removed, e.g., by
mutation from AUG to GUG, from the 5' replication recognition
sequence. For example, one or more initiation codons in any
combination at the following positions as shown in FIG. 1 can be
removed, e.g., mutated: 12, 45, 148, 154, 160, 258, 294, 299, 331,
390, 411, 441 and 499.
[0049] By removal of an initiation codon it is meant that the
nucleotide sequence is modified (e.g., according to methods
described herein and as known in the art) to delete or change the
initiation codon, thereby removing or altering initiation or
activity (e.g., translation activity) at that site. In some
embodiments, a majority of the initiation codons can be removed,
but it is possible that only a few of such codons in the 5' region
of a particular helper construct are in a context that is typically
recognized by a ribosome. Thus, for specific 5' sequences, removal
of 2-3 such codons, out of a possible 10-12 codons, may result in
expression levels that are not significantly different than a
construct in which all 10-12 codons have been removed. It is within
the scope of this invention that there are a numerous specific 5'
sequences, derived from the wild-type alphavirus sequences, that
when used in the helper molecules of this invention, will result in
sufficient expression within the packaging or helper cell to
provide acceptable yields of alphavirus replicon particles.
[0050] The RNA molecule of this invention can comprise a nucleotide
sequence encoding 1) an alphavirus capsid protein, 2) alphavirus E1
and E2 proteins in any order, 3) alphavirus capsid protein and
alphavirus E1 protein in any order, 4) alphavirus capsid protein
and alphavirus E2 protein in any order, 5) alphavirus E2 protein,
and/or 6) alphavirus E1 protein. In other embodiments, a single RNA
molecule of this invention can encode the three alphavirus
structural proteins, i.e., capsid protein, alphavirus E1 protein
and alphavirus E2 protein, in any order. In some embodiments, the
RNA molecule of this invention can specifically exclude a
nucleotide sequence encoding an alphavirus structural protein
(e.g., the molecule can specifically exclude a nucleotide sequence
encoding capsid, alphavirus E1 protein, alphavirus E2 protein or
any combination of capsid, E1 protein and E2 protein).
[0051] In various embodiments of this invention, the RNA molecule
can comprise sequence from the 5' end of Venezuelan equine
encephalitis (VEE) virus, which includes a 5' replication
recognition sequence. As described by Pushko et al. (1997), the 5'
replication recognition sequence of VEE promoter-assisted helpers
typically consists of 575 nucleotides (nt) of VEE sequence. The
first 519 are contiguous and represent the 44 nt untranslated
region (UTR) and the first 475 nt of nsP1 (44+475=519). The
remaining 56 nt encode the last 21 nt of the nsP4 gene (including
the TAA stop codon), 7 nt of the minimal 26S promoter (whose
sequence partially overlaps the nsP4 gene) and a 28 nt leader
sequence upstream of the VEE structural protein gene initiation
codon (21+7+28=56).
[0052] Thus, the complete 5' replication recognition sequence for
the promoter-assisted helpers described by Pushko et al. (1997)
consist of 575 nt of VEE sequence. The promoterless helpers of this
invention encode all or a portion of the first 514 nucleotides (nt)
found in the promoter-assisted helpers described above. In addition
to the 514 nt described above, sequence encoding an RsrII
restriction enzyme site (7 nt) is also present just upstream of the
structural protein coding sequence start site (ATG in DNA; AUG in
RNA). Inclusion of these nt increases the 5' replication
recognition sequence for the full length capsid helper (dHcap(FL)
to 521 nt (not including the A residue of the initiation
codon).
[0053] In some examples of the promoterless capsid helpers and all
examples with promoterless glycoprotein helpers, an additional
modification to include a near-consensus Kozak sequence (3 nt
(ACC)) just upstream of the structural protein coding sequence
initiation codon but downstream of the RsrII sequence have been
added. Because of the Kozak modification the full length
glycoprotein helper (dHgp(FL) has a 5' replication recognition
sequence of 524 nt. With these nucleotide sequences defined for the
promoterless capsid and glycoprotein helpers as the "full length"
("FL") 5' VEE sequence for the purposes of the following
description, deletions in this sequence result in other embodiments
that encompass the 5' replication recognition sequence. These
embodiments include nucleotides 1 through 141 (not including the A
residue of the initiation codon) of the VEE nucleotide sequence, at
a minimum. Within the first 200 nucleotides of the 5' sequence,
four stem-loop (SL) structures in the RNA are predicted.
[0054] Embodiments of the 5' sequence useful in the helper
constructs of this invention may include 1, 2, 3 or all of the SL
structures in this region. Embodiments that remove the SL2 region,
and retain the SL1, SL3 and SL4 structures, are useful in the
helper constructs of this invention. SL structures 1 and 2 are
contained in the first 145 nucleotides; SL 3 and 4 are present
between nucleotides 145 and 200. Thus, in some embodiments, the 5'
replication recognition sequence is included in a 5' non-coding
region of the construct which is 524 nucleotides in length (e.g.,
dHgp(FL) in FIG. 2) and in other embodiments, the 5' replication
recognition sequence can be included in a 5' non-coding region that
is anywhere from 70 (e.g., containing SL1, SL3 and SL4) to 524
nucleotides in length. For example, the 5' replication recognition
sequence can be 141, 144 (dH #8) 200, 203 (dH #7), 248, 249 (dH
#6), 309, 312 (dH #5), 351, 354 (dH #4), 412, 415 (dH #3) 450, 452
(dH #2), 499 or 502 (dH #1) nucleotides in length, including any
number between 70 and 524 not specifically recited herein (e.g.,
237, 379, 444, etc.). It should be noted that the exact nucleotide
number and length varies somewhat between different alphaviruses
and between different strains of a given alphavirus. It is well
within the ability of one skilled in the art to identify the
corresponding locations of the nucleotides described herein based
on corresponding structure and/or function and/or of the secondary
structures described herein in any alphavirus and create the RNA
helper molecules of this invention as well as the above-described
modifications from the primary nucleotide sequence of any
alphavirus.
[0055] The RNA helper molecules of this invention also comprise
sequence from the 3' end of an alphavirus, which in particular
embodiments, can be, but is not limited to the Venezuelan equine
encephalitis virus, which includes the alphavirus 3' replication
recognition sequence. The 3' terminal 19 nucleotides of all
alphaviruses are highly conserved, while the 3' sequence between
the last codon of the E1 glycoprotein and the highly conserved 19
nucleotides is less conserved, both in terms of length and sequence
among alphaviruses. The length of the 3' non-coding region
(including the conserved 19 nucleotides, herein SEQ ID NO:52) can
range from 25 to 325 nucleotides. In specific embodiments of this
invention, the 3' sequence is between 73 to 117 nucleotides of the
VEE 3' end. In particular embodiments, alphavirus 3' replication
recognition sequence of this invention can comprise, consist
essentially of and/or consist of the nucleotide sequence of SEQ ID
NO:55 (for dHcap(FL) through dHcap7; dHcap(FL)mm through dHcap7 mm,
dHcap(FL)mut1 through dHcap7-mut1), SEQ ID NO:56 (for Hgp(FL)
through dHgp7, dHgp(FL)mm through dHgp7-mm, dHgp(FL)mut1 through
dHgp7-mut1), SEQ ID NO:57 (for dHcap6mut1(w/stop), SEQ ID NO:58
(for dHcap7mut1(w/stop)+19 nt and dHgp7mut1-S+19 nt), and SEQ ID
NO:59 (dHcap6mut1(W-stop).
[0056] In particular embodiments, the alphavirus 5' replication
recognition sequence of this invention can comprise, consist
essentially of and/or consist of the nucleotide sequence of SEQ ID
NO:1 (dHcap(FL)), SEQ ID NO:2 (dHcap1), SEQ ID NO:3 (dHcap2), SEQ
ID NO:4 (dHcap3), SEQ ID NO:5 (dHcap4), SEQ ID NO:6 (dHcap5), SEQ
ID NO:7 (dHcap6), SEQ ID NO:8 (dHcap7), SEQ ID NO:9 (dHcap8), SEQ
ID NO:10 (dHgp(FL), SEQ ID NO:11 (dHgp1), SEQ ID NO:12 (dHgp2), SEQ
ID NO:13 (dHgp3), SEQ ID NO:14 (dHgp4), SEQ ID NO:15 (dHgp5), SEQ
ID NO:16 (dHgp6), SEQ ID NO:17 (dHgp7), SEQ ID NO:18 (dHgp8), SEQ
ID NO:19 (dHcap(FL)-mm), SEQ ID NO:20 (dHcap1-mm), SEQ ID NO:21
(dHcap2-mm), SEQ ID NO:22 (dHcap3-mm), SEQ ID NO:23 (dHcap4-mm),
SEQ ID NO:24 (dHcap5-mm), SEQ ID NO:25 (dHcap6-mm), SEQ ID NO:26
(dHcap7-mm), SEQ ID NO:27 (dHgp(FL)-mm), SEQ ID NO:28 (dHgp1-mm),
SEQ ID NO:29 (dHgp2-mm), SEQ ID NO:30 (dHgp3-mm), SEQ ID NO:31
(dHgp4-mm), SEQ ID NO:32 (dHgp5-mm), SEQ ID NO:33 (dHgp6-mm), SEQ
ID NO:34 (dHgp7-mm), SEQ ID NO:35 (dHcap(FL)mut1), SEQ ID NO:36
(dHcap1 mut1), SEQ ID NO:37 (dHcap2 mut1), SEQ ID NO:38 (dHcap3
mut1), SEQ ID NO:39 (dHcap4 mut1), SEQ ID NO:40 (dHcap5 mut1), SEQ
ID NO:41 (dHcap6 mut1), SEQ ID NO:42 (dHcap7 mut1), SEQ ID NO:43
(dHgp(FL)mut1), SEQ ID NO:44 (dHgp1 mut1), SEQ ID NO:45 (dHgp2
mut1), SEQ ID NO:46 (dHgp3 mut1), SEQ ID NO:47 (dHgp4 mut1), SEQ ID
NO:48 (dHgp5 mut1), SEQ ID NO:49 (dHgp6 mut1), SEQ ID NO:50 (dHgp7
mut1), SEQ ID NO:51 (dHcap6-mut1-dSL2), SEQ ID NO:52
(dHgp6-mut1-dSL2(-S)); SEQ ID NO:53 (dHcapU); and SEQ ID NO:54
(dHgpU). The specific helper for which these 5' sequence examples
have been synthesized is given in parentheses. The sequences can
vary slightly in length due to the use of additional nucleotides to
provide a near-optimal Kozak consensus sequence to enhance
translation of the structural protein coding sequence in some of
the helper constructs. (The ATG (AUG in RNA) of the coding region
for the structural protein coding sequence is not included in these
5' sequences). RNA molecules of this invention comprising the
nucleotide sequences identified above can be employed in the
methods of this invention for production of alphavirus replicon
particles in any combination, in any order and/or in any
multiplicity.
[0057] The present invention additionally provides a vector and/or
a nucleic acid construct comprising the RNA molecule of this
invention. Further provided is a cell comprising one or more RNA
molecules of this invention and one or more alphavirus replicon
vectors. By one or more is meant one, two, three, four, five, six,
seven, etc. A cell of this invention is any cell in which nucleic
acid constructs encoding alphavirus proteins can be expressed.
Examples of cells of this invention include, but are not limited
to, Vero, baby hamster kidney (BHK), 293, 293T/17 (ATCC accession
number CRL-11268), chicken embryo fibroblast (CEF), UMNSAH/DF-1
(ATCC accession number CRL-12203), PERC.6 and Chinese hamster ovary
(CHO) cells.
[0058] Further provided herein is a method of making an alphavirus
replicon particle, comprising introducing one or more of the RNA
molecules of this invention into a cell, whereby the combination of
RNA molecules encodes all alphavirus structural proteins necessary
for production of an alphavirus replicon particle, along with an
alphavirus replicon RNA, under conditions whereby alphavirus
replicon particles are produced. In some embodiments of this
invention, the alphavirus particle mimics the structural make-up of
the native alphavirus, in which the replicon RNA is coated with the
capsid protein and then enveloped with cell membrane containing the
alphavirus glycoproteins. In such embodiments, the alphavirus
structural proteins are all from the same alphavirus. In
alternative embodiments, the alphavirus proteins can be from
different alphaviruses, provided that these different proteins
"recognize" each other during particle assembly or that they are
modified (as described in the literature) so that they will be able
to recognize each other.
[0059] In some embodiments of the methods of this invention, two
RNA molecules of this invention are introduced into a cell of this
invention, wherein the two RNA molecules encode different
alphavirus structural proteins in a combination whereby all the
necessary structural proteins are produced in the packaging cell to
produce alphavirus replicon particles. Thus, the present invention
provides a method wherein two RNA molecules are introduced into the
cell and wherein a first RNA molecule of the two RNA molecules
encodes one or more alphavirus structural proteins but not all of
the structural proteins and a second RNA molecule of the two RNA
molecules encodes one or more alphavirus structural proteins that
are not encoded by the first RNA molecule.
[0060] Also provided is a method wherein three RNA molecules of
this invention are introduced into a cell, wherein the three RNA
molecules each encode a different alphavirus structural protein, in
a combination whereby all of the necessary structural proteins are
produced in the cell to produce alphavirus replicon particles.
Thus, a method is provided, wherein three of the RNA molecules of
this invention are introduced into the cell, wherein a first RNA
molecule of the three RNA molecules encodes one or more alphavirus
structural proteins but not all of the structural proteins and a
second RNA molecule of the three RNA molecules encodes one or more
alphavirus structural proteins that are different from the
alphavirus structural proteins encoded by the first RNA molecule
and a third RNA molecule of the three RNA molecules encodes one or
more alphavirus structural proteins that are different from the
alphavirus structural proteins encoded by the first RNA molecule
and the second RNA molecule. For example, in one embodiment, the
first RNA molecule can encode alphavirus capsid protein, the second
RNA molecule can encode alphavirus glycoprotein E1 and the third
RNA molecule can encode alphavirus glycoprotein E2.
[0061] In some embodiments, one or more, but not all, of the
alphavirus structural proteins can be encoded by the replicon RNA
that is packaged by the alphavirus structural proteins. For
example, a recombinant RNA used in the methods of making alphavirus
replicon particles claimed herein can comprise, as a nucleic acid
of interest and/or in addition to a nucleic acid of interest, a
nucleic acid sequence encoding one alphavirus structural protein or
more than one alphavirus structural protein. Thus, in a specific
embodiment, a replicon RNA encodes an alphavirus structural protein
or more than one alphavirus structural protein. This replicon RNA
can be introduced into a population of cells together with one or
more RNA helper molecules of this invention, such that the replicon
RNA and the RNA helper molecules(s) produce all of the alphavirus
structural proteins, and the replicon RNA is packaged into
particles in said cells.
[0062] In further embodiments, a method is provided for making an
alphavirus replicon particle, comprising introducing into a cell:
a) an alphavirus replicon RNA; b) one or more RNA molecules of this
invention; and c) one or more promoter-assisted alphavirus helper
constructs, whereby the combination of RNA molecules of (b) and
helper constructs of (c) encodes all alphavirus structural proteins
necessary for production of an alphavirus replicon particle, under
conditions whereby an alphavirus replicon particle is produced.
[0063] Thus, in additional embodiments of this invention,
"promoter-assisted helper constructs," i.e., recombinant DNA or RNA
molecules that express one or more alphavirus structural proteins
under the direction of a promoter, e.g., the 26S promoter, are used
in combination with the helper molecules of this invention. In one
set of RNA molecule embodiments, the "promoter-assisted helper
construct" comprises a first nucleic acid sequence encoding (i) a
5' alphavirus replication recognition sequence, (ii) a
transcriptional promoter, (iii) a nucleic acid sequence encoding
one or more alphavirus structural proteins, and (iv) a 3'
alphavirus replication recognition sequence.
[0064] In another set of RNA molecule embodiments, the
"promoter-assisted helper construct" is a recombinant helper
nucleic acid, as described in WO 2004/085660 (published Oct. 7,
2004 and incorporated herein by reference), comprising: a nucleic
acid sequence encoding a 5' alphavirus replication recognition
sequence, an alphavirus subgenomic promoter immediately upstream of
an IRES element, at least one nucleic acid encoding an alphavirus
structural protein, and a nucleic acid encoding a 3' alphavirus
replication recognition sequence. In further embodiments, these
promoter-assisted helper constructs can comprise a spacer nucleic
acid located immediately downstream of the subgenomic promoter and
immediately upstream of the IRES element. The spacer nucleic acid
can comprise or consist of any random or specific non-coding
nucleic acid sequence that is of a length sufficient to prevent at
least some, and in some embodiments, all translation from the 5'
cap of a messenger RNA, such that translation of the structural
proteins is then directed by the IRES, in part or in whole.
Alternatively, the spacer nucleic acid can be of a length and
sequence structure that imparts sufficient secondary structure to
the nucleic acid to prevent at least some and possibly all
translation activity from the 5' cap of a messenger RNA. The
promoter-assisted helper constructs used in this invention can also
be DNA molecules, which can be stably integrated into the genome of
the helper cell or transiently expressed from an episome (e.g., a
plasmid) without significant integration. The DNA molecule of this
invention can be any DNA vector, including but not limited to, a
non-integrating DNA vector, such as a plasmid, or a viral
vector.
[0065] In embodiments of this invention employing "helper cells" or
"packaging cells" as described herein, and comprising a
promoterless RNA molecule of this invention, the helper cell can
further comprise a promoter-assisted helper construct (RNA and/or
DNA) in any combination such that the helper cell comprises a
combination of nucleotide sequences encoding alphavirus structural
proteins sufficient to produce an alphavirus replicon particle of
this invention. In certain embodiments, the E1 and E2 glycoproteins
are encoded by a first helper construct, and the capsid protein is
encoded by a second helper construct. In another embodiment, the E1
glycoprotein, E2 glycoprotein, and capsid protein are each encoded
by separate (e.g., first, second and third) helper constructs. In
yet other embodiments, the capsid protein and either glycoprotein
E1 or E2 are encoded by a first helper construct, and the remaining
glycoprotein E1 or E2 not included in the first helper construct is
encoded by a second helper construct, with or without the capsid
coding sequence. In additional embodiments, alphavirus
glycoproteins E1 and E2, as well as capsid protein can all be
encoded on one helper construct, in any order and/or in any
multiplicity. Among the embodiments included in this invention, it
is also possible that a given alphavirus structural protein is
expressed by more than one helper construct. The promoterless RNA
helpers of this invention, optionally in combination with other
known helpers as described herein, can be introduced into an
alphavirus-permissive cell in any combination, in any order and/or
in any multiplicity.
[0066] In some embodiments of this invention (e.g., for DNA
constructs encoding promoterless RNA molecules or promoter-assisted
RNA helper constructs), a promoter for directing transcription of
RNA from DNA, i.e., a DNA dependent RNA polymerase is utilized to
synthesize RNA in an in vitro transcription reaction, and specific
promoters suitable for this use include, but are not limited to,
the SP6, T7, and T3 RNA polymerase promoters.
[0067] In all of the embodiments of this invention, it is
contemplated that at least one of the alphavirus structural and/or
non-structural proteins encoded by the promoterless helper
molecules and/or promoter-assisted helper constructs and/or the
replicon vector, as well as the nontranslated regions of the
replicon nucleic acid, can contain one or more attenuating
mutations, as described herein, in any combination.
[0068] The present invention further provides a population of
alphavirus replicon particles, wherein the population contains
fewer than one replication-competent alphavirus particle per
10.sup.8 alphavirus replicon particles. In further embodiments, the
population contains fewer than one replication-competent alphavirus
particle per 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12 or 10.sup.13
alphavirus replicon particles. The present invention additionally
provides a population of alphavirus replicon particles, wherein the
population contains no detectable replication-competent virus
particles, as determined by passage on permissive cells in culture
according to methods well known in the art.
[0069] Also provided herein is a population of alphavirus replicon
particles, wherein the population contains no detectable or fewer
than one replication-competent alphavirus particle per 10.sup.8,
10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12 or 10.sup.13 alphavirus
replicon particles, as determined by passage on permissive cells in
culture, wherein the alphavirus replicon particles comprise one or
more attenuating mutations in either an alphavirus structural
protein or an alphavirus nonstructural protein or both an
alphavirus structural protein and an alphavirus nonstructural
protein. Additionally provided is a population of alphavirus
replicon particles, wherein the population contains no detectable
replication-competent virus particles, as determined by passage on
permissive cells in culture, wherein the alphavirus replicon
particles comprise one or more attenuating mutations in either an
alphavirus structural protein or an alphavirus nonstructural
protein or both an alphavirus structural protein and an alphavirus
nonstructural protein.
[0070] It has been confirmed by the inventors that, despite the
lack of an identifiable "packaging signal," helper RNAs of this
invention, as well as helper RNAs described in the literature, are
packaged by the alphavirus structural proteins in the cultured
cells, sometimes at a frequency that is considerably higher than
that reported in the literature. Thus, the population of alphavirus
replicon particles of this invention is distinguished from those
particles described in the literature by the presence of a subset
of particles in the population in which are packaged the novel
helper molecules of this invention.
[0071] The terms "alphavirus replicon particles," "ARPs," "virus
replicon particles" or "recombinant alphavirus particles," used
interchangeably herein, mean a virion-like structural complex
incorporating an alphavirus replicon RNA that expresses one or more
heterologous RNA sequences. Typically, the virion-like structural
complex includes one or more alphavirus structural proteins
embedded in a lipid envelope enclosing a nucleocapsid that in turn
encloses the RNA. The lipid envelope is typically derived from the
plasma membrane of the cell in which the particles are produced. In
certain embodiments, the alphavirus replicon RNA is surrounded by a
nucleocapsid structure comprised of the alphavirus capsid protein,
and the alphavirus glycoproteins are embedded in the cell-derived
lipid envelope. The structural proteins and replicon RNA may be
derived from the same or different alphaviruses. In a specific
embodiment, the replicon RNA is derived from VEE and the structural
proteins are derived from Sindbis virus (see, e.g., Dubensky et
al., U.S. Pat. No. 6,376,236). The alphavirus replicon particles
are infectious but propagation-defective, i.e., the replicon RNA
cannot propagate beyond the host cell that the particles initially
infect, in the absence of the helper nucleic acid(s) encoding the
alphavirus structural proteins.
[0072] The terms "alphavirus RNA replicon," "alphavirus replicon
RNA," alphavirus RNA vector replicon," and "vector replicon RNA"
are used interchangeably to refer to an RNA molecule expressing
nonstructural protein genes such that it can direct its own
replication (amplification) and comprises, at a minimum, 5' and 3'
alphavirus replication recognition sequences (which may be the
minimal sequences, as defined above, but may alternatively be the
entire regions from the alphavirus), coding sequences for
alphavirus nonstructural proteins, and a polyadenylation tract. It
may additionally contain a promoter and/or an IRES. It may also be
engineered to express alphavirus structural proteins. Johnston et
al. and Polo et al. describe numerous constructs for such
alphavirus RNA replicons, and such constructs are incorporated
herein by reference. In one embodiment of the alphavirus replicon
RNA, the alphavirus nonstructural proteins are separated into two
separate translational units, as described in U.S. Patent
Publication 2003-0119182-A1, incorporated herein by reference.
[0073] An alphavirus replicon RNA with no heterologous sequences,
i.e., an empty replicon, can be used in an alphavirus replicon
particle to produce an adjuvant composition. Alternatively, the
alphavirus replicon RNA can express nucleic acid encoding
alphavirus structural proteins and/or other heterologous nucleic
acid sequences, the latter of which can be chosen from a wide
variety of sequences derived from viruses, prokaryotes and/or
eukaryotes. Examples of categories of heterologous sequences
include, but are not limited to, immunogens (including native,
modified or synthetic antigenic proteins, peptides, immunogenic
fragments, or epitopes), cytokines, toxins, therapeutic proteins,
enzymes, antisense sequences, and immune response modulators. If
appropriate and desired for the particular application, the
transcribed mRNA is then translated, i.e., protein is synthesized
or a functional RNA is produced. These mRNAs are "capped" within
the eukaryotic cell, i.e., a methyl-7-guanosine (5')pppN structure
is present at the 5' end of the mRNA (the "cap" or "5' cap"), and
this cap is recognized by the translation initiation factors that
synthesize protein from the mRNA. Thus, the 26S promoter directs
transcription, and the "cap" provides the initiation signal for
translation.
[0074] In some embodiments, the replicon RNA can lack nucleic acid
encoding any alphavirus structural protein(s). In other
embodiments, the alphavirus replicon RNA can comprise nucleic acid
encoding one or two alphavirus structural proteins, but the
replicon RNA does not contain nucleic acid encoding all of the
alphavirus structural proteins. Thus, the resulting alphavirus
replicon particles of this invention are propagation-defective
inasmuch as the replicon RNA does not encode all of the structural
proteins required for encapsidation of the replicon RNA and
assembly of an infectious virion.
[0075] Specific embodiments of the alphavirus RNA replicons
utilized in the claimed invention can contain one or more
attenuating mutations as described in detail herein, Examples of an
attenuating nucleotide substitution include the mutation at
nucleotide 3 in the VEE 5' end described herein and a mutation at
nsP1 amino acid position 538, nsP2 amino acid position 96, or nsP2
amino acid position 372 in the alphavirus S.A.AR86.
[0076] The alphavirus replicon particles of this invention can
comprise replicon RNA from any alphavirus. Furthermore, the
alphavirus replicon particles of this invention can comprise
alphavirus structural proteins from any of the alphaviruses of this
invention. Thus, the replicon particles can be made up of replicon
RNA and structural proteins from the same alphavirus or from
different alphaviruses, the latter of which would be chimeric
alphavirus replicon particles (e.g., a particle comprising VEE
virus-based replicon RNA and Sindbis virus structural
proteins).
[0077] In particular embodiments of the present invention, the
alphavirus structural protein of this invention can be a Sindbis
virus structural protein, a SFV structural protein, a VEE
structural protein, a Ross River virus structural protein, an EEE
structural protein and/or a WEE structural protein. These can be
present in any combination with one another and can be present in
combination with nonstructural proteins and other alphaviral
sequences, such as the 5' alphavirus replication recognition
sequence, the alphavirus subgenomic promoter and the 3' alphavirus
replication recognition sequence, from any of these or other
alphaviruses, to produce chimeric recombinant alphavirus replicon
particles and/or chimeric recombinant nucleic acids of this
invention.
[0078] In some embodiments of this invention, the present invention
can include alphavirus nucleic acids, alphavirus proteins,
alphavirus replicon RNA and/or alphavirus replicon particles
including one or more attenuating mutations, an attenuating
mutation being defined as a nucleotide deletion, addition, and/or
substitution of one or more nucleotide(s), or a mutation that
comprises rearrangement or chimeric construction, which results in
a loss of virulence in a live virus containing the mutation as
compared to the appropriate wild-type alphavirus.
[0079] Appropriate attenuating mutations will be dependent upon the
alphavirus used, and will be known to those skilled in the art.
Exemplary attenuating mutations include, but are not limited to,
those described in U.S. Pat. No. 5,505,947 to Johnston et al., U.S.
Pat. No. 5,185,440 to Johnston et al., U.S. Pat. No. 5,643,576 to
Davis et al., U.S. Pat. Nos. 5,792,462; 6,156,558 and 5,639,650 to
Johnston et al., the disclosures of each of which are incorporated
herein in their entireties by reference.
[0080] Specific attenuating mutations for the VEE E1 glycoprotein
can include an attenuating mutation at any one of E1 amino acid
positions 81, 272 or 253. Alphavirus replicon particles made from
the VEE-3042 mutant contain an isoleucine substitution at E1-81,
and virus replicon particles made from the VEE-3040 mutant contain
an attenuating mutation at E1-253. Specific attenuating mutations
for the VEE E2 glycoprotein can include an attenuating mutation at
any one of E2 amino acid positions 76, 120, or 209. Alphavirus
replicon particles made from the VEE-3014 mutant contain
attenuating mutations at both E1-272 and at E2-209 (see U.S. Pat.
No. 5,792,492). A specific attenuating mutation for the VEE E3
glycoprotein includes an attenuating mutation consisting of a
deletion of E3 amino acids 56-59. Virus replicon particles made
from the VEE-3526 mutant contain this deletion in E3 (aa56-59) as
well as a second attenuating mutation at E1-253. Specific
attenuating mutations for the S.A.AR86E2 glycoprotein include an
attenuating mutation at any one of E2 amino acid positions 304,
314, 372, or 376. Alternatively, the attenuating mutation can be a
substitution, deletion or insertion of an amino acid in the E2
glycoprotein, for example, at any one or more of the following
amino acid positions in any combination: 158, 159, 160, 161 and 162
(see Polo et al., PCT Publication No. WO 00/61772). Alternatively,
the RNA molecules of this invention can be derived from TC83, a
vaccine strain of VEE (see WO 2005/113782, which is incorporated
herein by reference).
[0081] Another attenuating mutation of this invention can be an
attenuating mutation at nucleotide 3 of the VEE genomic RNA, i.e.,
the third nucleotide following the 5' methylated cap (see, e.g.,
U.S. Pat. No. 5,643,576 describing a G.fwdarw.C mutation at nt 3).
This mutation, located in a non-coding sequence of the virus or
replicon, can be a G.fwdarw.A or a G.fwdarw.U mutation in some
embodiments. When the alphavirus structural and/or non-structural
proteins are from S.A.AR86, exemplary attenuating mutations in the
structural and non-structural proteins have been described in the
literature (see, e.g., U.S. Pat. No. 5,639,650 and U.S. Pat. No.
6,982,087, the disclosures of which are incorporated herein in
their entirety by reference).
[0082] The alphavirus of this invention can be a Sindbis virus
strain (e.g., TR339), VEE (e.g., having a mutation at nucleotide 3
of the genomic RNA following the methylated cap or TC83), S.A.AR86
virus, Girdwood S.A. virus, Ockelbo virus, and/or chimeric viruses
thereof. The complete genomic sequences, as well as the sequences
of the various structural and non-structural proteins are available
in the literature for numerous alphaviruses and include: Sindbis
virus genomic sequence (GenBank Accession Nos. J02363, NCBI
Accession No. NC.sub.--001547), S.A.AR86 genomic sequence (GenBank
Accession No. U38305), VEE genomic sequence (GenBank Accession No.
L04653, NCBI Accession No. NC.sub.--001449), TC-83 vaccine strain
of VEE (Kinney R M et al. (1989) Virology 170:19-30; with
correction noted in Kinney R M et al. (1993) J. Virol.
67(3):1269-1277); Girdwood S.A genomic sequence (GenBank Accession
No. U38304), Semliki Forest virus genomic sequence (GenBank
Accession No. X04129, NCBI Accession No. NC.sub.--003215), and the
TR339 genomic sequence (Klimstra et al., (1988) J. Virol. 72:7357;
McKnight et al. (1996) J. Virol. 70:1981).
[0083] Alphavirus replicon particles are prepared according to the
methods disclosed herein in combination with techniques known to
those skilled in the art. The methods include first introducing the
selected helper(s) and an alphavirus replicon RNA into a population
of alphavirus-permissive cells, and then incubating the cells under
conditions well known in the art that allow for the production of
alphavirus replicon particles. The step of introducing the
helper(s) and alphavirus replicon RNA into the population of helper
cells can be performed by any suitable means, as disclosed herein
and as known to those generally skilled in the art.
[0084] Populations of alphavirus replicon particles are collected
from the helper or packaging cells according to methods, e.g., as
described in U.S. Pat. No. 7,078,218, the content of which is
incorporated herein by reference in its entirety. Alternatively,
they can be collected from packaging cells using other techniques
known to those skilled in the art (e.g., U.S. Pat. Nos. 5,492,462
and 6,156,558). These populations are evaluated for the presence of
replication competent virus (RCV) according to methods as described
herein and as known in the literature. The populations of this
invention contain no detectable RCV, as determined by passage on
alphavirus-permissive cells in culture.
[0085] In some embodiments, the present invention can be employed
to package an alphavirus RNA replicon encoding an immunogenic
polypeptide in a subject (e.g., for vaccination), for immunotherapy
(e.g., to treat a subject with cancer or tumors), or an
immunomodulatory factor (e.g., for adjuvanting ARPs or other
vaccine modalities). The present invention provides methods of
eliciting or enhancing an immune response in a subject, comprising
administering to the subject an effective amount of a nucleic acid
packaged into particles by the helper constructs of this
invention
[0086] As used herein, "eliciting an immune response" and
"immunizing a subject" includes the development, in a subject, of a
humoral and/or a cellular immune response to a protein and/or
polypeptide of this invention (e.g., an immunogen, an antigen, an
immunogenic peptide, and/or one or more epitopes). A "humoral"
immune response, as this term is well known in the art, refers to
an immune response comprising antibodies, while a "cellular" immune
response, as this term is well known in the art, refers to an
immune response comprising T-lymphocytes and other white blood
cells, especially the immunogen-specific response by HLA-restricted
cytolytic T-cells, i.e., "CTLs."
[0087] It is also contemplated that the nucleic acids, particles,
populations and pharmaceutical compositions of this invention can
be employed in methods of delivering a NOT of interest to a cell,
which can be a cell in a subject. Thus, the present invention
provides a method of delivering a heterologous nucleic acid to a
cell, comprising introducing into the cell an effective amount of a
particle, population and/or composition packaged with the helper
constructs of this invention. Also provided is a method of
delivering a heterologous nucleic acid to a cell in a subject,
comprising delivering to the subject an effective amount of a
particle, population and/or composition packaged with the helper
constructs of this invention. The cell can be any cell that can
take up and express exogenous nucleic acids. The cell is maintained
under conditions whereby the heterologous nucleic acid is expressed
to produce a protein, peptide or other coding sequence product
(e.g., a functional RNA sequence) encoded by the heterologous
nucleic acid. Such methods can be employed to impart a therapeutic
effect on a cell and/or a subject of this invention, according to
well known protocols for immunization and/or gene therapy.
[0088] A "subject" of this invention includes, but is not limited
to, warm-blooded animals, e.g., humans, non-human primates, horses,
cows, cats, dogs, pigs, rats, and mice.
[0089] The present invention further provides a composition (e.g.,
a pharmaceutical composition) comprising a particle and/or
population of particles of this invention in a pharmaceutically
acceptable carrier. By "pharmaceutically acceptable" is meant a
material that is not biologically or otherwise undesirable, i.e.,
the material may be administered to a subject along with the
selected particles, and/or populations thereof, without causing
substantial deleterious biological effects or interacting in a
deleterious manner with any of the other components of the
composition in which it is contained. The pharmaceutically
acceptable carrier is suitable for administration or delivery to
humans and other subjects of this invention. The carrier would
naturally be selected to minimize any degradation of the active
ingredient and to minimize any adverse side effects in the subject,
as would be well known to one of skill in the art (see, e.g.,
Remington's Pharmaceutical Science; latest edition). Pharmaceutical
formulations, such as vaccines or other immunogenic compositions,
of the present invention comprise an immunogenic amount of the
infectious, propagation defective alphavirus replicon particles
produced using the helper constructs of this invention, in
combination with a pharmaceutically acceptable carrier. Exemplary
pharmaceutically acceptable carriers include, but are not limited
to, sterile pyrogen-free water and sterile pyrogen-free
physiological saline solution.
[0090] An "immunogenic amount" is an amount of the infectious
alphavirus particles in the populations of this invention that is
sufficient to evoke an immune response in a subject to which the
population of particles is administered or delivered. An amount of
from about 10.sup.4 to about 10.sup.9, especially 10.sup.6 to
10.sup.8, infectious units, or "IU", as determined by assays
described herein, per dose is considered suitable, depending upon
the age and species of the subject being treated. Administration
may be by any suitable means, such as intraperitoneally,
intramuscularly, intranasally, intravaginally, intravenously,
intradermally (e.g., by a gene gun), intrarectally and/or
subcutaneously. The compositions herein may be administered via a
skin scarification method, and/or transdermally via a patch or
liquid. The compositions can be delivered subdermally in the form
of a biodegradable material that releases the compositions over a
period of time.
[0091] As used herein, "effective amount" refers to an amount of a
population or composition or formulation of this invention that is
sufficient to produce a desired effect, which can be a therapeutic
effect. The effective amount will vary with the age, general
condition of the subject, the severity of the condition being
treated, the particular agent administered, the duration of the
treatment, the nature of any concurrent treatment, the
pharmaceutically acceptable carrier used, and like factors within
the knowledge and expertise of those skilled in the art. As
appropriate, an "effective amount" in any individual case can be
determined by one of ordinary skill in the art by reference to the
pertinent texts and literature and/or by using routine
experimentation. (See, for example, Remington, The Science And
Practice of Pharmacy (20th ed. 2000)).
[0092] Alternatively, pharmaceutical formulations of the present
invention may be suitable for administration to the mucous
membranes of a subject (e.g., via intranasal administration, buccal
administration and/or inhalation). The formulations may be
conveniently prepared in unit dosage form and may be prepared by
any of the methods well known in the art.
[0093] Also, the composition of this invention may be used to
infect or be transfected into dendritic cells, which are isolated
or grown from a subject's cells, according to methods well known in
the art, or onto bulk peripheral blood mononuclear cells (PBMC) or
various cell subtractions thereof from a subject.
[0094] If ex vivo methods are employed, cells or tissues can be
removed and maintained outside the body according to standard
protocols well known in the art while the compositions of this
invention are introduced into the cells or tissues.
[0095] Immunogenic compositions comprising a population of the
particles (which direct the expression of the nucleic acid
sequence(s) of interest when the compositions are administered to a
human or animal) of the present invention may be formulated by any
means known in the art. Such compositions, especially vaccines, are
typically prepared as injectables, either as liquid solutions or
suspensions. Solid forms suitable for solution in, or suspension
in, liquid prior to injection may also be prepared. Lyophilized
preparations are also suitable.
[0096] The active immunogenic ingredients (e.g., the alphavirus
replicon particles) are often mixed with excipients and/or carriers
that are pharmaceutically acceptable and/or compatible with the
active ingredient. Suitable excipients include but are not limited
to sterile water, saline, dextrose, glycerol, ethanol, or the like
and combinations thereof, as well as stabilizers, e.g., HSA or
other suitable proteins and reducing sugars.
[0097] In addition, if desired, the vaccines may contain minor
amounts of auxiliary substances such as wetting and/or emulsifying
agents, pH buffering agents, and/or adjuvants that enhance the
effectiveness of the vaccine. Examples of adjuvants which may be
effective include but are not limited to: QS-21, Freund's adjuvant
(complete and incomplete), aluminum salts (alum), aluminum
phosphate, aluminum hydroxide;
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP);
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred
to as nor-MDP);
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dip-
almitoyl-sn-glycero-3hydroxyphosphoryloxy)-ethylamine (CGP 19835A,
referred to as MTP-PE); and RIBI, which contains three components
extracted from bacteria, monophosphoryl lipid A, trehalose
dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2%
squalene/Tween 80 emulsion.
[0098] Additional examples of adjuvants can include, but are not
limited to, oil-in-water emulsion formulations, immunostimulating
agents, such as bacterial cell wall components or synthetic
molecules, or oligonucleotides (e.g., CpGs) and nucleic acid
polymers (both double stranded and single stranded RNA and DNA),
which can incorporate alternative backbone moieties, e.g.,
polyvinyl polymers.
[0099] The effectiveness of an adjuvant may be determined by
measuring the amount of antibodies or cytotoxic T-cells directed
against the immunogenic product of the alphavirus replicon
particles resulting from administration of the particle-containing
composition in a vaccine formulation that also comprises an
adjuvant or combination of adjuvants. Such additional formulations
and modes of administration as are known in the art may also be
used.
[0100] Adjuvants can be combined, either with the compositions of
this invention or with other vaccine formulations that can be used
in combination with the compositions of this invention.
[0101] The compositions of the present invention can also include
other medicinal agents, pharmaceutical agents, carriers, and
diluents.
[0102] The compositions of this invention can be optimized and
combined with other vaccination regimens to provide the broadest
(i.e., covering all aspects of the immune response, including those
features described hereinabove) cellular and humoral responses
possible. In certain embodiments, this can include the use of
heterologous prime-boost strategies, in which the compositions of
this invention are used in combination with a composition
comprising one or more of the following: immunogens derived from a
pathogen or tumor, recombinant immunogens, naked nucleic acids,
nucleic acids formulated with lipid-containing moieties,
non-alphavirus vectors (including but not limited to pox vectors,
adenoviral vectors, adeno-associated viral vectors, herpes virus
vectors, vesicular stomatitis virus vectors, paramyxoviral vectors,
parvovirus vectors, papovavirus vectors, retroviral vectors,
lentivirus vectors), and other alphavirus vectors. The viral
vectors can be virus-like particles or nucleic acids. Exemplary
alphavirus vectors can be replicon-containing particles, DNA-based
replicon-containing vectors (sometimes referred to as an "ELVIS"
system, see, for example, U.S. Pat. No. 5,814,482) and/or naked RNA
vectors.
[0103] The immunogenic (or otherwise biologically active)
alphavirus particle-containing populations and compositions of this
invention are administered in a manner compatible with the dosage
formulation, and in such amount as will be prophylactically and/or
therapeutically effective. The quantity to be administered, which
is generally in the range of about 10.sup.4 to about 10.sup.9
infectious units per mL in a dose, depends on the subject to be
treated, the route by which the particles are administered or
delivered, the immunogenicity of the expression product, the types
of effector immune responses desired, and the degree of protection
desired. In some embodiments, doses of about 10.sup.6, 10.sup.7,
and 10.sup.8 I.U. may be particularly effective in human subjects.
Effective amounts of the active ingredient required to be
administered or delivered may depend on the judgment of the
physician, veterinarian or other health practitioner and may be
specific for a given subject, but such a determination is within
the skill of such a practitioner.
[0104] The compositions and formulations of this invention may be
given in a single dose or multiple dose schedule. A multiple dose
schedule is one in which a primary course of administration may
include 1 to 10 or more separate doses, followed by other doses
administered at subsequent time intervals as required to maintain
and or reinforce the desired effect (e.g., an immune response),
e.g., weekly or at 1 to 4 months for a second dose, and if needed,
a subsequent dose(s) after several months (e.g., 4 or 6
months)/years.
[0105] Efficacy of the treatment methods of this invention can be
determined according to well known protocols for determining the
outcome of a treatment of a disorder of this invention.
Determinants of efficacy of treatment, include, but are not limited
to, overall survival, disease-free survival, improvement in
symptoms, time to progression and/or quality of life, etc., as are
well known in the art.
[0106] "Treat" or "treating" or "treatment" refers to any type of
action that imparts a modulating effect, which, for example, can be
a beneficial effect, to a subject afflicted with a disorder,
disease or illness, including improvement in the condition of the
subject (e.g., in one or more symptoms), delay or reduction in the
progression of the condition, prevention or delay of the onset of
the disorder, disease or illness, and/or change in any of the
clinical parameters of a disorder, disease or illness, etc., as
would be well known in the art.
[0107] It is understood that the foregoing detailed description is
given merely by way of illustration and that modifications and
variations may be made therein without departing from the spirit
and scope of the invention.
EXAMPLES
Example 1
Construction of dHcap and dHgp Helpers
[0108] Primers were designed (capsid F (SEQ ID NO:98), GP F (SEQ ID
NO:60) and 13-101.pr4 (SEQ ID NO:61) (Table 1), to amplify the
capsid and glycoprotein (GP) genes out of the VEE helper plasmids
(referred to as "13.2.2" for the capsid helper and "13.4.6" for the
glycoprotein helper), which are described in U.S. Pat. Nos.
5,792,462, Pushko et al., 1997 (Virology 239:389-401), and PCT
publication WO 02/03917 (Olmsted et al.). These primers provide an
Rsr II restriction site and also bind to the start of the capsid or
glycoprotein coding sequence, respectively. The DNA plasmids
described in the above-cited references are a convenient source for
obtaining the structural protein coding fragments, e.g., by PCR
amplification. Alternatively, these coding fragments can be
obtained from full-length clones of VEE or attenuated variants
thereof (see U.S. Pat. No. 5,185,440; U.S. Pat. No. 5,505,947).
[0109] Amplification with these primers resulted in fragments with
the following elements, listed from the 5' to the 3' ends of the
PCR product: 5'-RsrII restriction site, VEE structural protein
coding sequence ORF, 3' UTR, SphI restriction site -3'. The PCR
products were then digested with RsrII and SphI restriction enzymes
and ligated into an empty VEE replicon vector, as described in U.S.
Pat. No. 5,792,462, Pushko et al., 1997 (Virology 239:389-401) and
PCT Publication No. WO 02/03917 (Olmsted et al.). This replicon RNA
contains the VEE nonstructural genes and a single copy of the 26S
subgenomic RNA promoter followed by a multiple cloning site (MCS).
In a vaccine construct, one or more coding sequences encoding an
immunogen are inserted into this cloning site. This vector is
digested with RsrII and SphI (removing most of nsP1 and all of
nsPs2-4), and upon ligation, helpers are generated which comprise
the complete alphavirus 5' and 3' ends, i.e., "full-length" ends.
These two helpers are therefore designated dHcap(FL) and dHgp(FL)
and they have the 5' sequences of SEQ ID NO:1 and SEQ ID NO:10,
respectively and the 3' sequences of SEQ ID NO:55 and SEQ ID NO:56,
respectively (FIG. 1).
[0110] Subsequently, eight consecutive deletions of approximately
50 nt each were made in the 522 nt 5' end present in both the
dHcap(FL) and dHgp(FL) helpers (FIG. 2). The procedure was carried
out in two steps. First, eight different reverse primers (dHelp1-8
R, SEQ ID NOS: 63-70) were designed complementary to the 5' end up
to position 502 of the 13.2.2 and 13.4.6 helpers (described
hereinabove), and each was engineered to additionally contain an
RsrII restriction site (Table 1). A forward primer (3-16.1.1 (SEQ
ID NO:62), Table 1) was designed, which when combined with any of
the reverse primers, amplified a fragment with the following
elements (listed 5' to 3'): 5'-XbaI restriction site, T7 promoter,
5' truncated end, RsrII restriction site-3'. Second, the amplified
5' truncated end fragments were cloned into the dHcap(FL) and
dHgp(FL) helpers linearized with XbaI and RsrII. This generated
eight sets of 5' truncated end helper constructs, designated
dHcap1-8 and dHgp1-8, which have the 5'sequences of SEQ ID NOS: 2-9
and SEQ ID NOS: 11-18, respectively. The 3' sequence of each member
of the dHcap series is provided herein as SEQ ID NO:55 and the 3'
sequence of each member of the dHgp series is provided herein as
SEQ ID NO:56.
Example 2
Methods for Expression Analysis of Promoterless Helper Expression
Cassettes
[0111] To determine how well the .DELTA.26S helper configurations
described herein expressed VEE structural proteins, each helper was
electroporated into Vero cells along with a VEE replicon vector as
described above. For purposes of demonstrating the capability of
the novel promoterless structural protein expression cassettes of
this invention, VEE replicons were constructed by inserting a GFP
or a botulinum neurotoxin coding sequence into the VEE replicon
vector's cloning site. Expression of these coding sequences from
particles made with various combinations of the promoterless
structural protein expression cassettes described herein
demonstrated the utility and novelty of these cassettes.
[0112] RNA was transcribed from each helper and replicon vector by
run-off transcription using RiboMAX T7 Express.RTM. transcription
kits (Promega Corporation, Madison, Wis.) according to the
manufacturer's procedure. Before electroporation, helper and
replicon RNAs were purified by silica-based chromatography. Thirty
micrograms (30 .mu.g) of each helper and replicon RNA were combined
and electroporated into 3-5.times.10.sup.7 Vero cells.
Electroporated cells were diluted in medium and seeded into 25
cm.sup.2 flasks or 96 well plates. The electroporated cells were
then incubated for 16-24 hr at 37.degree. C.
A. IFA Analysis
[0113] Electroporated cells seeded into 96 well plates were washed
with phosphate buffered saline (PBS) one time and then fixed with
acetone:methanol (1:1) at room temperature for five min. The cells
were then analyzed for expression of VEE capsid or GP protein using
structural protein specific mouse antibodies. Primary antibody was
diluted in PBS:FBS (1:1) and 100 .mu.l was added to each well.
Plates were incubated at 37.degree. C. for 30 min, washed with 150
.mu.l PBS three times and then incubated with Alexa Fluor 488 goat
anti-mouse secondary antibody (Invitrogen, Carlsbad, Calif.) for 30
min at 37.degree. C. After incubation, cells were washed again as
described above and a final volume of 100 .mu.l PBS was added to
each well before inspection by ultraviolet fluorescence microscopy
(Nikon Eclipse TE300).
B. Northern Analysis
[0114] Electroporated cells seeded into 25 cm.sup.2 flasks were
washed with PBS and then total cellular RNA was extracted using
RNAwiz RNA.RTM. isolation reagent (Ambion, Austin, Tex.) following
the manufacturer's suggested protocol. RNA concentration was
determined by spectrophotometry. Five micrograms (5 .mu.g) of each
sample were electrophoresed through a 1% glyoxal agarose gel and
RNA was passively transferred to BrightStar Plus.RTM. (Ambion)
membranes. Northern analysis was carried out with a biotinylated
DNA oligo specific for the positive strand of the VEE 3'
replication recognition sequence using a BrightStar BioDetec.RTM.
kit (Ambion) following the manufacturer's suggested protocol.
Chemiluminescence was detected by exposing the processed membranes
to film.
C. Analysis of dHcap(FL) and dHgp(FL) Expression
[0115] To demonstrate that the full-length .DELTA.26S helpers
(dHcap(FL) and dHgp(FL)) could be replicated and express proteins,
these helper RNAs were electroporated into cells along with a
replicon vector, which is needed to provide the alphavirus
non-structural proteins that facilitate replication of the helper
RNAs. Vero cells were electroporated with either 30 or 60 .mu.g of
dHcap(FL) or dHgp(FL) helper RNA combined with 30 .mu.g of replicon
RNA. The electroporated cells were processed for IFA, Western blot
and Northern analysis as described above.
Example 3
Expression Analysis for Full-Length and Truncated .DELTA.26S
Helpers
[0116] The dHcap(FL) and dHgp(FL) helpers expressed protein as
determined by IFA and Western blot and were replicated efficiently
as demonstrated by Northern blot.
[0117] The complete set of truncated .DELTA.26S helpers (deletions
1-8) for both capsid and GP were analyzed for protein expression by
IFA and by Northern blot to determine how well each was expressed
and replicated. Each dHcap helper RNA was combined with a VEE
replicon RNA and the 13.4.6 glycoprotein helper RNA, and the three
RNAs were electroporated into Vero cells. Northern analysis and IFA
were carried out as described above. The results of IFA using a
capsid specific antibody are shown in Table 2. All dHcap helpers
were positive for capsid expression by IFA although the dHcap8
helper was only weakly positive.
[0118] Northern analysis of RNA extracted from electroporated cells
indicated that all of the truncated capsid .DELTA.26S helpers
replicated well except for dHcap8.
[0119] The dHgp helpers were examined in a similar manner but the
13.2.2 capsid helper was not included in this experiment. Each dHgp
helper was combined with a VEE replicon RNA, electroporated into
cells, and samples were generated as described above for IFA and
Northern analysis. Results of anti-GP IFA are shown in Table 3.
Similar to the dHcap helpers, all dHgp helpers were positive except
dHgp8. All dHgp helpers replicated well with the exception of
dHgp8.
Example 4
Modified Promoterless Helper Constructs
[0120] The inventors noted that the dHcap(FL) and dHgp(FL) helpers
expressed fusion proteins, as revealed by Western blotting. Such
fusion proteins could be the result of initiation of translation at
in-frame start codons upstream of the start codon for capsid or GP
on the .DELTA.26S helper transcripts. One such upstream codon is
the native start codon for VEE nsP1 (located at nucleotide 45 in
the VEE viral genome), which is present in the 5' end of both the
dHcap and dHgp helpers, and is in a favorable context for
initiation of translation (e.g., a Kozak consensus sequence). It is
possible that a start codon in a favorable Kozak environment could
be used by ribosomes scanning from the capped 5' end of these
helpers, thereby generating fusion proteins that are not functional
and decreasing the production of functional capsid and glycoprotein
polypeptides from the appropriate start codon located further
downstream.
[0121] Two approaches were used to decrease the amount of such
fusion proteins produced and increase full-length capsid and
glycoprotein protein expression. First, the favorable start codon
described above was mutated to a TAG stop codon and the remaining
start codons were left unchanged. This approach was taken to keep
the 5' end sequence as close to the sequence present in the native
VEE genome as possible, in order to maintain the replication
elements relied upon for these helpers. Second, all of the start
codons downstream of nt 3 (including the nsP1 (favorable) start
codon) and the capsid or glycoprotein coding sequence open reading
frame (ORF) were changed from AUG to GUG (there were a total of 12
such changes). This approach was taken to determine whether less
favorable ATG codons (AUG in RNA) might also have detrimental
effects on the production of full-length capsid or glycoprotein
expression.
A. Construction of dHcap-mut1 and dHgp-mut1 Helpers
[0122] To generate dHcap and dHgp helpers that have the favorable
nsP1 start codon changed to a TAG stop codon, site directed
mutagenesis was carried out on each dHcap and dHgp helper,
generating a complete set (FL and truncations 1-7) of mutated
helpers, designated dHcap-mut1 and dHgp-mut1 helpers, which have 5'
sequences as provided herein as SEQ ID NOS: 35-42 and 43-50,
respectively. Site directed mutagenesis was carried out with a
Quikchange XL.RTM. site directed mutagenesis kit (Stratagene, La
Jolla, Calif.) according to the manufacturer's protocol using
forward (SEQ ID NO:71) and reverse (SEQ ID NO:72) primers in Table
4.
B. Construction of dHcap-mm and dHgp-mm Helpers
[0123] To generate dHcap and dHgp helpers with 5' ends that do not
have any start codons downstream of nt 3 and the capsid or GP ORF
start codons, site directed mutagenesis was carried out to change
all intervening ATG (AUG IN RNA) codons to GTG (GUG in RNA) codons.
The dHgp(FL) construct was used as the template for site directed
mutagenesis. A Quikchange.RTM. multi site-directed mutagenesis kit
(Stratagene) was used to introduce the codon changes using the
manufacturer's protocol. The primers used to introduce the codon
changes are shown in Table 5 (SEQ ID NOS: 73-82). The dHgp(FL)
construct containing all of the codon changes was designated
dHgp(FL)-mm (having the 5' sequence provided herein as SEQ ID NO:
19). After sequence confirmation that all codon changes were
present, this DNA was used to generate the dHcap(FL)-mm construct
by replacing the dHcap(FL) 5' replication recognition sequence with
the 5' replication recognition sequence from dHgp(FL)-nm. This was
accomplished by digesting both DNAs with RsrII and Not I enzymes.
The dHgp(FL)-mm RsrII/NotI 5' replication recognition sequence
fragment was then ligated with the linearized dHcap(FL) DNA,
generating dHcap(FL)-mm (having the 5' sequence provided herein as
SEQ ID NO:27). In addition, the dHgp(FL)-mm DNA was used as the
template to generate the 5' truncated end sets for both capsid and
GP helpers using the method and primers described above for
dHcap1-7 and dHgp1-7. The new helpers were designated
dHcap1mm-dHcap7 mm (having 5' sequences provided herein as SEQ ID
NOS:20-26) and dHgp1mm-dHgp7 mm (having 5' sequences provided
herein as SEQ ID NOS:28-34).
C. Analysis of Expression of mut1 and mm Promoterless Helpers
[0124] Protein production from various mut1 and mm versions of the
.DELTA.26S helpers described above was analyzed. In this
experiment, the dHcap6-mut1 (with the 5' sequence provided herein
as SEQ ID NO:41), dHcap6-mm (with the 5' sequence provided herein
as SEQ ID NO:25), dHcap7-mm (with the 5' sequence provided herein
as SEQ ID NO:26) and dHgp7-mm (with the 5' sequence provided herein
as SEQ ID NO:27), as well as the 13.2.2 and 13.4.6 helpers, were
analyzed by Western blot. The .DELTA.26S helpers containing the mm
mutations expressed primarily full length capsid or GP proteins
with little or no fusion proteins detectable. The mut1 helpers
expressed significant amounts of full-length structural protein,
but they also continued to express some fusion proteins.
[0125] Northern analysis was carried out on the same samples to
analyze the replication characteristics of the mut1 and mm
.DELTA.26S helpers. The results indicate that the dHcap6-mut1
helper replicates as well as the 13.2.2 capsid helper. In contrast,
the dHcap6-mm, dHcap7-mm and dHgp7-mm helpers appear to replicate
to a lesser extent than 13.2.2 or mut1 helpers.
Example 5
VEE Replicon Particle Generation with .DELTA.26S Helpers
[0126] Listed in Table 6 are a number of experiments combining
different promoterless capsid and GP helpers with a VEE replicon
RNA to produce VEE replicon particles (VRP). In addition, the
amount of each helper RNA introduced into cells was also varied in
some experiments. VRPs were generated by electroporating
5.times.10.sup.7 to 1.times.10.sup.8 Vero cells with the indicated
amounts of helper RNA as well as 30 .mu.g of replicon RNA. In
general, for all experiments in which particles are generated,
electroporated cells were seeded into 300 cm.sup.2 flasks
containing serum free media and incubated 16-24 hr before the VRPs
were harvested.
[0127] VRP titers were determined by infecting Vero cells, grown in
96 well plates, with ten-fold serial dilutions of sample,
incubating the cells for 16-18 hr, fixing the cells and performing
IFA with antibodies specific for VEE nsP2 protein or the product of
the nucleic acid of interest. VRP yields are reported either as
total yield from an experiment (i.e., Table 6) or on a per ml basis
from a 20 ml preparation (Tables 7, 9-13, 15 and 16).
[0128] These preparations were also tested for the presence of
replication-competent virus (RCV) by a cytopathic effect (CPE)
assay. The CPE assay consisted of two blind passages in cell
culture to screen for the presence of RCV. For Passage 1, samples
from a VRP preparation were incubated with Vero cell monolayers for
1 hr at 37.degree. C., then the sample fluids were removed and
replaced with fresh medium, and the cultures were incubated for 24
hr to allow amplification of any RCV that might be present. For
Passage 2, cell culture supernatants at the end of Passage 1 were
added to fresh Vero cell monolayers and incubated at 37.degree. C.
for 72 hr. At the end of Passage 2, cultures were inspected for CPE
using an inverted light microscope. This assay has been
standardized and evaluated for sensitivity in detecting viable
virus in the presence of a large excess of VRP. Using either V3014
or TC-83 viruses in this assay, spiking studies revealed a lower
limit of detection of 3-8 PFU on a background of 1.times.10.sup.8
VRP. This assay has been performed on more than 10.sup.13 VRPs
produced with the promoterless helpers of this invention, and no
RCV has ever been detected. Despite the limit of detection of this
assay, theoretical calculations of the possible recombination
frequency for generation of RCV would be much lower using this
limit of detection, i.e., 1 in 10.sup.10, 1 in 10.sup.11, 1 in
10.sup.12, or 1 in 10.sup.13 VRPs.
Example 6
"Split Glycoprotein" Promoterless Helpers
A. Construction of Separate E2 and E1 Promoterless Helpers
[0129] Construction of glycoprotein promoterless helpers in which
the E2 and E1 coding sequences were placed on separate helpers was
performed by cloning the E2 and E1 glycoprotein cassettes
separately into the backbone of the dHgp6-mut1 helper. Primers were
designed to amplify by PCR the capsid-E3-E2 region of the VEE
structural protein coding region from pHCMV-Vsp (see U.S. Pat. No.
7,045,335, incorporated herein by reference). The amplified
fragment was cloned into the pCR-Blunt II TOPO.RTM. vector
(Invitrogen), generating pCR-CE3E2. The CE3E2 cassette was
sequenced to ensure that no errors were introduced during PCR
amplification. To produce a promoter-assisted helper that contained
the CE3E2 structural region, the pCR-CE3E2 DNA was digested with
SpeI restriction enzyme to release an E3E2 fragment. The E3E2
(SpeI) fragment was then ligated with the capsid helper (13.2.2)
linearized with SpeI enzyme to produce pHCE3E2. The promoterless E2
helper (designated dHE2-6M1) was prepared by digesting the E3-E2
coding region from pHCE3E2. The pHCE3E2 DNA plasmid was first
linearized with AscI restriction enzyme and then treated with T4
DNA polymerase to create a blunt end. Similarly, the dHgp6-mut1 DNA
plasmid was linearized with SphI restriction enzyme and T4 DNA
polymerase-treated to create a blunt end. Both linearized,
T4-polymerase treated DNAs were then digested with SpeI restriction
enzyme, and the resulting 3.6 kb dHgp6-mut1 vector fragment and 1.4
kb E3-E2 fragment were each gel-purified. The two purified
fragments were then ligated together using T4 DNA ligase to produce
the dHE2-6M1 promoterless helper.
[0130] Generation of a promoterless E1 helper was accomplished in
several steps. Primers were designed to amplify two structural
protein coding sequence fragments: 1) capsid-E3 (CE3), and 2) 6K-E1
(6KE1). The PCR products were cloned into the pCR-Blunt TOPO.RTM.
vector (Invitrogen), generating pCR-CE3 and pCR-6KEI. The clones
were sequenced to ensure that no errors were introduced during
amplification. To produce a cassette that contained both the E3 and
6K leader sequences upstream of the E1 glycoprotein, another
intermediate construct was produced. This was accomplished by
digesting pCR-6KE1 DNA with BamHI enzyme and purifying the 6KE1
fragment. The 6KE1 (BamHI) fragment was then ligated with pCR-CE3
DNA linearized with BamHI enzyme, generating pCR-CE36KEI. To
generate a promoter-assisted helper containing the CE36KE1
cassette, pCR-CE36KE1 DNA was digested with SpeI and SphI enzymes
releasing the structural protein coding sequence cassette. The
CE36KE1 (SpeI/SphI) fragment was then ligated with capsid helper
(13.2.2) linearized with SpeI and SphI to produce pHCE36KE1.
Generation of the promoterless E1 helper (designated dHE1-6M1) was
accomplished by digesting the E3-6K-E1 coding region from the
pHCE36KE1 plasmid. The pHCE36KE1 and dHgp6-mut1 DNA plasmids were
digested with SpeI and SphI restriction enzymes and the resulting
3.6 kb dHgp6-mut1 vector fragment and 1.7 kb E3-6K-E1 fragments
were gel-purified. The two purified fragments were then ligated
together using T4 DNA ligase to produce the dHE1-6M1 promoterless
helper.
B. Analysis of Split Glycoprotein Promoterless Helpers
[0131] The individual glycoprotein helpers were transcribed in
vitro, and the RNA transcripts were purified prior to being
electroporated into Vero cells along with a VEE replicon RNA.
Helper replication was analyzed by Northern blot and protein
expression was analyzed by IFA using E1 and E2 glycoprotein
specific antibodies. Northern results indicate the both the
dHE1-6M1 and dHE2-6M1 helper replicate efficiently. A
representative Northern blot is shown in FIG. 3.
[0132] To determine whether the two individual
glycoprotein-expressing promoterless helpers could be combined with
a .DELTA.26S capsid helper to package a replicon RNA to produce
VRP, the three helpers were combined with VEE replicon RNA
expressing a botulinum neurotoxin A fragment and electroporated
into Vero cells. VRP yields from one experiment are shown in Table
7.
Example 7
Modified 5' and 3' End Promoterless Helper Cassettes
A. Construction of Modified 5' End Helper Cassettes
[0133] The predicted secondary structure at the 5' end
(.about.first 250 nt) of the RNA of most alphaviruses contains four
stem loop (SL) structures (SL1, SL2, SL3 and SL4). Frolov et. al.
(RNA, 7:1638-1651 (2001)) demonstrated that removal of the
nucleotide sequences encoding SL2 from a Sindbis virus helper RNA
increased replication of that helper.
[0134] The SL2 region in the VEE 5' end (based on the M-fold
program), nt 46 to nt 116 inclusive, was removed from the
dHcap6-mut1 by PCR as follows. Two fragments were amplified from
dHcap6-mut1 DNA. A 5' fragment of approximately 1 kilobase (kb) was
amplified with primers 13-82.1.9 [SEQ ID NO. 83] and dLS2(EcoRV) R
[SEQ ID NO. 84] (Table 8) that contained the 45 nucleotides at the
5' end of dHcap6-mut1 and the nucleotides encoding the backbone
plasmid sequence. A 3' fragment of approximately 1.5 kb was
amplified with primers dSL2 (EcoRV) F [SEQ ID NO. 85] and 3-8.pr4
[SEQ ID NO. 86] (Table 8) that contained the portion of the VEE 5'
end beginning with nucleotide 117 and the nucleotides encoding the
entire capsid sequence through the VEE 3' end. The 5' .about.1 kb
PCR fragment was digested with XhoI and EcoRV restriction enzymes.
The 3' .about.1.5 kb PCR fragment was digested with EcoRV and NotI
restriction enzymes. Plasmid dHgp6-mut1 was linearized by digestion
with XhoI and NotI and the resulting .about.2.5 Kb vector backbone
was purified. To generate the new helper in which the SL2 region
was deleted, herein referred to as "dHcap6-mut1(dSL2)," the 5'
(XhoI/EcoRV) fragment, 3' (EcoRV/NotI) fragment, and the XhoI/NotI
linearized vector were ligated together. The dHcap6-mut1(dSL2)
helper, with a 5' end the sequence of which is provided herein as
SEQ ID NO. 51, was completely sequenced to ensure that no errors
were introduced during PCR amplification. To generate the matching
dHgp6-mut1(dSL2) helper, dHgp6-mut1 DNA was digested with XhoI and
RsrII restriction enzymes and the 5.4 kb fragment was purified. The
modified 5' end from dHcap6-mut1(dSL2) was collected by digesting
this DNA with XhoI and RsrII and purifying the 1.1 kb fragment.
These two fragments were ligated together to generate
dHgp6-mut1(dSL2), which has the identical 5' end [SEQ ID NO. 51] as
dHcap6-mut1(dSL2).
B. Construction of Shortened 3'-End Promoterless Helper
Cassettes.
[0135] In these examples, for the capsid helper constructs
dHcap(FL), dHcap1 through dHcap7, dHcap(FL)mm, dHcap1mm through
dHcap7 mm, dHcap(FL)mut1, and dHcap1mut1 through dHcap7mut1, the 3'
end sequence is provided herein as SEQ ID NO. 55. Although the VEE
capsid helpers of this invention lack the complete glycoprotein
coding region, a small portion of the E3 protein remains on the
capsid helper to allow the chymotrypsin-like cleavage to occur
within the packaging cell to produce mature capsid protein. For the
glycoprotein helper constructs dHgp(FL), dHgp1 through dHgp7,
dHgp(FL)mm, dHgp1mm through dHgp7 mm, dHgp(FL)mut1, and dHgp1mut1
through dHgp7mut1, the 3' end sequence was a shorter sequence,
since the sequence comprising the cleavage site for generating the
mature capsid protein is not required in the glycoprotein helper
constructs. The 3' sequence used for these glycoprotein constructs
in these examples is provided herein as SEQ ID NO. 56.
[0136] In addition, promoterless RNA helpers with shorter 3' end
lengths were constructed. By reducing the amount of alphavirus 3'
end sequence, the theoretical possibility for a second
recombination event, which would be required to generate
replication competent VEE virus, is further reduced. Initially, a
glycoprotein helper with a functional 26S promoter containing only
the 19 nucleotides comprising the alphavirus highly conserved 3'
sequence [SEQ ID NO. 52] was produced in the following two steps.
First, a plasmid was produced that contained a glycoprotein (GP)
coding sequence cassette with unique 5' and 3' restriction sites.
Primers were designed to amplify the VEE GP with a unique SphI site
just after the E1 termination codon at the 3' end ("GP (SphI) R,"
SEQ ID NO. 87, Table 8) and an existing internal SpeI site at the
5' end ("3-16.1.3," SEQ ID NO. 88, Table 8). The amplified fragment
was TA cloned into pCR2.1 DNA (Invitrogen, Carlsbad, Calif.)
generating pCR2.1/GP 19 nt 5'. Second, a forward primer was
designed to introduce a SphI site just upstream of the 19
nucleotide conserved sequence at the VEE 3' end (3' trunc (SphI) F,
SEQ ID NO. 89, Table 8). A reverse primer, specific for the plasmid
backbone sequence, was designed to amplify a fragment that would
contain a unique AflII restriction site at the 3' end (3' trunc
(AflIII) R, SEQ ID NO. 90, Table 8). The fragment resulting from
amplification with these primers was digested with SphI and AflII
and ligated into the 13.4.6 glycoprotein helper (described in
Example 1), which had been linearized with SphI and AflII
restriction enzymes, thereby resulting in construction of pGP
helper-int1. The pGP helper-int1 construct has a 72 nucleotide
region between the GP stop codon and the 3' end of the helper
(including the 19 nt conserved sequence). To generate a GP helper
with only the 19 nucleotide 3' end, the pCR2.1/GP 19 nt 5' DNA was
digested with SpeI and SphI and the GP coding sequence ligated into
the pGP helper-int1 digested with SpeI and SphI restriction
enzymes. The resultant construct was named pGP helper 19 nt.
[0137] The pGP helper 19 nt construct was then used to produce
.DELTA.26S helpers with variable length 3' replication recognition
sequences. The pGP helper 19 nt construct was digested with NcoI
and NotI restriction enzymes and the 2515 base pair fragment
containing the glycoprotein coding sequence with the 19 nt 3' end
region was gel-purified. This 2515 base pair (NcoI/NotI) fragment
was then ligated into dHgp constructs digested with NcoI and NotI
restriction enzymes, generating the various dHgp 19 nt
constructs.
C. Construction of a Modified Promoterless Helper Cassette
Expressing the Alphavirus Capsid Protein.
[0138] In a VEE virus-infected cell, the VEE capsid protein cleaves
itself from the structural polyprotein that is translated from the
26S subgenomic mRNA. Although the VEE capsid helpers of this
invention lack the complete glycoprotein coding region, a small
portion of the E3 protein remains on the capsid helper to allow the
chymotrypsin-like cleavage to occur within the packaging cell to
produce mature capsid protein. Introduction of a stop codon at the
3' end of the capsid, in place of the chymotrypsin-like cleavage
site, would increase the difficulty of producing functional
recombinants with a glycoprotein helper. That is, for a functional
recombination (i.e., one that generates a replication competent
virus) to occur with a dHgp helper of this invention, the
recombination event would have to be nucleotide perfect to replace
the engineered stop codon in the capsid coding sequence and
maintain an active capsid cleavage site. Two versions of dHcap
helpers with stop codons incorporated at the 3' end were produced.
One version, dHcap6-mut1-dSL2 (stop), which has a 3' sequence
provided herein as SEQ ID NO:57, replaced the C-terminal tryptophan
residue of the native capsid protein with a stop codon; the other
version retained the C-terminal tryptophan residue (dHcap6-mut1
(W-stop), which has a 3' sequence provided herein as SEQ ID NO: 59)
and inserted a stop codon immediately downstream of the tryptophan
residue. The capsid coding sequence was amplified with primers
designed to engineer a unique RsrII site at the 5' end (Capsid
(RsrII-Kozak) F, SEQ ID NO: 91, Table 8) and a unique SphI site at
the 3' end (Capsid (stop) SphI R, SEQ ID NO:92 or Capsid (W-stop)
SphI R, SEQ ID NO: 93, Table 8). The forward primer was also
engineered to place the capsid start codon in a near-optimal Kozak
consensus sequence (Kozak, Cell, 44(2):283-292 (1986)) to enhance
ribosome initiation of translation of the capsid mRNA. The
amplified capsid coding sequences were digested with RsrII and SphI
restriction enzymes and ligated into .DELTA.26S helper plasmids
linearized with RsrII and SphI to produce dHcap6-mut1-dSL2 (stop)
and dHcap6-mut1 (W-stop) constructs.
D. Construction of Modified Promoter Helper Cassette Expressing
Alphavirus Glycoproteins.
[0139] The VEE capsid protein is a chymotrypsin-like protease that
cleaves after the capsid C-terminal tryptophan residue. On the
basis of the cleavage specificity of chymotrypsin, it is expected
that all amino acid residues are tolerated in the position
immediately downstream of the tryptophan except methionine and
proline. Having either of these amino acids immediately downstream
of the tryptophan is expected to greatly reduce chymotrypsin
cleavage activity. In the native VEE virus, there are 18 amino
acids that comprise the VEE E3 signal sequence. Constructs were
designed to reduce the number of amino acids in the E3 signal
sequence while maintaining the signaling function of the E3
sequence. Since 16 of the 18 amino acids comprising the E3 sequence
are expected to be tolerated in the position downstream of the
capsid C-terminal tryptophan, reducing the number of amino acids in
the E3 signal sequence will reduce the number of sites that would
be functional as cleavage sites if they were placed immediately
downstream of the C-terminal tryptophan upon the occurrence of a
nucleotide-perfect recombination event that reconstituted the VEE
structural polyprotein coding sequence. As an example of such an
approach, the N-terminal serine residue normally present in the E3
signal sequence was removed by PCR, leaving a leucine residue as
the N-terminal residue, and a dHgp promoterless helper was
constructed to determine if such a modified gp helper would
function to package VRP.
[0140] A forward PCR primer (Gp (RsrII-Ser) F, SEQ ID NO: 94) was
designed to remove the N-terminal serine residue of E3 and maintain
a unique RsrII restriction site (Table 8). A reverse PCR primer
(3-16.2.14, SEQ ID NO: 95) was designed to amplify a gp fragment
that would contain a unique SnaBI restriction site (Table 8). The
resulting gp PCR fragment was digested with RsrII and SnaBI and
ligated into RsrII and SnaBI digested dHgp6-mut1 DNA, generating
dHgp6-mut1 (-S).
E. VRP Generation Experiments Using 5' and 3' Modified .DELTA.26S
Helpers
[0141] Helpers that contain combinations of the modifications
described above were also prepared. Different combinations and RNA
concentrations of the dHcap and dHgp promoterless helpers were
analyzed in VRP production experiments to determine how effectively
they would package a VEE replicon RNA (either one expressing the
botulinum neurotoxin fragment A or an influenza HA). In addition,
the effect of capping the .DELTA.26S helpers on VRP yields was
analyzed for a subset of the helper combinations. Representative
examples of VRP yields are shown in Tables 9-13 with different
combinations of .DELTA.26S helpers. The potency assay to quantitate
VRP infectivity and yield is performed in Vero cell monolayer
cultures in 48-well plates by serially diluting VRP and incubating
with Vero cells overnight at 37.degree. C. in 5% CO.sub.2 After
overnight incubation (18-20 hours), the cells are washed, fixed,
and the fixed monolayers stained with an antigen-specific primary
antibody followed by a FITC-conjugated secondary antibody. Cells
containing FITC-labeled antigen-antibody complexes are detected by
ultraviolet fluorescence microscopy (Nikon Eclipse TE300).
Individual antigen-positive cells are counted and the titer,
expressed as IU/mL, is calculated from the known dilution and
inoculation volume.
Example 8
Promoterless Helpers Incorporating a Ubiquitin Monomer
A. Construction of .DELTA.26S Helpers Containing Ubiquitin
Monomers
[0142] In eukaryotic cells, proteins fused or tagged with ubiquitin
are cleaved immediately after its C-terminal glycine by cellular
ubiquitin carboxyl-terminal hydrolase (UCH) (Pickart and Rose, J.
Biol. Chem 260:7903-7910 (1985)). Placing a monomer of the
ubiquitin coding sequence in-frame just upstream from the capsid
and glycoprotein coding sequences will eliminate the fusion
proteins produced with certain promoterless helper constructs of
this invention (such fusions resulting from multiple
transcriptional start sites upstream of the ATG for each structural
protein coding sequence). The elimination occurs because all
in-frame fusion proteins will include the ubiquitin monomer, and so
they will be cleaved by UCH, thereby releasing full-length VEE
structural proteins without any upstream, exogenous protein
sequence. Primers ubiquitin F (SEQ ID NO: 96) and ubiquitin R (SEQ
ID NO: 97) (Table 14) were designed to introduce RsrII sites at the
5' and 3' ends of the amplified ubiquitin monomer coding sequence,
while maintaining the Arg-Gly-Gly sequence necessary for cleavage
of the ubiquitin monomer by UCH (FIG. 4). These particular
constructs resulted in additional N-terminal amino acid residue(s)
on each of the resulting structural proteins following cleavage
that are not present on the native structural proteins (i.e., for
the capsid helper, an extra proline; for the glycoprotein helper,
extra proline and threonine) (FIG. 4).
[0143] The ubiquitin coding sequence was PCR amplified using Pfu
Taq polymerase (Stratagene) and cloned into the unique RsrII sites
of dHcap(FL) and dHgp(FL). Transformants were screened to determine
the orientation of the ubiquitin insert. Positive ubiquitin clones
for capsid and glycoprotein, designated dHcapU and dHgpU,
respectively (and with 5' end sequences provided herein as SEQ ID
NOS. 53 and 54, respectively), were isolated and sequenced to
confirm that no errors were introduced into the amplified ubiquitin
coding sequence. RNAs for electroporation were transcribed in
separate reactions from dHcapU, dHgpU, dHcap(FL), dHgp(FL), Hcap4,
and 13.4.6 plasmids using the RiboMax Express RNA.RTM. kit and
precipitated with lithium chloride.
B. VRP Generation Experiments Using Ubiquitin Modified .DELTA.26S
Helpers
[0144] Vero cells were electroporated with a VEE replicon RNA
expressing an HIV clade C glycoprotein ("DU151gp160") and selected
combinations of promoterless capsid and GP helpers at the indicated
RNA amounts. In some experiments, the "Hcap4" capsid helper was
used. This is a helper that has a truncated 5' end (corresponding
to the dHcap4 truncation described hereinabove) but retains the 26S
subgenomic promoter sequence and is fully described in U.S. Pat.
No. 7,045,335, which is incorporated herein by reference.
Electroporations were performed at 500V, 25 .mu.F, 4 pulses in a
0.4 cm cuvette in a volume of approximately 0.8 ml. Each
electroporation was seeded into 1-850 cm.sup.2 roller bottle with
100 ml Optipro.RTM. (Gibco, Carlsbad, Calif.). VRP were harvested
at 18 hrs on a 0.2 .mu.m filter with 25 ml of 0.5M NaCl wash. VRP
salt wash material was titered with the anti-gp120 goat antibody
(which recognizes the HIV gp 160 protein) at 1:400. Results of
packaging experiments are shown in Table 15.
[0145] Electroporations were subsequently performed to compare
titers of various nucleic acids packaged with capsid helpers dHcapU
or dHcap6-mut1(W-stop) combined with dHgp6-mut1. VRPs were titered
using a VEE nsP2 specific polyclonal antibody (Table 16).
C. Structural Protein Expression by Western analysis in
Electroporated Cells
[0146] Cell lysates were prepared from the cells used to generate
VRP in the packaging study summarized in Table 16. Cell lysates
from each sample were electrophoresed in 4-12% Bis-Tris Novex gels
at 200V, 400 mA in 1.times.MOPS for 45 min prior to semidry
transfer to PVDF at 400 mA in 1.times. transfer buffer for 40 min.
Membranes were blocked overnight in 1.times.BMB block/TBS. Primary
antibodies were a 1:500 dilution of 1A4A anti-VEE GP and a 1:1500
dilution of anti-VEE capsid in 1.times.BMB block/TBS. Western blot
results are shown in FIG. 5. The glycoprotein expressed from dHgpU
is processed into the PE2 and E2 GP forms more completely than the
glycoprotein expressed from dHgp(FL). This is demonstrated by the
difference in the pattern of fusion proteins seen without the
ubiquitin present in dHgp(FL) (FIG. 5, compare lanes 3 and 4 on the
Western blot using GP antibody). Placement of the ubiquitin protein
at the N-terminus of the capsid protein in the dHcapU helper
resulted in the disappearance of the capsid fusion proteins (FIG.
5) and a greater than 2 log increase in gp160 titer when packaged
with the 13.4.6 glycoprotein helper (Table 15).
D. Structural Protein RNA Expression by Northern Analysis of
Electroporated Cells
[0147] Total cellular RNA was extracted from the cells used to
generate VRP in the packaging study summarized in Table 15. The
cells were lysed with RNAwiz.RTM. reagent (Ambion, Inc., Austin,
Tex.), extracted with chloroform, precipitated, and subjected to
Northern analysis using capsid and GP specific probes (FIG. 6 and
FIG. 7, respectively). All RNA species are consistent with the
sizes expected from the various constructs.
Example 9
VRP Generation Using Capped and Non-Capped .DELTA.26S Helper
Constructs
A. VRPs Expressing the Glycoproteins of Various Alphaviruses
[0148] VRPs were produced using VEE replicons that express, as the
nucleic acid of interest (NOI), the coding sequence for the
glycoproteins of either VEE (3022), Eastern equine encephalitis
virus (EEE) (4200) or Western equine encephalitis virus (WEE)
(2100), in which each furin cleavage site has been deleted. DNA
plasmids encoding the helpers used to generate the VRP were
linearized with NotI and in vitro transcribed using a T7
RiboMax.RTM. kit (Promega, Madison Wis.) following the
manufacturer's instructions, and where indicated, supplemented with
7.5 mM CAP analog (Promega). Helpers produced with cap analog are
indicated as "+Cap" and those without cap analog are indicated as
"-Cap" in Table 17. Vero cells were electroporated with
combinations of replicon, capsid helper and GP helper RNAs and VRP
were produced as described in Example 5 hereinabove. The results of
three separate experiments are shown in Tables 17-19.
B. VRP Expressing the HA Coding Sequence of Influenza Strain
Wisconsin
[0149] In this experiment, the molar ratios of the Cap analog to
GTP were varied in the transcription reactions for producing
.DELTA.26S helper RNAs encoding either VEE capsid or VEE
glycoproteins. The transcription reactions were assembled as
follows: Promega 5.times. transcription buffer; rNTP mix (6 mM UTP,
CTP, ATP); GTP (at 0-6 mM, as indicated in the table); (Promega
Corporation Woods Hollow Rd., Madison Wis., catalog #P1300) and
Ribo m.sup.7G Cap.RTM. analog (6 mM) (Promega Corporation Woods
Hollow Rd., Madison Wis., catalog #P1712). Additional reactions
were made with Promega's 5.times. buffer and 7.5 mM rNTPs with and
without 7.5 mM Ribo m.sup.7G Cap analog to mimic the T7 RiboMAX
Express.RTM. RNA transcription kit conditions (Promega Corporation
Woods Hollow Rd., Madison Wis., catalog #P1320) specified by the
manufacturer, which is typically run with the 2.times. buffer
supplied with the kit. The VEE replicon that was packaged in this
experiment encoded the influenza HA (A/WI/05) protein. Thirty .mu.g
of the replicon RNA; 10 .mu.g of a .DELTA.26S capsid helper RNA,
and 60 .mu.g of a .DELTA.26S glycoprotein helper RNA were used for
each electroporation. Vero cells were expanded, then washed and
resuspended in sucrose buffer to 1.2.times.10.sup.8 cells/mL. These
cells were mixed with the RNAs, then electroporated with the BioRad
Gene Pulse II.RTM. apparatus set to 500 volts, 25 .mu.Fd and four
pulses. Cells were transferred to roller bottles with 100 mL
OptiPro.RTM. and incubated at 37.degree. C. Twenty-four hours
post-electroporation, VRPs were harvested. The VRPs were titered on
48-well plates of Vero and results are shown in Table 25.
Example 10
Protection Against Botulinum Neurotoxins in Mice Using VRPs Made
with .DELTA.26S Helper Constructs
[0150] VEE replicon vectors that express the non-toxic c-terminal
fragment of the heavy chain of either botulinum neurotoxin serotype
A or B (BoNT A or BoNT B, respectively) were packaged into VRPs
using either: (i) 30 .mu.g each of uncapped 13.2.2 and 13.4.6
helpers, or (ii) 20 .mu.g of the capped capsid .DELTA.26S helper
and 60 .mu.g of the capped glycoprotein .DELTA.26S helper, as
described in Example 5. These VRPs were used at a dose of
1.times.10.sup.7 IU to vaccinate Swiss mice two times at day 0 and
day 28. The mice were then challenged with 1000 times the dose
required to kill 50 percent of animals (1000 LD.sub.50) of either
BoNT A or BoNT B neurotoxin one month after the second
immunization. The results of the challenge experiment are
summarized in Table 20.
Example 11
Immunogenicity and Protection Studies with VRPs Expressing Antigens
from the Smallpox Virus
A. Immunogenicity in Mice and Primates of VRP Generated Using
.DELTA.26S Helper Constructs.
[0151] VEE replicon vectors optimized to express four vaccinia
virus (VACV) genes (L1R, B5R, A27L and A33R) were constructed using
the method described by Kamrud et al. (Virology 360(2):376-87
(2007)). The four VACV genes are collectively referred to as
"4pox." The 4pox genes were cloned into two different VEE replicon
vector systems, one based on the 3014 strain of VEE and the other
based on the TC-83 vaccine strain. Each optimized VACV coding
sequence-expressing replicon vector was used to generate VRPs by
combining 30 .mu.g of the replicon, 20 .mu.g of .DELTA.26S capsid
helper RNA, and 60 .mu.g of .DELTA.26S GP helper RNA and
electroporating them into Vero cells. Particles were produced and
collected as described in Example 5. The individual VACV VRPs were
then combined, producing a 4pox VRP mixture used to immunize either
BALB/c mice or Cynomolgus macaques and the humoral responses were
measured by VACV antigen-specific ELISA analysis. The VACV-specific
ELISA responses detected in vaccinated mice are shown in Table 21
and the VACV-specific ELISA responses detected in vaccinated
macaques are shown in Table 22.
B. Protection in Mice and Non-Human Primates Using the 4pox
VRPs
[0152] 1. Mice
[0153] Mice were challenged by the intranasal route with
2.times.10.sup.6 PFU of vaccinia virus (strain IHD-J), and the
results are presented in Table 23.
[0154] 2. Non-Human Primates
[0155] Non-human primates were challenged by the intravenous route
with 5.times.10.sup.6 PFU of monkeypox virus. The World Health
Organization's lesion count scoring system was used to determine
disease severity, and the results are presented in Table 24.
[0156] As will be understood by one skilled in the art, there are
several embodiments and elements for each aspect of the claimed
invention, and all combinations of different elements are
incorporated herein as embodiments of this invention, so the
specific combinations exemplified herein are not to be construed as
limitations in the scope of the invention as claimed. If specific
elements are removed or added to the group of elements available in
a combination, then the group of elements is to be construed as
having incorporated such a change.
[0157] All references cited herein, including non-patent
publications, patent applications, and patents, are incorporated by
reference herein in their entireties to the same extent as if each
was individually and specifically indicated to be incorporated by
reference, and was reproduced in its entirety herein.
TABLE-US-00001 TABLE 1 Primers to generate .DELTA.26S helpers SEQ
Primer ID name 5' primer sequence 3' NO: Capsid F
CCTCGGACCGATGTTCCCGTTCCAGCCAATG 98 GP F
CCTCGGACCGACCATGTCACTAGTGACCACCATG 60 13-101.pr4
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 61
TTTTTTTTTGAAATATTAAAAACAAAATCCGATTCG G 3-16.1.1
ACCGTCACCCTGGATGCTGT 62 dHe1p1 R
CCTCGGACCGAAACAGCGACTTGCCCTTCGTAGCGA 63 CAC dHe1p2 R
CCTCGGACCGCATAGTCTCAGTTTCCAGGTCAGGGT 64 CGC dHe1p3 R
CCTCGGACCGCGGCGAGCTCCTTCATTTTCTTGTCC 65 AATTCCT dHe1p4 R
CCTCGGACCGCAGCTTAGTTGCATACTTATACAATC 66 TGTCCGGA dHe1p5 R
CCTCGGACCGACATCTCATCGGACAGATACAATGAT 67 ACTTGTGCT dHe1p6 R
CCTCGGACCGTCCAATGTCAAGGATCGTGTCGGATG 68 GGT dHe1p7 R
CCTCGGACCGAGTTTTGAAGCCAGATGCGAAAACGC 69 TCTG dHe1p8 R
CCTCGGACCGCTTGGCTTCTACCTCAAACTGCGGGA 70 AGC
TABLE-US-00002 TABLE 2 IFA analysis of dHcap1-8 helpers Helper
Anti-capsid IFA dHcap1 Positive dHcap2 Positive dHcap3 Positive
dHcap4 Positive dHcap5 Positive dHcap6 Positive dHcap7 Positive
dHcap8 Positive (weak)
TABLE-US-00003 TABLE 3 Helper Anti-GP IFA DHgp1 Positive dHgp2
Positive dHgp3 Positive dHgp4 Positive dHgp5 Positive dHgp6
Positive dHgp7 Positive dHgp8 Negative
TABLE-US-00004 TABLE 4 Site directed mutagenesis primers to
generate mut1 helpers SEQ Primer ID name 5' primer sequence 3' NO:
Mut1 F GACCAATTACCTACCCAAATAGGAGAAAGTTCACGT 71 TGAC Mut1 R
GTCAACGTGAACTTTCTCCTATTTGGGTAGGTAATT 72 GGTC
TABLE-US-00005 TABLE 5 Primers used to change 5' replication
recogni- tion sequence ATG codons to GTG Primer name (location of
SEQ A residue ID in ATG codon) 5' primer sequence 3' NO nt- 12
ATAGGCGGCGCGTGAGAGAAGCCCAG 73 nt-45 CCTACCCAAAGTGGAGAAAGTTCACGTTG
74 ACATC nt-148/154/160 CAGGTCACTGATAGTGACCGTGCTAGTGC 75 CAGAGCG
nt-259 GCCCGCCCGCAGAGTGTATTCTAAGCAC 76 nt-295/300
GTATCTGTCCGGTGAGGTGTGCGGAAGAT 77 CCG nt-331
GACAGATTGTATAAGTGTGCAACTAAGCT 78 G nt-390
GAATGGACAAGAAAGTGAAGGAGCTC 79 nt-411 CCGTCGTGAGCGACCCTGACCTGGAAAC
80 nt-441 GAAACTGAGACTGTGTGCCTCCACG 81 nt-499
GTTTACCAGGGTGTATACGCGGTTG 82
TABLE-US-00006 TABLE 6 Capsid helper GP helper VRP yield BoNT B
replicon dHcap6 mut1 (30 .mu.g) 13.4.6 (30 .mu.g) 9.0 .times.
10.sup.9 BoNT A replicon dHcap6 (30 .mu.g) dHgp7 (30 .mu.g) 6.0
.times. 10.sup.9 dHcap6 (30 .mu.g) dHgp7 (90 .mu.g) 2.6 .times.
10.sup.10 BoNT A replicon dHcap5-mm (30 .mu.g) dHgp6 mut1 (90
.mu.g) 1.8 .times. 10.sup.7 dHcap6-mm (30 .mu.g) dHgp6 mut1 (90
.mu.g) 3.6 .times. 10.sup.8 dHcap7-mm (30 .mu.g) dHgp6 mut1 (90
.mu.g) 1.3 .times. 10.sup.8 dHcap4 mut1 (30 .mu.g) dHgp6 mut1 (90
.mu.g) 1.3 .times. 10.sup.9 dHcap6 mut1 (30 .mu.g) dHgp6 mut1 (90
.mu.g) 4.6 .times. 10.sup.9 dHcap7 mut1 (30 .mu.g) dHgp6 mut1 (90
.mu.g) 6.2 .times. 10.sup.9 dHcap5-mm (10 .mu.g) dHgp6 mut1 (90
.mu.g) 4.2 .times. 10.sup.6 dHcap6-mm (10 .mu.g) dHgp6 mut1 (90
.mu.g) 2.6 .times. 10.sup.8 dHcap7-mm (10 .mu.g) dHgp6 mut1 (90
.mu.g) 4.4 .times. 10.sup.7 dHcap4 mut1 (10 .mu.g) dHgp6 mut1 (90
.mu.g) 1.1 .times. 10.sup.10 dHcap6 mut1 (10 .mu.g) dHgp6 mut1 (90
.mu.g) 1.9 .times. 10.sup.10 dHcap7 mut1 (10 .mu.g) dHgp6 mut1 (90
.mu.g) 1.8 .times. 10.sup.10 SARS S replicon dHcap4 mut1 (10 .mu.g)
dHgp6 mut1 (90 .mu.g) 4.4 .times. 10.sup.9 dHcap6 mut1 (10 .mu.g)
dHgp6 mut1 (90 .mu.g) 2.6 .times. 10.sup.9 dHcap7 mut1 (10 .mu.g)
dHgp6 mut1 (90 .mu.g) 1.4 .times. 10.sup.9 BoNT A replicon dHcap1
(30 .mu.g) 13.4.6 (30 .mu.g) 3.0 .times. 10.sup.7 dHcap2 (30 .mu.g)
13.4.6 (30 .mu.g) 9.2 .times. 10.sup.7 dHcap3 (30 .mu.g) 13.4.6 (30
.mu.g) 2.0 .times. 10.sup.8 dHcap4 (30 .mu.g) 13.4.6 (30 .mu.g) 1.3
.times. 10.sup.9 dHcap5 (30 .mu.g) 13.4.6 (30 .mu.g) 3.2 .times.
10.sup.8 dHcap6 (30 .mu.g) 13.4.6 (30 .mu.g) 3.0 .times. 10.sup.8
dHcap7 (30 .mu.g) 13.4.6 (30 .mu.g) 1.2 .times. 10.sup.9 dHcap8 (30
.mu.g) 13.4.6 (30 .mu.g) 1.8 .times. 10.sup.7 dHcap6 mut1 (30
.mu.g) 13.4.6 (30 .mu.g) 8.4 .times. 10.sup.9 dHcap6 mut1 (30
.mu.g) 13.4.6 (30 .mu.g) 1.2 .times. 10.sup.10
TABLE-US-00007 TABLE 7 VRP yield generated using .DELTA.26S capsid,
E1 and E2 helpers. pERK/342/MS/BoNT A [30 .mu.g] VRP Capsid helper
GP helper #1 GP helper #2 titer/ml dHcap6-mut1 [10 .mu.g] dHE1-6M1
[30 .mu.g] dHE2-6M1 2.2 .times. 10.sup.7 [30 .mu.g] dHcap6-mut1 [10
.mu.g] dHgp7-mut1 [90 .mu.g] 1.3 .times. 10.sup.9
TABLE-US-00008 TABLE 8 PCR primers used to design modifications to
the 5' and 3' regions of .DELTA.26S helpers SEQ ID Primer name 5'
primer sequence 3' NO: 13-82.1.9 TCAGTGGAACGAAAACTCACG 83 dSL2
(EcoRV) R TTTGATATCGGTAATTGGTCTGGGCTTCTC 84 dSL2 (EcoRV) F
TTTGATATCGAAGCCAAGCAGGTCACTG 85 3-8.pr4 GCAACGCGGGGAGGCAGACA 86 GP
(SphI) R GCATGCTCAATTATGTTTCTGGTTGG 87 3-16.1.3
CGACATAGTCTAGTCCGCCA 88 3' trunc GCATGCATTTTGTTTTTAATATTTCAAA 89
(SphI) F 3' trunc GCTCACATGTTCTTTCCTGCG 90 (AfIIII) R Capsid
(RsrII- CCTCGGACCGACCATGTTCCCGTTCCAGCC 91 Kozak) F AATG Capsid
(stop) ACATGCATGCTTATTGCTCGCAGTTCTCCGG 92 SphI R Capsid (W-stop)
ACATGCATGCTTACCATTGCTCGCAGTTCTC 93 SphI R CGG Gp (RsrII-Ser)
CCTCGGTCCGACCATGCTAGTGACCACCAT 94 F G 3-16.2.14
ACATACACGGTAGTCACAAT 95
TABLE-US-00009 TABLE 9 Replicon packaged pERK/342/MS/BoNT A [30
.mu.g RNA] Capsid helper [RNA] GP helper [RNA] VRP titer IFU/ml
dHcap7-mut1 (W-stop) [10 .mu.g] dHgp7-mut1 [90 .mu.g] 1.0 .times.
10.sup.8 dHcap6-mut1 (W-stop) [10 .mu.g] dHgp7-mut1 [90 .mu.g] 8.9
.times. 10.sup.8 dHcap7-mut1 (W-stop) [20 .mu.g] dHgp7-mut1 [90
.mu.g] 3.0 .times. 10.sup.8 dHcap6-mut1 (W-stop) [20 .mu.g]
dHgp7-mut1 [90 .mu.g] 6.8 .times. 10.sup.8
TABLE-US-00010 TABLE 10 Replicon packaged pERK/342/MS/BoNT A [30
.mu.g RNA] VRP titer Capsid helper [RNA] GP helper [RNA] IFU/ml
dHcap6-mut1 [10 .mu.g] dHgp7-mut1 [60 .mu.g] 2.1 .times. 10.sup.8
dHcap6-mut1 (W-stop) [10 .mu.g] dHgp7-mut1 [60 .mu.g] 2.0 .times.
10.sup.8 dHcap6-mut1 (W-stop)-dSL2 [10 .mu.g] dHgp7-mut1 [60 .mu.g]
3.7 .times. 10.sup.7
TABLE-US-00011 TABLE 11 Replicon packaged pERK/342/MS/BoNT A [30
.mu.g RNA] Capsid helper [RNA] GP helper [RNA] VRP titer IFU/ml
dHcap7-mut1 [20 .mu.g] dHgp7-mut1 [90 .mu.g] 4.9 .times. 10.sup.7
dHcap7-mut1 19nt [30 .mu.g] dHgp7-mut1 [90 .mu.g] 2.2 .times.
10.sup.7
TABLE-US-00012 TABLE 12 Replicon packaged pERK/342/MS/BoNT A [30
.mu.g RNA] Capsid helper [RNA] Glycoprotein helper [RNA] VRP titer
[10 .mu.g] [60 .mu.g] IFU/ml dHcap7-mut1 (W-stop) dHgp6-mut1 6.1
.times. 10.sup.6 dHcap7-mut1 (W-stop) dHgp6-mut1-dSL2 (-S) 6.6
.times. 10.sup.5 dHcap7-mut1 (W-stop) dHgp6-mut1-dSL2 (-S) 19 nt
9.6 .times. 10.sup.4 dHcap7-mut1 (W-stop) dHgp6-mut1 (-S) 1.0
.times. 10.sup.7 dHcap6-mut1 (W-stop) dHgp6-mut1 2.7 .times.
10.sup.7 dHcap6-mut1 (W-stop) dHgp6-mut1-dSL2 (-S) 1.7 .times.
10.sup.6 dHcap6-mut1 (W-stop) dHgp6-mut1-dSL2 (-S) 19 nt 1.2
.times. 10.sup.5 dHcap6-mut1 (W-stop) dHgp6-mut1 (-S) 2.2 .times.
10.sup.7
TABLE-US-00013 TABLE 13 pERK/383/MS/HA (A Wyoming) [30 .mu.g RNA]
VRP titer Capsid helper [RNA] GP helper [RNA] IFU/ml dHcap6-mut1
(W-stop) [20 .mu.g] dHgp6-mut1 [60 .mu.g] 2.0 .times. 10.sup.8
dHcap6-mut1 (W-stop) capped dHgp6-mut1 capped 9.0 .times. 10.sup.9
[20 .mu.g] [60 .mu.g] dHcap6-mut1 (W-stop) [10 .mu.g] dHgp6-mut1
[90 .mu.g] 2.5 .times. 10.sup.7 dHcap6-mut1 (W-stop) capped
dHgp6-mut1 capped 2.5 .times. 10.sup.8 [10 .mu.g] [90 .mu.g]
dHcap6-mut1 (W-stop) [10 .mu.g] dHgp6-mm [90 .mu.g] 2.3 .times.
10.sup.7 dHcap6-mut1 (W-stop) capped dHgp6-mm capped 2.4 .times.
10.sup.8 [10 .mu.g] [90 .mu.g]
TABLE-US-00014 TABLE 14 SEQ Primer ID name 5' primer sequence 3'
NO: Ubiquitin F CATCGACGGACCGATGCAGATCTTCGTGAAGA 96 CCC Ubiquitin R
GATTTTCGGTCCGCCCCTCAGACGGAGGACCA 97 GG
TABLE-US-00015 TABLE 15 VRP generation using ubiquitin-modified
.DELTA.26S helper combinations Replicon RNA Glycoprotein VRP [30
.mu.g] Capsid helper helper [60 .mu.g] titer/ml DU151gp160
dHcap(FL) [10 .mu.g] 13.4.6 8.3 .times. 10.sup.5 DU151gp160 dHcapU
[10 .mu.g] 13.4.6 1.3 .times. 10.sup.8 DU151gp160 Hcap4 [30 .mu.g]
dHgp6-mut1 9.3 .times. 10.sup.7 DU151gp160 dHcap6-mut1 (W-stop)
13.4.6 5.6 .times. 10.sup.8 [10 .mu.g]
TABLE-US-00016 TABLE 16 VRP generation using multiple replicon
vectors and modified .DELTA.26S helper combinations Replicon RNA
VRP [30 .mu.g] Capsid helper [10 .mu.g] GP helper [60 .mu.g]
titer/ml BoNT A dHcapU dHgp6-mut1 1.4 .times. 10.sup.8 BoNT A
dHcap6-mut1 (W-stop) dHgp6-mut1 3.6 .times. 10.sup.8 BoNT E dHcapU
dHgp6-mut1 3.2 .times. 10.sup.7 BoNT E dHcap6-mut1 (W-stop)
dHgp6-mut1 1.4 .times. 10.sup.8 HA (A Wyoming) dHcapU dHgp6-mut1
3.8 .times. 10.sup.8 HA (A Wyoming) dHcap6-mut1 (W-stop) dHgp6-mut1
6.4 .times. 10.sup.8 NA (A Wyoming) dHcapU dHgp6-mut1 4.0 .times.
10.sup.8 NA (A Wyoming) dHcap6-mut1 (W-stop) dHgp6-mut1 5.3 .times.
10.sup.8 CEA dHcapU dHgp6-mut1 2.0 .times. 10.sup.8 CEA dHcap6-mut1
(W-stop) dHgp6-mut1 3.1 .times. 10.sup.8
TABLE-US-00017 TABLE 17 Comparison of use of Capped vs. Non-capped
Helpers NOI in VEE replicon Helpers +/-Cap IU/cell VEE glycoprotein
3022 13.2.2; 13.4.6 -Cap 131.1 VEE glycoprotein 3022 13.2.2; 13.4.6
+Cap 1095.4 VEE glycoprotein 3022 .DELTA.26S helpers (C & GP)
-Cap 49.0 VEE glycoprotein 3022 .DELTA.26S helpers (C & GP)
+Cap 508.8 EEE glycoprotein 4200 13.2.2; 13.4.6 -Cap 30.7 EEE
glycoprotein 4200 13.2.2; 13.4.6 +Cap 398.8 EEE glycoprotein 4200
.DELTA.26S helpers (C & GP) -Cap 9.3 EEE glycoprotein 4200
.DELTA.26S helpers (C & GP) +Cap 88.0
TABLE-US-00018 TABLE 18 NOI in VEE replicon Helpers +/-Cap IU/cell
VEE glycoprotein 3022 13.2.2; 13.4.6 -Cap 600.4 VEE glycoprotein
3022 13.2.2; 13.4.6 +Cap 2035.0 VEE glycoprotein 3022 .DELTA.26S
helpers (C & GP) -Cap 101.3 VEE glycoprotein 3022 .DELTA.26S
helpers (C & GP) +Cap 884.6 EEE glycoprotein 4200 13.2.2;
13.4.6 -Cap 75.2 EEE glycoprotein 4200 13.2.2; 13.4.6 +Cap 898.3
EEE glycoprotein 4200 .DELTA.26S helpers (C & GP) -Cap 29.8 EEE
glycoprotein 4200 .DELTA.26S helpers (C & GP) +Cap 206.3
TABLE-US-00019 TABLE 19 .DELTA.26S Capsid .DELTA.26S GP NOI in VEE
replicon Helper (+/-cap) Helper (+/-cap) IU/cell WEE glycoprotein
2100 -cap -cap 37.1 WEE glycoprotein 2100 +cap +cap 285.7 WEE
glycoprotein 2100 +cap -cap 38.6 WEE glycoprotein 2100 -cap +cap
34.3
TABLE-US-00020 TABLE 20 Results from challenge of mice vaccinated
with VRP produced using .DELTA.26S helpers Survival Survival
Replicon (helper set) BoNT-A/total BoNT-B/total MS/342/BoNT A
(13.2.2 + 13.4.6) 8/10 NA MS/342/BoNT A (.DELTA.26S capsid + gp)
10/10 NA Control VRP.sup.1 0/10 NA MS/357/BoNT B (13.2.2 + 13.4.6)
NA 10/10 MS/357/BoNT B ((.DELTA.26S capsid + gp) NA 8/10 Control
VRP.sup.1 NA 0/10 NA: not applicable .sup.1Contains irrelevant
protein-expressing coding sequence in replicon
TABLE-US-00021 TABLE 21 Replicon Log10 VACV-specific ELISA titer
expressing 4pox Dose (IU) L1R B5R A27L A33R V3014 1 .times.
10.sup.6 2 3 1 3 TC-83 1 .times. 10.sup.6 3 4 1 4 V3014 1 .times.
10.sup.7 3 4 3 4 TC-83 1 .times. 10.sup.7 4 4 1 4
TABLE-US-00022 TABLE 22 Replicon Log10 VACV-specific ELISA titer
expressing 4pox Dose (IU) L1R B5R A27L A33R TC-83 1 .times.
10.sup.8 3.2 2.4 2.2 3.2 V3014 1 .times. 10.sup.8 3.6 2.6 2 3.6
TABLE-US-00023 TABLE 23 Protection Study in Mice VRP vaccine # mice
tested % survival V3014 4pox 48 100% V3014 control 24 0% TC-83 4pox
40 100% TC-83 control 24 9%
TABLE-US-00024 TABLE 24 Protection study in Macaques VRP Challenge
Max pock Vaccine System Animal # Outcome * count 4pox VRP V3014 1
No disease 0 2 Mild disease 2 3 Mild disease 8 4 Mild disease 4 5
Mild disease 12 4pox VRP TC-83 1 No disease 0 2 Mild disease 8 3
Mild disease 12 4 Mild disease 10 5 Mild disease 8 Control V3014 1
Lethal disease TNTC.sup.1 VRP 2 Lethal disease TNTC 3 Lethal
disease TNTC Control TC-83 1 Lethal disease TNTC VRP 2 Grave
disease TNTC 3 Severe disease >100 .sup.1TNTC = too numerous to
count
TABLE-US-00025 TABLE 25 Study of effects of capping of .DELTA.26S
helpers on packaging of an alphavirus replicon vector encoding the
HA coding sequence from influenza strain Wisconsin. Buffer used in
in vitro transcription Cap:GTP ratio Titer IU/ EP reactions Capsid
GP IU/mL Total IU cell 1 5X 0:1 0:1 3.70E+08 9.26E+09 154 2 5X 1:1
0:1 4.66E+08 1.16E+10 194 3 5X 2:1 0:1 3.52E+08 8.80E+09 147 4 5X
4:1 0:1 3.70E+08 9.26E+09 154 5 5X 6:1 0:1 3.81E+08 9.54E+09 159 6
5X 0:1 1:1 1.91E+08 4.77E+09 79 7 5X 1:1 1:1 4.44E+08 1.11E+10 185
8 5X 2:1 1:1 4.88E+08 1.22E+10 203 9 5X 4:1 1:1 4.36E+08 1.09E+10
182 10 5X 6:1 1:1 4.36E+08 1.09E+10 182 11 5X 0:1 2:1 1.17E+08
2.93E+09 49 12 5X 1:1 2:1 3.04E+08 7.61E+09 127 13 5X 2:1 2:1
3.04E+08 7.61E+09 127 14 5X 4:1 2:1 3.37E+08 8.44E+09 141 15 5X 6:1
2:1 4.14E+08 1.04E+10 173 16 5X 0:1 4:1 1.71E+08 4.26E+09 71 17 5X
1:1 4:1 7.56E+08 1.89E+10 315 18 5X 4:1 4:1 4.66E+08 1.16E+10 194
19 5X 0:1 6:1 1.72E+08 4.31E+09 72 20 5X 6:1 6:1 4.03E+08 1.01E+10
168 21 5X 1:1 0:1 4.36E+08 1.09E+10 182 22 5X 0:1 1:1 1.60E+08
3.99E+09 66 23 5X 2:1 2:1 5.10E+08 1.27E+10 212 24 2X 0:1 1:1
1.80E+08 4.49E+09 75 (7.5 mM) (7.5 mM) 25 2X 1:1 0:1 3.56E+08
8.89E+09 148 (7.5 mM) (7.5 mM) 26 5X 1:1 1:1 6.82E+08 1.71E+10 284
(7.5 mM) (7.5 mM) 27 2X 1:1 1:1 7.04E+08 1.76E+10 293 (7.5 mM) (7.5
mM) 28 2X 1:1 1:1 6.24E+08 1.56E+10 260 (7.5 mM) (7.5 mM) 29 2X 0:1
0:1 3.30E+08 8.25E+09 138 (7.5 mM) (7.5 mM) 30 2X 0:1 0:1 3.41E+08
8.53E+09 142 (7.5 mM) (7.5 mM)
Sequence CWU 1
1
981521DNAVenezuelan equine encephalitis virus 1atgggcggcg
catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg 60ttgacatcga
ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc g
5212499DNAArtificialSynthetic noncoding recognition sequence
2ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttcggtccg 4993450DNAArtificialSynthetic
noncoding recognition sequence 3ataggcggcg catgagagaa gcccagacca
attacctacc caaaatggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgataatg accatgctaa tgtcagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt
ccgatgagat 300gtgcggaaga tccggacaga ttgtataagt atgcaactaa
gctgaagaaa aactgtaagg 360aaataactga taaggaattg gacaagaaaa
tgaaggagct cgccgccgtc atgagcgacc 420ctgacctgga aactgagact
atgcggtccg 4504412DNAArtificialSynthetic noncoding recognition
sequence 4ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag
aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc
ccgcagtttg 120aggtagaagc caagcaggtc actgataatg accatgctaa
tgccagagcg ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg
acccatccga cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg
tattctaagc acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga
tccggacaga ttgtataagt atgcaactaa gctgaagaaa aactgtaagg
360aaataactga taaggaattg gacaagaaaa tgaaggagct cgccgcggtc cg
4125351DNAArtificialSynthetic noncoding recognition sequence
5ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgcggtcc g 3516309DNAArtificialSynthetic
noncoding recognition sequence 6ataggcggcg catgagagaa gcccagacca
attacctacc caaaatggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgataatg accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt
ccgatgagat 300gtcggaccg 3097248DNAArtificialSynthetic noncoding
recognition sequence 7ataggcggcg catgagagaa gcccagacca attacctacc
caaaatggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca
gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc actgataatg
accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa actgatcgaa
acggaggtgg acccatccga cacgatcctt gacattggac 240ggtccgcg
2488200DNAArtificialSynthetic noncoding recognition sequence
8ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actcggtccg 2009141DNAArtificialSynthetic
noncoding recognition sequence 9ataggcggcg catgagagaa gcccagacca
attacctacc caaaatggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcggtcc g
14110524DNAVenezuelan equine encephalitis virus 10atgggcggcg
catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg 60ttgacatcga
ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc gacc
52411502DNAArtificialSynthetic noncoding recognition sequence
11ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttcggtccga cc
50212453DNAArtificialSynthetic noncoding recognition sequence
12ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgcggtccg acc
45313415DNAArtificialSynthetic noncoding recognition sequence
13ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgcggtc cgacc
41514354DNAArtificialSynthetic noncoding recognition sequence
14ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgcggacc gacc
35415312DNAArtificialSynthetic noncoding recognition sequence
15ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtcggaccga cc
31216249DNAArtificialSynthetic noncoding recognition sequence
16ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggac 240ggtccgacc 24917203DNAArtificialSynthetic
noncoding recognition sequence 17ataggcggcg catgagagaa gcccagacca
attacctacc caaaatggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgataatg accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa
actcggtccg acc 20318144DNAArtificialSynthetic noncoding recognition
sequence 18ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag
aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc
ccgcagtttg 120aggtagaagc caagcggacc gacc
14419521DNAArtificialSynthetic noncoding recognition sequence
19atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga tccggacaga
ttgtataagt gtgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaag tgaaggagct cgccgccgtc gtgagcgacc
420ctgacctgga aactgagact gtgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttaccagggt gtatacgcgg ttgacggacc g
52120499DNAArtificialSynthetic noncoding recognition sequence
20ataggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga tccggacaga
ttgtataagt gtgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaag tgaaggagct cgccgccgtc gtgagcgacc
420ctgacctgga aactgagact gtgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttcggtccg 49921450DNAArtificialSynthetic
noncoding recognition sequence 21atgggcggcg cgtgagagaa gcccagacca
attacctacc caaagtggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgatagtg accgtgctag tgccagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagagtg tattctaagc acaagtatca ttgtatctgt
ccggtgaggt 300gtgcggaaga tccggacaga ttgtataagt gtgcaactaa
gctgaagaaa aactgtaagg 360aaataactga taaggaattg gacaagaaag
tgaaggagct cgccgccgtc gtgagcgacc 420ctgacctgga aactgagact
atgcggtccg 45022412DNAArtificialSynthetic noncoding recognition
sequence 22atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag
aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc
ccgcagtttg 120aggtagaagc caagcaggtc actgatagtg accgtgctag
tgccagagcg ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg
acccatccga cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg
tattctaagc acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga
tccggacaga ttgtataagt gtgcaactaa gctgaagaaa aactgtaagg
360aaataactga taaggaattg gacaagaaaa tgaaggagct cgccgcggtc cg
41223351DNAArtificialSynthetic noncoding recognition sequence
23atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgcggtcc g 35124309DNAArtificialSynthetic
noncoding recognition sequence 24atgggcggcg cgtgagagaa gcccagacca
attacctacc caaagtggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgatagtg accgtgctag tgccagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagagtg tattctaagc acaagtatca ttgtttctgt
ccgatgagat 300gtcggtccg 30925246DNAArtificialSynthetic noncoding
recognition sequence 25atgggcggcg cgtgagagaa gcccagacca attacctacc
caaagtggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca
gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc actgatagtg
accgtgctag tgccagagcg ttttcgcatc 180tggcttcaaa actgatcgaa
acggaggtgg acccatccga cacgatcctt gacattggac 240ggtccg
24626200DNAArtificialSynthetic noncoding recognition sequence
26atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actcggtccg 20027524DNAArtificialSynthetic
noncoding recognition sequence 27atgggcggcg cgtgagagaa gcccagacca
attacctacc caaagtggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgatagtg accgtgctag tgccagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagagtg tattctaagc acaagtatca ttgtatctgt
ccggtgaggt 300gtgcggaaga tccggacaga ttgtataagt gtgcaactaa
gctgaagaaa aactgtaagg 360aaataactga taaggaattg gacaagaaag
tgaaggagct cgccgccgtc gtgagcgacc 420ctgacctgga aactgagact
gtgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc 480aagtcgctgt
ttaccagggt gtatacgcgg ttgacggacc gacc
52428507DNAArtificialSynthetic noncoding recognition sequence
28atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga tccggacaga
ttgtataagt gtgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaag tgaaggagct cgccgccgtc gtgagcgacc
420ctgacctgga aactgagact gtgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttcggtccga ggcgacc
50729453DNAArtificialSynthetic noncoding recognition sequence
29atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga tccggacaga
ttgtataagt gtgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaag tgaaggagct cgccgccgtc gtgagcgacc
420ctgacctgga aactgagact gtgcggtccg acc
45330415DNAArtificialSynthetic noncoding recognition sequence
30atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga tccggacaga
ttgtataagt gtgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgcggtc cgacc
41531354DNAArtificialSynthetic noncoding recognition sequence
31atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccggtgaggt 300gtgcggaaga tccggacaga
ttgtataata tgcaacctaa tctgcggtcc gacc
35432312DNAArtificialSynthetic noncoding recognition sequence
32atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagagtg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtcggtccga cc
31233249DNAArtificialSynthetic noncoding recognition sequence
33atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggac 240ggaccgacc
24934203DNAArtificialSynthetic noncoding recognition sequence
34atgggcggcg cgtgagagaa gcccagacca attacctacc caaagtggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgatagtg accgtgctag tgccagagcg
ttttcgcatc 180tggcttcaaa actcggtccg acc
20335521DNAArtificialSynthetic noncoding recognition sequence
35atgggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc g
52136499DNAArtificialSynthetic noncoding recognition sequence
36ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttcggtccg 49937450DNAArtificialSynthetic
noncoding recognition sequence 37ataggcggcg catgagagaa gcccagacca
attacctacc caaataggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgataatg accatgctaa tgtcagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt
ccgatgagat 300gtgcggaaga tccggacaga ttgtataagt atgcaactaa
gctgaagaaa aactgtaagg 360aaataactga taaggaattg gacaagaaaa
tgaaggagct cgccgccgtc atgagcgacc 420ctgacctgga aactgagact
atgcggtccg 45038412DNAArtificialSynthetic noncoding recognition
sequence 38ataggcggcg catgagagaa gcccagacca attacctacc caaataggag
aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc
ccgcagtttg 120aggtagaagc caagcaggtc actgataatg accatgctaa
tgccagagcg ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg
acccatccga cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg
tattctaagc acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga
tccggacaga ttgtataagt atgcaactaa gctgaagaaa aactgtaagg
360aaataactga taaggaattg gacaagaaaa tgaaggagct cgccgcggtc cg
41239351DNAArtificialSynthetic noncoding recognition sequence
39ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgcggtcc g 35140309DNAArtificialSynthetic
noncoding recognition sequence 40ataggcggcg catgagagaa gcccagacca
attacctacc caaataggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgataatg accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt
ccgatgagat 300gtcggaccg 30941248DNAArtificialSynthetic noncoding
recognition sequence 41ataggcggcg catgagagaa gcccagacca attacctacc
caaataggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca
gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc actgataatg
accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa actgatcgaa
acggaggtgg acccatccga cacgatcctt gacattggac 240ggtccgcg
24842200DNAArtificialSynthetic noncoding recognition sequence
42ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actcggtccg 20043524DNAArtificialSynthetic
noncoding recognition sequence 43atgggcggcg catgagagaa gcccagacca
attacctacc caaataggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgataatg accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa
actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa
240gtgcgcccgc ccgcagaatg tattctaagc acaagtatca ttgtatctgt
ccgatgagat 300gtgcggaaga tccggacaga ttgtataagt atgcaactaa
gctgaagaaa aactgtaagg 360aaataactga taaggaattg gacaagaaaa
tgaaggagct cgccgccgtc atgagcgacc 420ctgacctgga aactgagact
atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc 480aagtcgctgt
ttaccaggat gtatacgcgg ttgacggacc gacc
52444502DNAArtificialSynthetic noncoding recognition sequence
44ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttcggtccga cc
50245453DNAArtificialSynthetic noncoding recognition sequence
45ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgcggtccg acc
45346415DNAArtificialSynthetic noncoding recognition sequence
46ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgcggtc cgacc
41547354DNAArtificialSynthetic noncoding recognition sequence
47ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgcggacc gacc
35448312DNAArtificialSynthetic noncoding recognition sequence
48ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtcggaccga cc
31249249DNAArtificialSynthetic noncoding recognition sequence
49ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggac 240ggtccgacc 24950203DNAArtificialSynthetic
noncoding recognition sequence 50ataggcggcg catgagagaa gcccagacca
attacctacc caaataggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca
gagctttgca gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc
actgataatg accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa
actcggtccg acc 20351166DNAArtificialSynthetic noncoding recognition
sequence 51ataggcggcg catgagagaa gcccagacca attaccgata tcgaagccaa
gcaggtcact 60gataatgacc atgctaatgc cagagcgttt tcgcatctgg cttcaaaact
gatcgaaacg 120gaggtggacc catccgacac gatccttgac attggacgga ccgacc
1665219DNAArtificialSynthetic noncoding recognition sequence
52attttgtttt taatatttc 1953752DNAArtificialSynthetic noncoding
recognition sequence 53atgggcggcg catgagagaa gcccagacca attacctacc
caaaatggag aaagttcacg 60ttgacatcga ggaagacagc ccattcctca gagctttgca
gcggagcttc ccgcagtttg 120aggtagaagc caagcaggtc actgataatg
accatgctaa tgccagagcg ttttcgcatc 180tggcttcaaa actgatcgaa
acggaggtgg acccatccga cacgatcctt gacattggaa 240gtgcgcccgc
ccgcagaatg tattctaagc acaagtatca ttgtatctgt ccgatgagat
300gtgcggaaga tccggacaga ttgtataagt atgcaactaa gctgaagaaa
aactgtaagg 360aaataactga taaggaattg gacaagaaaa tgaaggagct
cgccgccgtc atgagcgacc 420ctgacctgga aactgagact atgtgcctcc
acgacgacga gtcgtgtcgc tacgaagggc 480aagtcgctgt ttaccaggat
gtatacgcgg ttgacggacc gatgcagatc ttcgtgaaga 540ccctgaccgg
caagaccatc accttggagg tggagcccag tgacaccatc gagaatgtga
600aggccaagat ccaggataaa gagggcatcc cccctgacca gcagaggctg
atctttgccg 660gcaagcagct agaagatggc cgcactctct ctgattacaa
catccagaaa gagtcgaccc 720tgcacctggt cctccgtctg aggggcggac cg
75254755DNAArtificialSynthetic noncoding recognition sequence
54ataggcggcg catgagagaa gcccagacca attacctacc caaaatggag aaagttcacg
60ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg
120aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg
ttttcgcatc 180tggcttcaaa actgatcgaa acggaggtgg acccatccga
cacgatcctt gacattggaa 240gtgcgcccgc ccgcagaatg tattctaagc
acaagtatca ttgtatctgt ccgatgagat 300gtgcggaaga tccggacaga
ttgtataagt atgcaactaa gctgaagaaa aactgtaagg 360aaataactga
taaggaattg gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc
420ctgacctgga aactgagact atgtgcctcc acgacgacga gtcgtgtcgc
tacgaagggc 480aagtcgctgt ttaccaggat gtatacgcgg ttgacggacc
gatgcagatc ttcgtgaaga 540ccctgaccgg caagaccatc accttggagg
tggagcccag tgacaccatc gagaatgtga 600aggccaagat ccaggataaa
gagggcatcc cccctgacca gcagaggctg atctttgccg 660gcaagcagct
agaagatggc cgcactctct ctgattacaa catccagaaa gagtcgaccc
720tgcacctggt cctccgtctg aggggcggac cgacc 75555374DNAVenezuelan
equine encephalitis virus 55tggtcactag tgaccaccat gtgtctgctc
gccaatgtga cgttcccatg tgctcaacca 60ccaatttgct acgacagaaa accagcagag
actttggcca tgctcagcgt taacatccct 120gctgggagga tcagccgtaa
ttattataat tggcttggtg ctggctacta ttgtggccat 180gtacgtgctg
accaaccaga aacataattg aatacagcag caattggcaa gctgcttaca
240tagaactcgc ggcgattggc atgccgcttt aaaattttta ttttattttt
cttttctttt 300ccgaatcgga ttttgttttt aatatttcaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 360aaaaaaaaaa aaaa 37456166DNAVenezuelan
equine encephalitis virus 56tgaatacagc agcaattggc aagctgctta
catagaactc gcggcgattg gcatgccgct 60ttaaaatttt tattttattt ttcttttctt
ttccgaatcg gattttgttt ttaatatttc 120aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaa 16657115DNAArtificialSynthetic
noncoding recognition sequence 57taagcatgcc gctttaaaat ttttatttta
tttttctttt cttttccgaa tcggattttg 60tttttaatat ttcaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaa 1155849DNAArtificialSynthetic noncoding
recognition sequence 58taagcatgca ttttgttttt aatatttcaa aaaaaaaaaa
aaaaaaaaa 4959118DNAArtificialSynthetic noncoding recognition
sequence 59taagcatgcc gctttaaaat ttttatttta tttttctttt cttttccgaa
tcggattttg 60tttttaatat ttcaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaa 1186034DNAArtificialOligonucleotide primer 60cctcggaccg
accatgtcac tagtgaccac catg 346173DNAArtificialOligonucleotide
primer 61tttttttttt tttttttttt tttttttttt tttttttttt tttttgaaat
attaaaaaca 60aaatccgatt cgg 736220DNAArtificialOligonucleotide
primer 62accgtcaccc tggatgctgt 206339DNAArtificialOligonucleotide
primer 63cctcggaccg aaacagcgac ttgcccttcg tagcgacac
396439DNAArtificialOligonucleotide primer 64cctcggaccg catagtctca
gtttccaggt cagggtcgc 396543DNAArtificialOligonucleotide primer
65cctcggaccg cggcgagctc cttcattttc ttgtccaatt cct
436644DNAArtificialOligonucleotide primer 66cctcggaccg cagcttagtt
gcatacttat acaatctgtc cgga 446745DNAArtificialOligonucleotide
primer 67cctcggaccg acatctcatc ggacagatac aatgatactt gtgct
456839DNAArtificialOligonucleotide primer 68cctcggaccg tccaatgtca
aggatcgtgt cggatgggt 396940DNAArtificialOligonucleotide primer
69cctcggaccg agttttgaag ccagatgcga aaacgctctg
407039DNAArtificialOligonucleotide primer 70cctcggaccg cttggcttct
acctcaaact gcgggaagc 397140DNAArtificialOligonucleotide primer
71gaccaattac ctacccaaat aggagaaagt tcacgttgac
407240DNAArtificialOligonucleotide primer 72gtcaacgtga actttctcct
atttgggtag gtaattggtc 407326DNAArtificialOligonucleotide primer
73ataggcggcg cgtgagagaa gcccag 267434DNAArtificialOligonucleotide
primer 74cctacccaaa gtggagaaag ttcacgttga catc
347536DNAArtificialOligonucleotide primer 75caggtcactg atagtgaccg
tgctagtgcc agagcg 367628DNAArtificialOligonucleotide primer
76gcccgcccgc agagtgtatt ctaagcac 287732DNAArtificialOligonucleotide
primer 77gtatctgtcc ggtgaggtgt gcggaagatc cg
327830DNAArtificialOligonucleotide primer 78gacagattgt ataagtgtgc
aactaagctg 307926DNAArtificialOligonucleotide primer 79gaatggacaa
gaaagtgaag gagctc 268028DNAArtificialOligonucleotide primer
80ccgtcgtgag cgaccctgac ctggaaac 288125DNAArtificialOligonucleotide
primer 81gaaactgaga ctgtgtgcct ccacg
258225DNAArtificialOligonucleotide primer 82gtttaccagg gtgtatacgc
ggttg 258321DNAArtificialOligonucleotide primer 83tcagtggaac
gaaaactcac g 218430DNAArtificialOligonucleotide primer 84tttgatatcg
gtaattggtc tgggcttctc 308528DNAArtificialOligonucleotide primer
85tttgatatcg aagccaagca ggtcactg 288620DNAArtificialOligonucleotide
primer 86gcaacgcggg gaggcagaca 208726DNAArtificialOligonucleotide
primer 87gcatgctcaa ttatgtttct ggttgg
268820DNAArtificialOligonucleotide primer 88cgacatagtc tagtccgcca
208928DNAArtificialOligonucleotide primer 89gcatgcattt tgtttttaat
atttcaaa 289021DNAArtificialOligonucleotide primer 90gctcacatgt
tctttcctgc g 219134DNAArtificialOligonucleotide primer 91cctcggaccg
accatgttcc cgttccagcc aatg 349231DNAArtificialOligonucleotide
primer 92acatgcatgc ttattgctcg cagttctccg g
319334DNAArtificialOligonucleotide primer 93acatgcatgc ttaccattgc
tcgcagttct ccgg
349431DNAArtificialOligonucleotide primer 94cctcggtccg accatgctag
tgaccaccat g 319520DNAArtificialOligonucleotide primer 95acatacacgg
tagtcacaat 209635DNAArtificialOligonucleotide primer 96catcgacgga
ccgatgcaga tcttcgtgaa gaccc 359734DNAArtificialOligonucleotide
primer 97gattttcggt ccgcccctca gacggaggac cagg
349831DNAArtificialOligonucleotide primer 98cctcggaccg atgttcccgt
tccagccaat g 31
* * * * *