U.S. patent application number 12/263139 was filed with the patent office on 2009-03-19 for methods and compositions for the detection of cervical disease.
This patent application is currently assigned to TriPath Imaging, Inc.. Invention is credited to Timothy J. Fischer, Douglas P. Malinowski, Margaret R. Parker, Adriann J. Taylor.
Application Number | 20090075300 12/263139 |
Document ID | / |
Family ID | 34964649 |
Filed Date | 2009-03-19 |
United States Patent
Application |
20090075300 |
Kind Code |
A1 |
Fischer; Timothy J. ; et
al. |
March 19, 2009 |
METHODS AND COMPOSITIONS FOR THE DETECTION OF CERVICAL DISEASE
Abstract
Methods and compositions for identifying high-grade cervical
disease in a patient sample are provided. The methods of the
invention comprise detecting overexpression of at least one
biomarker in a body sample, wherein the biomarker is selectively
overexpressed in high-grade cervical disease. In particular claims,
the body sample is a cervical smear or monolayer of cervical cells.
The biomarkers of the invention include genes and proteins that are
involved in cell cycle regulation, signal transduction, and DNA
replication and transcription. In particular claims, the biomarker
is an S-phase gene. In some aspects of the invention,
overexpression of a biomarker of interest is detected at the
protein level using biomarker-specific antibodies or at the nucleic
acid level using nucleic acid hybridization techniques. Kits for
practicing the methods of the invention are further provided.
Inventors: |
Fischer; Timothy J.;
(Raleigh, NC) ; Malinowski; Douglas P.;
(Hillsborough, NC) ; Taylor; Adriann J.; (Durham,
NC) ; Parker; Margaret R.; (Raleigh, NC) |
Correspondence
Address: |
ALSTON & BIRD LLP
BANK OF AMERICA PLAZA, 101 SOUTH TRYON STREET, SUITE 4000
CHARLOTTE
NC
28280-4000
US
|
Assignee: |
TriPath Imaging, Inc.
Burlington
NC
|
Family ID: |
34964649 |
Appl. No.: |
12/263139 |
Filed: |
October 31, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11521144 |
Sep 14, 2006 |
|
|
|
12263139 |
|
|
|
|
11087227 |
Mar 23, 2005 |
7157233 |
|
|
11521144 |
|
|
|
|
60556495 |
Mar 24, 2004 |
|
|
|
Current U.S.
Class: |
435/7.9 ;
435/7.1; 436/501 |
Current CPC
Class: |
C12Q 1/6886 20130101;
C12Q 2600/158 20130101; G01N 33/57411 20130101; C07K 16/3069
20130101; C12Q 2600/112 20130101; G01N 33/6875 20130101; G01N
2333/025 20130101 |
Class at
Publication: |
435/7.9 ;
436/501; 435/7.1 |
International
Class: |
G01N 33/53 20060101
G01N033/53 |
Claims
1. A kit comprising at least three antibodies, wherein each
antibody specifically binds to a nuclear biomarker protein that is
selectively overexpressed in high-grade cervical disease, and
wherein a first and a second antibody in the kit specifically bind
to the biomarker protein MCM2, and wherein a third antibody
specifically binds to the biomarker protein Topo2A.
2. The kit of claim 1, wherein said kit further comprises a
peroxidase blocking reagent, a protein blocking reagent, chemicals
for the detection of antibody binding to said biomarker proteins, a
counterstain, a bluing agent, and instructions for use.
3. The kit of claim 2, wherein said chemicals for the detection of
antibody binding comprise a chromogen and a secondary antibody
conjugated to a labeled polymer, wherein the chromogen comprises
3',3'-diaminobenzidine, and wherein the labeled polymer comprises
horseradish peroxidase conjugated to a dextran polymer.
4. The kit of claim 2, wherein said counterstain comprises
hematoxylin.
5. The kit of claim 2, wherein said bluing agent comprises a
solution comprising Tris buffered saline, pH 7.4, Tween-20, and
sodium azide.
6. The kit of claim 2 further comprising a positive control
sample.
7. The kit of claim 6, wherein said positive control sample
comprises SiHa cells.
8. The kit of claim 2 further comprising reagents for Papanicolaou
(Pap) staining.
9. The kit of claim 8, wherein the reagents for Pap staining
comprise EA50 and Orange G.
10. The kit of claim 1, wherein the at least three antibodies are
provided as separate reagents.
11. The kit of claim 1, wherein the at least three antibodies are
provided as a cocktail.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 11/521,144, filed Sep. 14, 2006, which is a continuation
of U.S. patent application Ser. No. 11/087,227, filed Mar. 23,
2005, now U.S. Pat. No. 7,157,233, which claims the benefit of U.S.
Provisional Application Ser. No. 60/556,495, filed Mar. 24, 2004,
all of which is incorporated herein by reference in their
entirety.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA
EFS-WEB
[0002] The official copy of the sequence listing is submitted
concurrently with the specification as a text file via EFS-Web, in
compliance with the American Standard Code for Information
Interchange (ASCII), with a file name of 364710SequenceListing.txt,
a creation date of Oct. 30, 2008, and a size of 116 KB. The
sequence listing filed via EFS-Web is part of the specification and
is hereby incorporated in its entirety by reference herein.
FIELD OF THE INVENTION
[0003] The present invention relates to methods and compositions
for the detection of high-grade cervical disease.
BACKGROUND OF THE INVENTION
[0004] Carcinoma of the cervix is the second most common neoplasm
in women, accounting for approximately 12% of all female cancers
and causing approximately 250,000 deaths per year. Baldwin et al.
(2003) Nature Reviews Cancer 3: 1-10. In many developing countries
where mass screening programs are not available, the clinical
problem is more serious. Cervical cancer in these countries is the
number one cause of cancer deaths in women.
[0005] The majority of cases of cervical cancer represent squamous
cell carcinoma, although adenocarcinoma is also seen. Cervical
cancer can be prevented by population screening as it evolves
through well-defined noninvasive intraepithelial stages, which can
be distinguished morphologically. Williams et al. (1998) Proc.
Natl. Acad. Sci. USA 95:14932-14937. While it is not understood how
normal cells become transformed, the concept of a continuous
spectrum of histopathological change from normal, stratified
epithelium through cervical intraepithelial neoplasia (CIN) to
invasive cancer has been widely accepted for years. The precursor
to cervical cancer is dysplasia, also known in the art as CIN or
squamous intraepithelial lesions (SIL). Squamous intraepithelial
abnormalities may be classified by using the three-tiered (CIN) or
two-tiered (Bethesda) system. Under the Bethesda system, low-grade
squamous intraepithelial lesions (LSIL), corresponding to CINI and
HPV infection, generally represent productive HPV infections with a
relatively low risk of progression to invasive disease. High-grade
squamous intraepithelial lesions (HSIL), corresponding to CINII and
CINIII in the three-tiered system, show a higher risk of
progression to cervical cancer than do LSIL, although both LSIL and
HSIL are viewed as potential precursors of malignancy. Patient
samples may also be classified as ASCUS (atypical squamous cells of
unknown significance) or AGUS (atypical glandular cells of unknown
significance) under this system.
[0006] A strong association of cervical cancer and infection by
high-risk types of human papilloma virus (HPV), such as types 16,
18, and 31, has been established. In fact, a large body of
epidemiological and molecular biological evidence has established
HPV infection as a causative factor in cervical cancer. Moreover,
HPV is found in 85% or more of the cases of high-grade cervical
disease. However, HPV infection is very common, possibly occurring
in 5-15% of women over the age of 30, but few HPV-positive women
will ever develop high-grade cervical disease or cancer. The
presence of HPV alone is indicative only of infection, not of
high-grade cervical disease, and, therefore, testing for HPV
infection alone results in many false positives. See, for example,
Wright et al. (2004) Obstet. Gynecol. 103:304-309.
[0007] Current literature suggests that HPV infects the basal stem
cells within the underlying tissue of the uterine-cervix.
Differentiation of the stem cells into mature keratinocytes, with
resulting migration of the cells to the stratified cervical
epithelium, is associated with HPV viral replication and
re-infection of cells. During this viral replication process, a
number of cellular changes occur that include cell-cycle
de-regulation, active proliferation, DNA replication,
transcriptional activation and genomic instability (Crum (2000)
Modern Pathology 13:243-251; Middleton et al. (2003) J. Virol.
77:10186-10201; Pett et al. (2004) Cancer Res. 64:1359-1368).
[0008] Most HPV infections are transient in nature, with the viral
infection resolving itself within a 12-month period. For those
individuals who develop persistent infections with one or more
oncogenic subtypes of HPV, there is a risk for the development of
neoplasia in comparison to patients without an HPV infection. Given
the importance of HPV in the development of cervical neoplasia, the
clinical detection of HPV has become an important diagnostic tool
in the identification of patients at risk for cervical neoplasia
development. The clinical utility of HPV-based screening for
cervical disease is in its negative predictive value. An HPV
negative result in combination with a history of normal Pap smears
is an excellent indicator of a disease-free condition and a low
risk of cervical neoplasia development during the subsequent 1-3
years. However, a positive HPV result is not diagnostic of cervical
disease; rather it is an indication of infection. Although the
majority of HPV infections is transient and will spontaneously
clear within a 12-month period, a persistent infection with a
high-risk HPV viral subtype indicates a higher risk for the
development of cervical neoplasia. To supplement HPV testing, the
identification of molecular markers associated with cervical
neoplasia is expected to improve the clinical specificity for
cervical disease diagnosis.
[0009] Cytological examination of Papanicolaou-stained cervical
smears (Pap smears) currently is the method of choice for detecting
cervical cancer. The Pap test is a subjective method that has
remained substantially unchanged for 60 years. There are several
concerns, however, regarding its performance. The reported
sensitivity of a single Pap test (the proportion of disease
positives that are test-positive) is low and shows wide variation
(30-87%). The specificity of a single Pap test (the proportion of
disease negatives that are test-negative) might be as low as 86% in
a screening population and considerably lower in the ASCUS PLUS
population for the determination of underlying high-grade disease.
See, Baldwin et al., supra. A significant percentage of Pap smears
characterized as LSIL or CINI are actually positive for high-grade
lesions. Furthermore, up to 10% of Pap smears are classified as
ASCUS (atypical squamous cells of undetermined significance), i.e.,
it is not possible to make a clear categorization as normal,
moderate or severe lesion, or tumor. However, experience shows that
up to 10% of this ASCUS population has high-grade lesions, which
are consequently overlooked. See, for example, Manos et al. (1999)
JAMA 281:1605-1610.
[0010] Thus, a method for diagnosing high-grade cervical disease
that is independent of or works in conjunction with conventional
Pap smears and molecular testing for high-risk HPV infection is
needed. Such a method should be able to specifically identify
high-grade cervical disease that is present in all patient
populations, including those cases classified as LSIL or CINI by
Pap staining that are actually positive for high-grade lesions
(i.e., "false negatives"). Therefore, there is a need in the art
for specific, reliable diagnostic methods that are capable of
detecting high-grade cervical disease and of differentiating
high-grade disease from conditions that are not considered clinical
disease, such as early-stage HPV infection and mild dysplasia.
SUMMARY OF THE INVENTION
[0011] Compositions and methods for diagnosing high-grade cervical
disease are provided. The methods of the invention comprise
detecting overexpression of at least one biomarker, particularly a
nuclear biomarker, in a body sample, wherein the detection of
overexpression of said biomarker specifically identifies samples
that are indicative of high-grade cervical disease. The present
method distinguishes samples that are indicative of high-grade
cervical disease from samples that are indicative of benign
proliferation, early-stage HPV infection, or mild dysplasia. Thus,
the method relies on the detection of a biomarker that is
selectively overexpressed in high-grade cervical disease states but
that is not overexpressed in normal cells or cells that are not
indicative of clinical disease.
[0012] The biomarkers of the invention are proteins and/or genes
that are selectively overexpressed in high-grade cervical disease,
including those that result from HPV-induced cell cycle dysfunction
and activation of certain genes responsible for S-phase induction.
Biomarkers of particular interest include S-phase genes, whose
overexpression results from HPV-induced cell-cycle dysfunction and
the subsequent activation of the transcriptional factors SP-1 and
E2F. The detection of overexpression of the biomarker genes or
proteins of the invention permits the differentiation of samples
that are indicative of high-grade disease, such as moderate to
severe dysplasia and cervical carcinomas, from normal cells or
cells that are not indicative of clinical disease (e.g.,
early-stage HPV infection absent dysplasia and mild dysplasia).
[0013] Biomarker overexpression can be assessed at the protein or
nucleic acid level. In some embodiments, immunocytochemistry
techniques are provided that utilize antibodies to detect the
overexpression of biomarker proteins in cervical cytology samples.
In this aspect of the invention, at least one antibody directed to
a specific biomarker of interest is used. Overexpression can also
be detected by nucleic acid-based techniques, including, for
example, hybridization and RT-PCR. Kits comprising reagents for
practicing the methods of the invention are further provided.
[0014] The methods of the invention can also be used in combination
with traditional gynecological diagnostic techniques that analyze
morphological characteristics or HPV infection status. Thus, for
example, the immunocytochemistry methods presented here can be
combined with the Pap test so that all the morphological
information from the conventional method is conserved. In this
manner, the detection of biomarkers that are selectively
overexpressed in high-grade cervical disease can reduce the high
false-negative rate of the Pap test and may facilitate mass
automated screening.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 provides a schematic summary of proliferation and
cell cycle de-regulation in cervical dysplasia. Cell cycle
alterations and proliferation control defects in cervical
neoplasia. HPV infection and over-expression of the E6 and E7
oncoproteins produces a series of alterations in the cell cycle and
proliferation control. The HPV E6 oncoprotein abrogates cell cycle
checkpoints at the G1/S and G2/M boundaries with subsequent
replication of DNA with somatic mutations. E7 promotes the
acceleration into the S-phase with prolonged expression of the
S-phase genes required for DNA replication (aberrant S-phase
induction). Likewise, E6 promotes expression of telomerase ensuring
continued chromosomal telomere integrity during proliferation and
cellular immortalization. Finally, E7 abrogates the TGF-beta
signaling pathway and abrogates this control mechanism for G1
arrest and control of proliferation.
[0016] FIG. 2 provides a schematic representation of aberrant
S-phase induction in cervical neoplasia. The effects of HPV
proteins on cell cycle control and proliferation include
inactivation of the p53 and Rb tumor suppressor pathways,
activation of E2F-1 transcription, induction of the S-phase genes
MCM-2, MCM-6, MCM-7, TOP2A and Cyclin E1 along others. In addition,
E2 interacts with the Sp-1 transcription factor to activate gene
expression of p21-waf-1.
[0017] FIG. 3 provides a schematic representation of the feedback
loop on cell proliferation in aberrant S-phase of the cell cycle.
Overexpression of Cyclin E and CDK2 in the S-phase results in an
independent mechanism to permit induction of the S-phase genes.
[0018] FIG. 4 provides a schematic representation of the role of
c-myc in aberrant S-phase induction. C-myc is an important
transcriptional activator in cellular proliferation. The gene
encoding c-myc is located on the chromosome. This is the same site
that HPV 18 integration has been documented with a corresponding
amplification of this gene region. Amplification of the c-myc gene
would result in over-expression of the encoded protein and
increased levels of c-myc would independently contribute to S-phase
gene transcription further accelerating cellular proliferation.
[0019] FIG. 5 provides a schematic representation of TaqMan.RTM.
primers directed to MCM7 transcript variants.
[0020] FIG. 6 illustrates the differential staining pattern of an
antibody directed to Claudin 1 in an IHC assay for a patient with
mild dysplasia and a patient with squamous cell carcinoma.
[0021] FIG. 7 illustrates the differential staining pattern of an
antibody directed to Claudin 1 in an IHC and ICC format. Normal
cells and cells indicative of CINIII and HSIL are shown.
[0022] FIG. 8 illustrates nuclear staining patterns obtained with a
nuclear biomarker (i.e., MCM2) and cytoplasmic staining patterns
obtained with a cytoplasmic biomarker (p16). Results are from an
immunocytochemistry (ICC) assay of a high-grade cervical disease
patient sample.
[0023] FIG. 9 illustrates desirable and undesirable antibody
staining in an immunohistochemistry (IHC) assay using two different
antibodies directed to MCM6 on cervical tissue from a patient with
high-grade cervical disease.
DETAILED DESCRIPTION OF THE INVENTION
[0024] The present invention provides compositions and methods for
identifying or diagnosing high-grade cervical disease. The methods
comprise the detection of the overexpression of specific biomarkers
that are selectively overexpressed in high-grade cervical disease
(e.g., moderate to severe dysplasia and cervical cancer). That is,
the biomarkers of the invention are capable of distinguishing
between HPV-infected cells and HPV-infected cells that are
pre-malignant, malignant, or overtly cancerous. Methods for
diagnosing high-grade cervical disease involve detecting the
overexpression of at least one biomarker that is indicative of
high-grade cervical disease in a tissue or body fluid sample from a
patient. In particular embodiments, antibodies and
immunocytochemistry techniques are used to detect expression of the
biomarker of interest. Kits for practicing the methods of the
invention are further provided.
[0025] "Diagnosing high-grade cervical disease" is intended to
include, for example, diagnosing or detecting the presence of
cervical disease, monitoring the progression of the disease, and
identifying or detecting cells or samples that are indicative of
high-grade cervical disease. The terms diagnosing, detecting, and
identifying high-grade cervical disease are used interchangeably
herein. By "high-grade cervical disease" is intended those
conditions classified by colposcopy as premalignant pathology,
malignant pathology, moderate to severe dysplasia, and cervical
cancer. Underlying high-grade cervical disease includes
histological identification of CINII, CINIII, HSIL, carcinoma in
situ, adenocarcinoma, and cancer (FIGO stages I-IV).
[0026] As discussed above, a significant percentage of patients
presenting with Pap smears classified as normal, CINI, or ASCUS
actually have lesions characteristic of high-grade cervical
disease. Thus, the methods of the present invention permit the
identification of high-grade cervical disease in all patient
populations, including these "false negative" patients, and
facilitate the detection of rare abnormal cells in a patient
sample. The diagnosis can be made independent of cell morphology
and HPV infection status, although the methods of the invention can
also be used in conjunction with conventional diagnostic
techniques, e.g., Pap test, molecular testing for high-risk types
of HPV, etc.
[0027] HPV types have been divided into high and low-risk
categories based on their association with cervical cancer and
precancerous lesions. Low-risk HPV types include types 6, 11, 42,
43, 44 and are not associated with an increased risk of cervical
cancer. In contrast, high-risk HPV types, including types 16, 18,
31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, have been strongly
associated with cervical cancer and squamous intraepithelial
lesions. See, for example, Wright et al. (2004) Obstet. Gynecol.
103:304-309. In fact, over 99% of cervical cancers are associated
with high-risk HPV infection. Persistent high-risk HPV infection
leads to the disruption of the cell cycle and mitotic checkpoints
in cervical cells through the action of HPV genes E2, E6, and E7.
In particular, HPV E7 causes an increase in cyclin E and the
subsequent release of the transcription factor E2f from the
retinoblastoma (Rb) protein. The released E2f transcription factor
then triggers the transcription of a variety of S-phase genes,
including topoisomerase II alpha (Topo2A), MCM proteins, cyclins E1
and E2, and p14arf, resulting in loss of cell cycle control. HPV E2
further stimulates overexpression of S-phase genes such as
p21.sup.waf-1 by activating the Sp-1 transcription factor. The cell
cycle disruption caused by persistent HPV infection can lead to
mild cervical dysplasia that may then progress to moderate or
severe dysplasia and eventually to cervical cancer in some cases.
By "cervical cancer" is intended any cancer or cancerous lesion
associated with cervical tissue or cervical cells.
[0028] HPV infection within cervical keratinocytes results in a
number of alterations that disrupt the activities within the cell
cycle. The E6 and E7 oncoproteins of the high-risk HPV subtypes
have been implicated in a number of cellular processes related to
increased proliferation and neoplastic transformation of the
infected keratinocytes. The E6 protein has been implicated in two
critical processes. The first is the degradation of the p53 tumor
suppressor protein through ubiquitin-mediated proteolysis. Removal
of functional p53 eliminates a major cell cycle checkpoint
responsible for DNA repair prior to entry into DNA replication and
mitosis (Duensing and Munger (2003) Prog Cell Cycle Res.
5:383-391). In addition, E6 has been shown to interact with the
c-myc protein and is responsible for direct transcriptional
activation of the hTERT gene with subsequent expression of
telomerase (McMurray and McCance (2003) J. Virol. 77:9852-9861;
Veldman et al. (2003) Proc Natl Acad Sci U.S.A. 100: 8211-8216).
Activation of telomerase is a key step in cancer biology
responsible for the maintenance of telomere length on replicating
chromosomes and this enzyme ensures functionally intact chromosomes
during cellular immortalization.
[0029] The HPV oncoprotein E7 is known to contribute to cellular
proliferation through two independent mechanisms. The first is the
inactivation of the TGF-beta tumor suppressor pathway responsible
for cell cycle arrest at the G1 phase through direct interaction of
E7 with the Smad proteins (Smad 2, 3 and 4), thereby inhibiting
their ability to bind to DNA (Lee et al. (2002) J Biol Chem.
277:38557-38564). Likewise, E7 is known to specifically interact
with the Rb tumor suppressor protein. Within the G1 phase of the
cell cycle, Rb complexes the E2F transcription factor and prevents
E2F from activating gene transcription. At the G1/S boundary, the
Rb protein is phosphorylated with release of the E2F transcription
factor--thereby initiating E2F gene transcription and entry into
the S phase of the cell cycle. The HPV E7 oncoprotein abrogates
this control mechanism by directly binding with Rb and displacing
E2F from the complex. This results in E2F driven gene transcription
independent of normal cell cycle control (Duensing and Munger
(2003) Prog Cell Cycle Res. 5:383-391; Duensing and Munger (2004)
Int J Cancer 109:157-162; Clarke and Chetty (2001) Gynecol Oncol.
82:238-246). This release of E2F uncouples gene transcription from
cell cycle control and results in prolonged and aberrant
transcription of S-phase genes responsible for DNA synthesis and
cellular proliferation. In addition, the combined actions of both
E6 and E7 have been shown to contribute to centrosome abnormalities
and the subsequent genomic instability in cervical neoplasia
(Duensing and Munger (2004) Int J Cancer 109:157-162).
[0030] While not intending to be limited to a particular mechanism,
in some embodiments, the molecular behavior of high-grade cervical
disease can be characterized as the overexpression of discrete
genes, normally expressed only during the S-phase of the cell
cycle, as a result of infection by oncogenic strains of HPV. The
subsequent uncontrolled activation of gene transcription and
aberrant S-phase induction is mediated through the E2F-1
transcription factor pathway. This behavior appears to be
indicative of high-grade cervical disease and provides a link
between oncogenic HPV infections and the molecular behavior of
cervical neoplasia. The use of these molecular biomarkers of
cervical neoplasia in molecular diagnostic assay formats can
improve the detection of cervical disease with an improved
sensitivity and specificity over current methods. See generally
FIGS. 1-4 and Malinowski (2005) BioTechniques 38:1-8 (in press),
which is herein incorporated by reference in its entirety. Thus, in
particular embodiments, a method for diagnosing high-grade cervical
disease comprises detecting overexpression of a biomarker, wherein
overexpression of the biomarker is indicative of aberrant S-phase
induction, as described herein. In still other embodiments, the
methods comprise detecting overexpression of a biomarker, wherein
overexpression of the biomarker is indicative of active
transcription or overexpression of the HPV E6 and HPV E7 genes.
[0031] Dysplasia is conventionally defined in morphological terms
by a loss of normal orientation of epithelial cells, accompanied by
alterations in cellular and nuclear size, shape, and staining
characteristics. Dysplasia is graded according to the degree of the
cellular abnormalities (i.e., mild, moderate, severe) and is widely
accepted to be an intermediate stage in the progression from normal
tissue to neoplasia, as evidenced by the identification of
pre-malignant dysplastic conditions such as CIN. The methods of the
present invention permit the identification of high-grade cervical
disease, which includes moderate to severe dysplasia and cervical
cancer (i.e., CINII conditions and above), based on the
overexpression of biomarkers that are specific to high-grade
cervical disease.
[0032] The methods disclosed herein provide superior detection of
high-grade cervical disease in comparison to PAP smears and/or HPV
infection testing. In particular aspects of the invention, the
sensitivity and specificity of the present methods are equal to or
greater than that of conventional Pap smears. As used herein,
"specificity" refers to the level at which a method of the
invention can accurately identify samples that have been confirmed
as NIL by colposcopy (i.e., true negatives). That is, specificity
is the proportion of disease negatives that are test-negative. In a
clinical study, specificity is calculated by dividing the number of
true negatives by the sum of true negatives and false positives. By
"sensitivity" is intended the level at which a method of the
invention can accurately identify samples that have been
colposcopy-confirmed as positive for high-grade cervical disease
(i.e., true positives). Thus, sensitivity is the proportion of
disease positives that are test-positive. Sensitivity is calculated
in a clinical study by dividing the number of true positives by the
sum of true positives and false negatives. See Examples 1-3 below.
In some embodiments, the sensitivity of the disclosed methods for
the detection of high-grade cervical disease is preferably at least
about 70%, more preferably at least about 80%, most preferably at
least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more.
Furthermore, the specificity of the present methods is preferably
at least about 70%, more preferably at least about 80%, most
preferably at least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%
or more.
[0033] The term "positive predictive value" or "PPV" refers to the
probability that a patient has high-grade cervical disease when
restricted to those patients who are classified as positive using a
method of the invention. PPV is calculated in a clinical study by
dividing the number of true positives by the sum of true positives
and false positives. In some embodiments, the PPV of a method of
the invention for diagnosing high-grade cervical disease is at
least about 40%, while maintaining a sensitivity of at least about
90%, more particularly at least about 95%. The "negative predictive
value" or "NPV" of a test is the probability that the patient will
not have the disease when restricted to all patients who test
negative. NPV is calculated in a clinical study by dividing the
number of true negatives by the sum of true negatives and false
negatives.
[0034] The biomarkers of the invention include genes and proteins,
and variants and fragments thereof. Such biomarkers include DNA
comprising the entire or partial sequence of the nucleic acid
sequence encoding the biomarker, or the complement of such a
sequence. The biomarker nucleic acids also include RNA comprising
the entire or partial sequence of any of the nucleic acid sequences
of interest. A biomarker protein is a protein encoded by or
corresponding to a DNA biomarker of the invention. A biomarker
protein comprises the entire or partial amino acid sequence of any
of the biomarker proteins or polypeptides.
[0035] A "biomarker" is any gene or protein whose level of
expression in a tissue or cell is altered compared to that of a
normal or healthy cell or tissue. Biomarkers of the invention are
selective for underlying high-grade cervical disease. By
"selectively overexpressed in high-grade cervical disease" is
intended that the biomarker of interest is overexpressed in
high-grade cervical disease but is not overexpressed in conditions
classified as LSIL, CINI, HPV-infected samples without any
dysplasia present, immature metaplastic cells, and other conditions
that are not considered to be clinical disease. Thus, detection of
the biomarkers of the invention permits the differentiation of
samples indicative of underlying high-grade cervical disease from
samples that are indicative of benign proliferation, early-stage
HPV infection, or mild dysplasia. By "early-stage HPV infection" is
intended HPV infection that has not progressed to cervical
dysplasia. As used herein, "mild dysplasia" refers to LSIL and CINI
where no high-grade lesion is present. The methods of the invention
also distinguish cells indicative of high-grade disease from normal
cells, immature metaplastic cells, and other cells that are not
indicative of clinical disease. In this manner, the methods of the
invention permit the accurate identification of high-grade cervical
disease, even in cases mistakenly classified as normal, CINI, LSIL,
or ASCUS by traditional Pap testing (i.e., "false negatives"). In
some embodiments, the methods for diagnosing high-grade cervical
disease are performed as a reflex to an abnormal or atypical Pap
smear. That is, the methods of the invention may be performed in
response to a patient having an abnormal or atypical Pap smear
result. In other aspects of the invention, the methods are
performed as a primary screening test for high-grade cervical
disease in the general population of women, just as the
conventional Pap test is performed currently.
[0036] The biomarkers of the invention include any gene or protein
that is selectively overexpressed in high-grade cervical disease,
as defined herein above. Such biomarkers are capable of identifying
cells within a cytology cell suspension that are pre-malignant,
malignant, or overtly cancerous. The biomarkers of the invention
detect cells of CINII conditions and above, but do not detect CINI
and HPV-infected cells where there is no underlying high-grade
disease. Biomarkers of particular interest include genes and
proteins involved in cell cycle regulation, HPV disruption of the
cell cycle, DNA replication and transcription, and signal
transduction. In some embodiments, the biomarkers are S-phase
genes, including those genes whose expression is stimulated by the
E2f transcription factor or the Sp-1 transcription factor. Nuclear
biomarkers may be used to practice certain aspects of the
invention. By "nuclear biomarker" is intended a biomarker that is
predominantly expressed in the nucleus of the cell. A nuclear
biomarker may be expressed to a lesser degree in other parts of the
cell. Although any biomarker indicative of high-grade cervical
disease may be used in the present invention, in certain
embodiments the biomarkers, particularly nuclear biomarkers, are
selected from the group consisting of MCM2, MCM6, MCM7,
p21.sup.waf1, topoisomerase II alpha (Topo2A), p14.sup.arf, and
cyclin E. More particularly, the biomarker may comprise an MCM
protein.
[0037] Minichromosome maintenance (MCM) proteins play an essential
part in eukaryotic DNA replication. The minichromosome maintenance
(MCM) proteins function in the early stages of DNA replication
through loading of the prereplication complex onto DNA and
functioning as a helicase to help unwind the duplex DNA during de
novo synthesis of the duplicate DNA strand. Each of the MCM
proteins has DNA-dependent ATPase motifs in their highly conserved
central domain. Levels of MCM proteins generally increase in a
variable manner as normal cells progress from G0 into the G1/S
phase of the cell cycle. In the G0 phase, MCM2 and MCM5 proteins
are much less abundant than are the MCM7 and MCM3 proteins. MCM6
forms a complex with MCM2, MCM4, and MCM7, which binds histone H3.
In addition, the subcomplex of MCM4, MCM6, and MCM7 has helicase
activity, which is mediated by the ATP-binding activity of MCM6 and
the DNA-binding activity of MCM4. See, for example, Freeman et al.
(1999) Clin. Cancer Res. 5:2121-2132; Lei et al. (2001) J. Cell
Sci. 114:1447-1454; Ishimi et al. (2003) Eur. J. Biochem.
270:1089-1101, all of which are herein incorporated by reference in
their entirety.
[0038] Early publications have shown that the MCM proteins, and in
particular, MCM-5, are useful for the detection of cervical disease
(Williams et al. (1998) Proc Natl Acad Sci U.S.A. 95:14932-14937),
as well as other cancers (Freeman et al. (1999) Clin Cancer Res.
5:2121-2132). The published literature indicates that antibodies to
MCM-5 are capable of detecting cervical neoplastic cells. The
specificity for detection of high-grade cervical disease has not
been demonstrated for MCM-5 (Williams et al. (1998) Proc Natl Acad
Sci U.S.A. 95:14932-14937). The detection of MCM-5 expression is
not restricted to high-grade cervical disease but is also detected
in identified low-grade dysplasia and proliferative cells that have
re-entered the cell cycle following infection with high-risk HPV.
The detection of cervical neoplasia with antibodies to MCM-5 is
shown in FIG. 4. In addition to MCM-5, other members from the MCM
family, including MCM-2 and MCM-7 have been shown to be potentially
useful markers for the detection of cervical neoplasia in tissue
samples (Freeman et al. (1999) Clin Cancer Res. 5:2121-2132; Brake
et al. (2003) Cancer Res. 63:8173-8180). Recent results have shown
that MCM-7 appears to be a specific marker for the detection of
high-grade cervical disease using immunochemistry formats (Brake et
al. (2003) Cancer Res. 63:8173-8180; Malinowski et al. (2004) Acta
Cytol. 43:696).
[0039] Topoisomerase II alpha (Topo2a) is an essential nuclear
enzyme involved in DNA replication and is a target for many
anti-cancer drugs used for cancer therapy. Decreased expression of
Topo2a is a predominant mechanism of resistance to several
chemotherapeutic agents. A significant variation in the range of
expression of this protein has been noted in many different tumors.
Topo2a is predominant in proliferating cells and is modified in M
phase by phosphorylation at specific sites, which is critical for
mitotic chromosome condensation and segregation.
[0040] p21 is a protein encoded by the WAF1/Cip1 gene on chromosome
6p. This gene was shown to inhibit the activity of several
cyclin/cyclin-dependent kinase complexes and to block cell cycle
progression. The expression of p21.sup.waf1 mediates the cell cycle
arrest function of p53. Because p21 appears to mediate several of
the growth-regulatory functions of p53, its expression may reflect
the functional status of p53 more precisely than p53 accumulation.
Furthermore, p21.sup.waf1 can inhibit DNA replication by blocking
the action of proliferating cell nuclear antigen (PCNA).
[0041] Cyclin E is a regulatory subunit of cdk-2 and controls G1/S
transition during the mammalian cell cycle. Multiple isoforms of
Cyclin E are expressed only in tumors but not in the normal
tissues, suggesting a post-transcriptional regulation of Cyclin E.
In vitro analyses indicated that these truncated variant isoforms
of Cyclin E are able to phosphorylate histone H1. Alterations in
Cyclin E proteins have been implicated as indicators of poor
prognosis in various cancers.
[0042] Although the above biomarkers have been discussed in detail,
any biomarker that is overexpressed in high-grade cervical disease
states (e.g., CINII, CINIII, and cervical carcinomas) may be used
in the practice of the invention. Other biomarkers of interest
include cell cycle regulated genes that are specific to the G1/S
phase boundary or to S-phase. Such genes include but are not
limited to helicase (DDX11), uracil DNA glycolase (UNG), E2F5,
cyclin E1 (CCNE1), cyclin E2 (CCNE2), CDC25A, CDC45L, CDC6, p21
WAF-1 (CDKN1A), CDKN3, E2F1, MCM2, MCM6, NPAT, PCNA, stem loop BP
(SLBP), BRCA1, BRCA2, CCNG2, CDKN2C, dihydrofolate reductase
(DHFR), histone H1, histone H2A, histone H2B, histone H3, histone
H4, MSH2, NASP, ribonucleotide reductase M1 (RRM1), ribonucleotide
reductase M2 (RRM2), thymidine synthetase (TYMS), replication
factor C4 (RFC4), RAD51, chromatin Factor 1A (CHAFIA), chromatin
Factor 1B (CHAF1B), topisomerase III (TOP3A), ORC1, primase 2A
(PRIM2A), CDC27, primase 1 (PRIM1), flap structure endonuclease
(FEN1), fanconi anemia comp. grp A (FNACA), PKMYT1, and replication
protein A2 (RPA2). See, for example, Whitfield et al. (2002) Mol.
Biol. Cell 13:1977-2000, herein incorporated by reference in its
entirety. Other S phase genes of interest include cyclin-dependent
kinase 2 (CDK2), MCM3, MCM4, MCM5, DNA polymerase I alpha (DNA
POL1), DNA ligase 1, B-Myb, DNA methyl transferase (DNA MET),
pericentrin (PER), KIF4, DP-1, ID-3, RAN binding protein (RANBP1),
gap junction alpha 6 (GJA6), amino levulinate dehydratase (ALDH),
histone 2A Z (H2A.Z), spermine synthase (SpmS), proliferin 2,
T-lymphocyte activation protein, phospholipase A2 (PLA2), and L6
antigen (L6). See, for example, Nevins et al. (2001) Mol. Cell.
Biol. 21:4689-4699, herein incorporated by reference.
[0043] In some aspects of the invention, the biomarkers comprise
genes that are induced by the E2f transcription factor. Such genes
include but are not limited to thymidylate synthase, thymidine
kinase 1, ribonucleotide reductase M1, ribonucleotide reductase M2,
CDK2, cyclin E, MCM3, MCM7, PCNA, DNA primase small subunit,
topoisomerase II A (Topo2A), DNA ligase 1, flap endonuclease 1,
RAD51, CDC2, cyclin A2, cyclin B1, cyclin B2, KI-67, KIFC1, FIN16,
BUB1, importin alpha-2, HMG2, enhancer of zeste, STK-1, histone
stem-loop BP, Rb, P18-INK4C, annexin VIII, c-Myb, CDC25A, cyclin
D3, cyclin E1, deoxycytosine kinase, DP-1, endothelin converting
enzyme, enolase 2, P18 INK4C, ribonucleotide reductase, and uracil
DNA glycolase 2. See, for example Nevins et al., supra; Muller et
al. (2000) Genes and Dev. 15:267-285. In particular embodiments the
biomarker of interest is a gene induced by E2f transcription factor
that is involved in cell cycle regulation and DNA replication, such
as, for example, cyclin E2, Ki-67, p57KIP2, RANBPM, and replication
protein A1. Some E2f-induced genes of interest are involved in
apoptosis, including APAF1, Bcl-2, caspase 3, MAP3 Kinase 5, and
TNF receptor associated factor. Other E2f-induced genes are
involved in the regulation of transcription and include, for
example, ash2 like, polyhomeotic 2, embryonic ectoderm protein,
enhancer of zeste, hairy/enhancer of split, homeobox A10, homeobox
A7, homeobox A9, homeodomain TF1, pre-B-cell leukemia FT3, YY1 TF,
POU domain TF, TAFII130, TBP-factor 172, basic TF3,
bromodomain/zinc finger, SWI/SNF, ID4, TEA-4, NFATC1, NFATC3, BT,
CNC-1, MAF, MAFF, MAFG, core binding protein, E74-like factor 4,
c-FOS, JUNB, zinc finger DNA BP, and Cbp/p300 transactivator.
E2f-induced genes involved in signal transduction are also
potential biomarkers of interest and include TGF beta, follistatin,
bone morphogenetic protein 2, BMP receptor type 1A, frizzled
homolog 1, WNT10B, sphingosine kinase 1, dual specificity
phosphatase 7, dual specificity (Y) phosphatase, FGF Receptor 3,
protein tyrosine phosphatase, dual specificity (Y) phosphatase
D6655, insulin receptor, mature T-cell proliferation 1, FGF
receptor 2, TGF alpha, CDC42 effector protein 3, Met, CD58, CD83,
TACC1, and TEAD4.
[0044] Although the methods of the invention require the detection
of at least one biomarker in a patient sample for the detection of
high-grade cervical disease, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more
biomarkers may be used to practice the present invention. It is
recognized that detection of more than one biomarker in a body
sample may be used to identify instances of high-grade cervical
disease. Therefore, in some embodiments, two or more biomarkers are
used, more preferably, two or more complementary biomarkers. By
"complementary" is intended that detection of the combination of
biomarkers in a body sample results in the successful
identification of high-grade cervical disease in a greater
percentage of cases than would be identified if only one of the
biomarkers was used. Thus, in some cases, a more accurate
determination of high-grade cervical disease can be made by using
at least two biomarkers. Accordingly, where at least two biomarkers
are used, at least two antibodies directed to distinct biomarker
proteins will be used to practice the immunocytochemistry methods
disclosed herein. The antibodies may be contacted with the body
sample simultaneously or concurrently. In certain aspects of the
invention, the overexpression of MCM2 and Topo2A is detected using
three antibodies, wherein two of the antibodies are specific for
MCM2 and the third antibody is specific for Topo2A.
[0045] In particular embodiments, the diagnostic methods of the
invention comprise collecting a cervical sample from a patient,
contacting the sample with at least one antibody specific for a
biomarker of interest, and detecting antibody binding. Samples that
exhibit overexpression of a biomarker of the invention, as
determined by detection of antibody binding, are deemed positive
for high-grade cervical disease. In particular embodiments, the
body sample is a monolayer of cervical cells. In some aspects of
the invention, the monolayer of cervical cells is provided on a
glass slide.
[0046] By "body sample" is intended any sampling of cells, tissues,
or bodily fluids in which expression of a biomarker can be
detected. Examples of such body samples include but are not limited
to blood, lymph, urine, gynecological fluids, biopsies, and smears.
Body samples may be obtained from a patient by a variety of
techniques including, for example, by scraping or swabbing an area
or by using a needle to aspirate bodily fluids. Methods for
collecting various body samples are well known in the art. In
particular embodiments, the body sample comprises cervical cells,
as cervical tissue samples or as cervical cells in suspension,
particularly in a liquid-based preparation. In one embodiment,
cervical samples are collected according to liquid-based cytology
specimen preparation guidelines such as, for example, the
SurePath.RTM. (TriPath Imaging, Inc.) or the ThinPrep.RTM.
preparation (CYTYC, Inc.). Body samples may be transferred to a
glass slide for viewing under magnification. Fixative and staining
solutions may be applied to the cells on the glass slide for
preserving the specimen and for facilitating examination. In one
embodiment the cervical sample will be collected and processed to
provide a monolayer sample, as set forth in U.S. Pat. No.
5,346,831, herein incorporated by reference.
[0047] The monolayer method relates to a method for producing a
monolayer of cytological material on a cationically-charged
substrate. The method comprises the steps of separating the
cytological material by centrifugation over a density gradient,
producing a packed pellet of the cytological material, mixing the
pellet of the cytological material, withdrawing an aliquot of a
predetermined volume from the mixed pellet, depositing the aliquot
and a predetermined volume of water into a sedimentation vessel,
which is removably secured to the cationically-charged substrate,
allowing the cytological material to settle onto the substrate
under the force of gravity, and after settlement of the cytological
material, removing the water from the sedimentation vessel. For
automated analysis, the sedimentation vessel may be detached from
the substrate. Disaggregation may be by any methods known in the
art, such as syringing, trypsinizing, ultrasonication, shaking,
vortexing, or by use of the device described in copending U.S. Pat.
No. 5,316,814, the contents of which are herein incorporated by
reference. In some embodiments, slides comprising a monolayer of
cervical cells are prepared from SurePath.TM. (TriPath Imaging,
Inc.) samples using the PrepStain.TM. slide processor (TriPath
Imaging, Inc.).
[0048] Any methods available in the art for identification or
detection of the biomarkers are encompassed herein. The
overexpression of a biomarker of the invention can be detected on a
nucleic acid level or a protein level. In order to determine
overexpression, the body sample to be examined may be compared with
a corresponding body sample that originates from a healthy person.
That is, the "normal" level of expression is the level of
expression of the biomarker in cervical cells of a human subject or
patient not afflicted with high-grade cervical disease. Such a
sample can be present in standardized form. In some embodiments,
particularly when the body sample comprises a monolayer of cervical
cells, determination of biomarker overexpression requires no
comparison between the body sample and a corresponding body sample
that originates from a healthy person. In this situation, the
monolayer of cervical cells from a single patient may contain as
few as 1-2 abnormal cells per 50,000 normal cells present.
Detection of these abnormal cells, identified by their
overexpression of a biomarker of the invention, precludes the need
for comparison to a corresponding body sample that originates from
a healthy person.
[0049] Methods for detecting biomarkers of the invention comprise
any methods that determine the quantity or the presence of the
biomarkers either at the nucleic acid or protein level. Such
methods are well known in the art and include but are not limited
to western blots, northern blots, southern blots, ELISA,
immunoprecipitation, immunofluorescence, flow cytometry,
immunocytochemistry, nucleic acid hybridization techniques, nucleic
acid reverse transcription methods, and nucleic acid amplification
methods. In particular embodiments, overexpression of a biomarker
is detected on a protein level using, for example, antibodies that
are directed against specific biomarker proteins. These antibodies
can be used in various methods such as Western blot, ELISA,
immunoprecipitation, or immunocytochemistry techniques. Likewise,
immunostaining of cervical smears can be combined with conventional
Pap stain methods so that morphological information and
immunocytochemical information can be obtained. In this manner, the
detection of the biomarkers can reduce the high false-negative rate
of the Pap smear test and may facilitate mass automated
screening.
[0050] In one embodiment, antibodies specific for biomarker
proteins are utilized to detect the overexpression of a biomarker
protein in a body sample. The method comprises obtaining a body
sample from a patient, contacting the body sample with at least one
antibody directed to a biomarker that is selectively overexpressed
in high-grade cervical disease, and detecting antibody binding to
determine if the biomarker is overexpressed in the patient sample.
A preferred aspect of the present invention provides an
immunocytochemistry technique for diagnosing high-grade cervical
disease. Specifically, this method comprises antibody staining of
biomarkers within a patient sample that are specific for high-grade
cervical disease. One of skill in the art will recognize that the
immunocytochemistry method described herein below may be performed
manually or in an automated fashion using, for example, the
Autostainer Universal Staining System (Dako) or the Biocare Nemesis
Autostainer (Biocare). One protocol for antibody staining (i.e.,
immunocytochemistry) of cervical samples is provided in Example
1.
[0051] In a preferred immunocytochemistry method, a patient
cervical sample is collected into a liquid medium, such as, for
example, in a SurePath.TM. collection vial (TriPath Imaging, Inc.).
An automated processor such as the PrepStain.TM. system (TriPath
Imaging, Inc.) is used to collect cells from the liquid medium and
to deposit them in a thin layer on a glass slide for further
analysis. Slide specimens may be fixed or unfixed and may be
analyzed immediately following preparation or may be stored for
later analysis. In some embodiments, prepared slides are stored in
95% ethanol for a minimum of 24 hours. Alternatively, in other
embodiments, slides are stored in a pretreatment buffer, as
described below.
[0052] Samples may need to be modified in order to make the
biomarker antigens accessible to antibody binding. In a particular
aspect of the immunocytochemistry methods, slides are transferred
to a pretreatment buffer, for example the SureSlide.RTM.
Preparation Buffer (Tripath Imaging, Inc.) and Optionally Heated to
Increase Antigen accessibility. Heating of the sample in the
pretreatment buffer rapidly disrupts the lipid bi-layer of the
cells and makes the antigens (i.e., biomarker proteins) more
accessible for antibody binding. The pretreatment buffer may
comprise a polymer, a detergent, or a nonionic or anionic
surfactant such as, for example, an ethyloxylated anionic or
nonionic surfactant, an alkanoate or an alkoxylate or even blends
of these surfactants or even the use of a bile salt. In particular
embodiments, the pretreatment buffer comprises a nonionic or
anionic detergent, such as sodium alkanoate with an approximate
molecular weight of 183 kD blended with an alkoxylate with an
approximate molecular weight of 370 kD (hereafter referred to as
RAM). In a particular embodiment, the pretreatment buffer comprises
1% RAM. In some embodiments, the pretreatment buffer may also be
used as a slide storage buffer, as indicated above. In another
embodiment a solution of 0.1% to 1% of deoxycholic acid, sodium
salt, monohydrate was used as both a storage buffer as well as a
pretreatment buffer. In yet another embodiment of the invention a
solution of sodium laureth-13-carboxylate (e.g., Sandopan LS) or
and ethoxylated anionic complex or even an alkylaryl ethoxlate
carboxylic acid can be used for the storage and pretreatment
buffers. In a particular aspect of the invention, the slide
pretreatment buffer comprises 0.05% to 5% sodium
laureth-13-carboxylate, particularly 0.1% to 1% sodium
laureth-13-carboxylate, more particularly 0.5% sodium
laureth-13-carboxylate. In one embodiment the slides can be stored
in the buffer for up to 72 hours prior to the pretreatment and
staining process. The pretreatment buffers of the invention may be
used in methods for making antigens more accessible for antibody
binding in an immunoassay, such as, for example, an
immunocytochemistry method or an immunohistochemistry method. See
Example 14. The terms "pretreatment buffer" and "preparation
buffer" are used interchangeably herein to refer to a buffer that
is used to prepare cytology or histology samples for
immunostaining, particularly by increasing antigen accessibility
for antibody binding.
[0053] Any method for making antigens more accessible for antibody
binding may be used in the practice of the invention, including the
antigen retrieval methods known in the art. See, for example, Bibbo
et al. (2002) Acta. Cytol. 46:25-29; Saqi et al. (2003) Diagn.
Cytopathol. 27:365-370; Bibbo et al. (2003) Anal. Quant. Cytol.
Histol. 25:8-11, herein incorporated by reference in their
entirety. In some embodiments, antigen retrieval comprises storing
the slides in 95% ethanol for at least 24 hours, immersing the
slides in 1.times. Target Retrieval Solution pH 6.0 (DAKO
S1699)/dH2O bath preheated to 95.degree. C., and placing the slides
in a steamer for 25 minutes. See Example 2 below.
[0054] Following pretreatment or antigen retrieval to increase
antigen accessibility, samples are blocked using an appropriate
blocking agent, e.g., a peroxidase blocking reagent such as
hydrogen peroxide. In some embodiments, the samples are blocked
using a protein blocking reagent to prevent non-specific binding of
the antibody. The protein blocking reagent may comprise, for
example, purified casein. An antibody, particularly a monoclonal
antibody, directed to a biomarker of interest is then incubated
with the sample. As noted above, one of skill in the art will
appreciate that a more accurate diagnosis of high-grade cervical
disease may be obtained in some cases by detecting more than one
biomarker in a patient sample. Therefore, in particular
embodiments, at least two antibodies directed to two distinct
biomarkers are used to detect high-grade cervical disease. Where
more than one antibody is used, these antibodies may be added to a
single sample sequentially as individual antibody reagents or
simultaneously as an antibody cocktail. See Example 3 below.
Alternatively, each individual antibody may be added to a separate
sample from the same patient, and the resulting data pooled. In
particular embodiments, an antibody cocktail comprises at least
three antibodies, wherein two antibodies specifically bind to MCM2
and a third antibody specifically binds to Topo2A.
[0055] Techniques for detecting antibody binding are well known in
the art. Antibody binding to a biomarker of interest may be
detected through the use of chemical reagents that generate a
detectable signal that corresponds to the level of antibody binding
and, accordingly, to the level of biomarker protein expression. In
one of the immunocytochemistry methods of the invention, antibody
binding is detected through the use of a secondary antibody that is
conjugated to a labeled polymer. Examples of labeled polymers
include but are not limited to polymer-enzyme conjugates. The
enzymes in these complexes are typically used to catalyze the
deposition of a chromogen at the antigen-antibody binding site,
thereby resulting in cell staining that corresponds to expression
level of the biomarker of interest. Enzymes of particular interest
include horseradish peroxidase (HRP) and alkaline phosphatase (AP).
Commercial antibody detection systems, such as, for example the
Dako Envision+ system and Biocare Medical's Mach 3 system, may be
used to practice the present invention.
[0056] In one particular immunocytochemistry method of the
invention, antibody binding to a biomarker is detected through the
use of an HRP-labeled polymer that is conjugated to a secondary
antibody. Antibody binding can also be detected through the use of
a mouse probe reagent, which binds to mouse monoclonal antibodies,
and a polymer conjugated to HRP, which binds to the mouse probe
reagent. Slides are stained for antibody binding using the
chromogen 3,3-diaminobenzidine (DAB) and then counterstained with
hematoxylin and, optionally, a bluing agent such as ammonium
hydroxide or TBS/Tween-20. In some aspects of the invention, slides
are reviewed microscopically by a cytotechnologist and/or a
pathologist to assess cell staining (i.e., biomarker
overexpression) and to determine if high-grade cervical disease is
present. Alternatively, samples may be reviewed via automated
microscopy or by personnel with the assistance of computer software
that facilitates the identification of positive staining cells.
[0057] The terms "antibody" and "antibodies" broadly encompass
naturally occurring forms of antibodies and recombinant antibodies
such as single-chain antibodies, chimeric and humanized antibodies
and multi-specific antibodies as well as fragments and derivatives
of all of the foregoing, which fragments and derivatives have at
least an antigenic binding site. Antibody derivatives may comprise
a protein or chemical moiety conjugated to the antibody.
[0058] "Antibodies" and "immunoglobulins" (Igs) are glycoproteins
having the same structural characteristics. While antibodies
exhibit binding specificity to an antigen, immunoglobulins include
both antibodies and other antibody-like molecules that lack antigen
specificity. Polypeptides of the latter kind are, for example,
produced at low levels by the lymph system and at increased levels
by myelomas.
[0059] The term "antibody" is used in the broadest sense and covers
fully assembled antibodies, antibody fragments that can bind
antigen (e.g., Fab', F'(ab).sub.2, Fv, single chain antibodies,
diabodies), and recombinant peptides comprising the foregoing.
[0060] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally-occurring
mutations that may be present in minor amounts.
[0061] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen-binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab')2, and Fv fragments; diabodies; linear antibodies (Zapata et
al. (1995) Protein Eng. 8(10):1057-1062); single-chain antibody
molecules; and multispecific antibodies formed from antibody
fragments. Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fc" fragment, whose
name reflects its ability to crystallize 35 readily. Pepsin
treatment yields an F(ab')2 fragment that has two antigen-combining
sites and is still capable of cross-linking antigen.
[0062] "Fv" is the minimum antibody fragment that contains a
complete antigen recognition and binding site. In a two-chain Fv
species, this region consists of a dimer of one heavy- and one
light-chain variable domain in tight, non-covalent association. In
a single-chain Fv species, one heavy- and one light-chain variable
domain can be covalently linked by flexible peptide linker such
that the light and heavy chains can associate in a "dimeric"
structure analogous to that in a two-chain Fv species. It is in
this configuration that the three CDRs of each variable domain
interact to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0063] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (CHI) of the heavy chain.
Fab fragments differ from Fab' fragments by the addition of a few
residues at the carboxy terminus of the heavy-chain C.sub.H1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group. F(ab')2
antibody fragments originally were produced as pairs of Fab'
fragments that have hinge cysteines between them.
[0064] Polyclonal antibodies can be prepared by immunizing a
suitable subject (e.g., rabbit, goat, mouse, or other mammal) with
a biomarker protein immunogen. The antibody titer in the immunized
subject can be monitored over time by standard techniques, such as
with an enzyme linked immunosorbent assay (ELISA) using immobilized
biomarker protein. At an appropriate time after immunization, e.g.,
when the antibody titers are highest, antibody-producing cells can
be obtained from the subject and used to prepare monoclonal
antibodies by standard techniques, such as the hybridoma technique
originally described by Kohler and Milstein (1975) Nature
256:495-497, the human B cell hybridoma technique (Kozbor et al.
(1983) Immunol. Today 4:72), the EBV-hybridoma technique (Cole et
al. (1985) in Monoclonal Antibodies and Cancer Therapy, ed.
Reisfeld and Sell (Alan R. Liss, Inc., New York, N.Y.), pp. 77-96)
or trioma techniques. The technology for producing hybridomas is
well known (see generally Coligan et al., eds. (1994) Current
Protocols in Immunology (John Wiley & Sons, Inc., New York,
N.Y.); Galfre et al. (1977) Nature 266:550-52; Kenneth (1980) in
Monoclonal Antibodies: A New Dimension In Biological Analyses
(Plenum Publishing Corp., NY); and Lerner (1981) Yale J. Biol.
Med., 54:387-402).
[0065] Alternative to preparing monoclonal antibody-secreting
hybridomas, a monoclonal antibody can be identified and isolated by
screening a recombinant combinatorial immunoglobulin library (e.g.,
an antibody phage display library) with a biomarker protein to
thereby isolate immunoglobulin library members that bind the
biomarker protein. Kits for generating and screening phage display
libraries are commercially available (e.g., the Pharmacia
Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the
Stratagene SurfZAP.theta. Phage Display Kit, Catalog No. 240612).
Additionally, examples of methods and reagents particularly
amenable for use in generating and screening antibody display
library can be found in, for example, U.S. Pat. No. 5,223,409; PCT
Publication Nos. WO 92/18619; WO 91/17271; WO 92/20791; WO
92/15679; 93/01288; WO 92/01047; 92/09690; and 90/02809; Fuchs et
al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum.
Antibod. Hybridomas 3:81-85; Huse et al. (1989) Science
246:1275-1281; Griffiths et al. (1993) EMBO J. 12:725-734.
[0066] Detection of antibody binding can be facilitated by coupling
the antibody to a detectable substance. Examples of detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials, bioluminescent materials, and
radioactive materials. Examples of suitable enzymes include
horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase,
or acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S, or .sup.3H.
[0067] In regard to detection of antibody staining in the
immunocytochemistry methods of the invention, there also exist in
the art, video-microscopy and software methods for the quantitative
determination of an amount of multiple molecular species (e.g.,
biomarker proteins) in a biological sample wherein each molecular
species present is indicated by a representative dye marker having
a specific color. Such methods are also known in the art as a
colorimetric analysis methods. In these methods, video-microscopy
is used to provide an image of the biological sample after it has
been stained to visually indicate the presence of a particular
biomarker of interest. Some of these methods, such as those
disclosed in U.S. patent application Ser. No. 09/957,446 to
Marcelpoil et al. and U.S. patent application Ser. No. 10/057,729
to Marcelpoil et al., incorporated herein by reference, disclose
the use of an imaging system and associated software to determine
the relative amounts of each molecular species present based on the
presence of representative color dye markers as indicated by those
color dye markers' optical density or transmittance value,
respectively, as determined by an imaging system and associated
software. These techniques provide quantitative determinations of
the relative amounts of each molecular species in a stained
biological sample using a single video image that is
"deconstructed" into its component color parts.
[0068] The antibodies used to practice the invention are selected
to have high specificity for the biomarker proteins of interest.
Methods for making antibodies and for selecting appropriate
antibodies are known in the art. See, for example, Celis, ed. (in
press) Cell Biology & Laboratory Handbook, 3rd edition
(Academic Press, New York), which is herein incorporated in its
entirety by reference. In some embodiments, commercial antibodies
directed to specific biomarker proteins may be used to practice the
invention. The antibodies of the invention may be selected on the
basis of desirable staining of cytological, rather than
histological, samples. That is, in particular embodiments the
antibodies are selected with the end sample type (i.e., cytology
preparations) in mind and for binding specificity.
[0069] In some aspects of the invention, antibodies directed to
specific biomarkers of interest are selected and purified via a
multi-step screening process. In particular embodiments, polydomas
are screened to identify biomarker-specific antibodies that possess
the desired traits of specificity and sensitivity. As used herein,
"polydoma" refers to multiple hybridomas. The polydomas of the
invention are typically provided in multi-well tissue culture
plates. In the initial antibody screening step, a tumor tissue
microarray comprising multiple normal (i.e., no CIN), CINIII,
squamous cell carcinoma, and adenocarcinoma samples is generated.
Methods and equipment, such as the Chemicon.RTM. Advanced Tissue
Arrayer, for generating arrays of multiple tissues on a single
slide are known in the art. See, for example, U.S. Pat. No.
4,820,504. Undiluted supernatants from each well containing a
polydoma are assayed for positive staining using standard
immunohistochemistry techniques. At this initial screening step,
background, non-specific binding is essentially ignored. Polydomas
producing positive results are selected and used in the second
phase of antibody screening.
[0070] In the second screening step, the positive polydomas are
subjected to a limiting dilution process. The resulting unscreened
antibodies are assayed for positive staining of CINIII or cervical
carcinoma samples using standard immunohistochemistry techniques.
At this stage, background staining is relevant, and the candidate
polydomas that only stain positive for abnormal cells (i.e., CINIII
and cancer cells) only are selected for further analysis.
[0071] To identify antibodies that can distinguish normal and CINI
samples from those indicative of high-grade cervical disease (i.e.,
CINII and above), a disease panel tissue microarray is generated.
This tissue microarray typically comprises multiple no CIN, CINI,
CINII, CINIII, squamous cell carcinoma, and adenocarcinoma samples.
Standard immunohistochemistry techniques are employed to assay the
candidate polydomas for specific positive staining of samples
indicative of high-grade cervical disease only (i.e., CINII samples
and above). Polydomas producing positive results and minimal
background staining are selected for further analysis.
[0072] Positive-staining cultures are prepared as individual clones
in order to select individual candidate monoclonal antibodies.
Methods for isolating individual clones are well known in the art.
The supernatant from each clone comprising unpurified antibodies is
assayed for specific staining of CINII, CINIII, squamous cell
carcinoma, and adenocarcinoma samples using the tumor and disease
panel tissue microarrays described herein above. Candidate
antibodies showing positive staining of high-grade cervical disease
samples (i.e., CINII and above), minimal staining of other cell
types (i.e., normal and CINI samples), and little background are
selected for purification and further analysis. Methods for
purifying antibodies through affinity adsorption chromatography are
well known in the art.
[0073] In order to identify antibodies that display maximal
specific staining of high-grade cervical disease samples and
minimal background, non-specific staining in cervical cytology
samples, the candidate antibodies isolated and purified in the
immunohistochemistry-based screening process above are assayed
using the immunocytochemistry techniques of the present invention.
Exemplary protocols for performing immunocytochemistry are provided
in Examples 1 and 2.
[0074] Specifically, purified antibodies of interest are used to
assay a statistically significant number of NIL (i.e., no invasive
lesion), ASCUS, LSIL, HSIL or cancerous cervical cytology patient
samples. The samples are analyzed by immunocytochemistry as
described herein and classified as positive, negative, or
indeterminate for high-grade cervical disease on the basis of
positive antibody staining for a particular biomarker. Sensitivity,
specificity, positive predictive values, and negative predictive
values for each antibody are calculated. Antibodies exhibiting
maximal specific staining of high-grade cervical disease in
cervical cytology samples with minimal background (i.e., maximal
signal to noise ratio) are selected for the present invention.
[0075] Identification of appropriate antibodies results in an
increase in signal to noise ratio and an increase in the clinical
utility of the assay. Assay format and sample type to be used are
critical factors in selection of appropriate antibodies. Many
antibodies directed to biomarkers do not produce a desirable signal
to noise ratio in an immunocytochemistry format with cytology
preparations or in an immunohistochemistry format with
formalin-fixed paraffin-embedded samples. Moreover, biomarker
antibodies that produce a maximal signal to noise ratio in an
immunohistochemistry format may not work as well in
immunocytochemistry assays. For example, an antibody that produces
the desired level of staining in an immunocytochemistry format may
not produce the appropriate level of staining in an
immunohistochemistry assay (data not shown). Likewise, an antibody
that produces an acceptable signal to noise ratio when used in the
immunohistochemistry assay may result in overstaining of
immunocytochemistry samples (data not shown). Thus, antibody
selection requires early consideration of the assay format and the
end sample type to be used.
[0076] Cytology-based assays (i.e., immunocytochemistry) differ
from tissue-based assays (i.e., immunohistochemistry) insofar as
the tissue architecture is not available to assist with staining
interpretation in the immunocytochemistry format. For example, in
an immunohistochemistry assay performed on samples from patients
with mild dysplasia or squamous cell carcinoma with an antibody
directed to Claudin 1, the results indicated that Claudin 1 was
expressed in the lesion of the mild dysplasia sample (i.e., light
brown staining) but was significantly overexpressed (i.e., dark
brown staining) in the cancer lesion (FIG. 12). The results
obtained with the same Claudin 1 antibody in an immunocytochemistry
assay format were indeterminate (FIG. 13). While abnormal cells are
easily detectable using a Claudin 1 antibody in an
immunohistochemistry assay, the results obtained by the staining of
Claudin 1 in the immunocytochemistry assay of the invention were
more difficult to interpret. Therefore, biomarkers that are
appropriate in an immunohistochemistry format may not be suitable
in an immunocytochemistry assay and, thus, are not included in the
preferred embodiment of the invention.
[0077] Furthermore, the location of biomarkers within the cell is
also an important consideration in immunocytochemistry assays.
Biomarkers that display nuclear, cytoplasmic, or membrane staining
patterns can be confirmed morphologically and are appropriate for
immunohistochemistry methods. Cytoplasmic and membrane staining,
however, make it difficult to identify critical morphological
characteristics of cervical disease (e.g., nuclear to cytoplasmic
ratio) in immunocytochemistry assays. See FIG. 15. In contrast,
biomarkers that are expressed in the nucleus and show a nuclear
staining pattern facilitate detection of antibody staining and also
permit morphological analysis. See FIG. 15. Thus, in some preferred
embodiments, only biomarkers that are selectively expressed in the
nucleus are used in an immunocytochemistry assay of the
invention.
[0078] One of skill in the art will recognize that optimization of
antibody titer and detection chemistry is needed to maximize the
signal to noise ratio for a particular antibody. Antibody
concentrations that maximize specific binding to the biomarkers of
the invention and minimize non-specific binding (or "background")
will be determined. In particular embodiments, appropriate antibody
titers for use in cervical cytology preparations are determined by
initially testing various antibody dilutions on formalin-fixed
paraffin-embedded normal and high-grade cervical disease tissue
samples. Optimal antibody concentrations and detection chemistry
conditions are first determined for formalin-fixed
paraffin-embedded cervical tissue samples. The design of assays to
optimize antibody titer and detection conditions is standard and
well within the routine capabilities of those of ordinary skill in
the art. After the optimal conditions for fixed tissue samples are
determined, each antibody is then used in cervical cytology
preparations under the same conditions. Some antibodies require
additional optimization to reduce background staining and/or to
increase specificity and sensitivity of staining in the cytology
samples.
[0079] Furthermore, one of skill in the art will recognize that the
concentration of a particular antibody used to practice the methods
of the invention will vary depending on such factors as time for
binding, level of specificity of the antibody for the biomarker
protein, and method of body sample preparation. Moreover, when
multiple antibodies are used, the required concentration may be
affected by the order in which the antibodies are applied to the
sample, i.e., simultaneously as a cocktail or sequentially as
individual antibody reagents. Furthermore, the detection chemistry
used to visualize antibody binding to a biomarker of interest must
also be optimized to produce the desired signal to noise ratio.
[0080] In other embodiments, the expression of a biomarker of
interest is detected at the nucleic acid level. Nucleic acid-based
techniques for assessing expression are well known in the art and
include, for example, determining the level of biomarker mRNA in a
body sample. Many expression detection methods use isolated RNA.
Any RNA isolation technique that does not select against the
isolation of mRNA can be utilized for the purification of RNA from
cervical cells (see, e.g., Ausubel et al., ed., (1987-1999) Current
Protocols in Molecular Biology (John Wiley & Sons, New York).
Additionally, large numbers of tissue samples can readily be
processed using techniques well known to those of skill in the art,
such as, for example, the single-step RNA isolation process of
Chomczynski (1989, U.S. Pat. No. 4,843,155).
[0081] The term "probe" refers to any molecule that is capable of
selectively binding to a specifically intended target biomolecule,
for example, a nucleotide transcript or a protein encoded by or
corresponding to a biomarker. Probes can be synthesized by one of
skill in the art, or derived from appropriate biological
preparations. Probes may be specifically designed to be labeled.
Examples of molecules that can be utilized as probes include, but
are not limited to, RNA, DNA, proteins, antibodies, and organic
molecules.
[0082] Isolated mRNA can be used in hybridization or amplification
assays that include, but are not limited to, Southern or Northern
analyses, polymerase chain reaction analyses and probe arrays. One
method for the detection of mRNA levels involves contacting the
isolated mRNA with a nucleic acid molecule (probe) that can
hybridize to the mRNA encoded by the gene being detected. The
nucleic acid probe can be, for example, a full-length cDNA, or a
portion thereof, such as an oligonucleotide of at least 7, 15, 30,
50, 100, 250 or 500 nucleotides in length and sufficient to
specifically hybridize under stringent conditions to an mRNA or
genomic DNA encoding a biomarker of the present invention.
Hybridization of an mRNA with the probe indicates that the
biomarker in question is being expressed.
[0083] In one embodiment, the mRNA is immobilized on a solid
surface and contacted with a probe, for example by running the
isolated mRNA on an agarose gel and transferring the mRNA from the
gel to a membrane, such as nitrocellulose. In an alternative
embodiment, the probe(s) are immobilized on a solid surface and the
mRNA is contacted with the probe(s), for example, in an Affymetrix
gene chip array. A skilled artisan can readily adapt known mRNA
detection methods for use in detecting the level of mRNA encoded by
the biomarkers of the present invention.
[0084] An alternative method for determining the level of biomarker
mRNA in a sample involves the process of nucleic acid
amplification, e.g., by RT-PCR (the experimental embodiment set
forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain
reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193),
self sustained sequence replication (Guatelli et al. (1990) Proc.
Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification
system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA
86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988)
Bio/Technology 6:1197), rolling circle replication (Lizardi et al.,
U.S. Pat. No. 5,854,033) or any other nucleic acid amplification
method, followed by the detection of the amplified molecules using
techniques well known to those of skill in the art. These detection
schemes are especially useful for the detection of nucleic acid
molecules if such molecules are present in very low numbers. In
particular aspects of the invention, biomarker expression is
assessed by quantitative fluorogenic RT-PCR (i.e., the TaqMan.RTM.
System). Such methods typically utilize pairs of oligonucleotide
primers that are specific for the biomarker of interest. Methods
for designing oligonucleotide primers specific for a known sequence
are well known in the art.
[0085] Biomarker expression levels of RNA may be monitored using a
membrane blot (such as used in hybridization analysis such as
Northern, Southern, dot, and the like), or microwells, sample
tubes, gels, beads or fibers (or any solid support comprising bound
nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305,
5,677,195 and 5,445,934, which are incorporated herein by
reference. The detection of biomarker expression may also comprise
using nucleic acid probes in solution.
[0086] In one embodiment of the invention, microarrays are used to
detect biomarker expression. Microarrays are particularly well
suited for this purpose because of the reproducibility between
different experiments. DNA microarrays provide one method for the
simultaneous measurement of the expression levels of large numbers
of genes. Each array consists of a reproducible pattern of capture
probes attached to a solid support. Labeled RNA or DNA is
hybridized to complementary probes on the array and then detected
by laser scanning. Hybridization intensities for each probe on the
array are determined and converted to a quantitative value
representing relative gene expression levels. See, U.S. Pat. Nos.
6,040,138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316, which
are incorporated herein by reference. High-density oligonucleotide
arrays are particularly useful for determining the gene expression
profile for a large number of RNA's in a sample.
[0087] Techniques for the synthesis of these arrays using
mechanical synthesis methods are described in, e.g., U.S. Pat. No.
5,384,261, incorporated herein by reference in its entirety for all
purposes. Although a planar array surface is preferred, the array
may be fabricated on a surface of virtually any shape or even a
multiplicity of surfaces. Arrays may be peptides or nucleic acids
on beads, gels, polymeric surfaces, fibers such as fiber optics,
glass or any other appropriate substrate, see U.S. Pat. Nos.
5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, each of
which is hereby incorporated in its entirety for all purposes.
Arrays may be packaged in such a manner as to allow for diagnostics
or other manipulation of an all-inclusive device. See, for example,
U.S. Pat. Nos. 5,856,174 and 5,922,591 herein incorporated by
reference.
[0088] In one approach, total mRNA isolated from the sample is
converted to labeled cRNA and then hybridized to an oligonucleotide
array. Each sample is hybridized to a separate array. Relative
transcript levels may be calculated by reference to appropriate
controls present on the array and in the sample.
[0089] Kits for practicing the methods of the invention are further
provided. By "kit" is intended any manufacture (e.g., a package or
a container) comprising at least one reagent, e.g., an antibody, a
nucleic acid probe, etc. for specifically detecting the expression
of a biomarker of the invention. The kit may be promoted,
distributed, or sold as a unit for performing the methods of the
present invention. Additionally, the kits may contain a package
insert describing the kit and methods for its use.
[0090] In a particular embodiment, kits for practicing the
immunocytochemistry methods of the invention are provided. Such
kits are compatible with both manual and automated
immunocytochemistry techniques (e.g., cell staining) as described
below in Example 1. These kits comprise at least one antibody
directed to a biomarker of interest, chemicals for the detection of
antibody binding to the biomarker, a counterstain, and, optionally,
a bluing agent to facilitate identification of positive staining
cells. Any chemicals that detect antigen-antibody binding may be
used in the practice of the invention. In some embodiments, the
detection chemicals comprise a labeled polymer conjugated to a
secondary antibody. For example, a secondary antibody that is
conjugated to an enzyme that catalyzes the deposition of a
chromogen at the antigen-antibody binding site may be provided.
Such enzymes and techniques for using them in the detection of
antibody binding are well known in the art. In one embodiment, the
kit comprises a secondary antibody that is conjugated to an
HRP-labeled polymer. Chromogens compatible with the conjugated
enzyme (e.g., DAB in the case of an HRP-labeled secondary antibody)
and solutions, such as hydrogen peroxide, for blocking non-specific
staining may be further provided. In other embodiments, antibody
binding to a biomarker protein is detected through the use of a
mouse probe reagent that binds to mouse monoclonal antibodies,
followed by addition of a dextran polymer conjugated with HRP that
binds to the mouse probe reagent. Such detection reagents are
commercially available from, for example, Biocare Medical.
[0091] The kits of the present invention may further comprise a
peroxidase blocking reagent (e.g., hydrogen peroxide), a protein
blocking reagent (e.g., purified casein), and a counterstain (e.g.,
hematoxylin). A bluing agent (e.g., ammonium hydroxide or TBS, pH
7.4, with Tween-20 and sodium azide) may be further provided in the
kit to facilitate detection of positive staining cells.
[0092] In another embodiment, the immunocytochemistry kits of the
invention additionally comprise at least two reagents, e.g.,
antibodies, for specifically detecting the expression of at least
two distinct biomarkers. Each antibody may be provided in the kit
as an individual reagent or, alternatively, as an antibody cocktail
comprising all of the antibodies directed to the different
biomarkers of interest. Furthermore, any or all of the kit reagents
may be provided within containers that protect them from the
external environment, such as in sealed containers. An exemplary
kit for practicing the methods of the invention is described below
in Example 8.
[0093] Positive and/or negative controls may be included in the
kits to validate the activity and correct usage of reagents
employed in accordance with the invention. Controls may include
samples, such as tissue sections, cells fixed on glass slides,
etc., known to be either positive or negative for the presence of
the biomarker of interest. In a particular embodiment, the positive
control comprises SiHa cells. This is a human cervical squamous
cancer cell line that is hypertriploid and positive for HPV-16
infection and, therefore, serves as a positive control for the
overexpression of biomarkers in high-grade cervical disease states.
SiHa control cells may be provided in the kits of the invention as
prepared slides or as a cell suspension that is compatible with
slide preparation. The design and use of controls is standard and
well within the routine capabilities of those of ordinary skill in
the art.
[0094] In other embodiments, kits for identifying high-grade
cervical comprising detecting biomarker overexpression at the
nucleic acid level are further provided. Such kits comprise, for
example, at least one nucleic acid probe that specifically binds to
a biomarker nucleic acid or fragment thereof. In particular
embodiments, the kits comprise at least two nucleic acid probes
that hybridize with distinct biomarker nucleic acids.
[0095] In some embodiments, the methods of the invention can be
used in combination with traditional cytology techniques that
analyze morphological characteristics. For example, the
immunocytochemical techniques of the present invention can be
combined with the conventional Pap stain so that all the
morphological information from the conventional method is
conserved. In this manner the detection of biomarkers can reduce
the high false-negative rate of the Pap smear test and may
facilitate mass automated screening. In a particular embodiment,
the immunocytochemistry methods disclosed herein above are combined
with the conventional Pap stain in a single method, as described
below in Example 6-7. A combined immunocytochemistry and Pap
staining method permits visualization of both biomarkers that are
selectively overexpressed in high-grade cervical disease and cell
morphology in a single sample (e.g., a microscope slide comprising
a monolayer of cervical cells). The combined immunocytochemistry
and Pap staining method may permit the more accurate identification
and diagnosis of high-grade cervical disease, particularly in cases
mistakenly classified as normal, LSIL, or ASCUS by conventional Pap
testing. Analysis of both biomarker overexpression and cell
morphology in a single method could replace the Pap smear as the
primary screening method for cervical cancer.
[0096] One of skill in the art will recognize that the staining
parameters (e.g., incubation times, wash conditions,
chromogen/stain concentrations, etc.) for this combined methodology
will need to be optimized such that a sufficient contrast between
the immunocytochemistry output (e.g., chromogen staining) and the
Pap stain is obtained. The design of assays to optimize staining
parameters is standard and well within the routine capabilities of
those of ordinary skill in the art. Kits for performing the
combined immunocytochemistry and Pap staining method are also
encompassed by the present invention. Such kits comprise the
reagents needed for immunocytochemistry, as described herein above,
and the reagents for conventional Pap staining, particularly EA50
and Orange G.
[0097] One of skill in the art will further appreciate that any or
all steps in the methods of the invention could be implemented by
personnel or, alternatively, performed in an automated fashion.
Thus, the steps of body sample preparation, sample staining, and
detection of biomarker expression may be automated.
[0098] The following examples are offered by way of illustration
and not by way of limitation:
EXPERIMENTAL
Example 1
Detection of Biomarker Overexpression Using Immunocytochemistry
Slide Preparation and Pretreatment
[0099] Patient cervical samples are collected and placed into a
SurePath.TM. collection vial (TriPath Imaging, Inc.). Cervical
cells are collected from the liquid medium and deposited in a thin
layer on a glass slide using the PrepStain.TM. slide processor
system (TriPath Imaging, Inc.). Prepared slides are immediately
transferred to a pretreatment buffer (1% RAM) and heated for 45
minutes at 95.degree. C. The slides are cooled to room temperature
and rinsed three times (2 minutes per rinse) in TBS (tris buffered
saline).
Manual Immunocytochemistry
[0100] To prevent non-specific background staining, slides are not
permitted to dry out during the staining procedure. Furthermore, in
order to block non-specific staining, hydrogen peroxide is applied
to the slides for 5 minutes, followed by a TBS rinse. An antibody
directed to MCM6 is applied to the slide for 1 hour at room
temperature. Following incubation with the MCM6 antibody, the slide
is washed three times with TBS for 2 minutes per wash. The Dako
Envision+HRP-labeled polymer secondary antibody is applied to the
slide for 30 minutes at room temperature, followed by a TBS rinse.
The HRP substrate chromogen DAB is applied for 10 minutes, and then
the slides are rinsed for 5 minutes with water. Each slide is
counterstained with hematoxylin and then rinsed with water until
clear. Following counterstaining, the slides are soaked in ammonium
hydroxide for 10 seconds and then rinsed with water for 1
minute.
[0101] Samples are dehydrated by immersing the slides in 95%
ethanol for 1 minute and then in absolute ethanol for an additional
minute. Slides are cleared by rinsing 3 times in xylene for 1
minute per rinse. Slides are then coverslipped with permanent
mounting media and incubated at 35.degree. C. to dry. Positive
staining cells are visualized using a bright-field microscope.
Automated Immunocytochemistry
[0102] The Dako Autostainer Universal Staining system is programmed
according to the manufacturer's instructions, and the necessary
staining and counterstaining reagents described above for manual
immunocytochemistry are loaded onto the machine. The prepared and
pretreated slides are loaded onto the Autostainer, and the program
is run. At the end of the run, the slides are removed and rinsed in
water for 5 minutes. The slides are dehydrated, cleared,
coverslipped, and analyzed as described above.
Example 2
Detection of Biomarkers in Clinical Samples
[0103] Approximately 180 cervical cytology patient samples
representing various diagnoses were collected. The presence or
absence of cancerous cells or lesions indicative of high-grade
disease in these patients was previously confirmed by colposcopy.
The following table indicates the number of samples within each
diagnosis group analyzed in this study, as well as a description of
the colposcopy findings (e.g., presence or absence of high-grade
lesions).
TABLE-US-00001 TABLE 1 Specimens analyzed Diagnosis Count
Description NIL 72 HPV Negative ASC-US 26 26 without lesion 0 with
lesion or high risk HPV LSIL 48 42 negative for high grade lesion 6
positive for high grade lesion HSIL 25 Cancer 10 Squamous Cell
Carcinoma and Adenocarcinoma
[0104] The samples were analyzed by immunocytochemistry methods to
identify high-grade cervical disease. Antibodies were used to
detect the overexpression of six biomarkers of interest: MCM2,
MCM6, MCM 7, p21.sup.waf1, Cyclin E, and Topo2A. Assay controls
included MCM2, MCM6, MCM7, p21.sup.waf1, Cyclin E, Topo2A and a
mouse IgG negative run on the SiHa cell line. Samples were also
analyzed by traditional Pap staining techniques.
Preparation of Slides
[0105] Each sample was removed from storage and allowed to come to
room temperature. 6 ml of TriPath CytoRich.RTM. preservative was
added to each vial, and the vials were vortexed. Samples were
processed on the TriPath PrepMate.RTM. automated processor, and any
remaining fluid in the vial was transferred to a centrifuge tube.
The samples were centrifuged for 2 minutes at 200.times.g, and the
supernatant was aspirated. The samples were then centrifuged for 10
minutes at 800.times.g, and the supernatant was decanted. Sample
tubes were loaded onto the TriPath PrepStain.RTM. system and the
system software (version 1.1; Transfer Only) was run. Eight slides
for each patient sample were prepared and stored in 95% ethanol for
at least 24 hours but not longer than 2 weeks prior to use in Pap
staining and immunocytochemistry methods.
Pap Staining Method
[0106] Prepared slides were incubated in 95% ethanol for 30 seconds
and then rinsed with water for an additional 30 seconds.
Hematoxylin was applied to the slides for 6 minutes. Slides were
rinsed in water for 1 minute, acid water for 2 seconds, and water
for 30 seconds. A bluing agent (ammonium hydroxide) was applied for
30 seconds, and the slides were rinsed first in water and then in
95% ethanol for 30 seconds each. EA 50 and Orange G (Autocyte.RTM.)
were applied for 6 minutes. The slides were rinsed 2 times in 95%
ethanol, 3 times in 100% ethanol, and 3 times in xylene for 30
seconds per rinse.
[0107] The slides were then coverslipped using Acrytol mounting
media and incubated at 35.degree. C. to dry. Samples were reviewed
by a pathologist using a bright-field microscope.
Immunocytochemistry Method
[0108] Prepared slides were removed from the 95% ethanol and rinsed
with deionized water for approximately 1 minute. Slides were placed
in a 1.times. Target Retrieval Solution pH 6.0 (DAKO S1699)/dH2O
bath preheated to 95.degree. C. and placed in a steamer for 25
minutes. Samples were allowed to cool for 20 minutes at room
temperature, rinsed well in deionized water, and placed in TBS.
Pretreated slides were stained for biomarker expression essentially
as described above in Example 1, "Automated Immunocytochemistry."
Commercial antibodies directed to MCM2 (1:200), MCM7 (1:25),
p21waf1 (1:100), and cylcin E (1:100) were diluted as indicated and
used to detect biomarker expression. Purified MCM6 antibody,
identified by polydoma screening as described in Example 4, was
used at a 1:6000 dilution.
Interpretation of Slides
[0109] Each slide was screened and reviewed by a cytotechnologist
and a pathologist. Samples were classified as positive, negative,
or indeterminate for high-grade cervical disease according to the
following parameters: [0110] Non-cellular artifacts and
inflammatory cells staining brown (DAB) were disregarded. [0111]
Mature, normal-appearing squamous cells and normal-appearing
glandular cells were not counted as positive when staining with
DAB. [0112] Squamous metaplastic cells along with abnormal cells
were considered positive. [0113] A staining intensity of less than
1.5 was considered negative. [0114] Discrepant results were
resolved through joint review of slides.
[0115] The immunocytochemistry results were compared with the
results previously obtained by colposcopy. Each slide was then
given a final result of true positive (TP), true negative (TN),
false positive (FP), false negative (FN), or indeterminate.
Sensitivity, specificity, positive predictive values, and negative
predictive values for each biomarker were calculated.
Results
[0116] The results for each biomarker are summarized below.
TABLE-US-00002 TABLE 2 MCM2 TP FP FN TN Indeter. Totals NIL 0 0 0
71 1 72 ASC-US (No Lesion) 0 0 0 25 1 26 ASC-US (Lesion) 0 0 0 0 0
0 LSIL (No HSIL) 0 7 0 31 4 42 LSIL (HSIL) 3 0 3 0 0 6 HSIL 24 0 1
0 0 25 Cancer 7 0 1 0 2 10 34 7 5 127 8 181 Sensitivity 0.8718
Specificity 0.9478 PPV 0.8293 NPV 0.9621
TABLE-US-00003 TABLE 3 MCM6 TP FP FN TN Indeter. Totals NIL 0 0 0
68 4 72 ASC-US (No Lesion) 0 3 0 22 1 26 ASC-US (Lesion) 0 0 0 0 0
0 LSIL (No HSIL) 0 14 0 24 4 42 LSIL (HSIL) 3 0 2 0 1 6 HSIL 22 0 0
0 3 25 Cancer 10 0 0 0 0 10 35 17 2 114 13 181 Sensitivity 0.9459
Specificity 0.8702 PPV 0.6731 NPV 0.9828
TABLE-US-00004 TABLE 4 MCM7 TP FP FN TN Indeter. Totals NIL 0 0 0
67 5 72 ASC-US (No Lesion) 0 2 0 21 3 26 ASC-US (Lesion) 0 0 0 0 0
0 LSIL (No HSIL) 0 12 0 28 2 42 LSIL (HSIL) 4 0 2 0 0 6 HSIL 24 0 1
0 0 25 Cancer 9 0 0 0 1 10 37 14 3 116 11 181 Sensitivity 0.9250
Specificity 0.8923 PPV 0.7255 NPV 0.9748
TABLE-US-00005 TABLE 5 Cyclin E TP FP FN TN Indeter. Totals NIL 0 0
0 72 0 72 ASC-US (No Lesion) 0 0 0 26 0 26 ASC-US (Lesion) 0 0 0 0
0 0 LSIL (No HSIL) 0 3 0 35 4 42 LSIL (HSIL) 2 0 4 0 0 6 HSIL 15 0
4 0 6 25 Cancer 7 0 2 0 1 10 24 3 10 133 11 181 Sensitivity 0.7059
Specificity 0.9779 PPV 0.8889 NPV 0.9301
TABLE-US-00006 TABLE 6 p21.sup.waf1 TP FP FN TN Indeter. Totals NIL
0 2 0 61 9 72 ASC-US (No Lesion) 0 1 0 22 3 26 ASC-US (Lesion) 0 0
0 0 0 0 LSIL (No HSIL) 0 12 0 23 7 42 LSIL (HSIL) 3 0 3 0 0 6 HSIL
21 0 1 0 3 25 Cancer 7 0 2 0 1 10 31 15 6 106 23 181 Sensitivity
0.8378 Specificity 0.8760 PPV 0.6739 NPV 0.9464
TABLE-US-00007 TABLE 7 TOPO2A TP FP FN TN Indeter. Totals NIL 0 0 0
68 4 72 ASC-US (No Lesion) 0 1 0 24 1 26 ASC-US (Lesion) 0 0 0 0 0
0 LSIL (No HSIL) 0 4 0 27 11 42 LSIL (HSIL) 3 0 3 0 0 6 HSIL 21 0 1
0 3 25 Cancer 9 0 0 0 1 10 33 5 4 119 20 181 Sensitivity 0.8919
Specificity 0.9597 PPV 0.8684 NPV 0.9675
[0117] Approximately 180 cases were analyzed for the presence of
high-grade cervical disease using the immunocytochemistry methods
of the invention. Of that number, the MCM biomarkers produced an
indeterminate rate ranging from 4% to 7%. Additionally, MCM2 showed
a specificity of 95% with a sensitivity of 87%. The MCM6 and MCM7
biomarkers produced comparable sensitivity results of 95% and 93%,
respectively. The specificity for these two biomarkers ranged from
87% to 89%.
[0118] Cyclin E produced the highest specificity value of 98%.
Although the indeterminate rate was 6%, the sensitivity was only
71%. The indeterminate rate for p21.sup.waf1 was the highest of all
markers tested at 13%. p21.sup.waf1 produced a sensitivity of 84%
and a specificity of 88%. 96% specificity was observed with the
biomarker Topo2A. The indeterminate rate for Topo2A was 11%, with a
sensitivity of 89%.
Example 3
Detection of Biomarkers in Clinical Samples Using Antibody
Cocktails
[0119] Approximately 180 colposcopy-confirmed cervical cytology
samples were analyzed by immunocytochemistry methods to identify
high-grade cervical disease. Each sample was analyzed for the
expression of multiple biomarkers of interest. Specifically,
various combinations of antibodies directed to MCM2, MCM6, MCM 7,
p21waf1, Cyclin E, and Topo2A were analyzed for their ability to
detect high-grade cervical disease. These samples were evaluated
for the expression of multiple biomarkers of interest using the
immunocytochemistry methods and slide interpretation guidelines
described in Example 2.
[0120] The immunocytochemistry results were compared with the
results previously obtained by colposcopy. Each slide was then
given a final result of true positive (TP), true negative (TN),
false positive (FP), false negative (FN), or indeterminate.
Sensitivity, specificity, positive predictive values, and negative
predictive values for each biomarker were calculated.
Results
[0121] The results for each biomarker are summarized below.
TABLE-US-00008 TABLE 8 MCM2 and MCM7 TP FP FN TN Indeter. Totals
NIL 0 0 0 66 6 72 ASC-US (No Lesion) 0 2 0 20 4 26 ASC-US (Lesion)
0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 25 4 42 LSIL (HSIL) 4 0 2 0 0 6
HSIL 24 0 1 0 0 25 Cancer 10 0 0 0 0 10 38 15 3 111 14 181
Sensitivity 0.9268 Specificity 0.8810 PPV 0.7170 NPV 0.9737
TABLE-US-00009 TABLE 9 MCM6 and MCM7 TP FP FN TN Indeter. Totals
NIL 0 0 0 65 7 72 ASC-US (No Lesion) 0 3 0 21 2 26 ASC-US (Lesion)
0 0 0 0 0 0 LSIL (No HSIL) 0 16 0 23 3 42 LSIL (HSIL) 4 0 2 0 0 6
HSIL 24 0 0 0 1 25 Cancer 10 0 0 0 0 10 38 19 2 109 13 181
Sensitivity 0.9500 Specificity 0.8516 PPV 0.6667 NPV 0.9820
TABLE-US-00010 TABLE 10 MCM7 and TOPO2A TP FP FN TN Indeter. Totals
NIL 0 0 0 64 8 72 ASC-US (No Lesion) 0 2 0 21 3 26 ASC-US (Lesion)
0 0 0 0 0 0 LSIL (No HSIL) 0 12 0 29 1 42 LSIL (HSIL) 4 0 2 0 0 6
HSIL 20 0 2 0 3 25 Cancer 8 0 0 0 2 10 32 14 4 114 17 181
Sensitivity 0.8889 Specificity 0.8906 PPV 0.6957 NPV 0.9661
TABLE-US-00011 TABLE 11 MCM7 and Cyclin E TP FP FN TN Indeter.
Totals NIL 0 0 0 67 5 72 ASC-US (No Lesion) 0 2 0 21 3 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 12 0 28 2 42 LSIL (HSIL) 4 0
2 0 0 6 HSIL 24 0 1 0 0 25 Cancer 10 0 0 0 0 10 38 14 3 116 10 181
Sensitivity 0.9268 Specificity 0.8923 PPV 0.7308 NPV 0.9748
TABLE-US-00012 TABLE 12 MCM7 and p21waf1 TP FP FN TN Indeter.
Totals NIL 0 2 0 57 13 72 ASC-US (No Lesion) 0 3 0 20 3 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 14 0 21 7 42 LSIL (HSIL) 4 0
2 0 0 6 HSIL 24 0 1 0 0 25 Cancer 9 0 0 0 1 10 37 19 3 98 24 181
Sensitivity 0.9250 Specificity 0.8376 PPV 0.6607 NPV 0.9703
TABLE-US-00013 TABLE 13 MCM2 and MCM6 TP FP FN TN Indeter. Totals
NIL 0 0 0 67 5 72 ASC-US (No Lesion) 0 3 0 21 2 26 ASC-US (Lesion)
0 0 0 0 0 0 LSIL (No HSIL) 0 17 0 21 4 42 LSIL (HSIL) 3 0 2 0 1 6
HSIL 24 0 0 0 1 25 Cancer 10 0 0 0 0 10 37 20 2 109 13 181
Sensitivity 0.9487 Specificity 0.8450 PPV 0.6491 NPV 0.9820
TABLE-US-00014 TABLE 14 MCM2 and TOPOIIA TP FP FN TN Indeter.
Totals NIL 0 0 0 67 5 72 ASC-US (No Lesion) 0 1 0 23 2 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 8 4 18 12 42 LSIL (HSIL) 3 0
3 0 0 6 HSIL 25 0 0 0 0 25 Cancer 9 0 0 0 1 10 37 9 7 108 20 181
Sensitivity 0.8409 Specificity 0.9231 PPV 0.8043 NPV 0.9391
TABLE-US-00015 TABLE 15 MCM2 and Cyclin E TP FP FN TN Indeter.
Totals NIL 0 0 0 71 1 72 ASC-US (No Lesion) 0 0 0 25 1 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 9 0 27 6 42 LSIL (HSIL) 3 0 3
0 0 6 HSIL 24 0 1 0 0 25 Cancer 8 0 2 0 0 10 35 9 6 123 8 181
Sensitivity 0.8537 Specificity 0.9318 PPV 0.7955 NPV 0.9535
TABLE-US-00016 TABLE 16 MCM2 and p21waf1 TP FP FN TN Indeter.
Totals NIL 0 2 0 60 10 72 ASC-US (No Lesion) 0 1 0 21 4 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 21 8 42 LSIL (HSIL) 3 0
3 0 0 6 HSIL 24 0 1 0 0 25 Cancer 9 0 1 0 0 10 36 16 5 102 22 181
Sensitivity 0.8780 Specificity 0.8644 PPV 0.6923 NPV 0.9533
TABLE-US-00017 TABLE 17 TOPO2A and Cyclin E TP FP FN TN Indeter.
Totals NIL 0 0 0 68 4 72 ASC-US (No Lesion) 0 1 0 24 1 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 5 0 27 10 42 LSIL (HSIL) 3 0
3 0 0 6 HSIL 22 0 1 0 2 25 Cancer 9 0 0 0 1 10 34 6 4 119 18 181
Sensitivity 0.8947 Specificity 0.9520 PPV 0.8500 NPV 0.9675
TABLE-US-00018 TABLE 18 TOPO2A and p21waf1 TP FP FN TN Indeter.
Totals NIL 0 2 0 58 12 72 ASC-US (No Lesion) 0 2 0 21 3 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 19 10 42 LSIL (HSIL) 3 0
3 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10 38 17 3 98 25 181
Sensitivity 0.9268 Specificity 0.8522 PPV 0.6909 NPV 0.9703
TABLE-US-00019 TABLE 19 p21waf1 and Cyclin E TP FP FN TN Indeter.
Totals NIL 0 2 0 61 9 72 ASC-US (No Lesion) 0 1 0 22 3 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 12 0 23 7 42 LSIL (HSIL) 3 0
3 0 0 6 HSIL 22 0 1 0 2 25 Cancer 8 0 1 0 1 10 33 15 5 106 22 181
Sensitivity 0.8684 Specificity 0.8760 PPV 0.6875 NPV 0.9550
TABLE-US-00020 TABLE 20 MCM2, MCM6, and MCM7 TP FP FN TN Indeter.
Totals NIL 0 0 0 64 8 72 ASC-US (No Lesion) 0 3 0 20 3 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 17 0 21 4 42 LSIL (HSIL) 4 0
2 0 0 6 HSIL 24 0 0 0 1 25 Cancer 10 0 0 0 0 10 38 20 2 105 16 181
Sensitivity 0.9500 Specificity 0.8400 PPV 0.6552 NPV 0.9813
TABLE-US-00021 TABLE 21 MCM2, MCM7, and TOPO2A TP FP FN TN Indeter.
Totals NIL 0 0 0 63 9 72 ASC-US (No Lesion) 0 2 0 20 4 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 21 8 42 LSIL (HSIL) 4 0
2 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10 39 15 2 104 21 181
Sensitivity 0.9512 Specificity 0.8739 PPV 0.7222 NPV 0.9811
TABLE-US-00022 TABLE 22 MCM6, MCM7, and TOPO2A TP FP FN TN Indeter.
Totals NIL 0 0 0 63 9 72 ASC-US (No Lesion) 0 3 0 21 2 26 ASC-US
(Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 16 0 20 6 42 LSIL (HSIL) 4 0
2 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10 39 19 2 104 17 181
Sensitivity 0.9512 Specificity 0.8455 PPV 0.6724 NPV 0.9811
TABLE-US-00023 TABLE 23 MCM6, MCM7, and Cyclin E TP FP FN TN
Indeter. Totals NIL 0 0 0 65 7 72 ASC-US (No Lesion) 0 3 0 21 2 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 16 0 23 3 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 24 0 0 0 1 25 Cancer 10 0 0 0 0 10 38 19 2
109 13 181 Sensitivity 0.9500 Specificity 0.8516 PPV 0.6667 NPV
0.9820
TABLE-US-00024 TABLE 24 MCM2, MCM7, and Cyclin E TP FP FN TN
Indeter. Totals NIL 0 0 0 66 6 72 ASC-US (No Lesion) 0 2 0 20 4 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 25 4 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 24 0 1 0 0 25 Cancer 10 0 0 0 0 10 38 15 3
111 14 181 Sensitivity 0.9268 Specificity 0.8810 PPV 0.7170 NPV
0.9737
TABLE-US-00025 TABLE 25 MCM2, MCM7, and p21waf1 TP FP FN TN
Indeter. Totals NIL 0 2 0 56 14 72 ASC-US (No Lesion) 0 3 0 18 5 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 14 0 20 8 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 24 0 1 0 0 25 Cancer 10 0 0 0 0 10 38 19 3
94 27 181 Sensitivity 0.9268 Specificity 0.8319 PPV 0.6667 NPV
0.9691
TABLE-US-00026 TABLE 26 MCM2, TOPOIIA and Cyclin E TP FP FN TN
Indeter. Totals NIL 0 0 0 67 5 72 ASC-US (No Lesion) 0 1 0 23 2 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 9 0 22 11 42 LSIL
(HSIL) 3 0 3 0 0 6 HSIL 25 0 0 0 0 25 Cancer 9 0 0 0 1 10 37 10 3
112 19 181 Sensitivity 0.9250 Specificity 0.9180 PPV 0.7872 NPV
0.9739
TABLE-US-00027 TABLE 27 MCM2, Cyclin E and p21waf1 TP FP FN TN
Indeter. Totals NIL 0 2 0 60 10 72 ASC-US (No Lesion) 0 1 0 21 4 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 21 8 42 LSIL
(HSIL) 3 0 3 0 0 6 HSIL 24 0 1 0 0 25 Cancer 9 0 1 0 0 10 36 16 5
102 22 181 Sensitivity 0.8780 Specificity 0.8644 PPV 0.6923 NPV
0.9533
TABLE-US-00028 TABLE 28 MCM2, TOPOIIA and p21waf1 TP FP FN TN
Indeter. Totals NIL 0 2 0 57 13 72 ASC-US (No Lesion) 0 2 0 20 4 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 18 11 42 LSIL
(HSIL) 3 0 3 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10 38 17 3
95 28 181 Sensitivity 0.9268 Specificity 0.8482 PPV 0.6909 NPV
0.9694
TABLE-US-00029 TABLE 29 MCM7, TOPO2A, and Cyclin E TP FP FN TN
Indeter. Totals NIL 0 0 0 64 8 72 ASC-US (No Lesion) 0 2 0 21 3 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 12 0 23 7 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10 39 14 2
108 18 181 Sensitivity 0.9512 Specificity 0.8852 PPV 0.7358 NPV
0.9818
TABLE-US-00030 TABLE 30 MCM7, p21waf1, and Cyclin E TP FP FN TN
Indeter. Totals NIL 0 2 0 57 13 72 ASC-US (No Lesion) 0 3 0 19 4 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 14 0 21 7 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 24 0 1 0 0 25 Cancer 10 0 0 0 0 10 38 19 3
97 24 181 Sensitivity 0.9268 Specificity 0.8362 PPV 0.6667 NPV
0.9700
TABLE-US-00031 TABLE 31 MCM7, p21waf1, and TOPO2A TP FP FN TN
Indeter. Totals NIL 0 2 0 54 16 72 ASC-US (No Lesion) 0 3 0 19 4 26
ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 14 0 18 10 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10 39 19 2
91 30 181 Sensitivity 0.9512 Specificity 0.8273 PPV 0.6724 NPV
0.9785
TABLE-US-00032 TABLE 32 MCM2, MCM7, Cyclin E, and p21waf1 TP FP FN
TN Indeter. Totals NIL 0 2 0 56 14 72 ASC-US (No Lesion) 0 3 0 18 5
26 ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 14 0 20 8 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 24 0 1 0 0 25 Cancer 10 0 0 0 0 10 38 19 3
94 27 181 Sensitivity 0.9268 Specificity 0.8319 PPV 0.6667 NPV
0.9691
TABLE-US-00033 TABLE 33 MCM2, MCM7, Cyclin E and TOPOIIA TP FP FN
TN Indeter. Totals NIL 0 0 0 63 9 72 ASC-US (No Lesion) 0 2 0 20 4
26 ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 13 0 21 8 42 LSIL
(HSIL) 4 0 2 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10 39 15 2
104 21 181 Sensitivity 0.9512 Specificity 0.8739 PPV 0.7222 NPV
0.9811
TABLE-US-00034 TABLE 34 MCM2, MCM7, Cyclin E, p21waf1, and TOPO2A
TP FP FN TN Indeter. Totals NIL 0 2 0 53 17 72 ASC-US (No Lesion) 0
3 0 18 5 26 ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0 14 0 18 10
42 LSIL (HSIL) 4 0 2 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0 0 0 0 10
39 19 2 89 32 181 Sensitivity 0.9512 Specificity 0.8241 PPV 0.6724
NPV 0.9780
TABLE-US-00035 TABLE 35 MCM2, MCM6, MCM7, TOPO2A, Cyclin E, and
p21waf1 TP FP FN TN Indeter. Totals NIL 0 2 0 52 18 72 ASC-US (No
Lesion) 0 4 0 18 4 26 ASC-US (Lesion) 0 0 0 0 0 0 LSIL (No HSIL) 0
18 0 16 8 42 LSIL (HSIL) 4 0 2 0 0 6 HSIL 25 0 0 0 0 25 Cancer 10 0
0 0 0 10 39 24 2 86 30 181 Sensitivity 0.9512 Specificity 0.7818
PPV 0.6190 NPV 0.9773
[0122] Data was compiled on 28 antibody cocktails, as described
above. Biomarker expression was analyzed using cocktails comprising
antibodies directed to 2, 3, 4, 5 or even all 6 of the biomarkers
of interest. Twenty-one of the 28 antibody cocktails showed
sensitivities greater than 92%. Four of the 28 cocktails produced
specificities above 90% with the lowest value at 78%. The highest
values were achieved with a combination of MCM2, TOPOIIA and Cyclin
E. This cocktail yielded a sensitivity of 93% along with a
specificity of 92%. It appears that a combination of at least 3
biomarkers should yield a sensitivity greater than 90%. It is
recognized that adjustments to the assay would further increase the
sensitivity and specificity of the assay.
Example 4
Detection of Biomarker Expression Using Antibody Cocktails
[0123] Antibody cocktails were prepared using various combinations
of antibodies directed to Cyclin E, MCM2, MCM6, MCM7, p21waf1, and
TOPO2a. The composition of each cocktail is listed in the table
below.
TABLE-US-00036 TABLE 36 Composition of Antibody Cocktails Cocktail
ID Biomarkers Cocktail 1 Cyclin E, MCM2, MCM7 Cocktail 2 Cyclin E,
MCM6, MCM7 Cocktail 3 Cyclin E, MCM7, p21waf1 Cocktail 4 Cyclin E,
MCM7, TOPO2a Cocktail 5 MCM2, MCM7, p21waf1 Cocktail 6 MCM6, MCM7,
p21waf1 Cocktail 7 MCM7, p21waf1, TOPO2a Cocktail 8 MCM2, MCM7,
TOPO2a Cocktail 9 MCM6, MCM7, TOPO2a Cocktail 10 MCM2, MCM6, MCM7
Cocktail 11 Cyclin E, MCM2, MCM6, MCM7, p21waf1, TOPO2a Cocktail 12
Cyclin E, MCM2, MCM7, p21waf1 Cocktail 13 MCM2 and MCM 7 Cocktail
14 MCM7 and p21waf1 Cocktail 15 MCM7 and Cyclin E Cocktail 16 MCM2
and p21waf1 Cocktail 17 Cyclin E and p21waf1 Cocktail 18 MCM2 and
Cyclin E Cocktail 19 MCM7 and TOPO2a Cocktail 20 MCM2 and TOPO2a
Cocktail 21 Cyclin E and TOPO2a Cocktail 22 p21waf1 and TOPO2a
[0124] Two sets of cervical cytology specimens were prepared by
pooling HSIL cases (HSIL pool) and NIL cases (NIL pool). Each
antibody cocktail was then tested on the HSIL pool and the NIL
pool. Biomarker antibodies were also tested individually as a
control. Slide preparation and automated immunocytochemistry were
performed as described in Example 2.
[0125] Slides were screened and reviewed by a cytotechnologist and
a pathologist. Specific staining of cells indicative of high-grade
cervical disease, staining of glandular cells, bacteria
cross-reactivity, and the location of cell staining were all
variables that were recorded during the screening process.
[0126] The immunocytochemistry results indicated an increase in
staining of cells indicative of high-grade cervical disease in the
HSIL pool with the biomarker antibody cocktails when compared to
the results obtained with detection of a single biomarker.
Additionally, there was no significant increase in background when
the number of antibodies in the cocktails increased from 2 to 3, 4
or 6. Furthermore, the various antibody cocktails did not show an
increase in background staining when tested on the NIL pool.
Example 5
Detection of Biomarker Overexpression in Cervical Samples Using
Immunocytochemistry
Slide Preparation and Pretreatment
[0127] Patient cervical samples were collected as described above
in Example 1. Slides comprising a monolayer of cervical cells were
prepared by the AutoPrep.RTM. System using "prep only" mode.
Prepared slides were immediately placed in 1.times. SureSlide.RTM.
Pretreatment Buffer (0.5% sodium laureth-13-carboxylate (Sandopan
LS) in deionized H.sub.20) for a minimum of 1 hour and a maximum of
72 hours. The pretreated slides were placed in a steamer at
95.degree. C. for 45 minutes without preheating. Slides were
removed from the steamer, allowed to cool at room temperature for
20 minutes, and then rinsed well in deionized water. Slides were
rinsed in TBST (TBS/Tween-20) twice at 2 minutes per rinse. The
slides were tapped to remove excess buffer and placed into a humid
chamber. Slides were subjected to manual or automated
immunocytochemistry, as described below.
Manual Immunocytochemistry
[0128] 200 .mu.l of peroxidase block reagent (0.03% hydrogen
peroxide) was applied to each slide to cover the cell deposition
area for a period of 5 minutes. The slides were then rinsed with
TBST three times at 2 minutes per rinse. Excess buffer was removed,
and the slides were placed into a humid chamber. 200 .mu.l of
protein block reagent (purified casein and surfactant) was applied
to each slide and incubated for 5 minutes. After the excess protein
block reagent was removed, the slides were placed in a humid
chamber.
[0129] 200 .mu.l of primary monoclonal antibody cocktail comprising
two mouse anti-human antibodies directed to MCM2 (clone 27C5.6 at
0.39 mg/ml, 1:800 dilution; clone 26H6.19 at 0.918 mg/ml, 1:10,000
dilution) and a third mouse anti-human antibody specific for Topo2A
(clone SWT3D1 at 100 .mu.g/ml, 1:10,000 dilution) was applied to
each slide to completely cover the cell deposition area. Slides
were incubated for 30 minutes and then rinsed with TBST three times
at 2 minutes per rinse. Excess buffer was removed, and the slides
were returned to the humid chamber. 200 .mu.l of mouse probe
reagent that binds to mouse monoclonal antibodies was applied as
above for 20 minutes. The slides were rinsed with TBST three times
at 2 minutes per rinse. Excess buffer was removed, and the slides
were again placed into the humid chamber.
[0130] 200 .mu.l of polymer reagent comprising a dextran polymer
conjugated with HRP and a secondary goat anti-mouse antibody that
binds to the mouse probe reagent was applied as above for 20
minutes and then the slides rinsed with TBST 3 times at 2 minutes
per rinse. After the excess buffer was removed, the slides were
returned to the humid chamber. 200 .mu.l of DAB substrate-chromogen
solution was applied as above for 5 minutes. The slides were rinsed
with deionized water for 5 minutes and then rinsed with TBST for 2
minutes with one change of buffer. Excess buffer was removed and
the slides were placed in a humid chamber as before. 200 .mu.l of
hematoxylin was added for 1 minute, followed by 3 rinses with
deionized water at 2 minutes per rinse. Excess deionized water was
removed, and the slides were placed into the humid chamber. 200
.mu.l of bluing agent (i.e., TBS, pH 7.4 with tween-20 and sodium
azide) was applied to each slide for 1 minute. The slides were then
rinsed in one change of TBST and 1 change of deionized water for 2
minutes each. The slides were then dehydrated, cleared,
coverslipped, and analyzed as described in Examples 1 and 2.
Automated Immunocytochemistry
[0131] The autostainer was programmed according to manufacturer's
instructions to include the following sequence of steps:
[0132] a. 2 buffer rinses (TBST)
[0133] b. 5 min peroxidase block
[0134] c. 2 buffer rinses (TBST)
[0135] d. 5 min protein block, blow
[0136] e. 30 min primary antibody cocktail incubation
[0137] f. 3 buffer rinses (TBST)
[0138] g. 20 min mouse probe reagent
[0139] h. 3 buffer rinses (TBST)
[0140] i. 20 min polymer-HRP
[0141] j. 3 buffer rinses (TBST)
[0142] k. 5 min DAB (1 drop of chromagen to 1 ml of buffer)
[0143] l. 3H.sub.2O rinses
[0144] m. 2 buffer rinses (TBST)
[0145] n. 1 min Mayer's hematoxylin
[0146] o. 3H.sub.2O rinses
[0147] p. 1 min bluing agent
[0148] q. 1 buffer rinse (TBST)
[0149] r. 1H.sub.2O rinse
[0150] The necessary staining and counterstaining reagents were
loaded onto the machine. The prepared and pretreated slides were
loaded onto the autostainer, and the above program was run. At the
end of the run, the slides were removed and rinsed briefly in tap
water. The slides were dehydrated, cleared, coverslipped, and
analyzed as described in Examples 1 and 2.
Results
TABLE-US-00037 [0151] TABLE 37 NIL Cases (n = 45) Pap Result NIL
Other Unsatisfactory 44 1 (ASC-US) 0 ICC Result Positive Negative
Unsatisfactory 0 44 1
TABLE-US-00038 TABLE 38 HSIL Cases (n = 45) Pap Result HSIL Other
Unsatisfactory 45 0 0 ICC Result Positive Negative Unsatisfactory
45 0 0
[0152] Of the 45 NIL cases tested, a review of the Pap stained
slides revealed one ASC-US case. The immunocytochemistry (ICC)
results for the NIL samples were negative, with one case deemed
unsatisfactory for evaluation. Regarding the HSIL cases, each of
the 45 cases was confirmed to be high-grade cervical disease based
upon the review of the Pap stained slides. Additionally, each of
the 45 HSIL cases was also positive in the ICC assay. The negative
control, i.e., a universal mouse IgG control applied to the SiHa
cell line control, produced negative results in the ICC assay. The
positive control, i.e., the primary antibody cocktail applied to
the SiHa cell line control, produced positive results in the ICC
assay.
Example 6
Combined Immunocytochemistry and Pap Staining Procedure
[0153] Patient cervical samples were collected as described above
in Example 1. Slides comprising a monolayer of cervical cells were
prepared and pretreated as indicated in Example 5. Each pretreated
slide was subjected to automated immunocytochemistry and Pap
staining, thereby permitting visualization of both biomarker
overexpression and cell morphology on a single slide.
Automated Immunocytochemistry
[0154] Automated immunocytochemistry was performed on each slide as
described above in Example 5. At the end of the staining program,
the slides were removed from the autostainer and rinsed in tap
water for 3-5 minutes. Each slide was then stained according to
conventional Pap staining methods, as described below.
Pap Staining Method
[0155] Following automated immunocytochemistry, each slide was
further stained with Pap stain. The slides were first rinsed in 95%
ethanol for 30 seconds. EA50 and Orange G were applied to half of
the slides for 3 minutes and to the remaining slides for 6 minutes.
All of the slides were then rinsed 2 times in 95% ethanol, 3 times
in 100% ethanol, and 3 times in xylene for 30 seconds per rinse.
The slides were then coverslipped with permanent mounting media and
analyzed as described above in Examples 1 and 2.
Results
[0156] A panel of 5 NIL and 5 HSIL cases were each subjected to 3
minutes or 6 minutes of staining with EA50 and Orange G in the Pap
staining method. Results indicated minimal difference between the 3
minute and the 6 minute staining protocols. The slides subjected to
3 minutes of Pap staining displayed slightly less intense staining.
Furthermore, the ICC positive staining HSIL cells were readily
observed with the Pap counterstain.
Example 7
Combined Immunocytochemistry and Pap Staining Procedure
Optimization of Pap Staining
[0157] The combined immunocytochemistry and Pap staining procedure
outlined in Example 6 was modified to optimize the Pap staining
parameters in order to maximize the contrast between the chromogen
(i.e., DAB) staining of the immunocytochemistry method and the
level of Pap staining.
[0158] Slides were prepared, pretreated, and subjected to automated
immunocytochemistry as described above in Example 6. The slides
were then stained with a conventional Pap stain essentially as
described in Example 6, with the following modifications.
Hematoxylin was tested using the Harris formulation along with
Myers formulation. EA/Orange G was applied for 3 minutes or 6
minutes. Additionally, there were 3 changes of 95% ethanol after
the EA/Orange G addition.
[0159] Slides received a determination of positive, negative, or
unsatisfactory based upon the immunocytochemistry staining.
Additionally, slides were evaluated morphologically for comparison
with the incoming Pap diagnosis.
Results
TABLE-US-00039 [0160] TABLE 39 Results of Combined
Immunocytochemistry and Pap Staining Method Incoming Pap ICC
Diagnosis Results Comments NIL Negative All cases confirmed as NIL.
n = 7 LSIL Negative 5 of the 6 LSIL cases did not have LSIL n = 6
cells on the slides. These cases were either NIL or ASC-US. HSIL
Positive All cases confirmed as HSIL. n = 6 Cancer Positive All
cases were squamous cell carcinoma. n = 4
[0161] The combined ICC and Pap staining procedure permitted both
morphological analysis and assessment of biomarker overexpression.
Additional experimentation will be required to further optimize the
method.
Example 8
Immunocytochemistry Kit for the Detection of Biomarker
Overexpression in Cervical Samples
I. Principles of the Procedure
[0162] An immunocytochemical test kit contains reagents required to
complete a three-step immunocytochemical staining procedure for
routinely prepared monolayer cervical specimens. Following
incubation with the monoclonal antibody cocktail, this kit employs
a ready-to-use visualization reagent based on dextran technology.
This reagent consists of a secondary goat anti-mouse antibody
molecule and horseradish peroxidase molecules linked to a dextran
polymer backbone. The enzymatic conversion of the subsequently
added chromogen results in the formation of a visible reaction
product at the antigen(s) site. The specimen is then counterstained
with hematoxylin, a bluing agent is applied, and the slide is
coverslipped. Results are interpreted using a light microscope. A
positive result indicative of cervical high-grade is achieved when
cells of interest are stained brown.
[0163] A gallery of potentially positive cells may be created using
automated imaging equipment. The gallery then can be reviewed to
determine a positive result or negative result.
[0164] The immunocytochemical test kit is applicable for both
manual and automated staining.
II. Reagents Provided
[0165] The following materials, sufficient for 75 monolayer
preparations using 200 .mu.L of the ready-to-use mouse monoclonal
cocktail per preparation, were included in the immunocytochemical
test kit:
TABLE-US-00040 TABLE 40 Immunocytochemistry Kit Components Vial No.
Quantity Description 1a 1 .times. 15 mL Peroxidase-Blocking
Reagent: Buffered hydrogen peroxide plus stabilizer and proprietary
components 1b 1 .times. 15 mL Protein Blocking Reagent: Purified
casein plus proprietary combination of proteins in modified PBS
with preservative and surfactant 2 1 .times. 15 mL Mouse Anti-Human
Antibody Cocktail: Ready-to-use monoclonal antibody cocktail
supplied in TRIS buffered solution with Tween 20, pH 7.4. Contains
0.39 mg/mL MCM2 mAb clone 27C5.6 (1:800 dilution), 0.918 mg/mL MCM2
mAb clone 26H6.19 (1:10,000 dilution), 100 .mu.g/mL Topo2a mAb
clone SWT3D1 (1:10,000 dilution), stabilizing proteins and
anti-microbial agent. 3a 1 .times. 15 mL Mouse Probe Reagent: Binds
to mouse monoclonal antibodies 3b 1 .times. 15 mL Polymer Reagent:
Polymer conjugated with horseradish peroxidase that binds to Mouse
Probe Reagent 4a 1 .times. 18 mL DAB Substrate Buffer: Substrate
buffer used in the preparation of the DAB Chromogen 4b 1 .times. 1
mL DAB Chromogen: 3,3'-diaminobenzidine chromogen solution 5 1
.times. 18 mL Hematoxylin Counterstain: aqueous based Mayers
Hematoxylin 6 1 .times. 18 mL Bluing Agent: Tris buffered saline,
pH 7.4 with Tween 20 and 0.09% NaN.sub.3
[0166] The following materials and reagents were required to
perform the immunocytochemistry methods but were not supplied in
the kit: [0167] Absorbent Wipes [0168] SiHa Cell Line (TriPath
Imaging, Inc.) [0169] Deionized or Distilled Water [0170] Ethanol
(95% and 100%) [0171] Glass Coverslips [0172] Gloves [0173] Humid
Chamber [0174] Light Microscope (10.times., 20.times., 40.times.
objectives) [0175] Mounting Media [0176] Pipettes and Pipette Tips
(capable of delivering 20 .mu.l, 200 .mu.l and 1000 .mu.l volumes)
[0177] SureSlide Preparation Buffer (TriPath Imaging,
Inc.)--Pretreatment Buffer (0.5% sodium laureth-13-carboxylate
(Sandopan LS) in deionized H.sub.2O) [0178] Staining Jars or Baths
[0179] Timer (capable of 1-60 minute intervals) [0180] Tris
Buffered Saline (TBS) [0181] Tween 20 [0182] Universal Mouse IgG
Negative Control [0183] Vortexer [0184] Xylene or Xylene
Substitutes [0185] Steamer/waterbath
III. Instructions for Use
Specimen Preparation
[0186] The following steps were followed for the preparation of
cervical samples: [0187] Consult the Operator's Manual for the
SurePath PrepStain System.TM. for the preparation of slides from
residual specimens. [0188] Add 8 mL of SurePath.TM. preservative
fluid to the residual sample in the SurePath.TM. vial (approx. 2
mLs). The diluted sample is processed on the PrepMate.TM. using the
standard technique and on the PrepStain.TM. using the GYN version
1.1, Slide Preparation. [0189] Prepared slides are immediately
placed into the pretreatment buffer for a minimum of 1 hour with a
maximum of 72 hours prior to immunostaining. [0190] Epitope
retrieval must be used for optimal kit performance. This procedure
involves soaking prepared slides in the pretreatment buffer for a
minimum of 1 hour at room temperature followed by heating slides in
the pretreatment buffer to 95.degree. C. Slides are held at
95.degree. C. for 15 minutes and allowed to cool down at room
temperature for 20 minutes. The use of a calibrated waterbath or
vegetable steamer capable of maintaining the required temperature
is recommended. Laboratories located at higher elevations should
determine the best method of maintaining the required
temperature.
[0191] The staining procedure is initiated immediately following
epitope retrieval and cool down. Deviations from the described
procedure may affect results.
Reagent Preparation
[0192] The following reagents were prepared prior to staining:
Tris Buffered Saline with 0.05% Tween 20 (TBST) [0193] Prepare TBS
according to manufacturer's specifications. [0194] Add Tween 20 to
a final concentration of 0.05%. [0195] Store at room temperature if
used within one week. [0196] Unused solution may be stored at
2-8.degree. C. for 3 months. [0197] Solution is clear and
colorless. Discard diluted solution if cloudy in appearance.
Substrate-Chromogen Solution (Dab) (Volume Sufficient for 5
Slides)
[0197] [0198] Transfer 1 mL of DAB Buffered Substrate to a test
tube. [0199] Add one drop (20-30 uL) of DAB+ Chromogen. Mix
thoroughly and apply to slides with a pipette. [0200] Prepare
Substrate-Chromogen solution fresh daily. [0201] Any precipitate
developing in the solution does not affect staining quality.
IV Staining Protocol (Performed at Room Temperature, 20-25.degree.
C.)
[0202] The following steps were performed for immunostaining of the
cervical cytology samples:
Staining Procedural Notes
[0203] The user should read these instructions carefully and become
familiar with all components prior to use. [0204] All reagents are
equilibrated to room temperature (20-25.degree. C.) prior to
immunostaining. All incubations are performed at room temperature.
[0205] Do not allow slides to dry out during the staining
procedure. Dried cellular preparations may display increased
non-specific staining. Cover slides exposed to drafts. Slides
should be placed in a humid chamber for prolonged incubations.
Epitope Retrieval
[0205] [0206] Place the prepared slides in the pretreatment buffer
for a minimum of 1 hour to a maximum of 72 hours. [0207] Incubate
for 15 minutes at 95.degree. C. [0208] Remove the entire coplin jar
with slides from the waterbath or steamer and allow slides to cool
in the buffer for 20 minutes. [0209] Rinse the slides with diH2O
and transfer to a TBST bath.
Peroxidase Blocking
[0209] [0210] Tap off excess buffer. [0211] Load slides into
prepared humidity chamber (filled with water moistened paper towels
or gauze). [0212] Apply 200 .mu.L Peroxidase Block reagent to cover
the cell deposition area. [0213] Incubate 5 minutes (.+-.1 minute).
[0214] Rinse slides in TBST, 3 changes, 2 minutes each.
Protein Block
[0214] [0215] Tap off excess buffer. [0216] Load the slides into
the prepared humidity chamber (filled with water moistened paper
towels or gauze). [0217] Apply 200 .mu.L of Protein Block to
completely cover cell deposition area. [0218] Incubate 5 minutes
(.+-.1 minute). [0219] Do not rinse slides.
Primary Antibody Cocktail
[0219] [0220] Tap off excess Protein Block. [0221] Load the slides
into the prepared humidity chamber (filled with water moistened
paper towels or gauze). [0222] Apply 200 .mu.L primary antibody
cocktail (to completely cover cell deposition area. [0223] Incubate
30 minutes at room temperature. [0224] Rinse each slide
individually with TBST using a wash bottle (do not focus the flow
directly on the cell deposition area). Load slides into a slide
rack. [0225] Rinse slides in TBST, 3 changes, 2 minutes each.
Detection Chemistry
[0225] [0226] Tap off excess buffer. [0227] Load slides into
prepared humidity chamber (filled with water moistened paper towels
or gauze). [0228] Apply 200 .mu.L Mouse Probe to completely cover
cell deposition area. [0229] Incubate 20 minutes (.+-.1 minute).
[0230] Rinse slides in TBST, 3 changes, 2 minutes each. [0231] Tap
off excess buffer. [0232] Load slides into prepared humidity
chamber (filled with water moistened paper towels or gauze). [0233]
Apply 200 .mu.L of Polymer to cover cell deposition area. [0234]
Incubate for 20 minutes (.+-.1 minute). [0235] Rinse slides in TBST
bath, 3 changes, 2 minutes each. [0236] Tap off excess buffer.
[0237] Load the slides into the prepared humidity chamber (filled
with water moistened paper towels or gauze). [0238] Apply 200 .mu.L
of DAB working solution to completely cover cell deposition area.
[0239] Incubate for 5 minutes (.+-.1 minute). [0240] Rinse slides
for 5 minutes in diH2O for 5 minutes.
Counterstain
[0240] [0241] Rinse slides in TBST, 1 change for 2 minutes. [0242]
Load slides into prepared humidity chamber (filled with water
moistened paper towels or gauze). [0243] Apply 200 .mu.L of
hematoxylin to completely cover cell deposition area. [0244]
Incubate for 1 minute (+10 seconds). [0245] Rinse slides for 3
minutes in running H2O. [0246] Load slides into prepared humidity
chamber (filled with water moistened paper towels or gauze). [0247]
Blue slides by applying 200 .mu.L Bluing Agent for 1 minute (+10
seconds). [0248] Repeat running water rinse for 1 minute.
Mounting
[0248] [0249] Immerse slides in 95% ethanol, 1 minute or 25 dips.
[0250] Immerse slides in absolute alcohol, 4 changes, 1 minute each
or 25 dips. [0251] Clear with xylene, 3 changes, 1 minute each or
25 dips. [0252] Coverslip slides with non-aqueous, permanent
mounting media using glass coverslips.
V. Quality Control
[0253] The following quality control issues were considered when
using the immunocytochemistry kit described in this example:
[0254] Variability in results is often derived from differences in
specimen handling and changes in test procedures. Consult the
proposed quality control guidelines of the NCCLS Quality Assurance
for Immunocytochemistry for additional information.
[0255] Control Cell Line is available from TriPath Imaging, Inc.
Each vial contains a cervical cancer cell line, which is processed
in a similar manner as the clinical specimens. Two slides should be
stained in each staining procedure. The evaluation of the control
slide cell line indicates the validity of the staining run.
VI. Interpretation of Staining
Control Slides:
[0256] The control slide stained with the immunocytochemical test
kit were examined first to ascertain that all reagents functioned
properly. The presence of a brown (3,3'-diaminobenzidine
tetrahydrochloride, DAB) reaction product in the nuclei of the
cells were indicative of positive reactivity.
Patient Specimens:
[0257] Slide evaluation was performed by a cytotechnologist or
pathologist using a light microscope. Cells were reviewed manually
or electronically stored in an image gallery derived from a light
microscope.
[0258] Approximately 1610 cervical samples representing various
diagnoses were collected. The following table indicates the number
of samples analyzed using the immunocytochemistry kit within each
diagnosis group, as determined by conventional Pap staining or
biopsy.
TABLE-US-00041 TABLE 41 Patient Specimens within Each Diagnosis
Group (Pap Staining) Cytology Results Number % NIL 671 41.7% LSIL
395 24.53% ASCUS 349 21.68% HSIL 150 9.32% ASC-H 38 2.36% AGUS 6
0.37% SCC 1 0.06% Total 1610
TABLE-US-00042 TABLE 42 Patient Specimens within Each Diagnosis
Group (Biopsy) Biopsy Results Number % NIL 968 60.20% CIN1 369
22.95% CIN2 140 8.71% CIN3 131 8.15% Missing 2 Total 1610
Slide Scoring Guide
[0259] The following procedure was followed for the scoring of all
slides analyzed by the immunocytochemistry methods described in
this example:
Step 1: Is it an Adequate Specimen?
[0260] The Bethesda System for Reporting Cervical Cytology (second
edition) states, "An adequate liquid-based preparation should have
an estimated minimum of at least 5000
well-visualized/well-preserved squamous cells." These same criteria
were applied when evaluating all of the slides. However, as with a
routine Pap preparation, any specimen with abnormal cells, which
are exhibiting a positive molecular reaction, was, by definition,
satisfactory for evaluation. If the answer to this step was "yes",
the cytotechnologist proceeded to the next step; if the answer was
"no," the result was Unsatisfactory for Evaluation.
Step 2: Is there Moderate to Intense Brown Nuclear Staining in
Epithelial Cells?
[0261] The detection chemicals used in the immunocytochemistry kit
of this example (e.g., SureDetect Detection Chemistry Kit) stains
dysplastic nuclei associated with .gtoreq.CIN 2 with a brown
chromagen, DAB. To answer "yes" to this step, samples were analyzed
for brown staining that was easily visualized. If just a faint
amount, or "blush," of brown was seen, this was not enough to
warrant a rendering of positive. If no brown nuclear stain was
seen, this was deemed a negative test result. If there was adequate
brown stain, the analysis proceeded to the next step.
Step 3: Is this a Squamous (or Glandular) Cell with Brown Nuclear
Staining and is the Cell .gtoreq.ASC (AGC)?
[0262] Using the same morphological criteria outlined in The
Bethesda System for Reporting Cervical Cytology (2nd Ed.) ("TBS"),
it was determined if the squamous cell containing the brown nucleus
was .gtoreq.ASC (atypical squamous cells). This would include
ASC-US, ASC-H, LSIL, HSIL, and cancer. If the cell was glandular in
appearance, the TBS criteria for determining if a cell is
.gtoreq.AGC (atypical glandular cells) applied. This would include
endocervical AGC, endometrial AGC, AIS, and adenocarcinoma. If the
cell was considered to be .gtoreq.ASC (or .gtoreq.AGC) than this
would result in a positive test result. If the cells in question
were consistent with NILM (negative for intraepithelial lesion or
malignancy) this would be a negative test result.
VII. Results
[0263] 27 cases that were originally classified as NIL by
conventional Pap staining methods stained positive in the
immunocytochemistry test. Of these 27 cases, 7 were classified as
HSIL, 10 as ASC-H, 3 as ASC-US, and 3 as indeterminate upon review
by aboard certified pathologist. The 7 HSIL cases are considered
high-grade cervical disease. These 27 cases were identified by
positive immunostaining in the immocytochemistry assay, thereby
indicating the value of the methods disclosed herein for
identifying patients misclassified as NIL by Pap staining.
[0264] Biopsy results were not obtained for all NIL specimens.
Estimates of sensitivity and positive predictive value (PPV) for
the immunocytochemistry method described in this example were
calculated based on comparison with the "gold standard" biopsy
results. Single biopsy has limitations as a gold standard. PPV for
the ICC assay will improve by serial monitoring of the patient or
utilizing a more aggressive surgical endpoint such as loop
electrosurgical excision procedure or cone biopsy. Single biopsy is
known to have a false negative result for disease of at least 31%.
See Elit et al. (2004) J. Lower Genital Tract Disease
8(3):181-187.
TABLE-US-00043 TABLE 43 Estimated sensitivity and positive
predictive value of ICC test based on the biopsy results ASC-H
ASCUS LSIL HSIL .gtoreq.ASCUS Sensitivity 76.5% 92.6% 97.7% 98.5%
96.2% (52.7%, 90.4%)* (76.6%, 97.9%) (92.1%, 99.4%) (94.6%, 99.6%)
(93.1%, 97.9%) PPV 59.1% 26.0% 31.0% 90.1% 46.9% (38.7%, 76.7%)
(18.3%, 35.6%) (25.9%, 36.7%) (84.1%, 94.0%) (42.8%, 51.2%) *(95%
confidence interval)
[0265] The sensitivity and PPV of the immunocytochemistry method
was also compared to those obtained with conventional Pap staining.
Two clinical endpoints for Pap staining (i.e., .gtoreq.LSIL and
.gtoreq.HSIL) were used. Again, the standard for all calculations
was the biopsy result.
TABLE-US-00044 TABLE 44 Comparison of Pap Test and
Immunocytochemistry Method .gtoreq.LSIL .gtoreq.HSIL (with Pap
test) (with Pap test) .gtoreq.ASCUS (with ICC) Sensitivity 76.5%
92.6% 97.7% (52.7%, 90.4%)* (76.6%, 97.9%) (92.1%, 99.4%) PPV 59.1%
26.0% 31.0% (38.7%, 76.7%) (18.3%, 35.6%) (25.9%, 36.7%) *(95%
confidence interval)
[0266] The results presented in Table 42 indicate that the
immunocytochemistry method detected more high-grade cervical
disease samples, while maintaining a high PPV.
[0267] There were 14 false negatives in this study using the
immunocytochemistry kit. HPV testing was conducted on 13 of the 14
patient samples. No remaining sample was available for one of the
false negative patients.
[0268] Genomic DNA was isolated from the cervical cytology samples
using the NucleoSpin.RTM. Tissue DNA Kit (BD Clontech, Cat#635967).
For quality control purposes, PCR analysis of beta-globin, a
housekeeping gene, was performed.
[0269] HPV L1 gene amplification was performed as described in the
art by both conventional L1 PCR with MY09/11 primer set and by
nested PCR with MY09/11 and GP5+/6+ primer sets to improve
detection sensitivity. DNA sequencing of the L1 amplicon was
further performed to identify the type(s) of HPV(s) present.
[0270] Good quality genomic DNA was isolated from 10 out of the 13
clinical cytology samples. 3 samples had poor quality genomic DNA
as indicated by beta-globin PCR analysis. HPV DNA was either
undetectable or negative in 10 of the 13 samples using both
conventional L1 PCR (with MY09/11 primers) and nested L1 PCR (with
MY09/11 and GP5+/6+ primers). This data indicates that a sampling
error occurred for a majority of the false negative samples, given
that HPV is positive for high-grade cervical disease (sensitivity
of >92%).
Example 9
MCM6 Antibody Selection
Polydoma Screening
[0271] Polydomas provided in multi-well tissue culture plates were
screened to identify MCM 6 biomarker-specific antibodies that
possess the desired traits of sensitivity and specificity. A tissue
microarray comprising multiple normal (i.e., no CIN), CINIII,
squamous cell carcinoma, and adenocarcinoma samples on a single
slide was generated. Undiluted supernatants from each well
containing a polydoma were assayed for positive staining of the
tissue microarray. Background, i.e. non-specific binding, was
essentially ignored at this stage. Eleven of the 35 polydomas
tested produced positive staining results and were selected for
further analysis.
[0272] In order to determine the specificity of the selected
polydomas, the staining patterns obtained with the polydoma
supernatants were compared with those obtained with a commercially
available MCM 6 antibody (BD Transduction Laboratories). The
staining patterns obtained with the polydoma supernatants appeared
to be more specific than those observed with the commercial MCM 6
antibody (FIG. 17).
[0273] The 11 selected polydomas were then subjected to a limiting
dilution process. Thirty limiting dilutions, resulting from the
supernatants of the selected polydomas, were assayed for positive
staining of a tissue microarray comprising multiple normal (i.e.,
no CIN), CINIII, squamous cell carcinoma, and adenocarcinoma
samples. Two limiting dilution clones, 9D4.3 and 9D4.4, were
selected as the best supernatants based on positive staining of
abnormal and cancerous cervical tissue samples. Varying dilutions
of these clones were then tested for their reactivity to NIL, LSIL,
HSIL tissue and pooled liquid based cytology samples. Clone 9D4.3
at a 1:100 dilution produced the maximal signal to noise ratio and
was selected for further characterization.
Characterization of MCM 6, clone 9D4.3
[0274] In order to further characterize clone 9D4.3, the clone was
assayed for positive staining of 40 liquid based cytology samples
selected from the following diagnostic categories: NIL (7), LSIL
(10), HSIL (18), and cervical carcinoma (5). Slides were prepared
using the PrepStain.TM. slide processor (TriPath Imaging, Inc.) for
each of the 40 samples. Two slides per sample were each stained
with an MCM 2 antibody (Dako) and clone 9D4.3. The remaining slides
were used for PAP staining or as a negative control.
[0275] To prepare slides, each sample was centrifuged for 2 minutes
at 200.times.g to form a pellet, and the supernatant was decanted.
2 mL of deionized water was added to each sample, and the samples
were vortexed and then centrifuged for 5 minutes at 600.times.g.
After decanting the supernatant, an additional 700 .mu.L of tris
buffered water was added. Finally the samples were loaded onto the
PrepStain.TM. slide processor (Tripath Imaging, Inc.), version 1.1,
and the Transfer Only program was run.
[0276] All slides were held in 95% ETOH for at least 24 hours and
no more than 3 days after preparation. Antigen retrieval for MCM2
was achieved by placing the slides in a 1.times. Target Retrieval
Solution pH 6.0 (DAKO S1699)/dH2O bath, preheated to 95.degree. C.,
for 25 minutes in a steamer. For MCM6, antigen accessibility was
achieved by placing the slides in a 1.times. Tris pH 9.5 buffer
(Biocare)/dH2O bath, preheated to 95.degree. C., for 25 minutes in
a steamer. After steaming, all slides were allowed to cool at room
temperature for 20 minutes.
[0277] Slides were stained by immunocytochemistry using the DAKO
Universal Autostainer as described in Example 1, "Automated
Immunocytochemistry." The slides were screened and evaluated by an
experienced cytotechnologist for a morphological determination of
diagnostic category. The samples were assessed for marker staining
intensity (0-3), percentage of positive-staining cells, and the
location of the marker staining (nuclear, cytoplasmic, membrane, or
a combination). Intensity of cell staining was given a score of
0-3. Cells scoring .gtoreq.1.5 were counted. Mature
normal-appearing squamous cells and normal-appearing glandular
cells were not counted as positive when staining brown. However,
squamous metaplastic cells were counted as positive along with
abnormal cells. The immunocytochemistry slides were then given a
designation of TN (true negative), FN (false negative), TP (true
positive), or FP (false positive).
TABLE-US-00045 TABLE 45 Clone 9D4.3 (MCM6) TP FP FN TN Indet. Total
NIL 0 0 0 1 0 1 LSIL 0 1 0 9 0 10 HSIL 23 0 1 0 0 24 Cancer 5 0 0 0
0 5 28 1 1 10 0 40 Sensitivity 0.9655 Specificity 0.9091 PPP 0.9655
NPP 0.9091
TABLE-US-00046 TABLE 46 MCM2 TP FP FN TN Indet. Total NIL 0 0 0 1 0
1 LSIL 0 1 0 9 0 10 HSIL 23 0 1 0 0 24 Cancer 4 0 1 0 0 5 27 1 2 10
0 40 Sensitivity 0.9310 Specificity 0.9091 PPP 0.9643 NPP 0.8333
Calculations Used Sensitivity = TP/(TP + FN) Specificity = TN/(FP +
TN) Positive Predictive Power (PPP) = TP/(TP + FP) Negative
Predictive Power (NPP) = TN/(FN + TN)
[0278] The sensitivity and specificity for clone 9D4.3 was
comparable to that obtained with the commercially available MCM2
antibody. One NIL case was negative for both antibodies. 9 of 10
LSIL cases were negative with clone 9D4.3 and the commercial MCM2
antibody. 23 of 24 HSIL cases were positive with clone 9D4.3 and
the commercial MCM2 antibody. With the cervical cancer samples, 5
of 5 were positive with clone 9D4.3, and 4 of 5 were positive with
the MCM 2 antibody.
Purification of MCM 6, Clone 9D4.3
[0279] Because of its sensitivity, specificity, and the
presentation of a nuclear staining pattern, clone 9D4.3 was
purified for further analysis. Purified antibody was obtained using
Streamline rProteinA (Amersham Biosciences) affinity adsorption
chromatography, in accordance with standard methods. The resulting
antibody solution was then tested for reactivity against HSIL
liquid-based cervical cytology pools at various dilutions between
1:500 and 1:6000. Signal was evident out to a titer of 1:6000.
Example 10
Real-Time PCR Detection of Biomarkers in Clinical Tissue
Samples
[0280] TaqMan.RTM. real-time PCR was performed with the ABI Prism
7700 Sequence Detection System (Applied Biosystems). The primers
and probes were designed with the aid of the Primer Express.TM.
program, version 1.5 (Applied Biosystems), for specific
amplification of the targeted cervical biomarkers (i.e., MCM7,
p21.sup.waf1, p14.sup.ARF/p16, cyclin E1, and cyclin E2) in this
study. The sequence information for primers and probes is shown
below:
TABLE-US-00047 MCM7: Primer Name: MCM7_T1T3-F Sequence:
CTCTGAGCCCGCCAAGC (SEQ ID NO: 25) Primer Name: MCM7_T1T3-R
Sequence: TGTAAGAACTTCTTAACCTTTTCCTTCTCTA (SEQ ID NO: 26) Probe
Name: MCM7_T1T3-Probe Sequence: CCCTCGGCAGCGATGGCACT (SEQ ID NO:
27) Primer Name: MCM7_T2T4-F Sequence: GAGGAATCCCGAGCTGTGAA (SEQ ID
NO: 28) Primer Name: MCM7_T2T4-R Sequence: CCCGCTCCCGCCAT (SEQ ID
NO: 29) Probe Name: MCM7_T2T4-Probe Sequence:
CCCATGTGCTTCTTTGTTTACTAAGAGCGGAA (SEQ ID NO: 30) Primer Name:
MCM7_T2-F Sequence: GTCCGAAGCCCCCAGAA (SEQ ID NO: 31) Primer Name:
MCM7_T2-R Sequence: CCCGACAGAGACCACTCACA (SEQ ID NO: 32) Probe
Name: MCM7_T2-Probe Sequence: CAGTACCCTGCTGAACTCATGCGCA (SEQ ID NO:
33) Primer Name: MCM7_T3T4-F Sequence: CGCTACGCGAAGCTCTTTG (SEQ ID
NO: 34) Primer Name: MCM7_T3T4-R Sequence: CCTTTGTTTGCCATTGTTCTCTAA
(SEQ ID NO: 35) Probe Name: MCM7_T3T4-Probe Sequence:
TGCCGTACAAGAGCTGCTGCCTCA (SEQ ID NO: 36) p21.sup.waf1: Primer Name:
p21T1T2-F Sequence: CAAACGCCGGCTGATCTT (SEQ ID NO: 37) Primer Name:
p21T1T2-R Sequence: CCAGGACTGCAGGCTTCCT (SEQ ID NO: 38) Probe Name:
p21T1T2-Probe Sequence: CAAGAGGAAGCCCTAATCCGCCCA (SEQ ID NO: 39)
Primer Name: p21T2-F Sequence: GAGCGGCGGCAGACAA (SEQ ID NO: 40)
Primer Name: p21T2-R Sequence: CCGCGAACACGCATCCT (SEQ ID NO: 41)
Probe Name: p21T2-Probe Sequence: CCCAGAGCCGAGCCAAGCGTG (SEQ ID NO:
42) Primer Name: p21T3-F Sequence: TGGAGACTCTCAGGGTCGAAA (SEQ ID
NO: 43) Primer Name: p21T3-R Sequence: TCCAGTCTGGCCAACAGAGTT (SEQ
ID NO: 44) Probe Name: p21T3-Probe Sequence: CGGCGGCAGACCAGCATGAC
(SEQ ID NO: 45) p14.sup.ARF/p16: Primer Name: p16T4-F Sequence: GCC
CTC GTG CTG ATG CTA CT (SEQ ID NO: 46) Primer Name: p16T4-R
Sequence: TCA TCA TGA CCT GGT CTT CTA GGA (SEQ ID NO: 47) Probe
Name: p16T4-Probe Sequence: AGC GTC TAG GGC AGC AGC CGC (SEQ ID NO:
48) Primer Name: p16T1-F Sequence: TGCCCAACGCACCGA (SEQ ID NO: 49)
Primer Name: p16T1-R Sequence: GGGCGCTGCCCATCA (SEQ ID NO: 50)
Probe Name: p16T1-Probe Sequence: TCGGAGGCCGATCCAGGTCATG (SEQ ID
NO: 51) Primer Name: p16T2-F Sequence: AAGCTTCCTTTCCGTCATGC (SEQ ID
NO: 52) Primer Name: p16T2-R Sequence: CATGACCTGCCAGAGAGAACAG (SEQ
ID NO: 53) Probe Name: p16T2-Probe Sequence: CCCCCACCCTGGCTCTGACCA
(SEQ ID NO: 54) Primer Name: p16T3-F Sequence:
GGAAACCAAGGAAGAGGAATGAG (SEQ ID NO: 55) Primer Name: p16T3-R
Sequence: TGTTCCCCCCTTCAGATCTTCT (SEQ ID NO: 56) Probe Name:
p16T3-Probe Sequence: ACGCGCGTACAGATCTCTCGAATGCT (SEQ ID NO: 57)
Primer Name: p16Universal-F Sequence: CACGCCCTAAGCGCACAT (SEQ ID
NO: 58) Primer Name: p16 Universal-R Sequence:
CCTAGTTCACAAAATGCTTGTCATG (SEQ ID NO: 59) Probe Name: p16
Universal-Probe Sequence: TTTCTTGCGAGCCTCGCAGCCTC (SEQ ID NO: 60)
Cyclin E1: Primer Name: CCNE1T1T2-F Sequence:
AAAGAAGATGATGACCGGGTTTAC (SEQ ID NO: 61) Primer Name: CCNE1T1T2-R
Sequence: GAGCCTCTGGATGGTGCAA (SEQ ID NO: 62) Probe Name:
CCNE1T1T2-P Sequence: CAAACTCAACGTGCAAGCCTCGGA (SEQ ID NO: 63)
Primer Name: CCNE1T1-F Sequence: TCCGCCGCGGACAA (SEQ ID NO: 64)
Primer Name: CCNE1T1-R Sequence: CATGGTGTCCCGCTCCTT (SEQ ID NO: 65)
Probe Name: CCNE1T1-Probe Sequence: ACCCTGGCCTCAGGCCGGAG (SEQ ID
NO: 66) Cyclin E2 Primer Name: CCNE2T1T2-F Sequence:
GGAATTGTTGGCCACCTGTATT (SEQ ID NO: 67) Primer Name: CCNE2T1T2-R
Sequence: CTGGAGAAATCACTTGTTCCTATTTCT (SEQ ID NO: 68) TaqMan Probe
Name: CCNE2T1T2-P Sequence: CAGTCCTTGCATTATCATTGAAACACCTCACA (SEQ
ID NO: 69) Primer Name: CCNE2T1T3-F Sequence:
TCAACTCATTGGAATTACCTCATTATTC (SEQ ID NO: 70) Primer Name:
CCNE2T1T3-R Sequence: ACCATCAGTGACGTAAGCAAACTC (SEQ ID NO: 71)
TaqMan Probe Name: CCNE2T1T3-P Sequence:
CCAAACTTGAGGAAATCTATGCTCCTAAACTCCA (SEQ ID NO: 72) Primer Name:
CCNE2T2-F Sequence: TTTTGAAGTTCTGCATTCTGACTTG (SEQ ID NO: 73)
Primer Name: CCNE2T2-R Sequence: ACCATCAGTGACGTAAGCAAGATAA (SEQ ID
NO: 74) TaqMan Probe Name: CCNE2T2-P Sequence:
AACCACAGATGAGGTCCATACTTCTAGACTGGCT (SEQ ID NO: 75)
[0281] The probes were labeled with a fluorescent dye FAM
(6-carboxyfluorescein) on the 5' base, and a quenching dye TAMRA
(6-carboxytetramethylrhodamine) on the 3' base. The sizes of the
amplicons were around 100 bp. 18S Ribosomal RNA was utilized as an
endogenous control. An 18S rRNA probe was labeled with a
fluorescent dye VIC.TM.. Pre-developed 18S rRNA primer/probe
mixture was purchased from Applied Biosystems. 5 .mu.g of total RNA
extracted from normal (N) or cancerous (T) cervical tissues was
quantitatively converted to the single-stranded cDNA form with
random hexamers by using the High-Capacity cDNA Archive Kit
(Applied Biosystems). The following reaction reagents were
prepared:
[0282] 20.times. Master Mix of Primers/Probe (in 200 .mu.l)
TABLE-US-00048 180 .mu.M Forward primer 20 .mu.l 180 .mu.M Reverse
primer 20 .mu.l 100 .mu.M TaqMan probe 10 .mu.l H.sub.2O 150
.mu.l
[0283] Final Reaction Mix (25 .mu.l/Well)
TABLE-US-00049 20X master mix of primers/probe 1.25 .mu.l 2X TaqMan
Universal PCR master mix (P/N: 4304437) 12.5 .mu.l cDNA template
5.0 .mu.l H.sub.2O 6.25 .mu.l
[0284] 20.times. TaqMan Universal PCR Master Mix was purchased from
Applied Biosystems. The final primer and probe concentrations, in a
total volume of 25 .mu.l, were 0.9 .mu.M and 0.25 .mu.M,
respectively. 10 ng of total RNA was applied to each well. The
amplification conditions were 2 minutes at 50.degree. C., 10
minutes at 95.degree. C., and a two-step cycle of 95.degree. C. for
15 seconds and 60.degree. C. for 60 seconds for a total of 40
cycles. At least three no-template control reaction mixtures were
included in each run. All experiments were performed in
triplicate.
[0285] At the end of each reaction, the recorded fluorescence
intensity is used for the following calculations: Rn.sup.+ is the
Rn.sup.- value of a reaction containing all components. Rn.sup.- is
the Rn value of an unreacted sample (baseline value or the value
detected in NTC). .DELTA.Rn is the difference between Rn.sup.+ and
Rn.sup.- and is an indicator of the magnitude of the signal
generated by the PCR. The comparative C.sub.T method, which uses no
known amount of standard but compares the relative amount of the
target sequence to any reference value chosen (e.g., 18S rRNA), was
used in this study. The TaqMan.RTM. Human Endogenous Control Plate
protocol was used to convert raw data for real-time PCR data
analysis.
Results
[0286] The results obtained with each biomarker and with the
specific primers are listed below in tabular form. Results obtained
with normal cervical tissue samples (i.e., NIL) are designated N;
those obtained with cervical cancer tissues are labeled T.
TABLE-US-00050 TABLE 47 MCM7 TaqMan .RTM. Results Sample T2 T5 T1T3
T2T4 T3T4 CV01-T 4 0.04 29.9 4.5 1.4 CV03-T 5.7 0.02 36.8 6.1 2.6
CV05-T 4.13 0.08 17.3 1.35 3.68 CV07-T 2.6 0.06 18.77 0.88 3.27
CV09-T 4.96 0.08 15.01 3.69 3.22 CV11-T 5.9 0.01 7.37 3.08 1.75
CV13-T 6.74 0.04 19.74 4.55 4.11 CV15-T 3.04 0.05 3.65 3.43 1.25
CV17-T 5.21 0.02 20.07 2.74 1.56 CV19-T 3.34 0.09 21.17 2.88 6
CV21-T 6.7 0.08 10.64 4.75 4.59 CV23-T 7.08 0.33 32.17 5.6 4.25
CV25-T 4.87 0.03 18.11 4.58 4.51 CV27-T 4.24 0.03 36.25 4.6 2.82
MEAN 4.89 0.07 20.50 3.77 3.22 MEDIAN 4.89 0.05 19.74 3.77 3.22 STD
1.32 0.07 9.46 1.39 1.32 CV02-N 2.5 0.02 10.6 2.6 1.1 CV04-N 4.6
0.02 7.1 4.8 2.4 CV06-N 1.75 0.01 2.14 1.36 2.63 CV08-N 1.35 0.01
4.8 1.71 1.54 CV10-N 5.6 0.03 5.07 5.12 1.85 CV12-N 5.68 0.02 7.34
3.19 2.29 CV16-N 4.35 0.08 3.72 2.75 1.78 CV18-N 3.98 0.01 4.74
3.63 1.7 CV20-N 2.03 0.03 5.42 1.4 2.78 CV22-N 2.66 0.02 4.33 2.26
2.42 CV24-N 4.88 0.09 9.03 1.53 2.77 CV28-N 2.71 0.01 10.38 1.36
1.7 MEAN 3.51 0.03 6.22 2.64 2.08 MEDIAN 3.51 0.02 5.42 2.60 2.08
STD 1.40 0.03 2.48 1.21 0.50
TABLE-US-00051 TABLE 48 p21.sup.waf1TaqMan .RTM. Results Patients
T1T2 T2 T3 Pt01-T 23.33 0.06 0.00 Pt02-T 14.66 0.01 0.00 Pt03-T
11.86 0.00 0.00 Pt04-T 27.04 0.01 0.00 Pt05-T 14.72 0.00 0.00
Pt06-T 22.84 0.01 0.00 Pt07-T 14.04 0.00 0.00 Pt08-T 31.93 0.01
0.01 Pt09-T 35.02 0.00 0.00 Pt10-T 13.2 0.00 0.00 Pt11-T 24.87 0.01
0.00 Pt12-T 10.85 0.00 0.00 Pt13-T 36.51 0.02 0.01 Pt14-T 12.72
0.00 0.00 Pt15-T 10.64 0.00 0.00 Pt16-T 22.58 0.04 0.00 Pt17-T
39.64 0.14 0.04 Pt01-N 4.57 0.03 0.00 Pt02-N 5.57 0.00 0.00 Pt03-N
3.54 0.00 0.00 Pt04-N 8.18 0.00 0.00 Pt05-N 5.4 0.10 0.00 Pt06-N
11.01 0.00 0.00 Pt08-N 10.39 0.00 0.00 Pt09-N 9.11 0.00 0.00 Pt10-N
4.41 0.00 0.00 Pt11-N 8.64 0.00 0.00 Pt12-N 3.03 0.00 0.00 Pt14-N
3.55 0.00 0.00 Pt15-N 2.42 0.01 0.00 Pt17-N 11.46 0.05 0.01 T-mean
21.5559 N-mean 6.52 St. T-test = 7.3E-06
TABLE-US-00052 TABLE 49 p14.sup.ARF/p16 TaqMan .RTM. Results
Patient T1 T2 T3 T4 UNIVERSAL Pt01-T 0.2 0.1 0.2 0.2 0.2 Pt02-T
16.3 11.2 5.1 21.7 36.5 Pt03-T 16.5 6.2 3.1 15.1 29.6 Pt04-T 10.1
2.8 2.6 13.2 27.7 Pt05-T 12.7 3.6 2.1 11.3 23.1 Pt01-N 0.1 0.1 0.1
0.1 0.1 Pt02-N 2.5 2.6 1.6 2.7 6.8 Pt04-N 2.6 0.6 0.8 2.4 5.8
Pt05-N 2.1 0.8 0.7 4.1 4.6 T-Mean 11.2 4.8 2.6 12.3 23.4 N-Mean 1.8
1.0 0.8 2.3 4.3
TABLE-US-00053 TABLE 50 Cyclin E1 TaqMan .RTM. Results T1 T1T2
Cancer Cancer T1T2 Normal Cancer Cancer T1 Normal Normal Patient M.
SD Normal M. SD M. SD M. SD Pt 01 12.19 0.12 4.11 0.13 1.34 0.04
0.5 0.03 Pt 02 16.72 0.21 4.44 0.34 1.35 0.02 0.47 0.05 Pt 03 11.45
0.41 2.81 0.13 1.17 0.01 0.06 0.02 Pt 04 21.33 0.45 5.33 0.09 0.76
0.1 0.23 0.01 Pt 05 11.17 0.25 3.68 0.15 0.95 0.05 0.15 0.03 Pt 06
21.65 0.24 3.11 0.22 0.89 0.03 0.13 0.02 Pt 07 23.26 0.54 0 0 0.75
0.06 0 0.01 Pt 08 8.37 0.24 3.1 0.01 0.12 0.01 0.13 0.02 Pt 09
17.74 0.43 2.17 0.08 0.73 0.02 0.09 0.01 Pt 10 18.51 0.29 4.56 0.17
1.37 0.03 0.41 0.04 Pt 11 10.58 0.52 3.92 0.12 0.57 0.01 0.23 0.03
Pt 12 33.67 0.58 7.87 0.1 0.78 0.01 0.28 0.05 Pt 13 36.9 0.41 0 0
1.05 0.04 0 0 Pt 14 31.01 0.29 6.01 0.26 1.68 0.05 0.24 0.03 Pt 15
7.35 0.23 1.24 0.09 0.34 0.08 0.08 0.02 Pt 16 12.71 0.61 3.72 0 1.1
0.06 0.07 0.01 Pt 17 12.13 0.21 11.46 0.15 0.34 0.07 0.05 0.01 Pt
18 14.22 0.14 5.94 0.06 0.73 0.08 0.26 0.04 Pt 19 12.69 0.81 3.52
0.02 0.41 0.04 0.24 0.02 Pt 20 16.56 0.16 6.1 0.12 0.17 0.02 0.06 0
Pt 21 11.63 0.23 3.01 0.06 0.54 0.04 0.23 0.01 Pt 22 17.39 0.34
2.36 0.02 0.47 0.02 0.24 0.05 Pt 23 16.56 0.16 2.1 0.02 0.18 0.03
0.09 0.01 Pt 24 22.23 0.33 4.06 0.28 1.9 0.17 0.52 0.01 Pt 25 13.98
0.48 3.72 0.05 0.54 0.04 0.23 0.01 Pt 26 22.71 0.76 4.48 0.07 0.47
0.02 0.24 0.05 Pt 27 16.17 0.4 5.64 0.3 0.18 0 0.12 0.01 Pt 28 12.6
0.56 3.8 0.06 0.29 0.03 0.05 0 Pt 29 13.69 0.34 3.1 0.18 0.29 0.03
0.11 0 Pt 30 17.69 0.61 4.3 0.11 0.36 0.01 0.03 0 Pt 31 20.46 0.3
3.91 0.21 0.47 0.03 0.08 0 Pt 32 18.38 0.18 3.16 0.06 0.42 0.02
0.17 0.01 Pt 33 21.1 0.62 4.52 0.33 1.07 0.05 0.24 0.01 Pt 34 21.5
1.37 4.56 0.13 0.24 0.01 0.11 0.01 Average 17.54 4.26 0.68 0.20 T/N
4.1 t-test 7.80E-14 P =
TABLE-US-00054 TABLE 51 Cyclin E2 TaqMan .RTM. Results T1T2 T1T3 T2
Std. Std. Std. Patients T1T2 Dev. T1T3 Dev. T2 Dev. Pt01-T 13.17
1.02 16.11 0.39 0.01 0.00 Pt02-T 13.42 0.3 18.12 2.21 0.15 0.02
Pt03-T 13.64 0.50 17.40 2.16 0.05 0.01 Pt04-T 19.37 1.41 24.26 1.01
0.01 0.00 Pt05-T 10.59 1.1 14.71 1.58 0.17 0.02 Pt06-T 7.96 0.91
9.32 0.51 0.06 0.01 Pt07-T 14.1 1.73 16.92 0.84 0.54 0.06 Pt08-T
8.11 0.67 9.50 0.66 0.34 0.07 Pt09-T 13.04 0.72 18.27 0.99 0.02
0.00 Pt10-T 19.56 2.29 23.42 0.00 0.02 0.01 Pt11-T 16.8 1.57 18.71
2.15 0.08 0.01 Pt12-T 16.05 0.85 18.81 0.74 0.91 0.01 Pt13-T 14.91
0.87 18.51 1.59 0.61 0.16 Pt14-T 14.89 0.32 20.49 0.86 0.42 0.03
Pt15-T 12.44 0.47 15.26 1.00 0.68 0.18 Pt16-T 11.54 1.58 13.13 0.75
1.02 0.14 Pt17-T 6.78 0.47 7.91 0.45 0.85 0.10 Pt01-N 4.89 0.21
5.94 0.53 0.00 0.00 Pt02-N 6.32 0.47 8.91 0.61 0.13 0.00 Pt03-N 4.8
0.31 5.89 0.30 0.04 0.00 Pt04-N 13.28 0.74 15.28 1.37 0.01 0.00
Pt05-N 6.51 1.2 9.04 0.82 0.16 0.02 Pt06-N 4.96 0.83 6.41 0.84 0.05
0.01 Pt08-N 6.48 0.73 6.82 0.60 0.07 0.02 Pt09-N 3.74 0.48 4.63
0.66 0.03 0.01 Pt10-N 10.32 0.93 11.31 0.89 0.02 0.00 Pt11-N 10.34
0.26 13.90 0.53 0.04 0.04 Pt12-N 13.81 1.69 16.60 1.45 0.24 0.07
Pt14-N 6.92 0.63 9.07 0.95 0.14 0.03 Pt15-N 4.8 0.73 8.55 1.40 0.10
0.03 Pt17-N 5.33 0.2 5.78 0.27 0.23 0.07 T-mean 13.32 16.52 0.35
N-mean 7.32 9.15 0.09 St. T-test 4.16E-05 3.31742E-05 0.008813
Example 11
Real-time PCR Detection of Biomarkers in Clinical Tissue
Samples
[0287] TaqMan.RTM. real-time PCR was performed as described in
Example 9 using cervical cancer tissue samples (e.g.,
adenocarcinoma, squamous cell carcinoma) and normal cervical tissue
samples. The primers and probes were designed with the aid of the
Primer Express.TM. program, version 1.5 (Applied Biosystems), for
specific amplification of the targeted cervical biomarkers (i.e.,
MCM2, MCM6, MCM7, and Topo2A) in this study. The sequence
information for primers and probes is shown below:
[0288] TaqMan Primers
TABLE-US-00055 MCM2: Primer Name: MCM2-F Sequence:
5'-GGAGGTGGTACTGGCCATGTA-3' (SEQ ID NO: 80) Primer Name: MCM2-R
Sequence: 5'-GGGAGATGCGGACATGGAT-3' (SEQ ID NO: 81) TaqMan Probe
Name: MCM2-P Sequence: 5'-CCAAGTACGACCGCATCACCAACCA-3' (SEQ ID NO:
82) MCM6: Primer Name: MCM6-F Sequence: 5'-CATTCCAAGACCTGCCTACCA-3'
(SEQ ID NO: 83) Primer Name: MCM6-R Sequence:
5'-ATGCGAGTGAGCAAACCAATT-3' (SEQ ID NO: 84) TaqMan Probe Name:
MCM6-P Sequence: 5'-ACACAAGATTCGAGAGCTCACCTCATCCA-3' (SEQ ID NO:
85) MCM7: Primer Name: MCM7_T1T3-F Sequence: CTCTGAGCCCGCCAAGC (SEQ
ID NO: 25) Primer Name: MCM7_T1T3-R Sequence:
TGTAAGAACTTCTTAACCTTTTCCTTCTCTA (SEQ ID NO: 26) Probe Name:
MCM7_T1T3-Probe Sequence: CCCTCGGCAGCGATGGCACT (SEQ ID NO: 27)
Primer Name: MCM7_T2T4-F Sequence: GAGGAATCCCGAGCTGTGAA (SEQ ID NO:
28) Primer Name: MCM7_T2T4-R Sequence: CCCGCTCCCGCCAT (SEQ ID NO:
29) Probe Name: MCM7_T2T4-Probe Sequence:
CCCATGTGCTTCTTTGTTTACTAAGAGCGGAA (SEQ ID NO: 30) Primer Name:
MCM7_T2-F Sequence: GTCCGAAGCCCCCAGAA (SEQ ID NO: 31) Primer Name:
MCM7_T2-R Sequence: CCCGACAGAGACCACTCACA (SEQ ID NO: 32) Probe
Name: MCM7_T2-Probe Sequence: CAGTACCCTGCTGAACTCATGCGCA (SEQ ID NO:
33) Primer Name: MCM7_T3T4-F Sequence: CGCTACGCGAAGCTCTTTG (SEQ ID
NO: 34) Primer Name: MCM7_T3T4-R Sequence: CCTTTGTTTGCCATTGTTCTCTAA
(SEQ ID NO: 35) Probe Name: MCM7_T3T4-Probe Sequence:
TGCCGTACAAGAGCTGCTGCCTCA (SEQ ID NO: 36) TOPO2A: Primer Name:
TOP2A_F Sequence: 5'-GGCTACATGGTGGCAAGGA-3' (SEQ ID NO: 86) Primer
Name: TOP2A_R Sequence: 5'-TGGAAATAACAATCGAGCCAAAG-3' (SEQ ID NO:
87) TaqMan Probe Name: TOP2A_P Sequence:
5'-TGCTAGTCCACGATACATCTTTACAATGCTCAGC-3' (SEQ ID NO: 88)
Results
[0289] The results obtained for each biomarker are listed below in
tabular form. The data is also summarized below.
TABLE-US-00056 TABLE 52 Snap-frozen Cervical Cancer Tissue Samples
MCM6 MCM7 TOP2A Patient TPO ID Path. Diag HPV Type MCM2 TaqM TaqMan
TaqM TaqM Pt 01 CV- Sq. Cell CA HPV16 8.93 11.31 29.9 23.76 001 Pt
02 CV- Adeno CA HPV18 10.94 14.29 36.8 25.28 003 Pt 03 CV- Adeno CA
HPV18 17.67 13.84 17.3 23.18 005 Pt 04 CV- Sq. Cell CA HPV16 23.61
13.3 18.77 23.26 007 Pt 05 CV- Sq. Cell CA HPV16 9.3 11.26 15.01
20.33 009 Pt 06 CV- Sq. Cell CA HPV16 13.86 11.58 7.37 8.37 011 Pt
07 CV- Adeno CA HPV18 27.03 16.32 19.74 34.29 013 Pt 08 CV- Sq.
Cell CA HPV16, 8.28 8.16 3.65 8.57 015 HPV18, + Pt 09 CV- Sq. Cell
CA HPV18 12.61 13.56 20.07 11.31 017 Pt 10 CV- Sq Cell CA HPV18
31.88 23.38 21.17 27.48 019 Pt 11 CV- Sq. Cell CA HPV16 11.27 14.76
10.64 12.73 021 Pt 12 CV- Sq. Cell CA HPV16 11.39 11.29 32.17 21.11
023 Pt 13 CV- Sq. Cell CA HPV16 23.88 18.98 18.11 27.96 025 Pt 14
CV- Sq. Cell CA HPV18, 12.26 15.53 36.25 26.63 027 HPV16, + Pt 15
CV- Sq Cell HPV16 6.56 7.92 9.64 7.81 029 Carcinoma Pt 16 CV- Sq
Cell HPV73 28.12 12.21 27.3 21.4 031 Carcinoma Pt 17 CV- Sq Cell
HPV16 8.76 7.59 14.37 12.42 033 Carcinoma Pt 18 CV- Sq Cell HPV16
21.4 12.65 23.63 27.57 035 Carcinoma Pt 19 CV- Sq Cell HPV18 12.59
13.06 14.37 9.24 037 Carcinoma Pt 20 CV- Adenosqu. HPV16, 7.24 8.17
16.97 15.13 039 Cell CA HPV18, + Pt 21 CV- Sq Cell CA HPV16 9.61
11.84 13.88 11.92 041 Pt 22 CV- Sq Cell CA HPV16 21.57 13.21 18.31
24.19 043 Pt 23 CV- Sq Cell CA HPV16 21.19 13.18 18.76 19.97 045 Pt
24 CV- Sq Cell CA HPV18 24.61 19.09 20.19 28.14 047 Pt 25 CV- Sq
Cell CA HPV18 11.43 10.2 13.70 10.55 049 Pt 26 CV- Sq Cell CA HPV16
24.25 20.54 23.26 33.26 051 Pt 27 CV- Sq Cell CA HPV45 26.74 21.34
20.96 20.34 053 Pt 28 CV- Sq Cell CA HPV16, 12.65 12 14.42 12.17
055 HPV18, + Pt 29 CV- Sq Cell CA HPV16 16 14.72 25.46 22.16 057 Pt
30 CV- Sq Cell CA HPV16, 22.55 17.87 15.30 25.54 059 HPV18, + Pt 31
CV- Sq Cell CA HPV16 24.08 21.88 23.11 25.28 061 Pt 32 CV- Sq Cell
CA HPV18, 24.16 12.55 21.63 22.39 063 HPV16, + Pt 33 CV- Sq Cell CA
HPV16 26.63 16.05 27.56 28.84 065 Pt 34 CV- Sq Cell CA HPV16 19.61
23.28 19.03 25.57 067
TABLE-US-00057 TABLE 53 Adjacent Normal Tissue Samples TPO HPV MCM2
MCM6 MCM7 TOP2A Patient ID Type TaqM TaqMan TaqM TaqM Pt 01 CV-
Negative 3.04 4.4 10.6 10.52 002 Pt 02 CV- Negative 6.26 6.28 7.1
9.06 004 Pt 03 CV- HPV18 2.06 2.53 2.14 3.86 006 Pt 04 CV- Negative
3.14 4.15 4.8 8.03 008 Pt 05 CV- Negative 2.2 3.45 5.07 6.91 010 Pt
06 CV- Negative 2.06 2.29 7.34 6.82 012 Pt 07 CV- Negative N/A N/A
N/A N/A 014 Pt 08 CV- Negative 2.55 3.13 3.72 2.02 016 Pt 09 CV-
Negative 2.09 3.09 4.74 1.24 018 Pt 10 CV- Negative 8.15 6.76 5.42
10.41 020 Pt 11 CV- Negative 4.53 5.34 4.33 6.64 022 Pt 12 CV-
Negative 1.94 2.45 9.03 6.13 024 Pt 13 CV- Negative N/A N/A N/A N/A
026 Pt 14 CV- Negative 2.62 2.95 10.38 5.3 028 Pt 15 CV- Negative
1.14 1.28 2.06 1.54 030 Pt 16 CV- Negative N/A N/A N/A N/A 032 Pt
17 CV- Negative 1.24 1.91 1.32 0.42 034 Pt 18 CV- Negative 3.4 1.89
4.01 4.32 036 Pt 19 CV- Negative 3.48 4.98 5.60 7.92 038 Pt 20 CV-
Negative 1.84 3.28 3.73 1.38 040 Pt 21 CV- Negative 1.53 3.3 4.77
1.01 042 Pt 22 CV- Negative 2.65 4.03 2.74 2.59 044 Pt 23 CV-
Negative 3.09 3.53 5.90 3.42 046 Pt 24 CV- HPV18 2.57 5.19 3.82
5.32 048 Pt 25 CV- Negative 5.84 4.64 7.78 9.14 050 Pt 26 CV-
Negative 5.11 5.22 5.37 5.13 052 Pt 27 CV- Negative 2.91 3.29 5.10
0.76 054 Pt 28 CV- Negative 4.14 3.74 5.54 4.15 056 Pt 29 CV- HPV16
2.83 4.98 10.13 7.57 058 Pt 30 CV- Negative 6.41 5 5.39 10.05 060
Pt 31 CV- Negative 5.72 4.93 9.29 9.95 062 Pt 32 CV- Negative 8.06
5.41 7.64 9 064 Pt 33 CV- Negative 9.93 7.94 10.78 9.95 066 Pt 34
CV- Negative 2.36 6.39 5.73 1.81 068
TABLE-US-00058 TABLE 54 Summary of Results Tumor vs adjacent normal
Marker Tumor (M .+-. SD) Normal (M .+-. SD) R P MCM2 17.43 .+-.
7.34 3.71 .+-. 2.21 4.70 <0.0001 MCM6 14.32 .+-. 4.32 4.12 .+-.
1.56 3.48 <0.0001 MCM7 19.38 .+-. 6.94 5.85 .+-. 2.59 3.31
<0.0001 TOP2A 20.53 .+-. 7.54 5.56 .+-. 3.33 3.69 <0.0001 M:
Mean; SD: Standard Deviation; R: Ratio of the means of tumor versus
normal; P: P value of t-test.
TABLE-US-00059 TABLE 55 HPV-16 vs HPV-18 Marker Tumor HPV type
Cases Tumor (M .+-. SD) Normal (M .+-. SD) MCM2 16 18 16.77 .+-.
6.78 3.29 .+-. 2.13 18 8 17.23 .+-. 8.16 3.99 .+-. 2.40 16 + 18 6
14.52 .+-. 7.18 4.27 .+-. 2.47 MCM6 16 18 14.19 .+-. 4.44 3.97 .+-.
1.75 18 8 14.24 .+-. 4.10 4.35 .+-. 1.54 16 + 18 6 12.38 .+-. 3.89
3.92 .+-. 1.04 MCM7 16 18 19.39 .+-. 6.94 6.07 .+-. 2.98 18 8 17.23
.+-. 4.16 5.07 .+-. 1.91 16 + 18 6 18.04 .+-. 7.71 6.07 .+-. 2.56
TOP2A 16 18 20.92 .+-. 7.38 5.46 .+-. 3.26 18 8 19.78 .+-. 9.52
6.19 .+-. 3.33 16 + 18 6 18.41 .+-. 7.49 5.32 .+-. 3.57
TABLE-US-00060 TABLE 56 Squamous Cell Carcinoma vs Adenocarcinoma
Marker Histopathology Cases Tumor (M .+-. SD) Normal (M .+-. SD)
MCM2 SCC 30 17.66 .+-. 7.28 3.74 .+-. 2.23 AC 4 15.72 .+-. 8.69
3.39 .+-. 2.49 MCM6 SCC 30 14.48 .+-. 4.44 4.13 .+-. 1.55 AC 4
13.16 .+-. 3.49 4.03 .+-. 1.98 MCM7 SCC 30 19.27 .+-. 7.25 6.01
.+-. 2.58 AC 4 20.20 .+-. 4.57 4.32 .+-. 2.53 TOP2A SCC 30 20.01
.+-. 7.47 5.65 .+-. 3.34 AC 4 21.47 .+-. 7.87 4.77 .+-. 3.92 SCC:
Squamous Cell Carcinoma; AC: Adenocarcinoma.
Example 12
Real-time PCR Detection of Biomarkers in Cervical and Breast Cancer
Cell Lines
[0290] TaqMan.RTM. real-time PCR was performed to detect MCM2, MCM6
and MCM7 expression levels in cervical and breast cancer cell
lines.
Experimental Design and Protocols
[0291] Three human cervical cancer cell lines of SiHa, Caski and
HeLa and three human breast cancer cell lines of MCF-7, SK-BR3 and
CAMA were purchased from ATCC and used in this experiment. Total
cellular RNA was extracted from freshly cultured cells by
RNeasy.RTM. Protect Mini kit (Qiagen, Valencia, Calif.) and
converted into the single stranded cDNA form with random hexamers
using the High-Capacity cDNA Archive Kit (Applied Biosystems, P/N:
4322171). Real-time PCR was performed on the ABI Prism.RTM. 7700
Sequence Detection System using TaqMan.RTM. Universal PCR Master
Mix (Applied Biosystems, Inc., Foster City, Calif.).
[0292] The primers and probes for specific amplification of MCM2,
MCM6 and MCM7 were designed with ABI Primer Express.TM. program,
v1.5. MCM7 contains four transcriptional variants: transcript
variant 1 (T1, refseq NM.sub.--005916) and transcript variant 2
(T2, refseq NM.sub.--182776) were identified in NCBI Entrez
nucleotide database. Variant T3 and T4 have alternate exons near
the 5'-end as analyzed by EST assembly through NCBI's Model Maker.
Primers and probes were designed as T1T3, T2T4, T2 and T3T4
specifically for detecting variants T1 and T3, T2 and T4, T2, and
T3 and T4, respectively. The sequences of primers and probes are
shown above in Example 10 and 11.
[0293] The probes were labeled with a fluorescent dye FAM
(6-carboxyfluorescein) on the 5' base, and a quenching dye TAMRA
(6-carboxytetramethylrhodamine) on the 3' base. 18S ribosomal RNA
was utilized as endogenous control. 18S rRNA probe was labeled with
a fluorescent dye VIC. Pre-developed 18S rRNA primer/probe mixture
was purchased from Applied Biosystems. 10 ng of cDNA were applied
to the reaction mixture containing 0.9 .mu.M and 0.25 .mu.M of the
primers and probes, respectively, in a total volume of 25 .mu.l.
The amplification conditions were: 2 minutes at 50.degree. C., 10
minutes at 95.degree. C., and a two-steps cycle of 95.degree. C.
for 15 seconds and 60.degree. C. for 60 seconds, for a total of 40
cycles. At least three no-template control reaction mixtures were
included in each run. All experiments were performed in duplicate.
The relative quantification method was employed to calculate the
expression levels of target genes relative to the 18S endogenous
control, based on their CT values following the ABI's user manual
(P/N 4303859).
Results
[0294] The results obtained for each biomarker are listed below in
tabular form.
TABLE-US-00061 TABLE 57 Biomarker Expression Cervical and Breast
Cancer Cell Lines SiHa Caski HeLa MCF7 SK-BR3 CAMA MCM2 21.4 5.01
8.79 18.84 7.65 17.32 MCM6 12.34 5.77 6.46 12.6 5.44 13.14 MCM7
20.53 17.27 8.31 26.91 30.38 25.36
Conclusions
[0295] The cervical HeLa cell line was shown to have low-expression
levels of MCM2, MCM6 and MCM7 biomarkers. The cervical SiHa, breast
MCM7, and CAMA cell lines all showed overexpression of MCM2, MCM6
and MCM7 biomarkers. Cervical Caski and breast SK-BR3 cell lines
showed overexpression of MCM7, but low-expression for MCM2 and
MCM6.
Example 13
Induction of Cervical Biomarker Expression in 293 Cells by
Transient HPV16 E6/E7 Gene Transfection
[0296] TaqMan.RTM. real-time PCR assay was used to investigate the
linkage of cervical biomarker expression with high-risk HPV
oncogene transcription in an HEK 293 cell line system.
Experimental Design and Protocols
[0297] A tetracycline regulated expression system (T-Rex system,
Invitrogen, Inc) was adapted in this experiment. T-Rex vectors
expressing HPV16 E2, E6 or E7 protein were constructed. Vectors
containing mutant E2, E6 or E7 genes were utilized as negative
controls. T-Rex 293 cells were then transfected with the HPV
plasmids, and expression of HPV genes were activated by
tetracycline for 4 hours, 24 hours and 72 hours. Total cellular RNA
was extracted from the transfected cells by RNeasy.RTM. Protect
Mini kit (Qiagen, Valencia, Calif.) and converted into the single
stranded cDNA form with random hexamers using the High-Capacity
cDNA Archive Kit (Applied Biosystems, P/N: 4322171). Real-time PCR
was performed on the ABI Prism.RTM. 7700 Sequence Detection System
using TaqMan.RTM. Universal PCR Master Mix (Applied Biosystems,
Inc., Foster City, Calif.).
[0298] The primers and probes for specific amplification of MCM2,
MCM6, MCM7, TOP2A, Cyclin E1, p21, p14, HPV16 E2, E6 and E7 were
designed with ABI Primer Express.TM. program, v1.5. MCM7 contains
four transcriptional variants: transcript variant 1 (T1, refseq
NM.sub.--005916) and transcript variant 2 (T2, refseq
NM.sub.--182776) were identified in NCBI Entrez nucleotide
database. Variant T3 and T4 have alternate exons near the 5'-end as
analyzed by EST assembly through NCBI's Model Maker. Primers and
probes were designed as T1T3, T2T4, T2 and T3T4 specifically for
detecting variants T1 and T3, T2 and T4, T2, and T3 and T4,
respectively. The sequences of primers and probes are shown as
shown in Examples 10 and 11.
[0299] The probes were labeled with a fluorescent dye FAM
(6-carboxyfluorescein) on the 5' base, and a quenching dye TAMRA
(6-carboxytetramethylrhodamine) on the 3' base. 18S ribosomal RNA
was utilized as endogenous control. 18S rRNA probe was labeled with
a fluorescent dye VIC. Pre-developed 18S rRNA primer/probe mixture
was purchased from Applied Biosystems. 10 ng of cDNA were applied
to the reaction mixture containing 0.9 .mu.M and 0.25 .mu.M of the
primers and probes, respectively, in a total volume of 25 .mu.l.
The amplification conditions were: 2 minutes at 50.degree. C., 10
minutes at 95.degree. C., and a two-steps cycle of 95.degree. C.
for 15 seconds and 60.degree. C. for 60 seconds, for a total of 40
cycles. At least three no-template control reaction mixtures were
included in each run. All experiments were performed in duplicate.
The relative quantification method was employed to calculate the
expression levels of target genes relative to the 18S endogenous
control, based on their CT values following the ABI's user manual
(P/N 4303859).
Results
[0300] Expression of HPV16 E2, E6 and E7 genes in T-Rex 293 cells
was observed to increase through the time-course of transfection.
mRNA expression of Topo2A, MCM2, MCM6, MCM7 and cyclin E in T-Rex
293 cells was significantly induced by HPV16 E6 or E7 genes,
post-transfection from 4 hours up to 72 hours. However, there were
no elevated expression levels detected for p21 and p14 post HPV
gene transfection. Expression of E6 or E7 did not appear to be
repressed by co-transfection of E2 gene. This is because the
expression of E6 or E7 was purely driven by the external CMV
promoter instead of the natural HPV promoters. The latter are not
present in this model system.
TABLE-US-00062 TABLE 58 Topo2A 0 h 4 h 24 h Transfection 0 h SD 4 h
SD 24 h SD 72 h 72 h SD 293-H16E2 6.91 0.07 5.22 0.13 5.68 0.14
6.61 0.36 293-H16E6 6.91 0.07 11.31 0.22 18.13 0.89 17.39 0.85
293-H16E7 6.91 0.07 20.33 0.9 28.94 0.71 35.02 1.03 293-H16dE7 6.91
0.07 6.43 0.35 8.18 0.64 7.39 0.18 293-LacZ 6.91 0.07 7.4 0.07 7.36
0.22 7.25 0.67
TABLE-US-00063 TABLE 59 MCM2 0 h 4 h 24 h Transfection 0 h SD 4 h
SD 24 h SD 72 h 72 h SD 293-H16E2 4.79 0.23 5.25 0.36 5.24 0.31
4.44 0.3 293-H16E6 4.79 0.23 6.04 0.21 9.38 0.37 12.08 0.18
293-H16E7 4.79 0.23 10.81 0.16 12.29 0.36 16.34 0.8 293-H16dE7 4.79
0.23 5.72 0.36 4.98 0.27 5.03 0.39 293-LacZ 4.79 0.23 5.67 0.61
5.68 0.47 5.98 0.79
TABLE-US-00064 TABLE 60 MCM6 0 h 4 h 24 h Transfection 0 h SD 4 h
SD 24 h SD 72 h 72 h SD 293-H16E2 3.62 0.2 3.5 0.22 4.72 0 4.44
0.26 293-H16E6 3.62 0.2 4.74 0.07 9.03 0.04 9.68 0.43 293-H16E7
3.62 0.2 7.7 0.04 13.5 0.33 14.03 0.41 293-H16dE7 3.62 0.2 5.23
0.28 4.6 0.32 4.73 0.37 293-LacZ 3.62 0.2 4.77 0.12 4.66 0.14 5.34
0.39
TABLE-US-00065 TABLE 61 MCM7 24 h 72 h Transfection 0 h 0 h SD 4 h
4 h SD 24 h SD 72 h SD 293-H16E2 4.2 0.04 6.3 0.28 5.3 0.18 5.8
0.31 293-H16E6 4.2 0.04 4.99 0.05 9.55 0.23 15.24 0.3 293-H16E7 4.2
0.04 10.11 0.84 14.23 0.84 21.18 0.31 293-H16dE7 4.2 0.04 3.65 0.3
6.06 0.3 4.64 0.07 293-LacZ 4.2 0.04 5.74 0.45 5.31 0.55 5.66
0.17
TABLE-US-00066 TABLE 62 Cyclin E1 0 h 4 h 24 h Transfection 0 h SD
4 h SD 24 h SD 72 h 72 h SD 293-H16E2 6.02 0.00 5.06 0.10 5.03 0.35
5.72 0.31 293-H16E6 6.02 0.00 9.19 0.18 8.95 0.79 9.38 0.18
293-H16E7 6.02 0.00 12.91 0.38 17.63 0.17 17.32 0.25 293-H16dE7
6.02 0.00 5.45 0.24 6.87 0.20 5.11 0.08 293-LacZ 6.02 0.00 5.72
0.31 6.28 0.37 5.65 0.64
TABLE-US-00067 TABLE 63 p21 0 h 4 h 24 h Transfection 0 h SD 4 h SD
24 h SD 72 h 72 h SD 293-H16E2 4.76 0.19 4.05 0.30 5.19 0.61 4.92
0.60 293-H16E6 4.76 0.19 5.56 0.19 5.60 0.08 7.21 0.07 293-H16E7
4.76 0.19 7.52 0.29 5.22 0.13 6.45 0.13 293-H16dE7 4.76 0.19 4.38
0.26 5.60 0.66 5.10 0.05 293-LacZ 4.76 0.19 3.86 0.00 4.53 0.27
5.37 0.29
TABLE-US-00068 TABLE 64 p14 0 h 4 h 24 h Transfection 0 h SD 4 h SD
24 h SD 72 h 72 h SD 293-H16E2 4.78 0.30 4.44 0.09 5.04 0.44 5.04
0.07 293-H16E6 4.78 0.30 4.77 0.12 5.48 0.13 4.52 0.11 293-H16E7
4.78 0.30 6.38 0.62 5.60 0.25 6.43 0.35 293-H16dE7 4.78 0.30 5.08
0.12 5.53 0.35 5.10 0.15 293-LacZ 4.78 0.30 4.54 0.40 4.68 0.16
5.76 0.25
TABLE-US-00069 TABLE 65 HPV16 E2 E2 E6 E7 dE2 dE6 dE7 E2 + E6 E2 +
E7 dE2 + E6 dE2 + E7 LacZ Mock 4 h 130.22 0 0 110.7 0 0 95.34 36.6
3.94 12.86 0 0 24 h 162.12 0 0 111.41 0 0 118.17 90.19 19.77 7.7 0
0 72 h 251.55 0 0 141.57 0 0 162.54 128.41 32.94 9.89 0 0
TABLE-US-00070 TABLE 66 HPV16 E6 E2 E6 E7 dE2 dE6 dE7 E2 + E6 E2 +
E7 dE2 + E6 dE2 + E7 LacZ Mock 4 h 0 205 0 0 219.87 0 128.41 0
199.65 0 0 0 24 h 0 329.67 0 0 225.96 0 158.31 0 188.03 0 0 0 72 h
0 757.26 0 0 315.22 0 392 0 271.55 0 0 0
TABLE-US-00071 TABLE 67 HPV16 E7 E2 E6 E7 dE2 dE6 dE7 E2 + E6 E2 +
E7 dE2 + E6 dE2 + E7 LacZ Mock 4 h 0 0 330.76 0 0 165.48 0 120.65 0
201.19 0 0 24 h 0 0 1514.6 0 0 239.63 0 857.89 0 600.57 0 0 72 h 0
0 2806.8 0 0 355.9 0 1444.25 0 809.11 0 0
Example 14
Increasing Antigen Accessibility in Immunocytochemistry and
Immunohistochemistry Methods Using a Slide Pretreatment Buffer
Specimen Selection and Reagent Description
[0301] Paired cytology and histology specimens, from the same
patient, were subjected to immunoassays to detect biomarker
overexpression. Paraffin block tissue samples and SurePath.RTM.
cytology specimens from patients categorized as ASCUS (3), LSIL
(6), and HSIL (5) were analyzed. The reagents used were the
Antibody Cocktail (for cytology), the Modified Antibody Cocktail
(for histology), Detection Reagents, Counterstains, and
SureSlide.RTM. Preparation Buffer 10.times. (pretreatment
buffer).
Cytology Slide Preparation and Automated Immunocytochemistry
[0302] For immunocytochemistry, slide preparation and pretreatment
was conducted as indicated in Example 5. Automated
immunocytochemistry was then performed on each cytology specimen as
described in Example 5 with one exception. The primary antibody
cocktail (MCM2 Clone 26H6.19 1:10,000, MCM2 Clone 27C5.6 1:800,
TOPOIIA Clone SWT3D1 1:1000) incubation was reduced to 30 minutes
for this experiment.
Histology Slide Preparation and Automated Immunohistochemistry
[0303] For each case, 4 micron sections were cut and dried
overnight or for 20 minutes in a 70.degree. C. forced air oven.
Sections were deparaffinized in 3 changes of xylene for 5 minutes
each. Slides were then cleared in absolute alcohol for 5 minutes
each. Slides were brought down to water and rinsed thoroughly.
Slides were transferred to a preheated solution of 1.times.
SureSlide Preparation Buffer and incubated in the steamer for 25
minutes. The slides were removed from the steamer and allowed to
cool at room temperature for 20 minutes. Slides were slowly rinsed
in water until the buffer was completely exchanged. A TBST rinse
was applied for 2 changes at 2 minutes each.
[0304] Automated immunohistochemistry was conducted as described in
Example 5 for immunocytochemistry, with two exceptions. The primary
antibody cocktail incubation was reduced to 30 minutes for this
experiment. Additionally, the primary antibody cocktail was
modified with the following dilutions (MCM2 Clone 26H6.19 1:4,000,
MCM2 Clone 27C5.6 1:200, TOPOIIA Clone SWT3D1 1:400).
Results
[0305] The anticipated staining patterns were observed on both the
histology and cytology specimens with the use of the RUO reagents.
Specifically, the ability to immunostain both histology and
cytology specimens with the SureSlide.RTM. Preparation Buffer,
Detection Reagents and the Counterstain Reagents was successfully
demonstrated.
TABLE-US-00072 TABLE 68 Biomarker Nucleotide and Amino Acid
Sequence Information Nucleotide Sequence Amino Acid Sequence
Accession Sequence Accession Sequence Biomarker Name No. Identifier
No. Identifier Cyclin E1 (Isoform 1) NM_001238 SEQ ID NO: 1
NP_001229 SEQ ID NO: 2 Cyclin E1 (Isoform 2) NM_057182 SEQ ID NO: 3
NP_476530 SEQ ID NO: 4 Cyclin E2 (Isoform1) NM_057749) SEQ ID NO: 5
NP_477097 SEQ ID NO: 6 Cyclin E2 (Isoform 2) NM_057735 SEQ ID NO: 7
NP_477083 SEQ ID NO: 8 Cyclin E2 (Isoform 3) NM_004702 SEQ ID NO: 9
NP_004693 SEQ ID NO: 10 MCM2 NM_004526 SEQ ID NO: 11 NP_0045417 SEQ
ID NO: 12 MCM6 NM_005915 SEQ ID NO: 89 NP_005906 SEQ ID NO: 90 MCM7
(Isoform 1) NM_005916 SEQ ID NO: 13 NP_005907 SEQ ID NO: 14 MCM7
(Isoform 2) NM_182776 SEQ ID NO: 15 NP_877577 SEQ ID NO: 16
p21/waf1 (Variant 1) NM_000389 SEQ ID NO: 17 NP_000380 SEQ ID NO:
18 p21/waf1 (Variant 2) NM_078467 SEQ ID NO: 19 NP_510867 SEQ ID
NO: 20 p14ARF NM_058195 SEQ ID NO: 21 NP_478102 SEQ ID NO: 22
Topo2a NM_001067 SEQ ID NO: 23 NP_0010568 SEQ ID NO: 24
[0306] In light of the above description and examples, one skilled
in the art will appreciate that the methods of the invention permit
superior detection of high-grade cervical disease, independent of
age, in comparison to conventional practice. The methods of the
invention may find particular use as described below: [0307] For
women over the age of thirty, the test may be a reflex from either
an HPV positive result or as a reflex from an ASCUS+ cytology
result. [0308] For women under the age of 30, the test may be used
in combination with cytology for the detection of high-grade
cervical disease. [0309] For women over the age of 30, the test may
be used in combination with cytology for the detection of
high-grade cervical disease. [0310] For women under the age of 30,
the test may be used as a primary screen to detect high-grade
cervical disease. [0311] For women over the age of 30, the test may
be used as a primary screen to detect high-grade cervical disease.
[0312] The test may be a replacement for the Pap smear in women
under the age of thirty. [0313] Ultimately, the test may be a
replacement for the Pap smear, independent of age.
[0314] Other potential advantages stemming from the practice of the
present invention include: [0315] Detection of histologic
high-grade abnormality in women 30 years old and above with NIL/HPV
positive results. [0316] Superior specificity for the detection of
high-grade cervical disease in women over the age of 30 who are
positive to the DNA+Pap test. [0317] Superior detection for
high-grade cervical disease in women within the ASC-US, ASC-H, and
LSIL categories, independent of age. [0318] Superior specificity
for the detection of high-grade cervical within HSIL category.
[0319] Detection of high-grade cervical disease in conjunction with
cytology-based diagnosis in women under the age of 30. [0320]
Detection of high-grade cervical disease in conjunction with
cytology-based diagnosis, independent of age. [0321] Improved
specificity for the detection of high-grade cervical disease as a
primary screen in women under the age of 30. [0322] Improved
specificity for the detection of high-grade cervical disease as a
primary screen, independent of age. [0323] Identification of
cervical disease and differentiation of HPV infection and
high-grade cervical disease. [0324] Acceptable assay performance
can be established using manual interpretation or assisted
interpretation via automated microscopy.
[0325] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0326] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
embodiments.
Sequence CWU 1
1
9011958DNAHomo sapiens 1agcagccggc gcggccgcca gcgcggtgta gggggcaggc
gcggatcccg ccaccgccgc 60gcgctcggcc cgccgactcc cggcgccgcc gccgccactg
ccgtcgccgc cgccgcctgc 120cgggactgga gcgcgccgtc cgccgcggac
aagaccctgg cctcaggccg gagcagcccc 180atcatgccga gggagcgcag
ggagcgggat gcgaaggagc gggacaccat gaaggaggac 240ggcggcgcgg
agttctcggc tcgctccagg aagaggaagg caaacgtgac cgtttttttg
300caggatccag atgaagaaat ggccaaaatc gacaggacgg cgagggacca
gtgtgggagc 360cagccttggg acaataatgc agtctgtgca gacccctgct
ccctgatccc cacacctgac 420aaagaagatg atgaccgggt ttacccaaac
tcaacgtgca agcctcggat tattgcacca 480tccagaggct ccccgctgcc
tgtactgagc tgggcaaata gagaggaagt ctggaaaatc 540atgttaaaca
aggaaaagac atacttaagg gatcagcact ttcttgagca acaccctctt
600ctgcagccaa aaatgcgagc aattcttctg gattggttaa tggaggtgtg
tgaagtctat 660aaacttcaca gggagacctt ttacttggca caagatttct
ttgaccggta tatggcgaca 720caagaaaatg ttgtaaaaac tcttttacag
cttattggga tttcatcttt atttattgca 780gccaaacttg aggaaatcta
tcctccaaag ttgcaccagt ttgcgtatgt gacagatgga 840gcttgttcag
gagatgaaat tctcaccatg gaattaatga ttatgaaggc ccttaagtgg
900cgtttaagtc ccctgactat tgtgtcctgg ctgaatgtat acatgcaggt
tgcatatcta 960aatgacttac atgaagtgct actgccgcag tatccccagc
aaatctttat acagattgca 1020gagctgttgg atctctgtgt cctggatgtt
gactgccttg aatttcctta tggtatactt 1080gctgcttcgg ccttgtatca
tttctcgtca tctgaattga tgcaaaaggt ttcagggtat 1140cagtggtgcg
acatagagaa ctgtgtcaag tggatggttc catttgccat ggttataagg
1200gagacgggga gctcaaaact gaagcacttc aggggcgtcg ctgatgaaga
tgcacacaac 1260atacagaccc acagagacag cttggatttg ctggacaaag
cccgagcaaa gaaagccatg 1320ttgtctgaac aaaatagggc ttctcctctc
cccagtgggc tcctcacccc gccacagagc 1380ggtaagaagc agagcagcgg
gccggaaatg gcgtgaccac cccatccttc tccaccaaag 1440acagttgcgc
gcctgctcca cgttctcttc tgtctgttgc agcggaggcg tgcgtttgct
1500tttacagata tctgaatgga agagtgtttc ttccacaaca gaagtatttc
tgtggatggc 1560atcaaacagg gcaaagtgtt ttttattgaa tgcttatagg
ttttttttaa ataagtgggt 1620caagtacacc agccacctcc agacaccagt
gcgtgctccc gatgctgcta tggaaggtgc 1680tacttgacct aagggactcc
cacaacaaca aaagcttgaa gctgtggagg gccacggtgg 1740cgtggctctc
ctcgcaggtg ttctgggctc cgttgtacca agtggagcag gtggttgcgg
1800gcaagcgttg tgcagagccc atagccagct gggcaggggg ctgccctctc
cacattatca 1860gttgacagtg tacaatgcct ttgatgaact gttttgtaag
tgctgctata tctatccatt 1920ttttaataaa gataatactg tttttgagac aaaaaaaa
19582410PRTHomo sapiens 2Met Pro Arg Glu Arg Arg Glu Arg Asp Ala
Lys Glu Arg Asp Thr Met1 5 10 15Lys Glu Asp Gly Gly Ala Glu Phe Ser
Ala Arg Ser Arg Lys Arg Lys20 25 30Ala Asn Val Thr Val Phe Leu Gln
Asp Pro Asp Glu Glu Met Ala Lys35 40 45Ile Asp Arg Thr Ala Arg Asp
Gln Cys Gly Ser Gln Pro Trp Asp Asn50 55 60Asn Ala Val Cys Ala Asp
Pro Cys Ser Leu Ile Pro Thr Pro Asp Lys65 70 75 80Glu Asp Asp Asp
Arg Val Tyr Pro Asn Ser Thr Cys Lys Pro Arg Ile85 90 95Ile Ala Pro
Ser Arg Gly Ser Pro Leu Pro Val Leu Ser Trp Ala Asn100 105 110Arg
Glu Glu Val Trp Lys Ile Met Leu Asn Lys Glu Lys Thr Tyr Leu115 120
125Arg Asp Gln His Phe Leu Glu Gln His Pro Leu Leu Gln Pro Lys
Met130 135 140Arg Ala Ile Leu Leu Asp Trp Leu Met Glu Val Cys Glu
Val Tyr Lys145 150 155 160Leu His Arg Glu Thr Phe Tyr Leu Ala Gln
Asp Phe Phe Asp Arg Tyr165 170 175Met Ala Thr Gln Glu Asn Val Val
Lys Thr Leu Leu Gln Leu Ile Gly180 185 190Ile Ser Ser Leu Phe Ile
Ala Ala Lys Leu Glu Glu Ile Tyr Pro Pro195 200 205Lys Leu His Gln
Phe Ala Tyr Val Thr Asp Gly Ala Cys Ser Gly Asp210 215 220Glu Ile
Leu Thr Met Glu Leu Met Ile Met Lys Ala Leu Lys Trp Arg225 230 235
240Leu Ser Pro Leu Thr Ile Val Ser Trp Leu Asn Val Tyr Met Gln
Val245 250 255Ala Tyr Leu Asn Asp Leu His Glu Val Leu Leu Pro Gln
Tyr Pro Gln260 265 270Gln Ile Phe Ile Gln Ile Ala Glu Leu Leu Asp
Leu Cys Val Leu Asp275 280 285Val Asp Cys Leu Glu Phe Pro Tyr Gly
Ile Leu Ala Ala Ser Ala Leu290 295 300Tyr His Phe Ser Ser Ser Glu
Leu Met Gln Lys Val Ser Gly Tyr Gln305 310 315 320Trp Cys Asp Ile
Glu Asn Cys Val Lys Trp Met Val Pro Phe Ala Met325 330 335Val Ile
Arg Glu Thr Gly Ser Ser Lys Leu Lys His Phe Arg Gly Val340 345
350Ala Asp Glu Asp Ala His Asn Ile Gln Thr His Arg Asp Ser Leu
Asp355 360 365Leu Leu Asp Lys Ala Arg Ala Lys Lys Ala Met Leu Ser
Glu Gln Asn370 375 380Arg Ala Ser Pro Leu Pro Ser Gly Leu Leu Thr
Pro Pro Gln Ser Gly385 390 395 400Lys Lys Gln Ser Ser Gly Pro Glu
Met Ala405 41031787DNAHomo sapiens 3gtgctcaccc ggcccggtgc
cacccgggtc cacagggatg cgaaggagcg ggacaccatg 60aaggaggacg gcggcgcgga
gttctcggct cgctccagga agaggaaggc aaacgtgacc 120gtttttttgc
aggatccaga tgaagaaatg gccaaaatcg acaggacggc gagggaccag
180tgtgggagcc agccttggga caataatgca gtctgtgcag acccctgctc
cctgatcccc 240acacctgaca aagaagatga tgaccgggtt tacccaaact
caacgtgcaa gcctcggatt 300attgcaccat ccagaggctc cccgctgcct
gtactgagct gggcaaatag agaggaagtc 360tggaaaatca tgttaaacaa
ggaaaagaca tacttaaggg atcagcactt tcttgagcaa 420caccctcttc
tgcagccaaa aatgcgagca attcttctgg attggttaat ggaggtgtgt
480gaagtctata aacttcacag ggagaccttt tacttggcac aagatttctt
tgaccggtat 540atggcgacac aagaaaatgt tgtaaaaact cttttacagc
ttattgggat ttcatcttta 600tttattgcag ccaaacttga ggaaatctat
cctccaaagt tgcaccagtt tgcgtatgtg 660acagatggag cttgttcagg
agatgaaatt ctcaccatgg aattaatgat tatgaaggcc 720cttaagtggc
gtttaagtcc cctgactatt gtgtcctggc tgaatgtata catgcaggtt
780gcatatctaa atgacttaca tgaagtgcta ctgccgcagt atccccagca
aatctttata 840cagattgcag agctgttgga tctctgtgtc ctggatgttg
actgccttga atttccttat 900ggtatacttg ctgcttcggc cttgtatcat
ttctcgtcat ctgaattgat gcaaaaggtt 960tcagggtatc agtggtgcga
catagagaac tgtgtcaagt ggatggttcc atttgccatg 1020gttataaggg
agacggggag ctcaaaactg aagcacttca ggggcgtcgc tgatgaagat
1080gcacacaaca tacagaccca cagagacagc ttggatttgc tggacaaagc
ccgagcaaag 1140aaagccatgt tgtctgaaca aaatagggct tctcctctcc
ccagtgggct cctcaccccg 1200ccacagagcg gtaagaagca gagcagcggg
ccggaaatgg cgtgaccacc ccatccttct 1260ccaccaaaga cagttgcgcg
cctgctccac gttctcttct gtctgttgca gcggaggcgt 1320gcgtttgctt
ttacagatat ctgaatggaa gagtgtttct tccacaacag aagtatttct
1380gtggatggca tcaaacaggg caaagtgttt tttattgaat gcttataggt
tttttttaaa 1440taagtgggtc aagtacacca gccacctcca gacaccagtg
cgtgctcccg atgctgctat 1500ggaaggtgct acttgaccta agggactccc
acaacaacaa aagcttgaag ctgtggaggg 1560ccacggtggc gtggctctcc
tcgcaggtgt tctgggctcc gttgtaccaa gtggagcagg 1620tggttgcggg
caagcgttgt gcagagccca tagccagctg ggcagggggc tgccctctcc
1680acattatcag ttgacagtgt acaatgcctt tgatgaactg ttttgtaagt
gctgctatat 1740ctatccattt tttaataaag ataatactgt ttttgagaca aaaaaaa
17874395PRTHomo sapiens 4Met Lys Glu Asp Gly Gly Ala Glu Phe Ser
Ala Arg Ser Arg Lys Arg1 5 10 15Lys Ala Asn Val Thr Val Phe Leu Gln
Asp Pro Asp Glu Glu Met Ala20 25 30Lys Ile Asp Arg Thr Ala Arg Asp
Gln Cys Gly Ser Gln Pro Trp Asp35 40 45Asn Asn Ala Val Cys Ala Asp
Pro Cys Ser Leu Ile Pro Thr Pro Asp50 55 60Lys Glu Asp Asp Asp Arg
Val Tyr Pro Asn Ser Thr Cys Lys Pro Arg65 70 75 80Ile Ile Ala Pro
Ser Arg Gly Ser Pro Leu Pro Val Leu Ser Trp Ala85 90 95Asn Arg Glu
Glu Val Trp Lys Ile Met Leu Asn Lys Glu Lys Thr Tyr100 105 110Leu
Arg Asp Gln His Phe Leu Glu Gln His Pro Leu Leu Gln Pro Lys115 120
125Met Arg Ala Ile Leu Leu Asp Trp Leu Met Glu Val Cys Glu Val
Tyr130 135 140Lys Leu His Arg Glu Thr Phe Tyr Leu Ala Gln Asp Phe
Phe Asp Arg145 150 155 160Tyr Met Ala Thr Gln Glu Asn Val Val Lys
Thr Leu Leu Gln Leu Ile165 170 175Gly Ile Ser Ser Leu Phe Ile Ala
Ala Lys Leu Glu Glu Ile Tyr Pro180 185 190Pro Lys Leu His Gln Phe
Ala Tyr Val Thr Asp Gly Ala Cys Ser Gly195 200 205Asp Glu Ile Leu
Thr Met Glu Leu Met Ile Met Lys Ala Leu Lys Trp210 215 220Arg Leu
Ser Pro Leu Thr Ile Val Ser Trp Leu Asn Val Tyr Met Gln225 230 235
240Val Ala Tyr Leu Asn Asp Leu His Glu Val Leu Leu Pro Gln Tyr
Pro245 250 255Gln Gln Ile Phe Ile Gln Ile Ala Glu Leu Leu Asp Leu
Cys Val Leu260 265 270Asp Val Asp Cys Leu Glu Phe Pro Tyr Gly Ile
Leu Ala Ala Ser Ala275 280 285Leu Tyr His Phe Ser Ser Ser Glu Leu
Met Gln Lys Val Ser Gly Tyr290 295 300Gln Trp Cys Asp Ile Glu Asn
Cys Val Lys Trp Met Val Pro Phe Ala305 310 315 320Met Val Ile Arg
Glu Thr Gly Ser Ser Lys Leu Lys His Phe Arg Gly325 330 335Val Ala
Asp Glu Asp Ala His Asn Ile Gln Thr His Arg Asp Ser Leu340 345
350Asp Leu Leu Asp Lys Ala Arg Ala Lys Lys Ala Met Leu Ser Glu
Gln355 360 365Asn Arg Ala Ser Pro Leu Pro Ser Gly Leu Leu Thr Pro
Pro Gln Ser370 375 380Gly Lys Lys Gln Ser Ser Gly Pro Glu Met
Ala385 390 39552748DNAHomo sapiens 5agcgggtgcg gggcgggacc
ggcccggcct atatattggg ttggcgccgg cgccagctga 60gccgagcggt agctggtctg
gcgaggtttt atacacctga aagaagagaa tgtcaagacg 120aagtagccgt
ttacaagcta agcagcagcc ccagcccagc cagacggaat ccccccaaga
180agcccagata atccaggcca agaagaggaa aactacccag gatgtcaaaa
aaagaagaga 240ggaggtcacc aagaaacatc agtatgaaat taggaattgt
tggccacctg tattatctgg 300ggggatcagt ccttgcatta tcattgaaac
acctcacaaa gaaataggaa caagtgattt 360ctccagattt acaaattaca
gatttaaaaa tctttttatt aatccttcac ctttgcctga 420tttaagctgg
ggatgttcaa aagaagtctg gctaaacatg ttaaaaaagg agagcagata
480tgttcatgac aaacattttg aagttctgca ttctgacttg gaaccacaga
tgaggtccat 540acttctagac tggcttttag aggtatgtga agtatacaca
cttcataggg aaacatttta 600tcttgcacaa gacttttttg atagatttat
gttgacacaa aaggatataa ataaaaatat 660gcttcaactc attggaatta
cctcattatt cattgcttcc aaacttgagg aaatctatgc 720tcctaaactc
caagagtttg cttacgtcac tgatggtgct tgcagtgaag aggatatctt
780aaggatggaa ctcattatat taaaggcttt aaaatgggaa ctttgtcctg
taacaatcat 840ctcctggcta aatctctttc tccaagttga tgctcttaaa
gatgctccta aagttcttct 900acctcagtat tctcaggaaa cattcattca
aatagctcag cttttagatc tgtgtattct 960agccattgat tcattagagt
tccagtacag aatactgact gctgctgcct tgtgccattt 1020tacctccatt
gaagtggtta agaaagcctc aggtttggag tgggacagta tttcagaatg
1080tgtagattgg atggtacctt ttgtcaatgt agtaaaaagt actagtccag
tgaagctgaa 1140gacttttaag aagattccta tggaagacag acataatatc
cagacacata caaactattt 1200ggctatgctg gaggaagtaa attacataaa
caccttcaga aaagggggac agttgtcacc 1260agtgtgcaat ggaggcatta
tgacaccacc gaagagcact gaaaaaccac caggaaaaca 1320ctaaagaaga
taactaagca aacaagttgg aattcaccaa gattgggtag aactggtatc
1380actgaactac taaagtttta cagaaagtag tgctgtgatt gattgcccta
gccaattcac 1440aagttacact gccattctga ttttaaaact tacaattggc
actaaagaat acatttaatt 1500atttcctatg ttagctgtta aagaaacagc
aggacttgtt tacaaagatg tcttcattcc 1560caaggttact ggatagaagc
caaccacagt ctataccata gcaatgtttt tcctttaatc 1620cagtgttact
gtgtttatct tgataaacta ggaattttgt cactggagtt ttggactgga
1680taagtgctac cttaaagggt atactaagtg atacagtact ttgaatctag
ttgttagatt 1740ctcaaaattc ctacactctt gactagtgca atttggttct
tgaaaattaa atttaaactt 1800gtttacaaag gtttagtttt gtaataaggt
gactaattta tctatagctg ctatagcaag 1860ctattataaa acttgaattt
ctacaaatgg tgaaatttaa tgttttttaa actagtttat 1920ttgccttgcc
ataacacatt ttttaactaa taaggcttag atgaacatgg tgttcaacct
1980gtgctctaaa cagtgggagt accaaagaaa ttataaacaa gataaatgct
gtggctcctt 2040cctaactggg gctttcttga catgtaggtt gcttggtaat
aacctttttg tatatcacaa 2100tttgggtgaa aaacttaagt accctttcaa
actatttata tgaggaagtc actttactac 2160tctaagatat ccctaaggaa
tttttttttt taatttagtg tgactaaggc tttatttatg 2220tttgtgaaac
tgttaaggtc ctttctaaat tcctccattg tgagataagg acagtgtcaa
2280agtgataaag cttaacactt gacctaaact tctattttct taaggaagaa
gagtattaaa 2340tatatactga ctcctagaaa tctatttatt aaaaaaagac
atgaaaactt gctgtacata 2400ggctagctat ttctaaatat tttaaattag
cttttctaaa aaaaaaatcc agcctcataa 2460agtagattag aaaactagat
tgctagttta ttttgttatc agatatgtga atctcttctc 2520cctttgaaga
aactatacat ttattgttac ggtatgaagt cttctgtata gtttgttttt
2580aaactaatat ttgtttcagt attttgtctg aaaagaaaac accactaatt
gtgtacatat 2640gtattatata aacttaacct tttaatactg tttattttta
gcccattgtt taaaaaataa 2700aagttaaaaa aatttaactg cttaaaagta
aaaaaaaaaa aaaaaaaa 27486404PRTHomo sapiens 6Met Ser Arg Arg Ser
Ser Arg Leu Gln Ala Lys Gln Gln Pro Gln Pro1 5 10 15Ser Gln Thr Glu
Ser Pro Gln Glu Ala Gln Ile Ile Gln Ala Lys Lys20 25 30Arg Lys Thr
Thr Gln Asp Val Lys Lys Arg Arg Glu Glu Val Thr Lys35 40 45Lys His
Gln Tyr Glu Ile Arg Asn Cys Trp Pro Pro Val Leu Ser Gly50 55 60Gly
Ile Ser Pro Cys Ile Ile Ile Glu Thr Pro His Lys Glu Ile Gly65 70 75
80Thr Ser Asp Phe Ser Arg Phe Thr Asn Tyr Arg Phe Lys Asn Leu Phe85
90 95Ile Asn Pro Ser Pro Leu Pro Asp Leu Ser Trp Gly Cys Ser Lys
Glu100 105 110Val Trp Leu Asn Met Leu Lys Lys Glu Ser Arg Tyr Val
His Asp Lys115 120 125His Phe Glu Val Leu His Ser Asp Leu Glu Pro
Gln Met Arg Ser Ile130 135 140Leu Leu Asp Trp Leu Leu Glu Val Cys
Glu Val Tyr Thr Leu His Arg145 150 155 160Glu Thr Phe Tyr Leu Ala
Gln Asp Phe Phe Asp Arg Phe Met Leu Thr165 170 175Gln Lys Asp Ile
Asn Lys Asn Met Leu Gln Leu Ile Gly Ile Thr Ser180 185 190Leu Phe
Ile Ala Ser Lys Leu Glu Glu Ile Tyr Ala Pro Lys Leu Gln195 200
205Glu Phe Ala Tyr Val Thr Asp Gly Ala Cys Ser Glu Glu Asp Ile
Leu210 215 220Arg Met Glu Leu Ile Ile Leu Lys Ala Leu Lys Trp Glu
Leu Cys Pro225 230 235 240Val Thr Ile Ile Ser Trp Leu Asn Leu Phe
Leu Gln Val Asp Ala Leu245 250 255Lys Asp Ala Pro Lys Val Leu Leu
Pro Gln Tyr Ser Gln Glu Thr Phe260 265 270Ile Gln Ile Ala Gln Leu
Leu Asp Leu Cys Ile Leu Ala Ile Asp Ser275 280 285Leu Glu Phe Gln
Tyr Arg Ile Leu Thr Ala Ala Ala Leu Cys His Phe290 295 300Thr Ser
Ile Glu Val Val Lys Lys Ala Ser Gly Leu Glu Trp Asp Ser305 310 315
320Ile Ser Glu Cys Val Asp Trp Met Val Pro Phe Val Asn Val Val
Lys325 330 335Ser Thr Ser Pro Val Lys Leu Lys Thr Phe Lys Lys Ile
Pro Met Glu340 345 350Asp Arg His Asn Ile Gln Thr His Thr Asn Tyr
Leu Ala Met Leu Glu355 360 365Glu Val Asn Tyr Ile Asn Thr Phe Arg
Lys Gly Gly Gln Leu Ser Pro370 375 380Val Cys Asn Gly Gly Ile Met
Thr Pro Pro Lys Ser Thr Glu Lys Pro385 390 395 400Pro Gly Lys
His72613DNAHomo sapiens 7agcgggtgcg gggcgggacc ggcccggcct
atatattggg ttggcgccgg cgccagctga 60gccgagcggt agctggtctg gcgaggtttt
atacacctga aagaagagaa tgtcaagacg 120aagtagccgt ttacaagcta
agcagcagcc ccagcccagc cagacggaat ccccccaaga 180agcccagata
atccaggcca agaagaggaa aactacccag gatgtcaaaa aaagaagaga
240ggaggtcacc aagaaacatc agtatgaaat taggaattgt tggccacctg
tattatctgg 300ggggatcagt ccttgcatta tcattgaaac acctcacaaa
gaaataggaa caagtgattt 360ctccagattt acaaattaca gatttaaaaa
tctttttatt aatccttcac ctttgcctga 420tttaagctgg ggatgttcaa
aagaagtctg gctaaacatg ttaaaaaagg agagcagata 480tgttcatgac
aaacattttg aagttctgca ttctgacttg gaaccacaga tgaggtccat
540acttctagac tggcttttag aggtatgtga agtatacaca cttcataggg
aaacatttta 600tcttgcttac gtcactgatg gtgcttgcag tgaagaggat
atcttaagga tggaactcat 660tatattaaag gctttaaaat gggaactttg
tcctgtaaca atcatctcct ggctaaatct 720ctttctccaa gttgatgctc
ttaaagatgc tcctaaagtt cttctacctc agtattctca 780ggaaacattc
attcaaatag ctcagctttt agatctgtgt attctagcca ttgattcatt
840agagttccag tacagaatac tgactgctgc tgccttgtgc cattttacct
ccattgaagt 900ggttaagaaa gcctcaggtt tggagtggga cagtatttca
gaatgtgtag attggatggt 960accttttgtc aatgtagtaa aaagtactag
tccagtgaag ctgaagactt ttaagaagat 1020tcctatggaa gacagacata
atatccagac acatacaaac tatttggcta tgctggagga 1080agtaaattac
ataaacacct tcagaaaagg gggacagttg tcaccagtgt gcaatggagg
1140cattatgaca ccaccgaaga gcactgaaaa accaccagga aaacactaaa
gaagataact 1200aagcaaacaa gttggaattc accaagattg ggtagaactg
gtatcactga actactaaag 1260ttttacagaa agtagtgctg tgattgattg
ccctagccaa ttcacaagtt acactgccat 1320tctgatttta aaacttacaa
ttggcactaa agaatacatt taattatttc ctatgttagc 1380tgttaaagaa
acagcaggac ttgtttacaa agatgtcttc attcccaagg ttactggata
1440gaagccaacc acagtctata ccatagcaat gtttttcctt taatccagtg
ttactgtgtt 1500tatcttgata aactaggaat tttgtcactg gagttttgga
ctggataagt gctaccttaa 1560agggtatact aagtgataca gtactttgaa
tctagttgtt agattctcaa aattcctaca 1620ctcttgacta gtgcaatttg
gttcttgaaa attaaattta aacttgttta caaaggttta 1680gttttgtaat
aaggtgacta atttatctat agctgctata gcaagctatt ataaaacttg
1740aatttctaca aatggtgaaa tttaatgttt tttaaactag tttatttgcc
ttgccataac 1800acatttttta actaataagg cttagatgaa catggtgttc
aacctgtgct ctaaacagtg 1860ggagtaccaa agaaattata aacaagataa
atgctgtggc tccttcctaa ctggggcttt 1920cttgacatgt aggttgcttg
gtaataacct ttttgtatat cacaatttgg gtgaaaaact 1980taagtaccct
ttcaaactat ttatatgagg aagtcacttt actactctaa gatatcccta
2040aggaattttt ttttttaatt tagtgtgact aaggctttat ttatgtttgt
gaaactgtta 2100aggtcctttc taaattcctc cattgtgaga taaggacagt
gtcaaagtga taaagcttaa 2160cacttgacct aaacttctat tttcttaagg
aagaagagta ttaaatatat actgactcct 2220agaaatctat ttattaaaaa
aagacatgaa aacttgctgt acataggcta gctatttcta 2280aatattttaa
attagctttt ctaaaaaaaa aatccagcct cataaagtag attagaaaac
2340tagattgcta gtttattttg ttatcagata tgtgaatctc ttctcccttt
gaagaaacta 2400tacatttatt gttacggtat gaagtcttct gtatagtttg
tttttaaact aatatttgtt 2460tcagtatttt gtctgaaaag aaaacaccac
taattgtgta catatgtatt atataaactt 2520aaccttttaa tactgtttat
ttttagccca ttgtttaaaa aataaaagtt aaaaaaattt 2580aactgcttaa
aagtaaaaaa aaaaaaaaaa aaa 26138359PRTHomo sapiens 8Met Ser Arg Arg
Ser Ser Arg Leu Gln Ala Lys Gln Gln Pro Gln Pro1 5 10 15Ser Gln Thr
Glu Ser Pro Gln Glu Ala Gln Ile Ile Gln Ala Lys Lys20 25 30Arg Lys
Thr Thr Gln Asp Val Lys Lys Arg Arg Glu Glu Val Thr Lys35 40 45Lys
His Gln Tyr Glu Ile Arg Asn Cys Trp Pro Pro Val Leu Ser Gly50 55
60Gly Ile Ser Pro Cys Ile Ile Ile Glu Thr Pro His Lys Glu Ile Gly65
70 75 80Thr Ser Asp Phe Ser Arg Phe Thr Asn Tyr Arg Phe Lys Asn Leu
Phe85 90 95Ile Asn Pro Ser Pro Leu Pro Asp Leu Ser Trp Gly Cys Ser
Lys Glu100 105 110Val Trp Leu Asn Met Leu Lys Lys Glu Ser Arg Tyr
Val His Asp Lys115 120 125His Phe Glu Val Leu His Ser Asp Leu Glu
Pro Gln Met Arg Ser Ile130 135 140Leu Leu Asp Trp Leu Leu Glu Val
Cys Glu Val Tyr Thr Leu His Arg145 150 155 160Glu Thr Phe Tyr Leu
Ala Tyr Val Thr Asp Gly Ala Cys Ser Glu Glu165 170 175Asp Ile Leu
Arg Met Glu Leu Ile Ile Leu Lys Ala Leu Lys Trp Glu180 185 190Leu
Cys Pro Val Thr Ile Ile Ser Trp Leu Asn Leu Phe Leu Gln Val195 200
205Asp Ala Leu Lys Asp Ala Pro Lys Val Leu Leu Pro Gln Tyr Ser
Gln210 215 220Glu Thr Phe Ile Gln Ile Ala Gln Leu Leu Asp Leu Cys
Ile Leu Ala225 230 235 240Ile Asp Ser Leu Glu Phe Gln Tyr Arg Ile
Leu Thr Ala Ala Ala Leu245 250 255Cys His Phe Thr Ser Ile Glu Val
Val Lys Lys Ala Ser Gly Leu Glu260 265 270Trp Asp Ser Ile Ser Glu
Cys Val Asp Trp Met Val Pro Phe Val Asn275 280 285Val Val Lys Ser
Thr Ser Pro Val Lys Leu Lys Thr Phe Lys Lys Ile290 295 300Pro Met
Glu Asp Arg His Asn Ile Gln Thr His Thr Asn Tyr Leu Ala305 310 315
320Met Leu Glu Glu Val Asn Tyr Ile Asn Thr Phe Arg Lys Gly Gly
Gln325 330 335Leu Ser Pro Val Cys Asn Gly Gly Ile Met Thr Pro Pro
Lys Ser Thr340 345 350Glu Lys Pro Pro Gly Lys His35592536DNAHomo
sapiens 9agcgggtgcg gggcgggacc ggcccggcct atatattggg ttggcgccgg
cgccagctga 60gccgagcggt agctggtctg gcgaggtttt atacacctga aagaagagaa
tgtcaagacg 120aagtagccgt ttacaagcta agcagcagcc ccagcccagc
cagacggaat ccccccaaga 180agcccagata atccaggcca agaagaggaa
aactacccag gatgtcaaaa gaagtctggc 240taaacatgtt aaaaaaggag
agcagatatg ttcatgacaa acattttgaa gttctgcatt 300ctgacttgga
accacagatg aggtccatac ttctagactg gcttttagag gtatgtgaag
360tatacacact tcatagggaa acattttatc ttgcacaaga cttttttgat
agatttatgt 420tgacacaaaa ggatataaat aaaaatatgc ttcaactcat
tggaattacc tcattattca 480ttgcttccaa acttgaggaa atctatgctc
ctaaactcca agagtttgct tacgtcactg 540atggtgcttg cagtgaagag
gatatcttaa ggatggaact cattatatta aaggctttaa 600aatgggaact
ttgtcctgta acaatcatct cctggctaaa tctctttctc caagttgatg
660ctcttaaaga tgctcctaaa gttcttctac ctcagtattc tcaggaaaca
ttcattcaaa 720tagctcagct tttagatctg tgtattctag ccattgattc
attagagttc cagtacagaa 780tactgactgc tgctgccttg tgccatttta
cctccattga agtggttaag aaagcctcag 840gtttggagtg ggacagtatt
tcagaatgtg tagattggat ggtacctttt gtcaatgtag 900taaaaagtac
tagtccagtg aagctgaaga cttttaagaa gattcctatg gaagacagac
960ataatatcca gacacataca aactatttgg ctatgctgga ggaagtaaat
tacataaaca 1020ccttcagaaa agggggacag ttgtcaccag tgtgcaatgg
aggcattatg acaccaccga 1080agagcactga aaaaccacca ggaaaacact
aaagaagata actaagcaaa caagttggaa 1140ttcaccaaga ttgggtagaa
ctggtatcac tgaactacta aagttttaca gaaagtagtg 1200ctgtgattga
ttgccctagc caattcacaa gttacactgc cattctgatt ttaaaactta
1260caattggcac taaagaatac atttaattat ttcctatgtt agctgttaaa
gaaacagcag 1320gacttgttta caaagatgtc ttcattccca aggttactgg
atagaagcca accacagtct 1380ataccatagc aatgtttttc ctttaatcca
gtgttactgt gtttatcttg ataaactagg 1440aattttgtca ctggagtttt
ggactggata agtgctacct taaagggtat actaagtgat 1500acagtacttt
gaatctagtt gttagattct caaaattcct acactcttga ctagtgcaat
1560ttggttcttg aaaattaaat ttaaacttgt ttacaaaggt ttagttttgt
aataaggtga 1620ctaatttatc tatagctgct atagcaagct attataaaac
ttgaatttct acaaatggtg 1680aaatttaatg ttttttaaac tagtttattt
gccttgccat aacacatttt ttaactaata 1740aggcttagat gaacatggtg
ttcaacctgt gctctaaaca gtgggagtac caaagaaatt 1800ataaacaaga
taaatgctgt ggctccttcc taactggggc tttcttgaca tgtaggttgc
1860ttggtaataa cctttttgta tatcacaatt tgggtgaaaa acttaagtac
cctttcaaac 1920tatttatatg aggaagtcac tttactactc taagatatcc
ctaaggaatt ttttttttta 1980atttagtgtg actaaggctt tatttatgtt
tgtgaaactg ttaaggtcct ttctaaattc 2040ctccattgtg agataaggac
agtgtcaaag tgataaagct taacacttga cctaaacttc 2100tattttctta
aggaagaaga gtattaaata tatactgact cctagaaatc tatttattaa
2160aaaaagacat gaaaacttgc tgtacatagg ctagctattt ctaaatattt
taaattagct 2220tttctaaaaa aaaaatccag cctcataaag tagattagaa
aactagattg ctagtttatt 2280ttgttatcag atatgtgaat ctcttctccc
tttgaagaaa ctatacattt attgttacgg 2340tatgaagtct tctgtatagt
ttgtttttaa actaatattt gtttcagtat tttgtctgaa 2400aagaaaacac
cactaattgt gtacatatgt attatataaa cttaaccttt taatactgtt
2460tatttttagc ccattgttta aaaaataaaa gttaaaaaaa tttaactgct
taaaagtaaa 2520aaaaaaaaaa aaaaaa 253610296PRTHomo sapiens 10Met Ser
Lys Glu Val Trp Leu Asn Met Leu Lys Lys Glu Ser Arg Tyr1 5 10 15Val
His Asp Lys His Phe Glu Val Leu His Ser Asp Leu Glu Pro Gln20 25
30Met Arg Ser Ile Leu Leu Asp Trp Leu Leu Glu Val Cys Glu Val Tyr35
40 45Thr Leu His Arg Glu Thr Phe Tyr Leu Ala Gln Asp Phe Phe Asp
Arg50 55 60Phe Met Leu Thr Gln Lys Asp Ile Asn Lys Asn Met Leu Gln
Leu Ile65 70 75 80Gly Ile Thr Ser Leu Phe Ile Ala Ser Lys Leu Glu
Glu Ile Tyr Ala85 90 95Pro Lys Leu Gln Glu Phe Ala Tyr Val Thr Asp
Gly Ala Cys Ser Glu100 105 110Glu Asp Ile Leu Arg Met Glu Leu Ile
Ile Leu Lys Ala Leu Lys Trp115 120 125Glu Leu Cys Pro Val Thr Ile
Ile Ser Trp Leu Asn Leu Phe Leu Gln130 135 140Val Asp Ala Leu Lys
Asp Ala Pro Lys Val Leu Leu Pro Gln Tyr Ser145 150 155 160Gln Glu
Thr Phe Ile Gln Ile Ala Gln Leu Leu Asp Leu Cys Ile Leu165 170
175Ala Ile Asp Ser Leu Glu Phe Gln Tyr Arg Ile Leu Thr Ala Ala
Ala180 185 190Leu Cys His Phe Thr Ser Ile Glu Val Val Lys Lys Ala
Ser Gly Leu195 200 205Glu Trp Asp Ser Ile Ser Glu Cys Val Asp Trp
Met Val Pro Phe Val210 215 220Asn Val Val Lys Ser Thr Ser Pro Val
Lys Leu Lys Thr Phe Lys Lys225 230 235 240Ile Pro Met Glu Asp Arg
His Asn Ile Gln Thr His Thr Asn Tyr Leu245 250 255Ala Met Leu Glu
Glu Val Asn Tyr Ile Asn Thr Phe Arg Lys Gly Gly260 265 270Gln Leu
Ser Pro Val Cys Asn Gly Gly Ile Met Thr Pro Pro Lys Ser275 280
285Thr Glu Lys Pro Pro Gly Lys His290 295113453DNAHomo sapiens
11acttttcgcg cgaaacctgg ttgttgctgt agtggcggag aggatcgtgg tactgctatg
60gcggaatcat cggaatcctt caccatggca tccagcccgg cccagcgtcg gcgaggcaat
120gatcctctca cctccagccc tggccgaagc tcccggcgta ctgatgccct
cacctccagc 180cctggccgtg accttccacc atttgaggat gagtccgagg
ggctcctagg cacagagggg 240cccctggagg aagaagagga tggagaggag
ctcattggag atggcatgga aagggactac 300cgcgccatcc cagagctgga
cgcctatgag gccgagggac tggctctgga tgatgaggac 360gtagaggagc
tgacggccag tcagagggag gcagcagagc gggccatgcg gcagcgtgac
420cgggaggctg gccggggcct gggccgcatg cgccgtgggc tcctgtatga
cagcgatgag 480gaggacgagg agcgccctgc ccgcaagcgc cgccaggtgg
agcgggccac ggaggacggc 540gaggaggacg aggagatgat cgagagcatc
gagaacctgg aggatctcaa aggccactct 600gtgcgcgagt gggtgagcat
ggcgggcccc cggctggaga tccaccaccg cttcaagaac 660ttcctgcgca
ctcacgtcga cagccacggc cacaacgtct tcaaggagcg catcagcgac
720atgtgcaaag agaaccgtga gagcctggtg gtgaactatg aggacttggc
agccagggag 780cacgtgctgg cctacttcct gcctgaggca ccggcggagc
tgctgcagat ctttgatgag 840gctgccctgg aggtggtact ggccatgtac
cccaagtacg accgcatcac caaccacatc 900catgtccgca tctcccacct
gcctctggtg gaggagctgc gctcgctgag gcagctgcat 960ctgaaccagc
tgatccgcac cagtggggtg gtgaccagct gcactggcgt cctgccccag
1020ctcagcatgg tcaagtacaa ctgcaacaag tgcaatttcg tcctgggtcc
tttctgccag 1080tcccagaacc aggaggtgaa accaggctcc tgtcctgagt
gccagtcggc cggccccttt 1140gaggtcaaca tggaggagac catctatcag
aactaccagc gtatccgaat ccaggagagt 1200ccaggcaaag tggcggctgg
ccggctgccc cgctccaagg acgccattct cctcgcagat 1260ctggtggaca
gctgcaagcc aggagacgag atagagctga ctggcatcta tcacaacaac
1320tatgatggct ccctcaacac tgccaatggc ttccctgtct ttgccactgt
catcctagcc 1380aaccacgtgg ccaagaagga caacaaggtt gctgtagggg
aactgaccga tgaagatgtg 1440aagatgatca ctagcctctc caaggatcag
cagatcggag agaagatctt tgccagcatt 1500gctccttcca tctatggtca
tgaagacatc aagagaggcc tggctctggc cctgttcgga 1560ggggagccca
aaaacccagg tggcaagcac aaggtacgtg gtgatatcaa cgtgctcttg
1620tgcggagacc ctggcacagc gaagtcgcag tttctcaagt atattgagaa
agtgtccagc 1680cgagccatct tcaccactgg ccagggggcg tcggctgtgg
gcctcacggc gtatgtccag 1740cggcaccctg tcagcaggga gtggaccttg
gaggctgggg ccctggttct ggctgaccga 1800ggagtgtgtc tcattgatga
atttgacaag atgaatgacc aggacagaac cagcatccat 1860gaggccatgg
agcaacagag catctccatc tcgaaggctg gcatcgtcac ctccctgcag
1920gctcgctgca cggtcattgc tgccgccaac cccataggag ggcgctacga
cccctcgctg 1980actttctctg agaacgtgga cctcacagag cccatcatct
cacgctttga catcctgtgt 2040gtggtgaggg acaccgtgga cccagtccag
gacgagatgc tggcccgctt cgtggtgggc 2100agccacgtca gacaccaccc
cagcaacaag gaggaggagg ggctggccaa tggcagcgct 2160gctgagcccg
ccatgcccaa cacgtatggc gtggagcccc tgccccagga ggtcctgaag
2220aagtacatca tctacgccaa ggagagggtc cacccgaagc tcaaccagat
ggaccaggac 2280aaggtggcca agatgtacag tgacctgagg aaagaatcta
tggcgacagg cagcatcccc 2340attacggtgc ggcacatcga gtccatgatc
cgcatggcgg aggcccacgc gcgcatccat 2400ctgcgggact atgtgatcga
agacgacgtc aacatggcca tccgcgtgat gctggagagc 2460ttcatagaca
cacagaagtt cagcgtcatg cgcagcatgc gcaagacttt tgcccgctac
2520ctttcattcc ggcgtgacaa caatgagctg ttgctcttca tactgaagca
gttagtggca 2580gagcaggtga catatcagcg caaccgcttt ggggcccagc
aggacactat tgaggtccct 2640gagaaggact tggtggataa ggctcgtcag
atcaacatcc acaacctctc tgcattttat 2700gacagtgagc tcttcaggat
gaacaagttc agccacgacc tgaaaaggaa aatgatcctg 2760cagcagttct
gaggccctat gccatccata aggattcctt gggattctgg tttggggtgg
2820tcagtgccct ctgtgcttta tggacacaaa accagagcac ttgatgaact
cggggtacta 2880gggtcagggc ttatagcagg atgtctggct gcacctggca
tgactgtttg tttctccaag 2940cctgctttgt gcttctcacc tttgggtggg
atgccttgcc agtgtgtctt acttggttgc 3000tgaacatctt gccacctccg
agtgctttgt ctccactcag taccttggat cagagctgct 3060gagttcagga
tgcctgcgtg tggtttaggt gttagccttc ttacatggat gtcaggagag
3120ctgctgccct cttggcgtga gttgcgtatt caggctgctt ttgctgcctt
tggccagaga 3180gctggttgaa gatgtttgta atcgttttca gtctcctgca
ggtttctgtg cccctgtggt 3240ggaagagggc acgacagtgc cagcgcagcg
ttctgggctc ctcagtcgca ggggtgggat 3300gtgagtcatg cggattatcc
actcgccaca gttatcagct gccattgctc cctgtctgtt 3360tccccactct
cttatttgtg cattcggttt ggtttctgta gttttaattt ttaataaagt
3420tgaataaaat ataaaaaaaa aaaaaaaaaa aaa 345312904PRTHomo sapiens
12Met Ala Glu Ser Ser Glu Ser Phe Thr Met Ala Ser Ser Pro Ala Gln1
5 10 15Arg Arg Arg Gly Asn Asp Pro Leu Thr Ser Ser Pro Gly Arg Ser
Ser20 25 30Arg Arg Thr Asp Ala Leu Thr Ser Ser Pro Gly Arg Asp Leu
Pro Pro35 40 45Phe Glu Asp Glu Ser Glu Gly Leu Leu Gly Thr Glu Gly
Pro Leu Glu50 55 60Glu Glu Glu Asp Gly Glu Glu Leu Ile Gly Asp Gly
Met Glu Arg Asp65 70 75 80Tyr Arg Ala Ile Pro Glu Leu Asp Ala Tyr
Glu Ala Glu Gly Leu Ala85 90 95Leu Asp Asp Glu Asp Val Glu Glu Leu
Thr Ala Ser Gln Arg Glu Ala100 105 110Ala Glu Arg Ala Met Arg Gln
Arg Asp Arg Glu Ala Gly Arg Gly Leu115 120 125Gly Arg Met Arg Arg
Gly Leu Leu Tyr Asp Ser Asp Glu Glu Asp Glu130 135 140Glu Arg Pro
Ala Arg Lys Arg Arg Gln Val Glu Arg Ala Thr Glu Asp145 150 155
160Gly Glu Glu Asp Glu Glu Met Ile Glu Ser Ile Glu Asn Leu Glu
Asp165 170 175Leu Lys Gly His Ser Val Arg Glu Trp Val Ser Met Ala
Gly Pro Arg180 185 190Leu Glu Ile His His Arg Phe Lys Asn Phe Leu
Arg Thr His Val Asp195 200 205Ser His Gly His Asn Val Phe Lys Glu
Arg Ile Ser Asp Met Cys Lys210 215 220Glu Asn Arg Glu Ser Leu Val
Val Asn Tyr Glu Asp Leu Ala Ala Arg225 230 235 240Glu His Val Leu
Ala Tyr Phe Leu Pro Glu Ala Pro Ala Glu Leu Leu245 250 255Gln Ile
Phe Asp Glu Ala Ala Leu Glu Val Val Leu Ala Met Tyr Pro260 265
270Lys Tyr Asp Arg Ile Thr Asn His Ile His Val Arg Ile Ser His
Leu275 280 285Pro Leu Val Glu Glu Leu Arg Ser Leu Arg Gln Leu His
Leu Asn Gln290 295 300Leu Ile Arg Thr Ser Gly Val Val Thr Ser Cys
Thr Gly Val Leu Pro305 310 315 320Gln Leu Ser Met Val Lys Tyr Asn
Cys Asn Lys Cys Asn Phe Val Leu325 330 335Gly Pro Phe Cys Gln Ser
Gln Asn Gln Glu Val Lys Pro Gly Ser Cys340 345 350Pro Glu Cys Gln
Ser Ala Gly Pro Phe Glu Val Asn Met Glu Glu Thr355 360 365Ile Tyr
Gln Asn Tyr Gln Arg Ile Arg Ile Gln Glu Ser Pro Gly Lys370 375
380Val Ala Ala Gly Arg Leu Pro Arg Ser Lys Asp Ala Ile Leu Leu
Ala385 390 395 400Asp Leu Val Asp Ser Cys Lys Pro Gly Asp Glu Ile
Glu Leu Thr Gly405 410 415Ile Tyr His Asn Asn Tyr Asp Gly Ser Leu
Asn Thr Ala Asn Gly Phe420 425 430Pro Val Phe Ala Thr Val Ile Leu
Ala Asn His Val Ala Lys Lys Asp435 440 445Asn Lys Val Ala Val Gly
Glu Leu Thr Asp Glu Asp Val Lys Met Ile450 455 460Thr Ser Leu Ser
Lys Asp Gln Gln Ile Gly Glu Lys Ile Phe Ala Ser465 470 475 480Ile
Ala Pro Ser Ile Tyr Gly His Glu Asp Ile Lys Arg Gly Leu Ala485 490
495Leu Ala Leu Phe Gly Gly Glu Pro Lys Asn Pro Gly Gly Lys His
Lys500 505 510Val Arg Gly Asp Ile Asn Val Leu Leu Cys Gly Asp Pro
Gly Thr Ala515 520 525Lys Ser Gln Phe Leu Lys Tyr Ile Glu Lys Val
Ser Ser Arg Ala Ile530 535 540Phe Thr Thr Gly Gln Gly Ala Ser Ala
Val Gly Leu Thr Ala Tyr Val545 550 555 560Gln Arg His Pro Val Ser
Arg Glu Trp Thr Leu Glu Ala Gly Ala Leu565 570 575Val Leu Ala Asp
Arg Gly Val Cys Leu Ile Asp Glu Phe Asp Lys Met580 585 590Asn Asp
Gln Asp Arg Thr Ser Ile His Glu Ala Met Glu Gln Gln Ser595 600
605Ile Ser Ile Ser Lys Ala Gly Ile Val Thr Ser Leu Gln Ala Arg
Cys610 615 620Thr Val Ile Ala Ala Ala Asn Pro Ile Gly Gly Arg Tyr
Asp Pro Ser625 630 635 640Leu Thr Phe Ser Glu Asn Val Asp Leu Thr
Glu Pro Ile Ile Ser Arg645 650 655Phe Asp Ile Leu Cys Val Val Arg
Asp Thr Val Asp Pro Val Gln Asp660 665 670Glu Met Leu Ala Arg Phe
Val Val Gly Ser His Val Arg His His Pro675 680 685Ser Asn Lys Glu
Glu Glu Gly Leu Ala Asn Gly Ser Ala Ala Glu Pro690 695 700Ala Met
Pro Asn Thr Tyr Gly Val Glu Pro Leu Pro Gln Glu Val Leu705 710 715
720Lys Lys Tyr Ile Ile Tyr Ala Lys Glu Arg Val His
Pro Lys Leu Asn725 730 735Gln Met Asp Gln Asp Lys Val Ala Lys Met
Tyr Ser Asp Leu Arg Lys740 745 750Glu Ser Met Ala Thr Gly Ser Ile
Pro Ile Thr Val Arg His Ile Glu755 760 765Ser Met Ile Arg Met Ala
Glu Ala His Ala Arg Ile His Leu Arg Asp770 775 780Tyr Val Ile Glu
Asp Asp Val Asn Met Ala Ile Arg Val Met Leu Glu785 790 795 800Ser
Phe Ile Asp Thr Gln Lys Phe Ser Val Met Arg Ser Met Arg Lys805 810
815Thr Phe Ala Arg Tyr Leu Ser Phe Arg Arg Asp Asn Asn Glu Leu
Leu820 825 830Leu Phe Ile Leu Lys Gln Leu Val Ala Glu Gln Val Thr
Tyr Gln Arg835 840 845Asn Arg Phe Gly Ala Gln Gln Asp Thr Ile Glu
Val Pro Glu Lys Asp850 855 860Leu Val Asp Lys Ala Arg Gln Ile Asn
Ile His Asn Leu Ser Ala Phe865 870 875 880Tyr Asp Ser Glu Leu Phe
Arg Met Asn Lys Phe Ser His Asp Leu Lys885 890 895Arg Lys Met Ile
Leu Gln Gln Phe900132821DNAHomo sapiens 13cgccccttcc cagccccaag
ggtctaggat acagtctttg tagatgagcg ggtccccctt 60ggaggacaga atgaagaatt
gggaaatcat ggccgttctg gagagtagac aagaagacgg 120cgaaagtcgg
gcctgccccg ccctgcggcc ccggaacaaa agaacgcgtg tgcgctggcc
180ctttaagagc gattctcctc cgcccgcgcc agctcggacc gcgggaaacc
cggcgcctgc 240actaccccgc ccggagattc ccttccgacg cccgcaccgc
ctccccgtca ctcattctag 300gcccgcacgg tgattggctt gcggctagcg
ggaggtgaag aaggccgcct tgtccgattg 360gcccgcacgc agtggcgccg
gtcacgtggg gggcgacgtt tcgcgccaat ttcggttggc 420cggccacagt
ccaccgcgcg gagattctca gcttccccag gagcaagacc tctgagcccg
480ccaagcgcgg ccgcacggcc ctcggcagcg atggcactga aggactacgc
gctagagaag 540gaaaaggtta agaagttctt acaagagttc taccaggatg
atgaactcgg gaagaagcag 600ttcaagtatg ggaaccagtt ggttcggctg
gctcatcggg aacaggtggc tctgtatgtg 660gacctggacg acgtagccga
ggatgacccc gagttggtgg actcaatttg tgagaatgcc 720aggcgctacg
cgaagctctt tgctgatgcc gtacaagagc tgctgcctca gtacaaggag
780agggaagtgg taaataaaga tgtcctggac gtttacattg agcatcggct
aatgatggag 840cagcggagtc gggaccctgg gatggtccga agcccccaga
accagtaccc tgctgaactc 900atgcgcagat ttgagctgta ttttcaaggc
cctagcagca acaagcctcg tgtgatccgg 960gaagtgcggg ctgactctgt
ggggaagttg gtaactgtgc gtggaatcgt cactcgtgtc 1020tctgaagtca
aacccaagat ggtggtggcc acttacactt gtgaccagtg tggggcagag
1080acctaccagc cgatccagtc tcccactttc atgcctctga tcatgtgccc
aagccaggag 1140tgccaaacca accgctcagg agggcggctg tatctgcaga
cacggggctc cagattcatc 1200aaattccagg agatgaagat gcaagaacat
agtgatcagg tgcctgtggg aaatatccct 1260cgtagtatca cggtgctggt
agaaggagag aacacaagga ttgcccagcc tggagaccac 1320gtcagcgtca
ctggtatttt cttgccaatc ctgcgcactg ggttccgaca ggtggtacag
1380ggtttactct cagaaaccta cctggaagcc catcggattg tgaagatgaa
caagagtgag 1440gatgatgagt ctggggctgg agagctcacc agggaggagc
tgaggcaaat tgcagaggag 1500gatttctacg aaaagctggc agcttcaatc
gccccagaaa tatacgggca tgaagatgtg 1560aagaaggcac tgctgctcct
gctagtcggg ggtgtggacc agtctcctcg aggcatgaaa 1620atccggggca
acatcaacat ctgtctgatg ggggatcctg gtgtggccaa gtctcagctc
1680ctgtcataca ttgatcgact ggcgcctcgc agccagtaca caacaggccg
gggctcctca 1740ggagtggggc ttacggcagc tgtgctgaga gactccgtga
gtggagaact gaccttagag 1800ggtggggccc tggtgctggc tgaccagggt
gtgtgctgca ttgatgagtt cgacaagatg 1860gctgaggccg accgcacagc
catccacgag gtcatggagc agcagaccat ctccattgcc 1920aaggccggca
ttctcaccac actcaatgcc cgctgctcca tcctggctgc cgccaaccct
1980gcctacgggc gctacaaccc tcgccgcagc ctggagcaga acatacagct
acctgctgca 2040ctgctctccc ggtttgacct cctctggctg attcaggacc
ggcccgaccg agacaatgac 2100ctacggttgg cccagcacat cacctatgtg
caccagcaca gccggcagcc cccctcccag 2160tttgaacctc tggacatgaa
gctcatgagg cgttacatag ccatgtgccg cgagaagcag 2220cccatggtgc
cagagtctct ggctgactac atcacagcag catacgtgga gatgaggcga
2280gaggcttggg ctagtaagga tgccacctat acttctgccc ggaccctgct
ggctatcctg 2340cgcctttcca ctgctctggc acgtctgaga atggtggatg
tggtggagaa agaagatgtg 2400aatgaagcca tcaggctaat ggagatgtca
aaggactctc ttctaggaga caaggggcag 2460acagctagga ctcagagacc
agcagatgtg atatttgcca ccgtccgtga actggtctca 2520gggggccgaa
gtgtccggtt ctctgaggca gagcagcgct gtgtatctcg tggcttcaca
2580cccgcccagt tccaggcggc tctggatgaa tatgaggagc tcaatgtctg
gcaggtcaat 2640gcttcccgga cacggatcac ttttgtctga ttccagcctg
cttgcaaccc tggggtcctc 2700ttgttccctg ctggcctgcc ccttgggaag
gggcagtgat gcctttgagg ggaaggagga 2760gcccctcttt ctcccatgct
gcacttactc cttttgctaa taaaagtgtt tgtagattgt 2820c 282114719PRTHomo
sapiens 14Met Ala Leu Lys Asp Tyr Ala Leu Glu Lys Glu Lys Val Lys
Lys Phe1 5 10 15Leu Gln Glu Phe Tyr Gln Asp Asp Glu Leu Gly Lys Lys
Gln Phe Lys20 25 30Tyr Gly Asn Gln Leu Val Arg Leu Ala His Arg Glu
Gln Val Ala Leu35 40 45Tyr Val Asp Leu Asp Asp Val Ala Glu Asp Asp
Pro Glu Leu Val Asp50 55 60Ser Ile Cys Glu Asn Ala Arg Arg Tyr Ala
Lys Leu Phe Ala Asp Ala65 70 75 80Val Gln Glu Leu Leu Pro Gln Tyr
Lys Glu Arg Glu Val Val Asn Lys85 90 95Asp Val Leu Asp Val Tyr Ile
Glu His Arg Leu Met Met Glu Gln Arg100 105 110Ser Arg Asp Pro Gly
Met Val Arg Ser Pro Gln Asn Gln Tyr Pro Ala115 120 125Glu Leu Met
Arg Arg Phe Glu Leu Tyr Phe Gln Gly Pro Ser Ser Asn130 135 140Lys
Pro Arg Val Ile Arg Glu Val Arg Ala Asp Ser Val Gly Lys Leu145 150
155 160Val Thr Val Arg Gly Ile Val Thr Arg Val Ser Glu Val Lys Pro
Lys165 170 175Met Val Val Ala Thr Tyr Thr Cys Asp Gln Cys Gly Ala
Glu Thr Tyr180 185 190Gln Pro Ile Gln Ser Pro Thr Phe Met Pro Leu
Ile Met Cys Pro Ser195 200 205Gln Glu Cys Gln Thr Asn Arg Ser Gly
Gly Arg Leu Tyr Leu Gln Thr210 215 220Arg Gly Ser Arg Phe Ile Lys
Phe Gln Glu Met Lys Met Gln Glu His225 230 235 240Ser Asp Gln Val
Pro Val Gly Asn Ile Pro Arg Ser Ile Thr Val Leu245 250 255Val Glu
Gly Glu Asn Thr Arg Ile Ala Gln Pro Gly Asp His Val Ser260 265
270Val Thr Gly Ile Phe Leu Pro Ile Leu Arg Thr Gly Phe Arg Gln
Val275 280 285Val Gln Gly Leu Leu Ser Glu Thr Tyr Leu Glu Ala His
Arg Ile Val290 295 300Lys Met Asn Lys Ser Glu Asp Asp Glu Ser Gly
Ala Gly Glu Leu Thr305 310 315 320Arg Glu Glu Leu Arg Gln Ile Ala
Glu Glu Asp Phe Tyr Glu Lys Leu325 330 335Ala Ala Ser Ile Ala Pro
Glu Ile Tyr Gly His Glu Asp Val Lys Lys340 345 350Ala Leu Leu Leu
Leu Leu Val Gly Gly Val Asp Gln Ser Pro Arg Gly355 360 365Met Lys
Ile Arg Gly Asn Ile Asn Ile Cys Leu Met Gly Asp Pro Gly370 375
380Val Ala Lys Ser Gln Leu Leu Ser Tyr Ile Asp Arg Leu Ala Pro
Arg385 390 395 400Ser Gln Tyr Thr Thr Gly Arg Gly Ser Ser Gly Val
Gly Leu Thr Ala405 410 415Ala Val Leu Arg Asp Ser Val Ser Gly Glu
Leu Thr Leu Glu Gly Gly420 425 430Ala Leu Val Leu Ala Asp Gln Gly
Val Cys Cys Ile Asp Glu Phe Asp435 440 445Lys Met Ala Glu Ala Asp
Arg Thr Ala Ile His Glu Val Met Glu Gln450 455 460Gln Thr Ile Ser
Ile Ala Lys Ala Gly Ile Leu Thr Thr Leu Asn Ala465 470 475 480Arg
Cys Ser Ile Leu Ala Ala Ala Asn Pro Ala Tyr Gly Arg Tyr Asn485 490
495Pro Arg Arg Ser Leu Glu Gln Asn Ile Gln Leu Pro Ala Ala Leu
Leu500 505 510Ser Arg Phe Asp Leu Leu Trp Leu Ile Gln Asp Arg Pro
Asp Arg Asp515 520 525Asn Asp Leu Arg Leu Ala Gln His Ile Thr Tyr
Val His Gln His Ser530 535 540Arg Gln Pro Pro Ser Gln Phe Glu Pro
Leu Asp Met Lys Leu Met Arg545 550 555 560Arg Tyr Ile Ala Met Cys
Arg Glu Lys Gln Pro Met Val Pro Glu Ser565 570 575Leu Ala Asp Tyr
Ile Thr Ala Ala Tyr Val Glu Met Arg Arg Glu Ala580 585 590Trp Ala
Ser Lys Asp Ala Thr Tyr Thr Ser Ala Arg Thr Leu Leu Ala595 600
605Ile Leu Arg Leu Ser Thr Ala Leu Ala Arg Leu Arg Met Val Asp
Val610 615 620Val Glu Lys Glu Asp Val Asn Glu Ala Ile Arg Leu Met
Glu Met Ser625 630 635 640Lys Asp Ser Leu Leu Gly Asp Lys Gly Gln
Thr Ala Arg Thr Gln Arg645 650 655Pro Ala Asp Val Ile Phe Ala Thr
Val Arg Glu Leu Val Ser Gly Gly660 665 670Arg Ser Val Arg Phe Ser
Glu Ala Glu Gln Arg Cys Val Ser Arg Gly675 680 685Phe Thr Pro Ala
Gln Phe Gln Ala Ala Leu Asp Glu Tyr Glu Glu Leu690 695 700Asn Val
Trp Gln Val Asn Ala Ser Arg Thr Arg Ile Thr Phe Val705 710
715152900DNAHomo sapiens 15agtgtcgtgt aaacagtgtc cttccgcgcg
gcggccgcgg agagagctgc ggcccggggg 60ggcgtgcctg ggatccggag cttcgctcgg
gcccgggaaa ggcggcagtg ggctgggatc 120gcggtgtctc tgggtgtgat
ggccaatggc tggactggct cccgccctgg gcggaggaat 180cccgagctgt
gaagcggctg gaatccgggc ccatgtgctt ctttgtttac taagagcgga
240agcgatggcg ggagcggggg tggggtgcgg tggcggggtg cggtggcgga
ggtcccggtg 300aaatcagggg ctaaggggac ccaaagaagg cgggggatca
taggggtgga aagaaagctg 360agaaccttga gaccggagtg tgaggggcca
acggggaagg gcgctagaat tttaaactaa 420agtagggacc ggaattcccc
tggggagatg ttggatggcc ctgtgcactg ccacgggctc 480tttattcttc
gctggttaga aacagacttg tgaaaaagag ttatgcccac tttggggaga
540cttcgaaaag gttaagaagt tcttacaaga gttctaccag gatgatgaac
tcgggaagaa 600gcagttcaag tatgggaacc agttggttcg gctggctcat
cgggaacagg tggctctgta 660tgtggacctg gacgacgtag ccgaggatga
ccccgagttg gtggactcaa tttgtgagaa 720tgccaggcgc tacgcgaagc
tctttgctga tgccgtacaa gagctgctgc ctcagtacaa 780ggagagggaa
gtggtaaata aagatgtcct ggacgtttac attgagcatc ggctaatgat
840ggagcagcgg agtcgggacc ctgggatggt ccgaagcccc cagaaccagt
accctgctga 900actcatgcgc agattgtgag tggtctctgt cgggaaagat
gtagggattg gttctccagg 960atcttgtttg tgactgtttt ctccccttag
tgagctgtat tttcaaggcc ctagcagcaa 1020caagcctcgt gtgatccggg
aagtgcgggc tgactctgtg gggaagttgg taactgtgcg 1080tggaatcgtc
actcgtgtct ctgaagtcaa acccaagatg gtggtggcca cttacacttg
1140tgaccagtgt ggggcagaga cctaccagcc gatccagtct cccactttca
tgcctctgat 1200catgtgccca agccaggagt gccaaaccaa ccgctcagga
gggcggctgt atctgcagac 1260acggggctcc agattcatca aattccagga
gatgaagatg caagaacata gtgatcaggt 1320gcctgtggga aatatccctc
gtagtatcac ggtgctggta gaaggagaga acacaaggat 1380tgcccagcct
ggagaccacg tcagcgtcac tggtattttc ttgccaatcc tgcgcactgg
1440gttccgacag gtggtacagg gtttactctc agaaacctac ctggaagccc
atcggattgt 1500gaagatgaac aagagtgagg atgatgagtc tggggctgga
gagctcacca gggaggagct 1560gaggcaaatt gcagaggagg atttctacga
aaagctggca gcttcaatcg ccccagaaat 1620atacgggcat gaagatgtga
agaaggcact gctgctcctg ctagtcgggg gtgtggacca 1680gtctcctcga
ggcatgaaaa tccggggcaa catcaacatc tgtctgatgg gggatcctgg
1740tgtggccaag tctcagctcc tgtcatacat tgatcgactg gcgcctcgca
gccagtacac 1800aacaggccgg ggctcctcag gagtggggct tacggcagct
gtgctgagag actccgtgag 1860tggagaactg accttagagg gtggggccct
ggtgctggct gaccagggtg tgtgctgcat 1920tgatgagttc gacaagatgg
ctgaggccga ccgcacagcc atccacgagg tcatggagca 1980gcagaccatc
tccattgcca aggccggcat tctcaccaca ctcaatgccc gctgctccat
2040cctggctgcc gccaaccctg cctacgggcg ctacaaccct cgccgcagcc
tggagcagaa 2100catacagcta cctgctgcac tgctctcccg gtttgacctc
ctctggctga ttcaggaccg 2160gcccgaccga gacaatgacc tacggttggc
ccagcacatc acctatgtgc accagcacag 2220ccggcagccc ccctcccagt
ttgaacctct ggacatgaag ctcatgaggc gttacatagc 2280catgtgccgc
gagaagcagc ccatggtgcc agagtctctg gctgactaca tcacagcagc
2340atacgtggag atgaggcgag aggcttgggc tagtaaggat gccacctata
cttctgcccg 2400gaccctgctg gctatcctgc gcctttccac tgctctggca
cgtctgagaa tggtggatgt 2460ggtggagaaa gaagatgtga atgaagccat
caggctaatg gagatgtcaa aggactctct 2520tctaggagac aaggggcaga
cagctaggac tcagagacca gcagatgtga tatttgccac 2580cgtccgtgaa
ctggtctcag ggggccgaag tgtccggttc tctgaggcag agcagcgctg
2640tgtatctcgt ggcttcacac ccgcccagtt ccaggcggct ctggatgaat
atgaggagct 2700caatgtctgg caggtcaatg cttcccggac acggatcact
tttgtctgat tccagcctgc 2760ttgcaaccct ggggtcctct tgttccctgc
tggcctgccc cttgggaagg ggcagtgatg 2820cctttgaggg gaaggaggag
cccctctttc tcccatgctg cacttactcc ttttgctaat 2880aaaagtgttt
gtagattgtc 290016543PRTHomo sapiens 16Met Val Val Ala Thr Tyr Thr
Cys Asp Gln Cys Gly Ala Glu Thr Tyr1 5 10 15Gln Pro Ile Gln Ser Pro
Thr Phe Met Pro Leu Ile Met Cys Pro Ser20 25 30Gln Glu Cys Gln Thr
Asn Arg Ser Gly Gly Arg Leu Tyr Leu Gln Thr35 40 45Arg Gly Ser Arg
Phe Ile Lys Phe Gln Glu Met Lys Met Gln Glu His50 55 60Ser Asp Gln
Val Pro Val Gly Asn Ile Pro Arg Ser Ile Thr Val Leu65 70 75 80Val
Glu Gly Glu Asn Thr Arg Ile Ala Gln Pro Gly Asp His Val Ser85 90
95Val Thr Gly Ile Phe Leu Pro Ile Leu Arg Thr Gly Phe Arg Gln
Val100 105 110Val Gln Gly Leu Leu Ser Glu Thr Tyr Leu Glu Ala His
Arg Ile Val115 120 125Lys Met Asn Lys Ser Glu Asp Asp Glu Ser Gly
Ala Gly Glu Leu Thr130 135 140Arg Glu Glu Leu Arg Gln Ile Ala Glu
Glu Asp Phe Tyr Glu Lys Leu145 150 155 160Ala Ala Ser Ile Ala Pro
Glu Ile Tyr Gly His Glu Asp Val Lys Lys165 170 175Ala Leu Leu Leu
Leu Leu Val Gly Gly Val Asp Gln Ser Pro Arg Gly180 185 190Met Lys
Ile Arg Gly Asn Ile Asn Ile Cys Leu Met Gly Asp Pro Gly195 200
205Val Ala Lys Ser Gln Leu Leu Ser Tyr Ile Asp Arg Leu Ala Pro
Arg210 215 220Ser Gln Tyr Thr Thr Gly Arg Gly Ser Ser Gly Val Gly
Leu Thr Ala225 230 235 240Ala Val Leu Arg Asp Ser Val Ser Gly Glu
Leu Thr Leu Glu Gly Gly245 250 255Ala Leu Val Leu Ala Asp Gln Gly
Val Cys Cys Ile Asp Glu Phe Asp260 265 270Lys Met Ala Glu Ala Asp
Arg Thr Ala Ile His Glu Val Met Glu Gln275 280 285Gln Thr Ile Ser
Ile Ala Lys Ala Gly Ile Leu Thr Thr Leu Asn Ala290 295 300Arg Cys
Ser Ile Leu Ala Ala Ala Asn Pro Ala Tyr Gly Arg Tyr Asn305 310 315
320Pro Arg Arg Ser Leu Glu Gln Asn Ile Gln Leu Pro Ala Ala Leu
Leu325 330 335Ser Arg Phe Asp Leu Leu Trp Leu Ile Gln Asp Arg Pro
Asp Arg Asp340 345 350Asn Asp Leu Arg Leu Ala Gln His Ile Thr Tyr
Val His Gln His Ser355 360 365Arg Gln Pro Pro Ser Gln Phe Glu Pro
Leu Asp Met Lys Leu Met Arg370 375 380Arg Tyr Ile Ala Met Cys Arg
Glu Lys Gln Pro Met Val Pro Glu Ser385 390 395 400Leu Ala Asp Tyr
Ile Thr Ala Ala Tyr Val Glu Met Arg Arg Glu Ala405 410 415Trp Ala
Ser Lys Asp Ala Thr Tyr Thr Ser Ala Arg Thr Leu Leu Ala420 425
430Ile Leu Arg Leu Ser Thr Ala Leu Ala Arg Leu Arg Met Val Asp
Val435 440 445Val Glu Lys Glu Asp Val Asn Glu Ala Ile Arg Leu Met
Glu Met Ser450 455 460Lys Asp Ser Leu Leu Gly Asp Lys Gly Gln Thr
Ala Arg Thr Gln Arg465 470 475 480Pro Ala Asp Val Ile Phe Ala Thr
Val Arg Glu Leu Val Ser Gly Gly485 490 495Arg Ser Val Arg Phe Ser
Glu Ala Glu Gln Arg Cys Val Ser Arg Gly500 505 510Phe Thr Pro Ala
Gln Phe Gln Ala Ala Leu Asp Glu Tyr Glu Glu Leu515 520 525Asn Val
Trp Gln Val Asn Ala Ser Arg Thr Arg Ile Thr Phe Val530 535
540172140DNAHomo sapiens 17agctgaggtg tgagcagctg ccgaagtcag
ttccttgtgg agccggagct gggcgcggat 60tcgccgaggc accgaggcac tcagaggagg
cgccatgtca gaaccggctg gggatgtccg 120tcagaaccca tgcggcagca
aggcctgccg ccgcctcttc ggcccagtgg acagcgagca 180gctgagccgc
gactgtgatg cgctaatggc gggctgcatc caggaggccc gtgagcgatg
240gaacttcgac tttgtcaccg agacaccact ggagggtgac ttcgcctggg
agcgtgtgcg 300gggccttggc ctgcccaagc tctaccttcc cacggggccc
cggcgaggcc gggatgagtt 360gggaggaggc aggcggcctg gcacctcacc
tgctctgctg caggggacag cagaggaaga 420ccatgtggac ctgtcactgt
cttgtaccct tgtgcctcgc tcaggggagc aggctgaagg 480gtccccaggt
ggacctggag actctcaggg tcgaaaacgg cggcagacca gcatgacaga
540tttctaccac tccaaacgcc ggctgatctt ctccaagagg aagccctaat
ccgcccacag 600gaagcctgca gtcctggaag cgcgagggcc tcaaaggccc
gctctacatc ttctgcctta 660gtctcagttt gtgtgtctta attattattt
gtgttttaat ttaaacacct cctcatgtac 720ataccctggc cgccccctgc
cccccagcct ctggcattag aattatttaa acaaaaacta 780ggcggttgaa
tgagaggttc ctaagagtgc tgggcatttt tattttatga aatactattt
840aaagcctcct catcccgtgt tctccttttc ctctctcccg gaggttgggt
gggccggctt 900catgccagct acttcctcct ccccacttgt ccgctgggtg
gtaccctctg gaggggtgtg 960gctccttccc atcgctgtca caggcggtta
tgaaattcac cccctttcct ggacactcag
1020acctgaattc tttttcattt gagaagtaaa cagatggcac tttgaagggg
cctcaccgag 1080tgggggcatc atcaaaaact ttggagtccc ctcacctcct
ctaaggttgg gcagggtgac 1140cctgaagtga gcacagccta gggctgagct
ggggacctgg taccctcctg gctcttgata 1200cccccctctg tcttgtgaag
gcagggggaa ggtggggtac tggagcagac caccccgcct 1260gccctcatgg
cccctctgac ctgcactggg gagcccgtct cagtgttgag ccttttccct
1320ctttggctcc cctgtacctt ttgaggagcc ccagcttacc cttcttctcc
agctgggctc 1380tgcaattccc ctctgctgct gtccctcccc cttgtctttc
ccttcagtac cctctcatgc 1440tccaggtggc tctgaggtgc ctgtcccacc
cccaccccca gctcaatgga ctggaagggg 1500aagggacaca caagaagaag
ggcaccctag ttctacctca ggcagctcaa gcagcgaccg 1560ccccctcctc
tagctgtggg ggtgagggtc ccatgtggtg gcacaggccc ccttgagtgg
1620ggttatctct gtgttagggg tatatgatgg gggagtagat ctttctagga
gggagacact 1680ggcccctcaa atcgtccagc gaccttcctc atccacccca
tccctcccca gttcattgca 1740ctttgattag cagcggaaca aggagtcaga
cattttaaga tggtggcagt agaggctatg 1800gacagggcat gccacgtggg
ctcatatggg gctgggagta gttgtctttc ctggcactaa 1860cgttgagccc
ctggaggcac tgaagtgctt agtgtacttg gagtattggg gtctgacccc
1920aaacaccttc cagctcctgt aacatactgg cctggactgt tttctctcgg
ctccccatgt 1980gtcctggttc ccgtttctcc acctagactg taaacctctc
gagggcaggg accacaccct 2040gtactgttct gtgtctttca cagctcctcc
cacaatgctg aatatacagc aggtgctcaa 2100taaatgattc ttagtgactt
taaaaaaaaa aaaaaaaaaa 214018164PRTHomo sapiens 18Met Ser Glu Pro
Ala Gly Asp Val Arg Gln Asn Pro Cys Gly Ser Lys1 5 10 15Ala Cys Arg
Arg Leu Phe Gly Pro Val Asp Ser Glu Gln Leu Ser Arg20 25 30Asp Cys
Asp Ala Leu Met Ala Gly Cys Ile Gln Glu Ala Arg Glu Arg35 40 45Trp
Asn Phe Asp Phe Val Thr Glu Thr Pro Leu Glu Gly Asp Phe Ala50 55
60Trp Glu Arg Val Arg Gly Leu Gly Leu Pro Lys Leu Tyr Leu Pro Thr65
70 75 80Gly Pro Arg Arg Gly Arg Asp Glu Leu Gly Gly Gly Arg Arg Pro
Gly85 90 95Thr Ser Pro Ala Leu Leu Gln Gly Thr Ala Glu Glu Asp His
Val Asp100 105 110Leu Ser Leu Ser Cys Thr Leu Val Pro Arg Ser Gly
Glu Gln Ala Glu115 120 125Gly Ser Pro Gly Gly Pro Gly Asp Ser Gln
Gly Arg Lys Arg Arg Gln130 135 140Thr Ser Met Thr Asp Phe Tyr His
Ser Lys Arg Arg Leu Ile Phe Ser145 150 155 160Lys Arg Lys
Pro192281DNAHomo sapiens 19agctgaggtg tgagcagctg ccgaagtcag
ttccttgtgg agccggagct gggcgcggat 60tcgccgaggc accgaggcac tcagaggagg
tgagagagcg gcggcagaca acaggggacc 120ccgggccggc ggcccagagc
cgagccaagc gtgcccgcgt gtgtccctgc gtgtccgcga 180ggatgcgtgt
tcgcgggtgt gtgctgcgtt cacaggtgtt tctgcggcag gcgccatgtc
240agaaccggct ggggatgtcc gtcagaaccc atgcggcagc aaggcctgcc
gccgcctctt 300cggcccagtg gacagcgagc agctgagccg cgactgtgat
gcgctaatgg cgggctgcat 360ccaggaggcc cgtgagcgat ggaacttcga
ctttgtcacc gagacaccac tggagggtga 420cttcgcctgg gagcgtgtgc
ggggccttgg cctgcccaag ctctaccttc ccacggggcc 480ccggcgaggc
cgggatgagt tgggaggagg caggcggcct ggcacctcac ctgctctgct
540gcaggggaca gcagaggaag accatgtgga cctgtcactg tcttgtaccc
ttgtgcctcg 600ctcaggggag caggctgaag ggtccccagg tggacctgga
gactctcagg gtcgaaaacg 660gcggcagacc agcatgacag atttctacca
ctccaaacgc cggctgatct tctccaagag 720gaagccctaa tccgcccaca
ggaagcctgc agtcctggaa gcgcgagggc ctcaaaggcc 780cgctctacat
cttctgcctt agtctcagtt tgtgtgtctt aattattatt tgtgttttaa
840tttaaacacc tcctcatgta cataccctgg ccgccccctg ccccccagcc
tctggcatta 900gaattattta aacaaaaact aggcggttga atgagaggtt
cctaagagtg ctgggcattt 960ttattttatg aaatactatt taaagcctcc
tcatcccgtg ttctcctttt cctctctccc 1020ggaggttggg tgggccggct
tcatgccagc tacttcctcc tccccacttg tccgctgggt 1080ggtaccctct
ggaggggtgt ggctccttcc catcgctgtc acaggcggtt atgaaattca
1140ccccctttcc tggacactca gacctgaatt ctttttcatt tgagaagtaa
acagatggca 1200ctttgaaggg gcctcaccga gtgggggcat catcaaaaac
tttggagtcc cctcacctcc 1260tctaaggttg ggcagggtga ccctgaagtg
agcacagcct agggctgagc tggggacctg 1320gtaccctcct ggctcttgat
acccccctct gtcttgtgaa ggcaggggga aggtggggtc 1380ctggagcaga
ccaccccgcc tgccctcatg gcccctctga cctgcactgg ggagcccgtc
1440tcagtgttga gccttttccc tctttggctc ccctgtacct tttgaggagc
cccagctacc 1500cttcttctcc agctgggctc tgcaattccc ctctgctgct
gtccctcccc cttgtccttt 1560cccttcagta ccctctcagc tccaggtggc
tctgaggtgc ctgtcccacc cccaccccca 1620gctcaatgga ctggaagggg
aagggacaca caagaagaag ggcaccctag ttctacctca 1680ggcagctcaa
gcagcgaccg ccccctcctc tagctgtggg ggtgagggtc ccatgtggtg
1740gcacaggccc ccttgagtgg ggttatctct gtgttagggg tatatgatgg
gggagtagat 1800ctttctagga gggagacact ggcccctcaa atcgtccagc
gaccttcctc atccacccca 1860tccctcccca gttcattgca ctttgattag
cagcggaaca aggagtcaga cattttaaga 1920tggtggcagt agaggctatg
gacagggcat gccacgtggg ctcatatggg gctgggagta 1980gttgtctttc
ctggcactaa cgttgagccc ctggaggcac tgaagtgctt agtgtacttg
2040gagtattggg gtctgacccc aaacaccttc cagctcctgt aacatactgg
cctggactgt 2100tttctctcgg ctccccatgt gtcctggttc ccgtttctcc
acctagactg taaacctctc 2160gagggcaggg accacaccct gtactgttct
gtgtctttca cagctcctcc cacaatgctg 2220aatatacagc aggtgctcaa
taaatgattc ttagtgactt taaaaaaaaa aaaaaaaaaa 2280a 228120164PRTHomo
sapiens 20Met Ser Glu Pro Ala Gly Asp Val Arg Gln Asn Pro Cys Gly
Ser Lys1 5 10 15Ala Cys Arg Arg Leu Phe Gly Pro Val Asp Ser Glu Gln
Leu Ser Arg20 25 30Asp Cys Asp Ala Leu Met Ala Gly Cys Ile Gln Glu
Ala Arg Glu Arg35 40 45Trp Asn Phe Asp Phe Val Thr Glu Thr Pro Leu
Glu Gly Asp Phe Ala50 55 60Trp Glu Arg Val Arg Gly Leu Gly Leu Pro
Lys Leu Tyr Leu Pro Thr65 70 75 80Gly Pro Arg Arg Gly Arg Asp Glu
Leu Gly Gly Gly Arg Arg Pro Gly85 90 95Thr Ser Pro Ala Leu Leu Gln
Gly Thr Ala Glu Glu Asp His Val Asp100 105 110Leu Ser Leu Ser Cys
Thr Leu Val Pro Arg Ser Gly Glu Gln Ala Glu115 120 125Gly Ser Pro
Gly Gly Pro Gly Asp Ser Gln Gly Arg Lys Arg Arg Gln130 135 140Thr
Ser Met Thr Asp Phe Tyr His Ser Lys Arg Arg Leu Ile Phe Ser145 150
155 160Lys Arg Lys Pro211275DNAHomo sapiens 21cctccctacg ggcgcctccg
gcagcccttc ccgcgtgcgc agggctcaga gccgttccga 60gatcttggag gtccgggtgg
gagtgggggt ggggtggggg tgggggtgaa ggtggggggc 120gggcgcgctc
agggaaggcg ggtgcgcgcc tgcggggcgg agatgggcag ggggcggtgc
180gtgggtccca gtctgcagtt aagggggcag gagtggcgct gctcacctct
ggtgccaaag 240ggcggcgcag cggctgccga gctcggccct ggaggcggcg
agaacatggt gcgcaggttc 300ttggtgaccc tccggattcg gcgcgcgtgc
ggcccgccgc gagtgagggt tttcgtggtt 360cacatcccgc ggctcacggg
ggagtgggca gcgccagggg cgcccgccgc tgtggccctc 420gtgctgatgc
tactgaggag ccagcgtcta gggcagcagc cgcttcctag aagaccaggt
480catgatgatg ggcagcgccc gagtggcgga gctgctgctg ctccacggcg
cggagcccaa 540ctgcgccgac cccgccactc tcacccgacc cgtgcacgac
gctgcccggg agggcttcct 600ggacacgctg gtggtgctgc accgggccgg
ggcgcggctg gacgtgcgcg atgcctgggg 660ccgtctgccc gtggacctgg
ctgaggagct gggccatcgc gatgtcgcac ggtacctgcg 720cgcggctgcg
gggggcacca gaggcagtaa ccatgcccgc atagatgccg cggaaggtcc
780ctcagacatc cccgattgaa agaaccagag aggctctgag aaacctcggg
aaacttagat 840catcagtcac cgaaggtcct acagggccac aactgccccc
gccacaaccc accccgcttt 900cgtagttttc atttagaaaa tagagctttt
aaaaatgtcc tgccttttaa cgtagatata 960tgccttcccc cactaccgta
aatgtccatt tatatcattt tttatatatt cttataaaaa 1020tgtaaaaaag
aaaaacaccg cttctgcctt ttcactgtgt tggagttttc tggagtgagc
1080actcacgccc taagcgcaca ttcatgtggg catttcttgc gagcctcgca
gcctccggaa 1140gctgtcgact tcatgacaag cattttgtga actagggaag
ctcagggggg ttactggctt 1200ctcttgagtc acactgctag caaatggcag
aaccaaagct caaataaaaa taaaataatt 1260ttcattcatt cactc
127522173PRTHomo sapiens 22Met Gly Arg Gly Arg Cys Val Gly Pro Ser
Leu Gln Leu Arg Gly Gln1 5 10 15Glu Trp Arg Cys Ser Pro Leu Val Pro
Lys Gly Gly Ala Ala Ala Ala20 25 30Glu Leu Gly Pro Gly Gly Gly Glu
Asn Met Val Arg Arg Phe Leu Val35 40 45Thr Leu Arg Ile Arg Arg Ala
Cys Gly Pro Pro Arg Val Arg Val Phe50 55 60Val Val His Ile Pro Arg
Leu Thr Gly Glu Trp Ala Ala Pro Gly Ala65 70 75 80Pro Ala Ala Val
Ala Leu Val Leu Met Leu Leu Arg Ser Gln Arg Leu85 90 95Gly Gln Gln
Pro Leu Pro Arg Arg Pro Gly His Asp Asp Gly Gln Arg100 105 110Pro
Ser Gly Gly Ala Ala Ala Ala Pro Arg Arg Gly Ala Gln Leu Arg115 120
125Arg Pro Arg His Ser His Pro Thr Arg Ala Arg Arg Cys Pro Gly
Gly130 135 140Leu Pro Gly His Ala Gly Gly Ala Ala Pro Gly Arg Gly
Ala Ala Gly145 150 155 160Arg Ala Arg Cys Leu Gly Pro Ser Ala Arg
Gly Pro Gly165 170235698DNAHomo sapiens 23aggttcaagt ggagctctcc
taaccgacgc gcgtctgtgg agaagcggct tggtcggggg 60tggtctcgtg gggtcctgcc
tgtttagtcg ctttcagggt tcttgagccc cttcacgacc 120gtcaccatgg
aagtgtcacc attgcagcct gtaaatgaaa atatgcaagt caacaaaata
180aagaaaaatg aagatgctaa gaaaagactg tctgttgaaa gaatctatca
aaagaaaaca 240caattggaac atattttgct ccgcccagac acctacattg
gttctgtgga attagtgacc 300cagcaaatgt gggtttacga tgaagatgtt
ggcattaact atagggaagt cacttttgtt 360cctggtttgt acaaaatctt
tgatgagatt ctagttaatg ctgcggacaa caaacaaagg 420gacccaaaaa
tgtcttgtat tagagtcaca attgatccgg aaaacaattt aattagtata
480tggaataatg gaaaaggtat tcctgttgtt gaacacaaag ttgaaaagat
gtatgtccca 540gctctcatat ttggacagct cctaacttct agtaactatg
atgatgatga aaagaaagtg 600acaggtggtc gaaatggcta tggagccaaa
ttgtgtaaca tattcagtac caaatttact 660gtggaaacag ccagtagaga
atacaagaaa atgttcaaac agacatggat ggataatatg 720ggaagagctg
gtgagatgga actcaagccc ttcaatggag aagattatac atgtatcacc
780tttcagcctg atttgtctaa gtttaaaatg caaagcctgg acaaagatat
tgttgcacta 840atggtcagaa gagcatatga tattgctgga tccaccaaag
atgtcaaagt ctttcttaat 900ggaaataaac tgccagtaaa aggatttcgt
agttatgtgg acatgtattt gaaggacaag 960ttggatgaaa ctggtaactc
cttgaaagta atacatgaac aagtaaacca caggtgggaa 1020gtgtgtttaa
ctatgagtga aaaaggcttt cagcaaatta gctttgtcaa cagcattgct
1080acatccaagg gtggcagaca tgttgattat gtagctgatc agattgtgac
taaacttgtt 1140gatgttgtga agaagaagaa caagggtggt gttgcagtaa
aagcacatca ggtgaaaaat 1200cacatgtgga tttttgtaaa tgccttaatt
gaaaacccaa cctttgactc tcagacaaaa 1260gaaaacatga ctttacaacc
caagagcttt ggatcaacat gccaattgag tgaaaaattt 1320atcaaagctg
ccattggctg tggtattgta gaaagcatac taaactgggt gaagtttaag
1380gcccaagtcc agttaaacaa gaagtgttca gctgtaaaac ataatagaat
caagggaatt 1440cccaaactcg atgatgccaa tgatgcaggg ggccgaaact
ccactgagtg tacgcttatc 1500ctgactgagg gagattcagc caaaactttg
gctgtttcag gccttggtgt ggttgggaga 1560gacaaatatg gggttttccc
tcttagagga aaaatactca atgttcgaga agcttctcat 1620aagcagatca
tggaaaatgc tgagattaac aatatcatca agattgtggg tcttcagtac
1680aagaaaaact atgaagatga agattcattg aagacgcttc gttatgggaa
gataatgatt 1740atgacagatc aggaccaaga tggttcccac atcaaaggct
tgctgattaa ttttatccat 1800cacaactggc cctctcttct gcgacatcgt
tttctggagg aatttatcac tcccattgta 1860aaggtatcta aaaacaagca
agaaatggca ttttacagcc ttcctgaatt tgaagagtgg 1920aagagttcta
ctccaaatca taaaaaatgg aaagtcaaat attacaaagg tttgggcacc
1980agcacatcaa aggaagctaa agaatacttt gcagatatga aaagacatcg
tatccagttc 2040aaatattctg gtcctgaaga tgatgctgct atcagcctgg
cctttagcaa aaaacagata 2100gatgatcgaa aggaatggtt aactaatttc
atggaggata gaagacaacg aaagttactt 2160gggcttcctg aggattactt
gtatggacaa actaccacat atctgacata taatgacttc 2220atcaacaagg
aacttatctt gttctcaaat tctgataacg agagatctat cccttctatg
2280gtggatggtt tgaaaccagg tcagagaaag gttttgttta cttgcttcaa
acggaatgac 2340aagcgagaag taaaggttgc ccaattagct ggatcagtgg
ctgaaatgtc ttcttatcat 2400catggtgaga tgtcactaat gatgaccatt
atcaatttgg ctcagaattt tgtgggtagc 2460aataatctaa acctcttgca
gcccattggt cagtttggta ccaggctaca tggtggcaag 2520gattctgcta
gtccacgata catctttaca atgctcagct ctttggctcg attgttattt
2580ccaccaaaag atgatcacac gttgaagttt ttatatgatg acaaccagcg
tgttgagcct 2640gaatggtaca ttcctattat tcccatggtg ctgataaatg
gtgctgaagg aatcggtact 2700gggtggtcct gcaaaatccc caactttgat
gtgcgtgaaa ttgtaaataa catcaggcgt 2760ttgatggatg gagaagaacc
tttgccaatg cttccaagtt acaagaactt caagggtact 2820attgaagaac
tggctccaaa tcaatatgtg attagtggtg aagtagctat tcttaattct
2880acaaccattg aaatctcaga gcttcccgtc agaacatgga cccagacata
caaagaacaa 2940gttctagaac ccatgttgaa tggcaccgag aagacacctc
ctctcataac agactatagg 3000gaataccata cagataccac tgtgaaattt
gttgtgaaga tgactgaaga aaaactggca 3060gaggcagaga gagttggact
acacaaagtc ttcaaactcc aaactagtct cacatgcaac 3120tctatggtgc
tttttgacca cgtaggctgt ttaaagaaat atgacacggt gttggatatt
3180ctaagagact tttttgaact cagacttaaa tattatggat taagaaaaga
atggctccta 3240ggaatgcttg gtgctgaatc tgctaaactg aataatcagg
ctcgctttat cttagagaaa 3300atagatggca aaataatcat tgaaaataag
cctaagaaag aattaattaa agttctgatt 3360cagaggggat atgattcgga
tcctgtgaag gcctggaaag aagcccagca aaaggttcca 3420gatgaagaag
aaaatgaaga gagtgacaac gaaaaggaaa ctgaaaagag tgactccgta
3480acagattctg gaccaacctt caactatctt cttgatatgc ccctttggta
tttaaccaag 3540gaaaagaaag atgaactctg caggctaaga aatgaaaaag
aacaagagct ggacacatta 3600aaaagaaaga gtccatcaga tttgtggaaa
gaagacttgg ctacatttat tgaagaattg 3660gaggctgttg aagccaagga
aaaacaagat gaacaagtcg gacttcctgg gaaagggggg 3720aaggccaagg
ggaaaaaaac acaaatggct gaagttttgc cttctccgcg tggtcaaaga
3780gtcattccac gaataaccat agaaatgaaa gcagaggcag aaaagaaaaa
taaaaagaaa 3840attaagaatg aaaatactga aggaagccct caagaagatg
gtgtggaact agaaggccta 3900aaacaaagat tagaaaagaa acagaaaaga
gaaccaggta caaagacaaa gaaacaaact 3960acattggcat ttaagccaat
caaaaaagga aagaagagaa atccctggtc tgattcagaa 4020tcagatagga
gcagtgacga aagtaatttt gatgtccctc cacgagaaac agagccacgg
4080agagcagcaa caaaaacaaa attcacaatg gatttggatt cagatgaaga
tttctcagat 4140tttgatgaaa aaactgatga tgaagatttt gtcccatcag
atgctagtcc acctaagacc 4200aaaacttccc caaaacttag taacaaagaa
ctgaaaccac agaaaagtgt cgtgtcagac 4260cttgaagctg atgatgttaa
gggcagtgta ccactgtctt caagccctcc tgctacacat 4320ttcccagatg
aaactgaaat tacaaaccca gttcctaaaa agaatgtgac agtgaagaag
4380acagcagcaa aaagtcagtc ttccacctcc actaccggtg ccaaaaaaag
ggctgcccca 4440aaaggaacta aaagggatcc agctttgaat tctggtgtct
ctcaaaagcc tgatcctgcc 4500aaaaccaaga atcgccgcaa aaggaagcca
tccacttctg atgattctga ctctaatttt 4560gagaaaattg tttcgaaagc
agtcacaagc aagaaatcca agggggagag tgatgacttc 4620catatggact
ttgactcagc tgtggctcct cgggcaaaat ctgtacgggc aaagaaacct
4680ataaagtacc tggaagagtc agatgaagat gatctgtttt aaaatgtgag
gcgattattt 4740taagtaatta tcttaccaag cccaagactg gttttaaagt
tacctgaagc tcttaacttc 4800ctcccctctg aatttagttt ggggaaggtg
tttttagtac aagacatcaa agtgaagtaa 4860agcccaagtg ttctttagct
ttttataata ctgtctaaat agtgaccatc tcatgggcat 4920tgttttcttc
tctgctttgt ctgtgttttg agtctgcttt cttttgtctt taaaacctga
4980tttttaagtt cttctgaact gtagaaatag ctatctgatc acttcagcgt
aaagcagtgt 5040gtttattaac catccactaa gctaaaacta gagcagtttg
atttaaaagt gtcactcttc 5100ctccttttct actttcagta gatatgagat
agagcataat tatctgtttt atcttagttt 5160tatacataat ttaccatcag
atagaacttt atggttctag tacagatact ctactacact 5220cagcctctta
tgtgccaagt ttttctttaa gcaatgagaa attgctcatg ttcttcatct
5280tctcaaatca tcagaggcca aagaaaaaca ctttggctgt gtctataact
tgacacagtc 5340aatagaatga agaaaattag agtagttatg tgattatttc
agctcttgac ctgtcccctc 5400tggctgcctc tgagtctgaa tctcccaaag
agagaaacca atttctaaga ggactggatt 5460gcagaagact cggggacaac
atttgatcca agatcttaaa tgttatattg ataaccatgc 5520tcagcaatga
gctattagat tcattttggg aaatctccat aatttcaatt tgtaaacttt
5580gttaagacct gtctacattg ttatatgtgt gtgacttgag taatgttatc
aacgtttttg 5640taaatattta ctatgttttt ctattagcta aattccaaca
attttgtact ttaataaa 5698241531PRTHomo sapiens 24Met Glu Val Ser Pro
Leu Gln Pro Val Asn Glu Asn Met Gln Val Asn1 5 10 15Lys Ile Lys Lys
Asn Glu Asp Ala Lys Lys Arg Leu Ser Val Glu Arg20 25 30Ile Tyr Gln
Lys Lys Thr Gln Leu Glu His Ile Leu Leu Arg Pro Asp35 40 45Thr Tyr
Ile Gly Ser Val Glu Leu Val Thr Gln Gln Met Trp Val Tyr50 55 60Asp
Glu Asp Val Gly Ile Asn Tyr Arg Glu Val Thr Phe Val Pro Gly65 70 75
80Leu Tyr Lys Ile Phe Asp Glu Ile Leu Val Asn Ala Ala Asp Asn Lys85
90 95Gln Arg Asp Pro Lys Met Ser Cys Ile Arg Val Thr Ile Asp Pro
Glu100 105 110Asn Asn Leu Ile Ser Ile Trp Asn Asn Gly Lys Gly Ile
Pro Val Val115 120 125Glu His Lys Val Glu Lys Met Tyr Val Pro Ala
Leu Ile Phe Gly Gln130 135 140Leu Leu Thr Ser Ser Asn Tyr Asp Asp
Asp Glu Lys Lys Val Thr Gly145 150 155 160Gly Arg Asn Gly Tyr Gly
Ala Lys Leu Cys Asn Ile Phe Ser Thr Lys165 170 175Phe Thr Val Glu
Thr Ala Ser Arg Glu Tyr Lys Lys Met Phe Lys Gln180 185 190Thr Trp
Met Asp Asn Met Gly Arg Ala Gly Glu Met Glu Leu Lys Pro195 200
205Phe Asn Gly Glu Asp Tyr Thr Cys Ile Thr Phe Gln Pro Asp Leu
Ser210 215 220Lys Phe Lys Met Gln Ser Leu Asp Lys Asp Ile Val Ala
Leu Met Val225 230 235 240Arg Arg Ala Tyr Asp Ile Ala Gly Ser Thr
Lys Asp Val Lys Val Phe245 250 255Leu Asn Gly Asn Lys Leu Pro Val
Lys Gly Phe Arg Ser Tyr Val Asp260 265 270Met Tyr Leu Lys Asp Lys
Leu Asp Glu Thr Gly Asn Ser Leu Lys Val275
280 285Ile His Glu Gln Val Asn His Arg Trp Glu Val Cys Leu Thr Met
Ser290 295 300Glu Lys Gly Phe Gln Gln Ile Ser Phe Val Asn Ser Ile
Ala Thr Ser305 310 315 320Lys Gly Gly Arg His Val Asp Tyr Val Ala
Asp Gln Ile Val Thr Lys325 330 335Leu Val Asp Val Val Lys Lys Lys
Asn Lys Gly Gly Val Ala Val Lys340 345 350Ala His Gln Val Lys Asn
His Met Trp Ile Phe Val Asn Ala Leu Ile355 360 365Glu Asn Pro Thr
Phe Asp Ser Gln Thr Lys Glu Asn Met Thr Leu Gln370 375 380Pro Lys
Ser Phe Gly Ser Thr Cys Gln Leu Ser Glu Lys Phe Ile Lys385 390 395
400Ala Ala Ile Gly Cys Gly Ile Val Glu Ser Ile Leu Asn Trp Val
Lys405 410 415Phe Lys Ala Gln Val Gln Leu Asn Lys Lys Cys Ser Ala
Val Lys His420 425 430Asn Arg Ile Lys Gly Ile Pro Lys Leu Asp Asp
Ala Asn Asp Ala Gly435 440 445Gly Arg Asn Ser Thr Glu Cys Thr Leu
Ile Leu Thr Glu Gly Asp Ser450 455 460Ala Lys Thr Leu Ala Val Ser
Gly Leu Gly Val Val Gly Arg Asp Lys465 470 475 480Tyr Gly Val Phe
Pro Leu Arg Gly Lys Ile Leu Asn Val Arg Glu Ala485 490 495Ser His
Lys Gln Ile Met Glu Asn Ala Glu Ile Asn Asn Ile Ile Lys500 505
510Ile Val Gly Leu Gln Tyr Lys Lys Asn Tyr Glu Asp Glu Asp Ser
Leu515 520 525Lys Thr Leu Arg Tyr Gly Lys Ile Met Ile Met Thr Asp
Gln Asp Gln530 535 540Asp Gly Ser His Ile Lys Gly Leu Leu Ile Asn
Phe Ile His His Asn545 550 555 560Trp Pro Ser Leu Leu Arg His Arg
Phe Leu Glu Glu Phe Ile Thr Pro565 570 575Ile Val Lys Val Ser Lys
Asn Lys Gln Glu Met Ala Phe Tyr Ser Leu580 585 590Pro Glu Phe Glu
Glu Trp Lys Ser Ser Thr Pro Asn His Lys Lys Trp595 600 605Lys Val
Lys Tyr Tyr Lys Gly Leu Gly Thr Ser Thr Ser Lys Glu Ala610 615
620Lys Glu Tyr Phe Ala Asp Met Lys Arg His Arg Ile Gln Phe Lys
Tyr625 630 635 640Ser Gly Pro Glu Asp Asp Ala Ala Ile Ser Leu Ala
Phe Ser Lys Lys645 650 655Gln Ile Asp Asp Arg Lys Glu Trp Leu Thr
Asn Phe Met Glu Asp Arg660 665 670Arg Gln Arg Lys Leu Leu Gly Leu
Pro Glu Asp Tyr Leu Tyr Gly Gln675 680 685Thr Thr Thr Tyr Leu Thr
Tyr Asn Asp Phe Ile Asn Lys Glu Leu Ile690 695 700Leu Phe Ser Asn
Ser Asp Asn Glu Arg Ser Ile Pro Ser Met Val Asp705 710 715 720Gly
Leu Lys Pro Gly Gln Arg Lys Val Leu Phe Thr Cys Phe Lys Arg725 730
735Asn Asp Lys Arg Glu Val Lys Val Ala Gln Leu Ala Gly Ser Val
Ala740 745 750Glu Met Ser Ser Tyr His His Gly Glu Met Ser Leu Met
Met Thr Ile755 760 765Ile Asn Leu Ala Gln Asn Phe Val Gly Ser Asn
Asn Leu Asn Leu Leu770 775 780Gln Pro Ile Gly Gln Phe Gly Thr Arg
Leu His Gly Gly Lys Asp Ser785 790 795 800Ala Ser Pro Arg Tyr Ile
Phe Thr Met Leu Ser Ser Leu Ala Arg Leu805 810 815Leu Phe Pro Pro
Lys Asp Asp His Thr Leu Lys Phe Leu Tyr Asp Asp820 825 830Asn Gln
Arg Val Glu Pro Glu Trp Tyr Ile Pro Ile Ile Pro Met Val835 840
845Leu Ile Asn Gly Ala Glu Gly Ile Gly Thr Gly Trp Ser Cys Lys
Ile850 855 860Pro Asn Phe Asp Val Arg Glu Ile Val Asn Asn Ile Arg
Arg Leu Met865 870 875 880Asp Gly Glu Glu Pro Leu Pro Met Leu Pro
Ser Tyr Lys Asn Phe Lys885 890 895Gly Thr Ile Glu Glu Leu Ala Pro
Asn Gln Tyr Val Ile Ser Gly Glu900 905 910Val Ala Ile Leu Asn Ser
Thr Thr Ile Glu Ile Ser Glu Leu Pro Val915 920 925Arg Thr Trp Thr
Gln Thr Tyr Lys Glu Gln Val Leu Glu Pro Met Leu930 935 940Asn Gly
Thr Glu Lys Thr Pro Pro Leu Ile Thr Asp Tyr Arg Glu Tyr945 950 955
960His Thr Asp Thr Thr Val Lys Phe Val Val Lys Met Thr Glu Glu
Lys965 970 975Leu Ala Glu Ala Glu Arg Val Gly Leu His Lys Val Phe
Lys Leu Gln980 985 990Thr Ser Leu Thr Cys Asn Ser Met Val Leu Phe
Asp His Val Gly Cys995 1000 1005Leu Lys Lys Tyr Asp Thr Val Leu Asp
Ile Leu Arg Asp Phe Phe Glu1010 1015 1020Leu Arg Leu Lys Tyr Tyr
Gly Leu Arg Lys Glu Trp Leu Leu Gly Met1025 1030 1035 1040Leu Gly
Ala Glu Ser Ala Lys Leu Asn Asn Gln Ala Arg Phe Ile Leu1045 1050
1055Glu Lys Ile Asp Gly Lys Ile Ile Ile Glu Asn Lys Pro Lys Lys
Glu1060 1065 1070Leu Ile Lys Val Leu Ile Gln Arg Gly Tyr Asp Ser
Asp Pro Val Lys1075 1080 1085Ala Trp Lys Glu Ala Gln Gln Lys Val
Pro Asp Glu Glu Glu Asn Glu1090 1095 1100Glu Ser Asp Asn Glu Lys
Glu Thr Glu Lys Ser Asp Ser Val Thr Asp1105 1110 1115 1120Ser Gly
Pro Thr Phe Asn Tyr Leu Leu Asp Met Pro Leu Trp Tyr Leu1125 1130
1135Thr Lys Glu Lys Lys Asp Glu Leu Cys Arg Leu Arg Asn Glu Lys
Glu1140 1145 1150Gln Glu Leu Asp Thr Leu Lys Arg Lys Ser Pro Ser
Asp Leu Trp Lys1155 1160 1165Glu Asp Leu Ala Thr Phe Ile Glu Glu
Leu Glu Ala Val Glu Ala Lys1170 1175 1180Glu Lys Gln Asp Glu Gln
Val Gly Leu Pro Gly Lys Gly Gly Lys Ala1185 1190 1195 1200Lys Gly
Lys Lys Thr Gln Met Ala Glu Val Leu Pro Ser Pro Arg Gly1205 1210
1215Gln Arg Val Ile Pro Arg Ile Thr Ile Glu Met Lys Ala Glu Ala
Glu1220 1225 1230Lys Lys Asn Lys Lys Lys Ile Lys Asn Glu Asn Thr
Glu Gly Ser Pro1235 1240 1245Gln Glu Asp Gly Val Glu Leu Glu Gly
Leu Lys Gln Arg Leu Glu Lys1250 1255 1260Lys Gln Lys Arg Glu Pro
Gly Thr Lys Thr Lys Lys Gln Thr Thr Leu1265 1270 1275 1280Ala Phe
Lys Pro Ile Lys Lys Gly Lys Lys Arg Asn Pro Trp Ser Asp1285 1290
1295Ser Glu Ser Asp Arg Ser Ser Asp Glu Ser Asn Phe Asp Val Pro
Pro1300 1305 1310Arg Glu Thr Glu Pro Arg Arg Ala Ala Thr Lys Thr
Lys Phe Thr Met1315 1320 1325Asp Leu Asp Ser Asp Glu Asp Phe Ser
Asp Phe Asp Glu Lys Thr Asp1330 1335 1340Asp Glu Asp Phe Val Pro
Ser Asp Ala Ser Pro Pro Lys Thr Lys Thr1345 1350 1355 1360Ser Pro
Lys Leu Ser Asn Lys Glu Leu Lys Pro Gln Lys Ser Val Val1365 1370
1375Ser Asp Leu Glu Ala Asp Asp Val Lys Gly Ser Val Pro Leu Ser
Ser1380 1385 1390Ser Pro Pro Ala Thr His Phe Pro Asp Glu Thr Glu
Ile Thr Asn Pro1395 1400 1405Val Pro Lys Lys Asn Val Thr Val Lys
Lys Thr Ala Ala Lys Ser Gln1410 1415 1420Ser Ser Thr Ser Thr Thr
Gly Ala Lys Lys Arg Ala Ala Pro Lys Gly1425 1430 1435 1440Thr Lys
Arg Asp Pro Ala Leu Asn Ser Gly Val Ser Gln Lys Pro Asp1445 1450
1455Pro Ala Lys Thr Lys Asn Arg Arg Lys Arg Lys Pro Ser Thr Ser
Asp1460 1465 1470Asp Ser Asp Ser Asn Phe Glu Lys Ile Val Ser Lys
Ala Val Thr Ser1475 1480 1485Lys Lys Ser Lys Gly Glu Ser Asp Asp
Phe His Met Asp Phe Asp Ser1490 1495 1500Ala Val Ala Pro Arg Ala
Lys Ser Val Arg Ala Lys Lys Pro Ile Lys1505 1510 1515 1520Tyr Leu
Glu Glu Ser Asp Glu Asp Asp Leu Phe1525 15302517DNAArtificial
SequencePrimer 25ctctgagccc gccaagc 172631DNAArtificial
SequencePrimer 26tgtaagaact tcttaacctt ttccttctct a
312720DNAArtificial SequencePrimer 27ccctcggcag cgatggcact
202820DNAArtificial SequencePrimer 28gaggaatccc gagctgtgaa
202914DNAArtificial SequencePrimer 29cccgctcccg ccat
143032DNAArtificial SequencePrimer 30cccatgtgct tctttgttta
ctaagagcgg aa 323117DNAArtificial SequencePrimer 31gtccgaagcc
cccagaa 173220DNAArtificial SequencePrimer 32cccgacagag accactcaca
203325DNAArtificial SequencePrimer 33cagtaccctg ctgaactcat gcgca
253419DNAArtificial SequencePrimer 34cgctacgcga agctctttg
193524DNAArtificial SequencePrimer 35cctttgtttg ccattgttct ctaa
243624DNAArtificial SequencePrimer 36tgccgtacaa gagctgctgc ctca
243718DNAArtificial SequencePrimer 37caaacgccgg ctgatctt
183819DNAArtificial SequencePrimer 38ccaggactgc aggcttcct
193924DNAArtificial SequencePrimer 39caagaggaag ccctaatccg ccca
244016DNAArtificial SequencePrimer 40gagcggcggc agacaa
164117DNAArtificial SequencePrimer 41ccgcgaacac gcatcct
174221DNAArtificial SequencePrimer 42cccagagccg agccaagcgt g
214321DNAArtificial SequencePrimer 43tggagactct cagggtcgaa a
214421DNAArtificial SequencePrimer 44tccagtctgg ccaacagagt t
214520DNAArtificial SequencePrimer 45cggcggcaga ccagcatgac
204620DNAArtificial SequencePrimer 46gccctcgtgc tgatgctact
204724DNAArtificial SequencePrimer 47tcatcatgac ctggtcttct agga
244821DNAArtificial SequencePrimer 48agcgtctagg gcagcagccg c
214915DNAArtificial SequencePrimer 49tgcccaacgc accga
155015DNAArtificial SequencePrimer 50gggcgctgcc catca
155122DNAArtificial SequencePrimer 51tcggaggccg atccaggtca tg
225220DNAArtificial SequencePrimer 52aagcttcctt tccgtcatgc
205322DNAArtificial SequencePrimer 53catgacctgc cagagagaac ag
225421DNAArtificial SequencePrimer 54cccccaccct ggctctgacc a
215523DNAArtificial SequencePrimer 55ggaaaccaag gaagaggaat gag
235622DNAArtificial SequencePrimer 56tgttcccccc ttcagatctt ct
225726DNAArtificial SequencePrimer 57acgcgcgtac agatctctcg aatgct
265818DNAArtificial SequencePrimer 58cacgccctaa gcgcacat
185925DNAArtificial SequencePrimer 59cctagttcac aaaatgcttg tcatg
256023DNAArtificial SequencePrimer 60tttcttgcga gcctcgcagc ctc
236124DNAArtificial SequencePrimer 61aaagaagatg atgaccgggt ttac
246219DNAArtificial SequencePrimer 62gagcctctgg atggtgcaa
196324DNAArtificial SequencePrimer 63caaactcaac gtgcaagcct cgga
246414DNAArtificial SequencePrimer 64tccgccgcgg acaa
146518DNAArtificial SequencePrimer 65catggtgtcc cgctcctt
186620DNAArtificial SequencePrimer 66accctggcct caggccggag
206722DNAArtificial SequencePrimer 67ggaattgttg gccacctgta tt
226827DNAArtificial SequencePrimer 68ctggagaaat cacttgttcc tatttct
276932DNAArtificial SequencePrimer 69cagtccttgc attatcattg
aaacacctca ca 327028DNAArtificial SequencePrimer 70tcaactcatt
ggaattacct cattattc 287124DNAArtificial SequencePrimer 71accatcagtg
acgtaagcaa actc 247234DNAArtificial SequencePrimer 72ccaaacttga
ggaaatctat gctcctaaac tcca 347325DNAArtificial SequencePrimer
73ttttgaagtt ctgcattctg acttg 257425DNAArtificial SequencePrimer
74accatcagtg acgtaagcaa gataa 257534DNAArtificial SequencePrimer
75aaccacagat gaggtccata cttctagact ggct 3476156PRTHomo
sapiensVARIANT(1)...(156)Partial amino acid sequence for p16/p14ARF
isoform 1 76Met Glu Pro Ala Ala Gly Ser Ser Met Glu Pro Ser Ala Asp
Trp Leu1 5 10 15Ala Thr Ala Ala Ala Arg Gly Arg Val Glu Glu Val Arg
Ala Leu Leu20 25 30Glu Ala Gly Ala Leu Pro Asn Ala Pro Asn Ser Tyr
Gly Arg Arg Pro35 40 45Ile Gln Val Met Met Met Gly Ser Ala Arg Val
Ala Glu Leu Leu Leu50 55 60Leu His Gly Ala Glu Pro Asn Cys Ala Asp
Pro Ala Thr Leu Thr Arg65 70 75 80Pro Val His Asp Ala Ala Arg Glu
Gly Phe Leu Asp Thr Leu Val Val85 90 95Leu His Arg Ala Gly Ala Arg
Leu Asp Val Arg Asp Ala Trp Gly Arg100 105 110Leu Pro Val Asp Leu
Ala Glu Glu Leu Gly His Arg Asp Val Ala Arg115 120 125Tyr Leu Arg
Ala Ala Ala Gly Gly Thr Arg Gly Ser Asn His Ala Arg130 135 140Ile
Asp Ala Ala Glu Gly Pro Ser Asp Ile Pro Asp145 150 15577105PRTHomo
sapiensVARIANT(1)...(105)Partial amino acid sequence for p16/p14ARF
isoform 2 77Met Met Met Gly Ser Ala Arg Val Ala Glu Leu Leu Leu Leu
His Gly1 5 10 15Ala Glu Pro Asn Cys Ala Asp Pro Ala Thr Leu Thr Arg
Pro Val His20 25 30Asp Ala Ala Arg Glu Gly Phe Leu Asp Thr Leu Val
Val Leu His Arg35 40 45Ala Gly Ala Arg Leu Asp Val Arg Asp Ala Trp
Gly Arg Leu Pro Val50 55 60Asp Leu Ala Glu Glu Leu Gly His Arg Asp
Val Ala Arg Tyr Leu Arg65 70 75 80Ala Ala Ala Gly Gly Thr Arg Gly
Ser Asn His Ala Arg Ile Asp Ala85 90 95Ala Glu Gly Pro Ser Asp Ile
Pro Asp100 10578116PRTHomo sapiensVARIANT(1)...(116)Partial amino
acid sequence for p16/p14ARF isoform 3 78Met Glu Pro Ala Ala Gly
Ser Ser Met Glu Pro Ser Ala Asp Trp Leu1 5 10 15Ala Thr Ala Ala Ala
Arg Gly Arg Val Glu Glu Val Arg Ala Leu Leu20 25 30Glu Ala Gly Ala
Leu Pro Asn Ala Pro Asn Ser Tyr Gly Arg Arg Pro35 40 45Ile Gln Val
Gly Arg Arg Ser Ala Ala Gly Ala Gly Asp Gly Gly Arg50 55 60Leu Trp
Arg Thr Lys Phe Ala Gly Glu Leu Glu Ser Gly Ser Ala Ser65 70 75
80Ile Leu Arg Lys Lys Gly Arg Leu Pro Gly Glu Phe Ser Glu Gly Val85
90 95Cys Asn His Arg Pro Pro Pro Gly Asp Ala Leu Gly Ala Trp Glu
Thr100 105 110Lys Glu Glu Glu11579173PRTHomo sapiens 79Met Gly Arg
Gly Arg Cys Val Gly Pro Ser Leu Gln Leu Arg Gly Gln1 5 10 15Glu Trp
Arg Cys Ser Pro Leu Val Pro Lys Gly Gly Ala Ala Ala Ala20 25 30Glu
Leu Gly Pro Gly Gly Gly Glu Asn Met Val Arg Arg Phe Leu Val35 40
45Thr Leu Arg Ile Arg Arg Ala Cys Gly Pro Pro Arg Val Arg Val Phe50
55 60Val Val His Ile Pro Arg Leu Thr Gly Glu Trp Ala Ala Pro Gly
Ala65 70 75 80Pro Ala Ala Val Ala Leu Val Leu Met Leu Leu Arg Ser
Gln Arg Leu85 90 95Gly Gln Gln Pro Leu Pro Arg Arg Pro Gly His Asp
Asp Gly Gln Arg100 105 110Pro Ser Gly Gly Ala Ala Ala Ala Pro Arg
Arg Gly Ala Gln Leu Arg115 120 125Arg Pro Arg His Ser His Pro Thr
Arg Ala Arg Arg Cys Pro Gly Gly130 135 140Leu Pro Gly His Ala Gly
Gly Ala Ala Pro Gly Arg Gly Ala Ala Gly145 150 155 160Arg Ala Arg
Cys Leu Gly Pro Ser Ala Arg Gly Pro Gly165
1708021DNAArtificial SequencePCR primer 80ggaggtggta ctggccatgt a
218119DNAArtificial SequencePCR primer 81gggagatgcg gacatggat
198225DNAArtificial SequencePCR primer 82ccaagtacga ccgcatcacc
aacca 258321DNAArtificial SequencePCR primer 83cattccaaga
cctgcctacc a 218421DNAArtificial SequencePCR primer 84atgcgagtga
gcaaaccaat t 218529DNAArtificial SequencePCR primer 85acacaagatt
cgagagctca cctcatcca 298619DNAArtificial SequencePCR primer
86ggctacatgg tggcaagga 198723DNAArtificial SequencePCR primer
87tggaaataac aatcgagcca aag 238834DNAArtificial SequencePCR primer
88tgctagtcca cgatacatct ttacaatgct cagc 34893769DNAHomo sapiens
89aaagctgcag cgtctggaaa aaagcgactt gtggcggtcg agcgtggcgc aggcgaatcc
60tcggcactaa gcaaatatgg acctcgcggc ggcagcggag ccgggcgccg gcagccagca
120cctggaggtc cgcgacgagg tggccgagaa gtgccagaaa ctgttcctgg
acttcttgga 180ggagtttcag agcagcgatg gagaaattaa atacttgcaa
ttagcagagg aactgattcg 240tcctgagaga aacacattgg ttgtgagttt
tgtggacctg gaacaattta accagcaact 300ttccaccacc attcaagagg
agttctatag agtttaccct tacctgtgtc gggccttgaa 360aacattcgtc
aaagaccgta aagagatccc tcttgccaag gatttttatg ttgcattcca
420agacctgcct accagacaca agattcgaga gctcacctca tccagaattg
gtttgctcac 480tcgcatcagt gggcaggtgg tgcggactca cccagttcac
ccagagcttg tgagcggaac 540ttttctgtgc ttggactgtc agacagtgat
cagggatgta gaacagcagt tcaaatacac 600acagccaaac atctgccgaa
atccagtttg tgccaacagg aggagattct tactggatac 660aaataaatca
agatttgttg attttcaaaa ggttcgtatt caagagaccc aagctgagct
720tcctcgaggg agtatccccc gcagtttaga agtaatttta agggctgaag
ctgtggaatc 780agctcaagct ggtgacaagt gtgactttac agggacactg
attgttgtgc ctgacgtctc 840caagcttagc acaccaggag cacgtgcaga
aactaattcc cgtgtcagtg gtgttgatgg 900atatgagaca gaaggcattc
gaggactccg ggcccttggt gttagggacc tttcttatag 960gctggtcttt
cttgcctgct gtgttgcgcc aaccaaccca aggtttgggg ggaaagagct
1020cagagatgag gaacagacag ctgagagcat taagaaccaa atgactgtga
aagaatggga 1080gaaagtgttt gagatgagtc aagataaaaa tctataccac
aatctttgta ccagcctgtt 1140ccctactata catggcaatg atgaagtaaa
acggggtgtc ctgctgatgc tctttggtgg 1200cgttccaaag acaacaggag
aagggacctc tcttcgaggg gacataaatg tttgcattgt 1260tggtgaccca
agtacagcta agagccaatt tctcaagcac gtggaggagt tcagccccag
1320agctgtctac accagtggta aagcgtccag tgctgctggc ttaacagcag
ctgttgtgag 1380agatgaagaa tctcatgagt ttgtcattga ggctggagct
ttgatgttgg ctgataatgg 1440tgtgtgttgt attgatgaat ttgataagat
ggacgtgcgg gatcaagttg ctattcatga 1500agctatggaa cagcagacca
tatccatcac taaagcagga gtgaaggcta ctctgaacgc 1560ccggacgtcc
attttggcag cagcaaaccc aatcagtgga cactatgaca gatcaaaatc
1620attgaaacag aatataaatt tgtcagctcc catcatgtcc cgattcgatc
tcttctttat 1680ccttgtggat gaatgtaatg aggttacaga ttatgccatt
gccaggcgca tagtagattt 1740gcattcaaga attgaggaat caattgatcg
tgtctattcc ctcgatgata tcagaagata 1800tcttctcttt gcaagacagt
ttaaacccaa gatttccaaa gagtcagagg acttcattgt 1860ggagcaatat
aaacatctcc gccagagaga tggttctgga gtgaccaagt cttcatggag
1920gattacagtg cgacagcttg agagcatgat tcgtctctct gaagctatgg
ctcggatgca 1980ctgctgtgat gaggtccaac ctaaacatgt gaaggaagct
ttccggttac tgaataaatc 2040aatcatccgt gtggaaacac ctgatgtcaa
tctagatcaa gaggaagaga tccagatgga 2100ggtagatgag ggtgctggtg
gcatcaatgg tcatgctgac agccctgctc ctgtgaacgg 2160gatcaatggc
tacaatgaag acataaatca agagtctgct cccaaagcct ccttaaggct
2220gggcttctct gagtactgcc gaatctctaa ccttattgtg cttcacctca
gaaaggtgga 2280agaagaagag gacgagtcag cattaaagag gagcgagctt
gttaactggt acttgaagga 2340aatcgaatca gagatagact ctgaagaaga
acttataaat aaaaaaagaa tcatagagaa 2400agttattcat cgactcacac
actatgatca tgttctaatt gagctcaccc aggctggatt 2460gaaaggctcc
acagagggaa gtgagagcta tgaagaagat ccctacttgg tagttaaccc
2520taactacttg ctcgaagatt gagatagtga aagtaactga ccagagctga
ggaactgtgg 2580cacagcacct cgtggcctgg agcctggctg gagctctgct
agggacagaa gtgtttctgg 2640aagtgatgct tccaggattt gttttcagaa
acaagaattg agttgatggt cctatgtgtc 2700acattcatca caggtttcat
accaacacag gcttcagcac ttcctttggt gtgtttcctg 2760tcccagtgaa
gttggaacca aataatgtgt agtctctata accaatacct ttgttttcat
2820gtgtaagaaa aggcccatta cttttaaggt atgtgctgtc ctattgagca
aataactttt 2880tttcaattgc cagctactgc ttttattcat caaaataaaa
taacttgttc tgaagttgtc 2940tattggattt ctttctactg taccctgatt
attacttcca tctacttctg aatgtgagac 3000tttccctttt tgcttaacct
ggagtgaaga ggtagaactg tggtattatg gatgaggttt 3060ctatgagaag
gagtcattag agaactcata tgaaagctag aggccttaga gatgactttc
3120caaggttaat tccagttgtt tttttttttt tttaagttta taaaagttta
ttatactttt 3180ttaaaattac tctttagtaa tttattttac ttctgtgtcc
taagggtaat ttctcaggat 3240tgttttcaaa ttgctttttt aggggaaata
ggtcatttgc tatattacaa gcaatcccca 3300aattttatgg tcttccagga
aaagttatta ccgtttatga tactaacagt tcctgagact 3360tagctatgat
cagtatgttc atgaggtgga gcagttcctg tgttgcagct tttaacaaca
3420gatggcattc attaaatcac aaagtatgtt aaaggtcaca aaagcaaaat
aactgtctga 3480ggctaaggcc cacgtgggac agtctaatac ccatgagtac
tcaacttgcc ttgatgtctg 3540agctttccag tgcaatgtga atttgagcag
ccagaaatct attagtagaa agcaagacag 3600attaatatag gttaaaacaa
tgatttaaat atgtttctcc caataattat ctctttccct 3660ggaatcaact
tgtatgaaac cttgtcaaaa tgtactccac aagtatgtac aattaagtat
3720tttaaaaata aatggcaaac attaaaaaca aaaaaaaaaa aaaaaaaaa
376990821PRTHomo sapiens 90Met Asp Leu Ala Ala Ala Ala Glu Pro Gly
Ala Gly Ser Gln His Leu1 5 10 15Glu Val Arg Asp Glu Val Ala Glu Lys
Cys Gln Lys Leu Phe Leu Asp20 25 30Phe Leu Glu Glu Phe Gln Ser Ser
Asp Gly Glu Ile Lys Tyr Leu Gln35 40 45Leu Ala Glu Glu Leu Ile Arg
Pro Glu Arg Asn Thr Leu Val Val Ser50 55 60Phe Val Asp Leu Glu Gln
Phe Asn Gln Gln Leu Ser Thr Thr Ile Gln65 70 75 80Glu Glu Phe Tyr
Arg Val Tyr Pro Tyr Leu Cys Arg Ala Leu Lys Thr85 90 95Phe Val Lys
Asp Arg Lys Glu Ile Pro Leu Ala Lys Asp Phe Tyr Val100 105 110Ala
Phe Gln Asp Leu Pro Thr Arg His Lys Ile Arg Glu Leu Thr Ser115 120
125Ser Arg Ile Gly Leu Leu Thr Arg Ile Ser Gly Gln Val Val Arg
Thr130 135 140His Pro Val His Pro Glu Leu Val Ser Gly Thr Phe Leu
Cys Leu Asp145 150 155 160Cys Gln Thr Val Ile Arg Asp Val Glu Gln
Gln Phe Lys Tyr Thr Gln165 170 175Pro Asn Ile Cys Arg Asn Pro Val
Cys Ala Asn Arg Arg Arg Phe Leu180 185 190Leu Asp Thr Asn Lys Ser
Arg Phe Val Asp Phe Gln Lys Val Arg Ile195 200 205Gln Glu Thr Gln
Ala Glu Leu Pro Arg Gly Ser Ile Pro Arg Ser Leu210 215 220Glu Val
Ile Leu Arg Ala Glu Ala Val Glu Ser Ala Gln Ala Gly Asp225 230 235
240Lys Cys Asp Phe Thr Gly Thr Leu Ile Val Val Pro Asp Val Ser
Lys245 250 255Leu Ser Thr Pro Gly Ala Arg Ala Glu Thr Asn Ser Arg
Val Ser Gly260 265 270Val Asp Gly Tyr Glu Thr Glu Gly Ile Arg Gly
Leu Arg Ala Leu Gly275 280 285Val Arg Asp Leu Ser Tyr Arg Leu Val
Phe Leu Ala Cys Cys Val Ala290 295 300Pro Thr Asn Pro Arg Phe Gly
Gly Lys Glu Leu Arg Asp Glu Glu Gln305 310 315 320Thr Ala Glu Ser
Ile Lys Asn Gln Met Thr Val Lys Glu Trp Glu Lys325 330 335Val Phe
Glu Met Ser Gln Asp Lys Asn Leu Tyr His Asn Leu Cys Thr340 345
350Ser Leu Phe Pro Thr Ile His Gly Asn Asp Glu Val Lys Arg Gly
Val355 360 365Leu Leu Met Leu Phe Gly Gly Val Pro Lys Thr Thr Gly
Glu Gly Thr370 375 380Ser Leu Arg Gly Asp Ile Asn Val Cys Ile Val
Gly Asp Pro Ser Thr385 390 395 400Ala Lys Ser Gln Phe Leu Lys His
Val Glu Glu Phe Ser Pro Arg Ala405 410 415Val Tyr Thr Ser Gly Lys
Ala Ser Ser Ala Ala Gly Leu Thr Ala Ala420 425 430Val Val Arg Asp
Glu Glu Ser His Glu Phe Val Ile Glu Ala Gly Ala435 440 445Leu Met
Leu Ala Asp Asn Gly Val Cys Cys Ile Asp Glu Phe Asp Lys450 455
460Met Asp Val Arg Asp Gln Val Ala Ile His Glu Ala Met Glu Gln
Gln465 470 475 480Thr Ile Ser Ile Thr Lys Ala Gly Val Lys Ala Thr
Leu Asn Ala Arg485 490 495Thr Ser Ile Leu Ala Ala Ala Asn Pro Ile
Ser Gly His Tyr Asp Arg500 505 510Ser Lys Ser Leu Lys Gln Asn Ile
Asn Leu Ser Ala Pro Ile Met Ser515 520 525Arg Phe Asp Leu Phe Phe
Ile Leu Val Asp Glu Cys Asn Glu Val Thr530 535 540Asp Tyr Ala Ile
Ala Arg Arg Ile Val Asp Leu His Ser Arg Ile Glu545 550 555 560Glu
Ser Ile Asp Arg Val Tyr Ser Leu Asp Asp Ile Arg Arg Tyr Leu565 570
575Leu Phe Ala Arg Gln Phe Lys Pro Lys Ile Ser Lys Glu Ser Glu
Asp580 585 590Phe Ile Val Glu Gln Tyr Lys His Leu Arg Gln Arg Asp
Gly Ser Gly595 600 605Val Thr Lys Ser Ser Trp Arg Ile Thr Val Arg
Gln Leu Glu Ser Met610 615 620Ile Arg Leu Ser Glu Ala Met Ala Arg
Met His Cys Cys Asp Glu Val625 630 635 640Gln Pro Lys His Val Lys
Glu Ala Phe Arg Leu Leu Asn Lys Ser Ile645 650 655Ile Arg Val Glu
Thr Pro Asp Val Asn Leu Asp Gln Glu Glu Glu Ile660 665 670Gln Met
Glu Val Asp Glu Gly Ala Gly Gly Ile Asn Gly His Ala Asp675 680
685Ser Pro Ala Pro Val Asn Gly Ile Asn Gly Tyr Asn Glu Asp Ile
Asn690 695 700Gln Glu Ser Ala Pro Lys Ala Ser Leu Arg Leu Gly Phe
Ser Glu Tyr705 710 715 720Cys Arg Ile Ser Asn Leu Ile Val Leu His
Leu Arg Lys Val Glu Glu725 730 735Glu Glu Asp Glu Ser Ala Leu Lys
Arg Ser Glu Leu Val Asn Trp Tyr740 745 750Leu Lys Glu Ile Glu Ser
Glu Ile Asp Ser Glu Glu Glu Leu Ile Asn755 760 765Lys Lys Arg Ile
Ile Glu Lys Val Ile His Arg Leu Thr His Tyr Asp770 775 780His Val
Leu Ile Glu Leu Thr Gln Ala Gly Leu Lys Gly Ser Thr Glu785 790 795
800Gly Ser Glu Ser Tyr Glu Glu Asp Pro Tyr Leu Val Val Asn Pro
Asn805 810 815Tyr Leu Leu Glu Asp820
* * * * *