U.S. patent application number 11/894005 was filed with the patent office on 2009-03-19 for human fgf-21 gene and gene expression products.
This patent application is currently assigned to Novartis Vaccines and Diagnostics. Invention is credited to Nobuyuki Itoh, Michael Kavanaugh.
Application Number | 20090074776 11/894005 |
Document ID | / |
Family ID | 27389288 |
Filed Date | 2009-03-19 |
United States Patent
Application |
20090074776 |
Kind Code |
A1 |
Itoh; Nobuyuki ; et
al. |
March 19, 2009 |
Human FGF-21 gene and gene expression products
Abstract
This invention relates to human fibroblast growth factor
(hF-GF-21), and to variants thereof and to polynucleotides encoding
FGF-21. The invention also relates to diagnostic and therapeutic
agents related to the polynucleotides and proteins, including
probes and antibodies, and to methods of treating liver disease
such as cirrhosis and cancer, methods of treating conditions
related to thymic function, and methods of treating conditions of
the testis. The invention also relates to mouse fibroblast growth
factor (mFGF-21), and to variants thereof and polynucleotides
encoding mFGF-21.
Inventors: |
Itoh; Nobuyuki; (Kyoto,
JP) ; Kavanaugh; Michael; (Mill Valley, CA) |
Correspondence
Address: |
DAVIS WRIGHT TREMAINE, LLP/Seattle
1201 Third Avenue, Suite 2200
SEATTLE
WA
98101-3045
US
|
Assignee: |
Novartis Vaccines and
Diagnostics
Emeryville
CA
Kyoto University
Kyoto
|
Family ID: |
27389288 |
Appl. No.: |
11/894005 |
Filed: |
August 16, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11441666 |
May 26, 2006 |
|
|
|
11894005 |
|
|
|
|
10060765 |
Jan 29, 2002 |
7259248 |
|
|
11441666 |
|
|
|
|
09715805 |
Nov 16, 2000 |
6716626 |
|
|
10060765 |
|
|
|
|
60203633 |
May 11, 2000 |
|
|
|
60166540 |
Nov 18, 1999 |
|
|
|
Current U.S.
Class: |
424/139.1 ;
424/93.21; 435/320.1; 435/325; 435/455; 435/6.16; 435/69.1;
514/44R; 530/350; 530/387.9; 536/23.5 |
Current CPC
Class: |
C07K 14/50 20130101;
G01N 33/57426 20130101; G01N 33/689 20130101; G01N 2800/367
20130101; G01N 33/6872 20130101; G01N 2800/085 20130101; C12P 21/02
20130101; G01N 33/576 20130101; G01N 2500/00 20130101; G01N
33/57407 20130101; G01N 2333/50 20130101; G01N 33/57438 20130101;
A61K 38/00 20130101 |
Class at
Publication: |
424/139.1 ;
536/23.5; 435/320.1; 435/455; 435/325; 435/69.1; 530/350;
530/387.9; 514/44; 424/93.21; 435/6 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07H 21/04 20060101 C07H021/04; C12N 15/63 20060101
C12N015/63; C12N 15/00 20060101 C12N015/00; C12N 5/00 20060101
C12N005/00; A61K 35/12 20060101 A61K035/12; C12Q 1/68 20060101
C12Q001/68; A61K 31/7088 20060101 A61K031/7088; C12P 21/06 20060101
C12P021/06; C07K 14/435 20060101 C07K014/435; C07K 16/00 20060101
C07K016/00 |
Claims
1-18. (canceled)
19. An isolated antibody that binds specifically to an isolated
polypeptide comprising amino acids at least 95% identical to amino
acids selected from the group consisting of: (a) amino acids from
about 1 to about 209 of SEQ ID NO:4: (b) amino acids from about 2
to about 209 of SEQ ID NO:4; (c) amino acids from about 1 to about
177 of SEQ ID NO:4; (d) amino acids from about 40 to about 209 of
SEQ ID NO:4; and (e) amino acids from about 40 to about 177 of SEQ
ID NO:4.
20. An isolated antibody that binds specifically to an isolated
polypeptide wherein, except for at least one conservative amino
acid substitution, said polypeptide has an amino acid sequence
selected from the group consisting of: (a) amino acids from about 1
to about 209 of SEQ ID NO:4; (b) amino acids from about 2 to about
209 of SEQ ID NO:4; (c) amino acids from about 1 to about 177 of
SEQ ID NO:4; (d) amino acids from about 40 to about 209 of SEQ ID
NO:4; and (e) amino acids from about 40 to about 177 of SEQ ID
NO:4.
21. An isolated antibody that binds specifically to an isolated
polypeptide comprising amino acids selected from the group
consisting of: (a) amino acids from about 1 to about 209 of SEQ ID
NO:4; (b) amino acids from about 2 to about 209 of SEQ ID NO:4: (c)
amino acids from about 1 to about 177 of SEQ ID NO:4; (d) amino
acids from about 40 to about 209 of SEQ ID NO:4; and (e) amino
acids from about 40 to about 177 of SEQ ID NO:4.
22-39. (canceled)
40. A kit for detecting the presence of FGF-21 polypeptide in a
sample from a patient, said kit comprising an antibody according to
claim 19, packaged in a container.
41-59. (canceled)
60. A kit for detecting the presence of FGF-21 polypeptide in a
sample from a patient, said kit comprising an antibody according to
claim 20, packaged in a container.
61. A kit for detecting the presence of FGF-21 polypeptide in a
sample from a patient, said kit comprising an antibody according to
claim 21, packaged in a container.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority from U.S. Provisional
Patent Application No. 60/166,540 filed Nov. 18, 1999 and U.S.
Provisional Patent Application No. 60/203,633 filed May 11, 2000,
which are incorporated by reference herein in their entirety.
TECHNICAL FIELD
[0002] The present invention relates to nucleic acid sequences
encoding a member of the Fibroblast growth factor (FGF) family, and
to polypeptides encoded by the nucleic acid sequence.
BACKGROUND OF THE INVENTION
[0003] The prototypic fibroblast growth factors (FGFs), FGF-1 and
FGF-2, were originally isolated from brain and pituitary as
mitogens for fibroblasts. However, FGF-1 and FGF-2 are widely
expressed in developing and adult tissues, and are polypeptides
with multiple biological activities including angiogenesis,
mitogenesis, cellular differentiation and repair of tissue injury
(Baird, A. et al., Cancer Cells 3:239-243 (1991); Burgess, W. H. et
al., Annu. Rev. Biochem. 58:575-606 (1989). According to the
published literature, the FGF family now consists of at least
nineteen members, FGF-1 to FGF-19. FGF-3 was identified to be a
common target for activation by the mouse mammary tumor virus
(Dickson et. al., Ann. N.Y. Acad. Sci. 638:18-26 (1991); FGF-4 to
FGF-6 were identified as oncogene products (Yoshida et al., Ann.
N.Y. Acad. Sci. 638:27-37 (1991); Goldfarb et al., Ann. NY Acad.
Sci. 638:38-52 (1991); Coulier et al., Ann. NY Acad. Sci. 638:53-61
(1991)). FGF-10 was identified from rat lung by homology-based
polymerase chain reaction (PCR) (Yamasaki et. al., J. Biol. Chem.
271:15918-15921 (1996)). FGF-11 to FGF-14 (FGF homologous factors
(FHFs) 1 to 4) were identified from human retina by a combination
of random cDNA sequencing, data base searches and homology-based
PCR (Smallwood et. al., Proc. Natl. Acad. Sci. USA 93:9850-9857
(1996)). FGF-15 was identified as a downstream target of a chimeric
homeodomain oncoprotein (McWhirter et al., Development
124:3221-3232 (1997)). FGF-16, FGF-17, and FGF-18 were identified
from rat heart and embryos by homology-based PCR, respectively
(Miyake et al., Biochem. Biophys. Res. Commun. 243:148-152 (1998);
Hoshikawa et al., Biochem. Biophys. Res. Commun. 244:187-191
(1998); Ohbayashi et al., J. Biol. Chem. 273:18161-18164 (1998)).
Recently, FGF-19 was identified from human fetal brain by data base
search (Nishimura et al., Biochimn. Biophys. Acta 1444:148-151
(1999)). They have a conserved .about.120-amino acid residue core
with .about.30 to 60% amino acid identity. These FGFs also appear
to play important roles in both developing and adult tissues. Thus,
there is a need in the art for additional FGF molecules having
functions and activities that differ from the know FGFs and for
FGF1 molecules specifically expressed in tissues implicated in
human disease.
SUMMARY OF THE INVENTION
[0004] The present invention provides a composition comprising an
isolated polynucleotide selected from the group consisting of:
[0005] (a) a polynucleotide comprising at least eight contiguous
nucleotides of SEQ ID NO:1 or 3;
[0006] (b) a polynucleotide having at least 80% homology to the
polynucleotide of (a); and
[0007] (c) a polynucleotide encoding a protein expressed by a
polynucleotide having the sequence of SEQ ID NO:1 or 3.
[0008] The invention further provides for the use of the isolated
polynucleotides or fragments thereof as diagnostic probes or as
primers.
[0009] The present invention also provides a composition comprising
a polypeptide, wherein said polypeptide is selected from the group
consisting of:
[0010] (a) a polypeptide comprising at least 6 contiguous amino
acids encoded by SEQ ID NO: 1 or 3;
[0011] (b) a polypeptide encoded by a polynucleotide comprising SEQ
ID NO:1 or 3; and
[0012] (c) a variant of the polypeptide of SEQ ID NO:2 or 4.
[0013] In certain preferred embodiments of the invention, the
polynucleotide is operably linked to an expression control
sequence. The invention further provides a host cell, including
bacterial, yeast, insect and mammalian cells, transformed with the
polynucleotide sequence. The invention also provides full-length
cDNA and full-length polynucleotides corresponding to SEQ ID NO:1
or 3.
[0014] Protein and polypeptide compositions of the invention may
further comprise a pharmaceutically acceptable carrier.
Compositions comprising an antibody that specifically reacts with
such protein or polypeptide are also provided by the present
invention.
[0015] The invention also provides for the production of large
amounts of otherwise minor cell populations of cells to be used for
generation of cDNA libraries for the isolation of rare molecules
expressed in the precursors cells or progeny; cells produced by
treatment may directly express growth factors or other molecules,
and conditioned media is screened in assays for novel
activities.
[0016] The invention further provides for the isolation,
self-renewal and survival of mammalian stem cells and the
differentiation of their progeny.
[0017] The invention also provides for compositions and methods of
preventing or slowing the degeneration of or increasing the numbers
of hepatic cells, in disease states including but not limited to,
cirrhosis of (i.e. liver, hepatitis, and post-surgical and
post-injury tissue regeneration; of preventing or slowing
degeneration of or increasing the numbers of cells in the testes in
disease states such as infertility and impotence, and of preventing
or slowing degeneration of or increasing the numbers of cells of
the thymus in disorders of the thymus and immune system.
[0018] The invention also provides for compositions and methods for
identifying inhibitors of FGF-21 function, useful in disease states
such as liver and testicular cancers, or leukemias, lymphomas or
other cancers, and proliferative or differentiation disorders of
cells derived from the thymus.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1. Amino acid sequence comparison of human FGF-21 with
mouse FGF-15. Asterisks indicate identical amino acid residues of
the sequences.
[0020] FIG. 2. Amino acid sequence comparison of human FGF-21 and
human FGF-19. Asterisks indicate identical amino acid residues of
the sequences.
[0021] FIG. 3. Expression of FGF-21 in mouse tissues.
[0022] FIG. 4. DNA sequence (SEQ ID NO:1) and amino acid sequence
(SEQ ID NO:2) of mouse FGF-21.
[0023] FIG. 5. DNA sequence (SEQ ID NO:3) and amino acid sequence
(SEQ ID NO:4) of human FGF-21.
[0024] FIG. 6. Alignment of the amino acid sequences of human (SEQ
ID NO:4) and mouse (SE Q ID NO:2) FGF-21.
[0025] FIG. 7. FIG. 7 provides codon usage for yeast. The first
field of information on each line of the table contains a
three-letter code for an amino acid. The second field contains an
unambiguous codon for that amino acid. The third field lists the
number of occurrences of that codon in the genes from which the
table is compiled. The fourth field lists the expected number of
occurrences of that codon per 1,000 codons in genes whose codon
usage is identical to that compiled in the codon frequency table.
The last field contains the fraction of occurrences of the codon in
its synonymous codon family.
[0026] FIG. 8. FIG. 8 provides codon usage for Drosophila.
[0027] FIG. 9. FIG. 9 provides codon usage for E. coli.
DETAILED DESCRIPTION OF THE INVENTION
[0028] Because of their potent activities for promoting growth,
proliferation, survival and differentiation of a wide variety of
cells and tissue types, FGFs continue to be pursued as therapeutic
agents for a number of different indications, including wound
healing, such as musculo-skeletal conditions, for example, bone
fractures, ligament and tissue repair, tendonitis, bursitis, etc.;
skin conditions, for example, burns, cuts, lacerations, bed sores,
slow healing ulcers, etc.; tissue protection, repair, and the
induction of angiogenesis during myocardial infarction and
ischemia, in the treatment of neurological conditions, for example,
neuro-degenerative disease and stroke, in the treatment of eye
disease, including macular degeneration, and the like.
[0029] The fibroblast growth factor (FGF) proteins identified to
date belong to a family of signaling molecules that regulate growth
and differentiation of a variety of cell types. The significance of
FGF proteins to human physiology and pathology relates in part to
their key roles in embryogenesis, in blood vessel development and
growth, and in bone growth. In vitro experiments have demonstrated
a role for FGF in regulating cell growth and division of
endothelial cells, vascular smooth muscle cells, fibroblasts, and
cardiac and skeletal myocytes. Other members of the FGF family and
their biological roles are described in Crossley et al.,
Development 121:439-451 (1995); Ohuchi et al., Development
124:2235-2244 (1997); Gemel et al., Genomics 35:253-257 (1996); and
Ghosh et al., Cell Growth and Differentiation 7:1425-1434
(1996).
[0030] FGF proteins are also significant to human health and
disease because of a role in cancer cell growth. For example, FGF-8
was identified as an androgen-induced growth factor in breast and
prostate cancer cells. (Tanaka et al., FEBS Lett. 363:226-230
(1995) and P.N.A.S. 89:8928-8932 (1992)).
[0031] The role of FGF in normal development is being elucidated in
part through studies of FGF receptors. Wilke, T. et al., Dev.
Dynam. 210:41-52 (1997) found that FGFR1, FGFR2, and FGFR3
transcripts were localized to specific regions of the head during
embryonic development in chickens. The expression pattern
correlated with areas affected by human FGFR mutations in Crouzon
syndrome, a condition of abnormal intramembranous bone formation.
Belluardo, N. et al., Jour. Compl. Neur. 379:226-246 (1997) studied
localization of FGFR 1, 2, and 3 mRNAs in rat brain, and found
cellular specificity in several brain regions. Furthermore, FGFR1
and FGFR2 mRNAs were expressed in astroglial reactive cells after
brain lesions, supporting a role of certain FGFs in brain disease
and injury. Ozawa, K et al., Mol. Brain. Res. 41:279-288 (1996)
reported that FGF1 and FGF-5 expression increased after birth,
whereas FGF3, FGF-6, FGF-7, and FGF-8 genes showed higher
expression in late embryonic stages than in postnatal stages.
[0032] New members of the FGF family are described here, wherein
the FGF protein is expressed in a variety of tissues but most
abundantly in the liver. A polynucleotide encoding the mouse FGF of
the invention has the sequence as shown in SEQ. ID NO:1. A
polynucleotide encoding the human FGF of the invention has the
sequence as shown in SEQ ID NO:3. The mouse polynucleotide was
identified as encoding a member of the FGF family by the conserved
regions throughout the amino acid sequence and by the regions of
homology shared by the polynucleotide and genes encoding known FGF
proteins.
[0033] The inventors believe that FGF-21 is a previously
unidentified member of the FGF family: To date, over 19 human FGF
proteins have been identified. In most cases, homologous proteins
in other manuals, particularly mice and rats, have also been
identified. The human proteins vary to different degrees in terms
of amino acid sequence, receptor specificity, tissue expression
patterns, and biological activity.
[0034] The present FGF-21 differs in sequence from all the FGF
proteins described to date in publications. As discussed herein,
the knowledge about the roles played by various FGF proteins
continues to grow, but is by far incomplete.
[0035] The present invention adds to this knowledge by disclosing
that the FGF of SEQ ID NO:1 is highly expressed in liver, and human
FGF-21 may play a role in development of and recovery from liver
disease. Further, FGF-21 is also expressed in testis and thymus,
and therefore may play a role in the development or recovery from
disorders of testicular function or function of cells derived from
the thymus. The invention therefore is based upon the
identification, isolation and sequencing of a new fibroblast growth
factor (FGF-21).
[0036] Isolation and Analysis of Mouse cDNA encoding FGF-21
According to the invention, DNA encoding a novel mouse FGF has been
identified. The nucleotide sequence of the entire coding region was
determined by adaptor-ligation mediated polymerase chain reaction
using mouse embryo cDNA as a template. The nucleotide sequence of
the coding region allowed for the elucidation of the complete amino
acid sequence of the mouse FGF (210 amino acids) (FIG. 4). This
protein is tentatively named FGF-21.
[0037] Isolation and Analysis of Human cDNA Encoding FGF-21 A human
gene encoding FGF-21 was located in the 5' flanking region of a
putative human .alpha.-fucosyltransferase gene. The cDNA encoding
the entire coding region of human FGF-21 was amplified from fetal
brain cDNA by PCR using FGF-specific primers as follows: sense
primer: 5' agccattgatggactcggac 3' (SEQ ID NO:5); antisense primer:
5' tggcttcaggaagcgtagct 3' (SEQ ID NO:6).
[0038] Expression of FGF-21 mRNA in Adult Mouse Tissues The
expression of FGF-21 mRNA was examined in adult mouse major tissues
including brain, heart, lung, liver, kidney, spleen, lung, thymus,
testis, muscle, skin, and small intestine by polymerase chain
reaction. FGF-21 mRNA expression was detected at high levels in the
liver (FIG. 3). Expression was also seen in testis and thymus. To
confirm the expression of FGF-21 mRNA in mouse tissues, mouse
tissue (A).sup.+ RNA was examined by Northern blotting analysis
using a .sup.32P-labeled rat FGF-21 cDNA probe. The results
confirmed a high level of expression in mouse liver. Expression was
also seen in thymus; larger transcripts were seen in testis
tissue.
[0039] Reference to FGF-21 herein is intended to be construed to
include growth factors of any origin which are substantially
homologous to and which are biologically equivalent to the FGF-21
characterized and described herein. Such substantially homologous
growth factors may be native to any tissue or species and,
similarly, biological activity can be characterized in any of a
number of biological assay systems.
[0040] The term "biologically equivalent" is intended to mean that
the compositions of the present invention are capable of
demonstrating some or all of the same growth properties in a
similar fashion, not necessarily to the same degree as the FGF-21
isolated as described herein or recomibination) produced human
FGF-21 of the invention.
[0041] By "substantially homologous" it is meant that the degree of
homology of human FGF-21 to FGF-21 from any species is greater than
that between FGF-21 and any previously reported member of the FGF
family.
[0042] Sequence identity or percent identity is intended to mean
the percentage of same residues between two sequences, referenced
to human FGF when determining percent identity with non-human
FGF-21, referenced to FGF-21 when determining percent identity with
non-FGF-21 growth factors, when the two sequences are aligned using
the Clustal method (Higgins et al, Cabios 8:189-191, 1992) of
multiple sequence alignment in the Lasergene biocomputing software
(DNASTAR, INC, Madison, Wis.). In this method, multiple alignments
are carried out in a progressive manner, in which larger and larger
alignment groups are assembled using similarity scores calculated
from a series of pairwise alignments. Optimal sequence alignments
are obtained by finding the maximum alignment score, which is the
average of all scores between the separate residues in the
alignment, determined from a residue weight table representing the
probability of a given amino acid change occurring in two related
proteins over a given evolutionary interval. Penalties for opening
and lengthening gaps in the alignment contribute to the score. The
default parameters used with this program are as follows: gap
penalty for multiple alignment=10; gal) length penalty for multiple
alignment=10; k-tuple value in pairwise alignment=1; gap penalty in
pair-wise alignment=3; window value in pairwise alignment=5;
diagonals saved in pairwise alignment=5. The residue weight table
used for the alignment program is PAM250 (Dayhoff et al., in Atlas
of Protein Sequence and Structure, Dayhoff, Ed., NDRF, Washington,
Vol. 5, suppl. 3, p. 345, 1978).
[0043] Percent conservation is calculated from the above alignment
by adding the percentage of identical residues to the percentage of
positions at which the two residues represent a conservative
substitution (defined as having a log odds value of greater than or
equal to 0.3 in the PAM250 residue weight table). Conservation is
referenced to human FGF-21 when determining percent conservation
with non-human FGF-21, and referenced to FGF-21 when determining
percent conservation with non-FGF-21 growth factors. Conservative
amino acid changes satisfying this requirement are: R-K; E-D, Y-F,
L-M; V-I, Q-H.
[0044] The invention provides FGF-21 proteins or variants thereof
having one or more polymers covalently attached to one or more
reactive amino acid side chains. By way of example, not limitation,
such polymers include polyethylene glycol (PEG), which can be
attached to one or more free cysteine sulfhydryl residues, thereby
blocking the formation of disulfide bonds and aggregation when the
protein is exposed to oxidizing conditions. In addition, pegylation
of FGF-21 proteins and/or muteins is expected to provide such
improved properties as increased half-life, solubility, and
protease resistance. FGF-21 proteins and/or muteins may
alternatively be modified by the covalent addition of polymers to
free amino groups such as the lysine epsilon or the N-terminal
amino group. Preferred cysteines and lysines for covalent
modification will be those not involved in receptor or heparin
binding or in proper protein folding. For example, cys 27 and cys
104 may be modified. It will be apparent to one skilled in the art
that the methods for assaying FGF-21 biochemical and/or biological
activity may be employed in order to determine if modification of a
particular amino acid residue affects the activity of the protein
as desired.
[0045] It may be advantageous to improve the stability of FGF-21 by
modifying one or more protease cleavage sites. Thus, the present
invention provides FGF-21 variants in which one or more protease
cleavage site has been altered by, for example, substitution of one
or more amino acids at the cleavage site in order to create an
FGF-21 variant with improved stability. Such improved protein
stability may be beneficial during protein production and/or
therapeutic use. A preferred site is a monobasic site within two
residues of a proline, such as near residue 160 of SEQ ID NO:4.
[0046] Suitable protease cleavage sites for modification are well
known in the art and likely will vary depending on the particular
application contemplated. For example, typical substitutions would
include replacement of lysines or arginines with other amino acids
such as alanine. The loss of activity, such as receptor binding or
heparin binding, can be tested for as described herein.
[0047] FGF-21 can also include hybrid and modified forms of FGF-21
including fusion proteins and FGF-21 fragments and hybrid and
modified forms in which certain amino acids have been deleted or
replaced and modifications such as where one or more amino acids
have been changed to a modified amino acid or unusual amino acid
and modifications such as glycosylations so long as the hybrid or
modified form retains the biological activity of FGF-21. Fusion
proteins can consist of the FGF-21 of the invention or fragment
thereof and a signal sequence of a heterologous protein to promote
secretion of the protein product.
[0048] Fusion proteins comprising FGF-21 or a biologically active
or antigenic fragment thereof can be produced using methods known
in the art. Such fusion proteins can be used therapeutically or can
be produced in order to simplify the isolation and purification
procedures. Histidine residues can be incorporated to allow
immobilized metal affinity chromatography purification. Residues
EQKLISEEDL contain the antigenic determinant recognized by the myc
monoclonal antibody and can be incorporated to allow myc monoclonal
antibody-based affinity purification. A thrombin cleavage site can
be incorporated to allow cleavage of the molecule at a chosen site;
a preferred thrombin cleavage site consists of residues LVPRG.
Purification of the molecule can be facilitated by incorporating a
sequence, such as residues SAWRHPQFGG, which binds to paramagnetic
streptavidin beads. Such embodiments are described in WO 97/25345,
which is incorporated by reference.
[0049] The invention further includes chimeric molecules between
FGF-21 and keratinocyte growth factor (KGF) (Reich-Slotky, R. et
al., J. Biol. Chem. 270:29813-29818 (1995)). The chimeric molecule
can contain specific regions or fragments of one or both of the
FGF-21 and KGF molecules, such as the FGF-21 fragments described
below.
[0050] The invention also includes fragments of FGF-21. Preferred
fragments of SEQ ID NO:4 and 2, respectively, include: amino acids
from about 1 to about 209 (210 for SEQ ID NO:2); amino acids from
about 2 to about 209 (210 for SEQ ID NO:2); amino acids from about
1 to about 177; amino acids from about 40 to about 209 for SEQ ID
NO:2 and amino acids from about 40 to about 177. Such fragments can
be prepared from the proteins by standard biochemical methods, or
by expressing a polynucleotide encoding the fragment.
[0051] FGF-21, or a fragment thereof, can be produced as a fusion
protein comprising human serum albumin (HSA) or a portion thereof.
Such fusion constructs are suitable for enhancing expression of the
FGF-21, or fragment thereof, in an eukaryotic host cell. Exemplary
HSA portions include the N-terminal polypeptide (amino acids 1-369,
1-419, and intermediate lengths starting with amino acid 1), as
disclosed in U.S. Pat. No. 5,766,883, and publication WO 97/24445,
incorporated by reference herein. Other chimeric polypeptides can
include a HSA protein with FGF-21, or fragments thereof, attached
to each of the C-terminal and N-terminal ends of the HSA. Such HSA
constructs are disclosed in U.S. Pat. No. 5,876,969, incorporated
by reference herein.
[0052] Also included with the scope of the invention are FGF-21
molecules that differ from native FGF-21 by virtue of changes in
biologically active sites.
[0053] Growth factors are thought to act at specific receptors.
According to the invention, FGF-21 and as yet unknown members of
this family of growth factors act through specific receptors having
distinct distributions as has been shown for other growth factor
families.
[0054] A preferred hFGF-21 of the present invention has been
identified. Also preferred is hFGF-21 prepared by recombinant DNA
technology. Included within the scope of the invention are
polynucleotides, including DNA and RNA, with 80% homology to SEQ ID
NO: 1 or SEQ ID NO:3; preferably at least 85% homology, more
preferably at least 90% homology, most preferably 95% homology.
Polynucleotides with 96%, 97%, 98%, and 99% homology to SE Q ID
NO:1 or 3 are also included. Percent homology is calculated using
methods known in the art. A non-limiting example of such a method
is the Smith-Waterman homology search algorithm as implemented in
MPSRCH program (Oxford Molecular), using an affine gap search with
a gap open penalty of 12 and a gap extension penalty of 1.
[0055] FGF-21 can also include hybrid and modified forms of FGF-21
including fusion proteins and FGF-21 fragments and hybrid and
modified forms in which certain amino acids have been deleted or
replaced and MODIFICATIONS such as where one or more amino acids
have been changed to a modified amino acid or unusual amino acid
and modifications such as glycosylations so long as the hybrid or
modified form retains the biological activity of FGF-21. By
retaining the biological activity, it is meant that the ability of
FGF-21 to promote the growth, survival or differentiation of
responsive cells is preserved, although not necessarily at the same
level of potency as that of the FGF-21 isolated as described herein
or that of the recombinantly produced FGF-21.
[0056] Also included within the meaning of substantially homologous
is any FGF-21 which may be isolated by virtue of cross-reactivity
with antibodies to the FGF-21 described herein or whose encoding
nucleotide sequences including genomic DNA, mRNA or cDNA may be
isolated through hybridization with the complementary sequence of
genomic or subgenomic nucleotide sequences or cDNA of the FGF-21
herein or fragments thereof. It will also be appreciated by one
skilled in the art that degenerate DNA sequences can encode human
FGF-21 and these are also intended to be included within the
present invention as are allelic variants of FGF-21.
[0057] Recombinant human FGF-21 may be made by expressing the DNA
sequences encoding FGF-21 in a suitable transformed host cell.
Using methods well known in the art, the DNA encoding FGF-21 may be
linked to an expression lector, transformed into a host cell and
conditions established that are suitable for expression of FGF-21
by the transformed cell.
[0058] The DNA encoding FGF-21 can be engineered to take advantage
of preferred codon usage of host cells. Codon usage in Pseudomonas
aeruginosa is described in, for example, West et al., Nucleic Acids
Res. 11:9323-9335 (1988). Codon usage in Saccharomyces cerevisiae
is described in, for example, Lloyd et al., Nucleic Acids Res.
20:5289-5295 (1992). Codon preference in Corynebacteria and a
comparison with E. coli preference is provided in Malubres et al.,
Gene 134:15-24 (1993). Codon usage in Drosophila melanogaster is
described in, for example, Akashi, Genetics 136:927-935 (1994).
Codon usage in yeast is also shown in FIG. 7, codon usage in
Drosophila is shown in FIG. 8, and codon usage for E. coli is shown
in FIG. 9.
[0059] Any suitable expression vector may be employed to produce
recombinant human FGF-21 such as expression vectors for use in
insect cells. Baculovirus expression systems can also be employed.
A preferable method is expression in insect cells, such as Tr5 or
Sf9 cells, using baculovirus vector.
[0060] The present invention includes nucleic acid sequences
including sequences that encode human FGF-21. Also included within
the scope of this invention are sequences that are substantially
the same as the nucleic acid sequences encoding FGF-21. Such
substantially the same sequences may, for example, be substituted
with codons more readily expressed in a given host cell such as E.
coli according to well known and standard procedures. Such modified
nucleic acid sequences are included within the scope of this
invention.
[0061] Specific nucleic acid sequences can be modified by those
skilled in the art and, thus, all nucleic acid sequences that code
for the amino acid sequences of FGF-21 can likewise be so modified.
The present invention thus also includes nucleic acid sequence
which will hybridize with all such nucleic acid sequences, or
complements of the nucleic acid sequences where appropriate, and
encode a polypeptide having the cell survival, growth or
differentiation activity of FGF-21. The present invention also
includes nucleic acid sequences that encode polypeptides that have
cell survival promoting activity and that are recognized by
antibodies that bind to FGF-21. Preferred methods and epitopes for
raising antibodies are described in Example 4.
[0062] The present invention also encompasses vectors comprising
expression regulatory elements operably linked to any of the
nucleic acid sequences included within the scope of the invention.
This invention also includes host cells of any variety that have
been transformed with vectors comprising expression regulatory
elements operably linked to any of the nucleic acid sequences
included within the scope of the present invention.
[0063] Methods are also provided herein for producing FGF-21.
Preparation can be by isolation from conditioned medium from a
variety of cell types so long as the cell type produces FGF-21. A
second and preferred method involves utilization of recombinant
methods by isolating or obtaining a nucleic acid sequence encoding
FGF-21, cloning the sequence along with appropriate regulatory
sequences into suitable vectors and cell types, and expressing the
sequence to produce FGF-21.
[0064] Although FGF-21 has been described on the basis of its high
expression level in liver, this factor may act on other cell types
as well. It is likely that FGF-21 will act on non-liver cells to
promote their survival, growth, differentiation state or function.
This expectation is based upon the activity of known growth
factors. Members of the FGF family act on many cell types of
different function and embryologic origin, even when their
expression is limited to one or a few tissues.
[0065] The inventors herein have identified that FGF-21 is
expressed at a higher level in liver. This suggests a role for
FGF-21 in, for example, precancerous lesions, hepatoma, cirrhosis,
repair, from inflammatory diseases, trauma or other types of
injury, and other diseases of the liver. Further, FGF-21 is also
expressed in thymus and testis. This suggests a role for FGF-21 in,
for example, infertility, control of testosterone production,
cancer of the testis or associated cells, and other disorders of
the testis, and in disorders of cells such as immune cells derived
from the thymus, for example, autoimmune disorders, leukemias and
lymphomas, immune deficiency states, and the like.
[0066] The present invention also includes therapeutic or
pharmaceutical compositions comprising FGF-21 in an effective
amount for treating patients with liver, testis or thymic disease,
and a method comprising administering a therapeutically effective
amount of FGF-21. These compositions and methods are useful for
treating a number of diseases. The compositions and methods herein
can also be useful to prevent degeneration and/or promote survival
in other non-liver tissues as well, such as promoting angiogenesis,
neuronal survival, wound healing, and the like. One skilled in the
art can readily use a variety of assays known in the art to
determine whether FGF-21 would be useful in promoting survival or
functioning in a particular cell type. Promotion of neuronal
survival is useful in the treatment of nervous system diseases and
conditions, including Parkinson's disease, Alzheimers disease,
traumatic injury to nerves, and degenerative disease of the nervous
system.
[0067] In certain circumstances, it may be desirable to modulate or
decrease the amount of FGF-21 expressed. Thus, in another aspect of
the present invention, FGF-21 anti-sense oligonucleotides can be
made and a method utilized for diminishing the level of expression
of FGF-21 by a cell comprising administering one or more FGF-21
anti-sense oligonucleotides. By FGF-21 anti-sense oligonucleotides
reference is made to oligonucleotides that have a nucleotide
sequence that interacts through base pairing with a specific
complementary nucleic acid sequence involved in the expression of
FGF-21 such that the expression of FGF-21 is reduced. Preferably,
the specific nucleic acid sequence involved in the expression of
FGF-21 is a genomic DNA molecule or mRNA molecule that encodes
FGF-21. This genomic DNA molecule can comprise regulatory regions
of the FGF-21 gene, or the coding sequence for mature FGF-21
protein. The term complementary to a nucleotide sequence in the
context of FGF-21 antisense oligonucleotides and methods therefor
means sufficiently complementary to such a sequence as to allow
hybridization to that sequence in a cell, i.e., under physiological
conditions. The FGF-21 antisense oligonucleotides preferably
comprise a sequence containing from about 8 to about 100
nucleotides and more preferably the FGF-21 antisense
oligonucleotides comprise from about 15 to about 30 nucleotides.
The FGF-21 antisense oligonucleotides can also contain a variety of
modifications that confer resistance to nucleolytic degradation
such as, for example, modified internucleoside linages (Uhlmann and
Peyman, Chemical Reviews 90:543-548 1990; Schneider and Banner,
Tetrahedron Lett. 31:335, 1990 which are incorporated by
reference), modified nucleic acid bases and/or sugars and the
like.
[0068] The therapeutic or pharmaceutical compositions of the
present invention can be administered by any Suitable route known
in the art including for example intravenous, subcutaneous,
intramuscular, transdermal, intrathecal or intracerebral.
Administration can be either rapid as by injection or over a period
of time as by slow infusion or administration of slow release
formulation.
[0069] FGF-21 can also be linked or conjugated with agents that
provide desirable pharmaceutical or pharmacodynamic properties. For
example, FGF-21 can be coupled to any substance known in the art to
promote penetration or transport across the blood-brain barrier
such as an antibody to the transferring receptor, and administered
by intravenous injection (see, for example, Friden et al. Science
259:373-377, 1993 which is incorporated by reference). Furthermore,
FGF-21 can be stably linked to a polymer such as polyethylene
glycol to obtain desirable properties of solubility, stability,
half-life and other pharmaceutically advantageous properties. (See,
for example, Davis et al., Enzyme Eng. 4:169-73, 1978; Burnham, Am.
J. Hosp. Pharm. 51:210-218, 1994 which are incorporated by
reference.)
[0070] The compositions are usually employed in the form of
pharmaceutical preparations. Such preparations are made in a manner
well known in the pharmaceutical art. One preferred preparation
utilizes a vehicle of physiological saline solution, but it is
contemplated that other pharmaceutically acceptable carriers such
as physiological concentrations of other non-toxic salts, five
percent aqueous glucose solution, sterile water or the like may
also be used. It may also be desirable that a suitable buffer be
present in the composition. Such solutions can, if desired, be
lyophilized and stored in a sterile ampoule ready for
reconstitution by the addition of sterile water for ready
injection. The primary solvent can be aqueous or alternatively
non-aqueous. FGF-21 can also be incorporated into a solid or
semi-solid biologically compatible matrix which can be implanted
into tissues requiring treatment.
[0071] The carrier can also contain other
pharmaceutically-acceptable excipients for modifying or maintaining
the pH, osmolarity, viscosity, clarity, color, sterility,
stability, rate of dissolution, or odor of the formulation.
Similarly, the carrier may contain still other
pharmaceutically-acceptable excipients for modifying or maintaining
release or absorption or penetration across the blood-brain
barrier. Such excipients are those substances usually and
customarily employed to formulate dosages for parenteral
administration in either unit dosage or multi-dose form or for
direct infusion into the cerebrospinal fluid by continuous or
periodic infusion.
[0072] Dose administration can be repeated depending upon the
pharmacokinetic parameters of the dosage formulation and the route
of administration used.
[0073] It is also contemplated that certain formulations containing
FGF-21 are to be administered orally. Such formulations are
preferably encapsulated and formulated with suitable carriers in
solid dosage forms. Some examples of suitable carriers, excipients,
and diluents include lactose, dextrose, sucrose, sorbitol,
mannitol, starches, gum acacia, calcium phosphate, alginates,
calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone,
cellulose, gelatin, syrup, methyl cellulose, methyl- and
propylhydroxybenzoates, talc, magnesium, stearate, water, mineral
oil, and the like. The formulations can additionally include
lubricating agents, wetting agents, emulsifying and suspending
agents, preserving agents, sweetening agents or flavoring agents.
The compositions may be formulated so as to provide rapid,
sustained, or delayed release of the active ingredients after
administration to the patient by employing procedures well known in
the art. The formulations can also contain substances that diminish
proteolytic degradation and promote absorption such as, for
example, surface active agents.
[0074] Depending on the treatment regimen contemplated, it may be
desired to control the rate of release of FGF-21 protein or variant
thereof to provide long-term treatment while minimizing the
frequency of administration. Such treatment regimens may be
desired, for example, where the FGF-21 protein is found to be
relatively unstable such that the localized concentration of active
protein is at an efficacious level for an insufficient period of
time. Thus, for example, for certain diseases, it may not be
desired or practical to perform repeated and frequent injections.
The major advantages of such sustained release systems include
targeted local delivery of drugs at a constant rate, less drug
required to treat the disease state, minimization of possible side
effects, and enhanced efficacy of treatment. Also, these forms of
delivery systems are capable of protecting drugs that are unstable
in vivo and that would normally require a frequent (losing
interval. Under such circumstances, sustained release may be
achieved by one of the methods readily available in the art such as
the encapsulation of FGF-21 conjugated heparin-Sepharose beads to
form heparin-alginate microspheres or the preparation of FGF-21 PLG
microspheres.
[0075] Heparin-alginate microspheres have been successfully
employed for the delivery of Basic Fibroblast Growth Factor to
tissue (Lopez et al., Journal of Pharmacology and Experimental
(1):385-390 (1997)). Similarly, Alginate/heparin-Sepharose
microspheres and films have been used as drug carriers to control
the release of a basic FGF-saponin conjugate in order to control
its release in small doses. Addition of heparin to solutions of
bFGF prevents losses in activity that accompany changes in pH or
elevation in temperature. See, for example, Gospodarowicz et al.,
J. Cell. Physiol. 128:475-484 (1986).
[0076] Binding of FGF-21 to heparin may be employed in order to
enhance its stability either during in vivo expression or
administration or in vitro during various stages of protein
purification. Thus, by the present invention, heparin may be added
to a solution of FGF-21 and the activity assayed by the methods
disclosed herein.
[0077] FGF-21 bound heparin-Sepharose beads may be encapsulated
into calcium alginate microspheres to permit the controlled release
of the heparin-stabilized FGF-21 protein. For example, microspheres
may be constructed by dropping a mixed solution of sodium alginate
with FGF-21 bound heparin-Sepharose beads into a hardening solution
of calcium chloride. Spheres are formed instantaneously as the
mixture enters the hardening solution. The size of the microsphere
may be adjusted by passing the FGF-21 bound heparin-Sepharose beads
through a cylinder of reduced cross-sectional area such as through
a hypodermic needle.
[0078] Encapsulation efficiency may be determined by comparing the
amount of encapsulated growth factor with that initially present in
solution. For example, the FGF-21 may be stripped from the
heparin-Sepharose beads with a solution of 3 M NaCl and functional
activity assays may be performed.
[0079] The specific dose is calculated according to the approximate
body weight or body surface area of the patient or the volume of
body space to be occupied. The dose will also be calculated
dependent upon the particular route of administration selected.
Further refinement of the calculations necessary to determine the
appropriate dosage for treatment is routinely made by those of
ordinary skill in the art. Such calculations can be made without
undue experimentation by one skilled in the art in light of the
activity disclosed herein in assay preparations of target cells.
Exact dosages are determined in conjunction with standard
dose-response studies. It will be understood that the amount of the
composition actually administered will be determined by a
practitioner, in the light of the relevant circumstances including
the condition or conditions to be treated, the choice of
composition to be administered, the age, weight, and response of
the individual patient, the severity of the patient's symptoms, and
the chosen route of administration.
[0080] In one embodiment of this invention, FGF-21 may be
therapeutically administered by implanting into patients vectors or
cells capable of producing a biologically-active form of FGF-21 or
a precursor of FGF-21, i.e., a molecule that can be readily
converted to a biological-active form of FGF-21 by the body. In one
approach cells that secrete FGF-21 may be encapsulated into
semipermeable membranes for implantation into a patient. The cells
can be cells that normally express FGF-21 or a precursor thereof or
the cells can be transformed to express FGF-21 or a precursor
thereof. It is preferred that the cell be of human origin and that
the FGF-21 be human FGF-21 when the patient is human. However, the
formulations and methods herein can be used for veterinary as well
as human applications and the term "patient" as used herein is
intended to include human and veterinary patients.
[0081] Cells can be grown ex vivo for use in transplantation or
engraftment into patients (Muench al, Leuk. & Lymph. 16:1-11,
1994 which is incorporated by reference). In another embodiment of
the present invention, FGF-21 is used to promote the ex vivo
expansion of a cells for transplantation or engraftment. Current
methods have used bioreactor culture systems containing factors
such as erythropoietin, colony stimulating factors, stem cell
factor, and interleukins to expand hematopoietic progenitor cells
for erythrocytes, monocytes, neutrophils, and lymphocytes
(Verfaillie, Stem Cells 12:466-476, 1994 which is incorporated by
reference). These stem cells can be isolated from the marrow of
human donors, from human peripheral blood, or from umbilical cord
blood cells. The expanded blood cells are used to treat patients
who lack these cells as a result of specific disease conditions or
as a result of high dose chemotherapy for treatment of malignancy
(George, Stem Cells 12(Suppl 1):249-255, 1994 which is incorporated
by reference). In the case of cell transplant after chemotherapy,
autologous transplants can be performed by removing bone marrow
cells before chemotherapy, expanding the cells ex vivo using
methods that also function to purge malignant cells, and
transplanting the expanded cells back into the patient following
chemotherapy (for review, see Rummel and Van Zant, J. Hematotherapy
3:213-218, 1994 which is incorporated by reference). Since FGF-21
is expressed in liver cells, it is believed that FGF-21 can
function to prevent or slow the progression of cirrhosis changes in
liver cells, and to promote hepatic cell regeneration after injury
or after surgical removal of part of the liver due to disease.
[0082] In a number of circumstances it would be desirable to
determine the levels of FGF-21 in a patient. The identification of
FGF-21 along with the present report showing expression of FGF-21
provides the basis for the conclusion that the presence of FGF-21
serves a normal physiological function related to cell growth and
survival. Endogenously produced FGF-21 may also play a role in
certain disease conditions.
[0083] Given that FGF-21 is expressed in liver, thymic and
testicular tissue, it is likely that the level of FGF-21 may be
altered in a variety of conditions and that quantification of
FGF-21 levels would provide clinically useful information.
Furthermore, in the treatment of degenerative conditions, altered
physiological function or in recovery from injury to the liver,
testis or thymic cells, compositions containing FGF-21 can be
administered and it would likely be desirable to achieve certain
target levels of FGF-21 in sera or in any desired tissue
compartment. It would, therefore, be advantageous to be able to
monitor the levels of FGF-21 in a patient. Accordingly, the present
invention also provides methods for detecting the presence of
FGF-21 in a sample from a patient.
[0084] The term "detection" as used herein in the context of
detecting the presence of FGF-21 in a patient is intended to
include determining the amount of FGF-21 or the ability to express
an amount of FGF-21 in a patient, distinguishing FGF-21 from other
growth factors, the estimation of prognosis in terms of probable
outcome of a degenerative disease and prospect for recovery,
monitoring the FGF-21 levels over a period of time as a measure of
status of the condition, and monitoring FGF-21 levels for
determining a preferred therapeutic regimen for the patient.
[0085] To detect the presence of FGF-21 in a patient, a sample is
obtained from the patient. The sample can be a tissue biopsy sample
or a sample of blood, plasma, serum, CSF or the like. FGF-21 is
expressed in liver tissues, as discussed in Example 2. Samples for
detecting FGF-21 can be taken from this tissue. When assessing the
levels of FGF-21 in the liver, thymus or testis, a preferred sample
is a sample taken from these tissues or from veins draining these
tissues.
[0086] In some instances it is desirable to determine whether the
FGF-21 gene is intact in the patient or in a tissue or cell line
within the patient. By an intact FGF-21 gene it is meant that there
are no alterations in the gene such as point mutations, deletions,
insertions, chromosomal breakage, chromosomal rearrangements and
the like wherein such alteration might alter production of FGF-21
or alter its biological activity, stability or the like to lead to
disease processes or susceptibility to cellular degenerative
conditions. Thus, in one embodiment of the present invention a
method is provided for detecting and characterizing any alterations
in the FGF-21 gene. The method comprises providing an
oligonucleotide that contains the FGF-21 cDNA, genomic DNA or a
fragment thereof or a derivative thereof. By a derivative of an
oligonucleotide, it is meant that the derived oligonucleotide is
substantially the same as the sequence from which it is derived in
that the derived sequence has sufficient sequence complementarily
to the sequence from which it is derived to hybridize to the FGF-21
gene. The derived nucleotide sequence is not necessarily physically
derived from the nucleotide sequence, but may be generated in any
manner including for example, chemical synthesis or DNA replication
or reverse transcription or transcription.
[0087] Typically, patient genomic DNA is isolated from a cell
sample from the patient and digested with one or more restriction
endonucleases such as, for example, TaqI and AluI. Using the
Southern blot protocol, which is well known in the art, this assay
determines whether a patient or a particular tissue in a patient
has an intact FGF-21 gene or an FGF-21 gene abnormality.
[0088] Hybridization to an FGF-21 gene would involve denaturing the
chromosomal DNA to obtain a single-stranded DNA; contacting the
single-stranded DNA with a gene probe associated with the FGF-21
gene sequence; and identifying the hybridized DNA-probe to detect
chromosomal DNA containing at least a portion of a human FGF-21
gene.
[0089] The term "probe" as used herein refers to a structure
comprised of a polynucleotide that forms a hybrid structure with a
target sequence, due to complementarity of probe sequence with a
sequence in the target region. Oligomers suitable for use as probes
may contain a minimum of about 8-12 contiguous nucleotides which
are complementary to the targeted sequence and preferably a minimum
of about 20.
[0090] The FGF-21 gene probes of the present invention can be DNA
or RNA oligonucleotides and can be made by any method known in the
art such as, for example, excision, transcription or chemical
synthesis. Probes may be labeled with any detectable label known in
the art such as, for example, radioactive or fluorescent labels or
enzymatic marker. Labeling of the probe can be accomplished by any
method known in the art such as by PCR, random priming, end
labeling, nick translation or the like. One skilled in the art will
also recognize that other methods not employing a labeled probe can
be used to determine the hybridization. Examples of methods that
can be used for detecting hybridization include Southern blotting,
fluorescence in situ hybridization, and single-strand conformation
polymorphism with PCR amplification.
[0091] Hybridization is typically carried out at 250-45.degree. C.,
more preferably at 32.degree.-40.degree. C. and more preferably at
37.degree.-38.degree. C. The time required for hybridization is
from about 0.25 to about 96 hours, more preferably from about one
to about 72 hours, and most preferably from about 4 to about 24
hours.
[0092] FGF-21 gene abnormalities can also be detected by using the
PCR method and primers that flank or lie within the FGF-21 gene.
The PCR method is well known in the art. Briefly, this method is
performed using two oligonucleotide primers which are capable of
hybridizing to the nucleic acid sequences flanking a target
sequence that lies within an FGF-21 gene and amplifying the target
sequence. The terms "oligonucleotide primer" as used herein refers
to a short strand of DNA or RNA ranging in length from about 8 to
about 30 bases. The upstream and downstream primers are typically
from about 20 to about 30 base pairs in length and hybridize to the
flanking regions for replication of the nucleotide sequence. The
polymerization is catalyzed by a DNA-polymerase in the presence of
deoxynucleotide triphosphates or nucleotide analogs to produce
double-stranded DNA molecules. The double strands are then
separated by any denaturing method including physical, chemical or
enzymatic. Commonly, the method of physical denaturation is used
involving heating the nucleic acid, typically to temperatures from
about 80.degree. C. to 105.degree. C. for times ranging from about
1 to about 10 minutes. The process is repeated for the desired
number of cycles.
[0093] The primers are selected to be substantially complementary
to the strand of DNA being amplified. Therefore, the primers need
not reflect the exact sequence of the template, but must be
sufficiently complementary to selectively hybridize with the strand
being amplified.
[0094] After PCR amplification, the DNA sequence comprising FGF-21
or pre-pro FGF-21 or a fragment thereof is then directly sequenced
and analyzed by comparison of the sequence with the sequences
disclosed herein to identify alterations which might change
activity or expression levels or the like.
[0095] In another embodiment, a method for detecting FGF-21 is
provided based upon an analysis of tissue expressing the FGF-21
gene. Certain tissues such as those identified below in Example 2
have been found to express the FGF-21 gene. The method comprises
hybridizing a polynucleotide to mRNA from a sample of tissues that
normally express the FGF-21 gene. The sample is obtained from a
patient suspected of having an abnormality in the FGF-21 gene or in
the FGF-21 gene of particular cells.
[0096] To detect the presence of mRNA encoding FGF-21 protein, a
sample is obtained from a patient. The sample can be from blood or
from a tissue biopsy sample. The sample may be treated to extract
the nucleic acids contained therein. The resulting nucleic acid
from the sample is subjected to gel electrophoresis or other size
separation techniques.
[0097] The mRNA of the sample is contacted with a DNA sequence
serving as a probe to form hybrid duplexes. The use of a labeled
probes as discussed above allows detection of the resulting
duplex.
[0098] When using the cDNA encoding FGF-21 protein or a derivative
of the cDNA as a probe, high stringency conditions can be used in
order to prevent false positives, that is the hybridization and
apparent detection of FGF-21 nucleotide sequences when in fact an
intact and functioning FGF-21 gene is not present. When using
sequences derived from the FGF-21 cDNA, less stringent conditions
could be used, however, this would be a less preferred approach
because of the likelihood of false positives. The stringency of
hybridization is determined by a number of factors during
hybridization and during the washing procedure, including
temperature, ionic strength, length of time and concentration of
formamide. These factors are outlined in, for example, Sambrook et
al., Molecular Cloning: A Laboratory Manual, 2.sup.nd Ed. (1989)
Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
[0099] In order to increase the sensitivity of the detection in a
sample of mRNA encoding the FGF-21 protein, the technique of
reverse transcription/polymerization chain reaction (RT/PCR) can be
used to amplify cDNA transcribed from mRNA encoding the FGF-21
protein. The method of RT/PCR is well known in the art, and can be
performed as follows. Total cellular RNA is isolated by, for
example, the standard guanidium isothiocyanate method and the total
RNA is reverse transcribed. The reverse transcription method
involves synthesis of DNA on a template of RNA using a reverse
transcriptase enzyme and a 3' end primer. Typically, the primer
contains an oligo(dT) sequence. The cDNA thus produced is then
amplified using the PCR method and FGF-21 specific primers.
(Belyavsky et al., Nucl. Acid Res. 17:2919-2932, 1989; Krug and
Berger, Methods in Enzymology, 152:316-325, Academic Press, NY,
1987 which are incorporated by reference).
[0100] The polymerase chain reaction method is performed as
described above using two oligonucleotide primers that are
substantially complementary to the two flanking regions of the DNA
segment to be amplified.
[0101] Following amplification, the PCR product is then
electrophoresed and detected by ethidium bromide staining or by
phosphoimaging.
[0102] The present invention further provides for methods to detect
the presence of the FGF-21 protein in a sample obtained from a
patient. Any method known in the art for detecting proteins can be
used. Such methods include, but are not limited to immunodiffusion,
immunoelectrophoresis, immunochemical methods, binder-ligand
assays, immunohistochemical techniques, agglutination and
complement assays. (for example, see Basic and Clinical Immunology,
217-262, Sites and Terr, eds., Appleton & Lange, Norwalk,
Conn., 1991 which is incorporated by reference). Preferred are
binder-ligand immunoassay methods including reacting antibodies
with an epitope or epitopes of the FGF-21 protein and competitively
displacing a labeled FGF-21 protein or derivative thereof.
Preferred antibodies are prepared according to Example 4.
[0103] As used herein, a derivative of the FGF-21 protein is
intended to include a polypeptide in which certain amino acids have
been deleted or replaced or changed to modified or unusual amino
acids wherein the FGF-21 derivative is biologically equivalent to
FGF-21 and wherein the polypeptide derivative cross-reacts with
antibodies raised against the FGF-21 protein. By cross-reaction it
is meant that an antibody reacts with an antigen other than the one
that induced its formation.
[0104] Numerous competitive aid non-competitive protein binding
immunoassays are well known in the art. Antibodies employed in such
assays may be unlabeled, for example as used in agglutination
tests, or labeled for use in a wide variety of assay methods.
Labels that can be used include radionuclides, enzymes,
fluorescers, chemiluminescers, enzyme substrates or co-factors,
enzyme inhibitors, particles, dyes and the like for use in
radioimmunoassay (RIA), enzyme immunoassays, e.g., enzyme-linked
immunosorbent assay (ELISA), fluorescent immunoassays and the
like.
[0105] Polyclonal or monoclonal antibodies to the FGF-21 protein or
an epitope thereof can be made for use in immunoassays by any of a
number of methods known in the art. By epitope reference is made to
an antigenic determinant of a polypeptide. An epitope could
comprise 3 amino acids in a spatial conformation which is unique to
the epitope. Generally an epitope consists of at least 5 such amino
acids. Methods of determining the spatial conformation of amino
acids are known in the art, and include, for example, x-ray
crystallography and 2 dimensional nuclear magnetic resonance.
[0106] One approach for preparing antibodies to a protein is the
selection and preparation of an amino acid sequence of all or part
of the protein, chemically synthesizing the sequence and injecting
it into an appropriate animal, usually a rabbit or a mouse (see
Example 4).
[0107] Oligopeptides can be selected as candidates for the
production of an antibody to the FGF-21 protein based upon the
oligopeptides lying in hydrophilic regions, which are thus likely
to be exposed in the mature protein. Preferred oligopeptides are
RQRYLYTDDAQQTEAH (residues 46-61 of SEQ NO:4) and HLPGNKSPHRDPAPR
(residues 146-160 of SEQ ID NO:4). Additional oligopeptides can be
determined using, for example, the Antigenicity Index of Welling,
G. W. et al., FEBS Lett. 188:215-218, 1985, incorporated herein by
reference.
[0108] Antibodies to FGF-21 can also be raised against
oligopeptides that include one or more of the conserved regions
identified herein such that the antibody can cross-react with other
family members. Such antibodies can be used to identify and isolate
the other family members.
[0109] Methods for preparation of the FGF-21 protein or an epitope
thereof include, but are not limited to chemical synthesis,
recombinant DNA techniques or isolation from biological samples.
Chemical synthesis of a peptide can be performed, for example, by
the classical Merrifeld method of solid phase peptide synthesis
(Merrifeld, J. Am. Chem. Soc. 85:2149, 1963 which is incorporated
by reference) or the FMOC strategy on a Rapid Automated Multiple
Peptide Synthesis system (E.I. du Pont de Nemours Company,
Wilmington, Del.) (Caprino and Han, J. Org. Chem. 37:3404, 1972
which is incorporated by reference).
[0110] Polyclonal antibodies can be prepared by immunizing rabbits
or other animals by injecting antigen followed by subsequent boosts
at appropriate intervals. The animals are bled and sera assayed
against purified FGF-21 protein usually by ELISA or by bioassay
based upon the ability to block the action of FGF-21 on liver or
other cells. When using avian species, e.g., chicken, turkey and
the like, the antibody can be isolated from the yolk of the egg.
Monoclonal antibodies can be prepared after the method of Milstein
and Kohler by fusing splenocytes from immunized mice with
continuously replicating tumor cells such as myeloma or lymphoma
cells. (Milstein and Kohler, Nature 256:495-497, 1975; Gulfre and
Milstein, Methods in Enzymology: Immunochemical Techniques 73:1-46,
Langone and Banatis eds., Academic Press, 1981 which are
incorporated by reference). The hybridoma cells so formed are then
cloned by limiting dilution methods and supernates assayed for
antibody production by ELISA, RIA or bioassay.
[0111] The unique ability of antibodies to recognize and
specifically bind to target proteins provides an approach for
treating an overexpression of the protein. Thus, another aspect of
the present invention provides for a method for preventing or
treating diseases involving overexpression of the FGF-21 protein by
treatment of a patient with specific antibodies to the FGF-21
protein.
[0112] Specific antibodies, either polyclonal or monoclonal, to the
FGF-21 protein can be produced by any suitable method known in the
art as discussed above. For example, marine or human monoclonal
antibodies can be produced by hybridoma technology or,
alternatively, the FGF-21 protein, or an immunologically active
fragment thereof, or an anti-idiotypic antibody, or fragment
thereof can be administered to an animal to elicit the production
of antibodies capable of recognizing and binding to the FGF-21
protein. Such antibodies can be from any class of antibodies
including, but not limited to IgG, IgA, IgM, IgD, and IgE or in the
case of avian species, IgY and from any subclass of antibodies.
[0113] Polypeptides encoded by the instant polynucleotides and
corresponding full-length genes can be used to screen peptide
libraries, protein libraries, small molecule libraries, and phage
display libraries, and other known methods, to identify analogs or
antagonists.
[0114] Native FGF polypeptides may play a role in cancer. For
example, FGF family members can induce marked morphological
transformation of NIH 3T3 cells, and exhibit strong tumorigenicity
in nude mice. Angiogenic activity has been exhibited by FGF family
members. Thus, inhibitors of FGF can be used to treat cancer, such
as prostate cancer.
[0115] A library of peptides may be synthesized following the
methods disclosed in U.S. Pat. No. 5,010,175, and in PCT No. WO
91/17823. As described below in brief, a mixture of peptides is
prepared, which is then screened to identify the peptides
exhibiting the desired signal transduction and receptor binding
activity. According to the method of the '175 patent, a suitable
peptide synthesis support (e.g., a resin) is coupled to a mixture
of appropriately protected, activated amino acids. The
concentration of each amino acid in the reaction mixture is
balanced or adjusted in inverse proportion to its coupling reaction
rate so that the product is an equimolar mixture of amino acids
coupled to the starting resin. The bound amino acids are then
deprotected, and reacted with another balanced amino acid mixture
to form an equimolar mixture of all possible dipeptides. This
process is repeated until a mixture of peptides of the desired
length (e.g., hexamers) is formed. Note that one need not include
all amino acids in each step: one may include only one or two amino
acids in some steps (e.g., where it is known that a particular
amino acid is essential in a given position), thus reducing the
complexity of the mixture. After the synthesis of the peptide
library is completed, the mixture of peptides is screened for
binding to the selected polypeptide. The peptides are then tested
for their ability to inhibit or enhance activity. Peptides
exhibiting the desired activity are then isolated and
sequenced.
[0116] The method described in. PCT No. WO 91/17823 is similar.
However, instead of reacting the synthesis resin with a mixture of
activated amino acids, the resin is divided into twenty equal
portions (or into a number of portions corresponding to the number
of different amino acids to be added in that step), and each amino
acid is coupled individually to its portion of resin. The resin
portions are then combined, mixed, and again divided into a number
of equal portions for reaction with the second amino acid. In this
manner, each reaction may be easily driven to completion.
Additionally, one may maintain separate "subpools" by treating
portions in parallel, rather than combining all resins at each
step. This simplifies the process of determining which peptides are
responsible for any observed receptor binding or signal
transduction activity.
[0117] In such cases, the subpools containing, e.g., 1-2,000
candidates each are exposed to one or more polypeptides of the
invention. Each subpool that produces a positive result is then
resynthesized as a group of smaller subpools (sub-subpools)
containing, e.g., 20-100 candidates, and reassayed. Positive
sub-subpools may be resynthesized as individual compounds, and
assayed finally to determine the peptides that exhibit a high
binding constant. These peptides can be tested for their ability to
inhibit or enhance the native activity. The methods described in
PCT No. WO 91/7823 and U.S. Pat. No. 5,194,392 (herein incorporated
by reference) enable the preparation of such pools and subpools by
automated techniques in parallel, such that all synthesis and
resynthesis may be performed in a matter of days.
[0118] Peptide agonists or antagonists are screened using any
available method, such as signal transduction, antibody binding,
receptor binding and mitogenic assays. The assay conditions ideally
should resemble the conditions under which the native activity is
exhibited in vivo, that is, under physiologic pH, temperature, and
ionic strength. Suitable agonists or antagonists will exhibit
strong inhibition or enhancement of the native activity at
concentrations that do not cause toxic side effects in the subject.
Agonists or antagonists that compete for binding to the native
polypeptide may require concentrations equal to or greater thin the
native concentration, while inhibitors capable of binding
irreversibly to the polypeptide may be added in concentrations on
the order of the native concentration.
[0119] The availability of FGF-21 and mFGF-21 allows for the
identification of small molecules and low molecular weight
compounds that inhibit the binding of FGF-21 to its receptor,
through routine application of high-throughput screening methods
(FITS). I-ITS methods generally refer to technologies that permit
the rapid assaying of lead compounds for therapeutic potential. HTS
techniques employ robotic handling of test materials, detection of
positive signals, and interpretation of data. Lead compounds may be
identified via the incorporation of radioactivity or through
optical assays that rely on absorbance, fluorescence or
luminescence as read-outs. Gonzalez, J. E. et al., (1998) Curr.
Opin. Biotech. 9:624-631. Assays for detecting interaction between
an FGF molecule and FGF receptor are described in, for example,
Blunt, A. C. et al., (1997) J. Biol. Chem. 272:3733-3738, and such
assays can be adapted for determining if a candidate molecule can
inhibit the interaction between FGF-21 and its receptor.
[0120] Model systems are available that can be adapted for use in
high throughput screening for compounds that inhibit the
interaction of FGF-21 with its receptor, for example by competing
with FGF-21 for receptor binding. Sarubbi et al., (1996) Anal.
Biochem. 237:70-75 describe cell-free, non-isotopic assays for
identifying molecules that compete with natural ligands for binding
to the active site of IL-1 receptor. Martens, C. et al., (1999)
Anal. Biochem. 273:20-31 describe a generic particle-based
nonradioactive method in which a labeled ligand binds to its
receptor immobilized on a particle; label on the particle decreases
in the presence of a molecule that competes with the labeled ligand
for receptor binding.
[0121] The therapeutic FGF-21 polynucleotides and polypeptides of
the present invention may be utilized in gene delivery vehicles.
The gene delivery vehicle may be of viral or non-viral origin (see
generally, Jolly, Cancer Gene Therapy 1:51-64 (1994); Kimura, Human
Gene Therapy 5:845-852 (1994); Connelly, Human Gene Therapy
1:185-193 (1995); and Kaplitt, Nature Genetics 6:148-153 (1994)).
Gene therapy vehicles for delivery of constructs including a coding
sequence of a therapeutic of the invention can be administered
either locally or systemically. These constructs can utilize viral
or non-viral vector approaches. Expression of such coding sequences
can be induced using endogenous mammalian or heterologous
promoters. Expression of the coding sequence can be either
constitutive or regulated.
[0122] The present invention can employ recombinant retroviruses
which are constructed to carry or express a selected nucleic acid
molecule of interest. Retrovirus vectors that can be employed
include those described in EP 0 415 731; WO 90/07936; WO 94/03622;
WO 93/25698; WO 93/25234; U.S. Pat. No. 5,219,740; WO 93/11230; WO
93/10218; Vile and Hart, Cancer Res. 53:3860-3864 (1993); Vile and
Hart, Cancer Res. 53:962-967 (1993); Rain et al., Cancer Res.
53:83-88 (1993); Takamiya et al. J. Neurosci. Res. 33:493-503
(1992); Baba et al., J. Neurosurg. 79:729-735 (1993); U.S. Pat. No.
4,777,127; GB Patent No. 2,200,651; and EP 0 345 242. Preferred
recombinant retroviruses include those described in WO
91/02805.
[0123] Packaging cell lines suitable for use with the
above-described retroviral vector constructs may be readily
prepared (see PCT publications WO 95/30763 and WO 92/05266), and
used to create producer cell lines (also termed vector cell lines)
for the production of recombinant vector particles. Within
particularly preferred embodiments of the invention, packaging cell
lines are made from human (such as HT1080 cells) or mink parent
cell lines, thereby allowing production of recombinant retroviruses
that can survive inactivation in human serum.
[0124] The present invention also employs alphavirus-based vectors
that can function as gene delivery vehicles. Such vectors can be
constructed from a wide variety of alphaviruses, including, for
example, Sindbis virus vectors, Semliki forest virus (ATCC VR-67;
ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and
Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250;
ATCC VR 1249; ATCC VR-532). Representative examples of such vector
systems include those described in U.S. Pat. Nos. 5,091,309;
5,217,879; and 5,185,440; and PCT Publication Nos. WO 92/10578; WO
94/21792; WO 95/27069; WO 95/27044; and WO 95/07994.
[0125] Gene delivery vehicles of the present invention can also
employ parvovirus such as adeno-associated virus (AAV) vectors.
Representative examples include the AAV vectors disclosed by
Srivastava in WO 93/09239, Samulski et al., J. Vir. 63:3822-3828
(1989); Mendelson et al., Virol. 166:154-165 (1988); and Flotte et
al., P.N.A.S. 90:10613-10617 (1993).
[0126] Representative examples of adenoviral vectors include those
described by Berkner, Biotechniques 6:616-627 (Biotechniques);
Rosenfeld et al., Science 252:431-434 (1991); WO 93/19191; Kolls et
al., P.N.A.S.: 215-219 (1994); Kass-Eisler et al., P.N.A.S.
90:11498-11502 (1993); Guzman et al., Circulation 88:2838-2848
(1993); Guzman et al., Cir. Res. 73:1202-1207 (1993); Zabner et
al., Cell 75:207-216 (1993); Li et al., Hum. Gene Ther. 4:403-409
(1993); Cailaud et al., Eur. J. Neurosci. 5:1287-1291 (1993);
Vincent et al., Nat. Genet. 5:130-134 (1993); Jaffe et al., Nat.
Genet. 1:372-378 (1992); and Levrero et al., Gene 101:195-202
(1992). Exemplary adenoviral gene therapy vectors employable in
this invention also include those described in WO 94/12649, WO
93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655.
Administration of DNA linked to killed adenovirus as described in
Curiel, Hum. Gene Ther. 3:147-154 (1992) may be employed.
[0127] Other gene delivery vehicles and methods may be employed,
including polycationic condensed DNA linked or unlinked to killed
adenovirus alone, for example Curiel, Hum. Gene Ther. 3:147-154
(1992); ligand-linked DNA, for example see Wu, J. Biol. Chem.
264:16985-16987 (1989); eukaryotic cell delivery vehicles cells,
for example see U.S. Ser. No. 08/240,030, filed May 9, 1994, and
U.S. Ser. No. 08/404,796; deposition of photopolymerized hydrogel
materials; hand-held gene transfer particle gun, as described in
U.S. Pat. No. 5,149,655; ionizing radiation as described in U.S.
Pat. No. 5,206,152 and in WO 92/11033; nucleic charge
neutralization or fusion with cell membranes. Additional approaches
are described in Philip, Mol. Cell Biol. 14:2411-2418 (1994), and
in Woffendin, Proc. Natl. Acad. Sci. 91:1581-1585 (1994).
[0128] Naked DNA may also be employed. Exemplary naked DNA
introduction methods are described in WO 90/11092 and U.S. Pat. No.
5,580,859. Uptake efficiency may be improved using biodegradable
latex beads. DNA coated latex beads are efficiently transported
into cells after endocytosis initiation by the beads. The method
may be improved further by treatment of the beads to increase
hydrophobicity and thereby facilitate disruption of the endosome
and release of the DNA into the cytoplasm. Liposomes that can act
as gene delivery vehicles are described in U.S. Pat. No. 5,422,120,
PCT Patent Publication Nos. WO 95/13796, WO 94/23697, and WO
91/14445, and EP No. 0 524 968.
[0129] Further non-viral delivery suitable for use includes
mechanical delivery systems such as the approach described in
Woffendin et al., Proc. Natl. Acad. Sci. USA 91(24):11581-11585
(1994). Moreover, the coding sequence and the product of expression
or such can be delivered through deposition of photopolymerized
hydrogel materials. Other conventional methods for gene delivery
that can be used for delivery of the coding sequence include, for
example, use of hand-held gene transfer particle gun, as described
in U.S. Pat. No. 5,149,655; use of ionizing radiation for
activating transferred gene, as described in U.S. Pat. No.
5,206,152 and PCT Patent Publication No. WO 92/11033.
[0130] FGF has been implicated in diseases characterized by loss of
function, inadequate function/number, abnormal function or death of
cells, tissues or organs for which function or survival can be
prolonged/rescued, and abnormalities reversed or prevented by
therapy with FGF.
[0131] Loss of pulmonary, bronchia or alveolar cells or function,
healing of pulmonary or bronchia wounds, pulmonary infraction,
emphysema/chronic obstructive pulmonary disease, asthma, sequelae
of infectious or autoimmune disease, sequelae of pulmonary arterial
or venous hypertension, pulmonary fibrosis, pulmonary disease of
immaturity, and cystic fibrosis are conditions amenable to
treatment with FGF.
[0132] Ischemic vascular disease may be amenable to FGF-21
treatment, wherein the disease is characterized by inadequate blood
flow to an organ(s). Treatment may induce therapeutic angiogenesis
or preserve function/survival of cells (myocardial
ischemia/infarction, peripheral vascular disease, renal artery
disease, stroke). Cardiomyopathies characterized by loss of
function or death of cardiac myocytes or supporting cells in the
heart (congestive heart failure, myocarditis) may also be treated
using FGF-21, as can musculoskeletal disease characterized by loss
of function, inadequate function or death of skeletal muscle cells,
bone cells or supporting cells. Examples include skeletal
myopathies, bone disease, and arthritis.
[0133] FGF-21 polynucleotides and polypeptides may aid in
correction of congenital defects due to loss of FGF-21 molecule or
its function (liver, heart, lung, brain, limbs, kidney, etc.).
[0134] Treatment of wound healing is yet another use of FGF-21
polypeptides and polynucleotides, either clue to trauma, disease,
medical or surgical treatment, including regeneration of cell
populations and tissues depleted by these processes. Examples
include liver regeneration, operative wound healing,
re-endothelialization of injured blood vessels, healing of
traumatic wounds, healing of ulcers due to vascular, metabolic
disease, etc., bone fractures, loss of cells due to inflammatory
disease, etc.
[0135] FGF-21 may also be used in screens to identify drugs for
treatment of cancers which involve over activity of the molecule,
or new targets which would be useful in the identification of new
drugs.
[0136] For all of the preceding embodiments, the clinician will
determine, based on the specific condition, whether FGF-21
polypeptides or polynucleotides, antibodies to FGF-21, or small
molecules such as peptide analogues or antagonists, will be the
most suitable form of treatment. These forms are all within the
scope of the invention.
[0137] Preferred embodiments of the invention are described in the
following examples. Other embodiments within the scope of the
claims herein will be apparent to one skilled in the art from
consideration of the specification or practice of the invention as
disclosed herein. It is intended that the specification, together
with the examples, be considered exemplary only, with the scope and
spirit of the invention being indicated by the claims which follow
the examples.
EXAMPLES
Example 1
[0138] Isolation and Analysis of Mouse FGF-21-DNA was prepared from
mouse embryo cDNA. DNA was amplified from mouse embryo cDNA by
polymerase chain reaction (PCR) for 30 cycles in 25 .mu.l of a
reaction mixture containing each of the sense and antisense
degenerate primers representing all possible codons corresponding
to the amino acid sequences of human FGF-19, RPYDGYN and LPMLPM,
respectively. The amplified product was further amplified by PCR
with each of the sense and antisense degenerate primers
representing all possible codons corresponding to the amino acid
sequences of human FGF-19, RPDGYN and HFLPML, respectively. The
amplified DNAs of expected size (approximately 120 base pairs) were
cloned. By determination of the nucleotide sequences of the cloned
DNAs, a novel mouse FGF, FGF-21, cDNA was identified. To determine
the entire coding region of the novel FGF cDNA, the coding region
was amplified from mouse embryo cDNA by adaptor-ligation mediated
PCR using a Marathon cDNA amplification kit (Clontech, Palo Alto,
Calif.) and primers specific for the FGF. The cDNA encoding the
entire coding region of the FGF was amplified from mouse embryo
cDNA by PCR using the FGF-specific primers including the 5' and 3'
noncoding sequences, and cloned into the pGEM-T DNA vector. The
nucleotide sequence is shown in SEQ ID NO:1 and the amino acid
sequence is shown in SEQ ID NO:2.
Example 2
[0139] Expression of FGF-21 in Mouse Tissues--Poly (A).sup.+ RNA
(10 .mu.g) from mouse tissues was dissolved on a denaturing agarose
gel (1%) containing formaldehyde, and transferred to a
nitrocellulose membrane in 20.times.SSC (1.times.SSC:0.15 M
NACl/0.015 M sodium citrate) overnight. A .sup.32P-labeled FGF-21
cDNA probe (-650 base pairs) was labeled with a random primer
labeling kit (Pharmacia Biotech, Uppsala, Sweden) and deoxycytidine
5'-[.alpha.-.sup.32P-]triphosphate (110 TBq/mmol) (ICN Biomedicals
Inc., Costa Mesa, Calif.). The membrane was incubated in
hybridization solution containing the labeled probe as described
(Hoshikawa et al., Biochem. Biophys. Res. Commun. 244:187-191
(1998)), and analyzed with a radio-imaging analyzer (BAS 2000, Fuji
Photo Film Co., Tokyo, Japan). As shown in FIG. 3, FGF-21
expression was most predominant in liver, with expression also seen
in testis and thymus.
Example 3
[0140] Isolation and Analysis of Human FGF-21--The human FGF-21
gene was located in the 5' flanking region of a putative human
alpha 1,2-fucosyltransferase gene. The cDNA encoding the entire
coding region of human FGF-21 was amplified from fetal brain cDNA
by PCR using the FGF-specific primers including the 5' and 3'
noncoding sequences, and cloned into the pGEM-1 DNA vector. The
protein contains 209 amino acids, as shown in SEQ ID NO:4 (FIG. 5),
and is encoded by the polynucleotide sequence of SEQ ID NO:3.
Primers for amplification of human FGF-21 cDNA coding region
are:
TABLE-US-00001 sense primer for FGF-21: 5' agccattgatggactcggac 3';
antisense primer for FGF-21: 5' tggcttcaggaagcgtagct 3'
Example 4
[0141] Preparation of Antisera to FGF-21 by Immunization of Rabbits
with an FGF-21 Peptide--A peptide sequence corresponding to
selected contiguous amino acids of the human FGF-21 protein is
synthesized and coupled to keyhole limpet hemocyanin (KLH) as
described (Harlow and Land, Antibodies: A Laboratory Manual, 1988.
Cold Spring Harbor Laboratory, New York, N.Y.) The KLH-coupled
peptide is used to immunize rabbits. Antisera are tested for
specificity to FGF-21, and for cross-reactivity with other FGF
proteins.
[0142] Exemplary peptide sequences are:
TABLE-US-00002 1. RQRYLYDDAQQTEAH (residues 46-61 of SEQ ID NO:4)
2. HLPGNKSPHRDPAPR (residues 146-160 of SEQ ID NO:4)
[0143] All patents, published patent applications and publications
cited herein are incorporated by reference as if set forth fully
herein.
[0144] Although certain preferred embodiments have been described
herein, it is not intended that such embodiments be construed as
limitations on the scope of the invention except as set forth in
the following claims.
Sequence CWU 1
1
171659DNAMus musculusCDS(14)...(646) 1gagcgcagcc ctg atg gaa tgg
atg aga tct aga gtt ggg acc ctg gga 49 Met Glu Trp Met Arg Ser Arg
Val Gly Thr Leu Gly 1 5 10ctg tgg gtc cga ctg ctg ctg gct gtc ttc
ctg ctg ggg gtc tac caa 97Leu Trp Val Arg Leu Leu Leu Ala Val Phe
Leu Leu Gly Val Tyr Gln 15 20 25gca tac ccc atc cct gac tcc agc ccc
ctc ctc cag ttt ggg ggt caa 145Ala Tyr Pro Ile Pro Asp Ser Ser Pro
Leu Leu Gln Phe Gly Gly Gln 30 35 40gtc cgg cag agg tac ctc tac aca
gat gac gac caa gac act gaa gcc 193Val Arg Gln Arg Tyr Leu Tyr Thr
Asp Asp Asp Gln Asp Thr Glu Ala45 50 55 60cac ctg gag atc agg gag
gat gga aca gtg gta ggc gca gca cac cgc 241His Leu Glu Ile Arg Glu
Asp Gly Thr Val Val Gly Ala Ala His Arg 65 70 75agt cca gaa agt ctc
ctg gag ctc aaa gcc ttg aag cca ggg gtc att 289Ser Pro Glu Ser Leu
Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile 80 85 90caa atc ctg ggt
gtc aaa gcc tct agg ttt ctt tgc caa cag cca gat 337Gln Ile Leu Gly
Val Lys Ala Ser Arg Phe Leu Cys Gln Gln Pro Asp 95 100 105gga gct
ctc tat gga tcg cct cac ttt gat cct gag gcc tgc agc ttc 385Gly Ala
Leu Tyr Gly Ser Pro His Phe Asp Pro Glu Ala Cys Ser Phe 110 115
120aga gaa ctg ctg ctg gag gac ggt tac aat gtg tac cag tct gaa gcc
433Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu
Ala125 130 135 140cat ggc ctg ccc ctg cgt ctg cct cag aag gac tcc
cca aac cag gat 481His Gly Leu Pro Leu Arg Leu Pro Gln Lys Asp Ser
Pro Asn Gln Asp 145 150 155gca aca tcc tgg gga cct gtg cgc ttc ctg
ccc atg cca ggc ctg ctc 529Ala Thr Ser Trp Gly Pro Val Arg Phe Leu
Pro Met Pro Gly Leu Leu 160 165 170cac gag ccc caa gac caa gca gga
ttc ctg ccc cca gag ccc cca gat 577His Glu Pro Gln Asp Gln Ala Gly
Phe Leu Pro Pro Glu Pro Pro Asp 175 180 185gtg ggc tcc tct gac ccc
ctg agc atg gta gag cct tta cag ggc cga 625Val Gly Ser Ser Asp Pro
Leu Ser Met Val Glu Pro Leu Gln Gly Arg 190 195 200agc ccc agc tat
gcg tcc tga ctcttcctga atc 659Ser Pro Ser Tyr Ala Ser *205
2102210PRTMus musculus 2Met Glu Trp Met Arg Ser Arg Val Gly Thr Leu
Gly Leu Trp Val Arg1 5 10 15Leu Leu Leu Ala Val Phe Leu Leu Gly Val
Tyr Gln Ala Tyr Pro Ile 20 25 30Pro Asp Ser Ser Pro Leu Leu Gln Phe
Gly Gly Gln Val Arg Gln Arg 35 40 45Tyr Leu Tyr Thr Asp Asp Asp Gln
Asp Thr Glu Ala His Leu Glu Ile 50 55 60Arg Glu Asp Gly Thr Val Val
Gly Ala Ala His Arg Ser Pro Glu Ser65 70 75 80Leu Leu Glu Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly 85 90 95Val Lys Ala Ser
Arg Phe Leu Cys Gln Gln Pro Asp Gly Ala Leu Tyr 100 105 110Gly Ser
Pro His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu 115 120
125Leu Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro
130 135 140Leu Arg Leu Pro Gln Lys Asp Ser Pro Asn Gln Asp Ala Thr
Ser Trp145 150 155 160Gly Pro Val Arg Phe Leu Pro Met Pro Gly Leu
Leu His Glu Pro Gln 165 170 175Asp Gln Ala Gly Phe Leu Pro Pro Glu
Pro Pro Asp Val Gly Ser Ser 180 185 190Asp Pro Leu Ser Met Val Glu
Pro Leu Gln Gly Arg Ser Pro Ser Tyr 195 200 205Ala Ser
2103643DNAHomo sapiensCDS(9)...(638) 3agccattg atg gac tcg gac gag
acc ggg ttc gag cac tca gga ctg tgg 50 Met Asp Ser Asp Glu Thr Gly
Phe Glu His Ser Gly Leu Trp 1 5 10gtt tct gtg ctg gct ggt ctt ctg
ctg gga gcc tgc cag gca cac ccc 98Val Ser Val Leu Ala Gly Leu Leu
Leu Gly Ala Cys Gln Ala His Pro15 20 25 30atc cct gac tcc agt cct
ctc ctg caa ttc ggg ggc caa gtc cgg cag 146Ile Pro Asp Ser Ser Pro
Leu Leu Gln Phe Gly Gly Gln Val Arg Gln 35 40 45cgg tac ctc tac aca
gat gat gcc cag cag aca gaa gcc cac ctg gag 194Arg Tyr Leu Tyr Thr
Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu 50 55 60atc agg gag gat
ggg acg gtg ggg ggc gct gct gac cag agc ccc gaa 242Ile Arg Glu Asp
Gly Thr Val Gly Gly Ala Ala Asp Gln Ser Pro Glu 65 70 75agt ctc ctg
cag ctg aaa gcc ttg aag ccg gga gtt att caa atc ttg 290Ser Leu Leu
Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu 80 85 90gga gtc
aag aca tcc agg ttc ctg tgc cag cgg cca gat ggg gcc ctg 338Gly Val
Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu95 100 105
110tat gga tcg ctc cac ttt gac cct gag gcc tgc agc ttc cgg gag ctg
386Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu
115 120 125ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc cac
ggc ctc 434Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His
Gly Leu 130 135 140ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg
gac cct gca ccc 482Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg
Asp Pro Ala Pro 145 150 155cga gga cca gct cgc ttc ctg cca cta cca
ggc ctg ccc ccc gca ctc 530Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro
Gly Leu Pro Pro Ala Leu 160 165 170ccg gag cca ccc gga atc ctg gcc
ccc cag ccc ccc gat gtg ggc tcc 578Pro Glu Pro Pro Gly Ile Leu Ala
Pro Gln Pro Pro Asp Val Gly Ser175 180 185 190tcg gac cct ctg agc
atg gtg gga cct tcc cag ggc cga agc ccc agc 626Ser Asp Pro Leu Ser
Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser 195 200 205tac gct tcc
tga agcca 643Tyr Ala Ser *4209PRTHomo sapiens 4Met Asp Ser Asp Glu
Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser1 5 10 15Val Leu Ala Gly
Leu Leu Leu Gly Ala Cys Gln Ala His Pro Ile Pro 20 25 30Asp Ser Ser
Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr 35 40 45Leu Tyr
Thr Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg 50 55 60Glu
Asp Gly Thr Val Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu65 70 75
80Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val
85 90 95Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu Tyr
Gly 100 105 110Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu
Leu Leu Leu 115 120 125Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala
His Gly Leu Pro Leu 130 135 140His Leu Pro Gly Asn Lys Ser Pro His
Arg Asp Pro Ala Pro Arg Gly145 150 155 160Pro Ala Arg Phe Leu Pro
Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 165 170 175Pro Pro Gly Ile
Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp 180 185 190Pro Leu
Ser Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 195 200
205Ser 520DNAArtificial SequencePCR primer 5agccattgat ggactcggac
20620DNAArtificial SequencePCR primer 6tggcttcagg aagcgtagct
20716PRTHomo sapiens 7Arg Gln Arg Tyr Leu Tyr Thr Asp Asp Ala Gln
Gln Thr Glu Ala His1 5 10 15815PRTHomo sapiens 8His Leu Pro Gly Asn
Lys Ser Pro His Arg Asp Pro Ala Pro Arg1 5 10 159218PRTMus musculus
9Met Ala Arg Lys Trp Asn Gly Arg Ala Val Ala Arg Ala Leu Val Leu1 5
10 15Ala Thr Leu Trp Leu Ala Val Ser Gly Arg Pro Leu Ala Gln Gln
Ser 20 25 30Gln Ser Val Ser Asp Glu Asp Pro Leu Phe Leu Tyr Gly Trp
Gly Lys 35 40 45Ile Thr Arg Leu Gln Tyr Leu Tyr Ser Ala Gly Pro Tyr
Val Ser Asn 50 55 60Cys Phe Leu Arg Ile Arg Ser Asp Gly Ser Val Asp
Cys Glu Glu Asp65 70 75 80Gln Asn Glu Arg Asn Leu Leu Glu Phe Arg
Ala Val Ala Leu Lys Thr 85 90 95Ile Ala Ile Lys Asp Val Ser Ser Val
Arg Tyr Leu Cys Met Ser Ala 100 105 110Asp Gly Lys Ile Tyr Gly Leu
Ile Arg Tyr Ser Glu Glu Asp Cys Thr 115 120 125Phe Arg Glu Glu Met
Asp Cys Leu Gly Tyr Asn Gln Tyr Arg Ser Met 130 135 140Lys His His
Leu His Ile Ile Phe Ile Gln Ala Lys Pro Arg Glu Gln145 150 155
160Leu Gln Asp Gln Lys Pro Ser Asn Phe Ile Pro Val Phe His Arg Ser
165 170 175Phe Phe Glu Thr Gly Asp Gln Leu Arg Ser Lys Met Phe Ser
Leu Pro 180 185 190Leu Glu Ser Asp Ser Met Asp Pro Phe Arg Met Val
Glu Asp Val Asp 195 200 205His Leu Val Lys Ser Pro Ser Phe Gln Lys
210 21510216PRTHomo sapiens 10Met Arg Ser Gly Cys Val Val Val His
Val Trp Ile Leu Ala Gly Leu1 5 10 15Trp Leu Ala Val Ala Gly Arg Pro
Leu Ala Phe Ser Asp Ala Gly Pro 20 25 30His Val His Tyr Gly Trp Gly
Asp Pro Ile Arg Leu Arg His Leu Tyr 35 40 45Thr Ser Gly Pro His Gly
Leu Ser Ser Cys Phe Leu Arg Ile Arg Ala 50 55 60Asp Gly Val Val Asp
Cys Ala Arg Gly Gln Ser Ala His Ser Leu Leu65 70 75 80Glu Ile Lys
Ala Val Ala Leu Arg Thr Val Ala Ile Lys Gly Val His 85 90 95Ser Val
Arg Tyr Leu Cys Met Gly Ala Asp Gly Lys Met Gln Gly Leu 100 105
110Leu Gln Tyr Ser Glu Glu Asp Cys Ala Phe Glu Glu Glu Ile Arg Pro
115 120 125Asp Gly Tyr Asn Val Tyr Arg Ser Glu Lys His Arg Leu Pro
Val Ser 130 135 140Leu Ser Ser Ala Lys Gln Arg Gln Leu Tyr Lys Asn
Arg Gly Phe Leu145 150 155 160Pro Leu Ser His Phe Leu Pro Met Leu
Pro Met Val Pro Glu Glu Pro 165 170 175Glu Asp Leu Arg Gly His Leu
Glu Ser Asp Met Phe Ser Ser Pro Leu 180 185 190Glu Thr Asp Ser Met
Asp Pro Phe Gly Leu Val Thr Gly Leu Glu Ala 195 200 205Val Arg Ser
Pro Ser Phe Glu Lys 210 2151110PRTUnknownResidues which contain the
anitgenic determinant recognized by the myc monoclonal antibody.
11Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu1 5
10125PRTUnknownPreferred thrombin cleave site. 12Leu Val Pro Arg
Gly1 51310PRTUnknownResidues which bind to paramagnetic
streptavidin beads (used for purification). 13Ser Ala Trp Arg His
Pro Gln Phe Gly Gly1 5 10147PRTHomo sapiens 14Arg Pro Tyr Asp Gly
Tyr Asn1 5156PRTHomo sapiens 15Leu Pro Met Leu Pro Met1 5166PRTHomo
sapiens 16Arg Pro Asp Gly Tyr Asn1 5176PRTHomo sapiens 17His Phe
Leu Pro Met Leu1 5
* * * * *