U.S. patent application number 12/069808 was filed with the patent office on 2009-03-19 for diagnosis and treatment of cancer:i.
This patent application is currently assigned to IMPERIAL COLLEGE INNOVATIONS LIMITED. Invention is credited to Raoul C. Coombes, James K. J. Diss, Mustafa B. A. Djamgoz, Scott P. Fraser.
Application Number | 20090074665 12/069808 |
Document ID | / |
Family ID | 23085371 |
Filed Date | 2009-03-19 |
United States Patent
Application |
20090074665 |
Kind Code |
A1 |
Diss; James K. J. ; et
al. |
March 19, 2009 |
Diagnosis and treatment of cancer:I
Abstract
A method of diagnosing cancer comprising the steps of (i)
obtaining a sample containing nucleic acid and/or protein from the
patient; and (ii) determining whether the sample contains a level
of SCN5A (and optionally also SCN9A) voltage-gated Na+ channel
nucleic acid or protein associated with cancer. A method of
diagnosing breast cancer comprising the steps of (i) obtaining a
sample containing nucleic acid and/or protein from the patient; and
(ii) determining whether the sample contains a level of
voltage-gated Na+ channel nucleic acid or protein, preferably SCN5A
or SCN9A, associated with cancer. A method of treating cancer
comprising the step of administering to the patient an agent which
selectively prevents the function of SCN5A (and optionally also
SCN9A) voltage-gated Na+ channel. A method of treating breast
cancer comprising the step of administering to the patient an agent
which selectively prevents the function of a voltage-gated Na+
channel, preferably SCN5A or SCN9A. Genetic constructs and
molecules useful in such methods. The methods and compositions are
particularly suited to breast cancer.
Inventors: |
Diss; James K. J.; (London,
GB) ; Coombes; Raoul C.; (London, GB) ;
Djamgoz; Mustafa B. A.; (London, GB) ; Fraser; Scott
P.; (London, GB) |
Correspondence
Address: |
NIKOLAI & MERSEREAU, P.A.
900 SECOND AVENUE SOUTH, SUITE 820
MINNEAPOLIS
MN
55402
US
|
Assignee: |
IMPERIAL COLLEGE INNOVATIONS
LIMITED
London
GB
|
Family ID: |
23085371 |
Appl. No.: |
12/069808 |
Filed: |
February 13, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10474778 |
Mar 4, 2004 |
7393657 |
|
|
12069808 |
|
|
|
|
PCT/GB02/01692 |
Apr 11, 2002 |
|
|
|
10474778 |
|
|
|
|
60283295 |
Apr 12, 2001 |
|
|
|
Current U.S.
Class: |
424/9.1 ; 435/29;
514/44R; 530/350 |
Current CPC
Class: |
C12Q 2600/118 20130101;
C07K 14/705 20130101; C12Q 2600/158 20130101; A61P 35/00 20180101;
A61K 38/00 20130101; A61P 43/00 20180101; A61K 48/00 20130101; C12Q
2600/156 20130101; C12Q 1/6886 20130101; A61P 35/04 20180101 |
Class at
Publication: |
424/9.1 ; 514/44;
435/29; 530/350 |
International
Class: |
A61K 49/00 20060101
A61K049/00; A61K 31/7052 20060101 A61K031/7052; C12Q 1/02 20060101
C12Q001/02; A61P 35/00 20060101 A61P035/00; C07K 14/00 20060101
C07K014/00 |
Claims
1-69. (canceled)
70. A method of treating cancer including breast cancer comprising
administering to the patient an agent which selectively prevents
the function of a voltage-gated Na.sup.+ channel.
71. A method as in claim 70 wherein the voltage-gated Na.sup.+
channel is SCN5A.
72. A method as in claim 70 wherein the agent performs a function
selected from the group consisting of preventing the expression of
and inhibiting the activity of the said voltage-gated Na.sup.+
channel.
73. A method as in claim 71 wherein the agent performs a function
selected from the group consisting of preventing the expression of
and inhibiting the activity of the said voltage-gated Na.sup.+
channel.
74. A method as in claim 72 wherein the agent prevents the
expression of the said voltage-gated Na.sup.+ channel, and wherein
the agent is selected from the group consisting of antisense
molecules and ribozymes.
75. A method as in claim 70 wherein the agent is contained in a
medicament for treating cancer.
76. A method as in claim 75 wherein the voltage-gated Na.sup.+
channel is SCN5A and wherein the agent is contained in a medicament
for treating cancer.
77. A method of identifying a compound which selectively inhibits a
SCN5A voltage-gated Na.sup.+ channel, the method comprising: (a)
contacting a test compound with any one of the said voltage-gated
Na.sup.+ channels and determining whether said compound is
inhibitory; (b) contacting the test compound with other
voltage-gated Na.sup.+ channels and determining whether said
compound is inhibitory; and (c) selecting a compound which is
substantially inhibitory in (a) but is not substantially inhibitory
in (b).
78. A compound comprising a moiety which selectively binds SCN5A
voltage-gated Na.sup.+ channel protein and a further moiety.
79. A compound as in claim 78 wherein the further moiety is
selected from the group consisting of readily detectable moieties,
directly or indirectly cytotoxic moieties and combinations
thereof.
80. A compound as in claim 78 wherein the moiety which selectively
binds the voltage-gated Na.sup.+ channel protein and the further
moiety are polypeptides which are fused.
81. A compound as in claim 80 encoded by a nucleic acid
molecule.
82. A compound as in claim 78 wherein the compound is a medicament
component.
83. A kit of parts selected from the group consisting of: (a) a kit
comprising: (1) a compound as in claim 84 wherein the further
moiety is a cytotoxic moiety which is able to convert a relatively
non-toxic prodrug into a cytotoxic drug, (2) a relatively non-toxic
prodrug; and (b) a kit comprising: (1) a compound comprising a
moiety which selectively binds SCN5A voltage-gated Na.sup.+ channel
protein and a further moiety wherein the further moiety is able to
bind selectively to a directly or indirectly cytotoxic moiety or to
a readily detectable moiety; and (2) any one of a directly or
indirectly cytotoxic moiety or a readily detectable moiety to which
the further moiety of the compound is able to bind.
84. A method of treating cancer, including breast cancer, the
method comprising administering to the human patient an effective
amount of a compound comprising a moiety which selectively binds a
voltage-gated Na.sup.+ channel protein and a further moiety,
wherein the further moiety of the compound is one which either
directly or indirectly is of therapeutic benefit to the
patient.
85. A method of imaging cancer, including breast cancer in a human
patient, comprising administering to the patient an effective
amount of a compound comprising a moiety which selectively binds a
voltage-gated Na.sup.+ channel protein and a further moiety,
wherein the further moiety of the compound is one which comprises a
readily detectable moiety.
Description
CROSS-REFERENCED TO RELATED APPLICATIONS
[0001] This application is a divisional application of application
Ser. No. 10/474,778, filed Oct. 10, 2003, which claims priority
from Application PCT/GB02/01692, filed Apr. 11, 2002 and
Provisional Application No. 60/283,295, filed Apr. 12, 2001, all of
which are deemed incorporated by reference in their entirety in
this application.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] Not applicable.
[0003] The present invention relates to methods of determining
whether a patient has cancer and whether the cancer is likely to
metastasise; and it relates to methods of treating cancer,
particularly breast cancer.
[0004] Cancer is a serious disease and a major killer. Although
there have been advances in the diagnosis and treatment of certain
cancers in recent years, there is still a need for improvements in
diagnosis and treatment.
[0005] Cancer is a genetic disease and in most cases involves
mutations in one or more genes. There are believed to be around
40,000 genes in the human genome but only a handful of these genes
have been shown to be involved in cancer. Although it is surmised
that many more genes than have been presently identified will be
found to be involved in cancer, progress in this area has remained
slow despite the availability of molecular analytical techniques.
This may be due to the varied structure and function of genes which
have been identified to date which suggests that cancer genes can
take many forms, occur in different combinations and have many
different functions.
[0006] Breast cancer is one of the most significant diseases that
affects women. At the current rate, American women have a 1 in 8
risk of developing cancer by the age of 95 (American Cancer
Society, Cancer Facts and Figures, 1992, American Cancer Society,
Atlanta, Ga., USA). Genetic factors contribute to an ill-defined
proportion of breast cancer cases, estimated to be about 5% of all
cases but approximately 25% of cases diagnosed before the age of 40
(Claus et al (1991) Am J. Hum. Genet. 48, 232-242). Breast cancer
has been divided into two types, early-age onset and late stage
onset, based on an inflection in the age-specific incidence curve
at around the age of 50. Mutation of one gene, BRCA1, is thought to
account for approximately 45% of familial breast cancer, but at
least 80% of families with both breast and ovarian cancer (Easton
et al (1993) Am. J. Hum. Genet. 52, 678-701).
[0007] Breast carcinoma is potentially curable only when truly
localised. The most common problem is either late presentation with
overt metastases or, more frequently, the development of systemic
metastases after apparent local cure. Metastatic breast carcinoma
is highly chemosensitive and effective chemotherapy routinely
induces disease remission, allowing delay in the onset of secondary
disease or amelioration of the symptoms of extensive disease.
[0008] Recently, the role of tumour-associated antigens in the
biology of cancer has begun to be investigated. Probably the best
studied example of tumour-associated antigens are the MAGE antigens
which are involved in melanoma and certain other cancers, such as
breast cancer. Therapeutic and diagnostic approaches making use of
the MAGE antigens are described in Gattoni-Celli & Cole (1996)
Seminars in Oncology 23, 754-758, Itoh et al (1996) J. Biochem.
119, 385-390, WO 92/20356, WO 94/23031, WO 94/05304, WO 95/20974
and WO 95/23874. However, other tumour-associated antigens have
also been implicated in breast cancer. For example, studies
concerning the antigens expressed by breast cancer cells, and in
particular how these relate to the antigenic profile of the normal
mammary epithelial cell, have been and continue to be a major
activity in breast cancer research. The role of certain antigens in
breast cancer, especially the role of polymorphic epithelial mucin
(PEM; the product of the MUC1 gene) and the c-erbB2 protooncogene,
are reviewed in Taylor-Papadimitriou et al (1993) Annals NY Acad.
Sci. 698, 31-47. Other breast cancer associated antigens include
MAGE-1 and CEA.
[0009] Immunotherapeutic strategies and vaccines involving the MUC1
gene or PEM are described in Burchell et al (1996), pp 309-313, In
Breast Cancer, Advances in Biology and Therapeutics, Calvo et al
(eds), John Libbey Eurotext; Graham et al (1996) Int. J. Cancer 65,
664-670; Graham et al (1995) Tumor Targeting 1, 211-221; Finn et al
(1995) Immunol. Rev. 145, 61-89; Burchell et al (1993) Cancer
Surveys 18, 135-148; Scholl & Pouillart (1997) Bull. Cancer 84,
61-64; and Zhang et al (1996) Cancer Res. 56, 3315-3319.
[0010] Despite the recent interest in the breast cancer
predisposing genes, BRCA1 and BRCA2, there remains the need for
further information on breast cancer, and the need for further
diagnostic markers and targets for therapeutic intervention.
[0011] For cancers such as breast cancer, present screening methods
are therefore unsatisfactory; there is no reliable method for
diagnosing the cancer, or predicting or preventing its possible
metastatic spread, which is the main cause of death for most
patients.
[0012] Grimes et al (1995) FEBS Lett. 369, 290-294 describes the
differential expression of voltage-gated Na.sup.+ currents in two
prostatic tumour cell lines and discusses their contribution to
invasiveness in vitro. The cell lines studied were rat cell lines
and there is no indication of which particular voltage-gated
Na.sup.+ channels may be involved.
[0013] Laniado et al (1997) Am J. Pathol. 150, 1213-1221 describes
the expression and functional analysis of voltage-gated Na.sup.+
channels in human prostate cancer cell lines and discusses their
contribution to invasion in vitro. There is no indication of which
particular voltage-gated Na.sup.+ channels may be involved.
[0014] Smith et al (1998) FEBS Lett. 423, 19-24 suggests that
Na.sup.+ channel protein expression enhances the invasiveness of
rat and human prostate cancer cell lines.
[0015] Grimes & Djamgoz (1998) J. Cell. Physiol. 175, 50-58
describes the electrophysiological and pharmacological
characterisation of voltage-gated Na.sup.+ current expressed in the
highly metastatic Mat-LyLu cell line of rat prostate cancer. The
underlying VGSC is identified as belonging to the
"tetrodotoxin-sensitive" class.
[0016] Dawes et al (1995) Visual Neuroscience 12, 1001-1005
describes the identification of voltage-gated Na.sup.+ channel
subtypes induced in cultured retinal pigment epithelium cells.
[0017] UK Patent application No 0021617.6 entitled "Diagnosis and
treatment of cancer" filed on 2 Sep. 2000 relates to methods of
treatment and diagnosis of cancer, particularly prostate cancer
concerning expression of VGSCs. VGSC expression correlates with
pathological progression and a VGSC which is associated with human
cancer, particularly prostate cancer and its metastases, is hNe-Na
(SCN9A). The amino acid sequence of the protein, and cDNA of the
mRNA encoding it is known (Klugbauer et al (1995) EMBO J. 14,
1084-1090).
[0018] Reviews of voltage-gated Na.sup.+ channels may be found in,
for example, Black & Waxman (1996) Develop. Neurosci. 18,
139-152; Fozzard & Hanck (1996) Physiol. Rev. 76, 887-926;
Bullman (1997) Hum. Mol. Genet. 6, 1679-1685; Cannon (1999); Marban
et al (1998) J. Physiol. 508, 647-657; Catterall (2000) Neuron 26,
13-25; Plummer & Meisler (1999) Genomics 57, 323-331, and
Goldin (2001) Ann Rev Physiol 63, 871-894. Some Na.sup.+ and other
ion channels are well known to underly certain genetic defects as
is described in Bullman (1997) Hum. Mol. Genet. 6, 1679-1685;
Burgess et al (1995) Nature Genet. 10, 461-465; and Cannon (1998)
Mol Neurology (J B Martin, Ed) Scientific American Inc., NY.
[0019] The involvement of VGSCs in breast cancer has not been
demonstrated, and the particular VGSC(s) involved in human breast
cancer have not been identified.
[0020] We have now found, surprisingly, that VGSC expression
correlates with pathological progression and that VGSCs which are
associated with human cancer, particularly breast cancer and its
metastases, are SCN5A, SCN8A and SCN9A, particularly SCN5A (also
termed h1, SkM2 and Na.sub.v1.5). These are known VGSCs (although
for SCN5A and SCN8A not previously known to be associated with
human cancer, in particular human breast cancer) and amino acid
sequences of the proteins, and cDNA of the mRNA encoding them have
been reported (SCN9A: Klugbauer et al (1995) EMBO J. 14, 1084-1090,
GenBank Accession No. X82835; SCN5A: Gellens et al (1992) Proc.
Natl. Acad. Sci. U.S.A. 89 (2), 554-558, GenBank Accession No.
M77235; SCN8A: GenBank Accession No. AB027567). Splice variants
(for example neonatal splice variants; discussed further below) and
other variants of the reported SCN5A, SCN8A and SCN9A are included
by the terms SCN5A, SCN8A and SCN9A. For example, sequences
determined in the present work are included and particularly
preferred, and are discussed in Example 1.
[0021] The chromosomal location of SCN9A (also termed hNe-Na
(human) and PN1 (rat), and recently Na.sub.v1.7) has not yet been
determined. However, the mouse equivalent has been located to the
voltage-gated Na.sup.+ channel cluster on mouse chromosome 2
(Beckers et al (1997) Genomics 36, 202-205). This cluster is also
present in human chromosome 2 where SCN9A may similarly be present
(Malo et al (1994) Cytogen. Cell. Genet. 67, 178-186; Malo et al
(1994) Proc. Natl. Acad. Sci. USA 91, 2975-2979; George et al
(1994) Genomics 19, 395-397). The hNe-Na gene (human SCN9A)
intron/exon organisation has not yet been determined but could be
inferred from other known, conserved VGSC intron positions, as
reported in gene structure studies on SCN4A (George et al (1993)
Genomics 15, 598-606), SCN5A (Wang et al (1996) Genomics 34, 9-16),
SCN10A (Sonslova et al (1997) Genomics 41, 201-209) and the
Drosophila para VGSC gene (Loughey et al (1989) Cell 58,
1143-1154).
[0022] The brain-type voltage-gated Na.sup.+ channels (rat brain
I-III (Noda et al (1986) Nature 322, 826-828; Kayano et al (1988)
FEBS Lett. 228, 187-194) that are most similar to hNe-Na are 20%
different over the whole sequence (human skeletal, 30%; heart 34%
different). However, (i) if sequence comparison is made within
specific structural/functional domains this homology is much
reduced (eg first one-third of DII-DIII cytoplasmic linker region
is only 45% homologous to the most similar channel (RBII/HBII);
(ii) hNe-Na has sufficiently different regions (eg residues
446-460: EYTSIRRSRIMGLSE) to make specific antibodies (see, for
example, Toledo-Aral et al (1997) Proc. Natl. Acad. Sci. USA 94,
1527-1532).
[0023] Subtype-specific antibodies for SCN5A are described in, for
example, Cohen & Levitt (1993) Circ Res 73, 735-742.
[0024] SCN8A is most similar to the brain-type VGSCs, sharing 70%
amino acid similarity (and approximately 60% similarity with other
VGSCs). SCN5A shares 60% similarity with most VGSCs, including the
brain types.
[0025] It is an object of the invention to provide methods useful
in providing diagnoses and prognoses of cancer, especially breast
cancer, and for aiding the clinician in the management of cancer,
particularly breast cancer. In particular, an object of the
invention is to provide a method of assessing the metastatic
potential of cancer, in particular breast cancer.
[0026] Further objects of the invention include the provision of
methods of treatment of cancer, in particular breast cancer, and
methods of identifying compounds which selectively inhibit the
VGSCs associated with human cancer, particularly breast cancer,
since these may be useful in treating cancer.
[0027] A first aspect of the invention provides a method of
determining the susceptibility of a human patient to cancer
comprising the steps of (i) obtaining a sample containing nucleic
acid and/or protein from the patient; and (ii) determining whether
the sample contains a level of SCN5A voltage-gated Na.sup.+ channel
nucleic acid or protein associated with cancer.
[0028] A second aspect of the invention provides a method of
diagnosing cancer in a human patient comprising the steps of (i)
obtaining a sample containing nucleic acid and/or protein from the
patient; and (ii) determining whether the sample contains a level
of SCN5A voltage-gated Na.sup.+ channel nucleic acid or protein
associated with cancer.
[0029] It will be appreciated that determining whether the sample
contains a level of SCN5A (or SCN9A in relation to the fourth and
fifth aspects of the invention) VGSC nucleic acid or protein
associated with cancer may in itself be diagnostic of cancer or it
may be used by the clinician as an aid in reaching a diagnosis.
[0030] For example, in relation to breast cancer, it is useful if
the clinician undertakes a histopathological examination of biopsy
tissue or carries out external digital examination or carries out
imaging. Clinical examination of breast cancer is done currently
through morphological assessment of cells removed in a needle
aspirate and also by mammography. Mammography is also dependent on
morphological changes on the mammogram. There is currently no
biochemical assessment which is used routinely to distinguish
between cancer and non cancer in relation to breast cancer.
Screening tests mentioned above relating to BRCA1 and BRCA2 may be
used. It will be appreciated that the clinician will wish to take
in to account these or other factors, as well as consider the level
of a said VGSC, before making a diagnosis.
[0031] A third aspect of the invention provides a method of
predicting the relative prospects of a particular outcome of a
cancer in a human patient comprising the steps of (i) obtaining a
sample containing nucleic acid and/or protein from the patient; and
(ii) determining whether the sample contains a level of SCN5A
voltage-gated Na.sup.+ channel nucleic acid or protein associated
with cancer.
[0032] A fourth aspect of the invention provides a method of
determining the susceptibility of a human patient to breast cancer
comprising the steps of (i) obtaining a sample containing nucleic
acid and/or protein from the patient; and (ii) determining whether
the sample contains a level of voltage-gated Na.sup.+ channel
nucleic acid or protein associated with cancer. Preferably the
method comprises the step of determining whether the sample
contains a level of SCN5A and/or SCN9A voltage-gated Na.sup.+
channel nucleic acid or protein associated with cancer.
[0033] A fifth aspect of the invention provides a method of
diagnosing breast cancer in a human patient comprising the steps of
(i) obtaining a sample containing nucleic acid and/or protein from
the patient; and (ii) determining whether the sample contains a
level of voltage-gated Na.sup.+ channel nucleic acid or protein
associated with cancer. Preferably the method comprises the step of
determining whether the sample contains a level of SCN5A and/or
SCN9A voltage-gated Na.sup.+ channel nucleic acid or protein
associated with cancer.
[0034] A sixth aspect of the invention provides a method of
predicting the relative prospects of a particular outcome of a
breast cancer in a human patient comprising the steps of (i)
obtaining a sample containing nucleic acid and/or protein from the
patient; and (ii) determining whether the sample contains a level
of voltage-gated Na.sup.+ channel nucleic acid or protein
associated with cancer. Preferably the method comprises the step of
determining whether the sample contains a level of SCN5A and/or
SCN9A voltage-gated Na.sup.+ channel nucleic acid or protein
associated with cancer.
[0035] Thus, the method of the third or sixth aspect of the
invention may be useful in prognosis or aiding prognosis. The
method may be used as an adjunct to known prognostic methods such
as histopathological examination of biopsy tissue, external digital
examination or imaging.
[0036] It is preferred for each of the preceding aspects of the
invention, particularly the third and sixth aspects, that the
method comprises the step of determining whether the sample
contains a level of SCN5A voltage-gated Na.sup.+ channel nucleic
acid or protein associated with cancer. The method may further
comprise the step of determining whether the sample contains a
level of SCN9A voltage-gated Na.sup.+ channel nucleic acid or
protein associated with cancer.
[0037] It will be appreciated that determination of the level of a
said VGSC (including determination of the level of more than one,
for example two said VGSCs) in the sample will be useful to the
clinician in determining how to manage the cancer in the patient.
For example, since elevated levels of a said VGSC, particularly
SCN5A, are associated with metastatic potential, particularly in a
breast cancer, the clinician may use the information concerning the
levels of the said VGSC(s) to facilitate decision making regarding
treatment of the patient. Thus, if the level of said VGSC
(preferably SCN5A) is indicative of a low metastatic potential of
the cancer, preferably a breast cancer, unnecessary radical surgery
may be avoided. Similarly, if the level of said VGSC is indicative
of a high metastatic potential of said cancer, preferably breast
cancer, radical surgery (ie mastectomy) may be the preferred
treatment. Even if it is not appropriate to alter the type of
surgery carried out, determining whether the level of said VGSC is
indicative of a high metastatic potential may help the clinician
decide whether the patient needs adjuvant systemic treatment or
not. At present, a major aim in oncology is to be able to
distinguish those breast cancers with a high metastatic potential
from those with a low metastatic potential, because those with a
low metastatic potential should not need to be put through six
months of very toxic chemotherapy treatment.
[0038] It will be appreciated from the foregoing, and from the
Examples below, that the determination of the levels of the said
VGSC(s), preferably SCN5A, may be exploited diagnostically to
predict whether a given cancer, particularly breast cancer, would
metastasise since expression of said VGSC, preferably SCN5A, is
believed to correspond to possible future spread of a tumour.
[0039] It is particularly preferred if the cancer under
consideration is breast cancer. Other appropriate cancers may
include prostate cancer, small cell carcinoma of the lung and
glioma (brain cancer).
[0040] It is also particularly preferred if the method of the
invention is employed to predict whether a given breast cancer
would metastasise.
[0041] The level of said VGSC which is indicative of cancer or
metastatic potential may be defined as the increased level present
in known cancerous or metastatic breast cells (preferably
epithelial cells but possibly also or alternatively other cell
types such as neuroendocrine or myoepithelial cells) over known
non-cancerous or non-metastatic breast cells. The level of said
VGSC protein may be, for example, at least 11/2 fold higher in
cancerous cells or metastatic cells, or it may be at least 2-fold
or 3-fold higher. Quantitative analysis by micro-densitometry of
immunohistochemically processed tissue sections may be used. An
antibody that is believed to react with all VGSCs may be used,
possibly in combination with PCR analysis, which may be capable of
distinguishing between VGSC types. The level of mRNA encoding said
VGSC may be, for example, at least 11/2 fold higher in cancerous
cells or metastatic cells, or it may be at least 2-fold or 3-fold
higher, or at least 10, 50, 100, 500, 1000, 1200, 1500 or 1800-fold
higher. Measurements by semi-quantitative PCR indicates that the
level of SCN5A mRNA is about 1800-fold higher in the highly
metastatic cell lines than in the lowly-metastatic cell lines, as
described in the Examples.
[0042] In one preferred embodiment of the invention it is
determined whether the level of said VGSC (preferably SCN5A)
nucleic acid, in particular mRNA, is a level associated with cancer
or metastatic potential. Preferably, the sample contains nucleic
acid, such as mRNA, and the level of said VGSC is measured by
contacting said nucleic acid with a nucleic acid which hybridises
selectively to said VGSC nucleic acid.
[0043] By "selectively hybridising" is meant that the nucleic acid
has sufficient nucleotide sequence similarity with the said human
nucleic acid that it can hybridise under moderately or highly
stringent conditions. As is well known in the art, the stringency
of nucleic acid hybridization depends on factors such as length of
nucleic acid over which hybridisation occurs, degree of identity of
the hybridizing sequences and on factors such as temperature, ionic
strength and CG or AT content of the sequence. Thus, any nucleic
acid which is capable of selectively hybridising as said is useful
in the practice of the invention.
[0044] Nucleic acids which can selectively hybridise to the said
human nucleic acid include nucleic acids which have >95%
sequence identity, preferably those with >98%, more preferably
those with >99% sequence identity, over at least a portion of
the nucleic acid with the said human nucleic acid. As is well
known, human genes usually contain introns such that, for example,
a mRNA or cDNA derived from a gene would not match perfectly along
its entire length with the said human genomic DNA but would
nevertheless be a nucleic acid capable of selectively hybridising
to the said human DNA. Thus, the invention specifically includes
nucleic acids which selectively hybridise to said VGSC mRNA or cDNA
but may not hybridise to a said VGSC gene. For example, nucleic
acids which span the intron-exon boundaries of the said VGSC gene
may not be able to selectively hybridise to the said VGSC mRNA or
cDNA.
[0045] Typical moderately or highly stringent hybridisation
conditions which lead to selective hybridisation are known in the
art, for example those described in Molecular Cloning, a laboratory
manual, 2nd edition, Sambrook et al (eds), Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., USA, incorporated
herein by reference.
[0046] An example of a typical hybridisation solution when a
nucleic acid is immobilised on a nylon membrane and the probe
nucleic acid is .A-inverted.500 bases or base pairs is:
6.times.SSC (saline Na.sup.+ citrate) 0.5% Na.sup.+ dodecyl
sulphate (SDS) 100 :g/ml denatured, fragmented salmon sperm DNA
[0047] The hybridisation is performed at 68.degree. C. The nylon
membrane, with the nucleic acid immobilised, may be washed at
68.degree. C. in 1.times.SSC or, for high stringency,
0.1.times.SSC.
[0048] 20.times.SSC may be prepared in the following way. Dissolve
175.3 g of NaCl and 88.2 g of Na.sup.+ citrate in 800 ml of
H.sub.2O. Adjust the pH to 7.0 with a few drops of a 10 N solution
of NaOH. Adjust the volume to 1 litre with H.sub.2O. Dispense into
aliquots. Sterilize by autoclaving.
[0049] An example of a typical hybridisation solution when a
nucleic acid is immobilised on a nylon membrane and the probe is an
oligonucleotide of between 15 and 50 bases is:
3.0 M trimethylammonium chloride (TMACl) 0.01 M Na.sup.+ phosphate
(pH 6.8)
1 mm EDTA (pH 7.6)
0.5% SDS
[0050] 100 .mu.g/ml denatured, fragmented salmon sperm DNA 0.1%
nonfat dried milk
[0051] The optimal temperature for hybridization is usually chosen
to be 5.degree. C. below the T.sub.i for the given chain length.
T.sub.i is the irreversible melting temperature of the hybrid
formed between the probe and its target sequence. Jacobs et al
(1988) Nucl. Acids Res. 16, 4637 discusses the determination of
T.sub.is. The recommended hybridization temperature for 17-mers in
3 M TMACl is 48-50.degree. C.; for 19-mers, it is 55-57.degree. C.;
and for 20-mers, it is 58-66.degree. C.
[0052] By "nucleic acid which selectively hybridises" is also
included nucleic acids which will amplify DNA from the said VGSC
mRNA by any of the well known amplification systems such as those
described in more detail below, in particular the polymerase chain
reaction (PCR). Suitable conditions for PCR amplification include
amplification in a suitable 1.times. amplification buffer:
10.times. amplification buffer is 500 mM KCl; 100 mM Tris.Cl (pH
8.3 at room temperature); 15 mM MgCl.sub.2; 0.1% gelatin.
[0053] A suitable denaturing agent or procedure (such as heating to
95.degree. C.) is used in order to separate the strands of
double-stranded DNA.
[0054] Suitably, the annealing part of the amplification is between
37.degree. C. and 60.degree. C., preferably 50.degree. C.
[0055] Although the nucleic acid which is useful in the methods of
the invention may be RNA or DNA, DNA is preferred. Although the
nucleic acid which is useful in the methods of the invention may be
double-stranded or single-stranded, single-stranded nucleic acid is
preferred under some circumstances such as in nucleic acid
amplification reactions.
[0056] The nucleic acid which is useful in the methods of the
invention may be any suitable size. However, for certain
diagnostic, probing or amplifying purposes, it is preferred if the
nucleic acid has fewer than 10 000, more preferably fewer than
1000, more preferably still from 10 to 100, and in further
preference from 15 to 30 base pairs (if the nucleic acid is
double-stranded) or bases (if the nucleic acid is single stranded).
As is described more fully below, single-stranded DNA primers,
suitable for use in a polymerase chain reaction, are particularly
preferred.
[0057] The nucleic acid for use in the methods of the invention is
a nucleic acid capable of hybridising to the said VGSC mRNA or
mRNAs. Fragments of the said VGSC genes and cDNAs derivable from
the mRNA encoded by the said VGSC genes are also preferred nucleic
acids for use in the methods of the invention.
[0058] It is particularly preferred if the nucleic acid for use in
the methods of the invention is an oligonucleotide primer which can
be used to amplify a portion of the said VGSC nucleic acid,
particularly VGSC mRNA.
[0059] Nucleic acids for use in the invention may hybridise to more
than one, for example all, substantially all or a particular subset
of VGSC mRNAs. The SCN5A, SCN8A and SCN9A mRNAs are similar to, but
distinct from other VGSC mRNAs. This is discussed further in
Examples 1 and 2. Thus the nucleic acid for use in the invention
may hybridise to a part of VGSC mRNAs that encodes a region of the
VGSC polypeptide that is conserved between VGSCs, for example has
the same amino acid sequence in all, substantially all or a
particular subset of VGSCs. Preferred nucleic acids for use in the
invention are those that selectively hybridise to the SCN5A, SCN8A
or SCN9A mRNA and do not hybridise to other VGSC mRNAs. Such
selectively hybridising nucleic acids can be readily obtained, for
example, by reference to whether or not they hybridise to the said
VGSC mRNA and not to other VGSC mRNAs.
[0060] For example, SCN5A may be distinguished from other
VGSC.alpha.s by possession of C-terminal PDZ domains, as discussed
in Example 1; a nucleic acid hybridising to a nucleic acid encoding
at least part of this C-terminal region in combination with a
nucleic acid hybridising to a nucleic acid encoding another
(non-PDZ domain) portion of SCN5A may be specific for SCN5A. The
nucleic acids may be part of the same nucleic acid molecule or may
be separate nucleic acid molecules.
[0061] Methods and nucleic acids as described, for example, in
Example 1, may be used. In particular, a semi-quantitative PCR
technique, for example as described in Example 1, may be used.
Examples of selectively hybridising nucleic acids for SCN5A, SCN8A
and SCN9A are shown in Table 1.
[0062] The methods are suitable in respect of any cancer but it is
preferred if the cancer is breast cancer. The cancer may be small
cell carcinoma of the lung or a glioma or ovarian cancer or
prostate cancer. It will be appreciated that the methods of the
invention include methods of prognosis and methods which aid
diagnosis. It will also be appreciated that the methods of the
invention are useful to the physician or surgeon in determining a
course of management or treatment of the patient.
[0063] The diagnostic and prognostic methods of the invention are
particularly suited to female patients.
[0064] It is preferred if the nucleic acid is derived from a sample
of the tissue in which cancer is suspected or in which cancer may
be or has been found. For example, if the tissue in which cancer is
suspected or in which cancer may be or has been found is breast, it
is preferred if the sample containing nucleic acid is derived from
the breast (including armpit tissue, for example lymph node tissue)
of the patient. Samples of breast may be obtained by surgical
excision, "true cut" biopsies, needle biopsy, nipple aspirate,
aspiration of a lump or image-guided biopsy. The image may be
generated by X-ray, ultrasound or (less preferably)
technetium-99-labelled antibodies or antibody fragments which bind
or locate selectively at the breast. Magnetic resonance imaging
(MRI) may be used to distinguish fibrosis from breast cancer.
[0065] The sample may be directly derived from the patient, for
example, by biopsy of the tissue, or it may be derived from the
patient from a site remote from the tissue, for example because
cells from the tissue have migrated from the tissue to other parts
of the body. Alternatively, the sample may be indirectly derived
from the patient in the sense that, for example, the tissue or
cells therefrom may be cultivated in vitro, or cultivated in a
xenograft model; or the nucleic acid sample may be one which has
been replicated (whether in vitro or in vivo) from nucleic acid
from the original source from the patient. Thus, although the
nucleic acid derived from the patient may have been physically
within the patient, it may alternatively have been copied from
nucleic acid which was physically within the patient. The tumour
tissue may be taken from the primary tumour or from metastases. The
sample may be lymph nodes, lymph or blood and the spread of disease
detected.
[0066] Conveniently, the nucleic acid capable of hybridising to the
said VGSC mRNA and which is used in the methods of the invention
further comprises a detectable label.
[0067] By "detectable label" is included any convenient radioactive
label such as .sup.32P, .sup.33P or .sup.35S which can readily be
incorporated into a nucleic acid molecule using well known methods;
any convenient fluorescent or chemiluminescent label which can
readily be incorporated into a nucleic acid is also included. In
addition the term "detectable label" also includes a moiety which
can be detected by virtue of binding to another moiety (such as
biotin which can be detected by binding to streptavidin); and a
moiety, such as an enzyme, which can be detected by virtue of its
ability to convert a colourless compound into a coloured compound,
or vice versa (for example, alkaline phosphatase can convert
colourless o-nitrophenylphosphate into coloured o-nitrophenol).
Conveniently, the nucleic acid probe may occupy a certain position
in a fixed assay and whether the nucleic acid hybridises to the
said VGSC nucleic acid can be determined by reference to the
position of hybridisation in the fixed assay. The detectable label
may also be a fluorophore-quencher pair as described in Tyagi &
Kramer (1996) Nature Biotechnology 14, 303-308.
[0068] Other types of labels and tags are disclosed above. The
nucleic acid may be branched nucleic acid (see Urdea et al (1991)
Nucl. Acids Symposium Series 24, 197-200).
[0069] It will be appreciated that the aforementioned methods may
be used for presymptomatic screening of a patient who is in a risk
group for cancer. High risk patients for screening include patients
over 50 years of age or patients who carry a gene resulting in
increased susceptibility (eg predisposing versions of BRCA1, BRCA2
or p53); patients with a family history of breast/ovarian cancer;
patients with affected siblings; nulliparous women; and women who
have a long interval between menarche and menopause. Similarly, the
methods may be used for the pathological classification of tumours
such as breast tumours.
[0070] Conveniently, in the methods of the invention the nucleic
acid which is capable of the said selective hybridisation (whether
labelled with a detectable label or not) is contacted with nucleic
acid (eg mRNA) derived from the patient under hybridising
conditions. Suitable hybridising conditions include those described
above.
[0071] The presence of a complex which is selectively formed by the
nucleic acid hybridising to the VGSC mRNA may be detected, for
example the complex may be a DNA:RNA hybrid which can be detected
using antibodies. Alternatively, the complex formed upon
hybridisation may be a substrate for an enzymatic reaction the
product of which may be detected (suitable enzymes include
polymerases, ligases and endonucleases).
[0072] It is preferred that if the sample containing nucleic acid
(eg mRNA) derived from the patient is not a substantially pure
sample of the tissue or cell type in question that the sample is
enriched for the said tissue or cells. For example, enrichment for
breast cells in a sample such as a blood sample may be achieved
using, for example, cell sorting methods such as fluorescent
activated cell sorting (FACS) using a breast cell-selective
antibody, or at least an antibody which is selective for an
epithelial cell. For example, anti-MUC1 antibodies such as HMFG-1
and HMFG-2 may be used (Taylor-Papadimitriou et al (1986) J. Exp.
Pathol. 2, 247-260); other anti-MUC1 antibodies which may be useful
are described in Cao et al (1998) Tumour Biol. 19, (Suppl 1),
88-99. The source of the said sample also includes biopsy material
as discussed above and tumour samples, also including fixed
paraffin mounted specimens as well as fresh or frozen tissue. The
nucleic acid sample from the patient may be processed prior to
contact with the nucleic acid which selectively hybridises to the
VGSC mRNA. For example, the nucleic acid sample from the patient
may be treated by selective amplification, reverse transcription,
immobilisation (such as sequence specific immobilisation), or
incorporation of a detectable marker.
[0073] Cells may be analysed individually, for example using
single-cell immobilisation techniques. Methods by which single
cells may be analysed include methods in which the technique of
Laser Capture Microdissection (LCM) is used. This technique may be
used to collect single cells or homogeneous cell populations for
molecular analysis and is described in, for example, Jin et al
(1999) Lab Invest 79(4), 511-512; Simone et al (1998) Trends Genet.
14(7), 272-276; Luo et al (1999) Nature Med 5(1), 117-122; Arcuturs
Updates, for example June 1999 and February 1999; U.S. Pat. No.
5,859,699 (all incorporated herein by reference). The cells of
interest are visualised, for example by immunohistochemical
techniques, and transferred to a polymer film that is activated by
laser pulses. The technique may also be used for isolation of cells
which are negative for a particular component. Microscopes useful
in performing LCM are manufactured by Arcturus Engineering, Inc.,
1220 Terra Bella Avenue, Mountain View, Calif. 94042, USA.
[0074] LCM may be used with other isolation or enrichment methods.
For example, LCM may be used following a method which enriches the
sample for the target cell type.
[0075] It will be appreciated that the VGSC mRNA may be identified
by reverse-transcriptase polymerase chain reaction (RT-PCR) using
methods well known in the art.
[0076] Primers which are suitable for use in a polymerase chain
reaction (PCR; Saiki et al (1988) Science 239, 487-491) are
preferred. Suitable PCR primers may have the following
properties:
[0077] It is well known that the sequence at the 5' end of the
oligonucleotide need not match the target sequence to be
amplified.
[0078] It is usual that the PCR primers do not contain any
complementary structures with each other longer than 2 bases,
especially at their 3' ends, as this feature may promote the
formation of an artifactual product called "primer dimer". When the
3' ends of the two primers hybridize, they form a "primed template"
complex, and primer extension results in a short duplex product
called "primer dimmer".
[0079] Internal secondary structure should be avoided in primers.
For symmetric PCR, a 40-60% G+C content is often recommended for
both primers, with no long stretches of any one base. The classical
melting temperature calculations used in conjunction with DNA probe
hybridization studies often predict that a given primer should
anneal at a specific temperature or that the 72.degree. C.
extension temperature will dissociate the primer/template hybrid
prematurely. In practice, the hybrids are more effective in the PCR
process than generally predicted by simple T.sub.m
calculations.
[0080] Optimum annealing temperatures may be determined empirically
and may be higher than predicted. Taq DNA polymerase does have
activity in the 37-55.degree. C. region, so primer extension will
occur during the annealing step and the hybrid will be stabilized.
The concentrations of the primers are equal in conventional
(symmetric) PCR and, typically, within 0.1- to 1-.mu.M range.
[0081] Any of the nucleic acid amplification protocols can be used
in the method of the invention including the polymerase chain
reaction, QB replicase and ligase chain reaction. Also, NASBA
(nucleic acid sequence based amplification), also called 3SR, can
be used as described in Compton (1991) Nature 350, 91-92 and AIDS
(1993), Vol 7 (Suppl 2), S108 or SDA (strand displacement
amplification) can be used as described in Walker et al (1992)
Nucl. Acids Res. 20, 1691-1696. The polymerase chain reaction is
particularly preferred because of its simplicity.
[0082] When a pair of suitable nucleic acids of the invention are
used in a PCR it is convenient to detect the product by gel
electrophoresis and ethidium bromide staining. As an alternative to
detecting the product of DNA amplification using agarose gel
electrophoresis and ethidium bromide staining of the DNA, it is
convenient to use a labelled oligonucleotide capable of hybridising
to the amplified DNA as a probe. When the amplification is by a PCR
the oligonucleotide probe hybridises to the interprimer sequence as
defined by the two primers. The oligonucleotide probe is preferably
between 10 and 50 nucleotides long, more preferably between 15 and
30 nucleotides long. The probe may be labelled with a radionuclide
such as .sup.32P, .sup.33P and .sup.35S using standard techniques,
or may be labelled with a fluorescent dye. When the oligonucleotide
probe is fluorescently labelled, the amplified DNA product may be
detected in solution (see for example Balaguer et al (1991)
"Quantification of DNA sequences obtained by polymerase chain
reaction using a bioluminescence adsorbent" Anal. Biochem. 195,
105-110 and Dilesare et al (1993) "A high-sensitivity
electrochemiluminescence-based detection system for automated PCR
product quantitation" BioTechniques 15, 152-157.
[0083] PCR products can also be detected using a probe which may
have a fluorophore-quencher pair or may be attached to a solid
support or may have a biotin tag or they may be detected using a
combination of a capture probe and a detector probe.
[0084] Fluorophore-quencher pairs are particularly suited to
quantitative measurements of PCR reactions (eg RT-PCR).
Fluorescence polarisation using a suitable probe may also be used
to detect PCR products.
[0085] Oligonucleotide primers can be synthesised using methods
well known in the art, for example using solid-phase
phosphoramidite chemistry.
[0086] The present invention provides the use of a nucleic acid
which selectively hybridises to SCN5A nucleic acid (eg mRNA) in a
method of diagnosing cancer or prognosing cancer or determining
susceptibility to cancer (preferably breast cancer); or in the
manufacture of a reagent for carrying out these methods. The
present invention further provides the use of a nucleic acid which
selectively hybridises to VGCS nucleic acid (eg mRNA), preferably
SCN5A and/or SCN9A nucleic acid, in a method of diagnosing breast
cancer or prognosing breast cancer or determining susceptibility to
breast cancer; or in the manufacture of a reagent for carrying out
these methods.
[0087] Other methods of detecting mRNA levels are included.
[0088] Methods for determining the relative amount of the said VGSC
mRNA include: in situ hybridisation (In Situ Hybridization
Protocols. Methods in Molecular Biology Volume 33. Edited by K H A
Choo. 1994, Humana Press Inc (Totowa, N.J., USA) pp 480p and In
Situ Hybridization: A Practical Approach. Edited by D G Wilkinson.
1992, Oxford University Press, Oxford, pp 163), in situ
amplification, northerns, nuclease protection, probe arrays, and
amplification based systems;
[0089] The mRNA may be amplified prior to or during detection and
quantitation. `Real time` amplification methods wherein the product
is measured for each amplification cycle may be particularly useful
(eg Real time PCR Hid et al (1996) Genome Research 6, 986-994,
Gibson et al (1996) Genome Research 6, 995-1001; Real time NASBA
Oehlenschlager et al (1996 Nov. 12) PNAS (USA) 93(23), 12811-6.
Primers should be designed to preferentially amplify from an mRNA
template rather than from the DNA, or be designed to create a
product where the mRNA or DNA template origin can be distinguished
by size or by probing. NASBA may be particularly useful as the
process can be arranged such that only RNA is recognised as an
initial substrate.
[0090] Detecting mRNA includes detecting mRNA in any context, or
detecting that there are cells present which contain mRNA (for
example, by in situ hybridisation, or in samples obtained from
lysed cells). It is useful to detect the presence of mRNA or that
certain cells are present (either generally or in a specific
location) which can be detected by virtue of their expression of
the said VGSC mRNA. As noted, the presence versus absence of the
said VGSC mRNA may be a useful marker, or low levels versus high
levels of the said VGSC mRNA may be a useful marker, or specific
quantified levels may be associated with a specific disease state.
It will be appreciated that similar possibilities exist in relation
to using the said VGSC polypeptide as a marker.
[0091] In a further preferred embodiment, the level of said VGSC
protein is measured. Preferably, the level of said protein is
measured by contacting the protein with a molecule which
selectively binds to said VGSC polypeptide.
[0092] The sample containing protein derived from the patient is
conveniently a sample tissue. It may be useful to measure the
presence (tumour) versus absence (normal) of the said VGSC
polypeptide in some circumstances, such as when assessing breast
tissue. The methods of the invention also include the measurement
and detection of the said VGSC polypeptide in test samples and
their comparison in a control sample.
[0093] The sample containing protein derived from the patient is
conveniently a sample of the tissue in which cancer is suspected or
in which cancer may be or has been found. These methods may be used
for any cancer, but they are particularly suitable in respect of
breast cancer. Methods of obtaining suitable samples are described
in relation to earlier methods. The sample may also be blood, serum
or lymph node-derived material which may be particularly useful in
determining whether a cancer has spread. Single cells may be
analysed, as noted above.
[0094] The methods of the invention involving detection of the said
VGSC proteins are particularly useful in relation to historical
samples such as those containing paraffin-embedded sections of
tumour samples.
[0095] The level of said VGSC protein may be determined in a sample
in any suitable way.
[0096] It is particularly preferred if the molecule which
selectively binds to the said VGSC (for example all VGSCs or
selected VGSC(s), for example SCN5A) is an antibody.
[0097] Antibodies which can selectively bind to VGSCs or a
particular form or forms of VGSC are described above and can be
made, for example, by using peptides which are respectively
conserved in all or in particular VGSCs, or which encompass the
differences between one form of VGSC and the other forms. For
example, SCN5A may be distinguished from other VGSC.alpha.s by
possession of C-terminal PDZ domains, as discussed in Example 1; an
antibody binding to part of this C-terminal region may be useful in
distinguishing SCN5A from other VGSCs (for example in conjunction
with an antibody binding to another portion of SCN5A (and other
VGSCs)).
[0098] The antibodies may be monoclonal or polyclonal. Suitable
monoclonal antibodies may be prepared by known techniques, for
example those disclosed in "Monoclonal Antibodies: A manual of
techniques", H Zola (CRC Press, 1988) and in "Monoclonal Hybridoma
Antibodies: Techniques and applications", J G R Hurrell (CRC Press,
1982), both of which are incorporated herein by reference.
[0099] The level of the said VGSC which is indicative of cancer or
metastatic potential may be defined as the increased level present
in known cancerous or metastatic cells, preferably cancerous or
metastatic breast cells over known non-cancerous or non-metastatic
breast cells. The level may be, for example, at least 11/2 fold
higher in cancerous or metastatic cells, or it may be at least
2-fold or 3-fold higher.
[0100] By "the relative amount of said VGSC protein" is meant the
amount of said VGSC protein per unit mass of sample tissue or per
unit number of sample cells compared to the amount of said VGSC
protein per unit mass of known normal tissue or per unit number of
normal cells. The relative amount may be determined using any
suitable protein quantitation method. In particular, it is
preferred if antibodies are used and that the amount of said VGSC
protein is determined using methods which include quantitative
western blotting, enzyme-linked immunosorbent assays (ELISA) or
quantitative immunohistochemistry.
[0101] As noted above, an increased level of the said VGSC, for
example SCN5A in a sample compared with a known normal tissue
sample is suggestive of a tumorigenic sample, with high metastatic
potential. In relation to breast tissue, the presence of the said
VGSC(SCN5A and/or SCN9A), compared to its absence, is suggestive of
carcinogenesis.
[0102] Other techniques for raising and purifying antibodies are
well known in the art and any such techniques may be chosen to
achieve the preparations useful in the methods claimed in this
invention. In a preferred embodiment of the invention, antibodies
will immunoprecipitate said VGSC proteins from solution as well as
react with said VGSC protein on western or immunoblots of
polyacrylamide gels. In another preferred embodiment, antibodies
will detect said VGSC proteins in paraffin or frozen tissue
sections, using immunocytochemical techniques.
[0103] Preferred embodiments relating to methods for detecting said
VGSC protein include enzyme linked immunosorbent assays (ELISA),
radioimmunoassay (RIA), immunoradiometric assays (IRMA) and
immunoenzymatic assays (IEMA), including sandwich assays using
monoclonal and/or polyclonal antibodies. Exemplary sandwich assays
are described by David et al in U.S. Pat. Nos. 4,376,110 and
4,486,530, hereby incorporated by reference.
[0104] It will be appreciated that other antibody-like molecules
may be used in the method of the inventions including, for example,
antibody fragments or derivatives which retain their
antigen-binding sites, synthetic antibody-like molecules such as
single-chain Fv fragments (ScFv) and domain antibodies (dAbs), and
other molecules with antibody-like antigen binding motifs.
[0105] A further aspect of the invention provides the use of a
molecule which selectively binds to SCN5A VGSC polypeptide
(including a natural fragment or variant thereof) in a method of
diagnosing cancer or prognosing cancer or determining
susceptibility to cancer (preferably breast cancer); or in the
manufacture of a reagent for diagnosing cancer or prognosing cancer
or determining susceptibility to cancer. The present invention
further provides the use of a molecule which selectively binds to a
VGSC polypeptide (including a natural fragment or variant thereof),
preferably SCN5A or SCN9A, in a method of diagnosing breast cancer
or prognosing breast cancer or determining susceptibility to breast
cancer; or in the manufacture of a reagent for carrying out these
methods.
[0106] In a further embodiment the level of the said VGSC is
measured by selectively assaying its activity in the sample. The
activity of VGSC, for example SCN5A VGSC, in a sample may be
assayed by dissociating a biopsy into single cells and in culture
assaying (i) the effect of voltage-gated Na.sup.+ channel blockers
on their motility and (ii) detecting goltage-gated Na.sup.+ channel
activity by electrophysiological recording. Suitable methods and
voltage-gated Na.sup.+ channel blockers are described in Example
1.
[0107] Preferred diagnostic methods of the invention include what
can broadly be described as "invasive" methods and "non-invasive"
methods. Invasive methods include, for example, the taking of a
biopsy for detection of voltage-gated Na.sup.+ channel expression
by, for example, (a) immunohistochemical application of a
sequence-specific antibody, (b) in situ PCR on tissue sections, or
(c) reverse transcription (RT)-PCR of cells, for example epithelial
cells (and/or other cell types, for example neuroendocrine or
myoepithelial cells) after separating them from the biopsy.
Non-invasive methods include obtaining breast-derived cells from
blood, which may be separated by affinity and assayed for
voltage-gated Na.sup.+ channel expression by PCR.
[0108] A further aspect of the invention provides the use of an
agent which is an agent useful in selectively assaying the activity
of SCN5A voltage-gated Na channel protein in a sample in a method
of diagnosing cancer or prognosing cancer or determining
susceptibility to cancer (preferably breast cancer); or in the
manufacture of a reagent for diagnosing cancer or prognosing cancer
or determining susceptibility to cancer. The present invention
further provides the use of an agent which is an agent useful in
selectively assaying the activity of a voltage-gated Na.sup.+
channel protein, preferably SCN5A or SCN9A, in a sample in a method
of diagnosing breast cancer or prognosing breast cancer or
determining susceptibility to breast cancer; or in the manufacture
of a reagent for carrying out these methods.
[0109] The agents as defined are therefore useful in a method of
diagnosing cancer.
[0110] A further aspect of the invention provides a kit of parts
useful for diagnosing cancer, especially breast cancer, comprising
an agent which is capable of use in determining the level of SCN5A
(and optionally SCN9A) VGSC protein or nucleic acid in a sample.
The agent may be a nucleic acid which selectively hybridises to the
said VGSC nucleic acid or the agent may be a molecule which
selectively binds to the said VGSC protein or the agent may be an
agent useful in selectively assaying the activity of the said VGSC.
Preferably, the kit further comprises a control sample containing
the said VGSC nucleic acid or protein wherein the control sample
may be a negative control (which contains a level of the said VGSC
protein or nucleic acid which is not associated with cancer or a
high metastatic potential for cancer) or it may be a positive
control (which contains a level of the said VGSC protein or nucleic
acid which is associated with cancer or a high metastatic potential
for cancer). The kit may contain both negative and positive
controls. The kit may usefully contain controls of the said VGSC
protein or nucleic acid which correspond to different amounts such
that a calibration curve may be made.
[0111] Suitably, the kit further comprises means for separating
breast cells (for example epithelial cells, neuroendocrine or
myoepithelial cells) from a sample in order to carry out said VGSC
assay. Preferably, the means for separating breast cells includes
antibody-coated micro-beads or columns. These are coated with
antibodies to cell membrane proteins. For example, as noted above,
anti-MUC1 antibodies such as HMFG-1 and HMFG-2 may be used
(Taylor-Papadimitriou et al (1986) J. Exp. Pathol. 2, 247-260);
other anti-MUC1 antibodies which may be useful are described in Cao
et al (1998) Tumour Biol. 19, (Suppl 1), 88-99. However, anti-MUC1
antibodies may bind to normal bone marrow cells. It is preferred to
use an anti epithelial cell adhesion molecule antibody, preferably
coated on magnetic beads. A preferred antibody is termed
BER-EP-4.
[0112] A further aspect of the invention provides a kit of parts
useful for diagnosing breast cancer, comprising (1) an agent which
is capable of use in determining the level of VGSC, preferably
SCN5A or SCN9A, protein or nucleic acid in a sample, and (2) means
for separating breast cells (for example epithelial cells,
neuroendocrine or myoepithelial cells) from a sample in order to
carry out said VGSC assay.
[0113] The kits may usefully further comprise a component for
testing for a further cancer-related polypeptide such as antibodies
which are reactive with one or more of the following cancer-related
polypeptides, all of which are well known in the art: MAGE-1,
MAGE-3, BAGE, GAGE-1, CAG-3, CEA, p53, oestrogen receptor (ER),
progesterone receptor (PR), MUC1, p52 trefoil peptide, Her2, PCNA,
Ki67, cyclin D, p90.sup.rak3, p170 glycoprotein (mdr-1) CA-15-3,
c-erbB1, cathepsin D, PSA, CA125, CA19-9, PAP, myc, cytokeratins,
bcl-2, telomerase, glutathione S transferases, rad51, VEGF,
thymidine phosphorylase, Flk1 or Flk2.
[0114] The kit may usefully still further or alternatively comprise
a nucleic acid which selectively hybridises to a further
cancer-related nucleic acid such as a gene or mRNA which encodes
any of the cancer-related polypeptides as described above. In
addition, useful nucleic acids which may be included in the kit are
those which selectively hybridise with the genes or miRNAs: ras,
APC, BRCA1, BRCA2, ataxia telangiectasia (ATM), hMSH2, hMCH1, hPMS2
or hPMS1. It is preferred if the further nucleic acid is one which
selectively hybridises to the gene or mRNA of any of erbB2, p53,
BRCA1, BRCA2 or ATM.
[0115] The kits usefully may contain controls and detection
material, (for example, for immunohistochemistry, secondary
antibodies labelled fluorophores, or enzymes, or biotin, or
digoxygenin or the like). For immunoassays, additional components
to the kit may include a second antibody to a different epitope on
the VGSC (optionally labelled or attached to a support), secondary
antibodies (optionally labelled or attached to a support), and
dilution and reaction buffers. Similar additional components may
usefully be included in all of the kits of the invention.
[0116] A further aspect of the invention provides a method of
treating cancer comprising the step of administering to the patient
an agent which selectively prevents the function of SCN5A (and
optionally also SCN9A) voltage-gated Na.sup.+ channel.
[0117] A further aspect of the invention provides a method of
treating breast cancer comprising the step of administering to the
patient an agent which selectively prevents the function of a
voltage-gated Na.sup.+ channel, preferably SCN5A or SCN9A, still
more preferably selectively SCN5A or SCN9A.
[0118] By "an agent which selectively prevents the function of a
voltage-gated Na.sup.+ channel" we include agents that (a) inhibit
the expression of a said VGSC or (b) inhibit the activity of a said
VGSC.
[0119] Agents that prevent the expression of said VGSC include but
are not limited to antisense agents and ribozymes.
[0120] Antisense oligonucleotides are single-stranded nucleic acid,
which can specifically bind to a complementary nucleic acid
sequence. By binding to the appropriate target sequence, an
RNA-RNA, a DNA-DNA, or RNA-DNA duplex is formed. These nucleic
acids are often termed "antisense" because they are complementary
to the sense or coding strand of the gene. Recently, formation of a
triple helix has proven possible where the oligonucleotide is bound
to a DNA duplex. It was found that oligonucleotides could recognise
sequences in the major groove of the DNA double helix. A triple
helix was formed thereby. This suggests that it is possible to
synthesise sequence-specific molecules which specifically bind
double-stranded DNA via recognition of major groove hydrogen
binding sites.
[0121] By binding to the target nucleic acid, the above
oligonucleotides can inhibit the function of the target nucleic
acid. This could, for example, be a result of blocking the
transcription, processing, poly(A)addition, replication,
translation, or promoting inhibitory mechanisms of the cells, such
as promoting RNA degradations.
[0122] Antisense oligonucleotides are prepared in the laboratory
and then introduced into cells, for example by microinjection or
uptake from the cell culture medium into the cells, or they are
expressed in cells after transfection with plasmids or retroviruses
or other vectors carrying an antisense gene. Antisense
oligonucleotides were first discovered to inhibit viral replication
or expression in cell culture for Rous sarcoma virus, vesicular
stomatitis virus, herpes simplex virus type 1, simian virus and
influenza virus. Since then, inhibition of mRNA translation by
antisense oligonucleotides has been studied extensively in
cell-free systems including rabbit reticulocyte lysates and wheat
germ extracts. Inhibition of viral function by antisense
oligonucleotides has been demonstrated in vitro using
oligonucleotides which were complementary to the AIDS HIV
retrovirus RNA (Goodchild, J. 1988 "Inhibition of Human
Immunodeficiency Virus Replication by Antisense
Oligodeoxynucleotides", Proc. Natl. Acad. Sci. (USA) 85(15),
5507-11). The Goodchild study showed that oligonucleotides that
were most effective were complementary to the poly(A) signal; also
effective were those targeted at the 5' end of the RNA,
particularly the cap and 5' untranslated region, next to the primer
binding site and at the primer binding site. The cap, 5N
untranslated region, and poly(A) signal lie within the sequence
repeated at the ends of retrovirus RNA (R region) and the
oligonucleotides complementary to these may bind twice to the
RNA.
[0123] Oligonucleotides are subject to being degraded or
inactivated by cellular endogenous nucleases. To counter this
problem, it is possible to use modified oligonucleotides, eg having
altered internucleotide linkages, in which the naturally occurring
phosphodiester linkages have been replaced with another linkage.
For example, Agrawal et al (1988) Proc. Natl. Acad. Sci. USA 85,
7079-7083 showed increased inhibition in tissue culture of HIV-1
using oligonucleotide phosphoramidates and phosphorothioates. Sarin
et al (1988) Proc. Natl. Acad. Sci. USA 85, 7448-7451 demonstrated
increased inhibition of HIV-1 using oligonucleotide
methylphosphonates. Agrawal et al (1989) Proc. Natl. Acad. Sci. USA
86, 7790-7794 showed inhibition of HIV-1 replication in both
early-infected and chronically infected cell cultures, using
nucleotide sequence-specific oligonucleotide phosphorothioates.
Leither et al (1990) Proc. Natl. Acad. Sci. USA 87, 3430-3434
report inhibition in tissue culture of influenza virus replication
by oligonucleotide phosphorothioates.
[0124] Oligonucleotides having artificial linkages have been shown
to be resistant to degradation in vivo. For example, Shaw et al
(1991) in Nucleic Acids Res. 19, 747-750, report that otherwise
unmodified oligonucleotides become more resistant to nucleases in
vivo when they are blocked at the 3' end by certain capping
structures and that uncapped oligonucleotide phosphorothioates are
not degraded in vivo.
[0125] A detailed description of the H-phosphonate approach to
synthesizing oligonucleoside phosphorothioates is provided in
Agrawal and Tang (1990) Tetrahedron Letters 31, 7541-7544, the
teachings of which are hereby incorporated herein by reference.
Syntheses of oligonucleoside methylphosphonates,
phosphorodithioates, phosphoramidates, phosphate esters, bridged
phosphoramidates and bridge phosphorothioates are known in the art.
See, for example, Agrawal and Goodchild (1987) Tetrahedron Letters
28, 3539; Nielsen et al (1988) Tetrahedron Letters 29, 2911; Jager
et al (1988) Biochemistry 27, 7237; Uznanski et al (1987)
Tetrahedron Letters 28, 3401; Bannwarth (1988) Helv. Chim. Acta.
71, 1517; Crosstick and Vyle (1989) Tetrahedron Letters 30, 4693;
Agrawal et al (1990) Proc. Natl. Acad. Sci. USA 87, 1401-1405, the
teachings of which are incorporated herein by reference. Other
methods for synthesis or production also are possible. In a
preferred embodiment the oligonucleotide is a deoxyribonucleic acid
(DNA), although ribonucleic acid (RNA) sequences may also be
synthesized and applied.
[0126] The oligonucleotides useful in the invention preferably are
designed to resist degradation by endogenous nucleolytic enzymes.
In vivo degradation of oligonucleotides produces oligonucleotide
breakdown products of reduced length. Such breakdown products are
more likely to engage in non-specific hybridization and are less
likely to be effective, relative to their full-length counterparts.
Thus, it is desirable to use oligonucleotides that are resistant to
degradation in the body and which are able to reach the targeted
cells. The present oligonucleotides can be rendered more resistant
to degradation in vivo by substituting one or more internal
artificial internucleotide linkages for the native phosphodiester
linkages, for example, by replacing phosphate with sulphur in the
linkage. Examples of linkages that may be used include
phosphorothioates, methylphosphonates, sulphone, sulphate, ketyl,
phosphorodithioates, various phosphoramidates, phosphate esters,
bridged phosphorothioates and bridged phosphoramidates. Such
examples are illustrative, rather than limiting, since other
internucleotide linkages are known in the art. See, for example,
Cohen, (1990) Trends in Biotechnology. The synthesis of
oligonucleotides having one or more of these linkages substituted
for the phosphodiester internucleotide linkages is well known in
the art, including synthetic pathways for producing
oligonucleotides having mixed internucleotide linkages.
[0127] Oligonucleotides can be made resistant to extension by
endogenous enzymes by "capping" or incorporating similar groups on
the 5N or 3N terminal nucleotides. A reagent for capping is
commercially available as Amino-Link II.TM. from Applied BioSystems
Inc, Foster City, Calif. Methods for capping are described, for
example, by Shaw et al (1991) Nucleic Acids Res. 19, 747-750 and
Agrawal et al (1991) Proc. Natl. Acad. Sci. USA 88(17), 7595-7599,
the teachings of which are hereby incorporated herein by
reference.
[0128] A further method of making oligonucleotides resistant to
nuclease attack is for them to be "self-stabilized" as described by
Tang et al (1993) Nucl. Acids Res. 21, 2729-2735 incorporated
herein by reference. Self-stabilized oligonucleotides have hairpin
loop structures at their 3' ends, and show increased resistance to
degradation by snake venom phosphodiesterase, DNA polymerase I and
fetal bovine serum. The self-stabilized region of the
oligonucleotide does not interfere in hybridization with
complementary nucleic acids, and pharmacokinetic and stability
studies in mice have shown increased in vivo persistence of
self-stabilized oligonucleotides with respect to their linear
counterparts.
[0129] In accordance with the invention, the inherent binding
specificity of antisense oligonucleotides characteristic of base
pairing is enhanced by limiting the availability of the antisense
compound to its intend locus in vivo, permitting lower dosages to
be used and minimizing systemic effects. Thus, oligonucleotides are
applied locally to achieve the desired effect. The concentration of
the oligonucleotides at the desired locus is much higher than if
the oligonucleotides were administered systemically, and the
therapeutic effect can be achieved using a significantly lower
total amount. The local high concentration of oligonucleotides
enhances penetration of the targeted cells and effectively blocks
translation of the target nucleic acid sequences.
[0130] The oligonucleotides can be delivered to the locus by any
means appropriate for localized administration of a drug. For
example, a solution of the oligonucleotides can be injected
directly to the site or can be delivered by infusion using an
infusion pump. The oligonucleotides also can be incorporated into
an implantable device which when placed at the desired site,
permits the oligonucleotides to be released into the surrounding
locus.
[0131] The oligonucleotides may be administered via a hydrogel
material. The hydrogel is noninflammatory and biodegradable. Many
such materials now are known, including those made from natural and
synthetic polymers. In a preferred embodiment, the method exploits
a hydrogel which is liquid below body temperature but gels to form
a shape-retaining semisolid hydrogel at or near body temperature.
Preferred hydrogel are polymers of ethylene oxide-propylene oxide
repeating units. The properties of the polymer are dependent on the
molecular weight of the polymer and the relative percentage of
polyethylene oxide and polypropylene oxide in the polymer.
Preferred hydrogels contain from about 10 to about 80% by weight
ethylene oxide and from about 20 to about 90% by weight propylene
oxide. A particularly preferred hydrogel contains about 70%
polyethylene oxide and 30% polypropylene oxide. Hydrogels which can
be used are available, for example, from BASF Corp., Parsippany,
N.J., under the tradename Pluronic.RTM..
[0132] In this embodiment, the hydrogel is cooled to a liquid state
and the oligonucleotides are admixed into the liquid to a
concentration of about 1 mg oligonucleotide per gram of hydrogel.
The resulting mixture then is applied onto the surface to be
treated, for example by spraying or painting during surgery or
using a catheter or endoscopic procedures. As the polymer warms, it
solidifies to form a gel, and the oligonucleotides diffuse out of
the gel into the surrounding cells over a period of time defined by
the exact composition of the gel.
[0133] The oligonucleotides can be administered by means of other
implants that are commercially available or described in the
scientific literature, including liposomes, microcapsules and
implantable devices. For example, implants made of biodegradable
materials such as polyanhydrides, polyorthoesters, polylactic acid
and polyglycolic acid and copolymers thereof, collagen, and protein
polymers, or non-biodegradable materials such as ethylenevinyl
acetate (EVAc), polyvinyl acetate, ethylene vinyl alcohol, and
derivatives thereof can be used to locally deliver the
oligonucleotides. The oligonucleotides can be incorporated into the
material as it is polymerized or solidified, using melt or solvent
evaporation techniques, or mechanically mixed with the material. In
one embodiment, the oligonucleotides are mixed into or applied onto
coatings for implantable devices such as dextran coated silica
beads, stents, or catheters. Polymeric nanoparticles/biodegradable
drug carriers may also be used (Mader (1998) Radiol. Oncol. 32,
89-94).
[0134] The dose of oligonucleotides is dependent on the size of the
oligonucleotides and the purpose for which it is administered. In
general, the range is calculated based on the surface area of
tissue to be treated. The effective dose of oligonucleotide is
somewhat dependent on the length and chemical composition of the
oligonucleotide but is generally in the range of about 30 to 3000
.mu.g per square centimetre of tissue surface area.
[0135] The oligonucleotides may be administered to the patient
systemically for both therapeutic and prophylactic purposes. The
oligonucleotides may be administered by any effective method, for
example, parenterally (eg intravenously, subcutaneously,
intramuscularly) or by oral, nasal or other means which permit the
oligonucleotides to access and circulate in the patient's
bloodstream. Oligonucleotides administered systemically preferably
are given in addition to locally administered oligonucleotides, but
also have utility in the absence of local administration. A dosage
in the range of from about 0.1 to about 10 grams per administration
to an adult human generally will be effective for this purpose.
[0136] It will be appreciated that it may be desirable to target
the antisense oligonucleotides to the cancerous tissue, for example
to the breast. This may be achieved by administering the antisense
oligonucleotides to the cancer location (for example the breast),
or it may be achieved by using antisense oligonucleotides which are
in association with a molecule which selectively directs the
antisense oligonucleotide to the cancer location. For example, the
antisense oligonucleotide may be associated with an antibody or
antibody like molecule which selectively binds a breast-related
antigen such as MUC-1. By "associated with" we mean that the
antisense oligonucleotide and the cancer-directing entity are so
associated that the cancer-directing entity is able to direct the
antisense oligonucleotide to the location of the cancer cells, for
example breast cells.
[0137] It will be appreciated that antisense agents also include
larger molecules, for example of around one hundred to several
hundred bases which bind to said VGSC mRNA or genes and
substantially prevent expression of said VGSC mRNA or genes and
substantially prevent expression of said VGSC protein. Thus,
expression of an antisense molecule which is substantially
complementary to said VGSC mRNA is envisaged as part of the
invention.
[0138] Thus, in this approach, synthetic oligonucleotides with
antisense sequence to specific regions of (i) SCN5A (and optionally
also SCN9A) channels or (ii) (for patients with or at risk of
breast cancer) SCN5A or SCN9A channels or VGSCs generally, are
administered (preferably to patients with or at risk of breast
cancer) to block channel activity. Details of particular synthetic
oligonucleotides are given in Example 2. It is noteworthy that
antisense oligonucleotide technology has already been used to
manipulate potassium channels in vitro (Roy et al (1996) Glia 18,
174-188) and VGSCs in vitro (Biochem Biophys Res Comm (1997) 234,
235-241) and in blocking neuropathic pain (Lai et al (1999)
"Blockade of neuropathic pain by antisense targeting of
tetrodotoxin-resistant sodium channels in sensory neurons" Methods
in Enzymol 314, 201-213).
[0139] A further method for blocking said VGSC activity includes
dominant negative suppression. In this technique, a mutated VGSC
gene product suppresses or eliminates the activity of the
corresponding normal gene product when the two are co-expressed. In
the case of voltage-gated potassium channels (VGPCs) which comprise
4 alpha subunits, such an approach making use of a highly truncated
gene product, has been used successfully to suppress functional
expression of VGPCs in vitro (Tu et al (1995) Biophys. J. 68,
147-156) and in vivo (London et al (1998) Proc. Natl. Acad. Sci.
USA 95, 2926-2931). The truncated subunit is capable of binding to
other VGPC subunits but does not contain the residues required for
channel functioning. Thus, the activity of the "combined" VGPC is
blocked. A number of naturally occurring alternatively spliced
channel subunits have been detected which may function to suppress
VGPC activity by a similar mechanism in vivo (Baumann et al (1987)
EMBO J. 6, 3419-3429; Kamb et al (1988) Neuron 1, 421-430; and
Pongs et al (1988) EMBO J. 7, 1087-1096). We believe that VGSC may
similarly be suppressed by interfering with functional channel
formation. Although VGSCs are formed from a single alpha subunit
(comprising four functional domains), recent studies have
demonstrated the specific expression (during development in human,
mouse and fish) of truncated VGSC proteins possessing only two
domains which might function in a dominant negative manner to
control VGSC activity (Plummer et al (1997) J. Biol. Chem. 272,
24008-24015; and Oh & Waxman (1998) NeuroReport 9, 1267-1271).
The neonatal VGSCs may act as inhibitors of VGSC activity, but this
inhibition is most probably specific to the related adult VGSC. It
is much less likely that, for example, neonatal SCN8A could inhibit
the activity of VGSC proteins derived from VGSC genes other than
SCN8A.
[0140] The larger molecules may be expressed from any suitable
genetic construct as is described below and delivered to the
patient. Typically, the genetic construct which expresses the
antisense molecule comprises at least a portion of the said VGSC
cDNA or gene operatively linked to a promoter which can express the
antisense molecule in the cell, preferably breast cell, which is or
may become cancerous.
[0141] Although the genetic construct can be DNA or RNA it is
preferred if it is DNA.
[0142] Preferably, the genetic construct is adapted for delivery to
a human cell.
[0143] Means and methods of introducing a genetic construct into a
cell in an animal body are known in the art. For example, the
constructs of the invention may be introduced into the tumour cells
by any convenient method, for example methods involving
retroviruses, so that the construct is inserted into the genome of
the tumour cell. For example, in Kuriyama et al (1991) Cell Struc.
and Func. 16, 503-510 purified retroviruses are administered.
Retroviruses provide a potential means of selectively infecting
cancer cells because they can only integrate into the genome of
dividing cells; most normal cells surrounding cancers are in a
quiescent, non-receptive stage of cell growth or, at least, are
dividing much less rapidly than the tumour cells. Retroviral DNA
constructs which encode said antisense agents may be made using
methods well known in the art. To produce active retrovirus from
such a construct it is usual to use an ecotropic psi2 packaging
cell line grown in Dulbecco's modified Eagle's medium (DMEM)
containing 10% foetal calf serum (FCS). Transfection of the cell
line is conveniently by calcium phosphate co-precipitation, and
stable transformants are selected by addition of G418 to a final
concentration of 1 mg/ml (assuming the retroviral construct
contains a neo.sup.R gene). Independent colonies are isolated and
expanded and the culture supernatant removed, filtered through a
0.45 .mu.m pore-size filter and stored at -70.degree.. For the
introduction of the retrovirus into the tumour cells, it is
convenient to inject directly retroviral supernatant to which 10
.mu.g/ml Polybrene has been added. For tumours exceeding 10 mm in
diameter it is appropriate to inject between 0.1 ml and 1 ml of
retroviral supernatant; preferably 0.5 ml.
[0144] Alternatively, as described in Culver et al (1992) Science
256, 1550-1552, cells which produce retroviruses are injected into
the tumour. The retrovirus-producing cells so introduced are
engineered to actively produce retroviral vector particles so that
continuous productions of the vector occurred within the tumour
mass in situ. Thus, proliferating tumour cells can be successfully
transduced in vivo if mixed with retroviral vector-producing
cells.
[0145] Targeted retroviruses are also available for use in the
invention; for example, sequences conferring specific binding
affinities may be engineered into preexisting viral env genes (see
Miller & Vile (1995) Faseb J. 9, 190-199 for a review of this
and other targeted vectors for gene therapy).
[0146] Other methods involve simple delivery of the construct into
the cell for expression therein either for a limited time or,
following integration into the genome, for a longer time. An
example of the latter approach includes (preferably
tumour-cell-targeted) liposomes (N.apprxeq.ssander et al (1992)
Cancer Res. 52, 646-653).
[0147] Immunoliposomes (antibody-directed liposomes) are especially
useful in targeting to cancer cell types which over-express a cell
surface protein for which antibodies are available. For example,
the immunoliposomes may be targeted by means of antibodies binding
to a breast cancer cell antigen such as MUC-1, or the said VGSC
(preferably in combination with other targeting means or methods),
as discussed further below. For the preparation of immuno-liposomes
MPB-PE (N-[4-(p-maleimidophenyl)butyryl]-phosphatidylethanolamine)
is synthesised according to the method of Martin &
Papahadjopoulos (1982) J. Biol. Chem. 257, 286-288. MPB-PE is
incorporated into the liposomal bilayers to allow a covalent
coupling of the antibody, or fragment thereof, to the liposomal
surface. The liposome is conveniently loaded with the DNA or other
genetic construct of the invention for delivery to the target
cells, for example, by forming the said liposomes in a solution of
the DNA or other genetic construct, followed by sequential
extrusion through polycarbonate membrane filters with 0.6 .mu.m and
0.2 .mu.m pore size under nitrogen pressures up to 0.8 MPa. After
extrusion, entrapped DNA construct is separated from free DNA
construct by ultracentrifugation at 80 000.times.g for 45 min.
Freshly prepared MPB-PE-liposomes in deoxygenated buffer are mixed
with freshly prepared antibody (or fragment thereof) and the
coupling reactions are carried out in a nitrogen atmosphere at
4.degree. C. under constant end over end rotation overnight. The
immunoliposomes are separated from unconjugated antibodies by
ultracentrifugation at 80 000.times.g for 45 min. Immunoliposomes
may be injected intraperitoneally or directly into the tumour.
[0148] Other methods of delivery include adenoviruses carrying
external DNA via an antibody-polylysine bridge (see Curiel Prog.
Med. Virol. 40, 1-18) and transferrin-polycation conjugates as
carriers (Wagner et al (1990) Proc. Natl. Acad. Sci. USA 87,
3410-3414). In the first of these methods a polycation-antibody
complex is formed with the DNA construct or other genetic construct
of the invention, wherein the antibody is specific for either
wild-type adenovirus or a variant adenovirus in which a new epitope
has been introduced which binds the antibody. The polycation moiety
binds the DNA via electrostatic interactions with the phosphate
backbone. The adenovirus, because it contains unaltered fibre and
penton proteins, is internalized into the cell and carries into the
cell with it the DNA construct of the invention. It is preferred if
the polycation is polylysine.
[0149] The DNA may also be delivered by adenovirus wherein it is
present within the adenovirus particle, for example, as described
below.
[0150] In the second of these methods, a high-efficiency nucleic
acid delivery system that uses receptor-mediated endocytosis to
carry DNA macromolecules into cells is employed. This is
accomplished by conjugating the iron-transport protein transferrin
to polycations that bind nucleic acids. Human transferrin, or the
chicken homologue conalbumin, or combinations thereof is covalently
linked to the small DNA-binding protein protamine or to polylysines
of various sizes through a disulfide linkage. These modified
transferrin molecules maintain their ability to bind their cognate
receptor and to mediate efficient iron transport into the cell. The
transferrin-polycation molecules form electrophoretically stable
complexes with DNA constructs or other genetic constructs of the
invention independent of nucleic acid size (from short
oligonucleotides to DNA of 21 kilobase pairs). When complexes of
transferrin-polycation and the DNA constructs or other genetic
constructs of the invention are supplied to the tumour cells, a
high level of expression from the construct in the cells is
expected.
[0151] High-efficiency receptor-mediated delivery of the DNA
constructs or other genetic constructs of the invention using the
endosome-disruption activity of defective or chemically inactivated
adenovirus particles produced by the methods of Cotten et al (1992)
Proc. Natl. Acad. Sci. USA 89, 6094-6098 may also be used. This
approach appears to rely on the fact that adenoviruses are adapted
to allow release of their DNA from an endosome without passage
through the lysosome, and in the presence of, for example
transferrin linked to the DNA construct or other genetic construct
of the invention, the construct is taken up by the cell by the same
route as the adenovirus particle.
[0152] This approach has the advantages that there is no need to
use complex retroviral constructs; there is no permanent
modification of the genome as occurs with retroviral infection; and
the targeted expression system is coupled with a targeted delivery
system, thus reducing toxicity to other cell types.
[0153] It may be desirable to locally perfuse a tumour with the
suitable delivery vehicle comprising the genetic construct for a
period of time; additionally or alternatively the delivery vehicle
or genetic construct can be injected directly into accessible
tumours.
[0154] It will be appreciated that "naked DNA" and DNA complexed
with cationic and neutral lipids may also be useful in introducing
the DNA of the invention into cells of the patient to be treated.
Non-viral approaches to gene therapy are described in Ledley (1995)
Human Gene Therapy 6, 1129-1144.
[0155] Alternative targeted delivery systems are also known such as
the modified adenovirus system described in WO 94/10323 wherein,
typically, the DNA is carried within the adenovirus, or
adenovirus-like, particle. Michael et al (1995) Gene Therapy 2,
660-668 describes modification of adenovirus to add a
cell-selective moiety into a fibre protein. Mutant adenoviruses
which replicate selectively in p53-deficient human tumour cells,
such as those described in Bischoff et al (1996) Science 274,
373-376 are also useful for delivering the genetic construct of the
invention to a cell. Thus, it will be appreciated that a further
aspect of the invention provides a virus or virus-like particle
comprising a genetic construct of the invention. Other suitable
viruses or virus-like particles include HSV, AAV, vaccinia and
parvovirus.
[0156] In a further embodiment the agent which selectively prevents
the function of the said VGSC is a ribozyme capable of cleaving
targeted VGSC RNA or DNA. A gene expressing said ribozyme may be
administered in substantially the same way and using substantially
the same vehicles as for the antisense molecules.
[0157] Ribozymes which may be encoded in the genomes of the viruses
or virus-like particles herein disclosed are described in Cech and
Herschlag "Site-specific cleavage of single stranded DNA" U.S. Pat.
No. 5,180,818; Altman et al "Cleavage of targeted RNA by RNAse P"
U.S. Pat. No. 5,168,053, Cantin et al "Ribozyme cleavage of HIV-1
RNA" U.S. Pat. No. 5,149,796; Cech et al "RNA ribozyme restriction
endoribonucleases and methods", U.S. Pat. No. 5,116,742; Been et al
"RNA ribozyme polymerases, dephosphorylases, restriction
endonucleases and methods", U.S. Pat. No. 5,093,246; and Been et al
"RNA ribozyme polymerases, dephosphorylases, restriction
endoribonucleases and methods; cleaves single-stranded RNA at
specific site by transesterification", U.S. Pat. No. 4,987,071, all
incorporated herein by reference.
[0158] It will be appreciated that it may be desirable that the
antisense molecule or ribozyme is expressed from a breast
cell-specific promoter element. Examples of breast cell-specific
promoters include the promoter element for c-erbB2 or the oestrogen
receptor.
[0159] The genetic constructs of the invention can be prepared
using methods well known in the art.
[0160] A variety of methods have been developed to operably link
DNA to vectors via complementary cohesive termini. For instance,
complementary homopolymer tracts can be added to the DNA segment to
be inserted to the vector DNA. The vector and DNA segment are then
joined by hydrogen bonding between the complementary homopolymeric
tails to form recombinant DNA molecules.
[0161] Synthetic linkers containing one or more restriction sites
provide an alternative method of joining the DNA segment to
vectors. The DNA segment, generated by endonuclease restriction
digestion as described earlier, is treated with bacteriophage T4
DNA polymerase or E. coli DNA polymerase I, enzymes that remove
protruding, 3'-single-stranded termini with their 3'-5'
exonucleolytic activities, and fill in recessed 3'-ends with their
polymerizing activities.
[0162] The combination of these activities therefore generates
blunt-ended DNA segments. The blunt-ended segments are then
incubated with a large molar excess of linker molecules in the
presence of an enzyme that is able to catalyze the ligation of
blunt-ended DNA molecules, such as bacteriophage T4 DNA ligase.
Thus, the products of the reaction are DNA segments carrying
polymeric linker sequences at their ends. These DNA segments are
then cleaved with the appropriate restriction enzyme and ligated to
an expression vector that has been cleaved with an enzyme that
produces termini compatible with those of the DNA segment.
[0163] Synthetic linkers containing a variety of restriction
endonuclease sites are commercially available from a number of
sources including International Biotechnologies Inc, New Haven,
Conn., USA.
[0164] A desirable way to modify the DNA encoding the polypeptide
of the invention is to use the polymerase chain reaction as
disclosed by Saiki et al (1988) Science 239, 487-491.
[0165] In this method the DNA to be enzymatically amplified is
flanked by two specific oligonucleotide primers which themselves
become incorporated into the amplified DNA. The said specific
primers may contain restriction endonuclease recognition sites
which can be used for cloning into expression vectors using methods
known in the art.
[0166] The present invention also relates to a host cell
transformed with a genetic (preferably DNA construct) construct of
the present invention. The host cell can be either prokaryotic or
eukaryotic. Bacterial cells are preferred prokaryotic host cells
and typically are a strain of E. coli such as, for example, the E.
coli strains DH5 available from Bethesda Research Laboratories
Inc., Bethesda, Md., USA, and RR1 available from the American Type
Culture Collection (ATCC) of Rockville, Md., USA (No ATCC 31343).
Preferred eukaryotic host cells include yeast and mammalian cells,
preferably vertebrate cells such as those from a mouse, rat, monkey
or human fibroblastic cell line. Yeast host cells include YPH499,
YPH500 and YPH501 which are generally available from Stratagene
Cloning Systems, La Jolla, Calif. 92037, USA. Preferred mammalian
host cells include Chinese hamster ovary (CHO) cells available from
the ATCC as CCL61, NIH Swiss mouse embryo cells NIH/3T3 available
from the ATCC as CRL 1658, and monkey kidney-derived COS-1 cells
available from the ATCC as CRL 1650.
[0167] Transformation of appropriate cell hosts with a DNA
construct of the present invention is accomplished by well known
methods that typically depend on the type of vector used. With
regard to transformation of prokaryotic host cells, see, for
example, Cohen et al (1972) Proc. Natl. Acad. Sci. USA 69, 2110 and
Sambrook et al (1989) Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Transformation
of yeast cells is described in Sherman et al (1986) Methods In
Yeast Genetics, A Laboratory Manual, Cold Spring Harbor, N.Y. The
method of Beggs (1978) Nature 275, 104-109 is also useful. With
regard to vertebrate cells, reagents useful in transfecting such
cells, for example calcium phosphate and DEAE-dextran or liposome
formulations, are available from Stratagene Cloning Systems, or
Life Technologies Inc., Gaithersburg, Md. 20877, USA.
[0168] Electroporation is also useful for transforming cells and is
well known in the art for transforming yeast cell, bacterial cells
and vertebrate cells.
[0169] For example, many bacterial species may be transformed by
the methods described in Luchansky et al (1988) Mol. Microbiol. 2,
637-646 incorporated herein by reference. The greatest number of
transformants is consistently recovered following electroporation
of the DNA-cell mixture suspended in 2.5.times.PEB using 6250V per
cm at 25 .mu.FD.
[0170] Methods for transformation of yeast by electroporation are
disclosed in Becker & Guarente (1990) Methods Enzymol. 194,
182.
[0171] Successfully transformed cells, ie cells that contain a DNA
construct of the present invention, can be identified by well known
techniques. For example, cells resulting from the introduction of
an expression construct of the present invention can be grown to
produce the molecule as defined in the invention. Cells can be
harvested and lysed and their DNA content examined for the presence
of the DNA using a method such as that described by Southern (1975)
J. Mol. Biol. 98, 503 or Berent et al (1985) Biotech. 3, 208.
Alternatively, the presence of the molecule, for example a protein,
in the supernatant can be detected using antibodies as described
below.
[0172] In addition to directly assaying for the presence of
recombinant DNA, successful transformation can be confirmed by well
known immunological methods when the recombinant DNA is capable of
directing the expression of the protein. For example, cells
successfully transformed with an expression vector produce proteins
displaying appropriate antigenicity. Samples of cells suspected of
being transformed are harvested and assayed for the protein using
suitable antibodies.
[0173] Thus, in addition to the transformed host cells themselves,
the present invention also contemplates a culture of those cells,
preferably a monoclonal (clonally homogeneous) culture, or a
culture derived from a monoclonal culture, in a nutrient
medium.
[0174] When the genetic construct is a plasmid DNA construct it can
be purified. The DNA construct of the invention is purified from
the host cell using well known methods.
[0175] For example, plasmid vector DNA can be prepared on a large
scale from cleaved lysates by banding in a CsCl gradient according
to the methods of Clewell & Helinski (1970) Biochemistry 9,
4428-4440 and Clewell (1972) J. Bacteriol. 110, 667-676. Plasmid
DNA extracted in this way can be freed from CsCl by dialysis
against sterile, pyrogen-free buffer through Visking tubing or by
size-exclusion chromatography.
[0176] Alternatively, plasmid DNA may be purified from cleared
lysates using ion-exchange chromatography, for example those
supplied by Qiagen. Hydroxyapatite column chromatography may also
be used.
[0177] A further aspect of the invention provides use of an agent
which selectively prevents (including inhibits) the function of
SCN5A (and optionally also SCN9A) voltage-gated Na.sup.+ channel in
the manufacture of a medicament for treating cancer, preferably
breast cancer. A further aspect of the invention provides use of an
agent which selectively prevents the function of a voltage-gated
Na.sup.+ channel, preferably SCN5A or SCN9A in the manufacture of a
medicament for treating breast cancer (including treating a patient
with or at risk of breast cancer).
[0178] A further aspect of the invention provides a method of
treating a patient with or at risk of cancer (preferably breast
cancer) wherein an agent which selectively prevents (including
inhibits) the function of SCN5A (and optionally also SCN9A)
voltage-gated Na.sup.+ channel is administered to the patient. A
further aspect of the invention provides a method of treating a
patient with or at risk of cancer (preferably breast cancer)
wherein an agent which selectively prevents the function of a
voltage-gated Na.sup.+ channel, preferably SCN5A or SCN9A is
administered to the patient.
[0179] Agents known as anti-arrhythmic and local anaesthetic drugs
may selectively prevent or inhibit the function of SCN5A voltage
gated Na.sup.+ channels, as well known to those skilled in the art.
Antiarrhythmic drugs that have been shown to inhibit SCN5A VGSC
activity include: naloxone, flecamide, cinnamophilin and
acrophyllidine; local anasthetics include pilsicamide and
lidocaine. However, they are not specific blockers of VGSCs,
including SCN5A subtype. Such anti-arrhythmic or local anaesthetic
drugs may be preferred agents for use in these aspects of the
invention.
[0180] A still further aspect of the invention provides a genetic
construct comprising a nucleic acid encoding a molecule capable of
preventing the function of SCN5A (and optionally also SCN9A)
voltage-gated Na.sup.+ channel expressed in a cell.
[0181] A further aspect of the invention provides a genetic
construct comprising a nucleic acid encoding a molecule capable of
preventing the function of a voltage-gated Na.sup.+ channel
expressed in a cell, preferably SCN5A and/or SCN9A (most preferably
SCN5A), wherein expression of said molecule by the genetic
construct is via a breast-selective promoter, or wherein the
genetic construct is adapted for selective delivery to a (human)
breast cell.
[0182] As noted above, the genetic construct may be RNA or DNA. The
molecule capable of preventing the function of the said VGSC is
conveniently an antisense molecule or a ribozyme as disclosed
above.
[0183] The genetic constructs are adapted for delivery to a human
cell, in particular a cell which is cancerous or in which cancer
may occur, and more particularly the genetic construct is adapted
for delivery to a breast cell. The genetic constructs of this
aspect of the invention include the viral and non-viral delivery
systems described above.
[0184] Suitably, the molecule is capable of preventing the function
of the said VGSC, for example SCN5A VGSC, such as a ribozyme or
antisense molecule, is selectively expressed in a cancer cell. For
example, expression of said molecule by the genetic construct may
be via a cancer cell- or tissue-selective promoter which, in the
case of breast cancer, may be the MUC-1 promoter or any other
breast-selective promoter.
[0185] A further aspect of the invention provides the genetic
constructs for use in medicine, preferably for use in treating
cancer, still more preferably breast cancer. Thus, the genetic
constructs are packaged and presented for use in medicine. A
further aspect of the invention provides the use of the said
genetic constructs for use in the manufacture of a medicament for
the treatment of cancer, preferably breast cancer.
[0186] A further aspect of the invention provides a pharmaceutical
composition comprising a genetic construct of the invention and a
pharmaceutically acceptable carrier. The carriers must be
"acceptable" in the sense of being compatible with the genetic
construct of the invention and not deleterious to the recipients
thereof. Typically, the carriers will be water or saline which will
be sterile and pyrogen free.
[0187] For the avoidance of doubt, the genetic constructs of the
invention specifically include virus or virus-like particles, but
also include constructs suitable use with for non-viral delivery
systems.
[0188] A further aspect of the invention provides a method of
identifying a compound which selectively inhibits a SCN5A
voltage-gated Na.sup.+ channel, the method comprising (a)
contacting a test compound with any one of the said voltage-gated
Na.sup.+ channels and determining whether said compound is
inhibitory; (b) contacting the test compound with other
voltage-gated Na.sup.+ channels and determining whether said
compound is inhibitory; and (c) selecting a compound which is
substantially inhibitory in (a) but is not substantially inhibitory
in (b). The compound may be useful in the treatment of cancer,
preferably breast cancer.
[0189] Typically, a range of compounds, including pharmacological
agents with known effects upon voltage-gated Na.sup.+ channels,
will be screened for their effectiveness in a number of assays.
Suitable assay formats include electrophysiological recording from
cells in long-term culture as cell-lines and short term culture of
cells dissociated from biopsies (see, for example Grimes &
Djamgoz (1998) J. Cell Physiol. 175, 50-58); electrophysiological
recording from oocytes functionally expressing recombinant said
VGSC following injection of cRNAs (see, for example, Fraser et al
(1993) In Electrophysiology, A practical approach (D. Willis, ed)
IRL Press); and in vitro (Boyden chamber) invasion assays (see, for
example, Grimes et al (1995) FEBS Lett 369, 290-294; and Smith et
al (1998) FEBS Lett. 423, 19-24).
[0190] The present invention also provides methods in which
treatment is targeted to cancer cells by means of targeting to
cells expressing SCN5A VGSC, or in which treatment is targeted to
breast cancer cells by means of targeting to cells expressing a
VGSC, preferably SCN5A or SCN9A, as noted above in relation to
targeting of genetic constructs to such cells. It will be
appreciated that targeting to cells expressing a said VGSC may
preferably be performed in conjunction with another targeting means
or method, for example local administration, in order to minimise
adverse effects on any normal tissues that express the said VGSC.
For example, cardiac tissue expresses SCN5A at high levels.
[0191] For example, anti-said VGSC antibodies (VGSC-Abs) conjugated
with a dye substance may be applied to the cancerous tissue in vivo
(eg Yasmuch et al (1993) "Antibody targeted photolysis" Critical
Review Revue Ther. Drug Carrier System 10, 197-252; Pogrebniak et
al (1993) "Targetted phototherapy with sensitizer-monoclonal
antibody conjugate and light" Surgical Onoclogy 2, 31-42). The
tissue is then irradiated locally with a wavelength of light/laser
matching the absorption peak of the `attached` dye. Absorption of
the light energy by the dye leads to local heating and cell death.
In this way, only the labelled (ie metastatic) cells will be
ablated. VGSC-Abs labelled with the following dyes may be used:
fluorescein (Pelegrin et al (1991) "Antibody fluorescein conjugates
for photoimmunodiagnosis of human colon-carcinoma in nude-mice"
Cancer 67, 2529-2537); rhodamine (Haghighat et al (1992)
"Laser-dyes for experimental phototherapy of human
cancer--comparison of 3 rhodamines" Laryngoscope 102, 81-87);
cyanins (Folli et al (1994) "Antibody-indocyanin conjugates for
immunophotodetection of human squamous-cell carcinoma in nude-mice"
Cancer Research 54, 2643-2649; Lipshutz et al (1994) "Evaluation of
4 new carbocyanine dyes for photodynamic therapy with lasers"
Laryngoscope 104, 996-1002; Haddad et al (1998) "In vitro and in
vivo effects of photodynamic therapy on murine malignant melanoma"
Annals of Surgical Oncology 5, 241-247). This may be useful with
oesophageal and lung cancer.
[0192] Thus, a further aspect of the invention provides a compound
comprising a moiety which selectively binds SCN5A voltage-gated
Na.sup.+ channel protein and a further moiety.
[0193] By "a moiety which selectively binds SCN5A voltage-gated
Na.sup.+ channel protein" we mean any suitable such moiety which
binds the said VGSC but does not substantially bind other
molecules, for example other VGSCs, for example SCN9A. The compound
comprising the binding moiety is one which preferably, in use, is
able to localise to areas of cancerous cells (preferably breast
cancerous cells), particularly metastatic cancer cells, but not
localise substantially to other areas where there are no cancerous
cells.
[0194] Preferably the binding moiety is able to bind to the said
VGSC with high affinity. For example, the binding constant for the
binding of the binding moiety to the said VGSC is preferably
between 10.sup.-7 and 10.sup.-10 M. Typically the binding moiety is
an anti-SNC5A antibody. Such antibodies and methods of preparing
suitable antibodies are discussed above.
[0195] The further moiety may be any further moiety which confers
on the compound a useful property with respect to the treatment or
imaging or diagnosis of cancer. In particular, the further moiety
is one which is useful in killing or imaging cancer cells,
particularly metastatic cancer cells. Preferably, the further
moiety is one which is able to kill the cancer cells to which the
compound is targeted.
[0196] In a preferred embodiment of the invention the further
moiety is directly or indirectly cytotoxic. In particular the
further moiety is preferably directly or indirectly toxic to cancer
cells, particularly metastatic cancer cells.
[0197] By "directly cytotoxic" we include the meaning that the
moiety is one which on its own is cytotoxic. By "indirectly
cytotoxic" we include the meaning that the moiety is one which,
although is not itself cytotoxic, can induce cytotoxicity, for
example by its action on a further molecule or by further action on
it.
[0198] In one embodiment the cytotoxic moiety is a cytotoxic
chemotherapeutic agent. Cytotoxic chemotherapeutic agents are well
known in the art.
[0199] Cytotoxic chemotherapeutic agents, such as anticancer
agents, include: alkylating agents including nitrogen mustards such
as mechlorethamine (HN2), cyclophosphamide, ifosfamide, melphalan
(L-sarcolysin) and chlorambucil; ethylenimines and methylmelamines
such as hexamethylmelamine, thiotepa; alkyl sulphonates such as
busulfan; nitrosoureas such as carmustine (BCNU), lomustine (CCNU),
semustine (methyl-CCNU) and streptozocin (streptozotocin); and
triazenes such as decarbazine (DTIC;
dimethyltriazenoimidazole-carboxamide); Antimetabolites including
folic acid analogues such as methotrexate (amethopterin);
pyrimidine analogues such as fluorouracil (5-fluorouracil; 5-FU),
floxuridine (fluorodeoxyuridine; FUdR) and cytarabine (cytosine
arabinoside); and purine analogues and related inhibitors such as
mercaptopurine (6-mercaptopurine; 6-MP), thioguanine
(6-thioguanine; TG) and pentostatin (2-deoxycoformycin). Natural
Products including vinca alkaloids such as vinblastine (VLB) and
vincristine; epipodophyllotoxins such as etoposide and teniposide;
antibiotics such as dactinomycin (actinomycin D), daunorubicin
(daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin
(mithramycin) and mitomycin (mitomycin C); enzymes such as
L-asparaginase; and biological response modifiers such as
interferon alphenomes. Miscellaneous agents including platinum
coordination complexes such as cisplatin (cis-DDP) and carboplatin;
anthracenedione such as mitoxantrone and anthracycline; substituted
urea such as hydroxyurea; methyl hydrazine derivative such as
procarbazine (N-methylhydrazine, MIH); and adrenocortical
suppressant such as mitotane (o,p-DDD) and aminoglutethimide; taxol
and analogues/derivatives; and hormone agonists/antagonists such as
flutamide and tamoxifen.
[0200] Various of these agents have previously been attached to
antibodies and other target site-delivery agents, and so compounds
of the invention comprising these agents may readily be made by the
person skilled in the art. For example, carbodiimide conjugation
(Bauminger & Wilchek (1980) Methods Enzymol. 70, 151-159;
incorporated herein by reference) may be used to conjugate a
variety of agents, including doxorubicin, to antibodies or
peptides.
[0201] Carbodiimides comprise a group of compounds that have the
general formula R--N.dbd.C.dbd.N--R', where R and R' can be
aliphatic or aromatic, and are used for synthesis of peptide bonds.
The preparative procedure is simple, relatively fast, and is
carried out under mild conditions. Carbodiimide compounds attack
carboxylic groups to change them into reactive sites for free amino
groups.
[0202] The water soluble carbodiumide,
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) is
particularly useful for conjugating a functional moiety to a
binding moiety and may be used to conjugate doxorubicin to tumor
homing peptides. The conjugation of doxorubicin and a binding
moiety requires the presence of an amino group, which is provided
by doxorubicin, and a carboxyl group, which is provided by the
binding moiety such as an antibody or peptide.
[0203] In addition to using carbodiimides for the direct formation
of peptide bonds, EDC also can be used to prepare active esters
such as N-hydroxysuccinimide (NHS) ester. The NHS ester, which
binds only to amino groups, then can be used to induce the
formation of an amide bond with the single amino group of the
doxorubicin. The use of EDC and NHS in combination is commonly used
for conjugation in order to increase yield of conjugate formation
(Bauminger & Wilchek, supra, 1980).
[0204] Other methods for conjugating a functional moiety to a
binding moiety also can be used. For example, sodium periodate
oxidation followed by reductive alkylation of appropriate reactants
can be used, as can glutaraldehyde crosslinking. However, it is
recognised that, regardless of which method of producing a
conjugate of the invention is selected, a determination must be
made that the binding moiety maintains its targeting ability and
that the functional moiety maintains its relevant function.
[0205] In a further embodiment of the invention, the cytotoxic
moiety is a cytotoxic peptide or polypeptide moiety by which we
include any moiety which leads to cell death. Cytotoxic peptide and
polypeptide moieties are well known in the art and include, for
example, ricin, abrin, Pseudomonas exotoxin, tissue factor and the
like. Methods for linking them to targeting moieties such as
antibodies are also known in the art. The use of ricin as a
cytotoxic agent is described in Burrows & Thorpe (1993) Proc.
Natl. Acad. Sci. USA 90, 8996-9000, incorporated herein by
reference, and the use of tissue factor, which leads to localised
blood clotting and infarction of a tumour, has been described by
Ran et al (1998) Cancer Res. 58, 4646-4653 and Huang et al (1997)
Science 275, 547-550. Tsai et al (1995) Dis. Colon Rectum 38,
1067-1074 describes the abrin A chain conjugated to a monoclonal
antibody and is incorporated herein by reference. Other ribosome
inactivating proteins are described as cytotoxic agents in WO
96/06641. Pseudomonas exotoxin may also be used as the cytotoxic
polypeptide moiety (see, for example, Aiello et al (1995) Proc.
Natl. Acad. Sci. USA 92, 10457-10461; incorporated herein by
reference).
[0206] Certain cytokines, such as TNFI and IL-2, may also be useful
as cytotoxic agents.
[0207] Certain radioactive atoms may also be cytotoxic if delivered
in sufficient doses. Thus, the cytotoxic moiety may comprise a
radioactive atom which, in use, delivers a sufficient quantity of
radioactivity to the target site so as to be cytotoxic. Suitable
radioactive atoms include phosphorus-32, iodine-125, iodine-131,
indium-111, rhenium-186, rhenium-188 or yttrium-90, or any other
isotope which emits enough energy to destroy neighbouring cells,
organelles or nucleic acid. Preferably, the isotopes and density of
radioactive atoms in the compound of the invention are such that a
dose of more than 4000 cGy (preferably at least 6000, 8000 or 10000
cGy) is delivered to the target site and, preferably, to the cells
at the target site and their organelles, particularly the
nucleus.
[0208] The radioactive atom may be attached to the binding moiety
in known ways. For example EDTA or another chelating agent may be
attached to the binding moiety and used to attach .sup.111In or
.sup.90Y. Tyrosine residues may be labelled with .sup.125I or
.sup.131I.
[0209] The cytotoxic moiety may be a suitable indirectly cytotoxic
polypeptide. In a particularly preferred embodiment, the indirectly
cytotoxic polypeptide is a polypeptide which has enzymatic activity
and can convert a relatively non-toxic prodrug into a cytotoxic
drug. When the targeting moiety is an antibody this type of system
is often referred to as ADEPT (Antibody-Directed Enzyme Prodrug
Therapy). The system requires that the targeting moiety locates the
enzymatic portion to the desired site in the body of the patient
(ie the site expressing the said VGSC, such as metastatic cancer
cells) and after allowing time for the enzyme to localise at the
site, administering a prodrug which is a substrate for the enzyme,
the end product of the catalysis being a cytotoxic compound. The
object of the approach is to maximise the concentration of drug at
the desired site and to minimise the concentration of drug in
normal tissues (see Senter, P. D. et al (1988) "Anti-tumor effects
of antibody-alkaline phosphatase conjugates in combination with
etoposide phosphate" Proc. Natl. Acad. Sci. USA 85, 4842-4846;
Bagshawe (1987) Br. J. Cancer 56, 531-2; and Bagshawe, K. D. et al
(1988) "A cytotoxic agent can be generated selectively at cancer
sites" Br. J. Cancer. 58, 700-703.)
[0210] Clearly, any said VGSC-binding moiety may be used in place
of an anti-said VGSC antibody in this type of directed enzyme
prodrug therapy system.
[0211] The enzyme and prodrug of the system using a said
VGSC-targeted enzyme as described herein may be any of those
previously proposed. The cytotoxic substance may be any existing
anti-cancer drug such as an alkylating agent; an agent which
intercalates in DNA; an agent which inhibits any key enzymes such
as dihydrofolate reductase, thymidine synthetase, ribonucleotide
reductase, nucleoside kinases or topoisomerase; or an agent which
effects cell death by interacting with any other cellular
constituent. Etoposide is an example of a topoisomerase
inhibitor.
[0212] Reported prodrug systems include: a phenol mustard prodrug
activated by an E. coli .beta.-glucuronidase (Wang et al, 1992 and
Roffler et al, 1991); a doxorubicin prodrug activated by a human
.beta.-glucuronidase (Bosslet et al, 1994); further doxorubicin
prodrugs activated by coffee bean .alpha.-galactosidase (Azoulay et
al, 1995); daunorubicin prodrugs, activated by coffee bean
.alpha.-D-galactosidase (Gesson et al, 1994); a 5-fluorouridine
prodrug activated by an E. coli .beta.-D-galactosidase (Abraham et
al, 1994); and methotrexate prodrugs (eg methotrexate-alanine)
activated by carboxypeptidase A (Kuefner et al, 1990, Vitols et al,
1992 and Vitols et al, 1995). These and others are included in the
following table.
TABLE-US-00001 Enzyme Prodrug Carboxypeptidase G2 Derivatives of
L-glutamic acid and benzoic acid mustards, aniline mustards, phenol
mustards and phenylenediamine mustards; fluorinated derivatives of
these Alkaline phosphatase Etoposide phosphate Mitomycin phosphate
Beta-glucuronidase p-Hydroxyaniline mustard-glucuronide
Epirubicin-glucuronide Penicillin-V-amidase Adriamycin-N
phenoxyacetyl Penicillin-G-amidase N-(4N-hydroxyphenyl acetyl)
palytoxin Doxorubicin and melphalan Beta-lactamase Nitrogen
mustard-cephalosporin p-phenylenediamine; doxorubicin derivatives;
vinblastine derivative-cephalosporin, cephalosporin mustard; a
taxol derivative Beta-glucosidase Cyanophenylmethyl-beta-D-gluco-
pyranosiduronic acid Nitroreductase
5-(Azaridin-1-yl-)-2,4-dinitrobenzamide Cytosine deaminase
5-Fluorocytosine Carboxypeptidase A Methotrexate-alanine
[0213] (This table is adapted from Bagshawe (1995) Drug Dev. Res.
34, 220-230, from which full references for these various systems
may be obtained; the taxol derivative is described in Rodrigues, M.
L. et al (1995) Chemistry & Biology 2, 223).
[0214] Suitable enzymes for forming part of the enzymatic portion
of the invention include: exopeptidases, such as carboxypeptidases
G, G1 and G2 (for glutamylated mustard prodrugs), carboxypeptidases
A and B (for MTX-based prodrugs) and aminopeptidases (for
2-.alpha.-aminocyl MTC prodrugs); endopeptidases, such as eg
thrombolysin (for thrombin prodrugs); hydrolases, such as
phosphatases (eg alkaline phosphatase) or sulphatases (eg aryl
sulphatases) (for phosphylated or sulphated prodrugs); amidases,
such as penicillin amidases and arylacyl amidase; lactamases, such
as .alpha.-lactamases; glycosidases, such as .beta.-glucuronidase
(for .alpha.-glucuronomide anthracyclines), .alpha.-galactosidase
(for amygdalin) and .beta.-galactosidase (for .alpha.-galactose
anthracycline); deaminases, such as cytosine deaminase (for 5FC);
kinases, such as urokinase and thymidine kinase (for gancyclovir);
reductases, such as nitroreductase (for CB1954 and analogues),
azoreductase (for azobenzene mustards) and DT-diaphorase (for
CB1954); oxidases, such as glucose oxidase (for glucose), xanthine
oxidase (for xanthine) and lactoperoxidase; DL-racemases, catalytic
antibodies and cyclodextrins.
[0215] The prodrug is relatively non-toxic compared to the
cytotoxic drug. Typically, it has less than 10% of the toxicity,
preferably less than 1% of the toxicity as measured in a suitable
in vitro cytotoxicity test.
[0216] It is likely that the moiety which is able to convert a
prodrug to a cytotoxic drug will be active in isolation from the
rest of the compound but it is necessary only for it to be active
when (a) it is in combination with the rest of the compound and (b)
the compound is attached to, adjacent to or internalised in target
cells.
[0217] When each moiety of the compound is a polypeptide, the two
portions may be linked together by any of the conventional ways of
cross-linking polypeptides, such as those generally described in
O'Sullivan et al (1979) Anal. Biochem. 100, 100-108. For example,
the said VGSC binding moiety may be enriched with thiol groups and
the further moiety reacted with a bifunctional agent capable of
reacting with those thiol groups, for example the
N-hydroxysuccinimide ester of iodoacetic acid (NHIA) or
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP). Amide and
thioether bonds, for example achieved with
m-maleimidobenzoyl-N-hydroxysuccinimide ester, are generally more
stable in vivo than disulphide bonds.
[0218] Alternatively, the compound may be produced as a fusion
compound by recombinant DNA techniques whereby a length of DNA
comprises respective regions encoding the two moieties of the
compound of the invention either adjacent one another or separated
by a region encoding a linker peptide which does not destroy the
desired properties of the compound. Conceivably, the two portions
of the compound may overlap wholly or partly.
[0219] The DNA is then expressed in a suitable host to produce a
polypeptide comprising the compound of the invention.
[0220] The cytotoxic moiety may be a radiosensitizer.
Radiosensitizers include fluoropyrimidines, thymidine analogues,
hydroxyurea, gemcitabine, fludarabine, nicotinamide, halogenated
pyrimidines, 3-aminobenzamide, 3-aminobenzodiamide, etanixadole,
pimonidazole and misonidazole (see, for example, McGinn et al
(1996) J. Natl. Cancer Inst. 88, 1193-11203; Shewach & Lawrence
(1996) Invest. New Drugs 14, 257-263; Horsman (1995) Acta Oncol.
34, 571-587; Shenoy & Singh (1992) Clin. Invest. 10, 533-551;
Mitchell et al (1989) Int. J. Radiat. Biol. 56, 827-836; Iliakis
& Kurtzman (1989) Int. J. Radiat. Oncol. Biol. Phys. 16,
1235-1241; Brown (1989) Int. J. Radiat. Oncol. Biol. Phys. 16,
987-993; Brown (1985) Cancer 55, 2222-2228).
[0221] Also, delivery of genes into cells can radiosensitise them,
for example delivery of the p53 gene or cyclin D (Lang et al (1998)
J. Neurosurg. 89, 125-132; Coco Martin et al (1999) Cancer Res. 59,
1134-1140).
[0222] The further moiety may be one which becomes cytotoxic, or
releases a cytotoxic moiety, upon irradiation. For example, the
boron-10 isotope, when appropriately irradiated, releases a
particles which are cytotoxic (see for example, U.S. Pat. No.
4,348,376 to Goldenberg; Primus et al (1996) Bioconjug. Chem. 7,
532-535).
[0223] Similarly, the cytotoxic moiety may be one which is useful
in photodynamic therapy such as photofrin (see, for example,
Dougherty et al (1998) J. Natl. Cancer Inst. 90, 889-905).
[0224] The further moiety may comprise a nucleic acid molecule
which is directly or indirectly cytotoxic. For example, the nucleic
acid molecule may be an antisense oligonucleotide which, upon
localisation at the target site is able to enter cells and lead to
their death. The oligonucleotide, therefore, may be one which
prevents expression of an essential gene, or one which leads to a
change in gene expression which causes apoptosis.
[0225] Examples of suitable oligonucleotides include those directed
at bcl-2 (Ziegler et al (1997) J. Natl. Cancer Inst. 89,
1027-1036), and DNA polymerase I and topoisomerase III (Lee et al
(1996) Anticancer Res. 16, 1805-1811.
[0226] Peptide nucleic acids may be useful in place of conventional
nucleic acids (see Knudsen & Nielsen (1997) Anticancer Drugs 8,
113-118).
[0227] In a further embodiment, the binding moiety may be comprised
in a delivery vehicle for delivering nucleic acid to the target,
for example a nucleic acid as discussed in relation to earlier
aspects of the invention. The delivery vehicle may be any suitable
delivery vehicle. It may, for example, be a liposome containing
nucleic acid, or it may be a virus or virus-like particle which is
able to deliver nucleic acid. In these cases, the moiety which
selectively binds to the said VGSC is typically present on the
surface of the delivery vehicle. For example, the moiety which
selectively binds to the said VGSC, such as a suitable antibody
fragment, may be present in the outer surface of a liposome and the
nucleic acid to be delivered may be present in the interior of the
liposome. As another example, a viral vector, such as a retroviral
or adenoviral vector, is engineered so that the moiety which
selectively binds to the said VGSC is attached to or located in the
surface of the viral particle thus enabling the viral particle to
be targeted to the desired site. Targeted delivery systems are also
known, such as the modified adenovirus system discussed above.
[0228] Immunoliposomes (antibody-directed liposomes) may be used in
which the moiety which selectively binds to the said VGSC is an
antibody. The preparation of immunoliposomes is described
above.
[0229] The nucleic acid delivered to the target site may be any
suitable DNA which leads, directly or indirectly, to cytotoxicity.
For example, the nucleic acid may encode a ribozyme which is
cytotoxic to the cell, or it may encode an enzyme which is able to
convert a substantially non-toxic prodrug into a cytotoxic drug
(this latter system is sometime called GDEPT: Gene Directed Enzyme
Prodrug Therapy).
[0230] Ribozymes which may be encoded in the nucleic acid to be
delivered to the target are described in references cited above.
Suitable targets for ribozymes include transcription factors such
as c-fos and c-myc, and bcl-2. Durai et al (1997) Anticancer Res.
17, 3307-3312 describes a hammerhead ribozyme against bcl-2.
[0231] EP 0 415 731 describes the GDEPT system. Similar
considerations concerning the choice of enzyme and prodrug apply to
the GDEPT system as to the ADEPT system described above.
[0232] The nucleic acid delivered to the target site may encode a
directly cytotoxic polypeptide.
[0233] In a further embodiment of the invention, the further moiety
comprised in the compound of the invention is a readily detectable
moiety.
[0234] By a "readily detectable moiety" we include the meaning that
the moiety is one which, when located at the target site following
administration of the compound of the invention into a patient, may
be detected, typically non-invasively from outside the body and the
site of the target located. Thus, the compounds of this embodiment
of the invention are useful in imaging and diagnosis.
[0235] Typically, the readily detectable moiety is or comprises a
radioactive atom which is useful in imaging. Suitable radioactive
atoms include technetium-99m or iodine-123 for scinitgraphic
studies. Other readily detectable moieties include, for example,
spin labels for magnetic resonance imaging (MRI) such as iodine-123
again, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15,
oxygen-17, gadolinium, manganese or iron. Clearly, the compound of
the invention must have sufficient of the appropriate atomic
isotopes in order for the molecule to be readily detectable.
[0236] The radio- or other labels may be incorporated in the
compound of the invention in known ways. For example, if the
binding moiety is a polypeptide it may be biosynthesized or may be
synthesized by chemical amino acid synthesis using suitable amino
acid precursors involving, for example, fluorine-19 in place of
hydrogen. Labels such as .sup.99mTc, .sup.123I, .sup.186Rh,
.sup.188Rh and .sup.111In can, for example, be attached via
cysteine residues in the binding moiety. Yttrium-90 can be attached
via a lysine residue. The IODOGEN method (Fraker er al (1978)
Biochem. Biophys. Res. Comm. 80, 49-57) can be used to incorporate
iodine-123. Reference ("Monoclonal Antibodies in
Immunoscintigraphy", J-F Chatal, CRC Press, 1989) describes other
methods in detail.
[0237] In a further preferred embodiment of the invention the
further moiety is able to bind selectively to a directly or
indirectly cytotoxic moiety or to a readily detectable moiety.
Thus, in this embodiment, the further moiety may be any moiety
which binds to a further compound or component which is cytotoxic
or readily detectable.
[0238] The further moiety may, therefore be an antibody which
selectively binds to the further compound or component, or it may
be some other binding moiety such as streptavidin or biotin or the
like. The following examples illustrate the types of molecules that
are included in the invention; other such molecules are readily
apparent from the teachings herein.
[0239] The further moiety may be or comprise a bispecific antibody
wherein one binding site comprises the moiety which selectively
binds to the said VGSC and the second binding site comprises a
moiety which binds to, for example, an enzyme which is able to
convert a substantially non-toxic prodrug to a cytotoxic drug.
[0240] The compound may be an antibody which selectively binds to
the said VGSC, to which is bound biotin. Avidin or streptavidin
which has been labelled with a readily detectable label may be used
in conjunction with the biotin labelled antibody in a two-phase
imaging system wherein the biotin labelled antibody is first
localised to the target site in the patient, and then the labelled
avidin or streptavidin is administered to the patient. Bispecific
antibodies and biotin/streptavidin (avidin) systems are reviewed by
Rosebrough (1996) Q J Nucl. Med. 40, 234-251.
[0241] In a preferred embodiment of the invention, the moiety which
selectively binds to the said VGSC and the further moiety are
polypeptides which are fused.
[0242] A further aspect of the invention comprises a nucleic acid
molecule encoding a compound of the preceding aspect of the
invention.
[0243] A further aspect of the invention provides a compound of the
invention for use in medicine. Typically, the compound is packaged
and presented as a medicament or as an imaging agent or as a
diagnostic agent for use in a patient.
[0244] A still further aspect of the invention provides a
pharmaceutical composition comprising a compound according to the
invention and a pharmaceutically acceptable carrier.
[0245] Typically the pharmaceutical compositions or formulations of
the invention are for parenteral administration, more particularly
for intravenous administration.
[0246] Formulations suitable for parenteral administration include
aqueous and non-aqueous sterile injection solutions which may
contain anti-oxidants, buffers, bacteriostats and solutes which
render the formulation isotonic with the blood of the intended
recipient; and aqueous and non-aqueous sterile suspensions which
may include suspending agents and thickening agents.
[0247] A still further aspect of the invention provides the use of
a compound of the invention in the manufacture of a medicament for
the treatment and/or diagnosis of a human patient with or at risk
of cancer, preferably breast cancer.
[0248] A still further aspect of the invention comprises a method
of treating cancer (preferably breast cancer) the method comprising
administering to the human patient an effective amount of a
compound of the invention wherein the further moiety of the
compound is one which either directly or indirectly is of
therapeutic benefit to the patient.
[0249] A still further aspect of the invention comprises a method
of imaging cancer, preferably breast cancer, (which may be useful
in determining the susceptibility of a human patient to cancer, or
of diagnosing cancer in a human patient, or of predicting the
relative prospects of a particular outcome of a cancer) in a human
patient, comprising administering to the patient an effective
amount of a compound of the invention wherein the further moiety of
the compound is one which comprises a readily detectable
moiety.
[0250] A still further aspect of the invention provides the use of
a compound comprising a moiety which selectively binds a
voltage-gated Na.sup.+ channel protein, preferably SCN5A or SCN9A,
most preferably SCN5A, and a further moiety (as defined above) in
the manufacture of a medicament for the treatment and/or diagnosis
of a human patient with or at risk of breast cancer.
[0251] A still further aspect of the invention comprises a method
of treating breast cancer, the method comprising administering to
the human patient an effective amount of a compound comprising a
moiety which selectively binds a voltage-gated Na.sup.+ channel
protein, preferably SCN5A or SCN9A, most preferably SCN5A, and a
further moiety (as defined above) wherein the further moiety of the
compound is one which either directly or indirectly is of
therapeutic benefit to the patient.
[0252] A still further aspect of the invention comprises a method
of imaging breast cancer in a human patient, comprising
administering to the patient an effective amount of a compound
comprising a moiety which selectively binds a voltage-gated
Na.sup.+ channel protein, preferably SCN5A or SCN9A, most
preferably SCN5A, and a further moiety (as defined above) wherein
the further moiety of the compound is one which comprises a readily
detectable moiety.
[0253] It will readily be appreciated that, depending on the
particular compound used in treatment, imaging or diagnosis, the
timing of administration may vary and the number of other
components used in therapeutic systems disclosed herein may
vary.
[0254] For example, in the case where the compound (for example
compound of the invention) comprises a readily detectable moiety or
a directly cytotoxic moiety, it may be that only the compound, in a
suitable formulation, is administered to the patient. Of course,
other agents such as immunosuppressive agents and the like may be
administered.
[0255] In respect of compounds which are detectably labelled,
imaging takes place once the compound has localised at the target
site.
[0256] However, if the compound is one which requires a further
component in order to be useful for treatment, imaging or
diagnosis, the compound of the invention may be administered and
allowed to localise at the target site, and then the further
component administered at a suitable time thereafter.
[0257] For example, in respect of the ADEPT and ADEPT-like systems
above, the binding moiety-enzyme moiety compound is administered
and localises to the target site. Once this is done, the prodrug is
administered.
[0258] Similarly, for example, in respect of the compounds wherein
the further moiety comprised in the compound is one which binds a
further component, the compound may be administered first and
allowed to localise at the target site, and subsequently the
further component is administered.
[0259] Thus, in one embodiment a biotin-labelled anti-SNC5A
antibody (for example) is administered to the patient and, after a
suitable period of time, detectably labelled streptavidin is
administered. Once the streptavidin has localised to the sites
where the antibody has localised (ie the target sites) imaging
takes place.
[0260] It is believed that the compounds of the invention wherein
the further moiety is a readily detectable moiety may be useful in
determining the metastatic state of cancer cells. This may be an
important factor influencing the nature and outcome of future
therapy.
[0261] A further aspect of the invention provides a kit of parts
(or a therapeutic system) comprising (1) a compound of the
invention wherein the further moiety is a cytotoxic moiety which is
able to convert a relatively non-toxic prodrug into a cytotoxic
drug and (2) a relatively non-toxic prodrug. The kit of parts may
comprise any of the compounds of the invention and appropriate
prodrugs as herein described.
[0262] A still further aspect of the invention provides a kit of
parts (or a therapeutic system) comprising (1) a compound of the
invention wherein the further moiety is able to bind selectively to
a directly or indirectly cytotoxic moiety or to a readily
detectable moiety and (2) any one of a directly or indirectly
cytotoxic moiety or a readily detectable moiety to which the
further moiety of the compound is able to bind.
[0263] For example, a kit of parts may contain an anti-SNC5A
antibody labelled with biotin and streptavidin labelled with a
readily detectable label as defined above.
[0264] The invention will now be described by reference to the
following, non-limiting Example and Figures.
[0265] FIG. 1. Voltage-gated membrane currents recorded in (A)
MDA-MB-231 cells and (B) MCF-7 cells (B). The currents were
generated by pulsing the membrane potential from a holding voltage
of -100 mV, in 10 mV steps, to +60 mV for 40 ms (A) and 200 ms (B),
respectively. Voltage pulses (indicated by the arrow-heads) were
applied with a repeat interval of 20 s. Only every second current
trace generated is displayed. (C) A typical current-voltage (I-V)
relationship generated in MDA-MB-231 cells by pulsing the membrane
potential from a holding voltage of -100 mV to test potentials
between -70 to +70 mV in 5 mV increments. Voltage pulses were
applied with a repeat interval of 20 s.
[0266] FIG. 2. Suppression of the inward current in MDA-MB-231
cells by tetrodotoxin (TTX). (A) A typical recording showing the
effect of 1 .mu.M TTX; the suppression effect, which was partial,
was fully reversible. The currents were generated by pulsing the
membrane potential from a holding voltage of -mV to -10 mV for 40
ms. Voltage pulses (indicated by the arrow-head) were applied with
a repeat interval of 20 s. The effect of TTX shown resulted from
the fourth pulse following drug application. (B) TTX dose-response
curve for MDA-MB-231 cells. Cells were depolarised from -100 mV to
-10 mV for 40 ms with a repeat interval of 20 s. The percentage
reduction of the peak current at the fourth pulse following TTX
application, was plotted as a function of drug concentration. Each
point represents the mean of >5 different cells; error bars
denote standard errors. Dotted line denotes 0% reduction.
[0267] FIG. 3. SQT-PCR electrophoresis results for scn5a (A), scn8a
(B), scn9a (C) and hCytb5R (D). Representative PCR cycle numbers
for given bands are indicated above the gels. In each panel, the
top image was derived from MDA-MB-231 cell extracts; the bottom
image, from MCF-7 extracts, as indicated in (A).
[0268] FIG. 4. Electrophoresis results of scn5a (C), scn8a (D),
scn9a (E) and hCytb5R (F) RT-PCRs performed on breast cancer tissue
samples. Sample numbers and associated evident lymph node
metastasis (LNM) are indicated above the gel images (A and B).
Multiple bands corresponding to the evident splice form products
(previously described in reference [21]) are shown to the left.
PCRs were performed for 55, 40, 40 and 30 cycles for scn5a, scn8a,
scn9a and hCytb5R tests, respectively, except for samples 5 (scn8a
and scn9a, 50 cycles each) and 6 (hCytb5R,40 cycles). (+) indicates
evident LNM, (-) indicates that LNM was not clinically evident.
NT=not tested.
[0269] FIG. 5. Proposed relative (%) expression levels of the three
VGSC.alpha.s found to occur in the strongly (white bars) and weakly
(black bars) metastatic cell lines. In each case, the vertical axis
denotes the approximate level of expression with respect to total
levels of expression of these three VGSC.alpha.s in the strongly
metastatic MDA-MB-231 cells. Relative expression levels were
estimated from degenerate screens and SQT-PCR data, taken
together.
EXAMPLE 1
Upregulation of Voltage-Gated Na.sup.+ Channel Expression and
Metastatic Potential in Human Breast Cancer
Correlative Studies on Cell Lines and Biopsy Tissues
[0270] Voltage-gated Na.sup.+ channel (VGSC) expression in human
breast cancer cell lines and breast cancer tissues was studied by
electrophysiological and reverse-transcription polymerase chain
reaction (RT-PCR) methods in a correlative approach. Whole-cell
patch-clamp recordings revealed depolarisation-activated Na.sup.+
currents in 29% of the strongly metastatic MDA-MB-231 cell line,
but never in the weakly metastatic MCF-7 cells. These currents were
largely tetrodotoxin (TTX)-resistant. The expression of three VGSC
a subunit (VGSC.alpha.) genes, SCN5A, SCN8A and SCN9A was
determined in both cell lines. Two of these genes (SCN5A and SCN9A)
were found to be more highly expressed in the MDA-MB-231 cells,
with semi-quantitative RT-PCRs indicating the relative levels of
expression as: scn5a>>scn9a>scn8a. The predominant
increase in the expression of scn5a (.about.1800-fold), also termed
h1 or SkM2, which indeed yields TTX-resistant VGSCs, was largely
responsible for the greater level of VGSC.alpha. expression in the
strongly metastatic cells. RT-PCRs performed on breast cancer
tissues in a double-blind test showed a strong correlation between
the detection of SCN5A gene products and clinically assessed lymph
node metastasis. Thus, all biopsies with evident lymph node
metastases expressed scn5a; the reverse situation was also mainly
true. We conclude that VGSC upregulation occurs as an integral part
of the metastatic process in breast cancer, as in prostate cancer,
and could serve as a novel marker of the metastatic phenotype.
Background
[0271] Breast cancer is the third most common cancer world wide and
the most common cancer of women, affecting 1 in 8 in the western
world (1,2). In the USA, breast cancer is the second leading cause
of female cancer mortality accounting for about 10% of all cancer
deaths (3). In breast cancer, as in other cancers, metastasis is
the main cause of death in most patients. To date, several breast
cancer metastasis-associated genes have been identified (for
review, see reference 2). However, indirect measures of metastatic
progression, including assessment of intratumoral vascular
invasion, presence or absence of lymph node involvement and size of
the primary carcinoma remain the most widely used methods for the
assessment of breast cancer progression. Electro-diagnosis has also
been practised, although its cellular/molecular basis remains
unknown (4).
[0272] We have shown previously that the functional expression of a
voltage-gated Na.sup.+ channel (VGSC) can distinguish strongly and
weakly metastatic human and rat prostatic cancer cells (5,6) and
that VGSC activity contributes to cellular behaviours integral to
metastasis, including cellular process extension (7), lateral
motility (8), transverse invasion (5,6,9) and secretory membrane
activity (10). Carcinomas of the breast and prostate have some
similar features, including hormone-sensitivity, a pronounced
tropism for metastasis to bone and tendency for co-occurrence in
families (11).
[0273] Voltage-gated Na.sup.+ channels (VGSCs).sup.1 are composed
of a large (.apprxeq.240 kD), four-transmembrane domain
.alpha.-subunit (VGSC.alpha.) and several different auxillary
.beta.-subunits (VGSC.beta.s) (Catterall, W. A. (1986) Ann. Rev.
Biochem. 55, 953-985). Expression of the VGSC.alpha. alone is
sufficient for functional channel formation (Goldin, A. L et al
(1986). Proc. Natl. Acad. Sci. USA 83, 7503-7507). The VGSC.beta.s)
serve a number of supporting roles such as facilitating functional
channel availability (Isom, L. L., et al (1995) Cell 83, 433-442),
modulating channel kinetics (Isom, L. L., et al (1992) Science 256,
839-842, Cannon, S. C., et al (1993) Pflugers Arch. 423, 155-157)
and perhaps even altering pharmacological characteristics (Bonhaus,
D. W., et al (1996) Neuropharmacol. 35, 605-613) (see also
(15)).
[0274] VGSC.alpha.s constitute a family of at least twelve
different genes in higher vertebrates (Plummer, N. W. and Meisler,
M. H. (1998) Genomics 57, 323-331; 17), denoted SCN1A to SCN11A;
their products have been cloned from a variety of excitable cell
types. Their specific expressions are under dynamic,
spatio-temporal control. At least two subfamilies of VGSC.alpha.
genes have been described based on sequence data: Na.sub.v1 and
Na.sub.v2 (George, A. L., et al (1992) Proc. Natl. Acad. Sci. USA
89, 4893-4897). Although not yet experimentally determined, it is
generally held that these subfamilies represent VGSC.alpha.s with
markedly different electro-physiological properties (Akopian, A.
N., et al (1997) FEBS Letts. 400, 183-187). In fact the lack of
conservation of landmark VGSC.alpha. sequences in Na.sub.v.sup.2
VGSC.alpha.s implies that they may not even be voltage-gated or
Na.sup.+ selective (Akopian, A. N., et al (1997) FEBS Letts. 400,
183-187, Schlief, T., et al (1996) Eur. Biophys. J. 25, 75-91). The
existence of a third subfamily, Na.sub.v3, has recently been
proposed with the cloning of a cDNA (NaN/SNS2) from rat dorsal root
ganglion (DRG) cells. Although NaN/SNS2 shares less than 50%
sequence homology with other VGSC.alpha.s, its deduced amino acid
sequence possesses all the characteristic sequences of Na.sub.v1
VGSC.alpha.s (Dib-Hajj, S. D, et al (1998) Proc. Natl. Acad. Sci.
USA 95, 8963-8968).
[0275] By utilizing RT-PCR and in situ hybridization methods,
several studies have documented the simultaneous expression of
multiple VGSC.alpha.s within diverse cell types (Black, J. A., et
al (1994) Mol. Brain. Res. 23, 235-245; Dib-Hajj, S. D., et al
(1996) FEBS Letts. 384, 78-82; Fjell, J., et al (1999) Mol. Brain
Res. 67, 267-282). Particular VGSC.alpha.s have been found to be
expressed at different levels, with expression under dynamic
control (e.g. during development or injury). For example, mRNAs for
at least eight different VGSC.alpha.s were found in adult rat DRG
cells, with a wide range of expression levels: RB1, Na6, NaN/SNS2
and SCL-11 mRNAs were expressed at very high levels, PN1 and
SNS/PN3 at intermediate levels, and RB2 and RB3 at very low levels
(Dib-Hajj, S. D, et al (1998) Proc. Natl. Acad. Sci. USA 95,
8963-8968; Black, J. A., et al (1996) Molec. Brain Res. 43,
117-131; Sangameswaren, L., et al (1997) J. Biol. Chem. 272,
14805-14809). Following axonal injury SNS and NaN/SNS2 mRNAs were
dramatically down-regulated, whilst expression of RB1, RB2 and RB3
was up-regulated (Dib-Hajj, S., et al (1996) Proc. Natl. Acad. Sci.
USA 93, 14950-14954; Dib-Hajj, S. D., et al (1998) J.
Neurophysiology 79, 2668-2676).
[0276] VGSC.alpha. genes can occur as a number of alternatively
spliced isoforms, expression of which is also under dynamic
control. Alternative splicing of exons coding for the third segment
(S3) of the first transmembrane domain (D1) has been found to be
developmentally regulated for SCN2A and SCN3A (19, 20), yielding
"neonatal" and "adult" forms. These code for proteins which differ
by only one amino acid, positioned at the extreme extracellular end
of S3. The effect of this change on VGSC.alpha. function is
presently unclear. Similar alternatively spliced exons exist at the
corresponding position in SCN8A and SCN9A (Belcher, S. M et al
(1995) Proc. Natl. Acad. Sci. USA 92, 11034-11038; Plummer, N. W.,
et al (1998) Genomics 54, 287-296) but not in SCN4A, SCN5A, SCN10A
and SCN11A (George, A. L., et al (1993) Genomics 15, 598-606; Wang,
D. W., et al (1996) Biophys. J. 70, 238-245; Souslova, V. A., et al
(1997) Genomics 41, 201-209; Dib-Hajj, S. D., et al (1999) Genomics
59, 309-318). To date, no evidence of such alternative splicing has
been found for SCN1A or SCN7A. Alternative splicing also occurs in
other regions of the VGSC.alpha., particularly inter-domain (ID)
1-2 and D3.
[0277] The strict regulation of multiple VGSC.alpha. gene and
splice product expression within the available VGSC.alpha. mRNA
pool, among different tissue types and during development or
following injury (e.g. Dib-Hajj, S., et al (1996) Proc. Natl. Acad.
Sci. USA 93, 14950-14954; Dib-Hajj, S. D., et al (1998) J.
Neurophysiology 79, 2668-2676; Kallen, R. G., et al (1990) Neuron
4, 233-242) would suggest that different VGSC.alpha. gene products
and their isoforms are likely to have significantly different
functional roles, which, at present, are largely unknown.
[0278] The functional roles of VGSCs are best understood in the
central nervous system where VGSC activity controls not only basic
impulse generation and conduction but also directional and
patterned growth, including target-specific axonal migration and
regional synaptic connectivity (Catalano, S. M. and Shatz, C. J.
(1998) Science 281, 559-562; Penn, A. A., et al (1998) Science 279,
2108-2112; Shatz, C. J. (1990) Neuron 5, 745-756). VGSCs have also
been implicated in several hereditary diseases of excitable tissues
(Plummer, N. W. and Meisler, M. H. (1998) Genomics 57, 323-331;
Zhou, J. and Hoffman, E. P. (1994) J. Biol. Chem. 269,
18563-18571), and in more complicated pathological disorders,
including chronic pain syndromes (Tanaka, M., et al (1998)
NeuroReport 9, 967-972), epilepsy (Bartolomei, F., et al (1997) J.
Neurocytol. 26, 667-678), ischaemic stroke (Skaper, S. D., et al
(1998) FASEB J. 12, 725-731) and Alzheimer's disease (Kanazirska,
M., et al (1997) Biochem. Biophys. Res. Comm. 232, 84-87). There is
increasing evidence that VGSC expression is also associated with
strong metastatic potential in rat (MAT-LyLu) and human (PC-3)
models of prostate cancer (Grimes, J. A., et al (1995) FEBS Letts.
369, 290-294; Laniado, M., et al (1997) Am. J. Pathol. 150,
1213-1221; Smith, P., et al (1998) FEBS Letts 423, 19-24). Indeed,
expression of functional VGSCs may have a direct, positive
influence upon the metastatic process. Accordingly, blockage of VGS
currents in these strongly metastatic cell lines, by application of
tetrodotoxin (TTX), significantly (.about.30%) reduced the cells'
invasive potential. Electro-physiological and pharmacological
properties of the current in the rat were consistent with the
channels being neuronal, TTX-sensitive (Na.sub.v1) type (Grimes, J.
A. and Djamgoz, M. B. A. (1998) J. Cell. Physiol. 175, 50-58).
SCN4A gene expression was found in both strongly and weakly
metastatic cell lines of human and rat (Diss, J. K. J., et al
(1998) FEBS Letts 427, 5-10). However, the pharmacological
properties of the VGS currents in the rat MAT-LyLu cells were not
consistent with those reported for this VGSC.alpha.. This could
result from (1) the numerous differences determined in the
MAT-LyLu/AT-2 rSkM1 primary sequence; (2) differences in
post-translational mechanisms (eg association with auxiliary
subunits, level of glycosylation/phosphorylation of the channel) in
these cells; or (3) the presence of other VGSCIs in the MAT-LyLu
cells that produce the recorded VGS currents.
[0279] The present study aimed to determine (i) whether mRNA and
functional protein expression of VGSCs differed between strongly
and weakly metastatic breast cancer cells; (ii) which member(s) of
the VGSC.alpha. family was responsible for the voltage-gated
Na.sup.+ (VGS) currents detected; and (iii) whether the VGSC.alpha.
expression pattern found in in vitro models would also be reflected
in human breast cancer biopsy tissues. These aspects were studied
using electrophysiological and reverse-transcription polymerase
chain reaction (RT-PCR) based techniques. Initially, two robust
breast cancer cell lines of contrasting metastatic aggressiveness
were adopted: the strongly metastatic MDA-MB-231 cells and the
weakly metastatic MCF-7 cells (18,19). The mRNA(s) responsible for
the functional VGSC .alpha.-subunit expression was determined.
Finally, VGSC mRNA expression was also investigated in frozen
biopsy tissues of different clinical grade to test whether
VGSC.alpha. occurrence could also be correlated with cancer
progression in vivo.
Materials and Methods
[0280] Cell culture. MDA-MB-231 and MCF-7 cells were grown and
maintained in Dulbecco's modified Eagle's medium (Life Technologies
Ltd, Paisley, UK) supplemented with 4 mM L-glutamine and 10% foetal
bovine serum. Cells were seeded into 100 mm Falcon tissue culture
dishes (Becton Dickinson Ltd, Plymouth, UK) and grown in an
incubator at 37.degree. C., 100% humidity and 5% CO.sub.2.
[0281] Electrophysiology. Patch pipettes (of normal resistances
between 5-15 M.OMEGA.) were filled with a solution containing (in
mM) NaCl 5, KCl 145, MgCl.sub.2 2, CaCl.sub.2 1, HEPES10 and EGTA
11, adjusted to pH 7.4 with 1 M KOH. Whole-cell membrane currents
were recorded from cells that appeared `isolated` in culture using
an Axopatch 200B (Axon Instruments) amplifier. Analogue signals
were filtered at 5 KHz using a low-pass Bessel filter. Signals were
sampled at 5 KHz and digitised using a Digidata (1200) interface.
Data acquisition and analysis of whole-cell currents were performed
using pClamp (Axon Instruments) software. Holding potentials of -90
mV or -100 mV were used to study K.sup.+ and Na.sup.+ currents,
respectively, unless stated otherwise. Resting potentials were
measured immediately following attainment of the `whole-cell`
recording configuration. Experiments on both MDA-MB-231 and MCF-7
cells were performed on three separate dishes which had been plated
for between 1-3 days.
[0282] Two basic command voltage protocols were used to study the
electrophysiological and pharmacological properties of the Na.sup.+
and K.sup.+ currents, as follows: [0283] 1. Current-voltage (I-V)
protocol. This protocol was used to study the voltage-dependence of
Na.sup.+ and K.sup.+ channel activation. Cells were pulsed to
depolarising test potentials between -70 and +60 mV, in 5 mV steps.
The test pulse duration was 40 ms (Na.sup.+ currents) or 200 ms
(K.sup.+ currents); the interpulse period was 20 s. [0284] 2.
Repeat single-pulse protocol. This was used to monitor the effects
of drugs on current amplitude. Test pulses were to -10 mV (Na.sup.+
currents) or +60 mV (K.sup.+ currents). The test pulse duration was
40 ms (Na.sup.+ currents) or 200 ms (K.sup.+ currents); the
interpulse duration was 20 s and there were 5 repeat pulses.
[0285] Pharmacology. Tetrodotoxin (TTX), purchased from Alomone
Labs Ltd (Jerusalem, Israel), was made as a stock solution
(.times.1000) in the external bath solution, frozen at -20.degree.
C., defrosted and diluted as required. Briefly, TTX was back-loaded
into a glass capillary (with a tip size of .about.5 .mu.m). The
glass capillary was then connected to a pneumatic picopump (PV 800,
WP Instruments), mounted on a microdrive (Lang-Electronik,
Huttenberg, Germany) and manoeuvred to within .about.10 .mu.m of
the cell under investigation.
[0286] The effect of TTX on the inward current (I) has been
presented as the percentage block of current (B) in comparison to
the control values, calculated as follows:
B(%)=[(I.sub.after-I.sub.before)/I.sub.before].times.100
[0287] VGSC.alpha. degenerate primer screens. Total cellular RNA
was isolated from two batches of each of the cell lines by the acid
guanidium thiocyanate-phenol-chloroform method (20) or as described
below. Briefly, cells were homogenized in a solution ("A"), using
an IKA homogeniser, such that 1 ml of solution was used per 0.1 g
of tissue. Solution A contained 4 M guanidinium thiocyanate, 25 mM
Na.sup.+ citrate (pH 7.0), 0.5% sarcosyl and 0.72% (v/v)
.beta.-mercaptoethanol. The following were then added and shaken
vigorously for 10 seconds: 2 M Na.sup.+ acetate, pH 4.0 (10% volume
of solution A), phenol (equal volume of solution A) and chloroform
(20% volume of solution A). Centrifugation was performed at
10,000.times.g for 20 mins at 4.degree. C. The supernatant was
taken and precipitated with isopropanol. Then, the samples were
centrifuged as before and the pellet was resuspended in about 30%
of the initial volume of solution A. A second isopropanol
precipitate was performed, the pellet was washed with 75% ethanol,
and resuspended in sterile distilled water.
[0288] Screens were then performed on each of the four extracts, as
described previously (21 and GB 0021617.6, supra), using
VGSC.alpha. degenerate PCR primers, YJ1 and YJ2C (Table 1A).
[0289] Twenty five clones with "inserts" were selected by gel
electrophoresis for each of the RNA extracts. A subset of the
twenty five clones with inserts, derived from each cell line, were
then sequenced using the Amersham Thermo Sequenase fluorescent
cycle sequencing kit and the Vistra DNA 725 automated sequencer.
Sequences were identified by searching the GenBank DNA database
using BLAST 2.0.8 (22). Oligonucleotide primers specific for scn5a
and scn9a VGSC.alpha.s, identified by the sequencing, were
subsequently designed (Table 1A). These worked in conjunction with
the Universal vector primers and permitted rapid PCR screening of
all other clones without the need for sequencing. PCRs using these
primers were initially tested on sequenced clones to confirm that
they yielded only specific products. Rapid screening PCR reactions
were then performed as in (21) and GB 0021617.6, supra. Products
were analysed by gel electrophoresis on 0.8% agarose gels.
Minipreps that did not test positive for these VGSC.alpha. types
were sequenced to determine identity.
TABLE-US-00002 TABLE 1 PCR primers used in (A) degenerate
VGSC.alpha. primer screening, (B) specific PCRs and (C) SQT-PCRs
(numbering according to GenBank). A. Degenerate VGSC.alpha. Primer
Screening YJ1:- (SEQ ID NO 7) 5'
GCGAAGCTT(C/T)TGG(C/T)TIATITT(C/T)I(A/C/G/T)IAT (A/T/C)ATGGG 3'
YJ2C:- (SEQ ID NO 8) 5'
ATAGGATCCAICCI(A/C/G/T)I(A/G)AAIGC(A/C/G/T)AC (C/T)TG 3'
(40.degree. C.) Scn5a-P1:- (SEQ ID NO 9) 5' TACAATTCTCCGGTCAAGTT 3'
(4312-4331; 56.degree. C.) Scn9a-P1:- (SEQ ID NO 10) 5'
ATGTTAGTCAAAATGTGCGA 3' (4139-4158; 54.degree. C.) B. Specific PCR
Tests Scn5a-P2:- (SEQ ID NO 11) 5' CATCCTCACCAACTGCGTGT 3'
(570-589) Scn5a-P3:- (SEQ ID NO 12) 5' CACTGAGGTAAAGGTCCAGG 3'
(1059-1078; 58.degree. C.) Scn8a-P1:- (SEQ ID NO 13) 5'
AGACCATCCGCACCATCCTG 3' (3855-3874) Scn8a-P2:- (SEQ ID NO 14) 5'
TGTCAAAGTTGATCTTCACG 3' (4351-4370; 60.degree. C.) Scn9a-P2:- (SEQ
ID NO 15) 5' TATGACCATGAATAACCCGC 3' (474-493) Scn9a-P3:- (SEQ ID
NO 16) 5' TCAGGTTTCCCATGAACAGC 3' (843-862; 59.degree. C.)
hCytb5R-P1:- (SEQ ID NO 17) 5' TATACACCCATCTCCAGCGA 3' (299-318)
hCytb5R-P2:- (SEQ ID NO 18) 5' CATCTCCTCATTCACGAAGC 3' (771-790;
60.degree. C.) C. SQT-PCRs Scn5a-P4:- (SEQ ID NO 19) 5'
CTGCTGGTCTTCTTGCTTGT 3' (2896-2915) Scn5a-P5:- (SEQ ID NO 20) 5'
GCTGTTCTCCTCATCCTCTT 3' (3329-3348; 60.degree. C.) Scn8a-P3:- (SEQ
ID NO 21) 5' AACCCTATTCCGAGTCATCC 3' (3827-3846) Scn8a-P4:- (SEQ ID
NO 22) 5' TGCACTTTCCTCTGTGGCTA 3(4325-4344; 60.degree. C.)
Scn9a-P4:- (SEQ ID NO 23) 5' AAGGAAGACAAAGGGAAAGA 3' (5941-5960)
Scn9a-P5:- (SEQ ID NO 24) 5' TCCTGTGAAAAGATGACAAG 3' (6289-6308;
56.degree. C.) VGSC.alpha.-specific PCR tests. These were
performed, as in (21) and GB 0021617.6 in order to ensure that the
VGSCas found in the degenerate primer screens were truiy expressed
in the respective cell lines (and not produced from contaminating
genomic DNA). Primer annealing positions are indicated in
parentheses.
[0290] Briefly, DNA was removed from the extracts by digestion with
DNase I and 5 .mu.g of the total RNA was used as the template for
single-stranded cDNA (sscDNA) synthesis (Superscript II, GIBCO
BRL). sscDNA synthesis was primed with a random hexamer mix (R6) in
a final volume of 20 .mu.l. VGSC.alpha. cDNA was then amplified
from the R6-sscDNA pool by PCR (Taq DNA polymerase, Amersham
Pharmacia) using degenerate PCR primers (YJ1 and YJ2C) used
previously to amplify both Na.sub.v1 and Na.sub.v2 VGSC.alpha.s
from adult rat retinal pigment epithelial cells (Dawes, H., et al
(1995) Vis. Neurosci. 12, 1001-1005), and novel VGSC.alpha.s from a
protochordate ascidian (Okamura, Y., et al (1994) Neuron 13,
937-948). PCR reactions were performed on 4 .mu.l of the R6-sscDNA
template, using 200 .mu.M of each dNTP, 1 unit of Taq, 1.times.Taq
buffer and 1 .mu.M of each primer, in a final volume of 20 .mu.l.
Amplification was via: (i) initial denaturation at 94.degree. C.
for 5 min; (ii) addition of 1 U enzyme; (iii) 33-35 cycles of
denaturation at 94.degree. C. for 1 min, annealing at 40.degree. C.
for 1 min, and elongation at 72.degree. C. for 1 min; and (iv)
elongation at 72.degree. C. for 10 min. For this and all PCRs
performed, reactions with no sscDNA added were also carried out to
control for cross-contamination from other DNA sources.
[0291] PCR products were analysed by electrophoresis and gel
purified prior to ligation into the pGEM-T vector (pGEM-T Easy
Vector System, Promega). These were then used to transform E. Coli
(pMosBlue, Amersham). Plasmid DNA was recovered from bacterial
cultures using a modified version of the Vistra Labstation 625
miniprep procedure (Vistra DNA Systems, Amersham).
[0292] Reactions designed to amplify specific VGSC.alpha.s were
performed on both strongly and weakly metastatic cell line
extracts, irrespective of whether these subunits had previously
been found in degenerate screens. The primer sequences and reaction
annealing temperatures used are shown in Table 1B. Evident products
were cloned and sequenced, and a consensus sequence for each
VGSC.alpha. in each cell line then produced (using at least three
clones).
[0293] Semi-quantitative PCR (SQT-PCR). SQT-PCRs based on kinetic
observation of reactions were performed similarly to (21) and GB
0021617.6.
[0294] DNased RNA extracts were used to produce sets of R6-sscDNAs
for each extract. 2.4 .mu.l of these R6-sscDNAs was used as the
template for VGSC.alpha.-specific PCRs (performed as above), in a
final volume of 60 .mu.l. To allow direct comparison of results
obtained from strongly and weakly metastatic cell lines, all
comparable R6-sscDNA and PCR reactions were performed
simultaneously. `Blanks`, with no template added, were used as
controls. PCRs were performed using different 20-mer primers for
each of the three VGSC.alpha.s which did not amplify multiple
VGSC.alpha. products derived from different splice variants (unlike
the specific PCRs above). The primers and annealing temperatures of
the PCRs used are shown in Table 1C. scn8a and scn9a VGSC.alpha.
products did not span conserved intron sites so control PCR
reactions were performed for these SQT-PCRs in which the sscDNA
template was replaced by an aliquot from a reverse transcription
reaction which had no reverse transcriptase added. All products
were cloned and sequenced, as above, to ensure that only
VGSC.alpha.-specific products were amplified.
[0295] A kinetic observation approach (45; Hoof et al (1991) Anal.
Biochem. 196, 161-169; Wiesner et al (1992) Biochem. Biophys. Res.
Comm. 183, 553-559) was adopted such that an aliquot of 5 .mu.l
from the 60 .mu.l reaction was taken at the end of each
amplification cycle, for eleven cycles, while reactions were held
at 72.degree. C. The amplification cycle at which aliquots were
first taken differed depending on the VGSC.alpha. studied. These
aliquots were then electrophoresed (0.8% agarose gels) with DNA
markers of known concentration. Gels were post-stained for 15
minutes (TBE buffer containing 0.8 .mu.g/ml ethidium bromide), and
digitally imaged (GDS 7500 Advanced Gel Documentation System,
Ultra-Violet Products). Total is product mass (nanograms) in each
aliquot was determined by image analysis (1D Image Analysis
Software, Kodak Digital Science). Two characteristic stages in each
PCR reaction were quantified: [0296] (1) Threshold PCR cycle number
(CN.sub.t) at which a given PCR product could just be detected by
the image analysis software (default settings). [0297] (2) PCR
cycle number at which the exponential phase of the reaction
finished (CN.sub.e).
[0298] Accumulation of reaction product with increasing PCR cycle
number follows a sigmoid curve (Kohler, T. (1995). Quantitation of
mRNA by Polymerase Chain Reaction, pp 3-14, eds. Kohler, T.,
Lassner, D., Rost, A.-K., Thamm, B., Pustowoit, B. and Remke, H.
(Springer, Heidelberg)).
[0299] However, the two extremes of this curve were unknown or
undetermined for the SQT-PCR data (i.e. the initial mass of cDNA at
zero cycles was unknown, and the final product mass at the end of
the PCR undetermined). Thus, a sigmoid curve could not be fitted to
the data. Instead a third-order polynomial equation, which also has
only one possible point of inflexion (here corresponding to the end
of the exponential phase of the PCR), was used to approximate a
sigmoid curve. Curve-fitting was performed using STATISTICA
(SoftStat Inc.), and the second derivative then calculated, to give
CN.sub.e. This procedure could be performed successfully, with the
calculated values of CN.sub.e falling within the data points
obtained experimentally (FIG. 1). Data are presented as means and
standard errors for each cell line (three repeats on two extracts
for each VGSC.alpha.). The values of CN.sub.t and CN.sub.e were
used directly to compare the levels of expression of each
VGSC.alpha. in the strongly and weakly metastatic cell lines.
[0300] Mean CNt values were calculated for each of the VGSC.alpha.s
present in MDA-MB-231 and MCF-7 cell extracts using the results of
SQT-PCRs on both cell batches (except for scn9a, amplified from
only one of the two MCF-7 cell line batches, and scn5a, which was
apparently expressed too lowly in one MCF-7 batch for CNe to be
calculated). Assuming that the PCR reactions performed on strongly
and weakly metastatic cell RNA extracts had similar efficiencies,
differences in the calculated CNt and CNe values would reflect real
differences in expression levels.
[0301] NADH-cytochrome b5 reductase (Cytb.sub.5R), which is
expressed at very similar levels in normal, cancerous and strongly
metastatic cells derived from numerous tissue types (20;
Fitzsimmons, S. A., et al (1996) J. Natl. Cancer Inst. 88, 259-269;
Marin, A., et al (1997) Br. J. Cancer 76, 923-929), was present in
both rat and human degenerate primer screens as a major constituent
of the non-specific products found (the "non-VGSC.alpha." clones).
Consequently, this was used as a control amplicon in SQT-PCRs, ie
to control for the effects of variations in quality and quantity of
the initial RNA, efficiency of the reverse-transcription and
amplification between samples (primers are shown in Table 1B).
Cytb.sub.5R 20-mer primers amplified nucleotides 385-809 and
299-790 of rat and human homologues, respectively (annealing
temperature, 60.degree. C. for both).
[0302] PCR tests on breast biopsy tissue. 0.1-0.5 g pieces of
frozen tissue were chopped into small pieces using a sterile
scalpel and forceps and placed in a cold, glass homogenizer. Total
cellular RNA was then isolated as described above. RNA quality was
preliminarily assessed by gel electrophoresis and quantity
determined by spectrophotometric analysis.
[0303] RNA extracts were then used as the template for sscDNA
synthesis, performed as above. The possible expression of scn5a,
scn8a and scn9a RNAs in the biopsy samples was tested by PCR, using
the same primers as for the specific PCRs (Table 1B). hCytb5R
specific PCR tests were also carried out to further control for the
quality of the extracted RNA; samples which did not yield evident
hCytb5R products were rejected. PCRs were performed, using 2.5 g of
the synthesised sscDNA, 0.2 millimolar dNTPs, 1 micomolar of each
specific primer and 1 unit of Taq, under the following conditions:
94.degree. C. for 5 min; 1 U enzyme added; 94.degree. C. for 1 min;
59-62.degree. C. for 1 min (depending on the primer pair);
72.degree. C. 1 min; final incubation at 72.degree. C. for 10 min
with the main section repeated 30-60 times (depending on the primer
pair). PCR reactions with no template added were also performed to
control for cross-contamination from other DNA sources. 5 .mu.l
aliquots of the final reaction were analysed by gel electrophoresis
on 0.8% agarose gels.
[0304] PCR tests were carried out on each of at least two cDNA
templates (except for sample 1, from which only 5 .mu.g of RNA was
obtained), manufactured independently from the same RNA extract,
thus controlling for possible variability in cDNA manufacture and
PCR efficiency.
[0305] Data analysis. All quantitative data were determined to be
normally distributed and are presented in the text as
means.+-.standard errors. Statistical significance was determined
with Student's t test or .chi..sup.2 test, as appropriate.
[0306] GenBank sequence nucleotide numbers. Nucleotide numbering
was according to accession numbers M77235, AB027567, X82835, Y09501
for scn5a, scn8a, scn9a and hCytb5R, respectively.
Results
[0307] Electrophysiological studies. The average resting potential
of MDA-MB-231 cells was -18.9.+-.2.1 mV (n=27; range -12 to -61 mV)
which was significantly more depolarised than the value of
-38.9.+-.2.5 mV (n=26; range -8 to -51 mV) for the MCF-7 cells
(p<0.001). The membrane capacitance of the MDA-MB-231 cells was
28.5.+-.2.7 pF (n=35; range 14.7 to 76.6 pF) which was
significantly smaller than the value of 36.9.+-.2.8 pF (n=38; range
13.5 to 90.0 pF) for the MCF-7 cells (p<0.05).
[0308] 29% of the MDA-MB-231 cells tested (n=16/56) expressed an
inward current of up to 600 pA in amplitude (FIG. 1A), which
corresponded to a current density of 5.6.+-.0.5 pA/pF (n=16). The
inward currents activated at -41.3.+-.2.4 mV (n=4), peaked at -6.3
2.4 mV (n=4; FIG. 1C) and were abolished in Na.sup.+-free medium
(not shown; n=2), consistent with them being VGS currents. In
contrast, none of the MCF-7 cells tested (n=72) showed an inward
current (FIG. 1B).
[0309] The VGS current was suppressed partially by micromolar TTX
(FIG. 2A). The effect of the toxin was concentration dependent in
the range 100 nM-6 .mu.M (FIG. 2B). However, even at the highest
concentration used (6 .mu.M), only 64.7.+-.6.1% of the current was
blocked by TTX (n=5). There was a small (9.+-.3%) reduction in peak
current with 100 nM TTX, which was significant (p<0.05),
indicating that a minor, TTX-sensitive (TTX-S) component was also
present (FIG. 2B).
[0310] Voltage-gated outward currents were also recorded. 100% of
the MCF-7 cells tested (n=72) expressed large outward currents of
up to 7 nA in amplitude (FIG. 1B), which corresponded to a current
density of 27.4.+-.4.9 pA/pF (n=33). These outward currents
activated at -9.2.+-.1.9 mV (n=12) and showed a peak amplitude of
1081.1.+-.264.7 pA at +90 mV (n=12). The current was reduced to
34.3.+-.5.4 pA (n=15; p<0.01), i.e. by 97%, by substituting
Cs.sup.+ for K.sup.+ in the internal pipette solution. In
comparison, MDA-MB-231 cells showed much smaller outward currents
of up to 150 pA (n=35; FIG. 1B), which corresponded to a current
density of only 2.6.+-.0.4 pA/pF (n=13; p<0.01 cf. comparable
currents recorded in the MCF-7 cells).
[0311] VGSC.alpha. mRNA expression in the cell lines. The results
of the degenerate-primer screens for the different cell line RNA
extracts are shown in Table 2.
[0312] Two VGSC.alpha.s were identified in the screens on the
strongly metastatic cell line: products of SCN5A and SCN9A
VGSC.alpha. genes. In contrast, scn8a was the only VGSC.alpha.
found in the degenerate screens of the weakly metastatic MCF-7
cells. It has previously been shown that for Nav1 VGSC.alpha.s, the
proportion of clones in degenerate primer screens representing each
VGSC.alpha.C type reflects the actual proportion of that subunit
within the cellular VGSC.alpha. mRNA pool (21). Thus, in the
strongly metastatic cells, screen results indicated that scn5a
(56.0.+-.4.0%) was expressed at a much greater level than scn9a
(12.0.+-.4.0%) and scn8a (0%) (Table 2).
TABLE-US-00003 TABLE 2 Summary of the VGCS.alpha. degenerate primer
screen results. Results are shown as percentage of clones tested (n
= 25 in each case). Each screen is the result of two extracts from
each cell line. Errors indicate standard errors. VGSC.alpha.
MDA-MB-231 MCF-7 Scn5a 56.0 .+-. 4.0 0 Scn8a 0 2.0 .+-. 2.0 Scn9a
12.0 .+-. 4.0 0 Non-VGSC.alpha. 32.0 .+-. 0 98.0 .+-. 2.0
[0313] Primer-specific PCRs yielded products for scn5a, scn8a and
scn9a (as well as for hCytb5R) in both cell lines, indicating that
all of these mRNAs were expressed in both MDA-MB-231 and MCF-7
cells. However, scn5a and scn9a required markedly less
amplification (CNt) to yield detectable products and reach CNe in
SQT-PCRs on MDA-MB-231 vs. MCF-7 cell extracts, indicating an
overall greater level of expression in the strongly metastatic
cells (FIGS. 3A and 3C). Importantly, the most striking, consistent
difference was seen for SCN5A: CNt=24.75.+-.0.48 vs. 37.50.+-.1.56;
CNe=28.36.+-.0.46 vs. 38.54.+-.0.14, for MDA-MB-231s vs. MCF-7
cells, respectively (FIG. 3A). Assuming an 80% PCR efficiency (21),
this would indicate .about.1800-fold difference in expression
levels between the two cell lines.
[0314] Scn9a was more readily amplified in the strongly metastatic
(CNt=30.75.+-.0.63; CNe=34.44.+-.0.65) than the weakly metastatic
cells (CNt=42.5.+-.4.5; CNe=46.0.+-.3.2), but this TTX-S
VGSC.alpha. was not as prominent as scn5a in degenerate screens,
indicating a lower level of expression. In contrast, hCytb5R
`control` and scn8a SQT-PCRs showed very similar levels of
expression in both MDA-MB-231 and MCF-7 cells (FIGS. 3B and 3D):
CNt=20.25.+-.0.25 vs. 22.0.+-.0.56, CNe=23.96.+-.1.00 vs.
25.16.+-.0.34, for hCytb5R; CNt=33.25.+-.0.25 vs. 32.75.+-.0.63,
CNe=36.85.+-.0.32 vs. 35.61.+-.0.49, for scn8a. Importantly,
hCytb5R was the major constituent of the `non-VGSC.alpha.` clones
found in the degenerate screens, representing almost all of the
non-VGSC.alpha. clones (equivalent to 28.0.+-.0% of all clones) in
the MDA-MB-231 cells and 54.0.+-.6.0% of all the clones in the
MCF-7 cell line screen. The increased incidence of this
non-VGSC.alpha. clone in the degenerate screens of the MCF-7 cells
is consistent with a lower VGSC.alpha. target to noise ratio in
these cells compared to their strongly metastatic counterpart, also
evident from the SQT-PCR data.
[0315] The MDA-MB-231/MCF-7 VGSC.alpha. sequences obtained have
been submitted to GenBank.
[0316] VGSC.alpha. mRNA expression in breast biopsy tissue. RNA was
extracted successfully, with positive hCytb5R tests obtained, from
12 samples. Generally, PCR results of the VGSC.alpha. and hCytb5R
control tests were readily repeatable across different synthesised
cDNA batches. The results obtained are summarised in Table 3. All
three VGSC.alpha. genes found to be expressed in the cell lines
were detected in the biopsy samples, confirming the conservation in
vivo of the VGSC.alpha. expression profile of the in vitro models.
Several SCN8A and SCN9A products (corresponding to different splice
forms of these genes; (21)) were amplified from all samples (FIGS.
4 D and E), as was the hCytb5R control (FIG. 4F), except in sample
6. It is likely that the RNA extracted from this sample was
significantly more degraded than the other samples, as evidenced by
the greater number of PCR cycles required to amplify the hCytb5R
control product (40 not 30 cycles). There was, however, no evident
correlation between scn8a or scn9a expression and lymph node
metastasis (LNM). In contrast, expression of scn5a was strictly
sample-dependent (FIGS. 4A and B). All evident products of these
tests were cloned and sequenced, and it was verified that these
products were truly derived from SCN5A. Scn5a VGSC.alpha. sequences
obtained from these samples have been submitted to GenBank.
[0317] Accession numbers of submitted sequences are as follows:
Accession#: AJ310882
[0318] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.7 (SCN9A gene) cell line MDA-MB-231
Accession#: AJ310883
[0319] Description: Homo sapiens partial mRNA for Nav1.7
voltage-gated-sodium channel (SCN9A gene) cell line MCF-7
Accession#: AJ310884
[0320] Description: Homo sapiens mRNA for Nav1.6
voltage-gated-sodium (SCN8A gene) Nav1.6, D3 neonatal splice
variant, cell lines MDA-MB-231
Accession#: AJ310885
[0321] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.6 (SCN8A gene), D3 neonatal splice variant,
cell line MCF-7
Accession#: AJ310886
[0322] Description: Homo sapiens partial mRNA for voltage gated
sodium channel Nav1.5 (SCN5A gene), D1 neonatal splice variant,
cell line MDA-MB-231
Accession#: AJ310887
[0323] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.5 (SCN5A gene) D1 neonatal splice variant, cell
line MCF-7
Accession#: AJ310888
[0324] Description: Homo sapiens partial mRNA for voltage gated
sodium channel Nav1.5 (SCN5A gene), D1 neonatal splice variant,
biopsy sample 2
Accession#: AJ310889
[0325] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.5 (SCN5A gene), D1 neonatal splice variant,
biopsy sample 3
Accession#: AJ310890
[0326] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.5 (SCN5A gene) D1 adult splice variant, biopsy
sample 1
Accession#: AJ310891
[0327] Description: Homo sapiens partial mRNA for voltage gated
sodium channel Nav1.5 (SCN5A gene), D1 adult splice variant, biopsy
sample 7
Accession#: AJ310892
[0328] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.5 (SCN5A gene), biopsy sample 6
Accession#: AJ310893
[0329] Description: Homo sapiens partial mRNA for voltage gated
sodium channel Nav1.5 (SCN5A gene), D1:S3 exon-skipped splice
variant, biopsy sample 8
Accession#: AJ310894
[0330] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.5 (SCN5A gene), D1 neonatal splice variant,
biopsy sample 4
Accession#: AJ310895
[0331] Description: Homo sapiens partial mRNA for Nav1.5 (scn5a/h1)
voltage-gated sodiumchannel (SCN5A gene), D1 neonatal splice
variant, biopsy sample 5
Accession#: AJ310896
[0332] Description: Homo sapiens partial mRNA for voltage-gated
sodium Nav1.5 (SCN5A gene) (SCN5A gene), cell line MDA-MB-231
Accession#: AJ310897
[0333] Description: Homo sapiens partial mRNA for voltage-gated
sodium Nav1.7 (SCN9A gene) (SCN9A gene), cell line MDA-MB-231
Accession#: AJ310898
[0334] Description: Homo sapiens partial mRNA for voltage-gated
sodium channel Nav1.6 (SCN8A gene), cell line MCF-7
Accession#: AJ310899
[0335] Description: Homo sapiens partial mRNA for NADH-cytochrome
b5 reductase (B5R gene) cell line MDA-MB-231
Accession#: AJ310900
[0336] Description: Homo sapiens partial mRNA for NADH-cytochrome
b5 reductase (B5R gene) cell line MCF-7
[0337] Sequences have also been submitted for the following:
scn5a MDA-MB-231 SQT-PCR sequence scn5a MCF-7 SQT-PCR sequence
scn9a MDA-MB-231 SQT-PCR sequence (3UTR) scn9a MCF-7 SQT-PCR
sequence (3UTR)
[0338] Some specific points regarding the SEQUENCE data:
[0339] SCN5A--Three nucleotide differences from the published
sequence (GenBank M77235) in the sequence obtained outside the D1
neonatal exon: 689/690 (CT to GC) differences would substitute an
alanine for a glycine residue at amino acid position 180 (all
numbering according to M77235). All other voltage-gated sodium
channel alpha subunit genes have a glycine at this residue, and
thus it is most probable that the published sequence (M77235)
contains sequence errors at this location. 992 (T to C) difference
would not change the amino acid sequence and may represent a
natural, silent-polymorphism in the SCN5A gene.
[0340] SCN8A--No nucleotide differences from our previously
published sequences [SCN8A in prostate cancer cell lines] (GenBank
AJ276141 and AJ276142).
[0341] SCN9A--No nucleotide differences from the published sequence
(GenBank X82835).
[0342] The SCN5A D1 neonatal exon--this could be clinically
important. This is the first report of the existence of an apparent
alternative splice form of scn5a at this location. The SCN5A gene
structure has been investigated previously (Wang et al., 1996),
using scn5a cDNA sequences to probe a human genomic library but
alternative exons for D1 S3 were not found, presumably because the
hybridizing cDNAs were of the known adult rather than the neonatal
form. The scn5a neonatal form differs from the previously published
adult form (Gellens et al., 1992; GenBank M77235) at 31 of the 92
nucleotides in this conserved exon. These 31 nucleotide differences
in the neonatal SCN5A form result in 7 amino acid substitutions,
many more than observed for the other VGSC alpha subunit genes
studied thus far.
[0343] To date, alternative splicing of neonatal and adult exons
has been found in D1S3 in four other VGSC alpha genes: SCN2A,
SCN3A, SCN8A and SCN9A. In each of these instances the alternative
exons have 19-21 nucleotide differences, which result in 1-2 amino
acid substitutions. One amino acid substitution at residue seven of
this exon is consistent across all of these genes: the substitution
of an aspartate residue in the adult form to a neutral amino acid
in the neonatal form. Alternative splicing in scn5a was not
completely consistent with D1 S3 splicing previously described for
other
[0344] VGSC alphas in two main ways:
[0345] (1) In the scn5a neonatal form, the aspartate residue in the
adult form was not substituted for a non-charged amino acid, but a
positively charged lysine residue.
[0346] (2) The 31 nucleotide differences in the neonatal scn5a
result in 7 amino acid substitutions, many more than the 1-2 amino
acid substitutions observed for the other VGSC alpha genes with
alternative splicing at D1 S3, previously studied.
TABLE-US-00004 TABLE 3 Summary of results of specific RT-PCR tests
on breast cancer biopsy samples. Clinical Sample Grade hCytb5R
scn8a scn9a Scn5a LNM 1 2 + NT + + + (4/4) 2 3 + + + + + (3/7) 3 2
+ + + + + (3/7) 4 2 + + + + + (8/12) 5 ND + + + + + (8/13) 6 2 +(*)
- - + + (9/14) 7 1 + + + + - (0/22) 8 2 + + + + - (0/13) 9 2 + + +
- - (0/15) 10 3 + + + - - (0/10) 11 1 + + + - - (0/15) 12 3 + + + -
- (0/9) (+) indicates that a specific product was obtained; (-)
indicates that no specific product was amplified; NT that the test
was not performed; ND that the grade of the tumour was not
determined. PCR tests were performed for up to 55, 50 and 50 cycles
for scn5a, scn8a and scn9a, respectively. hCytb5R tests were
performed for 30 cycles except for sample 6, for which 40 cycles
were used (denoted by *). Clinically assessment lymph node
metastasis (LNM) and tumour grade are also shown for each case. For
LNM (+), the values in parentheses indicate the number of lymph
nodes which were determined as positive/number of nodes
examined.
[0347] A `double-blind` test associating scn5a expression with LNM
revealed that these two characteristics were directly correlated in
10 out of the 12 (83%) cases examined, giving combinations of
scn5a.sup.+/LNM.sup.+ (n=6) and scn5a.sup.-/LNM.sup.- (n=4)
(.chi..sup.2=6.0; df=1; 0.02>p>0.01; Table 3). One of the two
exceptions where the sample was scn5a.sup.+ but apparently
LNM.sup.- (sample 7) was interesting in that the patient
subsequently relapsed, developing distant metastases within three
years of the preliminary diagnosis. Whether relapse also occurred
for the patient who provided the other exceptional case (sample 8)
could not be determined.
DISCUSSION
[0348] The present study shows (i) that strongly, but not weakly
metastatic breast cancer cells displayed VGS currents, almost
entirely composed of a TTX-resistant (TTX-R) component; (ii) that a
particular TTX-R VGSC.alpha. gene, SCN5A, was predominantly
expressed in strongly metastatic cells, but expressed at only very
low levels in weakly metastatic cells; and (iii) that scn5a
expression in biopsy samples correlated strongly with clinically
assessed lymph node metastasis. Furthermore, the high-level VGSC
expression was accompanied inversely by much reduced outward
currents in the cell lines, and a relatively depolarised resting
potential. Taken together, these characteristics would render
metastatic cell membranes potentially `excitable`, consistent with
their hyperactive behaviour.
[0349] Scn5a expression is associated with breast cancer
metastasis. The electrophysiological and RT-PCR results
demonstrated consistently that SCN5A gene products (also termed h1
or SkM2) were predominantly expressed in the strongly metastatic
cell line (FIG. 5) and were associated with breast cancer
metastasis in vivo. We have shown previously for human and/or rat
prostate cancer cells that VGSC activity contributes to cellular
behaviours integral to metastasis, including cellular process
extension (7), lateral migration (8), transverse invasion (5,6,9)
and secretory membrane activity (10). Subsequently, scn9a was
identified as the `culprit` VGSC.alpha. (21). In the present study,
the correlation of scn5a expression with increased cellular
metastatic potential in vitro, and lymph node metastasis in vivo,
would strongly indicate a significant role for scn5a activity in
the metastatic behaviour of breast cancer cells.
[0350] Although the present study is the first to associate scn5a
with cellular metastatic potential, others have previously reported
expression of this VGSC.alpha. in cancer cell lines. Scn5a mRNA and
functional protein expression have been shown to occur in B104
neuroblastoma cells (25) and RT4 peripheral neurotumour cancer cell
lines (26,27). At present, it is not clear why strongly metastatic
cells from carcinomas derived from different tissues should
specifically upregulate the expression of different VGSC.alpha.s.
Also, it is not known if, amongst the various VGSC.alpha.s, only
scn5a would be capable of potentiating metastasis in breast
carcinoma. If so, then it may be that this ability results from
characteristics peculiar only to this VGSC.alpha.. Such possible,
characteristic features of scn5a include the following: (i)
Possession of C-terminal PDZ domains (28,29), potentially enabling
particular interaction with the cytoskeleton; (ii) extremely low
level of protein glycosylation (5% of the total protein mass,
compared to up to 40% protein mass in other VGSC.alpha.s; (30));
(iii) highly promiscuous ion selectivity in given conditions,
allowing Ca.sup.2+ entry (31); (iv) very slow activation and
inactivation kinetics (28,32); and (v) regulation of expression by
steroid hormones (33).
[0351] Another notable characteristic of scn5a is that its
expression appears to be under very tight spatio-temporal control
and highly dynamic regulation.
[0352] SCN5A gene products are classically expressed at very high
levels in cardiac and neonatal/denervated skeletal muscle (29,34).
However, Scn5a mRNA has also been detected in non-excitable,
cultured spinal cord astrocytes (35) but not in a variety of cell
types which express almost all other VGSC.alpha.s, like dorsal root
ganglion neurones (26,36,37). Furthermore, in skeletal muscle
particularly, significant changes in expression levels can occur
over a period of only days after birth (34) and in response to
denervation (38).
[0353] Conservation of breast cancer VGSC.alpha. expression in
biopsy tissue. The profile of VGSC.alpha. expression in weakly and
strongly metastatic breast cancer cells that we have obtained from
the two cell lines (FIG. 5) is consistent with the results of the
PCRs performed on the biopsy tissues. All three VGSC.alpha.s found
in the cell lines were found to be expressed in the tissue samples
and the expression of the predominant scn5a type was correlated
strongly with the surgically characterised metastases.
[0354] Although relative expression levels of scn5a, scn8a and
scn9a cannot directly be determined from the PCR tests, the
apparent ease of amplification of the different VGSC.alpha.s from
the biopsy tissues is consistent with the biopsy samples consisting
almost entirely of a mass of essentially non-metastatic primary
tumour cells with only a very small number of strongly metastatic
cancer cells present in malignant tumours (e.g. 39,40). Thus, scn8a
and scn9a (which are expressed at greater levels than Scn5a in
weakly metastatic cells) could be detected in biopsy tissue using a
lower number of PCR cycles, compared with scn5a, even from samples
displaying evident lymph node metastasis.
[0355] The PCRs performed on the biopsy tissues did not yield
reliable quantitative information concerning expression levels of
the various VGSC.alpha.s, mainly due to the large variability in
the quality of extracted RNA from one sample to another, as
monitored by the control RNA. Scn5a expression was apparently so
low in weakly metastatic cells that it could not be detected in
non-malignant biopsy tissues. However, the expression, being
greatly upregulated in the strongly metastatic cells within the
biopsies, became readily detectable by PCR.
[0356] Multiplicity of VGSC.alpha. expression in breast cancer cell
lines. The expression of multiple VGSC.alpha. genes was determined
in both breast cancer cell lines and is consistent with the
relative VGSC.alpha. expression profiles illustrated in FIG. 5. In
brief, the level of scn8a was similar for both cell lines but very
low, whilst expression of scn5a and scn9a were significantly
greater for the MDA-MB-231 cell line. In particular, scn5a
expression accounted for >80% of the VGSC.alpha.s in these
cells. A D1 neonatal splice form of SCN5A may be of clinical
importance, as discussed above. Multiplicity of VGSC.alpha.
expression has also been found in rat and human prostate cancer
cell lines of differing metastatic potential (21). The
pharmacological data (TTX blockage) indicated that the VGS currents
detected in the MDA-MB-231 cells were mainly TTX-R (IC.sub.50>1
.mu.M). This is consistent with the determined mRNA expression
profile of these cells in which the TTX-R scn5a VGSC.alpha. is the
predominant channel. The scn9a VGSC.alpha. expressed, but at much
lower levels (FIG. 5), would yield TTX-S currents which could
contribute to the TTX sensitivity observed at lower (100 nM)
concentrations. Possible consequences of multiple VGSC.alpha.
expression have been discussed previously (21). Interestingly, the
full-length scn8a products detected in both strongly and weakly
metastatic breast cancer cells were the neonatal splice form as
determined by the product size (Diss, J. K. J., unpublished
observation). This form of scn8a codes for a highly truncated
VGSC.alpha. protein, and has been found to be preferentially
expressed in neonatal and non-excitable adult tissues (41).
Neonatal scn8a is thought not to be capable of creating functional
VGSCs, instead acting as a "fail-safe" mechanism, preventing the
functional expression of leakily expressed, non-truncated scn8a
VGSC.alpha.s. The detection of neonatal scn8a mRNA in biopsy
samples (as determined by the product size; FIG. 4D) indicates that
this mechanism is also present in vivo.
[0357] VGSC expression in breast and prostate cancer: Comparative
aspects. Many aspects of the findings of this study are similar to
those determined using similar techniques in rat and human prostate
cancer cell lines of differing metastatic potential (5,6,21): (i)
the strongly metastatic cells had relatively depolarised resting
potentials (6). (ii) VGS currents were detected in a sub-population
of strongly metastatic cells (54% MAT-LyLu, 10% PC-3, 29%
MDA-MB-231) and never detected in corresponding weakly metastatic
cells (AT-2, LNCaP, MCF-7); (iii) VGSC.alpha. mRNA was detected in
cells of both strong and weak metastatic potential, but with
greater expression in strongly metastatic cells; (iv) multiple
VGSC.alpha. expression was determined in all cells; (v) all cells
expressed scn8a, mainly in the non-functional, neonatal form (21);
and (vi) the predominant VGSC.alpha. (scn9a in prostate cancer
cells; scn5a in breast cancer cells) was expressed more than
1000-fold more in strongly vs. weakly metastatic cells.
[0358] That we should find a similar mechanism potentially involved
in metastasis of both breast and prostate cancer is not completely
surprising in view of their similarities in tumour biology (e.g.
hormone-responsiveness and propensity for bone metastasis) but does
strongly encourage future work to investigate VGSC activity and
metastasis in other cancer types. VGSC.alpha. expression has been
determined in developing small cell carcinoma of the lung (42) and
gliomas (43,44). Thus, functional VGSC expression may be part of a
general mechanism for cancer progression and metastasis.
[0359] On the other hand, it is unclear why a specific, but
different VGSC.alpha. should be associated with metastasis in
breast and prostate cancers. Whilst not intending to be bound by
theory, it is possible that all VGSC.alpha.s may have the
capability of potentiating the metastatic cascade, or only specific
types (including scn5a and scn9a). All VGSC.alpha.s that are
capable of potentiating metastasis may affect the same basic
cellular process(es) within the cascade, for example cellular
process extension, lateral migration, secretion or transverse
invasion. The specific association of a particular VGSC.alpha. with
metastasis in a given cancer type may result from tissue- (or
cancer-) specific transcriptional regulation/control mechanisms,
for example androgens in prostate cancer or oestrogen in breast
cancer. Alternatively, this specific association may result from
different VGSC.alpha.(s) affecting different cellular processes
which may be more or less important for successful metastasis from
different primary tumour sites.
[0360] Clinical implications. Prior to the present invention, only
indirect indicators as to the likelihood of metastatic potential
were available, since, although it is possible to detect
micrometastases in a proportion of patients with breast cancer,
many patients who do not have micrometastases at presentation
eventually develop overt metastatic disease during follow-up (45).
Consequently, clinicians, therefore, require a more accurate method
for predicting the likelihood of development of metastatic disease,
and the presence of VGSCs could act as an independent prognostic
parameter in a multivariant approach to this problem. Of perhaps
greater significance in the future is the potential implications of
inhibiting VGSC activity. The scn5a VGSC.alpha. is already the
specific target of numerous anti-arrhythmic and anti-convulsant
drugs, since dysfunction of scn5a in cardiac tissue is intricately
linked to several forms of heart disease and arrhythmia (46).
Interestingly, the breast cancer drug tamoxifen has been found also
to protect the heart (47) although it is not known if this involves
VGSC modulation (48). The present work, which identifies scn5a as
the potential `culprit` VGSC.alpha. in breast cancer metastasis,
therefore, indicates that scn5a-specific drugs may be inhibitors of
the metastatic cascade.
[0361] Sequence information The question of whether there is any
difference in the sequences of the `wild type` and the `breast
cancer culprit` SCN5A gene is an important one. In general, there
are two major reasons that suggest that differences in sequence are
less important than differences in level of expression: (a) The
sequence data that we have obtained so far shows identity (note
however that our data represent at the most only some 17% and often
less than 10% of the whole sequence) and (b) the expression levels
are >1000-fold different between the strongly vs the weakly
metastatic cells. Taken together, we think that it is the level of
expression (and whatever is responsible for it) rather than
sequence difference(s) that is important. Of course, there may be
some sequence differences that are important for cancer. To test
that would require complete sequencing of the gene which is not a
trivial exercise. There are examples of quite subtle nucleotide
changes in VGSC genes giving rise to profound changes in function,
leading to a pathological condition [see J. Physiol. (2000)
529:533-539, for a recent example].
REFERENCES
[0362] 1. Parkin, D. M., Pisani, P. and Ferlay, J. Estimates of the
worldwide incidence of 25 major cancers in 1990. Int. J. Cancer,
80: 827-841, 1999. [0363] 2. Schwirzke, M., Schiemann, S., Gnirke,
A. and Weidle, U. New genes potentially involved in breast cancer
metastasis. Anticancer Res., 19: 1801-1814, 1999. [0364] 3. Wingo,
P. A., Ries, L. A., Rosenberg, H. M., Miller, D. S, and Edwards, B.
K. Cancer incidence and mortality, 1973-1995--A report card for the
US. Cancer, 82: 1197-1207, 1998. [0365] 4. Cuzick, J., Holland, R.,
Barth, V., Davies, R., Faupel, M., Fentiman, I., Frischbier, H. J.,
LaMarque, J. L., Merson, M., Sacchini, V., Vanel, D. and Veronesi,
U. Electropotential measurements as a new diagnostic modality for
breast cancer. The Lancet, 352: 359-363, 1998. [0366] 5. Grimes, J.
A., Fraser, S. P., Stephens, G. J., Downing, J. E. G., Laniado, M.
E., Foster, C. S., Abel, P. D. and Djamgoz, M. B. A. Differential
expression of voltage-gated Na.sup.+ currents in two prostatic
tumour cell lines: contribution to invasiveness in vitro FEBS
Letts., 369: 290-294, 1995. [0367] 6. Laniado, M., Lalani, E. N.,
Fraser, S. P., Grimes, J. A., Bhangal, G., Djamgoz, M. B. A. and
Abel, P. D. Expression and functional analysis of voltage-activated
Na.sup.+ channels in human prostate cancer cell lines and their
contribution to invasiveness in vitro. Am. J. Pathol., 150:
1213-1221, 1997. [0368] 7. Fraser, S. P., Ding, Y., Liu, A.,
Foster, C. S, and Djamgoz, M. B. A. Tetrodotoxin suppresses
morphological enhancement of the metastatic MAT-LyLu rat prostate
cancer cell line. Cell Tissue Res., 295: 505-512, 1999. [0369] 8.
Fraser, S. P., Salvador, V. and Djamgoz, M. B. A. Voltage-gated
Na.sup.+ channel activity contributes to rodent prostate cancer
migration in vitro. J. Physiol., 513P: 131P, 1998. [0370] 9. Smith,
P., Rhodes, N. P., Shortland, A. P., Fraser, S. P., Djamgoz, M. B.
A., Ke, Y. and Foster, C. S. Sodium channel protein expression
enhances the invasiveness of rat and human prostate cancer cells.
FEBS Letts., 423: 19-24, 1998. [0371] 10. Mycielska, M., Fraser, S.
P., Szatkowski, M. and Djamgoz, M. B. A. Endocytic membrane
activity in rat prostate cancer cell lines: potentiation by
functional voltage-gated sodium channels. J. Physiol., (In the
press). [0372] 11. Rodriguez, C., Calle, E. E., Tatham, L. M.,
Wingo, P. A., Miracle-McMahill, H. L., Thun, M. J. and Heath, C. W.
Family history of breast cancer as a predictor for fatal prostate
cancer. Epidemiology, 9: 525-529, 1998. [0373] 12. Catterall, W. A.
From ionic currents to molecular mechanisms: the structure and
function of voltage-gated sodium channels. Neuron, 26: 13-25, 2000.
[0374] 13. Goldin, A. L., Snutch, T., Lubbert, H., Dowsett, A.,
Marshall, J., Auld, V., Downey, W., Fritz, L. C., Lester, H. A.,
Dunn, R., Catterall, W. A. and Davidson, N. Messenger-RNA coding
for only the alpha-subunit of the rat-brain Na-channel is
sufficient for expression of functional channels in
Xenopus-oocytes. Proc. Natl. Acad. Sci. USA, 83: 7503-7507, 1986.
[0375] 14. Isom, L. L., De Jongh, K. S., Patton, D. E., Reber, B.
F. X., Offord, J., Charbonneau, H., Walsh, K., Goldin, A. L. and
Catterall, W. A. Primary structure and functional expression of the
beta-1-subunit of the rat-brain sodium-channel. Science, 256:
839-842, 1992. [0376] 15. Morgan, K., Stevens, E. B., Shah, B.,
Cox, P. J., Dixon, A. K., Lee, K., Pinnock, R. D., Hughes, J.,
Richardson, P. J., Mizuguchi, K. and Jackson, A. P. 3: An
additional auxiliary subunit of the voltage-sensitive sodium
channel that modulates channel gating with distinct kinetics. Proc.
Natl. Acad. Sci. USA., 97: 2308-2313, 2000. [0377] 16. Plummer, N.
W. and Meisler, M. H. Exon organization, coding sequence, physical
mapping, and polymorphic intragenic markers for the human neuronal
sodium channel gene SCN8A. Genomics, 57: 323-331, 1998. [0378] 17.
Jeong, S. Y., Goto, J., Hashida, H., Suzuki, T., Ogata, K., Masuda,
N., Hirai, M., Isahara, K., Uchiyama, Y. and Kanazawa, I.
Identification of a novel human voltage-gated sodium channel alpha
subunit gene, SCN12A. Biochem. Biophys. Res. Commun., 267: 262-270,
2000. [0379] 18. Soule, H. D., Vasguez, J., Long, A., Albert, S,
and Brennan, M. A human cell line from a pleural effusion derived
from a breast carcinoma. J. Natl. Cancer Inst., 51: 1409-1416,
1973. [0380] 19. Zhang, R. D., Fidler, I. J. and Price, J. E.
Relative malignant potential of human breast-carcinoma cell-lines
established from pleural effusions and a brain metastasis. Invasion
Metastasis, 11: 204-215, 1991. [0381] 20. Chomczynski, P. and
Sacchi, N. Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Ann. Biochem., 162:
156-159, 1987. [0382] 21. Diss, J. K. J., Archer, S. N., Hirano,
J., Fraser, S. P. and Djamgoz, M. B. A. Predominant expression of
the SCN9A voltage-gated Na.sup.+ channel a-subunit gene in strongly
metastatic cell lines of both rat and human prostate cancer:
Semi-quantitative PCR analyses. Prostate (In press). [0383] 22.
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang,
Z., Miller, W. and Lipman, D. J. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res.,
25: 3389-3402, 1997. [0384] 23. Fitzsimmons, S. A., Workman, P.,
Grever, M., Paull, K., Camalier, R. and Lewis, A. D. Reductase
enzyme expression across the National Cancer Institute Tumor cell
line panel: correlation with sensitivity to mitomycin C and EO9. J.
Natl. Cancer Inst., 88: 259-269, 1996. [0385] 24. Marin, A., Lopez
de Cerain, A., Hamilton, E., Lewis, A. D., Martinez-Penuela, J. M.,
Idoate, M. A. and Bello, J. DT-diaphorase and cytochrome B5
reductase in human lung and breast tumours. Br. J. Cancer, 76:
923-929, 1997. [0386] 25. Gu, X. Q., Dib-Hajj, S. D., Rizzo, M. and
Waxman, S. G. TTX-sensitive and -resistant Na.sup.+ currents, and
mRNA for the TTX-resistant rH1 channel, are expressed in B104
neuroblastoma cells. J. Neurophysiol., 77: 236-246, 1997. [0387]
26. Donahue, L. M., Schaller, K. and Sueoka, N. Segregation of
Na.sup.+-channel gene-expression during neuronal glial branching of
a rat PNS-derived stem-cell line, RT4-AC. Devel. Biol., 147:
415-424, 1991. [0388] 27. Zeng, D. W., Kyle, J. W., Martin, R. L.,
Ambler, K. S, and Hanck, D. A. Cardiac sodium channels expressed in
a peripheral neurotumor-derived cell line, RT4-B8. Am. J. Physiol.,
39: C1522-C1531, 1996. [0389] 28. Gellens, M. E., George, A. L.,
Chen, L. Q., Chahine, M., Horn, R., Barchi, R. C. and Kallen, R. G.
Primary structure and functional expression of the human cardiac
tetrodotoxin-insensitive voltage-dependent sodium-channel. Proc.
Natl. Acad. Sci. USA., 89: 554-558, 1992. [0390] 29. Rogart, R. B.,
Cribbs, L. L., Muglia, L. K., Kephart, D. D. and Kaiser, M. W.
Molecular-cloning of a putative tetrodotoxin-resistant rat-heart
Na.sup.+ channel isoform. Proc. Natl. Acad. Sci. USA., 86:
8170-8174, 1989. [0391] 30. Cohen, S. A. and Levitt, L. K. Partial
characterization of the rH I sodium-channel protein from rat-heart
using subtype-specific antibodies. Circulation Res., 73: 735-742,
1993. [0392] 31. Santana, L. F., Gomez, A. M. and Lederer, W. J.
Ca.sup.2+ flux through promiscuous cardiac Na.sup.+ channels:
Slip-mode conductance. Science, 279: 1027-1033, 1998. [0393] 32.
White, M. M., Chen, L. Q., Kleinfield, R., Kallen, R. G. and
Barchi, R. L. Skm2, a Na.sup.+ channel cDNA clone from denervated
skeletal-muscle, encodes a tetrodotoxin-insensitive Na.sup.+
channel. Mol. Pharmacol., 39: 604-608, 1991. [0394] 33. Rich, M.
M., Kraner, S. D. and Barchi, R. L. Altered gene expression in
steroid-treated denervated muscle. Neurobiol. Dis., 6: 515-522,
1999. [0395] 34. Kallen R. G., Sheng Z. H., Yang J., Chen L. Q.,
Rogart R. B. and Barchi R. L. Primary structure and expression of a
sodium-channel characteristic of denervated and immature rat
skeletal-muscle. Neuron 4: 233-242, 1990. [0396] 35. Black, J. A.,
Dib-Hajj, S. D., Cohen, S., Hinson, A. W. and Waxman, S. G. Glial
cells have heart: rH1 Na.sup.+ channel mRNA and protein in spinal
cord astrocytes. Glia 23: 200-208, 1998. [0397] 36. Black, J. A.,
Dib-Hajj, S. D., McNabola, K., Jeste, S., Rizzo, M. A., Kocsis, J.
D. and Waxman, S. G. Spinal sensory neurons express multiple sodium
channel alpha-subunit mRNAs. Mol. Brain. Res., 43: 117-131, 1996.
[0398] 37. Dib-Hajj, S. D., Tyrell, L., Black, J. A. and Waxman, S.
G. NaN, a novel voltage-gated Na.sup.+ channel, is expressed
preferentially in peripheral sensory neurons and down-regulated
after axotomy. Proc. Natl. Acad. Sci. USA., 95: 8963-8968, 1998.
[0399] 38. Yang, J. S. J., Sladky, J. T., Kallen, R. G. and Barchi,
R. L. TTX-sensitive and TTX-insensitive sodium-channel
messenger-RNA transcripts are independently regulated in adult
skeletal-muscle after denervation. Neuron, 7: 421-427, 1991. [0400]
39. Fidler, I. J. Tumor heterogeneity and the biology of cancer
invasion and metastasis. Cancer Res., 38: 2651-2660, 1978. [0401]
40. Fidler, I. J. and Hart, I. R. Biological diversity in
metastatic neoplasms: origins ands implications. Science, 217:
998-1003, 1982. [0402] 41. Plummer, N. W., McBurney, M. W. and
Meisler, M. H. Alternative splicing of the sodium channel SCN8A
predicts a truncated two-domain protein in fetal brain and
non-neuronal cells. J. Biol. Chem., 272: 24008-24015, 1997. [0403]
42. Blandino, J. K. W., Viglione, M. P., Bradley, W. A., Ole, H.
K., Kim, Y. I. Voltage-dependent sodium-channels in human
small-cell lung-cancer cells --Role in action-potentials and
inhibition by Lambert-Eaton syndrome IgG. J. Membr. Biol., 143:
153-163, 1995. [0404] 43. Patt, S., Wlasak, R. and Kraft, R.
Influence of voltage-activated sodium channels on growth and
motility of human neuroblastoma cells in vitro. Brain Pathol., 10:
738, 2000. [0405] 44. Patt, S., Labrakakis, C., Bernstein, M.,
Weydt, P., CervosNavarro, J., Nisch, G., Kettenmann, H. Neuron-like
physiological properties of cells from human oligodendroglial
tumors. Neurosci., 71: 601-611, 1996. [0406] 45. Mansi, J. L.,
Gogas, H., Bliss, J. M., Gazet, J. C., Berger, U. and Coombes, R.
C. Outcome of primary-breast-cancer patients with micrometastases:
a long-term follow-up study. The Lancet, 354: 197-202, 1999. [0407]
46. Jongsma, H. J. Sudden cardiac death: A matter of faulty ion
channels? Curr. Biol., 8: R568-R571, 1998. [0408] 47. Hardy, S. P.,
deFelipe, C., Valverde, M. A. Inhibition of voltage-gated cationic
channels in rat embryonic hypothalamic neurones and C1300
neuroblastoma cells by triphenylethylene antooestrogens. FEBS Lett
434: 236-240, 1998. [0409] 48. Cushman, M., Costantino, J. P.,
Tracy, R. P., Song, K., Buckley, L., Roberts, J. D., D. N.
Tamoxifen and cardiac risk factors in healthy women: suggestion of
an anti-inflammatory effect. Thromb Vasc Biol 21: 255-261,
2001.
EXAMPLE 2
Design of Antisense Oligonucleotides for Suppressing VGSC
Expression in Human Prostate Cancer
[0410] 1. Alignment of all currently known VGSC types to identify
potential sites for VGSC subtype-specific antisense oligonucleotide
design.
TABLE-US-00005 Cons
agtgagtgtgaaagtcttatggagagcaacaaaactg---tccgatggaaa (SEQ ID NO 47)
hNav2.1 agtcggtgtgaaagccttctgt---ttaacgaatcca---tgctatgggaa (SEQ ID
NO 48) hNe-Na tccgaatgttttgcccttatgaATGTTAGTCAAAATG---TGCGAtggaaa
(SEQ ID NO 49) Human brain 1
actgattgcctaaaactaatagaaagaaatgagactg---ctcgatggaaa (SEQ ID NO 50)
Human brain 2 agtgagtgcaAAGCTCTCATTGAGAGCAATcaaactg---ccaggtggaaa
(SEQ ID NO 51) Human brain 3
agtgactgtc--aggctcttggcaagcaa-------g---ctcggtggaaa (SEQ ID NO 52)
Na6 (human) actgaatgtgaaaagcttatggaggggAACAATACAGAGATCAGATGgaag
(SEQ ID NO 53) hSkMl
aacaagtctgagtgcgagagCCTCATGCACACAGGCCAGGtccgctggctc (SEQ ID NO 54)
Human heart 1 aacaagagccagtgtgagtccttgaacttgaccggagaattgtactggacc
(SEQ ID NO 55) PN3/SNS (rat)
aacaagtccgagtgtcacaatcaaaacagcaccggccacttcttctgggtc (SEQ ID NO
56)
[0411] HNeNa is derived from SCN9A and Na6 from SCN8A.
[0412] In the above alignment the human VGSC equivalent has been
used where possible. The alignment has been optimised by the
introduction of sequence gaps indicated by a dash although gaps are
not actually present in the real sequence or any oligonucleotide
design. The most commonly occurring nucleotides are indicated in
the consensus line (Cons). Potential sites for the design of 20mer
antisense oligonucleotides are in bold case and underlined in four
human VGSC types. The most unconserved region of the fragment
produced by the degenerate screen has been used to produce this
line-up.
[0413] It would also be possible to design 20mer antisense oligos
in the 3/4 cytoplasmic linker (where VGSC sequence is highly
conserved across all types) that are individually capable of
`silencing` simultaneously a number of VGSC types. For example,
below the same 20 nucleotide sections of the 3/4 linker from three
VGSC types are shown aligned. In this section, the hNe-Na and the
human brain 2 sequences are identical and the hSkM1 sequence
differs at only two nucleotide positions. Therefore, in this region
it is possible to design two antisense oligonucleotides that will
knock-out at least three of the channels (possibly four when the
Na6 (human) sequence has been confirmed for this region).
TABLE-US-00006 hNe-Na TTATGACAGAAGAACAGAAG (SEQ ID NO 57) Human
brain 2 TTATGACAGAAGAACAGAAG (SEQ ID NO 58) hSkM1
TTATGACgGAgGAACAGAAG (SEQ ID NO 59)
Sequence CWU 1
1
5916371DNAHomo sapiens 1ctcttatgtg aggagctgaa gaggaattaa aatatacagg
atgaaaagat ggcaatgttg 60cctcccccag gacctcagag ctttgtccat ttcacaaaac
agtctcttgc cctcattgaa 120caacgcattg ctgaaagaaa atcaaaggaa
cccaaagaag aaaagaaaga tgatgatgaa 180gaagccccaa agccaagcag
tgacttggaa gctggcaaac aactgccctt catctatggg 240gacattcctc
ccggcatggt gtcagagccc ctggaggact tggaccccta ctatgcagac
300aaaaagactt tcatagtatt gaacaaaggg aaaacaatct tccgtttcaa
tgccacacct 360gctttatata tgctttctcc tttcagtcct ctaagaagaa
tatctattaa gattttagta 420cactccttat tcagcatgct catcatgtgc
actattctga caaactgcat atttatgacc 480atgaataacc cgccggactg
gaccaaaaat gtcgagtaca cttttactgg aatatatact 540tttgaatcac
ttgtaaaaat ccttgcaaga ggcttctgtg taggagaatt cacttttctt
600cgtgacccgt ggaactggct ggattttgtc gtcattgttt ttgcgtattt
aacagaattt 660gtaaacctag gcaatgtttc agctcttcga actttcagag
tattgagagc tttgaaaact 720atttctgtaa tcccaggcct gaagacaatt
gtaggggctt tgatccagtc agtgaagaag 780ctttctgatg tcatgatcct
gactgtgttc tgtctgagtg tgtttgcact aattggacta 840cagctgttca
tgggaaacct gaagcataaa tgttttcgaa attcacttga aaataatgaa
900acattagaaa gcataatgaa taccctagag agtgaagaag actttagaaa
atatttttat 960tacttggaag gatccaaaga tgctctcctt tgtggtttca
gcacagattc aggtcagtgt 1020ccagaggggt acacctgtgt gaaaattggc
agaaaccctg attatggcta cacgagcttt 1080gacactttca gctgggcctt
cttagccttg tttaggctaa tgacccaaga ttactgggaa 1140aacctttacc
aacagacgct gcgtgctgct ggcaaaacct acatgatctt ctttgtcgta
1200gtgattttcc tgggctcctt ttatctaata aacttgatcc tggctgtggt
tgccatggca 1260tatgaagaac agaaccaggc aaacattgaa gaagctaaac
agaaagaatt agaatttcaa 1320cagatgttag accgtcttaa aaaagagcaa
gaagaagctg aggcaattgc agcggcagcg 1380gctgaatata caagtattag
gagaagcaga attatgggcc tctcagagag ttcttctgaa 1440acatccaaac
tgagctctaa aagtgctaaa gaaagaagaa acagaagaaa gaaaaagaat
1500caaaagaagc tctccagtgg agaggaaaag ggagatgctg agaaattgtc
gaaatcagaa 1560tcagaggaca gcatcagaag aaaaagtttc caccttggtg
tcgaagggca taggcgagca 1620catgaaaaga ggttgtctac ccccaatcag
tcaccactca gcattcgtgg ctccttgttt 1680tctgcaaggc gaagcagcag
aacaagtctt tttagtttca aaggcagagg aagagatata 1740ggatctgaga
ctgaatttgc cgatgatgag cacagcattt ttggagacaa tgagagcaga
1800aggggctcac tgtttgtgcc ccacagaccc caggagcgac gcagcagtaa
catcagccaa 1860gccagtaggt ccccaccaat gctgccggtg aacgggaaaa
tgcacagtgc tgtggactgc 1920aacggtgtgg tctccctggt tgatggacgc
tcagccctca tgctccccaa tggacagctt 1980ctgccagagg gcacgaccaa
tcaaatacac aagaaaaggc gttgtagttc ctatctcctt 2040tcagaggata
tgctgaatga tcccaacctc agacagagag caatgagtag agcaagcata
2100ttaacaaaca ctgtggaaga acttgaagag tccagacaaa aatgtccacc
ttggtggtac 2160agatttgcac acaaattctt gatctggaat tgctctccat
attggataaa attcaaaaag 2220tgtatctatt ttattgtaat ggatcctttt
gtagatcttg caattaccat ttgcatagtt 2280ttaaacacat tatttatggc
tatggaacac cacccaatga ctgaggaatt caaaaatgta 2340cttgctatag
gaaatttggt ctttactgga atctttgcag ctgaaatggt attaaaactg
2400attgccatgg atccatatga gtatttccaa gtaggctgga atatttttga
cagccttatt 2460gtgactttaa gtttagtgga gctctttcta gcagatgtgg
aaggattgtc agttctgcga 2520tcattcagac tgctccgagt cttcaagttg
gcaaaatcct ggccaacatt gaacatgctg 2580attaagatca ttggtaactc
agtaggggct ctaggtaacc tcaccttagt gttggccatc 2640atcgtcttca
tttttgctgt ggtcggcatg cagctctttg gtaagagcta caaagaatgt
2700gtctgcaaga tcaatgatga ctgtacgctc ccacggtggc acatgaacga
cttcttccac 2760tccttcctga ttgtgttccg cgtgctgtgt ggagagtgga
tagagaccat gtgggactgt 2820atggaggtcg ctggtcaagc tatgtgcctt
attgtttaca tgatggtcat ggtcattgga 2880aacctggtgg tcctaaacct
atttctggcc ttattattga gctcatttag ttcagacaat 2940cttacagcaa
ttgaagaaga ccctgatgca aacaacctcc agattgcagt gactagaatt
3000aaaaagggaa taaattatgt gaaacaaacc ttacgtgaat ttattctaaa
agcattttcc 3060aaaaagccaa agatttccag ggagataaga caagcagaag
atctgaatac taagaaggaa 3120aactatattt ctaaccatac acttgctgaa
atgagcaaag gtcacaattt cctcaaggaa 3180aaagataaaa tcagtggttt
tggaagcagc gtggacaaac acttgatgga agacagtgat 3240ggtcaatcat
ttattcacaa tcccagcctc acagtgacag tgccaattgc acctggggaa
3300tccgatttgg aaaatatgaa tgctgaggaa cttagcagtg attcggatag
tgaatacagc 3360aaagtgagat taaaccggtc aagctcctca gagtgcagca
cagttgataa ccctttgcct 3420ggagaaggag aagaagcaga ggctgaacct
atgaattccg atgagccaga ggcctgtttc 3480acagatggtt gtgtacggag
gttctcatgc tgccaagtta acatagagtc agggaaagga 3540aaaatctggt
ggaacatcag gaaaacctgc tacaagattg ttgaacacag ttggtttgaa
3600agcttcattg tcctcatgat cctgctcagc agtggtgccc tggcttttga
agatatttat 3660attgaaagga aaaagaccat taagattatc ctggagtatg
cagacaagat cttcacttac 3720atcttcattc tggaaatgct tctaaaatgg
atagcatatg gttataaaac atatttcacc 3780aatgcctggt gttggctgga
tttcctaatt gttgatgttt ctttggttac tttagtggca 3840aacactcttg
gctactcaga tcttggcccc attaaatccc ttcggacact gagagcttta
3900agacctctaa gagccttatc tagatttgaa ggaatgaggg tcgttgtgaa
tgcactcata 3960ggagcaattc cttccatcat gaatgtgcta cttgtgtgtc
ttatattctg gctgatattc 4020agcatcatgg gagtaaattt gtttgctggc
aagttctatg agtgtattaa caccacagat 4080gggtcacggt ttcctgcaag
tcaagttcca aatcgttccg aatgttttgc ccttatgaat 4140gttagtcaaa
atgtgcgatg gaaaaacctg aaagtgaact ttgataatgt cggacttggt
4200tacctatctc tgcttcaagt tgcaactttt aagggatgga cgattattat
gtatgcagca 4260gtggattctg ttaatgtaga caagcagccc aaatatgaat
atagcctcta catgtatatt 4320tattttgtcg tctttatcat ctttgggtca
ttcttcactt tgaacttgtt cattggtgtc 4380atcatagata atttcaacca
acagaaaaag aagcttggag gtcaagacat ctttatgaca 4440gaagaacaga
agaaatacta taatgcaatg aaaaagctgg ggtccaagaa gccacaaaag
4500ccaattcctc gaccagggaa caaaatccaa ggatgtatat ttgacctagt
gacaaatcaa 4560gcctttgata ttagtatcat ggttcttatc tgtctcaaca
tggtaaccat gatggtagaa 4620aaggagggtc aaagtcaaca tatgactgaa
gttttatatt ggataaatgt ggtttttata 4680atccttttca ctggagaatg
tgtgctaaaa ctgatctccc tcagacacta ctacttcact 4740gtaggatgga
atatttttga ttttgtggtt gtgattatct ccattgtagg tatgtttcta
4800gctgatttga ttgaaacgta ttttgtgtcc cctaccctgt tccgagtgat
ccgtcttgcc 4860aggattggcc gaatcctacg tctagtcaaa ggagcaaagg
ggatccgcac gctgctcttt 4920gctttgatga tgtcccttcc tgcgttgttt
aacatcggcc tcctgctctt cctggtcatg 4980ttcatctacg ccatctttgg
aatgtccaac tttgcctatg ttaaaaagga agatggaatt 5040aatgacatgt
tcaattttga gacctttggc aacagtatga tttgcctgtt ccaaattaca
5100acctctgctg gctgggatgg attgctagca cctattctta acagtaagcc
acccgactgt 5160gacccaaaaa aagttcatcc tggaagttca gttgaaggag
actgtggtaa cccatctgtt 5220ggaatattct actttgttag ttatatcatc
atatccttcc tggttgtggt gaacatgtac 5280attgcagtca tactggagaa
ttttagtgtt gccactgaag aaagtactga acctctgagt 5340gaggatgact
ttgagatgtt ctatgaggtt tgggagaagt ttgatcccga tgcgacccag
5400tttatagagt tctctaaact ctctgatttt gcagctgccc tggatcctcc
tcttctcata 5460gcaaaaccca acaaagtcca gctcattgcc atggatctgc
ccatggttag tggtgaccgg 5520atccattgtc ttgacatctt atttgctttt
acaaagcgtg ttttgggtga gagtggggag 5580atggattctc ttcgttcaca
gatggaagaa aggttcatgt ctgcaaatcc ttccaaagtg 5640tcctatgaac
ccatcacaac cacactaaaa cggaaacaag aggatgtgtc tgctactgtc
5700attcagcgtg cttatagacg ttaccgctta aggcaaaatg tcaaaaatat
atcaagtata 5760tacataaaag atggagacag agatgatgat ttactcaata
aaaaagatat ggcttttgat 5820aatgttaatg agaactcaag tccagaaaaa
acagatgcca cttcatccac cacctctcca 5880ccttcatatg atagtgtaac
aaagccagac aaagagaaat atgaacaaga cagaacagaa 5940aaggaagaca
aagggaaaga cagcaaggaa agcaaaaaat agagcttcat ttttgatata
6000ttgtttacag cctgtgaaag tgatttattt gtgttaataa aactcttttg
aggaagtcta 6060tgccaaaatc ctttttatca aaatattctc gaaggcagtg
cagtcactaa ctctgatttc 6120ctaagaaagg tgggcagcat tagcagatgg
ttatttttgc actgatgatt ctttaagaat 6180cgtaagagaa ctctgtagga
attattgatt atagcataca aaagtgattg attcagtttt 6240ttggttttta
ataaatcaga agaccatgta gaaaactttt acatctgcct tgtcatcttt
6300tcacaggatt gtaattagtc ttgtttccca tgtaaataaa caacacacgc
atacagaaaa 6360aaaaaaaaaa a 637121977PRTHomo sapiens 2Met Ala Met
Leu Pro Pro Pro Gly Pro Gln Ser Phe Val His Phe Thr1 5 10 15Lys Gln
Ser Leu Ala Leu Ile Glu Gln Arg Ile Ala Glu Arg Lys Ser20 25 30Lys
Glu Pro Lys Glu Glu Lys Lys Asp Asp Asp Glu Glu Ala Pro Lys35 40
45Pro Ser Ser Asp Leu Glu Ala Gly Lys Gln Leu Pro Phe Ile Tyr Gly50
55 60Asp Ile Pro Pro Gly Met Val Ser Glu Pro Leu Glu Asp Leu Asp
Pro65 70 75 80Tyr Tyr Ala Asp Lys Lys Thr Phe Ile Val Leu Asn Lys
Gly Lys Thr85 90 95Ile Phe Arg Phe Asn Ala Thr Pro Ala Leu Tyr Met
Leu Ser Pro Phe100 105 110Ser Pro Leu Arg Arg Ile Ser Ile Lys Ile
Leu Val His Ser Leu Phe115 120 125Ser Met Leu Ile Met Cys Thr Ile
Leu Thr Asn Cys Ile Phe Met Thr130 135 140Met Asn Asn Pro Pro Asp
Trp Thr Lys Asn Val Glu Tyr Thr Phe Thr145 150 155 160Gly Ile Tyr
Thr Phe Glu Ser Leu Val Lys Ile Leu Ala Arg Gly Phe165 170 175Cys
Val Gly Glu Phe Thr Phe Leu Arg Asp Pro Trp Asn Trp Leu Asp180 185
190Phe Val Val Ile Val Phe Ala Tyr Leu Thr Glu Phe Val Asn Leu
Gly195 200 205Asn Val Ser Ala Leu Arg Thr Phe Arg Val Leu Arg Ala
Leu Lys Thr210 215 220Ile Ser Val Ile Pro Gly Leu Lys Thr Ile Val
Gly Ala Leu Ile Gln225 230 235 240Ser Val Lys Lys Leu Ser Asp Val
Met Ile Leu Thr Val Phe Cys Leu245 250 255Ser Val Phe Ala Leu Ile
Gly Leu Gln Leu Phe Met Gly Asn Leu Lys260 265 270His Lys Cys Phe
Arg Asn Ser Leu Glu Asn Asn Glu Thr Leu Glu Ser275 280 285Ile Met
Asn Thr Leu Glu Ser Glu Glu Asp Phe Arg Lys Tyr Phe Tyr290 295
300Tyr Leu Glu Gly Ser Lys Asp Ala Leu Leu Cys Gly Phe Ser Thr
Asp305 310 315 320Ser Gly Gln Cys Pro Glu Gly Tyr Thr Cys Val Lys
Ile Gly Arg Asn325 330 335Pro Asp Tyr Gly Tyr Thr Ser Phe Asp Thr
Phe Ser Trp Ala Phe Leu340 345 350Ala Leu Phe Arg Leu Met Thr Gln
Asp Tyr Trp Glu Asn Leu Tyr Gln355 360 365Gln Thr Leu Arg Ala Ala
Gly Lys Thr Tyr Met Ile Phe Phe Val Val370 375 380Val Ile Phe Leu
Gly Ser Phe Tyr Leu Ile Asn Leu Ile Leu Ala Val385 390 395 400Val
Ala Met Ala Tyr Glu Glu Gln Asn Gln Ala Asn Ile Glu Glu Ala405 410
415Lys Gln Lys Glu Leu Glu Phe Gln Gln Met Leu Asp Arg Leu Lys
Lys420 425 430Glu Gln Glu Glu Ala Glu Ala Ile Ala Ala Ala Ala Ala
Glu Tyr Thr435 440 445Ser Ile Arg Arg Ser Arg Ile Met Gly Leu Ser
Glu Ser Ser Ser Glu450 455 460Thr Ser Lys Leu Ser Ser Lys Ser Ala
Lys Glu Arg Arg Asn Arg Arg465 470 475 480Lys Lys Lys Asn Gln Lys
Lys Leu Ser Ser Gly Glu Glu Lys Gly Asp485 490 495Ala Glu Lys Leu
Ser Lys Ser Glu Ser Glu Asp Ser Ile Arg Arg Lys500 505 510Ser Phe
His Leu Gly Val Glu Gly His Arg Arg Ala His Glu Lys Arg515 520
525Leu Ser Thr Pro Asn Gln Ser Pro Leu Ser Ile Arg Gly Ser Leu
Phe530 535 540Ser Ala Arg Arg Ser Ser Arg Thr Ser Leu Phe Ser Phe
Lys Gly Arg545 550 555 560Gly Arg Asp Ile Gly Ser Glu Thr Glu Phe
Ala Asp Asp Glu His Ser565 570 575Ile Phe Gly Asp Asn Glu Ser Arg
Arg Gly Ser Leu Phe Val Pro His580 585 590Arg Pro Gln Glu Arg Arg
Ser Ser Asn Ile Ser Gln Ala Ser Arg Ser595 600 605Pro Pro Met Leu
Pro Val Asn Gly Lys Met His Ser Ala Val Asp Cys610 615 620Asn Gly
Val Val Ser Leu Val Asp Gly Arg Ser Ala Leu Met Leu Pro625 630 635
640Asn Gly Gln Leu Leu Pro Glu Gly Thr Thr Asn Gln Ile His Lys
Lys645 650 655Arg Arg Cys Ser Ser Tyr Leu Leu Ser Glu Asp Met Leu
Asn Asp Pro660 665 670Asn Leu Arg Gln Arg Ala Met Ser Arg Ala Ser
Ile Leu Thr Asn Thr675 680 685Val Glu Glu Leu Glu Glu Ser Arg Gln
Lys Cys Pro Pro Trp Trp Tyr690 695 700Arg Phe Ala His Lys Phe Leu
Ile Trp Asn Cys Ser Pro Tyr Trp Ile705 710 715 720Lys Phe Lys Lys
Cys Ile Tyr Phe Ile Val Met Asp Pro Phe Val Asp725 730 735Leu Ala
Ile Thr Ile Cys Ile Val Leu Asn Thr Leu Phe Met Ala Met740 745
750Glu His His Pro Met Thr Glu Glu Phe Lys Asn Val Leu Ala Ile
Gly755 760 765Asn Leu Val Phe Thr Gly Ile Phe Ala Ala Glu Met Val
Leu Lys Leu770 775 780Ile Ala Met Asp Pro Tyr Glu Tyr Phe Gln Val
Gly Trp Asn Ile Phe785 790 795 800Asp Ser Leu Ile Val Thr Leu Ser
Leu Val Glu Leu Phe Leu Ala Asp805 810 815Val Glu Gly Leu Ser Val
Leu Arg Ser Phe Arg Leu Leu Arg Val Phe820 825 830Lys Leu Ala Lys
Ser Trp Pro Thr Leu Asn Met Leu Ile Lys Ile Ile835 840 845Gly Asn
Ser Val Gly Ala Leu Gly Asn Leu Thr Leu Val Leu Ala Ile850 855
860Ile Val Phe Ile Phe Ala Val Val Gly Met Gln Leu Phe Gly Lys
Ser865 870 875 880Tyr Lys Glu Cys Val Cys Lys Ile Asn Asp Asp Cys
Thr Leu Pro Arg885 890 895Trp His Met Asn Asp Phe Phe His Ser Phe
Leu Ile Val Phe Arg Val900 905 910Leu Cys Gly Glu Trp Ile Glu Thr
Met Trp Asp Cys Met Glu Val Ala915 920 925Gly Gln Ala Met Cys Leu
Ile Val Tyr Met Met Val Met Val Ile Gly930 935 940Asn Leu Val Val
Leu Asn Leu Phe Leu Ala Leu Leu Leu Ser Ser Phe945 950 955 960Ser
Ser Asp Asn Leu Thr Ala Ile Glu Glu Asp Pro Asp Ala Asn Asn965 970
975Leu Gln Ile Ala Val Thr Arg Ile Lys Lys Gly Ile Asn Tyr Val
Lys980 985 990Gln Thr Leu Arg Glu Phe Ile Leu Lys Ala Phe Ser Lys
Lys Pro Lys995 1000 1005Ile Ser Arg Glu Ile Arg Gln Ala Glu Asp Leu
Asn Thr Lys Lys1010 1015 1020Glu Asn Tyr Ile Ser Asn His Thr Leu
Ala Glu Met Ser Lys Gly1025 1030 1035His Asn Phe Leu Lys Glu Lys
Asp Lys Ile Ser Gly Phe Gly Ser1040 1045 1050Ser Val Asp Lys His
Leu Met Glu Asp Ser Asp Gly Gln Ser Phe1055 1060 1065Ile His Asn
Pro Ser Leu Thr Val Thr Val Pro Ile Ala Pro Gly1070 1075 1080Glu
Ser Asp Leu Glu Asn Met Asn Ala Glu Glu Leu Ser Ser Asp1085 1090
1095Ser Asp Ser Glu Tyr Ser Lys Val Arg Leu Asn Arg Ser Ser Ser1100
1105 1110Ser Glu Cys Ser Thr Val Asp Asn Pro Leu Pro Gly Glu Gly
Glu1115 1120 1125Glu Ala Glu Ala Glu Pro Met Asn Ser Asp Glu Pro
Glu Ala Cys1130 1135 1140Phe Thr Asp Gly Cys Val Arg Arg Phe Ser
Cys Cys Gln Val Asn1145 1150 1155Ile Glu Ser Gly Lys Gly Lys Ile
Trp Trp Asn Ile Arg Lys Thr1160 1165 1170Cys Tyr Lys Ile Val Glu
His Ser Trp Phe Glu Ser Phe Ile Val1175 1180 1185Leu Met Ile Leu
Leu Ser Ser Gly Ala Leu Ala Phe Glu Asp Ile1190 1195 1200Tyr Ile
Glu Arg Lys Lys Thr Ile Lys Ile Ile Leu Glu Tyr Ala1205 1210
1215Asp Lys Ile Phe Thr Tyr Ile Phe Ile Leu Glu Met Leu Leu Lys1220
1225 1230Trp Ile Ala Tyr Gly Tyr Lys Thr Tyr Phe Thr Asn Ala Trp
Cys1235 1240 1245Trp Leu Asp Phe Leu Ile Val Asp Val Ser Leu Val
Thr Leu Val1250 1255 1260Ala Asn Thr Leu Gly Tyr Ser Asp Leu Gly
Pro Ile Lys Ser Leu1265 1270 1275Arg Thr Leu Arg Ala Leu Arg Pro
Leu Arg Ala Leu Ser Arg Phe1280 1285 1290Glu Gly Met Arg Val Val
Val Asn Ala Leu Ile Gly Ala Ile Pro1295 1300 1305Ser Ile Met Asn
Val Leu Leu Val Cys Leu Ile Phe Trp Leu Ile1310 1315 1320Phe Ser
Ile Met Gly Val Asn Leu Phe Ala Gly Lys Phe Tyr Glu1325 1330
1335Cys Ile Asn Thr Thr Asp Gly Ser Arg Phe Pro Ala Ser Gln Val1340
1345 1350Pro Asn Arg Ser Glu Cys Phe Ala Leu Met Asn Val Ser Gln
Asn1355 1360 1365Val Arg Trp Lys Asn Leu Lys Val Asn Phe Asp Asn
Val Gly Leu1370 1375 1380Gly Tyr Leu Ser Leu Leu Gln Val Ala Thr
Phe Lys Gly Trp Thr1385 1390 1395Ile Ile Met Tyr Ala Ala Val Asp
Ser Val Asn Val Asp Lys Gln1400 1405 1410Pro Lys Tyr Glu Tyr Ser
Leu Tyr Met Tyr Ile Tyr Phe Val Val1415 1420 1425Phe Ile Ile Phe
Gly Ser Phe Phe Thr Leu Asn Leu Phe Ile Gly1430 1435 1440Val Ile
Ile Asp Asn Phe Asn Gln Gln Lys Lys Lys Leu Gly Gly1445 1450
1455Gln Asp Ile Phe Met Thr Glu Glu Gln Lys Lys Tyr Tyr Asn Ala1460
1465 1470Met Lys Lys Leu Gly Ser Lys Lys Pro Gln Lys Pro Ile Pro
Arg1475 1480 1485Pro Gly
Asn Lys Ile Gln Gly Cys Ile Phe Asp Leu Val Thr Asn1490 1495
1500Gln Ala Phe Asp Ile Ser Ile Met Val Leu Ile Cys Leu Asn Met1505
1510 1515Val Thr Met Met Val Glu Lys Glu Gly Gln Ser Gln His Met
Thr1520 1525 1530Glu Val Leu Tyr Trp Ile Asn Val Val Phe Ile Ile
Leu Phe Thr1535 1540 1545Gly Glu Cys Val Leu Lys Leu Ile Ser Leu
Arg His Tyr Tyr Phe1550 1555 1560Thr Val Gly Trp Asn Ile Phe Asp
Phe Val Val Val Ile Ile Ser1565 1570 1575Ile Val Gly Met Phe Leu
Ala Asp Leu Ile Glu Thr Tyr Phe Val1580 1585 1590Ser Pro Thr Leu
Phe Arg Val Ile Arg Leu Ala Arg Ile Gly Arg1595 1600 1605Ile Leu
Arg Leu Val Lys Gly Ala Lys Gly Ile Arg Thr Leu Leu1610 1615
1620Phe Ala Leu Met Met Ser Leu Pro Ala Leu Phe Asn Ile Gly Leu1625
1630 1635Leu Leu Phe Leu Val Met Phe Ile Tyr Ala Ile Phe Gly Met
Ser1640 1645 1650Asn Phe Ala Tyr Val Lys Lys Glu Asp Gly Ile Asn
Asp Met Phe1655 1660 1665Asn Phe Glu Thr Phe Gly Asn Ser Met Ile
Cys Leu Phe Gln Ile1670 1675 1680Thr Thr Ser Ala Gly Trp Asp Gly
Leu Leu Ala Pro Ile Leu Asn1685 1690 1695Ser Lys Pro Pro Asp Cys
Asp Pro Lys Lys Val His Pro Gly Ser1700 1705 1710Ser Val Glu Gly
Asp Cys Gly Asn Pro Ser Val Gly Ile Phe Tyr1715 1720 1725Phe Val
Ser Tyr Ile Ile Ile Ser Phe Leu Val Val Val Asn Met1730 1735
1740Tyr Ile Ala Val Ile Leu Glu Asn Phe Ser Val Ala Thr Glu Glu1745
1750 1755Ser Thr Glu Pro Leu Ser Glu Asp Asp Phe Glu Met Phe Tyr
Glu1760 1765 1770Val Trp Glu Lys Phe Asp Pro Asp Ala Thr Gln Phe
Ile Glu Phe1775 1780 1785Ser Lys Leu Ser Asp Phe Ala Ala Ala Leu
Asp Pro Pro Leu Leu1790 1795 1800Ile Ala Lys Pro Asn Lys Val Gln
Leu Ile Ala Met Asp Leu Pro1805 1810 1815Met Val Ser Gly Asp Arg
Ile His Cys Leu Asp Ile Leu Phe Ala1820 1825 1830Phe Thr Lys Arg
Val Leu Gly Glu Ser Gly Glu Met Asp Ser Leu1835 1840 1845Arg Ser
Gln Met Glu Glu Arg Phe Met Ser Ala Asn Pro Ser Lys1850 1855
1860Val Ser Tyr Glu Pro Ile Thr Thr Thr Leu Lys Arg Lys Gln Glu1865
1870 1875Asp Val Ser Ala Thr Val Ile Gln Arg Ala Tyr Arg Arg Tyr
Arg1880 1885 1890Leu Arg Gln Asn Val Lys Asn Ile Ser Ser Ile Tyr
Ile Lys Asp1895 1900 1905Gly Asp Arg Asp Asp Asp Leu Leu Asn Lys
Lys Asp Met Ala Phe1910 1915 1920Asp Asn Val Asn Glu Asn Ser Ser
Pro Glu Lys Thr Asp Ala Thr1925 1930 1935Ser Ser Thr Thr Ser Pro
Pro Ser Tyr Asp Ser Val Thr Lys Pro1940 1945 1950Asp Lys Glu Lys
Tyr Glu Gln Asp Arg Thr Glu Lys Glu Asp Lys1955 1960 1965Gly Lys
Asp Ser Lys Glu Ser Lys Lys1970 197538491DNAHomo
sapiensmisc_feature(7027)..(7027)Unknown sequence 3gccgctgagc
ctgcgcccag tgccccgagc cccgcgccga gccgagtccg cgccaagcag 60cagccgccca
ccccggggcc cggccggggg accagcagct tccccacagg caacgtgagg
120agagcctgtg cccagaagca ggatgagaag atggcaaact tcctattacc
tcggggcacc 180agcagcttcc gcaggttcac acgggagtcc ctggcagcca
tcgagaagcg catggcggag 240aagcaagccc gcggctcaac caccttgcag
gagagccgag aggggctgcc cgaggaggag 300gctccccggc cccagctgga
cctgcaggcc tccaaaaagc tgccagatct ctatggcaat 360ccaccccaag
agctcatcgg agagcccctg gaggacctgg accccttcta tagcacccaa
420aagactttca tcgtactgaa taaaggcaag accatcttcc ggttcagtgc
caccaacgcc 480ttgtatgtcc tcagtccctt ccacccagtt cggagagcgg
ctgtgaagat tctggttcac 540tcgctcttca acatgctcat catgtgcacc
atcctcacca actgcgtgtt catggcccag 600cacgaccctc caccctggac
caagtatgtc gagtacacct tcaccgccat ttacaccttt 660gagtctctgg
tcaagattct ggctcgagct ttctgcctgc acgcgttcac tttccttcgg
720gacccatgga actggctgga ctttagtgtg attatcatgg catacacaac
tgaatttgtg 780gacctgggca atgtctcagc cttacgcacc ttccgagtcc
tccgggccct gaaaactata 840tcagtcattt cagggctgaa gaccatcgtg
ggggccctga tccagtctgt gaagaagctg 900gctgatgtga tggtcctcac
agtcttctgc ctcagcgtct ttgccctcat cggcctgcag 960ctcttcatgg
gcaacctaag gcacaagtgt gtgcgcaact tcacagcgct caacggcacc
1020aacggctccg tggaggccga cggcttggtc tgggaatccc tggaccttta
cctcagtgat 1080ccagaaaatt acctgctcaa gaacggcacc tctgatgtgt
tactgtgtgg gaacagctct 1140gacgctggga catgtccgga gggctaccgg
tgcctaaagg caggcgagaa ccccgaccac 1200ggctacacca gcttcgattc
ctttgcctgg gcctttcttg cactcttccg cctgatgacg 1260caggactgct
gggagcgcct ctatcagcag accctcaggt ccgcagggaa gatctacatg
1320atcttcttca tgcttgtcat cttcctgggg tccttctacc tggtgaacct
gatcctggcc 1380gtggtcgcaa tggcctatga ggagcaaaac caagccacca
tcgctgagac cgaggagaag 1440gaaaagcgct tccaggaggc catggaaatg
ctcaagaaag aacacgaggc cctcaccatc 1500aggggtgtgg ataccgtgtc
ccgtagctcc ttggagatgt cccctttggc cccagtaaac 1560agccatgaga
gaagaagcaa gaggagaaaa cggatgtctt caggaactga ggagtgtggg
1620gaggacaggc tccccaagtc tgactcagaa gatggtccca gagcaatgaa
tcatctcagc 1680ctcacccgtg gcctcagcag gacttctatg aagccacgtt
ccagccgcgg gagcattttc 1740acctttcgca ggcgagacct gggttctgaa
gcagattttg cagatgatga aaacagcaca 1800gcgcgggaga gcgagagcca
ccacacatca ctgctggtgc cctggcccct gcgccggacc 1860agtgcccagg
gacagcccag tcccggaacc tcggctcctg gccacgccct ccatggcaaa
1920aagaacagca ctgtggactg caatggggtg gtctcattac tgggggcagg
cgacccagag 1980gccacatccc caggaagcca cctcctccgc cctgtgatgc
tagagcaccc gccagacacg 2040accacgccat cggaggagcc aggcggcccc
cagatgctga cctcccaggc tccgtgtgta 2100gatggcttcg aggagccagg
agcacggcag cgggccctca gcgcagtcag cgtcctcaca 2160agcgcactgg
aagagttaga ggagtctcgc cacaagtgtc caccatgctg gaaccgtctc
2220gcccagcgct acctgatctg ggagtgctgc ccgctgtgga tgtccatcaa
gcagggagtg 2280aagttggtgg tcatggaccc gtttactgac ctcaccatca
ctatgtgcat cgtactcaac 2340acactcttca tggcgctgga gcactacaac
atgacaagtg aattcgagga gatgctgcag 2400gtcggaaacc tggtcttcac
agggattttc acagcagaga tgaccttcaa gatcattgcc 2460ctcgacccct
actactactt ccaacagggc tggaacatct tcgacagcat catcgtcatc
2520cttagcctca tggagctggg cctgtcccgc atgagcaact tgtcggtgct
gcgctccttc 2580cgcctgctgc gggtcttcaa gctggccaaa tcatggccca
ccctgaacac actcatcaag 2640atcatcggga actcagtggg ggcactgggg
aacctgacac tggtgctagc catcatcgtg 2700ttcatctttg ctgtggtggg
catgcagctc tttggcaaga actactcgga gctgagggac 2760agcgactcag
gcctgctgcc tcgctggcac atgatggact tctttcatgc cttcctaatc
2820atcttccgca tcctctgtgg agagtggatc gagaccatgt gggactgcat
ggaggtgtcg 2880gggcagtcat tatgcctgct ggtcttcttg cttgttatgg
tcattggcaa ccttgtggtc 2940ctgaatctct tcctggcctt gctgctcagc
tccttcagtg cagacaacct cacagcccct 3000gatgaggaca gagagatgaa
caacctccag ctggccctgg cccgcatcca gaggggcctg 3060cgctttgtca
agcggaccac ctgggatttc tgctgtggtc tcctgcggca ccggcctcag
3120aagcccgcag cccttgccgc ccagggccag ctgcccagct gcattgccac
cccctactcc 3180ccgccacccc cagagacgga gaaggtgcct cccacccgca
aggaaacaca gtttgaggaa 3240ggcgagcaac caggccaggg cacccccggg
gatccagagc ccgtgtgtgt gcccatcgct 3300gtggccgagt cagacacaga
tgaccaagaa gaggatgagg agaacagcct gggcacggag 3360gaggagtcca
gcaagcagca ggaatcccag cctgtgtccg gctggcccag aggccctccg
3420gattccagga cctggagcca ggtgtcagcg actgcctcct ctgaggccga
ggccagtgca 3480tctcaggccg actggcggca gcagtggaaa gcggaacccc
aggccccagg gtgcggtgag 3540accccagagg acagttgctc cgagggcagc
acagcagaca tgaccaacac cgctgagctc 3600ctggagcaga tccctgacct
cggccaggat gtcaaggacc cagaggactg cttcactgaa 3660ggctgtgtcc
ggcgctgtcc ctgctgtgcg gtggacacca cacaggcccc agggaaggtc
3720tggtggcggt tgcgcaagac ctgctaccac atcgtggagc acagctggtt
cgagacattc 3780atcatcttca tgatcctact cagcagtgga gcgctggcct
tcgaggacat ctacctagag 3840gagcggaaga ccatcaaggt tctgcttgag
tatgccgaca agatgttcac atatgtcttc 3900gtgctggaga tgctgctcaa
gtgggtggcc tacggcttca agaagtactt caccaatgcc 3960tggtgctggc
tcgacttcct catcgtagac gtctctctgg tcagcctggt ggccaacacc
4020ctgggctttg ccgagatggg ccccatcaag tcactgcgga cgctgcgtgc
actccgtcct 4080ctgagagctc tgtcacgatt tgagggcatg agggtggtgg
tcaatgccct ggtgggcgcc 4140atcccgtcca tcatgaacgt cctcctcgtc
tgcctcatct tctggctcat cttcagcatc 4200atgggcgtga acctctttgc
ggggaagttt gggaggtgca tcaaccagac agagggagac 4260ttgcctttga
actacaccat cgtgaacaac aagagccagt gtgagtcctt gaacttgacc
4320ggagaattgt actggaccaa ggtgaaagtc aactttgaca acgtgggggc
cgggtacctg 4380gcccttctgc aggtggcaac atttaaaggc tggatggaca
ttatgtatgc agctgtggac 4440tccagggggt atgaagagca gcctcagtgg
gaatacaacc tctacatgta catctatttt 4500gtcattttca tcatctttgg
gtctttcttc accctgaacc tctttattgg tgtcatcatt 4560gacaacttca
accaacagaa gaaaaagtta gggggccagg acatcttcat gacagaggag
4620cagaagaagt actacaatgc catgaagaag ctgggctcca agaagcccca
gaagcccatc 4680ccacggcccc tgaacaagta ccagggcttc atattcgaca
ttgtgaccaa gcaggccttt 4740gacgtcacca tcatgtttct gatctgcttg
aatatggtga ccatgatggt ggagacagat 4800gaccaaagtc ctgagaaaat
caacatcttg gccaagatca acctgctctt tgtggccatc 4860ttcacaggcg
agtgtattgt caagctggct gccctgcgcc actactactt caccaacagc
4920tggaatatct tcgacttcgt ggttgtcatc ctctccatcg tgggcactgt
gctctcggac 4980atcatccaga agtacttctt ctccccgacg ctcttccgag
tcatccgcct ggcccgaata 5040ggccgcatcc tcagactgat ccgaggggcc
aaggggatcc gcacgctgct ctttgccctc 5100atgatgtccc tgcctgccct
cttcaacatc gggctgctgc tcttcctcgt catgttcatc 5160tactccatct
ttggcatggc caacttcgct tatgtcaagt gggaggctgg catcgacgac
5220atgttcaact tccagacctt cgccaacagc atgctgtgcc tcttccagat
caccacgtcg 5280gccggctggg atggcctcct cagccccatc ctcaacactg
ggccgcccta ctgcgacccc 5340actctgccca acagcaatgg ctctcggggg
gactgcggga gcccagccgt gggcatcctc 5400ttcttcacca cctacatcat
catctccttc ctcatcgtgg tcaacatgta cattgccatc 5460atcctggaga
acttcagcgt ggccacggag gagagcaccg agcccctgag tgaggacgac
5520ttcgatatgt tctatgagat ctgggagaaa tttgacccag aggccactca
gtttattgag 5580tattcggtcc tgtctgactt tgccgacgcc ctgtctgagc
cactccgtat cgccaagccc 5640aaccagataa gcctcatcaa catggacctg
cccatggtga gtggggaccg catccattgc 5700atggacattc tctttgcctt
caccaaaagg gtcctggggg agtctgggga gatggacgcc 5760ctgaagatcc
agatggagga gaagttcatg gcagccaacc catccaagat ctcctacgag
5820cccatcacca ccacactccg gcgcaagcac gaagaggtgt cggccatggt
tatccagaga 5880gccttccgca ggcacctgct gcaacgctct ttgaagcatg
cctccttcct cttccgtcag 5940caggcgggca gcggcctctc cgaagaggat
gcccctgagc gagagggcct catcgcctac 6000gtgatgagtg agaacttctc
ccgacccctt ggcccaccct ccagctcctc catctcctcc 6060acttccttcc
caccctccta tgacagtgtc actagagcca ccagcgataa cctccaggtg
6120cgggggtctg actacagcca cagtgaagat ctcgccgact tccccccttc
tccggacagg 6180gaccgtgagt ccatcgtgtg agcctcggcc tggctggcca
ggacacactg aaaagcagcc 6240tttttcacca tggcaaacct aaatgcagtc
agtcacaaac cagcctgggg ccttcctggc 6300tttgggagta agaaatgggc
ctcggccccg cggatcaacc aggcagagtt ctgtggcgcc 6360gcgtggacag
ccggagcagt tggcctgtgc ttggaggcct cagatagacc tgtgacctgg
6420tctggtcagg caatgcccct gcggctctgg aaagcaactt catcccagct
gctgaggcga 6480aatataaaac tgagactgta tatgttgtga atgggctttc
ataaatttat tatatttgat 6540atttttttac ttgagcaaag aactaaggat
ttttccatgg acatgggcag caattcacgc 6600tgtctcttct taaccctgaa
caagagtgtc tatggagcag ccggaagtct gttctcaaag 6660cagaagtgga
atccagtgtg gctcccacag gtcttcactg cccaggggtc gaatggggtc
6720cccctcccac ttgacctgag atgctgggag ggctgaaccc ccactcacac
aagcacacac 6780acacacagtc ctcacacacg gaggccagac acaggccgtg
ggacccaggc tcccagccta 6840agggagacag gcctttccct gccggccccc
caaggatggg gttcttgtcc acggggctca 6900ctctggcccc ctattgtctc
ccaaggtccc attttccccc ttgtgttttc acgcaggtca 6960tattgtcagt
cctacaaaaa taaaaggctt ccagaggaga gtggcctggg gtcccagggc
7020tgggccntag gcactgatag ttgccttttc ttcccctcct gtaagagtat
taacaaaacc 7080aaaggacaca agggtgcaag ccccattcac ggcctggcat
gcagcttgtc cttgctcctg 7140gaacctggca ggccctgcca gccagccaat
ggaagagagg ggctgagcca tgggggtttg 7200gggctaagaa gttcaccagc
cctgagccat ggsnsccctc agcctgcctg aagagaggaa 7260actggcgatc
tcccagggct ctctggacca tacncggagg agttttcnng tgtggtctcc
7320agctcctctc cagacacaga gacatgggag tggggagcgg acgttggccc
tggccctgtg 7380cagggaaagg gatggtcagg cccagttctc gtgcccctta
gaggggaatg aaccatggca 7440cctttgagag agggggcact gtggtcaggc
ccagcctctc tggcnnagtc ccgggatcct 7500gatggcaccc acacagagga
cctctttggg gcaagatcca ggtggntccc ataggtcttg 7560tgaaaaggct
ttttcaggga aaaatatttt actagtccaa tcacccccag gacctcttca
7620gctgctgaca atcctattta gcatatgcaa atcttttaac atagagaact
gtcaccctga 7680ggtaacaggg tcaactggcg aagagcaggc cagggggctt
ggctgnncca ttccagctct 7740nccacngann ncctccwmnc nnnnncatnn
ctcccaggcc acctcagtct canctgccgg 7800ctctgggctg gctnctccta
acctacctnn ccgagctgtc ggagggctgg acatttgtgg 7860cagtgctgaa
nggggcattg snggcgagta aagtattakg tttcttcttg tcaccccagt
7920tcccttggtg gcaaccccag acccaaccca tgcccctgac agatctagtt
ctcttctsct 7980gtgttccctt tgagtccngt gtgggacacg gtttaactgt
cccagcgaga tttctccaag 8040tngaaatcct atttttgtag atctccatgc
tttgnctctc aaggcttgga gaggtatgtg 8100cccctcctng gbnctcaccg
cctgctacac aggcaggaat gcggnttggg aggcaggtcg 8160ggctssnagc
ccagctggcc ggaaggagac tgtggttttt gtgtgtgtgg acagcncggg
8220agctttgaga caggntgcct ggggctggct gcagacggtg tggttggggg
tgggaggtga 8280gctagaccnn ncccttagct tttagcctgg ctgtcacctt
tttaatttcc agaactgcac 8340aatgaccagn aggaggggag aagagagtag
gaaaaaggag ggaaggacag acatcaagtg 8400ccagatgttg tctgaactaa
tcgagcactt ctcaccaaac ttcnngtata aataaaatac 8460atannnnggg
gcaaaccaat aaatggctta c 849142016PRTHomo sapiens 4Met Ala Asn Phe
Leu Leu Pro Arg Gly Thr Ser Ser Phe Arg Arg Phe1 5 10 15Thr Arg Glu
Ser Leu Ala Ala Ile Glu Lys Arg Met Ala Glu Lys Gln20 25 30Ala Arg
Gly Ser Thr Thr Leu Gln Glu Ser Arg Glu Gly Leu Pro Glu35 40 45Glu
Glu Ala Pro Arg Pro Gln Leu Asp Leu Gln Ala Ser Lys Lys Leu50 55
60Pro Asp Leu Tyr Gly Asn Pro Pro Gln Glu Leu Ile Gly Glu Pro Leu65
70 75 80Glu Asp Leu Asp Pro Phe Tyr Ser Thr Gln Lys Thr Phe Ile Val
Leu85 90 95Asn Lys Gly Lys Thr Ile Phe Arg Phe Ser Ala Thr Asn Ala
Leu Tyr100 105 110Val Leu Ser Pro Phe His Pro Val Arg Arg Ala Ala
Val Lys Ile Leu115 120 125Val His Ser Leu Phe Asn Met Leu Ile Met
Cys Thr Ile Leu Thr Asn130 135 140Cys Val Phe Met Ala Gln His Asp
Pro Pro Pro Trp Thr Lys Tyr Val145 150 155 160Glu Tyr Thr Phe Thr
Ala Ile Tyr Thr Phe Glu Ser Leu Val Lys Ile165 170 175Leu Ala Arg
Ala Phe Cys Leu His Ala Phe Thr Phe Leu Arg Asp Pro180 185 190Trp
Asn Trp Leu Asp Phe Ser Val Ile Ile Met Ala Tyr Thr Thr Glu195 200
205Phe Val Asp Leu Gly Asn Val Ser Ala Leu Arg Thr Phe Arg Val
Leu210 215 220Arg Ala Leu Lys Thr Ile Ser Val Ile Ser Gly Leu Lys
Thr Ile Val225 230 235 240Gly Ala Leu Ile Gln Ser Val Lys Lys Leu
Ala Asp Val Met Val Leu245 250 255Thr Val Phe Cys Leu Ser Val Phe
Ala Leu Ile Gly Leu Gln Leu Phe260 265 270Met Gly Asn Leu Arg His
Lys Cys Val Arg Asn Phe Thr Ala Leu Asn275 280 285Gly Thr Asn Gly
Ser Val Glu Ala Asp Gly Leu Val Trp Glu Ser Leu290 295 300Asp Leu
Tyr Leu Ser Asp Pro Glu Asn Tyr Leu Leu Lys Asn Gly Thr305 310 315
320Ser Asp Val Leu Leu Cys Gly Asn Ser Ser Asp Ala Gly Thr Cys
Pro325 330 335Glu Gly Tyr Arg Cys Leu Lys Ala Gly Glu Asn Pro Asp
His Gly Tyr340 345 350Thr Ser Phe Asp Ser Phe Ala Trp Ala Phe Leu
Ala Leu Phe Arg Leu355 360 365Met Thr Gln Asp Cys Trp Glu Arg Leu
Tyr Gln Gln Thr Leu Arg Ser370 375 380Ala Gly Lys Ile Tyr Met Ile
Phe Phe Met Leu Val Ile Phe Leu Gly385 390 395 400Ser Phe Tyr Leu
Val Asn Leu Ile Leu Ala Val Val Ala Met Ala Tyr405 410 415Glu Glu
Gln Asn Gln Ala Thr Ile Ala Glu Thr Glu Glu Lys Glu Lys420 425
430Arg Phe Gln Glu Ala Met Glu Met Leu Lys Lys Glu His Glu Ala
Leu435 440 445Thr Ile Arg Gly Val Asp Thr Val Ser Arg Ser Ser Leu
Glu Met Ser450 455 460Pro Leu Ala Pro Val Asn Ser His Glu Arg Arg
Ser Lys Arg Arg Lys465 470 475 480Arg Met Ser Ser Gly Thr Glu Glu
Cys Gly Glu Asp Arg Leu Pro Lys485 490 495Ser Asp Ser Glu Asp Gly
Pro Arg Ala Met Asn His Leu Ser Leu Thr500 505 510Arg Gly Leu Ser
Arg Thr Ser Met Lys Pro Arg Ser Ser Arg Gly Ser515 520 525Ile Phe
Thr Phe Arg Arg Arg Asp Leu Gly Ser Glu Ala Asp Phe Ala530 535
540Asp Asp Glu Asn Ser Thr Ala Arg Glu Ser Glu Ser His His Thr
Ser545 550 555 560Leu Leu Val Pro Trp Pro Leu Arg Arg Thr Ser Ala
Gln Gly Gln Pro565 570 575Ser Pro Gly Thr Ser Ala Pro Gly His Ala
Leu His Gly Lys Lys Asn580 585 590Ser Thr Val Asp Cys Asn Gly Val
Val Ser Leu Leu Gly Ala Gly Asp595 600 605Pro Glu Ala Thr Ser Pro
Gly Ser His Leu Leu Arg Pro Val Met Leu610 615 620Glu His Pro
Pro
Asp Thr Thr Thr Pro Ser Glu Glu Pro Gly Gly Pro625 630 635 640Gln
Met Leu Thr Ser Gln Ala Pro Cys Val Asp Gly Phe Glu Glu Pro645 650
655Gly Ala Arg Gln Arg Ala Leu Ser Ala Val Ser Val Leu Thr Ser
Ala660 665 670Leu Glu Glu Leu Glu Glu Ser Arg His Lys Cys Pro Pro
Cys Trp Asn675 680 685Arg Leu Ala Gln Arg Tyr Leu Ile Trp Glu Cys
Cys Pro Leu Trp Met690 695 700Ser Ile Lys Gln Gly Val Lys Leu Val
Val Met Asp Pro Phe Thr Asp705 710 715 720Leu Thr Ile Thr Met Cys
Ile Val Leu Asn Thr Leu Phe Met Ala Leu725 730 735Glu His Tyr Asn
Met Thr Ser Glu Phe Glu Glu Met Leu Gln Val Gly740 745 750Asn Leu
Val Phe Thr Gly Ile Phe Thr Ala Glu Met Thr Phe Lys Ile755 760
765Ile Ala Leu Asp Pro Tyr Tyr Tyr Phe Gln Gln Gly Trp Asn Ile
Phe770 775 780Asp Ser Ile Ile Val Ile Leu Ser Leu Met Glu Leu Gly
Leu Ser Arg785 790 795 800Met Ser Asn Leu Ser Val Leu Arg Ser Phe
Arg Leu Leu Arg Val Phe805 810 815Lys Leu Ala Lys Ser Trp Pro Thr
Leu Asn Thr Leu Ile Lys Ile Ile820 825 830Gly Asn Ser Val Gly Ala
Leu Gly Asn Leu Thr Leu Val Leu Ala Ile835 840 845Ile Val Phe Ile
Phe Ala Val Val Gly Met Gln Leu Phe Gly Lys Asn850 855 860Tyr Ser
Glu Leu Arg Asp Ser Asp Ser Gly Leu Leu Pro Arg Trp His865 870 875
880Met Met Asp Phe Phe His Ala Phe Leu Ile Ile Phe Arg Ile Leu
Cys885 890 895Gly Glu Trp Ile Glu Thr Met Trp Asp Cys Met Glu Val
Ser Gly Gln900 905 910Ser Leu Cys Leu Leu Val Phe Leu Leu Val Met
Val Ile Gly Asn Leu915 920 925Val Val Leu Asn Leu Phe Leu Ala Leu
Leu Leu Ser Ser Phe Ser Ala930 935 940Asp Asn Leu Thr Ala Pro Asp
Glu Asp Arg Glu Met Asn Asn Leu Gln945 950 955 960Leu Ala Leu Ala
Arg Ile Gln Arg Gly Leu Arg Phe Val Lys Arg Thr965 970 975Thr Trp
Asp Phe Cys Cys Gly Leu Leu Arg His Arg Pro Gln Lys Pro980 985
990Ala Ala Leu Ala Ala Gln Gly Gln Leu Pro Ser Cys Ile Ala Thr
Pro995 1000 1005Tyr Ser Pro Pro Pro Pro Glu Thr Glu Lys Val Pro Pro
Thr Arg1010 1015 1020Lys Glu Thr Gln Phe Glu Glu Gly Glu Gln Pro
Gly Gln Gly Thr1025 1030 1035Pro Gly Asp Pro Glu Pro Val Cys Val
Pro Ile Ala Val Ala Glu1040 1045 1050Ser Asp Thr Asp Asp Gln Glu
Glu Asp Glu Glu Asn Ser Leu Gly1055 1060 1065Thr Glu Glu Glu Ser
Ser Lys Gln Gln Glu Ser Gln Pro Val Ser1070 1075 1080Gly Trp Pro
Arg Gly Pro Pro Asp Ser Arg Thr Trp Ser Gln Val1085 1090 1095Ser
Ala Thr Ala Ser Ser Glu Ala Glu Ala Ser Ala Ser Gln Ala1100 1105
1110Asp Trp Arg Gln Gln Trp Lys Ala Glu Pro Gln Ala Pro Gly Cys1115
1120 1125Gly Glu Thr Pro Glu Asp Ser Cys Ser Glu Gly Ser Thr Ala
Asp1130 1135 1140Met Thr Asn Thr Ala Glu Leu Leu Glu Gln Ile Pro
Asp Leu Gly1145 1150 1155Gln Asp Val Lys Asp Pro Glu Asp Cys Phe
Thr Glu Gly Cys Val1160 1165 1170Arg Arg Cys Pro Cys Cys Ala Val
Asp Thr Thr Gln Ala Pro Gly1175 1180 1185Lys Val Trp Trp Arg Leu
Arg Lys Thr Cys Tyr His Ile Val Glu1190 1195 1200His Ser Trp Phe
Glu Thr Phe Ile Ile Phe Met Ile Leu Leu Ser1205 1210 1215Ser Gly
Ala Leu Ala Phe Glu Asp Ile Tyr Leu Glu Glu Arg Lys1220 1225
1230Thr Ile Lys Val Leu Leu Glu Tyr Ala Asp Lys Met Phe Thr Tyr1235
1240 1245Val Phe Val Leu Glu Met Leu Leu Lys Trp Val Ala Tyr Gly
Phe1250 1255 1260Lys Lys Tyr Phe Thr Asn Ala Trp Cys Trp Leu Asp
Phe Leu Ile1265 1270 1275Val Asp Val Ser Leu Val Ser Leu Val Ala
Asn Thr Leu Gly Phe1280 1285 1290Ala Glu Met Gly Pro Ile Lys Ser
Leu Arg Thr Leu Arg Ala Leu1295 1300 1305Arg Pro Leu Arg Ala Leu
Ser Arg Phe Glu Gly Met Arg Val Val1310 1315 1320Val Asn Ala Leu
Val Gly Ala Ile Pro Ser Ile Met Asn Val Leu1325 1330 1335Leu Val
Cys Leu Ile Phe Trp Leu Ile Phe Ser Ile Met Gly Val1340 1345
1350Asn Leu Phe Ala Gly Lys Phe Gly Arg Cys Ile Asn Gln Thr Glu1355
1360 1365Gly Asp Leu Pro Leu Asn Tyr Thr Ile Val Asn Asn Lys Ser
Gln1370 1375 1380Cys Glu Ser Leu Asn Leu Thr Gly Glu Leu Tyr Trp
Thr Lys Val1385 1390 1395Lys Val Asn Phe Asp Asn Val Gly Ala Gly
Tyr Leu Ala Leu Leu1400 1405 1410Gln Val Ala Thr Phe Lys Gly Trp
Met Asp Ile Met Tyr Ala Ala1415 1420 1425Val Asp Ser Arg Gly Tyr
Glu Glu Gln Pro Gln Trp Glu Tyr Asn1430 1435 1440Leu Tyr Met Tyr
Ile Tyr Phe Val Ile Phe Ile Ile Phe Gly Ser1445 1450 1455Phe Phe
Thr Leu Asn Leu Phe Ile Gly Val Ile Ile Asp Asn Phe1460 1465
1470Asn Gln Gln Lys Lys Lys Leu Gly Gly Gln Asp Ile Phe Met Thr1475
1480 1485Glu Glu Gln Lys Lys Tyr Tyr Asn Ala Met Lys Lys Leu Gly
Ser1490 1495 1500Lys Lys Pro Gln Lys Pro Ile Pro Arg Pro Leu Asn
Lys Tyr Gln1505 1510 1515Gly Phe Ile Phe Asp Ile Val Thr Lys Gln
Ala Phe Asp Val Thr1520 1525 1530Ile Met Phe Leu Ile Cys Leu Asn
Met Val Thr Met Met Val Glu1535 1540 1545Thr Asp Asp Gln Ser Pro
Glu Lys Ile Asn Ile Leu Ala Lys Ile1550 1555 1560Asn Leu Leu Phe
Val Ala Ile Phe Thr Gly Glu Cys Ile Val Lys1565 1570 1575Leu Ala
Ala Leu Arg His Tyr Tyr Phe Thr Asn Ser Trp Asn Ile1580 1585
1590Phe Asp Phe Val Val Val Ile Leu Ser Ile Val Gly Thr Val Leu1595
1600 1605Ser Asp Ile Ile Gln Lys Tyr Phe Phe Ser Pro Thr Leu Phe
Arg1610 1615 1620Val Ile Arg Leu Ala Arg Ile Gly Arg Ile Leu Arg
Leu Ile Arg1625 1630 1635Gly Ala Lys Gly Ile Arg Thr Leu Leu Phe
Ala Leu Met Met Ser1640 1645 1650Leu Pro Ala Leu Phe Asn Ile Gly
Leu Leu Leu Phe Leu Val Met1655 1660 1665Phe Ile Tyr Ser Ile Phe
Gly Met Ala Asn Phe Ala Tyr Val Lys1670 1675 1680Trp Glu Ala Gly
Ile Asp Asp Met Phe Asn Phe Gln Thr Phe Ala1685 1690 1695Asn Ser
Met Leu Cys Leu Phe Gln Ile Thr Thr Ser Ala Gly Trp1700 1705
1710Asp Gly Leu Leu Ser Pro Ile Leu Asn Thr Gly Pro Pro Tyr Cys1715
1720 1725Asp Pro Thr Leu Pro Asn Ser Asn Gly Ser Arg Gly Asp Cys
Gly1730 1735 1740Ser Pro Ala Val Gly Ile Leu Phe Phe Thr Thr Tyr
Ile Ile Ile1745 1750 1755Ser Phe Leu Ile Val Val Asn Met Tyr Ile
Ala Ile Ile Leu Glu1760 1765 1770Asn Phe Ser Val Ala Thr Glu Glu
Ser Thr Glu Pro Leu Ser Glu1775 1780 1785Asp Asp Phe Asp Met Phe
Tyr Glu Ile Trp Glu Lys Phe Asp Pro1790 1795 1800Glu Ala Thr Gln
Phe Ile Glu Tyr Ser Val Leu Ser Asp Phe Ala1805 1810 1815Asp Ala
Leu Ser Glu Pro Leu Arg Ile Ala Lys Pro Asn Gln Ile1820 1825
1830Ser Leu Ile Asn Met Asp Leu Pro Met Val Ser Gly Asp Arg Ile1835
1840 1845His Cys Met Asp Ile Leu Phe Ala Phe Thr Lys Arg Val Leu
Gly1850 1855 1860Glu Ser Gly Glu Met Asp Ala Leu Lys Ile Gln Met
Glu Glu Lys1865 1870 1875Phe Met Ala Ala Asn Pro Ser Lys Ile Ser
Tyr Glu Pro Ile Thr1880 1885 1890Thr Thr Leu Arg Arg Lys His Glu
Glu Val Ser Ala Met Val Ile1895 1900 1905Gln Arg Ala Phe Arg Arg
His Leu Leu Gln Arg Ser Leu Lys His1910 1915 1920Ala Ser Phe Leu
Phe Arg Gln Gln Ala Gly Ser Gly Leu Ser Glu1925 1930 1935Glu Asp
Ala Pro Glu Arg Glu Gly Leu Ile Ala Tyr Val Met Ser1940 1945
1950Glu Asn Phe Ser Arg Pro Leu Gly Pro Pro Ser Ser Ser Ser Ile1955
1960 1965Ser Ser Thr Ser Phe Pro Pro Ser Tyr Asp Ser Val Thr Arg
Ala1970 1975 1980Thr Ser Asp Asn Leu Gln Val Arg Gly Ser Asp Tyr
Ser His Ser1985 1990 1995Glu Asp Leu Ala Asp Phe Pro Pro Ser Pro
Asp Arg Asp Arg Glu2000 2005 2010Ser Ile Val201557008DNAHomo
sapiens 5gagcgctcca agatggcgcc caccgcagtc ccgcccgccg catcctcggc
gcctttgcag 60tccggccgcg cctcccgggc cccgcgttag ggccgccgct gcctccctcg
ccgccgccgc 120tgccagctga cctgtcctgg acgcagcata actaacgaag
ctgctgcagg atgagaagat 180ggcagcgcgg ctgcttgcac caccaggccc
tgatagtttc aagcctttca cccctgagtc 240actggcaaac attgagaggc
gcattgctga gagcaagctc aagaaaccac caaaggccga 300tggcagtcat
cgggaggacg atgaggacag caagcccaag ccaaacagcg acctggaagc
360agggaagagt ttgcctttca tctacgggga catcccccaa ggcctggttg
cagttcccct 420ggaggacttt gacccatact atttgacgca gaaaaccttt
gtagtattaa acagagggaa 480aactctcttc agatttagtg ccacgcctgc
cttgtacatt ttaagtcctt ttaacctgat 540aagaagaata gctattaaaa
ttttgataca ttcagtattt agcatgatca ttatgtgcac 600tattttgacc
aactgtgtat tcatgacttt tagtaaccct cctgactggt cgaagaatgt
660ggagtacacg ttcacaggga tttatacatt tgaatcacta gtgaaaatca
ttgcaagagg 720tttctgcata gatggcttta cctttttacg ggatccatgg
aactggttag atttcagtgt 780catcatgatg gcgtatataa cagagtttgt
aaacctaggc aatgtttcag ctctacgcac 840tttcagggta ctgagggctt
tgaaaactat ttcggtaatc ccaggcctga agacaattgt 900gggtgccctg
attcagtctg tgaagaaact gtcagatgtg atgatcctga cagtgttctg
960cctgagtgtt tttgccttga tcggactgca gctgttcatg gggaaccttc
gaaacaagtg 1020tgttgtgtgg cccataaact tcaacgagag ctatcttgaa
aatggcacca aaggctttga 1080ttgggaagag tatatcaaca ataaaacaaa
tttctacaca gttcctggca tgctggaacc 1140tttactctgt gggaacagtt
ctgatgctgg gcaatgccca gagggatacc agtgtatgaa 1200agcaggaagg
aaccccaact atggttacac aagttttgac acttttagct gggccttctt
1260ggcattattt cgccttatga cccaggacta ttgggaaaac ttgtatcaat
tgactttacg 1320agcagccggg aaaacataca tgatcttctt cgtcttggtc
atctttgtgg gttctttcta 1380tctggtgaac ttgatcttgg ctgtggtggc
catggcttat gaagaacaga atcaggcaac 1440actggaggag gcagaacaaa
aagaggctga atttaaagca atgttggagc aacttaagaa 1500gcaacaggaa
gaggcacagg ctgctgcgat ggccacttca gcaggaactg tctcagaaga
1560tgccatagag gaagaaggtg aagaaggagg gggctcccct cggagctctt
ctgaaatctc 1620taaactcagc tcaaagagtg caaaggaaag acgtaacagg
agaaagaaga ggaagcaaaa 1680ggaactctct gaaggagagg agaaagggga
tcccgagaag gtgtttaagt cagagtcaga 1740agatggcatg agaaggaagg
cctttcggct gccagacaac agaataggga ggaaattttc 1800catcatgaat
cagtcactgc tcagcatccc aggctcgccc ttcctctccc gccacaacag
1860caagagcagc atcttcagtt tcaggggacc tgggcggttc cgagacccgg
gctccgagaa 1920tgagttcgcg gatgacgagc acagcacggt ggaggagagc
gagggccgcc gggactccct 1980cttcatcccc atccgggccc gcgagcgccg
gagcagctac agcggctaca gcggctacag 2040ccagggcagc cgctcctcgc
gcatcttccc cagcctgcgg cgcagcgtga agcgcaacag 2100cacggtggac
tgcaacggcg tggtgtccct catcggcggc cccggctccc acatcggcgg
2160gcgtctcctg ccagaggcta caactgaggt ggaaattaag aagaaaggcc
ctggatctct 2220tttagtttcc atggaccaat tagcctccta cgggcggaag
gacagaatca acagtataat 2280gagtgttgtt acaaatacac tagtagaaga
actggaagag tctcagagaa agtgcccgcc 2340atgctggtat aaatttgcca
acactttcct catctgggag tgccacccct actggataaa 2400actgaaagag
attgtgaact tgatagttat ggaccctttt gtggatttag ccatcaccat
2460ctgcatcgtc ctgaatacac tgtttatggc aatggagcac catcctatga
caccacaatt 2520tgaacatgtc ttggctgtag gaaatctggt tttcactgga
attttcacag cggaaatgtt 2580cctgaagctc atagccatgg atccctacta
ttatttccaa gaaggttgga acatttttga 2640cggatttatt gtctccctca
gtttaatgga actgagtcta gcagacgtgg aggggctttc 2700agtgctgcga
tctttccgat tgctccgagt cttcaaattg gccaaatcct ggcccaccct
2760gaacatgcta atcaagatta ttggaaattc agtgggtgcc ctgggcaacc
tgacactggt 2820gctggccatt attgtcttca tctttgccgt ggtggggatg
caactctttg gaaaaagcta 2880caaagagtgt gtctgcaaga tcaaccagga
ctgtgaactc cctcgctggc atatgcatga 2940ctttttccat tccttcctca
ttgtctttcg agtgttgtgc ggggagtgga ttgagaccat 3000gtgggactgc
atggaagtgg caggccaggc catgtgcctc attgtcttta tgatggtcat
3060ggtgattggc aacttggtgg tgctgaacct gtttctggcc ttgctcctga
gctccttcag 3120tgcagacaac ctggctgcca cagatgacga tggggaaatg
aacaacctcc agatctcagt 3180gatccgtatc aagaagggtg tggcctggac
caaactaaag gtgcacgcct tcatgcaggc 3240ccactttaag cagcgtgagg
ctgatgaggt gaagcctctg gatgagttgt atgaaaagaa 3300ggccaactgt
atcgccaatc acaccggtgc agacatccac cggaatggtg acttccagaa
3360gaatggcaat ggcacaacca gcggcattgg cagcagcgtg gagaagtaca
tcattgatga 3420ggaccacatg tccttcatca acaaccccaa cttgactgta
cgggtaccca ttgctgtggg 3480cgagtctgac tttgagaacc tcaacacaga
ggatgttagc agcgagtcgg atcctgaagg 3540cagcaaagat aaactagatg
acaccagctc ctctgaagga agcaccattg atatcaaacc 3600agaagtagaa
gaggtccctg tggaacagcc tgaggaatac ttggatccag atgcctgctt
3660cacagaaggt tgtgtccagc ggttcaagtg ctgccaggtc aacatcgagg
aagggctagg 3720caagtcttgg tggatcctgc ggaaaacctg cttcctcatc
gtggagcaca actggtttga 3780gaccttcatc atcttcatga ttctgctgag
cagtggcgcc ctggccttcg aggacatcta 3840cattgagcag agaaagacca
tccgcaccat cctggaatat gctgacaaag tcttcaccta 3900tatcttcatc
ctggagatgt tgctcaagtg gacagcctat ggcttcgtca agttcttcac
3960caatgcctgg tgttggctgg acttcctcat tgtggctgtc tctttagtca
gccttatagc 4020taatgccctg ggctactcgg aactaggtgc cataaagtcc
cttaggaccc taagagcttt 4080gagaccctta agagccttat cacgatttga
agggatgagg gtggtggtga atgccttggt 4140gggcgccatc ccctccatca
tgaatgtgct gctggtgtgt ctcatcttct ggctgatttt 4200cagcatcatg
ggagttaact tgtttgcggg aaagtaccac tactgcttta atgagacttc
4260tgaaatccga tttgaaattg aagatgtcaa caataaaact gaatgtgaaa
agcttatgga 4320ggggaacaat acagagatca gatggaagaa cgtgaagatc
aactttgaca atgttggggc 4380aggatacctg gcccttcttc aagtagcaac
cttcaaaggc tggatggaca tcatgtatgc 4440agctgtagat tcccggaagc
ctgatgagca gcctaagtat gaggacaata tctacatgta 4500catctatttt
gtcatcttca tcatcttcgg ctccttcttc accctgaacc tgttcattgg
4560tgtcatcatt gataacttca atcaacaaaa gaaaaagttc ggaggtcagg
acatcttcat 4620gaccgaagaa cagaagaagt actacaatgc catgaaaaag
ctgggctcaa agaagccaca 4680gaaacccatt ccccgcccct tgaacaaaat
ccaaggaatc gtctttgatt ttgtcactca 4740gcaagccttt gacattgtta
tcatgatgct catctgcctt aacatggtga caatgatggt 4800ggagacagac
actcaaagca agcagatgga gaacatcctc tactggatta acctggtgtt
4860tgttatcttc ttcacctgtg agtgtgtgct caaaatgttt gcgttgaggc
actactactt 4920caccattggc tggaacatct tcgacttcgt ggtagtcatc
ctctccattg tgggaatgtt 4980cctggcagat ataattgaga aatactttgt
ttccccaacc ctattccgag tcatccgatt 5040ggcccgtatt gggcgcatct
tgcgtctgat caaaggcgcc aaagggattc gtaccctgct 5100ctttgcctta
atgatgtcct tgcctgccct gttcaacatc ggccttctgc tcttcctggt
5160catgttcatc ttctccattt ttgggatgtc caattttgca tatgtgaagc
acgaggctgg 5220tatcgatgac atgttcaact ttgagacatt tggcaacagc
atgatctgcc tgtttcaaat 5280cacaacctca gctggttggg atggcctgct
gctgcccatc ctaaaccgcc cccctgactg 5340cagcctagat aaggaacacc
cagggagtgg ctttaaggga gattgtggga acccctcagt 5400gggcatcttc
ttctttgtaa gctacatcat catctctttc ctaattgtcg tgaacatgta
5460cattgccatc atcctggaga acttcagtgt agccacagag gaaagtgcag
accctctgag 5520tgaggatgac tttgagacct tctatgagat ctgggagaag
ttcgaccccg atgccaccca 5580gttcattgag tactgtaagc tggcagactt
tgcagatgcc ttggagcatc ctctccgagt 5640gcccaagcca aataccattg
agctcatcgc tatggatctg ccaatggtga gcggggatcg 5700catccactgc
ttggacatcc tttttgcctt caccaagcgg gtcctgggag atagcgggga
5760gttggacatc ctgcggcagc agatggaaga gcggttcgtg gcatccaatc
cttccaaagt 5820gtcttacgag ccaatcacaa ccacactgcg tcgcaagcag
gaggaggtat ctgcagtggt 5880cctgcagcgt gcctaccggg gacatttggc
aaggcggggc ttcatctgca aaaagacaac 5940ttctaataag ctggagaatg
gaggcacaca ccgggagaaa aaagagagca ccccatctac 6000agcctccctc
ccgtcctatg acagtgtaac taaacctgaa aaggagaaac agcagcgggc
6060agaggaagga agaagggaaa gagccaaaag acaaaaagag gtcagagaat
ccaagtgtta 6120gaggagaaca aaaattcagt attatacaga tctaaaactc
gcaagtgaaa gattgtttac 6180aaacttcctg aatattatca atgcagaaca
gctgtggaga ctctaacctg aagatctata 6240ccaaacgtcg tctgcttacc
acgtaacaca gctgcatctt gagcagtgac ctgccaaggg 6300caaaggaccc
cgctccctag acttacagat tttctaatgc ttgggcaggt ggttactgca
6360tgttccacat cagtcaatgc aacttaggac aaaactaacc agatacagaa
acagaagaga 6420ggctgccggg accagcatat ttccgttgca gccaaatgga
ttttattttt tcattttatt 6480gattctcaga agcagaaagc atcactttaa
aagttcgttt gttcatgcaa actatatttg 6540cattcttaca ttagttaagc
taagcagcaa aaagaaaaca cacacacaca ctcacattta 6600gcccatgtca
tttaattgtc agtttctttg acataaagcg catcttctcc acatgggctt
6660cacgtggttt ggagatgggt gggggaaaac aatcaggttt cttcaggctg
aggaggactt 6720gctcaggccg attccaaaca ttgtgctcgt tcaatgcgta
gaaatgattt gcatgatggc 6780atgccgtgat cagaagtcat gcatgagatc
catacaccac
aggacactac taatctagtc 6840ccttgcactg ggtcagcctt tggacaggac
ccagccctgc accgttcact gtatttggag 6900aaaatggtaa gagttccata
ccgggctaca attctttgag ttcttaaaag tccttcatac 6960accttctggg
tagggaaaca accaactaat tgactaacac caccaacg 700861980PRTHomo sapiens
6Met Ala Ala Arg Leu Leu Ala Pro Pro Gly Pro Asp Ser Phe Lys Pro1 5
10 15Phe Thr Pro Glu Ser Leu Ala Asn Ile Glu Arg Arg Ile Ala Glu
Ser20 25 30Lys Leu Lys Lys Pro Pro Lys Ala Asp Gly Ser His Arg Glu
Asp Asp35 40 45Glu Asp Ser Lys Pro Lys Pro Asn Ser Asp Leu Glu Ala
Gly Lys Ser50 55 60Leu Pro Phe Ile Tyr Gly Asp Ile Pro Gln Gly Leu
Val Ala Val Pro65 70 75 80Leu Glu Asp Phe Asp Pro Tyr Tyr Leu Thr
Gln Lys Thr Phe Val Val85 90 95Leu Asn Arg Gly Lys Thr Leu Phe Arg
Phe Ser Ala Thr Pro Ala Leu100 105 110Tyr Ile Leu Ser Pro Phe Asn
Leu Ile Arg Arg Ile Ala Ile Lys Ile115 120 125Leu Ile His Ser Val
Phe Ser Met Ile Ile Met Cys Thr Ile Leu Thr130 135 140Asn Cys Val
Phe Met Thr Phe Ser Asn Pro Pro Asp Trp Ser Lys Asn145 150 155
160Val Glu Tyr Thr Phe Thr Gly Ile Tyr Thr Phe Glu Ser Leu Val
Lys165 170 175Ile Ile Ala Arg Gly Phe Cys Ile Asp Gly Phe Thr Phe
Leu Arg Asp180 185 190Pro Trp Asn Trp Leu Asp Phe Ser Val Ile Met
Met Ala Tyr Ile Thr195 200 205Glu Phe Val Asn Leu Gly Asn Val Ser
Ala Leu Arg Thr Phe Arg Val210 215 220Leu Arg Ala Leu Lys Thr Ile
Ser Val Ile Pro Gly Leu Lys Thr Ile225 230 235 240Val Gly Ala Leu
Ile Gln Ser Val Lys Lys Leu Ser Asp Val Met Ile245 250 255Leu Thr
Val Phe Cys Leu Ser Val Phe Ala Leu Ile Gly Leu Gln Leu260 265
270Phe Met Gly Asn Leu Arg Asn Lys Cys Val Val Trp Pro Ile Asn
Phe275 280 285Asn Glu Ser Tyr Leu Glu Asn Gly Thr Lys Gly Phe Asp
Trp Glu Glu290 295 300Tyr Ile Asn Asn Lys Thr Asn Phe Tyr Thr Val
Pro Gly Met Leu Glu305 310 315 320Pro Leu Leu Cys Gly Asn Ser Ser
Asp Ala Gly Gln Cys Pro Glu Gly325 330 335Tyr Gln Cys Met Lys Ala
Gly Arg Asn Pro Asn Tyr Gly Tyr Thr Ser340 345 350Phe Asp Thr Phe
Ser Trp Ala Phe Leu Ala Leu Phe Arg Leu Met Thr355 360 365Gln Asp
Tyr Trp Glu Asn Leu Tyr Gln Leu Thr Leu Arg Ala Ala Gly370 375
380Lys Thr Tyr Met Ile Phe Phe Val Leu Val Ile Phe Val Gly Ser
Phe385 390 395 400Tyr Leu Val Asn Leu Ile Leu Ala Val Val Ala Met
Ala Tyr Glu Glu405 410 415Gln Asn Gln Ala Thr Leu Glu Glu Ala Glu
Gln Lys Glu Ala Glu Phe420 425 430Lys Ala Met Leu Glu Gln Leu Lys
Lys Gln Gln Glu Glu Ala Gln Ala435 440 445Ala Ala Met Ala Thr Ser
Ala Gly Thr Val Ser Glu Asp Ala Ile Glu450 455 460Glu Glu Gly Glu
Glu Gly Gly Gly Ser Pro Arg Ser Ser Ser Glu Ile465 470 475 480Ser
Lys Leu Ser Ser Lys Ser Ala Lys Glu Arg Arg Asn Arg Arg Lys485 490
495Lys Arg Lys Gln Lys Glu Leu Ser Glu Gly Glu Glu Lys Gly Asp
Pro500 505 510Glu Lys Val Phe Lys Ser Glu Ser Glu Asp Gly Met Arg
Arg Lys Ala515 520 525Phe Arg Leu Pro Asp Asn Arg Ile Gly Arg Lys
Phe Ser Ile Met Asn530 535 540Gln Ser Leu Leu Ser Ile Pro Gly Ser
Pro Phe Leu Ser Arg His Asn545 550 555 560Ser Lys Ser Ser Ile Phe
Ser Phe Arg Gly Pro Gly Arg Phe Arg Asp565 570 575Pro Gly Ser Glu
Asn Glu Phe Ala Asp Asp Glu His Ser Thr Val Glu580 585 590Glu Ser
Glu Gly Arg Arg Asp Ser Leu Phe Ile Pro Ile Arg Ala Arg595 600
605Glu Arg Arg Ser Ser Tyr Ser Gly Tyr Ser Gly Tyr Ser Gln Gly
Ser610 615 620Arg Ser Ser Arg Ile Phe Pro Ser Leu Arg Arg Ser Val
Lys Arg Asn625 630 635 640Ser Thr Val Asp Cys Asn Gly Val Val Ser
Leu Ile Gly Gly Pro Gly645 650 655Ser His Ile Gly Gly Arg Leu Leu
Pro Glu Ala Thr Thr Glu Val Glu660 665 670Ile Lys Lys Lys Gly Pro
Gly Ser Leu Leu Val Ser Met Asp Gln Leu675 680 685Ala Ser Tyr Gly
Arg Lys Asp Arg Ile Asn Ser Ile Met Ser Val Val690 695 700Thr Asn
Thr Leu Val Glu Glu Leu Glu Glu Ser Gln Arg Lys Cys Pro705 710 715
720Pro Cys Trp Tyr Lys Phe Ala Asn Thr Phe Leu Ile Trp Glu Cys
His725 730 735Pro Tyr Trp Ile Lys Leu Lys Glu Ile Val Asn Leu Ile
Val Met Asp740 745 750Pro Phe Val Asp Leu Ala Ile Thr Ile Cys Ile
Val Leu Asn Thr Leu755 760 765Phe Met Ala Met Glu His His Pro Met
Thr Pro Gln Phe Glu His Val770 775 780Leu Ala Val Gly Asn Leu Val
Phe Thr Gly Ile Phe Thr Ala Glu Met785 790 795 800Phe Leu Lys Leu
Ile Ala Met Asp Pro Tyr Tyr Tyr Phe Gln Glu Gly805 810 815Trp Asn
Ile Phe Asp Gly Phe Ile Val Ser Leu Ser Leu Met Glu Leu820 825
830Ser Leu Ala Asp Val Glu Gly Leu Ser Val Leu Arg Ser Phe Arg
Leu835 840 845Leu Arg Val Phe Lys Leu Ala Lys Ser Trp Pro Thr Leu
Asn Met Leu850 855 860Ile Lys Ile Ile Gly Asn Ser Val Gly Ala Leu
Gly Asn Leu Thr Leu865 870 875 880Val Leu Ala Ile Ile Val Phe Ile
Phe Ala Val Val Gly Met Gln Leu885 890 895Phe Gly Lys Ser Tyr Lys
Glu Cys Val Cys Lys Ile Asn Gln Asp Cys900 905 910Glu Leu Pro Arg
Trp His Met His Asp Phe Phe His Ser Phe Leu Ile915 920 925Val Phe
Arg Val Leu Cys Gly Glu Trp Ile Glu Thr Met Trp Asp Cys930 935
940Met Glu Val Ala Gly Gln Ala Met Cys Leu Ile Val Phe Met Met
Val945 950 955 960Met Val Ile Gly Asn Leu Val Val Leu Asn Leu Phe
Leu Ala Leu Leu965 970 975Leu Ser Ser Phe Ser Ala Asp Asn Leu Ala
Ala Thr Asp Asp Asp Gly980 985 990Glu Met Asn Asn Leu Gln Ile Ser
Val Ile Arg Ile Lys Lys Gly Val995 1000 1005Ala Trp Thr Lys Leu Lys
Val His Ala Phe Met Gln Ala His Phe1010 1015 1020Lys Gln Arg Glu
Ala Asp Glu Val Lys Pro Leu Asp Glu Leu Tyr1025 1030 1035Glu Lys
Lys Ala Asn Cys Ile Ala Asn His Thr Gly Ala Asp Ile1040 1045
1050His Arg Asn Gly Asp Phe Gln Lys Asn Gly Asn Gly Thr Thr Ser1055
1060 1065Gly Ile Gly Ser Ser Val Glu Lys Tyr Ile Ile Asp Glu Asp
His1070 1075 1080Met Ser Phe Ile Asn Asn Pro Asn Leu Thr Val Arg
Val Pro Ile1085 1090 1095Ala Val Gly Glu Ser Asp Phe Glu Asn Leu
Asn Thr Glu Asp Val1100 1105 1110Ser Ser Glu Ser Asp Pro Glu Gly
Ser Lys Asp Lys Leu Asp Asp1115 1120 1125Thr Ser Ser Ser Glu Gly
Ser Thr Ile Asp Ile Lys Pro Glu Val1130 1135 1140Glu Glu Val Pro
Val Glu Gln Pro Glu Glu Tyr Leu Asp Pro Asp1145 1150 1155Ala Cys
Phe Thr Glu Gly Cys Val Gln Arg Phe Lys Cys Cys Gln1160 1165
1170Val Asn Ile Glu Glu Gly Leu Gly Lys Ser Trp Trp Ile Leu Arg1175
1180 1185Lys Thr Cys Phe Leu Ile Val Glu His Asn Trp Phe Glu Thr
Phe1190 1195 1200Ile Ile Phe Met Ile Leu Leu Ser Ser Gly Ala Leu
Ala Phe Glu1205 1210 1215Asp Ile Tyr Ile Glu Gln Arg Lys Thr Ile
Arg Thr Ile Leu Glu1220 1225 1230Tyr Ala Asp Lys Val Phe Thr Tyr
Ile Phe Ile Leu Glu Met Leu1235 1240 1245Leu Lys Trp Thr Ala Tyr
Gly Phe Val Lys Phe Phe Thr Asn Ala1250 1255 1260Trp Cys Trp Leu
Asp Phe Leu Ile Val Ala Val Ser Leu Val Ser1265 1270 1275Leu Ile
Ala Asn Ala Leu Gly Tyr Ser Glu Leu Gly Ala Ile Lys1280 1285
1290Ser Leu Arg Thr Leu Arg Ala Leu Arg Pro Leu Arg Ala Leu Ser1295
1300 1305Arg Phe Glu Gly Met Arg Val Val Val Asn Ala Leu Val Gly
Ala1310 1315 1320Ile Pro Ser Ile Met Asn Val Leu Leu Val Cys Leu
Ile Phe Trp1325 1330 1335Leu Ile Phe Ser Ile Met Gly Val Asn Leu
Phe Ala Gly Lys Tyr1340 1345 1350His Tyr Cys Phe Asn Glu Thr Ser
Glu Ile Arg Phe Glu Ile Glu1355 1360 1365Asp Val Asn Asn Lys Thr
Glu Cys Glu Lys Leu Met Glu Gly Asn1370 1375 1380Asn Thr Glu Ile
Arg Trp Lys Asn Val Lys Ile Asn Phe Asp Asn1385 1390 1395Val Gly
Ala Gly Tyr Leu Ala Leu Leu Gln Val Ala Thr Phe Lys1400 1405
1410Gly Trp Met Asp Ile Met Tyr Ala Ala Val Asp Ser Arg Lys Pro1415
1420 1425Asp Glu Gln Pro Lys Tyr Glu Asp Asn Ile Tyr Met Tyr Ile
Tyr1430 1435 1440Phe Val Ile Phe Ile Ile Phe Gly Ser Phe Phe Thr
Leu Asn Leu1445 1450 1455Phe Ile Gly Val Ile Ile Asp Asn Phe Asn
Gln Gln Lys Lys Lys1460 1465 1470Phe Gly Gly Gln Asp Ile Phe Met
Thr Glu Glu Gln Lys Lys Tyr1475 1480 1485Tyr Asn Ala Met Lys Lys
Leu Gly Ser Lys Lys Pro Gln Lys Pro1490 1495 1500Ile Pro Arg Pro
Leu Asn Lys Ile Gln Gly Ile Val Phe Asp Phe1505 1510 1515Val Thr
Gln Gln Ala Phe Asp Ile Val Ile Met Met Leu Ile Cys1520 1525
1530Leu Asn Met Val Thr Met Met Val Glu Thr Asp Thr Gln Ser Lys1535
1540 1545Gln Met Glu Asn Ile Leu Tyr Trp Ile Asn Leu Val Phe Val
Ile1550 1555 1560Phe Phe Thr Cys Glu Cys Val Leu Lys Met Phe Ala
Leu Arg His1565 1570 1575Tyr Tyr Phe Thr Ile Gly Trp Asn Ile Phe
Asp Phe Val Val Val1580 1585 1590Ile Leu Ser Ile Val Gly Met Phe
Leu Ala Asp Ile Ile Glu Lys1595 1600 1605Tyr Phe Val Ser Pro Thr
Leu Phe Arg Val Ile Arg Leu Ala Arg1610 1615 1620Ile Gly Arg Ile
Leu Arg Leu Ile Lys Gly Ala Lys Gly Ile Arg1625 1630 1635Thr Leu
Leu Phe Ala Leu Met Met Ser Leu Pro Ala Leu Phe Asn1640 1645
1650Ile Gly Leu Leu Leu Phe Leu Val Met Phe Ile Phe Ser Ile Phe1655
1660 1665Gly Met Ser Asn Phe Ala Tyr Val Lys His Glu Ala Gly Ile
Asp1670 1675 1680Asp Met Phe Asn Phe Glu Thr Phe Gly Asn Ser Met
Ile Cys Leu1685 1690 1695Phe Gln Ile Thr Thr Ser Ala Gly Trp Asp
Gly Leu Leu Leu Pro1700 1705 1710Ile Leu Asn Arg Pro Pro Asp Cys
Ser Leu Asp Lys Glu His Pro1715 1720 1725Gly Ser Gly Phe Lys Gly
Asp Cys Gly Asn Pro Ser Val Gly Ile1730 1735 1740Phe Phe Phe Val
Ser Tyr Ile Ile Ile Ser Phe Leu Ile Val Val1745 1750 1755Asn Met
Tyr Ile Ala Ile Ile Leu Glu Asn Phe Ser Val Ala Thr1760 1765
1770Glu Glu Ser Ala Asp Pro Leu Ser Glu Asp Asp Phe Glu Thr Phe1775
1780 1785Tyr Glu Ile Trp Glu Lys Phe Asp Pro Asp Ala Thr Gln Phe
Ile1790 1795 1800Glu Tyr Cys Lys Leu Ala Asp Phe Ala Asp Ala Leu
Glu His Pro1805 1810 1815Leu Arg Val Pro Lys Pro Asn Thr Ile Glu
Leu Ile Ala Met Asp1820 1825 1830Leu Pro Met Val Ser Gly Asp Arg
Ile His Cys Leu Asp Ile Leu1835 1840 1845Phe Ala Phe Thr Lys Arg
Val Leu Gly Asp Ser Gly Glu Leu Asp1850 1855 1860Ile Leu Arg Gln
Gln Met Glu Glu Arg Phe Val Ala Ser Asn Pro1865 1870 1875Ser Lys
Val Ser Tyr Glu Pro Ile Thr Thr Thr Leu Arg Arg Lys1880 1885
1890Gln Glu Glu Val Ser Ala Val Val Leu Gln Arg Ala Tyr Arg Gly1895
1900 1905His Leu Ala Arg Arg Gly Phe Ile Cys Lys Lys Thr Thr Ser
Asn1910 1915 1920Lys Leu Glu Asn Gly Gly Thr His Arg Glu Lys Lys
Glu Ser Thr1925 1930 1935Pro Ser Thr Ala Ser Leu Pro Ser Tyr Asp
Ser Val Thr Lys Pro1940 1945 1950Glu Lys Glu Lys Gln Gln Arg Ala
Glu Glu Gly Arg Arg Glu Arg1955 1960 1965Ala Lys Arg Gln Lys Glu
Val Arg Glu Ser Lys Cys1970 1975 1980733DNAartificial
sequenceprimer sequence 7gcgaagcttn tggntnatnt tnnnnatnat ggg
33828DNAartificial sequenceprimer sequence 8ataggatcca nccnnnnaan
gcnacntg 28920DNAartificial sequenceprimer sequence 9tacaattctc
cggtcaagtt 201020DNAartificial sequenceprimer sequence 10atgttagtca
aaatgtgcga 201120DNAartificial sequenceprimer sequence 11catcctcacc
aactgcgtgt 201220DNAartificial sequenceprimer sequence 12cactgaggta
aaggtccagg 201320DNAartificial sequenceprimer sequence 13agaccatccg
caccatcctg 201420DNAartificial sequenceprimer sequence 14tgtcaaagtt
gatcttcacg 201520DNAartificial sequenceprimer sequence 15tatgaccatg
aataacccgc 201620DNAartificial sequenceprimer sequence 16tcaggtttcc
catgaacagc 201720DNAartificial sequenceprimer sequence 17tatacaccca
tctccagcga 201820DNAartificial sequenceprimer sequence 18catctcctca
ttcacgaagc 201920DNAartificial sequenceprimer sequence 19ctgctggtct
tcttgcttgt 202020DNAartificial sequenceprimer sequence 20gctgttctcc
tcatcctctt 202120DNAartificial sequenceprimer sequence 21aaccctattc
cgagtcatcc 202220DNAartificial sequenceprimer sequence 22tgcactttcc
tctgtggcta 202320DNAartificial sequenceprimer sequence 23aaggaagaca
aagggaaaga 202420DNAartificial sequenceprimer sequence 24tcctgtgaaa
agatgacaag 20251012DNAHomo sapiens 25gagcgcggcg cgggccacca
tgggggccca gctcagcacg ttgggccata tggtgctctt 60cccagtctgg ttcctgtaca
gtctgctcat gaagctgttc cagcgctcca cgccagccat 120caccctcgag
agcccggaca tcaagtaccc gctgcggctc atcgaccggg agatcatcag
180ccatgacacc cggcgcttcc gctttgccct gccgtcaccc cagcacatcc
tgggcctccc 240tgtcggccag cacatctacc tctcggctcg aattgatgga
aacctggtcg tccggcccta 300tacacccatc tccagcgatg atgacaaggg
cttcgtggac ctggtcatca aggtttactt 360caaggacacc catcccaagt
ttcccgctgg agggaagatg tctcagtacc tggagagcat 420gcagattgga
gacaccattg agttccgggg ccccagtggg ctgctggtct accagggcaa
480agggaagttc gccatccgac ctgacaaaaa gtccaaccct atcatcagga
cagtgaagtc 540tgtgggcatg atcgcgggag ggacaggcat caccccgatg
ctgcaggtga tccgcgccat 600catgaaggac cctgatgacc acactgtgtg
ccacctgctc tttgccaacc agaccgagaa 660ggacatcctg ctgcgacctg
agctggagga actcaggaac aaacattctg cacgcttcaa 720gctctggtac
acgctggaca gagcccctga agcctgggac tacggccagg gcttcgtgaa
780tgaggagatg atccgggacc accttccacc cccagaggag gagccgctgg
tgctgatgtg 840tggcccccca cccatgatcc agtacgcctg ccttcccaac
ctggaccacg tgggccaccc 900cacggagcgc tgcttcgtct tctgagggcc
gggcaccggt cacacggcca ccgcccccgc 960gcaccccacg ccctgttcac
gctcacccag tcacctcccc acatcgcaca ct 101226349DNAHomo sapiens
26cggactggac caaaaatgtc gagtacactt ttactggaat atatactttt gaatcacttg
60taaaaatcct tgcaagaggc ttctgtgtag gagaattcac ttttcttcgt gacccgtgga
120actggctgga ttttgtcgtc attgtttttg cgtatttaac agaatttgta
aacctaggca 180atgtttcagc tcttcgaact ttcagagtat tgagagcttt
gaaaactatt tctgtaatcc 240caggcctgaa gacaattgta ggggctttga
tccagtcagt gaagaagctt tctgatgtca 300tgatcctgac tgtgttctgt
ctgagtgtgt ttgcactaat tggactaca 34927349DNAHomo sapiens
27cggactggac caaaaatgtc gagtacactt ttactggaat
atatactttt gaatcacttg 60taaaaatcct tgcaagaggc ttctgtgtag gagaattcac
ttttcttcgt gacccgtgga 120actggctgga ttttgtcgtc attgtttttg
cgtatttaac agaatttgta aacctaggca 180atgtttcagc tcttcgaact
ttcagagtat tgagagcttt gaaaactatt tctgtaatcc 240caggcctgaa
gacaattgta ggggctttga tccagtcagt gaagaagctt tctgatgtca
300tgatcctgac tgtgttctgt ctgagtgtgt ttgcactaat tggactaca
34928423DNAHomo sapiens 28gaatatgctg acaaagtctt cacctatatc
ttcatcctgg agatgttgct caagtggaca 60gcctatggct tcgtcaagtt cttcaccaat
gcctggtgtt ggctggactt cctcattgtg 120gctgtaccat taaatttgtc
tggcttaatt taatggggac ttctgggacc tgcagagact 180gtaaagggcg
agggtggtgg tgaatgcctt ggtgggcgcc atcccctcca tcatgaatgt
240gctgctggtg tgtctcatct tctggctgat tttcagcatc atgggagtta
acttgtttgc 300gggaaagtac cactactgct ttaatgagac ttctgaaatc
cgatttgaaa ttgaagatgt 360caacaataaa actgaatgtg aaaagcttat
ggaggggaac aatacagaga tcagatggaa 420gaa 42329423DNAHomo sapiens
29gaatatgctg acaaagtctt cacctatatc ttcatcctgg agatgttgct caagtggaca
60gcctatggct tcgtcaagtt cttcaccaat gcctggtgtt ggctggactt cctcattgtg
120gctgtaccat taaatttgtc tggcttaatt taatggggac ttctgggacc
tgcagagact 180gtaaagggcg agggtggtgg tgaatgcctt ggtgggcgcc
atcccctcca tcatgaatgt 240gctgctggtg tgtctcatct tctggctgat
tttcagcatc atgggagtta acttgtttgc 300gggaaagtac cactactgct
ttaatgagac ttctgaaatc cgatttgaaa ttgaagatgt 360caacaataaa
actgaatgtg aaaagcttat ggaggggaac aatacagaga tcagatggaa 420gaa
42330469DNAHomo sapiens 30tcatggccca gcacgaccct ccaccctgga
ccaagtatgt cgagtacacc ttcaccgcca 60tttacacctt tgagtctctg gtcaagattc
tggctcgagg cttctgcctg cacgcgttca 120ctttccttcg ggacccatgg
aactggctgg actttagtgt gattatcatg gcgtatgtat 180cagaaaatat
aaaactaggc aatttgtcgg ctcttcgaac tttcagagtc ctgagagctc
240taaaaactat ttcagttatc ccagggctga agaccatcgt gggggccctg
atccagtctg 300tgaagaagct ggctgatgtg atggtcctca cagtcttctg
cctcagcgtc tttgccctca 360tcggcctgca gctcttcatg ggcaacctaa
ggcacaagtg cgtgcgcaac ttcacagcgc 420tcaacggcac caacggctcc
gtggaggccg acggcttggt ctgggaatc 46931469DNAHomo sapiens
31tcatggccca gcacgaccct ccaccctgga ccaagtatgt cgagtacacc ttcaccgcca
60tttacacctt tgagtctctg gtcaagattc tggctcgagg cttctgcctg cacgcgttca
120ctttccttcg ggacccatgg aactggctgg actttagtgt gattatcatg
gcgtatgtat 180cagaaaatat aaaactaggc aatttgtcgg ctcttcgaac
tttcagagtc ctgagagctc 240taaaaactat ttcagttatc ccagggctga
agaccatcgt gggggccctg atccagtctg 300tgaagaagct ggctgatgtg
atggtcctca cagtcttctg cctcagcgtc tttgccctca 360tcggcctgca
gctcttcatg ggcaacctaa ggcacaagtg cgtgcgcaac ttcacagcgc
420tcaacggcac caacggctcc gtggaggccg acggcttggt ctgggaatc
46932469DNAHomo sapiens 32tcatggccca gcacgaccct ccaccctgga
ccaagtatgt cgagtacacc ttcaccgcca 60tttacacctt tgagtctctg gtcaagattc
tggctcgagg cttctgcctg cacgcgttca 120ctttccttcg ggacccatgg
aactggctgg actttagtgt gattatcatg gcgtatgtat 180cagaaaatat
aaaactaggc aatttgtcgg ctcttcgaac tttcagagtc ctgagagctc
240taaaaactat ttcagttatc ccagggctga agaccatcgt gggggccctg
atccagtctg 300tgaagaagct ggctgatgtg atggtcctca cagtcttctg
cctcagcgtc tttgccctca 360tcggcctgca gctcttcatg ggcaacctaa
ggcacaagtg cgtgcgcaac ttcacagcgc 420tcaacggcac caacggctcc
gtggaggccg acggcttggt ctgggaatc 46933469DNAHomo sapiens
33tcatggccca gcacgaccct ccaccctgga ccaagtatgt cgagtacacc ttcaccgcca
60tttacacctt tgagtctctg gtcaagattc tggctcgagg cttctgcctg cacgcgttca
120ctttccttcg ggacccatgg aactggctgg actttagtgt gattatcatg
gcgtatgtat 180cagaaaatat aaaactaggc aatttgtcgg ctcttcgaac
tttcagagtc ctgagagctc 240taaaaactat ttcagttatc ccagggctga
agaccatcgt gggggccctg atccagtctg 300tgaagaagct ggctgatgtg
atggtcctca cagtcttctg cctcagcgtc tttgccctca 360tcggcctgca
gctcttcatg ggcaacctaa ggcacaagtg cgtgcgcaac ttcacagcgc
420tcaacggcac caacggctcc gtggaggccg acggcttggt ctgggaatc
46934469DNAHomo sapiens 34tcatggccca gcacgaccct ccaccctgga
ccaagtatgt cgagtacacc ttcaccgcca 60tttacacctt tgagtctctg gtcaagattc
tggctcgagg cttctgcctg cacgcgttca 120ctttccttcg ggacccatgg
aactggctgg actttagtgt gattatcatg gcatacacaa 180ctgaatttgt
ggacctgggc aatgtctcag ccttacgcac cttccgagtc ctccgggccc
240tgaaaactat atcagtcatt tcagggctga agaccatcgt gggggccctg
atccagtctg 300tgaagaagct ggctgatgtg atggtcctca cagtcttctg
cctcagcgtc tttgccctca 360tcggcctgca gctcttcatg ggcaacctaa
ggcacaagtg cgtgcgcaac ttcacagcgc 420tcaacggcac caacggctcc
gtggaggccg acggcttggt ctgggaatc 46935469DNAHomo sapiens
35tcatggccca gcacgaccct ccaccctgga ccaagtatgt cgagtacacc ttcaccgcca
60tttacacctt tgagtctctg gtcaagattc tggctcgagg cttctgcctg cacgcgttca
120ctttccttcg ggacccatgg aactggctgg actttagtgt gattatcatg
gcatacacaa 180ctgaatttgt ggacctgggc aatgtctcag ccttacgcac
cttccgagtc ctccgggccc 240tgaaaactat atcagtcatt tcagggctga
agaccatcgt gggggccctg atccagtctg 300tgaagaagct ggctgatgtg
atggtcctca cagtcttctg cctcagcgtc tttgccctca 360tcggcctgca
gctcttcatg ggcaacctaa ggcacaagtg cgtgcgcaac ttcacagcgc
420tcaacggcac caacggctcc gtggaggccg acggcttggt ctgggaatc
46936469DNAHomo sapiens 36tcatggccca gcacgaccct ccaccctgga
ccaagtatgt cgagtacacc ttcaccgcca 60tttacacctt tgagtctctg gtcaagattc
tagctcgagg cttctgcctg cacgcgttca 120ctttccttcg ggacccatgg
aactggctgg actttagtgt gattatcatg gcgtatgtat 180cagaaaatat
aaaactaggc aatttgtcgg ctcttcgaac tttcagagtc ctgagagctc
240taaaaactat ttcagttatc ccagggctga agaccatcgt gggggccctg
atccagtctg 300tgaagaagct ggctgatgtg atggtcctca cagtcttctg
cctcagcgtc tttgccctca 360tcggcctgca gctcttcatg ggcaacctaa
ggcacaagtg cgtgcgcaac ttcacagcgc 420tcaacggcac caacggctcc
gtggaggccg acggcttggt ctgggaatc 46937340DNAHomo sapiens
37tcatggccca gcacgaccct ccaccctgga ccaagtatgt cgagtatgta tcagaaaata
60taaaactagg caatttgtcg gctcttcgaa ctttcagagt cctgagagct ctaaaaacta
120tttcagttat cccagggctg aagaccatcg tgggggccct gatccagtct
gtgaagaagc 180tggctgatgt gatggtcctc acagtcttct gcctcagcgt
ctttgccctc atcggcctgc 240agctcttcat gggcaaccta aggcacaagt
gcgtgcgcaa cttcacagcg ctcaacggca 300ccaacggctc cgtggaggcc
gacggcttgg tctgggaatc 34038467DNAHomo sapiens 38tcatgcccag
cacgaccctc caccctggac caagtatgtc gagtacacct tcaccgccat 60ttacaccttt
gagtctctgg tcaagattct ggctcgaggc ttctgcctgc acgcgttcac
120tttcttcggg acccatggaa ctggctggac tttagtgtga ttatcatggc
gtatgtatca 180gaaaatataa aactaggcaa tttgtcggct cttcgaactt
tcagagtcct gagagctcta 240aaaactattt cagttatccc agggctgaag
accatcgtgg gggccctgat ccagtctgtg 300aagaagctgg ctgatgtgat
ggtcctcaca gtcttctgcc tcagcgtctt tgccctcatc 360ggcctgcagc
tcttcatggg caacctaagg cacaagtgcg tgcgcaactt cacagcgctc
420aacggcacca acggctccgt ggaggccgac ggcttggtct gggaatc
46739468DNAHomo sapiens 39tcatggccca gcacgaccct ccaccctgga
ccaagtatgt cgagtacacc ttcaccgcca 60tttacacctt tgagtctctg gtcaagattc
tagctcgagg cttctgcctg cacgcgttca 120ctttcttcgg gacccatgga
actggctgga ctttagtgtg attatcatgg cgtatgtatc 180agaaaatata
aaactaggca atttgtcggc tcttcgaact ttcagagtcc tgagagctct
240aaaaactatt tcagttatcc cagggctgaa gaccatcgtg ggggccctga
tccagtctgt 300gaagaagctg gctgatgtga tggtcctcac agtcttctgc
ctcagcgtct ttgccctcat 360cggcctgcag ctcttcatgg gcaacctaag
gcacaagtgc gtgcgcaact tcatagcgct 420caacggcacc aacggctccg
tggaggccga cggcttggtc tgggaatc 46840184DNAHomo sapiens 40cgtgaacctc
tttgcgggga agtttgggag gtgcatcaac cagacagagg gagacttgcc 60tttgaactac
accatcgtga acaacaagag ccagtgtgag tccttgaact tgaccggaga
120attgtactgg accaaggtga aagtcaactt tgacaacgtg ggggccgggt
acctggccct 180tctg 18441184DNAHomo sapiens 41agtaaatttg tttgctggca
agttctatga gtgtattaac accacagatg ggtcacggtt 60tcctgcaagt caagttccaa
atcgttccga atgttttgcc cttatgaatg ttagtcaaaa 120tgtgcgatgg
aaaaacctga aagtgaactt tgataatgtc ggacttggtt acctatctct 180gctt
18442187DNAHomo sapiens 42agttaacttg tttgcgggaa agtaccacta
ctgctttaat gagacttctg aaatccgatt 60tgaaattgaa gatgtcaaca ataaaactga
atgtgaaaag cttatggagg ggaacaatac 120agagatcaga tggaagaacg
tgaagatcaa ctttgacaat gttggggcag gatacctggc 180ccttctt
18743452DNAHomo sapiens 43tgatgacaag ggcttcgtgg acctggtcat
caaggtttac ttcaaggaca cccatcccaa 60gtttcccgct ggagggaaga tgtctcagta
cctggagagc atgcagattg gagacaccat 120tgagttccgg ggccccagtg
ggctgctggt ctaccagggc aaagggaagt tcgccatccg 180acctgacaaa
aagtccaacc ctatcatcag gacagtgaag tctgtgggca tgatcgcggg
240agggacaggc atcaccccga tgctgcaggt gatccgcgcc atcatgaagg
accctgatga 300ccacactgtg tgccacctgc tctttgccaa ccagaccgag
aaggacatcc tgctgcgacc 360tgagctggag gaactcagga acaaacattc
tgcacgcttc aagctctggt acacgctgga 420cagagcccct gaagcctggg
actacggcca gg 45244452DNAHomo sapiens 44tgatgacaag ggcttcgtgg
acctggtcat caaggtttac ttcaaggaca cccatcccaa 60gtttcccgct ggagggaaga
tgtctcagta cctggagagc atgcagattg gagacaccat 120tgagttccgg
ggccccagtg ggctgctggt ctaccagggc aaagggaagt tcgccatccg
180acctgacaaa aagtccaacc ctatcatcag gacagtgaag tctgtgggca
tgatcgcggg 240agggacaggc atcaccccga tgctgcaggt gatccgcgcc
atcatgaagg accctgatga 300ccacactgtg tgccacctgc tctttgccaa
ccagaccgag aaggacatcc tgctgcgacc 360tgagctggag gaactcagga
acaaacattc tgcacgcttc aagctctggt acacgctgga 420cagagcccct
gaagcctggg actacggcca gg 45245423DNAHomo sapiens 45gaatatgctg
acaaagtctt cacctatatc ttcatcctgg agatgttgct caagtggaca 60gcctatggct
tcgtcaagtt cttcaccaat gcctggtgtt ggctggactt cctcattgtg
120gctgtaccat taaatttgtc tggcttaatt taatggggac ttctgggacc
tgcagagact 180gtaaagggcg agggtggtgg tgaatgcctt ggtgggcgcc
atcccctcca tcatgaatgt 240gctgctggtg tgtctcatct tctggctgat
tttcagcatc atgggagtta acttgtttgc 300gggaaagtac cactactgct
ttaatgagac ttctgaaatc cgatttgaaa ttgaagatgt 360caacaataaa
actgaatgtg aaaagcttat ggaggggaac aatacagaga tcagatggaa 420gaa
42346423DNAHomo sapiens 46gaatatgctg acaaagtctt cacctatatc
ttcatcctgg agatgttgct caagtggaca 60gcctatggct tcgtcaagtt cttcaccaat
gcctggtgtt ggctggactt cctcattgtg 120gctgtaccat taaatttgtc
tggcttaatt taatggggac ttctgggacc tgcagagact 180gtaaagggcg
agggtggtgg tgaatgcctt ggtgggcgcc atcccctcca tcatgaatgt
240gctgctggtg tgtctcatct tctggctgat tttcagcatc atgggagtta
acttgtttgc 300gggaaagtac cactactgct ttaatgagac ttctgaaatc
cgatttgaaa ttgaagatgt 360caacaataaa actgaatgtg aaaagcttat
ggaggggaac aatacagaga tcagatggaa 420gaa 4234748DNAartificial
sequenceconsensus sequence 47agtgagtgtg aaagtcttat ggagagcaac
aaaactgtcc gatggaaa 484845DNAHomo sapiens 48agtcggtgtg aaagccttct
gtttaacgaa tccatgctat gggaa 454948DNAHomo sapiens 49tccgaatgtt
ttgcccttat gaatgttagt caaaatgtgc gatggaaa 485048DNAHomo sapiens
50actgattgcc taaaactaat agaaagaaat gagactgctc gatggaaa
485148DNAHomo sapiens 51agtgagtgca aagctctcat tgagagcaat caaactgcca
ggtggaaa 485239DNAHomo sapiens 52agtgactgtc aggctcttgg caagcaagct
cggtggaaa 395351DNAHomo sapiens 53actgaatgtg aaaagcttat ggaggggaac
aatacagaga tcagatggaa g 515451DNAHomo sapiens 54aacaagtctg
agtgcgagag cctcatgcac acaggccagg tccgctggct c 515551DNAHomo sapiens
55aacaagagcc agtgtgagtc cttgaacttg accggagaat tgtactggac c
515651DNARattus rattus 56aacaagtccg agtgtcacaa tcaaaacagc
accggccact tcttctgggt c 515720DNAartificial sequenceartificical
sequence 57ttatgacaga agaacagaag 205820DNAartificial
sequenceartificial sequence 58ttatgacaga agaacagaag
205920DNAartificial sequenceartificial sequence 59ttatgacgga
ggaacagaag 20
* * * * *